text
stringlengths 4.16k
144k
|
|---|
treatments on tissue slices The efficacies of monophage and cocktail treatments against soft rot caused by P. carotovorum subsp. carotovorum were evaluated using a potato slice assay . Potato tubers (cultivar Igorota) were surface sterilised by soaking in 70% ethanol for 10 min, washed with sterile distilled water, and air dried under the laminar flow hood. The tubers were cut into 7.0 mm-thick transverse disks using sterile knives and three wells (5-mm diameter) were made on each slice using a sterile cork borer. For monophage treatments, log phase culture of P. carotovorum subsp. carotovorum containing approximately 10 8 cells mL −1 (0.5 MFS) was mixed with the phage lysates at optimal MOI. For cocktail preparations, low (0.001) and high (100) MOIs were used for the experiment. Three potato slices were used for each treatment. Wells were filled with 20 µL of the bacteria-phage mixtures, 20 µL of sterile SM buffer as negative control, and 20 µL of P. carotovorum subsp. carotovorum (0.5 MFS) as positive control. The diameter of the rotten tissues around the wells inoculated with bacteria and wells coinoculated with bacteria and phages were measured after incubation at 30°C for 72 h. Treatment means were compared using one-way ANOVA with Tukey's post-test (α = 0.05). 2.4.2. Protective and curative potential of monophage treatments against soft rot A potato tuber assay was conducted to determine the protective and curative effect of monophage treatments at various application time points relative to P. carotovorum subsp. carotovorum inoculation following a previously described protocol by Czajkowski et al. (2014). Potato tubers (cultivar Igorota) were washed in running water to remove soil and other organic particles, surface-sterilised with 70% ethanol for 10 min, rinsed with sterile water for three times, and air dried under laminar flowhood. For each tuber, two wells (8 mm diameter) were made using flame-sterilised cork borer. Two set-ups were prepared for the experiment: (1) advanced phage introduction (API) treatment, and (2) delayed phage introduction (DPI) treatment. For both treatments, log phase culture of P. carotovorum subsp. carotovorum containing approximately 10 7 cells mL −1 was used and the phage lysate was added to the wells at MOI 10. In the API treatment, wells were filled with 25 μL of the phage suspension at 0, 1, 3, 8, 15 and 30 h prior to the inoculation of 25 μL of the bacterial suspension. In the DPI treatment, wells were filled with 25 μL of the phage suspension at 0, 1, 3, 8, 15 and 30 h after bacterial inoculation. Three potato tubers were used per time point for each of the API and DPI treatment. For the control set-ups, 25 μL aliquots of sterile water was used as negative control while 25 μL of P. carotovorum subsp. carotovorum suspension was used as positive control. The tubers were placed in a humid box and the degree of tissue maceration was qualitatively assessed (scored as +/-) after incubation at 30°C for 72 h. Isolation of lytic bacteriophages Bacteriophages vB_PcaP-A3, vB_PcaM-D1 and vB_PcaM-J3 were isolated from rhizosphere soil, symptomatic tissues, and sewage water, respectively, using P. carotovorum subsp. carotovorum as enrichment and isolation host. The three phages were named following the unified phage naming system proposed by Kropinski et al. (2009). All three phages formed clear plaques typical for lytic phages, with varying sizes (Table 1). Characterization of bacteriophages All three phages exhibited strong adsorption to P. carotovorum subsp. carotovorum, and approximately 90% of the phage particles adsorbed to the bacterial cells within five min ( Figure 2). vB_PcaP-A3 and vB_PcaM-D1 showed similar infection kinetics with a latent period of 10 min and a burst size of 142-151 progeny phages/cell, whereas vB_PcaM-J3 showed a longer latent period of 20 min and a smaller burst size of 42 progeny phages/cell (Table 1, Figure 2(A,B)). Among the three phages, vB_PcaP-A3 has the lowest optimal MOI (0.01), followed by vB_PcaM-D1 (1.0) and vB_PcaM-J3 (10.0) ( Table 1). All of the three phages retained infectivity after incubation at 30°C, 40°C, and 50°C for 1 h, and in the pH range 3-9 for 16-24 h (Figure 2(C)). Host range Spot test assay revealed that the three phages showed antibacterial activity specific for P. carotovorum subsp. carotovorum. None of the three phages were able to lyse the 48 Pectobacterium spp. isolates and the eight representative strains from other genera. Phage activity in vitro Killing curves established for vB_PcaP-A3, vB_PcaM-D1 and vB_PcaM-J3 showed that all three phages have strong lytic activity and were highly effective against P. carotovorum subsp. carotovorum at optimal MOI (Figure 3(A)). The bacterial cell density remained less than 0.05 (OD 600 ) throughout the 8-h observation period. The absence of any increase in OD 600 reading also suggests that there is no observed phage resistance development of the host, at least during the observation period (Muturi et al., 2019). These results indicate that monophage treatments of vB_PcaP-A3, vB_PcaM-D1 and vB_PcaM-J3 at optimal MOI were equally effective in inhibiting the growth of P. carotovorum subsp. carotovorum in vitro. For the cocktail treatments, low MOI (0.001) and high MOI (100) were used in the in vitro challenge tests. Each phage was used at the same concentration and the phage cocktails consisting of two or three phages were combined and evaluated. At MOI of 0.001, the killing curves of the phage cocktails composed of two or three phages maintained its bacterial inactivation with an OD 600 < 0.05 for 8 h (Figure 4(A)). At low MOI, it appears that a phage cocktail containing any of the three phages effectively controlled bacterial growth during the 8-h observation period. At MOI 100, killing curves showed that all cocktail treatments were highly effective against P. carotovorum subsp. carotovorum (Figure 4(A)). The bacterial density remained less than 0.05 (OD 600 ) throughout the duration of the experiment. 3.1.6. Phage-Mediated biocontrol using monophage and cocktail treatments 3.1.6.1. Monophage and cocktail treatments reduced soft rot symptoms in tissue slices. The average diameter of rotting tissue was significantly lower in all monophage treatments than in the set-up inoculated with P. carotovorum subsp. carotovorum only (Figure 3(B-D)). The set-up co-inoculated with P. carotovorum subsp. carotovorum and vB_PcaP-A3 exhibited the lowest diameter of rotting tissue among the three treatments (Figure 3(B-D)). Phage vB_PcaP-A3 was able to reduce potato tuber tissue maceration by at least 60%, while phages vB_PcaM-D1 and vB_PcaM-J3 were able to reduce tissue maceration by at least 50% of that observed for the control potato slices inoculated with P. carotovorum subsp. carotovorum only (Figure 3(B-D)). All of the phage cocktail treatments completely prevented tissue maceration at low and high MOI (Figure 4(B-D)). 3.1.6.2. Advanced phage introduction can protect tubers from soft rot. The potential use of phages as a post-harvest disease control strategy was assessed using potato tubers artificially inoculated with P. carotovorum subsp. carotovorum treated with monophage suspensions applied at different time points. Results of the whole tuber assay showed that in the API treatment, monophage suspensions of the three phages applied on to the wound up to 30 h before bacterial inoculation provided protection against soft rot disease development (Figure 3(E)). In the DPI treatment, a 3-h and 8-h delay in the application of monophage suspensions of vB_PcaM-J3, and vB_PcaP-A3 and vB_PcaM-D1, respectively, following bacterial inoculation resulted in disease development (Figure 3(E)). Discussion Phage-mediated biocontrol of soft rot disease is a promising and an up-and-coming technology that has been widely explored worldwide. To our knowledge, this is the first report on the isolation and characterization of bacteriophages infecting P. carotovorum subsp. carotovorum in the Philippines, which explores some aspects that need to be considered for potential formulation of a postharvest biocontrol product against soft rot disease including phage stability, bioactivity in tissues, and application timing. The latent period and burst size of phages vB_PcaP-A3, vB_PcaM-D1, and vB_PcaM-J3 were determined based on one-step growth curve experiments. The phages were further characterised, and the adsorption rate, optimal MOI, and stability on varying temperature and pH levels were also determined. Of the three phage isolates, vB_PcaP-A3 has the lowest optimal MOI of 0.01, a latent period of 10 min and a calculated burst size value of 142 PFU/cell. Phage vB_PcaM-D1 has an optimal MOI of 0.1, latent period of 10 min and a burst size of 151 PFU/cell. vB_PcaM-J3 has an optimal MOI of 10, longest latent period of 30 min, and the lowest calculated burst size of 42 PFU/cell. Since phages displaying shorter latent periods and higher burst sizes are reported to provide better efficiency than phages with longer latent periods in cultures where the density of the host is high, vB_PcaM-J3 showed less promising growth characteristics compared to vB_PcaP-A3 and vB_PcaM-D1 (Abedon et al., 2003). All three phages, however, showed strong adsorption to their host evidenced by the observed 90% phage adsorption within 5 min after incubation. When their stabilities on varying temperature and pH levels were tested, all three phages survived incubations at 30°C-50°C and at pH 3-9, but were inactivated at 60°C and at pH 12. These are important environmental factors in biological control applications. Since temperatures under field conditions do not exceed 50°C and pH levels usually range from pH 3.3-4.3, results indicate that vB_PcaP-A3, vB_PcaM-D1 and vB_PcaM-J3 can be suitable for possible field applications (Navarrete et al., 2017). All three phages showed specificity to their isolation host, P. carotovorum subsp. carotovorum. Phages are generally known to have narrow host ranges, typically limited to strains within a certain species of their bacterial host (Ross et al., 2016). This can allow the formulation of phage cocktails targeting bacterial species of interest only, which may be a certain bacterial plant pathogen or a specific bacterium in a microbial community that negatively impacts plant growth or health conditions. Developing a phage-based biocontrol product that can eliminate multiple genera, or even different related species could be challenging, but combining phages specific to target hosts may overcome this problem (Buttimer et al., 2017;Frampton et al., 2012). The specificity of phages also reduces the risk of harming the natural microbiota, especially those nontarget bacteria that are potentially beneficial, and it limits the emergence of phage-resistant bacteria (Loc-Carrillo & Abedon, 2011). In recent years, there were numerous attempts to systematise the single and cocktail application of phages to tubers and vegetable crops. For example, the first bacteriophage of P. carotovorum subsp. carotovorum that was sequenced, PP1, exhibited effective protection against its host in lettuce (Lim et al., 2013). In another study, two other phages namely ϕPD10.3 and ϕPD23.1 were applied together in both whole potato tubers and slices against a number of Pectobacterium and Dickeya isolates. Tissue maceration was significantly reduced by 80% and 95% in slices and whole tubers, respectively . Two further studies revealed effective inhibition of SRPs in potato tubers using monophage formulations (J. Lee et al., 2017;Smolarska et al., 2018). In this study, the efficacy of the three bacteriophages, vB_PcaP-A3, vB_PcaM-D1, and vB_PcaM-J3, in both monophage and cocktail suspensions (combinations of two and three phages) were assessed through in vitro and semi-in planta bacterial challenge tests, and we found that both monophage and phage cocktails completely inactivated the growth of P. carotovorum subsp. carotovorum. However, phages in cocktail suspensions were more effective over individual application in terms of their protective effect against soft rot by P. carotovorum subsp. carotovorum as indicated by the complete maceration reduction in both MOI (0.001 and 100) tested in the study. Recent reports of phage cocktail formulations against P. carotovorum subsp. carotovorum have also described efficient inhibition of bacterial growth both in vitro and in vivo (Carstens et al., 2019;Muturi et al., 2019;Zaczek-Moczydłowska et al., 2020). The use of higher MOI in phage formulations has also been reported to increase the chance for the bacteriophages to infect all host cells, thus effectively killing all host cells after one round of replication (Alves et al., 2016;Thomas, 2001). Using different novel phage isolates against a number of SRP model strains, our work and the several studies mentioned above have provided preliminary evidence of the biocontrol potential of bacteriophages in controlling bacterial soft rot. However, a comprehensive understanding of their bioefficacy in postharvest applications is still limited and our work contributes to this pool of information by determining the efficient timing of phage treatment on tissues. Preliminary experiments conducted to assess possible timing strategies in employing phage treatments to control post-harvest soft |
rot revealed the protective effect of introducing phages prior to bacterial inoculation (Figure 3(E)). In each monophage treatment, advanced phage introduction (API) treatments of up to 30 h were observed to protect the tubers from developing the disease (Figure 3(E)). With API, we hypothesise that, considering that the phage number applied is higher than or equal to the optimal MOI, the phages were able to rapidly kill the inoculated bacterial population, thus suppressing both the bacterial growth and the emergence of visible symptoms of the disease. In contrast, a shorter window of time wherein the phage treatment seemed to offer effective protection from the disease was observed in the delayed phage introduction (DPI) treatment. This observation, in line with the hypothesised phage-bacterium interaction in the API treatment, seemed to suggest that a critical bacterial population relative to the phage population was required to effect noticeable disease manifestation. It was previously reported that quorum sensing regulates the coordination of the synthesis of virulence factors, including the production of plant cell wall degrading enzymes by Pectobacterium spp, which links the observed longer protective window of API treatment and the reduced protective window observed in DPI treatment (Pollumaa et al., 2012). Furthermore, taking both into account the differences in the characteristics of the phages and the MOI used in this experiment (MOI 10.0, relative to bacterial population at time 0), it follows that, for the DPI treatment, a shorter protective window shall be observed for vB_PcaM-J3, which has the longest latent period (30 min), lowest burst size (42 CFU/cell) and highest MOI (10.0). That is, with the advanced introduction of the bacterial population of at least 3 h, the bacterial population seemed to have grown enough such that the vB_PcaM-J3 population is not at its optimal MOI anymore. In line with this is the observed longer protective window afforded by vB_PcaP-A3 and vB_PcaM-D1 that have lower optimal MOIs of 0.01 and 1.0 respectively, which are both lower than the MOI used in this experiment, and higher burst sizes of 151 and 142 CFU/cell, respectively. These characteristics may have also provided a buffering effect to account for the bacterial growth in DPI treatment. Taken together, these results are suggestive of a potential post-harvest soft rot disease control strategy that may maximise the benefit of phage treatment by introducing efficiently lytic phages (ie. short latent period, larger burst size, and low optimal MOI) at a high MOI at the earliest time point after harvest. By doing so, while a small population of the soft rot-causing bacteria may have been inadvertently introduced during the process of harvesting, this population can be effectively controlled thus preventing bacterial growth, disease manifestation, and cross-contamination. However, we are also aware that the use of higher MOI could also possibly increase the emergence of phage-resistant bacterial variants (Chen et al., 2018). This is due to the rapid evolution of the bacterial population from the dominance of phage-sensitive clones to phage-resistant clones when exposed to the selection pressure of lytic phages (Castillo et al., 2015;Hyman & Abedon, 2010;Middelboe, 2000;Middelboe et al., 2001). This implies that the use of heavy phage loads is an important selection factor that should be taken into account in phage therapy and that lower MOIs should also be used when testing protective effect and bacterial inactivation by phages, particularly in actual plant tissues (Chen et al., 2018). To this end, further experimental studies to optimise the phage treatment parameters and to identify the minimum effective phage number for potential field and post-harvest application are to be conducted. A detailed assessment of the sequence of the whole genome of the characterised phages in this report would also be a necessary step moving forward. Elucidation of the genomic sequences of these phage isolates would allow phylogenetic relationship analysis that would shed light on their taxonomic relationships with other previously reported phages from other countries. More importantly, by analyzing the sequences of these phage isolates, the presence of genes related to lysogeny, antimicrobial resistance, or toxin production might also be detected, which are all important considerations for the development of a potential phage-based biocontrol treatment against soft rot disease caused by Pectobacterium spp. Lysis of erythrocytes by complement in the absence of antibody. A new pathway of complement-mediated hemolysis has been described. It is independent of antibody and does not require binding of the first four complement components to the target-cell surface. The actual attack of the target cell begins with the attachment of C5, C6, and C7. The binding reaction is catalyzed by C4, 2, 3, an enzyme which may be formed in cell-free solution. C4, 2, 3 may effect binding of C5, 6, 7 by acting from the fluid phase or from the surface of another cell to which it is specifically bound (EAC 4, 2, 3). In either case, the resulting product is EC5, 6, 7 which is susceptible to lysis by C8 and C9. Erythrocytes from patients with paroxysmal nocturnal hemoglobinuria (PNH) were particularly susceptible to lysis by the above described mechanism. PNH cells, but not normal human erythrocytes, could also be lysed through activation of complement by cobra factor. These observations allow the operational distinction of an activation and an attack mechanism of complement. in whole sheep or guinea pig blood, complement-dependent hemolysis has been reported to occur (3,4). It will be shown that, unlike normal human erythrocytes, PNH cells are exceptionally susceptible to this mode of hemolysis. The results contained in this paper have been presented in part in the form of two abstracts (5,6). Isolated C3 and C5 were utilized for quantitative uptake studies in radioactively labeled form. The chloramine T method (16) was used and the average specific radioactivity was, respectively, 50,000 and 120,000 cpm/#g of C3 and C5. Partially purified C6 was prepared as follows. The euglobulin fraction was precipitated from serum by dialysis against a 0.008 M EDTA solution of pH 5.4 and a conductance at 22°C of 1.25 mmho/cm. The protein precipitate was dissolved in 0.02 ~ sodium phosphate buffer, pH 7.3, containing approximately 0.2 ~ sodium chloride. After clearing the solution by centrifugation for 60 rain at 36,000 rpm in a Spinco No. 40 rotor (Beckman Instrument Co., Spinco Division, Palo Alto, Calif.), it was dialyzed against 0.02 M sodium phosphate buffer, pH 7.3, overnight and applied to a 3.3 X 70 cm column of triethylaminoethyl (TEAE) cellulose equilibrated with buffer used for dialysis. The chromatogram was developed with a combined salt and pH gradient, the limiting solution being 0.3 M NaH2PO4. C6 was eluted between pH 6.5 and 6.0, corresponding to a conductance range of 6.0-7.5 mmho/cm. C6 activity was detected using washed, optimally sensitized sheep erythrocytes (EA) and C6deficient rabbit serum (17). The fractions containing the greatest activity were pooled and concentrated by pressure filtration in an Amieon apparatus (Amicon Corp., Lexington, Mass.) using a UM 10 membrane. The material was then further separated by chromatography on a 2.5 X 38 cm column of carboxymethyl (CM) Sephadex C-50 equilibrated with sodium phosphate buffer, pH 6.0, ionic strength 0.05, containing sufficient NaC1 to yield a conductance of 10 mmho/cm. A NaC1 gradient was employed, the limiting conductance being 50 mmho/cm. C6 activity was eluted at a conductance range of 14.5-17.5 mmho/cm. This preparation was concentrated, frozen in liquid nitrogen, and stored at -70°C and used throughout this study. Approximately 60 ng of the preparation gave 50% lysis of 5 X 107 EA in 60 rain at 37°C (total volume 1.5 ml), in presence of 6.6% of C6-deficient rabbit serum. Partially purified C7 was prepared from the pseudoglobulin fraction of human serum, i.e., the supernatant of the euglobulin preparation (see above). The pH of the protein solution (400 ml) was adjusted to 7.3 with 1 ~NaOH and the conductance was raised to 2.2 mmho/cm with NaC1. The material was applied to a 7.5 X 50 cm column of TEAE cellulose equilibrated with 0.02 ~ sodium phosphate buffer, pH 7.3, and was eluted stepwise with the same buffer containing NaC1 to yield 10 mmho/cm. The activity emerged within a conductance range of 4.0-6.5 mmho/em. C7 activity was assayed with EAC1-3 plus an excess of C5, 6, 8, and 9. The active material was concentrated to 15 ml and applied to a 5 X 120 cm column of Sephadex G-200 equilibrated with 0.05 ~ tris(hydroxymethyl)aminomethane (Tris)-HC1 buffer, pH 8.0, containing 0.50 ~ NaC1. C7 activity was detected in fractions between the second and third peak of the elution profile. The active protein was then applied to a 2 X 30 cm column of P-cellulose (Cellex P, Bio-Rad Laboratories, Richmond, Calif.) equilibrated with sodium phosphate buffer, pH 6.0, ionic strength 0.1. After elution by NaC1 concentration gradient, C7 activity was found in fractions of 17-23 mmho/cm. With the assay system used, approximately 280 ng of C7 gave 50% lysis of 5 X 107 cells in 60 rain at 37°C. Cobra Factor.--The cobra factor was isolated from lyophilized Naja naja venom purchased from Ross Allen Reptile Farm, Silver Springs, Fla. The method of isolation has previously been described (19 Conditions of Lysis of Nonsensitized Erythrocytes.--In experiments where lysis was induced from the fluid phase, 2 X l0 s washed erythrocytes (sheep E) or 1 X l0 s human E were packed by centrifugation into the bottom of a small test tube and the supernatant was removed with a Pasteur pipette. Usually C3, 5, 6, and 7 were then added and the cells suspended by use of a Vortex mixer. After addition of C4,2 the reaction mixture was incubated for 20 min at 37°C. The diluent was GVBE, pH 6.5. The total reaction volume was 0.25-0.3 ml. The cells were washed twice in GVBE of pH 7.4 and suspended in 2 ml of this buffer. 0.5 ml of the suspension was reacted with 1 ml of a solution of C8 and C9 for 60 min at 37°C. Controls included 2 X 0.5 ml of cell suspension plus 1 ml buffer and 1 ml distilled water, respectively. The free hemoglobin concentration was measured spectrophotometrically at 412 nm. The C4,2 enzyme was prepared by mixing, in a total of 1 ml, 12 X 10 l° effective molecules of °xyC2 (approximately 7 #g protein), 3 X 10 l° effective molecules of C4 (approximately 3 #g protein), and 0.75/zg of Cls. The pH was adjusted to 7.4 and the Mg ion concentration to 0.0005 M. This mixture was incubated at 37°C for 30 min after which time EDTA was added to a final concentration of 0.02 M, and the pH was lowered to 6.5 with 0.1 N HC1. The final volume was 1.5 ml, of which 0.05~0.1 ml were used per 2 X l0 s sheep E or 1 X l0 s human E, unless otherwise indicated. The amount of C3 used for the same number of cells was usually 20 #g and was varied in some experiments between 5 and 100 #g. The amount of C5 was generally 15 #g per tube and was varied in dose response experiments over a 10,000-fold range. C6 and C7 were employed in optimal concentrations, which cannot be defined by weight since only functionally pure material was available. C8 and C9 were used in amounts of 26 and 60 ng per tube, respectively. In experiments where target-cell lysis was induced by trigger cells, C4,2 or C4,2,3 were bound to the trigger cells according to published methods (20). The number of C4-~or C4,2,3 complexes per cell was 3000-5000. Usually 1 X 10 s 51Cr-labeled sheep E was mixed with 1 X 10 s trigger cells and a cell button was formed by centrifugation. The supernatant was withdrawn and replaced by 0.2 ml of a solution of C3, 5, 6, 7 or C5, 6, 7 in pH 6.5 buffer. The mixture was incubated for 20 min at 37°C, washed twice in 4 ml pH 7.4 buffer, resuspended in 2 ml of the latter buffer and 3 X 0.5 ml of this suspension were treated and evaluated as described above for lysis induced from the fluid phase. 51Cr release was measured using 1 ml of the cell-free supernatant obtained after completion of the reaction. In experiments where lysis of human erythrocytes was induced by cobra factor, 5 X 107 red cells were incubated with 0.1 ml of a blood group-compatible human serum |
in the presence of purified cobra factor in a total reaction volume of 0.310 ml. The pH had been ad-justed to 8.0 and the Mg ion concentration to 0.0005 ~. After 30 rain at 37°C, 2 ml of isotonic NaCl-veronal buffer containing 0.1% gelatin, 0.00015 M calcium, and 0.0005 M magnesium (GVB) of pH 8.0 was added to each tube and incubation was continued for another 60 rain. Labeling of E with ~lCr.--lO ml of sheep E containing 5 X 10 ~ cells were incubated with 0.25q).5 mCi of 51Cr sodium chromate (New England Nuclear Corp., Boston, Mass.) for 45 min at 37°C in GVBE of pH 6.5. The cells were washed with 5 X 10 ml of the same buffer and resuspended to obtain the desired concentration. The uptake of label corresponded to 20,000-40,000 cpm per 2 X 10 s cells. Serological Detection of Cell-Bound Complement Proteins.---Cell-bound C3, C4, or C5 were detected using monospecific complement antisera and the microtiter technique (Cooke Engineering Co., Alexandria, Va.). 0.025 ml samples of 5 X 107 cells/ml were mixed with dilutions of the antisera ranging from 1:50 to 1:6400. The plates were kept for 20 rain at 37°C and overnight at 4°C, and the reaction was evaluated by reading the settling patterns. Cell-bound C3 was also detected by immune adherence (21,22) using lysates prepared from cell suspensions containing 5 X 1@ to 1 X 109 cells/ml. Complement-Dependent Lysis of Nonsensitized Sheep Erythrocytes Initiated by C4,2 in Free Solution Requirement of Components.--Treatment of nonsensitized sheep erythrocytes (E) with C3,5,6,7 in presence of preformed C412 rendered these cells susceptible to lysis by C8 and C9. Similarly, incubation of E with C3-8 in presence of C4,2 caused these cells to become susceptible to the action of C9. Since treatment of E was performed in two consecutive steps which were separated by repeated washings of the cells, it is evident that the first treatment led to the formation of intermediate complexes carrying either C7 or C8 sites. Deletion from the reaction mixture of either the activating enzyme C4,2 or the components C3-7 or C3-8 prevented lysis. Also, when E was first incubated with C4,2 plus C3 and then washed, these cells were unable to undergo lysis upo___nn later addition of C5-9. The latter control indicated that fluid phase C4,2 did not form hemolytically active C3 sites on the surface of E. The results are summarized in Table I. Fig. 1 shows that lysis of E is proportional to the concentration of the C4,2 enzyme in the reaction mixture. In each of the two experiments depicted, the amounts of the other complement proteins were constant. When the concentration of C5 was varied and that of all other proteins including C4,2 was kept constant, lysis of E was found to be proportional to C5 input (Fig. 2). Relationship Between Lysis of E and the Concentration of C4,2 and C5.-- Physical Uptake of Complement Proteins by E.--Since E treated with C3, 5,6,7 and C4,2 acquired reactivity with C8 and C9, the question arose as to which complement proteins were specifically bound to their surface. Qualitative detection was attempted using antisera to three different complement proteins. In all of five separate experiments, treated E failed to react with anti-C3 and anti-C4, but gave a definite agglutination reaction with anti-C5. The absence of specifically bound C3 was further substantiated by the observation of negative immune adherence reactivity (Table II). On the other hand, Lysis of Nonsensitized Erythrocytes (E) by Complement Following Activation in Free Solution Treatment of E Hemolysis Conditions: Treatment I: 2 X 108 E, reagents in 0.2 ml GVBE, pH 6.5, 20 rain at 37°C; the cells were then washed twice. Treatment II: conditions as in I. Treatment III: 5 X 107 E, reaction volume 1.5 ml, 60 rain at 37°C. EAC4,2,3 and EAC4,2,3,5 gave strongly positive serological reactions as anticipated. These findings indicated that the treated E cells which could be lysed with C8 and C9, but lacked C3 and C4, were in the state EC5,6,7. The serological data were confirmed and extended by quantitative uptake studies using radiolabeled C3 and C5. Table III lists results of experiments with 125I-C3 in which the input of C3 was varied and in which uptake was determined in the presence and absence of C4,2 or C5,6,7. Compared to EAC4-~, 2, which showed a C3 uptake of 15 % of input or more than 14,000 molecules per In the case of C5, uptake by EAC4,2,3 was 1.9 % of input____, in agreement with previous studies (18). Nonspecific adsorption to EAC4,2 was 0.95%. The specific uptake therefore may be calculated to be 1% or 1480 molecules per cell. Similarly, the specific uptake of C5 by nonsensitized E was approximately 1% of input, corresponding in two experiments respectively to 600 and 438 C5 molecules per cell. This degree of C5 binding must be considered highly significant (Table IV). In addition, these cells could be agglutinated with an anti-C5 serum as indicated in Table II. The control cells with nonspecifically adsorbed C5 on their surface gave no agglutination reaction. Conditions: 2 X 10 s cells, reagents in 0.2 ml GVBE, pH 6.5, 20 rain, 37°C. The cells were then washed five times and uptake of l~SI was measured. To determine the degree of hemolysis, 5 X 10 7 treated cells were incubated with C8 and C9 in a total volume of 1.5 ml for 60 rain at 37°C. * Difference between uptake in presence and absence of C4,2. Complement-Dependent Lysis of Nonsensitized Sheep Erythrocytes Triggered by EAC4,2 or EAC4,2,3 Requirement of Components.--The results obtained so far raised the question whether the activating enzyme may be bound to one cell and yet mediate up_ take of C5,6,7 by another cell. Therefore, EAC4,2,3 was mixed with 51Crlabeled E and the cell mixture was treated first with C5,6, 7, washed, and then with C8 and C9. As shown in Table V, 51Cr was released under these conditions, indicating lysis of 25 % of E present. In addition, there was complete lysis of the trigger cells, EAC4,2,3. There was no chromium release when C3 was omitted from the reaction mixture. This and similar experiments showed that C5,6,7, when activated by cell-bound C4,2,3, may transfer and become bound to an adjacent target cell, thereby initiating the cytolytic reaction. To determine whether a hemolytically reactive EC5 intermediate can be prepared the following experiment was carried out. EAC4,2,3 was mixed wim 51Cr E and the mixture was treated for 10 rain at 30°C with various amounts of C5. The cells were then washed and reacted with a reagent containing C6-9. Conditions: 2 X 107 EAC, 8 X 107 E; reagents in 0.2 ml GVBE, pH 6.5; incubation, 30 rain at 37°C, followed by washing and exposure to C8,9 for 60 min at 37°C. E labeled with 51Cr; lysis of E measured by 51Cr release. The amount of chromium released appeared insignificant and bore no relationship to the increasing amounts of C5 added (Table VI). It was concluded that C5 cannot be bound to E specifically and in hemolytically active form without C6 and C7. Concentration.--Fig. 3 demonstrates that lysis of nonsensifized E by EAC4,2 and C3-9 is markedly dependent on a high cell concentration. Lysis of E was 44% at the highest concentration tested Conditions: 10 s E and 108 EAC412,3 in GVBE, pH 6.5, were treated with C5 for 10 rain at 30°C in a total volume of 0.3 ml. The cells were washed twice, resuspended with 0.2 ml C6-9 or C8 and C9 and incubated for 20 rain at 37°C. To every tube was then added 2.0 ml of GVBE, pH 7.4, and incubation was continued for another 60 rain. E was labeled with 5ICr and lysis of E was detected by 51Cr release. Relative Concentration of C~ Fla. 5. Dependence of lysis of nonsensitized PNH and normal human erythrocytes upon the concentration of C4,2,3 in the reaction mixture. The C4,2,3 concentration was varied over a fourfold range, whereas the concentration of the other complement components was constant. Erythrocytes from two patients with PNH and from three normal individuals were used. tration of 6.6 X l0 s cells/ml with C5-9. Whereas all other parameters were constant, the C5 concentration was varied from 0.04 ng to 10 pg. As shown in Fig, 4, 50% lysis of EAC4,2,3 was obtained with 0.34 ng of C5, whereas the same degree of lysis of E required 4.1 tzg of C5. Complement-Dependent Lysis of PNH and Normal Human Erythrocytes Initiated in Free Solution Relationship Between Lysis and the Concentralion of C4,2,3 and C5.-- Fig. 5 shows the extent of lysis of PNH and normal human erythrocytes as a function of C4,2,3 concentration. 50 % lysis of PNH cells was observed with a relative amount of C4,2,3 of 1.5 and the same degree of lysis of normal cells was ob-0,4. Micrograms C5 FIG. 6. Dependence of lysis of nonsensltized PNH and normal human erythrocytes upon the C5 concentration. FlC. 7. Comparison of the binding efficiency of activated C5 by PNI-I and normal human erythrocytes. PNHE and E were each incubated with varying amounts of 125I-C5 and constant amounts of C4,2, C3, C6, and C7. After 20 rain at 37°C, the cells were washed and the uptake of radiolabel was determined. tained within a relative amount of 2.2-3.4. Lysis of these two types of cells as a function of C5 concentration is demonstrated in Fig. 6. To achieve the same degree of lysis, 3.5-11 ~g of C5 were required for PNH cells and 23-100 ~g of C5 for normal cells. Relationship Between C5 Uptake and Cell Lysis.--Under identical conditions and in the presence of fluid phase C4,2,3 PNH erythrocytes bound more than three times the number of C5 molecules than normal human erythrocytes (Fig. 7). The degree of ensuing hemolysis was proportional to the number of C5 molecules bound. When the same number of C5 molecules had become bound to either cell type, the same degree of hemolysis was observed (Fig. 8). Complement-Dependent Lysis of PNH Erythrocytes Triggered by Cobra Factor. --Isolated cobra factor was used to activate the C3 serum proinactivator. Micrograms of Cobra Factor Fio. 9. Comparison of lysis of PNH and normal human erythrocytes induced by cobra factor. S X 10 T cells were incubated with 0.1 ml of blood group-compatible serum and varying amounts of cobra factor in a total volume of 0.310 ml. The diluent was GVB, pH 8.0. After 3(1 rain at 37°C, 2.0 ml of GVB o£ pl--I 8.0 were added to each tube and incubation was continued for another 60 rain. Addition of increasing amounts of cobra factor to samples of human serum containing PNH cells and incubation at 37°C and pH 8.0 led to development of marked hemolysis (Fig. 9). Subsequent examination of lysed and uulysed cells with antisera to complement proteins gave positive agglutination reactions. Normal human erythrocytes were unaffected by this mechanism of hemolysis. DISCUSSION The present experiments define a new pathway of complement-mediated hemolysis which is not dependent on the participation of antibody and on the presence of the first four complement components at the surface of the target cells. The attack of complement proteins on the target cell membrane begins with C5 and involves only the five terminal components. This study represents a detailed exploration of preliminary observations which were made several years ago (23). The mechanism described resembles, to a certain extent, that postulated by Yachnin for PNH-cell lysis (24) and may be related to the mechanism underlying the phenomenon of reactive hemolysis reported by Thompson and Lachmann (25). The results demonstrate that activated C5 in the presence of C6 and C7 may bind directly and in hemolytically active form to receptors of unsensitized erythrocytes. They show that C5, C6, and C7 act as a functional unit in this reaction and that the three proteins can transfer from the site of activation on one cell to the site of binding on another cell. The nature of the binding site of C5 in classical immune hemolysis is still unknown, although it has been clearly shown that firm, physical binding of C5 is a prerequisite of the formation of hemolytically active C5 sites on the cell surface (26)(27)(28). Shin et al. (28) believe guinea pig C5 to be bound in close proximity to |
the C2 and C3 molecules on EAC4,2,3,5. This assumption is based on their observation that C5 is dissociated from cells concomitant with the decay-release of C2. Release of specifically bound l~sI-C5 could not be demonstrated for the human analog, neither in conjunction with C2 release nor as a consequence of decay of cell-bound hemolytic C5-sites (18). Thus, the hypothesis that the receptor of C5 is the C4,2,3 complex can neither be verified nor refuted on the basis of this study. However, the reported formation of EC5,6,7 cells shows that C5,6,7 sites may be established directly on membrane receptors without the previous binding to this membrane of C4,2,3 or of antibody. Specific binding of C5 by E required the participation of C6 and C7, since a hemolytically reactive EC5 complex could not be formed. This is in contrast to C5 binding by EAC4,2,3, which proceeds in absence of C6 and C7 (26)(27)(28). But even in the classical immune hemolytic reaction, C6 and C7 greatly enhance C5 action by facilitating attachment of activated C5 molecules to the cell surface (18). Thus, it appears most probable from this and other studies (18,26) that C5, C6, and C7 constitute a functional unit, although under specified conditions C5 can act independently of C6 and C7. Comparing the effect of C5-C9 on E and on EAC4,2,3 present in the same reaction mixture disclosed a large quantitative difference in lysis of the two cell types. Whereas under otherwise identical conditions lysis of EAC4,2,3 proceeded with nanogram amounts of C5, lysis of E required microgram quan-tities. This difference may indicate that successful binding of activated C5,6,7 is more likely to occur in the proximity of the activation site (C4-, 2,3) than at some distance from it. In agreement with this assumption, the degree of lysis of E was found to be proportional to cell concentration, i.e., inversely proportional to the average distance between trigger and target cells. If nonimmune cytolysis should occur in vivo, the prevailing conditions would be more favorable than the optimal conditions employed in these experiments; in vivo the local cell concentration is generally high and so is the concentration of complement proteins in plasma. Binding of C5,6,7 to target cells (E) after activation by trigger ceils (EAC 4,2,3) requires transfer of the activated components. Transfer of C5,6,7 from the site of activation on one cell to the site of binding on another cell is distinct from any other known or postulated transfer phenomenon of complement components. It is reminiscent of the transfer of activated C3 (1) which was deduced from electron microscope evidence (29). C3 transfer, however, appears to occur only between an activation site (C4~,2) and a receptor site located on the same cell. C3 fails to achieve binding to a cell following activation in the fluid phase or at the surface of an adjacent cell. The C5,6, 7 transfer is also distinct from transfer of C5 from EAC4,2,3,5 to EAC4,2,3, which Shin et al. (28) postulated for guinea pig complement. Here, a C5 molecule which was previously bound to a C4,2,3 receptor site is assumed to transfer to other C4,2,3 sites, including those located on other cells. A completely different type of reaction is the well documented transfer of C1 between antibody sites of the same or of different cells (30). This process is due to the relatively weak binding of C1 to immunoglobulins and to the stability of the C1 combining site. In contrast, the binding potential of other activated complement proteins, including C5,6,7, is labile; however, once binding has occurred the bond is usually much firmer than that of C1. Thus, the ability of C5,6,7 to transfer from the activation site (trigger cell) to a relatively distant binding site (target cell), suggests that the half-life of the activated combining site is not as short as in the case of C3. The experimental conditions which allowed effective transfer of C5,6,7 between trigger and target cells permit estimation of the maximal life span of the C5,6,7 combining potential. The inflection point of the 51Cr release curve in Fig. 3 was determined by extrapolation of the two straight portions of the curve. It corresponds to a reaction volume of 0.3 ml. Since the total number of cells present was 108, the average distance (d) between the cells in suspension was calculated to be 2.6 X 10 -4 cm, assuming a mean diameter for sheep erythrocytes of 4 X 10 4 cm. The approximate time (t) required for the activated trimolecular complex, (C5,6,7) to diffuse over the distance d is: t --d2/2D = 0.1 sec. For D, the diffusion coefficient of (C5,6,7) at 37°C, a value of 3.3 X 10 -7 cm2/sec was assumed. It may be inferred from these considerations that the maximal life span of the activated binding site of C5, 6,7 is smaller than or equal to 0.1 sec, and that this permits the activated complex to react with receptors which are separated from the site of activation by maximally 2.5 ~. Although most of the work has been done with sheep erythrocytes, similar results were obtained with normal human E and particularly with PNHE. The latter are known to be considerably more susceptible to lysis by complement than normal cells (31). This greater susceptibility can in part be explained in this study by the ability of PNH cells to bind a larger number of C5 molecules than normal human red cells. In addition, PNH cells exhibited a marked susceptibility to lysis triggered by cobra factor. This protein had previously been shown to combine with a fi-globulin when added to serum and to form an enzymatically active complex which is able to cleave C3 in a manner analogous to C4,--2 (2). Recently, Picketing et al. (3) and Ballow and Cochrane (4) demonstrated that cobra factor could induce lysis of unsensitized sheep or guinea pig erythrocytes by autologous serum. It is pr___obable that the cobra factor-B-globulin complex can substitute for the C4,2 enzyme and thus activate in typical fashion the late-acting complement proteins. It is further probable that cobra factor analogs occur in the mammalian organism which are capable of activating the fi-globulin in vivo. Similarly, formation of the C4,2 enzyme might occur in vivo through antibody-independent activation of C1 which has been achieved in vitro by plasmin, trypsin (32), and kallikrein (33). Thus, both mechanisms might conceivably be operative in complement-dependent nonimmune cytolysis in vivo. The concept emerging from this work may be formulated as follows. The C5,6,7 complex following enzymatic activation of its combining site can transfer to a receptor site on the surface of nonsensitized cells which contain no measurable amounts of either C2, C3, or C4. Bound C5,6,7 can then react with C8 and C9, following which the cell undergoes lysis. The C4,2,3 enzyme can act either from the fluid phase or from the surface of another cell. Since C8 and C9 are unable to cause lysis of E in the presence of EAC4,2,3,5,6,7, * it appears that direct attack of complement on a target membrane cannot start later than at the C5,6,7 step. These findings allow an operational distinction between an activation mechanism of complement, consisting of C1,2,3 and C4, and an attack mechanism comprising C5,6,7,8 and C9. SUIfI~ARY A new pathway of complement-mediated hemolysis has been described. It is independent of antibody and does not require binding of the first four complement components to the target-cell surface. The actual attack of the target cell begins with the attachment of C5, C6, and C7. The binding reaction is catalyzed by C4,2,3, an enzyme which may be formed in cell-free s~lution. C4,2,3 may effect binding of C5,6,7 by acting from the fluid phase or from the surface of another cell to which it is specifically bound (EAC4,2,3). In either case, the resulting product is EC5,6,7 which is susceptible to lysis by C8 and C9. Erythrocytes from patients with paroxysmal nocturnal hemoglobinuria (PNH) were particularly susceptible to lysis by the above described mechanism. PNH cells, but not normal human erythrocytes, could also be lysed through activation of complement by cobra factor. These observations allow the operational distinction of an activation and an attack mechanism of complement. The skillful technical assistance of Mrs. Arlene Bayne is gratefully acknowledged. Topical imiquimod in combination with brachytherapy for unresectable cutaneous melanoma scalp metastases ITM: in-transit metastases INTRODUCTION Scalp melanomas are associated with poor disease-related and survival outcomes compared with melanomas affecting other anatomical sites, partially due to high rates of in-transit metastases (ITM), defined as localized[2 cm from the primary tumor but not beyond draining lymph nodes. The standard treatment for ITMs is surgical excision; however, surgery is often impractical for multiple or diffuse ITMs. Currently, the only Food and Drug Administration-approved therapy, specifically directed at ITMs is talimogene laherparepvec, an injectable modified oncolytic herpes simplex virus, which has shown modest response rates in phase III studies in patients with locally advanced melanoma. Local therapies (intra-arterial regional perfusion, intralesional interleukin-2, Bacille Calmette-Guerin vaccination, diphencyprone, carbon dioxide laser, electrochemotherapy) have also been tried with varying degrees of success. One local therapy is topical imiquimod, an immunomodulator which binds to toll-like receptor 7 stimulating tumor-specific T cell responses. Imiquimod has already been found to be safe and effective in treating cutaneous malignancies such as lentigo maligna. Recent guidelines recommend INTRODUCTION Scalp melanomas are associated with poor disease-related and survival outcomes compared with melanomas affecting other anatomical sites, partially due to high rates of in-transit metastases (ITM), defined as localized [2 cm from the primary tumor but not beyond draining lymph nodes. 1,2 The standard treatment for ITMs is surgical excision 3 ; however, surgery is often impractical for multiple or diffuse ITMs. Currently, the only Food and Drug Administration-approved therapy, specifically directed at ITMs is talimogene laherparepvec, an injectable modified oncolytic herpes simplex virus, which has shown modest response rates in phase III studies in patients with locally advanced melanoma. 4 Local therapies (intra-arterial regional perfusion, intralesional interleukin-2, Bacille Calmette-Guerin vaccination, diphencyprone, carbon dioxide laser, electrochemotherapy) have also been tried with varying degrees of success. 5,6 One local therapy is topical imiquimod, an immunomodulator which binds to toll-like receptor 7 stimulating tumor-specific T cell responses. 7 Imiquimod has already been found to be safe and effective in treating cutaneous malignancies such as lentigo maligna. 8 Recent guidelines recommend topical imiquimod application for 10 to 14 weeks, 9 with individualized regimens tailored based on clinical reactions. Aside from local therapies, radiation has been used for palliative or adjuvant therapy in advanced cutaneous malignant melanoma. A retrospective study on palliative external beam radiotherapy in stage III melanoma patients, half with ITMs, demonstrated a complete response of 44% at 3 months. 10 Compared with conventional external beam radiotherapy, brachytherapy is short-range radiation delivered via sources placed within or close to the target, which has already been used to treat cutaneous and hematologic malignancies. 11 An important advantage of brachytherapy is the ability to match radiation dose to the curvature of complex surfaces like the scalp, achieving a more homogeneous dose throughout the target and minimizing injury to adjacent normal tissue, and over a curvaceous surface, is much more conformal than standard electron beam therapy. Mounting evidence suggests that radiation can stimulate antitumor immune responses, thereby mediating a response distant from the irradiated volume (abscopal effect); thus, leading to regression of not only the treated tumor but also untreated metastases at other locations. 12 Here, we describe 3 patients with surgically unresectable scalp ITMs who experienced complete responses with brachytherapy followed by topical imiquimod. Case 1 A 63-year-old man presented with an enlarging, darkening macule on his left posterior scalp. Biopsy revealed lentigo maligna melanoma, invasive to 2.9 mm with 2 mitoses/mm 2 , without ulceration (T3a). Six months after wide local excision and negative sentinel lymph node biopsy, he developed multiple scalp lesions adjacent to his melanoma excision site which were consistent with ITMs. Given the presence of multiple lesions, he received high-dose rate brachytherapy (5 fractions of 6 Gray over 3 weeks) with moderate improvement (Fig 1). He then received topical imiquimod to the residual lesions, 5 days a week for 12 weeks, with complete clinical resolution (Fig 2, A). During treatment, increased erythema in areas of brachytherapy suggestive of a radiation recall effect was noted (Fig 2, B). He later developed pulmonary and liver |
metastases, for which he completed treatment with 4 doses of ipilimumab leading to a complete response. He has been disease-free for 8 years. Case 2 A 60-year-old man presented with a ''red circle'' on his scalp. Biopsy demonstrated invasive malignant melanoma, Breslow thickness 1.35 mm, without ulceration (stage IB). Four months after wide local excision and sentinel lymph node biopsy, which revealed clear margins and no lymph node involvement, he developed 2 lesions surrounding the excision site consistent with satellite metastases. Given bilateral scalp metastases, high-dose rate brachytherapy was initiated (5 fractions of 6 Gray over 2 weeks) after wide local excision of the 2 metastases and negative sentinel lymph node biopsy, followed by adjuvant topical imiquimod twice daily to the entire scalp. Three months later, the patient presented with extensive forehead erythema (Fig 2, C ), prompting discontinuation of imiquimod to all areas except the right scalp, which had not yet developed erythema. He achieved complete response after 3 months of topical imiquimod (Fig 2, D), with subsequent biopsies confirming no residual melanoma. One year later, screening Positron Emission Tomography/Computed Tomography revealed a lung nodule consistent with metastatic melanoma. He received 5 doses of nivolumab with radiographic resolution of pulmonary nodules and no additional metastatic disease. Case 3 A 79-year-old man presented with a tender pink scalp nodule. Biopsy showed melanoma invasive to 3 mm thickness by Breslow, with 7 mitoses/mm 2 , without ulceration. He underwent wide local excision with rotational flap reconstruction and sentinel lymph node biopsy. The excision revealed residual melanoma 1.4 mm from the nearest margin and 4.2 mm from the deep margin. The sentinel lymph node biopsy revealed no involvement with melanoma. Two months later, he developed scalp lesions which were biopsied and demonstrated metastatic melanoma (Fig 2, E ). Given the presence of numerous ITMs on a reconstructed area, he underwent highdose rate brachytherapy (5 fractions of 6 Gray over 2 weeks) (Fig 2, F ), followed by 3 months of daily imiquimod application with excellent response. He has been disease-free for 7 years. DISCUSSION Scalp melanoma may represent a more aggressive subtype with high rates of ITMs. 1,2 The standard treatment for isolated ITMs is surgical excision; however, there is currently no standard of care for multiple and diffuse ITMs that preclude surgery. A systematic review of ITM treatments showed that surgery was associated with rates of local progression between 25% and 72% at 10 to 160 months, while topical imiquimod was associated with rates of local progression between 18% and 70% over 12 to 30 months. 4 The 3 patients treated with brachytherapy followed by topical imiquimod described here achieved rapid clearance of ITMs with minimal cutaneous adverse effects and sustained clinical remission during follow-up of at least 5 years, and for some of these patients up to 8 years. Brachytherapy allows precise targeting of skin lesions, minimizing excessive brain irradiation, 13 which is especially beneficial for patients with cutaneous metastases on complex surfaces such as the scalp. Moreover, brachytherapy may have utility for close-margin excisions, as demonstrated by case 3 who has remained disease-free. Finally, this treatment combination is well-tolerated with minimal adverse effects limited to pruritus, low-grade dermatitis, and likely permanent hair loss in the highdose radiation area. These 3 patients sustained clearance of cutaneous melanoma for a median follow-up of 5 years. While 2 of the patients developed distant metastases on interval screening, their metastatic disease responded well to systemic immunotherapy. It is possible that local imiquimod augmented the antitumor activity of skin-resident T cells, potentiating the response to systemic immunotherapy. 14 Since brachytherapy followed by topical imiquimod was not sufficient to prevent distant metastases in these patients, there may be differences in T cell populations that monitor the skin compared to systemic organs. This raises the question of what mechanisms are involved in generating different subsets of memory T cells in the skin compared to other organ systems. Patients with cutaneous metastases from melanoma have longer overall survival rates compared to those with distant metastases, 10 therefore, ITMs may be more responsive to treatment than distant metastases. Nonetheless, the combination of brachytherapy and topical imiquimod described here is an effective and well-tolerated treatment for ITMs. To our knowledge, this is the first case series of unresectable cutaneous melanoma metastases on the scalp locally controlled with brachytherapy and topical imiquimod. Although, further investigations using larger patient cohorts are needed to determine the reproducibility of our findings, this combination for cutaneous melanoma metastases is a promising treatment strategy that should be considered. We thank these 3 patients for contributing to increased knowledge of novel combination therapies for unresectable cutaneous melanoma metastases. Low lung function, sudden cardiac death and non-fatal coronary events in the general population Background Many of those who suffer from a first acute coronary event (CE) die suddenly during the day of the event, most of them die outside hospital. Poor lung function is a strong predictor of future cardiac events; however, it is unknown whether the pattern of lung function impairment differs for the prediction of sudden cardiac death (SCD) versus non-fatal CEs. We examined measures of lung function in relation to future SCD and non-fatal CE in a population-based study. Methods Baseline spirometry was assessed in 28 584 middle-aged subjects, without previous history of CE, from the Malmö Preventive Project. The cohort was followed prospectively for incidence of SCD (death on the day of a first CE, inside or outside hospital) or non-fatal CE (survived the first day). A modified version of the Lunn McNeil’s competing risk method for Cox regression was used to run models for both SCD and non-fatal CE simultaneously. Results A 1-SD reduction in forced expiratory volume in 1 s (FEV1) was more strongly associated with SCD than non-fatal CE even after full adjustment (FEV1: HR for SCD: 1.23 (1.15 to 1.31), HR for non-fatal CE 1.08 (1.04 to 1.13), p value for equal associations=0.002). Similar associations were found for forced vital capacity (FVC) but not FEV1/FVC. The results remained significant even in life-long never smokers (FEV1: HR for SCD: 1.34 (1.15 to 1.55), HR for non-fatal CE: 1.11 (1.02 to 1.21), p value for equal associations=0.038). Similar associations were seen when % predicted values of lung function measures were used. Conclusions Low FEV1 is associated with both SCD and non-fatal CE, but consistently more strongly associated with future SCD. Measurement with spirometry in early life could aid in the risk stratification of future SCD. The results support the use of spirometry for a global assessment of cardiovascular risk. INTRODUCTION Sudden cardiac death (SCD) is an unexpected death of cardiac origin, occurring within 1 hour of onset of symptoms in witnessed cases or within 24 hours of being seen alive and well if unwitnessed. 1 Since there is usually incomplete information from witnesses in population-based settings, other operational definitions are frequently used, such as coronary deaths outside hospital or a fatal outcome during the day of the acute coronary event (CE) in individuals without any previous history of acute CEs. The typical pathophysiological sequence of events in the majority of cases is the onset of ventricular tachycardia, degenerating into ventricular fibrillation and finally to asystole. 2 Coronary heart disease (CHD) is the underlying condition in approximately 70%-80% of SCD events, 1 3 4 and in many cases, SCD is the first and only indication of heart disease. 5 It has been thought of as an 'epidemiological paradox' since a large proportion of the absolute number of SCD comes from those not considered to be high-risk individuals. 4 6 The value of conventional cardiovascular risk markers to predict fatal arrhythmic events in individual subjects is low, and, therefore, a search for more specific markers of predicting fatal arrhythmias leading to SCD are needed. 2 Although an association between low vital capacity (VC) and SCD has been proposed, 7 8 there have not been many studies of the general population to explore this association further. Chronic obstructive pulmonary disease (COPD) has been associated with SCD, 9 but few studies exist for pulmonary function in otherwise healthy individuals, as a marker of SCD. A Key messages ► Although poor lung function is a strong predictor of future cardiac events, it is unknown whether sudden cardiac death events or coronary events that survive the first 24 hours are more strongly associated with poor lung function earlier in life. ► Low forced expiratory volume in 1 s is more strongly associated with future sudden cardiac death than incident coronary events that survive the first day, even in life-long never smokers. ► More specific markers of predicting sudden cardiac death (SCD) in the general population are needed as a large proportion of the absolute number of sudden cardiac death comes from those not considered to be high risk; we propose measurement with spirometry in early life could aid in the risk stratification of future SCD. Open access prospective population-based study in 2015 assessed impaired pulmonary function as a risk predictor for SCD in over 1000 middle-aged men and found that reduced lung function as measured by spirometry was a robust predictor of SCD; a finding that was also replicated in non-smokers. 10 In an additional population-based study in Malmö, Sweden, it was found that in just under 5500 apparently healthy men with moderately reduced lung function, a higher case-fatality was found for future CE. 11 One of the most striking findings was that lung function predicted the fatality of a CE when the men were comparatively young (mean age 47 years) and healthy, that is, many years before the CE took place itself. Although poor lung function is a strong predictor of future cardiac events, it is unknown whether the pattern of lung function impairment differs for the prediction of SCD versus non-fatal CE, and which of the two outcomes are more strongly associated with poor lung function earlier in life. In this study, we aim to assess if measures of spirometry are associated with future SCD and non-fatal CE using prospective data from a general population study in over 28 500 participants. Study population The study population consisted of subjects from the Malmö Preventive Project where middle-aged individuals were screened with an aim to offer preventative treatment to any identified high-risk individuals. Screening was carried out between 1974 and 1992 in 33 346 subjects (22 444 men and 10 902 women) (participation rate of over 70%). Complete birth cohorts for 1921-1949 were invited for a physical examination, laboratory tests, spirometry and self-administered questionnaires. Men were mostly screened between 1974 and 1982 and women between 1982 and 1992. The screening programme was approved and funded by the Health Service Authority of Malmö. Subjects with prevalent CHD or cardiovascular disease (CVD) were excluded, which included a history of CEs or a history of stroke, based on self-reported questionnaire data or registers of hospital inpatients (n=182). Spirometry was performed in birth cohorts during most but not all screening periods (94% of men and 71% of women); however, individuals were not selected based on symptoms or disease. Subjects with missing information on spirometry were excluded (n=4389). Subjects with missing information on key covariates were excluded (n=147). Subjects with an erythrocyte sedimentation rate (ESR) ≥50 mm/hour were excluded as this could potentially indicate the presence of a specific inflammatory lung pathology (n=63). The final study population consisted of 28 584 subjects (20 939 men and 7645 women). Patient and public involvement Study participants were not involved in the study design and conduct, or the reporting and dissemination of the study findings. Baseline examinations Forced expiratory volume in 1 s (FEV 1 ) and forced VC (FVC) were measured using a spirotron apparatus (Drägerwerk AG, Lübeck, Germany), carried out by trained nursing staff. Only one acceptable manoeuvre was required. FEV 1 , FVC and FEV 1 /FVC were standardised for age and height using published equations derived from linear regression of never smokers in the present cohort 12 13 (online supplemental methods). Height (metres) was measured using a fixed stadiometer; weight (kg) was measured on a balance beam scale. Body mass index (BMI) was calculated as kg/m 2 . Blood pressure (BP) (mm Hg) was measured after a 10 min rest in the supine position (two measurements taken and mean value recorded). Blood samples were taken after an overnight fast |
and analysed at the Department of Clinical Chemistry, Malmö University hospital. ESR was determined according to the Westergren method. Information on smoking habits was assessed using a questionnaire, and based on their responses, participants were divided into current, former or never smokers. Endpoint ascertainment All individuals with a history of CE, according to self-report or patient registers, were excluded. SCD was defined as a fatal CE where death took place on the first day of the CE (within the first 24 hours), in individuals without a previous CE. This includes cases that died out of hospital. International Classification of Diseases (ICD) 8 and 9 codes included 410, 412 and 414; and ICD 10 codes I21, I24 and I25 were used. 14 15 Cause of death was based on autopsy for 61% of the SCDs in this study. A non-fatal CE was defined as a CE with ICD 8 and 9 code 410 or ICD 10 code I21, which survived the first day. Data linkage with the National Cause of Death Registry, Swedish Hospital Discharge registry and the Malmö Myocardial Infarction Register 16 was used to retrieve cases. All subjects were followed from the baseline examinations until the first non-fatal CE or fatal CE, death from other causes, emigration or last follow-up date (31 December 2018), whichever came first. During the entire follow-up period, the Swedish inpatient registry had been in operation in the south of Sweden, which became nationwide in 1987. Data from this registry have acceptable validity for epidemiological research. 17 Statistical analysis All analyses were carried out using SPSS V.26 (IBM, Armonk, New York, USA) and Stata V.14.0. Cox regression models were run to obtain HRs for SCD and nonfatal CE per 1-SD change in lung function measures. Time from baseline examination to the first incident CE, SCD, emigration or mortality from other causes, whichever came first, was used. Adjustments were made for potential confounding factors (model 1: age, sex and height; model 2: age, sex, height, BMI, smoking status, prevalent diabetes, systolic BP and cholesterol). Time-dependent Open access covariate analysis was used to check proportional hazards assumption for all models. They were met for all except models for non-fatal outcomes per 1-SD decrease in FEV 1 , FEV 1 /FVC ratio and FVC (for FVC model 1 only). To further assess the proportional hazards for these models, we tested the assumptions using Kaplan Meier plots. A modified version of the Lunn McNeil's competing risks method for Cox regression 18 was used to run models for both SCD and non-fatal CE simultaneously. The null hypothesis associated with the p value obtained from this method is that the lung function variable has the same association with SCD and non-fatal CE. This method has been described in detail elsewhere. 19 In order to assess the effect of inflammation, models were additionally adjusted for ESR. To fully control for the effect of smoking, we carried out an analysis in life long never smokers (n=9947). RESULTS Subject characteristics are presented in table 1. The mean age of participants was approximately 45 years. Almost half the cohort were current smokers; however, the known prevalence of COPD at baseline was low at 0.3%. Mean follow-up time was approximately 30 years. Sudden cardiac death There were 1609 SCD events over the follow-up period. Crude incident rates of SCD by quartiles of lung function measures are presented in table 2 and online supplemental figure 1. Q1 (low lung function) had the highest rates of SCD (events per 1000 person-years). There was an increased adjusted risk of SCD per 1-SD decrease in In life-long never smokers (table 4 and online supplemental table 2), there was a strong-adjusted risk of SCD per 1-SD decrease in FEV 1 and FVC (L) (HR: 1.34 (1.15 Comparing the risk of SCD events and incident non-fatal CE for baseline lung function An 1-SD reduction in FEV 1 and FVC was more strongly associated with SCD than non-fatal CE even after full adjustment (p value 0.0020 and 0.0055, respectively) (table 3), which remained significant even after further adjusting for ESR. Similar associations were seen using %predicted values of FEV 1 and FVC (online supplemental table 1). In life-long never smokers, a 1-SD reduction in FEV 1 remained more strongly associated with SCD than non-fatal CE (p value, 0.0380), which after further adjustment for ESR was borderline significant (p value, 0.05). Similar associations were seen using %predicted values of FEV 1 and FVC (online supplemental table 2), and after further adjustment for ESR, results remained borderline significant for FEV 1 %predicted (p value for equal associations-0.045). An additional analysis in ever smokers (former and current smokers) showed broadly similar results to the main analysis, where FEV 1 and FVC (litres and %predicted values) were more strongly associated with SCD than nonfatal CE, even after full adjustments (online supplemental Table 3 HRs for fatal (death on day 1) and non-fatal CEs per 1-SD decrease in lung function measures (n=28 584) Open access table 3), which remained largely unchanged after taking into account ESR (results not shown). Figure 1 shows age, sex and height-adjusted HR of SCD and non-fatal CE by quartiles of FEV 1 (L). DISCUSSION This prospective study shows that poor lung function is more strongly associated with SCD events than non-fatal CE in the general population, even in life-long never smokers. The present study is the first to compare the HR of SCD directly to those of non-fatal CE in relation to various baseline lung function measures in the healthy general population. A study assessing risk factors for SCD in under 7000 middle-aged British men found that FEV 1 was not independently associated with SCD after 8 years of follow-up. 20 The reason for this difference in results is unclear; however, the present study comprised of a much larger cohort of subjects over a longer follow-up period, which may be more reflective of the life-time risk of SCD in relation to early lung function. A strong association exists between COPD and CVD, where CVD morbidity and mortality are known to be more frequent in patients with COPD than in the general population. 21 It has been found that COPD is also associated with an increased risk of SCD. 9 The prevalence of COPD in the present cohort was very low at baseline. The FEV 1 /FVC ratio at baseline was not associated with future SCD, and an association between FEV 1 and SCD was replicated in life-long never smokers. This suggests that the association between poor lung function and SCD extends beyond that expected due to the known link between COPD and CVD. Our findings support liberal use of spirometry in general health assessments. For those with low lung function, lifestyle changes to improve lung health should be implemented to prevent further deterioration of lung function and increase in cardiac risk. There is also reason to evaluate the levels of the most important cardiovascular risk factors in those with low lung function and optimise their treatment to further reduce the risk of SCD and non-fatal CE. It has been found that left ventricular (LV) dysfunction is associated with an increased risk of SCD 22 along with being associated with low FEV 1 and FVC. 23 However, a reduced FVC has been associated with cardiac hospitalisations even after adjustments for left heart size and in those with normal LV ejection fraction (LVEF). 23 Previous research nevertheless found that different patterns of loss of lung health in young adulthood are associated with specific cardiac phenotypes in middle age. 24 A decline in FVC with a preserved FEV 1 /FVC ratio was found to be associated with LV hypertrophy and diastolic dysfunction-a 'hypertrophic, high output phenotype' later in life, whereas a declining FEV 1 with decline in FEV 1 / FVC was associated with decreased left heart chamber size and decreased cardiac output-a 'small heart, low output phenotype'. 24 There was no echocardiography information available in the present study, so we were unable to assess the role of subclinical heart failure in the relationship between low lung function and SCD. If this association is explained to some extent by the presence of heart failure, it would then be important to establish if it is independent of LVEF by assessing whether similar findings between reduced lung function and ventricular arrhythmias (VA) or SCD are also observed in those with diastolic dysfunction. There is emerging evidence that arrhythmias contribute to the increased cardiovascular mortality in COPD. 25 However, the pathophysiology that links COPD to fatal arrhythmias may indeed differ from that which links low lung function in the absence of pulmonary disease to fatal malignant arrhythmias. A study in the 'Men Born in 1914' cohort in Malmö, Sweden assessed the association between low levels of lung function and the occurrence and prognostic significance of VA. 26 In 68-year-old men free from CVD, the occurrence of VA on 24-hour ambulatory ECG (24-hour ECG) was inversely associated with pulmonary function, and additionally the increased cardiac risk and mortality risk associated with VA were mainly limited to men with low FEV 1 %predicted or low FEV 1 /VC. The Cardiovascular Health Study also used 24-hour ECG to assess the prevalence and correlates of cardiac arrhythmias in the elderly and reported significantly lower lung function in those with arrhythmias compared with those without. 27 These studies support the hypothesis of VA as a potential link between lung function and SCD. To better understand underlying mechanisms, further studies are needed of the arrhythmic risk in individuals with poor lung function. A corrected QT interval (QTc) of >440 ms is associated with a high risk of SCD, independently of age, sex, history of myocardial infarction, heart rate and medication use. 28 The population-based Multi-Ethnic Study of Atherosclerosis found an inverse association between FEV 1 %, FVC%, FEV 1 /FVC% and prolonged QTc. 29 The results suggest that low lung function could be a risk factor for longer QTc in the general male population, Open access even in those without lung disease. Autonomic dysfunction associated with reduced lung function has been suggested as a potential mechanism for these findings. 29 We did not have ECG information in the present study, so were unable to determine if the association between low lung function and SCD was explained by a prolonged cardiac repolarisation. An additional explanation may include the association between lung function and atherosclerosis, 30 which could be mediated through systemic inflammation and potentially increase the risk of VA and SCD. Although we attempt to take into the account the role of systemic inflammation by additionally adjusting the final models for ESR, we are aware that there is likely a residual effect of confounding from inflammation that could potentially effect the results. However, it unlikely that any residual confounding effect influenced the results of SCD more than non-fatal outcomes; therefore, it cannot explain the stronger association of low lung function with SCD compared with non-fatal CE. Limitations The study protocol was developed before the current guidelines for spirometry were developed. Therefore, no nose clips were used, and only one acceptable manoeuvre was required. All lung function measurements were prebronchodilator values. However, it has been thought that postbronchodilator measurements may not be necessary in studies assessing long-term outcomes. 31 Due to the long follow-up time associated with prospective follow-up studies, there are many risk factors that would have changed over this period, such as smoking status, BMI, diagnosis of COPD/other comorbidities or the use of medications such as inhaled corticosteroids. However, we do not expect that the results were influenced by an increase in uptake of smoking over the follow-up period as prevalence of smoking in Sweden decreased over the duration of the study 32 and is uncommon for non-smokers to start smoking in adulthood. 33 Changing smoking habits should affect the risk of SCD and non-fatal CE in a similar way, and a systematic bias seems unlikely. It has been found that the burden of CVD in 50-year old men in Sweden has reduced over the last approximately 50 years, 34 and although we expect this would be mirrored in the population of Malmö, it would if anything bias results towards the null. It has generally been established that a greater proportion of the out-of-hospital deaths is directly caused by ventricular dysrhythmia rather than |
coronary thrombosis 35 and FEV 1 could be a potentially useful tool in risk stratification for out of hospital SCD in the general population. 36 We were unable to determine whether the fatal CEs were witnessed and, therefore, whether death occurred within the first hour of onset of symptoms. However, we are able to select cases of fatal CE that occurred on the day of an acute CE, which, therefore, fulfils the definition of unwitnessed SCD events and would also include both in and out of hospital SCD. SCD is a devastating event with profound consequences for surviving family members. 1 Prediction of SCD in the general population remains a challenge as the largest patient groups for SCD are those with the fewest known risk factors. 4 37 This study is the first to directly compare the risk of SCD and non-fatal CE in the general population in relation to baseline lung function measures in both men and women. CONCLUSION Low FEV 1 is consistently more strongly associated with future SCD than incident non-fatal CE. Measurement with spirometry in early life could aid in the risk stratification of future SCDs, and, therefore, allow for early intervention to potentially reduce the risk of this devastating event. Contributors SZ, K-FE, PW and GE participated in study design, interpretation of data, drafting the manuscript and approved the final version of the manuscript. SZ performed the statistical analyses and prepared the first draft of the manuscript. All authors take responsibility for the integrity and accuracy of the work. The authors read and approved the final manuscript. Funding This study was supported by the Swedish Heart-Lung foundation [2016-0315]. The funding body had no role in the study design or interpretation of the results. Competing interests PW reports grants from Swedish Heart and Lung Foundation during the conduct of the study, and personal fees from Chiesi Pharma, personal fees from GlaxoSmithKline, outside the submitted work. PW has a patent device and method for pulmonary function measurement issued. Patient consent for publication Not required. Ethics approval The Health Service Authority of Malmö approved and funded the screening programme. Linkage with the national cause of death and patient registers and ethical approval to study incidence of cardiopulmonary diseases and death was approved by the Regional Ethics Committee at Lund University (LU 85-2004; LU 2011-412). Provenance and peer review Not commissioned; externally peer reviewed. Data availability statement Data are available upon reasonable request. Author note The abstract from this manuscript has been presented as an e-poster at the European Respiratory Society (ERS) International Congress 2021. Supplemental material This content has been supplied by the author(s). It has not been vetted by BMJ Publishing Group Limited (BMJ) and may not have been peer-reviewed. Any opinions or recommendations discussed are solely those of the author(s) and are not endorsed by BMJ. BMJ disclaims all liability and responsibility arising from any reliance placed on the content. Where the content includes any translated material, BMJ does not warrant the accuracy and reliability of the translations (including but not limited to local regulations, clinical guidelines, terminology, drug names and drug dosages), and is not responsible for any error and/or omissions arising from translation and adaptation or otherwise. Synthesis and Characterisation of Photocrosslinked poly(ethylene glycol) diacrylate Implants for Sustained Ocular Drug Delivery Purpose To investigate the sustained ocular delivery of small and large drug molecules from photocrosslinked poly(ethylene glycol) diacrylate (PEGDA) implants with varying pore forming agents. Methods Triamcinolone acetonide and ovalbumin loaded photocrosslinked PEGDA implants, with or without pore-forming agents, were fabricated and characterised for chemical, mechanical, swelling, network parameters, as well as drug release and biocompatibility. HPLC-based analytical methods were employed for analysis of two molecules; ELISA was used to demonstrate bioactivity of ovalbumin. Results Regardless of PEGDA molecular weight or pore former composition all implants loaded with triamcinolone acetonide released significantly faster than those loaded with ovalbumin. Higher molecular weight PEGDA systems (700 Da) resulted in faster drug release of triamcinolone acetonide than their 250 Da counterpart. All ovalbumin released over the 56-day time period was found to be bioactive. Increasing PEGDA molecular weight resulted in increased system swelling, decreased crosslink density (Ve), increased polymer-water interaction parameter (χ), increased average molecular weight between crosslinks (Mc) and increased mesh size (ε). SEM studies showed the porosity of implants increased with increasing PEGDA molecular weight. Biocompatibility showed both PEGDA molecular weight implants were non-toxic when exposed to retinal epithelial cells over a 7-day period. Conclusion Photocrosslinked PEGDA implant based systems are capable of controlled drug release of both small and large drug molecules through adaptations in the polymer system network. We are currently continuing evaluation of these systems as potential sustained drug delivery devices. INTRODUCTION Delivery of drug molecules to treat visually impairing ocular diseases, namely those that originate in the posterior segment of the eye, has been an extremely challenging task for pharmaceutical scientists and retinal specialists. The most prevalent posterior segment ocular conditions that affect vision are age-related macular degeneration (AMD) and diabetic retinopathy (DR). AMD results in damage to the macula, the central area of the retina, a zone that is essential for detailed and central vision. The condition is extremely detrimental to those affected as it results in the inability to carry out normal, everyday activities due to the disruption of central vision. AMD is the leading cause of irreversible blindness in the Western world (1)(2)(3)(4), estimates show 8.7% of the global population are suffers (5) and the World Health Organisation state that 8 million people have severe blindness due to AMD (6). The development of DR is common in poorly controlled diabetic patients. Over time consistently raised blood glucose levels can cause narrowing and leaking of blood vessels within the posterior segment of the eye. This results in retinal damage and ultimately blindness if the condition is left untreated. There is estimated to be 93 million patients suffering with DR worldwide (7). The treatment of both AMD and DR involves the delivery of large molecular weight (MW) protein based therapeutics (e.g. anti-vascular endothelial growth factors (VEGF)), which aims to prevent the choroidal neovascularisation (CNV) associated with these conditions. In addition, small MW corticosteroid molecules are also used to reduce the inflammation associated with AMD and DR, and theoretically they can also benefit patients by acting as anti-angiogenic and anti-fibrotic agents and stabilising the blood retinal barrier (8). Delivery of these agents to the required site of action is problematic, as the eye contains multiple barriers designed for protection and to aid in preventing unwanted substances entering the ocular tissue. This results in many challenges associated with the delivery of both small and larger MW drug molecules into the eye and profusion to the intended area of action. The posterior segment cannot be treated effectively using topical formulations, as they are incapable of reaching the required site of action. Consequently intravitreal injections have become the standard delivery method, but due to their invasive nature multiple adverse effects are associated (9). The limitations of current delivery methods have led to increased research into controlled release systems for ocular delivery. A significant emerging field of research is implantable polymer based systems, which aim to provide sustained release of drug molecules in the back of the eye. There are three polymer based ocular implants currently on the market; Retisert® and Iluvein® are non-biodegradable systems that provided sustained delivery of fluocinolone acetonide for up to 3 years (10). The only biodegradable system available is Ozurdex® that releases dexamethasone over a 6 month time period (10). At present no ocular controlled release system has demonstrated the ability to adequately deliver peptide or protein molecules to the posterior segment. This is a major problem as multiple therapies indicated to treat posterior segment disorders involve the use of protein-based molecules. Photocrosslinked implant systems have been exploited for multiple applications over the past decades. Their use in biomedical applications such as tissue engineering (11,12) and prevention of thrombosis (13,14) is well documented. In terms of use in drug delivery (15,16) these photocrosslinked systems have shown the ability to provide drug release for markedly extended time periods. Poly(ethylene glycol) (PEG) based polymers are used in a variety of biomedical applications as they can be easily synthesised and exhibit good biocompatibility and tissue-like properties (17). Specifically, PEG based polymers containing acrylate side groups show great potential in the area of photocrosslinking. PEG diacrylate (PEGDA) contains double-bond acrylate groups at each end of the PEG chain, giving it the ability to undergo free radical photopolymerisation in the presence of a photoinitiator molecule (18) to produce a photocrosslinked system or implant (11). PEGDA is non-toxic, elicits only a minimal immune response (19,20) and is a biodegradable polymer. Browning et al. recently demonstrated that the primary mechanism of PEGDA hydrogel degradation in vivo is due to hydrolysis of the end group acrylate esters linkages within the polymer (21). PEGDA is available in various MWs making it ideal for obtaining the required system crosslink density (18) and its highly versatile nature allows for small adaptions to optimise the system (21). As PEGDA has been proven to be a favorable material for biological applications (25) and is used in the engineering of a number of tissues such as bone (26), cartilage (27) and cornea (28,29), in this study we investigate photocrosslinked PEGDA hydrogels for their use in drug delivery systems. The tunable nature of photocrosslinked PEGDA hydrogels systems and their accepted use in biomedical applications makes them ideal candidates for adaption to provide a controlled drug release. Specifically, photocrosslinked systems, such as those composed of PEGDA, have advantages in the release of protein drug molecules. Most significantly initiation of photocrosslinkage does not require extreme pH conditions, organic solvents or high temperature (30), which could cause issues when working with protein molecules. This study aims to fabricate and characterise PEGDAbased photocrosslinked implants of different polymer MW (250 and 700 Da) for sustained ocular delivery of triamcinolone acetonide (TA, 434 Da) and ovalbumin (OVA, 45 kDa). Alternations in the MW of PEGDA results in changes to the crosslink density of the system formed, with lower MWs resulting in a more densely crosslinked system. This study has selected PEGDA at MW 250 and 700 Da for investigate to assess the degree of difference in release profile and implant properties at these MWs. With regards to drug molecule selection, TA has been chosen for its clinical relevance in treating AMD and DR, while OVA was chosen as a model protein molecule that is similar in MW to anti-VEGF drug ranibizumab (Lucentis®). In vitro release profiles from the PEGDA implants were investigated. Due to the vast difference in MW of each drug, a number of pore forming agents have been incorporated into the PEGDA implants to assess their effect on pore formation, drug release, protein bio-stability, mechanical properties, swelling behaviour, network parameters and biocompatibility. Fabrication of PEGDA Implants The drugs under investigation (TA and OVA) were incorporated in PEGDA (700 or 250) to produce 2.5% w/w solutions. Once the drug was fully dissolved/suspended the desired a m o u n t o f p or e f o r m e r w a s t h e n a d d e d t o t h e drug/PEGDA (700 or 250) solutions and left to dissolve at room temperature. Prior to photocrosslinking, Irgacure® 2959 (2% w/v in 70% ethanol in water) was added to the formulation and vortexed for 1 min to ensure complete mixing. The composition of all prepared formulations are shown below in Table I. Moulds for implant fabrication were then prepared using Scotch™ Magic tape (one strip has a thickness of 50 μm) layered onto glass microscope slides and cut to the required implant dimensions of 10 × 5 × 0.5 mm (Fig. 1). The previously prepared formulations (Table I) where then loaded into the moulds using a 27G needle. Each mould was passed through the UV crosslinker, Fusion UV Light-Hammer 6 high power UV curing system (Maryland, USA) fitted with a BD^class mercury discharge bulb, with a belt speed of 10-10.5 m/s and at wavelength 365 nm, lamp intensity 50% and 5 times to crosslink the formulation. Each implant was then carefully removed from their mould and weighed. In vitro Drug Release Studies For in vitro drug release studies, TA loaded implants |
were placed in a plastic tub containing 50 mL PBS (pH 7.4 ± 0.2) release media to maintain sink conditions. All the experiments were carried out in triplicate. The tubs were then incubated at 37°C and 40 RPM and at predetermined time intervals the entire medium was removed and replaced with fresh medium. The concentration of released TA in the PBS samples was then analysed using the HPLC assay described below. For in vitro drug release study of OVA each preformed implant was placed in a glass vial containing 5 mL PBS (pH 7.4 ± 0.2) release media and samples as above. The concentration of released OVA in the PBS samples was then analysed using the size-exclusion HPLC assay described below. Analytical Techniques Analysis of TA samples was carried out using reversed-phase Agilent 1260 Infinity Quaternary System HPLC using an Agilent Zorbax Eclipse Plus 250 mm, 4.6 mm ID, 5 μm particle size, C18 bonded silica column and an Agilent Zorbax guard column held at 25°C (Agilent Technologies Ltd., Stockport, UK). A mobile phase of 60% water and 40% acetonitrile at UV absorbance of 236 nm was found to give optimal peak shape. Injection volume was fixed to 20 μl and flow rate was set at 0.8 mL/min. A standard calibration curve was then prepared, between the concentration range of 0.1-250 μg/mL, and used to determine the TA drug concentration in each of the release samples. Analysis of OVA samples was carried out using Agilent 1260 Infinity Quaternary System HPLC using a Phenomenex BIOSEP-SEC-s3000 300 mm, 7.8 mm ID, 3 μm particle size column and GFC 3000 guard column held at 25°C (Phenomenex., Cheshire, UK). A mobile phase of 250 mM NaCl at UV absorbance of 214 nm was found to give optimal peak shape. Injection volume was fixed to 20 μL and flow rate was set at 1 mL/min. A standard calibration curve was then prepared, between the concentration range 3.125-100 μg/ml, and used to determine the OVA drug concentration in each of the release samples. ELISA for Bioactivity Analysis of OVA The bioactivity of released OVA was determined using a sandwich ELISA technique previously developed by McCrudden et al. (31). Monoclonal anti-chicken egg ovalbumin antibody produced in mouse (MoAb) was diluted in 0.1 M bicarbonate buffer, pH 9.6 to the optimised concentration of 2.5 μg/mL. An aliquot (100 μl) of this anti-ovalbumin was dispensed into the plate and incubated overnight at 4°C. The plate washed to remove unbound antibody (0.05% Tween 20 in PBS) 3 times. Blocking was performed with SuperBlock® T20 (200 μl/well), for 2 h. A 50 μl volume of sample was dispensed into each well, with each sample analysed in triplicate and a freshly prepared standard concentration curve was plated (50-1000 ng/ml), and incubated for 1 h. Excess sample was washed off (as before). Following this, 50 μl of rabbit anti-chicken egg ovalbumin, polyclonal antibody conjugate with biotin at the optimised concentration of 1 μg/mL in SuperBlock® T20 buffer was added to each well for 1 h. Excess sample was washed off (as previously detailed). The plate was then incubated with Streptavidin -Horseradish Peroxidase (Strep-HRP) conjugate at the optimised dilution of 1:2000 in PBS, for 30 min. Washing was performed as before. To detect the antibody binding, 100 μl of substrate TMB (3,3′,5,5′-tetramethylbenzidine) was added to each well and incubated for 20 min and the reaction was ended using 100 μl/well, 4.0 M hydrochloric acid. Optical density was measured at 450 nm using a micro 96 well plate spectrophotometer (Powerwave™ XS, Bio-Tek Instruments Inc., Minooski, USA). Results were expressed as means ± SD of three replicates. Dynamic and Equilibrium Swelling Studies For swelling studies the crosslinked implants were weighed as m o (xerogels) and were then swollen in HPLC grade water for 48 h at 37°C. At regular intervals, the implants were removed, blotted with filter paper to eliminate excess surface water and weighed as m t (hydrogels). The implants at equilibrium were weighed as m e , and were dried under vacuum at 80°C for 24 h to obtain extracted xerogels, which were weighed as m d (32). The percentage swelling, % S, and equilibrium water content, EWC, was calculated, respectively, by using Eq. 1 and 2. Network Parameters M c , the average MW between crosslinks, is calculated using Flory-Rehner theory, which gives the values of Mc between two adjacent crosslinks and represents the degree of crosslinking of hydrogel networks (33) and is shown in Eq. 3. The magnitude of Mc affects the mechanical, physical and thermal properties of crosslinked polymers, as we descried previously (32). V s is the molar volume of water (18 cm 3 /mol), Φ is volume fraction of polymer in the hydrogel, χ is the Flory-Huggins polymer-solvent interaction parameter. The volume fraction of a polymer, Φ, in the swollen state defines the amount of liquid that can be enter a hydrogel and is described as a ratio of the polymer volume to the swollen gel volume (32), show in Eq. 4. Where, m a and m b are the mass of polymer before and after swelling and d p and d s are the densities of polymer and solvent, respectively. The density of the polymeric films was calculated using the following formula; d p = w/SX, where; X is the average thickness of the film, S is the cross-sectional area and w weight of the film (34). The polymer-water interaction parameter (χ) of hydrogels can be obtained experimentally via Eq. 5. Mesh size was calculated first by assessing the distance between polymer chains, r 0 −2 . Where l is the average bond length, 1.54, Cn is the characteristic ratio for the polymer here we will use the Cn of PEG, typically 4.0 (35,36). The mesh size, ε, was then calculated by: Mechanical Strength Addition of pore forming agents on the implant mechanical property was assessed via the comparison of implant strength and integrity. This was conducted using a TA.XTplus Texture Analyser (Stable Micro Systems, Surrey, UK) to compress the implants 5 mm, as shown in Fig. 2. The implants were tested directly after fabrication (dry implants) and then again after 24 h in PBS (pH 7.3 ± 0.2) (wet implants). Implants were attached to the probe and the Texture Analyser was set in compression mode, and the probe moved towards a solid aluminium block. When the implant came in contact with the solid surface, the test began with the probe moving at 0.05 mm/s. The maximum force required to compress the implant to 5 mm was recorded using the Exponent TA.XT software (Version 4). The study was performed in triplicate for each formulation. Structural Analysis using Scanning Electron Microscope (SEM) In order to investigate the structural differences in implants composed of varying PEGDA molecular weights and assess the addition of pore forming agents, SEM images were collected using a Hitachi TM 3030 Table top Microscope (Hitachi High-Technologies Europe GmbH, Krefeld Germany). After photocrosslinking and placement in PBS (pH 7.3 ± 0.2) for both 24 h and 7 days the implants were then removed and rinsed using deionised water, with the excess liquid removed using tissue paper, the implants were left to dry. Once dry, the implants were sectioned accordingly and mounted for imaging. Biocompatibility Testing Biocompatibility experiments were carried out by both indirect and direct contact methods. During formulation preparation both PEGDA 700 and PEGDA 250 were filtered through a sterile 0.2 μm syringe filter with a membrane material of cellulose acetate (VWR®, International Ltd., Leicestershire, UK). Prepared formulations where then loaded into the moulds and crosslinked using a UV crosslinker, Fusion UV LightHammer 6 high power UV curing system (Maryland, USA) fitted with a BD^class mercury discharge bulb, with a belt speed of 9.8-10 m/s and at wavelength 365 nm, lamp intensity 50% and 5 times to crosslink the formulation. Indirect Contact Assay Each implant was then carefully removed from their mould, dipped in ethanol to sterilise and placed into 5 mL DMEM/F-12 media (Gibco®, Life Technologies™, Paisley UK) in autoclaved glass vials. At defined time points (1, 4 and 7 days after formation), the entire 5 mL of media was removed and replaced with fresh media. The media collected at various time points was then exposed to the cells. All treatments were performed on human retinal pigment epithelia cells (ARPE-19) seeded in 96-well plates (Nunc®, Denmark) at a cellular density of 2 × 104 cells/well, which were incubated at 37°C for 24 h in DMEM/F-12. The DMEM/F-12 medium was removed and replaced with 200 μl of the release media from each time point (fresh media was used as the control). Subsequently, the cells were incubated for a further 24 h. Direct Contact Assay Each implant was removed from their mould, cut to size, dipped in ethanol to sterilise and placed into 5 mL DMEM/F-12 media (Gibco®, Life Technologies™, Paisley UK) in autoclaved glass vials and incubated at 37°C until swollen to equilibrium. Simultaneously, ARPE-19 cells were seeded in 96-well plates (Nunc®, Denmark) at a cellular density of 2 × 104 cells/well and incubated at 37°C for 24 h in DMEM/F-12. Media was then removed from each well and implants were carefully placed on top of the cells, followed by addition of 200 μl of fresh media. The cells were then incubated for a further 24 h. Following aspiration of the remaining media, the 96-well plate was inverted to allow removal of each implant from the treatment wells. For both indirect and direct contact methods cell viability was then determined using a MTS assay and DAPI (4′,6diamidino-2-phenylindole) fluorescent staining. For the cell proliferation assay 20 μl of Promega G3580 MTS assay solution (Promega Corporation, Wisconsin, USA) was added to each well. After 2 h of incubation, the UV absorbance was determined at 490 nm. The percentage cell viability was then calculated by dividing the average absorbance value of each formulation by the average absorbance of the control (which consisted of ARPE-19 cells grown in media, without any exposure to PEGDA implants) and multiplying by 100. For DAPI fluorescent staining 50 μl of Formalin was used to fix the cells before the addition of 50 μl DAPI solution (Fisher Scientific, Loughborough, UK) diluted 2:10,000 in PBS, which was subsequently aspirated from the cells after 10 min and replaced with 50 μl of PBS, the cells were then imaged using a fluorescent microscope under the DAPI filter. Statistical Analysis The effects of PEGDA MW and the loading of various pore forming agents on swelling, mechanical strength, cell viability and drug release from the implant formulations were analysed using a one-way analysis of variance (ANOVA) where p < 0.05 was taken to represent a statistically significant difference. When there was a statistically significant difference, post-hoc Tukey's HSD tests were used. Statistical analysis was conducted using GraphPad Prism Version 6 (GraphPad Software Inc., San Diego, USA). In vitro Drug Release TA release, from all PEGDA 700 implant formulations, reached approximately 100% between days 21-28. From the range of pore forming agents selected only sodium bicarbonate (T7) and sucrose (T13) display a slower release rate than the control formulation (T1) without pore forming agent, and this observed difference is not significant (p = 0.9971 and 0.8759 respectively). All other formulation types released TA faster than the control. However, there was not a significantly faster rate of release, with the exception of gelatin (T9). Gelatin provides a significant increase in the day 1 release (burst release) of TA, 24.82% release was exhibited compared to 13.70% from the control (p = 0.0437), but following this time point release did not remain significantly greater than the control (Fig. 3a). With regards to TA release from PEGDA 250 implants (Fig. 3b); no pore-forming agent showed significantly greater release than the control formulation (T2) before the day 252 time point is reached. At day 252 loading with sodium bicarbonate (T6) resulted in the greatest drug release, 53.51%, followed by maltose (T12) at 51.69% and then sodium carbonate (T8) at 38.45%, compared to the control formulation (T2), which released 25.61% of the drug loading. Of these three pore forming agents, the release from sodium bicarbonate (T6) and maltose (T12) exhibited a statistically significant increase in release rate when compared to the control formulation (p = 0.0450 and 0.0465 respectively). Regardless of the pore-forming agent loaded, |
PEGDA 250 implants showed a significantly slower release rate than those prepared with PEGDA 700. OVA release from all implants, regardless of PEGDA MW or pore forming loading, follow a similar release pattern. An initial burst release of drug is observed, within the first 24 h, followed by a reduction in release in the following days. Results highlight that the effect of PEGDA MW on release of OVA is less substantial than the effect of pore former loading. Only formulations loaded with sodium carbonate (O7 and O8), sodium bicarbonate (O5 and O6), gelatin (O9 and O10) and sucrose (O13 and O14) showed a significant difference in release across the two PEGDA MW's. Conversely, the addition of pore forming agent has a significant effect on OVA release in almost all formulation types. Regardless of PEGDA MW the three pore forming agents that cause the most significant increase in OVA release over the 84-day period were sodium carbonate (O7 and O8, releasing 62.34% and 38.59% respectively), sodium bicarbonate (O5 and O6, releasing 35.79% and 46.42% respectively) and sucrose (O13 and O14, releasing 30.85% and 41.48% respectively). From OVA loaded PEGDA 250 implants, with the exception of mannitol (O4) and maltose (O12), all remaining pore forming agents release significantly more than the control samples, across all times points (day 1 p < 0.0001 for sodium carbonate, sodium bicarbonate, getalin and sucrose. At day 84, p < 0.0001 for sodium carbonate, sodium bicarbonate, getalin and p = 0.0022 for sucrose). Bioactivity of OVA From HPLC chromatograms it can be confirmed that only visible peaks present are attributed to OVA and the dimer molecule, no degradation products are visible eluting from the column, indicating that OVA remains stable through the study (Fig. 5). However, this observation requires confirmation and thus OVA bioactivity was tested to ensure the tertiary structure was maintained throughout the release study. Release samples from the implants were studied to determine whether the released OVA was still active and that the quantity of OVA detected from the SEC HPLC assay was structurally sound. Table II presents data relating to the percentage of active OVA released after 56 days. Results indicate that active OVA was released from the implants throughout the time period. From day 1-56, greater than 90% of the OVA released was determined to be active for all formulation types. The presence or absence of pore forming agents does not appear to play a significant role in OVA activity within PEGDA 700 or PEGDA 250 implant systems. (Figures 6 and 7) Swelling Studies In relation to implant swelling, varying the PEGDA MW shows significant differences within the implant. PEGDA 700 implants exhibit 35-50% swelling across all formulations; in contrast no PEGDA 250 implant swells above 5%. In fact C6 (containing sodium bicarbonate) exhibited an initial drop in implant weight, which may be due to loss of uncrosslinked surface monomer, but this weight drop is not significant (p = 0.9537). When directly comparing formulations containing the same pore forming agents but different MW's of PEGDA, the difference in system swelling was highly significant. With the head to head comparison of each pore forming agent with their differing MW counterpart p < 0.0001 for all pore forming agents and control formulations. With regards to swelling of PEGDA 700 implants the only pore forming agents that made a significant difference to swelling is gelatin (C9) (p = 0.0254). No pore forming agent loaded in PEGDA 250 implants shows a significant difference in swelling when compared to the control formulation. Network Parameters As shown in Table III, pore former loading does not play a significant role in the systems network parameters. However, T1 T3 T5 T7 T9 T11 T13 T15 0 the crosslink density, Ve, increases notably with a decrease in PEGDA MW within the implants. The network parameters also assess the polymer-water interaction within the system. In polymer-water systems, the higher the value of χ, the weaker is the interaction between polymer and water (32). This study shows that there is a slight increase in the polymer-water interaction parameter (χ) with increased crosslink density and decrease in PEGDA MW. With regards to Mc and mesh size, both values increase as the MW of PEGDA within the system increases. PEGDA 700 systems have a higher average MW between crosslinks and a larger mesh size. Mechanical Strength Implant mechanical strength was assessed on both dry and wetted implants (which were exposed to an aqueous environment for 24 h). All dry implant formulation types loaded with pore forming agents exhibited an increased mechanical strength when compared to the control implants (C1 and C2), containing no pore former loading. The increase in mechanical strength observed in the PEGDA 700 implants, was not statistically significant (p = 0.8746). Conversely, all PEGDA 250 implants loaded with pore forming agents were significantly stronger than the control (C2) formulation with the exception of sodium bicarbonate (C8) When comparing C2 and C8 p = 0.8964. SEM Images SEM images are useful in assessing both the top and crosssectional view of implants in intricate detail. Figure 8 highlights the smooth external and internal surfaces of control implants, containing no pore-forming agent (C1 and C2) compared to implants loaded with sodium carbonate (formulations C7 and C8). The PEGDA 700 implants are noticeably more porous than the lower MW PEGDA implants in the top sectional image. However, upon analysis of the cross-sectional images both PEGDA MW implants show significant pore formation. With regards to drug loading on implant pore formation, Fig. 9 highlights the difference between non-drug loaded; TA loaded and OVA loaded PEGDA 700 and PEGDA 250 implants. As demonstrated in Fig. 8, the PEGDA 700 implants are noticeably more porous than their PEGDA 250 counterpart. Additionally, a slight affect on drug loaded can be observed, with non-drug loaded implants (C3 and D3) appearing more porous than those loaded with TA and OVA. Biocompatibility Cell toxicity studies were carried out using ARPE-19 cells to assess potential cytotoxicity. Experiments were carried out using both indirect and direct contact assays. Indirect contact tests involved calculating the percentage cell viability after ARPE-19 cells were exposed to release media collected 1, 4 and 7 days after the implant was added to the media. Direct contact tests involved direct placement of the implant on top of the cell line and assessing the cell viability. Percentage cell viability was calculated using an MTS assay and reading the UV absorbance. In all cases percentage cell viability was recorded as greater than 80%. Indirect exposure to these release samples for all PEGDA 700 time points and for PEGDA 250 at day 4 and 7 actually resulted in cell proliferation as indicated by a percentage cell viability of greater than 100% (Fig. 10). Direct contact resulted in greater than 90% cell viability in all cases (Fig. 11). Cells were also stained with DAPI, which allows the live cells to be visualised under a fluorescence filter, with live cells appearing blue. Figure 12 shows the results from staining post (A) indirect contact assay and (B) direct contact assay, both images show a high portion of live cells present with morphology of the cells maintained, corroborating the cell viability results. DISCUSSION Prevalence of debilitation, sight treating ocular diseases is increasing and although currently there are drug molecules available to treat these conditions, delivery of these molecules to the required site of action is suboptimal and associated with a high level of adverse effects. Therefore, a delivery device capable of providing an extended time period for drug release could present a viable alternative to the currently used intravitreal injections. This study focuses on the development of novel photocrosslinked biodegradable ocular implants that will provide continuous sustained drug delivery to the posterior segment of the eye. Photocrosslinked implants composed of varying PEGDA MWs (250 Da and 700 Da), photoinitiator and loaded with both small and large MW drug molecules and various pore forming agents have been formulated and characterised. As expected, drug release results differed based on implant formulation type and was dependent on the type of drug, PEGDA MW and the pore forming agent. It was postulated that the addition of water-soluble agents would result in the formation of pores by dissolving when infiltrated by the aqueous release medium, thus causing the porogen to leach out of the implant system, in turn leaving behind a porous structure (37). This hypothesis reflected the results observed regarding OVA from PEGDA implants, with the use of specific pore forming agents showing marked increase in OVA release compared to the control formulation (Fig. 4). Namely, sodium carbonate (O7 and O8), sodium bicarbonate (O5 and O6) and sucrose (O13 and O14), were shown to be the most effective pore forming agents with respect to increasing OVA release. As stated in the results section, there were only two pore forming agents that did not improve OVA release, namely mannitol (O3 and O4) and maltose (O11 and O12), which both release significantly less OVA than the control formulation. These results indicate that there is a potential interaction between these pore forming agents and the protein molecule, which is preventing drug release (38). The effect of pore forming agent on TA release from PEGDA 700 implants appears minimal and this is likely related to the MW of the drug molecule. Due to TAs low MW the introduction of pores within the system does not produce any significant effect on release from the implant, as it already exhibits a significant level of release devoid of pore forming agents. Regarding TA loaded PEGDA 250 implants, the effect of pore former loading on drug release does become evident, but not until long-term release periods are reached. With respect polymer MW on release rate, there is significantly higher release of TA from PEGDA 700 implants when compared to PEGDA 250 implants (p < 0.0001 for all pore forming agents). This is likely due the lower PEGDA MW resulting in a denser and more tightly crosslinked system inhibiting drug release and leaving the TA molecule trapped within the implant system. In contrast, the effect of PEGDA MW on drug release is less significant than the use of certain pore forming agents on OVA release. It is important to confirm that incomplete OVA release cannot be attributed to protein denaturation, thus an ELISA technique was used to determine OVA activity as an alternative to SEC HPLC for protein detection and quantification. SEC HPLC chromatogram shown in Fig. 5 suggests active, non-degraded OVA was released throughout the study, as there was the absence of additional or degradation peaks on the chromatogram. However, the ELISA technique can provide highly specific, sensitive, reliable and rapid results on protein stability and activity and confirm which portion of the protein released is structurally sound (39). From the ELISA results shown in Table it can be clearly concluded that, over the 56-day period, high levels (>90% in all cases) of active protein were continually released. This is a notable finding as current PLGA based implants commonly result in degradation of the encapsulated protein molecules during the release lifetime. A major advantage of this PEGDA based release system is its ability to prevent inactivation of protein over the current release period. This benefit can be attributived to the hydrophilic nature of PEGDA, unlike PLGA, which can commonly cause not only a drop in pH upon degradation (40), resulting in protein denaturation, but also hydrophobic interactions between the polymer and protein molecule hindering drug release (41). Swelling results indicate that higher MW PEGDA implants result in increased system swelling (15). This likely occurs due to high crosslink density within the system when lower MW PEGDA is used, resulting in less space within the network for water ingression and thus swelling potential (42). The addition of pore forming agent on swelling percentage is minimal with both low and higher MW PEGDA systems. As the results stated, no pore-forming agent loaded in PEGDA 700 or PEGDA 250 implants demonstrated a significant difference in swelling when compared to the control formulation (with the exception of gelatin (C9) loaded PEGDA 700 implants). This indicates that polymer MW is the key factor influencing swelling. It is likely that the PEGDA 700 system has reached its maximum swelling capacity and once this is reached the introduction of pore formers does not induce an |
increase in swelling as the system is saturated. In contrast the PEGDA 250 system is so tightly crosslinked that water cannot access the system and consequently pore forming loading has minimal effect on swelling (36). From the implant swelling data, network parameters were utilised to assess crosslink density (Ve), polymer-water interaction parameter (χ), average molecular weight between crosslinks (Mc), and mesh size (ε). Network parameters were employed to characterise the complex system structure and evaluate the degree of crosslinking and interaction occurring within the implant formulations (32). As demonstrated by the network parameters, a decrease in polymer chain length results in an increase in crosslink density (Ve) within the system. Indicating that PEGDA 250 implants are more densely crosslinked than their PEGDA 700 counterparts and accounting for the significant differences observed with TA release from the varying MW systems. Higher χ values for PEGDA 250 implants indicating more polymer-polymer interaction within these systems (32) and thus less polymer-water interactions i.e. increasing crosslinking densities decreases the interaction between the polymeric system and water. This is demonstrated by the swelling data, which shows a drastic reduction in swelling from PEGDA 250 systems when compared with those composed of PEGDA 700. As the results highlighted, formulations composed of higher MW PEGDA resulted in higher Mc and mesh size values, which is due to lower crosslink densities, Ve. By decreasing PEGDA MW, the shorter chained monomer molecules are capable of crosslinking tighter, resulting in the increase in crosslinking densities of these hydrogels. Consequently, decreasing PEGDA MW resulted in more rigid network structures, due to an increased number of crosslinks within the network, which also produced less water ingression into the system and thus the decrease in swelling potential of the lower MW PEGDA systems. As small alterations in photocrosslinked PEGDA formulation composition have the ability to majorly affect the systems network parameters it is important to ensure that implant mechanical strength is preserved throughout these changes. PEGDA has been shown to be extremely responsive to mechanical modification (43), resulting in hydrogels with flexible properties for drug delivery. Nevertheless, it's imperative that a b c d e f mechanical strength remains intact to allow implant placement and drug release without substantial bending or breaking of the implant system. Mechanical strength data indicates, that in the dry state, the polymer structures exhibit more rigid polymer chains, and no pores were visible within the structure (although they may be present, but at such a small pore size that they cannot be detected). Due to the lack of visible pores within the implant structure until they are exposed to an aqueous environment, it stands to reason that all dry implants will exhibit greater mechanical strength than wetted implants. The addition of pore former within the implant adds to implant structure and strength when dry, making them harder to compress. In contrast when the implants are subjected to an aqueous environment, for 24 h and mechanical strength is retested, all the wetted samples are consistently weaker than the control of no pore former (with the exception of formulation C4, which still shows increased mechanical strength than the control implant). The decrease in mechanical strength observed in the PEGDA 700 implants, was not statistically significant, however, all PEGDA 250 implants loaded with pore forming agents were significantly weaker than the control (C2) formulation (with the exception of sodium bicarbonate (C8)). Indicating the pore forming agents produce pores within the implant structure on addition to PBS, decreasing the mechanical strength of the implants. When comparing the effect of PEGDA MW on implant mechanical strength, all PEGDA 250 implants are consistently significantly stronger than their PEGDA 700 counterparts, both when dry (p < .0001), and upon wetting (p < .0001). This is likely due to the smaller MW monomers providing tighter crosslinkage within the system, requiring more force to compress and resulting in an increased mechanical strength. SEM images support all previously discussed data, with Fig. 8 highlighting the smooth external and internal surfaces of control implants, containing no pore forming agent (C1 and C2) compared to the more porous appearance of those implants loaded with sodium carbonate (formulations C7 and C8). All PEGDA 700 implants are noticeably more porous than the lower MW PEGDA implants in the top sectional image. Suggesting a faster rate of release, increased swelling and lower crosslink densities should be expected from the high MW systems. Additionally, SEM images, as shown in Fig. 9, help support the hypothesis of a potential interaction between the pore forming agents mannitol and maltose and the OVA protein molecule. Figure 9 highlights the effect of drug loading and drug type on pore formers ability to produce pores within the system. It is clear that the drug type has minimal visual effect on pore formation, further indicating that the decrease in OVA release from mannitol loaded implants is not due to the inability of mannitol (and indeed maltose) to form pores, but rather an interaction or crystallisation of these pore forming agents and the protein molecule preventing release (38). This in turn explains why mannitol loaded TA formulations do not experience the same decrease in drug release that is observed within the OVA formulations. Biocompatibility studies were conducted using ARPE-19 cells to assess any potential toxicity issues with the formulations. Specifically, there was concern that toxicity could arise from unreacted monomer with the photocrosslinked system (44). Cell viability results shown in Fig. 10 and Fig. 11 indicate that both PEGDA 700 and PEGDA 250 implants were nontoxic to cells. With regards to indirect contact testing, cell exposure to release media collected on day 1 from PEGDA 250 implants resulted in the lowest percentage of cell viability, 86.21%. The ISO standard for tests for in vitro cytotoxicity state that a cell viability reading of below 70% is considered a cytotoxic effect (45). Thus, results signify lack of cytotoxicity for all formulations tested. Figure 12 highlights the high portion of live cells (stained blue) present post indirect and direct contact exposure and that the ARPE-19 cells maintain the morphology following exposure. The biocompatibility results are promising and indicate that both the photocrosslinked PEGDA polymer (at MW 250 and 700) and the photoinitiator, Irgacure® 2959, at this concentration are non-toxic to retinal epithelial cells. Photoinitiator selection, along with the polymer used, plays a major role in the crosslinked system that is formed. In this study we use the a type I α-hydroxyalkylphenone (Irgacure® molecule), which is a member of a group of photoinitiator compounds suitable for polymerisation reactions (22). Irgacure® 2959 is an extremely effective type I photoinitiator used in UV photocrosslinked systems (23), and is also suitable for use in aqueous systems or environments (23). Additionally, Irgacure® 2959 is activated by low intensity UV light at a wavelength of 365 nm (24), which is less damaging to tissues and helps further explain its low toxicity. When activated Irgacure® photoinitiators form benzoyl and alkyl radicals, both radicals are reactive to initiate photo-polymerisation but the benzoyl radical presents higher reactivity (46). This free radical formation could have resulted in toxicity, but this study has disproved that. In addition, Williams et al. tested a range of α-hydroxyalkylphenones photoinitiators, findings showed that the photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure® 2959) exhibited minimal toxicity in mammalian cells lines, including corneal epithelial cells lines (24), and was well tolerated at a range of concentrations, between 0.03-0.1% w/w (24,47) supporting findings in this study. This suggests Irgacure® 2959 is a suitable photoinitiator choice and could be safely used in preparations intended for ocular use. CONCLUSION Photocrosslinked PEGDA implants investigated in this study can provide sustained delivery of both small and large molecules. We have demonstrated that the implant system is capable of releasing bioactive protein molecules over at least a 2 month time period. Additionally, this study shows varying PEGDA MW and/or the addition of pore forming agents can affect drug release from the implant based system and alter its mechanical strength and swelling properties. Thus indicating that this delivery system has the capability to control the drug release by varying the implant composition. Future work will focus on exploiting PEGDA's tuneable nature to optimise crosslink density and thus further improve drug release. Different approaches will be investigated for each drug molecule, given their varied physical and chemical properties. The primary aim is to adapt the PEGDA implant system to provide at least 3 months release of active protein, along with desirable mechanical and thermal properties. ACKNOWLEDGMENTS AND DISCLOSURES Kathryn McAvoy is a DEL funded PhD student. COMPLIANCE WITH ETHICAL STANDARDS Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Kathryn McAvoy is a PhD student in Ocular Drug Delivery Research Group in the School of Pharmacy who is funded by Northern Ireland's Department of Employment and Learning (DEL). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Aptamer-functionalized pH-sensitive liposomes for a selective delivery of echinomycin into cancer cells Echinomycin (quinomycin A) is a peptide antibiotic from the quinoxaline family, which has a DNA bifunctional intercalating activity and an inhibitor of hypoxia-inducible factor (HIF1α). Echinomycin was discovered in 1957 as a potent antitumor agent; however, it was not successful in clinical use due to its low water solubility and short half-life. To revitalize this potent drug, it is important to increase its aqueous solubility and bioavailability. In this study, echinomycin was loaded into PEGylated pH-sensitive liposomes (PEGLippH) and functionalized with anti-nucleolin aptamer (AptNCL) for selective targeting and pH-responsive release of echinomycin into cancer cells. Echinomycin was complexed with γ-cyclodextrin (ECγCD) to enhance its water solubility and then encapsulated into pH-sensitive liposomes (PEGLippH-ECγCD). Then, liposomes were functionalized with AptNCL (AptNCL-PEGLippH-ECγCD) and the successful functionalization was confirmed by dynamic light scattering (DLS) measurements and gel electrophoresis. Cellular uptake for AptNCL-PEGLippH was evaluated by flow cytometry analysis using MDA-MB-231, MCF7, A549 cancer cell lines with respect to the normal fibroblast cells. The results showed a higher uptake and selectivity for AptNCL-PEGLippH compared to PEGLippH. The anti-proliferative effects of AptNCL-PEGLippH-ECγCD were more potent than PEGLippH-ECγCD by 3.5, 4, and 5 folds for A549, MDA-MB-231, and MCF7, respectively. Selectivity indices (SI) for AptNCL-PEGLippH-ECγCD for the tumor cell lines compared to the normal cell line after 72 h were MDA-MB-231 (43.3), MCF7 (16.9), and A549 (8.5). Furthermore, SI after 3 h for the three cancer cell lines were 4.7, 2.5, 2.8, respectively. Introduction Echinomycin (quinomycin A), a hydrophobic DNA bisintercalator peptide and an inhibitor of Hypoxia-Inducible Factor (HIF1a) has been proved to have potent anticancer 1,2 and antibacterial activities. 3,4 Echinomycin structure is composed of two quinoxaline-2-carboxylic acid moieties, depsipeptide ring, and a thioacetal bridge. 5 Echinomycin is an example of promising drug that failed in clinical trials. 3,6,7 For example, a clinical trial conducted to investigate echinomycin in patients with metastatic so tissue sarcoma using cremophor as a solubilizing agent and dose escalation on subsequent cycles of therapy produced no clinical responses in the 12 evaluated patients. 6 Unfortunately, because of severe side effects including severe nausea and vomiting dose escalation occurred in only 5 of 25 treatment cycles. 6 Most anticancer drugs lack specicity and belong to substances with both low solubility in aqueous uids and poor cellular uptake, which leads to unwanted side effects. 8 The development of drug delivery systems implied to reconsider the benet of such toxic products. 8,9 In 2015, echinomycin received an orphan drug designation for the treatment of acute myeloid leukemia in the U.S.A. 9 Drug delivery systems offer the potential to enhance the therapeutic index of drugs, by increasing the drug concentration, the residence time in target cells, and by decreasing the contact in normal host tissues. 10,11 Liposomes are widely used nanoparticles for drug delivery mainly due to their biocompatibility, stability, ease in formulation, high drug-loading efficiency, 12 and high bioavailability, and their safe excipients are used in formulations. [13][14][15] Moreover, liposome cell-specic targeting can be achieved by decorating the surface of liposomes with ligand moieties such as aptamer, antibody, polymers, small molecules, and peptides. 16,17 Aptamers are single-stranded oligonucleotides that can |
be selected for a wide range of targets and can bind its target with high affinity and selectivity. Aptamers were used as a targeting ligand for many drug delivery systems and showed potent and promising targeting efficacy in vitro and in vivo. 18,19 Trigger-release liposomes are smart liposomes that release their payload on demand in response to endogenous (pH, enzymes, redox, or molecules) or external stimuli (heat or light). 20 pH-triggered release liposomes undergo bilayer destabilization and leakage of their cargo at low pH inside diseased tissues or cells. 21,22 These pH-sensitive liposomes are of particular interest for the delivery of anticancer drugs since the extracellular pH of cancer tissues is slightly acidic due to the 22,23 high metabolic activity of cancer cells 24,25 in addition to the low pH of some intracellular organelles that enable liposomes to release their loads into the cell cytoplasm. 26 These types of liposomes are categorized into different classes, mainly composed of polymorphic lipids, e.g., dioleoyl phosphatidylethanolamine (DOPE), which can be stabilized by PEG and cholesterol. [27][28][29][30] Aer internalization inside tumor cells, pH-sensitive liposomes are retained in early endosomes (pH 6.5), which will be developed into late endosomes (pH 5), without being destructed by the lysosomal enzymes. 31,32 There are three mechanisms for cytoplasmic delivery of the cargo from pH-sensitive liposomes; (i) destabilization of liposomes and drug defuses through the endosomal membrane into the cytoplasm, (ii) liposomes destabilize the endosomal membrane by the formation of pores in the membrane, and (iii) nally, the fusion of liposome with the endosome leading to drug release into the cytoplasm. 22,33 In a previous study, echinomycin was complexed with gcyclodextrin and inclusion complexes were encapsulated inside PEGylated liposomes and showed promising anti-proliferative and anti-invasive activity against U-87 MG glioblastoma cells. 9 In the current study, we propose aptamer-guided and stimulisensitive liposomes as a smart multifunctional drug delivery system for selective delivery of echinomycin into breast and lung cancer cell lines. First, the echinomycin-g-cyclodextrin complexes were prepared and loaded into PEGylated and pH-sensitive liposomes. Then, the loaded liposomes were functionalized with antinucleolin aptamer using a post-insertion method for targeting nucleolin-expressing cancer cells. Further, the selectivity and antiproliferative activity of the resulting aptamer-functionalized and echinomycin-loaded pH-sensitive liposomes were tested against three types of nucleolin-expressing cancer cell lines and compared with normal cell line broblasts. Finally, the impact of freezedrying on the stability and functionality of the formulated liposomes was investigated. Preparing echinomycin-g-cyclodextrin (ECgCD) complex Based on our previous work, 9 ECgCD inclusion complexes were prepared using the co-evaporation dispersion method. Echinomycin solution in chloroform (100 mL) was added dropwise to 235 mL of gCD aqueous solution to get an ECgCD ratio of 1 : 2 (v/v). The complex solution was shaken for 24 h to achieve equilibrium, then chloroform was evaporated under vacuum for 30 min. The nal volume of ECgCD inclusion was adjusted to 1 mL in PBS (pH 7.4) for loading into liposomes. 9 total lipids concentration). Liposomes made from 10 mM of DPPC and cholesterol (70 : 30) were used for comparison. PErhodamine-labelled liposomes were prepared using PErhodamine 0.5% molar ratio subtracted from the DPPC ratio. Liposomes were prepared using the conventional thin-lm hydration technique. [34][35][36] Briey, lipids were mixed in 3 mL of chloroform in a 50 mL round bottom ask. The thin lm was formed by evaporation of chloroform using 20 rpm at 50 C under a gradual decrease in negative pressure down to 100 psi (IKA RV 05 Basic Rotary Evaporator combined with VacuuBrand CVC2000, Germany). The lm was then hydrated with 2 mL of PBS buffer, pH 7.4 at $50 C for 30-60 min with vigorous vortexing every 2-3 min. 34 The vesicle suspension was successively extruded through a polycarbonate membrane (100 nm, What-man®) using Mini-Extruder (Avanti Polar Lipids, Inc. USA) at 50 C for 13 times (same size for more than 13 times) to obtain the nal liposomes with low polydispersity and desired size, which then stored at 4 C for further use. Calcein releasing assay For the calcein-releasing assay, the dry lm was dispersed into 2 mL of 50 mM calcein solution of pH 8.8. Then, calcein-loaded vesicles (50 mL) were added to 1 mL PBS solutions with different pHs (4.4, 5.4, 6.4, and 7.4). The mixtures were incubated for 15 min at room temperature under 100 rpm stirring. Then, 10 mL of the samples were diluted to 1 mL and the pH was adjusted to 7.4. Calcein uorescence was measured using the GloMax-Multi detection system (Promega, USA) before and aer the addition of 50% absolute ethanol. The percentage of calcein release was calculated using the following equation: where F i is the uorescence intensity of calcein in the buffer (pH 7.4), F t is the uorescence intensity aer incubation in the acid buffer, and F f is the uorescence intensity aer the addition of 50% absolute ethanol. The uorescence intensity at various pH should be adjusted to the intensity at pH 7.4 since the liposomes were prepared at pH 7.4 and the intensity of calcein uorescence decreases at acidic pH. PEG 2000 conical smile was imported from PUBCHEM (https://pubchem.ncbi.nlm.nih.gov) to Discovery Studio (version 2.5.5, Biovia, San Diego, CA, USA), and the covalent bond forming tool was used to connect it to DSPE. The aptamer was imported from the PDB databank (PDB ID: 2N3M) by removing the rst nucleotide at the 5 0 end and adding an extra 11 thymidine monophosphate (TMP) at the 3 0 end by Discovery Studio. The resulting aptamer was added by a linker using a "covalent bond forming tool" in Discovery studio to a cholesterol molecule (according to the experimentally calculated ratio). The nal structure was minimized several times with the minimization tool in Discovery studio untill converging to the most stable state. Preparing liposomes loaded with echinomycin-gcyclodextrin complexes pH-Sensitive liposomes composed of DPPC, DOPE, cholesterol, and DSPE-PEG 2000 with a molar ratio of 37 : 30 : 30 : 3, respectively, were prepared by a thin-lm-hydration extrusion method as described before. Instead of PBS buffer hydration, the thin lm was hydrated with 400 mL of ECgCD complexes and continued with the liposomal preparation protocol. The free ECgCD complexes were removed and washed two times with PBS solution using ultraltration 100 kDa cutoff amicon lter (Millipore, USA). The ECgCD loaded-liposomes were stored at 4 C for further use. 37 Differential scanning calorimetry (DSC) for pH-sensitive liposomes The liposome samples weights in the range of 3-6 mg were analyzed by Netzsch DSC 204 F1 instrument (Germany). The liposome suspension was heated up to 50 C and was then cooled with liquid nitrogen to À50 C. The DSC patterns of the samples were obtained by heating liposomes suspension gradually from À50 C to 200 C at a heating rate of 5 C min À1 under a constant ow (100 mL min À1 ) of nitrogen gas. Post-insertion of Apt NCL into PEGylated liposomes Functionalizing liposomes and PEG-liposomes with Apt NCL aptamer was performed using a post-insertion method. 38,39 Free or loaded different liposome formulations were mixed with cholesterol-linked Apt NCL at (0.3 mg lipid: 10 mg Apt NCL ) or Alexa-tagged Apt NCL (0.3 mg lipid: 9 mg Apt NCL : 1 mg Alexa-tagged Apt NC ). The mixture was stirred at room temperature (25 C) for 1 h. Post-inserted Apt NCL was nally mixed with 2.5 mM MgCl 2 and 140 mM KCl in 1Â PBS, pH 7.4 as a folding buffer for an extra 10 min to enable folding. Characterization of aptamer-liposomes (Apt NCL -Lip pH ) 2.10.1. Agarose gel electrophoresis. Agarose gel electrophoresis was performed to conrm the successful conjugation of Apt NCL to the surface of liposomes. Samples of free liposomes, free Apt NCL and Apt NCL -PEG Lip pH were loaded into 3% agarose gel (Promega, USA) supplemented with 5 ml of 2.5 mg mL À1 ethidium bromide followed by running electrophoresis in 1Â TBE buffer (pH 8) at 85 V for 15 min. Images for analysis were obtained using the Chemi-Doc™ Bio-Rad gel imaging system (USA). 34 2.10.2. Size and zeta potential. The size, PDI and zeta potential of different liposomal formulations, encapsulated liposomes and free liposomes, were measured at 25 C by dynamic light scattering (DLS) using nano zeta sizer (Malvern Instruments, UK). The different liposome formulations were diluted in PBS 1Â to obtain 8 mM sodium chloride nal concentration (pH 7.4). 34 2.11. Freeze-drying of the liposomes Freshly prepared liposomal suspensions were freeze-dried in the presence of trehalose and sucrose ratios; 1%, 2.5%, 5%, and 10% (w/v). Liposomes without lyoprotectant were lyophilized as a reference. Liposomes were freeze-dried using an OPERON freeze-dryer (OPERON Co., Ltd). A volume of 1 mL liposomal dispersion was transferred into vials and stored for 24 h at À20 C. Then, the liposomes were soaked in liquid nitrogen for 10 min. The temperature of the freeze dryer was then lowered to À55 C. Sublimation of the aqueous solvent was then initiated by decreasing the pressure to 150 mbar for the next 24 h. At the end of the process, the vials were closed with rubber caps and stored at À20 C until further analysis. The inuence of the type and molar ratio of lyoprotectant on the nal quality of the product was examined by measuring size and charge before and aer lyophilization, with and without lyoprotectants. Flow cytometry analysis Apt NCL -Lip pH binding selectivity and cellular uptake against four cell lines (broblast, A459, MCF7, and MDA-23) were evaluated by measuring the mean uorescence intensity (MFI) using a ow cytometer (BD FACSCantoTM II). Approximately, 2.5 Â 10 5 cells of each cell line were seeded in 12-well plates and incubated for 24 h at 37 C to reach 80% conuency. Aer that, cells were washed with PBS and incubated in 500 mL of fresh media and 200 nM tagged Alexa-Apt NCL -Rhod-Lip pH was incubated with cells for 3 h at 37 C. The unbound Alexa-Apt NCL -Rhod-Lip pH was washed three times with PBS and detached by 100 mL of EDTA-accutase for 5 min. Aer detachment, cells were transferred into ow cytometry tubes and 10 000 events were counted for each sample using y FACS Canto II and analyzed using BD FACSDiva™ soware version 8.0 (BD, USA). Cells treated with lipo-Rhod and Alexa-tagged aptamers were used for comparison. Cells with media have been used as negative controls. In vitro stability of PEG Lip pH -ECgCD and Apt NCL -PEG Lip pH -ECgCD The stability assay of PEG Lip pH -ECgCD and Apt NCL -PEG Lip pH -ECgCD was performed by measuring the mean hydrodynamic diameter, zeta potential, and PDI in PBS at pH 7.4 with a storage period of 10 at 4 C and 3 days at 37 C. The releasing assay of echinomycin from PEG Lip pH -ECgCD and Apt NCL -PEG Lip pH -ECgCD was performed at 37 C in PBS at pH 7.4 and 5.4. Different samples of 700 mL were incubated at different time intervals (0, 10, 20, 30,60, and 720 min). The free ECgCD inclusions at each time point were removed by ultraltration using Amicon® lters (cut-off of 100 kDa) (Millipore, Germany). The concentration of echinomycin in the liposomal fraction was quantied by HPLC. Cytotoxicity (MTT) assay of Lip pH -ECgCD and Apt NCL -Lip pH -ECgCD The cytotoxicity of free echinomycin and liposomal preparations was measured using the cell viability MTT assay (microculture tetrazolium). Cells were seeded at a density of 5 Â 10 4 cells per well in a microtiter 96-well plate (Costar, USA) in 100 mL complete culture medium and incubated for 24 h in a humidi-ed atmosphere of 5% CO 2 at 37 C. Then, stock solutions of free echinomycin (free EC), PEG Lip pH -ECgCD, and Apt NCL -PEG -Lip pH -ECgCD were serially diluted in the medium of concentrations range from 0.02 to 50 nM in 100 mL medium and added to seeded cells. Aer that, treated cells were incubated in a humidied atmosphere of 5% CO 2 at 37 C for 72 h. For comparison with the 72 h treatment time, cells were treated with similar concentrations of free EC, PEG Lip pH -ECgCD, and Apt NCL -PEG Lip pH -ECgCD for 3 h and replaced with 100 mL fresh medium and incubated in a humidied atmosphere of 5% CO 2 |
at 37 C for 72 h. The solutions were then removed and replaced with 100 mL fresh media and 15 mL of MTT solution were added to each well, followed by incubation at 37 C for 3 h. Aer that, MTT-media solution was removed and 50 mL of DMSO was added to solubilize the dark blue formazan crystals. Results and discussion 3.1. pH-sensitive liposomes preparation and characterization 3.1.1. Calcein dye releasing assay. Dioleoylphosphatidyl ethanolamine (DOPE) can form an inverted hexagonal (H II ) phase above 10-15 C in neutral and acidic media. 40 Phosphatidyl ethanolamine lipids have a smaller head group to acyl chain ratio, when the smaller heads get close to each other, the broader the acyl chains leading to a positive curvature. 41 On the other hand, the phosphatidylcholine lipids are packed and organized into lamella without any curvature. 42 To optimize a stable pH-sensitive liposomal formulation with a good release under acidic pHs, DPPC was used as the bulk constituent of the formulation ($40%), while the DOPE molar ratio was #30%. DPPC can form a stable lamellar phase (L b ) and has a transitional temperature slightly higher than physiological temperature (41 C). 43 This stable lipid can decrease the intermolecular interaction of the headgroups of DOPE and increase surface hydration. 32 Cholesterol, at a molar ratio up to 30%, increased the stability of nanoparticles. 44 Cholesterol lls up gaps between the packing of other lipid species. It is a membrane constituent widely found in biological systems and serves a unique purpose of modulating membrane uidity, elasticity, as well as permeability. 44 Cholesterol serves the same purpose in model membranes. 45 These lipid combinations are consistent with a previous literature 10,33 in which the pH-sensitive liposomes should contain the very low transition temperature phospholipid, DOPE, as a basic component in addition to cholesterol as a stability lipid. 43 The calcein-releasing experiment revealed that the release at physiological pH (pH z 7.4) was (8.82 AE 2.5%), while the release at pH z 5.4 was (46.65 AE 6.3%) (Fig. 1A). Based on these results, the pH-sensitive liposomal formulation is stable at physiological pH and releases approximately 50% of its content at the endosomal pH. Moreover, the incorporation of DSPE-PEG 2000 into DOPE-containing liposomes decreased the release of calcein (24.7 AE 1.2%) from DOPE-containing liposomes at acidic pHs, which indicates higher stability and lower pHsensitivity. Besides, liposomes containing DPPC and cholesterol only showed low and stable release at different pHs. The stability and pH sensitivity results of the developed formula were consistent with previous studies. For example, Ghanbarzadeh et al., (2014) developed a liposomal formula composed of DPPC: DOPE: CHO: with a molar ratio of 50 : 30 : 20, respectively, and had a better antiproliferative effect on MCF-7 cells compared to conventional liposomes. 33 3.1.2. Differential scanning calorimetry (DSC). The DSC method was used to determine the phase changes in the pHsensitive liposomes' transitional temperature (Tm) due to the presence of DOPE in different formulations. DSC analysis depends on the thermodynamic concept of heat ow differences among samples and the reference. Thus, the calorimeter measures the amount of heat absorbed or released during material transformation. 46 Fig. 1B shows a clear endothermic peak between 10-14.6 C for the Tm of DOPE in the intended liposomes. Another broad and highly endothermic peak at 100-130 C, which indicates the evaporation of water or melting of other constituents. The slight shi in DOPE Tm indicates the effect of different formulations on the DOPE transition temperature. Despite these slight shis in DOPE Tm, the results of DSC and calcein release at acidic pH indicate that the release is pH-sensitive rather than thermo-sensitive. Apt NCL post-insertion into liposome surface and characterization of Apt NCL -PEG Lip pH In this study, PEGylated pH-sensitive liposomes ( PEG Lip pH ) were functionalized with anti-nucleolin cholesterol-modied AS1411 aptamer (Apt NCL -PEG Lip pH ) to selectively target nucleolinexpressing cancer cells. The liposomes were stealthed with 3% DSPE-PEG 2000 and encapsulated with calcein to investigate release and pH-sensitivity or with ECgCD complexes to investigate the anti-proliferative effect on different cancer cell lines. The pegylated Lip pH was graed with Apt NCL using a postinsertion method that utilized cholesterol (CHO) as an anchoring unit to incorporate Apt NCL on the surface of preformed and loaded liposomes ( Fig. 2A). 38 3.2.1. Agarose gel electrophoresis. The post-insertion of Apt NCL on the surface of pH-sensitive liposomes was also conrmed by agarose gel electrophoresis (Fig. 2B). Free aptamers and blank liposomes were used as controls for comparison. Apt NCL -PEG Lip pH appeared to be entrapped in the well where a very low signal was obtained for blank Lip pH . As a negatively charged single-strand DNA, free Apt NCL can transfer freely through the gel from the negative to the positive electrode, while the large molecular weight of Apt NCL -PEG Lip pH prevents Apt NCL from free migration and was trapped in the well. 3.2.2. Size and zeta potential. The effect of Apt NCL postinsertion on the size and zeta potential of preformed pHsensitive liposomes was examined and compared to blank liposomes as illustrated in Fig. 2C. The mean hydrodynamic size and PDI of Apt NCL -Lip pH (146 AE 6 nm and 0.2 AE 0.05) and Apt NCL -PEG Lip pH (149.5 AE 5 nm and 0.24 AE 0.2) were found to be slightly higher than the Lip pH (130.5 AE 3 nm and 0 AE 0.02) and PEG Lip pH (145 AE 6 nm and 0.12 AE 0.01). Moreover, the zeta potential of Apt NCL -Lip pH (À32 AE 2.6 mV) and Apt NCL -PEG Lip pH (À34 AE 4.3 mV) were decreased compared to Lip pH (À17 AE 0.8 mV) and PEG -Lip pH (À19 AE 1.1 mV) in diluted PBS buffer (8 mM NaCl, pH 7.4). The increase in liposome size (16 nm) and a decrease in zeta potential (À15 mV) conrm the successful post-insertion of the negatively charged aptamer to our liposomes. Moreover, our results indicated that aptamer conjugation has increased liposomal stability by decreasing aggregation through the process of aptamer immobilization onto the surface of Lip pH as reported in previous reports. 47 pH-Sensitivity and calcein release from the Apt NCL -PEG Lip pH The calcein releasing assay was performed to demonstrate the effect of aptamer and PEG 2000 on the pH sensitivity and stability of liposome formulation. Fig. 2D shows higher stability of Apt NCL -PEG Lip pH liposomes than Apt NCL -Lip pH at different pHs. These results evidenced the role of PEG and aptamer in increasing liposome stability. Cellular uptake and selectivity of Apt NCL -Lip pH using ow cytometry The in vitro selectivity and cellular uptake of Apt NCL -PEG Lip pH against MDA-MB-231, MCF7, A549, and normal skin broblast cells were examined by measuring the mean uorescence intensity (MFI) of the uorescent signal obtained from Alexa 647-labeled Apt NCL and rhodamine-labeled liposomes in free Apt NCL,PEG Lip pH , and Apt NCL -PEG Lip pH (Fig. 3A-D). All examined cells showed higher MFI of rhodamine signals when treated with Rhod-labelled Apt NCL -PEG Lip pH compared to rhod-labeled PEG Lip pH and untreated cells, whereas all cells showed a slight increase in the MFI of Alexa Fluor 647 signals when treated with Alexa-and Rhod-labelled Apt NCL -PEG Lip pH compared to Rhod labeled PEG Lip pH and untreated cells. The cellular uptake results proved the role of the aptamer for liposomal selective targeting and accumulation into the cancer cells by at least by two folds versus the plain liposome in cancer cells. The same conclusion can be obtained from the ow cytometry histogram analysis as reported in Fig. 3A-D. Interestingly, broblasts showed a higher uptake for the free Alexa-Apt NCL and Alexa-and Rhod-labelled Apt NCL -PEG Lip pH compared to cancer cell lines. Previous reports have explained that the higher uptake of the anti-nucleolin aptamer by the normal cells compared to cancer cells is due to different uptake mechanism. 48,49 In cancer cells, the uptake was mediated by macropinocytosis (uid-phase endocytosis) that stimulates further macropinocytosis by nucleolin-dependent mechanism while in normal cells the uptake is mediated by a different mechanism (nonmacropinocytic pathway). Encapsulation of echinomycin-gCD into pH-sensitive liposomes ( PEG Lip pH-ECgCD) In our previous study, 9 echinomycin-gCD (ECgCD) was prepared and characterized using 1 H-NMR spectroscopy, the phase solubility diagram, and the Benesi-Hildebrand method. In the current work, ECgCD was prepared and encapsulated into PEGylated pH-sensitive liposome formulation composed of DPPC : DOPE : CHO : DSPE-PEG 2000 with 37 : 30 : 30 : 3 molar ratio (Fig. 4A-D). It is worth mentioning that the current formula is different from the previously investigated liposomes, which were composed of DPPC, and cholesterol. Fig. 5A shows DLS measurements of PEG Lip pH , PEG Lip pH -ECgCD, and Apt NCL -PEG Lip pH -ECgCD in addition to encapsulation efficiency. The average size of PEG Lip pH was 134 AE 10 nm and was 120 AE 16 nm for PEG Lip pH -ECgCD with no signicant differences. Both liposome preparations showed a similar polydispersity index ($0.1), which demonstrates the presence of a monodisperse distribution. The zeta potential of PEG Lip pH was À12 AE 2 mV with values similar to the one observed for PEG Lip pH -ECgCD (À15 AE 2 mV). The encapsulation efficiency of echinomycin was found to be around 6.3 AE 0.4% and a drug loading of 0.03% (wt/wt), which is similar to our previous work (5.1 AE 0.8). 9 3.6. In vitro releasing assay of EC from PEG Lip pH -ECgCD and Apt NCL -PEG Lip pH -ECgCD The in vitro release of echinomycin from PEG Lip pH -ECgCD and Apt NCL -Lip pH -ECgCD was assessed in physiological PBS buffer (pH 7.4 and pH 5) at 37 C over a period of 12 h at different intervals. As illustrated in Fig. 5B, echinomycin release from PEG Lip pH -ECgCD was higher than Apt NCL -PEG Lip pH -ECgCD at both pHs. This can be explained by the fact that the Apt NCL was post inserted and immobilized onto the surface of PEGylated Lip pH utilizing CHO as anchoring units. Extra CHO molecules increase the rigidity of the vesicles while the presence of DSPE- PEG 2000 decreases the release by decreasing the pH sensitivity of DOPE. 50 Moreover, the aptamers post-inserted to the surface of liposomes may decrease the pH sensitivity of the PEG Lip pH -ECgCD. In general, these ndings conrm the pH sensitivity for Apt NCL -PEG Lip pH -ECgCD, which might be benecial for the drug delivery in the tumor microenvironment. Colloidal stability for PEG Lip pH -ECgCD and Apt NCL -PEG Lip pH -ECgCD The stability of blank PEG Lip pH , PEG Lip pH -ECgCD, and Apt NCL -PEG -Lip pH -ECgCD was investigated by measuring the changes in the mean size and polydispersity index (PDI) over a period of three days in physiological buffer at 37 C (physiological temperature) ( Fig. 6A-C) and at 4 C (storage temperature) (Fig. 6D-F). The results showed acceptable stability of PEG Lip pH , PEG Lip pH -ECgCD, and Apt NCL -PEG Lip pH -ECgCD at tested temperatures as indicated by minimal changes in the mean size, zeta potential, and PDI. The lipid bilayer of liposomes graed with PEG 2000 and Apt NCL was simulated to investigate the stability, distribution, and packing of lipids. The top view, side view, and tilt of the bilayer for the primary sheet composed of different types of lipids showed stable and uniform distribution of DPPC, DOPE, cholesterol, DSPE-PEG 2000, and CHO-Apt NCL (Fig. 7A-C), respectively. Cytotoxicity study MTT assay was performed to investigate the cytotoxic effects of free EC, PEG Lip pH -ECgCD, and Apt NCL -PEG Lip pH -ECgCD in terms of the absolute IC 50 aer 72 h treatment incubation for MDA-MB-231, MCF7, A549, and normal broblast cells. Fig. 8A-D represents the viability dose-response curve and the absolute IC 50 of free EC, PEG Lip pH -ECgCD, and Apt NCL -PEG -Lip pH -ECgCD for 72 h treatment incubation of MDA-MB-231, A549, MCF7 cancer cell lines, and broblast cells, respectively. The cytotoxicity results showed a higher anti-proliferative effect for Apt NCL -PEG Lip pH -ECgCD compared to PEG Lip pH -ECgCD and were |
1.5, 2, and 5 folds for A549, MCF7, and MDA-MB-231, respectively, aer 72 h treatment incubation Fig. 8E. Moreover, Fig. 8A-D showed the selective localization of Apt NCL -PEG Lip pH -ECgCD versus PEG Lip pH -ECgCD aer adding the treatment for 3 h to allow binding of EC loaded nanoparticles to the cell surface and to be internalized into the cell cytoplasm. The remaining free treatment was removed, and the cells were incubated for 72 h. These results were consistent with the previously described cellular uptake study of unloaded Apt NCL -PEG Lip pH and PEG Lip pH ($2 folds for all cells) using ow cytometry. However, selectivity values in terms of cell viability were higher, which reects the high potency of echinomycin drug. The IC 50 values of free EC and PEG Lip pH -ECgCD were around 1 nM for all investigated cancer cell lines and were around 6 nM for broblast cells. The IC 50 for PEG Lip pH -ECgCD and Apt NCL --PEG Lip pH -ECgCD were about 7.5 nM for the broblast cells. Furthermore, the IC 50 of Apt NCL -PEG Lip pH -ECgCD for broblast was higher than PEG Lip pH -ECgCD IC50 by 1.5 folds (Fig. 8E) when treatment was removed aer 3 h incubation. These ndings are in favor of echinomycin (either free or formulated) as more cytotoxic for cancer cells than normal cells. It is revealed from Fig. 8E that the in vitro cytotoxicity of Apt NCL -PEG Lip pH -ECgCD in terms of IC 50 against MDA-MB-231, MCF7, A549 were 0.18 AE 0.01, 0.46 AE 0.03 and 0.92 AE 0.12, respectively, compared to PEG Lip pH -ECgCD, which where 0.92 AE 0.17, 0.94 AE 0.08 and 1.18 AE 0.7, respectively. The viability results provided a promising potential for selectivity and higher toxicity of Apt NCL -PEG Lip pH -EC-gCD over non functionalized formulations into cancer cells. The cytotoxicity results and conclusions are consistent with previous studies. For example, in vivo and an in vitro study conducted by Xing et al., (2013) showed aptamer-liposomes bind with high affinity and specicity to nucleolin cell surface receptors, which overexpressed on MCF-7. 51 Moreover, Liao et al., (2015) conjugated liposomes encouraged the specic binding of liposomes to the nucleolin receptors, improving the affinity and cellular uptake by tumor cells more than plain liposomes. 52 The selectivity index (SI) of anticancer drugs, measures the window between toxicity against normal cells and anticancer activity. The higher the SI ratio, the more effective and safer a drug during in vivo treatment for anti-cancer drugs. 53 An SI value greater than 2 indicates that the compound is more than twice cytotoxic to the tumor cell line compared to the normal cell line, while SI <2 means that the drug has general toxicity. 53 Selectivity indices are shown in Fig. 8F for the tested PEG -Lip pH -ECgCD, and Apt NCL -PEG Lip pH -ECgCD against the cancer cell lines (A549, MDA-MB-231, and MCF7) and normal broblast cells. The selectivity index (SI) of Apt NCL -PEG Lip pH -ECgCD for tumor cell lines compared to the normal cell line aer 72 h was 43.3 (MDA-MB-23), 16.9 (MCF7) and 8.5 (A549). Furthermore, SI aer 3 h were found 4.7, 2.5, 2.8, respectively. These results conrmed the selectivity of aptamer-guided drug delivery systems, especially SI aer 3 h. In addition, the selectivity index (SI) of PEG Lip pH -ECgCD for tumor cell lines compared to the normal cell line aer 72 h was 8.3 (MDA-MB-231), 8.1 (MCF7), and 6.4 (A549). Furthermore, SI aer 3 h were found to be 0.71, 0.4, 0.4, respectively. Based on the SI of PEG Lip pH -ECgCD aer 72 h, selectivities were comparable for the three cancer cell lines and it is proposed that PEG Lip pH -ECgCD is more toxic on cancer cells than on normal cells. Whereas, aer 3 h, the SI indicated that PEG Lip pH -ECgCD was retained in the cell and then released in a controlled manner over a longer time. In general, both PEG Lip pH -ECgCD and Apt NCL -PEG Lip pH -ECgCD showed higher selectivity toward cancer cells than normal cells. Lyophilization of the liposomal formulation Lyophilization of liposomal formulations is a commonly used method to increase liposomal stability and shelf life. Lyoprotectants such as sucrose, maltose, lactose, and trehalose are needed to prevent liposomal collapse during the lyophilization process and vesicle fusion upon rehydration. 54 Freshly prepared liposomal suspensions were freeze-dried in the presence of either trehalose or sucrose in ratios; 1%, 2.5%, 5%, and 10%. It is worth mentioning that protected liposomes were signicantly lower in size and PDI than unprotected liposomes, which means that both sugars protect liposomes from fusion and become larger in size aer rehydration, (Table S1 †). Sucrose and trehalose were used as cryoprotectants. Both sugars resulted in stable particle size upon reconstitution. However, sucrose was slightly better than trehalose. This can be explained due to the condition of the freeze dryer, which was used, and the lowest temperature and pressure that can be reached. 54 Lyophilization of the nal formulation was successfully performed using 5% sucrose as a cryoprotectant. This was illustrated in (Fig. 9A and B). The stability of the nal lyophilized formulations was investigated by measuring the changes in the mean size, size distribution (PDI), Z-potential, and EE% blank PEG Lip pH , PEG Lip pH -ECgCD, and Apt NCL -PEG Lip pH -ECgCD aer rehydration (Fig. 9A). Moreover, the results showed acceptable stability of both blank and loaded liposomes indicated by minimal changes in the mean size, PDI, and EE%. In addition, PEG Lip pH -ECgCD and Apt NCL -PEG Lip pH -ECgCD retained their cytotoxic and targeting functions by measuring their anti-proliferative activity on the MDA-MB-231 breast cancer cell line (Fig. 9C). Indeed, the toxicity of Apt NCL -PEG Lip pH -ECgCD was 2.7 fold higher than that of PEG Lip pH -ECgCD. Conclusions Smart and multifunctional aptamer-guided and PEGylated pHsensitive liposomes were designed, formulated, and fully characterized. These liposomes were stable at physiological pH and released their payload at low pH. Particle size, size distribution and charge stability were evaluated at storage and physiological temperatures. These smart-multifunctional liposomes were tested for pH sensitivity and release using calcein dye and echinomycin. Both the dye and the potent anticancer antibiotic drug, echinomycin, were successfully encapsulated inside Table showing the effect of lyophilization on the stability of PEG Lip pH , PEG Lip pH -ECgCD, and Apt NCL -PEG Lip pH -ECgCD in terms of mean hydrodynamic diameter, PDI, and zeta potential, encapsulation efficiency, and drug loading (B) successfully prepared lyophilized liposomes. Labels: a, PEG Lip pH ; b, PEG Lip pH -ECgCD; and c, Apt NCL -PEG Lip pH -ECgCD (C) the dose-response curve for MDA-MB-231breast cancer cells treated with lyophilized Apt NCL -PEG Lip pH -ECgCD and PEG Lip pH -ECgCD (treatment was removed after 3 h). (mean AE SD, n ¼ 3). liposomes. Apt NCL -PEG Lip pH -EC-gCD exhibited excellent selectivity and cytotoxic activity on three cancer cell lines (MCF7, MDA-MB-231, and A549) compared to normal cells. The current aptamer-guided pH-sensitive liposomes can be used as a delivery system for other therapeutic molecules. Moreover, in vivo and mechanistic studies can provide valuable information about the antitumor efficacy and more understanding of the mechanism of selective uptake by cancer cells. Conflicts of interest The authors declare no conict of interest. The Influence of a Juvenile’s Abuse History on Support for Sex Offender Registration We investigated whether and how a juvenile’s history of experiencing sexual abuse affects public perceptions of juvenile sex offenders in a series of 5 studies. When asked about juvenile sex offenders in an abstract manner (Studies 1 and 2), the more participants (community members and undergraduates) believed that a history of being sexually abused as a child causes later sexually abusive behavior, the less likely they were to support sex offender registration for juveniles. Yet when participants considered specific sexual offenses, a juvenile’s history of sexual abuse was not considered to be a mitigating factor. This was true when participants considered a severe sexual offense (forced rape; Study 3 and Study 4) and a case involving less severe sexual offenses (i.e., statutory rape), when a juvenile’s history of sexual abuse backfired and was used as an aggravating factor, increasing support for registering the offender (Study 3 and Study 5). Theoretical and practical implications of these results are discussed. ison cases, however, making it difficult to understand the effect of offender age on registration support. In a series of experimental studies, Salerno, Najdowski, and colleagues (2010) found that the public was highly supportive of registering both juvenile and adult sex offenders, but only when they were asked about support for registry laws in general. When asked about specific cases, participants were significantly less likely to support registration in cases involving (a) younger as compared to older juveniles and (b) less severe offenses, such as sexting, sexual harassment, and statutory rape (offenses for which juveniles are registered in some states), as compared to more forced and violent forms of rape. Indeed, support for juvenile sex offender registration is influenced by a variety of factors, including the education level of the individual (Stevenson, Smith, Sekely, & Farnum, 2013) and the race (Stevenson, Sorenson, Smith, Sekely, & Dzwairo, 2009) and sexual orientation (Salerno, Murphy, & Bottoms, 2014) of the offender and victim. Although neither adult (Hanson & Bussiere, 1998;Widom & Ames, 1994) nor juvenile sex offenders (Rasmussen, 1999;Silovsky & Niec, 2002) are especially likely to have a history of experiencing child sexual abuse themselves, many laypersons, legislators, and other legal decision makers believe that a majority of adult sex offenders were abused themselves Sample & Kadleck, 2008). This inaccurate belief might also extend to juvenile sex offenders, and in turn, influence legal action taken against them, a possibility that motivated the present research. In five studies, we investigated (a) the extent to which laypeople believe that juveniles commit sex offenses because they were themselves sexually abused as children (Study 1), (b) how such beliefs influence laypeople's support for juvenile sex offender registration in general (Study 1 and Study 2), (c) whether such beliefs influence support for registering juveniles differently depending on the specific type of sex offense committed (Study 3), and (d) how the experimental manipulation of a juvenile sex offender's childhood abuse history influences support for sex offender registration for a more severe offense (forced rape, Study 4) and for a less severe offense (statutory rape, Study 5). Before describing the experiments, we review the extant literature regarding laypersons' beliefs about the prevalence of childhood sexual abuse among juvenile sex offenders and how it influences perceptions of them. With attribution theory as a guiding framework, we make predictions about the effects of prior beliefs on registration support and on the underlying psychological processes. Hanson and Slater's (1988) work suggests that the child sexual abuse rate for adult sex offenders is 28%, while Ryan, Miyoshi, Metzner, Krugman, and Fryer (1996; for review, see Worling, 2001) estimates it to be around 31-39% for juvenile sex offenders. Yet the public believes as many as 67% of adult offenders were sexually abused themselves . We predicted that the public would overestimate the prevalence of sexual abuse histories among juvenile sex offenders as they do for adult sex offenders. Further, we investigated the prevalence of this belief and its link to support for registry laws, given that Fortney et al. (2007) and argue that people assume early sexual abuse leads to future sexual offending. Beliefs About and Effects of Offenders' Experiences of Childhood Sexual Abuse Some studies have revealed that an adult defendant's history of child abuse leads perceivers to have a more positive reaction to those defendants (Garvey, 1998;Heath, Stone, Darley, & Grannemann, 2003;Lynch & Haney, 2000). For example, Stalans and Henry (1994) asked community members to read a vignette describing a 16-year-old boy accused of killing either his father or a neighbor following a heated argument. Participants were less likely to think that the boy intended to kill the victim or understood the wrongfulness of his actions when he was portrayed as having been abused by his father than when not. Those inferences decreased participants' recommendations that the abused boy be transferred from juvenile court to adult |
criminal court. Using the same experimental design, Nunez, Dahl, Tang, and Jensen (2007) found that mock jurors were less likely to endorse retributive goals (i.e., a "just desserts" desire to get even with the juvenile) for punishing an abused versus a nonabused juvenile offender, and in turn, less likely to recommend that the abused juvenile be transferred from juvenile court to adult criminal court. Similarly, Najdowski, Bottoms, and Vargas (2009) found that mock jurors believed that a girl's history of neglect, physical abuse, and sexual abuse might have contributed to various offenses (shoplifting, drug offense, murder in self-defense, aggravated murder). They perceived an abused (vs. nonabused) offender as less deviant, less responsible, and more amenable to rehabilitationbut only when the crime was murder in self-defense against the perpetrator of abuse. In contrast, jurors perceived an abused girl as less amenable to rehabilitation than a nonabused girl when she had committed aggravated murder. Thus, even though jurors intuit the link between childhood abuse and later criminal behavior (i.e., "the cycle of violence," Widom, 1989), they may not account for past abuse when determining a juvenile's criminal culpability and may even use it as evidence of future dangerousness, especially when the juvenile commits a crime against someone other than the perpetrator of abuse. Thus, the evidence is mixed regarding whether offenders are perceived more favorably if they have been abused than if not. Grisso (2002) even expressed concern that expert witnesses might link a juvenile's history of being abused with being permanently damaged and less amenable to rehabilitation. Indeed, there is evidence that physically abused juveniles are treated more severely within the juvenile justice system, likely because they are perceived as "lost causes" (Stevenson, 2009). This is not consistent with laws mandating that a juvenile's abuse history should be used as a mitigating factor when deciding whether to transfer a juvenile to adult court (e.g., Illinois' Juvenile Court Act, 1987). Moreover, defense attorneys might hope or even assume that a juvenile's history of being sexually abused as a child will be used as a mitigating factor and reduce sentence severity-an assumption that has yet to be empirically tested. The goal of the present research is to explore assumptions and myths people have about juvenile sex offenders, and to test how those influence their support for registration policies. Attribution Theory Attribution theory is useful for disentangling these mixed findings. Attributions, or inferences about the causes of behavior, are made with regard to three aspects of behavior: (a) locus, or whether the causal factor is within the actor (i.e., internal) versus the environment (i.e., external); (b) stability, or whether the causal factor is constant (i.e., stable) versus changing (i.e., unstable) over time; and (c) controllability, or whether the actor does (i.e., controllable) or does not (i.e., uncontrollable) possess the ability to change his or her behavior (for reviews, see Shaver, 1985;Weiner, 2006). According to attribution theory (Weiner, 2006), different attributions produce specific, reliable predictions about perceivers' (a) judgments regarding a transgressor's responsibility for the crime (i.e., not responsible vs. responsible), (b) affective reactions to the case (i.e., sympathy vs. anger), and (c) sentencing goals (i.e., utilitarian vs. retributive). Jurors should render more punitive case judgments when the cause of a transgression is perceived to have been internal, controllable, and stable, as opposed to external, uncontrollable, and unstable (Shaver, 1985;Weiner, 2006). In fact, research has shown that the less people perceive the cause of a crime to be internal, controllable, or stable, the less punitively they treat the offender (Carroll, 1978;Carroll & Payne, 1977;Graham, Weiner, & Zucker, 1997;Najdowski & Bottoms, 2012). Graham and colleagues (1997), however, theorized that different attributions could influence different punishment goals and, in turn, punishment severity. Specifically, perceiving that an offender had control of his or her criminal behavior would increase retributive goals for punishing the offender (i.e., the defendant should "get what he deserves"). In contrast, perceiving that the cause of the offender's criminal behavior is stable would increase one's utilitarian goals for punishing the offender (i.e., concern for protecting society). Either of these attributional processes is expected to increase punitiveness toward an offender. It is this model that is particularly useful for understanding reactions to previously abused juvenile sex offenders. Why a Juvenile Sex Offender's Abuse History Could Be a Mitigating or Aggravating Factor On the one hand, believing that juveniles commit sex offenses because they were abused themselves as children might be associated with more uncontrollable attributions and diminished retributive goals, consistent with prior research (e.g., Graham et al., 1997;Najdowski et al., 2009). In turn, these attributions and goals might be associated with less support for the application of sex offender registry laws to juveniles. In support, Stevenson, Bottoms, and Diamond (2010) found that many mock jurors made uncontrollable attributions for an adult defendant who had a history of being physically abused as a child by arguing that the abuse explained his inability to control his adult criminal behavior (i.e., murder). The more jurors endorsed such uncontrollable attributions, the more they supported a sentence of life versus death. In addition, retributive goals play a major role in explaining public support for registry laws: People are less likely to support registry laws for juveniles who commit less versus more severe sex offenses , who perpetrate offenses against victims of the same race versus different race (Stevenson, Najdowski, Bottoms, & Haegerich, 2009), and who perpetrate male-on-female versus male-on-male offenses (Salerno et al., 2014) because they are less motivated to punish such juveniles. Thus, believing that juveniles perpetrate sex offenses because they were sexually abused themselves could have a mitigating effect on registration support. On the other hand, believing juveniles commit sex offenses because they were sexually abused might lead to more stable attributions that juvenile sex offenders are permanently damaged and likely to reoffend, as well as internal attributions that juveniles commit sex offenses because of mental illness or sexual deviance. Such beliefs might increase utilitarian motives to protect society and, in turn, support for the registry. In support, Stevenson and colleagues (2010) illustrated that the more likely jurors were to argue that physical abuse causes permanent psychological damage (a stable, internal attribution), the more likely they were to recommend a sentence of death versus life for an adult defendant who had been physically abused as a child. Also, Sample and Kadleck's (2008) survey revealed that legislators and other decision makers perceive sex offenders as incurable and destined to reoffend over and over again, and cite this belief as justification for sex offender legislation. In addition, Salerno, Stevenson, and colleagues (2010) found that people overestimated the likelihood that juvenile sex offenders would commit future offenses (although estimates were lower for juvenile than adult sex offenders). According to attribution theory, such stable attributions lead to increased utilitarian goals to protect society and, in turn, sentence severity (Graham et al., 1997;Weiner, 2006). In fact, utilitarian goals to protect society explain why the public supports more punitive sex offender registry laws for offenders who are older or commit more severe offenses compared to those who are younger or commit less severe offenses . Thus, beliefs about the effects of prior abuse on later sexual offending could have an aggravating effect on registration support. Study 1 In Study 1, we investigated people's estimates of the prevalence of sexual abuse among juvenile sex offenders, and whether they believe such abuse explains why juveniles commit sex offenses. We also tested our competing hypotheses (discussed above) to determine whether such beliefs would relate to decreased or increased support for applying registry laws to juvenile sex offenders. Materials. An online survey first provided participants with the following information and instructions (developed by : Adults found guilty of a sex offense must be listed on a public sex offender registry. In various states, this registry includes information such as name, social security number, age, race, gender, birth date, physical description, address, place of employment, details about the offense(s), fingerprints, a photo, a blood sample, and a hair sample. This information is available to the public upon request, sometimes by being posted on the Internet. In some cases, the police directly notify the people who live in the same area as the registered sex offender. Sex offenders are required to register anywhere from a few years to their entire life, depending on the state. We are interested in your thoughts about applying these registration laws to juveniles (16 years old or younger) who have been adjudicated (found guilty in juvenile court) or convicted as sex offenders. The survey then assessed participants' beliefs about (a) the prevalence of sexual abuse among juvenile sex offenders, (b) the link between sexual abuse and later offending, and (c) support for applying registry laws to juvenile sex offenders. Spontaneous attributions of sex offending to sexual abuse. Because we were interested in participants' spontaneous attributions about the causes of sex offending among juveniles, we first asked, "Why do you think the typical juvenile sex offender commits his or her crimes?" This question appeared alone on the computer screen before all other questions to ensure that responses were not biased by any subsequent measures. Modeled after coding methods in Stevenson et al. (2010), responses were coded for references to (a) sexual abuse (e.g., "They were previously sexually abused"); (b) abuse of an unspecified nature (e.g., "Maybe they were abused when they were young"); (c) some other dysfunctional background (e.g., "Lack of home support and or guidance"); or (d) none of the above (e.g., "Mental issues"). Two independent raters coded 50% of responses and were reliable on each code (proportion of agreement Ն99%). Disagreements were resolved by discussion and one rater coded the remaining data. Four participants (3%) did not respond to this item. Registration support. Next, participants were asked to agree or disagree with the following statement, our measure of registration support: "Public registration laws are too severe for juvenile sex offenders," using a scale ranging from 1 (strongly disagree) to 5 (strongly agree). This was reverse-scored so that higher scores reflect greater support for the registry. Direct attributions of sex offending to sexual abuse. On a separate computer screen, participants were asked to respond to the statement, "Many juvenile sex offenders commit sex offenses because they were sexually abused themselves," using a 5-point scale ranging from 1 (strongly disagree) to 5 (strongly agree). This item was modeled after a similar item used by Bumby and Maddox (1999). Estimates of abuse prevalence. Participants then provided estimates of sexual abuse prevalence by responding on an 11-point scale (ranging from 0% to 100% in intervals of 10%) to the question, "In your opinion, what percentage of all juvenile sex offenders were sexually abused as children?" (modeled after an item used by . Demographics. Finally, participants were asked to provide their gender, age, and ethnicity. Procedure. Community members were recruited via postings on http://www.craigslist.org in various U.S. cities. They (a) were informed that their participation was voluntary and anonymous, (b) received all instructions and completed all measures online using SurveyMonkey.com web survey software, and (c) were thanked and debriefed, in keeping with an approved Institutional Review Board (IRB) protocol. Results Most participants (62%) spontaneously attributed sexual offending to previous abuse or other dysfunctional background factors: 31% (n ϭ 38) cited prior sexual abuse as a cause, 9% (n ϭ 11) mentioned abuse of an unspecified nature, and 22% (n ϭ 27) mentioned other dysfunctional background factors. When subsequently asked directly, 84% of participants agreed or strongly agreed that "Many juvenile sex offenders commit sex offenses because they were sexually abused themselves" (M ϭ 4.12, SD ϭ .74). Discussion As predicted, when asked about juvenile sex offenders in general, many people believe that juvenile sex offenders have had prior experiences of abuse or other dysfunctional backgroundsboth when asked to report their spontaneous thoughts about why juveniles commit sex offenses and when asked directly about sexual abuse. These estimates are nearly exactly the same as found for adult sex offenders (67%) and more than double the actual prevalence among boy sex offenders (31%, Worling, 2001). Further, the more participants believed that sexual abuse causes sexual offending, the less they supported registry laws for juvenile sex offenders. This is consistent with other findings that abuse is sometimes used as a mitigating factor (e.g., Najdowski et al., 2009;Nunez et al., 2007;Stalans & |
Henry, 1994), and demonstrates that this effect extends to public support for juvenile sex offender registration policies. Study 2 Study 2 was designed to replicate and extend the results of Study 1 with a larger and more diverse sample and to explore whether attributions about why juveniles commit sex offenses explain the mitigating effect of beliefs about abuse on registration support found in Study 1. We hypothesized that greater agreement that sexual abuse causes sex offending would be associated with increased uncontrollable attributions and decreased retributive punishment goals, which would, in turn, decrease registration support. Although Study 1 showed that attributing sex offending to past abuse is associated with diminished registration support, we still tested for the competing possibility that this belief would increase registration support due to stable and internal attributions, because it is still possible that people who attribute sex crimes to past abuse also believe that juvenile sex offenders who experienced sexual abuse have deviant sexual arousal and mental illness (internal attributions), which cause them to commit sex crimes. Such beliefs might increase expectations that a juvenile sex offender will commit future sex crimes (stable attributions). Even so, given the results of Study 1, we did not anticipate that these beliefs would translate into greater registration support. As theorized by Weiner (2006), internal attributions (i.e., mental illness) and stable attributions (i.e., likely recidivism) do not always translate into unfavorable judgments when behavioral causes are also perceived to be the result of uncontrollable factors-in this case, a prior history of sexual abuse. Thus, we expected that the mitigating influence of uncontrollable attributions and diminished retributive goals would override the hypothesized aggravating effects of internal and stable attributions that stem from believing sexual abuse contributes to sexual offending. Method Participants. Participants were a diverse, urban group of undergraduates at a large Midwestern research university (n ϭ 87), and community members (n ϭ 91) who were 18 years old or older. Undergraduates were 66% women, 19 years old on average (SD ϭ 2, ranging from 18 to 30 years), and 41% Caucasian, 32% Asian, 12% African American, 12% Hispanic, and 4% of other ethnicities. Community members were 55% women, 37 years old on average (SD ϭ 13, ranging from 18 to 80 years), and 57% Caucasian, 10% African American, 15% Asian, 14% Hispanic, and 3% of other ethnicities. The two samples were combined for analyses because, importantly, preliminary analyses revealed no significant differences in their responses, all s Յ .13, all ns. Materials. A questionnaire included the same measures used in Study 1 in addition to items assessing uncontrollable, internal, and stable attributions for juveniles' sex offending behavior and participants' retributive and utilitarian punishment goals. Unless otherwise noted, all responses were made on 6-point scales ranging from Ϫ3 (strongly disagree) to ϩ 3 (strongly agree) with no midpoint. Values were transformed to create scales ranging from 1 (strongly disagree) to 6 (strongly agree). To measure uncontrollable attributions, participants indicated their agreement with the statement: "Juvenile sex offenders are unable to control their behavior." To assess internal attributions of juveniles' sex offenses, participants indicated agreement with the following statements: "Many juvenile sex offenders commit sex offenses because of deviant sexual arousal," "In your opinion, what percentage of all juvenile sex offenders are severely mentally ill?" Responses were given on an 11-point scale ranging from 0% to 100% in intervals of 10%. These measures were modeled after items used in prior research examining perceptions of juvenile offenders in general (Haegerich & Bottoms, 2004;Najdowski & Bottoms, 2012;Najdowski et al., 2009;Vidal & Skeem, 2007) and sex offenders specifically (Bumby & Maddox, 1999;Malesky & Keim, 2001;Proeve & Howells, 2006). To measure stable attributions, participants were asked, "In your opinion, what percentage of all juvenile sex offenders eventually commit another sex offense?" Responses were made on the 11point percentage scale. To measure retributive goals, participants indicated how much they agreed that, "I would support the sex offender registry for juveniles, even if there is no scientific evidence showing that it reduces sexual abuse." To measure utilitarian goals, participants indicated how much they agreed that, "Juvenile sex offenders pose a danger to society." Procedure. Undergraduates completed the questionnaire with items in the order described above during a mass-testing session, along with various unrelated surveys. Community members completed the questionnaire after being approached in various public settings in a large metropolitan area (mainly trains, but also airports, malls, etc.). All participants were told that their participation was voluntary and anonymous, then thanked for their participation, in keeping with IRB-approved procedures. Undergraduates were compensated with course credit for participating and community members received no compensation. Results As in Study 1, many participants overestimated the proportion of juvenile sex offenders who were sexually abused as children (M ϭ 53%, SD ϭ 23%, Range ϭ 0 -100%) and, when asked directly, 51% of participants agreed or strongly agreed that many juveniles commit sex offenses because they were sexually abused themselves (M ϭ 3.50, SD ϭ .93). A series of multiple linear regression analyses tested the effect of beliefs that sexual abuse causes sex offending on (a) uncontrollable, internal, and stable attributions for offending; (b) utilitarian and retributive goals; and (c) support for registry laws. Next, we tested for potential mediators of the effect of beliefs that sexual abuse causes sex offending on registration support (see Figure 1). We included as potential mediators only variables that were significantly predicted by abuse attributions in the prior analyses, as recommended by Baron and Kenny (1986). First, we tested whether each potential mediator significantly predicted registration support, finding that neither internal attributions to deviant sexual arousal nor to mental illness emerged as significant predictors, s Ͻ Ϫ.10, ts Ͻ Ϫ1.26, ns, and thus, they were not included in the mediation model. Although the effect of stable attributions on registration support was significant,  ϭ .23, t ϭ 3.11, p Ͻ .01, this effect was in the opposite direction as the effect of abuse attributions on registration support, instead predicting greater registration support. That is, although greater agreement that abuse contributes to sex offending was associated with less registration support (i.e., a lenient judgment), greater agreement that abuse contributes to sex offending was associated with greater stable attributions (i.e., belief that the juvenile will reoffend)-a variable that predicts greater registration support (i.e., a harsher judgment). Because stable attributions predict greater registration support, and greater abuse attributions predicted greater stable attributions, stable attributions logically cannot explain why abuse attributions predicted reduced registration support. Thus, according to Baron and Kenny (1986), stable attributions logically cannot explain (i.e., mediate) the effect of abuse history on support for the full application of the registry, and so this variable was not considered further. Yet, uncontrollable attributions and retributive goals positively predicted registration support, s Ͼ .23, ts Ͼ 3.11, ps Ͻ .01, and were therefore included in the mediation model. As recommended for research involving multiple mediators, we employed nonparametric bootstrapping analyses (see Preacher & Hayes, 2004;Preacher, Rucker, & Hayes, 2007) to test our meditational model (see Figure 1). According to Preacher and Hayes (2004), for mediation to be significant, the 95% bias-corrected and accelerated confidence intervals for the indirect effects (IE) must not include 0. Results based on 5,000 bootstrapped samples revealed that the total effect (TE) of abuse attributions on registration support was significant (TE ϭ Ϫ.26, SE ϭ .08, t ϭ Ϫ2.97, p Ͻ .05) but the direct effect (DE) was only marginal (DE ϭ Ϫ.14, SE ϭ .08, t ϭ Ϫ1.81, p ϭ .07). Next, we determined whether the indirect effects of the independent variable on the dependent variable through the three proposed mediators were statistically significant by relying on the following criteria: When zero is not in the 95% confidence interval, the indirect effect is significantly different from zero at p Ͻ .05 (two-tailed). Both uncontrollable attributions, 95% CI [Ϫ.11, Ϫ.002] and retributive goals of punishment, 95% CI [Ϫ.17, Ϫ.01] significantly mediated the relationship between abuse attributions and registration support. Finally, a comparison of the relative strength of the individual indirect effects against each other revealed no significant difference (i.e., the confidence interval included zero), 95% CI [Ϫ.06, .14]. Discussion Study 2 replicated Study 1's findings that (a) people overestimate the prevalence of sexual abuse history among juvenile sex offenders and believe that sexual abuse is a precursor to juvenile sex offending, and (b) these beliefs are associated with less support requiring juveniles to register as sex offenders. Study 2 demonstrated that this effect was explained by participants' uncontrollable attributions and retributive goals, in line with attribution theory (Graham et al., 1997;Weiner, 2006). That is, as predicted, the more participants believed that a history of sexual abuse explains why juvenile sex offenders commit sex offenses, the more likely they were to believe that juvenile sex offenders are unable to control their behavior and the less likely they were to support registration. Holding juvenile sex offenders less accountable for their actions and having less desire to punish them, in turn, predicted less registration support. As expected, this pattern was obtained even though participants' belief that childhood sexual abuse explains juveniles' later sex offenses also predicted internal attributions to mental illness, deviant sexual arousal, and marginally greater estimations of recidivism. This is consistent with past research revealing that jurors sometimes perceive abuse as psychologically damaging for review, see Stevenson, 2009). Even so, uncontrollable attributions and diminished retributive goals associated with attributing sex abuse to past abuse overshadowed the possible aggravating effects of negative internal attributions to mental illness and deviant sexual arousal. In other words, consistent with attribution theory (Weiner, 2006), we found that internal and stable attributions do not translate into unfavorable judgments when transgressions are also perceived as being caused by uncontrollable factors-in this case, a prior history of sexual abuse. Study 3 Study 3 tested whether Study 1 and 2 findings generalize to specific cases, because public support of sentencing policies tends to be stronger in the abstract as compared to when applied to specific cases in the context of support for the juvenile death penalty (Moon, Wright, Cullen, & Pealer, 2000); crime policy, punishment, and rehabilitation (Applegate, Cullen, & Fisher, 2002); three-strikes sentencing policies (Applegate, Cullen, Turner, & Sundt, 1996); and parental responsibility laws (Brank, Hays, & Weisz, 2006). In fact, Salerno, Najdowski, and colleagues (2010) found that people support sex offender registry laws for both adults and juveniles when they are asked about sex offenders in general, and that when asked to imagine a typical sex offender or offense, most people naturally envision sex offenders who commit the most heinous sex offenses such as rape and child sexual abuse. Yet, when given specific cases to consider, people supported registration less for younger juveniles and those who perpetrate less serious offenses (i.e., sexting, sexual harassment, statutory rape) as compared to older juveniles and those who perpetrate more serious offenses (i.e., forced rape). Therefore, in Study 3, we tested the extent to which beliefs that sexual abuse leads to sex offending influence registration support for juvenile sex offenders in specific cases (i.e., forced rape, statutory rape, harassment, and sexting). Because participants naturally envision severe prototypes of sex offenders when queried in the abstract, as in Studies 1 and 2 herein, we expected to replicate our findings that abuse attributions mitigate support for registration in a specific case involving a particularly severe offense (i.e., forced rape). Further, we anticipated that greater uncontrollable attributions and diminished retributive goals would mediate this mitigating effect, as in Study 2. We had competing hypotheses regarding how beliefs linking sexual abuse to sex offending might influence registration support in less severe cases (i.e., statutory rape, harassment, and sexting). On the one hand, the mitigating effect already observed in Studies 1 and 2 and predicted for severe cases in Study 3 might generalize to less severe cases. On the other hand, such beliefs might be used in an aggravating way by increasing registration support in less severe cases, because participants might vary in the extent to which they perceive less severe acts to be developmentally normal sexual exploration rather than true crimes. In support, found that even though the majority of participants (66%) did not support registration for less severe offenses, a significant minority of participants (34%) did. Further, it is possible that extralegal factors might alter the thresholds individuals |
have for determining whether certain sexual behaviors are labeled as normative versus deviant. For instance, Salerno et al. (2014) found that participants supported registration more for a less serious crime when the male juvenile offender was accused of having consensual sex with another underage boy than with an underage girl. Yet, this antigay bias did not emerge in the context of a serious crime involving an adult perpetrator and the underage victim. They theorized that when the crime is less serious, participants are more susceptible to expressions of bias that alter thresholds for labeling a sex act a crime. Stevenson et al. (2009) made a similar theoretical argument. In the context of a less serious crime (i.e., consensual oral sex), participants were more supportive of registering a juvenile when he and his victim were of different races than when they were of the same race. The authors theorized that, because interracial relationships are perceived as less normative and are generally less accepted, participants might have been more likely to label a less severe sex crime as a true crime when it was interracial rather than intraracial. Thus, it is possible that participants who think that juveniles commit sex offenses because they were sexually abused as a child might be more likely than others to interpret less severe sex acts between juveniles as true sex crimes. Further, we predicted that such an effect would be mediated by internal and stable attributions such that people who believe that a juvenile committed a sex offense because he was sexually abused might also believe that the juvenile is mentally ill, sexually deviant, and likely to commit future sex offenses. These attributions might, in turn, increase support for registration. Method Participants. Participants were a diverse, urban group of undergraduates at a large Midwestern research university (n ϭ 192) and community members (n ϭ 83). Undergraduates were 56% women, 19 years old on average (SD ϭ 1, ranging from 18 to 30 years), and 37% Caucasian, 32% Asian, 7% African American, 19% Hispanic, and 5% of other ethnicities. Community members were 56% women, 42 years old on average (SD ϭ 17, ranging from 18 to 84 years), and 63% Caucasian, 8% Asian, 12% African American, 11% Hispanic, and 6% of other ethnicities. Again, the two samples were combined for analyses because analyses revealed no significant differences in their responses, all s Ͻ .27, all ns. Materials. Materials included the same questionnaire described in Study 2, modified by adding a second brief paragraph to describe a specific 16-year-old boy who had been found guilty of committing one of four specific sex offenses: (a) attacking and raping a girl in a park (forced rape), (b) participating in and videotaping mutually desired oral sex with an underaged girl (statutory rape), (c) running through school hallways grabbing girls' buttocks (sexual harassment), or (d) getting caught looking at naked pictures of his underage girlfriend that she had e-mailed to him (sexting). The latter three offenses were based on actual cases in which sex offender registration was a possible outcome (Wilson v. State of Georgia, 2006;Goldsmith, 2007;and Stockinger, 2009;respectively). For example, in the sexting vignette, participants read: While David (a 16-year-old male) was checking his e-mail in the school library, he received a message that contained naked pictures of his girlfriend. As he was viewing the pictures, a librarian walked by, noticed, and sent him to the principal's office. After the school officials investigated, they discovered that the girl in the pictures was underage. David was adjudicated for possession of child pornography. The other three vignettes were similar in length and level of detail. Questionnaire items assessing (a) registration support; (b) beliefs that sexual abuse causes sex offending; (c) uncontrollable, internal, and stable attributions; and (d) utilitarian goals were the same as those described in Studies 1 and 2, except they were tailored to ask specifically about the juvenile described in the vignette (e.g., "Public registration laws are too severe for David's case"). To assess the motivation underlying retributive goals of punishment more directly, we asked participants the extent to which they agreed that, "Listing David on the sex offender registry is an appropriate way to punish him for his offense." Demographic items were the same. Procedure. Seventy-nine percent of the undergraduates participated in the same type of mass-testing session as in Study 2, and 21% completed the questionnaire in a laboratory alone or in groups ranging from 2 to 24. Community members were recruited as in Study 2. Participants were randomly assigned to read about one of the four specific cases and then asked to complete all questions in response to the specific offense described in the vignette. When done, they were debriefed and thanked. Undergraduates were compensated with course credit for participating. Community members received no compensation. Results Because our a priori definitions of the three less severe cases were that they would elicit less punitive case judgments than the fourth, more severe, case (as previous research has revealed, , we choose to simplify the presentation of our results by collapsing across the three less severe cases and presenting the results of our more severe case separately. Indeed, a planned contrast analysis comparing the case judgments of the fourth, severe case to the average case judgments of the three less severe cases revealed consistent significant effects such that participants endorsed more lenient (pro-offender) judgments in the less severe cases than the fourth, severe case (all s Ͼ Ϫ.13, all p Ͻ .05) for all dependent variables except for internal attributions to deviant sexual arousal,  ϭ .05, ns. Thus, our a priori definitions of the severity of the cases were largely supported by data analysis. Moreover, although we found a few significant differences between the three less severe case vignettes (i.e., statutory rape, harassment, and sexting) on some, but not all, dependent variables, Fs(3, 261-268) Ͼ 8.11, ps Ͻ .01, these differences were uninteresting theoretically for the purposes of this research. Further, the range of mean differences between the three less severe cases on all dependent variables was much smaller (M range ϭ .79) and was far outweighed by the range of mean differences between the average of the three less severe cases and the more severe case (i.e., forced rape) (M range ϭ 1.81). First, we present the main effects of abuse attributions on registration support, attributions, and punishment goals for the more severe case, followed by mediation analyses seeking to explain the main effect of abuse attributions on registration support. Then, we present the same analyses conducted for the less severe offenses. More severe case. Analyses revealed that among participants who read about a juvenile who committed a more severe offense, those who expressed greater agreement that sexual abuse contributes to sex offending were significantly less supportive of the registry,  ϭ Ϫ.46, t(38) ϭ Ϫ3.17, p Ͻ .01, R ϭ .46, R 2 ϭ .21, F(1, 38) ϭ 10.09, p Ͻ .01; and made significantly more uncontrollable attributions,  ϭ .31, t(39) ϭ 2.02, p ϭ .05, R ϭ .31, R 2 ϭ .10, F(1, 39) ϭ 4.09, p ϭ .05; significantly more internal attributions to deviant sexual arousal,  ϭ .37, t(41) ϭ 2.56, p Ͻ .05, R ϭ .37, R 2 ϭ .14, F(1, 41) Next, we conducted a series of regression analyses to determine which possible mediators explained the effects of beliefs that sexual abuse causes later offending on support for registering a juvenile who committed a more severe sex offense. We used the same mediation procedures described in Study 2. More stable attributions,  ϭ .39, t(34) ϭ 2.44, p Ͻ .05, and greater retributive goals,  ϭ .39, t(34) ϭ 2.44, p Ͻ .05, were associated with significantly greater registration support, but none of the other potential mediators emerged as significant predictors, all s Ͻ Ϫ.15, ts Ͻ Ϫ.92, ns. Therefore, we tested whether stable attributions and retributive goals mediated the effect of beliefs that sexual abuse leads to sex offending on registration support for a juvenile convicted of a more severe offense. Results from nonparametric bootstrapping analyses (as discussed above; see Preacher & Hayes, 2004;Preacher et al., 2007) based on 5,000 samples revealed no evidence of mediation. Specifically, the total effect of abuse attributions on registration support was significant (TE ϭ Ϫ.65, SE ϭ .21, t ϭ Ϫ3.14, p Ͻ .05), yet the direct effect was also Higher endorsement of retributive goals,  ϭ .41, t(228) ϭ 5.91, p Ͻ .001, and utilitarian goals,  ϭ .42, t(227) ϭ 6.99, p Ͻ .001, emerged as significant predictors of registration support, but none of the other potential mediators did, s Ͻ .11, ts Ͻ Ϫ1.39, ns. Therefore, we tested whether retributive goals and utilitarian goals mediated the effect of beliefs about sexual abuse on support for registering juveniles convicted of less severe offenses (see Figure 2). Supporting evidence of mediation, results based on 5,000 bootstrapped samples, revealed that the total effect of abuse attributions on registration support was significant (TE ϭ .29, SE ϭ .08, t ϭ 3.95, p Ͻ .001), whereas the direct effect was not significant (DE ϭ .03,SE ϭ .08,t ϭ .38,ns). Indeed, both retributive, 95% CI [.04, .20] and utilitarian goals of punishment, 95% CI [.05, .28] significantly mediated the effect of attributing a less severe sex offense to a history of being sexually abused on registration support (see Figure 2). Finally, a comparison of the relative strength of the individual indirect effects against each other revealed no significant difference, 95% CI [Ϫ.23, .13]. Discussion Results of Study 3 are consistent with past research showing that public support for sex offender registration varies depending on whether individuals are asked about juveniles in general or about specific juveniles accused of different crimes ranging in severity . The more participants thought that a juvenile's history of being sexually abused led him to perpetrate forced rape, the less they supported registering the juvenile as a sex offender. These results, as well as Studies 1 and 2 and Salerno, Najdowski et al.'s (2010) results, support the idea that laypeople naturally think about heinous crimes when they are asked about sex offenders in general. In contrast, the more participants thought that a history of sexual abuse led juveniles to perpetrate less severe offenses (i.e., statutory rape, harassment, and sexting), the more they supported registering the juvenile as a sex offender. Although some studies have shown that child sexual abuse mitigates reactions toward juveniles accused of nonsexual offenses Nunez et al., 2007;Stalans & Henry, 1994), our results suggest that people sometimes use beliefs about a history of sexual abuse as an aggravating factor when determining whether juveniles should register as sex offenders for committing less severe sex offenses. Why? People sometimes consider abused offenders to be "damaged goods" Stevenson et al., 2010). In fact, in less severe cases, beliefs linking sexual abuse to sex offending increased internal attributions to sexual deviance and mental illness, stable attributions in terms of perceived recidivism likelihood, retributive goals of punishment, and utilitarian goals of punishment. Moreover, both retributive and utilitarian goals of punishment explained why beliefs about sexual abuse and sex offending increased support for registry laws, which is partially in line with attribution theory (Weiner, 2006) and our hypothesis that stable attributions triggering utilitarian goals would explain this aggravating effect. Some research indicates that although self-reported sentencing goals are utilitarian in nature (e.g., a desire to protect society; Ellsworth & Ross, 1983), actual sentencing goals primarily stem from a retributive desire to punish (Carlsmith, Darley, & Robinson, 2002;Darley, Carlsmith, & Robinson, 2000;Stevenson et al., 2010), perhaps explaining why both retributive goals and utilitarian goals mediated this effect. Furthermore, this finding is consistent with our hypothesis that participants who believe that a juvenile's history of sexual abuse drove him to engage in sexual behavior might be more likely to interpret relatively less severe sex acts as true sex crimes and, in turn, treat the juvenile more punitively. In contrast, forced rape is probably always considered a true sex crime, regardless of beliefs about the causes of the perpetrator's behavior (e.g., history of sexual abuse). Finally, for the more severe offense, beliefs linking past sexual abuse to sex offending were associated with more uncontrollable attributions, more internal attributions to deviant sexual arousal, fewer stable attributions, and less |
retributive goals. These factors did not, however, mediate the effect of such beliefs on support for registering a juvenile who committed forced rape. This is in contrast to Study 2 findings, which indicated that uncontrollable attributions and diminished retributive goals explained that effect. Perhaps when participants are forced to consider an actual rape case, sympathy induced by the belief that the rapist was sexually abused may override other cognitions and attributions associated with this belief in a way that does not happen when participants are asked to consider a sex crime in the abstract. In support, much research shows that participants tend to be more sympathetic toward offenders when considering specific perpetrators of crime rather than criminal acts in general (e.g., Applegate et al., 2002;Brank et al., 2006;Moon et al., 2000). Study 4 Thus far, we provided indirect evidence that the belief that sexual abuse leads to sex offending reduces support for registering juveniles who commit serious sex offenses, whereas this belief increases support for registering juveniles who commit less severe sex offenses. To conclude this with more certainty about causality, we conducted a direct experimental test to understand how a juvenile's history of sexual abuse influences registration support in a forced rape case (Study 4) and separately in a statutory rape case (Study 5). Again, this work was guided by attribution theory and tested competing hypotheses. On the one hand, a history of being sexually abused as a child (relative to none) might cause participants to believe that the juvenile was less able to control his sexual behavior, which should, in line with Graham and colleagues' (1997) results, diminish retributive goals and reduce registration support. On the other hand, knowing that a juvenile sex offender was sexually abused as a child might predict greater internal attributions for juveniles' sex offending to factors such as deviance or mental illness, as well as stable attributions that the juvenile is likely to reoffend and, in turn, greater registration support. Yet in Study 3, abuse attributions predicted diminished registration support in the severe rape case but greater retributive and utilitarian goals and greater registration support in the lenient cases. We theorized that participants were more likely to interpret the relatively less severe sex crimes (e.g., statutory rape) as more like true sex crimes when the juvenile had been sexually abused himself as a child. In contrast, believing the juvenile had a history of sexual abuse might not have influenced perceptions of whether forced rape is a true sex crime because participants probably perceived forced rape as an unambiguous sex offense. Thus, in Study 4, we tested the extent to which this pattern of results would generalize when we experimentally manipulated abuse history in the context of a more severe sex crime-forced rape. Method Study 4 conformed to a one-way between-subjects experimental design in which the sexual abuse history (abused or nonabused) of a juvenile who committed forced rape was experimentally manipulated. Participants. Participants were 82 community members chosen to be nationally representative. Forty-four participants (54%) were in the abused condition and 38 (46%) were in the nonabused condition. Ten participants failed the manipulation check (i.e., three participants in the abused condition said the juvenile was not abused and seven participants in the nonabused condition said the juvenile was abused). These participants were excluded from analyses, resulting in a final sample size of 72, which was 54% women, 39 years old on average (SD ϭ 9, ranging from 20 to 62 years), and 73% Caucasian, 6% Asian, 11% African American, 7% Hispanic, and 2% of other ethnicities. Materials. Materials included the same description of the forced rape case followed by the same questions used in Study 3, with these exceptions: To accommodate the sexual abuse manipulation, we described the juvenile as having been "sexually abused by his father when he was a child" or as having "no history of being sexually abused as a child." We did not measure participants' beliefs that sexual abuse causes sex offending because we manipulated abuse history. We included an additional measure of support for the full application of the registry, developed from an item used by and . Specifically, we asked participants, "In your opinion, what is the most appropriate outcome for David?" Response options were 1 (should not be required to register), 2 (should be required to register, but his information should not be posted on the Internet), 3 (should be required to register, but his information should not be posted on the Internet until he turns 18, at which time his information should be publicly posted on the Internet), and 4 (should be required to register and his information should be publicly posted on the Internet), with higher numbers indicating greater support for the full application of the registry. Finally, a manipulation check item asked participants to respond (yes or no) to the question, "Was the juvenile offender sexually abused as a child?" Procedure. Community members were recruited via StudyResponse, a nationally representative database from which participants are recruited and given a $5 incentive to participate. Participants completed the questionnaire online, were thanked, and given their incentive, in keeping with IRB-approved procedures. Results and Discussion We conducted a series of one-way analyses of variance (ANO-VAs) to test the effect of abuse history (abused or nonabused) on participants' registration support; degree of support for the full application of the registry; internal, uncontrollable, and stable attributions for offending; and retributive goals of punishment. There were no significant effects of abuse history on any case judgments, all Fs(1, 57-70) Յ 2.66, ns. Thus, although Studies 1, 2, and 3 showed that participants' abuse attributions predict lenient treatment of juvenile sex offenders, in a true experimental test of the influence of abuse history, participants did not use abuse history as a mitigating factor. Instead, participants appeared to ignore abuse history, just as they frequently discount adult defen-dants' histories of child physical abuse as a mitigating factor in death penalty cases . Study 5 In Study 5 we experimentally manipulated abuse history in the context of a less severe sex crime, statutory rape, to replicate and extend Study 4 to a type of sex crime with which juveniles are more commonly charged. Method Study 5 conformed to a one-way between-subjects experimental design in which the sexual abuse history (abused or nonabused) of a juvenile who committed statutory rape was experimentally manipulated. Participants. Participants were 78 community members chosen to be nationally representative. Thirty-nine participants (50%) were in the abused condition and 39 (50%) were in the nonabused condition. Eight participants failed the manipulation check (i.e., two participants in the abused condition said the juvenile was not abused and six participants in the nonabused condition said the juvenile was abused). These participants were excluded from analyses, resulting in a final sample size of 70, which was 50% women, 38 years old on average (SD ϭ 9, ranging from 22 to 65 years), and 68% Caucasian, 7% Asian, 12% African American, 12% Hispanic, and 3% of other ethnicities. Materials and procedure. Materials included the same descriptions of the less severe cases (i.e., statutory rape, harassment, and sexting) as in Study 3, with all the same questions and procedures used in Study 4. Results We conducted the same series of ANOVAs as in Study 4 to test the effect of abuse history on participants' case judgments. Next, although the effect of abuse history on support for the full application of the registry was only marginally significant, it was in line with our theoretically driven hypotheses, and so we conducted analyses to explore possible mediators of that effect (see Figure 3). Because ANOVAs revealed no relationship between abuse history and attributions to deviant sexual arousal, according to Baron and Kenny (1986), this variable could possibly mediate the relationship between abuse history and support for the full application of the registry, and was therefore not considered for mediation analyses. Stable attributions emerged as a statistically significant predictor of support for the full application of the registry,  ϭ .62, t(64) ϭ 5.70, p Ͻ .001, as did uncontrollable attributions,  ϭ Ϫ.20, t(64) ϭ Ϫ2.13, p Ͻ .05, retributive goals,  ϭ .68, t(67) ϭ 7.58, p Ͻ .001, and utilitarian goals,  ϭ .72, t(66) ϭ 8.32, p Ͻ .001. Attributions to mental illness emerged as a marginally significant predictor of support for the full application of the registry,  ϭ .20, t(64) ϭ 1.82, p ϭ .07. Although the effect of uncontrollable attributions on support for the full application of the registry was significant, this effect was in the opposite direction as the effect of abuse history on support for the full application of the registry. That is, although participants were more supportive of the full application of the registry for the abused juvenile than the nonabused juvenile (i.e., a punitive judgment), the abused juvenile was also perceived as less able to control his behavior-a variable that predicts less support for the full application of the registry (i.e., a lenient judgment). Because uncontrollable attributions are lenient (prodefense) judgments, and the abused juvenile was rated as less able to control his behavior, this belief logically cannot explain why participants were more punitive toward the abused than nonabused juvenile (i.e., more supportive of the full application of the registry), and so this variable will no longer be considered. We were, however, able to test whether stable attributions, attributions to mental illness, retributive goals, and utilitarian goals mediated the effect of abuse history on support for the full application of the registry (see Figure 3). Supporting evidence of mediation, results based on 5,000 bootstrapped samples, revealed that the total effect of abuse attributions on registration support was marginally significant (TE ϭ .54, SE ϭ .29, t ϭ 1.87, p ϭ .07), but the direct effect was not significant (DE ϭ Ϫ.09,SE ϭ .19,t ϭ Ϫ.49,ns). Yet, only utilitarian goals emerged as a significant mediator, 95% CI [.02, .58]. Retributive goals, attributions to mental illness, and stable attributions did not emerge as significant mediators, 95% CIs [Ϫ.05-.00, .40 -.52] (see Figure 3). Finally, a comparison of the relative strength of the individual indirect effects against each other revealed no significant differences, 95% CIs [Ϫ.51-.13, .27-.53]. Thus, participants supported the full application of the registry more for the abused than the nonabused juvenile because they were more likely to believe he posed a danger to society. Discussion Although abuse history did not influence the registration support variable, participants were marginally more supportive of the full application of the registry for a sexually abused juvenile than a nonabused juvenile who had committed statutory rape. Also, an abused juvenile who committed statutory rape was perceived as more mentally ill, less able to control his behavior, and more likely to recidivate than a nonabused juvenile. Participants also endorsed marginally greater retributive and utilitarian goals for the abused than the nonabused juvenile. Further, mediation analyses revealed that utilitarian goals of punishment (i.e., the belief the juvenile was a danger to society) drove the effect of abuse history on support for the full application of the registry. Interestingly, participants were more supportive of registering an abused versus a nonabused juvenile who committed statutory rape, even though they believed the abused juvenile was less able to control his behavior-an attribution that both the present and past research (Weiner, 2006) shows predicts leniency in case judgments. The present research demonstrates an interesting instance in which fear of recidivism (i.e., utilitarian goals of punishment) overrides the leniency that would otherwise be produced by uncontrollable attributions, and instead results in severe case judgments. Thus, just as in Study 3, participants might be more likely to label a relatively less severe sex crime (i.e., statutory rape) as a true crime when the juvenile has a history of sexual abuse and, in turn, use his history of abuse as evidence that he is permanently damaged, a danger to society, and deserving of registration. This is in line with past work illustrating that participants sometimes use abuse history as an aggravating factor . It is noteworthy that abuse history predicted support for the full application of the registry, but not registration support. It is possible that the registration support variable triggers retributive goals of punishment because its wording refers to the severity of registration (i.e., "Public registration laws are |
too severe for juvenile sex offenders like David"). In contrast, the question assessing support for the full application of the registry does not require participants to consider the punitive severity of registration. Instead, participants are merely asked to recommend one of various registration options (i.e., no registration; registration, but without the juvenile's information posted online; etc.) without making a value judgment about those options. In support, the effect of abuse history on support for the full application of the registry was not mediated by retributive goals of punishment but instead utilitarian goals to protect society. General Discussion As expected, when asked about juvenile sex offenders generally, participants greatly overestimated the prevalence of a history of sexual abuse among juvenile sex offenders, just as they overestimate histories of sexual abuse for adult sex offenders . In line with attribution theory (e.g., Weiner, 2006), when asked in the abstract, the more participants attributed sex offending to past abuse, the less they sup- Figure 3. Mediators of the effect of abuse history on support for the full application of the registry for the statutory rape sex offense (Study 5). † p Ͻ .10, ء p Ͻ .05. ported policies that require juveniles to register as sex offenders. Further supporting attribution theory, this effect was significantly mediated by uncontrollable attributions and retributive goals of punishment. These results are in line with Stevenson and colleagues' (2010) research, which showed that uncontrollable attributions about a defendant's history of having been physically abused as a child predicted lenient sentence preferences (i.e., life over death). Yet when participants were asked to consider specific cases, attributions to abuse reduced support for juvenile registration policies only for severe sex crimes like rape, which, unsurprisingly, are the very types of crimes that participants naturally tend to envision when asked generally about sex crimes . For less severe juvenile sex crimes, however, the more participants attributed sex offending to past abuse, the more they supported registration. Finally, when a history of sexual abuse was experimentally manipulated, abuse history was consistently used as an aggravating factor in a less severe statutory rape case, consistent with what Najdowski et al. (2009) found for a juvenile who committed crimes against someone other than the perpetrator of abuse, and was ignored entirely in a severe forced rape case. Although the results of these studies might seem inconsistent, they are in line with existing theory and our hypotheses. That is, serious types of sexual crimes are considered prototypical sex crimes , and in turn, participants' use of abuse history mirrors how it is used when asked about sex crimes generally: Abuse history mitigates support for juvenile sex offender registration. Yet, for nonprototypical (but more common; U.S. Department of Justice, 2007) less serious sex crimes, a different trend emerges, in large part due to the malleability of the perceived seriousness of the sexual offense-malleability that does not exist for extremely serious types of sexual offenses. Specifically, less severe sex crimes (i.e., statutory rape) are more likely to be perceived as true crimes when the juvenile has a history of sexual abuse and, in turn, participants use a juvenile's sexual abuse history as evidence that he is permanently damaged, a danger to society, and deserving of registration. Public Policy Implications Throughout this manuscript, we have discussed the social psychological implications of our work in terms of attribution theory and decision making. Our results, however, also have a number of implications that inform child-related public policy and law ; for a review, see Bottoms, Najdowski, & Goodman, 2009). Most people inaccurately assume juvenile sex offenders have been abused. Moreover, normative and consensual adolescent sexual activity is particularly criminalized when people assume that the adolescent is engaging in sexual activity because of his own history of abuse. Such findings have implications with respect to the fairness of registration policies, particularly because most juvenile sex offenders have not been sexually abused (Ryan et al., 1996). To the extent that judges are allowed judicial discretion in applying registration policies to adolescents, the present research suggests that juvenile registration is likely to be applied capriciously and affect certain groups more than others. This research also has implications for sentencing. Sexual abuse history, presumed by the law to be a mitigating factor (e.g., Illinois' Juvenile Court Act, 1987), is at best frequently discounted, especially in severe cases, and at worst, even backfires in lenient cases, being used against juvenile sex offenders as an aggravating factor, as are other factors such as drug abuse, alcohol abuse, and child physical abuse (Barnett, Brodsky, & Price, 2007;Brodsky, Adams, & Tupling, 2007;Najdowski et al., 2009;Stevenson et al., 2010; for review, see Stevenson, 2009). This is especially noteworthy considering that less severe sex crimes constitute the majority of juvenile sex offenses (U.S. Department of Justice, 2007). This finding is likely to be of interest to trial attorneys who must attempt to anticipate the factors that jurors will consider aggravating versus mitigating. Although laws such as the Illinois Juvenile Court Act (1987) mandate that child abuse be considered a mitigating factor, evidence suggests that the opposite is happening for child physical abuse (Stevenson, 2009) and, in some cases, child sexual abuse (e.g., Najdowski et al., 2009). Yet, because the current research demonstrates that abuse attributions mitigate case judgments when participants consider juvenile sex offenses in the abstract, it is likely that legal decision makers and the general public assume that child abuse is being used as a mitigating factor. These assumptions undermine the effectiveness of such laws. Courts and policymakers should be encouraged to implement legal instructions and policies designed to encourage legal decision makers explicitly to be sensitive to a juvenile offender's history of abuse, to educate them about the actual consequences of being abused, and to admonish them against using a history of abuse against a juvenile offender. It may be prudent for legal decision makers to provide rehabilitative resources and mental health services to juvenile sex offenders who commit these less severe nonviolent offenses, particularly those with histories of child sexual abuse, instead of resorting to potentially harmful sex offender registration . Given that participants greatly overestimate the prevalence of a history of sexual abuse among juvenile sex offenders, and that this belief can lead to more severe treatment of juvenile sex offenders, another policy implication is to educate legal decision makers about actual prevalence rates of abuse histories among juvenile sex offenders. Although only a small minority of sexually abused individuals become sex offenders (Worling, 2001), due to welldocumented human reliance on heuristics in decision making (e.g., Kahneman & Tversky, 2000), these common errors in thinking and illusory correlations are likely to continue, particularly if not corrected. Policy-focused educators should take precautions when teaching this information and be careful to correct such mistakes in logic-mistakes that have the potential to result in discriminatory treatment of sexually abused juveniles. Limitations and Future Directions Abuse history influences the types of attributions laypeople made about a juvenile's sex offending and their goals for sentencing a juvenile, but these attributions and goals did not consistently explain the effects abuse had on laypeople's support for registering a juvenile as a sex offender. Perhaps this is explained by the fact that internal attributions to sexual deviance and mental illness could be perceived as either controllable or uncontrollable as well as either permanent or transitory. In fact, because of the potential for confounds among the dimensions of controllability, locus, and stability, Weiner (1985Weiner ( , 2006 has argued that attributions of controllability are most central to understanding people's beliefs about the causes of behavior. Even so, uncontrollable attributions significantly explained the effects of a juvenile's past history of abuse on public support for sex offender registration in only one of our studies. Future research might better test whether participants use abuse as a mitigating or aggravating factor by teasing these confounds apart; for example, by experimentally manipulating whether internal attributions for sexual deviance or mental illness are viewed as either stable or unstable and controllable or uncontrollable. Also, future research could provide a more complete test of Weiner's (2006) attribution theory by exploring whether affective reactions, such as sympathy and anger, mediate the effects of abuse attributions and abuse history on perceptions of juvenile sex offenses. Future studies should also explore how abuse attributions influence policymakers', juvenile justice officials', and other legal decision makers' perceptions of juvenile sex offenders. Our methods were realistic in several regards: the vignettes were modeled after real cases, and we employed both undergraduate and representative community member samples in an attempt to obtain generalizable results. A key methodological finding, aside from all our central findings related to our theories about reactions to juvenile offenders, is that there were no differences between these two types of samples. The fungibility of undergraduate and community jurors has long been debated in the field of psychology and law. In understanding reactions to juvenile offenders, our work stands in support of research with undergraduate subjects as a proxy for community members. Although the purpose of this research was to test factors that shape public support for social policy, future research should test the possibility that these results generalize to a trial context. Indeed, replication of this line of research in mock trial contexts, with more realism and ecological validity, including lengthier trial transcripts and jury deliberations, is prudent. For instance, participant samples were primarily White, and future research should include more diverse participant samples. In addition, participants were provided with minimal information explaining sex offender registration policy and the sexual crime vignettes were short and did not contain a great deal of case-related evidence. Even so, no psycho-legal study will fully replicate real events, nor is complete replication necessary to test basic psychological mechanisms underlying some decisions (e.g., Golding, Dunlap, & Hodell, 2009). Our work is a necessary first step in understanding how abuse attributions and abuse history influence public support for policies affecting juvenile sex offenders. Conclusion Examining how a juvenile sex offender's history of sexual abuse shapes support for registration policies across a series of five studies with various methodologies and case types certainly gets us closer to a fuller understanding of public attitudes toward particularly vulnerable and young offenders. The questions addressed by this research are critical given that registering juveniles is not only ineffective at reducing sex offenses, but also potentially negatively influences the lives of those registered in ways that could contribute to future recidivism (see, e.g., . Understanding biases against juvenile offenders who have already experienced maltreatment (i.e., sexual abuse) is one important step toward the development of future policy designed to combat discrimination against victimized and vulnerable young offenders. Immunosuppressant-Induced Oxidative Stress and Iron: A Paradigm Shift from Systemic to Intrahepatic Abnormalities Immunosuppressants are used clinically to lower rejection rates in transplant patients. Unfortunately, the adverse side effects of these immunosuppressants can be severe, which is one of the rationales that life expectancy of individuals after transplant still significantly falls short of that of the general population. The current experimental setup was designed to analyze the tacrolimus-induced hepatic iron overload in Wistar rats. Four experimental groups were orally given 1 ml of aqueous suspension of tacrolimus (12 mg/kg) through oral gavage, and rats were sacrificed after 6, 12, 24, and 48 h of tacrolimus dose. Hepatic hepcidin expression was found to be significantly augmented along with the upregulation of Tf and TfR1, Ferritin-L, Ferritin-H, TNF-α, and HO-1 gene expression at 6 and 12 h, and downregulation of Fpn-1, Hjv, and Heph at 6 h was detected. Significant downregulation of IL-6, IFN-α, IFN-β, and IFN-γ at all study time points was also observed. Serum iron level was decreased while serum hepcidin level was found to be significantly increased. Iron staining showed blue-stained hemosiderin granules within the hepatocytes, sinusoidal spaces, and portal areas at 12 and 24 h time points and remarkable fall of iron contents in the splenic red pulp. These results suggest that the use of tacrolimus leads to the onset of an intrahepatic acute-phase response-like reaction and causes iron overload in hepatic cells by altering the expression of key proteins involved in iron metabolism. Introduction Generally, transplantation is a lifesaving intervention for the patients suffering from organ failure at end stages and transplantation medication plot is one of the foremost complex and challenging area |
of a modern medical system [1]. The organ rejection is the major limitation factor in successful application of the technique, and that happens due to activated T-lymphocytes as a part of adaptive immune response. Patients after organ transplantation are forced to take lifelong immunosuppressive drugs to suppress the immunity and thus stabilize the transplant in the body of the patient [2]. Graft survival has improved significantly over the last few decades; nevertheless, late posttransplantation complications still present a growing challenge. All immunosuppressant used in transplant can be considered a high-risk medication. Tacrolimus is a pivotal immunosuppressive drug used clinically to lower the rate of immunological rejection after solid organ transplantation [3]. It is well known that its immunosuppressive possessions are dependent on calcineurin inhibition [4,5]. Due to the inhibition of calcineurin, tacrolimus modifies several biochemical processes, which can lead to undesirable side effects [6,7]. Anemia is common after transplantation, and immunosuppressants have long been involved in the pathogenesis of anemia after transplantation [8]. Iron status is a critical factor in patient-related outcomes in transplant medicine. Iron deficiency and/or iron overload have been supposed to be risk factors after organ transplantation [9]. The decrease in serum and the increase in hepatic iron uptake are the hallmark of acute-phase response (APR) [10]. According to an actual hypothesis, iron homeostasis is regulated by a large group of iron regulatory proteins including hepcidin (Hepc) which is a major acute-phase protein, ferroportin-1 (Fpn-1) which is a negative acutephase protein, hemojuvelin (Hjv), ferritin, transferrin (Tf), and transferrin receptors (TfR1, TfR2) [11]. Hepc, a central regulator of iron homeostasis, is a liver-secreted peptide that binds to the sole iron exporter, Fpn-1, and causes its internalization and degradation [12]. Through this mechanism, Hepc decreases the circulating iron by blocking iron absorption via duodenal enterocytes and macrophage iron release. Fpn-1 and a ferroxide that is hephaestin (Heph) play a collaborative role in iron transport from enterocytes. In the presence of Fpn-1 and Heph, the newly released ferrous iron oxidized to its ferric form, which allows it to bind to Tf [10]. Tf and transferrin receptors are major proteins which take part in the transport and cellular uptake of iron. Plasma iron is majorly bound with Tf, which is an abundant iron-binding protein. The majority of the cells fulfill their iron need by taking iron-bounded Tf from the plasma and extracellular fluids via a transferrin receptor 1-(TfR1-) mediated process [13]. Both monoferric and diferric Tf move towards endosomes, where low pH detaches iron from the receptor-ligand complex. Then, iron-free Tf is transferred back to the cell membrane which is further released into the plasma at neutral pH, and TfR1 becomes ready to enter the next cycle of iron uptake [14,15]. Because TfR1 is ubiquitously expressed, Tfmediated iron uptake is considered to occur in the majority of cell types [16]. Ferritin-H and Ferritin-L subunits are accountable for iron storage within the hepatic cells [17]. The two subunits are regulated differentially and independently of each other at the transcriptional and posttranslational levels [18]. Ferritin level remains the primary mean of clinically assessing iron overload; however, it is to be considered that the inflammatory response may be accompanied by elevated ferritin levels [19]. Heme oxygenase (HO) is a ubiquitously expressed enzyme responsible for the degradation of heme. The expression of intracellularly located HO-1 is induced by cellular stress, such as elevated levels of prooxidants by inflammatory stimuli. HO-1 is induced in vascular endothelial cells by the cytokine, tumor necrosis factor-α (TNF-α), and plays a significant part in mediating the proinflammatory effect of TNF-α [20,21]. To date, there is no published data reporting dysregulation of iron metabolism by use of tacrolimus in an animal model. This study was aimed at investigating the induction of changes in the expression of the key genes involved in iron metabolism generated by hepatotoxic potential of tacrolimus. Our results clarify hematologic effects of tacrolimus, indicating this immunosuppressant as a potential cause of impaired Hepc production and iron overload in hepatic cells after transplantation. Methods 2.1. Animals and Treatment. 45 adult male Wistar rats of twelve to fourteen weeks of age, weighing 250 ± 25 g, were used in this project. Prior to experimentation, the rats were housed 5 per cage and kept under controlled environmental conditions. Rats were given free access to standard rat laboratory diet and tap water. This study was performed in accordance with the guidelines for the care and experimentation protocol of laboratory animals approved by Local Ethical and Review Committee of the Department of Zoology, University of the Punjab, Lahore. Nine animals were used as the control and thirty-six as experimental (nine for each time point). Four experimental groups were orally given 1 ml of aqueous suspension of tacrolimus powder (12 mg/kg) through oral gavage. Normal drinking water was given to control rats, and animals were euthanized by an overdose of ether after 6, 12, 24, and 48 h of tacrolimus suspension administration. All the animals were anesthetized by using an equal ratio of ketamine plus pyrogen-free water intraperitoneally. Blood was collected through direct cardiac puncture for serum separation under anesthesia conditions. After euthanizing by an overdose of ether, liver lobes were removed and divided into two parts: the first part was snap frozen at -80°C for genomic analysis and the second part was fixed in 10% formalin for histochemical analysis. The spleen was also removed and fixed in 10% formalin for histochemical analysis. RNA Isolation. Snap-frozen liver samples were used for total RNA extraction by using a TRIzol method. RNA samples were quantified via a spectrophotometer (NanoDrop, ND-1000). Total RNA concentration was calculated by measuring the absorbance at A260. The ratio of A260/A280 is used to evaluate the purity of RNA. A ratio of 1.8-2.0 was accepted as pure. Quantitative Real-Time PCR. cDNA was generated via 1.5 μg of total RNA by using the Fermentas reverse transcription kit (cat#K1632) according to the manufacturer's instructions. Expressions of different genes (Hepc, Fpn-1, Hjv, Heph, Tf, Tfr1, Ferritin-L, Ferritin-H, HO-1, TNF-α, IL-6, IFN-α, IFN-β, and IFN-γ) were examined by using Maxima SYBR Green qPCR Master Mix. β-Actin was used for normalization (housekeeping gene). Gene-specific primer sequences are listed in Table 1. The assay of all the samples was done in triplicate. The curves of amplification were analyzed to measure the Ct value. Measurement of Serum Iron Levels. A colorimetric method is used in which ferric iron (Fe +3 ) is released from its carrier protein, transferrin, in an acid medium (pH 4.0) and simultaneously reduced to the ferrous form (Fe +3 ) by ascorbic acid. The ferrous iron is then bound to chromogen, a sensitive iron indicator, to form a blue-colored chromophore which absorbs maximally at 595 nm. 2.5. ELISA. ELISA, which is a solid-phase enzyme-amplified sensitivity immunoassay, was used for quantitative detection of serum Hepc level using the commercially available specific enzyme-linked immunosorbent assay kit (BioSource International). Both intra-assay and interassay variations were less than 15% and a sensitivity of 1.0 ng/ml for Hepc assay. All the serum samples were analyzed in triplicate. 2.6. Histochemical Analysis. Liver and spleen tissues were fixed in 10% formalin, dehydrated in different grades of ethyl alcohol in ascending order of their strengths (40%-100%), cleared in xylene, and embedded in a paraffin wax followed 2 Oxidative Medicine and Cellular Longevity by sectioning. Sections (5 μm thick) were stained with Prussian blue iron stain from Sigma-Aldrich. For staining, a standard protocol was followed with minor modifications as described by [22]. Briefly, slides having sections were deparaffinated and tissues were rehydrated with deionized water for about five minutes. Slides were placed in working iron stain solution for 15 minutes followed by three washes in deionized water. For counterstaining, slides were subsequently stained in nuclear fast red working solution for 10 minutes and rinsed in deionized water followed by dehydration through alcohol and tissue clearance by xylene. Statistical Analysis. Data were evaluated using Prism GraphPad 5 software (San Diego, CA). One-way analysis of variance (ANOVA) and Tukey's post hoc test were performed to identify any significant differences between the groups. P values less than 0.05 were considered significant. Changes in mRNA Expression of Iron Regulatory Proteins. The expression of different iron regulatory genes was analyzed at different time points to assess the disturbances in iron metabolism. An initial increase in Hepc expression was observed at 6 h (1:95 ± 0:2-fold) and 12 h time points (2:1 ± 0:05-fold) after administration of tacrolimus. After 12 h, Hepc expression starts to decline towards baseline level (Figure 1 Changes in mRNA Expression of Cytokines and Other Inflammatory Proteins. TNF-α was also analyzed to assess the acute hepatotoxic potential of tacrolimus. A rapid upregulation of TNF-α was observed at 6 h (3:77 ± 0:6-fold) and 12 h (3:2 ± 0:30-fold) time points as compared to the control. Intergroup comparison showed a significant downregulation in the expression of TNF-α at 48 h (1:38 ± 0:42-fold) as compared to 6 h (3:77 ± 0:6-fold) upregulation (Figure 4(a)). At the same time, however, a rapid and significant decrease in the expression of IL-6 expression was observed throughout the study (Figure 4(b)). Similarly, a quick and highly significant downregulation of IFN-α ( Figure 5(a)), IFN-β ( Figure 5(b)), and IFN-γ ( Figure 5(c)) gene expression was observed throughout the planed experimental time points. 3.5. Changes in the Serum Iron Levels. Serum iron level was found to be significantly decreased at 6 h (231:7 ± 30:02) time point (P < 0:05) as compared to the control group (337:8 ± 31:74) when analyzed by Tukey's post hoc test, while there was no statistically significant difference in the levels of serum iron between different time points (Figure 6(a)). Changes in Serum Hepcidin Levels. Serum Hepc concentration was measured via quantitative sandwich ELISA. A (Figure 6(b)). Prussian Blue Iron Staining of Liver and Spleen Tissues. No significant hemosiderin granules were found in hepatocytes, Kupffer cells, and sinusoidal spaces of hepatic sections (Figure 7(a)). After 12 and 24 h time points, blue-stained hemosiderin granules were observed within the hepatocytes, sinusoidal spaces, and portal areas. These clearly noticeable bluish granules were directed consideration towards the storage of iron in the liver (Figures 7(c) and 7(d)). A mild level of iron deposition was also observed at 48 h time point (Figure 7(e)). In contrast, splenic iron showed a tendency to decrease after 6, 12, and 24 h time points as compared to control sections (Figures 8(b)-8(d)). Iron staining revealed remarkable fall of iron contents in the splenic red pulp, which is rich in mononuclear cells, whereas the white pulp showed hardly any iron accumulation. Discussion This study was started to analyze the effect of tacrolimus on iron homeostasis. Tacrolimus works by binding to an immunophilin protein and inhibiting phosphatase activity of calcineurin in T-lymphocytes and lowers the risk of organ rejection [23]. Calcineurin inhibitors (CNIs) are a group of 7 Oxidative Medicine and Cellular Longevity drugs which are given to pre-and posttransplantation to decrease the risk of rejection. With the use of CNIs as immunosuppressive agents, the risk of rejection has been reduced, but still, adverse effects of lifelong immunosuppression are a major concern [24]. Oral administration of aqueous suspension of tacrolimus in rats induced significant variations in the gene expression of key proteins considered to be involved in iron regulation. In the present work, Hepc expression was found to be significantly upregulated at 6 and 12 h time points. As Hepc is an acute-phase reactant, its expression is raised in conditions of liver damage and iron overload. It is also upregulated in conditions considered to overwhelm Kupffer cell engulfment capacity. Increased hepatic and nonhepatic Hepc expression was also described in turpentine oil-induced APR in rats [15], and also, upregulation of Hepc expression was indicated in response to hepatic damage in vivo and in vitro [12]. Pigeon and his colleagues, in 2001, first time described the relationship between Hepc and iron metabolism [25]. A previous literature also linked the upregulation of Hepc expression and iron-deficiency anemia [26]. Hepc is therefore considered to play a role as a negative regulator of iron absorption, recycling, and release from stores [14]. Fpn-1 gene expression was downregulated in our study as demonstrated by the reduction of the specific RNA preceding upregulation of Hepc gene expression. This downregulation was parallel to the significant decline in serum iron levels. The signal for downregulation |
of Fpn-1 was possibly linked with TNF-α upregulation. Previously, Fpn-1 was found to be downregulated when bound with Hepc, as Hepc leads to internalization and degradation of this iron exporter protein [27]. Downregulation of Hjv and Heph expression in this study confirms previous studies [12,15,28] in different rat models of extrahepatic and intrahepatic APR that Hepc and Hjv-Heph gene expression together with Fpn-1 changes simultaneously and in an opposite direction. The same results occurred in rats after oral administration of tacrolimus; an early upregulation of Hepc gene expression associated with time-dependent downregulation of Fpn-1, Hjv, and Heph gene expression was observed. Early upregulation of Tf gene expression was observed in this study. Expression of TfR1 together with TfR2, accountable for iron uptake from diferric Tf through receptor-mediated endocytosis [15], was upregulated. Plasma iron deficiency was reported to have an effect on the stimulation of transcriptional activity of the hepatic Tf gene. A previous study conducted on patients with hepatic siderosis indicated that iron upholds stimulate Tf gene activity even when cellular iron contents are significantly increased [29]. A decline in the level of serum iron contents and successive raise in hepatocellular iron level is also a major characteristic of APR [11]. In our study, upregulation of both Ferritin-H and Ferritin-L chains was observed. This upregulation further confirms the hepatic iron storage. Hepatic ferritin gene expression is stimulated by iron overload which was previously observed in many in vitro and animal model studies [30]. Oxidative stress, cytokines, xenobiotics, and other mediators produced during inflammatory processes are mainly responsible for HO-1 induction [31]. In the current study, upregulation of HO-1 gene expression could be linked with the tacrolimus-induced "inflammatory" condition in the liver. High levels of HO-1 are repeatedly noticed in a variety of pathological states and generally in conditions containing oxidative stress at cellular level [32]. A rapid upregulation of intrahepatic TNF-α, one of the major acute-phase cytokines at early time points, was also observed in the current study confirming the inflammatory condition [33]. A quick and highly significant downregulation of IL-6, IFN-α, IFN-β, and IFN-γ was observed throughout the planned experimental time period. This downregulation may be one of the main immunosuppressive functions of tacrolimus acting directly in the transplanted organ. On the other hand, the immunosuppressant tacrolimus is a very powerful suppressor of T-lymphocyte activation, and at the same time, activated T-cells and NK cells are considered to be major contributors of IL-6 and interferons [34]. Our data of histochemical analysis revealed that in the conditions of acute iron overload, iron was rapidly deposited in hepatocytes. During toxic conditions, a diversion of iron transfer occurs; i.e., iron accumulates not only in a reticuloendothelial system but also in hepatocytes instead of circulation consequently reducing the availability of this essential element [35]. Conclusion From these findings, we can conclude that the use of tacrolimus may lead to the onset of intrahepatic APR-like reaction and causes iron overload in hepatic cells by altering the expression of key proteins involved in iron metabolism. This study established a facet to the concept that despite being essential on the one hand, this drug can also contribute to posttransplant iron deficiency and anemia due to the accumulation of iron in the liver. Clinical Perspectives (i) We investigated the effect of short-term early exposure of tacrolimus on the gene expression of main proteins involved in iron metabolism (ii) This study established a facet to the concept that despite being essential on one the hand, this drug can also cause damaging effects through the onset of an intrahepatic acute-phase response-like reaction (iii) These findings are beneficial and can be used as ready reference when prescribing this medicine for therapeutic purpose Data Availability The data used to support the findings of this study is available from the corresponding author upon request. Ethical Approval The study was performed in accordance with the guidelines for the care and experimentation protocols of laboratory animals approved by Local Ethical and Review Committee of Conflicts of Interest There is no conflict of interest regarding the publication of this paper. Perineuronal Net Receptor PTPσ Regulates Retention of Memories Perineuronal nets (PNNs) have an important physiological role in the retention of learning by restricting cognitive flexibility. Their deposition peaks after developmental periods of intensive learning, usually in late childhood, and they help in long-term preservation of newly acquired skills and information. Modulation of PNN function by various techniques enhances plasticity and regulates the retention of memories, which may be beneficial when memory persistence entails negative symptoms such as post-traumatic stress disorder (PTSD). In this study, we investigated the role of PTPσ [receptor-type tyrosine-protein phosphatase S, a phosphatase that is activated by binding of chondroitin sulfate proteoglycans (CSPGs) from PNNs] in retention of memories using Novel Object Recognition and Fear Conditioning models. We observed that mice haploinsufficient for PTPRS gene (PTPσ+/–), although having improved short-term object recognition memory, display impaired long-term memory in both Novel Object Recognition and Fear Conditioning paradigm, as compared to WT littermates. However, PTPσ+/– mice did not show any differences in behavioral tests that do not heavily rely on cognitive flexibility, such as Elevated Plus Maze, Open Field, Marble Burying, and Forced Swimming Test. Since PTPσ has been shown to interact with and dephosphorylate TRKB, we investigated activation of this receptor and its downstream pathways in limbic areas known to be associated with memory. We found that phosphorylation of TRKB and PLCγ are increased in the hippocampus, prefrontal cortex, and amygdaloid complex of PTPσ+/– mice, but other TRKB-mediated signaling pathways are not affected. Our data suggest that PTPσ downregulation promotes TRKB phosphorylation in different brain areas, improves short-term memory performance but disrupts long-term memory retention in the tested animal models. Inhibition of PTPσ or disruption of PNN-PTPσ-TRKB complex might be a potential target for disorders where negative modulation of the acquired memories can be beneficial. CSPGs have been reported to exert their inhibitory action on neuronal plasticity by binding to protein tyrosine phosphatase sigma (PTPσ), a transmembrane receptor (Shen et al., 2009;Coles et al., 2011). PTPσ is a multi-functional molecule playing a role in various processes in the nervous system, such as cell proliferation and adhesion, synapse organization, synaptic transmission, axonal regeneration, and hypothalamuspituitary axis functioning (Elchebly et al., 1999;Thompson et al., 2003;Takahashi et al., 2011;Horn et al., 2012;Ji et al., 2015;Han et al., 2018Han et al., , 2020Bomkamp et al., 2019). Importantly, PTPσ downregulation has been demonstrated to reduce CSPG deposition induced by glial scar formation following axonal injury (Luo et al., 2018;Tran et al., 2018). However, the interaction of PTPσ with CSPGs constituting specifically perineuronal nets has not been studied. We have recently found that the PNN-PTPσ complex exerts its inhibitory action on neuronal plasticity by restricting the signaling of neurotrophic receptor tyrosine kinase 2 (TRKB; Lesnikova et al., 2021). TRKB is a receptor for brain-derived neurotrophic factor (BDNF) and a well-known activator of plasticity in the brain (Minichiello et al., 1999;Castrén and Antila, 2017;Umemori et al., 2018). PTPσ has been found to interact with and dephosphorylate TRK receptors, including TRKB (Faux et al., 2007;Kurihara and Yamashita, 2012). We found that genetic deficiency of PTPσ increases phosphorylation of TRKB and promotes cortical plasticity at the network level (Lesnikova et al., 2021). We also showed that chABC-induced plasticity in the adult brain requires intact TRKB expression in PV+ interneurons, a neuronal class whose mode of function is particularly dependent on PNNs. There, we propose a model where, under normal conditions in the adult brain, perineuronal nets bind to PTPσ and promote dephosphorylation of TRKB and restriction of its activity, while reduction of interaction between PNNs and PTPσ or PTPσ and TRKB enhances the ability of BDNF to phosphorylate TRKB and promote plasticity (Lesnikova et al., 2021). Here, we set out to further investigate the effects of PTPσ downregulation on neuronal plasticity. In particular, our aim was to characterize the molecular profile of enhanced plasticity induced by PTPσ genetic deficiency and to reveal any changes in the behavioral phenotype of animals haploinsufficient for PTPRS gene. Animals Adult BALB/c mice heterozygous for PTPRS gene (PTPσ +/− ) and their wild-type (WT) littermates of both sexes were used for the experiments. PTPσ −/− mice is a hardly viable phenotype with severe growth deficits and a 2-3% survival rate (Elchebly et al., 1999;Wallace et al., 1999). Animals with such major developmental problems often develop compensatory mechanisms that may complicate phenotyping. Our previous study found that only partial genetic deficiency of PTPσ produces a robust phenotype of enhanced plasticity at molecular and network levels (Lesnikova et al., 2021). Therefore, we continued using PTPσ +/− mice in this study. The animals were grouphoused (2-5 animals per cage in type-2: 552 cm 2 floor area, Tecniplast, Italy) under standard laboratory conditions with a 12-h light/dark cycle and access to food and water ad libitum. Behavioral experiments were carried out during the light phase of the cycle. All the procedures involving animals were carried out with the approval of the Experimental Animal Ethical Committee of Southern Finland (ESAVI/38503/2019). Brain Sample Collection and Processing For immunohistochemical analysis, the mice were anesthetized with 300 mg/kg pentobarbital mixed with 50 mg/kg lidocaine. They were transcardially perfused with PBS (137 mM NaCl, 10 mM sodium phosphate, 2.7 mM KCl; pH 7.4) followed by cold 4% PFA in PBS. The brains were removed and post-fixed in 4% PFA in PBS at +4 • C overnight. On the following day, the brains were cryoprotected in 30% sucrose in phosphate buffer (PB; 0.1 M PB without sodium chloride, pH 7.4) and left for 2 days at +4 • C. After that, the brains were embedded into Tissue-Tek O.C.T. Compound (BioLab, #4583) and cut into 40 µm coronal sections using Cryostat (Leica Byosystems). The brain sections were stored in cryoprotectant solution (30% ethylene glycol, 25% glycerol in 0.05 M PB) at −20 • C until further processing. For the ELISA and Western blot analysis, the animals were euthanized by CO 2 , then the prefrontal cortex, hippocampus, and amygdaloid complex were dissected out of the fresh brain and immediately placed on dry ice. The samples were homogenized by sonication in NP lysis buffer (137 mM NaCl, 20 mM Tris, 1% NP-40, 10% glycerol, 48 mM NaF) containing a protease and phosphatase inhibitor mix (#P2714 and #P0044, Sigma Aldrich) and 2 mM Na 2 VO 3 . The homogenized samples were centrifuged for 15 min at 15,000× g, 4 • C. The supernatant was collected and stored at −80 • C until further use. Protein quantification was done by colorimetric Lowry method using DC Protein Assay Kit (Bio-Rad, #5000116) and the product of the colorimetric reaction read at 750 nm in a Varioskan Flash plate reader (Thermo Fisher Scientific). Immunohistochemical (IHC) Analysis For the Immunohistochemical (IHC) analysis, samples from 2 months old male and female mice were used. The samples were washed in PBST (137 mM NaCl, 10 mM sodium phosphate, 2.7 mM KCl, 0.1% Tween 20; pH 7.4) 2 × 5 min and blocked in the blocking buffer (3% BSA, 10% normal goat serum, and 0.04% sodium azide in PBST) for 30 min at room temperature. After that, the samples were incubated in the primary anti-PSD-95 and anti-synaptophysin antibodies mix (1:100 in the blocking buffer) at +4 • C for 48 h. After that, the slices were washed in PBST 2 × 5 min and incubated in secondary antibodies mix (goat anti-mouse Alexa Fluor 568 and goat anti-rabbit Alexa Fluor 647) at room temperature for 1 h. After the incubation, the slices were washed in PBST 3 × 10 min and stored in 0.1 PB during mounting on slides. The mounting was done with DAKO fluorescence mounting medium (Agilent, #S3023). Confocal Imaging and Image Analysis Brain slice imaging was performed using confocal microscope LSM 700 (Carl Zeiss) with 63× /1.46 M27 oil-immersed Plan Apochromat objective (Carl Zeiss, # 420780-9971-000) and 3.0 digital zoom-in. A Z-stack containing six consecutive images with a distance of 0.5 µm was obtained from each section. Colocalization analysis was performed with Zen Blue 2.1 software using Manders Overlap Coefficient (MOC; Manders et al., 1993). An average value over a Z-stack for each brain slice was evaluated, and then an average MOC value of four slices per animal was calculated for statistical analysis. Enzyme-Linked Immunosorbent Assay (ELISA) Samples from female mice 2-3 months |
old were used for this experiment. We assessed levels of TRKB phosphorylation (pTRKB) using a protocol previously described by Antila et al. (2014). A high-binding 96-well OptiPlate (Perkin Elmer) was coated with anti-TRKB antibody incubated in carbonate buffer (57.4 mM sodium bicarbonate and 42.6 mM sodium carbonate, pH 9.8) 1:500 at 4 • C overnight. On the next day, the antibody was removed, and the wells were blocked using a blocking buffer containing 3% bovine serum albumin (BSA; Sigma-Aldrich, #A9647) in PBST (137 mM NaCl; 10 mM sodium phosphate; 2.7 mM KCl; 0.1% Tween-20; pH 7.4) for 2 h. After that, homogenized and centrifuged brain lysates (80 µg of total protein) were transferred to the plate and incubated at 4 • C overnight. On day 3, the samples were removed, the plate was washed four times with PBST using a plate washer (Thermo Fisher Scientific Wellwash Versa), and anti-pTRKB antibody (1:1,000 in the blocking buffer) was incubated at 4 • C overnight. On the final day, the antibody was removed, the plate was washed four times with PBST, and incubated with horseradish peroxidase (HRP)-conjugated antibody (1:5,000 in the blocking buffer) for 1 h at room temperature. The antibody was removed, the plate was washed four times with PBST, and HRP ECL substrate (Thermo Fisher Scientific, #32209) was incubated in the plate for 3 min. Chemiluminescence was measured using 1 s integration time in a Varioskan Flash plate reader (Thermo Fisher Scientific). Western Blot Samples from male and female mice (2 months old) were used for this experiment. Forty microgram of total proteins from each sample was heated in 2X Laemmli buffer (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.02% bromophenol blue and 125 mM Tris HCl, pH 6.8) for 5 min at 95 • C and loaded to NuPAGE 4-12% Bis-Tris Protein polyacrylamide gels (Invitrogen, #NP0323BOX). After electrophoresis, the proteins were transferred to a polyvinylidene difluoride (PVDF) membrane, blocked in the blocking buffer for 1 h (3% BSA in Tris-PB: TBST, 20 mM Tris-HCl; 150 mM NaCl; 0.1% Tween-20; pH 7.6) and incubated with the primary antibody diluted 1:1,000 in the blocking buffer overnight at 4 • C. The membranes were subsequently incubated in HRP-conjugated secondary antibodies diluted in the blocking buffer (1:10,000) for 1 h at room temperature. The signal was detected using enhanced chemiluminescent (ECL) HRP substrate WesternBright Quantum (Advansta, #K-12042) in a CCD camera (G:Box Chemi, Syngene). The levels of phosphoproteins analyzed by Western blot were normalized by total levels of the corresponding proteins; the levels of total TRKB, PSD-93, and PSD-95 were normalized by B-actin. PSD-95 samples from PFC were not normalized due to low detection signal from the housekeeping protein. Novel Object Recognition Test Male and female mice (3-4 months old) were used for these experiments. NOR test was performed in a transparent arena (39 × 20 × 16 cm) where two identical objects (white plastic ping-pong balls glued to 50-ml Falcon tube caps) were located (adapted from Casarotto et al., 2021). The animals were allowed to explore the objects for 15 min on three consecutive days (training sessions). At the test session (4 h or 5 days after the last training session to assess short-term or long-term memory, respectively) one of the old objects was replaced by a new one (black rubber squash ball glued to 50-ml Falcon tube caps), and the animals were allowed to explore both objects for 5 min. The number of interactions with the objects was calculated, and the difference between the visits to the new object and the old object (fB-fA) was used to assess memory. The total number of visits (fA+fB) was used to assess total exploratory activity. Two independent cohorts of animals were used to assess short-term and long-term memory. Fear Conditioning Male mice (4-7 months old) were used for this experiment. This cohort of mice was older than the rest of the mice used in the other experiments. However, previous studies in the literature found no difference in the rodent performance of these age groups as compared to 2-3 months old animals in the cued fear conditioning paradigm (Stoehr and Wenk, 1995;Oler and Markus, 1998;Houston et al., 1999;Kaczorowski and Disterhoft, 2009). Mice were subjected to fear conditioning in a squared arena A (23 cm width, 35 cm height) with a metal grid on the floor and transparent acrylic glass walls, with continuous background white noise and 100 lux illumination. On day 1, the animals received five foot shocks (0.6 mA, 1 s) preceded by a 30-s sound cue each (latency to the first foot shock: 150 s, time between the last foot shock and the end of the trial: 30 s, inter-shock interval: 30-120 s, total session length: 8 min 45 s). On day 10, the mice were first placed in a new arena B (same size as arena A but with plastic gray floor and plastic black walls), and freezing in response to the sound cue was measured (cue retrieval). Two hours later, the mice were placed in the same context where fear conditioning took place (arena A), and freezing in response to the sound cue was measured (context + cue retrieval). Behavior was counted as freezing if the mouse was not moving for at least 3 s, and measurements were done automatically by TSE system software. Elevated Plus Maze Male mice (3 months old) were used for this experiment. The apparatus consisted of a central zone (5 × 5 cm), two open arms (30 × 5 cm), and two closed arms (30 × 5 cm) surrounded by transparent acrylic glass walls (15 cm height). The maze was elevated 40 cm above the floor. The illumination was set to ∼150 lux. The animal was placed in the center of the arena and allowed to explore the maze for 5 min. The animal activity was tracked automatically by the Noldus EthoVision XT 8 system. Open Field Test Male mice (3 months old) were used for this experiment. The test was carried out in a squared arena (30 cm wide) with transparent walls (20 cm) and white floor. The illumination was set at ∼100 lux. The mice were placed in the center of the arena and allowed to explore it freely for 5 min. The activity was tracked automatically by Noldus EthoVision XT 8 system. Marble Burying Test Male mice (3 months old) were used for this experiment. 12 glass marbles were evenly distributed on a fresh 5 cm-deep wood chip bedding in a rectangular plastic arena similar in size to the mouse home cage (39 × 20 × 16 cm). The mice were given 15 min to explore the marbles, and the number of buried marbles was counted. A marble was considered buried if at least 2/3 of its surface was covered with bedding chips (Njung'e and Handley, 1991). Forced Swimming Test Male mice (3 months old) were used for this experiment. The animals were placed in a 5l 19-cm ø glass cylinder with a 20-cm water column at room temperature (∼22 • C) for 6 min. Total time spent floating during the last 4 min (immobility time) was used for the analysis. Statistical Analysis The data were analyzed using Graph Pad Prism 6 software. Parametric tests were preferentially used when possible, non-parametric tests were used when the values were discrete or homoscedasticity was not observed. ROUT test was used to identify outliers (Motulsky and Brown, 2006). Detailed information on statistical tests and values is provided in Table 1. Differences between groups were considered statistically significant when p < 0.05. Data in the figures are presented as mean ± SEM. RESULTS We have recently demonstrated that PTPσ restricts TRKB signaling in vitro and in vivo through dephosphorylation, and we have shown that genetic PTPσ deficiency increases basal TRKB phosphorylation and activates network level-plasticity in the visual cortex (Lesnikova et al., 2021). However, it is unknown which intracellular signaling pathways mediate the effects of the increase in pTRKB induced by the lack of PTPσ. In order to investigate the molecular profile of changes triggered by PTPσ deficiency, we carried out a biochemical analysis of tissue from different brain areas extracted from PTPσ +/− mice and compared it with brain tissue from their wild-type littermates. First, we confirmed that the effect of PTPσ haploinsufficiency on TRKB phosphorylation is not brain region-specific. We checked pTRKB levels in the prefrontal cortex (PFC), hippocampus (HPC), and amygdala (AMG) of PTPσ +/− mice by ELISA, and observed around 50% increase in pTRKB as compared to WT littermates in all of the brain regions tested ( Figure 1A). To confirm that these changes in pTRKB are driven by increased phosphorylation and not by alterations in the TRKB expression, we tested levels of total TRKB protein in the PTPσ +/− mouse samples by Western blot and detected no changes in total TRKB expression ( Figure 1B). Next, we analyzed phosphorylation levels of phospholipase C gamma 1 (PLCγ1), protein kinase B (Akt), extracellular signal-regulated kinase 1 and 2 (Erk1 and Erk2), and ribosomal protein S6 kinase beta-1 (p70S6 kinase), which are known to be activated downstream of TRKB. We observed a significant increase in pPLCγ1 ( Figure 1C) but not in pAkt, pErk1, pErk2, or p-p70S6 kinase (Figures 1D-G correspondingly) in PFC, HPC, and AMG of PTPσ +/− mice. Finally, we checked levels of postsynaptic density proteins 93 and 95 (PSD-93 and PSD-95) which are known to be important for synaptic plasticity but did not find any difference in their expression (Figures 1H,I). Since PTPσ is also known to be involved in synapse organization, acting specifically on excitatory synapses (Takahashi et al., 2011;Takahashi and Craig, 2013;Li et al., 2015b;Han et al., 2018Han et al., , 2020, we assessed the number of excitatory synapses in PTPσ +/− mice and WT littermates by immunostaining pre-(synaptophysin) and post-synaptic (PSD-95) markers, in hippocampal slices. We evaluated the colocalization of the pre-and post-synaptic markers using MOC and did not find any difference between the genotypes (Supplementary Figure 1). Considering the important role of BDNF-TRKB for various brain functions, including learning and memory (Thoenen, 1995;Minichiello et al., 1999;Cunha et al., 2010), we set out to investigate the behavioral phenotype of PTPσ +/− mice. We started with the Novel Object Recognition test, a cognitive test that evaluates memory-related performance in rodents (Dere et al., 2007). When tested 4 h after the last training session, PTPσ +/− mice exhibited significantly more interest towards the new object as opposed to the old object, suggesting improved short-term memory (Figure 2A). This result was similar to the findings by Horn et al. (2012) who observed improved short-term recognition memory in full PTPσ knock-out mice (PTPσ −/− ). However, when tested 5 days after the last training session, PTPσ +/− mice demonstrated essentially no difference in exploration between the old and the new object, which indicates that they have significantly impaired long-term recognition memory as opposed to the WT, who remembered the old object and tended to visit the new one more often (Figure 2B). No difference in total exploratory activity was found between the genotypes in either of the tests. In order to understand if the impaired long-term memory observed in the PTPσ +/− mice was specific to recognition memory or if it was a more generalized memory impairment, we tested those mice also in the fear conditioning model using a protocol that involves both context-and cue-dependent memory components. In the fear conditioning experiment (Figure 2C), the fear-related memory was established by pairing foot shocks (unconditioned stimulus) with the context (transparent cage with metallic grid floor) and cue (tone). The conditioned response (freezing) was measured immediately after the foot shocks (acquisition) and again 10 days later (retrieval). WT and PTPσ +/− mice displayed similar levels of freezing right after the foot shocks, demonstrating comparable acquisition of fear memories in both genotypes. Ten days later, we tested memory retrieval triggered by the cue presented either in a novel context (black cage with a smooth floor) or in the same context where the foot shocks were previously applied (conditioned context, transparent cage with metallic grid floor). Statistical analysis indicates that there was no significant change in the levels of freezing when the acquisition was compared with either of the retrieval sessions, in both genotypes, suggesting that the fear memory did not spontaneously fade away with time. Interestingly, |
in WT but not in the PTPσ +/− mice, the fear response triggered by the cue in the retrieval session was potentiated by the context, since freezing was greatly increased in the conditioned context in comparison with the novel context in the WT group (indicated by the sharp sign in Figure 2C). On the other hand, PTPσ +/− mice responded similarly to the cue presented in the novel or the conditioned context. Finally, the freezing response triggered by the cue combined with conditioned context (cue + context) was significantly higher in the WT compared to the PTPσ +/− mice (indicated by the asterisk in Figure 2C), reinforcing the evidence that PTPσ deletion might attenuate the retrieval of certain types of longterm memories. Altogether, the behavioral data suggest that PTPσ may play a role in memory processes as its deficiency facilitates shortterm memory and deteriorates long-term memory retention in the behavior paradigms we tested. However, it is important to keep in mind that the Novel Recognition Memory and Fear conditioning behavioral data are not directly comparable due to the intrinsic characteristics of each model and other methodological differences caused by practical limitations in obtaining animal cohorts. One limitation of the current study was the variation in the sex and age of mice used in each behavioral model. However, all the animals tested belonged to the adult group (2-7 months old) and thus were no longer in the age of juvenile plasticity, which otherwise could have affected the performance. Whenever mice from both sexes were tested, no difference was found between the sex groups. Moreover, the data we obtained from different groups of animals tested were not contradictory but rather complementary and harmonic. Nevertheless, we kindly ask the reader to keep in mind this limitation of the study. Finally, we ran a behavior battery to test whether PTPσ +/− mice have any behavioral abnormalities other than those related to learning and memory (Figure 3). The tests were separated by at least 24 h and carried out in the following order: marble burying, elevated plus maze, open field, and forced swimming test. Interestingly, PTPσ +/− mice displayed no abnormalities in any of these tests, indicating no difference in the levels of anxiety, total exploratory activity, and locomotion as compared to the WT. DISCUSSION We have previously observed that the plasticity-promoting effects of PNN removal are dependent on TRKB signaling in PV interneurons and that PTPσ acts as an agent mediating the opposing effects that perineuronal nets and TRKB have on plasticity (Lesnikova et al., 2021). We demonstrated that PNN-PTPσ-TRKB interaction in parvalbumin interneurons plays a particularly important role, as the chondroitinase ABC effect on network plasticity is abolished in mice lacking full-length TRKB in PV+ cells (PV-TRKB +/− mice; Lesnikova et al., 2021). Therefore, it is plausible that PV+ interneurons may contribute to the plastic phenotype of PTPσ mice as they are the major class of neurons expressing PNNs, and are known to be strongly affected by PNN modulation. PV+ cells play a crucial role in many cognitive processes, including learning and memory (Korotkova et al., 2010;Kim et al., 2016), and manipulation of PV+ neurons modulates plasticity states of the neuronal networks (Donato et al., 2013;Winkel et al., 2021). The firing of the PV+ interneurons mediates both memory consolidation (Ognjanovski et al., 2017) and extinction (Trouche et al., 2013;Davis et al., 2017), and optogenetic manipulation of PV+ neurons was sufficient to restore memory-related deficits induced by PNN degradation (Shi et al., 2019). We have shown that optical activation of TRKB in PV+ interneurons is alone sufficient to orchestrate and coordinate large brain networks, rendering them into a state of juvenile-like plasticity . TRKB is a well-characterized positive modulator of plasticity in the brain, essential for learning memory, and other cognitive processes (Yamada and Nabeshima, 2003;Minichiello, 2009). Learning events have been demonstrated to prompt BDNF expression and TRKB phosphorylation (Hall et al., 2000;Gooney et al., 2002), while BDNF mutations in mice and humans are known to induce learning deficits (Linnarsson et al., 1997;Dincheva et al., 2012). TRKB phosphorylation leads to activation of three major downstream signaling pathways: Sch adaptor protein recognizes phosphorylation of tyrosine 515 and activates PI3K/Akt and Ras/MEK/Erk pathways that regulate neuronal survival and neuronal differentiation (Atwal et al., 2000;Minichiello, 2009). PLCγ1 recognizes phosphorylated tyrosine 816 and, once phosphorylated, induces signaling through calmodulin kinase-2 and CREB, thereby modulating neuronal connectivity and plasticity (Patapoutian and Reichardt, 2001;Minichiello, 2009). Specificity of the downstream pathway activation is mediated through different docking partners, and it's been demonstrated that mutation of PLCγ1 docking site critically affects hippocampal long-term potentiation (LTP), plasticity, and learning (Minichiello et al., 2002;Gruart et al., 2007). Surprisingly, a similar mutation of the Shc recognition site, which mediates Akt and Erk activation, produces only minimal effects on BDNF signaling in vivo (Minichiello et al., 1998). Given that PTPσ +/− mice demonstrate an increase in PLCγ1 activation, their phenotype of facilitated plasticity and learning is not entirely surprising. However, the reason for the specificity of activation for this particular pathway remains to be further investigated. TRKB overexpression in a transgenic mouse line (TRKB.TK+) has yielded similar results with positive modulation of PLCγ1 but not PI3K/Akt or Erk pathways (Koponen et al., 2004). These TRKB.TK+ mice demonstrated facilitated learning (tested in Morris water maze) similar to PTPσ +/− mice. However, TRKB.TK+ mice also showed improved long-term memory in both Morris water maze and fear conditioning paradigms (Koponen et al., 2004), as opposed to PTPσ +/− mice having impaired long-term fear conditioning and object recognition memory. However, direct comparison of these observations FIGURE 2 | PTPσ +/− mice demonstrate improved short-term but impaired long-term memory. PTPσ +/− mice have (A) improved short-term memory and (B) impaired long-term memory and no changes in the total exploratory activity in the Novel Object Recognition test. (C) The fear response triggered by the cue in the retrieval session was potentiated by the context in WT but not in the PTPσ +/− mice. Data were analyzed by (A,B) Mann-Whitney test, and (C) two-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001. In (C): # p < 0.05 (vs. WT cue), *p < 0.05 (vs. WT context+cue). is difficult due to the timeline differences between the tests and because TRKB.TK+ mice overexpress TRKB in pyramidal cells and not in PV neurons. TRKB.TK+ were tested 48 h after training at the latest, when the memory traces were relatively fresh, while PTPσ +/− mouse memory was assessed 5-10 days after the initial learning. Moreover, even though BDNF-TRKB signaling is known to be critical for both short-term and long-term memory function (Bekinschtein et al., 2014), excessive BDNF-TRKB activation can also render previously established long-term memories labile and promote their erasure. For example, direct BDNF infusion into the infralimbic prefrontal cortex facilitates extinction of fear and drug-induced conditioned place preference memories (Peters et al., 2010;Otis et al., 2014;Kataoka et al., 2019), with similar effects achieved by TRKB facilitation by chronic antidepressant treatment (Karpova et al., 2011). Even though time and regionspecific mechanisms of BDNF-TRKB's role in memory events remain to be fully clarified, it is plausible to assume that TRKB activation has to be time-precise and transient in order to lead to robust memory acquisition. Since PTPσ +/− mice have chronically increased TRKB activation due to reduced dephosphorylation from PTPσ, their neuronal networks seem to acquire a state of hyperplasticity, or tonic plasticity (as opposed to the phasic plasticity in the normal brain), which allows for the enhanced acquisition of memories but not for their retention. It is interesting that a similar dissociation between shortand long-term memories can be experimentally induced by PNN manipulation. PNN downregulation by chABC digestion or genetic knockdown of their components has been shown to improve object recognition memory for a period up to 48 h (Romberg et al., 2013;Rowlands et al., 2018). However, perineuronal nets are also indispensable for long-term memory retention, as PNN degradation has been demonstrated to impair the persistence of memories and promote their erasure in different brain areas such as the prefrontal cortex (Hylin et al., 2013;Slaker et al., 2015), hippocampus (Hylin et al., 2013;Riga et al., 2017;Shi et al., 2019), and amygdala (Gogolla et al., 2009;Xue et al., 2014;Pignataro et al., 2017). Since PTPσ +/− mice have a lower number of PNN receptors available for transduction of their signals, the PNN network consolidation function in their brain is likely to be compromised, which may improve shortterm but impair long-term memory performance. PTPσ is a complex molecule attributed to a number of different functions. Apart from being a phosphatase and a receptor for PNNs, it is also known to be a synaptic adhesion molecule, playing an important role in excitatory synapse assembly. It binds a number of partners in both cis-and trans-synaptic manner, including SLIT and NTRK-like proteins (Slitrks; Um et al., 2014), synaptic adhesion-like molecule 3 (SALM3; Li et al., 2015b), leucine-rich repeat transmembrane protein 4 (LRRTM4; Ji et al., 2015), liprin-α (Bomkamp et al., 2019) and tropomyosin receptor kinase C (TRKC; Takahashi et al., 2011;Coles et al., 2014). These interactions have been demonstrated to be critical for normal excitatory synaptic formation. According to the model proposed in the literature, PTPσ drives excitatory synapse formation through a combination of trans-synaptic interactions with partners such as TRKC (but not TRKB) and Slitrks, and intracellular signaling cascades when PTPσ intracellular domains interact in cis with adaptor proteins (such as liprin-α) and direct substrates, such as N-cadherin or TRKB (Coles et al., 2011;Han et al., 2018;Bomkamp et al., 2019). Global PTPσ knockout and conditional deletion of PTPσ impairs excitatory synapse transmission, leading to abnormalities in synaptic structure (Horn et al., 2012;Han et al., 2020) and reduced number of excitatory synapses FIGURE 3 | PTPσ +/− mice exhibit normal behavior in tests that do not involve cognitive flexibility. PTPσ +/− mice display no behavioral changes in (A) elevated plus maze, (B) marble burying, (C) open field, and (D) forced swimming tests as compared to their wild-type littermates. Data were analyzed by t-test (A total time, C,D) or by Mann-Whitney test (A, # entries for Open and Closed Arms, and B). (Han et al., 2018(Han et al., , 2020. Curiously, in the present study, no difference in the number of excitatory synapses was found when comparing WT and PTPσ+/-mouse brain. That discrepancy might be due to methodological differences. For example, in the study by Han et al. (2018) and Han et al. (2020), PTPσ role on excitatory synapse development was investigated in vitro. In Han et al. (2020), PTPσ conditional KO was used, thus it is likely that the location and developmental stage in which PTPσ expression was disrupted, as well as the degree of the downregulation, were different from the conditions in our study. PTPσ deficiency also increases frequency but reduces the efficiency of excitatory postsynaptic currents (Horn et al., 2012;Han et al., 2020) and impairs LTP (Horn et al., 2012). LTP deficits were also observed when PTPσ knockdown was restricted to excitatory cortical and hippocampal neurons (Kim et al., 2020). Similarly, overexpression of TRKB in pyramidal neurons, which increases TRKB phosphorylation and signaling through PLCγ1, also impairs LTP (Koponen et al., 2004). Interestingly, Kim et al. (2020) showed that presynaptic PTPσ deficiency selectively impairs NMDA-dependent postsynaptic currents, and it happens through a mechanism independent of PTPσ trans-synaptic adhesion, suggesting further involvement of PTPσ cytoplasmic phosphatase domains in this process. Even though the direct relationship between LTP and memory remains a subject to debate (Stevens, 1998;Nicoll, 2017), NMDA-dependent LTP is known to be critical for normal memory performance, and disturbances in this pathway impair memory function (Nakazawa et al., 2004;Li and Tsien, 2009;Morris, 2013;Nabavi et al., 2014). Since PTPσ plays a substantial role in excitatory synaptic transmission and normal LTP, its partial deletion from PTPσ +/− mouse brain may cause deficiencies in normal synapse function and stabilization, leading to an inability of the synapses to efficiently support long-term memory maintenance. Evanescence of long-term memories may be a disadvantage; however, it may also be beneficial under certain conditions when memories carry over a trauma such as in post-traumatic stress disorder (PTSD). Labilization of memories has been proposed to be a potential therapeutic tool for such disorders (Kindt et al., 2009), and treatment strategies targeting both PNNs (Gogolla et al., 2009;Banerjee et al., 2017;Pignataro et al., 2017) and BDNF-TRKB |
system (Karpova et al., 2011;Andero and Ressler, 2012;Kataoka et al., 2019) were suggested to carry translational promise. Now that PTPσ has been established as a missing link in the PNN-PTPσ-TRKB axis in PV interneurons, its further investigation as a potential target for PTSD treatment is promising. Small molecule compounds inhibiting PTPs and specifically PTPσ have been discovered (Martin et al., 2012(Martin et al., , 2014Lazo et al., 2018;Zhang et al., 2019). Moreover, intracellular sigma peptides (ISP) that bind to PTPσ intracellular domain and inhibit its phosphatase activity have recently been developed and successfully tested in the rodent models of spinal cord injury (Li et al., 2015a) and multiple sclerosis (Luo et al., 2018;Tran et al., 2018). ISPs are currently undergoing an FDA approval procedure and are being prepared for the first clinical trials, which bears promise for their future use in patients. However, further development and application of PTPσ-targeting treatments in humans must be carried out with caution. Long-term memory loss may come up as one potential side effect of ISP or small molecule treatment. Moreover, PTPσ is widely expressed in different cell types in the central nervous system and beyond and regulates multiple processes, including cell adhesion, hormone immunoreactive cell functioning, and hematopoietic stem cell proliferation and migration (Elchebly et al., 1999;Quarmyne et al., 2015;Zhang et al., 2019). Therefore, modulation of PTPσ system at the systemic level may have complex and non-direct consequences, including untoward side effects such as hormonal or hematopoietic cell dysfunction, and further research is required to ensure safety of such interventions. In conclusion, our findings contribute to the emerging recognition of the importance of perineuronal nets and their downstream targets in neuropsychological processes in the brain and shed light on the molecular underpinnings of complex systemic events such as memory and learning. Future studies will be needed in the field to resolve the remaining questions and improve our understanding of the role of PNN-PTPσ-TRKB complex in both healthy and diseased brains. DATA AVAILABILITY STATEMENT The dataset presented in this study can be found at Figshare, DOI: 10.6084/m9.figshare.c.5316767. ETHICS STATEMENT The animal study was reviewed and approved by Experimental Animal Ethical Committee of Southern Finland (ESAVI/38503/2019). AUTHOR CONTRIBUTIONS PC, CB, and EC designed the study. AL, PC, RM, SF, and CB performed the experiments. AL, PC, and CB analyzed the data. AL wrote the manuscript draft. AL, PC, RM, SF, CB, and EC revised the manuscript. All authors contributed to the article and approved the submitted version. FUNDING This work was supported by Doctoral Program in Integrative Life Science, Jalmari ja Rauha Ahokkaan Säätiö grant, Centre for International Mobility (CIMO) Grant TM-16-10112, by grants from European Research Council (#322742), EU Joint Programme-Neurodegenerative Disease Research (JPND) CircProt (#301225 and #643417), Sigrid Jusélius Foundation, Jane and Aatos Erkko Foundation, and the Academy of Finland (#294710 and #307416). None of the funders had a role in the data acquisition, analysis or manuscript preparation. Situation analysis and an insight into assessment of pandemic COVID-19 The world is seeing a catastrophic pandemic of SARSCoV2 or of the disease COVID-19, in first quarter of 21st century with the emergence of novel corona virus. After starting in Wuhan city of China in Dec’19 it has spread over 183 countries so far, with varying degree of severity and fatalities. Nearly 1.2 million of world population have been confirmed as cases of COVID-19 and above 66 thousand deaths were reported by April 4, 2020. The intensity of pandemic varies from country to country and the worst affected ones are Italy, Spain and France regarding the fatality ratio. It is learnt that 40% of total global cases and 79.5% of total global deaths due to COVID19 are reported in European region. Regional statistics of World health organization depicts that Eastern Mediterranean region (EMRO) stands fourth in the rank of prevalence of confirmed cases of COVID-19 after Europe, Americas and Western pacific, with a total number of 66 thousand cases and 3592 deaths. Among EMRO countries, Iran contributes the highest proportion 88% of cases as compared to that of 3.7% cases recognized in the KSA. Correspondingly, 98% of deaths due to COVID-19 in EMRO region were documented in Iran. The Case fatality rate (CFR) would be a misleading indicator without knowing the complete natural course of the disease and the number of total cases due to limited diagnostic and research facilities at the moment. Nevertheless, case fatality rate in COVID-19 documented to be 3.4% as mean (in age >80 as high as 14.8%), as compared to 10% of SARS-CoV1 and 35% of MERS-CoV. In current scenario, nature of the virus and its ability to affect populations, is still unclear. But we should not forget the example of HIV/AIDS, Spanish flu and Hong Kong flu pandemics, where resurgence, mutation of virus, unusual trend, deceptive figures of pandemic and certain misconceptions further deteriorated the scenario and hampered with peoples' response to control strategies. Likely clinical diagnosis of COVID-19 is based on clinical symptoms ranging from high fever, dry cough, shortness of breath to acute respiratory distress syndrome. Few asymptomatic cases were also identified in family clusters. It was evaluated that 81% of the cases were mild, 14% required oxygen therapy while 5% were critical with multiple organ failure and septic shock. 6 For its laboratory diagnosis, CDC has developed a new laboratory test kit, called as "CDC 2019-nCoV Real-Time Reverse Transcriptase (RT)-PCR Diagnostic Panel." It is intended for use with upper and lower respiratory specimens collected from persons suspected of COVID-19. This test is said to be 70% sensitive. Till date no specific pharmacological therapy has been identified. Patients have been treated with symptomatic therapy 6 of Oxygen, antiviral preparations, while hydroxychloroquine also shows some promising results lately. In an epidemiologist's perspective, definitely two aspects are to be investigated to characterize the pandemic; one is transmission rate and the other is clinical severity. Transmission can be studied by calculating basic reproduction number R 0 , rate of infection in household, schools or workplace, travel history of suspected cases, and outpatient reporting of cases. If R 0 is calculated less than 1, the pandemic is unlikely to occur, if 1 less likely and if more than 1 then a pandemic is certain. 7 The COVID-19 has R 0 of 1.4e 6.5, that is higher than of SARS. 4 The other indicator besides transmission rate, is severity of the pandemic, that can be studied by ratio of cases to hospitalization, ratio of deaths to hospitalization and ratio of Intensive care Unit admissions to total admissions. 8 It is imperative to identify pandemic severity index to tackle the situation accordingly. Pandemic severity index should be assessed in the early phase of the outbreak by taking into account transmissibility, seriousness of clinical course and impact of pandemic on health care and societies. 9 The pandemic severity Index is categorized as Depending on COVID-19 overall mortality ratio it can be classified as having category 2 pandemic severity index. In the absence of vaccines and any known treatment against COVID-19, the mainstay of the control strategies for communities at large, is non-pharmacological measurements namely 'suppression' and 'mitigation' strategies. 10 Suppression is aimed at reversing pandemic growth to low levels for indefinite time, whereas mitigation measures to flatten the pandemic curve or to slow down its progression. The public health actions taken to prevent the transmission of virus include social distancing of the entire population, home isolation of mild cases, household quarantine of their family members, travel restrictions, school closures, working from home and partial or complete lockdown. At individual level, wearing of mask, frequent hand washing and sneezing and coughing etiquette are encouraged. Though standard guiding principles have been laid down by international health agencies but countries taking steps according to their own feasibility and requirements. Besides these community measures, availability of skilled health work force, enough diagnostic kits, medical and protective supplies and preparedness of health systems would play an important role in containment of pandemic. We drew sufficient evidence that despite technological advancements and public health awareness, the average basic reproduction number R 0 in COVID-19 pandemics is evidently increased up to 3.3 as compared to 2 of early 20th century pandemics. Moreover, the fatality ratio reported being 3.4% in COVID-19, 0.03% in 2009 H1N1 flu, as compared to >2.5 in 1918 Spanish flu. 11 Whereas, pandemic severity index was 3 and 4 in last century pandemics as compared to 2 in this millennium. This disparity in fatality and pandemic severity index may be due to several factors such as higher virulence of virus and availability of better preventive or therapeutic health care services etc. The path to assess new infections is to be explored further under the guidance of global frameworks 9 and, there is a dire need to conduct research through syndromic surveillance and proper case control studies to find out associated risk factors and fulminant or less fulminant outcomes. Equally important is integration of data sources and data types to identify severity pyramid in order to be prepared for the future. Because the question at present is when and which next pandemic confronts us rather than will it happen altogether or not. At present, overestimation of the pandemic can not be ruled out unless evidence-based data is gathered and robust analysis is performed accordingly. We may conclude that though our community and technical efforts have been improved to tackle the emergent infections but the viruses also getting adversely smarter in its virulence and causing higher severity in terms of fatality ratio and reproduction number. Time has come to win the battle with a holistic armamentarium against these deadly pandemics by bringing a balance between economic stability and health related timely disclosures. We got to be ready to address all components of health, including physical, social, mental, and spiritual wellbeing and try to maintain harmony in life at its best. Source of funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Time to Conduct Community-Oriented Researches in Geriatrics Geriatric medicine is a specialty that focuses on medical issues among older adults with low physical function. We are investigating changes in humans with aging and agerelated pathologic process and are identifying patterns and rules that are different from those of young individuals. This involves not only biological factors but also various social determinant factors. For example, increased body weight among older adults could cause degenerative changes in lower articular cartilages. Although the diagnosis is as simple as arthritis, if it is combined with social frailty (e.g., lack of social support), it could deteriorate the function of the lower extremities and result in an individual being homebound. It is difficult for individuals who are homebound to use medical services for treating arthritis and/or other health problems all by themselves. As a result, the vicious cycle of homebound state and frailty will aggregate the health condition of older adults: decreased physical function → homebound state → unmet healthcare needs → decreased physical function →.... Thus, if we do not figure out the whole reasons of homebound state, the physical function of individuals who are homebound may not be completely restored even with the treatment of arthritis. From a gerontological point of view, homebound state is significantly associated with the concept of Aging in Place (AIP). AIP is defined as the ability to live in one’s own home and community safely, independently, and comfortably, regardless of age, income, or ability level. Since 1968, the establishment of the Korean Geriatric Society in Korea has been making remarkable progress over 50 years. However, only few studies in which were comprehensively reviewed in the context of homebound state or AIP have been conducted. Although the novel concept of frailty has been actively investigated for the last 15 years, it has still been described in terms of physical frailty or sarcopenia on the basis of biomedical perspective. However, ironically, community-dwelling older adults seldom use the term frailty to describe themselves or their conditions. According to qualitative studies on patient-centered perspective, being at home is more than occupying a physically familiar space; i.e., it is an anchorage to prior frequently habituated places. Therefore, we must provide careful consideration in deciding what place is more appropriate in diagnosing and treating older adults. Particularly, in the case of frail older |
adults, unnecessary admission to an acute care unit (i.e., hospitalization) may remarkably aggregate health conditions due to immobility syndrome. In some cases, disease may be cured. However, physical function might not be restored. Thus, the organization of healthcare is one of the outmost important issues in the field of geriatric medicine. Will homebound state, AIP, or organization of care be the important issues of geriatric medicine in Korea? I think they will be soon. In Korea, The Plan for Community Care has been introduced in June 2018, and several ambitious projects have been initiated by the Ministry of Health and Welfare. The Plan for Community Care is a novel system in which residents who need care can continue to lead a life in the community, such as home or group homes, and receive sufficient health and welfare services. Among the topics for healthcare action, there are noteworthy plans (1) to strengthen the community-based healthcare system, (2) to support settlements of individuals who need care, and (3) to encourage the rational use of hospitals and long-term care facilities. More specifically, pilot projects, such as (1) the homebased hospice pilot project (until August 2018), (2) pilot project of healthcare physician for the disabled (until April 2019), and (3) house call project for the severely ill pediatric patients (from September 2018), are being planned or initiated. These pilot projects are expected to be disseminated to community-dwelling older adults, particularly those who are in homebound state. Then, physician’s home visit will be more frequent than before. What issues should be pursued in the policy environment of the Plan for Community Care? (1) Social determinants of health in microlevels, such as self-efficacy, social network, and social engagement (2) Social determinants of disability in meso-levels, such as neighborhood characteristics (3) Organization of healthcare, such as transitional care, home visits, assisted-living facilities, group or foster homes, and continuing care retirement community Regarding the issues about the organization of care, the systems of healthcare in Korea may not be optimal for the treatment of chronic illness among community-dwelling older adults. Several models of acute care system are available in Korea. However, the care systems for subacute and long-term care for older adults are limited. Recently, Korea is more likely to concentrate on nursing home and long-term care hospitals for impaired older adults rather than a continuum of sheltered housing environments or community-based care. However, a contemporary discussion of long-term care is more likely to emphasize alternatives to institutionalization and homeand community- Geriatric medicine is a specialty that focuses on medical issues among older adults with low physical function. We are investigating changes in humans with aging and agerelated pathologic process and are identifying patterns and rules that are different from those of young individuals. This involves not only biological factors but also various social determinant factors. For example, increased body weight among older adults could cause degenerative changes in lower articular cartilages. Although the diagnosis is as simple as arthritis, if it is combined with social frailty (e.g., lack of social support), it could deteriorate the function of the lower extremities and result in an individual being homebound. It is difficult for individuals who are homebound to use medical services for treating arthritis and/or other health problems all by themselves. As a result, the vicious cycle of homebound state and frailty will aggregate the health condition of older adults: decreased physical function → homebound state → unmet healthcare needs → decreased physical function →…. Thus, if we do not figure out the whole reasons of homebound state, the physical function of individuals who are homebound may not be completely restored even with the treatment of arthritis. From a gerontological point of view, homebound state is significantly associated with the concept of Aging in Place (AIP). AIP is defined as the ability to live in one's own home and community safely, independently, and comfortably, regardless of age, income, or ability level. Since 1968, the establishment of the Korean Geriatric Society in Korea has been making remarkable progress over 50 years. However, only few studies in which were comprehensively reviewed in the context of homebound state or AIP have been conducted. Although the novel concept of frailty has been actively investigated for the last 15 years, it has still been described in terms of physical frailty or sarcopenia on the basis of biomedical perspective. However, ironically, community-dwelling older adults seldom use the term frailty to describe themselves or their conditions. 1,2) According to qualitative studies on patient-centered perspective, being at home is more than occupying a physically familiar space; i.e., it is an anchorage to prior frequently habituated places. 2) Therefore, we must provide careful consideration in deciding what place is more appropriate in diagnosing and treating older adults. Particularly, in the case of frail older adults, unnecessary admission to an acute care unit (i.e., hospitalization) may remarkably aggregate health conditions due to immobility syndrome. In some cases, disease may be cured. However, physical function might not be restored. Thus, the organization of healthcare is one of the outmost important issues in the field of geriatric medicine. Will homebound state, AIP, or organization of care be the important issues of geriatric medicine in Korea? I think they will be soon. In Korea, The Plan for Community Care has been introduced in June 2018, and several ambitious projects have been initiated by the Ministry of Health and Welfare. The Plan for Community Care is a novel system in which residents who need care can continue to lead a life in the community, such as home or group homes, and receive sufficient health and welfare services. Among the topics for healthcare action, there are noteworthy plans (1) to strengthen the community-based healthcare system, (2) to support settlements of individuals who need care, and (3) to encourage the rational use of hospitals and long-term care facilities. More specifically, pilot projects, such as (1) the homebased hospice pilot project (until August 2018), (2) pilot project of healthcare physician for the disabled (until April 2019), and (3) house call project for the severely ill pediatric patients (from September 2018), are being planned or initiated. These pilot projects are expected to be disseminated to community-dwelling older adults, particularly those who are in homebound state. Then, physician's home visit will be more frequent than before. What issues should be pursued in the policy environment of the Plan for Community Care? (1) Social determinants of health in microlevels, such as self-efficacy, social network, and social engagement (2) Social determinants of disability in meso-levels, such as neighborhood characteristics (3) Organization of healthcare, such as transitional care, home visits, assisted-living facilities, group or foster homes, and continuing care retirement community Regarding the issues about the organization of care, the systems of healthcare in Korea may not be optimal for the treatment of chronic illness among community-dwelling older adults. Several models of acute care system are available in Korea. However, the care systems for subacute and long-term care for older adults are limited. Recently, Korea is more likely to concentrate on nursing home and long-term care hospitals for impaired older adults rather than a continuum of sheltered housing environments or community-based care. However, a contemporary discussion of long-term care is more likely to emphasize alternatives to institutionalization and home-and community-110 Chang-O Kim www.e-agmr.org based care. 3) For example, in the United States, various models of community-based long-term care, such as the Program of All-inclusive Care for the Elderly, Home Based Primary Care, Adult Day Health Care, and social health maintenance organization, have been investigated and virtually operated. 4,5) These models have something in common. That is, they follow the AIP philosophy. Canada and some countries in Western Europe, which include long-term care as a basic component of their national health financing system have expanded consumer directed care models rapidly. In this model, homecare recipients can choose to hire and pay their family members to provide community-based long-term care services with state funds. 5) One thing seems to be certain, to make these alternative structures, we have to think more deeply and concentrate on the psychosocial aspect of aging. In addition, the physician's role in homecare setting will be different from that in the hospital. In community-based long-term care setting, the physician must provide ongoing medical services, coordinate activities of the interdisciplinary team, and serve as an advocate for patients. In addition, home visits may reveal new problems, such as use of multiple drugs, nutritional deficits, depression, living alone, insufficient caregiver, and unhealthy lifestyle. More complicated problems (e.g., care of dying patients, mistreatment of elderly individuals, decisional capacity, informed consent, surrogate decision making, and advance care planning) should be re-examined in homecare setting. It will be a new challenge that has not been experienced before. Thus, the Plan for Community Care that was introduced by the Korean government will provide both opportunities and challenges to geriatricians. New unpredictable issues that have only been observed in hypothetical theories may arise. However, if we take these as opportunities to significantly improve geriatric medicine in Korea, there are too many themes to conduct community-oriented researches in the future. In particular, efforts in identifying an alternative care system that is appropriate to the policy environment in Korea should be continued over the next 10 years. In relation to this, homebound older adults can demand a physician to come to their house as a social right. This will be the greatest challenge for geriatricians in the near future. However, this will clearly portray the right to health of older individuals. I hope that such meaningful efforts can be initiated by the Korean Geriatric Society and be published in the Annals of Geriatric Medicine and Research. How diverse is the diet of adult South Africans? Background The objective of the current study was to measure dietary diversity in South Africans aged 16 years and older from all population groups as a proxy of food security. Methods A cross-sectional study representative of adults from all specified ages, provinces, geographic localities, and socio-economic strata in South Africa was used (n = 3287). Trained interviewers visited participants at their homes during the survey. Dietary data was collected by means of a face validated 24 hour recall which was not quantified. A dietary diversity score (DDS) was calculated by counting each of 9 food groups. A DDS <4 was regarded as reflecting poor dietary diversity and poor food security. Results The provinces with the highest prevalence of poor dietary diversity (DDS <4) were Limpopo (61.8%) and the Eastern Cape (59.6%). By contrast, only 15.7% of participants in Western Cape had a low score. Participants in tribal areas (63.9%) and informal urban areas (55.7%) were by far the worst affected. There were significant differences in DDS by Living Standards Mean (LSM) analysis (p < 0.05) with the lowest LSM group having the lowest mean DDS (2.93).The most commonly consumed food groups were cereals/roots; meat/fish; dairy and vegetables other than vitamin A rich. Eggs, legumes, and vitamin A rich fruit and vegetables were the least consumed. Conclusion Overall the majority of South Africans consumed a diet low in dietary variety. The tribal areas and informal urban areas were worst affected and eggs, legumes and vitamin A rich fruit and vegetables, were the least consumed. Introduction A diet which is sufficiently diverse reflects nutrient adequacy [1]. This statement is based on the fact that there is no single food which contains all required nutrients for optimal health. Hence, the more food groups included in a daily diet the greater the likelihood of meeting nutrient requirements. Monotonous diets, based mainly on starches e.g. maize, bread, have been closely associated with food insecurity [1]. According to Hoddinott [2], dietary diversity is an outcome measure of food security at the individual or household level, while food security is defined as access by all people at all times to enough food for an active, healthy life [3]. Recently there has been a lack of clarity regarding food security and dietary diversity status of the South African population. This being due in part to large temporal differences in food security obtained by different surveys when using the same hunger scale [4,5]. It is difficult to determine whether the higher levels of hunger in 2005 (51.6%) [4] compared with that of 2008 (25.9%) [5] reflect an improvement in food |
security or whether other factors including differences in the sampling methodologies of the relevant surveys may have influenced the outcomes. This was one of the reasons food diversity was evaluated in 2009 (current study) by the Human Sciences Research Council (HSRC) of South Africa as an additional measure of food security, since one measure of food security is not usually used on its own. In the national child population (1-9 years) surveyed in 1999 [in the National Food Consumption Survey (NFCS) of South Africa [4], a dietary diversity score (DDS) was determined and validated against both mean adequacy ratio (MAR) of the diet and anthropometric status [6]. MAR and DDS showed significant correlations with weight for age (W/A) and height for age (H/ A) Z scores, indicating a strong relationship between DDS and child growth. The NFCS further showed that the prevalence of stunting was highest in tribal areas and in certain provinces, namely Eastern Cape, Northern Cape and Limpopo. The most commonly consumed foods at the time were maize, tea, sugar and bread, indicating a very monotonous diet [7]. The dietary data from the NFCS further indicated that the diet of many children was low in energy and certain essential micronutrients [7]. It was noted that dietary diversity was poor and that this could be assumed to reflect poor food security [1,2]. A subsequent secondary dietary analysis showed that participating children had a mean DDS of 3.6 (SD = 1.4) [6]. Furthermore, a DDS of at least 4 was shown to be the lowest minimum requirement and provided a specificity of 70% and a sensitivity of 75% of at least at 50% MAR of the overall diet. Determining dietary diversity in South African adults has not been possible to date since there are no national dietary data on adolescents or adults. Hence, the aim of the present study was to include a dietary assessment in 2009 of adolescents and adults (16 years and older) participating in the national South African Social Attitudes Survey (SASAS) and to calculate DDS for this group. Further, to assess the determinants of dietary diversity in this population. Methods The SASAS has been conducted annually by the HSRC since 2003. The aim of the survey is to track longitudinally the public's attitudes, beliefs and behavior patterns on social issues [8]. The survey has been designed to yield a nationally representative sample of people aged 16 years and older. The sampling frame for the survey is enumerator areas adjacent (i.e. including the household next door to the one in the master sample) to the HSRCs Master Sample which was designed in 2006 and consists of 1 000 primary sampling units (PSUs). The 2001 population census enumerator areas (EAs 1 In order to collect data for censuses, Statistics South Africa (Stats SA) demarcates work areas that are manageable for one enumerator to enumerate within limited number of days, within the local municipalities and place names. Such areas are called EAs and are the units for planning, executing and capturing of census data. This spatial set of EA boundaries is updated before each census (http://mapserver2. statssa.gov.za/geographywebsite/about.html)) were used as PSUs. These PSUs were drawn, with probability proportional to size, from a pre-census 2001 list of EAs provided by Statistics South Africa. The Master Sample focused on dwelling units or visiting points as secondary sampling units which have been defined as residential stands, addresses, structures, flats and homesteads. The sample was stratified to include all nine provinces (Table 1) and geographic areas (formal urban, informal urban, formal rural, tribal) and ethnic groups (black, white, mixed ancestry, and Indian). The tribal areas refer to predominantly rural areas where traditionally chiefs still make decisions on matters under their jurisdiction. These areas include mostly those people living in the former TBVC homelands. TBVC refers to Transkei, Bophuthatswana, Venda and Ciskei. The age categories included 16-24; 25-34; 35-49 and 50 or more years. The Living Standards Measurement (LSM) system was used to classify people according to their living standards, using criteria such as degree of urbanization and ownership of cars and major appliances to place people in low or high categories [9]. In 2009, 3827 sampling units (projected sample) were randomly selected for a nutrition module included in the SASAS survey on food diversity and population consumption of all foods by the Centre for the Study of the Social and Environmental Determinants of Nutrition (CSSEDN), Knowledge Systems, HSRC. The nutrition module comprised a face validated questionnaire (evaluated by four PhDs in nutrition), which also included a non-quantified 24 hour recall. Results presented here are only for the 24 hour recalls. The questionnaire was translated into 11 official languages of South Africa and back-translated to ensure retention of meaning. Trained interviewers completed the questionnaires while interviewing the randomly selected participants. Quality of data was assured by telephonic and physical back checks on 10% of questionnaire interviews. These were undertaken to check that interviewers had visited the homes they were required to visit and secondly to check the correctness of data entered. The realized sample comprised 3287 adults of which 76.6% were black; 10.9% white and 12% other ethnic groups. The sample was weighted to reflect the actual population distribution. The final sample provided dietary information by means of a non-quantified 24 hour recall face validated questionnaire while being interviewed at their randomly selected households. The 24 hour recall included the interviewer documenting all foods and drinks consumed by the person during the previous 24 hours. The survey was undertaken in October/November 2009 and hence reflects consumption of foods consumed in spring and summer. A dietitian checked and cleaned the final data. Mixed dishes were coded simply by entering every food item in the dish since quantities or proportions were not required. A Dietary Diversity Score (DDS) was calculated by counting each of nine food groups. The food groups were the same as those used in an earlier validation study on children [6]. These were calculated as follows: The South African Food Composition Tables [10] were used to group food items. Each specific food item was included in a group of nine selected food groups as used in an earlier study on children [6]. Since national dietary data is not available on adults the children's mean DDS of 4 was used as a reference point [6]. A score below 4 would be indicative of poor dietary diversity (and by association poor food security) while a score of nine would represent a very varied diet. Each food group was only counted once when calculating DDS. The nine groups used were: 1) cereals/roots/tubers; 2) meat/poultry/fish; 3) dairy; 4) eggs; 5) vitamin A rich fruit and vegetables; 6) legumes; 7) other fruit; 8) other vegetables; 9) fats and oils. The results also included calculating the proportion of people who had consumed a food group at least once. Logistic regression was done using DDS as the response variable and evaluating the risk of different determinants on DDS while adjusting for the confounders, of gender and ethnicity. Chi-square analyses and the Bonferroni multiple comparison test were used to test for differences between and within groups. The survey received ethics approval [REC 8/1/12/09/ 07] from the HSRCs Ethics Committee. All participants signed informed consent and were assured that all information would be treated confidentially. Participants who were 16 and 17 years old signed assent and parental/ guardian consent was obtained, whereas those 18 years and older signed their own consent in accordance with the Ethics Committee of the HSRC .50] while tribal areas had the lowest mean score; which was significantly lower than any other group (p < 0.05) . Just over one third of households nationally and just under two thirds of households in tribal areas had a DDS <4, respectively ( Figure 2). After cereals, in all geographic areas, meat and dairy were most commonly consumed food groups. Chisquare analysis showed significant differences between geographic areas, particularly in terms of other fruit ( not vitamin A rich) (p < 0.001); other vegetables ( not vitamin A rich) (p < 0.05); legumes and nuts (p < 0.01); fats and oils (p = < 0.001); meat (p < 0.001); dairy (p < 0.001); and eggs (p < 0.001). There were significant differences in DDS by LSM (p < 0.05) with the lowest LSM group having the lowest DDS of 2.93 [CI:2.81-3.05] ( Table 3). The highest prevalence (73.9%) of a DDS less than 4 was also recorded for the lowest LSM group (Figure 3). There were no age and gender differences in the mean DDS. In terms of food groups it should be noted that with the exception of cereals and legumes the low LSM group had significantly lower intake from all food groups while the highest LSM group had the highest in each group, excluding legumes and nuts. The discriminatory value of using DDS is further shown by the additional finding that the means of the three LSM groups differ significantly. Differences in DDS by ethnic group (Table 4) Indicated that the black ethnic group had the lowest mean DDS of 3.63 [CI:3.55-3.71] and highest percentage of individuals with a low DDS (50%) (Figure 4) of the population with a DDS < 4, which was significantly lower than all other ethnic groups (p < 0.05). By contrast the white ethnic group had the highest mean DDS (4.96) and lowest percentage (9%) of individuals with a DDS < 4(p < 0.05). The relative odds of having a DDS < 4 compared with a DDS >= 4 ( Table 5) was the highest under the following conditions: When a river was the source of drinking water (OR 7.060) the household had no toilet (OR 3.350) and no access to electricity (OR 2.310); source of income was casual work (OR 2.769) and being chronically sick or disabled (OR 2.130). A participant was most likely to buy from the small local store (spaza) in the immediate vicinity and having a limited variety of food items (OR 1.979) and to live in a traditional mud house (OR 2.394). Determinants which were protective against having an odds DDS <4 compared with a DDA >= 4 were those related to better socio-economic status, for instance earning a salary reduced the odds ratio of low DDS by nearly 48.4%(OR 0.584) water in the house Discussion In order to achieve nutrition security individuals need access not only to sufficient, safe, and nutritious food, but also to other essential factors [11]. These include: (i) access to health-care services; (i) access to safe water, hygiene, and sanitation; and (iii) knowledge about child care, food hygiene and preparation, and a healthy environment. Food security on the other hand indicates whether sufficient and adequate food is available to the individual or household, and dietary diversity is an outcome measure of this. A varied diet is associated with a number of improved health outcomes, including birth weight; child anthropometric status and improved iron status [12]. In the present study we did not try to evaluate nutrition security and hence do not know whether other factors like access to health care and safe water are adequate. In order to evaluate nutrition security these factors would also need to be evaluated. This however was not within the scope of our study. However, we recommend that these aspects also be included in future national studies investigating food security. Data from the present study portray the situation regarding dietary variety of the South African population, and by association, food security. The findings are a cause for serious concern. Dietary variety is low *Significant relationship between LSM, age category and gender groups respectively, and whether or not subjects consume food from a specific group, Chisquare test, p < 0.05. **Significant relationship between LSM, age category and gender groups respectively, and whether or not subjects consume food from a specific group, Chisquare test, p < 0.01. ***Significant relationship between age category and gender groups respectively, and whether or not subjects consume food from a specific group, Chi-square test, p < 0.0001. overall and certainly not in line with the food-based dietary guideline promoted by the Department of Health (DOH) in South Africa which states "eat a variety of foods" [13]. Dietary variety was particularly low in the low LSM group and in black South Africans. Nearly 40% of |
South Africans only had between one and three different food groups on the day prior to the survey; these being a cereal, meat or chicken and a vegetable other than a vitamin A rich one. The most neglected food groups were vitamin A rich fruit and vegetables; and legumes and nuts, despite the DOH dietary guidelines which state: "Eat plenty of fruit and vegetables" and "Eat plenty of dry beans, lentils and soya regularly" [13]. It is possible that these health promotion messages may not be reaching, or be understood, by those who need them. Poor people often do not have access to a variety of food-and unless access is being addressed, knowledge on the food-based dietary guidelines will probably have little effect. Furthermore, it also needs to be realized that including more variety in the diet will in all likelihood increase the cost. A comparison of the DDS of the present study (national mean DDS = 4.02), was done with some local studies. Firstly, a survey in Sekhukune in Limpopo, confirmed the link between food security and dietary diversity [14]. They found a significant inverse correlation between the "household food insecurity and access scale" (HFIAS) and dietary diversity (p < 0.01). A study on the low income elderly in Sharpeville, South Africa showed a DDS of 3.41(SD 1.34), similar to that of the low LSM in the present study [15].They also determined that having a better DDS results in a better mean nutrient adequacy ratio. Another study in South Africa determined the DDS of infants (6-24 months) [16]. They found that low dietary diversity was more common in HIV infected children than those who were not ( crude odds ratio (OR), 2.59; 95% CI, 1.52 to 4.41). In terms of studies in other developing countries who have evaluated DDS, a mean DDS of 4.91 was found in Filipino children aged 24-71 months using a score out of nine groups [17]. In Burkino Faso it was 4.6, in Laos 5.2 and 3.3 in Northern Uganda [18]. It is apparent that poor dietary variety is a feature of many developing countries, and is not restricted to the South African population. Results from the present national survey indicate that environmental factors are important determinants associated with household food security. However, it is also important to realize that improving the environment is not necessarily going to lead to better household food security if people do not have access to food. Furthermore, it is known that nutrition security cannot be achieved without food security, knowledge and skills to improve dietary intake and access to health services [11]. Using DDS as a proxy for food security showed that for example, a river water source was associated with a seven fold relative odds ratio of having a DDS < 4 compared with those with a DDS >= 4. Other factors which contributed to low DDS, included: having no toilet; living in a traditional type house; and no access to electricity. Health care was also regarded as a contributing factor to nutrition security since those chronically ill (by implication many HIV) or disabled had twice the odds of having a low DDS. Indeed, the majority of environmental risk factors are the direct outcome of poverty and are inter-related. A recent publication indicates that a limited understanding of the current situation of a population/community is likely to hamper the development of effective strategies to improve the nutrition situation [19]. In this regard, the determinants of poor food security are multiple and complex comprising both environmental and social factors, with poverty being one of the primary contributors [20]. Food-based approaches are most likely to be successful, if they are part of a long term process which leads to economic growth. One approach, based on the current findings, would be to identify those communities which use a river or stream as a source of drinking water. Such communities should be given priority regarding the piping of water to their homes and in further development initiatives. Within communities, families without a toilet in their home or yard and no access to electricity can be targeted for individual social support. The data from this survey do imply that improvements to the environment (housing, water, electrification, sanitation) will lead to improved nutrition security. However, to improve food security will still require better access to food. These are hence aspects that policymakers need to focus on, in addition to direct nutrition strategies which improve access to food. In terms of access to food it should be noted that buying food from local spaza shops also doubled the relative odds of having a poor DDS while having a big supermarket close was protective against a DDS < 4. Spaza shops generally sell very basic necessities and generally are not good sources of fresh fruit and vegetables. Furthermore, studies in South Africa have shown that food prices are highest where the poor live [21,22]. Hence, availability and access to healthy foods needs to be improved for those residing far from large supermarkets. The issue of small-scale agricultural production is one that needs to be continuously evaluated despite lack of access to land by the large majority of people. Government and the private sector need to be creative in this regard and should focus on ways to make access to land for food production possible [23]. At this point in time it is appropriate to question what we still need to know about the determinants of poor dietary variety in the South African population. A search of the literature reveals that there is a paucity of data on people's knowledge and practices with regard to the food-based dietary guidelines promoted by the DOH. In this regard, one needs to know how effective the marketing of the dietary guidelines are, and whether people interpret and practice them effectively. Furthermore, one needs to know whether having better nutrition knowledge will impact favorably on households which are food insecure due to lack of access to food. Knowledge does not necessarily imply access to food. In this regard, Hart (2009) [24] emphasized the essential importance of more qualitative and in-depth studies of household food insecurity to determine why some households remain more or less constantly food insecure while some in the same community do not. There is a large evidence base for school curriculumbased nutrition education programs in terms of improved knowledge, self-efficacy and attitudes leading to improved nutritional behavior [25]. Additionally, if this is coupled with healthy foods with plenty of variety in the primary school nutrition program, one would be able to provide both knowledge and access to food. It is also essential that school policies reinforce healthy eating behavior in terms of the type of foods sold at the school. The introduction of the food-based dietary guidelines into the Life Orientation (LO) curriculum at schools is currently being evaluated at 8 schools in the Western Cape Province [26,27]. The LO curriculum covers a range of life skills aimed at promoting healthy and responsible citizens. One way in which one could improve intake of vitamin A rich fruits and vegetables would be to have a school vegetable garden and teach children how to grow their own vegetables. Lastly, it needs to be recognized that nutrition security of individuals and households are influenced by a myriad of factors, particularly those related to the immediate environment. Ideally, South Africa should strive for all households to have access to food, water, sanitation and health care. This can only happen if economic growth takes place and there are employment opportunities for all. Conclusions Overall the majority of South Africans consumed a diet low in dietary variety. The tribal areas and informal urban areas were worst affected and eggs, legumes and vitamin A rich fruit and vegetables, were the least consumed. The Impact of Diet and Lifestyle on Gut Microbiota and Human Health There is growing recognition of the role of diet and other environmental factors in modulating the composition and metabolic activity of the human gut microbiota, which in turn can impact health. This narrative review explores the relevant contemporary scientific literature to provide a general perspective of this broad area. Molecular technologies have greatly advanced our understanding of the complexity and diversity of the gut microbial communities within and between individuals. Diet, particularly macronutrients, has a major role in shaping the composition and activity of these complex populations. Despite the body of knowledge that exists on the effects of carbohydrates there are still many unanswered questions. The impacts of dietary fats and protein on the gut microbiota are less well defined. Both short- and long-term dietary change can influence the microbial profiles, and infant nutrition may have life-long consequences through microbial modulation of the immune system. The impact of environmental factors, including aspects of lifestyle, on the microbiota is particularly poorly understood but some of these factors are described. We also discuss the use and potential benefits of prebiotics and probiotics to modify microbial populations. A description of some areas that should be addressed in future research is also presented. Introduction There are approximately 10 times as many microorganisms within the gastro-intestinal (GI) tract of humans (approximately 100 trillion) as there are somatic cells within the body. While most of the microbes are bacteria, the gut can also harbor yeasts, single-cell eukaryotes, viruses and small parasitic worms. The number, type and function of microbes vary along the length of the GI tract but the majority is found within the large bowel where they contribute to the fermentation of undigested food components, especially carbohydrates/fiber, and to fecal bulk. Some of the most commonly found or recognized genera of gut bacteria in adults are Bifidobacterium, Lactobacillus, Bacteroides, Clostridium, Escherichia, Streptococcus and Ruminococcus. Approximately 60% of the bacteria belong to the Bacteroidetes or Firmicutes phyla [1]. Microbes which produce methane have been detected in about 50% of individuals and are classified as Archaea and not bacteria [2]. Although individuals may have up to several hundred species of microbes within their gut, recent findings from The Human Microbiome Project and others [3,4] show that thousands of different microbes may inhabit the gut of human populations collectively and confirm a high degree of variation in the composition of these populations between individuals. Despite this variation in taxa the abundance of many of the microbial genes for basic or house-keeping metabolic activities are quite similar between individuals [3]. There is growing evidence that imbalances in gut microbial populations can be associated with disease, including inflammatory bowel disease (IBD) [5], and could be contributing factors. Consequently, there is increased awareness of the role of the microbiota in maintaining health and significant research and commercial investment in this area. Gut microbes produce a large number of bioactive compounds that can influence health; some like vitamins are beneficial, but some products are toxic. Host immune defenses along the intestine, including a mucus barrier, help prevent potentially harmful bacteria from causing damage to tissues. The maintenance of a diverse and thriving population of beneficial gut bacteria helps to keep harmful bacteria at bay by competing for nutrients and sites of colonization. Dietary means, particularly the use of a range of fibers, may be the best way of maintaining a healthy gut microbiota population. Strategies such as ingestion of live beneficial bacteria (probiotics) may also assist in maintaining health. In this review, we will expand upon these subjects relating to diet and lifestyle, the gut microbiota and health, and provide some indication of opportunities and knowledge gaps in this area. Microbial Products that Impact Health-Beneficial and Harmful Microbial mass is a significant contributor to fecal bulk, which in turn is an important determinant of bowel health. Consumption of dietary fibers reduces the risk of colorectal cancer (CRC) [6] at least partly as a consequence of dilution and elimination of toxins through fecal bulk, driven by increases in fermentative bacteria and the presence of water-holding fibers [7][8][9]. Aspects of this will be discussed in more detail later in the review. Gut microbes are capable of producing a vast range of products, the generation of which can be dependent on many factors, including nutrient availability and the luminal environment, particularly pH [10]. A more in-depth review of gut microbial products can be found elsewhere [11]. Microbial products can be taken up by GI |
tissues, potentially reach circulation and other tissues, and be excreted in urine or breath. Fermentation of fiber and protein by large bowel bacteria results in some of the most abundant and physiologically important products, namely short chain fatty acids (SCFA) which act as key sources of energy for colorectal tissues and bacteria, and promote cellular mechanisms that maintain tissue integrity [12][13][14]. SCFA can reach the circulation and impact immune function and inflammation in tissues such as the lung [15]. However, some protein fermentation products such as ammonia, phenols and hydrogen sulphide can also be toxic. There are many other products which deserve mention for their influence on health. Bacteria such as Bifidobacterium can generate vitamins (e.g., K, B12, Biotin, Folate, Thiamine) [11]. Synthesis of secondary bile acids, important components of lipid transport and turnover in humans, is mediated via bacteria, including Lactobacillus, Bifidobacterium and Bacteroides [11]. Numerous lipids with biological activity are produced by bacteria, including lipopolysaccharide (LPS), a component of the cell wall of gram negative bacteria that can cause tissue inflammation [16]. Also, many enteropathogenic bacteria (e.g., some E. coli strains) can produce toxins or cause diahorrea under the right conditions, but under normal circumstances other non-pathogenic commensal bacteria with similar metabolic activities outcompete and eventually eliminate them [17]. Bacteria such as Bifidobacterium can also help prevent pathogenic infection through production of acetate [18]. Many enzymes produced by microbes influence digestion and health. Indeed, much of the microbial diversity in the human gut may be attributable to the spectrum of microbial enzymatic capacity needed to degrade nutrients, particularly the many forms of complex polysaccharides that are consumed by humans [19]. Some bacteria such as Bacteroides thetaiotamicron have the capacity to produce an array of enzymes needed for carbohydrate breakdown [20], but in general numerous microbes appear to be required in a step-wise breakdown and use of complex substrates. Bacterial phytases of the large intestine degrade phytic acid present in grains, releasing minerals such as calcium, magnesium and phosphate that are complexed with it [21], making these available to host tissues (e.g., bone). Enzymes which degrade mucins help bacteria meet their energy needs and assist in the normal turnover of the mucus barrier lining the gut. Competition between bacteria for substrates has a significant influence on which products are generated. Hydrogen is used by many bacteria and there is a hydrogen economy within the gut based around production by some bacteria and its use by others, including methanogens and sulphate-reducing bacteria (SRB) [22,23]. The use of hydrogen for production of methane by methanogenic Archaea may limit acetate production by other microbes, thereby potentially limiting production of beneficial butyrate and impacting health [2,23]. The role of methanogens in health is not yet clear. Breath methane correlates with levels of constipation in irritable bowel syndrome (IBS) [24] but methanogens numbers are depleted in IBD [2]. Production of gases such as methane, hydrogen, hydrogen sulphide and carbon dioxide is associated with digestion and fermentation within the GI tract. While excess production may cause GI problems such as bloating and pain, the gases may serve useful purposes. However, there is debate over whether hydrogen sulphide is largely beneficial or detrimental [23]. There is a strong interaction between the host immune system and the microbiota, with both producing compounds that influence the other. Some bacteria such as the key butyrate-producer Faecalibacterium prausnitzii may produce anti-inflammatory compounds [25]. Microbes also produce substances that allow communication between each other. Lifestage Microbes colonise the human gut during or shortly after birth. The fact that babies delivered naturally have higher gut bacterial counts at 1 month of age than those delivered by caesarean section [26] suggests gut colonization by microbes begins during, and is enhanced by, natural birth. The growth and development of a robust gut microbiota is important for the development of the immune system [27] and continues during breast-feeding, a stage which seems to be important for the long-term health of the individual. Oligosaccharides present in breast milk promote the growth of Lactobacillus and Bifidobacterium, which dominate the infant gut, and this can strengthen or promote development of the immune system and may help prevent conditions such as eczema and asthma [28][29][30]. These bacteria are undetectable in the stool of preterm infants in their first weeks of life [31]. A significant shift in the populations of gut microbes occurs when infants switch to a more solid and varied diet, including a decline in populations of Lactobacillus and Bifidobacterium to only a small percentage of the large bowel microbiota [32]. A wide diversity of microorganisms is needed to utilize the many fibers and other nutrients present in adult diets [19,33]. Functional maturation of the human microbiota, including the capacity to produce vitamins, increases during the early years of life [34]. The complexities and variability of adult gut microbial populations have become increasingly evident in recent years. The variability may relate to the influence of numerous factors, including diet and host genetics. The composition and activity of gut bacteria can vary according to (and possibly a result of) life events, including puberty, ovarian cycle, pregnancy and menopause [11]. The diets of children being weaned may have particular influence on microbial diversity in later life. Another broad shift in gut microbe populations occurs with age. The Bacteroidetes phylum bacteria tend to dominate numerically during youth but numbers decline significantly by old age, whereas the reverse trend occurs for bacteria of the Firmicutes phylum [11]. The consequences and reason for this change are not yet clear. However, the gut microbiota profiles of the elderly may not be optimal. One study found a high prevalence of potentially toxic Clostridium perfringens and lower numbers of Bifidobacterium and Lactobacillus in those in long-term care [35]. The latter also have a reduced microbial diversity compared to the elderly living in the community and this is related to increased frailty and changes in nutrition [36]. Lifestyle The impact of non-dietary lifestyle factors on the gut microbiota has been largely ignored. Smoking and lack of exercise can significantly impact the large bowel (and potentially the microbiota) as they are risk factors for CRC [37]. Indeed, smoking has a significant influence on gut microbiota composition, increasing Bacteroides-Prevotella in individuals with Crohn's Disease (CD) and healthy individuals [38]. Smoking-induced changes in microbial populations could potentially contribute to increased risk of CD. Air-borne toxic particles can reach the large bowel via mucociliary clearance from the lungs, and increased environmental pollution associated with industrialization could contribute to concomitant increases in IBD cases [39]. Another lifestyle factor, stress, has an impact on colonic motor activity via the gut-brain axis which can alter gut microbiota profiles, including lower numbers of potentially beneficial Lactobacillus [40]. Stress may contribute to IBS, one of the most common functional bowel disorders, and the associated changes in microbial populations via the central nervous system (CNS). The gut-brain axis is bi-directional, involving both hormonal and neuronal pathways [41], and so changes in the gut microbiota may influence brain activity, including mood [42]. Autism, a neurodevelopmental disorder, is associated with significant shifts in gut microbiota populations [43][44][45]. Obesity is associated with excess energy intakes and sedentary lifestyles. Exercise (or rather a lack of it) may be an important influence on any shifts in microbial populations that are associated with obesity. This is highlighted by a recent study that showed an increase in the diversity of gut microbial populations in professional athletes in response to exercise and the associated diet [46]. In humans and animal models with obesity, shifts in gut microbial populations occur, with increases in the Firmicutes and decreases in the Bacteroidetes, which could potentially contribute to adiposity through greater energy harvest [47][48][49]. However, other data suggests the shifts in microbial populations are driven primarily by the high fat obesogenic diets [50,51]. Irrespective of the cause, there are associated increases in gut bacteria linked with poor health outcomes (e.g., Staphylococcus, E. coli, Enterobacteriaceae) [52,53]. Dietary saturated fats may increase numbers of pro-inflammatory gut microbes by stimulating the formation of taurine-conjugated bile acids that promotes growth of these pathogens [54]. Geography also has a strong bearing on the composition of gut microbial populations. The diversity of fecal microbes in children from rural Africa is greater than that of children of developed communities in the EU, as is the number of bacteria associated with breakdown of fiber [55], suggesting dietary differences contributes significantly to the microbial differences. In another study, the type of fecal bacteria and their functional genes differed between individuals in the USA and in rural areas of Venezuela and Malawi [34]. Other environmental factors may also influence health via gut microbes. Travel, particularly to overseas destinations, increases the risk of contracting and spreading infectious diseases, including those causing diarrhoea. Some infections may go undiagnosed but result in long-term GI problems, including IBS [56]. Poor sanitary conditions in developing countries, and poor personal hygiene, can facilitate the spread of infectious agents. Circadian disorganization, occurring because of travel, shift work or other reasons, also impacts gut health and alters gut microbial populations [57]. Substrate Supply to the Colonic Microbiota An adult colon contains approximately 500 g of contents, most of which is bacteria [58], and about 100 g/day is voided as stool. A typical western type diet supplies the colonic microbiota with about 50 g daily of potentially fermentable substrate, predominantly dietary fiber (DF). Non-starch polysaccharides (NSP) are major components of DF and account for 20%-45% of the dry matter supplied to the colon. Simple sugars and oligosaccharides each represent a further 10% whereas starch (and starch hydrolysis products) supplies less than 8% of dry matter. Some sugar alcohols also escape small intestine (SI) absorption and are minor dietary substrates for the colonic microbiota [59]. About 5-15 g of protein and 5-10 g of lipid passes into the proximal colon daily, largely of dietary origin. Various other minor dietary constituents, including polyphenols, catechins, lignin, tannins and micronutrients also nourish colonic microbes. About 90% of the approximately 1 g/day of dietary polyphenols escapes digestion and absorption in the SI [60,61] and can have significant influence on microbial populations and activities [62][63][64]. Carbohydrates-Importance for Large Bowel Fermentation and Health Carbohydrates are the principal carbon and energy source for colonic microbes. Collectively, they have an immense capacity to hydrolyse a vast range of these nutrients, especially complex polysaccharides [65]. DF is integral to a healthy diet and Australian adults consume ~27 g each day [66], which is greater than in other high income countries, including the USA (<20 g/day). Epidemiological and experimental studies show that DF is both preventative and therapeutic for many large bowel disorders and other conditions or diseases, including cardiovascular diseases, type II diabetes and obesity [67][68][69][70][71]. One mechanism by which fiber promotes and maintains bowel health is through increasing digesta mass. Incompletely fermented fiber (e.g., insoluble NSP such as cellulose), increases digesta mass primarily though its physical presence and ability to adsorb water. An increase in digesta mass dilutes toxins, reduces intracolonic pressure, shortens transit time and increases defecation frequency. Fibers can also increase fecal mass to a lesser degree by stimulating fermentation, which leads to bacterial proliferation and increased biomass [7]. Many of the health benefits ascribed to fiber are a consequence of their fermentation by the colonic microbiota and the metabolites that are produced. Carbohydrates are fermented to organic acids that provide energy for other bacteria, the bowel epithelium and peripheral tissues. SCFA are the major endproducts of carbohydrate fermentation. These weak acids (pKa ~4.8) help lower the pH within the colon thereby inhibiting the growth and activity of pathogenic bacteria. Other minor organic acids produced include lactate, succinate and formate. Branched-chain SCFA (e.g., isobutyrate and isovalerate) results from fermentation of branched chain amino acids [72]. There are spatial gradients in microorganisms along the length of the gut. Bacterial growth and metabolic activity (fermentation) is greatest in the proximal colon where substrate availability is at a maximum [13,73]. Accordingly, pH progressively increases as stool progresses from the proximal to distal colon (from 5.8 to 7.0-7.5), largely because of the progressive depletion of carbohydrate substrates and absorption of SCFA, and increasing efficiency of protein fermentation and production of alkaline metabolites [72]. Total SCFA concentrations are highest in the proximal colon (~100 mM) and decline progressively toward the distal colon. Acetate, propionate and butyrate are the |
major individual SCFA, accounting for 90% of the total, with molar ratios approximating 65:20:15 [74]. Butyrate has attracted significant attention because it serves as the principal source of metabolic energy for the colonocytes [75], is instrumental in maintaining mucosal integrity, modulates intestinal inflammation and promotes genomic stability. The capacity of butyrate to regulate colonocyte differentiation and apoptosis, promoting removal of dysfunctional cells, underscores its potential to protect against colon cancer [76]. The SCFA also have roles beyond the gut and may improve risk of metabolic and immune system diseases and disorders, such as osteoarthritis, obesity, type II diabetes and cardiovascular disease [13,76]. More than 90% of the total SCFA produced in the colon is absorbed by the epithelium, through mechanisms that are not fully elucidated. SCFA-stimulated sodium-coupled transport in the apical membrane of colonocytes is especially important as it mediates (co)absorption of water and helps recover electrolytes as well as energy [77]. The SCFA can bind to G-protein coupled receptors in colorectal tissues, particularly GPR 41 and 43, which may influence immune function and tumour suppression, but these pathways are still relatively poorly characterized [76]. Most of the absorbed acetate reaches the liver via the portal vein, whereas propionate, and butyrate to an even larger extent, is metabolized extensively by colonocytes. Acetate and propionate are used by the liver for oxidation, and for lipogenesis and gluconeogenesis, respectively. Hepatic metabolic clearance of SCFA is very high and so concentrations in the systemic bloodstream are about 100-fold lower than those in colonic digesta and feces (~50 µM versus 100 mM, respectively) [13]. Protein Dietary proteins are an important part of a balanced diet. Humans are unable to synthesize numerous amino acids and must obtain them from proteins in food to maintain health. Some protein-rich foods such as meat, eggs and nuts are also good sources of vitamins or nutrients such as iron. There is good evidence that a diet containing moderate to high amounts of protein can also contribute to weight loss in overweight individuals, particularly if combined with exercise [78], thereby minimising the health risks associated with obesity. Dietary proteins also have a significant impact on gut health. Depending on the type of protein and the other nutrients present in the food this can be beneficial or harmful. Some epidemiological studies, particularly large studies (up to 500,000 people), indicate a slight but significant association between CRC risk and the consumption of high levels of red and processed meats [79][80][81][82]. Not all epidemiological studies show such an association and the inconsistent findings may relate to the many factors which may contribute to CRC [83,84]. The potential for protein to harm colorectal tissues is explicable using current knowledge. An increase in protein intake usually results in more of the macronutrient, and hence fermentable substrate, reaching the colon. Although protein digestibility has an important influence on how much reaches the colon, most common dietary protein sources are highly susceptible to hydrolysis by SI enzymes. Dietary protein serves as the major source of nitrogen for colonic microbial growth and is essential to their assimilation of carbohydrates and the production of beneficial products such as SCFA. Hence, a combination of protein and carbohydrates in the large bowel can contribute to bowel health. However, unlike carbohydrates, fermentation of protein sources by the microbiota produces a much greater diversity of gases and metabolites, and increasing the nitrogenous substrate for the microbiota can also increase putrefactive fermentation products [85]. As digesta passes down the bowel its carbohydrate content dwindles and protein fermentation becomes progressively more important. Putrefactive fermentation has been implicated in the development and progression of many common bowel diseases given their greater prevalence in the distal colon [86], including CRC and IBD. Many of these protein fermentation endproducts, which include ammonia, hydrogen sulphide, amines, phenols, thiols and indoles, have been shown to be cytotoxins, genotoxins and carcinogens [87], in in vitro and animal models [88]. Generally, fecal levels of protein fermentation products, such as sulphide, are positively associated with dietary protein consumption in humans and there is evidence from rat studies that higher dietary protein intake (including higher red meat intake) is associated with greater DNA damage in colonic mucosa when dietary levels of fermentable carbohydrate are low [88][89][90][91]. Recently completed studies suggest that this relationship holds true for humans [92][93][94]. However, higher protein intake does not always result in higher fecal levels of protein fermentation products [95] nor does it necessarily increase the genotoxicity of fecal water in humans [96]. Although ammonia is a well-known toxin [97] it is used as an N source by the microbiota and most is excreted via stool or absorbed in the gut and eliminated in urine. Diets promoting microbial protein synthesis (and concomitant increased utilisation of ammonia), effectively reroute systemic N excretion from the kidneys to the fecal stream, which has benefits for renal health [98]. Other components derived from dietary protein sources such as red meat may also influence the gut microbiota and health. Microbial metabolism of L-carnitine, abundant in red meat, may generate products such as trimethylamine-N-oxide that could increase risk of atherosclerosis [99]. Fat Dietary fat also influences the composition and metabolic activity of the gut microbiota and some evidence for this has been described earlier in relation to obesity. High fat diets induce increased circulating levels of bacteria-derived LPS in humans, possibly as a consequence of increased intestinal permeability [100]. LPS is an immune system modulator and potent inflammatory agent linked to the development of common metabolic diseases. The influence of dietary fat on the gut microbiota may be indirectly mediated by bile acids. Hepatic production and release of bile acids from the gall bladder into the SI, and the amount that escapes enterohepatic recycling and enters the colon, is increased with fat intake. Secondary bile acids, produced by 7 α-dehydroxylation of primary bile acids by colonic microbiota, are potentially carcinogenic and have been implicated in the aetiology of CRC and other GI diseases [101,102]. Further research is required on the interactions between dietary fat, the type and amount of bile acids that reach the large bowel, and the population structure and function of the microbiota in that viscus. Effects of Polyphenols on the Microbiota Dietary polyphenols, sourced from many foods including grapes, grains, tea, cocoa and berries, generally promote health and are linked to prevention of diseases such as cancer and cardiovascular disease [103]. Although many dietary polyphenols may have biological impacts through anti-oxidant effects or anti-inflammatory pathways [103], polyphenols which reach the colon can be metabolized by the resident microbiota and result in bioactive products, but our understanding of the microbial bioconversion processes is limited [104][105][106]. Metabolic profiling of polyphenolic products in excreta and blood using tools such as NMR is enabling greater insights into effects of dietary polyphenols in humans [107] but linking the metabolic changes to health outcomes remains a challenge [108]. Individual differences in microbiota populations may result in different capacities for polyphenol bioconversion [109] with potential consequences for health. In this context, it is noteworthy that the gut microbiota population profiles of individuals with IBD are significantly different from healthy individuals, and also that the polyphenolic metabolite profiles are also different between the two groups [110]. Western-Style Diets The Western lifestyle, including diet, is associated with high incidences of chronic diseases, such as cardiovascular disease, CRC and type II diabetes which individually and collectively carry a hefty socioeconomic burden [111]. Most Western populations over-consume highly refined, omnivorous diets of poor nutritional quality. Those diets are energy dense, high in animal protein, total and saturated fats, and simple sugars but low in fruits, vegetables and other plant-based foods. Consequently, they are typically low in DF, NSP in general and RS in particular. For Western civilisations, refined cereal products (e.g., white bread) are the main DF source. Overfeeding (and sedentary behaviour) is also a hallmark of these populations. Much of what is known about the diversity and complexity of human gut microbiota comes from molecular analysis of fecal samples obtained mainly from small cohorts of Caucasian adults habitually consuming Western style diets. Considerably less is understood about how other dietary patterns (e.g., vegetarian, Mediterranean) might influence the community structure and metabolic activity of microbiota. Diet and Dietary Change In humans, the microbial gene set is 150 times larger than the gene complement of the host [112]. However, only about 50 species belonging to just five or six genera and two phyla account for 99% of biomass. Of the genera Bacteroides, Bifidobacterium and Eubacterium are numerically the most important and may account for more than 60% of culturable bacteria present in human stool. Clostridium, Enterobacteriaceae and Streptococcus are also important but less numerous. Nearly all (~90%) of the bacteria in the human gut can be mapped to just two phyla, Bacterioidetes and Firmicutes. The relative proportions of the two dominant phyla vary, and can be influenced by a range of factors, but most people have similar proportions of each [113]. Long-term, habitual diet (i.e., dietary pattern) and shorter term dietary variation influences gut microbiota composition. The population structure is responsive to acute dietary change (daily variation), as evidenced by rapid and substantial increases in populations at the genus and species level. However, dietary change does not necessarily result in a permanent (paradigm) compositional shift, at least at phylum level, although evidence for this assertion is limited [114]. Observational Studies Cross-sectional studies have shown some evidence that Western-style diets are associated with gut microbial populations that are typified by a Bacteroides enterotype whereas traditional diets rich in plant polysaccharides are associated with a Prevotella enterotype [114]. The Prevotella enterotype was only weakly associated with components that typify Western diets but strongly linked to carbohydrates and simple sugars. The fecal microbiota of children in the USA is dominated by Bacteroides [34,115]. Similarly, Italian children have high levels of Enterobacteriaceae (mainly Shigella, Escherichia and Salmonella). In contrast, the stool of children in rural Africa and South America consuming traditional plant-based diets was enriched in Bacteroidetes, in particular the Prevotella enterotype and species associated with fiber utilization (e.g., Xylanibacter) [55]. Prevotella and (Xylanibacter) are known to use cellulose and xylans as substrates [55,116]. Diets of North American and Italian urban children are much richer in animal protein and saturated fats whereas the diets for the other two populations are plant-based and have higher levels of fiber. The Bacteroidetes:Firmicutes ratio was lower for children in the Western countries. As stated earlier, there is a paucity of data on the association between vegetarian dietary patterns and the gut microbiota, especially using molecular methods. A study that used PCR-denaturing gradient gel electrophoresis (DGGE) for microbial population fingerprinting found no significant differences in the fecal microbiota of vegetarians and omnivores, although the abundance of Clostridium cluster IV in the latter tended to be greater [117]. In a cohort of female college students from rural India, the fecal microbiota of those whose dietary pattern was omnivorous had a greater relative abundance of Clostridium cluster XIVa bacteria, specifically Roseburia-E. rectale (butyrate-producing bacteria), compared to the lacto-vegetarians [118]. There were no differences in the relative proportions of other major bacterial groups targeted. A gene encoding for a pivotal enzyme (butyryl-CoA CoA-transferase) involved in butyrate synthesis was also upregulated in the omnivores. The study demonstrates differences in the composition and functional capacity of the microbiota of individuals with two markedly diverse dietary patterns. The taxonomic diversity of the fecal microbiota of individuals on habitual Western diets appears to be less than for those consuming plant-based diets. Also, individuals who are obese or have type II diabetes, inflammatory diseases (osteoarthritis) and other major health problems (prevalent in Western societies) have a sub-optimal fecal microbiota profile. Specifically, it is less diverse than that of healthy controls [119,120] and there are also major compositional differences at the phylum level. Obesity is associated with an increased fecal Bacteroidetes:Firmicutes ratio relative to lean subjects [121]. Whether a microbiota with lower compositional diversity is less resilient to environmental challenges and is less "healthier" for the host is not yet known [122]. The fecal hydrogenotrophic microbiota of native Africans, whose diet is low in animal products, compared to that of African and European Americans consuming a typical Western diet was more diverse and contained different populations of hydrogenotrophic Archaea and methanogenic Archaea as well as SRB populations [123]. The differences |
in bacterial community structures of native African populations were reflective of the diets of the hosts. Those on Western diets, characterized by higher intakes of dietary animal proteins (as meat, milk and eggs), may deliver greater amounts of sulphur compounds to the colonic microbiota [124], thus favouring sulfidogenic hydrogen disposal whereas in native Africans methane is the major hydrogen sink. Native African populations have lower intake of animal products and higher breath methane concentrations than westernized populations [123,125]. Dietary Interventions Replacing a habitual Western diet with one high in fiber elicited rapid (within 24 h) and marked alterations in fecal microbiota composition, although the changes were insufficient to produce a broad switch from Bacteroides to Prevotella enterotype [114]. In an inpatient study [126], altering dietary energy load in lean and obese adults induced rapid changes in the proportional abundance of Bacteroidetes and Firmicutes. The former decreased whereas the latter increased with increasing energy intake. Further studies are required to determine if the changes in microbiota composition were the result of the increase in dietary fat or another macronutrient. High fat diets are also associated with substantial compositional changes in the colonic microbiota at the phylum and genus levels, including reductions in both Gram positive (e.g., Bifidobacterium spp.) and Gram negative bacteria (e.g., Bacteroides) [123]. Animal models are also proving useful in understanding factors that impact the gut microbiota, particularly in regards to high fat diets and obesity. A study using a murine (RELMβ) knockout model showed that dietary fat-induced changes to gut microbiome composition were independent of obesity [127]. In conventional mice, increased dietary fat intake resulted in fewer numbers of Bacteroidetes and increases in Firmicutes and Proteobacteria. A high fat diet also reduced cecal Bifidobacterium numbers and increased circulating LPS concentrations [128,129] and has also been shown to reduce the abundance of Clostridium cluster XIVa, including Roseburia spp. [130]. Diet-induced changes in mucosal integrity have been shown to promote metabolic endotoxemia and trigger systemic low grade inflammatory responses in a range of tissues [100,128,129]. Microbes and Mucosal Health A layer of mucus, produced by goblet cells, lines the epithelium of the GI tract and acts as a barrier to microbial invasion of tissues and can contribute to intestinal homeostasis [131,132]. The basic component of mucus is mucin. Some bacterial products (SCFA) stimulate the production of mucus in response to dietary components such as NSP [133]. Over-utilization of the mucus by bacteria or reduced production can lead to thinning of the barrier under certain dietary conditions [88]. In the colon, "mucindepleted foci" may develop as one of the features associated with tumorigenesis in rodents and humans in response to carcinogens [134]. However, the role of mucin depletion in oncogenesis is not clear as a recent study in rats showed that inflammation associated with mucin-depleted foci was not due to infiltration of bacteria, whereas colonic tumors did appear to be colonized by bacteria [135]. Many bacteria can adhere to and degrade the outer layer of colonic mucus but the inner layer is generally bacteria free [136]. Although break-down of mucus by bacteria is a normal part of mucus barrier turnover, an overabundance of mucus-degrading bacteria, such as Akkermansia muciniphila in the adherent mucus layer of individuals with IBD [137,138], could contribute to tissue inflammation by weakening the barrier. Tight junctions between cells also helps prevent translocation of bacteria and molecules (including toxins) across gut epithelial tissues. A loss of this integrity (a so-called "leaky gut") may have serious consequence for health. In the first few years of life, interactions between the gut microbiota and the mucosal barrier appear important and perturbations in the relationship that lead to excessive gut permeability and immune changes may result in susceptibility to a range of diseases in later life [139]. A significant proportion of the activities of the immune system occur within the gut. Gut-associated lymphatics contribute substantially to this defense but other cells lining the gut also produce a range of molecules which can neutralise pathogenic microbes. Dendritic cells sample the gut luminal environment for harmful bacteria and can induce a suite of responses including the activation of macrophages, B cells and T cells within mucosal tissues and the release of broad specificity ant-microbial agents such as Immunoglobulin A and α-defensins into the luminal environment [140]. A loss of gut barrier function may contribute to numerous diseases. An example is Parkinsons disease (PD), a multi-system disease in which there is dysfunction of the GI tract, including changes in the enteric nervous system which appear before obvious degeneration of the CNS [141,142]. Individuals with PD have increased intestinal permeability, greater intestinal infiltration of E. coli and greater endotoxin (LPS) exposure, and these changes correlate with the enteric neuronal damage [143], leading to suggestions that a pathogen may be responsible for PD [144] and a breakdown in mucosal barrier function may play a central role. An impaired gut barrier may also contribute to symptoms or complications of autism, kidney disease, type 2 diabetes, cardiovascular disease, metabolic syndrome, obesity, and liver diseases [45,100,[145][146][147][148][149]. Inter-Individual Variation in Gut Microbiota and Responses to Diet Each individual has a distinct combination of gut microbial species. This has become increasingly evident from molecular analyses of recent decades, including The Human Microbiome Project. One metagenomic analysis also suggested that the gut microbiota of each human is typified by one of three enterotypes, with each enterotype characterised by distinct dominant groups of microbes [150], namely Bacteroides, Prevotella and Ruminococcus. However, subsequent studies, including those of The Human Microbiome Project, have been unable to provide clear support for the concept as initially proposed [4,114]. More recent findings and analysis of the evidence roughly support typing with Prevotella or Bacteroides dominance of the microbiota but the numerous factors, especially dietary, that impact gut microbial populations means there is considerable variation in numbers of these genera, making it difficult to classify populations as a particular "type" [113]. Inter-individual differences in populations of the gut microbiota may lead to different capacities to utilize dietary components and to different levels of disease risk. For example, some individuals have consistently low stool levels of the microbial fermentation product butyrate, levels which generally remain lower relative to others despite concentrations increasing in response to a diet high in RS [151]. Butyrate production is important for the maintenance of colorectal tissue integrity and may protect against colorectal diseases [13,76]. Individual differences in numbers and functions of bacteria such as Ruminococcus bromii, important for the generation of SCFA in response to RS in humans [152,153], could potentially influence colorectal health. Use of Probiotics and Prebiotics as Nutritional Strategies to Improve Health Probiosis and prebiosis are diet-based processes/strategies for promoting the health of the host through improving the composition of the colonic microbiota. Although both prebiotics and probiotics have been shown to increase numbers of selected bacteria at the species and genus level, typically Bifidobacterium and Lactobacillus, changes in the overall composition of the gut microbiota are often relatively small, and generally persist only for as long as the period of the intervention. Also, definitive proof that the identified compositional alterations are directly responsible for an improvement in host health generally remains elusive. While the concepts have practical relevance they are simplistic given the current limited understanding of the complex and dynamic interplay between the host and their gut microbiota. Prebiotics are dietary substrates that selectively promote proliferation and/or activity of "beneficial" bacteria indigenous to the colon. The concept, first published by Gibson and Roberfroid [154] in 1995, has been refined and redefined on several occasions. Prebiotics are defined currently as "selectively fermented ingredients that result in specific changes, in the composition and/or activity in the GI microbiota, thus conferring benefit(s) upon host health" [155]. To qualify as a prebiotic all of the following properties must be demonstrated: (i) a food ingredient that escapes assimilation in the small intestine; (ii) upon reaching the colon its fermentation by the microbiota flora selectively alters its taxonomic composition and/or activity which (iii) confers demonstrable health benefits for the consumer [156]. The validity of the prebiotic concept and evidence of a role for prebiotics in promoting health and reducing risk of bowel and systemic diseases have been recently reviewed in depth [157][158][159][160]. Data from studies in animals provides strong evidence of the potential of prebiotics to afford protection against a range of chronic diseases or conditions common in humans (e.g., CRC, IBD, type 2 diabetes, obesity) by preventing colonization by enteric pathogens [61,158,161]. Prebiotics have been shown to improve bowel and immune function, metabolic health and mineral bioavailability in humans but the evidence is strong only for bowel habit and colonic uptake of calcium and magnesium. There is mounting evidence that prebiotics both directly and indirectly modulate the immune system and reduce the risk and severity of bowel infectious and inflammatory conditions, such as IBD, as well as functional bowel disorders, notably IBS [159]. Short-chain nondigestible carbohydrates (inulin-type fructans, fructo-oligosaccharides (FOS) and galacto-oligosaccharides (GOS)) are the quintessential prebiotics and the target bacterial groups are typically Bifidobacterium and Lactobacillus. Fructan prebiotics, such as inulin and FOS, occur naturally in various foods including cereals, fruits and vegetables and so are ubiquitous in most diets. Dietary intakes have been estimated to be ~5-10 g/day [162]. The prebiotic concept as it currently stands is probably too narrowly focused. It has been proposed [163,164] that the taxonomic focus should be widened beyond the Bifidobacterium and Lactobacillus which have been historical targets. These genera may not be the most important contributors to host health. Emerging candidates include Ruminococcus bromii, Roseburia intestinalis, Eubacterium rectale, and Faecalibactrium prausnitzii, but there are many others that may be of benefit. It has been suggested that a prebiotic index might offer greater utility for evaluating the efficacy of different prebiotics [165]. The prebiotic concept also encompasses selective improvements in metabolic activity of the microbiota but this has been given little attention to date. Changes in concentration patterns of key beneficial microbial metabolites such as butyrate should be integrated into prebiotic index models. All established prebiotics to date are carbohydrates, specifically inulin type fructans and GOS. However, other dietary carbohydrates also qualify as prebiotics, for instance resistant starch (RS) [156,166], but evidence from human studies is limited. More studies are required on the prebiotic properties of different types, doses and food sources of RS. The inter-individual variability in the microbial response to RS suggests successful dietary interventions with RS need to be personalised [167]. Dietary constituents other than carbohydrates conceivably could function as prebiotics. For instance, cocoa flavonols can increase the relative abundance of Bifidobacterium and Lactobacillus at the expense of potentially pathogenic bacteria, notably the C. histolyticum group [64]. Probiotics are defined as live microorganisms which when administered in adequate amounts confer a health benefit on the host. The most commonly consumed probiotics belong to the genus Lactobacillus and Bifidobacterium. Mechanisms by which probiotics might improve host health include immune function augmentation through reinforcing mucosal barrier function, reducing mucosal transfer of luminal organisms and metabolites to the host, increasing mucosal antibody production, strengthening epithelia integrity and direct antagonism of pathogenic microorganisms. However, the results of studies in humans are varied, due most likely to methodological differences (dose and duration of probiotic administration, sampling regimen and microbiological techniques) and differences in host cohorts (age, health status). Perhaps most importantly, it is clear from in vivo studies in humans and animal models that probiotic efficacy in promoting health is strain dependent and not species and genus specific. For a more comprehensive and detailed description of the health benefits of probiotics and their prophylactic potential for various gut diseases the reader is referred to recent narrative and systematic reviews [168][169][170][171][172][173]. Gaps in Understanding There are still many gaps in our understanding of the interactions between diet, lifestyle, gut microbes and health. Here, we present some of the areas we believe should be addressed to help fill that knowledge gap. There is a growing need for an understanding of the activities of gut microbes, particularly their physiological relevance. Current molecular methods such as sequencing technologies are allowing the identification of the many hundreds of microbial species present in human GI tracts and are beginning to identify the types of genes that they possess. The next steps will be to understand the functions of the many poorly characterised microbes, particularly their |
roles in the breakdown of food and how the associated by-products contribute to health and disease. The majority of gut microbes are present within the large bowel and most GI microbiology research has focused on this area. However, the SI can, like the colon and rectum, become inflamed in cases of IBD and bacteria are implicated. The role that bacteria play in SI enteropathies and leaky gut is also yet to be clearly elucidated. The contribution of diet to maintenance of SI health is also not well understood. Understanding in this area is hampered by the general inaccessibility to these sites within human subjects, especially in healthy individuals who have no need to visit a gastroenterologist. The integrity of the gut mucosa is of critical importance to health. Understanding which foods or dietary components strengthen or weaken that barrier may assist in tailoring diets to prevent microbes and toxins such as LPS from accessing tissues and causing inflammation. A better understanding of the interactions between the host immune system and gut bacteria, particularly in children, should also shed light on how microbes may contribute to lifelong susceptibility to some diseases, and how diet may be used to promote optimal microbial populations. The gut-brain axis is increasingly viewed as having an important role in health with bi-directional communication of information of relevance to areas such as satiety, mood and gut motility and suggestions of roles in conditions that include IBS and autism. The gut microbiota has been implicated in some of these conditions and there is great scope for research into understanding which of the many microbial products reach the CNS and impact health, including mental health, via the brain, and consequently for understanding how dietary manipulation of the microbiota then impacts these important areas. Since it has been shown that many microbial products can influence health, the inter-individual variation in gut microbial profiles in humans may lead to differences in disease risk. A better understanding of the origins of the variation may ultimately allow the microbial profiles to be modulated. Environmental and dietary factors appear to play some role during a child's early development but the extent to which host genetics contribute to the variation is not known. Studies which follow the development of microbial profiles in children, and the impact that diet and environment have on these, are sorely needed. It may be possible to develop diets that lead to optimal microbial population and health outcomes. The extent to which long-term dietary patterns can shift the composition of microbial populations is yet to be clearly determined despite some emerging knowledge and should be investigated further. Our understanding of how different sources and forms of macronutrients such as carbohydrates, proteins and lipids interact and affect the GI tract is still lacking. Knowledge of how micronutrients impact the gut and its microbes is even scarcer. Food structure is also an important determinant of how a food impacts the body, with particle size and the associated food matrix influencing the accessibility of host and microbial enzymes to nutrients. For example, smaller starch granules may be more readily degraded due to higher surface area to volume ratios and this increases the rate at which sugars are absorbed by tissues, an important issue when considering glycaemic control. Since most gut microbes are within the large bowel, food structures which minimize SI digestion and allow food to pass into the colon will have the greatest impact on the microbiota. Cooking practices can potentially impact food structure and digestibility of foods. Strategies which optimize the structure of foods for defined benefits (i.e., glycemic control) are already being implemented but more work is needed in this area to achieve a broader range of health outcomes. Ingestion of probiotics, prebiotics and microencapsulated nutrients, beneficial molecules or microbes [174,175] is designed to deliver a health benefit to the body by increasing numbers of beneficial microbes or their products with the gut. A greater knowledge of which microbes and functions are beneficial is needed to effectively culture, deliver and/or stimulate the growth of the appropriate microbes. Presently, only a small number of adult human gut microbes have been used for probiotics, or targeted in assessments of the impacts of diets (including prebiotics) on gut health. Conclusions We have sought to provide a broad picture of how diet, and to some extent lifestyle, can have significant and wide-ranging impacts on human health and shown that the microbes which inhabit the GI tract play an important role in mediating these effects. Although significant gains have been made recently in our understanding of the complexity of gut microbial populations, a more detailed understanding is needed of microbial functions and products that maintain (or negatively impact) the integrity of tissues, at sites within and distant from the gut. Alongside this is a need to understand which factors within the diet supply substrates to the microbes so that this knowledge can be harnessed to generate the desired shifts in microbial populations, products and health outcomes. Particularly challenging will be the task of understanding what constitutes a healthy population of gut microbes. Certain microbial population profiles may be associated with diseases and conditions. In many cases, it is not clear if environmental/lifestyle factors, diet or genetic predisposition leads to these profiles, or indeed whether the altered microbial populations contribute to the condition. While dietary intervention can induce significant change, it is possible that the level of impact may not always be sufficient to engineer the changes in microbial populations that are conducive to better health. The use of probiotics and other strategies may be required. An understanding of the ontogenesis of our gut microbial population profiles, and how this contributes to the development of our immune system, may enable early intervention or prevention of the formation of undesirable microbial profiles and the consequences. In this context, defining the factors which dictate the development of our human microbial populations in early life will be important. A new LC-MS Method for the Determination of p- Chloroaniline and (S)-5-Chloro-α- (cyclopropylethynyl)-2- Amino-α- (trifluoromethyl) Benzene Methanol in Efavirenz Bulk Form The main objective of the present research study is to develop and validate a sensitive, specific, accurate and precise LC-MS method for the determination of p-Chloroaniline and (S)-5-Chloro-α(cyclopropylethynyl)-2amino-α(trifluoromethyl) benzene methanol in Efavirenz bulk form. The effective separation of p-Chloroaniline and (S)-5-Chloro-α-(cyclopropylethynyl)-2amino-α(trifluoromethyl) benzene methanol were achieved by using Hypersil BDS (C18, 100 x 4.6 mm, 3 μm) column and a solvent system of Buffer (0.1% Formic acid in water): Methanol (30:70 v/v) with a flow rate of 0.4 ml/min. The p-Chloroaniline and (S)-5-Chloro-α-(cyclopropylethynyl)-2amino-α(trifluoromethyl) benzene methanol were monitored on mass spectrometer coupled with atmospheric pressure chemical ionization, positive polarity mode and quadrapole mass analyzer. Original Research Article Devanna et al.; JPRI, 33(45B): 379-386, 2021; Article no.JPRI.74655 380 The Retention time of p-Chloroaniline, (S)-5-Chloro-α-(cyclopropylethynyl)-2amino-α(trifluoromethyl) benzene methanol and Efavirenz were found at 5.7min, 7.6min and 11.1min resepectively. The detection limit and quantification limit were observed at 0.25ppm and 0.75 ppm respectively for both p-Chloroaniline and (S)-5-Chloro-α-(cyclopropylethynyl)-2amino-α(trifluoromethyl) benzene methanol. Those analytes were linear in the concentration ranges from 0.75ppm to 3.75ppm and the percentage relative standard deviation of six replicates of same concentrations of both the analytes were less than 10%. Hence this method was effective in separation and determination of p-Chloroaniline and (S)-5-Chloro-α-(cyclopropylethynyl)-2aminoα(trifluoromethyl) benzene methanol in Efavirenz. INTRODUCTION Efavirez is an anti-viral agent used to treat Hepatitis -B and human immune virus diseases 1,2 alone or in combination with other antiviral agents. It mainly acts by inhibiting the DNA polymerase non competitively results in ceases of replication of viral DNA (1,2). The IUPAC name of Efavirez is4S)-6-chloro-4-(2cyclopropylethynyl)-4-(trifluoromethyl)-1H-3,1benzoxazin-2-one. p-Chloroaniline (PCA) and (S)-5-Chloro-α-(cyclopropylethynyl)-2-amino-α-(trifluoromethyl) benzene methanol (Impurity-1) are major process impurities in the synthesis of Efavirez. Hence there is a possibility to presence of those impurities in the Efavirez drug substance. To identify and quantify the PCA and impurity-1 in Efavirez, an appropriate and proper analytical method should be needed. The chemical structure of Efavirez PCA and impurity-1 were shown in Fig. 1. MATERIALS AND METHODS The PCA, Impurity-1 and Efavirenz pure forms were obtained as a gift sample from Fortune Pharma, Hyderabad upon request. All solvents of HPLC grade were purchased from local distributor of Sigma Aldrich Limited, India. All the solvents were filtered with the support of 0.22µm filters earlier to introduce into the LC-MS system. Optimized LC-MS/MS Method Conditions The method was developed on Agilent, Model: 1290 mass spectrometer coupled with Atmospheric pressure chemical ionization (APCI) and Quadrupole mass analyzer. The effective separation of PCA and impurity -1 were achieved by using Hypersil BDS (C18, 100 x 4.6 mm, 3 µm) column and a solvent system of Buffer (0.1% Formic acid in water): Methanol (30:70 v/v) with a flow rate of 0.4 ml/min. 0.1% Formic acid in water used as diluents to prepare the different levels of standard and sample solution. The PCA and impurity -1 were monitored on mass spectrometer coupled with APCI, positive polarity mode and quadrapole mass analyzer. An ambient and 20ºC temperature was maintained in the auto sampling system and column respectively. MS parameters were described in the Table-1. Preparation of PCA and Impurity -1 Standard Stock Solution (100 ppm) Accurately weighed 5 mg of each PCA and IMPURITY-1 standard substances were diluted to10ml with diluent. 0.1ml of the obtained solution further diluted to 25ml to to obtain a solutuion of 100ppm. Preparation of Standard Solution of PCA and Impurity -1 (2.5 ppm) 0.5 ml of the above standard stock solution was further diluted to 20 ml to get of 2.5 ppm concentration. Preparation of Test Solution Weigh accurately and transfer about 100 mg of test sample into a 5 mL volumetric flask dilute to the volume with diluent and mix well. System suitability test The system suitability of the current method was done by injecting standard solution PCA and impurity -1 for six times into LC-MS system. At the end % RSD was calculated for the peak areas of PCA and impurity -1 of the obtained chromatograms. As per ICH guidelines, the % RSD should be less than or equal to 10 for six replicates. Linearity Linearity study was performed for both PCA and impurity -1 were in the range of 0.75ppm (LOQ level) to 3.75(150% level). Each linearity level solution was injected in thrice and chromatograms were recorded. The regression coefficient (R 2 ) value was determined from the linear graph plotted between concentration levels versus their average peak areas. Accuracy The accuracy of the present method was validated through the recovery studies at QL level and 100% level standard solution concentrations specified in linearity. To the each specified level a known amount of test sample was spiked and the produced each spiked level solutions was introduced three times into LC-MS system. At the each level concentration the percent recovery of both PCA and impurity -1 in spiked solutions were calculated. Precision The system precision and precision at QL of the current method was done by injecting both the standard solution and QL solution for six times into LC-MS system. At the end % RSD was calculated for the peak areas of PCA and impurity -1 of the obtained chromatograms. Sensitivity Signal to noise ratio(S/N) method used to determine the detection limit (DL) and quantification limit (QL) of the analytical method. DL solution prepared from standard stock solution in such a way to get signal to noise ratio (S/N) around 3:1. The QL solution was prepared to get S/N ratio about 10:1. Specificity The specificity of the method was validated by injecting blank solution followed by standard solution, test solution and test solution blended with standard solution subsequently. Observation was done to check the interference at the retention times of PCA and impurity due to bank and other substances in test solution. Method Optimization The LC-MS method with optimized conditions such as Hypersil BDS (C18, 100 x 4.6 mm, 3 µm) column and a solvent system of Buffer (0.1% Formic acid in water): Methanol (30:70 v/v) with a flow rate of 0.4 ml/min was effectively separate the PCA and impurity-1 with retention time of 5.7min and 7.6min respectively (Fig. 2). Method Validation The method was validated according to Q2 guidelines ICH. System Suitability The system suitability parameter of the optimized method was confirmed by calculating the % RSD of the peak areas of the PCA and impurity-1. |
The % RSD values were found to be 1.7 and 3.5 for PCA and impurity-1 respectively ( Table 2). Linearity The regression coefficient (R 2 ) value for the given series of concentrations were computed to be as 0.994 and 0.992 respectively for PCA and impurity-1 (Table 3 and Fig. -3). Accuracy The % recovery of PCA and impurity -1 in spiked solutions of QL level and 100% levels were found to be in the range of 88.8 to 109.4 % (Table 4) which were in the acceptance limits about 85 to 100%. Hence the method said to be highly accurate. Precision The % RSD values for precision at QL and system precision (100%level) of the PCA and impurity-1 were ≤10. The Table 5 represents the precision results. Sensitivity The DL and QL values were observed to be 0.25ppm and 0.75ppm for both PCA and impurity-1, which resembles that the method has sensitive. The DL and QL results of PCA and impurity-1 were represented in Table 6. Specificity Interference was not observed at retention time of the PCA and impurity-1 by the blank and impurities. Hence this method was specific to the determination of PCA and impurity-1only. A specific and sensitive LC-MS method was essential for determination of the process impurities in pure and pharmaceutical dosage form. Till now a single analytical method was not available to estimate PCA and impurity-1 in Efavirenz powder and pharmaceutical tablet dosage form. Even though few LC analytical methods were reported for estimation of Efavirenz and its degradants which were generated by forced degradation studies, a new LC-ms method was required to produces y good sensitive, accuracy and specificity. Hence the developed method has advantages over reported methods in process chemistry department and quality control department to identify and quantify the Phenyl vinyl sulfone impurity in Eletriptan hydrobromide. CONCLUSION A LC-MS method with simple mobile phase composition was developed for the estimation of PCA and impurity-1 in Efavirenz bulk powder and pharmaceutical tablet dosage form. The validated method has very good sensitive, accurate, and precision. Besides it has the advantage of shorter elution time and the possibility of examination of more number of samples, both of those significantly trim down the analysis time per sample. Thus, this method can rightly appropriate for regular analysis of PCA and impurity-1 in Efavirenz pure and dosage forms in quality control department in the pharmaceutical industry DISCLAIMER The products used for this research are commonly and predominantly use products in our area of research and country. There is absolutely no conflict of interest between the authors and producers of the products because we do not intend to use these products as an avenue for any litigation but for the advancement of knowledge. Also, the research was not funded by the producing company rather it was funded by personal efforts of the authors. CONSENT It is not applicable. ETHICAL APPROVAL It is not applicable. Effects of longitudinal asymmetric distribution of a lipid core on plaque wall stress The rupture of the atherosclerotic plaque is related to the mechanical stress and structural integrity of plaque wall tissues. In order to investigate the longitudinal asymmetry across the stenosis of the arterial plaque wall, asymmetric plaque wall models were constructed by skewing the lipid core distribution in the upstream direction. Wall stress and blood flow in the coronary artery models were computationally analyzed considering fluid and structure interaction. The values of maximum cap stress increased, and its location moved toward the proximal cap as asymmetry increased. Hemodynamic wall shear stress (WSS) did not change much owing to negligible changes in luminal geometry, but the maximum WSS and the spatial gradient of WSS were higher in the asymmetry models than in the symmetry model. The pressure drop and pressure gradient across the stenosis were also higher in the asymmetry models. Because higher peak wall stress, wall strain, increased WSS, WSS gradient, pressure drop, and pressure gradient are correlated with weakening and rupture of the plaque wall, we suspect that longitudinal asymmetric distribution of the lipid core in the plaque could affect plaque wall stability and vulnerability. low spatial resolutions, image artifacts and difficulties differentiating plaque tissues and three dimensional volume reconstruction. Although hemodynamic wall shear stress (WSS) is not high enough to disintegrate the plaque wall, the endothelium is very sensitive to it. Furthermore, it affects the function of the cells and tissues of the intima during disease progression. Intima thickening is correlated with low and oscillatory shear stress (Peiffer et al. 2013), and the plaque region exposed to lower shear stress shows lower strain (Gijsen et al., 2008). In the stenotic lumen observed in the advanced stage of atherosclerotic plaque, the endothelium is exposed to variable hemodynamic stress along the longitudinal direction. In the upstream of the stenosis, elevated wall shear stress activates inflammatory path ways and the infiltration of macrophages (Dirksen et al., 1998) and dendritic cells (Yilmaz et al., 2007) into the region is increased. In contrast, smooth muscle cell proliferations and increased endothelial cell apoptosis are found in the downstream region. Changes in cellular function and the distribution of tissue along the longitudinal direction of the stenosis cause variations in the cross sectional morphology and mechanical properties of the plaque wall. However, the longitudinal heterogeneity along the stenotic plaque wall has not been considered in analyzing mechanical stress in plaque models. In this study, mechanical stress in the plaque wall and hemodynamic stress in the lumen were computationally analyzed for arterial plaque models considering fluid and structure interaction. Plaque wall composition may be different for the upstream and downstream walls of the throat, where the lumen has minimal cross sectional area. Longitudinal asymmetry of the plaque wall was modeled by skewing the lipid core distribution upstream of the stenosis and increasing the cap tissue thickness downstream of the stenosis, because intimal thickening is more pronounced in the distal wall. Effects of lipid core distribution skewness (asymmetry) on plaque wall stress, strain and hemodynamic stress were explored. Methods An ideal three dimensional coronary artery with an eccentric stenosis was modeled using the 3-D modeler (SolidWorks, Dassault Systèmes, MA, U.S.A.) as shown in Fig. 1. A cylindrical vessel of 100 mm long was attached in the upstream and downstream of the stenotic plaque model in order to provide flow development as well as to minimize the fixed wall boundary effect on wall deformation. The diameter of the lumen was 3 mm, while the length of the stenosis was 8.2 mm. The stenotic plaque wall is composed of the lipid core and fibrous cap. The luminal height of the throat (minimum lumen cross section) was about 1 mm, and the area reduction was about 36%. The vessel wall thickness was 1 mm, and the minimum thickness of the fibrous cap was about 40 μm, as shown in Fig. 2. The symmetry model had a symmetric lipid core with respect to the throat, and the half base length of the lipid core was 3.775 mm (Sym). The distal base length of the lipid core was decreased to 3.28 mm (Asym1), 2.78 mm (Asym2) and 1.81 mm (Asym3) in the asymmetric models, and the cap thickness was increased in order to construct the same lumen geometry for all plaque vessel models. The Asym3 model had the most asymmetric lipid core distribution. The constructed three dimensional models were imported into ADINA version 9.2 (ADINA R&D Inc., MA, U.S.A.), a commercial finite element package, to analyze the stress and flow fields in the plaque models considering fluid and structure interaction (FSI). ADINA uses unstructured finite element methods for both fluid and solid models, and nonlinear incremental iterative procedures were used to handle FSI problems. It has been tested in many FSI problems with hyperelastic materials (Bathe, 1996(Bathe, , 2002, and also has been validated in FSI analysis in arteries and plaques (Yang et al., 2010, Tang et al., 2014, Yuan et al., 2015. The 4-node tetrahedral elements were used for computational meshes, and they were fitted with the shape of the vessel lumen and the plaque wall tissue. Finer meshes were used in the plaque cap and the lipid core zone to accommodate abrupt changes in geometry. Mesh was refined near the fibrous cap to get mesh independent solutions in stress and strain calculations. Mesh analysis was performed by increasing mesh size near the fibrous cap zone until the maximum stress values converged within 5 percent. The mesh was then chosen for FSI computation. In the symmetric model, the vessel and lipid core consisted of about 99,679 and 11,991elements, respectively. In the asymmetric models, about 91,000 to 95,000 elements were used for the vessel and about 5,000 to 9,100 elements were used for lipid core. The fluid domain of all four models consisted of 65,556 elements. For all models, the fluid was assumed to be incompressible and Newtonian, with a density of 1,050 kg/m3 and a viscosity of 0.0035 kg/m.s. No slip boundary conditions were used on the walls. The Navier-Stokes equation with arbitrary Lagrangian-Eulerian formulation was used to solve governing equations in the presence of fluid-structure interaction (FSI), and a transient implicit scheme was applied to fluid flow computations. The velocity waveform obtained from a coronary flow waveform and the physiological pressure waveform (Rambhia et al., 2012) were applied at the inlet and the outlet of the vessel, respectively, in order to consider the phase lag between the pressure and the flow waves (Fig. 3). The inlet velocity was assumed to be uniform, and initial velocities and pressure were assumed to be zero. The computational simulation was performed for three cardiac cycles until solutions became periodic and converged. The computational results from the third period were used for analysis. The Mooney-Rivlin (M-R) model was used to describe the material properties of the wall of the plaque tissue, which was assumed to be hyperelastic and anisotropic. The modified M-R model after adding anisotropic terms is given by Chhai, Lee and Rhee, Journal of Biomechanical Science and Engineering, Vol.12, No.1 (2017) where C=Cij=F T F is the right Cauchy-Green deformation tensor, X i is the current position, Xj is the original position, nc is the circumferential direction of the vessel, and I1 and I2 are the first and second strain invariants. The parameters in the strain energy density function, C1, C2, D1, D2, K 1 , and K2, were chosen to match the mechanical properties of the plaque wall obtained from experimental measurements. Data from planar biaxial tests of coronary arteries were used (Kural et al., 2012) to fit the modified Mooney-Rivlin model, and the parameters in the strain energy density function were C1=-1312.9 kPa, C2=114.7 kPa, D1=629.7 kPa, D2=2.0, K 1 =35.9 kPa, K 2 =23.5. The lipid core was assumed to be incompressible and isotropic with C1=0.5 kPa, D1=0.5 kPa and D2=0.5, and C2 and K 1 are zeroes. ). The arterial wall was fixed at the lower edge of the outer vessel wall, and both inlet and outlet cross-sections of the vessel wall were fixed in all directions. FSI boundary conditions were imposed on the luminal surface of the arterial wall. Results and Discussion Equivalent stress in the plaque wall, which is the scalar quantity defined on the surface, was compared for the different plaque models. Figure 4 shows the contour of equivalent stress at peak pressure in the longitudinal cross section where the maximum values were found. The high stress was distributed on the cap and near the interfaces between the medial wall and lipid core base. Maximum equivalent stresses on the cap are shown in Table 1, and the values of maximum cap stress increased as the asymmetry increased. The location of maximum cap stress was near the throat for the symmetric model, and it moved to the proximal cap for the asymmetric models (see arrow heads in the Fig. 4). The point of the maximum cap stress located on the proximal throat region, where plaque rupture, was frequently observed. Because the cap stress, which is a potential physical factor that contributes to plaque rupture, increased as the asymmetry increased, we suspect that asymmetric plaque geometry could increase the danger of plaque rupture. This observation also agreed with clinical findings that upstream ruptured plaques exhibited a strongly pronounced longitudinal asymmetry (Cicha et al., 2011 Fig. 4 Equivalent stress contour in |
the longitudinal cross section at peak pressure (the arrow head denotes max stress location).The maximum cap stress increased as the asymmetry increased, and the location of it moved to the proximal cap for the asymmetric models. The wall strain was also compared for the different plaque models. Stains were higher in the lipid core regions and the cap tissues. The maximum strains in the fibrous cap (cap strains) in the asymmetric models were higher compared to those in the symmetric model, but they did not change noticeably for the different asymmetric models (Table 1). The high strain region coincided with the lipid core region, and it decreased as the size of a lipid core decreased for asymmetry models, as shown in Fig. 5. Furthermore, higher cap strains were shown in the proximal cap region. These strains may cause more vulnerabilities because of a strong positive correlation between strain and macrophage content . Compared to other models, asymmetry model 3, which has a smaller lipid core size and a thicker distal cap, had a lower cap strain in the distal cap region. Fig. 7 Temporal variation of wall shear stresses at the throat. The maximum WSSs in the asymmetry models at peak flow were higher than those in the symmetry model. Hemodynamic shear stress contours at peak flow are shown in Fig. 6. The wall shear stress (WSS) due to fluid motion is high near the throat of the stenosis, which is where maximum WSSs were observed. WSSs were higher in the distal sites than in the proximal sites of the throat, but they were lower near the distal end of the stenosis. The maximum WSSs at the throat in the asymmetry models at peak flow were higher than those in the symmetry model (Fig. 7). The temporal variation of the WSS was also higher in the asymmetry models. The maximum and temporal mean wall shear stresses along the stenotic region are shown in Fig. 8. Both the maximum and mean WSSs were highest near the throat for all models, and they were higher in the mid-distal sites than in the mid proximal sites for all models. The WSSs were lower in the symmetric models than in the asymmetry models, but the degree of asymmetry (skewness of core distribution) did not significantly affect WSS distribution. The spatial gradient of WSS (the slope of shear stress distribution curve) was higher in the proximal throat compared to changes in WSS decrease in the distal throat. The spatial gradient of WSS was higher in the asymmetry models than in the symmetry model. The temporal and spatial gradients of WSS affect the plaque progression and wall thickening (Soulis et al., 2014), and high peak and spatial gradients of WSS stimulate matrix degrading proteins, which induce wall weakness (Dolan et al.,2013, Li et al., 2009. Because the asymmetric models showed higher WSS temporal and spatial gradients than the symmetric models, we speculate that hemodynamic stresses in asymmetric lipid core distribution may promote thinning and weakening of the plaque wall. Figure 9 shows the maximum and temporal mean pressure distributions along the stenotic region. The pressure drop and pressure gradient across the stenotic region were higher in the asymmetric models than in the symmetric models. The increased pressure drop across the stenosis may increase plaque vulnerability because of larger pressure drag force on the plaque (Li et al., 2009). The pressure distribution was not significantly influenced by its degree of asymmetry. in the symmetric models than in the asymmetry models. Abscissa denotes the distance from the throat. Fig. 9 Maximum pressure (a) and mean pressure (b) distributions along the stenotic region. The pressure drop and pressure gradient across the stenotic region were higher in the asymmetric models than in the symmetric models. Abscissa denotes the distance from the throat. Stenotic arterial geometry provides the endothelium with varying hemodynamic environment, which affects vascular cellular functions. The upstream side of the stenosis is characterized by steep increase of WSS while a flow separation and recirculation, and the low and oscillating WSS are observed on the downstream of the stenosis. The different lipid core distribution might change the luminal geometry in the stenotic region due to wall deformation caused by fluid motion. FSI simulation was performed, and the lumen geometry change due to different lipid core distribution was barely noticeable. But, noticeable differences in the WSS gradients and pressure were found between symmetric and asymmetric models. Because the WSS and pressure gradient affected wall weakening and dragging force on the plaque, asymmetric lipid core distribution might affect the plaque stability. Though the effects of asymmetric distribution of the lipid core on the mechanical parameters were explored in this computational study, there were many limitations that should be improved in further studies. The first limitation is related the idealized plaque and lumen geometries. The patient specific models which were constructed from the ultrasound and MRI images would provide more realistic vessel geometries, but sufficient number of simulations should be performed to draw meaningful results accounting for the individual geometrical differences of patients. Also, the small size wall tissues such as calcium deposits and thrombi were not considered, which might affect local stress concentration. The second limitation is related to the modeling of the material properties of plaque wall and blood. Anisotropic and viscoelastic properties in the arterial wall tissues were not modelled, because they were less serious in the plaque tissues and lipid core (Yuan et al., 2015). Non-Newtonian blood viscosity and turbulence were not modelled, because flow characteristic would not affect the wall stress a lot via FSI. Another limitation is related to wall stress calculations. Residual stress, arterial curvature and cycle bending due to cardiac motions were not considered, which might affect the wall stress a lot . These limitations should be kept in mind when interpreting our simulation results. Nevertheless, major results from this computational study would provide meaning insight in analyzing plaque wall stability. Conclusion In this study, computational analysis incorporating FSI was performed in order to study the effect of the longitudinal asymmetric distribution of the lipid core on arterial wall mechanics and hemodynamics. The values of maximum cap stress increased, and its location moved toward the proximal cap as asymmetry increased. The maximum strains in the asymmetric models were also higher compared to those in the symmetric model. Because high wall stress and wall strain are positively correlated with plaque rupture, longitudinal asymmetric distribution of the lipid core may increase the vulnerability of the plaque. The hemodynamic WSS did not change much with longitudinal asymmetry, because the luminal geometry varied only slightly in the asymmetry models. However, the maximum WSS and its spatial gradient, which were believed to be positively related to the endothelium denudation and degradation, were higher in the asymmetry models than in the symmetry model. Furthermore, the pressure drop and pressure gradient across the stenosis were higher in the asymmetry models than in the symmetry model. Therefore, higher wall stress and strain, and increased WSS, pressure drops, and gradients of them in asymmetric plaques may provide a more unfavorable biomechanical environment for plaque stability. Atezolizumab in combination with intrathecal chemotherapy and radiation for treatment of isolated cerebral nervous system relapse in a patient with extranodal NK/T cell lymphoma: a case report Background Extranodal NK/T cell lymphoma (ENKTL) is an aggressive form of Epstein-Barr virus (EBV)-associated non-Hodgkin’s lymphoma which historically has a poor prognosis. When relapse occurs, particularly in the cerebral nervous system (CNS), survival is rare. The immune checkpoint pathway family of proteins is highly expressed in many human tumors, especially in EBV-related malignancies. To the best of our knowledge, there are no reports of immune checkpoint inhibitors used either alone or in combination for the treatment of ENTKL CNS relapse, yet there are promising results in metastatic CNS involvement of other malignancies. Case presentation This is the case of a 29-year-old Hispanic male with ENKTL who was treated at first relapse with 24 doses of the programmed death-ligand 1 (PD-L1) immune checkpoint inhibitor, atezolizumab, over a 17-month period. He remained in remission for 18 months until he experienced an isolated CNS relapse and on-going evidence of chronic EBV infection. Salvage therapy was provided as a combination of triple intrathecal (TIT) chemotherapy, radiation, and atezolizumab. He continues on maintenance atezolizumab and remains alive 1-year post CNS relapse. Conclusions The results from this case suggest that atezolizumab should be considered as part of the treatment regimen for relapsed ENKTL. They also demonstrate the benefit of using atezolizumab in combination with TIT chemotherapy and radiation as a viable treatment option for ENKTL CNS relapse and indicate that atezolizumab is an option for long-term maintenance therapy for patients with ENKTL. body can also be affected, such as the gastrointestinal tract, skin, and testis [2]. Cerebral nervous system (CNS) involvement is uncommon, but has been reported in up to 17% of patients, although the rate tends to be dependent on the stage and histology of the tumor [3][4][5][6][7]. ENKTL is usually both chemotherapy and radiotherapy sensitive, but the prognosis remains poor for patients who relapse, especially those with CNS disease. Proposed treatments for these patients include intrathecal (IT) or high-dose methotrexate-based regimens [3,8,9]. Programmed death-ligand 1 (PD-L1), belonging to the immune checkpoint pathway family of proteins, is highly expressed in many human tumors, but especially in EBV-related malignancies. Multiple studies have demonstrated a particularly high expression of PD-L1 in ENKTL due to the EBV-infected T-cells [4,[10][11][12]. Therefore, immune checkpoint inhibitors can be a potential therapy for malignancies such as ENKTL which is related to EBV infection. The PD-L1 immune checkpoint inhibitor, atezolizumab, shows promise as a treatment alternative in this devastating disease in the following case. Atezolizumab is a humanized immunoglobulin (IgG1) monoclonal antibody that selectively binds to PD-L1 and blocks its interaction with the programmed death-1 (PD-1) receptor and B7.1 (CD80), thus potentially activating an anticancer immune response. The U.S. Food and Drug Administration (FDA) has approved atezolizumab for the treatment of various cancer types, such as lung cancer, bladder cancer, and breast cancer [13]. Recently, other PD-1 inhibitors, such as pembrolizumab and nivolumab, both of which have a similar mechanism to atezolizumab, have emerged as successful treatments for multiple refractory, relapsed, and advanced ENKTL [14]. Pembrolizumab and nivolumab are now recommended as treatment choices for relapsed/ refractory ENKTL per National Comprehensive Cancer Network (NCCN) guidelines last updated in 2018 [15]. The following is a report of a patient with relapsed ENKTL who achieved a second remission with atezolizumab and then was re-treated in combination with triple intrathecal (TIT) chemotherapy for isolated CNS relapse. Our aim in presenting this case report is to demonstrate the successful use of atezolizumab in the initial relapse, but specifically to highlight its potential role in the treatment of CNS relapse. Case presentation We report the case of a 29-year old Hispanic male with ENKTL with the first relapse in the nasopharynx and then an isolated relapse in the CNS. At initial diagnosis in 2012, at age 21 years, he presented with disease in the caecum, hypopharynx, and bone marrow. He was treated with the SMILE protocol (dexamethasone, methotrexate, ifosfamide, l-asparaginase, and etoposide) for 3 cycles, followed by autologous stem cell transplant with the BEAM regimen (carmustine, etoposide, cytarabine, and melphalan). He relapsed 4 years later, with presentation of left hemifacial pain, left otorrhea, fever, night sweats, fatigue, difficulty breathing through his nose, loss of smell, and loss of appetite. At this time, a positron emission tomography-computed tomography scan (PET-CT) revealed he had left cervical lymphadenopathy and nasopharynx, oropharynx, and soft palate avid (Fig. 1). Baseline Post Cycle 24 Post Cycle 16 a c b Fig. 1 Positron emission tomography-computed tomography (PET-CT) scan at diagnosis of first relapse and after atezolizumab treatment. a Avid left cervical lymphadenopathy and nasopharynx, oropharynx, and soft palate at baseline. b After 16 doses of 1200 mg intravenous infusion of atezolizumab every 3 weeks, showing complete response of the target lesion and overall partial response. c After 24 doses of atezolizumab, the avid region was biopsied and confirmed by pathology to be negative for lymphoma The patient was then enrolled in a clinical trial (Clini-calTrials.gov Identifier: NCT02541604) in August 2016 to receive 1200 mg (maximum dose) intravenous (IV) infusion therapy with atezolizumab every 3 weeks. Side effects were monitored according to the protocol. |
The target and non-target lesions were assessed by PET-CT after every two courses and evaluated by the Response Evaluation Criteria in Solid Tumors v1.1 (RECIST). The patient received his first dose of atezolizumab in September 2016 and his last dose in January 2018, for a total of 24 doses. At the start of treatment his EBV status was according to PCR analysis. Side effects were minimal without any Grade 3 or Grade 4 toxicity. He experienced striking clinical improvement within 3 weeks of receiving the first dose of atezolizumab. He reported increased appetite, weight gain, increased energy, disappearance of night sweats, no fever, and no missed days of work. At cycle 3, he was jogging approximately 3 miles per day about 5 days a week. At the end of treatment, the drainage from his left ear had almost completely disappeared. After completion of course 16, complete response (CR) of the target lesion and overall partial response (PR) were documented by PET-CT (Fig. 2). After course 24, biopsies of the PET-positive areas in the nasopharynx and tonsils were taken to assess the pathologic response. Biopsies showed scattered Epstein-Barr encoding region (EBER)-positive cells without evidence of lymphoma. The decision was then taken to stop the administration of atezolizumab due to sustained clinical response. The patient remained disease free for approximately 18 months off treatment. During follow-up he developed diabetes and had an increasing number of EBV copies, as determined by PCR, despite antiviral therapy. He was assessed for EBV-targeted therapy but did not meet the criteria. In June 2019, he developed a headache and nuchal rigidity. The work-up determined that he had an isolated CNS relapse and on-going evidence of chronic EBV infection with the EBV detectable in blood and cerebrospinal fluid (CSF) (Figs. 3, 4); no additional sites of disease were identified. TIT chemotherapy consisting of methotrexate, hydrocortisone, and cytarabine was started and given twice a week, then weekly, and finally every 3 weeks. After 12 courses of TIT chemotherapy, the CSF still had disease and the plasma EBV load was still elevated; thus atezolizumab was added to the treatment regimen. Craniospinal radiation 3000 cGy to the brain and 2400 cGy to spine was started when it became evident that there was still EBER+ cells in the CSF. Following radiation, his EBV viral load was greatly diminished, but was still detectable albeit not quantifiable. Remarkably, the patient remains clinically well almost 1 year post CNS relapse while continuing on atezolizumab infusions. Discussion and conclusions According to NCCN guidelines, a clinical trial is the preferred treatment option for patients with relapsed ENKTL. In the absence of a clinical trial, PD-1 inhibitors or a stem cell transplant, if the patient is eligible, are suitable alternatives [15]. Our patient previously had an autologous stem cell transplant, as this was the standard of care at the time of his initial diagnosis. In this case, allogeneic transplant was considered in the setting of both relapses. As described above, our patient had a high EBV viral load at the time of his second relapse. A recent study by Jeong et al. indicates that in patients with ENKTL and EBV present in the blood, progressionfree survival after allogeneic transplant trends towards a poorer outcome [16]. In addition, there is no consensus on the use of stem cell transplant in the relapse setting [15,17]. In our patient, the use of a checkpoint inhibitor administered in the context of a clinical trial was the more viable and individualized option since a clinical trial was available at the time of his first relapse. Furthermore, given a combination of psychosocial factors, including lack of funding, the decision was made to proceed with the atezolizumab clinical trial at first relapse. At time of his CNS relapse, the same agent was made available through the Medication Assistance Program (MAP). Allogeneic stem cell transplant was again considered but was rejected as an option since the use of checkpoint inhibitors prior to transplant predisposes patients to develop hyperacute graft-versus-host disease and increases the transplantation-related mortality [15,17]. Although atezolizumab is FDA approved and used in the treatment of other cancer types, it has not been documented in the treatment of relapsed ENKTL with or without CNS involvement [13]. Our case demonstrates the successful use of atezolizumab at first and second relapse. This case also indicates a viable treatment option for those patients with CNS involvement when given in conjunction with TIT chemotherapy and radiation therapy. The median overall survival for patients with ENKTL CNS disease is 3.8 months. Another study reported that patients with peripheral T-cell lymphoma relapse have a median overall survival of 1.5 months [3,7]. Remarkably, our patient has greatly surpassed the median survival. Studies have shown that pembrolizumab, a PD-1 inhibitor, is successful in treating patients with ENKTL relapse. In a study by Kwong et al. of seven patients treated with a median of seven cycles of pembrolizumab, patients with higher PD-L1 expression fared better. Interestingly, five of the patients were still in CR at the end of the 6-month follow-up period [14]. Similarly, Li et al. also reported a positive outcome in four of seven patients treated with a median of four cycles of pembrolizumab [18]. A small number of patients with ENKTL with CNS involvement have been followed to determine specific disease patterns and outcome. Determinants of a higher risk of CNS involvement include Ann Arbor stage III/IV, NK/T Cell Lymphoma Prognostic Index (NKPI) score of III or IV, location of extra-upper aerodigestive tract, and lymph node involvement [3,4]. Our patient exhibited most of the risk factors identified for the development of CNS involvement. Involvement of the CNS in ENKTL historically has a very poor prognosis with no standard treatment identified. A retrospective study by Nevel et al. described the outcomes of patients with ENKTL CNS disease. All patients received methotrexate (MTX) either systemically or intrathecally. Additional treatments varied greatly and included radiation, high-dose systemic chemotherapy, other IT chemotherapy, or autologous stem cell transplant [3]. Many patients were noted to succumb to infection and toxicity due to CNS-targeted treatment [3]. Of interest, our patient experienced few toxicities to atezolizumab alone or in combination with TIT. There are currently no reports on the use of immune checkpoint inhibitors in patients with ENKTL CNS disease. However, there are promising results in other disease types with CNS involvement. Pembrolizumab has been shown to be effective against solid tumor Fig. 4 Atypical lymphocytes in the CSF during treatment with atezolizumab and triple intrathecal (TIT) chemotherapy following second relapse. At the patient's second relapse, atypical lymphocytes were elevated at 1550. With atezolizumab infusion and TIT chemotherapy, the atypical lymphocyte count dropped significantly and remained very low over the course of the treatment metastasis of melanoma and non-small cell lung cancer, with a response rate ranging from 20 to 30% [19]. Similar results for CNS metastasis of melanoma and renal cell carcinoma are also reported for nivolumab [20,21]. Interestingly, nivolumab is observed to be an effective treatment in rare extranodal large B-cell lymphomas of primary CNS lymphoma and CNS recurrence of primary testicular lymphoma [22]. EBV status is important when considering treatment with PD-L1 inhibitors since there is increased expression of PD-L1 in EBV-related cancers. A correlation between increased viral load in the cancer cells and cancer progression has been documented [23]. Of note, after completion of the atezolizumab course for the first relapse, our patient had an increased level of EBV viral load despite treatment with antiviral therapy. However, upon restarting atezolizumab as adjunct therapy to TIT and radiation therapy, the EBV viral load declined significantly. Overall, there is no consensus on CNS prophylaxis in ENKTL, but NCCN guidelines recommend IT chemotherapy for adult T-cell leukemia/lymphoma, which tends to have a higher rate of relapse [7]. In their retrospective review of risk factors for CNS involvement in lymphoma, Kim et al. conclude that patients with NKPI groups III and IV might benefit from prophylaxis; however, this conclusion was based on 12 patients identified with CNS disease [24]. One question raised by our case is whether the continued use of atezolizumab as maintenance therapy could have prevented the CNS relapse. Also, our case indicates that patients with ENKTL with CNS relapse may benefit from treatment with immune checkpoint inhibitors. Taken together, our case and observations from other studies suggest that further investigation is warranted on the use of immune checkpoint inhibitors in maintenance therapy and for treatment of CNS disease. Cytotoxic Activity and Phytochemical Analysis of Artemisia haussknechtii Boiss Cytotoxic activity of crude extract and fractions (petroleum ether, dichloromethane, and n-butanol) of Artemisia haussknechtii aerial parts was investigated by MTT assay. Dichloromethane fraction showed the highest cytotoxic effect on MCF-7 cell line (IC50 = 297.17 ± 7.99 µg/mL). Phytochemical analysis of the most effective fraction was carried out using normal phase column chromatography (CC) to get eight sub-fractions (A-H). Thin-layer chromatography (TLC) and high-performance liquid chromatography (HPLC) were used for further purification. Four known compounds with cytotoxic effects on cancer cell lines were isolated from the most active fraction, including 5-Hydroxy-3',4',6,7-tetramethoxyflavone (eupatilin 7-methyl ether), 5-hydroxy 3,3',4',6,7-pentamethoxy-flavone (artemetin), 6-methoxy-7-hydroxycoumarin (scopoletin), and methyl caffeate. Structure elucidation of isolated compounds was done using spectroscopic techniques, including ESIMS and 1D-NMR (1H and 13C). Cytotoxic activity of A. haussknechtii is probably due to coumarin and flavonoid compounds. Background The genus Artemisia, with more than 500 species, is the largest member of the Compositae (Asteraceae) family, distributed in different areas of Asia, Europe, and North America (1). The inhibitory effects of essential oils, crude extracts, and different fractions of Artemisia against the growth of cancer cell lines have been reported (2). The studies have demonstrated that secondary metabolites, mainly flavonoids, terpenoids, and coumarins, are responsible for the cytotoxic effects in the genus Artemisia (3)(4)(5)(6). Essential oil of A. persica and A. turcomanica inhibited the MCF-7 cell line time and dose-dependently (7). Essential oil of A. annua showed cytotoxic activity on SMMC-7721 cells via inducing apoptosis (8). Essential oil of A. lavandulaefolia exhibited antiproliferative activity against HeLa cells by activating caspase 3 (9). Essential oil of A. vulgaris induced apoptosis in HL-60 leukemic cells and showed anticancer activity with cytochrome C releasing and activating caspases-3, 8, and 9 (10). Dichloromethane extract of A. biennis showed the most effective cytotoxic activity on K562 and HL-60 cancer cell lines by apoptosis induction (11). Similar results have been obtained for A. ciniformis, A. turanica, and A. armeniaca on human cancer cell lines (12)(13)(14). Select fractions obtained from A. ciniformis and A. biennis were assessed for their cytotoxic activity on B16/F10, PC3, and MCF-7 cells and revealed promising results as potential sources of cytotoxic phytochemicals (15). A study on extracts of three samples of A. khorassanica for their cytotoxic activity against AGS, HELA, HT-29, and MCF-7 exhibited that dichloromethane extract was most effective on cancer cell lines. Furthermore, MCF-7 was the most sensitive among other cell lines (16). Objectives Due to the importance of the Artemisia genus for inhibiting the growth of different cancer cell lines, this study investigated the cytotoxicity effect of their crude extract and fractions. In addition, the purification and structure elucidation of compounds responsible for cytotoxic effects of the most effective fraction were done. Plant Material The aerial parts of A. haussknechtii Boiss. were collected from Kurdistan province (Salavat Abad mountain pass), Iran, in November 2018. The sample was identified by Alireza Dolatyari. The voucher specimen (No. 320) was deposited in the Herbarium of the Iranian Biological Research Center, Tehran, Iran. Extraction and Fractionation Shade-dried and grained aerial parts of A. haussknechtii (800 g) were macerated by 70% MeOH/H 2 O (4 × 8 L × 3 days). The crude extract (100 g) was fractionated via liquid-liquid extraction. The crude extract was dispersed in H 2 O, and three solvents (petroleum ether (40:60), dichloromethane, and n-butanol) were used to yield 3, 11, and 65 g of each fraction, respectively. All samples were concentrated using a rotary evaporator under reduced pressure and temperature below 45°C. General Experimental Procedures The chromatographic process was performed using an analytical HPLC system (Shimadzu Lc 10A, Tokyo, Japan) equipped with a photodiode array detector (PDA) and an Ascentis® column (250 × 10 mm i. d., 5 µm). Pre-coated TLC aluminum sheets (silica gel 60 F 254 , Merck, Germany) were applied for monitoring all subfractions under a UV cabinet |
(254 and 365 nm) using an anisaldehyde sulfuric acid reagent to combine similar subfractions. The NMR spectra were recorded on a Varian INOVA (500 MHz) spectrometer using CDCl 3 and DMSO-d 6 as the solvent. The ES-IMS data were obtained from Triple Quad LC/Mass (Agilent technologies 6410, USA). All solvents used in the extraction and purification process were purchased from Merck (German) and Chem lab (Belgium) with laboratory and HPLC grades. Cytotoxicity Assay The cytotoxic effects of crude extract and fractions on the MCF-7 cell line were evaluated by MTT assay. First, 180 µL of medium containing MCF-7 cells was seeded on 96-well plates (approximately 5 × 10 3 cells/well). Each well was treated with a specific concentration of samples (20 µL) after 24 h incubation (37°C and 5% CO 2 ). All samples and media were removed 48 h later. Then, 20 µL MTT (5 mg/mL) was added to each well, and the plates were further incubated for 3 h at 37°C. Finally, 100 µL of dimethyl sulfoxide (DMSO) was added to each well to dissolve formazan crystals. All experiments were repeated three times for each concentration. The optical density (OD) was measured on a microplate reader (BioTek Instruments, USA) at 570 nm. The inhibitory rate of cell proliferation was calculated according to the following formula: Growth inhibition (%) = Where A control is the absorbance of the control group (containing no samples) and A treated indicates absorbance of the sample at 570 nm. The results were reported for each sample as IC 50 (µg/mL). Purification and Structure Elucidation The chromatographic process of the most effective fraction based on cytotoxic results was performed with column chromatography (CC) (L = 100 cm and D = 5.5 cm). A portion of dichloromethane fraction (10 g) moved on silica gel normal phase (230 -400 mesh ASTM, Merck, Germany) column and eluted with the increasing amount of ethyl acetate in chloroform (1:9 -10:0) to get eight subfractions (A-H) (Figure 1). Further purification of C was performed on TLC sheets and mobile phase chloroform: ethyl acetate (9:1) to get compounds 1 and 2 (R f = 0.65, 5 mg, and R f = 0.72, 2 mg, respectively Results and Discussion This study evaluated the cytotoxic effects of crude extract and three fractions on MCF-7 cells by MTT assay. The results showed that the dichloromethane fraction had the most effective cytotoxic effect (Table 1). Nonpolar and semipolar extracts and fractions can be good candidates for cytotoxicity studies of the Artemisia genus. The polarity of the solvent plays a vital role in the extraction process. Dichloromethane is an organic solvent with a low polarity that can extract secondary metabolites with similar polarities, like terpenoids, coumarins, alkaloids, and polymethoxylated flavonoids. These types of phytochemical compounds can be responsible for cytotoxic effects on cancer cell lines (11,12,23,24). Also, some mechanisms have been proposed for exerting cytotoxic effects of dichloromethane fractions and their isolated compounds, such as increasing the level of Bax protein, cleavage of PARP protein, and formation of DNA fragments (11,14). Phytochemical analysis of the fraction with the most cytotoxic effects led to the isolation of eupatilin 7-methyl ether (1), artemetin (2), scopoletin (3), and methyl caffeate (4). Spectroscopic Data of Isolated Compounds Compound (1) Polymethoxyflavones (PMFs) belong to flavonoid compounds with two or more methoxy groups in the structure, imposing anti-inflammatory and anticancer pharmacological effects. Acetylation and hydroxylation of PMFs have been shown to reduce lipophilicity and improve their pharmacological effects. The in vitro and in vivo studies have revealed potent cytotoxic activity of these compounds in all three stages of cancer cells formation (initiation, promotion, and progression) (37). Eupatilin 7-methyl ether and artemetin are polymethoxyflavones that have been found in various Artemisia species (31,(38)(39)(40)(41)(42)(43). Eupatilin 7-methyl ether has shown moderate cytotoxic effects against Hep-G2, MCF-7, and HeLa cell lines with IC 50 values of 28.3, 9.5, and 10.1 µg/mL, respectively (29). While up to 100 µM of this compound had no cytotoxic effect, 200 and 300 µM have exhibited significant cytotoxic effects against human normal fibroblast cells (BJ-1) (44). Eupatilin 7-methyl ether isolated from A. argyi has shown a significant protective effect on contrast-induced nephrotoxicity by iodixanol in LLC-PK1 cells (38). Scopoletin belongs to coumarin compounds and has been found in A. annua and A. incisa (45,46). Many pharmacological effects have been reported for scopoletin, such as antibacterial, antifungal, antioxidant, and antiproliferative (47). Scopoletin, isolated from the ethyl acetate extract of A. argyi, showed outstanding antiproliferative activity against CCRF-CEM leukemia cells with an IC 50 of 2.6 µM (48). Methyl caffeate has been reported from A. integrifolia, A. argyi, and A. annua (49)(50)(51). In vitro studies have shown significant cytotoxic activity of cinnamic acid derivatives, like methyl caffeate, on different cancer cell lines (IC 50 ≤ 5 µg/mL) (52). Conclusions To the best of our knowledge, this is the first report on cytotoxic activity and phytochemical analysis of total extract and fractions of A. haussknechtii, which resulted in the isolation of compounds with cytotoxic potential on cancer cell lines. Various compounds isolated from this plant, especially polymethoxyflavones, can be considered for further studies. Sphincter preservation in patients with low rectal cancer: striking the right oncological balance Background The surgical treatment options for low rectal cancer patients include the Abdominoperineal Resection and the sphincter saving Low Anterior Resection. There is growing evidence towards better outcomes for patients being treated with a Low Anterior Resection compared to an Abdominoperineal Resection. Objective The aim of this study was to evaluate the short term and oncological outcomes in low rectal cancer treatment. Design This is a retrospective cohort study of prospectively collected data. Setting Rectal cancer patients from a single center in the United Kingdom. Patients Patients included all low rectal cancer patients (≤ 6 cm from the anal verge) undergoing Low Anterior Resection or Abdominoperineal Resection between 2006 and 2016. Outcome measures To identify differences in postoperative complications and disease free and overall survival. Results A total of 262 patients were included for analysis (Low Anterior Resection n = 170, Abdominoperineal Resection n = 92). Abdominoperineal Resection patients were significantly older (69 versus 66 years), had lower tumours (3 versus 5 cm), received more neo-adjuvant radiation, had longer hospital stay and more complications (wound infections and wound dehiscence). Low Anterior Resections had a significantly higher number of harvested lymph nodes (17 versus 12) however there was no difference in nodal involvement and R0 resection rate. No significant difference was found for recurrence, overall survival and disease free survival. Limitation Retrospective review of cancer database and single center data. Conclusion In the treatment of low rectal cancer Abdominoperineal Resection is associated with higher rates of postoperative complications and longer hospital stay compared to the Low Anterior Resection, with similar oncological outcomes. Introduction Once the classical paradigm for rectal cancer treatment was; 'The lower the cancer, the worse its prognosis' . Nowadays equivalent oncological outcomes can be achieved for all rectal cancer patients, no matter its height and even with sphincter preserving options. The first one to describe the APER or Abdomino Perineal Excision of Rectum was Sir W. E. Miles in 1908 and for a century this procedure remained the gold standard for the treatment of cancers of the lower rectum. This article was presented as an poster presentation on the BASO-The Association for Cancer Surgery Annual Scientific Meeting, 16th-18th November 2019 Over the last few decades the surgical management of distal rectal cancer has shifted from the traditional APER or Miles procedure to low or even ultralow sphincter-preserving anterior resections (LAR, uLAR) [1,2]. These changes have been facilitated by the widespread application of the Total Mesorectal Excision (TME) principle [3], better stapling devices [4], recognition of the prognostic importance of an involved circumferential resection margin (CRM) (rather than the distal resection margin) and the increasing use of neoadjuvant (chemo)radiotherapy for locally advanced rectal tumours [5,6]. At present, a safe margin is considered to be a distal mural margin of 1-2 cm [7]. For low rectal tumors a one cm distal margin is accepted because distal intramural spread occurs over 1 cm in only 4% to 10% of the cases [8,9]. This knowledge, that a distal margin of 1 cm is considered to be oncologically safe, means that in theory an anastomosis can be made at almost any level in the pelvis [6]. Whenever safe margins cannot be achieved, a non-restorative procedure is still the treatment of choice. Such is the case when the CRM is involved, with involved Extra Mural Vascular Invasion (EMVI), locally advanced lesions with poor response to neoadjuvant therapy and with tumours with external sphincter or levator ani muscle invasion [10,20]. Consequently, sphincter-preserving surgery has now become a priority with many units publishing APER to LAR ratio of 1:3 or 1:4 in recent times [11][12][13]. Furthermore the intersphincteric resection technique offers reconstructive surgery in patients with a tumor close to or even in the anal canal without compromising local control and survival. Radical oncological surgery still remains the main goal of the surgical treatment; however functional outcome, both short and long term, must be considered in the balance. Several studies have shown that quality of life in patients treated with APER is not inferior to LAR, despite the presence of a permanent colostomy [14]. In case of a low or ultra-low anastomosis the possibility of incontinence or low anterior rectum syndrome (LARS) should also be considered [15]. Thus it still remains an argument of debate whether those patients with lower rectal cancer eligible for surgical treatment or better treated with the non-restorative APER or sphincter saving LAR. The aim of this analysis is to compare outcomes between sphincter preserving surgery and APER in a single center series of low and ultralow rectal cancer patients, stratified by stage, looking at oncological adequacy of resection, morbidity and short-term results. Patients and methods Between September 2006 and December 2016, all patients undergoing TME surgery with curative intent for low rectal cancer (up to 6 cm from the anal verge) at Queen Alexandra Hospital in Portsmouth (UK) were included in this retrospective analysis of a prospectively collected database. All included patients underwent digital rectal examination, sigmoidoscopy and staging with computer tomography (CT) of the chest and abdomen and magnetic resonance imaging (MRI) of the pelvis and/or endoanal ultrasound for preoperative staging. Patients were offered surgery following a consensus decision by the local Colorectal Multidisciplinary Team (cr-MDT) after deciding the need for neoadjuvant chemoradiotherapy (CRT). Long course chemoradiotherapy was given to T4 rectal cancers or those with a threatened or involved circumferential resection margin (CRM) on MRI. Curative resection was performed either by an open approach or laparoscopically according to the TME principle. Curative being defined as no macroscopic cancer left within the abdomen at time of surgery. The choice between an open and laparoscopic procedure was dependent upon the surgeon's experience and preference for that particular patient. APER or LAR decision was made after detailed consultation with the patient and analysis of their preoperative scans and examination findings with regards to the tumor height and distance from the anal verge. 3 mortality (defined as either in-hospital mortality or death within 30 days of surgery in case of earlier discharge), length of hospital stay and post-operative complications using the Clavien-Dindo classification. Survival data was last updated on the 30th of June 2017. Disease-free survival was defined as the time from the date of primary treatment (surgery) to the date of first recurrence, be it local, systemic or both if they had occurred 6 months apart. Overall survival was defined as the time from the date of the primary treatment to the date of death. Patients were divided into 2 groups according to the type of procedure, the LAR and the APER group. Study outcomes The primary study outcome was the long-term oncological outcomes (survival, recurrence and disease free survival) in patients who had low rectal cancer surgery. Secondary outcome was short term outcomes, including peri-operative complications, following rectal surgery. Statistical analysis Statistical analyses was performed using SPSS version 22.0 (SPSS Inc., Chicago, IL, USA). Data was expressed as median with inter-quartile ranges. Intergroup comparisons were made using a Mann-Whitney U test for continuous variables or chi squared or Fishers exact test for categorical variables. A difference with a p value < 0.05 was considered significant. Kaplan-Meier survival plots |
and the log rank test were used to compare disease-free and overall survival between the two groups. Cox regression analysis was performed on all available factors. Clinicopathologic features A total of 270 patients were identified to have surgical treatment for low rectal cancer during the study period. Eight patients were excluded from further analysis due to incomplete data and lack of follow up. Thus, data from 262 patients who underwent a curative surgical TME resection for low rectal cancer were reviewed (Fig. 1). Of these, 170 patients underwent LAR and 92 patients were treated with APER. The majority of the resections were performed laparoscopically (LAR 82.4%, APER 68.5%), by highly experienced surgeons assisted by a senior registrar/fellow. Patient characteristics and treatment details are summarized in Table 1. Overall, the majority of patients was male (72%) with no significant difference in the male/female distribution between the groups. Patients in the APER group were significantly older, p = 0.040, with no significant difference in ASA score and BMI. The APER group had a significantly lower tumor height (3 cm in APER vs. 5 cm in LAR, p < 0.001). When comparing the distribution of the pre-operative MRI T and N stage, the two groups showed no significant difference. However, significant more APER patients had pre-operative radio-and chemotherapy, (p = 0.001 and 0.020 respectively). Oncological and long-term outcomes Median tumor size was similar in both groups, p = 0.253. The absolute R1 rate (microscopic tumor infiltration of the margin) was higher in the APER group, albeit not reaching statistical significance, p = 0.085. The LAR group had a significantly higher number of harvested lymph nodes (LN) compared to the APER group, p < 0.001. However, there was no difference in lymph node positivity between the two groups, see Table 2. The median survival was 55 months in the APER group versus 49 months for the LAR group, although non-significant, p = 0.514 (Fig. 2). The overall recurrence rate (local and distant) was 17.6% in the LAR group compared to 23.9% for APER, p = 0.257. There was no difference either in the local recurrence or in the distant recurrence rate between the 2 groups (p = 1.000 and 0.215 respectively). There was also no significant difference in disease-free survival between the two groups (p = 0.455, Fig. 3). R1 resection was found to have a negative impact on survival and recurrence disease (Figs. 4 and 5). Furthermore, T stage and N stage was found to have a negative impact on patient survival (Figs. 6 and 7). Short term outcomes Patients in the APER groups had a significantly longer length of primary hospital stay compared to LAR patients, p < 0.001. Overall, the post-operative complications rate was higher in the APER group compared to the LAR group, Table 3. Amongst both groups only one APER patient died of a myocardial infarction within 30 days of the operation. Ten LAR patients had to return to theatre, 6 for an anastomotic leak, 2 cases for abdominal sepsis and 2 cases for loop ileostomy related complications. In the APER group, again, 10 patients had to return to theatre, but for different reasons; 4 patients for stoma related complications, 3 cases for intra-abdominal sepsis and 3 patients needed a small bowel resection. The LAR group had 22 patients who had anastomotic leakage (13%), of which 6 had to return to theatre, 2 had a percutaneous drainage and the remnant patients were treated conservatively. All 22 cases had been given a defunctioning loop ileostomy during the first operation. Major complications (Clavien Dindo grade III and IV) occurred in 49 patients of the entire cohort (19%), but a major complication did not have a negative impact on long term survival, Fig. 8. During last follow up, 99/170 (58.2%) in the LAR group had their loop ileostomy reversed. 19 cases (14%) from the APER group had developed a symptomatic parastomal hernia. Discussion Rectal cancer patients still often experience surgical complications, regardless of the important progress made so far within both techniques and perioperative management. In this study, considerable short-term survival benefits in favor of the LAR group were achieved. Overall, post-operative complication rate was higher in APER group which was mainly caused by the high incidence of perineal wound failure and they had a significantly longer length of primary hospital stay compared to LAR patient (median 12 vs. 7 days, Table 3). The anastomotic leak rate in LAR was 13%. The most common complication of APER is perineal wound failure and can be as high as 30% [16]. Anastomotic leakage is considered to be the major complication of restorative LAR with studies reporting an average leakage rate of 11-12% in high volume centers following rectal cancer surgery which is comparable with our AL rate [17]. However, it is demonstrated that the postoperative complications such as pelvic sepsis, urinary and sexual dysfunction, are higher in the APER group than in the LAR group [17]. In this study we achieved a sphincter-preservation rate of 50% in low rectal cancers and believe that this should remain a priority since only an average of 20% of patients in the APER group is satisfied with having a permanent colostomy [14]. In fact, patients undergoing APER have restrictions in their postoperative Quality of Life, such as body image, which can lead to altered social life [14,15]. However, in elderly patients with more distal, more locally advanced disease that requires radiotherapy, as our data show, APER performed with appropriate skill, remains a safe option. For the oncological outcome, the achievement of technical excellence in TME surgery at our center is reflected in the low local recurrence rates in both surgical groups when compared to other studies. For instance, a meta-analysis from 2015 suggested that compared to APER, LAR has better 5-year survival rates, lower CRM rates, less local recurrence and less complications [18]. CRM involvement is a recognized prognostic factor for local recurrence. Patients who undergo APER have shown to have a higher incidence of CRM involvement [18,19] and has, unfortunately, not diminished with TME. The distance from the anal verge is related to the completeness of TME, because of the greater challenge of performing a perfect resection with adequate margins low down in the pelvis. TME surgery cannot always be carried out down to the levator muscles plane in APER because of the presence of a large tumor. CRM involvement in the APER specimens is often related to the removal of less tissue at the level of the tumor because of a different resection plane. However, the lower cancers elected for APER may be associated with a different pattern of lymphatic spread, which is not included in the tumor package harvested with TME [18,19]. We believe that in selected low rectal cancer patients, APER is a better option than LAR. In current literature, despite rigorous methodology, the intrinsic limitation/bias of the studies should be considered, and conclusions interpreted with caution. The APER tumors are usually closer to the anal verge and more bulky. Although the patients in the LAR and APER groups are comparable in terms of age, tumor stage, and neoadjuvant treatment and the distribution of tumor stage, however, it would not be possible to eliminate this bias as bigger tumors would tend to undergo a Miles procedure, as sphincter saving would not be attempted. The extent of tumor spread in itself is therefore unlikely to account for the increased surgical margin involvement, consequent local recurrence and lower survival in the APR group. Conclusion In conclusion, our single centre findings show that LAR has a similar oncological outcome for low rectal cancer when compared to APER. However, APER is associated with a higher rate of post-operative complications and longer hospital stay. A tailored approach suited to the individual patients needs supported by the multidisciplinary team should be recommended. Ageism and loneliness in the subjective perceptions of elderly people from nursing homes and households Background. Ageism and loneliness in old age are largely dependent on the social causes that force elderly people to seek long-term care in nursing homes. Objectives. To study and assess the phenomenon of ageism and the experience of loneliness based on the perceptions of elderly people from nursing homes and households. Material and methods. Elderly people (42 women and 20 men) aged 65+ (76,0 ± 5,24) years were examined. Group I included 29 people living in a nursing home, while group II included 33 people living in households. The levels of ageism were evaluated according to the Fraboni scale, while the experience of loneliness was evaluated based on the UCLA method. Results. We found that the level of ageism was classified as neutral in 80% of the respondents and did not differ significantly in the groups. Only the classification “alienation, avoidance” in the Fraboni scale was expressed more in group II ( p < 0.05). Group I informants were twice as likely to experience a high level of loneliness ( p < 0.05). For respondents from nursing home, a high level of loneliness was facilitated by the phenomenon of the closed structure of institutions of social services. For those living in households, the experience of loneliness was more typical in connection with the manifestations of ageism in the form of gerontostereotypization, discrimination and especially alienation-avoidance. Conclusions. Manifestations of ageism and loneliness were identified among the elderly in both groups and each have their own char -acteristics. The high level of loneliness and ageism among the elderly should be considered as factors contributing to the emergence of psycho-emotional disorders. Background The aging of the population poses serious challenges to public health and the social policy of the state [1]. Old age is just beginning to be understood as a period that conceals great reserves and opportunities [2,3]. Representatives of the 65+ age group are a special social group and require attention not only from the family but also from society as a whole [4]. Thanks to the progress of medicine in the prevention, diagnosis and treatment of diseases, including diseases associated with age, most people over 65 years continue to be socially active. Unfortunately, some older adults reduce their previous activities for various reasons, which often leads to the loss of social contacts and loneliness [5]. Most people would like to live in their own home, cared for by their family, not strangers, and not to become a burden to their relatives. Unfortunately, this is not always possible due to difficult life situations (loss of house or restrictions in self-care) or the refusal of children to take care of their parents. An increase in life expectancy and an increase in the number of older adults is likely to increase the demand for long-term social services [6]. The living conditions of the elderly in specialized institutions do not always meet the modern criteria of comfort and preservation of the dignity of old age [7]. The relevance and significance of the research topic specifies the growing number of older adults who apply to social service institutions. It is known that older adults who find themselves in new conditions of living in an nursing home are forced to abandon their usual way of life, reduce the level of social claims, part with their hopes and plans, move to a different social status, revise the existing system of values and change the usual style of interaction between people. Limited external access to clients of nursing homes contributes to higher levels of loneliness and ageism among the elderly [8]. Robert Butler defined ageism as the social stereotyping and discrimination of people based on age [9]. Most often, gerontological ageism is associated with a biased attitude towards the elderly, as a type of social discrimination, including negative, dismissive or degrading attitudes, together with practices implemented on the basis of negative age stereotyping and avoidance [10,11]. Deeply rooted social attitudes towards older adults is a serious obstacle to the full realization of the need for communication, which is subjectively assessed as loneliness [12,13]. Loneliness is usually understood as a negative socio-psychological experience that occurs as a result of inadequate satisfaction of the social needs of the individual, the consequence of which is a feeling of uselessness, abandonment and loss of emotional connection with others [14]. The reality of aging is connected to many causes of loneliness [13]. Thus, in |
longitudinal studies, the relationship between the experience of loneliness and subjectively perceived disadvantage in society is revealed [10]. Often, loneliness is characterized by the presence of individual experiences of varying intensity, which have a predominantly negative emotional coloring [15]. the hypothesis of the study is that the level of gerontological ageism and the experience of loneliness in a sample of elderly adults living in a nursing home and their peers living in households have their own characteristics in subjective perception and may be related to the phenomenon of privacy in Russian social service institutions (nursing homes). Objectives to study the phenomenon of ageism and the experience of loneliness, to assess the comparative aspect of subjective perception level for these phenomena among elderly people from nursing homes and households. Study design The study sample is represented by two groups of elderly people with age-related diseases without disability within the 65+ age group. The sample included a total of 62 people (42 women and 20 men). Group I included 29 elderly adults who lived in public nursing home in Krasnoyarsk (at least 360 days). The living conditions were satisfactory, apartment-by-apartment accommodation of the hostel type. The standard of this type of social institutions provides for the services necessary for the elderly (with usual source of care). Group II included 33 elderly adults living in households. Inclusion criteria: men and women aged 65+ with age-related illnesses in remission, permanently living in a nursing home (at least 360 days) or in a household. Exclusion criteria: acute and chronic infections; diseases of the central nervous system: metabolic, oncological, etc., as well as TBI, epilepsy, psychosis; somatic diseases (III degree hypertension, ischemic heart disease, bronchial asthma, diabetes, etc.); taking sedatives, antidepressants, alcoholism and drug addiction. People aged 65+ were enrolled in the study after obtaining their written consent. Data collection The research was conducted in 2020. Before starting the follow-up, all the participants were informed about its goals and methodology. The respondents were also confident in complete anonymity and voluntary participation in the survey. The Fraboni Ageism Scale This project used the generally accepted method of assessing ageism based on the Fraboni scale [16] in its Russian-language interpretation [17]. The value of Cronbach's alpha for all factors exceeded 0.80 (varying across scales from 0.75 to 0.86). Respondents were asked to rate 25 standard statements about elderly people. For the answers, a 4-point psychometric Likert scale was used. The total score was based on the answers to the questions of three classical scales: "Age stereotypes and prejudices", "Discrimination and negative emotional attitudes" and "Alienation, avoidance". A higher total score indicated a greater age bias towards oneself and peers. UCLA Loneliness Scale To diagnose the subjective perception of loneliness, we used the generally accepted scale of ucLA (university of california Los Angeles) by D. Russell and M. Ferguson, which is used to study a mainly one-dimensional approach to determining the perception of loneliness in a predominantly negative light [18]. Cronbach's α coefficient of the questionnaire is 0.79. The scale uses 11 negatively ("lonely") and 9 positively ("not alone") rated statements. The total indicator allows you to diagnose a construct with the following factors: lack of unity with others; lack of interpersonal contacts with relatives; alienation, isolation; dissatisfaction with the quality of relationships with others [19]. All this can be interpreted as a state of forced isolation and as a desire or need for solitude. Ethical considerations All procedures performed in the studies involving human participants were in accordance with the ethical standards of the institutional research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. the study did not infringe upon human rights and did not endanger the respondents. it also met the requirements of biomedical ethics: reviewed and approved in accordance with the GCP rules by the Scientific Research Institute of the North Medical Problems, Siberian Branch of the Russian Academy of Sciences, Krasnoyarsk, Russia (06.06. 2020, N6). Statistical methods The statistical software package Statistica 13 PL (StatSoft, uSA) was used for classical statistical processing and searching for significant dependencies of indicators in the studied groups. The correspondence of the obtained values to the law of normal distribution of the variation series was preliminarily evaluated using the Shapiro-Wilk W-statistical test. Since the final quantitative indicators on all scales and the total levels of ageism and loneliness experience had a different distribution from the norm, nonparametric evaluation criteria were used for processing and interpreting the results. Descriptive statistics included the median, the minimum and maximum values and the interquartile range-IQR (difference value of 25 top 75 lower quartiles). In addition, the following generally accepted indicators were used: the arithmetic mean (Mean), together with the standard deviation (SD). The formula for the Wilson score interval was applied when calculating 95% CI for level of loneliness. To assess the reliability of the differences between the two groups of respondents, the Mann-Whitney U-test was used. In all analyses, a p-value less than 0.05 was considered statistically significant. In addition, to determine possible natural groupings and the main dependencies between the indicators of the primary scales of the questionnaires, an exploratory factor analysis using the principal component analysis (Exploratory Factor Analysis -EFA) [20] was conducted. The calculations were performed in the statistical data analysis environment R (r-project.org, version 4.0.3). The analyzed data set was an array of indicators of the primary scales of both questionnaires. The indicator of an informant belonging to the group of elderly people in inpatient social service institutions and those living in a household was not included in the analysis but was used only for marking respondents correlated according to the results of the exploratory factor analysis. Results There were no differences in age (76.6 ± 6.18 vs 75.5 ± 4.66 years) and gender (34.5% of men in group I and 30.3% in group II). Descriptive results of gerontological ageism and loneliness by group are presented in Table 1. Of the three Fraboni scales, only the "alienation, avoidance" scale showed statistically significant differences between the groups, with a more pronounced indicator in people living in households (p < 0.05). There were no significant differences in the total ageism index. the experience of loneliness is significantly more pronounced in group I informants compared to group ii (p < 0.05). According to the data obtained using the UCLA scale, respondents in each of the groups were identified who showed different levels of loneliness experience in the range from 20 to 80 points. A low level (less than 40 points) was not observed among the respondents of both groups. An average level (40-60 points) was observed in 48 people (77.4%). A high level (more than 60 points) was found in 14 respondents (22.6%). The ranges of the level of loneliness experience in the respondents in the study groups are presented in Table 2. Table 3 shows the leading statements on the ageism and loneliness scales where there were statistically significant differences between groups. the selected main component of the exploratory factor analysis determines the separation of the two groups of elderly adults. According to the semantic component of the statements of the scales of both questionnaires that "load" the main component, the most appropriate manifestation of the differentiating factor is polarization on the conditionally selected scale "extraversion-introversion". In the area of the extreme pole of the "extraversion" scale, the indicators of elderly people from the nursing home are predominantly clustered. in the area of the opposite pole ("introversion"), the peers from households were largely clustered. Key results The present study identified factors that contribute to the occurrence of psycho-emotional disorders among elderly people from nursing homes and households. For group i, these are the objective factors of experiencing loneliness (constant stay in a permanent facility). For group II, these were subjective factors (associated with a lack of motivation for active life, negative social stereotypes or low self-esteem, most often due to the fear of being criticized, failing in a relationship or becoming psychological dependent). The results of the most pronounced factors for each of the studied groups of elderly people were confirmed statistically (p < 0.05). Interpretation elderly people living in nursing homes and in households demonstrate the specificity of the severity of the characteristics and features of the subjective perception of the phenomenon of ageism and loneliness. Subjectively experienced ageism and loneliness in the responses of elderly people from nursing homes and households In general, in both groups of respondents, the total ageism index can be described as neutral or close to positive (about 80%). Therefore, it is reasonable to assume that the severity of ageism will decrease with the transformation of society and the Informants with medium and, especially, high levels of ageism, as expected, were significantly less likely to recognize the social significance of themselves and their peers in society. The revealed manifestations of ageism and feelings of loneliness coincide with the results presented in literature [8,[21][22][23]. Exploratory factor analysis using principal component analysis and the results of basic statistics The conducted exploratory factor analysis showed that the entire set of correlations of respondents' indicators in the data set of the primary scales of both questionnaires was reduced to only three mutually independent factors, and only one of them described the division into groups. The greatest contribution to the factor describing the division into groups (the coefficients were standardized by normalization -bringing the standard deviation to 1) is shown by the following components of the Fraboni and UCLA questionnaires, according to the ranking by the absolute value of the contribution. Elderly people living in nursing homes differ both in some of the statements in the Fraboni scale and in the statements specific to the experience of loneliness (UCLA): • "Elderly people should feel welcome at the social gatherings of young people"; • "Many elderly people are stingy and hoard their money and possessions"; • "I am a contact and sociable person"; • "I have a lot in common with the people around me"; • "I have no one to whom I could (la) turn". the results indicate that this group of respondents has a fairly positive image of an elderly person who has something to share with others and is open to communication. the indicator of loneliness experience in the studied groups of elderly people is at an average level. The proportion of respondents with a high level of loneliness is greatest in the 1 st group. For those living in households, the statements of the Fraboni scale are typical in descending order: №17 "It is best that elderly people live where they won't bother anyone" (with a negative contribution of 0.35); № 6 "I sometimes avoid eye contact with elderly people when I see them" (with a negative contribution of 0.32); №16 "Most elderly people should not be trusted to This will allow us to analyze the phenomenon of ageism and loneliness in the subjective perception of elderly people living in nursing home and households. A limitation was the low samples size, limiting statistical power. Another limitation was lack of control for confounding. There may be other characteristics that are responsible for the results found. Conclusions The present study examined and evaluated subjectively experienced ageism and loneliness in elderly people living in nursing home and households. Practical recommendations can be extended to clients of the nursing home rehabilitation unit. 1. Manifestations of ageism and loneliness were identified among the elderly in both groups, and each group had their own characteristics. 2. For respondents from a nursing home, the frequency of occurrence of a high level of loneliness was twice as high as for peers from households. This was facilitated by the phenomenon of the closed structure of nursing homes as institutions of the domestic structure of social services. 3. For those living in households, the experience of loneliness was more typical in connection with the manifestations of ageism in the form of gerontostereotypization, discrimination and, especially, alienation-avoidance. 4. the high level of loneliness and ageism among the elderly should be considered as factors contributing to the emergence of psycho-emotional disorders. take care of infants" (with a negative contribution of 0.30); № 1 "Teenage suicide is more tragic than suicide among the elderly" (with a negative contribution of 0.27)"; №22 "I would prefer not to live with an elderly person" |
(with a negative contribution equal to 0.23); and № 24 "Elderly people complain more than other people do" (with a positive contribution equal to 0.21). This may indicate that this group of respondents has a negative image of an elderly person who looks unreliable and socially neglected. In this group, there are a number of psychological factors that contribute to loneliness. Avoiding contact with other people, most often because of the fear of being criticized, failing in a relationship or becoming psychologically dependent, which in turn leads to a drop in self-esteem and, as a result, alienation. People with poorly developed interpersonal skills also often tend to be lonely, especially if they already have bad experiences with other people. The experience of loneliness and its relationship with the reduction in the frequency of social communication can be considered as a reaction to the accelerated discriminatory stereotypes and other manifestations of ageism in society. The data is consistent with literature [24][25][26]. Generalizability In this study, when studying the experience of ageism and loneliness, the most pronounced factors contributing to the occurrence of psycho-emotional disorders were identified. Special attention was paid to elderly people living in a nursing home due to the phenomenon of private institutions of the social service structure. Specific objective criteria indicating high levels of their experience of loneliness were identified. In this context, 31% of the elderly in group I and 15% of those in group II are most likely to develop psycho-emotional disorders. Limitations of the study The participants agreed to participate and presented with vital energy, activity and an unwillingness to give in to age, which may limit generalizability. Our research was conducted not only in Russia but also in Poland, Belarus and Lithuania. Loss of Myelin Basic Protein Function Triggers Myelin Breakdown in Models of Demyelinating Diseases Summary Breakdown of myelin sheaths is a pathological hallmark of several autoimmune diseases of the nervous system. We employed autoantibody-mediated animal models of demyelinating diseases, including a rat model of neuromyelitis optica (NMO), to target myelin and found that myelin lamellae are broken down into vesicular structures at the innermost region of the myelin sheath. We demonstrated that myelin basic proteins (MBP), which form a polymer in between the myelin membrane layers, are targeted in these models. Elevation of intracellular Ca2+ levels resulted in MBP network disassembly and myelin vesiculation. We propose that the aberrant phase transition of MBP molecules from their cohesive to soluble and non-adhesive state is a mechanism triggering myelin breakdown in NMO and possibly in other demyelinating diseases. primary mouse oligodendrocytes at DIV 5 with the calcium ionophore ionomycin (10 µM, 1 or 2 mins) and subsequent immunostaining for MBP in green and with QD9 in red. (B) Quantification of the MBP to QD9 ratio of integrated density (n=3, >80 cells per condition, **=p<0.01, one-way ANOVA). (C) Representative images of MBP staining in green and PIP2 stain in red of oligodendrocytes at DIV 5 after 10 µM ionomycin treatment for 2 mins. (D) Quantification of the MBP to PIP2 ratio of integrated density (n=3, >80 cells per condition, ***=p<0.001, Student's t-test). (E) Images representative of oligodendrocytes at DIV 5 after treatment with 100 µM sphingosine for 5 mins stained for MBP in green and QD9 in red (zoom in in the white box, scale bar 25 µm) and in (F), the quantification of the MBP to QD9 ratio of the integrated density (n=3, >80 cells per condition, **=p<0.01, ***=p<0.001, Student's t-test). All graphs show the mean with SEM. (G) Acute brain slices of mouse brains were treated with 50 µM ionomycin in aCSF and subsequently stained with MBP (green) and QD9 (red) (scale bar 200 µm). (H) Quantification of the MBP to QD9 integrated density ratio (n=3 animals, 3-5 regions of same size per animal,***=p<0.001, Student's t-test). (I) Representative electron micrographs of high-pressure frozen samples after 30 mins ionomycin treatment (scale bar 500 nm). (J) Quantification of percentage of vesiculated myelin sheaths over ionomycin treatment time course (50 µM, 5 to 30 mins). Bars shown mean with SEM (n=3 animals, >200 axons per animal, ***=p<0.001, one way ANOVA). Supplemental Experimental Procedures: Experimental autoimmune encephalomyelitis (EAE) Biozzi ABH mice were obtained from Harlan UK Ltd. (Bicester, UK). Mice were injected subcutaneously with 50 µg recombinant MOG emulsified in complete Freund's adjuvants (CFA) on d0 and d7. Furthermore, the animals received an i.p. injection of 50 ng pertussis toxin (PTX) (List Biological Laboratories, Campbell, USA) on d0, d1, d7 and d8. The animals were scored daily for the development of paralytic disease and processed for electron microscopy at the peak of the first relapse. Cuprizone treatment For cuprizone time course studies, eight week old, male wild type (WT) C57B6N mice were fed with 0.2 % cuprizone (Sigma-Aldrich, Munich, Germany) in powered chow18. The animals were weighed once per week and if the body weight dropped below 20 % of the starting weight, the animal was euthanized. The animals were treated for a maximum of 5 weeks, and every week, one set of animals was perfused for histological studies, whereas the other set was processed by high pressure freezing for electron microscopy. Acute slices of lesion site of AQP4 antibody injected Lewis rats After injection of Lewis rats with AQP4 antibody and complement, rats were decapitated. Coronal slices were cut using a Leica VT1200S Microtome (Leica) at 200 μm thickness in ice-cold cutting solution containing the following: 130 mM NaCl, 3.5 mM KCl, 10 mM MgSO4, 0.5 mM CaCl2, 1.25 mM NaH2PO4, 24 mM NaHCO3, and 10 mM glucose with pH 7.4. Acute slices were allowed to recover in artificial CSF (aCSF) containing 148.2 mM, NaCl, 3.0 mM KCl, 1.4 mM CaCl2, 0.8 mM MgCl2, 0.8 mM Na2HPO4 and 0.2 mM NaH2PO4) at 35°C for 1h. The slices were then treated with 25 mM EGTA in aCSF or aCSF alone for 2h at RT. ACSF was continuously bubbled with carbogen (95% O2 and 5% CO2) gas. The acute slices were then fixed with 4% PFA and subsequently stained with guinea pig GFAP (Synaptic Systems) to identify the lesion site, mouse QD9 (Abcam) and rabbit MBP (Dako). For treatment with ionomycin, the recovered slices were incubated in 50 µM ionomycin (dissolved in aCSF) at 35°C for 5 to 30 mins. Afterwards, the sections were processed for immunohistochemistry or for electron microscopy. Immunoelectron microscopy Immunoelectron microscopy was carried out as described previously (Werner et al., 2007). The brain sections were immersion fixed in 4% PFA with 0.25% glutaraldehyde, after infiltration with 2.3 M sucrose overnight, mounted on aluminium pins and snap-frozen in liquid nitrogen. The ultrathin cryosections were cut with a Leica UC6 cryoultramicrotome (Leica, Vienna, Austria) using a cryoimmuno diamond knife (Diatome, Biel, Switzerland). The immunolabeling was performed as described previously (Peters and Pierson, 2008) using anti-MBP (Dako, rabbit, 1:300) or anti-PLP A431 (Sigma-Aldrich, rabbit, 1:250). The rabbit antibody was detected using protein A gold (10 nm, CMC, Utrecht, Netherlands) at a dilution of 1:20 for 20 min. The sections were imaged with a LEO912AB electron microscope (Zeiss, Oberkochen, Germany) equipped with a 2k CCD camera (TRS, Moorenweis, Germany). The quantification of the labels was on >70 axons, where the gold particles for the compact myelin were counted and divided by the label obtained in vesiculated myelin. Cell culture, transfections and treatments Primary cultures of mouse oligodendrocytes were prepared from postnatal day zero (P0) mice as described previously (Trajkovic et al., 2006). In brief, the oligodendroglial progenitor cells growing on top of a monolayer of astrocytes were obtained via differential shaking. After their harvest, the cells were cultured on PLL-coated dishes or coverslips with minimum essential media containing B27 supplement, 1% horse serum, L-thyroxine, glucose, glutamine, penicillin, streptomycin, pyruvate and bicarbonate (SuperSato-B27). Treatment of the oligodendrocytes DIV 5 was carried out with 10 µM ionomycin in Krebs-Ringer solution (120 mM NaCl, 4.7 mM KCl, 10 mM glucose, 20 mM HEPES, 1.2 mM CaCl 2 , 0.7 mM MgSO 4 , pH 7.4) by first washing the cell layer in Krebs-Ringer without CaCl 2 and then incubating with 10 µM ionomycin for 1-2 min in Krebs-Ringer with CaCl 2 . Treatment of oligodendrocytes at DIV 5 with 100 µM sphingosine was carried out for 5 min in serum-free media. The viability of the cells was assessed using the MTT assay. Cells were fixed after treatment or transient transfection with 4% PFA with 0.25% glutaraldehyde and stained with MBP and QD9 or PIP2 or CNP. PtK2 cells were cultured in DMEM with 4.5 g/L glucose supplemented with 10 % FCS, 2 mM GlutaMAX, 1 mM pyruvate and 50 units/mL of penicillin and streptomycin. The adherent cells were split on a regular basis with 0.05% trypsin-EDTA. For transient transfections, the TransIT-LT1 transfection reagent (MoBioTec, Göttingen, Germany) was used according to the manufacturer's protocol. Immunofluorescence and microscopy Immunocytochemistry was carried out was described previously (Trajkovic et al., 2006). All fluorescent images were acquired at the Leica DMI6000 fluorescence microscope equipped with a 20x NA 0.40 and 40x NA 0.60 dry plan-apochromate objective; or Leica TCS SP2 AOBS confocal microscope (Leica Microsystems, Mannheim, Germany) equipped with a 40X NA 1.25 and 63X NA 1.40 oil plan-apochromat objective or Leica TCS SP5 AOBS confocal laser scanning setup (Leica Microsystems, Mannheim, Germany) with a 40X NA 1.25 and 63X NA 1.40 oil plan-apochromat objective. At least, three independent experiments were performed for each analysis. For experiments employing cells, at least 20 cells were imaged per condition. For immunohistochemistry, at least 3 areas per animals with 3 animals per experimental condition were assessed. The images were processed and analyzed using the public domain Java-based image processing software ImageJ (created by W.S. Rasband, National Institutes of Health, Bethesda, Maryland, USA) by determining the signal intensity and the integrated density (area multiplied by the signal intensity). Immunohistochemistry Animals for immunohistochemistry were perfused after with ice-cold filtered PBS followed by freshly prepared filtered 4% PFA in PBS. The tissues were immersion-fixed overnight in 4% PFA and 1% PFA prior to cryoprotection in 30% sucrose. After embedding, the tissues were cut using the Leica cryostat CM1850 and stored in cryoprotective solution (25% glycerol, 25% ethylene glycol in PBS) at -20°C. Sections for immunofluorescence were either processed free-floating after washing with PBS (thrice for 30 min) The samples were permeabilized with 0.5% Triton X-100 in PBS for 1 h at room temperature (RT) and then, blocked in 5% horse serum, 5% goat serum and 5% fetal calf serum in 0.5% Triton X-100 (blocking solution) for 1 h at RT. For tissue injected with an human antibody, blocking with 1:100 dilution of goat anti-human IgG and IgM (Dianova, Hamburg, Germany) in blocking solution was carried out for 1 h at RT. The sections were incubated with the desired primary antibodies in appropriate dilution in blocking solution overnight. Primary antibodies used were polyclonal rabbit anti-MBP (Dako, Carpinteria, USA) and mouse monoclonal QD9 antibody (Abcam, Cambridge, UK) or mouse monoclonal MAG antibody (Millipore, Billiceria, USA). The sections were washed and incubated with the secondary antibodies conjugated with Alexa Fluor 488 or Alexa Fluor 555 and the nuclear counterstain DAPI for 1 h at RT. After washing the sections, they were mounted using mowiol and dried. Immunohistochemistry of human tissue MS and control brain tissue samples were provided by the UK Multiple Sclerosis Tissue Bank (UK Multicentre Research Ethics Committee, MREC/02/2/39), funded by the Multiple Sclerosis Society of Great Britain and Northern Ireland (registered charity 207495). All brain tissues were routinely screened by a neuropathologist to confirm diagnosis of MS and to exclude other confounding pathologies.Immunohistochemistry of human brain tissues was performed on tissue sections from 6 tissue blocks from 4 MS cases and on 5 tissue blocks from 4 control cases. CNS tissue from 4 patients with serologically confirmed NMO or NMO spectrum disease obtained at biopsy was examined. Brain or spinal cord biopsy was performed for diagnostic purposes to exclude tumor, lymphoma or infection. The study was approved by the local ethics committee. All tissue blocks were fresh frozen within a post mortem-time of maximum 18 h and an average post-mortem time of 12 h. Cryostat sections of 12μm were mounted on Superfrost Plus glass slides, dried at room temperature (RT) and stored at -80°C. The slides were thawed for 15 mins at 4°C and then fixed in 4% fresh PFA |
for 5 minutes at RT. The sections were washed thrice in PBS for 5 minutes at RT (for all washes, unless stated otherwise). For the MBP and QD9 staining, a permeabilization was performed in 70% Ethanol in PBS overnight at RT. After washing, endogenous peroxidase activity was blocked with 0.06% hydrogen peroxide in PBS for 30 mins at RT (for CD68: 0.06% hydrogen peroxide and 80% methanol in PBS). The tissue sections were washed again and blocked in buffer containing 5% normal donkey serum and 0.05% Triton X-100 in PBS for 1h at RT (for CD68: 1% normal donkey serum, 0.1% Triton X-100 and 0.05% Tween-20 in PBS). The primary antibody was incubated overnight at 4°C in the following dilutions: MBP diluted 1:300, QD9 diluted 1:2000 and CD68 diluted 1:250 in blocking buffer. After washing the sections, the secondary antibody was added for 1 h at RT. The tissue sections were washed and the avidin biotin complex (PK6100-Standard, Vector Laboratories, Inc., California, USA) was added Cerebrospinal fluid analysis in patients with COVID-19-associated central nervous system manifestations: a systematic review ABSTRACT Background: Central nervous system (CNS) symptoms may occur in patients with acute COVID-19. The role of CSF examination in these patients remains to be established. Objective: A systematic review of CSF findings relating to COVID-19 was carried out. Methods: CSF parameters, including cytological and biochemical analyses, SARS-CoV-2 RT-PCR and other CSF markers, were recorded and analyzed among patients with acute COVID-19 and one of the following CNS syndromes: stroke, encephalopathy, encephalitis, inflammatory syndromes, seizure, headache and meningitis. Results: Increased white blood cells and/or increased protein concentration were found in 52.7% of the patients with encephalitis, 29.4% of the patients with encephalopathy and 46.7% of the patients with inflammatory syndromes (P < 0.05). CSF RT-PCR for SARS-CoV-2 was positive in 17.35% of the patients with encephalitis and less than 3.5% of the patients with encephalopathy or inflammatory syndromes (P < 0.05). Intrathecal production of immunoglobulins was found in only 8% of the cases. More than 85% of the patients had increased CSF cytokines and chemokines. Increased CSF neurofilament light chain (NfL) and CSF Tau were found in 71% and 36% of the cases, respectively. Conclusion: Non-specific inflammatory CSF abnormalities were frequently found in patients with COVID-19 CNS syndromes. The increase in neurodegeneration biomarkers suggests that neuronal damage occurs, with long-term consequences that are still unknown. Cerebrospinal fluid (CSF) analysis is essential in making diagnoses of infections of the central nervous system (CNS), since it can provide information about the inflammatory response and can identify the etiological agent 3 . However, the precision of CSF analysis among patients with acute COVID-19 and CNS manifestations has not yet been fully established 4 . In this article, we present a systematic review of CSF findings among patients with COVID-19 and acute CNS symptoms and discuss the potential findings in different CNS syndromes. We also discuss the potential contribution of CSF analysis in understanding the underlying mechanisms in CNS manifestations associated with acute COVID-19. MeTHOdS MEDLINE (accessed from PubMed) was systematically searched from January 1, 2020, to April 30, 2021. The search strategy included the key words: "COVID 19" AND "Cerebrospinal Fluid". Articles written in English, Spanish, Portuguese and French were included in this search. We included the following study types: case reports, descriptive retrospective studies and longitudinal studies. Review articles were not included. We only included studies that reported CSF findings. Studies reporting CSF findings from patients with COVID-19 and peripheral nervous system (PNS) manifestations were not included in the present analysis. We also excluded reports on multisystem inflammatory syndrome in children, associated with COVID-19. Cases in which an infectious etiology other than COVID-19 was identified to explain the neurological condition, either through conventional microbiology or through molecular methods, were also excluded. We retrieved the results from CSF analysis in the different clinical syndromes that were reported in the studies: stroke, encephalitis, encephalopathy, inflammatory syndromes, meningitis, seizures and headache. The clinical syndrome definitions used had some variation between studies but, in general, encephalopathy was defined as alteration of one or more brain functions that was attributed to systemic disease without structural brain lesions 4 , while encephalitis was characterized by typically focal neurological signs, with or without meningeal involvement. Neuroimaging studies and/or detection of inflammatory cells in the cerebrospinal fluid can identify meningeal involvement when it is present 4-14 . Other inflammatory syndromes considered included cases of acute disseminated encephalomyelitis (ADEM) 15 , neuromyelitis optica, clinically isolated syndrome (CIS) 7 and acute hemorrhagic leukoencephalopathy 11 . When described in a study, the classification of epileptic seizures was reported. We statistically compared the CSF data from encephalitis, encephalopathy and inflammatory syndrome cases. The statistical comparisons were carried out using the chi-square test or Fisher' s exact test, depending on the number of observations in the contingency table. The significance level was set at P < 0.05. ReSULTS A total of 222 articles were identified. Among these, we selected 75 articles in accordance with the search criteria. The study types were case report (37 studies), retrospective (38 studies) and longitudinal (one study). The findings of CSF parameters were as follows: • Opening CSF pressure: this parameter was reported in 59 cases, which were 14 cases of headache, 13 cases of inflammatory syndromes, 30 cases of encephalitis and two cases of encephalopathy. Among these, 22% presented increased opening CSF pressure 5-9 . The results according to the different CNS clinical syndromes are shown in Table 1 IgG index was negative in all 12 cases tested. Among the specific antibodies tested in CSF, anti-MOG was positive in one of two cases (50%), anti-NMDA was positive in three of 17 cases (11%) and anti-cardiolipin was positive in two of 11 cases (18%) 16,18,21,22,24,26,31,52,56,59,63 . The complete list of antibodies tested and their results are shown in Table 2. • Inflammatory mediators: The complete list of cytokines and chemokines tested and their results is shown in Table 2. The most frequently tested inflammatory mediators were Il-1ß, Il-2, Il-6, Il-8 and TNF-α. Increased CSF concentration of inflammatory mediators was found in at least 85% of the cases in which they were tested. The only exception was in relation to Il-12, which was increased in only 22% of the cases, although it had only been tested in 18 cases 8,12,13,36,47,48,60,67,70,76 . • Neurodegeneration CSF biomarkers: The most frequently tested CSF neurodegeneration biomarkers were Tau protein, NfL and GFAP, in 33, 51 and 33 cases, respectively. Increased levels were found in 36%, 71% and 18%, respectively 9,61,66,70,77 . One study found a correlation between Tau and NfL levels and the opening CSF pressure 9 . The complete list of biomarkers and their results is shown in Table 2. • Statistical analyses: Table 3 shows the statistical comparison between CSF data from patients with encephalitis, encephalopathy and inflammatory syndromes. The percentage of increased WBC in patients with encephalitis was significantly higher than in cases with encephalopathy or inflammatory syndrome. Patients with encephalitis and inflammatory syndrome had significantly higher protein concentration in the CSF than those with encephalopathy. The percentage of RT-PCR positivity was significantly higher among cases with encephalitis than in patients with encephalopathy and inflammatory syndromes. There was no difference between the groups regarding the presence or the type of OCBs, or the frequency of increased Il-6. diSCUSSiOn Mild inflammatory changes in conventional CSF analyses were frequently found in patients with central neurological manifestations associated with COVID-19, and were seen more frequently in cases of encephalitis. The SARS-CoV-2 genome was found in a small percentage of cases, more commonly among those with encephalitis than in those with encephalopathy or other inflammatory syndromes. Most patients, regardless of the clinical syndrome, presented increased CSF cytokines and chemokines. CSF neurodegeneration markers were increased in several cases. These data suggest that CSF analysis is useful in the clinical evaluation of these patients and may contribute to better understanding of the CNS neurological manifestations associated with COVID-19. However, with the present data, it is not yet possible to define the precise mechanisms involved in neuronal injury and in generation of neurological symptoms. The number of patients with ischemic and hemorrhagic stroke on whom CSF analysis was done was too small to allow any definitive conclusion about the role of CSF in these conditions. There were no abnormalities in the conventional CSF analysis in cases of ischemic stroke. The levels of Il-6, IL-8 and TNF-α were increased in all cases of ischemic and hemorrhagic stroke that were tested. It is still uncertain whether the inflammatory process revealed by these CSF measurements has a role in the pathogenesis of vascular injury associated with these clinical syndromes 21,24,43,49,57 . Most patients with encephalitis had mild pleocytosis with mild to moderate increases in CSF protein concentration. Only in 17.14% of the encephalitis cases was the SARS-CoV-2 genome detected in CSF. Previous studies have shown that SARS-CoV-2 can invade the CNS, via the olfactory nerve or through hematogenous spread, which thus explains why RT-PCR was positive in some cases 7 . However, the precise role of neuroinvasion and the presence of SARS-CoV-2 within the CNS in encephalitis cases are still unknown. Interleukins, chemokines and TNF-α were increased in encephalitis cases 68 . One potential explanation for this is that inflammation has a more frequent role than direct virus-mediated neuronal injury; however, this hypothesis still needs confirmation. Another possibility is that the CSF viral load is extremely low, thus reducing the positivity of CSF RT-PCR 9 . Future studies comparing cases with and without detection of the viral genome and correlating CSF data with neuroimaging findings may help to elucidate the pathophysiology of COVID-19 encephalitis and perhaps may contribute to a more refined definition of these cases according to these findings. Changes to the conventional CSF analysis were found in a minority of cases of encephalopathy. The viral genome was found in the CSF in a small percentage of these patients. It is possible that systemic inflammation is a determining factor in these cases; however, this cannot be definitively stated since systemic inflammation was not evaluated in the present study with regard to encephalitis 5,8,10-12, [14][15][16][17][18][19][20][21][22][23][24][25][27][28][29] . Other factors, such as hypoxia, metabolic alterations and drugs with effect on the CNS, may also have contributed but were not separately analyzed in the studies included in this review. CSF abnormalities were reported; pleocytosis was found in 12% of the encephalopathy cases and 3.35% had positive CSF RT-PCR for SARS-CoV-2. It is not possible to rule out the possibility that at least some of these cases were actually encephalitis rather than encephalopathy cases. The lack of uniformity in case definition between studies may have contributed to such heterogeneity. Distinguishing between COVID-19 encephalitis and COVID-19-associated encephalopathy can be difficult and much other information besides CSF needs to be considered, such as the clinical picture, electrophysiological findings and the brain magnetic resonance imaging findings 4 . Future studies should establish more homogeneous criteria for distinguishing between these syndromes and for assessing possible differences in neurological prognosis between these two conditions. Patients with other inflammatory syndromes presented with conventional CSF changes similar to what is normally seen in patients with ADEM due to other etiologies, i.e. normal CSF or CSF with mild inflammatory changes. The SARS-CoV-2 genome was found in only one case of CIS and was not found in cases of ADEM. ADEM cases can have transient OCBs in the CSF and not in the serum. In the present review, no cases with SARS-CoV-2-associated ADEM had intrathecal immunoproduction, but it is important to mention that only nine cases of inflammatory syndromes underwent this analysis. It is possible that an autoimmune disorder triggered by SARS-CoV-2 infection occurred in these cases. One case that was positive for anti-MOG antibodies and two cases with anti-cardiolipin antibodies suggest the possibility of an immunological crossreaction 26 . Unfortunately, these cases were not evaluated for the presence of CSF anti-SARS-CoV-2 antibodies 56 , which could have contributed to better understanding of the pathogenesis of this inflammatory brain injury. With the available data, it is not possible to establish whether ADEM associated with COVID-19 presents neurological differences in comparison with ADEM associated with other etiologies. The meaning of anti-NMDA positivity in a few cases, including some with a clinical pattern compatible with limbic encephalitis, still needs to be better elucidated. One hypothesis is |
that SARS-CoV-2 may trigger not only ADEM but also, on rare occasions, autoimmune limbic encephalitis 62,63 . Table 3. Statistical comparisons of the following variables: increased WBC/mm 3 , increased protein concentration, percentage detection of the SARS-CoV-2 genome, percentage of type 2 and type 4 OCBs and percentage of cases with increased CSF IL-6, among patients classified as having encephalitis, encephalopathy or inflammatory syndromes, using the chi-square test or Fisher's exact test. The number of cases of patients with seizures and meningitis was too small for an accurate analysis on CSF findings in these groups 16,31,33 . It is more likely that seizures represent a manifestation of encephalopathy or encephalitis and not a specific clinical syndrome in the context of acute SARS-CoV-2 infection. Almost half of the patients with headache had increased opening pressure without other CSF abnormalities 6,9,48 . The mechanism for this increased pressure is unknown. It is possible that COVID-19-associated coagulopathy explains this increased opening pressure, for example, through thrombosis and stenosis in the venous drainage system. An alternative explanation is that a dysfunction in CSF production and absorption may occur during COVID-19. Both hypotheses still need to be better evaluated in future studies. Increased Increased levels of neurodegeneration markers were found in more than 40% of the patients with encephalitis in whom these markers were tested. One study showed higher levels of NfL in patients with encephalitis than in patients with encephalopathy 71 . It is possible that NfL determination, along with other CSF, clinical and neuroimaging data, contributes to refining the assessment of these patients. Also, abnormalities in neurodegeneration markers not only may be important in acute COVID-19 but also may potentially contribute to assessing long-term cognitive symptoms in patients with post-COVID-19 syndrome. In fact, previous studies showed a correlation between some markers of neurodegeneration and neuroinflammatory response in patients with COVID-19 and the risk of cognitive abnormalities 77 . Future studies providing prospective evaluations on cognition and neurodegenerative markers among patients who recovered from the acute phase of this disease may contribute to better understanding of the long-term neurological consequences of this infection. This study had limitations that deserve to be mentioned. The most important concerns the definition of cases. The distinction between encephalopathy and encephalitis is often difficult to ascertain, as both conditions can lead to lowered consciousness. The presence of epileptic seizures can be part of the context of either encephalopathy or encephalitis, so it is difficult to assess this manifestation in isolation. Considering the non-uniformity of criteria for defining cases between the different studies, it is possible that this influenced the interpretation of CSF data in these different syndromes. Other limitations included the fact that the studies were retrospective or case reports. The extensive period of review, taking into account the period of occurrence of the pandemic, and the analysis of a wide CSF database are strengths of this study. In conclusion, the present review shows that CSF analysis has a role in evaluation of COVID-19-associated CNS disorders. CSF may also contribute to better understanding of the relationship between SARS-CoV-2 infection and the CNS. Prospective studies including assessment of CSF inflammatory and neurodegeneration biomarkers may possibly contribute to better understanding of the determinants of the neurological prognosis after acute COVID-19. Attomolar Sensitive Magnetic Microparticles and a Surface-Enhanced Raman Scattering-Based Assay for Detecting SARS-CoV-2 Nucleic Acid Targets Highly sensitive, reliable assays with strong multiplexing capability for detecting nucleic acid targets are significantly important for diagnosing various diseases, particularly severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The nanomaterial-based assay platforms suffer from several critical issues such as non-specific binding and highly false-positive results. In this paper, to overcome such limitations, we reported sensitive and remarkably reproducible magnetic microparticles (MMPs) and a surface-enhanced Raman scattering (SERS)-based assay using stable silver nanoparticle clusters for detecting viral nucleic acids. The MMP–SERS-based assay exhibited a sensitivity of 1.0 fM, which is superior to the MMP-fluorescence-based assay. In addition, in the presence of anisotropic Ag nanostructures (nanostars and triangular nanoplates), the assay exhibited greatly enhanced sensitivity (10 aM) and excellent signal reproducibility. This assay platform intrinsically eliminated the non-specific binding that occurs in the target detection step, and the controlled formation of stable silver nanoparticle clusters in solution enabled the remarkable reproducibility of the results. These findings indicate that this assay can be employed for future practical bioanalytical applications. ■ INTRODUCTION The outbreak of coronavirus disease 2019 (COVID- 19), which is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has caused an insidious global pandemic. 1−3 Early diagnosis is essential to control the COVID-19 outbreak as it helps in reducing the potential spread of the virus. 4 Various assays, such as reverse transcription-polymerase chain reaction (RT-PCR), reverse transcription loop-mediated isothermal amplification, 5 and clustered regularly interspaced short palindromic repeats, 6 have been utilized for the detection of SARS-CoV-2 viral nucleic acids. Among them, the RT-PCRbased assay is the most commonly used method. RT-PCR involves the conversion of viral RNA into complementary DNA using RNA-dependent DNA polymerase, which is amplified through thermal cycling. The RT-PCR-based assay relies on enzymatic amplification to attain attomolar sensitivity; however, this amplification leads to high falsepositive results owing to the presence of artificial signals from sequence interference by oligonucleotides and cross-reactivity. 7 Therefore, it is essential to develop a new robust assay platform that does not rely on enzymatic amplification for the diagnosis of COVID-19. There are three different nucleic acid targets required to verify the infection of SARS-CoV-2 for the diagnosis of COVID- 19,4,8 which are the RNA-dependent RNA polymerase (RdRp), the envelope protein (E), and the nucleocapsid protein (N) genes of SARS-CoV-2. However, there are many variants of these nucleic acid targets, indicating the importance of accurate and high throughput assay platforms. 9 Several assay platforms, which are based on unique signal amplification strategies using nanomaterials, have been developed to achieve highly sensitive and reproducible results. Electrical, 10,11 electrochemical, 12−14 magnetic, 15 and optical 16,17 signals have been widely investigated as signal transduction modes for the diagnosis of SARS-CoV-2 infection. Among them, assays based on optical signals, such as fluorescence and Raman scattering, have been extensively utilized. Although fluorescence signals are well-established optical signals in various assay platforms, the significant photobleaching, broad emission spectrum, and lack of molecular information of this signal have limited their further application. 18 In contrast, Raman signals have emerged as a promising alternative because they are not susceptible to photobleaching. In addition, owing to their molecular information and signal amplification via plasmonic nanomaterials, the surface-enhanced Raman scattering (SERS) phenomenon and the bioanalytical applications of Raman signals have attracted significant research attention. 19−23 To obtain an enhanced Raman signal intensity, the formation of nanogaps (ideally less than 1.0 nm), also known as a "hot spot", using plasmonic nanoparticles (NPs) is required. 23 Accordingly, two major strategies have been utilized for the formation of hot spots in most SERS-based assays. One of these strategies involves the formation of random NP aggregates via salt-induced or specific target binding events. 24−26 Although this strategy can be used to detect a single molecule in dry-state analysis, single-molecule detection is not a realistic practical assay platform for detecting biomolecules because of the unavoidable non-specific binding between NPs or NPs and biomolecules. 27,28 The other strategy involves the use of NPs as a label, known as "SERS-tag", which is composed of specific nanostructures with nanogaps and Raman reporters. 29−31 Highly bright SERS tags with Raman reporters can detect multiple nucleic acids or protein targets at aM sensitivity. 32−34 However, the poor reproducibility of most SERS-based assay platforms that rely on the use of NPs has limited the further application of these platforms. 20,22,28,35 This is because of the non-specific binding of NPs that occurs in the target detection step. 28 Moreover, the required conditions for measuring SERS signals in the dry state or the formation of NP aggregates in the solution state significantly enhance the Raman signals and background signals. These factors significantly affect the efficiency of SERS-based assay platforms, particularly at a low target concentration (<pM). 22,27 To overcome the non-specific binding problem of SERSbased assay platforms, Chuong et al. reported a dual-reporter SERS-based biomolecular assay that reduced false-positive signals, and the reported assay detected 86 pM of the thrombin target and eliminated false-positive results. 28 However, the sensitivity of this assay is lower than that of the conventional method (4 pM). To address the reproducibility issue of drystate SERS-based analysis, Dai et al. utilized an optical tweezer to control the hot spots in solution to achieve a sensitive and reproducible SERS-based analysis of single-protein structures. 35 Although this method characterized the state of a single protein, it is not a feasible method for a practical assay. To address these issues, we designed new strategies with the hypothesis, which is excluding the use of NPs in the target detection step and measuring the SERS signals in a stable NP cluster solution. 23,36 In a recent study, we demonstrated a twostep assay platform, which utilizes magnetic microparticles (MMPs) and amplifies SERS signals using gold nanoparticles (AuNPs) to detect bacterial nucleic acid targets, and the platform exhibited a high sensitivity of up to 30 fM and excellent reproducibility. 37 However, its sensitivity is significantly lower than that of the PCR-based assay. In this study, we designed an MMP−SERS-based platform to detect three nucleic acid targets (i.e., RdRp, E, and N genes) 8 in SARS-CoV-2. A highly stable and controlled AgNP cluster was prepared, and its ensemble-averaged responses were measured to examine the reproducibility of the platform. In addition, the sensitivity and selectivity of the platform for the detection of the targets using two different optical signals (i.e., fluorescence and Raman signals) were rigorously compared. Further investigation revealed that the use of anisotropic Ag nanostructures (i.e., nanostars (AgNSs) and triangular nanoplates (AgTPs)) greatly improved the sensitivity of the assay for the detection of the RdRp gene target (10 aM). These results indicate that the MMP−SERS-based assay platform can effectively address the long-standing issues of NPs and SERS-based assay platforms. In addition, the results indicate that the MMP−SERS-based assay is a promising platform, which does not rely on enzymatic amplification, for future practical bioanalytical applications. Instruments. Extinction spectra were obtained using ultraviolet− visible (UV−vis) spectrometry (SCINCO, South Korea). The NPs were characterized using TEM (H-7100, Hitachi, Tokyo, Japan). Bright-field and fluorescence images were recorded using a microscope equipped with a 40× air objective and 100× oil immersion objective lens (1.3 N.A.; Olympus, DP80, Tokyo, Japan) and EzScan software (NOST, South Korea). A Cytation 3 cell imaging multimode reader (BioTek Inc., Winooski, USA) was used to measure the fluorescence intensity. DNA Information. Target-specific probe sequences were designed by modifying SARS-. Preparation of the Capture Probe-Modified MMPs. Capture probe-modified MMPs were prepared using the EDC coupling method. 49 First, carboxylic acid-modified Dynabeads (MMPs, 100 μL, 30 mg/mL) were washed using 25 mM MES buffer (100 μL) for 10 min. Subsequently, the MMPs were separated by applying a magnetic field for 2 min, after which the supernatant was removed. This step was repeated two to three times. Thereafter, amine-modified DNA oligonucleotides (i.e., RdRp, E, and N gene capture probes, 10 −4 M, 20 μL each) were added to the MMP solution (100 μL, 30 mg/mL). After incubating the solution using slow-tilt rotation at room temperature for 30 min, EDC solution (100 mg/mL in 100 mM MES buffer, 30 μL) was added to the MMP solution, after which the resulting solution was incubated overnight using slow-tilt rotation. Last, the MMPs were washed with 50 mM ethanolamine in PBS (pH 8.0) for 60 min using slow-tilt rotation at room temperature. The washing step with PBS was repeated four times. The obtained capture probe-modified MMPs were redispersed in distilled water (DW, 10 mL). Measurement of the Number of the Capture DNA on the MMPs. The binding and quantity of the capture probe sequences on the MMPs were confirmed by hybridizing the MMPs with fully complementary dye-modified DNA sequences. After hybridizing the MMPs (100 μL) with the dye-modified DNA sequences (50 μL, 10 −6 M) for 3 h in 0.3 M PBS, the sequences were washed five times using 0.15 M PBS, after which they were separated from the MMPs by heating the solutions to 95°C. The number of released DNA sequences was determined based on the fluorescence intensity and calibration |
curves. The numbers of the capture DNA sequences of RdRp, E, and N genes per MMP were approximately 2.1 × 10 4 , 4.7 × 10 4 , and 1.6 × 10 4 , respectively. Fluorescence Measurement Conditions. The fluorescence images of the MMPs hybridized with signal probes were obtained using a microscope equipped with a filter set. The ATTO 488, ATTO 565, and ATTO 647N signals on the MMPs were detected using green fluorescent protein (518−559 nm), tetramethylrhodamine (572−638 nm), and cyanine 5 (665−715 nm) filters exposed for 0.5, 0.15, and 2 s, respectively. The fluorescence intensities of the signal probe solutions were measured by exciting them at specific wavelengths of 500 nm (ATTO 488), 570 nm (ATTO 565), and 650 nm (ATTO 647N) and recording the fluorescence intensity at wavelengths of 530, 600, and 680 nm, respectively. SERS Measurement Conditions. SERS spectra were collected using an inverted Raman microscope (NOST, South Korea) with a 40× objective lens (0.6 N.A.) (Olympus, Tokyo, Japan) from a solution by illuminating the solution with a 532 nm laser (21 mW at the sample). The scattered Raman signal was detected using a confocal motorized pinhole (100 μm) directed toward a spectrometer (FEX-MD, NOST, South Korea; 1200 g mm −1 grating) and finally to a spectroscopy charge-modified device camera (Andor (DV401A-BVF), Belfast, Northern Ireland). Solution-State Raman Analysis. For each SERS spectral analysis, AgNPs (optical density: 10, 3 μL) were mixed with 3.0 μL of the signal probe solution released from the MMPs. Immediately after the addition of 3.0 μL of PBS (0.15 M) to the mixture, the solution (9.0 μL) was transferred to the well of a silicone isolator (diameter: 2.5 mm) on a cover glass and the Raman spectrum was measured (exposure time: 1 s). Conditions for Raman Mapping. The dried spots on the glass surface of AgNP solution with signal probe sequences were imaged with Raman mapping analysis. About a 1.5−2.0 mm spot on the glass was scanned with a 40× objective for the 25 × 25 pixels (1 s exposure time per pixel; it takes about 12 min for single-spot imaging). The Raman mapping images were based on the intensity of the Raman Scheme 1. Schematic of the Magnetic Microparticle (MMP)-Based Assay for the Detection of Virus DNA Targets a a (a) First, the three capture probes for the RNA-dependent RNA polymerase (RdRp), the envelope protein (E), and the nucleocapsid protein (N) genes of SARS-CoV-2 were attached to the MMPs in solution, after which the sample was added. Subsequently, the MMPs hybridized with the capture probes and target DNA were separated by applying a magnetic field. (b) Fluorescence intensity and surface-enhanced Raman scattering (SERS) signals from the MMPs and released signal probes were measured from the capture probes and Ag nanoparticles (AgNPs). T, assay temperature T m , melting temperature. Preparation of Silver Nanostars (AgNSs). AgNSs were synthesized based on a previously reported method. 50 Typically, 0.5 mL of 6.44 mM hydroxylamine and 0.5 mL of 0.05 M NaOH were mixed and agitated for 2 min. Subsequently, 9.0 mL of 0.98 mM AgNO 3 solution was added into the mixture immediately and the solution was further agitated for 5 min. Last, 100 μL of 0.29 mM trisodium citrate was added and the solution was shaken for 15 min. After the solution turned dark gray, it was centrifuged (2600 relative centrifugal force (RCF), 15 min) and the residue was redispersed in DW to adjust the optical density to 1.0. Preparation of Silver Triangular Nanoplates (AgTPs). Citrate-stabilized AgTPs were synthesized as follows. 51 Typically, a solution consisting of 39.3 mL of DW, 2.0 mL of trisodium citrate (75 mM), 256 μL of H 2 O 2 (0.6%), and 186 μL of AgNO 3 (10 mM) was prepared. Subsequently, the solution was subjected to vigorous stirring, after which 192 μL of sodium borohydride (NaBH 4 , 100 mM) was rapidly added to initiate reduction, which was accompanied by a change in the color of the solution to a pale yellow color. After 5 min, the color shifted to golden yellow. Thereafter, the solution was stored overnight at room temperature. Following this aging period, 2.1 mL of the seed stock was added to a clean 8 mL vial and stirred vigorously. Subsequently, 200 μL of L-ascorbic acid (5.0 mM) was added to this mixture, after which AgNO 3 (10 mM) was added to the solution dropwise until a yellow-orange color was obtained (typically 100 μL). The resulting solution was centrifuged (2600 RCF, 15 min) three times, after which the residue was redispersed in 5.0 mL of water and stored at 4°C. Preparation of Silver Nanocubes (AgNCs). AgNCs were synthesized based on a previously reported method. 52 Typically, 6.0 mL of EG was pre-heated (150°C) under stirring. Next, 100 μL of 3.0 mM NaHS solution in EG was injected. After heating the reaction mixture for 10 min, 1.5 mL of PVP (20 mg/mL, MW ∼55,000) and 0.5 mL of AgNO 3 (48 mg/mL) in EG were sequentially injected into the mixture. After the addition of AgNO 3 , the clear and colorless solution turned purple-black and changed to a transparent bright yellow color. Finally, the solution changed to a whitish brown color and remained opaque. The reaction mixture was cooled down, diluted with acetone, and centrifuged at 2600 RCF for 15 min. The obtained residue was washed with water, centrifuged (2600 RCF, 15 min, 3 times), and finally suspended in 4.0 mL of DW. ■ RESULTS AND DISCUSSION Design of the MMP-Based Assay for the Detection of Target Viral DNA. MMPs showed excellent dispersibility in solutions owing to their superparamagnetic property. 38 Consequently, MMPs can efficiently bind with target molecules and can be easily separated by applying an external magnetic field. 39 In addition, a high throughput assay can be achieved using MMPs owing to the multiple binding sites of MMPs. 39,40 In this study, as a proof of concept, MMPs (2.8 μm, COOH surface functionality) were modified using the three amine-modified capture probe sequences of RdRp, E, and N gene targets via EDC coupling chemistry. The probe sequences were partly complementary to their specific target DNA sequence (Scheme 1). The numbers of the capture probe sequences of the RdRp, E, and N gene targets per MMP were approximately 2.1 × 10 4 , 4.7 × 10 4 , and 1.6 × 10 4 , respectively ( Figure S1). In the first step, the MMPs were hybridized with both the target and signal probe sequences (fluorescence-tagged), which were partly complementary to their specific target DNA sequences. In the second step, the fluorescence intensity of the MMPs, which is proportional to the quantity of the target DNA, was measured. The fluorescence signal intensity could also be measured after releasing the signal probes into distilled water by increasing the temperature of the MMP solution to 95°C (>T m ) ( Figure S2). 37 The SERS-based detection was enabled by the fluorescence molecules in the released signal probes and the PBS-induced stable AgNP clusters in the solution ( Figure S3). Consequently, the performances of the assay based on two different optical signals (i.e., fluorescence and Raman scattering) could be accurately compared. As the NPs were not involved in the target detection step (first step), the possibility of non-specific binding between the NPs and the target was eliminated. In the second step, the detection of optical signals (i.e., fluorescence or Raman responses) from the MMPs or AgNP clusters in solution was performed to compare the assay performances of both platforms (Scheme 1). For Raman analysis, two different experimental setups such as solution-state analysis or dry-state analysis (Raman mapping) were performed ( Figure S3). Formation of Stable Silver Nanoparticle Clusters in Solution. The formation of hot spots using plasmonic NPs is essential to obtain a significantly enhanced Raman scattering signal intensity. 22,23 However, the SERS measurement in the dry state showed a high background signal and poor reproducibility in the assay results. The solution-state analysis also showed a low signal reproducibility because of the random aggregation of NPs and rapidly changing aggregated states in the solution. 22,23 Therefore, in this study, we focused on solution-state Raman analysis and investigated the electrolyte conditions that enable the production of uniform and stable AgNP clusters in solution for more than 30 min at room temperature ( Figure 1). The four representative electrolyte compositions such as phosphate buffer (PB), NaCl, 0.3 M PBS, and 0.15 M PBS were investigated. As shown in Figure 1a, the addition of PB alone (10, 1.0, and 0.1 mM) did not induce the formation of AgNP clusters in the AgNP mixture and signal probe sequence, which could be attributed to the weak adsorption affinity of PB on the AgNPs. 41 (Figure 1c, (3, 4)). The results indicate that the instant formation of aggregates and low colloidal stability is not a desirable condition to obtain a reproducible Raman (Figure 2a). The color of the AgNP solution (yellowish green) readily changed to gray, indicating the slight aggregation of AgNPs. In addition, a strong fluorescence intensity could only be obtained from the MMP solutions in the presence of a specific target gene sequence, such as RdRp, E, and N, whereas a low fluorescence intensity was observed in the absence of a target (Figure 2b). Moreover, similar results were observed in the fluorescence images of the MMPs. In addition, the released signal probe solution exhibited a strong fluorescence intensity in the presence of targets (Figure 2c). Furthermore, the SERS spectra of the solution containing the signal probes and AgNPs were consistent with the reference Raman spectra (dotted line) of ATTO 488, ATTO 565, and ATTO 647N dyes obtained at a laser excitation of 532 nm (Figure 2d). The two characteristic peaks at 1348, 1643 cm −1 for ATTO 488 (RdRp gene), 1502, 1651 cm −1 for ATTO 565 (E gene), and 1426, 1631 cm −1 for ATTO 647N (E gene) were clearly identified. As a higher local electromagnetic field was obtained with the excitation of AgNPs at a shorter wavelength (532 vs 633 nm), a wavelength of 532 nm was considered as a more preferable laser source for the Raman analysis ( Figure S3). 42 These results indicate that the MMPs exhibited a sequence-specific binding capability toward their single DNA target. Comparison of the Sensitivity of the Fluorescence and SERS Signals. (Figure 3a). This could be attributed to the fact that the signal-to-noise ratio was not sufficiently large at ranges between 10 −10 and 0 M. Moreover, the MMPs were not visible in the fluorescence images at target concentrations below 10 −10 M (Figure 3b). However, distinguishable Raman spectra were observed in the SERS spectra from the mixture of released solution at a target concentration of 10 −15 M ( Figure 3c) and AgNPs. The SERS mapping images for the dried spot of the mixture, which was based on the Raman shift at 1348 cm −1 , could be observed at a target concentration of 10 −15 M (Figure 3d). For the E gene target, the limit of detection (LOD) of the fluorescence intensity of the MMPs and the released signal probes was observed at 10 −10 M (Figure 3e,f), whereas a signal intensity was observed in the SERS spectrum and SERS mapping image (based on the Raman shift at 1502 cm −1 ) at a target concentration of 10 −15 M (Figure 3g,h). For the N gene target, the LOD values of the fluorescence intensity of the MMPs and released signal probes were observed at 10 −10 M (Figure 3i,j), whereas a signal intensity was observed in the SERS spectra and SERS mapping images (based on 1426 cm −1 ) at a target concentration of 10 −12 M (Figure 3k,l), which was lower than those of ATTO 488 and ATTO 565. This could be attributed to the non-resonant effect of ATTO 647N dyes at an excitation wavelength of 532 nm. In summary, the LOD of the MMP−SERS-based system for the detection of RdRp and E gene targets was 1.0 fM and that of the N gene target was 1.0 pM with detection ranges from 10 −9 to 10 −15 M and 10 −9 to 10 −12 M, respectively, in the solution and dry-state analysis, thereby demonstrating its excellent performance as a highly sensitive assay platform. 43 In addition to the high |
sensitivity, the signal reproducibility of the SERS-based assay is also a critical parameter for practical application. As shown in the Raman spectrum (Figure 3c,g,k), the Raman spectral patterns were consistent with a decreasing target concentration from 10 −9 to 10 −12 M. However, small new peaks could be observed in the case of the 10 −15 M target concentration and no target. Since the Raman signal is obtained from the solution state, these fluctuating signals are expected to be the background noise signal from the random orientation of Raman reporters in the silver nanoparticle clusters. This kind of transiently fluctuating signal becomes more clearly visible in the case of the low target concentration because of a decreased intensity of characteristic Raman peaks. This is the reason why the small unusual peak could be seen in the 10 −15 M target concentration. However, the small transient peak is not greatly problematic in determining the assay results because of the observed two characteristic peaks of Raman reporters (Figure 3c,g,k). To further examine the signal reproducibility of the SERS-based assay platform, three independent assays were performed for the targets at varying concentrations (10 −9 , 10 −10 , 10 −12 , and 10 −15 M and no target) using MMP, and the Raman responses were measured. No significant difference in the SERS spectral patterns and intensities in the three independently performed assays demonstrates the excellent signal reproducibility of the MMP−SERS assay platform ( Figure S4). Selectivity of the MMP-Based Assay. The capability of an assay to selectively detect a specific target sequence in the presence of multiple sequences in an analyte is an essential parameter for the practical application of an assay. 44 To this end, the selectivity of the MMP−SERS-based assay was evaluated in the presence of dual-target sequences ( Figure S5) and triple-target sequences ( Figure 4). First, in the presence of dual-target sequences, the assay was performed by adding the MMPs to binary mixtures of RdRp and E gene target sequences (concentration: 10 −9 M), where the ATTO 488modified sequence was used for the RdRp gene, the ATTO 565-modified sequence was used for the E gene, and the ATTO 647N-modified sequence was used for the N gene. The binding of the ATTO 488 and ATTO 565 signal probe sequences to their target sequences was observed; however, the binding of ATTO 647N was not observed owing to the absence of its target sequence in the mixture ( Figure S5). Similar results were observed in the fluorescence images of the MMPs, released signal probe solution, and SERS spectra, indicating the excellent selectivity of the signal probe sequences with no interference in the presence of dual-target sequences ( Figure S5). The selectivity of the MMP-based assay was further investigated in the presence of triple-target sequences ( Figure 4a). For this, MMPs were added to tertiary mixtures of the RdRp, E, and N gene target sequences (concentration: 10 −9 M) containing the same three signal probe sequences. Strong and discriminable fluorescence intensity was observed for the (Figure 4b,c). In addition, a high background fluorescence intensity was observed for the RdRp gene target, which could be attributed to the relatively high fluorescence signals of the MMPs. 45 The results in Figure 4b−d indicate the absence of mutual sequence interference and the excellent selectivity of the designed assay. Improved Sensitivity Using Anisotropic Ag Nanostructures. In this study, the SERS-based assay using AgNPs achieved a sensitivity of 1.0 fM for RdRp and E gene targets and a sensitivity of 1.0 pM for the N gene target (Figure 3). However, to enhance the possibility of replacing the PCRbased assay with the SERS-based assay, it is essential to further improve the sensitivity of the SERS-based assay to the attomolar range. In our recent study, 37 we reported an MMP−SERS assay, which exhibited a sensitivity of 10 fM for the detection of an Enterococcus faecalis target using AuNPs (Cys-AuNPs, 30 nm). In this study, the sensitivity of SERSbased detection was only slightly improved using AgNPs instead of AuNPs. Accordingly, we anticipated that the sensitivity of SERS-based detection can be further improved by utilizing anisotropic Ag nanostructures because of the enhanced localized electromagnetic field in their tips and edges. 46,33,47 Therefore, AgNSs, AgTPs, and AgNCs were synthesized to compare the effects of various anisotropic Ag nanostructures on the sensitivity of the SERS-based assay ( Figure S6). The sizes of the AgNSs, AgTPs, and AgNCs were 45 ± 5 nm with 5−6 nm tips, 65 ± 5 nm, and 55 ± 5 nm, respectively, with peak extinctions at 390, 477, and 432 nm, respectively ( Figure S6a−d). These sizes were selected to accurately compare the effect of the shape of the nanostructures on the signal enhancement compared to that of spherical AgNPs (40−45 nm). Since all silver nanostructures in this study are negatively charged, the salt conditions to produce Ag nanoclusters in solution could be applied for all structures. The changes of AgNPs as a representative were investigated in detail for the behavior in PB, NaCl, and PBS ( Figure 1). AgTPs also showed the same trends of cluster formation with that of AgNPs as observed in solution color changes, TEM, and D/F images as well as SERS responses ( Figure S7). To compare the effects of anisotropic Ag nanostructures on the sensitivity of the SERS-based assay, the SERS intensity performances of the three signal probe sequences (i.e., ATTO 488, ATTO 565, and ATTO 647N) in the presence of the various Ag nanostructures were compared by obtaining their SERS mapping images. Spots of the mixtures on glass were imaged using SERS mapping at 1348 cm −1 for ATTO 488, 1502 cm −1 for ATTO 565, and 1426 cm −1 for ATTO 647N with 532 nm excitation. When AgNPs were used, signals were observed in the SERS mapping images of the ATTO 488 and ATTO 565 signal probe sequences at a concentration of 10 −15 M ( Figure S6e−g), whereas signals were observed in the SERS mapping image of the ATTO 647N probe sequence at 10 −12 M ( Figure S6g). In addition, the SERS mapping results revealed that, when AgNSs were used, the mapping images of ATTO 488, ATTO 565, and ATTO 647N signal probe sequences were observed at 10 −18 ( Figure S6h Based on these results, we next performed the MMP−SERSbased assay for the RdRp gene target at varying target concentrations (10 −12 , 10 −15 , 10 −16 , 10 −17 , 10 −18 , and 0 M) using AgNPs, AgNSs, AgTPs, and AgNCs ( Figure 5a). The difference in the Ag nanostructures did not affect the Raman spectra of the ATTO 488 dye (Figure 5b). The LOD was measured using SERS mapping at a Raman shift of 1348 cm −1 . When AgNPs, AgNSs, AgTPs, and AgNCs were used, the target was detected at concentrations of 10 −15 , 10 −17 , 10 −17 , and 10 −12 M, respectively (Figure 5c−f). This indicates that AgNSs or AgTPs were significantly more sensitive than the other structures. The significantly enhanced SERS intensity when AgNSs or AgTPs were used could be attributed to the high degree of anisotropy and a large number of edges in the AgNS and AgTP structures. 48,47 As reproducibility in a low target concentration is crucial for SERS-based assays, three independent assays were performed for the detection of RdRp gene targets using AgNSs and AgTPs to examine their signal reproducibility in both the dry and solution states ( Figure S8). The three independent assays performed using AgNSs ( Figure S8a−c) or AgTPs ( Figure S8d−f) showed a detectable Raman response at a concentration of 10 aM in both analyses. However, the SERS mapping images performed in the dry-state analysis were not consistent in the result (10 aM in Figure S8c,e) because of the random distribution of hot spots in the dry-state analysis. In contrast, the results obtained from the solution state clearly showed the difference Raman spectrum between 10 −17 and 10 −18 M. These repeated assay results indicate that the use of anisotropic structures, such as AgNSs and AgTPs, greatly amplified the SERS signal and excellent signal reproducibility from the stable NP clusters in solution. ■ CONCLUSIONS In this study, we demonstrated a highly sensitive and reproducible MMP−SERS-based assay platform for nucleic acid target detection. The DNA sequences designed to detect the RdRp, E, and N genes of SARS-CoV-2 exhibited reliable sensitivity and reproducible assay results. The sensitivity of the assay platform using two different optical signals (i.e., fluorescence and SERS) was rigorously compared. The SERS-based detection using AgNPs exhibited significantly higher sensitivity (1.0 fM for the RdRp and E genes and 1.0 pM for the N gene) than the fluorescence-based detection for all the three target genes. In addition, the use of anisotropic Ag nanostructures (AgNSs and AgTPs) for the MMP−SERSbased assay significantly improved the sensitivity of the assay for the detection of the RdRp gene target (10 aM). The number of target sequences in 10 aM LOD is calculated to be 114, which corresponds to ca. 376 copies/mL. Therefore, the sensitivity of the MMP−SERS-based assay is comparable with that of current commercial kits (200−500 copies/mL). 53 It is important to note that the possibility of false-positive results from the use of NPs, particularly at low target concentrations, was significantly minimized in this platform owing to exclusion of the NPs in the target detection step. In addition, the ensemble-averaged measurement of the SERS response from the highly stable Ag clusters in solution significantly improved the signal reproducibility of this platform. These results indicate that the method demonstrated in this study can effectively address the two key issues of NPs and the SERSbased assay. Therefore, we expect that the MMP−SERS-based method will be a promising high-throughput platform technology with attomolar sensitivity and robust assay results. Measurement of the quantity of the capture probes on the magnetic microparticle (MMP); experimental setup of the filter set; surface-enhanced Raman scattering (SERS) spectra of the three different signal probes with ATTO 488, ATTO 565, and ATTO 647N dyes and experimental setups for solution-state or dry-state Raman analysis; Raman spectra of the three independent assays for the detection of RNA-dependent RNA polymerase (RdRp) gene target DNA; performance of the magnetic microparticle (MMP)-based assay with fluorescenceand surface-enhanced Raman scattering (SERS)-based detection of dual DNA targets; characterization of the various Ag nanostructures; results of the salt-induced formation of AgTPs clusters in solutions; and reproducibility of the three independent SERSbased assays for the detection of RdRp gene target DNA using AgNSs and AgTPs (PDF) Skin Displacement as fascia tissue manipulation at the lower back affects instantaneously the flexion-and extension spine, pelvis, and hip range of motion Low back pain (LBP), associated with spine, pelvis, and hip mobility impairments can be caused by tight muscle contractions, to protect sensitized lumbar fasciae. Fascia tissue manipulations are used to treat lumbar fascia in LBP. The effect of fascia tissue manipulations through lumbodorsal skin displacement (SKD) on mobility is inconclusive likely depending on the location and displacement direction of the manipulation. This study aimed to assess whether lumbodorsal SKD affects the flexion -and extension range of motion (ROM), in healthy subjects. Furthermore, we aimed to test the effect of SKD at different locations and directions. Finally, to assess intertester and intratester reliability of SKD. Effects of SKD were tested in a motion capture, single-blinded, longitudinal, experimental study. Sixty-three subjects were randomly assigned to SKD- or sham group. SKD group was subjected to either mediolateral directed SKD during flexion or extension movement, versus a sham. The thoracic, lumbar, and hip angles and finger floor distance were measured to assess the change in ROM. Statistics indicated that the effect size in instantaneously change of flexion -and extension ROM by SKD was large (Effect size: flexion η2 p = 0.12–0.90; extension η2 p = 0.29–0.42). No significant effect was present in the sham condition. Flexion ROM decreased whereas the extension ROM increased, depending on SKD location- and displacement direction (p < 0.05). The ICC indicates a good intertester and intratester reliability (resp. ICC3,k = 0.81–0.93; ICC3,1 = 0.70–0.84). Lumbodorsal SKD affects the flexion- and extension spine, pelvis, and hip range of motion. The effects of SKD are direction- and location dependent as well as movement (flexion/extension) specific. Lumbodorsal SKD during flexion and extension may be useful to determine |
whether or not a patient would benefit from fascia tissue manipulations. Further research is required to obtain insight into the mechanisms via which the SKD affects ROM and muscle activation, in healthy, asymptomatic-LBP, and LBP subjects. Introduction Regarding the effectiveness of Fascia Tissue Manipulations (FTMs) on pain and mobility, it has been proposed that this will depend on both location and direction of the applied skin displacement (SKD) (Noten, 2021). It has been proposed that SKD will affect fasciae stiffness and their relative positions to surrounding tissues (Huijing and Baan, 2003;Maas, 2019), which can be beneficial but may also 'worsen' pain and decrease mobility (Noten, 2021). To indicate whether or not a patient would benefit from FTMs, a fascial diagnostic test has been proposed: The Dynamic ArthroMyofascial Translation® Test (OSF, https://osf.io/52ze7). The test consists of 3 steps: 1) affirmation of the most painful movement from stance to either flexion or extension, as a reference test, 2) the same test with ongoing mediolateral directed SKD to the right at e.g. L3 or L5, and 3) the same reference test with on-going SKD to the left. SKD leading to the largest mobility improvement and/or pain reduction can be utilized for FTMs at the tested location (Noten, 2021). Several studies in which FTMs have been applied to healthy humans by elastic tape or myofascial release have shown that fasciae and muscles below the skin undergo deformations and are locally strained (Tu et al., 2016;Wong et al., 2017;de las Penas, 2019;Wang et al., 2019). Therefore, it is conceivable that variable effects in alterations in mobility (i.e., increase or decrease) due to FTMs by SKD are also expected to occur in healthy subjects, but could be less pronounced than in patients with limited mobility for instance in case of low back pain. Although changes in joint mobility through SKD seem to be clinically effective, the basal effects of SKD on healthy subjects have not been tested objectively. Therefore, this research test protocol has been developed corresponding to the clinical test protocol published (Noten, 2021). The aims of this study were: a) to assess whether SKD at the lower back affects flexion-and extension range of motion of the spine, pelvis, and hip complex versus a sham skin-displacement, in healthy subjects, and b) if present, to test the effect of SKD at different locations and directions, as well as c) to assess intertester and intratester reliability of applying the SKD. 1.2.Marker, strober & CSU setting In total, two strobers (1 for the subject and 1 for the custom-made station) were utilized. The connection process is depicted in Figure 1. In maintaining consistency for data processing, during every measurement, the markers were linked in the same order, also, the marker-connectors were plugged into the same strober portals, and both strobers into the same system control unit (SCU) portals. The strober marker-linkages order is described in order from cranial to caudal marker: • Sixteen markers in 1 st strober which is connected in CSU portal 1. Station 2 nd strober marker-linkages: Strober Portal 1: one each station angle a marker was adherend (n=4) • Four markers in 2 nd strobes which are connected in CSU portal 2. 1.3.Motion capture position The three Optotrak® cameras were set and aligned within an arch. The custom-made station setup was counterclockwise so that the right side of the custom-made station was perpendicular to the Optotrak® camera -1 y-axis (sagittal plane). The other two cameras (2 & 3) were placed at an angle of + -35° degrees towards the custom-made station. The distance between the cameras and the lateral border of the station was 4 meters for optimal visualization. The three Optotrak® cameras were connected via a linking cable, of which the connector of the last cable was placed in the CSU ( Figure 2). 1.4.Preparation and marker placements A total of sixteen active infrared markers were attached to the skin to the pre-palpated anatomical landmarks, marked with a pencil by a 10 year experienced physical therapist (right side) and four markers were attached to the custom-made station (right side): 1) Six markers represented the right leg: • Metatarsofalangeaal, os calcaneus, lateral malleolus, femur cluster (3 marker-cluster) 2) Six markers represented the spinal column: • Sacrum (3 marker-cluster), thoracolumbar junction (T8-T12: 2 marker-cluster), 4 th thoracic spinal process (T4) 3) Three markers represented the right arm: • Tuber deltoid, os olecrani, processus styloid radii 4) Other three: • Medial Crista illicus, SIPS, SIAS Three custom-made spinal-clusters were positioned at the sacrum, 9 th thoracic spinous process, and 4 th thoracic spinous process. All markers were fixated to the skin by double-sided adhesive tape. All cluster-markers were extra supported by an elastic band (Fabrifoam®) and Fixomull®strech tape (BSN Medical) ( Figure 5A). Carry-over effects In analyzing the SKD effect on the spinopelvic-hip mobility various actions were taken to minimalize measurement errors. To wash out the warming-up effect of the repeated index test and the SKD carryover effects, a rest period of 30 seconds was inserted between each single performed mobility test. As well, the applied SKD condition (location incl. location) was mixed in order in different sequences. Besides, the 1 st index test was followed by the opposite 2 nd index test (1 st flexion followed with 2 nd extension or 1 st extension followed with 2 nd flexion). Each 1 st and 2 nd index test with its 2 corresponding conditions was performed 3 times within a cluster (n= 6). After a cluster was completed, a rest period of 180 seconds was inserted in washing out warming-up effects before performing the 2 nd cluster. Between the rest periods 30, 120, and 180 seconds the subject remained stationary. After performing the first SKD condition-order (e.g. 1A) a ten minutes break had been inserted before the subject crossed over to the other equivalent SKD condition-order (e.g. 2A). In these ten minutes, the subject was disconnected from the Optotrak® system and was allowed to walk around the lab but was not allowed to sit down (see flowchart, Figure 3). 3.1.Execution index test and division tasks Two researchers performed and directed the standardized procedure, in minimalizing and controlling the external errors ( Figure 4). Task Physical therapist_1 or 2: The physical therapist instructed the subject_d how the index tests should be performed. Task Researcher_a: The researcher who monitors the computer also gave the cues, because he was the only one who could overview the registration system (time of recording). Task Researcher_b: Before the test started, researcher_b showed the information given on the block card (Figure 9) to the physical therapist concealed from the subject. Besides, he/she monitored the subject's end of the spinopelvic-hip ROM and controlled that the subject stayed in this position for four seconds, monitored with a stopwatch. See for index test instruction §3.3 and table 1. 3.2.Pre-instruction physical therapist A detailed explanation was discussed with the subject before the execution of the tests. After the markers were applied, the subject was instructed how the index test should be performed. Physical therapist_2 took place on the station where physical therapist_1 briefly explained how the test should be performed. During this explanation, physical therapist_2 executed the instruction for visualization for subject clarity. After this, the subject was asked to stand on the station platform and was hooked to the CSU. The station was set in such a way that the knee could only flex till 10 degrees from the neutral standing position to end trunk flexion. This was controlled with a BASELINE®BUBBLE®INCLINOMETER. When everything was set and the subject was familiar with the index tests, the extended instruction was performed where each index test was practiced 10 times. After the baseline, before the tests started, the following sentence was communicated to the subject ( SKD-and sham-group) by the physical therapist, '' you may perform the index test as we have practiced before, one of us will stand behind you and palpate some points on your back, 'you do not have to do anything with this then only performing the index test at the given cue''. 3.3.Index tests For this purpose, the spinopelvic-hip flexion-and extension motion was used as an index test in evaluating the SKD effect on spinopelvic-hip ROM, performed as follow: 1. Start position: the subject stood straight up, gaze forward, with arms hung along its thighs, thumbs pointed forward, and feet stood parallel and contiguous (Picture 5A). 2. Flexion: At the cue for flexion, the subject brought his chin to his chest and rolled it down from torso to lower back, and bent as far as possible without forcing. During this flexion movement, the subject's shins were placed against the shin support and the hamstrings towards the leg support in securing the 10 degrees flexion. At the end ROM the subject relaxed and hung out for four seconds (Picture 5B) and came back to starting position. 3. Extension: From starting position on the cue for trunk extension the subject placed its hands on his trochanter major. Subsequently, the subject extended its head followed by extending its torso to the lower back till the end range was reached. This position was held for four seconds without forcing the extension (Picture 5C). During this extension movement, the subject shins were placed against the shin support without contacting the hamstrings with the leg support. Experimental-and SHAM Skin Displacement Maneuver From starting position (standing tall) the subject its skin and underlying fasciae were manually lateral-horizontal displaced by the physical therapist utilizing the SKD. During the starting position, the subject was stationary, and the physical therapist stood behind the subject. Researcher_a monitored the rest periods (timing turning on the optotrak®system). Researcher_a called out,''10 seconds to go'', which informed the physical therapist to palpate the reference point (Picture 6A) displayed on the block card ( Figure 9). Ten seconds later researcher_a called out ''camera set'' which was the cue for the physical therapist to apply the SKD (Picture 6B or 6C) in de direction and location displayed on the block card which was followed with the cue,'' GO'', which triggered the subject to perform the index test. During this movement, the physical therapist performed the SKD and held the skin and underlying fasciae under tension till the subject was back in the start position (Picture 7A and 8A). Skin Displacement condition orders Different condition orders had been made ( Table 2). The index test and SKD condition that should be applied were shown on a block card (Figure 9) to the physical therapist concealed from the subject. Intussusception caused by heterotopic gastric mucosa in small intestine: a case report Background Intestinal intussusception is the most frequent cause of small bowel obstruction in children between the ages of 2 months and 5 years and often remains idiopathic in etiology, even after surgery. On microscopic examination, in intussusception normal mucosa is noted but in a few cases heterotopic tissue can be seen. Heterotopic gastric mucosa in the small intestine is extremely rare except for its occurrence in remnants of Meckel’s diverticulum. In view of the rarity of this condition, we report a case of ectopic gastric mucosa in the small intestine that was not associated with remnants of vitelline duct. Case presentation A 6-year-old boy of Indo-Aryan ethnicity from India presented with episodes of acute abdominal pain and distension with vomiting and non-passage of stools. On ultrasonography intussusception was suspected. A laparotomy was done and the ileal segment (tip of intussusception) was sent for histopathological examination. On histopathology, sections from the tip of intussusception showed extensive gastric metaplasia of the mucosa. Conclusions A definitive diagnosis of heterotopic gastric mucosa is established by histopathological examination and it is important to differentiate heterotopia, which is a developmental anomaly, from metaplasia, which is an acquired condition. Heterotopic gastric mucosa is usually clinically silent and surgical intervention can be considered in patients with complications such as gastrointestinal hemorrhage and intestinal obstruction. Background Intestinal intussusception is the most frequent cause of small bowel obstruction in children between the ages of 2 months and 5 years; it often remains idiopathic in etiology, even after surgery. According to a study, approximately 75% of children with intussusception caused by intestinal obstruction were in their first year of life, which is in concordance with other studies where the commonest age group affected was below 1 year [1,2]. However, after 2 |
years of age, an increasing number of intussusceptions are due to lesions of the small intestine, namely Meckel's diverticulum, Henoch-Schönlein purpura, and Peutz-Jeghers polyps [3]. On microscopic examination, in intussusception normal mucosa is noted but in a few cases heterotopic tissue can be seen. In view of the rarity of this condition, we report a case of a 6-year-old boy with heterotopic gastric mucosa (HGM) in the small bowel. Case presentation A 6-year-old boy of Indo-Aryan ethnicity from the northern part of India presented with episodes of acute abdominal pain and abdominal distension with vomiting and non-passage of stools. He denied a history of taking any medications in the past and his family history was not contributory. A physical examination was normal except for slight pallor. There was no hepatosplenomegaly. His complete blood counts, erythrocyte sedimentation rate (ESR), and serum electrolytes were within normal limits. On ultrasonography intussusception was suspected along with enlarged multiple mesenteric lymph nodes. At laparotomy, small bowel intussusception was found which was irreducible so a resection anastomosis was performed and the ileal segment (tip of intussusception) was sent for histopathological examination. We received a part of the ileal segment measuring 3 × 1.5 cm; the external and cut surfaces were unremarkable (Fig. 1). On histopathology, sections from the tip of intussusception showed extensive gastric metaplasia of the mucosa with long coiled branching glands containing both abundant chief and parietal cells (Figs. 2 and 3). Following an uneventful postoperative outcome, he recovered satisfactorily and is currently under follow up. Discussion Aberrant gastric gland is the term used where gastric glands are found in an organ other than the stomach. HGM of the intestinal tract is an occasional incidental gross or microscopic finding at surgery or autopsy [4]. HGM was described by Schmidt as early as 1805 [5]. Poindecker reported the first case of HGM in 1912 [6]. It is classified as either acquired metaplasia as in Barrett's esophagus or a true gastric heterotopia of congenital origin as in Meckel's diverticulum. The biggest diagnostic dilemma is of a simple true congenital gastric heterotopia being misdiagnosed as a gastric metaplasia [4]. HGM may be found anywhere in the gastrointestinal tract from the tongue to the rectum [7]. It is commonly found in congenital abnormalities such as Meckel's diverticulum and gastrointestinal duplications [8]. However, it has been reported throughout the entire alimentary tract from the oral cavity to the anus, in the airways, umbilicus, urinary bladder, and even in the scrotum. The incidence of HGM in the esophagus varies widely from 0.1 to 13.8% and that of HGM in the duodenum varies from 0.5 to 8.9% [9]. Gastric heterotopias are mostly seen in the duodenum but very rarely in the small intestine as was found in our case [10]. Clinical presentation varies and depends on the size and location of HGM. It usually presents as an inlet patch in the proximal esophagus, as polypoid masses in the rectum, or as nodular tumors in the duodenum [11,12]. Most of the patients are symptomatic and present with intermittent abdominal pain secondary to intestinal obstruction, chronic intussusception, perforated ulceration, or intestinal bleeding [12][13][14][15]. It may serve as the leading cause for the development of intussusception. The cause of the ulcer is due to acid pepsin secreted by the ectopic gastric mucosa [4]. It can also cause failure to thrive because of the chronic abdominal pain associated with recurrent episodes of vomiting and diarrhea [16]. Radioisotope scan is the investigation of choice to detect bleeding ectopic gastric mucosa. Depending on the location, three mechanisms have been suggested for the development of HGM. One possibility is that during the developmental descent of the stomach, remnant tissue could have remained in the distal esophageal portion of the gut. However, although this mechanism could explain gastric heterotopia of the esophagus, it cannot explain gastric heterotopia in more distal intestinal tracts [17]. It has also been said that the condition may be acquired and is the result of an abnormal regenerative process following destruction of the normal intestinal mucosa. Acquired HGM is common in the jejunum and ileum in areas of mucosal regeneration accompanying inflammatory lesions such as regional enteritis [18]. However, this theory is not supported by any of the descriptions of gastric heterotopia following destruction of the gastrointestinal mucosa due to gastroenteritis or other inflammatory conditions [19]. The third and most possible hypothesis is that HGM is the result of abnormal differentiation of local tissue. Pluripotent primitive endoderm stem cells have the ability to differentiate into cell types of the gastrointestinal epithelium. An error in differentiation could lead to the gastric mucosa being present anywhere throughout the gastrointestinal tract [17,19]. It is important to differentiate heterotopias from metaplasias. Metaplasia is a change of one type of full developed tissue to another differentiated tissue usually due to sustained inflammation and its complications. Heterotopias imply a developmental anomaly, whereas metaplasias imply an acquired condition. The common sites of gastric metaplasia occurring as a protective response to the injurious action of gastric acid are the lower esophagus and duodenal bulb. In a case of acquired HGM, gastric mucosa consists mainly of mucus-secreting cells with the appearance of gastric pyloric glands. Parietal and chief cells are absent or, if present, are sparse. However, HGM consists of full mucosal thickness of structured gastric fundic mucosa consisting mainly of chief and parietal cells; the abnormality is considered developmental or congenital in origin as was seen in our case [20]. Thus, whereas heterotopias form a perfect mucosal island, metaplasias are of partial thickness and intermingle with the native tissue. Conclusions Definitive diagnosis of HGM is established by histopathological examination and it is important to differentiate heterotopia, which is a developmental anomaly, from metaplasia, which is an acquired condition. It is usually clinically silent and does not require treatment. However, surgical intervention can be considered in patients with complications such as gastrointestinal hemorrhage and intestinal obstruction [21]. Impact of Mean Platelet Volume on Long-Term Mortality in Chinese Patients with ST-Elevation Myocardial Infarction We investigated the association between mean platelet volume (MPV) and risk of all-cause mortality in Chinese patients with ST-Elevation Myocardial Infarction (STEMI). We enrolled 1836 patients with STEMI in Xuanwu Hospital from January 2008 to December 2013. Based on MPV, patients were categorized into the following groups: <9.5 fL (n = 85), 9.5–11.0 fL (n = 776), 11.1–12.5 fL (n = 811) and >12.5 fL (n = 164), respectively. Mean duration of follow-up was 56.9 months, and 197 patients (10.7%) died during follow-up. All-cause mortality rates were compared between groups. The lowest mortality occurred in patients with MPV between 9.5–11.0 fL, with a multivariable-adjusted hazard ratio (HR) of 1.15(95%CI 0.62–1.50), 1.38(95%CI 1.20–1.68), and 1.72(95%CI 1.41–1.96) in patients with MPV of <.5, 11.1–12.5 and >12.5 fL, respectively. Therefore, increased MPV was associated with all-cause mortality in Chinese patients with STEMI. MPV might be useful as a marker for risk stratification in Chinese patients with STEMI. Clinical Outcomes. Patients were followed between 2 and 7 years (mean 56.9months). 197 patients (10.7%) died, including 144 deaths from cardiac causes (recurrent myocardial infarction, n = 41; heart failure, n = 75; serious cardiac arrhythmias, n = 23; and sudden death, n = 5) during the follow-up period. Kaplan-Meier curves showed that the lowest cumulative survival rate occurred in patients with MPV ﹥12.5 fL, while the lowest mortality occurred in patients with MPV between 9.5-11.0 fL (p = 0.011; Fig. 1). The results of the Cox proportional hazards model examining the relationship between MPV and all-cause mortality using 9.5-11.0 fL as the reference group. After adjustment for other factors independently associated with mortality, the risk associated with lower MPV was no longer significant. The risk associated with elevated MPV was attenuated but remained statistically significant with increased risk for mortality even for patients with MPV within the normal range (Table 3). Discussion The main finding in the present study was that increased MPV was associated with all-cause mortality in Chinese patients with STEMI. The association remained significant even after adjustment for other independent variables. Platelets are quite heterogeneous blood elements, diverging in terms of size, density and reactivity. The changing of these parameters might be associated with various diseases either as a triggering or propagating factor. In general, the smaller platelet size indicates low production state such as aplastic anemia or myelodystrophic states 13 , while the larger size indicates a higher destruction rate such as autoimmune related or other acute inflammatory states 14 . MPV, which is the most accurate measure of the size of platelets, is a simple and easy measurement. A higher MPV has been previously observed in patients with a history of smoking 15 , diabetes mellitus 16 , cerebrovascular disease 17,18 , congestive heart failure 19 and in hypertensive patients with evidence of target organ damage 20 . Recent studies have showed that a higher MPV might be identified as a marker of increased morbidity and mortality in patients with ACS, especially in STEMI. Martin et al. found that higher MPV values were associated with increased subsequent ischemic events among patients with acute myocardial infarction 21 26 . Similarly, we also found that increased MPV was associated with long-term mortality in Chinese patients with STEMI, even after adjustment of other factors. Although recent studies have showed that increased MPV was an independent risk factor for poor outcomes in cardiovascular disease, the mechanistic links between MPV and poor prognosis in cardiovascular disease have not yet been fully understood. Thrombus formation in the setting of acute myocardial infarction is a complex dynamic process involving both thrombogenesis and thrombolysis and platelets are of pathogenic importance in coronary atherosclerosis and its complications. It has been shown that larger platelets are metabolically and enzymatically more active than smaller ones and aggregate easily 27 . They express higher levels of prothrombotic substance, thromboxan A 2 , serotonin, β -thromboglobulin, and procoagulatory surface proteins such as P-selectin and glycoprotein IIIa. These inflammatory makers play a pathogenic role in atherogenesis and cardiovascular disease progression and instability 28 . An increased MPV decreases the inhibitory effectiveness of prostacyclin I2 (PGI2) on both platelet aggregation and the release reaction 29 . A shortening of bleeding time and a higher level of P-selectin were previously reported to associate with acute myocardial infarction. Cytokines may possibly trigger the production of larger, more reactive platelets following platelet destruction in peripheral blood. Moreover, elevated levels of CD40 ligands, which are expressed by activated platelets, have been found in atheromatous plaques 30 . Based on the above Analysis, further studies are needed to clarify the relationship between MPV and different clinical endpoints. Some limitations in the present study must be considered. This was a single-center, retrospective analysis. Residual confounding factors might thus have affected the results, regardless of the adjusted analysis. Further studies are needed to clarify the mechanisms underlying the relationship between MPV and mortality. In conclusion, increased MPV was associated with all-cause mortality in Chinese patients with STEMI. MPV might be useful as a marker for risk stratification in Chinese patients with STEMI. Study Population. This was a single-center, retrospective analysis. This retrospective study was approved by the Ethics Committee of Xuanwu Hospital, Capital Medical University. The methods were carried out in accordance with the approved guidelines. Since this was a retrospective study, the requirement for informed consent was waived. We enrolled 1836 patients with STEMI in Xuanwu Hospital from January 2008 to December 2013. STEMI was a clinical syndrome defined by characteristic symptoms of myocardial ischemia in association with persistent electrocardiographic (ECG) ST elevation and subsequent release of biomarkers of myocardial necrosis. We excluded patients with any blood, renal, hepatic, autoimmune diseases, malignancy, and the use of thrombolytic drugs within the previous 24 hours. Baseline blood analyses were measured on admission. Demographic data (including age, gender and so on), treatments and comorbidities (hypertension, diabetes, dyslipidemia, prior myocardial infarction and cerebrovascular disease) were also recorded. Classification of MPV. Baseline MPV was measured on admission using XE-5000 automated hematology analyzer (Sysmex, Kobe, Japan) and the normal range was 9.5-12.5 fL. The majority of patients (n = 1587, 86.5%) had MPV within the normal range, while 85 (4.6%) patients below normal range and 164 (8.9%) above normal range. Considering the small numbers of patients with MPV out of the normal range, the relation between MPV |
(if it's divided by tertiles or quartiles) and clinical outcome would be attenuated. It's more significant when MPV was divided by reference range. Thus, to evaluate the relation between MPV and clinical outcome, the 1836 patients were categorized into the following groups: <9.5 fL (n = 85), 9.5-11.0 fL (n = 776), 11.1-12.5 fL (n = 811) and ﹥12.5 fL(n = 164), respectively. Clinical Outcome. The end-point of this study was the incidence of all-cause mortality. Cardiac death was defined as death caused by recurrent myocardial infarction, heart failure, serious cardiac arrhythmias and sudden death. Clinical outcome data were collected until 1st November 2015 and mean duration of follow-up was 56.9 months after hospital discharge. Clinical event data were fully collected during the follow-up period for all patients by reviewing the national death registry and by contacting each patient individually and independently reviewing the hospital course for major clinical events if the patient had been rehospitalized. Statistical Analysis. For baseline characteristics, variables were summarized as percentages for discrete variables and means ± standard deviations for continuous variables. We used χ 2 test or analysis of variance, respectively, to test for differences in categorical or continuous factors between different groups of MPV. Multivariate linear regression was used to determine factors associated with MPV. We used Cox proportional-hazards model with backward selection to examine the association between MPV and clinical outcome. Variables considered for inclusion in the multivariable model included: age, gender, TG, LDL-C, WBC, platelet, coronary revascularization, medication, and history of hypertension, diabetes mellitus, dyslipidemia, prior myocardial infarction and cerebrovascular disease. Survival curves were constructed using the Kaplan-Meier method, and comparisons were made using the log-rank test. Statistical analyses were performed using the SPSS statistical software version 17.0 (Chicago, IL). Differences were considered statistically significant at the 2-sided P < 0.05 level. Childhood health and social class reproduction in China ...that the health and nutrition of one generation contributes, through mothers and through infant and childhood experience, to the strength, health and longevity of the next generation; at the same time, increased health and longevity enable the members of that next generation to work harder and longer to create the resources which can then, in their turn, be used to assist the next, and succeeding, generations to prosper. Fogel and Grotte (2011) impact the prospect of adulthood, rather than only examining who can gain upward social mobility. Here, "childhood living condition" is a multidimensional and holistic concept. In China, current research on social stratification and mobility mainly focuses on the role of education in social reproduction. This article, instead, focuses on the role of another key factor, childhood health. Examining childhood health can enhance our understanding of social stratification, intergenerational reproduction of inequality, and determinants of earnings and income (Palloni 2006). Unlike in the West, in the Chinese academia the impacts of childhood health on human development and social reproduction remain a highly unexplored area (Sun and Peng 2014). Using retrospective studies and data of heights, this research analyzes the impacts of childhood nutrition, hygiene, and health on adult socioeconomic status (SES) attainment. Two questions will be addressed: First, how does family background impact childhood nutrition, hygiene, and health? And second, do childhood nutrition, hygiene and health have impacts on adult SES? This article is organized as follows: Section one will review the existing literature, discuss the long-term impacts of childhood health and determinants, and propose several hypotheses accordingly. Section two will describe the data, variables and models used in this research. Section three will examine the effects of childhood nutrition, hygiene, and health in the intergenerational transmission of SES. Finally, Secton four will summarize and discuss the findings. Mechanisms of social stratification: education and health Various pathways exist between family background variables (parental characteristics) and the variables related to child outcomes. These pathways can be classified into two groups: (1) direct pathways: parents influence their children's SES by directly passing on resources to the latter. An unequal power structure, for example, allows those holding redistributive power to transfer resources directly to their offspring through rentseeking behaviors (Chen 2010;Liu 2018). The social capital possessed by different social classes vary, which will influence the next generation's career advancement. (2) Indirect pathways: parents' resources influence children's SES, but the influence has to be mediated by children's attributes, such as education, health, etc. 1 Past research on indirect pathways to social stratification mainly focuses on the role of education, whereas the role of childhood health has not been adequately discussed (Currie 2009). Numerous economic and public health studies have revealed that health, in particular childhood health, have significant impacts on adulthood health condition and SES (Case and Paxson 2008;Campbell et al. 2014;Basu 2015). It has been reported that some rural areas in China face severe challenges of infant nutrition and health. For instance, in a 2013 survey on 1808 infants from 351 villages in several impoverished counties in south Shaanxi Province, 48.8% of the infants suffered anemia, 20% experienced cognitive developmental delays, and 32.3% were delayed in their psychomotor development (Luo et al. 2015). These childhood health problems not only affect children's academic performance and education attainment (Wang et al. 2016), but also will have long-term impacts on their adulthood SES (Almond et al. 2010). In other words, poor childhood health may have already compromised the prospect of their adult life. However, the role of childhood health in social stratification and social mobility has not been adequately discussed in China, primarily because of the neglect from existing theories. First, in existing research on social stratification and social mobility, education has been viewed as the main mediating factor. The classic Blau-Duncan model distinguished ascriptive characteristics and achieved characteristics, highlighting the key role of child's education (achieved characteristic variable) in intergenerational transmission of SES (Blau and Duncan 1967;Zhou 2009). Based on the Blau-Duncan model, the Wisconsin model further studied and underscored the impacts of educational expectation and influences of significant others (Sewell et al. 2001). The current research on social stratification and social mobility in China still follows the Blau-Duncan model (Li and Zhu 2015); as a result, social stratification research in the country predominantly focuses on educational stratification. Of course, there is no doubt that education consists in an important factor in SES attainment in modern society, and a social resource that members of a society actively pursue and compete for (Treiman and Yip 1989;Xu 2017). Studies have found that education inequality in China has worsened, despite the expansion of education system (Hao 2007;Li 2014). The worst educational stratification is found in the period of primary and junior secondary education (Wu 2013;Tang 2015). Scholars are increasingly aware of the importance of early educational inequality, but most research on the topic focuses on the different forms of capital possessed by family, or parents' educational practice. Based on the CFPS2010 data, Yu Xie and his colleagues found significant correlations between family's economic condition and children's skill acquisition. Paradoxically, this research also found that although the main pathway is through non-material resources such as educational practice, educational practice per se is not influenced by economic condition (Liu and Xie 2015). Studies abroad found that family's socioeconomic condition during one's early childhood has important influence on his/her educational attainment, and this effect is greater than that of socioeconomic condition during one's middle childhood Case et al. 2002). That being said, it remains unclear the pathways through which socioeconomic condition affects children's skill acquisition and educational attainment (Currie 2009). Besides the diverse forms of capital or upbringing, we believe childhood health could be another key to open this black box. Second, past research on social stratification did not pay enough attention to the individuals' ascriptive statuses (including childhood health) prior to entering the educational system. Instead, they are often treated as control variables. On one hand, sociologists tend to assume that individual differences are none or negligible upon birth, which has been strongly challenged by sociologists of genetics. This group of scholars argue that the outcomes of the influence of social factors on individuals depend on specific genetic types and the nature of the social factors (Hu et al. 2012). On the other hand, when researchers of stratification study ascriptive factors, they tend to look into parental SES (such as in the Blau-Duncan model) and treat predetermined factors that influence individual educational or job attainment rather as disturbance variables, as they believe that individuals are born with certain "capability", intelligence, or genes. 2 Although genetic influences are not negligible, the genetic influences that have been identified can only explain a small proportion of human diversity (Currie 2011). A larger proportion of the variation is attributable to social factors. There is no definitive conclusion on to what extent so-called IQ and talent are genetic factors. Previous research concluded that genetic factors can only explain 23% of the variation in educational attainment, whereas family factors can explain 41% (Nielsen and Roos 2015). In addition, the influence of genetic factors is also mediated by environmental factors; whether the impacts of genetic factors are triggered depend on socio-environmental factors. In a beneficial environment, negative genetic influences may not be triggered on infants. Therefore, childhood health is the outcome of the combination of genetic propositions and family background/ resources. Further research is needed to understand the complexity of the mechanisms. Third, although sociologists in China pay increasing attention to health-related research, existing research tends to focus on the influence of social background on health outcomes (Wang 2011(Wang , 2012(Wang , 2017Jiao 2014) but somehow overlooks the impacts of the stratification in childhood health on social stratification and social mobility. Bulk of the health-related research debates on the social causation theory and the health selection theory. The former views socioeconomic inequality as the fundamental cause of health inequality (Warren 2009;Bird et al. 2010); and education is believed to be the key determinant of health outcome, among the three socioeconomic indicators (occupation, education, and income, see Ross and Mirowsky 2010;Hu 2014;Hong and Chen 2017). Wang (2011)'s research, for example, concludes that intergenerational social mobility has significant impact on children's health outcomes-in other words, health outcomes are viewed as the result of social stratification, rather than an independent variable that can influence the dynamics of stratification. Meanwhile, education is treated as both an independent and a dependent variable. In contrast, the health selection theory underscores the influence of health inequality on the attainment of educational and socioeconomic status (Haas 2006). Economists see education and health as core components of human capital, which can influence economic output (Schultz 1961). Grossman (1972) even proposed the concept "health capital" and framed health as a lasting form of capital stock, which provides healthy working time. Extensive economic research has shown that on one hand, poor health can lead to impoverishment by affecting individuals' job acquisition, income, and wealth accumulation; on the other hand, childhood health may affect cognitive development and the formation of human capital (Haas 2006;Heckman 2007;Cheng et al. 2014). A longitudinal study in UK identified the close relationship between individual height, family social class background, and social mobility, which, according to the researchers, reflects the influence of childhood health on social reproduction (Power et al. 1986). Using birth weight as indicator of childhood health, a research on twins in Norway found that birth weight has significant influence on infant morality, future height, IQ, educational attainment, and income (Black et al. 2007). In China, due to the Great Famine, the cohort born between 1959 and 1961 are more likely to be analphabetic and unemployed than other cohorts. Males from this cohort are more likely to marry late, and females from this cohort are more likely to be married to spouse that have lower educational attainment (Almond et al. 2010). The disagreement between the social causation theory and the health selection theory centers around their views on the relationship between education and health. Extensive research has tested the relationship between education and health; yet there is no consensus over the causal relationship between them (Grossman 2008). However, if we take a life cycle perspective of health and incorporate health in the discussion of social reproduction and social mobility, it is still possible to reconcile the two theoretical perspectives. Health is both a result and a cause of social stratification. Education influences health, but childhood health can also influence educational attainment |
and future health. One's health condition also changes in tandem with his or her life trajectory and is determined by both childhood and adulthood living condition (Strauss and Thomas 1998). Therefore, the prevalent analytical framework that places education as the core mediating factor for social stratification and mobility has some flaws. Adding health inequality in the analytical framework can help us to make sense of the contradicting arguments and empirical evidence generated from the two theoretical perspectives, which will also shed light on the dynamics of social stratification and mobility (Palloni 2006;Palloni and Milesi 2006;Haas 2006). In individual's life course, family background influences children's future SES attainment by influencing their early health, which is an important pathway for social reproduction. More specifically, empirical research needs to answer two questions: does parental SES have influence on the childhood health of their children? Does childhood health have influence on adult SES attainment? Family background and childhood health. Childhood health is closely associated with the resources and income level of the child's family. This relationship becomes more significant as the child grows up, because many harms resulting from disadvantageous conditions are cumulative (Case et al. 2002). Childhood health is mainly influenced by four factors: material conditions of the family, parents' educational attainment and knowledge, psychological impacts of adverse events, and prenatal health. First, family resources influence childhood health via medical service, nutrient intake, and living environment (Bradley and Corwyn 2002). Due to material hardship, impoverished families are often unable to provide their offspring with qualified healthcare and adequate safe food. Housing condition is also suboptimal. Nutrient intake is closely related to family economic conditions; insufficient nutrient intake leads to malnutrition, which in turn influences productivity and income (Strauss and Thomas 1998). Thanks to the rapid economic development following China's Economic Reform and Opening Up, the Chinese population has experienced a fast improvement in health, nutrient intake, and life expectance. However, malnutrition still persists in some rural areas and economically undeveloped regions (Almond et al. 2010). Between 1987 and 1992, children's height grew in urban areas as 5 times as fast than in the rural areas, mainly due to the inequality in nutritional adequacy (Shen et al. 1996). For 3-year-old children, their heights and weights are significantly related to whether they receive physical exam, their intake of nutrients, and parenting practice (Wu 2011). Children from some rural areas and economically underdeveloped regions show significant disadvantages in these aspects and are more prone to malnutrition (Chen et al. 2006). The major threat the children face in their living environment is hygiene. First, suboptimal hygienic condition can lead to infectious diseases such as flu, malaria, measles, and diarrhea. Although infectious diseases are in general under control in developed countries, yet children from low-income families are still more likely to suffer from asthma, as well as dental and hearing problems (Currie 2009). In developing countries, diarrhea caused by inferior hygienic conditions and diseases is an important threat to the healthy growth of infants (Lutter et al. 1992). In addition, unhygienic living conditions expose children to toxic substance, including air pollution, lead poisoning, and unsafe food. Children from low-income families in these countries are particularly likely to become victims of these hazards Gundersen and Kreider 2009). Living in contaminated areas or drinking from well instead of collective supply of water expose individuals to pollution of heavy metal (Zou et al. 2008). Second, due to their low educational attainment, parents in low-income families often lack knowledge on healthcare and parenting, which may affect their children's health (Currie and Goodman 2010). Surveys have shown that in some rural areas in China, caregivers' lack of knowledge have posed a serious challenge to infants and children's nutritional adequacy and health . In India, discrimination against females affects girls' nutrient intake and care, which affects girls' heights and weights (Deaton 2008). Education is considered as a learned effectiveness, which enables individuals to think in logical, rational, and integral manner so that they can develop effective solutions to problems and avoid anxiety and depression (Ross and Mirowsky 2010). Therefore, education not only influences one's own health, but can also impact the health of his/her offspring through parenting practices. Third, children from low-income families are often more likely to experience negative events, leading to stress, depression, and negative impacts on sociopsychological health (Chen 2004). Fourth, childhood health also reflects prenatal health. Besides genetical factors, prenatal health is also influenced by family's social and economic resources. Research has shown that infants born in impoverished mothers are likely to suffer stunting (Currie and Moretti 2007). Natural disasters such as famine can also lead to increasing stress and malnutrition among mothers (Almond et al. 2010), which will influence the health of their offspring. Therefore, in the early stages of life course, family SES has significant impacts on childhood health, and children born to low-income families are often found in unsatisfactory health state. Heckman (2007) proposed that workers' income is mainly determined by their individual capability, including cognitive capability, non-cognitive capability, and health. He contends that childhood health will influence adulthood health, as well cognitive and non-cognitive capabilities, which will influence adulthood labor supply and productivity, and thus, SES. Poor childhood health leads to low educational attainment and early occurrence of chronical diseases, affecting employment and income (Haas et al. 2011). A study in UK found that adults who suffered chronical disease between age 7 and 16 face higher likelihood of low educational attainment, unemployment, and low income (Case et al. 2005). Data from the China Health and Nutrition Survey (CHNS) show that individuals who experienced famine during childhood are significantly disadvantageous in heights and income (Chen and Zhou 2007). Overall childhood health and nutrient intake have significant impacts on adulthood income (He and Yuan 2014). Two pathways are at play in this relationship: first, early life health affects cognitive development and educational attainment, which influences job attainment and income. Second, health in adult life also influences adulthood SES. Mechanisms through which childhood health exerts influence A large amount of research conducted under the Blau-Duncan model reveals the important the key role of education in individual SES. Family economic conditions have important influence on children's educational attainment Case et al. 2002). As poverty persists, its negative impacts also accumulate . Childhood health and development have important mediating effects in this process. Family's SES influence children's cerebral cortex development, particularly the zones that influence abilities such as language, reading, action execution, and spatial skills (Noble et al. 2015). Poverty leads to lower preschool abilities, resulting in worse academic performance, failure to enter higher school, low participation in school activities, and even dropping out ). The malnutrition caused by poverty affects children's cognitive development (Maluccio et al. 2006). Health issues such as auditory, dental and psychological problems will severely affect children's academic performance and educational attainment (Currie and Goodman 2010). A survey conducted in the early years of China's Economic Reform revealed the close correlation between childhood malnutrition and future health/ cognitive development (Jamison 1986). Years later, in China's impoverished rural areas, many children still suffer insufficient intake of micronutrient, anemia, and infectious parasitic diseases, or have vision problems but lack resources to acquire eyeglasses, which poses a severe constraint on their learning potential (Hannum and Zhang 2012;Wang et al. 2016). The China Education Panel Survey (CEPS) data also suggest that better childhood and adolescent health is associated with better exam performance, higher cognitive ability, stronger sense of self-efficacy, and social skills (Liang 2017). In general, individual educational attainment remains unchanged after reaching certain age. This, however, is not the case of one's health state. Health in one's early life is likely to have impacts on the health state in later life stage. At least three pathways exist between one's childhood health and likelihood of disease in adult life: (1) incubation mode: event in a critical moment can generate long-term risk for disease in later life stages; (2) accumulation mode: advantages and disadvantages accumulate throughout one's life course; and (3) pathway mode: one's health state at the starting point will influence that at the endpoint (Marmot 2004). In his famous Children of the Great Depression, Elder (1999) documented the strong impacts of childhood economic deprivation on health in adult life. Studies based in the US revealed that the variable "family background by age 10" has significant impacts on one's smoking behavior, health state, and obesity by age 30 (Conti and Heckman 2010). The impacts of childhood health are so persistent that it is significantly associated with elderly health and self-care ability (Haas 2008;Pakpahan et al. 2017). Based on a longitudinal cohort study in Canada, Currie and colleagues (2010) concluded that childhood health has impacts on adult SES by affecting health in later life stages, except if the health event is only short-term such as leg fracture or open wound. In addition, empirical evidence has shown that childhood psychological health has greater impacts on adulthood educational attainment, job income than other factors such as physical health (Delaney and Smith 2012;Lundborg et al. 2014). In sum, chronical, accumulative factors of health have critical impacts on adulthood SES (Case et al. 2002). Therefore, Palloni (2006) argued that the role of childhood health in adulthood SES acquisition is no less important than other factors that have been widely discussed, such as education. Research strategies and hypothesis A major challenge in childhood health research is the difficulty in collecting interviewees' childhood health data, unless in longitudinal studies. 3 There are two alternative options: (1) to ask interviewees to recall their childhood health ). Yet, retrospective self-assessment of childhood health is biased (Currie 2009) because it is highly subjective and is subject to collective and systematic bias (Qi 2014). In comparison, retrospective self-assessment of nutrient intake is more objective and reliable, although retrospective bias also exists. (2) to use proxies such as birth weight as indicator of fetal health (Currie and Moretti 2007), or to use height as indicator of childhood health (Shen et al. 1996;Case and Paxson 2008). The advantage of using height as proxy is that it allows objective measurement. Also, adult height is the outcome of childhood height and the growth during childhood and adolescence, and it is influenced by factors such as disease and nutrient intake (Bozzoli et al. 2009). Thus, adult height reflects fairly accurately the socioeconomic and public health condition during interviewee's childhood (Deaton 2008;Smith et al. 2012). Although height is also strongly related to intergenerational transmission, existing research has found that the genetic factor can only explain 5% of the intergenerational transmission of height; and that family background can be another important explanatory variable (Maher 2008). Thus, when it is impossible to directly measure childhood health, researchers often use adult height as proxy to measure childhood health and life conditions (Power et al. 1986;Fogel 1994;Deaton 2008;Case and Paxson 2008). This article also uses this method. So far, we have discussed the important mediating role that childhood health plays in social reproduction. Therefore, this study will first examine the impact of parental SES on childhood health. Based on the existing data, we use nutrient intake and hygiene to describe the family background that influences childhood health. Then, we will analyze the impacts of childhood health (using height as proxy) on individual educational attainment and SES. More specifically, the following hypothesis will be tested: Hypothesis 1a Higher family SES (measured by father's ISEI by age 14, parental educational attainment, parental household registration status) is associated with better childhood nutritional and hygienic condition. Hypothesis 1b Better childhood nutritional and hygienic conditions are associated with better childhood health (measured by height). Hypothesis 2a Better childhood health (measured by height) is associated with more years of schooling one receives. Hypothesis 2b Better childhood health (measured by height) is associated with higher adult SES (measured by the ISEI of first job and of current job). Hypothesis 2c Better childhood health (measured by height) is associated with better current health state. Data, variables and models This research uses the data from the "Urbanization and Labor Migration Survey" (hereafter referred as Tsinghua survey) conducted by Tsinghua University in 2012. The survey collected the information from 12,592 participants aged 18-69. The samples covered 500 villages/ residential communities from 147 districts/ counties in 28 provinces, autonomous regions, and direct-administered municipalities (that is, all the country's provincial-level administrative divisions |
except Qinghai, Tibet, and Hainan). The sampling in villages/ residential communities was based on mapping in the field, which created a sample space consisting of a list of addresses. Two types of dependent variables are included: (1) individual's current SES, using the ISEI score of respondent's current job as proxy 4 ; and (2) individual's self-assessment of current state of health (4 = excellent, 3 = good, 2 = fair, and 1 = poor). Five independent variables are used in this study. First, childhood nutrition and hygiene condition by or before age 14 include 4 measures. Two measures are used to describe hygienic condition: (1) main sources of potable water at age of 14 (3 = centralized water system or bottled water; 2 = well or spring water; 1 = water from sources such as a reservoir, river, creek, pond, lake, or rainwater), and (2) type of sanitation amenity at age of 14 (3 = flush toilet; 2 = non-flush toilet; 3 = other places, such as yard, livestock pen, pond, sea, lake, creek, river, or gutter). 5 The other two measures describe nutrient intake: (1) whether suffering hanger due to insufficient food supply before age of 14 (1 = never; 2 = sometimes; 3 = often), and (2) frequency of eating fish or diary product before age of 14 (ranging from 0 = never to 8 = at least once per day). Second, childhood health is measured by adult height (in centimeter, interval variable). Third, family SES includes the ISEI score for father's job when respondent was at the age of 14, 6 parental educational attainment (0 = never attend school; 1 = primary school; 2 = middle school; 3 = high school or above), parental household registration status (1 = urban; 0 = rural). 4 If the ISEI score of current job is not available, we used the ISEI scores of the last job instead. This, according to our results, makes no significant difference from simply deleting those cases from the sample. In addition, we did not use individual income when measuring SES. This is because this information is usually only available among formal employees and self-employed. However, 25% of the survey respondents were migrant workers of rural origin and 13% were dedicated to domestic work. Their income is often unclear or is only roughly added to their family income. To avoid having to delete a large number of samples or dealing with the unclear data, we followed the reviewers' advice and used ISEI score of current job to measure respondent's current SES. 5 As required by the structural equation modeling method, we treated the two hygiene measures as ordinal variables. In Table 2, the gradient relationship between these two variables and adult SES somehow supports this practice. 6 We only included the ISEI score for father's job in the model because many mothers did not hold formal employment, causing a large amount of missing data. Fourth, respondent's educational attainment is measured by years of schooling. The fifth one is ISEI score for respondent's first job. All the five independent variables are endogenous except family SES. The exogenous control variables include respondent's age, sex (1 = male; 0 = female), and ethnicity (1 = ethnic Han; 0 = ethnic minorities). A description of the variables can be found in Tables 1 and 2. The correlation coefficients among variables can be found in "Appendix Table 1". The sample size of Tsinghua survey is 12,592. Considering the timing of entering into and withdrawing from the labor market, our study targets respondents aged 30-60, which reduces the sample size to 8256. We also deleted 18.53% of the cases due to missing data, which further reduced our sample size to 6726, based on which we ran (1) standard deviations in parentheses; (2) the variables "experience of suffering hunger", "source of drinking water" and "type of sanitation amenity" are listed in the column 5 of Table 2 examines the correlations among variables of childhood nutrition and hygiene, height (a proxy for childhood health), and adult SES (including years of schooling, ISEI of first job, and ISEI of current job). For the nominal variables of nutrient intake and hygiene, we reported the mean value of adult SES variables in different nutritional/ hygienic categories. For the interval variables, we reported the Pearson's correlation coefficients (r). According to results shown in Table 2, those who never suffered hunger before age 14 have significant advantage in education, ISEI of first job and ISEI of current job, compared to those who occasionally or often suffered hunger before age 14. For example, those who never suffered hunger on average attended school for 3.7 more years compared to those who did. As for sources of potable water, respondents who drank water from a centralized water system or bottled water have much higher SES than those who relied on other sources for potable water. The variable "type of sanitation amenity" has similar effects on SES variables. In addition, the variables "frequency of eating fish etc. ", "adult height", and of adult SES also have significant, positive correlation. That being said, it is possible that childhood nutrition, hygiene, and health reflect the impacts of other social and economic resources of the family. Therefore, it is necessary to introduce control variables to examine the effects of childhood nutrition, hygiene, and health. To clarify the mechanisms and pathways of the effects of childhood nutrition, hygiene, and health, we conducted an SEM analysis. As shown in Fig. 1 and Table 3, we use "father's ISEI when respondent was at age of 14", "parental educational attainment", "parental household registration status" to measure respondent's family SES; use "experience of suffering hunger", "frequency of eating fish etc. ", "sources of drinking water", and "type of sanitation amenity" to measure childhood nutrition, and hygiene; and use "ISEI of current job" to measure respondents' current SES. We develop a structural model that includes these three latent variables, respondent's years of schooling, ISEI of respondent's first job, and self-assessment of current health state. Meanwhile, we control the effects of "sex", "ethnicity", and "age" on childhood nutrition and hygiene, ISEI of first job, education, ISEI of current job, and current health state. The correlations among the variables are shown in Fig. 1. We assume that family's SES and ISEI of current job have no direct effect on health-that effect is mediated through childhood health, education, and ISEI of first job. As it is difficult to assert the causal relationship between ISEI of current job and health-mutual causality may exist here-we set their relationship as correlated. 8 The goodness of fit of the structural equation model concludes that the causal model of Fig. 1 can be accepted. The CMIN/df is high. Yet, the chi square is closely associated with the sample size. Due to the large sample size used in this research, the RMSEA is a Fig. 1 Basic relationships in the structural equation model. Note the oval shapes represent latent variables, and the rectangular shapes represent variables that can be directly measured. The control variables include sex, age, and ethnicity, all having direct influence on nutrition and hygiene, height, education, current health state, ISEI of first job and ISEI of current job Pathway Effect Family SES → Nutrition and hygiene → ISEI of current job 0.775 × 0.134 = 0.14 satisfactory goodness of fit. As shown in Table 3, the RMSEA is smaller than 0.08, suggesting a fair goodness of fit. The values of NFI, TLI and CFI are all above 0.9 (Wu 2010: 486-491), suggesting a high goodness of fit. As shown in Table 3, the measurement model results (part 1) suggest that all the indicators we selected are significantly related to the latent variables that we want to measure. The structural model results (part 2) show that childhood nutrition and hygiene, as well as childhood health consist in an important pathway of social reproduction. First, family SES has significant impact on respondent's childhood nutrition and hygiene, and respondent's height. In the influence of family SES on height, approximately 40.5% of the influence is from the effects of childhood nutrition and hygiene. Thus, Hypotheses 1a and 1b are both supported. Second, we found significant positive impacts of height on years of schooling. Each 10 cm of increase in respondent's height is correlated to 0.2year increase in year of schooling, which supports the Hypothesis 2a. Third, respondent's height and childhood nutrition and hygiene do not have significant effects on first job's ISEI; meanwhile, the acquisition of the first job is impacted by family SES and educational attainment. The effects of height are completely mediated by education. Fourth, childhood nutrition and hygiene have highly significant effect on the ISEI of current job. Height does not have significant impact. The standardized coefficients suggest that childhood nutrition and hygiene have similar effects on ISEI of current job as education, which is ¼ of the effects of the ISEI of the first job. Hypothesis 2b is not supported, since childhood health, measured by respondent's height, has no significant impacts on the ISEI of the first job and the current job. Fifth, self-assessment of the current health state is highly influenced by childhood nutrition and hygiene, as well as height; the effects of these two variables are 5 times as large as the effects of education. ISEI of the first job does not have significant impacts. Thus, Hypothesis 2c is supported. Part 3 of Table 3 reveals the pathways of the effects of family's SES on respondent's ISEI of the current job. The effects of "childhood nutrition and hygiene" and "height" combine to count for as much as 23.3% of the total impacts of family SES on ISEI of current job, with the pathway "childhood nutrition and hygiene -ISEI of current job" (1) For the coefficients of the effects of the control variables (respondent's sex, age, and ethnicity) on nutrition and hygiene, height, education, ISEI of first job, and ISI of current job, please see "Appendix Table 2" (2)*p < 0.05; **p < 0.01; ***p < 0.001 counting for 22.9%. The direct effects of education and of ISEI of first job are similar, counting for 23.3% and 29.2% of the impacts, respectively. The mixed indirect effects of adding education and ISEI of first job count for 24.2%. This means that ¾ of the intergenerational transmission of SES occurs through the conventional pathways of education and first job (as in the Blau-Duncan Model), and the rest ¼ is explained by childhood nutrition, hygiene, and health. "Childhood nutrition and hygiene" and "height" have no significant impact on the acquisition of first job, but "childhood nutrition and hygiene" has significant impact on the ISEI score of respondent's current job. This is consistent with previous studies on the topic (Case et al. 2002); that is, as lives unfold, the impacts of childhood health on adult SES are also amplified. Our explanation of this delay is that individuals tend to be healthy in the early adulthood, but as they age, their health conditions are also stratified. In the Tsinghua survey sample, only 0.94% of the respondents aged 25-30 reported poor health, while 80.5% reported good or very good health. Among respondents aged 31-40, 3.59% viewed their health state as poor and 73.2% as good or very good. The proportion of the respondents reporting poor health state increased to 10.7%, and those reporting good or very good health dropped to 55.9%. This somehow confirms what Marmot (2004) called "incubation mode. " The impact of childhood health is often only latent when young individuals just enter job market, but it becomes increasingly manifest as they age. Numerous studies in the West also reached similar conclusions (e.g., Hass 2008; Pakpahan et al. 2017). Our analysis of the factors that influence self-assessment of current health state also supports the health-selection argument. The status of first job does not have significant impact on one's self-assessment of current health condition. The effect of "education" is reduced compared to "childhood nutrition and hygiene" and "height". This, of course, does not mean a complete rejection to the social causality argument. Education still has significant positive impact on one's self-assessment of current health state. This somehow supports the Ross and Mirowsky (2010)'s viewpoint, that is, among the three variables of "occupation", "income", and "education, " education is the key |
factor of health. Therefore, based on the results from the structural equation modeling analysis, we argue that family background has significant impacts on individual's childhood nutrition, hygiene, and health. Childhood health can influence educational attainment, but its impact on first job acquisition is minimal. The effect of childhood health is cumulative: it remains latent during early adulthood, but it gets more prominent in later life stages when individual health conditions are increasingly stratified. Conclusions and discussion Existing research in China on social stratification and mobility has been largely focusing on education, and research on health inequality tends to focus on the influence of adult socioeconomic status on health, or what Marmot (2004) called "status symptom. " This research examines the role of health in the process of intergenerational social reproduction. We conclude that childhood nutrition, hygiene and health can have lasting impacts on adult SES, and stratification in childhood health is an important mechanism that creates and reproduces social stratification and social inequality. The structural equation modeling analysis of the data from the Tsinghua University "Urbanization and Labor Migration Survey" reveals that, health and education are two important pathways for intergenerational social reproduction. However, their influences vary with stages of life course. First, family background has significant positive influence on childhood nutrition, hygiene, and health (using height as proxy). Second, childhood health has significant influence on education. Third, "childhood nutrition and hygiene" and "childhood health" have no significant influence on the acquisition of first job; but "childhood nutrition and hygiene" has significant impact on the ISEI of current job, with an effect similar to the direct effect of education. When young people first enter labor market, they tend to be in good health condition and their job acquisition is mainly influenced by their family SES and individual educational attainment. As they age, their health conditions are also increasingly stratified, and the effects of childhood health on occupational status and income also become manifest and significant. The effects of health and education are cumulative but in different ways. For members of a society, their educational attainments are likely to remain stable after certain age, but the cumulative effects of health are persistent until individuals permanently leave labor market or die. Childhood health has significant influence on current health state, which explains why the effects of childhood health are persistent and stable. Fourth, although it is questionable whether adult height is an accurate proxy to measure childhood health, we view it as a useful alternative when direct and objective measures are not available. Incorporating health inequality in the analysis of social stratification can help to resolve the disagreement between the health selection theory and the social causation theory in the existing literature. According to Wang (2011), the social causation theory has greater explanatory power in China, although the health selection theory fits better when explaining the social gradient in health between manual and non-manual labor. In other words, different theories may fit better when applied on different social groups. In our opinion, the reason why these two theories show contradicting empirical evidence is that the relationship between health and SES varies with stages of life course. In the early stages of life course, family SES is a key determinant of childhood health, suggesting a greater explanatory power of the social causation theory. As adults enter job market, the health selection theory becomes increasingly relevant. Therefore, both theories are valid for explaining the dynamics of social stratification. In social stratification and social mobility research, health should not be viewed merely as a result of social stratification. Rather, we need to explore the role of health in the dynamics of social stratification. This will expand the horizon of the stratification research and deepen our understanding on social stratification and social mobility in China and other countries. The results of the structural equation model reveals that the effect of childhood nutrition, hygiene and health on social reproduction is about half of the effect of education. Thus, childhood health and their key factors should not be overlooked in social stratification and social mobility research. Exclusively focusing on the role of education in social stratification and overlooking the role of health may lead to victim blaming. Children from low-income families are more likely to suffer poor health, which hinders their physical and cognitive development; even they are given the same education opportunity as their affluent peers, they tend to fall behind in school. Society tends to attribute their poor performance to individual idiosyncrasies, such as IQ, efforts, etc., which is counterproductive for reducing class rigidity and social inequality. Although poor childhood health hinders individuals' future development, it does not mean that the damage cannot be repaired. Many policy initiatives can potentially mitigate the negative impacts of poor childhood health (Almond and Currie 2011). Research has found that the intergenerational transmission of health conditions varies from place to place. In Indonesia, the intergenerational correlation of health in economically developed regions is relatively weak, comparing to that in undeveloped regions (Almond et al. 2012;Kim et al. 2015). The highly developed social security system in Australia has virtually eliminated the impact of mother's mental disorder on children (Le and Nguyen 2015). In China, where the popular saying "Don't let your children lose at the starting line" is widely accepted, how to effectively reduce inequality in childhood health is closely related to future human capital and labor productivity, and to mitigate "class crystallization"-a heated debate topic in the country. First, "dietary supplements programs" (such as midday meal program) will be necessary for low-income pregnant women and children. Improving the nutrient intake among low-income children will help to reduce future educational and social inequality. Research in other countries has shown that dietary supplements programs can significantly improve infants' nutritional conditions and benefit their future development (Habicht et al. 1995;Campbell et al. 2014). Second, improving the hygienic conditions and personal hygiene habits among vulnerable and low-income population is also a critical intervention measure. Third, simply improving medical service for impoverished children does not suffice. To improve their health conditions requires not only treating their diseases, but also improving the overall conditions of their family (Santrock 2009: 132). This article has several limitations. First, collecting data on childhood health is a serious challenge, which requires not only high-quality data collection, but also a thorough discussion on the weight of the influence of genetic factors and of family resources on health outcomes. Second, in the cross-sectional data used in this research, it is often impossible to capture the premature deaths from health problems among earlier cohorts. However, this only leads to an underestimation of the impacts of health on education and SES acquisition (Haas 2006) and will not alter the conclusions of this study. Third, we have not found an effective solution to the endogeneity issue. SES variables such as parental educational attainments contain genetic factors of capabilities, but they are not good proxy variables because genetic factors can influence the SES acquisition of both parents and children. The fourth challenge is associated with controlling for family background variables. Although the variables of nutrition, hygiene and health may reflect the family income levels after controlling for the family background variables, data on respondent's family income during childhood remain largely unavailable in the cross-sectional data. We hope to obtain larger high-quality datasets in the future in order to further examine the complex mechanisms through which childhood health impacts individuals' future SES acquisition. (1) Pearson correlation coefficient is used to measure the correlation between variables. 5′AMP-activated protein kinase α deficiency enhances stress-induced apoptosis in BHK and PC12 cells Abstract 5′AMP-activated protein kinase (AMPK) activation occurs under a variety of stress conditions but the role of this enzyme in the promotion or inhibition of stress-induced cell death is unclear. To address this issue, we transformed two different cell lines with shRNA-expressing plasmids, targeting the alpha subunit of AMPK, and verified AMPKα downregulation. The cell lines were then stressed by exposure to medium without glucose (PC12 cells) or with the viral thymidine kinase-specific DNA replication inhibitors: acyclovir, penciclovir and ganciclovir (herpes simplex virus thymidine kinase-expressing Baby Hamster Kidney cells). In non-AMPK-downregulated cells, these stress treatments induced AMPK upregulation and phosphorylation, leaving open the question whether the association of AMPK activation with stress-induced cell death reflects a successful death-promoting or an ineffective death-inhibiting activity. In AMPKα-deficient cells (expressing AMPKα-specific shRNAs or treated with Compound C) exposure to low glucose medium or DNA replication inhibitors led to an enhancement of cell death, indicating that, under the conditions examined, the role of activated AMPK is not to promote, but to protect from or delay stress-induced cell death. this enzyme in cell death. Contrasting the reported protective effects of AICAR, Saitoh et al. [6] report that AICAR treatment effects a reduction in gastric cancer cell viability. Further evidence supporting the argument that AMPK activation leads to apoptosis is provided in a study showing that both the AMPK activators, metformin, and AICAR induce  cell apoptosis and that 'compound C', an inhibitor of AMPK, reduced metformin-induced apoptosis. It was further shown that apoptosis associated with activated AMPK involves JNK and c-Jun phosphorylation and coincides with Caspase-3 activation [7]. Finally, in a study on AMPK1 subunit induction in response to treatment with DNA-damaging agents, Li et al. [8] report that AMPK1 is upregulated during DNA damage-induced apoptosis in a variety of cell lines, that overexpression of AMPK1 causes growth arrest, and hypothesize that AMPK1 induction may facilitate cell killing. Mammalian AMPK is a heterotrimeric complex comprising a catalytic ␣ subunit and regulatory  and ␥ subunits. Multiple isoforms exist for each subunit (␣1, ␣2, 1, 2, ␥1, ␥2, ␥3) theoretically giving rise to 12 AMPK holoenzymes, differing in subunit isoform combination. Functional properties of the enzyme may also depend on isoform usage, for example, complexes containing the ␣1 isoform have an exclusively cytoplasmic location and are stimulated to a much lesser extent by AMP than complexes containing the ␣2 isoform which are predominantly nuclear, suggesting a role for ␣2 complexes in regulating gene expression [9]. Phosphorylation (activation) of AMPK occurs at the T172 residue on the ␣ subunit and is promoted by AMP binding. Dephosphorylation (inactivation) of AMPK occurs when the enzyme is bound to ATP instead of AMP. The activation status of AMPK is therefore controlled by the intracellular AMP:ATP ratio, so that if intracellular ATP levels fall, and the ratio shifts in favour of AMP (during stress conditions such as glucose and/or oxygen depletion), the enzyme is predominantly bound to AMP and becomes activated. Once activated, AMPK is known to phosphorylate several downstream targets including acetyl-CoA carboxylase, glycogen synthase, phosphofructokinase [10,11] and the transcriptional coactivator p300 [12], with the overall effect of switching off ATP-consuming pathways (such as fatty acid, glycogen and protein synthesis) and switching on ATP-generating pathways (such as glycolysis and fatty acid oxidation). This in turn has the effect of restoring cellular energy levels, which may be important in maintaining cell survival under conditions of stress. However, when cell death is inevitable, AMPK may further be important in influencing whether death occurs via the necrotic or apoptotic route. It is suggested that the downstream controller capable of directing cells towards either necrosis or apoptosis is ATP, based on the accepted hypothesis that apoptosis is an active, energy-requiring process [13][14][15]. Evidence suggests that, when the cell's ATP levels fall below a critical threshold, apoptosis ensues as long as enough ATP is still available for energy-requiring apoptotic processes. Further falls in ATP levels below the critical threshold result in failure to maintain apoptotic processes and necrosis ensues [16]. Therefore, as a cell's ATP levels fall below the critical threshold for maintenance of survival, the effect of AMPK activation may be to promote apoptotic, rather than necrotic, death. To address the paradox concerning the role of AMPK activation in cell death or survival, we investigated the phosphorylation status of AMPK in two in vitro death systems: in herpes simplex virus thymidine kinase-expressing Baby Hamster Kidney (HSVTK + BHK) cells, which undergo cell death on treatment with the antiviral guanosine nucleoside analogues acyclovir (ACV), penciclovir (PCV) and ganciclovir (GCV) [17], and in PC12 cells exposed to glucose-free medium. In both systems cell death was associated with AMPK activation, and the magnitude of AMPK activation positively correlated with the extent of apoptotic death. |
Furthermore, transformation of the cells with shRNA-expressing vectors, which downregulated AMPK, resulted in accelerated and enhanced death, indicating that AMPK plays an important role in cell death inhibition under conditions of stress. Materials and methods Cell culture HSVTK-transformed BHK cells were grown in Dulbecco's Modified Minimal Essential Medium (DMEM) supplemented with 5% fetal bovine serum (FBS). PC12 cells were grown in RPMI1640 medium supplemented with 10% horse serum and 5% fetal calf serum. For glucose-deprivation experiments, PC12 cells were washed three times in PBS and maintained in RPMI1640 medium, with or without glucose, supplemented with 2% horse serum and 1% fetal calf serum. Compounds GCV, PCV, and ACV were obtained from GlaxoSmithkline Research and Development, Stevenage, UK. Guanosine nucleoside analogues were solubilized in water and, for experiments, were used at working concentrations of 1 M and 10 M. The AMPK activator, AICAR, was obtained from Toronto Research Chemicals, solubilized in water and used at working concentrations of 100 M and 1 mM. The AMPK inhibitor, 'compound C' (6- Semiquantitative Western blotting was carried out according to standard protocols. Rabbit polyclonal antibodies to cleaved Caspase-3 were obtained from the Hôpitaux Universitaires de Genève. Rabbit polyclonal anti-PARP antibody (reactive with both the 112 kD and 85 kD fragments) was obtained from Santa Cruz and used at a dilution of 1:1000. Rabbit polyclonal anti total AMPK␣ and anti phosphorylated AMPK␣ antibodies were obtained from Cell Signaling Technology and rabbit polyclonal antibodies specific to AMPK␣1 or ␣2 were obtained from Upstate. All AMPK␣ antibodies were used at a dilution of 1:2000. Flow cytometry analysis To assess viability, cells were harvested by trypsinization, washed once in PBS and resuspended in 800 l PBS containing 4l of propidium iodide solution (5 mg/ml). After 20 min incubation at 4ЊC the extent of staining was compared among the treatment groups by flow cytometry. For cell cycle analysis, cells were harvested by trypsinization, washed once in PBS and fixed in ice cold 70% ethanol for 1 hr. Cells were then washed once in PBS and resuspended in 800l PBS with 10 g of DNase-free RNase and incubated for 30 min at room temperature. 4 l of propidium iodide solution (5 mg/ml) were then added and after further 30 min incubation at 4°C, cells were analyzed by flow cytometry. Production of stable shRNA-expressing cell lines DNA templates encoding short hairpin (sh)RNAs, targeted against a region within the protein kinase domain of the ␣ subunit of AMPK, were cloned into the Ambion pSilencer2.1-U6 neo vector, according to the kit manufacturer's instructions. The upper strand sequence of the AMPK␣1 shRNA template (excluding the restriction sites for cloning into pSilencer) was: 5'CATGATGTCAGATGGT-GAATT CTCAAGAGA AATTCACCATCTGACATCATGTT TTTTGGAA 3' and the corresponding AMPK␣2 shRNA template was: 5'GTATGATGTCAGATGGTGAATT CTCAA-GAGA AATTCACCATCTGACATCATACTT TTTTGGAA 3' where the sequences in italics correspond to the sense and antisense siRNA templates respectively, the underlined 'G' at the beginning of the ␣2 sequence is an additional nucleotide inserted to improve RNA polymerase III transcription (since the enzyme preferentially initiates with a purine residue), the underlined sequence between the sense and antisense templates corresponds to the loop joining the siRNA template strands and the terminal, nonunderlined sequence corresponds to the RNA polymerase III terminator sequence and 'gene silencing' element. The vectors generated are referred to here as 'pSilencer/AMPK␣1shRNA' or 'pSilencer/AMPK␣2sh RNA'. Vectors were linearized prior to transformation. Cells were electroporated with pSilencer/AMPK ␣1shRNA, pSilencer/AMPK␣2shRNA or pSilencer/ negative control shRNA (the latter plasmid was provided by Ambion and contains a scrambled sequence of no known similarity to the human, rat or mouse genomes, for which the shRNA cassette is shown below). 5' ACTACCGTTGTTATAGGTG TTCAAGAGA CACCTATAACAACGGTAGT TTTTTGGA 3'. Stable clones and cell populations were selected in G418 (1 mg/ml for BHK and 0.5 mg/ml for PC12 cells) and assayed by semi-quantitative Western blotting for reduced levels of AMPK␣. Assessment of cell growth and viability For Trypan blue exclusion assays cells were resuspended in PBS and the same volume of Trypan blue (0.4%) was added to the cell suspension. Viable cells were counted in a Neubauer chamber. Confirmation of apoptosis in glucose-deprived PC12 and drug-treated HSVTK+ BHK cells Detection of poly ADP ribose polymerase (PARP) cleavage by Western blotting confirmed that glucose deprivation induced apoptosis in PC12 cells (data not shown). Guanosine nucleoside analogue treatment of HSVTK-expressing cells is reported to induce both apoptotic and non-apoptotic death, depending on the analogue used: previously we showed that PCV and GCV-induced apoptosis of HSVTK + BHK cells was associated with DNA laddering and phosphatidyl serine exposure, whereas death induced by ACV was not associated with these events [17]. To further clarify the GCV-and PCV-induced apoptotic process we show here that cleavage of proCaspase-3, and its substrate PARP, is also involved. Contrarily, PARP cleavage was not detected in ACV-treated cells and, although some residual Caspase-3 cleavage also occurred, this did not exceed the background levels observed in the non-treated control (Fig. 1). AMPK␣ 1/2 isoform expression AMPK␣ isoforms are reported to exhibit differing cell type and subcellular expression. Western blotting using AMPK␣1 and ␣2-specific antibodies revealed that the ␣1 isoform is predominantly expressed in PC12 and in HSVTK + BHK cells, whereas significant levels of both isoforms are detectable in HeLa cells (Fig. 2). However, no changes in individual isoform ratios were detectable upon cell death induction in PC12 or HSVTK + BHK cells by glucose deprivation or by guanosine nucleoside analogue treatment, respectively ␣ data not shown). AMPK␣ phosphorylation is associated with cell death in glucose-deprived PC12 cells, and in guanosine nucleoside analogue-treated HSVTK + BHK cells The extent of AMPK␣ phosphorylation occurring during glucose deprivation in PC12 cells and guanosine nucleoside analogue treatment of HSVTK + BHK cells was investigated by Western blotting. Glucosedeprived PC12 cells displayed increased levels of phosphorylated AMPK␣ (Fig. 3A shows the effects of 48 hrs glucose deprivation on AMPK␣ phosphorylation). In GCV and PCV-treated HSVTK + BHK cells, compared to the non-treated and ACV-treated samples, AMPK␣ is markedly phosphorylated by 24 hrs. Phosphorylation of the AMPK␣ subunit is further increased for all drug-treated samples, including ACV, on days 2 and 3 (Fig. 3B). Confirmation of AMPK␣ downregulation, and reduction in stress-induced phospho AMPK␣ levels, in pSilencer/AMPK␣ shRNA-transformed cell populations Stable transformants, expressing shRNAs targeting AMPK␣, were generated in a number of ways: (a) in HSVTK + BHK cells, cell populations were electroporated with the constructed pSilencer vectors and individual clones were grown up under G418 selection. Reduction in levels of AMPK␣ in individual clones was verified by Western blotting (Fig. 4A, panel (ii)). The clones were then treated with 10 M GCV and, compared to GCV-treated clones transformed with the negative control vector, also displayed reduced levels of total and phospho AMPK␣ (Fig. 4A, panels (v) and (vi)). Individual clones were then tested for differences in susceptibility to cell death during guanosine nucleoside analogue treatment. (b) HSVTK + BHK cells were first 'cloned out' to obtain a homogeneous, GCV-sensitive, population, prior to electroporation with the constructed pSilencer vectors. The electroporated populations were then selected with G418, tested for reduction in AMPK␣ expression (Fig. 4B), and assayed for differences in susceptibility to guanosine nucleoside analogueinduced death. (c) The homogeneous, GCV sensitive, HSVTK + BHK cell population generated in 'b' above, was electroporated with pSilencer vectors, followed by cloning out under G418 selection. Individual clones, with reduced or undetectable levels of AMPK␣, were then assayed for differences in susceptibility to guanosine nucleoside analogueinduced death. (d) PC12 cells were electroporated with the constructed pSilencer vectors, selected with G418, tested for reduction in levels of AMPK␣, and of phospho AMPK␣ during glucose deprivation (Fig. 4C), and assayed for differences in susceptibility to glucose deprivation-induced death. AMPK␣ downregulation slows cell growth and enhances cell death under stress conditions shRNA-expressing, AMPK-downregulated HSVTK + BHK cell clones, generated by method 'a' described above (where the cell population was not rendered homogeneous by 'cloning out' prior to electroporation), displayed disparate differences in the rate and extent of GCV-induced apoptosis, observed morphologically and by flow cytometry analysis of propidium iodide-stained cells (data not shown). These differences were unrelated to AMPK expression. However, since one of the clones generated was no longer sensitive to GCV due to loss of the HSVTK gene, it is likely that the disparate results between individual clones reflected differences in HSVTK expression. Despite this, it is of interest that, regardless of the method used to generate the AMPK-targeted, shRNAexpressing cell population, and regardless of the cell type transformed (to date, we have tested HSVTK + A B C BHK, HeLa and PC12 cell lines), the populations transformed with the pSilencer/AMPK␣2shRNA vector were the most difficult to grow and displayed a slower growth rate compared to the pSilencer/ AMPK␣1shRNA-transformed populations which also displayed a slightly slower growth rate than the pSilencer/negative control shRNA-transformed cells (Fig. 5). In some cases, however, recovery from slowed growth occurred within 3-5 passages, but this regain of growth rate was generally accompanied by regain-or increase in-AMPK␣ expression, despite maintained G418 resistance. shRNA-expressing, AMPK-downregulated HSVTK + BHK cells, generated by method 'b' described above (where the cell population was rendered homogeneous by 'cloning out' prior to electroporation) displayed obvious differences in susceptibility to 10 M PCV and GCV on days 2 and 3 of treatment, with an increased proportion of dead cells detected in the AMPK-downregulated populations compared to the negative control. However, no increased susceptibility to cell death was observed on treatment with the less potent compound, ACV. shRNA-expressing, AMPK-downregulated HSVTK + BHK cell clones, generated by method 'c' described above, displayed differences in susceptibility to 10 M PCV and GCV on day 2 and to 10 M PCV on day 3 of treatment, with an increased proportion of dead cells detected in the AMPK-downregulated populations compared to the negative control (Fig. 6A). Again, no increased susceptibility to cell death was observed with ACV. Compound C treatment of PC12 cells was found to be toxic at concentrations of 50 M (100% cell death within 24 hrs) and 5 M (50% cell death within 2-3 days of treatment). Marginal toxicity was observed with 1 M Compound C from day 3 of treatment. For this reason experiments were conducted with 1 M Compound C with the additional inclusion of a nontoxic concentration of 0.1 M. Treatment with 0.1 M Compound C resulted in an enhancement of cell death during glucose deprivation (Fig. 6C). These results strongly suggest that, while activated AMPK is increased under stress conditions, its role is to protect from cell death. The AMPK activator, AICAR, induces apoptosis in HSVTK + BHK cells, but via mechanisms not involving AMPK To investigate whether AMPK activation, independent of guanosine nucleoside analogue treatment, could induce apoptosis in HSVTK + BHK cells, nontransformed HSVTK + clones were treated with the AMPK activator, AICAR, at concentrations of 100 M and 1 mM. AICAR induced significant AMPK phos- shRNA-expressing cells) treated for 18 hrs with 0, 100M or 1 mM AICAR. Dead cells were counted as those scoring above the 10 2 value on the FL2 scale. Data are averaged from n = 3 clones per shRNA-expressing group. Asterisk indicates significant difference between levels of cell death in the negative control shRNA and AMPK␣ shRNA-expressing cells, treated with 1 mM AICAR (P < 0.05, Student's t-test). (C) Cell cycle analysis of propidium iodide-stained HSVTK + BHK cells at 42 hrs of treatment with 100 M or 1 mM AICAR. AICAR induces G1 phase exit and S-phase accumulation. AMPK expressiondependent differences in AICAR-mediated cell cycle distribution were not observed. A B C phorylation at the 1 mM, but not at the 100 M dose (Fig. 7A). While cells were unaffected by 100 M AICAR, the 1 mM concentration induced cell death associated with Caspase-3 cleavage (Fig. 7B). In order to determine whether cell death was a direct result of AICAR-induced AMPK phosphorylation, the effects of AICAR treatment were investigated using an AMPK␣-targeted shRNA-expressing clone, in which phosphorylated AMPK was undetectable, both in the absence or presence of 1 mM AICAR (Fig. 7C). This AMPK␣-deficient clone nevertheless underwent cell death on treatment with 1 mM AICAR, associated with Caspase-3 cleavage (Fig. 7D). To further investigate this, we additionally compared the effects of 100 M and 1 mM AICAR on the extent of cell death in nine HSVTK + BHK cell clones (n = 3 pSilencer/negative control shRNA, n = 3 pSilencer/AMPK␣1shRNA |
and n = 3 pSilencer/ AMPK␣2shRNA-expressing clones) at 18 hrs, 42 hrs, and 64 hrs). As before, 100 M AICAR was found to have no effect on cell death or survival. However, 1 mM AICAR increased levels of cell death in all clones regardless of expression of AMPK␣. While, at later timepoints (42 hrs and 64 hrs of treatment), 1 mM AICAR caused no significant differences in extent of death between AMPKexpressing and AMPK␣-downregulated clones, significant differences were observed between clones at 18 hrs of treatment with increased levels of death in the AMPK-downregulated clones (Fig. 8A, B). The observed increased levels of death in AICARtreated AMPK-downregulated cells not only provides an additional cell stress model supporting the increased sensitivity of AMPK-deficient cells, but also suggests that AICAR functions to kill cells via additional mechanisms other than activation of AMPK. AICAR treatment induces S-phase accumulation in HSVTK+ BHK cells Cell cycle analysis, carried out at 18 hrs, 42 hrs, and 64 hrs on HSVTK + BHK cells exposed to 100 M or 1 mM AICAR, revealed a dose-dependent overall reduction in the G1 peak and an increase in the proportion of cells in S-phase at the 42 hrs and 64 hrs timepoints (Fig. 8C). However, cell cycle stage accumulation appeared to be independent of AMPK expression level. Discussion The results of this study confirm a role for activated AMPK in delaying and reducing the extent of apoptotic cell death occurring as a result of glucose deprivation or of DNA damage. Activated AMPK may diminish apoptotic processes by influencing gene expression, via phosphorylation of transcriptional (co-)activators, or via inhibitory phosphorylation of proteins directly involved in apoptosis. This may have implications in cancer therapy, where specific inhibitors of AMPK might improve the outcome of standard chemotherapy. Here we used two different cell lines and two different cell death models and showed in both cases that AMPK downregulation resulted in enhanced cell death under the stress conditions imposed. The first model, in which HSVTK-expressing BHK cells were treated with antiherpesvirus guanosine nucleoside analogues, was originally described by Moolten in 1986 [18] and is employed as a suicide gene therapy approach for treating cancer. The majority of studies confirm that GCV induces apoptotic death in HSVTK-transformed cancer cell lines. Few studies have additionally employed ACV and PCV, probably because GCV is the most effective of these analogues. The pathway of GCV-induced apoptosis in HSVTK-transformed cells is not entirely elucidated. In the BHK cell model described, we confirm Caspase-3 and PARP cleavage, accompanied by cell shrinkage, DNA laddering and phosphatidyl serine exposure [17] during both GCV and PCV treatment. However, in this model the cell-killing effect of ACV treatment has always been less potent, appeared to induce sustained cell cycle arrest leading eventually to cell death but did not involve any significant Caspase-3 and PARP cleavage, phosphatidyl serine exposure or DNA laddering. In addition we previously reported ACV treatment of HSVTK + BHK cells to induce cell swelling, typical of necrosis, rather than the cell shrinkage characteristic of apoptosis. The slowed growth rate associated with AMPK depletion in untreated HSVTK + BHK cells might be predicted to render these cells more resistant to guanosine nucleoside analogue-induced death (due to the accompanying reduced rate of DNA replication). However, in the case of GCV and PCV, the AMPK-depleted cells display greater sensitivity to these analogues. It is of interest that, while AMPK downregulation enhanced apoptotic death by GCV and PCV treatment, it failed to influence ACV-mediated necrosis. This might be explained by the fact that GCV and PCV-treated cells die by an ATP-dependent mechanism: apoptosis, a pre-requisite for which would be a reduction in ATP levels in order to reach the 'apoptotic threshold', coupled with sufficient ATP levels to permit the apoptotic process [16]. In AMPK-deficient cells, ATP levels are likely to fall faster to the apoptotic threshold resulting in earlier or enhanced induction of apoptosis. ACV-mediated death appears to occur via an ATP-independent mechanism and is therefore less likely to be influenced by reduced AMPK activity. In the second model, in which glucose deprivation has been shown to induce apoptosis of PC12 cells [19,20], we show again that the apoptotic process is enhanced by AMPK depletion. Therefore we tentatively conclude that AMPK depletion may enhance certain apoptotic death processes but is unlikely to influence necrotic processes. Further studies are, however, necessary to establish whether this phenomenon is extendable to the majority of cell types. It should be considered, that these studies were carried out on cell types in which, using the Upstate isoform-specific antibodies, only AMPK␣1 could be detected. The fact that the AMPK␣2-targeted shRNA was able to achieve downregulation of total AMPK␣ in these cell lines, suggests that the ␣2 sequence may exhibit some cross-specificity, resulting in additional ␣1 knock-down. (This is conceivable, since the target ␣1 and ␣2 sequences differ in only one nucleotide.) Since the work was carried out only on ␣1-expressing cell lines, the apoptosis-enhancing effect of AMPK depletion may be specific only to ␣1 complexes. We have additionally not investigated  or ␥ isoform usage of the AMPK complexes within these cell types, which may again affect the outcome of the stress-induced cell death process. The alternative school of thought supporting a proapoptotic role for activated AMPK is generally supported by observations that the AMPK activator, AICAR, induces apoptosis at concentrations which also induce AMPK phosphorylation. Our study, however, which showed that an shRNA-expressing clone, with no detectable AMPK expression, not only underwent apoptosis on AICAR treatment, but also appeared to be more susceptible, than AMPK-expressing cells, to AICAR-induced death, provides evidence that AICARinduced apoptosis occurs via mechanisms independ-ent of AMPK activation and possibly also that AICARinduced AMPK activation may delay AICAR-induced death. A candidate mechanism by which AICAR may induce cell death, independently of AMPK activation, could be inhibition of DNA synthesis. This is evidenced by the AICAR-induced S-phase accumulation, observed in our cell cycle study, which supports the hypothesis that ZMP, the intracellular monophosphorylated form of AICAR, which mediates AMPK activation, is further converted to ZTP, the triphosphorylated form. dZTP could then interfere in DNA synthesis, resulting in cell death as a result of triggering of DNA damage pathways. The additional reduced levels of AMPK in the AMPK-downregulated clones, might subsequently render them more susceptible to the DNA synthesis-inhibition mechanism of cell death, which would provide an explanation for the AMPK expression-dependent differences in cell viability in the absence of AMPK expression-dependent differences in cell cycle stage accumulations. While we provide evidence from these studies, that AMPK depletion enhances stress-induced apoptosis, suggesting that AMPK inhibitors might be beneficial in combination with certain cancer therapies, the additional likelihood that AMPK upregulation/activation may delay stress-induced apoptosis, may be of clinical benefit in reducing damage induced by conditions such as hypoglycaemic shock or stroke. Implementation of disability policy framework in Namibia: A qualitative study Background This study explores some of the experiences of national programme managers, heads of national organisations of persons with disabilities (OPDs) and persons with disabilities in the implementation of the disability policies and legal framework in Namibia. Method In-depth interviews were conducted with multiple key stakeholders mentioned above. Interviews were digitally recorded and transcribed verbatim. The Community Based Rehabilitation (CBR) matrix (health, education, livelihood, social and empowerment) was utilised to guide the development of themes and subthemes. Results Twenty-one key informants participated in the study. Participants stated that while Namibia has made significant progress in addressing the medical and social needs of persons with disabilities, further progress can be achieved through better coordination, capacity building, review and updating of policies which allows for the inclusion of personal assistance, access to justice, improving supply chain management for a wide range of assistive devices, mainstreaming HIV prevention and treatment programmes, improved access to sexual reproduction and family planning, improved access to higher education, curricula reviews and effective monitoring and evaluating of the CBR programme. Conclusions The study revealed key issues that need to be addressed in reviewing the policy and legal framework so that it is responsive to the current needs of persons with disabilities. Further, the CBR programme needs an evaluation tool to assess its effectiveness and efficiency in meeting the needs of persons with disabilities and also to elicit their experiences and satisfaction. budgetary constraints, inconsistent definitions or models of disability and failure to address gender differences (Shumba & Moodley 2017). Similarly, South Africa has a comprehensive disability policy framework, but there is a dichotomy in policy formulation and implementation (Duncan, Sherry & Watson 2011). It appears that there is a universal tendency by governments to create disability policies as a symbolic gesture (Alant, Emmett & Samuels 2007). Thus, most of these disability policies miss the mark because they are interpreted by service providers as tools to deal with 'problems' of persons with disabilities and thus fail to accord them their equal rights to enjoy full citizenship (Duncan et al. 2011). This study explores some of the experiences of national programme managers, heads of national organisations of persons with disabilities (OPDs) and persons with disabilities in the implementation of the disability policies and legal framework in Namibia. While Namibia has made moderate progress in establishing policies and legislation (Shumba & Moodley 2017), there is no evidence of a study conducted to assess the awareness, knowledge and progress of implementation from the perspectives of implementers. This study provides some insights into the status of Namibia disability services and potentially could assist policymakers in identifying areas that need review and strengthening. Methods We conducted a retrospective analysis of progress in implementing policies that directly address the needs and rights of persons with disabilities in Namibia. This study utilised a research design that is qualitative, explorative, descriptive and contextual. Participants A review of policy and legal framework in Namibia (Shumba & Moodley 2017) provided an opportunity for purposive maximum variation sampling to identify key participants in this study. The participants were identified through searching the Namibian government websites and individual referral by staff in each ministry during manual searching of policies and acts. An initial sample size of 12 key participants was identified. However, this list was expanded through snowball sampling for other potential key participants until data saturation was achieved. The final list consisted of 21 participants who are the actual implementers and included national programme managers, heads of national OPDs and selected persons with disabilities. Each participant had 10 or more years of work experience and it was anticipated that they could provide both a retrospective and current reflection based on their experiences. Data collection Interviews were conducted from June 2016 to August 2016 in English, the official language in Namibia. These interviews were conducted at the offices of the selected participants. An information sheet and consent forms were sent to all participants prior to the interview. A semi-structured questionnaire was used to collect data. This consisted of Section A with four closed-ended questions and Section B with three open-ended and non-directive questions. The openended and non-directive questions focused on participants` awareness and experiences for the implementation of the policies (Appendix 1). Rewording of the questions was done as necessary, and given the semi-structured nature of the interviews, additional probing was used. All interviews were audio-recorded and lasted between 45 and 60 min. Analytic framework Theoretical framework This study utilised the Community Based Rehabilitation (CBR) matrix ( Figure 1) that forms the basis of CBR guidelines (WHO et al. 2010) to guide the analysis. The WHO CBR matrix, which has five key components including health, education, livelihood, social and empowerment formed the basis on which to record the themes and subthemes from the key informant interviews. The reason for selecting the CBR matrix and CBR guidelines as a theoretical framework for analysis was threefold. Firstly, an initial study on a review of policy and legal framework in Namibia (Shumba & Moodley 2017) identified that CBR underpins the policy and legal framework as the main strategy for the delivery of disability services. Secondly, the CBR guidelines and matrix may enable a 'society for all' through targeting sectors of development and ensuring that they are inclusive. Involving all sectors of development has the potential of empowering persons with disabilities with the ultimate aim of improving their quality of life. Thirdly, the CBR guidelines and matrix are resolutely underpinned by |
the UNCRPD (United Nations 2006) that promotes and enhances the social and human rights model of disability. Transcripts analysis Audio recordings were transcribed verbatim, replacing any identifying information with pseudonyms. General thematic analysis was undertaken based on the entire set of transcripts. Responses to some closed-ended questions (Question 2, Section B) (Appendix 1) were analysed quantitatively using descriptive statistics. A preliminary report of the interviews was given to the key informants for review and comments and corrections were made, where applicable. Each theme consisted of statements that best described the detail, thought or idea on a particular topic. To ensure systematic identification of statements for each theme, each transcript was analysed and agreed upon as to which of the statements could be included and those that should be excluded from each particular theme. Disagreements on inclusion and exclusion of statements that best represent a category were resolved through discussion. Data management and analysis were done using QSR International's NVivo 11 qualitative analysis software. This involved six steps: data cleaning, uploading the data onto NVivo 11 software, recognising the data, conducting data exploration (using Query command), coding relevant information in the data and generating themes. Trustworthiness Trustworthiness was ensured using Lincoln and Guba's strategies for the qualitative approach including credibility, transferability, dependability and confirmability (Lincoln & Guba 1985). Credibility was assured by prolonged engagement until the scope of data was adequately covered and data saturation on progress on policy implementation was obtained; referential adequacy through use of tape recorder and field notes, triangulation through engagement with different stakeholders, member checks on participants' responses and peer debriefing of themes with the second author were also applied. Purposive sampling and dense descriptions ensured transferability. Recorded audiotapes, written field notes, methodological notes and reflexivity ensured dependability and confirmability. Ethical consideration Ethics approval was obtained from the Human Sciences Ethics Research Committee of the University of KwaZulu-Natal (Reference No: HSS/0646/015D) and approval to conduct research was obtained from the Ministry of Health and Social Services in Namibia (Reference No: 17/3/3). Findings The results are presented according to participants' demographics, disability programmes, participants' awareness and knowledge of policy framework, and participants' experiences regarding implementation of disability programmes. Participant demographics The roles and functions of the 21 participants varied significantly, from representatives of persons with disabilities to a cabinet minister, as shown in Table 1, ensuring a broad spectrum of experiences and responses. Disability programmes in Namibia The disability programmes implemented by various agencies are shown in Table 2. Most participants confirmed implementing CBR services for all disability groups or for the specific disability they support (Shumba & Moodley 2017). Awareness of disability policies and legislation in place Participants' awareness of the existence of different disability policies and legislation was assessed by asking participants to name any of the policies and legislation that directly relates to disability. Overall, there is a general awareness of all the policies in place with some participants failing to identify some critical policies or legislation. The four most known documents are: National Policy on Disability, UNCRPD, National Disability Council Act and the Sector Policy on Inclusive Education. The extent of awareness of each document is shown in Table 3. All participants (100%) were aware of the National Policy on Disability, with over three-quarters (81%) being aware of the UNCRPD. Despite the National Policy on Mental Health (38%) and the National Orthopaedic Technical Services Policy (33%) being in place for over 15 years, only those participants actually involved in their implementation were aware of their existence. In contrast, despite the Sector Policy on Inclusive Education being in place for just over 2 years, two-thirds of the participants (67%) reported being aware of its existence. Participants' experiences regarding implementation progress Participants reported on their experiences regarding the progress of implementation of the disability policies according to the main themes and subthemes predetermined by the WHO CBR matrix (WHO et al. 2010) as outlined below. Key theme 1: Health Progress of implementation for the inclusion of persons with disabilities in health services was reported according to the following subthemes: access to rehabilitation services, health promotion and prevention, assistive devices and medical care. Subtheme 1: Access to rehabilitation services: The interviewees reported that there appears to be a critically low budget allocation for rehabilitation services. Further delivery of rehabilitation services has been hampered by a critical shortage of rehabilitation staff as most are attracted by the private sector. Despite overall shortages of rehabilitation personnel, the orthopaedic technical services have attempted to address the skills gap through sending their staff for qualifying courses and postgraduate courses in other African countries. The categories/codes for access to rehabilitation services and the accompanying participants` responses are presented in Table 4. Subtheme 2: Access to assistive devices: Most participants reported the lack of adequate budget allocation for the provision of assistive devices. Further challenges were revealed including poor supply chain, lack of some assistive Access to rehabilitation services Coordination 'The national level is not capacitated to coordinate physiotherapy, occupational therapy and medical rehabilitation services. There is only one person at national level at the moment to manage all these services.' (P14) 'Our linkage with other sectors is very poor … don't have good coordination with especially private sector with regard to purchasing of assistive devices'. (P3) Finance 'National Disability Council has not been functional for years due to very low budget allocation … and not able to consult widely with persons with disabilities.' (P8) 'Orthopaedic Technical Services are under Directorates with what they call "priority programmes" like HIV/AIDS, TB, Malaria. We receive second priority after these programmes are funded.' (P17) ' … for years mental health services have had no budget at regional and district level. We only have a very small budget at national level.' (P4) Staff shortage 'Most of the occupational therapists in this country are foreigners mostly from southern Africa who work on contracts. Namibia does not have courses for training rehabilitation professionals.' (P13) 'We do not have enough mental health staff at regional and national level … one person at national level is coordinating mental services with no focal person in the regions.' (P4) ' … there are only three audiologists in public sector of whom one is in the MOHSS and the other two in Ministry of Education … in contrast in the private sector where there is about 10 audiologists and two hearing aid acousticians….' (P18) Lack of skills 'The orthopaedic technical services send staff for training from certificate to Masters level in different categories. Most of our posts are now filled and we are wondering what we will do with the ones that are under training now.' (P3) Access to assistive devices Finance ' … we just provide basic assistive devices to our clients. Budgets for orthopaedic technical services have been going down since 2012 from N$20 million, to only N$1 million in 2017.' (P3) 'Ministry of Education has no budget for hearing aids for learners and MOHSS has a very small budget only for adult patients, not children.' (P18) ' … bursaries for disabled students do not include a portion for assistive devices. You are given the same N$20 000 for tuition as for able bodied students. A visually impaired student will have to find extra money to buy software for your computer and other assistive devices ….' (P9) Supply chain 'The tender process says that companies should be 100% Namibian owned. There are no manufacturers of orthopaedic devices in Namibia. We have middle men who put low prices during tender bidding and when asked to supply they fail.' (P17) 'We don't have assistive devices for visually impaired in Namibia. We import and it's very expensive and difficult to order as an individual. They ask you VAT and other taxes. So we end up using registered welfare organisation that are exempted from these charges at the border.' (P15) ' … wheelchairs and clutches are on government tender but not white canes and hearing aids.' (P9) CBR programme 'CBR is driven by volunteers who assist in identifying and referring persons in need of assistive devices … this has been helping in remote areas.' (P1) ' … If CBR was in most rural areas, persons with disabilities will gain much … the only challenge I see with is that we have not done any evaluation to see how is it benefitting persons with disabilities … we only collect demographic data and not asking persons with disabilities how they are perceiving this programme.' (P11) Access to medical care Mental health 'We only have two centres in the country providing mental health treatments, Oshakati Hospital and Windhoek Central Hospital … all patients are sent to these centres which are always full and not having space.' (P4) Lack of Braille and sign language 'We cannot read prescriptions. We don't know whether this is Panadol or paracetamol because the prescriptions are not in Braille. We don't have privacy to our medication.' (P9) '…it's very difficult for the deaf to access health care due to lack of sign language interpreters and non-deaf personnel who are trained in offering counselling and other important services … information of PHC is missing leading to most deaf would be mothers not getting information on their unborn babies and other issues of concern.' (P16) devices on government tender, as well as exorbitant import tax when importing assistive devices that are not locally available. Notwithstanding the challenges in accessing assistive devices, CBR programmes were noted as the main vehicle assisting with access to assistive devices in remote areas. The categories/codes for access to assistive devices and the accompanying participants' responses are presented in Table 4. Subtheme 3: Access to medical care: The study revealed that there is an exemption for persons with disabilities from medical fees. However, this exemption option is not being applied consistently by health workers. Another challenge revealed was the lack of mental health services, with only two mental health centres countrywide. However, the government is making efforts to improve mental health services through the establishment of postgraduate mental health courses at a local university, sending students outside the country for mental health training, and provision of short courses to intern social workers. Access to medical care for persons with visual and hearing impairments was reported to be hindered by lack of Braille on prescriptions and sign language during doctors' consultations, respectively. Persons with visual impairments further reported poor signage in most hospitals which allow for ease of physical accessibility. The categories/codes for access to medical care and the accompanying participants' responses are presented in Table 4. Subtheme 4: Health promotion and prevention: Success has been recorded in this regard with the National Disability Council allocating funds for raising awareness. One key issue that participants pointed out was that the policies and legal framework failed to address HIV and sexual reproductive issues. Most HIV and AIDS and sexual reproduction programmes are not adapted to meet their individual needs. The categories/codes for health promotion and prevention and the accompanying participants' responses are presented in Table 4. Key theme 2: Education The key subthemes identified regarding progress in accessing education are early childhood development (ECD), primary and secondary education and higher education. Subtheme 1: Early childhood development: Most participants expressed that a large proportion of children and young people with disabilities are not receiving a comprehensive education. Factors hindering implementation of the policy framework in this regard include few facilities for ECD and discrimination with regard to the refusal by some schools in enrolling children with disabilities. Despite these challenges, there are factors that have enabled implementation of ECD including political will, occupational therapy assessments and support from non-governmental organisations and the private sector. The categories/codes for ECD and the accompanying participants' responses are presented in Table 5. Subtheme 2: Primary and secondary education: Participants reported that a number of challenges have been encountered regarding primary and secondary education including the medium of communication, poor collaboration, lack of equity in inclusive education and lack of adequate preparation before launching of the Sector Policy on Inclusive Education (SPIE). Notwithstanding these challenges, efforts have been made to enable implementation of the SPIE through the provision of free education, sign language training, the appointment of class assistants for the deaf and advocacy by OPDs. The categories/codes for primary and secondary education and the accompanying participants' responses |
are presented in Table 5. Subtheme 3: Higher education and vocational training: Participants identified many challenges in the delivery of higher and vocational education including reasonable accommodation (sign language, Braille, large print and physical accessibility), limited courses for vocational training and lack of guidelines for assessing examinations for persons with different types of disabilities. The categories/codes for higher education and vocational training and the accompanying participants' responses are presented in Table 5. Key theme 3: Livelihood The key subthemes elicited under this theme are social protection, employment and skills development. Subtheme 1: Social protection: A few participants noted that the government has instituted a secure social protection system in the form of disability grants. However, disbursement of the disability grant is faced with challenges of inconsistent assessment of disability by state doctors and in some cases abuse of the disability grant by caregivers. The categories/codes for social protection and the accompanying participants' responses are presented in Table 6. Subtheme 2: Employment (wage and self-employment): The key issues identified as limiting employment opportunities for persons with disabilities include lack of education, reasonable accommodation (sign language, Braille, large print, physical accessibility and appropriate assistive devices) and stigmatisation. The categories/codes for employment and the accompanying participants' responses are presented in Table 6. Key theme 4: Social This study found that persons with disabilities do not enjoy full participation and inclusion within their families and communities. Key subthemes elicited responses covering personal assistance and access to justice. Subtheme 1: Personal assistance: Personal assistants are essential in enabling some persons with disabilities to achieve their full participation and inclusion in society. Participants indicated that some key issues hindering the implementation of this subtheme include lack of specific policy provision regarding personal assistance particularly for persons with multiple disabilities and budget limitations. The categories/ codes for personal assistance and the accompanying participants' responses are presented in Table 7. Subtheme 2: Access to justice: Most persons with disabilities remain vulnerable owing to lack of knowledge of their rights enshrined in the policy and legal frameworks. In analysing the participants' views, a number of issues emerged such as lack of specific policy provisions including the provision of evidence in court for persons with visual impairments and Stigmatisation 'We have challenges in preschools whereby parents of the so called "normal children" want to remove their child if they see that the preschool has enrolled a child with disability.' (P21) Success of ECD (political will, occupational therapy assessments, support from non-governmental organisations and the private sector) ' … now the situation of ECD is much better. Most of the preschools have been taken over by government and the government is advocating for free education.' (P5) ' … the government has created a post of deaf-teacher assistant to help with learning facilitation in class but this is only in resource schools.' (P19) ' … occupational therapists help with school assessments for children with learning disabilities. We also assist with school placements for all types of disabilities.' (P13) ' … for the deaf children we [CLASH] have at our kindergarten, we assist them with school placements when they graduate into primary education.' (P18) Assessments of examinations ' … most persons with disabilities spend lot of years up to 6 years in vocational training. They just give a reason that we don't know how to assess them with examinations … some end up dropping without being examined.' (P21) ' … persons with albinism suffer when it comes to assignments, books and examinations. All these are not given in large print … spend more time straining eyes in examinations….' (P20) Social protection Success of disability grant ' … I must say the political will is there to provide disability grants. … Recently the government even increased the amount of disability grant from N$500 to N$1100. Namibia is amongst very few African countries that provide disability grants.' (P12) ' … we have a central system that has been working well in paying out disability grants.' (P7) Inconsistency in disability grant assessments 'Doctors support applications for disability grants of some persons but not others. For example, with Albinism, you can go to this doctor they refuse and when you go to the other you can get support….' (P20) Abuse of disability grants ' … some children don't even know they are receiving a disability grant. Government should put a monitoring system to see that the needs of the child are met once the grant is paid out every month.' (P21) lack of physical accessibility to courtrooms. However, the Ministry of Justice and other non-governmental organisations have made efforts to improve information accessibility for persons with hearing and visual impairments. The categories/ codes for justice and the accompanying participants' responses are presented in Table 7. Key theme 5: Empowerment Empowerment is a cross-cutting theme for all the other four themes. The key subthemes elicited in this study were advocacy and communication, disabled persons' organisations and political participation. Subtheme 1: Advocacy and communication: Advocacy and communication are critical in ensuring that the rights of persons with disabilities are upheld. Most of the participants acknowledged that a reasonable amount of advocacy has been conducted by OPDs and the government. Some of these advocacy initiatives include the creation of disability desks in some offices/agencies/ministries and training of politicians on the UNCRPD. The categories/codes for advocacy and communication and the accompanying participants' responses are presented in Table 8. Subtheme 2: Organisations of persons with disabilities: Notwithstanding the government's commitment to OPDs through policy, most of the OPDs have been faced with challenges, including donor dependency and lack of funds and leadership skills. The categories/codes for OPDs and the accompanying participants responses are presented in Table 8. Subtheme 3: Political participation: This study revealed progress in facilitating the political participation of persons with disabilities including advocacy, participation in voting in national elections and accessibility to public buildings. The categories/codes for political participation and the accompanying participants' responses are presented in Table 8. Discussion The study explored the knowledge and experiences regarding the implementation of the disability policies in Namibia from the perspective of key informants. Namibia has a relatively comprehensive disability policy and legal framework that has been progressively developed since 1990 (Shumba & Moodley 2017). This study revealed both strengths and weaknesses that have been recorded regarding health, education, livelihood, social and empowerment opportunities for persons with disabilities. Shumba and Moodley (2017) in their review of policy and legal framework in Namibia identified that the CBR strategy underpins policy and legal framework in Namibia. This finding was confirmed by many participants in this study reporting utilising the CBR strategy in implementing disability services. Further, participants reported that CBR is a major vehicle for accessing assistive devices in remote areas of Namibia. Community Based Rehabilitation is a practical, multisectoral strategy that meets the basic needs of persons with disabilities ensuring their access to health, education, livelihood and social opportunities (WHO et al. 2010). However, participants reported the lack of a qualitative Subtheme Subcategory/code Participant(s) responses Personal assistance Lack of policy provision ' … the question is who needs a personal assistant? ... This is not clear in the policy.' (P12) Assistance of persons with multiple disabilities ' … we also need to look at personal assistance for those with serious disabilities. If we have funds from the National Disability Council, we could take care of their needs more adequately.' (P8) Access to justice Provision of evidence in court ' … in courts, most of the evidence is visual … you are told to touch your suspect when they know you cannot see. The legal system should provide other ways to assist visually impaired to provide evidence in court.' (P6) Physical accessibility in courts ' … we had a case of a man on wheelchair who was in the gallery … could not see or be seen by the magistrate during the court case. Our court rooms are not accessible to persons on wheelchair.' (P21) Inaccessibility to information 'Both the National Disability Policy and NDC Act are not in Braille and neither are on recorded CDs, so this makes them inaccessible to people with visual impairments.' (P10) Success of accessibility to information 'When local language court interpreters have court cases for the deaf, we usually call a sign language interpreter.' (P6) 'The National Federation for the Visually Impaired have Brailled a lot of copies for UNCRPD but nothing for other policies ….' (P10) Advocacy and communication Disability desk in offices/ ministries/agencies 'As OPDs, we lobbied vigorously to have an office at the highest office in the country. We first had the Disability Unit in the Office of the Prime Minister and in 2015, our President created a Disability Office in the Presidency. We have also lobbied for disability desks in some ministries.' (P9) Training of politicians on UNCRPD '… we (NFVI) have trained parliamentarians, councilors, mayors to understand the UNCRPD and how they can apply it in Namibia. We are focusing only on Article 5, 9, 24 and 27.' (P15) Organisations of persons with disabilities (OPDs) Declining donor support 'OPDs have been always supported by donors. Now donors are pulling out because Namibia is considered a middle-income country, and we are struggling. The remaining donors ask for high requirements for their grants that most OPDs don't have.' (P9) All participants were aware of the National Policy on Disability and few were aware of the National Policy on Mental Health and the National Policy on Orthopaedic Technical Services. Further, it emerged that some participants had a poor understanding of the contents of the policy documents. Lack of awareness and knowledge of the existing policy documents can be attributed to poor dissemination and lack of policy orientation and training which hinders effective implementation. Duncan et al. (2011) argue that effective implementation at every level is dependent on capacitating users to policy content in order to foster commitment. Health services In critically analysing participants' responses, it appears that there is an overall dissatisfaction amongst persons with disabilities with regard to access to health services. Critical gaps were noted with regard to access to rehabilitation services, health promotion and prevention, assistive devices and medical care. Coordination emerged as a significant challenge hindering access to health services. Studies have indicated that coordination of services ensures cost-efficient and equitable distribution of resources to persons with disabilities (Antonelli, McAllister & Popp 2009;Kendall & Clapton 2006). Thus, it is important to develop appropriate referral policies and procedures for effective communication systems amongst service providers. Participants reported a shortage of staff and essential skills sets. Thus, participants recommended the benefits of including postgraduate training in mental health as well as on-the-job training of intern social workers on mental health issues. It is thus important to bridge this gap through mainstreaming disability courses in both undergraduate and postgraduate training as well as conducting continuous awareness training. Thompson, Emrich and Moore (2003) in their study reported positive outcomes of changing the nursing curriculum on the attitudes of nursing students regarding disability issues. Although the CBR programme has been instrumental in accessing assistive devices to persons with disabilities, participants reported challenges with the supply chain. For example, government tenders do not include a wide range of devices such as white canes for persons with visual impairments. Another supply chain problem reported was the exorbitant import duties. This indicates the need to review the public procurement system of Namibia to be inclusive of and sensitive to the needs of persons with disabilities. To ease the challenge of procurement, several studies have recommended that government procurement policies can create incentives for the industry to adopt technical standards for universally designed technology (Engelen 2009;Seelman 2008). In addition, southern African countries can consider passing resolutions of harmonising procurement policies as is the case with the European Parliament and other bodies within the European Union (European Commission 2008). The lack of accessibility has been revealed as hampering access to health services for persons with disabilities. Most participants particularly those with visual and hearing impairments revealed the lack of physical environment accommodation (signage and ramps) and information accessibility (Braille, large print and sign language). Similar findings were reported in Uganda where health services lacked both physical and information accessibility for persons with disabilities (Action on Disability and Development 2005). Miscommunication can also impair understanding of health information, medical instructions, |
prescribed medications and medical and surgical interventions, and can lead to poor adherence to treatment recommendations (Hoffman et al. 2005;O'Hearn 2006;Sullivan, Heng & Cameron 2006). In Namibia, this finding is attributed to lack of accessibility regulations. The study revealed that most buildings and information has become accessible as a result of continuous advocacy from persons with disabilities. Thus, there is pressure for Namibia to develop accessibility regulations. However, caution should be noted when developing accessibility regulations as it requires focus on 'pull' factors, rather than the 'push' factors of regulation (Maskery 2007). There is a need to enforce the regulations once they are developed. The National Disability Council of Namibia has the mandate to propose, develop and monitor the implementation of disability regulation and policy. This function can be supplemented by setting up an independent audit committee. The Uganda National Association on Physical Disability created a National Accessibility Audit Team following the passing of accessibility standards (Uganda National Action on Physical Disability 2017). In addition to this, the OPDs in Namibia can potentially serve as a source of information for local building officials to review building plans, safeguarding against a lack of knowledge amongst local municipalities, planners and designers (WHO & World Bank 2011). Reference can be made to Canada where a local action group worked with the local authorities in the assessment of accessibility problems and plans of improvement (Ringaert 2001). Notwithstanding the success regarding awareness raising campaigns on disability issues, there is a lack of policy provisions on health education on HIV and sexual reproduction. The study revealed that a significant number of persons with intellectual disabilities are sexually active, yet health promotion is lacking. Parents often do not talk about sexual matters to their children with disabilities (Wazakili, Mpofu & Devlieger 2006), particularly since it has been found that adolescents with physical disabilities are more sexually active than their non-disabled counterparts (Maart & Jelsma 2010). These insights indicate the need for a future review of disability policies to include issues of HIV and sexual reproduction. Similarly, review of the CBR guidelines can consider extending their emphasis on HIV and sexual reproduction. Education There is a general trend that children with disabilities are more likely not to attend schools than children without disabilities (Filmer 2008) and this is even more prevalent in poor countries (United Nations Educational, Scientific and Cultural Organization 2009). Enrolment is also dictated by disability type, with more children with physical disabilities attending schools than children with intellectual and sensory impairments (WHO & World Bank 2011). The National Statistics Agency (2016) reported that 87% of children with disabilities aged 0-4 years are not attending early childhood development programmes and the proportion of persons with disabilities without any formal education was high in rural areas (82.3%) compared to urban areas (17.7%). To mitigate these challenges, Namibia adopted the Sector Policy on Inclusive Education in 2013. The study has indicated that to enhance the limited success of this policy, there has been a need to provide free education for all primary and secondary schools, incorporation of sign language training in postgraduate training of teacher education, appointment of class assistants for the deaf and advocacy by OPDs. Community Based Rehabilitation programmes can also be used as a vehicle to advance inclusive education. However, there is always a tendency to fall into a trap of 'one-size-fits-all' regarding inclusive education. Research has revealed that deaf students and those with intellectual impairments have a negative experience in mainstream schools (Fuchs & Fuchs 1994 Further, contrary to the National Policy on Disability which calls for women with disabilities to be taken as a special target group and Article 6 of the UNCRPDs that requires countries to ensure that women enjoy full human rights, the Employment Equity Commission Report (Ministry of Labour 2014) shows that only 0.2% of women with disabilities are in employment. These lower rates of employment, as most of the participants expressed, are attributed to lack of reasonable accommodation and low educational levels. When chances of securing employment are limited, it often leads to poverty. These statements are supported by WHO, UNESCO and ILO (2004) when they stated that there is a strong correlation between disability and poverty. Social The mission of the National Policy on Disability is to achieve social integration of persons with disabilities. The study revealed key aspects that can promote social integration including personal assistance and access to justice. Although the National Policy on Disability requires that persons with disabilities be provided with personal assistance, it does not provide a clear definition of what constitutes personal assistance. This has resulted in failure and inconsistencies in provision of personal assistance. Thus, appropriate personal assistance schemes should be developed and be inclusive of all types of disabilities (WHO & World Bank 2011). However, other options can be utilised to strengthen personal assistance including the use of CBR strategy and community, home-based care in strengthening personal assistance at the community level. Access to justice is an enabler for upholding human rights that can promote social integration. The justice system has made progress regarding access to information including use of braille in court documents and provision of sign language interpreters for the deaf during court sessions. However, the study revealed that provision of accessible evidence for the visually impaired and structural adjustments of courtrooms remains a challenge. Article 2 of the UNCRPD states that disability rights litigation also requires the member states to enforce reasonable accommodation for people with disabilities. There are no provisions in the Constitution of Namibia that explicitly address disability (Shumba & Moodley 2017). Further, disability is not listed as one of the prohibited grounds of discrimination (Ntinda 2013). This study noted cases of discrimination in employment and in schools, and it remains a grey area as to whether courts entertain cases of discrimination. Thus, there is a need for Namibia to pass antidiscrimination laws as is the case with Australia (1992), Canada (1986Canada ( , 1995, New Zealand (1993) and the United States (1990) (WHO & World Bank 2011). Alternatively, antidiscrimination clauses can either be included in existing legislation like in Germany and South Africa (Mont 2004) or as clauses in constitutions like that of Brazil and Ghana (Degener 2005). Empowerment The study recognised good progress regarding empowerment. Key successes were reported in advocacy and political participation. Namibia has made progress with the representation of persons with disabilities at national, regional and district level as stipulated in Section 3 of the National Policy on Disability. One of the celebrated achievements is the appointment of a person with a disability as a Member of Parliament and the creation of a Department of Disability Affairs in the Office of the Presidency in 2015. Although OPDs are playing a vital role in advocacy related to disability issues, the study noted financial constraints as all OPDs are dependent on donor support. Most of the donor support has reduced significantly and sustainability of OPDs is threatened. The OPDs called for more government support to ensure sustainability. This may include inclusion of clauses in existing legislation for funding OPDs. Conclusion This study showed that while Namibia has made significant progress in addressing the medical and social needs of persons with disabilities, further progress can be achieved through taking note of the following key issues: policy training; better coordination; review and updating policies; improving supply chain management; developing personal assistance schemes; development of accessibility standards; inclusion of anti-discrimination clauses; mainstreaming HIV and sexual reproduction programmes; increasing funding for OPDs; standardising disability definitions and consideration of adopting the ICF for disability grant assessments; and inclusion of disability studies in undergraduate and postgraduate training. Community Based Rehabilitation underpins the delivery of disability and rehabilitation programmes in Namibia. However, those interviewed reported that the current monitoring and evaluation system only measures demographic information, including the number of persons with disabilities, types of disabilities and gender of persons with disabilities. The current monitoring and evaluation process does not allow for eliciting the experiences of persons with disabilities in evaluating the effectiveness of the CBR programme. Thus, future research could potentially focus on developing a comprehensive monitoring and evaluation system which also measures the experiences and quality of life of persons with disabilities. Major gaps in the implementation of disability policies in Namibia are attributed to limited accountability. It appears that the government has not adequately provided the means to be answerable to persons with disabilities regarding health, education, social and empowerment opportunities. This lack of accountability explains why Namibia has a dichotomy between policy formulation and implementation. Implementation is hampered if the policy does not include accountability for service provision (Gilson & Erasmus 2008). The starting point to revise the policy and legal framework is to include social and legal accountability. Allan (2008) states that social accountability includes aspects like soliciting inputs from a broad cross-section of stakeholders, evaluation of strategic plans, budget reviews, expenditure tracking reports, service delivery reports, analyses of cases of misuse or abuse of resources and accountability in the form of an oversight report. Legal accountability as stated by Aldersey and Turnbull (2011) ensures that courts uphold the rights of persons with disabilities. Furthermore, Aldersey and Turnbull (2011) propose a mixture of both social and legal accountabilities in future policy adoptions or modifications. Antibacterial and phytochemical studies on twelve species of Indian medicinal plants ed by: African Index Medicus (WHO), CAB Abstracts, Index Copernicus, Global Health Abstracts, Asian Science Index, Index Veterinarius, Bioline International , African Journals online Full-text available at http://www.ajbrui.com http://www.bioline.br/md http://www.ajol.com Received: September 2006 Accepted (Revised): February 2007 Published May 2007 Full Length Research Article Antibacterial and phytochemical studies on twelve species of Indian medicinal plants Jigna Parekh, and Sumitra Chanda* Phyochemical, Pharmacological and Microbiological Laboratory, Department of Biosciences, Saurashtra University, Rajkot – 360 005, India. . INTRODUCTION Nature has been a source of medicinal agents since times immemorial. The importance of herbs in the management of human ailments cannot be overemphasized. It is clear that the plant kingdom harbors an inexhaustible source of active ingredients invaluable in the management of many intractable diseases. Furthermore, the active components of herbal remedies have the advantage of being combined with many other substances that appear to be inactive. However, these complementary components give the plant as a whole a safety and efficiency much superior to that of its isolated and pure active components (Shariff, 2001). Antibiotic resistance has become a global concern (Westh et al., 2004). There has been an increasing incidence of multiple resistances in human pathogenic microorganisms in recent years, largely due to indiscriminate use of commercial antimicrobial drugs commonly employed in the treatment of infectious diseases. This has forced scientist to search for new antimicrobial substances from various sources like the medicinal plants. Search for new antibacterial agents should be continued by screening many plant families. Recent work revealed the potential of several herbs as sources of drugs (Iwu, 2002). The screening of plant extracts and plant products for antimicrobial activity has shown that higher plants represent a potential source of novel antibiotic prototypes (Afolayan, 2003). Numerous studies have identified compounds within herbal plants that are effective antibiotics (Basile et al., 2000). Traditional healing systems around the world that utilize herbal remedies are an important source for the discovery of new antibiotics (Okpekon et al., 2004); some traditional remedies have already produced compounds that are effective against antibiotic-resistant strains of bacteria (Kone et al., 2004). The results of this indicate the need for further research into traditional health systems (Romero et al., 2005). It also facilitates pharmacological studies leading to synthesis of a more potent drug with reduced toxicity (Ebana et al., 1991;Manna and Abalaka, 2000). The need of the hour is to screen a number of medicinal plants for promising biological activity. In the present work twelve different medicinal plants each belonging to different families was evaluated for their antibacterial properties. MATERIALS AND METHODS Plant material: Fresh plant/plant parts were collected randomly from the semi-arid region of Rajkot Gujarat, India. The details of plant/ plant parts screened, their families, vernacular names and their therapeutic uses are given in Table 1. The taxonomic identities of these plants were confirmed by Dr. P. S. Nagar, Department of Biosciences, Saurashtra University, Rajkot and the voucher specimen numbers of the plants were preserved. Fresh plant material were washed under running |
tap water, air dried and then homogenized to fine powder and stored in airtight bottles. Preparation of extracts: For aqueous extraction, 10 g of air-dried powder was added to distilled water and boiled on slow heat for 2 h. It was then filtered through 8 layers of muslin cloth and centrifuged at 5000g for 10 min. The supernatant was collected. This procedure was repeated twice. After 6 h, the supernatant collected at an interval of every 2 h, was pooled together and concentrated to make the final volume one-fourth of the original volume (Parekh et al., 2005). It was then autoclaved at 121 °C temperature and at 15 lbs pressure and stored at 4 o C. For solvent extraction, 10 g of air-dried powder was taken in 100 ml of organic solvent (methanol or ethanol) in a conical flask, plugged with cotton wool and then kept on a rotary shaker at 190-220 rpm for 24 h. After 24 hours the supernatant was collected and the solvent was evaporated to make the final volume one-fourth of the original volume (Parekh et al., 2005) and stored at 4 o C in airtight bottles. Microorganisms: In vitro antimicrobial activity was examined for aqueous and ethanol extracts from six medicinal plants used by traditional healers. Microorganisms were obtained from National Chemical Laboratory (NCL), Pune, India. Microorganisms were maintained at 4°C on nutrient agar slants. Amongst five microorganisms investigated two Gram positive bacteria were B. cereus and S. epidermidis while three Gram negative bactreria were E. aerogenes, P. vulgaris and S. typhimurium. Antimicrobial assay: The antimicrobial assay was performed by two methods viz. agar disc diffusion method (Bauer et al., 1966) for aqueous extract and agar well diffusion method (Perez et al., 1990) for solvent extract. The molten Mueller Hinton Agar (HiMedia) was inoculated with the 100 µl of the inoculum (1 x 10 8 Cfu) and poured into the sterile Petri plates (Himedia). For agar disc diffusion method, the disc (0.7cm) (Hi-Media) was saturated with 100 µl of the test compound, allowed to dry and was introduced on the upper layer of the seeded agar plate. For agar well diffusion method, a well was prepared in the plates with the help of a cork-borer (0.85cm). 100 µl of the test compound was introduced into the well. The plates were incubated overnight at 37 °C. Microbial growth was determined by measuring the diameter of zone of inhibition. For each bacterial strain controls were maintained where pure solvents were used instead of the extract. The result was obtained by measuring the zone diameter. The experiment was done three times and the mean values are presented. The results were compared with the standard antimicrobics piperacillin (100 µg /disc) and gentamicin (10 µg/disc). RESULTS AND DISCUSSION The presence of antibacterial substances in the higher plants is well established (Srinivasan, 2001). Plants have provided a source of inspiration for novel drug compounds as plants derived medicines have made significant contribution towards human health. Phytomedicine can be used for the treatment of diseases as is done in case of Unani and Ayurvedic system of medicines or it can be the base for the development of a medicine, a natural blueprint for the development of a drug (Didry et al., 1998). Successive isolation of botanical compounds from plant material is largely dependent on the type of solvent used in the extraction procedure. The traditional healers use primarily water as the solvent but we found in this study the plant extracts by methanol provided more consistent antimicrobial activity compared to those extracted by water. The results of antibacterial activity of all the 12 plants against the investigated bacterial strains are shown in Table 3. None of the aqueous extracts produced zones of inhibition in the Kirby-Bauer analysis. This might have resulted from the lack of solubility of the active constituents in aqueous solutions while methanol extract showed some degree of antibacterial activity. Further trials using solvents of various polarities will explore the effects of solvent composition on extract efficacy (Romero et al., 2005). S. typhimurium was the most resistant bacteria. None of the plant extracts both aqueous as well as methanol extract could inhibit S. typhimurium. The phytoconstituents of Argyrea nervosa Burm. F are not reported here Aq. - Aq. - Aq. - Aq (Lin et al., 1999;Parekh and Chanda, 2006). These differences may be attributed to fact that the cell wall in Gram positive bacteria is of a single layer, whereas the Gram negative cell wall is multilayered structure (Yao et al., 1995). Alternatively, the passage of the active compound through the Gram negative cell wall may be inhibited. It is thought that observed differences may result from the doses used in this study. In addition, microorganisms show variable sensitivity to chemical substances related to different resistance levels between strains (Cetin and Gurler, 1989). Preliminary phytochemical analysis revealed the presence of alkaloids (+ve test for Wagnor's) (Table 2) and flavonoids, though the latter was in lesser amount. The other secondary metabolites like tannins, saponins, steroids, cardiac glycosides, etc were present in trace amounts in some of the plants (Table 2). It is not surprising that there are differences in the antimicrobial effects of plant groups, due to phytochemical properties and differences among species. The investigated plants did not show strong antibacterial activity; however, negative results do not mean absence of bioactive constituents nor is that the plant inactive. Active compound(s) may be present in insufficient quantities in the crude extracts to show activity with the dose levels employed (Taylor et al., 2001). Lack of activity can thus only be proven by using large doses (Farnsworth, 1993). Alternatively, if the active principle is present in high enough quantities, there could be other constituents exerting antagonistic effects or negating the positive effects of the bioactive agents (Jager et al., 1996). With no antibacterial activity, extracts may be active against other bacterial species which were not tested (Shale et al., 1999). Amongst the plant species investigated, methanol extract of Bauhinia variegata bark showed the most remarkable activity. This plant can be further subjected to isolation of the therapeutic antimicrobials and carry out further pharmacological evaluation. Real time near-infrared Raman spectroscopy for the diagnosis of nasopharyngeal cancer Near-infrared (NIR) Raman spectroscopy has been investigated as a tool to differentiate nasopharyngeal cancer (NPC) from normal nasopharyngeal tissue in an ex-vivo setting. Recently, we have miniaturized the fiber-optic Raman probe to investigate its utility in real time in-vivo surveillance of NPC patients. A posterior probability model using partial linear square (PLS) mathematical technique was constructed to verify the sensitivity and specificity of Raman spectroscopy in diagnosing NPC from post-irradiated and normal tissue using a diagnostic algorithm from three significant latent variables. NIR-Raman signals of 135 sites were measured from 79 patients with either newly diagnosed NPC (N = 12), post irradiated nasopharynx (N = 37) and normal nasopharynx (N = 30). The mean Raman spectra peaks identified differences at several Raman peaks at 853 cm−1, 940 cm−1, 1078 cm−1, 1335 cm−1, 1554 cm−1, 2885 cm−1 and 2940 cm−1 in the three different nasopharyngeal conditions. The sensitivity and specificity of distinguishing Raman signatures among normal nasopharynx versus NPC and post-irradiated nasopharynx versus NPC were 91% and 95%; and 77% and 96% respectively. Real time near-infrared Raman spectroscopy has a high specificity in distinguishing malignant from normal nasopharyngeal tissue in vivo, and may be investigated as a novel non-invasive surveillance tool in patients with nasopharyngeal cancer. INTRODUCTION Non-keratinizing nasopharyngeal cancer (NPC) is a cancer that originates from the nasal epithelium of nasopharynx and it is often difficult to detect in the early stage due to the deep anatomical location. It is a common cancer in Asia where the incidence reaches its peak in countries such as Hong Kong, Southern China and Singapore. In Singapore, it is the 8th most common cancer among males [1] and carries with it risk of loco-regional recurrence of up to 20% following definitive chemoradiotherapy [2]. Early detection of local recurrence in NPC is pivotal towards successful surgical salvage, which has been shown to improve survival [3]. However, the challenge lies in having a reliable and accurate method of detecting early recurrence. Currently, the most reliable way of detecting nasopharyngeal recurrence is endoscopic examination of the nasopharynx, although the morphology of early recurrences is unknown. Most cases of recurrences are detected as a recurrent mass or ulcer in the nasopharynx. These recurrences are sometimes not surgically salvageable due to local extension of the tumor to critical structures such as the internal carotid artery, Research Paper skull base and optic nerve that are in close proximity to the nasopharynx. Therefore, identifying early morphologic changes preceding the development of these clinically obvious recurrences will allow prompt surgical salvage of these recurrences; and hence improve clinical outcomes of NPC patients. Raman spectroscopy is a unique optical technique, which utilizes inelastic scattering of light from tissue to characterize its molecules and tissue composition. This system has been well studied in gastric cancer in diagnosing dysplasia and premalignant condition [4][5][6]. Lau DP et al. reported a preliminary analysis on differentiating nasopharyngeal cancer from normal tissue ex vivo using Raman spectroscopy [7]. However, the data was not optimized as it only covered a narrow spectral window of 950-1650 cm -1 with no statistical significance. Recently, Huang's group [8] has developed a rapid fiber-optic NIR Raman spectroscopy system for better characterization of tissue Raman signals in vivo, and miniaturizing the probe size to 1.8 mm; which allows clinicians to obtain a more reliable Raman signals in tight anatomical confines in the nasopharynx. Putting this together, we aim to test this new NIR Raman spectroscopy method in detecting distinctive molecular signatures specific to normal healthy nasopharynx, post-irradiated nasopharynx and NPC tissue. The clinical relevance of this study is to investigate if this tool may be employed in the surveillance of NPC patients; with the overarching goal to detect early Raman signals which precede the development of clinically apparent local recurrence in the nasopharynx of these patients. DISCUSSION Utilizing Raman spectroscopy in cancer diagnostics has gained momentum over the past decade. This technology has been used in the differentiating normal and cancerous tissues in lung cancer [9,10], gastric cancer [6,11,12], cervical cancer [13], laryngeal and nasopharyngeal cancer [7,[14][15][16]. Much of this enthusiasm lies in the capability and reliability of Raman scattering signals to reveal biomedical and bio-molecular signatures that are unique to the tissue composition being evaluated and hence, provide an opportunity to distinguish different pathologies on tissues at a molecular level. In this pilot study, we sought to examine the Raman signatures in 3 patient cohorts, namely in patients with nasopharyngeal cancer, normal nasopharynx and post-irradiated nasopharynx following radiotherapy for nasopharyngeal cancer. The main motivation in performing this pilot study is to establish if a differential Raman scattering signatures may be obtained reliably using a 1.8 mm probe, which is currently the smallest probe utilized towards Raman spectroscopy diagnostics. With this validation study, the possibility of using Raman spectroscopy may be envisaged in earlier diagnosis of local recurrence of nasopharyngeal cancer; which is usually detected late given the deep anatomical location. Our real-time in-vivo test using this fiber-optic-Raman (1.8 mm) probe was successful in obtaining reliable and consistent Raman signatures among patients with nasopharyngeal cancer, post-irradiated nasopharynx and normal controls. There were several Raman spectra peaks whereby distinct Raman scattering peaks were obtained and hence, validated our hypothesis that these tissues exhibited different tissue compositions, which can be picked up by Raman spectroscopy. We have adopted the PLS algorithm in constructing our normogram data based on our previous published reports [17,18] as well as a recent study in nasopharyngeal cancer, where the PLS algorithm was more sensitive than the PCA model in detecting malignant Raman signatures in nasopharyngeal cancer [19]. Additionally, the PLS regression method further rotates the components (latent variables (LVs)) to achieve the maximum group separation compared to the PCA model. Hence, these LVs could explain the diagnostic relevant variations rather than the significant differences in the dataset. We believe that our study represents a step forward in the development of Raman spectroscopy in the diagnostic of nasopharyngeal cancer on several counts. Firstly, ever since the first report of using Raman spectroscopy in nasopharyngeal cancer by Lau et al. [7], all previous studies have been based on using Raman |
signatures taken on ex-vivo nasopharyngeal tissues which may result in differences in the Raman signatures due to desiccation efforts following tissue ex-plantation [15,19,20]. Therefore, the clinical utility of real-time molecular diagnostics using Raman spectroscopy cannot be directly translated. Secondly, to our knowledge, the1.8 mm probe size is the smallest size being used for evaluation in Raman spectroscopy. Li et al. [15] performed micro-Raman spectroscopy on tissue samples in differentiating the Raman signatures between normal nasopharyngeal tissue and nasopharyngeal cancer. The micro-Raman tissue measurements based on commercially bulky Raman microscope system are impractical for clinical Raman applications at endoscopy. Therefore, a smaller caliber probe is more desirable. Lastly, we have included an additional cohort of patients following radiotherapy of their nasopharyngeal cancer. In this regard, Raman signatures among patients with post-irradiated nasopharynx may be investigated and studied so that any Raman shifts between post-irradiated nasopharynx and nasopharyngeal cancer may be analyzed. This has translational application towards surveillance of the nasopharynx for recurrence following radiotherapy. Our pilot study demonstrated a relatively high specificity of 95% and 96% in distinguishing normal nasopharynx versus nasopharyngeal cancer and postirradiated nasopharynx versus nasopharyngeal cancer. With this high specificity values, we believe our in vivo fiber-optic Raman spectroscopy system has the potential for real time surveillance of nasopharyngeal cancer by selecting patients with "malignant" Raman signatures for further confirmation by histology. Additionally, patients with previously treated nasopharyngeal cancer who present with a normal looking nasopharynx plus a "benign" Raman signature may be more reassured of having no local disease; rather than relying on a purely normal looking nasopharyngeal finding on endoscopy. We demonstrate for the first time that real-time near-infrared Raman spectroscopy using a 1.8 mm fiberoptic Raman probe can detect reliable and consistent Raman scattering signatures among patients with nasopharyngeal cancer, post-irradiated nasopharynx and normal nasopharynx. The high specificity in distinguishing malignant from normal nasopharyngeal tissue and postirradiated nasopharyngeal tissue warrants investigation of this tool as a new non-invasive surveillance tool in patients with nasopharyngeal cancer. MATERIALS AND METHODS Under an Institutional approved clinical protocol (National Healthcare Group DSRB; 2014/00323), prospective patients with newly diagnosed NPC, postirradiated nasopharynx (at least 6 months following completion of radiotherapy) and normal nasopharynx were accrued in this study. Patients with nasopharyngeal cancer were biopsied proven to be cancer while patients with normal nasopharynx were identified based on normal endoscopic examination of the nasopharynx. Patients with post-irradiated nasopharynx were those who had received prior definitive radiotherapy for nasopharyngeal cancer and were disease free at the time of examination. This assessment was based endoscopic examination of the nasopharynx showing no residual tumor as well as a post-treatment magnetic resonance imaging (MRI) scan of the nasopharynx demonstrating complete resolution of their initial tumor. Any clinically suspicious areas of the nasopharynx were biopsied and were all proven to be negative of cancer. Additionally, all these patients with post-irradiated nasopharynx were followed up for at least 6 months with no evidence of recurrence. Detection of Raman signals of the nasopharynx During endoscopic examination of the nasopharynx, a1.8-mm miniature Raman probe is navigated to the nasopharynx under direct vision from the endoscope. In patients with normal and post irradiated nasopharynx, the probe is placed close to the fossa of Rosenmuller and additional measurements were performed in the midline of the nasopharynx of some patients ( Figure 5). In patients with newly diagnosed (pre-treatment) NPC, the probe is positioned directly on the tumor ( Figure 5). Once contact to the nasopharynx is achieved, a NIR laser is emitted at 785-nm from the probe and the backscattered light (Raman signal) is captured by the Raman system. In this study, we have adopted a simultaneous fingerprint (FP) and high wavenumber (HW) fiberoptic Raman spectroscopy technique for real-time in vivo tissue Raman measurements during endoscopy. The 785-nm laser excitation power at ~12 mW was selected as it was within the maximal permissible skin exposure limit set out for a 785-nm laser beam (American National Standards Institute). Multiple spectra (~8-10) for each tissue site were measured with scanning times of 0.1 to 0.5 sec, which permits a rapid survey of the tissue areas. The entire process of capturing of Raman signals is typically completed within 15-20 seconds. Construction of the nomogram data The NIR Raman spectra measured from in-vivo nasopharyngeal tissue represent a combination of weak tissue Raman signal, intense auto-fluorescence (AF) background and noise. The raw spectra are preprocessed by a third-order Savitzky-Golay smoothing filter (a window width of 3 pixels)to remove the spectral noise [8,14,17,18]. In the finger-print (FP) region (800-1800 cm -1 ), a fifth-order polynomial was found to be optimal for fitting the AF background in the noise-smoothed spectrum, and this polynomial was then subtracted from the measured FP spectrum to yield the FP tissue Raman spectrum alone. In the high-wave number (HW) range (2800-3600 cm -1 ), a first-order polynomial fit was used for removing the AF background [17,21,22]. The FP/HW Raman spectra are then normalized over the integrated area under the FP and HW ranges to allow a better comparison of the spectral shapes and relative Raman band intensities among NPC, normal and post-irradiated tissues. Partial least squares (PLS) (also called Projection to Latent Structure) regression is a validated method for modeling in Raman system, providing an alternate approach to PCA (Principle component analysis). PLS technique is an extension of the multiple linear regression model and a linear model specifies the (linear) relationship between a dependent (response) variable Y, and a set of predictor variables, the X's. It follows the principle of PCA, but further rotates the components (latent variables (LVs)) to achieve the maximum group separation. Hence, the LVs could explain the diagnostic relevant variations rather than the significant differences in the dataset. Many studies have constructed and validated this statistical model to predict the sensitivity and specificity of Raman system in NPC model [15,23,24]. Additionally, consistent and reproducible results using this statistical model have been validated in various cancers including, gastric cancer [11,12], esophageal cancer [11,25], colon cancer [21,26] and NPC [14]. Authors' contributions Dr Lim Chwee Ming has significantly contributed to the article by writing, editing and reviewing it. Dr Huang Zhi Wei and the co-authors have contributed for the instrumentation development, data collection and analysis, editing and reviewing this paper. CONFLICTS OF INTEREST The author and co-authors have no conflicts of interest to declare. Impact of the COVID-19 Pandemic on Colorectal Cancer Care in the Netherlands: A Population-based Study Introduction The COVID-19 pandemic disrupted health care services worldwide. In the Netherlands, the first confirmed COVID-19 infection was on February 27, 2020. We aimed to investigate the impact of the pandemic on colorectal cancer care in the Netherlands. Methods Colorectal cancer patients who were diagnosed in 25 hospitals in weeks 2 to 26 of the year 2020 were selected from the Netherlands Cancer Registry (NCR) and divided in 4 periods. The average number of patients treated per type of initial treatment was analyzed by the Mantel-Haenszel test adjusted for age. Median time between diagnosis and treatment and between (neo)adjuvant therapy and surgery were analyzed by the Mann Whitney test. Percentages of (acute) resection, stoma and (neo)adjuvant therapy were compared using the Chi-squared test. Results In total, 1,653 patients were included. The patient population changed during the COVID-19 pandemic regarding higher stage and more clinical presentation with ileus at time of diagnosis. Slight changes were found regarding type of initial treatment. Median time between diagnosis and treatment decreased on average by 4.5 days during the pandemic. The proportion of colon cancer patients receiving a stoma significantly increased with 6.5% during the pandemic. No differences were found in resection rate and treatment with (neo)adjuvant therapy. Conclusion Despite the disruptive impact of the COVID-19 pandemic on global health care, the impact on colorectal cancer care in the Netherlands was limited. Introduction The coronavirus disease 2019 (COVID-19) was first diagnosed in Wuhan, China, and is caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). 1 In the Netherlands, the first confirmed COVID-19 infection was on February 27, 2020. 2 After this, the coronavirus spread fast through the whole country. To prevent COVID-19 from spreading any further, the Dutch government has taken various societal measures such as social distancing, closing stores and schools, and urging people to only leave their homes when necessary. Impact of the COVID-19 Pandemic on Colorectal Cancer The COVID-19 pandemic also had a major impact on the health care services worldwide. [4][5][6][7] Patients who were infected with the coronavirus were prioritized within the health care services. Furthermore, the Dutch official authorities suggested to only visit the general practitioner (GP) with serious complaints. This led to a situation in which patients were less likely to go to the GP with complaints, leading to a lower number of patients being diagnosed with cancer during the COVID-19 pandemic. 5 , 6 , 8 , 9 Moreover, national screening programs were halted due to the COVID-19 pandemic, including the screening program for colorectal cancer in the Netherlands from mid-March 2020 to mid-May 2020. 4 , 8 Studies showed that the number of colorectal cancer diagnoses dropped mainly in the age group eligible for screening, 55 to 75 years, during the COVID-19 pandemic. 4 , 8 In the beginning of March 2020, the Foundation of Oncological Cooperation (SONCOS) and the Dutch Association for Medical Oncology (NVMO) published the first recommended measures on how to deal with the COVID-19 pandemic within health care services in the Netherlands. Examples of the recommended measures for colorectal cancer care were postponing surgery after neoadjuvant therapy and adjuvant therapy after surgery, to adjust the planned elective care during the COVID-19 pandemic. 10 The aim of this study was to investigate the impact of the COVID-19 pandemic on colorectal cancer care in the Netherlands in 2020 and whether patients received treatment according to the recommended measures published for colorectal cancer care during the COVID-19 pandemic. Patients Patients ≥18 years diagnosed with colorectal cancer during weeks 2 to 26 of 2020 were included in this study. Data were selected from the Netherlands Cancer Registry (NCR) and derived from 25 of the 70 hospitals in the Netherlands, consisting of 10 general hospitals, 11 large teaching hospitals and 4 academic hospitals spread throughout the Netherlands. For patients included in this study, the following data were gathered: patient characteristics (eg, age at diagnosis, gender, performance status, and comorbidity), tumor characteristics (eg, clinical stage, pathological stage, and ileus), type of treatments (eg, systemic therapy, radiotherapy, and resection), interval between different events (eg, number of days between diagnosis and initial treatment), as well as the hospital where the patient's received treatment. Definitions For all patients, age at diagnosis was grouped into ages < 55, 55 to 75 and > 75 years. The selected period was divided in 4 periods based on national data requested from the nationwide network and registry of histoand cytopathology in the Netherlands (PALGA) 11 : period A, weeks 2 to 8 (ie, before the COVID-19 pandemic); period B, weeks 9 to 11 (ie, COVID-19 pandemic before screening program was halted); period C, weeks 12 to 17 (ie, COVID-19 pandemic with more than 25% of the expected amount of screening colonoscopies); and period D, weeks 18 to 26 (ie, COVID-19 pandemic with less than 25% of the expected amount of screening colonoscopies). To analyze treatment with adjuvant therapy and time between surgery and start of adjuvant therapy, patients were divided in these 4 periods based on date of surgery. For all other analyses, patients were divided in these 4 periods based on date of diagnosis. The Eastern Cooperative Oncology Group (ECOG) Scale of Performance Status (PS) was used for performance status. TNM classification (7th edition) was used for staging the tumors. 12 For colon cancer, the pathological stage was used if available and otherwise clinical stage, while for rectal cancer, clinical stage was always used. Hospitals where patients received their treatment for colorectal cancer were categorized into different regions in the Netherlands: North/East, South and West. The regions were defined to investigate whether there were regional disparities regarding the impact of the COVID-19 pandemic. Statistical Analysis The baseline characteristics of included patients were tested by Chi-squared tests to determine significant differences between patients diagnosed in period B, C, and D of the year 2020 separately compared to period A of 2020. To analyze type |
of initial treatment, the average weekly incidence of patients per type of initial treatment was calculated by type of cancer, tumor stage and period. The average weekly incidence in period B, C, and D was separately compared with the average weekly incidence in period A using the Mantel-Haenszel test adjusted for age. The median time between diagnosis and initial treatment was calculated by type of cancer, region, and period. The median time between neoadjuvant therapy and surgery was calculated for patients with clinical stage II or III rectal cancer by type of neoadjuvant therapy and period. The median time between surgery and adjuvant therapy was calculated for patients with stage III colon cancer by period. All median times of period B, C, and D were separately compared with period A using the Mann Whitney test. Proportions of patients who underwent a resection and received a stoma were calculated by type of cancer, tumor stage and period. Also, the proportion of patients treated with neoadjuvant therapy was calculated for patients with stage II or III rectal cancer by type of neoadjuvant therapy and period. For patients with stage III colon cancer, the proportion of patients treated with adjuvant therapy was calculated by period. Here, all proportions of period B, C, and D separately as well as combined were compared with period A using the Chi-squared test. Stata version 16.1 software was used to analyze all data and for all tests performed, and a 2-sided P -value of < .05 was considered statistically significant. Research population In total, 1,653 patients were included, with a total number of 410, 161, 231, and 385 colon cancer patients in period A to D, respectively. Corresponding numbers of rectal cancer patients among the 4 periods were 174, 68, 84, and 140, respectively. The baseline characteristics are presented in Table 1a (colon cancer) and The proportion of colon and rectal cancer patients aged 55 to 75 years was lower in period D ( P < .01) compared to period A. The proportions of patients diagnosed with colon cancer stage I or II were lower in period C ( P = .04), and D ( P < .01) compared to period A. Furthermore, the proportion of colon cancer patients presenting with ileus was higher in period C and D than in period A, 13.9% and 14.3% versus 8.0% respectively. Finally, the proportion of rectal cancer patients with a good performance status was significantly lower in period D compared to period A, 37.1% versus 51.1% respectively. Type of Initial Treatment Differences between type of initial treatment among the different periods are summarized in Figure 1A (and Supplementary Table A.1) for colon cancer patients and in Figure 1B (and Supplementary Table A.2) for rectal cancer patients. A significant increase in the weekly average number of resections per week was observed in patients aged > 75 years with colon cancer stage I, aged < 55 years with colon cancer stage III, aged > 75 years with colon cancer stage III, and all ages with colon cancer stage IV. By contrast, the weekly average number of resections significantly decreased in patients aged 55 to 75 years and diagnosed with colon cancer stage III. For all ages and colon cancer stage II, the weekly average number of patients who underwent resection with construction of a stoma on the same day significantly increased. Finally, a significant increase of the average number of local excisions was observed in clinical stage I rectal cancer patients > 75 years of age. In rectal cancer patients diagnosed with clinical stage II, III, or IV, no significant differences in type of initial treatment were found between the different periods. Time Between Diagnosis and Initial Treatment In colon cancer patients, the median time between diagnosis and initial treatment was significantly shorter in period C and D compared to period A; 14 days and 20 days versus 23 days, respectively (Supplementary Figure A). Regarding regional disparities, the median time until initial treatment was significantly shorter in periods B, C, and D compared to period A for the region North/East (Supplementary Figure A) compared to period A for the region South and West (Supplementary Figure A). In rectal cancer patients, the median time between diagnosis and initial treatment was significantly shorter in period C compared to period A; 23 days versus 30 days, respectively (Supplementary Figure B). No significant differences were found for the region North/East (Supplementary Figure B). However, the median time was significantly shorter in period B for the region South (Supplementary Figure B) and in period C for the region West (Supplementary Figure B) compared to period A. Treatment The proportions of patients treated with (acute) resection, stoma, and (neo)adjuvant therapy are shown in Table 2a (colon cancer) and Table 2b (rectal cancer). A significantly higher proportion of colon cancer patients underwent an acute resection in period C (8.4% and 8.4%), period D (9.6% and 5.5%), as well as combined periods B to D (7.7% and 6.2%) if compared to period A (5.3% and 2.6%). In the combined periods B to D, 18.7% of colon cancer patients received a stoma versus 12.2% in period A. If analyzing period C and D separately, a significant higher proportion of stoma construction of 19.5% and 18.7% respectively, was found if compared to 12.2% stomas in period A. Analyzing the use of neoadjuvant therapy (radiotherapy and/or chemoradiation) and the administration of adjuvant therapy did not reveal any significant differences for the different periods. Colon cancer stage IV lands. Despite the disruptive impact of the COVID-19 pandemic on global health care, the impact on colorectal cancer care in the Netherlands was found to be limited. However, only slight changes were shown. First of all, the patient population changed during the COVID-19 pandemic. Our results show that in period C and D, colon cancer patients more often presented with ileus or underwent an acute resection. This might be a reflection from the national recommendation to visit the GP only with serious complaints. 4 , 8 Another possible explanation is the temporary halt of the colorectal cancer screening program 4 , 5 . Indeed, less tumors were diagnosed in the population eligible for screening during the COVID-19 pandemic, 8 resulting in a relative overrepresentation of symptomatic cancers. Due to the COVID-19 pandemic, overall surgical capacity within the hospitals was limited and many elective surgeries were postponed. 9 Contrary to expectations, the current study shows a reduction in median time between diagnosis and initial treatment. A possible explanation is the decrease in number of (colorectal) cancer diagnoses during the COVID-19 pandemic. 9 Period A, weeks 2 to 8 of 2020; Period B, weeks 9 to 11 of 2020; Period C, weeks 12 to 17 of 2020; Period D, weeks 18 to 26 of 2020; Period B to D, weeks 9 to 26 of 2020. The P -value was calculated excluding missing values, using the Chi-squared test to compare patients diagnosed in period B, C, or D of 2020 with patients diagnosed in period A of 2020. * Patients who received adjuvant therapy are divided in 4 periods based on surgery date, while the patients who underwent a resection are divided in 4 periods based on incidence date. Therefore, the proportions shown for adjuvant therapy are not calculated as a proportion of the total number of patients who underwent a resection shown in this table. Joyce Meijer et al the COVID-19 pandemic, the number of cancer diagnoses in general also decreased, and many elective surgeries were postponed. 9 In addition, colorectal cancer surgery generally does not require postoperative Intensive Care Unit (ICU) admission, which was the limiting factor in many hospitals. For this reason, cardiac and neurosurgery procedures were cancelled, which resulted in more capacity for elective colorectal cancer procedures. Although overall hospital capacity was limited, this did not impact the waiting time before surgery for colorectal cancer patients. This could be a possible explanation for the reduction in median time between diagnosis and initial treatment as found in the current study. Rectal cancer stage I During the whole of the analyzed period, the region North/East of the Netherlands showed a significant decrease in the interval between diagnosis and initial treatment for colon patients. This region was in the beginning of the COVID-19 pandemic least affected by COVID-19, illustrating that even in small countries regional difference in cancer care can be observed in relation to infection rates. 13 We could observe changes in the median times between (neo)adjuvant therapy and surgery during the COVID-19 pandemic. The changes partly reflect the recommended measures to postpone surgery after neoadjuvant therapy and to postpone adjuvant therapy after surgery. However, there is also an increase trend towards longer waiting times after neoadjuvant therapy with further delaying surgery to increase the clinical response rate and enable better selection of patients with clinical complete response who are candidate for organ preserving treatment. 14 Therefore, the change in median time does not necessarily have to be COVID-19 related. Due to the low number of patients, these results were not significant. Results of our study show that the proportion of patients who received a stoma increased significantly during the COVID-19 period. This is likely related to a change in patient characteristics with a relative increase of symptomatic patients that presented in an emergency setting during the COVID-19 pandemic. Furthermore, not constructing an anastomosis or performing a defunctioning stoma lowers the risks of postoperative infectious complications such as wound infection or anastomotic leakage. Such a risk aversive strategy is intended to lower the need for ICU admission. As the ICU was almost entirely occupied by COVID-patients, a colostomy may have been performed more often to reduce the need for additional ICU-beds. [15][16][17] For rectal cancer patients, a recommended measure published during the COVID-19 pandemic was to replace neoadjuvant chemoradiation with short course neoadjuvant radiotherapy and a long waiting time before a resection. Another recommended measure was to omit neoadjuvant radiotherapy if there was capacity available to perform surgery on short-term notice, because operative capacity was often difficult to estimate beyond the coming week. However, results of our study showed no significant differences in the use of neoadjuvant chemoradiation and neoadjuvant radiotherapy. Therefore, these recommended measures during the COVID-19 pandemic were apparently not implemented in clinical practice. To our knowledge, this was the first study to report on the impact of the COVID-19 pandemic on colorectal cancer care on a population-based level. However, we could include data from 25 of the 70 hospitals in the Netherlands. Although this data will provide a good representation of the total colorectal cancer population in the Netherlands, the impact of data fluctuations unrelated to the COVID-19 pandemic cannot be excluded and interpretations of the results need to be made with caution. Conclusion Despite the disruptive impact of the COVID-19 pandemic on global health care, the impact on colorectal cancer care in the Netherlands was found to be limited. Only slight changes in colorectal cancer care during the COVID-19 pandemic were revealed, which was partly due to a higher proportion of symptomatic patients during the pandemic. Future studies will investigate the long-term effects of the COVID-pandemic on the outcome of these patients. Clinical Practice Points • To our knowledge, this was the first study to report on the impact of the COVID-19 pandemic on colorectal cancer care on a population-based level. Although this data will provide a good representation of the total colorectal cancer population in the Netherlands, the impact of data fluctuations unrelated to the COVID-19 pandemic cannot be excluded and interpretations of the results need to be made with caution. • Despite the disruptive impact of the COVID-19 pandemic on global health care, the impact on colorectal cancer care in the Netherlands was found to be limited. Only slight changes in colorectal cancer care during the COVID-19 pandemic were shown, which was partly due to a higher proportion of symptomatic patients during the pandemic. • First, the patient population changed during the COVID-19 pandemic because of the temporary halt of the colorectal cancer screening program and the recommendation of the Dutch authorities to only visit the GP with serious complaints resulting in several changes in type of first treatment. • Second, colorectal cancer patients experienced no delay in start of first treatment after diagnosis. The interval became shorter since |
the decrease in number of cancer diagnosis and the decrease in elective surgeries during the COVID-19 pandemic. • Last, the proportion of patients who received a stoma during the COVID-19 pandemic was higher. • Future studies will investigate the long-term effects of the COVID-pandemic on the outcome of these patients. Microglia and CNS Interleukin-1: Beyond Immunological Concepts Activation of microglia and expression of the inflammatory cytokine interleukin-1 (IL-1) in the CNS have become almost synonymous with neuroinflammation. In numerous studies, increased CNS IL-1 expression and altered microglial morphology have been used as hallmarks of CNS inflammation. A central concept of how CNS IL-1 and microglia influence functions of the nervous system was derived from the notion initially generated in the peripheral immune system: IL-1 stimulates monocyte/macrophage (the peripheral counterparts of microglia) to amplify inflammation. It is increasingly clear, however, CNS IL-1 acts on other targets in the CNS and microglia participates in many neural functions that are not related to immunological activities. Further, CNS exhibits immunological privilege (although not as absolute as previously thought), rendering amplification of inflammation within CNS under stringent control. This review will analyze current literature to evaluate the contribution of immunological and non-immunological aspects of microglia/IL-1 interaction in the CNS to gain insights for how these aspects might affect health and disease in the nervous tissue. Activation of microglia and expression of the inflammatory cytokine interleukin-1 (IL-1) in the CNS have become almost synonymous with neuroinflammation. In numerous studies, increased CNS IL-1 expression and altered microglial morphology have been used as hallmarks of CNS inflammation. A central concept of how CNS IL-1 and microglia influence functions of the nervous system was derived from the notion initially generated in the peripheral immune system: IL-1 stimulates monocyte/macrophage (the peripheral counterparts of microglia) to amplify inflammation. It is increasingly clear, however, CNS IL-1 acts on other targets in the CNS and microglia participates in many neural functions that are not related to immunological activities. Further, CNS exhibits immunological privilege (although not as absolute as previously thought), rendering amplification of inflammation within CNS under stringent control. This review will analyze current literature to evaluate the contribution of immunological and non-immunological aspects of microglia/IL-1 interaction in the CNS to gain insights for how these aspects might affect health and disease in the nervous tissue. Keywords: cytokine, neuroinflammation, brain, neuromodulation, iL-1R1 iNTRODUCTiON Changes in microglial morphology are one of the most common findings of neuropathology in almost all CNS diseases. Long regarded as the resident immune cells in the immunologically temperate environment of the CNS, the resting spider-shaped microglia become deramified and amoeboid in activated states (1). This shape shift has been observed in acute brain injury (2), various neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease (3), CNS autoimmune diseases such as multiple sclerosis (MS) (4,5), convulsive disorders such as epilepsy (6), and even affective disorders including major depression (7,8), anxiety disorders (9), and autism (10). These evidences led to the hypothesis that microglial activation is a significant common cause of neuropathology in these diseases (11), although microglial morphological changes alone may not always reflect the precise activation status (12,13) among the variegated states that these cells can adapt. Another salient-related observation in CNS diseases is the increased expression of the inflammatory cytokine interleukin-1 (IL-1). IL-1 is a master regulator of inflammatory reactions in the immune system, capable of activating innate immunity by inducing the expression of numerous inflammatory cytokines and chemokines, eliciting leukocyte infiltration into the inflammatory loci, increasing phagocytic and bactericidal activity of immune cells, enhancing activity of the complement system, and facilitating the activation of the adaptive immune responses (14). Correlations of plasma or CNS levels of IL-1 and disease severities in the abovementioned CNS diseases have been widely reported (15)(16)(17)(18)(19)(20), although there are also many reports that fail to show correlation between plasma IL-1 level and the presence of disease symptoms in these diseases (21,22). Combining increased IL-1 expression and microglial activation as a composite indicator of pathogenesis in CNS diseases seems to be an attractive idea because it might overcome the shortcomings of using each of them separately. In peripheral tissues, increased IL-1 expression is tightly linked with macrophage activation during inflammation (23); in the CNS, neuroinflammation may not display the entire panoply of peripheral inflammation, e.g., swelling may not occur during neuroinflammation, but increased expression of IL-1 by brain tissue together with morphological changes in microglia appear to be a frequently observed phenomenon in both human neuropathology and animal models of brain diseases (16,(24)(25)(26)(27)(28). Adding increased brain IL-1 expression to supplement microglial morphology changes would further specify that the changes in microglia are part of the inflammatory microgliosis. The villainization of microglial activation and CNS IL-1 expression, however, has been countered by the teleological argument: is the CNS designed to have microglial activation and IL-1 expression just to cause pathology (29)? Such incredulity has been substantiated by the facts that blocking inflammatory microglial activation can lead to the exacerbation of some symptoms of certain CNS diseases (30)(31)(32)(33)(34) and clinical benefits of drug treatments for reducing microglial activation or IL-1 activity have been demonstrated recently in stroke patients (35), but the utility of this strategy for the treatment of the vast majority of the above-mentioned diseases remains to be firmly established after it has been advocated for at least 10 years. Besides their pathogenic roles, functions of microglial activation and IL-1 expression in CNS development, repair, and physiological activity have been intensely studied recently. This endeavor has yielded tremendous advances, revealing many new areas of understanding on the non-immunological functions of IL-1 and microglia in the CNS (11,(36)(37)(38)(39). These new findings in the realm of the positive contributions of microglia and IL-1 in the CNS educe the critical inquiry: how would the immunological and the non-immunological aspects of IL-1 and microglial functions coordinate or disrupt each other to affect health and disease? THe PROMiSeS AND LiMiTATiONS OF THe iNFLAMMATORY PARADiGM Although current literature is beginning to shed light on the multifaceted roles played by microglia and CNS IL-1, the simple inflammatory paradigm, viz., increased CNS IL-1 expression together with microglial activation amplifies neuroinflammation and causes neuropathology, has accrued formidable experimental support. The following rationales have propelled the research in this area: (1) inflammatory process is designed to sequester and kill infectious pathogens and contain necrotic tissue damage; this entails the induction of proinflammatory cytokines and chemokines, recruitment of leukocytes, and the production of bactericidal reactive oxygen species (ROS), all potentially neurotoxic, (2) CNS is immunologically privileged site, bystander neuronal casualty from inflammation is likely to cause irreversible damage to this delicate tissue which lacks significant regenerative potential and expandable volume, and (3) neuroinflammation could lead to CNS autoimmunity resulting in attacks by immune cells to CNS antigens which are normally dormant. Neurotoxicity from infiltration of peripheral leukocytes has also been documented. Typically, in experimental conditions that resulted in leukocyte infiltration into the brain, the infiltrated peripheral myeloid cells show higher expression levels of proinflammatory cytokines than resident glial cells (62)(63)(64). Thus, entrance of peripheral leukocytes into the CNS may represent a more severe type of CNS inflammation. Reduction of leukocyte infiltration by blocking vascular adhesion molecules or chemokine activity has been shown to improve outcomes in acute brain injury (65,66) and CNS autoimmune diseases (67,68). Interestingly, although infiltration of peripheral leukocytes into the CNS is generally not a common observation in human affective disorders, this phenomenon occurs in several animal models of stress-or inflammation-induced depression and/or anxiety (69,70). Preventing CNS infiltration of IL-1 expressing leukocytes protected animals from displaying depressive and/or anxiety-like behaviors in these models (64,71). Other studies demonstrated a pathogenic role of oxidative stress. Blocking inflammation-induced production of ROS or ROS activity alleviates neural damage in cerebral ischemia (72)(73)(74) and cerebral hemorrhage (75), reduces depressive and anxiety-like behaviors caused by peripheral inflammatory stimulation (76), lessens certain symptoms induced in an Alzheimer's mouse model (77). In addition, ROS production and antioxidant defense imbalance has been observed in acute brain injury (78,79), inflammation-induced depression and anxiety, and neurodegenerative diseases (80,81). These evidences support the hypothesis that oxidant/antioxidant imbalance downstream of IL-1-stimulated microglial activation is a common feature for both acute and chronic neuropathology and their attendant psychopathology (82,83). The possibility of bystander damage of CNS inflammation is best demonstrated in situations of CNS infection. Initially, postinfectious neurological dysfunction was thought as a consequence of permanent damage caused by the invading pathogens and the specific immune responses to the pathogen (84). However, patients who survived CNS infection sometimes show deficits implicating brain regions beyond the foci of the initial infection (85) and animal studies show chronic neuroinflammation may persist after the acute infectious pathogens have been eradicated (86). Thus, off-target inflammatory activity may contribute to post-infectious neuropathology. Further bolstering the case for malignant inflammatory effects are the findings that endogenous CNS antigens that normally do not induce autoimmune attacks can be turned susceptible when CNS inflammation is present. In experimental autoimmune encephalitis (EAE), the brain endothelial receptor for IL-1 (IL-1R1) and infiltration of myeloid cells expressing IL-1β was found to be required for the induction of illness (63). Because IL-1βexpressing myeloid cells are involved in inflammatory activity, not antigen specific immunity, these results point to the importance of inflammation in facilitating autoimmune activity of the CNS. Dysregulation of microglia may also contribute to the pathogenesis of PANDAS (Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal Infections) which was thought to be caused by the induction of post-infectious crossreactive autoantibodies against CNS tissue (87)(88)(89). Therefore, neuroinflammation might augment autoimmune activity-related neuropathology. A major recent advance in the field of inflammation is the discovery of inflammasomes. Inflammasomes are protein complexes that act as intracellular sensors for the disruption of homeostasis (90). They include NOD like receptors and ASC (apoptosisassociated speck-like protein containing a caspase recruitment domain). Inflammasomes regulate IL-1 and IL-18 activity by regulating caspase-1, which cleaves inactive pro-IL-1 and pro-IL-18 to derive the active IL-1 and IL-18. This intermediate step allows preformed pro-IL-1 and pro-IL-18 to be quickly activated, ensures inflammation occurs through the priming stage (the synthesis of pro-IL-1 and molecules of the Inflammasomes) and the activation stage (the generation of mature inflammatory cytokines), thus providing a mechanism that requires "two-hit" to induce inflammation, allowing finer control of the timing and the magnitude of inflammatory cascade. In addition, inflammasomes are sensitive to stimulations by internal disturbance, such as misfolded or aggregated proteins and aberrant products of energy metabolism, broadening the range of inflammation inducers beyond infectious stimuli (90). In ischemic or hemorrhagic stroke models, expression of the NLRP3, a known microglial inflammasome (91, 92) component, was increased, and specific blockade of NLRP3 reduced stroke induced neural damage and functional deficits (93,94). Several NLRP3 component proteins were also induced in the pathological tissues in Alzheimer's disease (95). Aggregated or fibrillary α-synuclein, a known pathogenic factor for Parkinson's disease also stimulates the activation of NLRP3 (96). Activation of NLRP3 has been documented in depression and anxiety and both pharmacological blockade of NLRP3 or gene deletion of NLRP3 reduces depressive behavior and anxiety in animal models of these disorders (97,98). The inflammatory paradigm, increased brain IL-1 expression and microglial activation drives the progression of CNS diseases, has gained further momentum from studies that used drugs to inhibit IL-1 activity and/or microglial activation. A naturally occurring antagonist for IL-1 is the IL-1 receptor antagonist (IL-1ra). A recent meta-analysis shows treatment with IL-1ra reduces infarct volume by 36% in animal models of cerebral stroke with more reliable efficacy if the drug is delivered into the cerebral ventricle than into the blood (99). IL-1ra was also effective in blocking stress-induced depression and anxiety (51,52,100), and in improving clinical outcomes in experimental epilepsy (101,102). Minocycline, a tetracycline derived antibiotics, has been found to inhibit inflammatory microglial activation (103). Specifically, activated microglia could differentiate into multiple activated states: the most inflammatory type is designated as M1 and the most anti-inflammatory type is designated as M2. Besides changes in morphology, M1 microglia express inflammatory cytokines including IL-1, TNF-α, and iNOS, whereas the M2 microglia express TGF-β, IL-4 or IL-10, and arginase 1. Treatment with minocycline selectively inhibits M1 microglial activation (104). Pretreatment with minocycline provides neuroprotection against excitotoxicity (105), oxidative stress (106), reduces symptoms in animal models of Parkinson's disease (107), cerebral stroke (108), epilepsy (109), and stress-induced depression (110). In EAE, a model |
of MS, minocycline treatment was found to be effective in reducing disease severity and histological outcomes when used in combination with other conventional treatments (111)(112)(113)(114)(115)(116) or alone (117,118). The promise of using drugs against IL-1 and microglial activation to treat CNS diseases is attested by the current clinical trials that use IL-1ra to treat cerebral stroke (119)(120)(121), fatigue in Sojegren's syndrome (122), and minocycline to treat cerebral stroke (123,124), cerebral hemorrhage (125), Parkinson's disease (126,127), epilepsy (128), bipolar and treatment resistant depression (129,130), and schizophrenia (131). These trials have generated promising results, although large scale clinical tests are still needed. In human MS trials, minocycline treatment reduced MS lesion detected by MRI (132) and reduced the risk of conversion of patients with first demyelinating event from progressing to MS (133). The notion that all CNS diseases can be effectively treated by inhibition of IL-1 driven microglial activation, of course, is overly simplistic. A dramatic cautionary tale is supplied by a study that investigated the role of IL-1β in Alzheimer's disease. Beta-amyloid aggregation in this disease causes the formation of senile plaques. Transgenic overexpression of IL-1β unexpectedly reduced plaque formation, despite inducing robust neuroinflammation (134). In another surprising study, chronic unpredictable stress induced depressive-like behavior; stimulating rather than inhibiting microglia provided anti-depressant effects (135). These results highlight the limitation of the inflammatory paradigm and suggest non-immunological functions of IL-1 and microglia should be examined. iL-1 AND MiCROGLiA AS NeUROMODULATORS The neurophysiological functions of IL-1 were first investigated in temperature-sensitive neurons because IL-1 was identified as the endogenous pyrogen that mediates fever after bacterial infection. In the temperature control center of the brain, the preoptic area of the hypothalamus, IL-1 decreased the sensitivity of warmsensitive neurons, but increased the sensitivity of cold-sensitive neurons, thereby modulating the thermoregulatory circuits in a manner consistent with its pyrogenic role (136,137). This IL-1 activity is not related to neuroinflammation but could be an indirect effect because it can be blocked by inhibitors of cyclooxygenase, which catalyzes prostaglandin production downstream of IL-1 signaling (138). IL-1 may even mediate neurophysiological effects under sterile condition. A good example here is its role in regulating normal sleep. IL-1 is expressed in the brain with a diurnal rhythm, and increased expression of IL-1 is associated with increased spontaneous sleep whereas inhibition of IL-1 activity reduces sleep (139). Interestingly, neuronal IL-1 expression and indirect activation of neurons by CNS IL-1 may underlie the sleep promoting effects of IL-1 as it can promote synchronization of sensory neurons (140). Other indirect electrophysiological effects of IL-1 have been reported in neurons of the supraoptic (138) and paraventricular nucleus of the hypothalamus (141). Direct effects of IL-1 on neuronal excitability have also been reported (138); but the mechanism for this function remains unclear. IL-1 was found to inhibit Ca+ channel currents (142), reduce GABA A receptormediated response (143), inhibit NMDA receptor-mediated synaptic transmission (144), activate non-selective cationic conductance (145), potentiate voltage-dependent sodium currents in nociceptive neurons (146,147), and increase voltage-gated potassium currents (148), depending on the different types of neurons studied. In the dentate gyrus, IL-1 may facilitate or inhibit the generation of long-term potentiation (LTP) (149,150), a critical neural mechanism for learning and memory. LTP occurs as persistent increases of synaptic strength after high-frequency synaptic stimulation, thus potentially coding for learning or memory processes. Interestingly, the learning process itself causes hippocampal expression of non-inflammatory levels of IL-1, which in term, helps maintain LTP (150,151). These scattered reports of IL-1-mediated neurophysiological effect appear incongruent at first glance, but an emerging theme is IL-1 can modulate sensory system of the nervous system in order to modulate perception and learning. It should be noted that such modulation may have time-dependent and concentration-dependent variable effects. Acute IL-1 effects may heighten perception and learning whereas chronic IL-1 effects may reduce sensory function, retard learning, and cause fatigue (147,148,(152)(153)(154). Similarly, low levels of IL-1 may facilitate memory whereas high levels of IL-1 or complete blockade of IL-1 signaling may impair memory (155). One difficulty in the past is to identify IL-1 receptor expressing neurons and the observed neuromodulatory effects of IL-1 may be attributed to the indirect action of IL-1 that might elicit neural active substances such as nitric oxide (156), ATP (157), or prostaglandins (145). Recently, we have developed a knockin mouse line that allowed the tracking of IL-1 receptor expression cells in a cell type specific manner. We now have unpublished results that show IL-1 type 1 receptor is preferentially expressed in numerous sensory brain regions. Another neuromodulatory role of IL-1 is on neurogenesis. Reduced production of new neurons in adult hippocampus has been linked with the pathogenesis of depression (51). This role of IL-1 was initially observed in animal models of interferon-γ (IFN-γ) treatment. IFN-γ is used to treat hepatitis C but has the unfortunate side effect of causing depression. In a rat model of IFNγ-induced depression, hippocampal IL-1β expression and reduced neurogenesis in dentate gyrus was induced and administration of IL-1ra blocked these effects together with the depressive behavior (158). This mechanism is also operative in chronic stress induced depression: chronic mild stress was found to induce IL-1β expression in the hippocampus, reduce neurogenesis, and cause depressive like behavior in wild-type mice. These changes were absent in IL-1 receptor knockout mice or transgenic mice that express IL-1ra in the brain (159). That IL-1 driven microglial activation may be involved in this phenomenon is further supported by the evidence that inhibition of NFκB activation blocked the antineurogenic and depressive effects of the stress (160). Brain IL-1 is known to induce microglial NFκB activation (161). It should be noted that chronic mild stress dose not induce leukocyte infiltration into the brain; thus this IL-1-mediated microglial activation may not represent an immunological neuroinflammation. In addition, the antineurogenic effect of IL-1 may also be concentration dependent as IL-1 can facilitate neuronal survival by promoting the expression of nerve growth factors (NGFs) (162). Induction of neurotrophic factors is one of the early observations on IL-1-mediated non-immunological neural effects (163,164). In traumatic brain injury, increased NGF expression follows the increased expression of IL-1 in the wounded tissue. Injection of IL-1ra blocked NGF and the associate neuroreparative responses (165). IL-1 has also been found to stimulate neurotrophin-3 and brain derived neurotrophic factor, supporting neuronal survival and neurite growth (166,167). However, interaction between IL-1 and the neurotrophic factors can also be a double-edged sword. Systemic IL-1, not central IL-1, have been reported to reduce hippocampal BDNF expression (168); while acute intracerebral IL-1 caused the expression of neurotrophic factors and neuroprotection, subacute IL-1 (4 days of IL-1 injection) caused the opposite effects (169); IL-1 can also increase neuronal vulnerability by increasing the surface expression of the p75 neurotrophin receptor (170). Physiological activities of IL-1 in the brain also include neuroendocrine functions. Psychological and metabolic stress induced ACTH and glucocorticoid responses were reduced in IL-1 receptor knockouts or transgenic mice overexpressing brain IL-1ra (171). Intracerebral administration of IL-1 is known to induce CRH release (172) and psychological stress has been shown to induce brain IL-1 expression (173). Therefore, brain IL-1 could mediate physiological response to stress by stimulating the production of the immunosuppressive hormone glucocorticoid. In addition, IL-1 acting in the brain can stimulate brain metabolism despite hypoglycemia. Neuronal IL-1 synthesis was found to be induced by stimulation of AMPA receptors on neurons and the resulting release of IL-1 can stimulate glucose uptake by neurons in an autocrine or paracrine fashion (174). It is interesting to speculate that these physiological activities of IL-1 might coordinate with the immune activities of IL-1 such that hyper-inflammation may be prevented and brain energy usage may be spared even when immune activity might be energetically costly. It is interesting to note that the neuroendocrine function of IL-1 may be evolutionary conserved from invertebrates. In molluscs, CRF causes the production of biogenic amines as a stress response. This response is significantly reduced by IL-1 (175). Thus, this non-immunological IL-1 activity may have an ancient origin. The non-immunological activities of microglia have been reviewed extensively. The readers are referred to these excellent reviews (11,36,(176)(177)(178). Briefly, emerging evidences show microglia perform surveillance function during "resting state, " prune excessive synapse during development, contribute to adult neurogenesis, support neuronal survival, and modulate neurotransmission. Current research using advanced techniques in molecular biology, imaging and immunology has also identified significant heterogeneity in brain microglia in terms of morphology, gene expression profile, and cellular origin and fate (179). Some characteristics of subsets of microglia appear to be tightly linked with the potential neural function of these cells. For example, microglia from neurogenic regions are capable of substantial proliferation whereas microglia from non-neurogenic regions are not (180). Analysis of microglial expression patterns suggests that microglia from cerebellum and hippocampus appear immunologically more vigilant than microglia from other brain regions. Within Basal ganglia, microglia were found to show regional specific morphology, cell number, expression profile and activity relevant to motor activity and motion control, shaped by local cues (181). These findings demonstrate non-immunological functions of the microglia could be influenced by the specific neural circuitry they modulate. From this perspective, it is interesting to note that chronic unpredictable stress causes depression in association with a reduction of microglia numbers in hippocampus and stimulation of microglial activation by LPS or M-CSF restored microglia numbers and ameliorated stress-induced depression. In another study, chronic unpredictable stress was found to activate microglial cells in association with elevated CSF-1 expression in the prefrontal cortex (PFC), increase microglial phagocytosis of neuronal elements, and reduce dendritic spine density. Viral vector mediated knockdown of CSF-1 in the PFC blocked these effects and stress-induced anxiety-and depressive-like behavior (182). In neurodegenerative disease models, microglial production of proinflammatory cytokines and growth factors has been found to mediate neuroprotection against excitotoxicity (183,184). In addition, microglia-mediated synaptic stripping was found to be neuroprotective following acute neural injury (185,186). On the other hand, abnormal synaptic pruning have been observed in obsessive-compulsive disorder (OCD), indicating this mechanism might be pathogenic in OCD (187). These findings show nonimmunological activities of microglia can be either neuroprotective or pathogenic depending on the specific circumstances. THe BiG PiCTURe The dizzying progress made in the field of CNS IL-1 and microglia has produced great excitement and confusion. It is clear CNS IL-1 and microglia have both immunological and non-immunological functions. These two types of functions may be separated not only by the physical barrier, such as the blood brain barrier, but also by an invisible barrier: the activation threshold of inflammatory cytokines. For example, IL-1 is able to activate neurons at 1,000fold lower concentration than that is required for the activation of non-neuronal cells (188). It is possible that low levels of IL-1 acts in the CNS to perform non-immunological functions including non-immunological activation of microglia, which are involved in the remodeling of the CNS tissue. Higher concentration of IL-1 could engage non-neuronal cells of the CNS to produce neuroinflammation. Interestingly, although microglia is the main source of IL-1 production in the brain without infiltrated leukocytes, IL-1 does not directly stimulate microglial cell to produce IL-1 (189). Our unpublished results show IL-1 receptor is not expressed on resting microglia and CNS IL-1 induce microglia to produce IL-1 indirectly via cells of the blood-brain barrier and cells of CSF-brain barrier. The separation of the immunological and non-immunological functions of CNS IL-1 and microglia may be compromised during neural injury or aberrant neural activity. Thus the integrated perspective suggests that the disruption of the proper separation and coordination of the immunological and the non-immunological functions of CNS IL-1 and microglia might be a new way to think about the pathogenic potential of these two critical factors in CNS diseases. Another important insight is that the detrimental effects of IL-1 and microglial activation does not always stem from immunological functions of these factors. A series studies from Centonze's group showed that IL-1 and TNFα can cause hyperexcitation in neurons, causing excitotoxicity in MS (190). In addition, they found IL-1 could cause anxiety by blocking neuronal cannabinoid receptor 1-mediated control of GABAergic synapses (49,100,191,192). Thus, aberrant non-immunological function of IL-1 can also contribute to disease progression. The complex contribution of CNS IL-1 and microglia argues against a one size-fits-all approach to target these factors in treatment without careful considerations for the different phases of pathological processes. For acute brain tissue injury, blocking |
IL-1 activity and microglial activation at the early phase of the disease could be beneficial as this might dampen excessive neuroinflammation (15,193); however, blocking later expression of low levels of IL-1 related to its promotion of clearing of debris and wound healing (194) may not be advisable. In chronic degenerative diseases, blockade of CNS IL-1 activity and microglial activation may also need to be titrated, such that the excessive activation of these factors may be attenuated, but the physiological neuroregulatory functions can be preserved. In an extreme case of an animal model of major depression, loss of microglia in hippocampus has been found to be a cause and stimulation of microglia proliferation can effectively alleviate behavioral symptoms of depression (195). Thus, one cannot assume that microglial activation, not deficiency, is always the cause of CNS diseases. The integrated perspective of microglial activation and IL-1 activity in the brain in regards to the pathogenesis of CNS diseases is presented in Figure 1 in which the immunological and non-immunological functions of IL-1 and microglial activation are seen as an integrated whole and dysregulation of either types of functions alone or in combination may contribute to disease progression. AUTHOR CONTRiBUTiONS NQ and XL cowrote this review. FUNDiNG This study was supported by National Institute of Health (NIH) grants R01-MH-109165 to NQ. Pilot Study in Temporary Peripheral Nerve Stimulation in Oncologic Pain Objectives Temporary, percutaneous peripheral nerve stimulation (PNS) has been shown to provide analgesia for acute postoperative pain, postamputation pain, and low back pain. The implanted device stimulates the neural target for up to 60 days at which point the leads are extracted. Patients have demonstrated prolonged analgesia continuing after extraction of the leads. The purpose of this case series is to demonstrate peripheral neural targets that could feasibly be used to treat various pain syndromes prevalent in the oncologic population. Materials and Methods A temporary, percutaneous PNS was implanted under ultrasound guidance in 12 oncologic chronic pain patients seen in an outpatient pain clinic who had failed medical and/or interventional management. The device was implanted for up to 60 days. Clinical progress of pain and functional capacity was monitored through regular clinical visits. Results The case series presents seven successful cases of implementation of the PNS to treat oncologic pain. Three of these cases demonstrate targeting of proximal spinal nerves to treat truncal neuropathic pain and lumbar radicular pain. The four remaining cases demonstrate successful targeting of other peripheral nerves and brachial plexus. We also share five failed cases without adequate pain relief with PNS. Conclusions PNS has potential uses in the treatment of oncologic pain. Further high‐quality studies should be designed to further elucidate use of the PNS to treat oncologic pain. INTRODUCTION Of the 14 million cancer patients in the United States, up to as many as 40% have pain as a significant symptom (1). Neuropathic pain in oncologic patients is due to both the disease itself and associated treatments. Tumors may invade or compress nerves (2,3). Surgical resection can result in nerve transection and scar tissue formation. Commonly used chemotherapy agents such as vinca-alkaloids, taxanes, platinum-based agents, anti-microtubule agents, and anti-angiogenesis agents are known to cause neuropathy in 30-70% of patients, often of dose-limiting severity (4). Lastly, radiation therapy can cause fibrosis causing tissue and nerve damage (2,4). The use of a temporary, percutaneous peripheral nerve stimulator (PNS) (SPRINT ® PNS system, SPR Therapeutics, Cleveland, OH, USA) for controlling neuropathic pain has been supported clinically in the literature. The device has received FDA-approval for implantation for up to 60-days as treatment for both acute and chronic pain. In addition to providing analgesia during stimulation, a unique feature of the device is that it has shown to continue to provide analgesia after extraction of the PNS leads. Currently, data are limited to one randomized-control trial in postamputation pain (5), and multiple case series in axial low back pain (6,7), acute postoperative pain after rotator cuff surgery (8), total knee arthroplasty (9), and foot surgery (10). Analgesic benefits up to 12 months (5) and 4 months (6,7) after extraction of the PNS were noted in postamputation and low back pain patients, respectively. Experience for the use of this device is developing. In the oncologic population, minimal information is known regarding concerns or appropriate targets for pain relief. While controlled trials may be difficult to perform in the oncologic population, clinical experience is valuable to improve patient care. We highlight interesting cases and observed limitations of this therapy in this 819 population and propose recommendations for the use of PNS in chronic intractable neuropathic pain related to cancer. PNS being discussed in this article is a form of peripheral neuromodulation directly stimulating nerves that are the source of the patient's pathology. In these cases, the stimulator will be located proximally along the anatomical pathway of the nerve innervating the region of pain. The stimulation will not necessarily occur at the direct region of pain, although the paresthesia experienced should cover the painful region. Initial devices required surgical implantation with placement of leads in direct contact with peripheral nerves. Newer devices such as the percutaneous PNS demonstrated in this study allow percutaneous implantation under visual guidance under fluoroscopy or ultrasound. This technology needs to be differentiated from another form of peripheral neuromodulation called peripheral nerve field stimulation (PNfS). This procedure involves stimulating the subcutaneous tissue directly in the region of the pain. This stimulation acts on the various afferent peripheral nerves innervating the region and altering their nociceptive pathways (11). Patient Selection This was an institutional review board (IRB) approved singlecenter retrospective analysis of patients at Memorial Sloan Kettering Cancer Center (MSKCC), approved via a waiver for informed consent and supported by MSKCC support grant (P30 core grant). Data from all consecutive cases with management of cancerrelated pain using the PNS device at MSKCC outpatient interventional pain clinic from September 2017 through June 2019 were included in the study. Technique A portable ultrasound (GE LOGIQ P9™, Chicago, IL, USA) and either linear probe (8-10 Hz) for femoral nerve, suprascapular nerve, and brachial plexus or curvilinear probe (1)(2)(3)(4)(5) for the proximal spinal nerves and sciatic nerve was used to visualize the nerve. Additionally, fluoroscopy was used to confirm appropriate positioning of the leads targeting proximal spinal nerves. First patient was positioned to optimize visualization of the target nerve. Once the neural target was appropriately visualized by ultrasound, an 18-gauge stimulating needle (SPR Therapeutics) was inserted into the skin and directed towards the target nerve. Electrical stimulation was initiated once the 18-gauge stimulating needle was within 1-1.5 cm of the nerve. Per manufacturer guidelines (SPR Therapeutics), a pulsed, square waveform was applied at a frequency of 100 Hz using the manufacturer-provided pulse generator (SPR Therapeutics). The amplitude (range: 0.2-20 mA) and pulse duration (range: 2-100 μs) were titrated until "comfortable sensations" were produced in the distribution of the nerve covering the targeted region of pain. The 18-gauge stimulating needle was repositioned as necessary to produce the desired "comfortable sensation." At this point, the inner cannula of the stimulating needle was removed, with the outer cannula stabilized. Then, the 12.5 cm, 20 G introducer needle was introduced into the cannula using Seldinger technique deploying the stimulating lead. The external portion of the stimulating lead was connected to the pulse generator. The lead and pulse generator were then secured to the skin using sterile occlusive dressing (provided by SPR Therapeutics). Follow-Up After the implantation procedure, patients continued to followup at the outpatient interventional pain clinic as clinically indicated per discretion of the pain provider. Patients were able to adjust the amplitude and pulse duration on their own according to a preprogramed scale. Patients continued to receive continuous, pulsed, square-waveform stimulation until extraction of the leads. If needed, the amplitude and pulse duration were reprogrammed by the clinician and device representatives to again achieve the desired "comfortable sensation" at clinic visits. While the PNS was implanted and thus receiving stimulation, patients were contacted weekly via telephone or clinic visit to record the efficacy of treatment as measured by improved pain score, decreased use of analgesics, and functional improvement. Successful response to the PNS was defined as a 50% or greater relief of pain based on the analog pain score during both the stimulation phase and continuing after extraction of the leads compared to baseline prior to implantation. At the end of the stimulation phase, patients had the PNS extracted. This occurred at 60 days as planned for all but one patient, who needed to have the leads removed earlier due to an urgent need for an MRI. The patients were then continued to be followed in the outpatient clinic to monitor for continued response after extraction of the device. The duration of continued analgesia of 50% or greater was also measured as a secondary outcome. RESULTS Tables 1 and 2 describe the clinical experience of seven patients with neuropathic pain who received successful benefit from the PNS. Two patients were treated for upper extremity radicular pain, three were treated for lower extremity neuropathic pain, and two were treated for truncal neuropathic pain. As mentioned earlier, the peripheral nerve stimulators were implanted for a duration of 60 days in all cases except one where it had to be extracted early due to urgent need for an MRI. Patient demographics, clinical pathology, and analgesic outcomes are shown in Tables 1 and 2. Patients 1-3 had specific proximal spinal nerves targeted using the paravertebral and/or neuroforaminal approach. Ultrasound was used to visualize the transverse process and the needle was advanced in a lateral to medial direction to target the specific proximal spinal nerve. The approach for targeting the thoracic proximal spinal nerve in Patient 2 is shown in Fig. 1 and that for targeting the lumbar proximal spinal nerves in Patient 3 is shown in Figs. 2 and 3. In Patient 4, the suprascapular nerve was targeted under the transverse ligament at the suprascapular notch of the scapula using a medial to lateral approach. In Patient 5, the brachial plexus block was performed at the supraclavicular level (Figs. 4 and 5). The sciatic nerve was blocked at the popliteal fossa in Patient 6 and the femoral nerve at the femoral crease in Patient 7. Additionally, we describe five patients in Table 3 that did not have adequate pain relief from the PNS. DISCUSSION The mechanism of action of PNS is a topic of ongoing research, with likely both centrally and peripherally mediated effects. One theory suggests that the effect of PNS may be carried out via the gate control theory similar to dorsal column stimulation, which causes stimulation of the A-beta fibers as they traverse the dorsal www.neuromodulationjournal.com columns. Comparatively, PNS leads to activation of A-beta fibers at the location of the peripheral leads with orthodromic activation of the A-beta fibers as the travel back to the spinal cord (12,13). Stimulation of A-beta neurons leads to excitation of inhibitory dorsal horn interneurons, which in turn inhibit the transmission of nociceptive, small-diameter A-delta and C nerve fibers. Some of these effects may be mediated through the effects of neuropeptides such as substance P and calcitonin gene-related peptides (12). A second paradigm focuses on the local effects at the site of peripheral stimulation. Chemical mediators, such as neurotransmitters and endorphins, may play a key role in transmission of pain signals by increasing local blood flow (14). Animal models have demonstrated that nerve injury leads to localized inflammatory changes such as edema, ischemia, and increased vascular permeability (14). Studies have suggested that PNS may reduce the levels of these biochemical mediators thus producing their analgesic effect (12,13). This theory is supported by a study that demonstrated increased latency of afferent signals via A and C nerve fibers when stimulated by electrical stimulation. This effect was most significant on small-diameter fibers, which primarily carry nociceptive signals (15). Further research in this area should help elucidate the roles of these various theories in PNS. The first three patients in our case series demonstrate novel targeting of proximal spinal nerves at the thoracic and lumbar levels with the temporary PNS. Prior studies using this device have targeted peripheral nerves and the brachial plexus to treat pain in the extremities (5,(8)(9)(10). Our approach introduces a unique approach for treating truncal pain using this device by allowing |
selective targeting of dermatomal patterns as we have demonstrated with post-mastectomy pain syndrome and postherpetic neuralgia. Patient 1 with post-mastectomy pain syndrome 822 had pain return to baseline six weeks after extraction of the PNS. She continues to have her pain medically managed with amitriptyline as she was prior to PNS implantation. Patient 2 with postherpetic neuralgia has not had recurrence of pain for 12 months after lead extraction. It is unclear whether the PNS continues to have residual analgesic effect or post-herpetic neuralgia pain has resolved on its own. Patient 3 with neuralgia after sarcoma resection had four months of relief after lead extraction. The patient subsequently chose to receive a spinal cord stimulator after return of pain, which continues to provide analgesia at the time of this writing. Patient number 4 demonstrates the first use of PNS leads targeting the suprascapular nerve for analgesia in acute or chronic cancer pain settings. Targeting the suprascapular nerve for a patient with disease near the spinal cord reflects the understanding of referral pain patterns. While there was not a direct lesion on the peripheral nerve, stimulation of the nerve improved pain occurring at the spinal cord level. This idea underscores the use of visceral and somatic referral patterns as potential targets for PNS. This patient continues to have residual analgesia at the time of this writing, totaling 18 months thus far. Patient number 5 in our case series demonstrates the first time PNS was successfully used to target the brachial plexus in an active cancer pain patient. In a prior study, analgesia for rotator cuff surgery was successfully performed by targeting the C5 proximal spinal nerve, superior trunk, and the middle trunk (8). Unfortunately, Patient 5 had progression of her malignancy leading to urgent need for an MRI requiring extraction of the leads at 45 days, 15 prior to the target of 60 days. The patient then passed away shortly after from progression of her disease with continued analgesia after extraction. This case highlights a potential use of temporary PNS in end-of-life scenarios. Patient 6 demonstrated successful targeting of the sciatic nerve at the popliteal fossa. Prior attempts at doing this approach have led to subjective cramping sensations, lead dislodgement, and spontaneous lead fractures during use, and lead fractures during extraction (10). Our patient did not experience any of these complications. This patient has had six months of residual analgesia after extraction that still persists. Lastly, the femoral nerve was successfully targeted in Patient 7 as has been demonstrated in postamputation pain (5) and for postsurgical pain in total-knee arthroplasty (9). This patient continues to have analgesia in the distribution of the femoral nerve. The patient continues to have pain in distribution of lateral femoral cutaneous nerve, which has been treated with repeated peripheral nerve steroid injections. In our experience, there were five PNS cases that did not lead to significant improvement in pain after extraction of leads. Three of these cases failed due to inadequate analgesia during stimulation. Two other cases failed due to discomfort or aggravation from lead stimulation. Discomfort and aggravation of pain are known side effects associated with other neurostimulation techniques such as spinal cord stimulators. These patients were offered other forms of stimulation and intrathecal drug delivery, which neither patient was interested in. Both patients are currently maintained on oral opioids. Furthermore, in this cohort, we had one lead fracture, which is one of the most common complications with this device (8)(9)(10). Retained fragments only have conditional MRI compatibility, which should be a significant concern in the oncologic population. The patient was informed of the complication and potential risks associated with MRI-imaging. Thus far, we have not had any complications related to MRI-imaging. A prior study on fracture rates using the same helical-coiled leads in other devices showed an 7.5% incidence of lead fracture on extraction (10). The retained leads are restricted to a static magnetic field of 1.5 T, maximum spatial field gradient of 20 T/m, and maximum whole body averaged specific absorption rate (SAR) of 2 W/kg. Of these three criteria, the greatest limitation is likely to be due to the 1.5 T restriction (16). Over the past decade, 3 T MRI are becoming increasingly common in clinical practice. Market data from 2004 showed that 25% of new MRI machines purchased featured 3 T magnets 823 www.neuromodulationjournal.com (17,18). Although we were unable to find more recent data, that number is likely higher now. The restriction on the maximum spatial gradient and SAR is less likely to place significant restrictions. The maximum spatial gradient determines the translational force applied to the retained lead. The maximum spatial gradient even for typical 3 T MRI will have a maximum spatial gradient of about 10 T/m (16), which is significantly less than the limit. Additionally, gradient experienced by the retained lead could be significantly less if it is not within the core of the magnet itself (16,17), as would be the case in a patient receiving a brain MRI with a retained lead in the popliteal fossa. The restriction of SAR limits the permissible amount of energy that can be transferred to the body tissue over a designated amount of time preventing excessive heating of the implanted device and body tissue. The SAR can be reduced by extending the duration of the MRI scan allowing extra time for cooling (17). Persistent Pain Post-Breast Cancer Treatment Breast cancer is the most commonly diagnosed cancer among women with five-year survival greater than 90% (19). The prevalence of persistent pain after breast cancer treatment is 25-60% (20,21). Three of the common causes of chronic pain in these patients include intercostobrachial neuralgia from transection of the intercostobrachial nerve during surgery, radiation-induced cutaneous changes, and radiation-induced inflammation (20). Current literature on treatment modalities is limited. However, some studies suggest that early intervention, including improved perioperative analgesia can reduce incidence. One prospective, randomized, double-blinded, placebo-controlled trial showed that one-time preoperative paravertebral blocks with local anesthetic at levels T1-5 before breast cancer surgery reduced risk of persistent pain at three and six months postoperative by 32.6% and 40.5%, respectively (21). We feel PNS of the proximal spinal nerves introduces a novel modality to consider in treating this patient population, as we demonstrated with Patient 1 in our case series. Postherpetic Neuralgia Similar to patients with post-mastectomy related pain, patients with post-herpetic neuralgia (PHN) have potential PNS targets at the proximal spinal nerve level. The annual incidence of herpes zoster is about 3.4 cases per 1000 people (22) and even higher in the cancer population. The incidence in patients with hematologic malignancies is 4.8 times higher and that in patients with solid tumors is 1.9 times higher. The relative risk of developing herpes zoster increases with increasing levels of immunosuppression such as in patients on chemotherapy or corticosteroids (23). Approximately, 20% of all patients with herpes zoster will continue to have pain three months and 15% two years after a herpes zoster episode (22). We feel a temporary PNS system may be an ideal treatment for PHN since a majority of patients are expected to have resolution of their symptoms within three to six months, as was demonstrated in the case of Patient 2. Postthoracotomy Pain Syndrome Lung cancer is among the most common cancers in the United States, often treated via surgical resection. Chronic postthoracotomy pain syndrome affects 30-60% (24-26) of patients and is debilitating in about 5% (25). Currently, there is a lack of literature on management strategies for chronic post-thoracotomy pain. We hypothesize that targeting the thoracic proximal spinal nerves using a paravertebral approach as we did in Patient 1 and 2 in this case series could provide analgesia in this unique patient population as these same neural targets have been shown to be effective in treating acute postoperative pain after a thoracotomy (25). Surgical Resections of Cancer Many patients who undergo surgical resection of cancer present to chronic pain specialists for management of chronic postoperative pain (27,28). The pathophysiology of pain after resection likely has significant overlap with post-amputation pain, which has been shown to be successfully treated with PNS in a prior randomized, placebo-controlled, double-blinded study (5). However, in our case series, only two out of six cases with postsarcoma resection pain responded well to the PNS. Three of the failures were due to lack of analgesic response and one due to discomfort with stimulation. Only one of our cases involved a resection of bone (finger amputation). The remaining five cases involved soft-tissue resection. Furthermore, patients with subacute pain, less than one year since surgery, had an improved outcome relative to patients with longstanding pain symptoms. Electrical Stimulation and Progression of Cancer Pain providers should be aware of the theoretical risk of exacerbation of malignancy associated with electrical stimulation. This has mostly been addressed in the context of transcutaneous electrical nerve stimulation (TENS). The rationale behind this concern is that electrical stimulation may stimulate DNA synthesis and cell replication leading to increased tumor growth. However, as of now, there is no literature to substantiate this theory. Pain providers should be aware of this issue to help address patient concerns (29). Limitations and Future Directions The results and conclusions that can be drawn from this study are limited by the case series nature of the data. Two prior studies using this PNS have studied acute postoperative pain using randomized, 824 www.neuromodulationjournal.com crossover studies (8) (10) and one prior study looked at chronic postamputation pain using a randomized, controlled trial (5). Future research should focus on generating additional high-quality evidence to help identify criteria predictive of successful response to PNS. In the data provided here, five out of 12 patients did not have successful response to PNS, which leaves significant space for improvement. The prior RCT on postamputation pain had a sample size of 25 patients and targeted femoral and sciatic nerves (5). Future studies could similarly focus on specific neural targets and pathology. A larger sample size should be employed to facility subgroup analysis. Thus far, limited research has been done on clinical factors that may influence efficacy of PNS. Two particular factors that might be relevant are patient body mass index and psychiatric co-morbidities. Extremes of BMI in either direction may make it hard to target the nerve and increase risk of lead migration during the stimulation phase. Psychiatric co-morbidities are often considered relative contraindications to spinal cord stimulation due to reduced efficacy in this patient population, which may extend to PNS. Additionally, studies with larger sample sizes would be indicated to identify risk of rare complications such as infection or hematoma. CONCLUSIONS This case series demonstrates that the temporary, percutaneous PNS has several feasible targets to treat acute and chronic oncologic pain. Our data introduce novel targeting of proximal spinal nerves and corroborates prior data demonstrating targeting of various peripheral nerves. Further randomized, placebo-controlled, blinded trials will need to be designed to determine PNS efficacy in various oncologic pathologies. Temporary, percutaneous PNS is a promising and evolving field but needs significant research to help develop clinical guidelines before it can become a routine part of the pain providers regular armamentarium. Authorship Statement Ojas Mainkar helped write the paper. Che Antonio Sollo helped perform the cases and write the paper. Grant Chen helped perform the cases and edit the paper. Aron Legler helped perform the cases and edit the paper. Amitabh Gulati helped perform the cases and helped write the paper. underserved population will benefit from the expansion of treatment options. This report advances that objective. William Rosenberg, MD Kansas City, MO, USA *** The main conclusion one can draw from this articlethe electrical neuromodulation is a valid option for patients with cancer pain. Even though the first patient that underwent spinal cord stimulation in 1967 by Shealy was suffering from cancer pain, the neurostimulation for pain is used today almost exclusively for patients with pain due to non-malignant causes. Two main reasons for avoiding neurostimulation in patients with cancer pain have been their short life expectancy (that makes conventional neuromodulation non-costeffective) and the need in MRI scanning (for which the previous neuromodulation devices were a contraindication). However, the technology advances have addressed these concerns, and the devices that the authors used for percutaneous peripheral nerve stimulation in this series of cancer pain patients are different from conventional neuromodulation |
systems: they are not intended for permanent implantation and are removed after up to 60 days of continuous use. With neuromodulation devices becoming more affordable and MRI compatible (conditionally approved) their use in cancer pain patients may be explored further, perhaps with associated decrease in opioid consumption and reduction in situations that would necessitate neurodestructive interventions. The experience of the authors should prompt a change in the therapy paradigm for management of cancer pain, introducing neurostimulation of peripheral nerves, dorsal root ganglia, spinal cord and brain as a valid option before, instead of, or in addition to other pain-relieving approaches. Connective Tissue Graft to Improve Aesthetic Peri-implant Area: Modified Clinical Technique This article reports a clinical case with a 4-years follow-up in which sub epithelial connective tissue graft harvested by two different technique was used to recuperate the aesthetic conditions of the two-previous implanted anterior areas which presented soft tissue fenestration and osseous dehiscence promoted by dental extraction. The highly compromised areas were treated using sub epithelial connective tissue grafts which due the necessity of the quantity and quality were harvested by using two different surgical techniques: dental wedge and free gingival graft. After 4-years of follow-up the goal of treatment was fully reached. The gingival soft tissue around perimplantar area is stable and seems to be normal. The two techniques applied to harvest sub epithelial connective tissue in this case were essential to obtain a large amount of tissue to be grafted. Quality and quantity of the sub epithelial graft are critical conditions to maintain stability during the early phase of healing process, allowing and improving initial revascularization. Introduction Anterior single tooth replacement with a dental implant is challenging, especially in a highly compromised area [1][2][3][4]. Anterior areas with bone dehiscence defects promoted by dental extraction may cause aesthetic concerns and functional abnormalities such as gingival recession and dentin hypersensitivity in adjacent teeth [5][6][7]. When bone dehiscence in anterior area is not recovered by bone augmentation techniques, before dental implant therapy, a critical and complex aesthetic defect may be created [7]. The aesthetic finish of implant/restoration interface always requires healthy peri-implant soft tissue at the adequate location [8][9][10][11]. In this case, it was suggested that surgical manipulation/augmentation of peri-implant soft tissue may be beneficial to increase the width/thickness of gingival keratinized tissue and also to improve aesthetic outcomes of implant therapy [12][13][14][15][16]. The sub epithelial connective tissue graft is a gingival plastic surgery that may be used to enhance the aesthetic and gingival contour of the periodontium [17,18]. This technique is designed to create gingival keratinized tissue, to recover areas with gingival recession, and also to enhance both the aesthetics and functional periodontal contours surrounding dental implants [17]. Various forms of the connective tissue graft have been used in the aesthetic zone to recover unaesthetic conditions after implant therapy and before definitive crown placement [12][13][14][15]. In this clinical case, were applied free gingival graft and distal edge techniques to harvest an adequate amount of sub epithelial connective tissue graft, to recover the functional and aesthetic appearance in two compromised areas, which previously received implant replacement of teeth 12 and 22. The treatment goal was achieved, and the final outcome resemble, aesthetically and functionally the real teeth surrounded by natural soft tissues. Case Report A patient woman aged 18-year-old, previously received implant replacement of teeth 12 and 22. The two respective areas presented osseous dehiscence and soft tissue fenestration promoted by dental extraction which induced recession and hypersensitivity in adjacent teeth. Clinical and radiographic evaluation revealed that the pre-existing Osseo integrated fixtures were apically and labially malposition. The soft tissue profiles were deficient, and the resulting gingival margins were 5 mm apical to the ideal gingival level. The platforms of the fixtures were visible, and considerable black spaces were present in the compromised areas following placement of the provisional restorations ( Figure 1). Considerable labial and coronal augmentation were necessary to achieve an aesthetic result. The treatment plan consisted of soft tissue augmentation by using the sub epithelial connective tissue graft with technique modification to harvest the connective tissue [19]. The two affected sites were surgically treated by similar procedures, with interval of time around three months. The provisional crowns and abutments were removed from the fixtures, and the internal cover screws were placed in the fixtures. A labial flap was created with splitthickness dissection, and a palatal pouch was made also by split-thickness dissection. A free gingival graft was dissected from the palate and its width was dictated by the site to be augmented and depth of the palatal vault (Figures 2a and 2b). A distal wedge procedure was made at the same side, and the excised connective tissue also was used to improve the augmentation of the compromised area (Figure 2c). The epithelial tissue from both, the free gingival graft and excised tissue of the distal wedge procedure were suitable eliminated and then placed over the surgical donor site (Figures 2b-2d). The connective tissue which was excised by distal edge procedure was placed and fixed on the fixture by a cover screw. The sub epithelial graft harvested from free gingival graft technique was then disposed over the cover screw and inserted into labial and palatal flaps (Figure 3a). The labial and palatal flaps were approximated as much as possible and then sutured to cover the sub epithelial graft (Figures 3b and 3c). The second site was surgically treated by the same technique. The sites were allowed to heal at least for 5 months and were then evaluated to determine if the prosthetic procedures could be defined. After each surgery, bonded restorations were provided with ovate pontic form and placed into prepared sites. After both two areas were recovered with soft tissue, the punch uncovering was performed to uncover the two areas and the convenient healing abutments were placed to keep the areas uncovered. Restorations were initiated 2 weeks later, and the provisional restorations were placed for 2 months to induce healthy and normal gingival shape surround dental implant. After treatment, a rigorous home care routine was established, and the patient was recalled once every six months for professional maintenance care, keeping the treated area under control. After one year the teeth 13 and 21 presented apical lesions and were treated by endodontic treatment (Figure 4). After four years the areas of the implanted teeth 12 and 22 are healthy, with normal aspect, keeping the contour of gingival tissues surround restorations without alterations of the position (Figure 5). Discussion Fine aesthetic finish of implant/restorations requires healthy peri-implant soft tissue at appropriate location [10]. A discrepant and abnormal position among implant-restoration, adjacent teeth, peri-implant and periodontal soft tissue may cause unaesthetic appearance [6]. Bone resorption following maxillary anterior tooth extraction is common and often promotes dehiscence defects, which compromises gingival tissue level for the implant restoration [5,6,10]. When dehiscence defect was caused by tooth extraction in an anterior area, the presurgical planning should include bone augmentation before implant therapy [6,20]. If the affected area is not recovered the fixture may be placed inadequately and the crown restoration will have an undesirable appearance, and the adjacent teeth may present functional abnormalities as gingival recession and dental hypersensitivity [5,7]. Although some implant fixture may need to be trephined or retrieved and the site grafted and retreated, these are a long process [12]. One alternative is to attempt soft tissue augmentation around the unaesthetic restoration. The sub epithelial connective tissue graft concept may be useful to augment soft tissue around previously restored implants in an aesthetic zone [13][14][15][16][17]. In this clinical case was applied the distal wedge technique associated with the free gingival graft technique to obtain an adequate quality and quantity of sub epithelial connective tissue graft to recover the compromised areas. The distal edge technique was applied, and the eliminated tissue was dissected to remove its epithelium. An ample free gingival graft was harvested from the palate and its epithelium and a thin layer of connective tissue was dissected and simultaneously with the epithelium eliminated from the distal edge, was placed at the donor site. This procedure permitted to control any risk of heavy bleeding in the donor site which was large and propense for haemorrhagic process and also may facilitate faster healing of the donor site [19] (Figure 4). These two surgical techniques permitted to harvest a significant amount of connective tissue to be used as sub epithelial connective tissue graft, necessary to be grafted at compromised area. The free gingival graft technique, also allowed the possibility to harvest a controlled connective tissue graft, long, wide, thick with a regular amount, and desirable shape. This large and regular connective tissue graft could be placed over the fixture and the connective tissue harvested by distal edge procedure, with its end reaching a minimum of 5 mm apical to the platform of the implant in both sides, which were enveloped into labial and palatal flaps. This procedure was significant to aid mainly the initial stability of the sub epithelial graft allowing the revascularization and maintenance of the amount of connective tissue graft during healing process and also to preserve keratinized gingival in buccal side [21]. Although conventional sub epithelial connective tissue graft may improve the buccal aspect of compromised sites, coronal gains remain unpredictable. The depth and thickness of the palate will affect the possibility to obtain ample amount of the connective tissue without fat and glandular tissue, postoperative sequelae as bleeding and palatal necrosis [19]. The free gingival graft and distal edge techniques may improve harvesting the connective tissue graft in quality and quantity which may permit successful development of vertical soft tissue augmentation with aesthetic appearance and functional peri-implant soft tissue structure. Although scientific evidence in most part is lacking, soft tissue vertical augmentation at implant sites may need to be considered in some clinical situations. After resolving the discrepancy in gingival areas around implants 11 and 21, the challenge became to promote a healthy, normal and adequate aesthetics gingiva surround the prosthetic restoration. The cervical contour of provisional restoration was used to simulate the drawing of the amelocementary junction. This specific design will be responsible by defining the structural shape of the gingival papillae, since the design of the gingival papillae depends intrinsically on the structuring of the biological width surrounding each normal healthy tooth. In normal clinical conditions the biologic width is defined as the junctional epithelium and supracrestal gingival connective tissue attachment surrounding every tooth. The main physiological function of the biologic width seems to be a protective barrier for the subjacent periodontal ligament and the supporting alveolar bone. In a normal healthy dentition, the measurement between the alveolar bone crestal and cementoenamel junction is always almost constant and is occupied by gingival connective tissue attachment surrounding every tooth. To maintain the measurement of the biological width constant surrounding each normal healthy tooth, the alveolar bone crest follows the design of the cement enamel junction surround each tooth and in consequence marginal gingiva delineates and express similarly the shape of the alveolar bone crest surround each tooth. Thus, the structural shape of the gingival margin by buccal and lingual side seems to be a regular concave arc and the structural shape of the interproximal gingiva called gingival papillae seem to acquire almost the shape of a triangle whose design follows the architecture of the amelocementary junction by mesial and distal sides. These singularities also occur in dental implants with supracrestal gingival connective tissue collagen fibers arranged in the titanium surface parallel to the long axis of the dental implants. Then to restructure the physical shape of the gingival papillae is necessary as part of a strategy with the aim of redrawing the limits of the cement enamel junction and sometimes redraw to reposition the height of the interproximal contact point. Once definition of the gingival contour surrounds the two implants were achieved, a final impression was taken, and the definitive restorations were placed. However, the difficulty in treating this case, emphasize the importance of pre-evaluation of the gingival morphotypes, smiles, and bone architecture previous dental implant placement, to avoid improper implant position with inadequate soft tissue condition. Conclusion Surgical manipulation of peri-implant soft tissue by using techniques to harvest sub epithelial connective tissue graft as applied in this clinical case, may be beneficial to increase |
gingival keratinized tissue and also to improve aesthetic outcomes of implant therapy. Early prediction of mandibular third molar eruption/impaction using linear and angular measurements on digital panoramic radiography: A radiographic study Background: The impaction rate is higher for the third molars than for any other tooth in modern human population. This study was conducted with the aim to evaluate the validity of linear and angular measurements on the digital panoramic radiograph as a reference for early prediction of mandibular third molar eruption/impaction. Materials and Methods: Digital panoramic radiographs of 200 subjects were selected based on their status of eruption of mandibular third molars; fully erupted (Group A), partially erupted (Group B), fully developed but not erupted (Group C) and partially developed groups (Group D). Each group comprised 50 subjects with 25 males and 25 females. Nine variables (linear measurements, angles, and ratios) were determined and measured bilaterally by two observers and values were compared between the study groups and genders. Results: The data thus obtained were analyzed for comparison among all the study groups. It was found that the difference in the mean values of lower eruption space (LES) measurements, α-angle (angle between long axis of the third molar and gonial-symphyseal plane) and β-angle (angle between long axis of mandibular second and third molars) were significant (P < 0.05). The mean values of mesiodistal width, LES-ramus, LES-Xi point and β-angle were found more in males than in females. No significant difference was observed between the sides. Conclusion: α- and β-angle together with LES measurements give the accurate information on early prediction of lower third molar eruption or impaction. INTRODUCTION The dental profession has witnessed a dramatic reduction in dental disease and tooth loss over the last century, but the problems associated with third molars still persist. The impaction rate is higher for the third molars than for any other tooth in the modern human population. It is observed that in the evolution process of the man and due to big changes in feeding habits emphasized by the decrease of physiological activity of maxillary and mandibular bones; the growth is compromised, inducing a decrease in size of these bones. The eruption space for the mandibular third molar is also affected by the direction of tooth eruption during the functional phase of the eruption. When properly positioned, third molars normally emerge between the age of 17 and 21 years. However, 40% of the teeth become partially or completely impacted in the bone. Decreased space between second permanent molar and mandibular ramus has been identified as a major factor in the etiology of mandibular third molar impaction. [1,2] This study was conducted with the aim to assess early prediction of eruption or impaction of mandibular third molars using linear and angular measurements and its validity on digital panoramic radiographic images. MATERIALS AND METHODS The subjects with the age group of 15-25 years of both sexes were drawn from the out-patient department of K D Dental College, Mathura. These subjects were clinically evaluated for the status of eruption or impaction of mandibular third molars. No history of orthodontic treatment, orthognathic surgery, extraction, and other pathologies associated with the mandibular third molar were included in the study. After taking ethical committee approval and informed consents, patients were subjected to digital panoramic radiographic examination (Planmeca ProMax II Digital Panoramic X-ray Unit, Helsinki, Finland) with 68 kV, 5 mA and 16 s parameters. The obtained images were displayed on the computer screen with the aid of Planmeca Dimaxis Pro 4.1.4 software (Planmeca, Helsinki, Finland). The final selection of 200 subjects was based on the radiographic presence of fully or partially developed mandibular third molars. The subjects were divided into four groups based on their status of eruption or impaction. Each group comprised 50 subjects of which 25 were males and 25 females. The four groups were as follows: The interpretation of digital panoramic radiographic images was done using Planmeca Dimaxis Classic 4.1.4 version software (Planmeca, Helsinki, Finland). Using the digital ruler, nine variables (3 linear, 4 angular, 2 ratios) were determined and measured bilaterally by two observers, to avoid the bias with measurements. While measuring the linear measurements, magnification factor of 1.23% was adjusted. The nine variables were mesio-distal width (MDW of lower third molar at its greatest diameter), lower eruption space-ramus (LES-R, measured by a line drawn from the distal surface of lower second molar to the anterior edge of the ramus along the occlusal plane), lower eruption space-Xi (LES-Xi point measured by a line drawn from the distal surface of the lower second molar to Rickett's Xi point), α-angle (made by joining the line extending through the long axis of lower third molar and the Gonion-Symphyseal plane), β-angle (angle made between the long axis of the lower second and third molars), γ-angle (angle made between the long axis of the lower second molar and mandibular plane), Go-angle (angle made between the ramal and mandibular planes), space width ratios-R1 (ratio between LES-R and MDW) and R2 (ratio between LES-Xi and MDW) as shown in Figure 1. [3,4,2] The descriptive statistics (mean and standard deviation) were obtained for the aforementioned variables. The data thus obtained were analyzed using SPSS software version 11.5 (IBM, USA) for windows and comparison of the mean values among all the study groups, genders and sides was carried out using unpaired Student's t-test and the difference of the mean values of the two observers was calculated using paired Student's t-test. RESULTS The selected nine variables were determined and measured by two observers independently and the values of each variable were recorded and statistically analyzed for the mean values, t-test and probability chance (P value). No significant difference was found between the values of both the observers. The mean and standard deviation of each variable in all the study groups is given in Table 1. A gradual increase was observed in the mean values of MDW, whereas a gradual decrease was observed in the mean values of LES-R, LES-Xi, R1 and R2 when compared among Groups A, B, and C. The mean value of α-angle in Group C was found to smaller than those of Group A and B. β-angle showed a marked increase in values for Group B and C when compared with that of Group A. Table 2 shows the comparison of mean variables between all the study groups. Statistically significant Table 3. The early prediction can be performed in case of partially developed mandibular third molar, i.e., for Group D. The values of measured variables in the Group D in this study population were closely related to those of Group B (partially erupted group) as the difference in mean values of all variables was statistically nonsignificant except that for α-angle as depicted in Table 2. DISCUSSION Previous studies have attempted to predict the probability of third molar eruption using dissected skulls and lateral cephalometric radiographs. Several studies have demonstrated that panoramic radiographs can give comparable measurements as that of lateral skull radiographs. However, the left and right sides can be measured separately in panoramic radiographs without any superimposition which is not possible with conventional cephalograms. Digital technology further offers accurate viewing with numerous image adjustment capabilities that can be used to enhance the radiographic image. [2] In the overview of the superiority, this study was carried out on digital orthopantomogram. The results were analzsed and compared for all linear and angular measurements on both the sides and the genders recorded by two observers. In this study, mandibular third molars were found to be wider in partially or not erupted groups than the fully erupted group since the increase in MDW of mandibular third molar results in reduced chances of the eruption. [5,6] A gradual decrease in the values of LES-R was observed in partially erupted and not erupted groups than the fully erupted group. This could be attributed to the fact that the shortage of space between the second molar and the ramus has long been identified as a major factor in the etiology of lower third molar impaction. [3,2] Rickett's point (Xi) represents the center of the ramus and is considered as a physiologic center of occlusion that can be accurately determined. Moreover, it is a stable landmark during mandibular growth. [7,8] For these reasons, its superiority has been suggested for LES analysis over that measured from the anterior border of the ramus, since the anterior border of the ramus could be resorbed during mandibular growth as one mechanism for retromolar space development. [7][8][9] Furthermore, a gradual decrease in the values of LES-Xi was observed in partially erupted and not erupted groups than the fully erupted group as with shortage of space between the second molar and the center of ramus, the chances of impaction increase. [10] A marked decrease was observed in the values of α-angle in not erupted group when compared with that of fully erupted group since with more acute angulation of mandibular third molar, the chances of eruption decreases. On the contrary, the mean value of α-angle in partially erupted group was found to be higher than that of the fully erupted group because teeth with more α-angle, i.e., vertical impactions or teeth with more distal angulations are more commonly found partially erupted in the oral cavity, whereas the teeth with lesser α-angle like mesio-angular impactions are more commonly found completely impacted. [11,12] The β-angle showed a marked increase in values for the partially and not erupted groups when compared with that of the fully erupted group. This difference could be related to the fact that mandibular third molars which are not upright but have mesial angulations are not able to completely erupt into the oral cavity but remain either partially erupted or completely impacted. Variables MDW (mm) LES-R (mm) LES-Xi (mm) α-angle (°) β-angle (°) γ-angle (°) Go-angle (°) R1 (ratio) R2 (ratio) In this study, γ-angle and Go-angle showed a least variation for the mandibular third molar in all the study groups. It was suggested that the favorable erupting path of lower third molars cannot be predicted from either γ-angle or Go-angle alone. [6,13] A significant decrease was observed in the values of R1 and R2 in partially erupted, and the not erupted groups than the fully erupted group since decreased LESs (LES-R and LES-Xi) leads to increased degree of impaction. [2,14] The mean values of MDW, LES-R, LES-Xi, and β-angle were found more in males than in females; but in other variables, no such differences were found in genders. No change exists between the left and right of the jaws in the eruption/ impaction of the mandibular third molar. [12,15] CONCLUSION LES measurements, αand β-angle are considered to be highly accurate indicators in assessing the lower third molar eruption/impaction. Among these variables, LES-Xi is the most reliable indicator for predicting the status of mandibular third molar in the partially developed group, since it is a stable point during mandibular growth. For predicting mandibular third molar eruption/impaction, one should not rely only on any one or two variables; all the variables have to be taken into consideration. It is recommended to conduct a longitudinal study to assess the validity of this method. Financial support and sponsorship Nil. Conflicts of interest There are no conflicts of interest. Factors associated with falls in hemodialysis patients: a case-control study Objective: to identify possible associations between a higher probability of falls among hemodialysis patients and laboratory values, comorbidities, pharmacological treatment, hemodynamic changes, dialysis results and stabilometric alterations. Method: this was a retrospective case-control study with hemodialysis patients. Patients in a hemodialysis unit who had suffered one or more falls were included in the case group. Patients from the same unit who had not suffered falls were the controls. Data were gathered from the patients’ clinical history and also from the results of a balance test conducted six months before the study. Results: thirty-one patients were included (10 cases and 21 controls). Intradialytic body weight change was significantly greater among cases (p <0.05). Patients in the case group also presented greater lateral instability after dialysis (p <0.05). Other factors such as high blood pressure, antihypertensives, beta-blockers, and lower heart rates were also associated with falls. Conclusion: a greater intradialytic weight change was associated with an increase in risk of falls. Nursing staff can control these factors to |
prevent the incidence of falls in dialysis patients. Introduction Moderate to severe Chronic Kidney Disease (CKD) (stages 3-5) affects 6.8%-9.5% of the population (1) and involves the accumulation of waste substances such as uremic toxins, which cannot be eliminated due to impaired renal function. In Latin America the prevalence of patients treated with hemodialysis (HD) is 451 per million inhabitants (2) . In these circumstances, patients must undergo dialysis several times a week, with the aim of eliminating uremic toxins and excess fluids, as well as rebalancing the concentrations of ions and other substances, which affect the body's homeostasis. These biochemical alterations affect the functioning of organs and systems related to balance; in fact, hyponatremia, which affects 6%-29% of patients receiving HD (3) , has been associated with an increased risk of falls. The excess liquid that must be extracted from patients varies depending on the weight gain that they experience in the interdialytic period and the difference between their calculated optimum weight or dry weight, which is defined as weight when there is no fluid excess or deficiency, without the presence of detectable peripheral edemas, with normal blood pressure, and with no postural hypotension. The excess volume is removed during dialysis, which lasts about 4 hours. The higher the weight gain, the higher the ultrafiltration rate required, resulting in an increased risk of hypotension during dialysis or postHD orthostatic hypotension (4)(5) , both situations associated with greater morbidity and mortality in patients receiving HD (6)(7) . Therefore, HD produces hemodynamic changes and acute homeostasis, affecting postural control. Previous studies have observed that, after HD sessions, patients suffer changes in postural control (8)(9) . Likewise, severe CKD, even when treated by HD, results in the progressive deterioration of structures involved in balance. One example is HD-related amyloidosis (10) , which affects joints such as the hip, which plays an important role in postural control in older adults (11) . In addition, patients treated with HD usually have other comorbidities, which require treatment and in many cases lead to the polymedication of HD patients, which poses a greater risk of falls (12) . Consequently, numerous factors may place HD patients' postural control at risk. Preventing falls in HD patients is essential, because the consequences in terms of quality of life, associated morbidity and reduction in life expectancy are very important (13)(14) . The nursing staff in charge of our dialysis unit is responsible for connecting, supervising and disconnecting the dialyzed patient. In these processes, clinical situations can occur, which are already contemplated by protocols, given that greater postural instability is observed after the sessions. In turn, other subclinical situations possibly related to the factors already mentioned continue to pose a risk, which keeps the incidence of falls high among our patients, at levels similar to those observed in prevalence studies, in which the incidence was between 1-1.6 falls per patient-year (15)(16) . The aim of this study was to identify possible associations between a higher probability of falls among hemodialysis patients and the laboratory values, comorbidities, pharmacological treatment, hemodynamic changes, dialysis results and stabilometric alterations. Study design This was a retrospective case-control study with a ratio of 1 case/2 controls, with hemodialysis patients. The STROBE (Strengthening the Reporting of Observational Studies in Epidemiology) guide for observational studies was followed, as recommended by the EQUATOR network. Study location and period The study was conducted in the hemodialysis unit of the Infanta Leonor University Hospital (HUIL), in Madrid (Spain), between January and October 2019. Participants The study was conducted with 31 patients: 10 cases Patients in the hemodialysis unit who had suffered one or more falls in the last 6 months and who reported this in the questionnaires administered monthly by the nursing staff were considered cases (n=10). Thus, the participants were unaware that the event "fall" was what categorized them as cases in the study. The controls (n=21) were patients from the same unit who did not report falls during the study period and they were also blind to this criterion. The nurses who had collected the data relative to falls were also unaware of this study. Data collection After the cases were recruited, the researchers obtained by the dialyzer were analyzed. We also evaluated a balance study conducted 6 months earlier in these same patients, using an AMTI AccuGait force platform, previously validated by other study (17) . In this study, each patient underwent a stabilometry test before (preHD) and immediately after (postHD) the same dialysis session. Variables The researchers gathered the following information regarding the general characteristics of the patients: age, sex, body mass index (BMI) and years in renal replacement therapy. Kt/v is Kt divided by the volume (v) of urea distribution. All these factors were continuous quantitative variables. Hemodynamic variables collected before and after HD were also analyzed. The following were recorded: 1) systolic blood pressure (SBP), diastolic blood pressure (DBP) and pulse pressure; 2) heart rate; 3) dry weight, preHD weight and postHD weight. Changes and differences between preHD and postHD variables were calculated. All these factors were continuous quantitative variables. The stabilometry variables studied as factors were extracted from a stabilometry study conducted with hemodialized patients 6 months prior to this study and all the patients that composed this sample were included. In this stabilometry study, the balance of patients was tested before and after HD, following the same protocol for all patients, which had been used previously in a similar study (18) . The tests were carried out by two people trained to handle the platform in an office prepared for this purpose, where the lighting conditions were the same throughout the day. The variables analyzed were: 1) average displacement range of the center of pressure (CoP) on the Y axis (Y range) and X axis (X range) measured in cm (centimeter); 2) maximum and average velocity (Vymax, Vxmax and Vavg) of these movements measured in cm/s (centimeter/second); and 3) the area that included the displacement of the CoP with 95% confidence (Area95) measured cm 2 (square centimeters). All these factors were continuous quantitative variables. Data processing and analysis After the database was built, it was cleansed. The Ethical aspects This study was approved by the Ethics Committee Results A total of 31 patients, 19 (61.3%) men and 12 (38.7%) women, participated in the study. No significant gender differences were found among the cases (6 men and 4 Rev. Latino-Am. Enfermagem 2021;29:e3505. women) and the controls (13 men and 8 women). Table 1 shows the differences between cases and controls in terms of age, BMI, years treated with HD, laboratory variables, comorbidities and polymedication status. Participants in the case group were 10 times less likely to be hypertensive than the control group (OR= 0.105, 95%CI=0.02-0.71). A significant difference was observed between mean levels of beta-2 microglobulin between cases and controls, with a 95% confidence level, the mean levels of cases were 0.09-9.39 higher than controls (95%CI=0.09-9.39). Perez-Gurbindo I, Alvarez-Mendez AM, Perez-Garcia R, Arribas-Cobo P, Angulo-Carrere MT. weight recorded by the nursing team before and after dialysis. Table 3 presents the results. We analyzed the distribution of HD variables as recorded by the dialysis machine, in addition to the hemodynamic values of blood pressure, heart rate and The cut-off point was set at 1.1 kg, 1.9 kg and 2.7 kg, which resulted in a sensitivity of 100%, 70% and 40%, respectively and a specificity of 28.6%, 66.7% and 95.2%, respectively. The Youden index (J=0.367) indicated that the point that determined the highest sensitivity and specificity together was 1.9 kg. Table 4 presents the means of cases and controls in terms of the variables obtained in the balance test, performed before and after the same dialysis session. This group of variables did not present a normal distribution (K-S p<0.05), so the Mann-Whitney U test was used to assess whether there were significant differences between cases and controls. Based on the other results of this study, patients receiving dialysis who fall also had significantly lower heart rates after HD than the controls. Physiologically, heart rate is supposed to increase when volemia decreases. If this does not occur, brain perfusion may be affected. The decrease in cardiac stimulus may be due to patients' medication and in fact, this study found that patients receiving HD and who fall are more often treated with beta-blockers, which is consistent with the fact that these drugs are included into the group of those that increase the risk of falls (24) . However, the association between postHD heart rate and beta-blocker treatment was not statistically significant, so this hypothesis was ruled out. It seems likely that patients with a limited chronotropic response due to intrinsic or extrinsic causes are at greater risk of falls when undergoing HD. As for the other drugs analyzed here, all belonging to the group of medications that increase the risk of falls, it was observed that patients who fell took antihypertensives more frequently than those in the control group. These findings are based on the association between lower preHD blood pressure values and increased risk of hypotension (25) and falls (26) . Regarding laboratory values, dialysis patients with a history of falls had higher levels of beta-2 microglobulin. Increased levels of this protein are due to the passing of time in renal replacement therapy: after 15 years receiving HD, about 80% of patients present with dialysis-related amyloidosis (10) , which can affect structures related to The controls presented significant differences (p<0.05) in the PreHD and PostHD data for all the stabilometric variables, except for V x max. In contrast, the differences related to HD among the cases were not significant (p>0.05) for any of the variables. Discussion This case-control study describes is the first of its kind to describe intradialytic weight change as a factor associated with falls in dialysis patients. The study showed that patients in HD who suffer from falls have greater intradialytic weight changes. When patients arrive at the HD session, they are weighed by the nursing staff, who determine if there is excess weight relative to their reference weight or dry weight. The greater the weight difference, the greater the volume of liquid that should be removed. This usually occurs in patients who do not have good adherence to treatment or dietary guidelines (20) . The session lasts an average of 4 hours, so to remove a greater volume, a higher ultrafiltration rate must be used, which can generate a greater risk of intradialytic hypotension (21) and orthostatic hypotension (22) . Previous studies have related these events with falls, and this study directly demonstrated that intradialytic weight change is a factor related to the risk of falls. Falls are factors of poor prognosis in patients who receive dialysis (14) and after observing an incidence of falls of 32%, similar to the 37% described in a recent study (23) , it would be interesting to analyze the ability to prevent falls in Perez-Gurbindo I, Alvarez-Mendez AM, Perez-Garcia R, Arribas-Cobo P, Angulo-Carrere MT. motor ability such as joints or the central nervous system. (29) . After dialysis, both cases and controls experienced an increase in the ranges, speeds and area of displacement of the CP, indicating the acute effect of HD on postural balance. This effect of HD was consistent with the results of other study (9) and it used a similar methodology. Unlike another study (18) which observed an increase in postHD lateral range associated with a higher risk of falls, in our study, we found no significant differences between Limitations of this study include mainly its retrospective methodology. The time between assessments and the fall that defined the cases varied within the 6-month period considered in this study. Furthermore, the fall that defined a case was always outside the hospital and in the period between sessions, but the circumstances and the exact time of the falls were not taken into account. Conclusion This case-control study identified some factors change. Furthermore, the cases also presented lateral instability and a lower heart rate at the end of dialysis than the controls. Regulation of Protein Kinase C (cid:109) by Basic Peptides and Heparin PUTATIVE ROLE OF AN ACIDIC DOMAIN IN THE ACTIVATION OF THE KINASE* Protein kinase C (cid:109) is a novel member of the protein kinase C (PKC) family that differs from the other isoen- |
zymes in structural and enzymatic properties. No substrate proteins of PKC (cid:109) have been identified as yet. Moreover, the regulation of PKC (cid:109) activity remains ob-scure, since a structural region corresponding to the pseudosubstrate domains of other PKC isoenzymes has not been found for PKC (cid:109) . Here we show that aldolase is phosphorylated by PKC (cid:109) in vitro . Phosphorylation of aldolase and of two substrate peptides by PKC (cid:109) is inhibited by various proteins and peptides, including typical PKC substrates such as histone H1, myelin basic protein, and p53. This inhibitory activity seems to depend on clusters of basic amino acids in the protein/peptide structures. More-over, in contrast to other PKC isoenzymes PKC (cid:109) is activated by heparin and dextran sulfate. Maximal activa- tion by heparin is about twice and that by dextran sulfate four times as effective as maximal activation by phosphatidylserine plus 12- O -tetradecanoylphorbol-13-acetate, the conventional activators of c- and nPKC isoforms.Wepostulate that PKC (cid:109) contains an acidic domain, which is involved in the formation and stabilization of an active state and which, in the inactive enzyme, is blocked by Protein kinase C (PKC) 1 is a serine/threonine protein kinase that is phospholipid-dependent and activated by diacylglycerol and the phorbol ester TPA (1)(2)(3). In this respect, PKC behaves similarly as most PKC isoenzymes (cPKCs and nPKCs, for reviews see Refs. 4 and 5) of the PKC family. However, PKC differs in some structural and enzymatic features from the other PKC isotypes known so far (1)(2)(3)6), indicating that it may represent a novel subfamily of PKC. Thus, the two cysteine-rich domains, which serve as binding sites for cofactors and activators, are much further apart in PKC than in all the other PKCs and in contrast to the other PKC isoenzymes, PKC contains a pleckstrin homology domain and lacks a region corresponding to pseudosubstrate regions of the PKC family members. Moreover, PKC is not inhibited by a PKCspecific inhibitor (7) and is not down-regulated upon prolonged TPA treatment of murine keratinocytes and epidermis (8). As yet, no substrate proteins of PKC have been found (3,9), neither in vivo nor in vitro, even though numerous proteins are known that are phosphorylated by the other PKC isoenzymes. Recently, Sidorenko et al. (10) claimed that the tyrosine kinase Syk and the phospholipase C␥1 were substrates of PKC. However, incorporation of phosphate into these proteins was lower than into myelin basic protein, which was shown by us and others to be an extremely poor substrate of PKC (3,9). As PKC substrates are not known so far, the function of PKC in cellular signaling is for the most part obscure. Very recently, data were presented suggesting that PKC is located at the Golgi apparatus and is involved in basal transport processes (11). Moreover, it was suggested that PKC regulates lymphocyte signaling (10). Here, we report on a possibly differential regulation of the kinase activities of PKC and other PKC isoenzymes. In contrast to other PKCs, PKC is inhibited by various proteins and peptides, most likely due to clusters of basic residues in their structure, and is activated by heparin and dextran sulfate. Based on these results, the putative role of an acidic domain in the activation of PKC is discussed. Other materials were bought from companies as indicated: [␥-32 P]ATP (specific activity, 5000 Ci/mmol), Hartman Analytic (Braunschweig, Germany); aldolase, Boehringer (Mannheim, Germany); heparin, phosphatidylserine (PS), protamine sulfate, dextran sulfate, histone H1 (III-S), myelin basic protein, poly-L-lysine (M r 15,000 -60,000), poly-L-lysine (M r 1,000 -4,000) poly-L-arginine (M r 15,000 -60,000), Llysine, histamine, quinine, Sigma (Munich, Germany). Materials Recombinant PKC-Sf 158 cells were infected with recombinant PKC baculovirus, and cell extracts were prepared and used as source for PKC as described previously (3,7). Protein Kinase C Assay-Phosphorylation reactions were carried out in a total volume of 100 l containing buffer I (50 mM Tris-HCl, pH 7.5, 10 mM -mercaptoethanol), 4 mM MgCl 2 , 5 l of a Sf 158 cell extract containing recombinant PKC, 35 M ATP containing 1 Ci of [␥-32 P]ATP and 5 g of syntide 2 or -peptide 1 as substrates. PS, TPA, heparin, Gö6976, Gö6983, or various other compounds (see Table I) were added at concentrations indicated in the legends of the figures and Table I. After incubation for 7 min at 30°C, the reaction was terminated by transferring 50 l of the assay mixture onto a 20-mm square piece of phosphocellulose paper (Whatman p81), which was washed three times in deionized water and twice in acetone. The radioactivity on each paper was determined by liquid scintillation counting. Phosphate incorporated into the substrate peptide was obtained by subtracting values determined in the absence of kinase. Autophosphorylation and Phosphorylation of Aldolase or Histone H1-These phosphorylations were carried out essentially as described for the protein kinase C assay. However, no substrate was added for the autophosphorylation, and for the phosphorylation of aldolase or histone H1, these proteins instead of the substrate peptides were added, at the concentrations indicated in the text. The assay contained 7 Ci of [␥-32 P]ATP. Proteins of the reaction mixture were separated by SDSpolyacrylamide gel electrophoresis and visualized by autoradiography. RESULTS AND DISCUSSION No substrate protein of PKC, neither in vitro nor in vivo, has been found so far. In accordance with previous reports (3,9), we observed that typical PKC substrates, such as histone H1, myelin basic protein, and protamine sulfate, were phosphorylated very weakly by PKC and, therefore, cannot be considered as PKC substrates. Recently, the tyrosine kinase Syk and the phospholipase C␥1 were claimed to be substrates of PKC. However, phosphorylation by PKC in vitro of these proteins was even weaker than that of myelin basic protein (10). Here we show that aldolase can serve as a substrate for PKC in vitro. Aldolase was phosphorylated by PKC much more effectively than histone H1 (Fig. 1). To our surprise, when aldolase (5 g) and histone (5 or 10 g) were both present in the kinase assay, histone H1 suppressed the phosphorylation of aldolase almost completely and also autophosphorylation of PKC was inhibited ( Fig. 1). To determine the dose dependence of the inhibitory effect of histone H1 on PKC, we used syntide 2 as well as a novel synthetic peptide that we termed -peptide 1 as substrates for PKC. The -peptide 1 with the amino acid sequence RKRYS-VDKTLSHPWL, corresponding to the sequence 825-839 of human PKC, proved to be a potent PKC substrate. It incorporated around 30% more phosphate than syntide 2 on phosphorylation with PKC. 2 Phosphorylation of syntide 2 and -peptide 1 by PKC was inhibited by histone H1 depending on the concentration of the inhibitor (Fig. 2). Half-maximal inhibition was reached with 0.2-0.3 g of histone H1/100 l (IC 50 ). To prove the hypothesis that the basic properties of histone H1 were responsible for the suppression of PKC activity, we tested various proteins and peptides containing basic regions and other basic compounds (5 g/100 l each) for their inhibitory capacity (Table I). All proteins tested suppressed the PKC-catalyzed phosphorylation, with the exception of the elongation factor EF-1␣. Protamine sulfate and histone H1 were most effective in this respect, followed by myelin basic protein and the human tumor suppressor protein p53. The p53-peptide with the amino acid sequence SHLKSKKGQS-TSRHKK, corresponding to sequence 367-382 of human p53, was similarly active as the p53 protein. Peptides derived from proteins, basic peptides, and other basic compounds Incorporation of phosphate into syntide 2 by PKC was determined by applying the kinase assay as described under "Experimental Procedures." Mutated amino acids in the Ser-pseudosubstrates 1 and 2 are in bold. The elongation factor EF-1␣ was purified from porcine spleen as described previously (12). Compound (5 g Poly-L-arginine, M r 15,000-60,000 90 Poly-L-lysine, M r 15,000-60,000 76 Poly-L-lysine, M r 1,000-4,000 64 L-Lysine, histamine, quinine (free base) 0 the pseudosubstrate domain of PKC (IYRRGSRRWRKL) and (RKRQRSMRRRVH), which contain serine instead of alanine and therefore serve as substrates for several PKC isoenzymes, were also found to effectively inhibit PKC. However, the respective peptide derived from the pseudosubstrate of PKC␦ (MNRRGSIKQAKI) as well as the -peptide 2 (GVRRRRL), corresponding to the amino acid sequence 198 -204 of human PKC, did not show such an inhibitory effect. A major difference between the two peptides and the inhibitory peptides (-peptide, -peptide, myristoylated alanine-rich protein kinase C substrate-peptide, and p53-peptide) exists in the total number and clustering of basic amino acids (Arg/Lys). The ␦-peptide and the -peptide 2 contain four basic amino acids and one cluster of two or four basic amino acids, respectively, whereas the inhibitory peptides have at least six basic amino acids arranged in two or three clusters. The myristoylated alanine-rich protein kinase C substrate-peptide (KKKKKRFS-FKKSFKLSGFSFKKSK) with 12 basic residues and three clusters was the most effective inhibitor peptide. Thus, a peptide might require a minimal positive net charge and/or specific clusters of basic amino acids to be able to inhibit PKC. In fact, an exchange of one or two basic amino acids in the -peptide for neutral residues resulting in -peptide-1 (IYRRGSIRWRKL) and -peptide-2 (IYRRGSIRWAKL) caused a gradual loss of inhibitory activity (Table I). -peptide-2 has a similar arrangement of basic amino acids as the ␦-peptide. EF-1␣ protein, which does not contain any cluster of basic amino acids even though it is basic (pI ϭ 9), did not inhibit PKC thus further supporting our notion. The strongly basic polypeptides poly-Larginine and poly-L-lysine (molecular weights of 15-60 kDa), and even the smaller poly-L-lysine (molecular mass of 1-4 kDa) inhibited PKC effectively. L-Lysine and other basic low mo-lecular weight compounds, such as histamine and quinine, were on the other hand unable to inhibit PKC activity. This indicates that structural features, such as the above mentioned clusters of basic amino acids, rather than a positive net charge, determine the suitability of a compound to act as PKC inhibitor, thus pointing to some specificity of the interaction with the kinase. Most of the proteins and peptides inhibiting PKC are substrates rather than inhibitors of the other PKC isoenzymes, and some of them, such as protamine and poly-L-arginine, have been found to activate other PKC isoenzymes (13). On the other hand, none of the inhibitory proteins and peptides was significantly phosphorylated by PKC. Thus, inhibition of PKC was not likely to be due to a competition of the inhibitory compound with the substrate syntide 2 for ATP. Inhibition was not reduced by increasing substrate concentrations, as demonstrated in Fig. 3 for the inhibition by protamine sulfate of syntide 2 phosphorylation by PKC. For comparative purposes, Fig. 3 shows also the inhibition of PKC␦ by the pseudosubstrate peptide. In this case, inhibition decreased upon increasing the concentration of the substrate syntide 2. This clearly demonstrates that the PKC-inhibiting peptides do not act like the well known pseudosubstrate peptides that inhibit other PKC isoenzymes by competing with the PKC substrate for its binding site (14). Therefore, we postulate that PKC contains an acidic domain, different from the acidic substrate-binding motif of other PKCs (see Ref. 15), which is involved in enzyme activation or stabilization of the active state of the kinase. In the active state PKC is inhibited by proteins and peptides containing clusters of basic residues probably due to an interaction with this "activating" domain. In the inactive state the acidic domain might not be accessible, due to an interaction with an autoregulatory basic domain of the enzyme. Indeed, PKC exhibits a highly acidic domain (amino acid sequence 336 -391 of human PKC) in the regulatory part close to the C terminus of the cysteine-rich regions. This domain contains 40% acidic and just 2% basic residues and, in a smaller region (342-362), even 48% acidic residues. It is intriguing that the other PKC isoenzymes lack a comparable domain. Our hypothesis would imply that polyanions are able to break up the autoinhibitory interaction between the acidic and the basic domain. In fact, the highly sulfated polysaccharides heparin and dextran sulfate were found to function as potent activators of PKC. Maximal activation of PKC by heparin alone, i.e. in the absence of any other cofactor, was about twice and that by dextran sulfate four times as effective as maximal activation by PS/TPA (Fig. 4). Dextran sulfate contains more sulfate groups than heparin and is, therefore probably, more active than heparin in stimulating PKC. Application of |
PS/ TPA together with heparin or dextran sulfate did not further increase the activity of PKC. Activation of PKC by heparin or dextran sulfate was saturable at low concentrations (Fig. 5). The K a values for heparin and dextran sulfate, as determined by a Lineweaver-Burk plot, were approximately 0.36 and 0.05 M (based on an average molecular weight of 20,000 and 500,000, respectively, as given by the supplier). Thus, heparin and dextran sulfate are very effective activators as compared for instance with diacylglycerol (e.g. the K a value of dioctanoylglycerol for PKC␦ is 10 M, see Ref. 16). As shown in Fig. 6, A and B, the maximal velocities (V max ) of the heparin-and dextran sulfate-activated syntide 2 phosphorylations (23.3 pmol/ min and 41.7 pmol/min, respectively) were much higher than that of the PS/TPA-activated phosphorylation (9.5 pmol/min). On the other hand, the affinity of the enzyme for the substrate was rather lower upon activation with the two polyanions (same K m for both: 9.5) than with PS/TPA (K m : 4.8 M). Thus, the much more effective incorporation of phosphate into syntide 2 by the polyanion-activated PKC than by the PS/TPAactivated kinase is due to an increase in the maximal velocity of the phosphorylation reaction. As the mechanisms of action of heparin and dextran sulfate are likely to be identical, we will in the following just deal with heparin. Autophosphorylation of PKC was also more efficiently stimulated by heparin alone than by PS/TPA (Fig. 7). Both, heparin-and PS/TPA-activated (7) autophosphorylation could be strongly suppressed by 1 M of the PKC inhibitor Gö6976, but not at all by 1 M of Gö6983, an effective inhibitor of the other PKC isoenzymes. These inhibitors are known to interact with the ATP binding site of PKC. TPA is generally thought to activate PKC by a conformational change that results from its binding to the zinc finger regions of the enzymes (4). As a consequence, an inhibitory pseudosubstrate domain is removed from the substrate binding site. Whether this mechanism can explain the activation by TPA/PS of PKC remains an open question, since a domain corresponding to the pseudosubstrate regions of other PKC isoenzymes has not been found in the PKC structure (7). This does not exclude, however, that upon identification of bona fide in vivo substrates of PKC, a specific pseudosubstrate sequence will be identified in the future. Within the PKC family the activation by heparin may, on the other hand, turn out to be a specific feature of PKC, since PKC␦ activity was not affected by heparin (data not shown) and a PKC preparation from rat brain (containing mainly PKC ␣, , ␥) was even inhibited by heparin (17). The latter result is in agreement with the finding that heparin might block smooth muscle cell proliferation by inhibition of PKC␣ (18). Several other protein kinases, such as casein kinase 1 and 2, nuclear kinases, the tyrosine kinase Syk, and G-protein-coupled receptor kinases are inhibited by heparin (17,19,20, and references in Ref. 17). On the other hand, activation by heparin was reported for instance for a RNAactivated protein kinase (21) and a Lyn-related tyrosine protein kinase (22). Activation of each of the two kinases by heparin was shown to occur through mechanisms different from those of other known activators of these kinases, thus resembling the activation of PKC by heparin. Moreover, many growth factors are known to bear specific heparin-binding sites that contain a cluster of basic amino acid residues (23,24). The activation by heparin or dextran sulfate of PKC appears to be rather specific, as other acidic compounds, such as chondroitin sulfate, cholesterol sulfate, double-stranded polyinosinic-polycytidylic acid, DNA (calf thymus), poly-L-aspartic acid, and poly-L-glutamic acid, did not or just very weakly activate PKC (data not shown). This supports the notion that heparin and dextran sulfate specifically break up the intramolecular interaction of basic residues with an acidic domain of PKC. The apparent specificity of the stimulatory effect may be taken as an indication for a physiological function of heparin or heparin-like compounds in the control of PKC activity. Heparin has been shown to affect various intracellular signaling pathways, including PKC-dependent pathways, and to be a potent proliferation inhibitor of several cell types (Refs. 25 and 26 and references therein). However, these effects are thought to be mediated by binding of heparin to cell surface binding sites or growth factors (23,24,27). Little is known about possibly direct actions of heparin on signaling pathways inside the cell. As heparin is synthesized in the Golgi complex and PKC has recently been shown to be localized there (11), a direct action of heparin on PKC in this cellular compartment is conceivable. Alternatively, heparin might mimic the effects of heparin-like factors in vivo. Such factors are produced, for instance, by endothelial and smooth muscle cells and are growth-inhibitory for these cells (28,29). Corneal Hydration Control in Fuchs' Endothelial Corneal Dystrophy Purpose To assess corneal hydration control across a range of severity of Fuchs' endothelial corneal dystrophy (FECD) by measuring the percent recovery per hour (PRPH) of central corneal thickness after swelling the cornea and to determine its association with corneal morphologic parameters. Methods Twenty-three corneas of 23 phakic FECD patients and 8 corneas of 8 healthy control participants devoid of guttae were graded (modified Krachmer scale). Effective endothelial cell density (ECDe) was determined from the area of guttae and local cell density in confocal microscopy images. Steady-state corneal thickness (CTss) and standardized central corneal backscatter were derived from Scheimpflug images. Corneal swelling was induced by wearing a low-oxygen transmissible contact lens for 2 hours in the morning. De-swelling was measured over 5 hours after lens removal or until corneal thickness returned to CTss. Percent recovery per hour was 100 × (1 – e−k), where k was determined from CT(t) = (de−kt) + CTss, and where d was the initial change from CTss. Results After contact lens wear, corneas swelled by 9% (95% CI 9–10). Percent recovery per hour was 49%/h (95% CI 41–57) in controls and 37%/h in advanced FECD (95% CI 29–43, P = 0.028). Low PRPH was associated with disease severity, low ECDe, and increased anterior and posterior corneal backscatter. Anterior backscatter was associated with PRPH in a multivariable model (R2 = 0.44). Conclusions Corneal hydration control is impaired in advanced FECD and is inversely related to anterior corneal backscatter. Anterior corneal backscatter might serve as an indicator of impaired endothelium in FECD. F uchs' endothelial corneal dystrophy (FECD) is characterized by the presence of endothelial guttae and corneal edema from progressive endothelial dysfunction. 1 Fuchs' endothelial corneal dystrophy has traditionally been considered to have nonedematous and edematous stages, 2 and this is still reflected in current clinical grading scales that assess progressive morphologic changes in guttae and the presence of clinically detectable edema only at the most advanced grade. 3,4 Nevertheless, studies of large cohorts of patients with FECD disclose that corneas are thicker than normal early in the course of the disease, 5,6 presumably from subclinical edema, which suggests that corneal endothelial function, whether pump or barrier or both, is compromised early in the course of the disease. This chronic state of edema may contribute to early optical and ultrastructural changes in FECD. 7,8 Corneal hydration control can be assessed by measuring the percent recovery per hour (PRPH) of corneal thickness after inducing corneal swelling, and barrier function of the endothelium to small molecules can be assessed by fluorophotometry. [9][10][11][12] Hypoxia causes corneal lactate accumulation, which produces an osmotic load leading to swelling; removal of lactate is therefore inherent to endothelial pump function and the PRPH measurement. 13 Assuming an intact epithelium, PRPH may serve as a valid measure of overall endothelial function. 11 Percent recovery per hour has been previously measured in FECD or after endothelial keratoplasty, [14][15][16] but disease severity was not characterized well by using recognized clinical grading systems, preventing a clear understanding of changes in hydration control with severity of the disease. In this study, we examined corneal hydration control expressed as PRPH after purposefully swelling the cornea across a range of severity of FECD and in normal corneas. Because this direct measurement of overall endothelial function is time-consuming and not practical in clinical settings, we also measured morphologic parameters of the same corneas at steady-state to assess their association with corneal hydration control. A simple noninvasive and objective measure of the cornea that reflects endothelial function would be ideal in clinical practice to evaluate the functional severity of the disease. Participants Participants of either sex and any race were recruited from the cornea service at Mayo Clinic (Rochester, MN, USA). All participants had FECD or were healthy volunteers older than 50 years. Exclusion criteria were ocular pathology except FECD (in the FECD group only) or cataract, any previous ocular surgery, current contact lens wear, administration of systemic or topical medications known to affect the cornea, or systemic iovs.arvojournals.org j ISSN: 1552-5783 diseases that could affect the cornea including diabetes. This study was reviewed and approved by the Institutional Review Board at Mayo Clinic; the research followed the tenets of the Declaration of Helsinki. Informed consent was obtained from the subjects after explanation of the nature and possible consequences of the study. Clinical Grading and Corneal Imaging at Steady-State Enrollment visits were scheduled on an afternoon when corneas were assumed to be at steady-state. Fuchs' endothelial corneal dystrophy was graded clinically by a trained observer (KW, KHB, or SVP) based on the area and confluence of guttae, and the presence of edema by using slit-lamp biomicroscopy. 3,4 Corneas without guttae were categorized as normal (grade 0). Corneas with 1 to 12 or 12 or more nonconfluent central guttae (grades 1 and 2) were considered to have mild FECD; corneas with confluent guttae of 1-to 2-mm and 2-to 5-mm diameter (grades 3 and 4) were considered to have moderate FECD; and corneas with more than 5-mm diameter of confluent guttae or any visible edema (grades 5 and 6) were considered to have advanced FECD. 17 The epithelium was intact and without bullae in all participants. Effective endothelial cell density (ECD e ) was determined by using confocal microscopy (Confoscan 4; Nidek Technologies, Freemont, CA, USA) with a widefield (320) noncontact objective. Images of the endothelium were analyzed by a standardized image-processing method that determined the area of guttae and local endothelial cell density. 18 Central corneal thickness was determined from tomographic images acquired by using a rotating Scheimpflug camera (Pentacam HR; Oculus, Lynnwood, WA, USA) as described previously. 17 Central corneal haze (backscatter) in the anterior 120 lm and posterior 60 lm of the cornea was also determined from Scheimpflug images. 7 All corneal backscatter measurements were standardized by adjusting corneal image brightness to that of a fixed scatter source to account for any fluctuations in the intensity of the light source and sensitivity of the detection system over time. 19,20 All Scheimpflug images were checked for data acquisition errors (Pentacam software version 1.20r29). Axial resolution of our instrument is 11.8 lm per pixel (range, 11.5-12.4 lm per pixel); because of the software's surface-fitting algorithm, axial resolution should be better than the resolution of one pixel. 17 Inducing Corneal Swelling Follow-up visits for measurement of corneal hydration control started at approximately 8:00 AM and Scheimpflug images were repeated before any intervention. A low-oxygen transmissible hydrogel contact lens (Polymacon; oxygen permeability, 7.9 3 10 À11 cm 2 /s mL O 2 /mL mm Hg; Westcon Contacts, Duluth, GA, USA) with thickness of 500 lm and diameter of 12 mm was placed on one eye and the eyelid was taped closed. The contact lens base curve was 8.0 mm or 8.2 mm depending on the patient's corneal curvature and clinical assessment of contact lens fit and centration. After 2 hours, the contact lens was removed and Scheimpflug images were immediately acquired. Scheimpflug photography was then repeated every 15 minutes for the next hour and every 30 minutes through 5 hours or until corneal thickness returned to corneal thickness within 5% of the thinner of the measurements at presumed steady-state or immediately before contact lens application (CT ss ). Participants were asked not to close their eyes for prolonged periods after contact lens removal. All measurements were taken in the same air-conditioned and humiditycontrolled environment. 21 Statistical Analysis Descriptive summary statistics were |
reported as mean 6 SD by severity of FECD. Regression models were used to calculate mean differences in steady-state characteristics between FECD groups adjusted for age and multiple comparisons by the Bonferroni method (Table). Recovery of corneal thickness was expected to follow an exponential curve 10 : where CT(t) was corneal thickness at time t after removing the contact lens, CT(0) was corneal thickness immediately after removing the contact lens, and k was a constant. Equation 1 was solved for k by regression for each patient. Percent recovery per hour was determined as follows: Time to 95% thickness recovery (T95%) was 15 For a global test of association between PRPH and swelling with severity of FECD in regression models, we used a likelihood ratio test and a test for trend across FECD groups (grade 0-6). Regression models were used to assess associations between PRPH and CT ss , swelling (difference between central corneal thickness immediately after contact lens removal and the thinner of the two measurements at steady-state or immediately before contact lens application), anterior and posterior steady-state backscatter, and ECD e with respective 95% confidence intervals (95% CI). Correlations were assessed with Spearman (q, ordinal) or Pearson (r, continuous) correlation coefficients. Differences were considered statistically significant if P < 0.05 (two-sided tests). Stepwise selection for regression models (removal if P ‡ 0.15, eligible for addition if P < 0.1) was used to identify predictors of PRPH among predefined factors, including CT ss , swelling, anterior and posterior backscatter (all continuous), and ECD e (binary, >1000 cells/ mm 2 vs <1000 cells/mm 2 ); predicted PRPH values were calculated for significant factors. Careful data and regression diagnostic were conducted to identify possible outliers, leverage, and influence. All statistics were calculated by using Stata version 13.1 (StataCorp, College Station, TX, USA). Participants Twenty-three corneas of 23 Caucasian participants with FECD and 8 corneas of 8 Caucasian participants with normal eyes were examined (Table). Age was 67 6 12 years (mean 6 SD) in the FECD group and 63 6 9 years (P ¼ 0.4) in the control group. In a multivariable analysis, only anterior backscatter (P ¼ 0.012) and corneal swelling (P ¼ 0.009) were independently associated with PRPH; R 2 for the multivariable model was 0.44. Predicted PRPH values for the identified range of anterior steady-state backscatter are provided in Figure 3 based on corneal swelling of 50 lm. DISCUSSION Corneal hydration control and thickness recovery after stressinduced corneal edema are reduced in advanced FECD compared with normal corneas. Anterior corneal backscatter, which is known to be increased early in the course of FECD, 7,8 is associated with overall endothelial function and should be further investigated for its ability to estimate endothelial function in clinical practice. Ideal control of corneal hydration requires a balance between passive barrier leakage into the cornea and active pump of solute back to the aqueous humor. 9,22 Alterations in corneal hydration can result from pump or barrier dysfunction and are known to adversely affect stromal transparency. 23 In this study, we found that corneal hydration control was impaired in clinically advanced FECD compared with normal and was associated with a delay in recovery of steady-state corneal thickness in FECD; we were unable to detect a significant difference in mild or moderate disease, although there were similar trends toward decreased PRPH. Percent recovery per hour in normal corneas (49%/h, 95% CI 41-57) was similar to that found in a previous study from our laboratory (48%/h; 95% CI 43-53) in normal, young noncontact-lens wearers. 9 Another study found lower PRPH (34%/h in normal corneas and 25%/h in FECD), 15 and these differences might be due to different experimental conditions and FECD severity. Nielsen et al. 16 found a similar amount of swelling in advanced FECD and normal corneas (approximately 44 lm or 7%); PRPH was not determined, but the percentage of swelling was significantly higher in advanced FECD compared with normal. In our study, we defined severity of FECD according to a morphologic grading scale, 3,4 which can be easily implemented in clinical practice. Nevertheless, this grading scale is subjective, which leads to interobserver variation, 6 and does not account for the presence of subclinical corneal edema that can be present even when morphologic changes are not sufficiently advanced. 6,24 We investigated the association between corneal hydration control and various morphologic parameters, including clinical grade and its objective morphological equivalent, ECD e , 18 corneal swelling, and corneal backscatter in an effort to provide the clinician with objective measures beyond the patient's subjective symptoms. Although all of these parameters were associated with PRPH in univariable analyses, only anterior corneal backscatter and induced swelling were associated with PRPH in a multivariable analysis. Notably, clinical grading and ECD e , which are known to be associated, 18 and CT ss , did not improve the prediction of PRPH. Because the range of normal corneal thickness is large, 25 measurements that fall within this range cannot discriminate well between normality and corneal edema, and thus it is not unexpected that corneal thickness did not improve the prediction of PRPH. Corneal thickness is still an important parameter in the evaluation of FECD, especially when measurements are thicker than the normal range, or when a change in corneal thickness can be documented. Determining PRPH by the method described in this study is time-consuming and not feasible in routine clinical practice. Therefore, one of the goals of this study was to determine if any objective and easily measured variables could be used as a surrogate for corneal hydration control. Anterior corneal backscatter was the only variable that was associated with PRPH and could be measured easily and noninvasively (Fig. 3). Anterior corneal backscatter in FECD originates from edema and ultrastructural tissue changes in the basal epithelium and anterior stroma. 7,8,26 Early improvement in backscatter after restoring endothelial function has been explained by resolution of corneal edema, 27,28 suggesting that anterior backscatter is a more sensitive indicator of subtle corneal edema than is clinical examination or pachymetry. Corneal backscatter is unrelated to corneal thickness in normal (nonedematous) corneas; by combining the steady-state data in this study with previously published data from our laboratory, 7 there was no association between central corneal thickness and standardized anterior backscatter in 23 normal eyes of subjects aged 50 years or older (r ¼ 0.1, P ¼ 0.6). In contrast, there was a weak association between central thickness and anterior backscatter in FECD (r ¼ 0.3, P ¼ 0.004; n ¼ 88), in which increased thickness can be attributed to corneal edema. Although there was overlap between central corneal thickness in FECD (range, 456-666 lm) and normal (range, 484-594 lm) eyes, anterior corneal backscatter greater than 2 SDs above the normal mean was present in 8 of 29 mild, 11 of 29 moderate, and 21 of 30 advanced FECD eyes, indicating the potential discriminative value of anterior backscatter. Although the presence of corneal edema can explain the association between anterior backscatter and PRPH, the relationship was not highly predictive (R 2 ¼ 0.44), possibly because a component of backscatter originates from chronic ultrastructural tissue changes and not from edema. 28 Because corneal hydration control reflects both barrier and pump function, permeability measures might improve sensitivity and prediction of true pump function. 9 The main limitation of this study was our inability to estimate activity of the endothelial pump independent from the endothelial barrier. The PRPH provides an estimate of the net activity of both activities and pump function and can be determined only if the barrier function, based on permeability of the endothelium to a small tracer such as fluorescein, is known. 9 Unfortunately, determination of endothelial permeability to fluorescein in FECD is challenging and estimates of the barrier function have differed by a factor of 4 between studies, which led to different conclusions regarding FECD. 29,30 These variations may be from unreliable measurement of fluorescein concentration in the stroma because of increased scattered light in these corneas. 7 Also, estimates of corneal volume from central corneal thickness may be unreliable because of the abnormal thickness profile in FECD, 17 although our thickness measurements based on the entire cornea profile measured by the Scheimpflug camera were likely more representative of the cornea than thickness measured at the center by ultrasonic pachymetry. For this study, we also assumed that the difference in recovery of induced edema was solely attributed to overall endothelial function 11 and not influenced by evaporation from the anterior corneal surface. The epithelium is considerably less permeable than the endothelium, and would likely not influence this measurement significantly. Also, the epithelium of all participants remained intact during the study and the environmental conditions were controlled, minimizing potential variations in any evaporative component. The small sample size of the moderate FECD group may have limited our ability to detect a difference in PRPH from normal. In summary, we found that corneal hydration control became impaired in advanced stages of FECD (based on morphologic grading), and that anterior corneal backscatter could provide an imperfect but notable estimate of endothelial function. Although morphologic grading is quick and simple in clinical practice, it was more helpful when penetrating keratoplasty was the procedure of choice for FECD because most surgeons waited for clinically detectable edema to be present before offering a transplant. With distinct advantages of endothelial over penetrating keratoplasty, and with knowledge that subclinical edema is present earlier in FECD, the threshold to offer a transplant has decreased. However, a simple method of estimating corneal endothelial function in these cases, in which classic biomicroscopy and pachymetric findings are not discriminatory, could help in deciding whether patients will benefit from intervention. Similarly, a simple estimate of endothelial function could be a prognostic indicator of the outcome of intraocular surgery in the setting of a compromised endothelium. Further investigation of anterior backscatter as a surrogate for endothelial function is worthwhile to better understand its role in clinical practice. Intravenous pamidronate versus oral and intravenous clodronate in bone metastatic breast cancer: a randomized, open-label, non-inferiority Phase III trial Purpose Patients with metastasized breast cancer often suffer from discomfort caused by metastatic bone disease. Thus, osteoprotection is an important part of therapy in breast cancer metastasized to bone, and bisphosphonates (BPs) are a major therapeutic option. In this study, our objectives were to compare the side effects of oral versus intravenous BP treatment and to assess their clinical effectiveness. Patients and methods In this prospective randomized, open-label, non-inferiority trial, we enrolled breast cancer patients with at least one bone metastasis and an Eastern Cooperative Oncology Group performance status of 0–2. Patients were randomly assigned to one of the three treatment groups: A, 60 mg pamidronate intravenously q3w; B-iv, 900 mg clodronate intravenously q3w; and B-o, 2,400 mg oral clodronate daily. Assessments were performed at baseline and every 3 months thereafter. Results Between 1995 and 1999, 321 patients with confirmed bone metastases from breast cancer were included in the study. At first follow-up, gastrointestinal (GI) tract side effects were most common, and adverse effects on the GI tract were more frequent in the oral treatment group (P=0.002 and P<0.001, respectively). There were no statistically significant differences among the treatment cohorts for other documented side effects (skin, serum electrolytes, urinary tract, immune system, and others). No significant differences in clinical effectiveness of BP treatment, as assessed by pain score, were detected among the groups; however, pathologic fractures were more effectively prevented by intravenous than oral BP administration (P=0.03). Noncompliance rates were similar among the study cohorts. Conclusion We conclude that oral BP treatment is significantly associated with higher rates of adverse GI side effects. Additionally, our data indicate that intravenous BP administration is more effective than oral treatment in prevention of pathologic fractures; hence, oral administration should be considered with caution. Introduction Breast cancer is the most common malignancy among women, with nearly 70,000 new cases in Germany every year. 1 Primary treatment options include surgery, chemotherapy, irradiation, and Her2/neu-targeted and endocrine therapies. Individual treatment depends on various factors, such as TNM status, tumor grade, and hormone receptor, and Her2/neu status, as well as the age of the patient. Approximately 10%-15% of all breast cancer patients develop early metastatic disease within 3 years 2 and .50% of patients with advanced breast cancer develop metastatic lesions |
of the bony matrix. 3 Of note, the survival of women with metastatic breast cancer exclusively in their bones is higher than that of patients with additional organs affected by metastases. 4,5 Patients with metastatic bone disease often suffer from a great deal of pain and functional disability. Eventually, severely debilitating consequences may occur, including pathologic fractures and spinal cord compression. 3,6 Metastatic cancer treatment is primarily aimed at improving the quality of life of patients, in terms of physical functioning and psychological well-being. In addition to various local and systemic therapies, including radiation and chemotherapeutics, the use of osteoprotective drugs has led to significant advances for patients. 7 Osteoprotective substances comprise osteoclast inhibitors, that is, bisphosphonates (BPs) and denosumab, a fully human monoclonal antibody. Although clinical trials have shown that denosumab is superior to BPs in the prevention of skeletal-related events, 8 BPs are still widely used. BPs are chemically related to inorganic pyrophosphate, and are preferentially adsorbed onto hydroxyapatite crystals in the extracellular matrix of bone. From the extracellular matrix, they are taken up by osteoclasts and induce apoptotic processes. 9,10 Parenterally infused BPs are completely bioavailable, independent of varying individual intestinal absorption rates. Currently, three generations of approved BPs are available, which differ in their aliphatic side chains. Non-nitrogen-containing BPs, for example, clodronate, belong to the first generation. Clodronate can be administered intravenously or orally. Intravenous administration is suitable for normalization of hypercalcemia and to reduce skeletal complications, but because of a requirement for long infusion times, it is not frequently used and clodronate is usually taken as an oral medication. 10 Pamidronate was the first of the second-generation aminobisphosphonates to be approved for treatment of hypercalcemia and osteolytic disease due to breast cancer and multiple myeloma. Pamidronate can only be administered intravenously. Due to its strong affinity for bone surface hydroxyapatite, pamidronate is more potent than clodronate. 10 By contrast, third-generation nitrogencontaining BPs, such as zoledronic acid and ibandronic acid, are substantially more effective than earlier compounds. While zoledronate, with its high potency, is currently the most commonly used BP, ibandronate is also frequently prescribed, since it is suitable for both intravenous and oral administration. 10 Despite the overall beneficial effects of osteoclast inhibitors, these therapies are not without untoward effects. 10,11 In this study, we aimed to assess the adverse effects and clinical value of two different classes of BPs, administered either intravenously or orally. Patients and methods study design and patients In this prospective randomized controlled trial, we enrolled patients according to the following eligibility criteria: $18 years of age, female sex, at least one radiologically confirmed bone metastasis from a histologically confirmed breast cancer, approximate life expectancy of $6 months, Eastern Cooperative Oncology Group (ECOG) performance status of 0-2, and willingness to give written informed consent. Exclusion criteria were treatment with BPs within 6 months before randomization, cerebral or liver metastases, hypercalcemia or hypercalciuria, tumors other than breast cancer, insulin-dependent diabetes mellitus, chronic heart failure or myocardial infarction within 6 months before randomization, and pregnancy. The present trial was approved by the University of Heidelberg Ethics Committee, and all patients gave written informed consent to participate in the study. Patients assigned to groups A, B-o, and B-iv received 60 mg of pamidronic acid intravenously every 3 weeks, 2,400 mg of clodronic acid orally daily, and 900 mg of clodronic acid intravenously every 3 weeks, respectively. 12,13 The planned duration of treatment was 24 months ( Figure 1). Study assessments were made at baseline and subsequently every 3 months for at least three follow-up visits, while fractures were documented throughout the follow-up period. Baseline assessment included a full medical history, details of previous breast cancer diagnosis and treatment, pain scoring (visual analog scale), hormone receptor status, distribution of metastatic disease, and laboratory results, including full-blood count and biochemistry (hemoglobin, hematocrit, red blood cell count, white blood cell count, platelets, gammaoxalacetic transaminase, gamma-pyruvic transaminase, gamma-glutamic transpeptidase, alkaline phosphatase, sodium, potassium, calcium, creatinine, lactate dehydrogenase, uric acid, and urea). Subsequent 3-monthly assessments included medical check-up, ECOG status, pain scoring, progression of breast cancer, medication, laboratory results OncoTargets and Therapy 2016:9 submit your manuscript | www.dovepress.com 4175 Bisphosphonates in metastatic breast cancer (as described earlier), adverse effects (in terms of quality, quantity, and time of incidence), and patient compliance (attendance at appointment for intravenous BP administration or patient confirmation of taking oral BP). Adverse effect records were evaluated three times. Dose modifications were made in each group for hypocalcemia (,2.2 mmol/L), and in cases of persistent hypocalcemia (,1.9 mmol/L) or hypercalcemia (.3 mmol/L), participants were withdrawn from the study protocol. statistical analyses Statistical analyses were performed using SAS version 9.1 (SAS Institute Inc., Cary, NC, USA). The primary aim of our study was to demonstrate that oral BP treatment is not inferior to intravenous BP therapy, with regard to side effects and patient compliance. As a secondary objective, we also examined the effectiveness of treatments according to the number of pathologic fractures and the development of pain. Statistical analysis of pain development was performed by calculating the difference between the number of patients with pain increase and those with pain decrease for each treatment group and comparing these differences using the chi-squared test. Differences between mean values were calculated using the Kruskal-Wallis test. To compare the number of side effects among the three study groups, the chi-squared test was employed. A Wilcoxon test was applied to compare effectiveness among the different treatment groups. A value of P,0.05 was considered to indicate a statistically significant difference, while a P-value of ,0.1 was considered to indicate a tendency toward difference. Patient characteristics Between 1995 and 1999, we enrolled 392 patients with confirmed bone metastases from breast cancer to our study, of whom 375 were randomly allocated to one of the three treatment groups (group A, 129 patients; group B-iv, 120 patients; group B-o, 126 patients). For various reasons, 20, 15, and 19 patients from groups A, B-iv, and B-o, respectively, were excluded from the study. Finally, 109 patients were allocated to receive pamidronate intravenously (group A), 105 patients received intravenous clodronate (group B-iv), and 107 patients took oral clodronate (group B-o) (Figure 1). Follow-up was planned to continue for 24 months. The average follow-up achieved was 15.6 months (standard The baseline characteristics of patients (age, BMI, tumor stage, and hormone, receptor, and menopausal statuses) were also similar among the cohorts, as were initial tumor stages (T and N status; Table 1). Patient compliance A total of 50 out of 321 patients (15.6%) were noncompliant during BP treatment, with no significant difference among the three study groups (A =11.9%, B-iv =15.2%, adverse effects of BPs Side effects occurring during BP treatment were categorized as those of the skin, gastrointestinal (GI) tract, serum electrolytes, urinary tract, or immune system. Adverse events that could not be allocated to one of these groups (eg, cough, depression, vertigo, headache) were summarized as "other side effects". Results are presented in Table 2. Documented cutaneous side effects were exanthema, rash, or necrosis due to extravasation. Nine events were relatively evenly distributed among the study groups (P=0.682) at first follow-up, while no skin side effects were noted at subsequent follow-up visits. GI tract-associated side effects, including nausea, vomiting, heartburn, abdominal cramps/pain, and diarrhea, were the most common adverse effects experienced by participants in this study. In total, 40 patients were affected by GI tract side effects at first follow-up, with significantly more adverse effects occurring in the oral treatment group (P=0.002; Figure 2). The significance of this finding was even more evident when oral BP treatment (group B-o) was compared with all intravenous administration (ie, groups A and B-iv together). The occurrence of GI effects diminished markedly at subsequent follow-up visits, with no significant differences among the study cohorts ( Table 2). With BP therapy, serum electrolyte analyses revealed only rare changes of calcium levels (hypocalcemia), independent of the type of treatment. Similarly, immune system effects were infrequent and mainly took the form of acutephase reactions (ie, flu-like symptoms, including subfebrile temperatures, bone pain, arthralgias, myalgias, and abnormal fatigue), and no significant differences were observed among the study groups. In addition, few renal function or "other side effects" were recorded, and these did not differ significantly among groups (Table 2). clinical effectiveness of BPs As a secondary aim, we examined the effectiveness of the three BP treatment regimens by comparing pain 4177 Bisphosphonates in metastatic breast cancer development and occurrence of pathologic fractures among the study groups. The results of this analysis are summarized in Table 3. Employing the visual analog scale, pain scores at baseline and final examinations were not significantly different among the trial cohorts (Table 3). Pain development was documented as pain increase, pain decrease, or stable pain between check-ups. Overall, there was a slight increase in pain scores over time, with no significant difference among the three groups (P=0.36; Figure 3). At baseline, 10.3% of all study patients had already presented with pathologic fractures (Table 3). At final check-up, the highest number of new pathologic fractures was recorded for group B-o with 19 incidents, compared to 15 for B-iv and Discussion Currently, BPs are routinely used for treatment of metastatic bone disease, secondary to breast cancer, to reduce pain and In terms of our primary objective (evaluation of BP-associated side effects), this large randomized prospective Phase III study did not demonstrate non-inferiority of daily oral clodronate, compared to intravenous infusions of clodronate or pamidronate every 3 weeks. GI side effects occurred significantly more frequently with oral clodronate, which is in line with previous reports demonstrating that intravenous pamidronate is an appropriate alternative for treatment of osteoporosis in cases with contraindications for, or intolerance to, oral BPs. 16 The recently published results of the ZICE trial, demonstrating a higher occurrence of adverse GI effects with oral ibandronate than with intravenous zoledronate in the treatment of bone metastatic breast cancer, are also consistent with our findings. 14 In the present study, nephrotoxic side effects 11,17 and the occurrence of hypocalcemia, 18,19 acute-phase reactions, and adverse cutaneous events were rare and occurred at similar frequencies in the three patient groups, thus precluding clear clinical conclusions. The secondary aim of our trial was assessment of the clinical efficacy of BP administered by oral versus intravenous routes, in terms of pain reduction and prevention of pathologic fractures. With regard to pain development, there was a shift to an increased pain score in category 3 (visual analog scale) over time, with no significant difference among the three groups studied. The numbers of patients with "no pain" or "pain score 1" remained unchanged in all groups. These data are at variance with earlier reports that intravenous BPs are more effective in pain reduction than oral medication. 10,[20][21][22] However, other recently published data demonstrate an equivalent pain-reducing capacity for oral and intravenous BPs, 14 in complete agreement with the present results. New pathologic fractures occurred significantly more frequently during BP treatment in the oral clodronate group compared to the intravenous BP groups. Intriguingly, these data are perfectly concurrent with a recent report demonstrating oral ibandronate to be inferior to intravenous zoledronate in terms of reducing the frequency of skeletalrelated events in patients with breast cancer metastatic to bone. 14 The limited overall efficacy of oral BPs might be due, at least in part, to a degree of noncompliance, which is typical of any oral therapy. In the present trial, however, compliance rates were not significantly different among the study groups. A limitation of this study is that compliance with oral clodronate was only determined by patient reports of drug use. Another limitation is that bone imaging was not routinely performed to diagnose asymptomatic pathologic fractures, although most skeletal-related events do present symptomatically. Finally, the trial was an open-label type, that is, pain assessments were made with patients and investigators being aware of the drug or treatment being given, and the results should therefore be interpreted with caution. Conclusion Our results suggest that oral clodronate is associated with significantly more frequent adverse events affecting the GI tract than intravenous BPs. Further, our results indicate that oral clodronate is inferior to intravenous clodronate and pamidronate in preventing pathologic fractures. Thus, despite the inconvenience and costs of parenteral administration, intravenous BPs appear to be preferable for treatment of patients with breast cancer |
metastasized to bone. Natural Products as Modulators of the Proteostasis Machinery: Implications in Neurodegenerative Diseases Proteins play crucial and diverse roles within the cell. To exert their biological function they must fold to acquire an appropriate three-dimensional conformation. Once their function is fulfilled, they need to be properly degraded to hamper any possible damage. Protein homeostasis or proteostasis comprises a complex interconnected network that regulates different steps of the protein quality control, from synthesis and folding, to degradation. Due to the primary role of proteins in cellular function, the integrity of this network is critical to assure functionality and health across lifespan. Proteostasis failure has been reported in the context of aging and neurodegeneration, such as Alzheimer’s and Parkinson’s disease. Therefore, targeting the proteostasis elements emerges as a promising neuroprotective therapeutic approach to prevent or ameliorate the progression of these disorders. A variety of natural products are known to be neuroprotective by protein homeostasis interaction. In this review, we will focus on the current knowledge regarding the use of natural products as modulators of different components of the proteostasis machinery within the framework of age-associated neurodegenerative diseases. Proteostasis Failure in Aging and Neurodegenerative Diseases The proteostasis network is composed of a series of interconnected elements that assure correct protein functionality and degradation [1]. It starts when polypeptide chains are synthetized in the ribosome and fold with the help of chaperones and co-chaperones. Newly folded proteins are transported to their appropriate locations and once their life cycle finishes, they are degraded either by the ubiquitin proteasome system (UPS) or the autophagy machinery. Proteostasis network imbalance plays a key -if not causative-role in many age-related pathologies [2]. Age is the most relevant risk factor for neurodegenerative diseases including Alzheimer's disease (AD), Parkinson disease (PD), frontotemporal dementia (FTD) and several other forms of proteinopathies [3]. Although there is no consensus in the field regarding the molecular mechanisms that explain their augmented incidence in the elderly brain, a common feature of all these diseases is the accumulation of abnormal protein aggregates in the form of oligomers and inclusions, suggesting that general mechanisms controlling proteostasis may underlay the etiology of these diseases [4]. Recent hypotheses suggest that a progressive reduction in the repair capacity of the proteostasis network may generate a "pathological aging" that results in protein aggregation and higher incidence of neurodegenerative disease [5][6][7][8]. Cerebral aging involves a range of cellular and molecular alterations related to proteostasis impairment such as increased oxidative stress [9], altered autophagy machinery [10], accumulation of ubiquitinated protein aggregates [11], and impaired signaling by numerous neurotransmitters and neurotrophic factors [12]. The endoplasmic reticulum (ER) is an essential compartment of the proteostasis network, which is also disturbed by the aging process [4]. Importantly, functional studies indicate that altered proteostasis at the level of the ER is one of the major contributors to aging [4,13]. Several harmful stimuli, such oxidative stress and disturbances in the secretory pathway may lead to accumulation of unfolded or misfolded proteins at the ER lumen, thus activating the ER stress response [14]. The most prominent pathological hallmarks of AD are the extracellular accumulation of amyloid β (Aβ) peptides in the form of plaques and the intracellular accumulation of hyper-phosphorylated tau (ptau) proteins as neurofibrillary tangles (NFTs) [15], whereas in PD, α-synuclein tends to misfold and accumulate inside dopaminergic neurons, leading to Lewy bodies formation [16]. Formation of misfolded proteins as oligomers, proto-fibrils and fibrils leads to the accumulation of amyloid deposition and spreading to affected areas [17,18]. Several intrinsic and extrinsic factors that alter proteostasis cause a decreased protein quality control, contributing to the accumulation of damaged proteins. If not rescued, this condition can lead to protein misfolding disorders, such as AD and PD [19][20][21][22][23]. For instance, a growing amount of evidence indicate that the activity of the molecular chaperones -Hsp60, Hsp70 and Hsp90-is compromised in age-related neurodegenerative diseases [24,25]. The fact that the expression of Hsp60 and Hsp70 is decreased in AD animal models [26], suggests that impairments in the folding pathways play a key role in promoting age-related neurodegeneration. In prion diseases, reduction of the molecular chaperone GRP78/BiP expression leads to the acceleration of the pathology [27]. Alterations in the major protein degradation pathways have a major involvement as well. For instance, the reduction in the activity of the UPS through the manipulation of various UPS components (Rpt2, Rpt3, ubiquitin) causes deposition of pathological misfolded proteins and subsequent neurodegeneration in experimental models, resembling what is observed in AD and PD [28][29][30]. In addition, neurodegenerative diseases have in common autophagic failure [31,32]. The inhibition of the autophagy response is known to exacerbate protein toxicity and accelerate disease progression [33][34][35]. The genetic and pharmacological activation of the autophagy has shown to improve the clearance of AD and PD misfolded aggregated proteins [36][37][38]. Therefore, one can conclude that boosting up the elements of the proteostasis machinery is a promising broad-spectrum therapeutic approach, with the potential to treat or revert not only age-associated neurodegeneration, but a variety of protein misfolding disorders. Chaperone System Chaperones are highly conserved proteins that assist and mediate the achievement of the proper three-dimensional conformation of proteins. They bind and stabilize unfolded polypeptides, aiding their folding during synthesis and inter-organelle transport [39]. Chaperones play important roles during stress response, hence they are known as heat shock proteins (Hsp). Hsp are classified by their molecular mass (Hsp32, Hsp27, Hsp40, Hsp60, Hsp70, Hsp90). They possess a substrate binding domain that transiently binds to hydrophobic regions of polypeptides, shielding them from undesired intermolecular interactions that could interfere with their adequate folding [40]. The capacity of the Hsp is overloaded during chronic cellular stress, proteotoxic conditions and disease. For instance, Hsp failure has been observed in the context of neurodegenerative disorders, such as AD, PD and Huntington's disease [41]. Notably, the solely over-expression of different Hsp members has been able to rescue in vivo neuronal toxicity in different models [42][43][44][45]. With this in mind, the pharmacological activation of Hsp represents an interesting therapeutic approach to treat neurodegeneration. To date, several natural products have been identified as Hsp modulators. Among them, the potent phytochemical curcumin, a polyphenol of the plant Curcumin longa, has shown the ability to induce the in vitro (rat glioma cells, rat liver cells, and mouse fibroblasts) and in vivo (heat-stressed rats) expression of Hsp27 and Hsp70 under proteotoxic conditions, through the formation of an intermediate form of Hsf1 (heat shock factor 1) [46,47]. Although the administration of curcumin in animal models of neurodegenerative diseases has proven to be beneficial [48,49] and has no major side effects in humans, some clinical trials show no evidence of efficacy in ameliorating memory impairment nor reducing levels of amyloid in blood, suggesting a low bioavailability of curcumin following oral administration [50,51]. Several other nutraceuticals have the ability to boost the chaperone system, such as the proanthocyanidins present in cranberry extract. When administered to an AD nematode model, they delayed Aβ toxicity through the activation of Hsf1, which is a master regulator of Hsp expression [52]. Another interesting phytochemical is celastrol (extracted from the thunder god vine, Tripterygium wilfordii). Celastrol administration to aged mature cortical cultures induced the expression of Hsp70, Hsp32 and Hsp27 [53]. To highlight the in vivo neuroprotective activity of this natural product, intraperitoneal as well as subcutaneous administration in AD mice reduced Aβ pathology [54]. No clinical trials have been performed using cranberry extract or celastrol to treat AD. Paeoniflorin is an herbal compound isolated from the perennial flowering plant Paeonia lactiflora and the fern Salvinia molesta. This phytochemical bears the ability to induce Hsp expression through activation of Hsf1 and promotes thermotolerance in mammalian cell culture as well [55]. Another major constituent of the same herbal medicines is Glycyrrhizin, which can be found in the liquorice root. Several properties have been attributed to Glycyrrhizin, such as antiviral, anti-inflammatory, and anti-allergic. In fact, it has been tested in over 20 different clinical trials related with liver diseases with positive outcomes, but none of them evaluated its effect in neurodegenerative diseases. In the case of the heat shock response, Glycyrrhizin is not able to promote the expression of Hsp itself, however it enhances their induction, making it an interesting compound that could potentially be used in combination with activators of the heat shock response [55]. Some natural occurring antibiotics have Hsp induction properties too. Geldanamycin is a 1,4-benzoquinone ansamycin natural antibiotic compound isolated from the bacterial species Streptomyces hygroscopicus. When administered to mammalian cells expressing huntingtin exon 1 protein, it induces the expression of Hsp40, Hsp70 and Hsp90. The consequent activation of the heat shock response causes a marked inhibition on huntingtin aggregation [56]. In patients with primary brain tumor or brain metastases, geldanamycin induces Hsp70 with minimal toxicity [57]. Therefore, this compound bears the potential to treat disease-associated protein aggregation. Another antibiotic compound isolated from Streptomyces is herbimycin-A. Herbimicyn-A has the ability to induce the expression of Hsp72 thereby protecting cell cultures from heat stress [58]. Radicicol is a natural macrocyclic compound biosynthesized and isolated from the nematophagous fungi Pochonia chlamydosporia. This compound protects primary cell cultures against stressful conditions, by inducing the heat shock response in a HSF-1 related manner, following a similar mechanism than Herbimicyn and Geldanamycin [59]. In addition to this natural antibiotics, several other compounds have shown the ability to boost the chaperone system. While there are not reports yet on their action in the context of neurodegeneration or even clinical trials, they represent promising candidates to restore proteostasis balance and may have potential to delay the onset or treat diseases such AD or PD. One example is withaferin, a lactone derived from the plant Vassobia breviflora. Withaferin enhanced the heat shock response through Hsp70, Hsp32 and Hsp27 upregulation in a cancer model [60] and it is reported to ameliorate symptoms in schizophrenia patients with minimal side effects [61]. Shikonin is another potential candidate to treat proteinopaties. Its ability to induce Hsp70 in a human lymphoma cell model was discovered through a screening of chemical inducers derived from medicinal plants. Shikonin is present in the roots of Lithospermum erythrorhizon and it bears antibacterial, anti-inflammatory and anticancer activities as well [62]. Edible gastropods seem to be an interesting source of compounds with potential to modulate proteostasis response. As an example, the derivative 6-bromoindirubin-3-oxime, an indirubin present in mollusks, increased proteasome subunits and Hsp70 expression, with a consequent increase in healthspan and lifespan in Drosophila [63]. Few clinical trials have tested the efficacy and safety of indirubins, such as indigo naturalis extract. Although it can be considered a safe therapy [64], these studies have been tested in psoriasis patients and therefore, its bioavailability remains unknown. Autophagy Autophagy is a highly conserved homeostatic clearance mechanism. Is in charge of the degradation of damaged proteins, cytosolic components and organelles. It involves the lysosomal system and contributes to the regulation of metabolism, healthspan and longevity. Cellular autophagy activity is present at basal levels, however is particularly stimulated under stress conditions, as a protective mechanism to assure survival and homeostasis [65,66]. Autophagy impairment has been reported in several pathologies, from neurodegeneration to cancer [67,68]. Autophagy targets the degradation of misfolded aggregated proteins considered hallmarks of different proteinopathies [67,69]. However, during disease, the autophagy machinery fails, with deleterious cellular consequences [31]. Several studies have pinpointed a downregulation of important components of the autophagy pathway during AD and PD, such as Beclin 1 [70], as well as alteration in vesicle trafficking and inhibition of autophagic vesicles [71]. Notably, the genetic and pharmacological induction of autophagy has the ability to reduce the accumulation of misfolded proteins and has been associated to amelioration of these disorders [36,37,72]. In this regard, polyphenolic compounds are known potent activators of the autophagy response. As an illustration, the red wine polyphenol quercetin prevents Aβ associated aggregation and its obnoxious consequences through modulation of autophagy, both in nematodes [73] and murine models of AD [74] and PD [75]. Currently, there is a clinical trial to determine the brain penetration of quercetin to potentially treat AD patients using a senolytic therapy. Kaempferol is another potent polyphenol found in different dietary sources such as grapes and tomatoes. In vitro kaempferol treatment increases LC3-II, an autophagosome-bound microtubule-associated protein, and preserved the stratial glutamatergic response in a rat model of PD, positioning this natural product as an important enhancer of |
autophagy with promising therapeutic applications [76]. Interestingly, caffeine elevates LC3-II levels as well and has proven protective actions against AD and PD [77,78]. In fact, some studies suggest that drinking coffee may be associated with a decreased risk to develop AD and PD [79][80][81], however, no evidence has been obtained from randomized controlled trials about the beneficial effect of caffeine in neurodegenerative diseases to our knowledge. Resveratrol is another compound of interest present in grapes and berries. The fact that it can cross the blood-brain-barrier makes it an interesting candidate to treat neurodegeneration [82]. Among the many reported activities of resveratrol, it activates autophagy by up-regulating Sirtuin 1, a potent inductor of autophagy [83,84]. Moreover, in a clinical trial performed in AD patients, resveratrol modulates Aβ deposition and reduces inflammatory markers with no side effects [85,86]. In addition to this dietary sources, there is a growing amount of evidence demonstrating the beneficial effects of Mediterranean diet on age-associated neurodegeneration [87]. Olive oil is a significant component of this dietary regimen. Olive oil is enriched with the polyphenol oleuropein aglycone. The administration of oleuropein aglycone improved cognition and reduced amyloid deposition in a transgenic AD mouse model, mainly through activation of the autophagy [88]. A multitude of studies have study the effect of olive oil in combination with Mediterranean diet in an effort to evaluate its effect in patients with cognitive decline and dementia [89], including AD and PD, but none of them analyzed the capability of oleuropein aglycone to cross the blood-brain barrier (BBB), tolerance, biodistribution or its effect in treating neurodegenerative disorders. Another dietary molecule, present in high quantities on mushrooms and aged cheese, is spermidine. This compound induces autophagy and delays aging, the main risk factor for AD and PD, in humans and mice [90,91]. Glycoconjugate metabolites isolated from traditional medicine remedies are an interesting group of phytochemical compounds with properties to activate autophagy. For example, the ginseng derived steroid glycoside Rg2 is a potent inducer of in vitro and in vivo autophagy in an AMPK-ULK1 dependent [92]. In the same line, a derivative chemical compound from the root ginseng, 1-(3,4-dimethoxyphenethyl)-3-(3-dehydroxyl-20(s)-protopanaxadiol-3β-yl)-urea (DDPU), improved cognition and promoted neuroprotection in the APP/PS1 mouse model of AD. No clinical trials have been reported. DDPU targets different branches of the proteostasis network, as it has activity on both the ER stress and autophagy [93]. Berberine is a natural alkaloid isolated from Rhizoma coptidis, a traditional Chinese herbal medicine, with high distribution when administered orally, including the CNS, in pre-clinical studies [94]. When berberine was orally administered to a triple-transgenic AD mouse model, it promoted Aβ clearance through autophagy by increasing the levels of LC3-II. Phenotipically, berberine treatment significantly improved spatial learning and memory retention in the treated animals [95]. Corynoxine B joins the list of natural alkaloid molecules with autophagy-inducer properties in cellular and mouse AD models. Corynoxine B is an oxindole alkaloid present in the medicinal plant Uncaria rhynchophylla, a widely used Chinese traditional remedy. This compound was tested in cells expressing the APP Swe mutation and intraperitoneally administered once a day to Tg2576 mice at 8 months of age. Corynoxine B treatment reduced Aβ levels by increasing LC3-II, lysosomal activation and changes in APP [96]. Surprisingly, the source of compounds with potential anti-neurodegenerative capacity is not limited to the ground. The study of marine organisms has helped to identify several compounds with the ability to modulate proteostasis. Among them, chromomycin A2, psammaplin A, and ilimaquinone induced the expression of autophagy, in the context of cancer [97]. It would be extremely interesting to test their effect on neurodegeneration, both in vitro and in vivo, as it will expand the sources of therapeutic molecules. As stated, autophagy is a major player in the cellular response to stress and turnover of damaged proteins. In view of its potential, targeting autophagy through the use of natural products is an emerging and promising field that requires further exploration. Ubiquitin Proteasome System The ubiquitin proteasome system (UPS) is the main responsible for degrading intracellular damaged proteins. Briefly, a subset of enzymes is involved in ubiquitin-tag the proteins that need to be degraded, this tag is then recognized by the proteasome -a multi-subunit barrel complex-for its proteolytic degradation [98]. Several natural compounds have been widely explored for their ability to decrease the activity of the UPS, especially in the context of cancer research [99]. However, relatively few have been studied for their capacity to activate the UPS. The mechanisms of action among them vary, for example, the natural compounds olein, linoleic acid, linolenic acid, ceramides, and oleuropein increase proteasome activity by exerting conformational changes that promote the entry of the substrate into the proteolytic chamber [100]. A derivative of linoleic acid has been reported to cross the BBB, tolerable, and safe, but specific studies to determine its potential to treat dementia are still needed [101]. On the other hand, dietary intake of linolenic acid seems to have no effect in other brain disorders such as stroke [102]. It remains to be determined whether this is due to a low brain penetrance of the compound in the CNS or lack of therapeutic potential in this specific disorder. Other natural molecules activate the proteasome by enhancing its catalytic activities, such as the lipid fraction of the algae Phaeodactylum tricornutum and the triterpene betulinic acid [103][104][105]. Two clinical trials are currently ongoing to determine the safety, tolerability and effectiveness of betulinic acid. The compounds present in the Chinese traditional herb Corydalis bungeana boost in vivo proteasomal activity by upregulation of the regulatory subunits [106]. In the same line, the polyphenol resveratrol enhances proteasome activity through increase on the expression of proteasome subunits and proteolysis in the brain of AD transgenic mice, protecting them against memory loss and enhancing cognition [107]. Quercetin is another polyphenolic compound that exhibits in vivo enhancing proteasome activity [108] and reduces Aβ-induced toxicity in a dose-dependent manner when administered to a Caenorhabditis elegans AD model [73]. Since impaired UPS activity is one of the main features present in all protein misfolding disorders, it will be interesting to explore the natural chemical space in the lookout for more activators. Unfolded Protein Response Three branches of a conserved signaling pathway collectively termed as the unfolded protein response (UPR) are triggered in response to the ER stress: ATF6 (activating transcription factor 6), PERK (PKR-like kinase), and IRE1 (inositol-requiring enzyme 1) [14]. UPR activation results in global protein synthesis reduction [109] and upregulation of genes involved in protein folding [14], which facilitates proper protein folding, therefore arresting protein aggregation. In the brain of AD, PD and FTD patients, levels of UPR markers are elevated [110,111]. This could represent an emergency response triggered by the ability of misfolded proteins to induce neuronal ER stress and activate the UPR [112]. However, when the ER response is chronically activated, proteostasis cannot be restored with devastating consequences for the brain, leading to synaptic impairment and neurodegeneration. In this line of thoughts, recent studies indicate that reduction of ER stress with chemical chaperones alleviate synapse and memory loss in experimental models of AD [111,112]. Levels of eIF2α phosphorylation are elevated in AD brains. PERK regulation decreases eIF2α phosphorylation levels and ameliorates memory impairment in AD and prion-infected mice [113,114]. On the other hand, activation of PERK increases tau phosphorylation [115], as well as ptau activates UPR [116]. IRE1 leads to the expression of XBP1 (X-box binding protein 1) that upregulates the expression of chaperones, increasing the size of the ER and promoting the degradation of misfolded proteins through the proteasome system [14,117]. It has been recently described that IRE1 signaling promotes AD progression whereas its deletion ameliorates learning and memory impairment as well as reduces amyloid deposition [118]. Furthermore, tau and Aβ accumulation has been also found associated with UPR activation by inhibition of ATF6 and ER-associated degradation (ERAD), likely through soluble oligomeric forms [116,119,120]. Few natural occurring compounds have been explored in regards to their ability to modulate the UPR in the context of neurodegeneration. Among them, Bajijiasu, a dimeric fructose isolated from the Chinese medicinal herb Morinda officinalis, has shown to exert protection against Aβ induced neurotoxicity by attenuation of ER stress in the hippocampus and cortex of APP/PS1 mice [121]. No clinical trials have been reported evaluating this compound. Kaempferol is phytoestrogen and one of the main components of Ginkgo biloba extract with the ability to inhibit ER stress and protect cells against apoptosis by upregulation of CHOP mRNA levels in vitro [122]. Clinical trial using G. biloba extracts indicate its symptomatic beneficial effects in patients with MCI, AD, and related dementia [123][124][125]. Honokiol is a promising biphenolic lignan isolated from the Magnolia tree that can cross the blood brain barrier and therefore represents an interesting candidate to treat neurodegeneration due to its high bioavailability. This lignan modulated ER-stress in the brain of mice, and reduced the levels of proinflammatory cytokines as well [126]. Its tolerance, safeness, biodistribution, and effectiveness has not been tested yet to treat brain disorders. More research is needed to evaluate the effect on neurodegeneration of other known modulators of ER-stress, as the current literature is quite limited. A special focus should be made on compounds with the ability to cross the blood brain barrier that can effectively target the cells that are compromised in this diseases. Conclusions Aging is the main risk factor for a variety of neurodegenerative disorders, such as AD and PD. Recent studies indicate that there is a dramatic age-associated collapse of proteostasis responses, leaving the cells vulnerable to physiological and environmental stressors, and more susceptible to disease. In the case of diseases associated with protein misfolding, the proteostasis machinery takes initial care of the aberrant protein aggregates. However, as the clearance ability gets compromised, the accumulated aggregates cause cellular toxicity, tissue dysfunction, and disease. Therefore, boosting up the proteostasis machinery by the use of natural compounds emerges as a potent pharmacological tool with promising effects to treat and protect against neurodegenerative disorders. In this study we compile a list of natural modulators of the proteostasis network ( Figure 1). Not surprisingly, majority of them are of plant-origin. However it is remarkable to note that we report some compounds of marine-animal-origin as well. It is indeed necessary to explore more alternative sources of natural compounds. In addition, further studies are required to understand the precise mechanism of action of the natural proteostasis activators, their off-target effects and their in vivo bioavailability. We foresee that the development of innovative, natural and safe therapeutic strategies to tackle the accumulation of misfolded protein aggregates through the modulation of the proteostasis machinery, will have exceptional effects to prevent and treat disorders related to age-dependent protein aggregation. vivo bioavailability. We foresee that the development of innovative, natural and safe therapeutic strategies to tackle the accumulation of misfolded protein aggregates through the modulation of the proteostasis machinery, will have exceptional effects to prevent and treat disorders related to agedependent protein aggregation. There is an extensive heterogeneity of chemical classes that compose the proteostasis-enhancing compounds, however we observed an enrichment in polyphenolic molecules. It is noted that oleuropein aglycone, resveratrol, and quercetin target the autophagy and the UPS, suggesting that they could be used as strong activators to restore the proteostasis network during aging and disease, whereas chaperones' modifiers seem to exclusively interfere with this pathway. Conflicts of Interest: The authors declare no conflict of interest. There is an extensive heterogeneity of chemical classes that compose the proteostasis-enhancing compounds, however we observed an enrichment in polyphenolic molecules. It is noted that oleuropein aglycone, resveratrol, and quercetin target the autophagy and the UPS, suggesting that they could be used as strong activators to restore the proteostasis network during aging and disease, whereas chaperones' modifiers seem to exclusively interfere with this pathway. Conflicts of Interest: The authors declare no conflict of interest. Relationship between tinnitus and headache in Riyadh, Saudi Arabia Abstract Objective: Our aim was to estimate prevalence rates of different headache forms among tinnitus patients in Arabia, to investigate whether there is a relationship between tinnitus laterality and headache laterality in patients with unilateral tinnitus and unilateral headache, to explore the relationship between tinnitus and headache over time, and to know the effect of headache pain medications in tinnitus in Riyadh, Saudi Arabia. Method: The study is a quantitative |
observational cross-sectional study with a convenient sample by data from patients with tinnitus. The participants received a self-administrated electronic questionnaire measuring demographics, prevalence of an associated headache, and the relationship between tinnitus and headache. Results: A total of 226 patients enrolled themselves into the study, and all of them came from the capital city Riyadh of Saudi Arabia. 58% were females, and the remainder of them were males. Females reported significantly more ear tinnitus than males, and patients aged 51 years or older were significantly less inclined to report ear tinnitus compared to those younger; however, those aged 20–31 years were found to be significantly more inclined to report ear tinnitus. There was a statistically significant association between patients experiencing headaches and those experiencing ear tinnitus. Surprisingly, patients who take medications of any type to alleviate their headaches were significantly less inclined to report ear tinnitus than those who do not take medications. However, patients with ear tinnitus experienced longer headache duration in years than those who had no history of tinnitus. Moreover, those people who experienced right-sided tinnitus tended to report significantly more right-sided headaches, and the same goes for left-sided headaches. Conclusion: Our results showed that there is a relationship between headaches and tinnitus. Painkillers also showed a protective effect against tinnitus. High awareness about the relationship between headaches and tinnitus among physicians and patients may lead to early recognition and lead to early implementation of primary prevention, which is the cornerstone of family medicine practice, and treatment without referring to other specialties. However, the pathophysiology is still not clear. Further studies should be performed to know the pathophysiology. Introduction Tinnitus is a phenomenon where the individual hears a sound while there is absence of external sounds. [1] to accumulated cerumen in the ear canal. [5] The motioned risk factors will be considered during the current study among migraine participants. Migraine is the most common neurological cause of disability in the world. [6] There are some pathologies that can combine these two together, such as traumatic brain injury, arteriovenous malformations, intra-cranial hypo-or hypertension, [7] and carotid artery dissections. [8,9] However, in an epidemiological study of elderly people, it has been identified that a history of migraine is a risk factor for the development of tinnitus. [10] Moreover, in some other studies, it has been shown that patients with tinnitus who also suffer from headaches are between 26 and 47%. [11,12] In other studies conducted in Sweden and China, it has been suggested that headaches could contribute to tinnitus distress and potentially its severity. [13][14][15] There are no studies conducted about this topic in Saudi Arabia. In this study, our aim is to test the relationship between these two factors. Setup, sampling, and process This quantitative, observational, cross-sectional approach was carried out in Riyadh City, Saudi Arabia between September 2019 and October 2019. A self-administrated questionnaire was distributed in paper-based and electronic formats to Saudis in the Primary care and ENT/NEUROLOGY clinics in Riyadh City. Ethical approval for the study was obtained from the College of Medicine Research Center, King Saud University, Riyadh, Saudi Arabia. The sentence "completion of the following questionnaire will be taken as an indication of your consent to participate and please fill the questionnaire once" was added at the top of the questionnaire form as a method of obtaining consent and to avoid duplication of data and to ensure that every participant fills up the questionnaire once. A quantitative observational cross-sectional study was performed. The adopted questionnaire was based on the translated version of "Tinnitus and headache," with the translation following the guidelines detailed in "translation, adaptation, and validation of instruments or scales for use in cross-cultural health care research: a clear and user-friendly guideline" A sample size estimation was carried out using a single proportion sample size formula, n = z 2 p (1-p)/d 2 , with a 95% confidence level and 5% margin of error. This indicated the minimum sample size for estimating significance to be 205. Allowing for a 10% rate of uncompleted surveys, the required sample size was deemed to be 226. Data were analyzed by using Statistical Package for Social Studies (SPSS 22; IBM Corp., New York, NY, USA). Continuous variables were expressed as mean ± standard deviation, and categorical variables were expressed as percentages. The t-test and one-way ANOVA were used for continuous variables. A P value <0.05 was considered statistically significant. Results A total of 226 patients enrolled themselves into the study, and all of them came from the capital city Riyadh of Saudi Arabia. 58% were females, and the remainder of them were males. The analysis findings also suggested that 23.5% of the patients were aged between 21 and 30 years, 33.2% were aged between 31 and 40 years, 18.1% of them were aged between 41 and 50 years, and the remainder of the patients were aged 51 years or older. The patients past medical neurologic and ear risk factor analysis showed that 40.2% of them had a positive history of ear pain, 40.9% had a positive history of mid-ear pathology, and 5.2% of the patients had brain pathology; nonetheless, 43.7% of the patients had a history of hearing loss and/ or difficulty with 40.8% diagnosed with excess ear wax or subjected to the recurrent ear-dewaxing procedure, and 48.9% of them had a history of positive psychological stress [ Table 1]. 88.5% of the patients had a history of headaches, and 81.9% of them had a history of ear tinnitus that is associated with the headaches. Most of them (47.5%) experienced pain on the sides of their heads. Regarding the pain location, 49.6% had bilateral headaches that usually appear on both sides of their heads. 15.4% of them report that their pain usually is located on the right side; 20.8% of them however reported headaches on the left side of the head usually [ Table 2]. Moreover, the patients were asked to indicate with (No/Yes) whether they take pain killers of any type for their headaches; 59.3% of them agreed and 40.7% disagreed. Most of the patients (64.8%) take paracetamol, and 18.8% used non-steroidal anti-inflammatory drugs (NSAID) like ibuprofen and diclofenac sodium pills [ Table 3]. There was a statistically significant correlation between patients' gender and experience of ear tinnitus; females reported significantly more ear tinnitus than males, P < 0.001, according to the Chi-squared test of association. Also, another Chi-squared test of association showed that the patient's age was significantly correlated with the experience of ear tinnitus, P = 0.002; those patients aged 51 years or older were significantly less inclined to report ear tinnitus compared to those younger, but those aged 20-31 years were found to be significantly more inclined to report ear tinnitus compared to the other age groups. The patients with a positive history of hearing loss/difficulty were significantly more inclined to report ear tinnitus than those with a negative history of hearing loss, P < 0.001. Also, the patients with a positive history of psychological stress were significantly more inclined to report tinnitus than those with a negative history of psychological stress. There was a statistically significant association between patients experiencing headaches and those experiencing ear tinnitus, P = 0.023. Also, those who reported left-sided headaches are significantly more inclined to experience ear tinnitus than those who had right headaches or bilateral headaches or those who were uncertain [ Tables 4 and 5]. There was a statistically significant association between those who experienced headaches and tinnitus locations; those people who experienced right-sided tinnitus tended to report significantly more right-sided headaches; similarly, those who experienced left-sided headaches were predicted to report significantly more left tinnitus too, and those people who reported no tinnitus experience tended to report significantly more bilateral headaches [ Table 6]. Discussion This study was conducted on a cohort reporting headache associated with tinnitus. The study outcome measures provided scope on the following: the prevalence rates of headache types and relationships of both the laterality and severity of headache and tinnitus for this cohort. In addition, the study aimed to investigate the effect of painkillers' medication on tinnitus. Starting with the first aim, the prevalence rates of migraine and tension-type headache forms were studied by Deleu et al. (2001) [13] on a larger sample of 403 medical students in Oman (age range: 18 to 23 years). A unilateral headache had the highest rate among other headache forms by showing 43.9%, followed by the frontal headache recording 30.2%. The current study recorded different rates of headache forms in Riyadh City by showing the highest rate (47.5%) of the headache form that was on sides of the head, followed by the headache form above the eyebrows recording 39%. This difference might be attributed to the wider range of our participants' age (age range: 21 to >51 year-old). In addition, in a large youth group (5729 participants) in a French University, a cross-sectional study was conducted and focused on the relationship between tinnitus and migraine from many aspects including the following: health, lifestyle, family history, and alcohol consumption (Guichard et al. (2016). [14] Authors found an association between tinnitus and migraine, particularly the migraine with aura. On the other hand, Langguth et al. (2015) [12] conducted a study with a similar sample size (193 patients) to the current study and an age range of 18 to 90 years. The authors recorded a higher rate of migraine (44.6%) compared to other tension-type headaches (13%), and the remaining sample had non-classifiable headache (33%). The laterality of both headache and tinnitus was also measured by Langauth et al. (2015). [12] Authors concluded a statistically significant relationship between headache and tinnitus laterality and expected that they are pertained to a pathophysiological cause. This outcome was consistent with our study results. It was surprising that the laterality of headache and tinnitus was higher for the left side in both Langguth and current studies. However, the underlying pathophysiological cause was not investigated, and instead, the history of other associated conditions was considered and revealed the highest rates of the following: psychological stress and hearing loss (48.9% and 43.7%, respectively). Further investigation was carried out by Langguth et al. (2017) [15] on a sample of 193 participants suffering from tinnitus linked with headache and compared the headache laterality and headache type to another group of 765 patients who reported tinnitus without any associated condition. The study revealed a worse quality of life in a group of people with tinnitus associated with headache more than people who reported tinnitus without co-morbid headache. Particularly, the left-side migraine alongside the tinnitus showed a lower score in quality of life. In addition, vertigo was reported with all headache sides (left, right, and bilateral), which was not considered in the current study. Severity of tinnitus showed no significant relation to the headache, which was correlated to our findings in the current study. Regarding the pain killer medication in tinnitus, Deleu et al. (2001) [13] have shed light on this concern and revealed that the majority of the sample who suffered from headache took a non-prescribed pain killer (72.9%), whereas the least depended on a traditional remedy (2.5%). However, their study was applied on cohorts reporting headache without tinnitus. On the other hand, the group of people with headache (left-sided and bilateral) associated with tinnitus were mostly managed in a psychology clinic (Langguth et al., 2017). [15] Implication of findings • Referring patients suffering from tinnitus to both audiology and psychology clinics in order to rule out any hearing loss or psychological stress would probably manage the possible underlying causes, subsequently decreasing the tinnitus. • Painkiller medication might lessen the tinnitus in the case of association with headache. Future directions • Overlapping symptoms of migraine, vestibular migraine, and Meniere's disease suggest a vestibular test to confirm the diagnoses. Limitations • Self-reporting including recall bias. • Uncertainty, that is, some participants could not remember the predominant side/duration/onset of either headache or tinnitus. • Some participants might have had middle ear pathology yet not diagnosed clinically. • The episode of vertigo was not included in the questionnaire to rule out Meniere's disease. Conclusion Our results showed that there is a relationship between headaches and tinnitus. Painkillers also showed a protective effect against tinnitus. High awareness about the relationship between headaches and tinnitus among physicians and patients |
may lead to early recognition and lead to early implementation of primary prevention, which is the cornerstone of family medicine practice, and treatment without referring to other specialties. However, the pathophysiology is still not clear. Further studies should be performed to know the pathophysiology. Financial support and sponsorship Nil. Conflicts of interest There are no conflicts of interest. Quantification of Synergistic Effects of Ceragenin CSA-131 Combined with Iron Oxide Magnetic Nanoparticles Against Cancer Cells Background Therapeutic efficiency of ceragenins against cancers may be limited by lack of their hemocompatibility when high concentrations of molecules are required to reach a desired result. Synergistic effects observed upon administration of anticancer agents and metal nanoparticles may provide an opportunity to limit toxicity of immobilized ceragenins on the surface of metal nanoparticles and to improve their therapeutic efficiency at the same time. The aim of present work is to investigate the anticancer activities and hemocompatibility of nanoformulations consisting of ceragenin CSA-131 united with aminosilane-modified iron oxide-based magnetic nanoparticles (MNP) and prepared by 1) covalent bonding (MNP@CSA-131) or 2) by combining CSA-131 with MNP in 1:1 ratio (CSA-131 + MNP). Possible synergistic interactions between CSA-131 and magnetic nanoparticles were also quantified. Methods MNP@CSA-131 and CSA-131+MNP were tested in vitro against selected lung and colon cancer cells using colorimetric, fluorimetric and flow cytometry methods. Results Performed analysis demonstrates that MNP-based nanosystems significantly improve the killing efficiency of tested ceragenin, decreasing the viability of extra 1.37±4.72% to 76.07±15.30% cancer cells when compared to free CSA-131. Quantification of synergistic effects indicates the favorable interactions between CSA-131 and magnetic nanoparticles (CI < 1 for all tested doses), revealing at the same time a reduction in effective doses of ceragenin from 1.17 ± 0.61 to 34.57 ± 12.78 times when combined with MNP. We demonstrate that both MNP@CSA-131 and CSA-131+MNP induce significantly apoptosis of cancer cells and prevent the division of colon cancer cells even at relatively low doses of the active compound (10 µg/mL). Importantly, combining CSA-131 with MNP decreases the hemolytic activity of free ceragenin 4.72 to 7.88 times, which indicates a considerable improvement of hemotoxicity profile. Conclusion Comparative analyses have revealed that both developed CSA-containing nanoformulations due to the utility of synergistic interactions between MNP and CSA-131, which are effective against lung and colon cancer cells. This indicates the new directions in preparation of MNP-based therapeutics, which are relatively easy to synthetize, cost-effective and safe when intravenously administrated. Introduction Differences between surface plasma membranes, such as higher negative membrane potential and increased fluidity, between cancer and healthy cells are associated with interactions that control receptor accessibility and cell adhesion, 1 and these might be considered as potential targets for anticancer molecules. This possibility is supported by actions of endogenous membrane-active antimicrobial peptides, which have been described as anticancer agents with the capability to selectively kill malignant cells. 2 To date, a number of host defense and synthetic anticancer peptides (ACPs) have been described. These peptides display selective recognition of cancer cells, usually based on electrostatic interactions, resulting in mitochondrial membrane damage, induction of apoptosis and PIP 2 -mediated membrane permeabilization and growth inhibition. 1,2 Nevertheless, despite the characterization of numerous peptides with such activity, there is still a need to reduce their side effects, low stability in body fluids and toxicity in relation to healthy cells. 3 Therefore, continued efforts are required to design novel or modified membrane-active compounds with reduced side effects and high therapeutic efficiency. An ever-growing number of studies confirm that ceragenins (CSAs), bile acid-based analogs of antimicrobial peptides, may be considered as anti-neoplastic agents due to their 1) membrane-permeabilizing properties, 2) ability to induce both caspase-dependent and independent apoptosis, 3) introduction of cells into cell cycle arrest and 4) disruption of oxidative balance. 4,5 Importantly, ceragenins CSA-13, CSA-90, CSA-131, and CSA-192 were demonstrated to exert anti-proliferative properties against breast cancer, colon cancer and lung adenocarcinoma, which confirms their non-specific mechanism of killing action. 4,6 Nevertheless, at higher doses, considerable toxicity and hemolytic activity of ceragenins were observed, limiting the therapeutic utility when intravenous administration is required. 7 Combination chemotherapy of tumors is currently a primary treatment option, allowing for improvement of overall survival rates and simultaneously limiting toxicities and adverse effects, despite ever-growing tumor resistance. 8 Importantly, combined therapies present an opportunity to utilize nanocarrier-based methods. 8 Due to the unique properties of these materials at the nanoscale level, a variety of nanostructures, including metallic nanoparticles have attracted attention in biomedical engineering, particularly as drug delivery systems (DDS), diagnostic tools, antimicrobial agents and anticancer therapeutics. [9][10][11][12][13] A compelling number of reports indicate the possibility of attaching anticancer drugs on the surface of nanoparticles, thereby facilitating drug delivery and increasing drug accumulation in cancer cells, which results in improved therapeutic efficiency of anti-neoplastic agents and potentially overcoming drug resistance. 14 Immobilization techniques used for bioconjugation processes include physical interactions (electrostatic or affinity interactions) and chemical interactions such as covalent bonding. 15 One of the crucial advantages of metallic nanoparticles is their easy, reagent-controllable synthesis and considerable cytotoxicity. [16][17][18][19] Among them, iron oxide nanoparticles are characterized by high targetability, relatively easy surface functionalization and strong affinity towards cancer cells and are more stable than organic nanoparticles. 20,21 Importantly, while the safety of bare magnetic nanoparticles might be questionable, 22 their cytotoxicity and genotoxicity might be significantly limited by coating with aminosilane shell. 23 Our previously published reports have shown that covalent attachment of the first-generation ceragenin, CSA-13 to aminosilane-functionalized iron oxide magnetic nanoparticles (MNP) surface significantly improves the killing features of membrane-active compounds with subsequent improvement of their hemocompatibility. 4,6 It was also revealed that simple combining MNP and CSA-13 significantly improves the bactericidal effects against bacteria. Importantly, such nanoformulations are easy to prepare and do not require additional reagents and synthesis steps. 24 Nevertheless, none mathematic quantification of synergistic effects resulting from combining ceragenins with magnetic nanoparticles was performed to date. No study was also performed, in which anticancer effectiveness of ceragenins-containing nanosystems was compared to the efficiency of nanomixtures consisting of CSA-131 co-administrated with MNP. In agreement with the benefits of combinatory therapy, we aimed to develop an efficient, non-toxic and costeffective nanoparticles-based formulation, based on iron oxide nanoparticles united with ceragenin CSA-131, a second-generation ceragenin, with some improvements in activity over CSA-13. For this purpose, we compared the efficiency of 1) ceragenin CSA-131 nanoformulation consisting of CSA-131 covalently attached to the surface of iron oxide magnetic nanoparticles (MNP@CSA-131) and 2) combined by simple mixing of two compounds with each other (CSA-131 + MNP) against colon and lung cancer cells. We investigated whether immobilization significantly affects the anticancer activity of membraneactive ceragenin CSA-131 and determined mathematically possible synergistic interactions between CSA-131 and magnetic nanoparticles. Hemocompatibility of such nanoformulations was tested as well. According to our knowledge, none of those issues were addressed to date, which underlines the novelty of the research presented. Synthesis of Ceragenin-Decorated Magnetic Nanoformulations Aminosilane-coated iron oxide particles (MNP) were synthesized according to the published procedure and thoroughly characterized using TEM, XRD, FT-IR, TGA, and magnetization measurements. 27,28 The obtained iron oxide cores (average diameter 10 ± 2 nm) form small clusters surrounded by thin aminosilane shell (~1nm) clearly observed in TEM images. 28 MNP particles (30 mg) were suspended in an aqueous solution of glutaraldehyde (25%, 50 mL) using an ultrasound bath (1 h). After 6 h of mechanical stirring at room temperature, glutaraldehyde-functionalized MNPs were magnetically separated from the solution, washed several times with ethanol, and re-suspended in ethanol containing CSA-131 (10 mL, 3 mg/mL). The mixture was stirred overnight. Then, the particles were magnetically isolated, washed three times with ethanol, and dried to powder at 60°C. The product was analysed by FT IR, TGA and DSC methods. In another approach, CSA-131 was mixed with magnetic nanoparticles in a 1:1 ratio (indicated as CSA-131 + MNP), suspended in phosphate-buffered saline (PBS) and left for 48 h before experiments. Physicochemical Characterization of Magnetic Nanosystem The formation of nanosystems, including aminosilanemodified and ceragenin-functionalized magnetic nanoparticles, was evaluated using spectral and thermal techniques. ATR FT-IR spectra were recorded on Nicolet 6700 FT-IR Spectrometer from Thermo Scientific in the range of 4000 to 500 cm −1 by co-adding 16 scans with a resolution of 4 cm −1 . Thermogravimetric analyses (TGA) were performed on a Mettler Toledo Star TGA/DSC unit. Samples weighing 2-3 mg were placed in aluminum oxide crucibles and heated from 50°C to 900°C at a heating rate of 10 K min −1 under an argon flow rate of 20 mL‧min −1 . Differential scanning calorimetry (DSC) measurements were performed on a Mettler Toledo Star DSC system. A solid-state sample (2-3 mg) was placed in an aluminum crucible, sealed and heated from 25°C to 450°C at a heating rate of 10 K‧min −1 under an argon flow rate of 200 mL‧min −1 . An empty aluminum crucible was used as the reference. Cytotoxicity Assessment Cell viability after treatment with CSA-131 and ceragenincontaining combinations was estimated using the metabolic activity-assessing tetrazolium test (MTT assay) as described previously. 4 Briefly, 5x10 3 of both A549 and DLD-1 cells were plated in 96-well plates in 200 µL of media per well and left to cultivate until confluence~80% was obtained. Next, ceragenin CSA-131, MNP@CSA-131 and CSA-131 + MNP in concentrations ranging from 0 to 50 µg/mL were added in three replicates to each cell population and left for further incubation for 24 h at 37°C . To quantify the viability of cells, the MTT solution at a final concentration of 0.5 mg/mL was added, followed by further incubation for 4 h. The absorbance of MTTcontaining samples was measured using Varioscan Lux microplates reader at 540 nm (Thermo Fisher Scientific, Waltham, MA, USA) by the dissolution of formazan by 100 µL of dimethyl sulfoxide (DMSO) and gently shaking. The absorbance value obtained in cultures of control cells (without tested agents) was taken as 100%. The average of all the experiments has been shown as a cell viability percentage in comparison to the control. Interaction Assessment To quantitively evaluate the pharmacological interactions between CSA-131 and magnetic nanoparticles when ceragenin is covalently attracted to MNPs or combined in equal ratio, the combination method of Chou 29 and commercially available CompuSyn software were employed. Antagonism, additive or synergistic interaction between tested compounds was calculated using multiple drug effect equation allowing for the quantitative determination of the combinatory index (CI) and dose-reduction index (DRI). The CI was calculated based on the equation: CI = (D)1/(Dx)1+(D)2/(Dx)2+(D)1 (D)2/(Dx)1(Dx)2, where (Dx)1 and (Dx)2 are the doses of drug 1 and drug 2, alone, inhibiting "x%", whereas (D1) is the dose of drug 1 in combination, and (D2) the dose of drug 2 in a combination that corresponds to the observed "x" inhibition. Accordingly, CI values higher than 1 indicate antagonistic interaction, CI = 1 is an indicator that two drugs have an additive effect and CI < 1 corresponds to synergistic interaction, with the discrimination that values between 1 and 0.76, 0.75-0.3 and <0.3 indicate slight synergistic effects (SlS), synergistic (S) and strong synergistic effects (SS), respectively. CI values were calculated for a broad spectrum of effect levels and on the basis of this analysis, fraction affected (FA) versus CI plots was generated. To evaluate the drug dose in a synergistic combination, dose-reduction index (DRI) was calculated as follows: (DRI) 1=(Dx)1/(D)1 and (DRI)2=(DRI)2/(D)2, where DRI>1 shows that combinations could result in reduced drug doses when compared to doses for each drug alone. Analysis of Ceragenin-Induced Apoptosis To qualitatively evaluate the anticancer activities of ceragenin CSA-131 and ceragenin-based formulations and to investigate the mechanisms of detected antineoplastic features, a series of flow cytometry-and fluorimetric-based analyses was employed. In the first, alterations in intracellular glutathione (GSH) levels, being an early hallmark in the progression of cell death in response to different apoptotic stimuli, were investigated. For this purpose, vitality assay (ChemoMetec, Denmark) employing fluorescent dye VitaBright-48™ (VB-48) (reacting with thiols forming a fluorescent product) was performed according to the manufacturer's instructions. By comparing the VB-48™ and propidium iodide (PI) intensities recorded for control and treated cells, the fractions of 1) healthy cells, 2) PI-negative cells with low viability and 3) dead cells can be determined. The proliferation capability of CSA-131-treated cancer cells was measured according to a previously described procedure. 4,30 The externalization of phosphatidylserine (PS) to the cell surface in the |
response to the treatment with CSA-131 and its MNP-based derivatives, and thus the induction of CSA-mediated apoptosis was assessed using Muse ® Annexin V & Dead Cell Kit (Merck, Germany). Differentiation of early and late apoptotic cells and necrotic cells was performed through the use of a combination of FITC-labeled Annexin V with 7-AAD (7-aminoactinomycin D; indicator of cell membrane structural integrity). Visualization of CSA-131-and MNP@CSA-131-induced DNA fragmentation and investigation of changes in nuclei morphology was performed using fluorescence microscopy (BD Pathway Bioimaging Systems, BD Biosciences, San Jose, CA, USA). For this assay, A549 or DLD-1 cells were seeded in 96-well plates and treated with test agents for 24 h. Cells were then fixed with 4% paraformaldehyde in PBS for 15 min at room temperature. After incubation with 0.1% Triton X-100 in PBS (5 min, room temperature), cells were thoroughly washed and stained with DAPI solution (1 µg/mL) for 5 min at room temperature. All experiments were performed using test agents at a concentration of 10 µg/mL for 24 h. Hemolysis Assay Hemocompatibility of test agents was evaluated using a hemolysis assay, which is based on the colorimetric measurement of the amount of hemoglobin released from damaged red blood cells (RBCs). For this purpose, human red blood cells (RBCs), isolated from the blood of healthy volunteers, were suspended in phosphate-buffered saline (PBS) (hematocrit~5%) with concentrations of test agents ranging from 0 to 100 μg/mL. RBCs were then incubated with analyzed compounds for 1 h at 37°C. Relative hemoglobin concentration in supernatants after centrifugation at 2500 g was monitored by measuring optical absorbance at 540 nm. Complete hemolysis was measured in samples treated with 1% Triton X-100, which disrupts all cell membranes. Statistical Analysis Provided data are mean from 3 to 6 independent experiments ± SD. The significance of differences was determined using the two-tailed Student's t-test. Statistical analyses were performed using Statistica 10 (StatSoft Inc, Tulsa, OK, USA), and p<0.05 was considered to be statistically significant. Lung and Colon Cancer Cells Treated with CSA-131 and MNP Exhibit Decrease in Cell Viability To test whether ceragenin CSA-131 and iron oxide-based magnetic nanoparticles reduce lung and colon cancer cell viability, lung carcinoma A549 and colon cancer DLD-1 cells were incubated with increasing concentrations of test agents (concentrations ranging from 1 to 50 µg/mL) for 24 h. As shown in Figure 1 and Tables 1 and 2, treatment of both cancerous cell lines with CSA-131 resulted in a dosedependent decrease of cell survival; at the highest tested dose, ie 50 µg/mL, cell growth of A549 and DLD-1 cells was inhibited by 89.34 ± 7.65% and 57.91 ± 1.03%, respectively. Using Chou-Talalay median-effect analyses, effective doses (ED) necessary to decrease the cellular viability by 10%, 50% and 75% were calculated by extrapolation from each dose-response curves; accordingly, ED10%, ED50% and ED75% were 2.03 ± 0.71, 12.63 ± 5.44 and 31.65 ± 14.89 µg/mL for A549 cells and 3.49 ± 3.45, 24.83 ± 5.69 and 201.4 ± 102.67 µg/mL for DLD-1 cells. Cancer cells were considerably less sensitive to MNP-mediated treatment (with no CSA-131), since at the dose of 50 µg/mL cell growth inhibition was 34.87 ± 3.22% and 16.18 ± 4.57% for lung and colon cancer cells, respectively. Synthesis and Physicochemical Analysis of Ceragenin-Containing Nanoformulations Given the 1) considerable anticancer potential of ceragenin CSA-131, 2) decrease of cancer viability upon MNP treatment and 3) previous reports on the intensification of antineoplastic features of biologically active compounds by nanomaterials, two questions were raised: (a) do ceragenin However, in the system containing CSA-131, more intense and wider signal was observed. The absorption peak at 1630 cm −1 was detected in the spectrum of the cerageninfunctionalized particles and was assigned to C=N stretching vibrations. Weak bands observed at 2853 and 2928 cm −1 were ascribed to C-H stretching modes. The signals above 3300 cm −1 were characterized as N-H stretching vibrations. Differential scanning calorimetry and thermogravimetric analysis were used to evaluate the thermal characteristic of synthesized nanosystems and support the data from FT-IR analysis. The DSC curves of analyzed nanoparticles (MNP and MNP@CSA-131, Figure 2B) indicate differences in the chemical nature of the coating. A new endothermic transition above 350°C is observed in the heating curve of CSA-131-modified particles. It is most likely associated with the presence of ceragenin and its partial decomposition. Figure 2C Combined Therapy with Use of CSA-131-Containing Nanoformulations Exerts Enhanced Anticancer Activity When Compared to Single Treatments The effect of combined treatment using CSA-131 and MNPs on lung and colon cancer cell viability was determined using the MTT assay. For this purpose, lung adenocarcinoma A549 and colon cancer DLD-1 cells were treated with MNP@CSA-131 and CSA-131+MNP at doses ranging from 1 to 50µg/mL and combination effects are summarized in Figure 3A and C. Combined treatment using MNP@CSA-131 and CSA-131 + MNP shifted the dose-response curves to lower doses indicating that activity of above compounds was greater than either CSA-131 or MNP alone. A considerable alteration in cytomorphological characteristics of A549 and DLD-1 cells were observed by inverted phase-contrast microscopy ( Figure 3B and D). Compared to control cells, both treated lung and colon cancer cells, upon treatment with tested compounds, became less adhered, more round and shrunken, displaying vacuolization in cytoplasm. Importantly, these changes became progressively more pronounced when a combined treatment using CSA-131 and MNP was used. Nevertheless, it is difficult to draw conclusions on a synergistic interaction between CSA-131 and MNP based on microscopic observations and dose-response curves alone, despite the statistically significant shifts. To more quantitively analyze the interactions between test compounds, relative inhibitory effect (RIE), combinatory index (CI) and dose reduction (DRI) values were calculated using the median effect principle method developed by Chau and Talalay. 29 The results of this analysis are summarized in Tables 1-4. Notably, combined treatment using CSA-131 with MNP exhibited synergistic interactions at all tested doses, since relative inhibitory effect (RIE) values were positive in a range from +0.73 ± 3.32% (for 1 µg/mL of CSA-131 + MNP against DLD-1 cells; Table 2) to +76.07 ± 15.30% (for 10 µg/mL of MNP@CSA-131 against A549 cell line; Table 1). More precisely, when comparing RIE values for both cells lines, it seems that covalent immobilization of CSA-131 on the surface of nanocarriers is more prone to exert synergistic effectemployment of combined treatment using MNP@CSA-131 intensify the activity of CSA-131 by 34.09% and 24.70% by average against A549 and DLD-1 cells, respectively. At the same time, a mixture of CSA-131+MNP improves the therapeutic efficiency of CSA-131 against A549 and DLD-1 cells by 11.25% and 12.52%, respectively (Tables 1 and 2). Accordingly, combined treatments resulted also in the decrease of effective doses (ED) values. As shown in Figure 4A and D, effective doses at 10%, 50% and 75% effects levels were 2.97 to 9.01-fold lower than those noted for a single treatment with CSA-131. These results indicated that the combination treatment was more powerful in decreasing both A549 and DLD-1 cell viability. From the date described above, the combinatory index (CI) analysis demonstrated synergistic interactions between CSA-131 and MNP (Tables 3 and 4). Because our aim was to achieve maximal effects of tested nanoformulations, a mean combinatory index value was calculated for each tested dose and for each fraction affected (Fa) value (ie indicating the fraction of cells inhibited after drug exposure). To indicate the effects of drugs at different Considering that Fa <0.2 indicates low growth inhibition and a large population of cells actively growing, we considered these effects as less important than those at higher growth inhibition. For Fa > 0.6, CI values were below 1 indicating synergistic to mostly strong synergistic interactions. In addition, CI values of <1 corresponded to favorable DRI values (>1). According to the established definition, DRI designates how many folds of dose reduction are allowed for each drug at a given effect level compared with the drug alone. Regardless of the dose and the cell line used, the DRI values were always >1, indicating a beneficial dose reduction of CSA-131. The Fa-DRI plots ( Figure 4C and F) constructed using DRI for each Fa, indicate that chemotherapeutic doses of CSA-131 might be reduced from 1.17 ± 0.61 to 34.57 ± 12.78 times, which not only highlights the high capability of MNP to reduce effective doses of agents incorporated into nanoformulations, but most importantly, provides the possibility to improve the safety of performed cytostatic therapy. Apoptosis Increases Death-Associated Effects in Cancer Cells Upon Combined Treatment Using CSA-131-Containing Nanoformulations To more qualitatively describe the potential of combined treatment consisting of ceragenin CSA-131 and MNP, using covalent-based immobilization technique and co-treatment using both agents, a set of flow cytometry experiments was performed, and results of these studies are demonstrated in Figures 5 and 6. Due to the different content of ceragenin in the analyzed formulations, we decided to unify the tested amount and one dose of the substance was used for all combinations to compare the anti-cancer effects. Having in mind the dose-dependent toxicity of ceragenin against mammalian cells, flow cytometry analyses were carried out at a dose of 10 µg/mL. Increased levels of reduced glutathione (GSH) in ceragenin-treated cancer cells were observed, which indicates the introduction of cells into death processes ( Figures 5A and 6A), conditioned by the exhaustion of intracellular reductive substances and rapid oxidative stress in treated cells. When compared to untreated, control cells characterized by the relatively low level of GSH (16.25 ± 11.24% and 23.5 ± 3.54% for A549 and DLD-1 cells, respectively), treatment of cancer cells with ceragenin CSA-131 resulted in a nearly 3-fold increase of reduced GSH, confirming the anti-cancer potential of this compound against lung and colon carcinomas. More importantly, this effect was further intensified when cells were exposed to MNP@CSA-131 or CSA-131 + MNP in doses corresponding to ceragenin concentrations. This observation was confirmed by the introduction of cells into orange acridine (AO)/propidium iodide (PI) double staining, which allowed for discrimination between 1) viable, healthy cells, 2) PI-negative cells with low viability and 3) PI-positive dead cells with permeable membranes. According to results shown in Figures 5B and 6B, both MNP@CSA-131 and CSA-131+MNP in a dose of 10 µg/mL significantly increased the number of dead and membrane-permeable cellscombined treatment induced killing processes in extra 30.8% and 20.9% of A549 and DLD-1 cells, respectively, when compared to CSA-131 alone. This observation was also confirmed by resazurin-based quantification of the ability of treated cancer cells to proliferateas shown in Figures 5C and 6C. Tested agents efficiently arrested the proliferation of nanoformulation-treated cells, with MNP@CSA-131 as the most effective agent. To investigate the killing mechanism of ceragenin CSA-131 and ceragenin-containing nanoformulations, the externalization of phosphatidylserine (PS) into the outer leaflet of cell membranes was investigated using FITC-labeled Annexin V followed by PI-staining of cells (apoptosis assay). As shown in Figures 5D and 6D, combined treatment with CSA-131 + MNP increased the level of late apoptotic cells to 68.68 ± 8.88% and 52.76 ± 3.29% for A549 and DLD-1 cells, respectively. At the same time, the number of necrotic cells remained unchanged when compared to control and CSA-131-treated cells, which indicates that the killing ability of these compounds is determined by the induction of apoptosis processes. This observation is also in agreement with fluorescence microscopic observations of genetic material destruction upon exposed treatment (Figures 5E and 6E). Considering that DNA fragmentation is recognized as a major and most crucial event occurring in late apoptosis, it is justified to state that ceragenin-containing nanoformulations do not alter the route of cells death, but only intensify the main killing ceragenin-associated mechanisms. CSA-131 in Combination with Magnetic Nanoparticles Improves the Hemocompatibility and Membrane-Permeabilizing Properties A considerable limitation in the clinical introduction of membrane-active compounds with anticancer activity is their low selectivity and thus, potential damage to host cells membranes. To evaluate whether combining of ceragenin CSA-131 in MNP-based nanoformulations would prevent toxic effects against host cells, a hemolysis assay was performed. In this assay, isolated red blood cells act as a model of host membranes, allowing for the determination of membrane-permeabilizing properties of designed agents. As presented in Figure 7, ceragenin-based nanosystems are characterized by low hemolytic activity in a broad spectrum of doses, up to 50 µg/mL, ie doses 5 times higher than effective against cancer cells. At dose of 20 µg/mL MNP@CSA-131 and CSA-131+MNP induce hemoglobin release from |
only 3.07 ± 3.57% and 1.47 ± 0.79% red blood cells, when CSA-131 alone damage 34.04 ± 10.12% of RBCs at the same dose. Using doseresponse curves, MHC10% (minimal hemolytic concentration causing the release of hemoglobin from 10% red blood cells) was calculated. Importantly, MHC10% for MNP@CSA-131 and CSA-131+MNP were 7.88 and 4.72fold higher than for CSA-131 alone, clearly indicating the improvement of hemocompatibility of ceragenin CSA-131 upon its immobilization with magnetic nanoparticles. Discussion Currently, a variety of both single and combinatory therapies is proposed as an option for the treatment of lung adenocarcinoma and colon cancer; nevertheless, high numbers of drugresistant tumors and considerable toxicity of currently used chemotherapeutics hamper the treatment process. 31,32 Efforts are being made to design potent cytostatics characterized by lower toxicity. Ceragenins, due to their favorable pharmacodynamic features and nonspecific, cellular membrane-based mechanism of action, are currently tested as potential anticancer agents. [4][5][6]33 Previous reports have demonstrated that ceragenin CSA-13 effectively inhibits the proliferation capability of cancer cells in vitro and disrupt the oxidative balance of treated cells resulting in the induction of apoptosis. 4,5 Nevertheless, in higher doses of ceragenins of approx. 50-100 µg/mL, considerable hemolysis and cellular toxicity are observed, restricting its utility via intravascular routes. 7 Responding to the basic assumptions of combined therapy, we aimed to create a ceragenin-containing nanoformulation with high anticancer activity and low toxicity at the same time, which is easy to synthetize and cost-effective. To date, a variety of nanomaterials, including liposomes, 34 polymeric nanoparticles, 35 dendrimers, 36 carbon nanoparticles 37 and metallic nanoparticles 38 were demonstrated as compounds enhancing the anticancer effectiveness of conventional chemotherapeutics. In our study, the employment of iron oxide-based magnetic nanoparticles as synergistic agents in combination with ceragenin CSA-131 was encouraged and justified by our previously published reports, clearly indicating the improvement of activity of ceragenins, particularly ceragenin CSA-13, in the presence of magnetic nanoparticles. 7,24,30,39 Apart from the role of MNP as drug nano-delivers, we believe that a significant advantage of magnetic nanoparticles employment when compared to other materials is the possibility to easily purify developed nanosystems from residues of reagents that are necessary for the proper functionalization of anticancer drugs and relatively low toxicity of MNP. A compelling number of studies indicate that aminosilane coating reduces the toxicity of iron oxide nanoparticles, 23 making them appropriate agents for combining with other anticancer agents. Considering the above assumptions, we have chosen a relatively low concentration of CSA-131 (10 µg/mL) in combination with magnetic nanoparticles, both covalently attached or co-administrated together in one nanomixture to explore the synergistic inhibitory effect against lung A549 adenocarcinoma and colon DLD-1 cancer cells. When assessing cell growth inhibition, we have noted that for clinically relevant cytotoxicity, higher doses of tested agents, particularly magnetic nanoparticles, are required ( Figure 1). At the same time, combinations of these therapeutics have demonstrated significant synergy and dosereduction effects, which suggest that the combined use of MNPs could strongly limit the toxicity of ceragenin CSA-131 by reducing its effective dose (Figure 4, Tables 3 and 4). Although a majority of studies aiming to assess the improvement of killing abilities of ceragenins using MNP involve covalent-based nanosystems, it was demonstrated that antibacterial properties of membrane-active compounds against Pseudomonas aeruginosa and Staphylococcus aureus might be potentiated by combining the ceragenin with aminosilane-, gold-or poly (quaternary ammonium salt-coated iron oxide nanoparticles). 24 Anticancer activities of those formulations and mathematic quantification of such have not been investigated to date, which highlights the novelty of this research. According to our results, both MNP@CSA-131 and CSA-131 +MNP nanoformulations exert accelerated inhibitory effects. Although comparative analysis of these nanoagents is considerably hampered due to different amount of ceragenin in those formulations, a favorable interaction between MNP and CSA-131 is strongly highlighted in both cases, since the ED75 of MNP@CSA-131 was 2.97-9.22 fold lower and the ED75 of CSA-131+MNP was 3.64-4.62 fold lower when compared to free CSA-131 ( Figure 4A and D). Analysis of combinatory effects using the Chou-Talalay method indicated mostly synergistic or strong synergistic interactions between tested compounds, highlighting their utility as nanoagents for lung and colon cancer treatment (Tables 3 and 4). These results suggest that not only covalent attachment of ceragenin CSA-131 to MNP surface but also simple combining of these agents into one nanomixture seems to be sufficient to exert potent anticancer activity, which provides new possibilities to design novel ceragenin-containing nanoformulations. Our data are in agreement with previous reports demonstrating the possibility to co-deliver antineoplastic agents using metal nanoparticles. 40,41 Most recently, Tao et al prepared novel disulfiram/doxorubicin co-loaded nanoparticles using the attraction of cytostatic to NPs. Accordingly, disulfiram and doxorubicin were found to have increased intracellular accumulation in breast cancer cells, compared to free drug solutions. 40 Synergistic effect of silver nanoparticles conjugated with gemcitabine against metastatic breast cancer cells resulted in a significant reduction of both gemcitabine and silver nanoparticles effective doses, and thus, has allowed for improvement of treatment safety. 41 Importantly, combining of active agents into one nanomixture as indicated by Karuppaiah et al were much simpler and cost-effective methods, when compared to linkers required for covalent immobilization. 41 We suggest that similar advantages might be recognized for ceragenin-containing nanoformulation proposed in this work. Although the exact mechanism of observed synergistic interactions was not determined in this study, some hypotheses can be made. Firstly, it is suggested that enhanced anticancer activity of developed nanoformulations results from the increased intracellular accumulation of CSA-131. Previous studies clearly indicated that iron oxide magnetic nanoparticles exert a synergistic effect with daunorubicin due to enhanced drug uptake of targeted leukemia cells. 42 Effective delivery of daunorubicin and let-7a mRNA on the surface of zinc-doped iron oxide core nanoparticles with mesoporous silica was demonstrated to be efficient to overcome drugresistance in breast cancer cells. 43 Our previously published research performed using HT-29 colon cells revealed increased cellular internalization of MNP@CSA-13 when compared to free alone. 6 Although the similar analyses employing CSA and MNP simply combined were not performed to date, it is suggested that a similar mechanism might determine the therapeutic effectiveness of CSA-131+MNP. The second hypothesis, which does not exclude the mechanism proposed above, assumes that both MNP and CSA-131 target similar points in cancer cells resulting in an increase of overall cytotoxicity. Our previous study performed using breast cancer MCF-7 cells clearly indicated that ceragenin CSA-13 acts as pro-apoptotic agents due to the induction of excessive oxidative stress followed by membrane depolarization, caspases activation and DNA fragmentation and this effect is further intensified by attachment of CSA-13 to Excellence in 2019-2022", project number: 024/RID/2018/ 19, financing amount: 11.999.000,00 PLN. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Disclosure PBS is a paid consultant for N8 Medical, Inc. All other authors declare that they have no competing interests. Modeling Prion-Like Processing of Tau Protein in Alzheimer’s Disease for Pharmaceutical Development Following our discovery of a fragment from the repeat domain of tau protein as a structural constituent of the PHF-core in Alzheimer’s disease (AD), we developed an assay that captured several key features of the aggregation process. Tau-tau binding through the core tau fragment could be blocked by the same diaminophenothiazines found to dissolve proteolytically stable PHFs isolated from AD brain. We found that the PHF-core tau fragment is inherently capable of auto-catalytic self-propagation in vitro, or “prion-like processing”, that has now been demonstrated for several neurodegenerative disorders. Here we review the findings that led to the first clinical trials to test tau aggregation inhibitor therapy in AD as a way to block this cascade. Although further trials are still needed, the results to date suggest that a treatment targeting the prion-like processing of tau protein may have a role in both prevention and treatment of AD. concept of prion-like processing of proteins to form characteristic pathological aggregates has come to be understood as a general molecular mechanism underlying a number of progressive neurodegenerative disorders [2][3][4][5][6]. For us, the idea arose from attempts to understand the surprising ability of a family of molecules of the diaminophenothiazine class to reverse the proteolytic stability of the otherwise highly resistant tau polymers, known as paired helical filaments (PHFs), isolated from the brains of patients dying with AD. We had found [7,8] that it was possible to prepare an essentially pure preparation of PHFs from AD brain tissues using a combination of differential centrifugation and digestion with a broad spectrum exoprotease (Pronase). The resulting PHFs retained their typical structural characteristics apart from the loss of a proteolytically susceptible fuzzy outer coat [9,10]. Treatment of these preparations with formic acid released a 10-12 kDa fragment of tau protein restricted to the repeat domain of the molecule [8], thereby establishing this fragment as a critical structural constituent of the proteolytically stable core of the PHF and not simply one of the many proteins which can be labelled in tangles and co-purify with PHFs in crude brain extracts [11][12][13][14][15][16][17][18][19][20][21] (Fig. 1). Since this fragment of tau accounted for 92% of the total protein content of such preparations, it followed that molecules of the diaminophenothiazine type must be blocking a tau-tau binding interaction that is critical for maintaining the structural and proteolytic stability of the PHF. Pre-treatment with a diaminophenothiazine eliminated the proteolytic stability of the 10-12 kDa protein fragment [22]. This implied that the proteolytic stability of the PHF core unit was not inherent to the tau molecule, but was rather secondary to its configuration within the assembled filament. In order to understand the mechanism better, we developed a relatively simple in vitro tau-tau binding assay in which the PHF-core tau fragment (Ile-297 -Ala-390) was first incubated in the solid phase, and the binding of full-length recombinant 4-repeat tau added in the aqueous phase was measured immunochemically [22,23] (Fig. 2). Three surprising observations emerged from these studies. The first was that binding could be blocked by the same diaminophenothiazines found to dissolve proteolytically stable PHFs isolated from AD brain [22]. The second was that after digestion of the bound complex with Pronase, full-length tau lost its Nterminal domain and acquired a neo-epitope detected with mAb 6/423 which recognizes a C-terminal truncation at Glu-391 present in the core of the PHF [22,24]. Since both species in the bound complex lacked this epitope, its appearance after exoprotease digestion could only be explained as having come from full-length tau as the proteolytically stable footprint of the tau-tau binding interaction in the repeat domain. The third feature was that the binding interaction could be propagated through repeated binding/digestion cycles after addition of fresh full-length tau at each cycle with increasing Fig. 1. Tau composition of the PHF core. Fragmented PHFs (A), isolated from AD brain tissue, release a 10-12 kDa doublet following extraction with formic acid (B). This doublet corresponds to fragments from the C-terminal part of tau protein that contain the repeated tubulin-binding domain (yellow boxes) and vary depending upon the inclusion or exclusion of an additional repeat (green box) inserted in the protein by alternative splicing (C). Scale bar in A, 200 nm. Fig. 2. Tau aggregation in vitro demonstrates that the tau fragment from the PHF core permits autocatalytic propagation at the expense of normal tau. When incubated in the solid phase, the tau fragment from the core of the PHF binds full-length tau with high affinity and converts the repeat domain from the bound full-length tau molecule into a proteolytically stable replicate of the starting fragment. In these assays, the broad spectrum exoprotease Pronase was used [22]. A neo-epitope at the C-terminus of the newly truncated fragment recognized by mAb 6/423 (which recognizes a C-terminal truncation at position Glu-391) is created after digestion and is amplified in the course of repeated binding/digestion cycles. The core domain is shown in a C-shaped hairpin conformation to take account of what is now known of the atomic structure of this fragment within the PHF-core [39]. accumulation of the proteolytically stable core unit in the solid phase [22]. Taken together, these observations implied that the tau-tau binding interaction occurring through the repeat domain of the molecule was responsible for both the proteolytic and structural stability of the of PHF and was inherently auto-catalytic and self-propagating, i.e., "prion-like" [1]. These properties were later confirmed in a stable cellular model |
system [25]. The core 10-12 kDa tau unit is highly toxic when overexpressed in cells. In order to model the templated truncation process within a cellular environment, it was necessary to establish a dual expression system in cells that do not normally express tau, namely fibroblasts. In this system, the PHF-core tau unit is expressed constitutively at very low non-toxic levels, and fulllength four-repeat tau is expressed under the control of an inducible vector. Induction of full-length tau leads to its templated conversion to the core unit with the characteristic 10-12 kDa gel mobility. This conversion was blocked quantitatively by the same diaminophenothiazine-class molecules which had been found to dissolve proteolytically stable PHFs and which also blocked the tau-tau binding assay modelled in a cell-free environment [25]. Therefore, once present, the core-tau unit is able to propagate itself at the expense of normal full-length tau within the normal cellular milieu. Finally, overexpression of the PHF-core tau unit in a transgenic mouse model produced tau aggregation pathology which is restricted to entorhinal cortex and hippocampus in 3-6-month-old mice, and spreads to isocortex only after mice are 12 months old (Fig. 3). This pattern of spread reproduces a characteristic feature of the tau pathology of AD that forms the basis of the Braak staging system in humans [27] discussed further below. A significant cognitive deficit was present already from 3 months of age in the absence of any motor impairment. Amelioration of both tau aggregation pathology and cognitive impairment were achieved following six weeks treatment with methylthioninium (MT) [26], the prototype diaminophenothiazine we have taken into clinical development and which is discussed further below. STRUCTURE AND ASSEMBLY OF PHFS PHFs isolated from AD brain tissue without Pronase digestion have a fuzzy outer coat (Fig. 4A). Although such PHFs are still recognized by mAb 6/423, they require higher concentrations of the antibody to do so [24]. This suggests that the N-and C-terminally truncated repeat domain tau unit is present within PHFs in a manner that is partially occluded by the fuzzy coat. This interpretation was supported by immunohistochemical studies examining the sequencing of tau aggregation and truncation in AD brain tissues. The aggregates recognized by mAb 6/423 are initially amorphous and are not labelled by benzothiazole fluorophores that bind to assembled PHFs. As these aggregates are converted to PHFs, they acquire the ability to bind benzothiazoles, but lose mAb 6/423 immunoreactivity. The latter can be revealed by formic acid treatment of the histological section [28]. The fuzzy coat contains the portions of the tau molecule that are N-terminal to the repeat domain core. Immunoreactivity associated with the N-terminal portion of the molecule is lost after proteolytic removal of the fuzzy coat [8,10]. Since the core structure remains intact after removal of the fuzzy coat, it can be concluded that the N-terminal half of the tau molecule makes no contribution to the core, which contains no post-translational modifications [29]. The epitopes recognized by phosphate-dependent antibodies are located exclusively in the fuzzy coat [30]. These complex immunochemical properties have led to considerable confusion in the literature regarding the potential role of phosphorylation of tau protein both as a therapeutic target and as providing a conjectural bridge to altered process of APP in AD. A widely quoted misconception that has remained in the literature since 1991 [31] is that "PHFs are composed almost entirely of hyperphosphorylated tau protein". However, the molecular mass of the PHF core is ∼65 kDa/nm [10], or ∼6.5 × 10 kDa core tau units per nm. Since the mass of the N-terminal half of the tau molecule is ∼23 kDa, the predicted mass of PHFs isolated without protease treatment would be ∼210 kDa/nm if all of the PHF tau protein were N-terminally intact. However, such PHFs have a maximal mass of 110 kDa/nm, and more typically 80-95 kDa/nm [10]. This implies that the bulk of the molecular mass of the PHF is made up of truncated tau, and only 1 in 7 tau molecules is N-terminally intact. These approximations, based on structural data, agree well with direct immunochemical measurements of PHF preparations, since phosphorylated tau accounts for less than 5% of total PHF-tau measured independently of phosphate-dependent immunoreactivity [7,32]. Whether full-length hyperphosphorylated tau protein is simply attached on the outside of the core polymer, or whether some of the structural tau units of the core are N-terminally intact is not known at present. Either way, it is extremely unlikely that PHFs could be composed "almost entirely of hyperphosphorylated tau protein" as widely supposed. Systematic tau-tau binding studies in vitro using the assay described above showed that, as the concentration of either truncated tau in the solid phase or full-length tau in the aqueous phase species increases, their respective binding affinities increase to asymptotic values of 21.1 ± 2.9 and 31.5 ± 22.6 nM, respectively [33]. This implies that a conformational change can be induced in a concentration-dependent manner which facilitates tau-tau binding. This concentration-dependent enhancement is not seen in the tau-tubulin binding interaction, which has a 19-fold lower binding affinity of 403 ± 86 nM irrespective of tau or tubulin concentration [33]. Both tau-tau and tau-tubulin binding through the repeat domain are profoundly disturbed by phosphorylation. In the case of tau-tau binding, phosphorylation produces a 10-to 50-fold inhibition depending on the precise configuration of the measurement [33]. For tau-tubulin binding, the inhibition is 24-fold. Therefore, phosphorylation controls the folding of the tau molecule in solution in such a way as to occlude the availability of the binding domain. These findings also imply that it is unnecessary to invoke phosphorylation as a mechanism responsible for the transfer of tau protein from predominantly tubulin-bound to predominantly aggregated states, as is widely assumed [34]. Once the repeat-domain fragment is available in a suitable conformation, the dynamics of microtubule assembly and disassembly will favor the redistribution of the tau protein pool to the aggregated state simply by virtue of differential binding affinities. The progressive accumulation of endogenously truncated tau in AD brain suggests that the cellular clearance mechanisms are compromised once the repeat domain is locked in its proteolytically stable configuration and that the aggregated truncated form represents a kinetic sink [32]. Indeed, quantitative analyses of soluble and aggregated tau in AD brain tissues implied that the loss of soluble tau is insufficient to explain the accumulation of aggregated tau. Rather, it appears that the soluble tau pool is being maintained by increased production to compensate for loss into the aggregated form [32]. The inhibitory effect of phosphorylation can be eliminated by first binding full-length tau to the solid phase [33]. This removes the conformational protection afforded by phosphorylation which shields the repeat domain from pathological aggregation. There is some evidence supporting the idea that the critical binding substrate which enables the initial conformational change required to trigger the tau aggregation cascade may be related to products of incomplete mitochondrial clearance [1,35]. Lipofuscin deposits which typically accumulate in aging neurons are composed of undigested products of mitochondrial turnover [36]. These mitochondria-derived fragments co-localize with truncated tau in lysosomes, copurify with proteolytically stable PHFs and form SDS-resistant complexes with truncated tau [22,35]. Although such aggregates may provide the primary substrate needed to seed tau aggregation, the process is self-propagating and autocatalytic once initiated. Such a scenario would then locate the initiation of tau aggregation within the framework of a more general age-related impairment in the efficiency of endosomal-lysosomal processing which is required for clearance of membrane-bound proteins (such as APP) and mitochondria [37,38] (Fig. 5). A low resolution structure of the PHF core was initially described on the basis of direct negativestain electron microscopy observations and model building [9]. Isolated PHFs are characterized by longitudinal strands which transition between a 4stranded to a 3-stranded appearance in the course of a left-hand helical rotation of an underlying ribbonlike structure (Fig. 4A). Since the filaments have clean transverse breaks, the underlying subunit must be transverse in orientation. These features can be explained by two C-shaped subunits back to back with a core unit consisting of three distinct domains. This structure was confirmed by image diffraction analysis of isolated core-PHFs (Fig. 4B). More recently, this core structure has been confirmed more elegantly by cryo-electronmicroscopy which has permitted detailed resolution at the atomic level [39]. The sequence of the repeating core tau unit, determined structurally [39], corresponds almost exactly to the sequence first isolated from the PHF core 29 years ago [8]. The only difference is that the proteolytically stable unit, shown biochemically [8,24], extends by 8 residues N-terminal and 13 residues C-terminal relative to the sequence that could be visualised by cryo-electronmicroscopy (i.e., Ile-297 -Glu-391, rather than Val-306 -Phe-378). The atomic resolution structure has made it possible to see for the first time that this core tau unit is arranged as a bent hairpin structure arranged to produce the Cshaped structural subunit (Fig. 4C). We have recently found that the core tau expressed in vitro unit exists in two distinct conformations with gel mobilities of 10-and 12-kDa, respectively [40]. Only the 12-kDa form is assembly competent, and assembles spontaneously into double helical ribbons with the same 4-stranded to 3-stranded transitions that indicate the presence of the same C-shaped subunit originally seen in PHFs. This suggests that the bent hairpin configuration of the repeat domain can occur in solution, that the bonds maintaining it are SDS-resistant even in the monomeric form, and that this critical conformational transition can occur in the absence of any post-translational modification [40]. In particular, these studies exclude any requirement for formation of disulphide cross-links in PHF assembly. These structural findings have important implications for understanding exactly how diaminophenothiazines are able to disassemble the PHF core and reverse the proteolytic stability of the repeat domain in its assembly-competent configuration [22]. It has been known for some time that the tau-tau and tau-tubulin binding interactions are pharmacologically distinct, even though both occur through the repeat domain [22]. Using MT as the prototype compound, dissolution of PHFs isolated from AD brain can be demonstrated at MT concentrations approximately 1/10th that of the PHFs [25]. This makes it unlikely that the action of MT is competitive, but rather suggests a catalytic interaction of some kind. It is tempting to speculate that MT works by destabilizing the hairpin configuration of the of the core tau unit which makes it assembly-competent. This would result in reversion of the core tau unit into a form which is both assembly-incompetent and more susceptible to proteolytic pathways available for protein clearance [41]. In the cell model described above, which is an inherently dynamic system, the levels of the core tau unit relative to full-length tau are reduced after treatment with diaminophenothiazines, implying both inhibition of tau aggregation and enhanced clearance of tau aggregates. That is, the core tau unit is no longer kinetically trapped in the aggregated state in the presence of diaminophenothiazines. Interestingly, MT enhances autophagy and clearance of aggregated tau protein in a transgenic mouse model at 0.05 M [42] and, at low dose, induces genes regulated by NF-E2-related factor 2 (Nrf2) which control pathways available for clearance of proteotoxic proteins in another transgenic tauopathy mouse model [43]. How these effects are related to dissolution of tau aggregates is unknown, but both point to enhancement of the ability of neurons to clear them. POTENTIAL CLINICAL EFFICACY OF TAU PROTEIN AGGREGATION INHIBITOR THERAPY IN AD Although MT has attractive properties in vitro and in transgenic mouse models as a possible treatment for the tau pathology of AD, its clinical pharmacology is complex. This is due in part to the redox lability of the molecule at physiological pH values. The best studied example is in the treatment of methemoglobinemia which is the only approved clinical indication for the use of MT. When the MT moiety is administered intravenously in its oxidized form (MT + ) as methylthioninium chloride (MTC, commonly known as "methylene blue") it needs first to be reduced to its uncharged form (LMT for "leuco-MT") to permit it to cross the red cell membrane [44] (Fig. 6). It is then concentrated inside the cell as a result of an equilibrium between the oxidized form which is favored at physiological pH and the reduced form which is maintained in an energy-dependent fashion by consumption of reduced glutathione [44]. This dynamic equilibrium permits |
MT to transfer electrons to oxidized hemoglobin thereby reducing it. A similar electron shuttling mechanism is thought to underlie the ability of MT to enhance mitochondrial metabolism [45]. It is not known whether this redox lability is critical either for dissolution of PHFs or preventing tau aggregation. The first tau protein aggregation inhibitor (TAI) to enter clinical development was MT in its oxidized MT + form as MTC. As indicated above, MTC has a long history of safe use, both as an approved treatment for methemoglobinemia [46], and experimentally in urolithiasis and bipolar disorder amongst others [47][48][49]. A phase II clinical trial was conducted between 2004-2008 in 321 subjects with mild/moderate AD [50] The trial was designed as an exploratory double-blind, randomized, placebocontrolled, 24-week dose-finding study of MT as monotherapy in AD to test the doses 69, 138 and 218 mg day given in divided doses three times per day on clinical and functional brain imaging (HMPAO-SPECT) outcomes. The primary efficacy analysis at 24 weeks showed that treatment with MT 138 mg/day is the minimum effective dose required to prevent disease progression when given as MTC. In the pre-specified primary efficacy analysis, treatment with 138 mg/day produced statistically significant benefit with respect to placebo on the ADAS-cog scale (effect size = -5. Surprisingly, a higher dose of 228 mg-MT/day was less effective on both clinical and functional imaging outcomes [50]. This was found to be due to dosedependent impairment in absorption in the presence of food [51]. As indicated above, the oxidized MT + needs to be reduced to the uncharged LMT form to permit absorption. This was confirmed in vivo by the observation that the red cell uptake of the LMT form is 20-fold better than the MT + form [51]. Red cell uptake is important for distribution of MT to the brain, since this sequestration protects the molecule from an efficient first-pass metabolism which inactivates MT as a tau aggregation inhibitor [51]. The conversion from the MT + form to the LMT form, which is favored at low pH values [52], most likely occurs in the stomach and is impaired in the presence of food. The further clinical development of the MT moiety in Phase 3 was therefore switched to a sta-ble reduced dosage form as leuco-methylthioninium bis(hydromethanesulfonate) (LMTM). LMTM is a distinct novel chemical entity which retains tau aggregation inhibitor activity in vitro and in vivo [25,26], has superior pharmaceutic properties in terms of solubility and pKa, and is not subject to the absorption limitations of the MT + form as MTC [51] (Fig. 7). LMTM was tested in two Phase 3 randomized controlled double-blind clinical trials in AD. The first (TRx-237-015, "Study 015") was a 15-month study in 891 patients with mild to moderate AD and compared 150 mg/day and 250 mg/day with a low dose intended as a control (8 mg/day) in divided doses twice per day [53]. The second (TRx-237-005, "Study 005") was an 18-month study in 800 patients with mild AD and compared 200 mg/day with the same intended control in divided doses twice per day. The control dose of 8 mg/day was selected as the lowest dose found to be able to mask urine discoloration relative to higher doses in earlier Phase 1 studies, and was expected to be ineffective on the basis of the results of the earlier Phase 2 study using MTC. In addition to having an active control arm, the Phase 3 studies also differed from the earlier Phase II study in permitting LMTM to be taken as add-on to approved anti-dementia treatments (cholinesterase inhibitors and/or memantine), whereas the Phase 2 study did not. In Study 015, it was shown that there was no difference between either of the two higher doses and the intended control dose on either of the coprimary outcomes (ADAS-cog and ADCS-ADL) or any of the secondary outcomes [53]. However, the primary prespecified analysis model showed that patients who received LMTM as monotherapy had a lower rate of progression (ADAS-cog, p < 0.0001; ADCS-ADL, p = 0.0174; ADCS-CGIC, p < 0.0001; MMSE, p < 0.0001). A further prespecified post hoc analysis was therefore undertaken in the whole population which included anti-dementia treatment status as an interaction term with LMTM treatment and as an interaction term with visit in the model. In patients taking LMTM as monotherapy, the differences with respect to the control arm were significant after correction for multiple comparisons on all treatment outcomes. For ADAS-cog, the effect size at 150 mg/day was -6. Similar results were seen for other clinical outcomes, and importantly the rate of brain atrophy was significantly less in the monotherapy patients. In patients taking the same doses of LMTM as add-on to approved anti-dementia treatments, the decline was indistinguishable from controls as randomized or from placebo controls in recently reported studies [54,55]. When the control arm was analyzed in similar manner, patients receiving LMTM 8 mg/day as monotherapy also had significantly better outcomes than those receiving the same dose as add-on to approved anti-dementia treatments. For ADAS-cog, the difference between 8 mg/day as monotherapy relative to add-on was -5. These differences between monotherapy and addon could not be explained by differences in age or sex distribution, in baseline ADAS-cog or MMSE scores, or time between diagnosis and randomization. Patients with mild (but not moderate) AD who were not taking these medications were marginally worse on the ADCS-ADL scale, had a slightly greater hippocampal volume and smaller lateral ventricular volume on baseline MRI, and had a lower APOE 4 allele carrier frequency. There were no differences in mild or moderate patients in whole brain volume, temporoparietal volume, or in the extent of vascu-lar pathology burden. There was also no difference in the initial rate of expansion of lateral ventricular volume over the first 6 months. When the differences in baseline severity, hippocampal volume, and other parameters were corrected for, the differences in favor of monotherapy remained statistically significant (Fig. 8). The results of Study 015, which became available prior to database lock and unblinding of Study 005, raised the possibility that LMTM might be effective only as monotherapy and that the minimum effective dose might be substantially lower for LMTM than that previously identified using MTC [50]. Since the originally intended analyses as randomized were unlikely to be able to achieve their intended purpose, the primary analyses and treatment comparisons in the statistical analysis plan for Study 005 were modified prior to database lock and unblinding to investigate whether the monotherapy differences could be confirmed as observational cohort comparisons defined as primary outcomes with strong control of family-wise type I error in the second independent study. The monotherapy cohort comparisons which were of particular interest in light of the earlier study were: 100 mg twice a day as monotherapy compared with 4 mg twice a day as originally randomized, and 4 mg twice a day as monotherapy compared with 4 mg twice a day as add-on to standard AD treatments. These were defined as two parallel primary comparisons which each had to be significant at ␣ = 0.025 for the analysis to be successful. The results of Study 005 have been reported recently [56]. As expected, there was no evidence of any difference on any of the primary or secondary endpoints in the as-randomized analyses comparing all patients receiving LMTM at a dose of 100 mg twice a day and those receiving 4 mg twice a day. In the non-randomized cohort comparisons defined as the primary outcomes in the revised statistical analysis plan, both primary comparisons were statistically significant for both co-primary clinical outcomes (ADAS-cog and ADCS-ADL), as well as for volumetric MRI and glucose uptake (FDG-PET) biomarker outcomes. Patients receiving LMTM as monotherapy at either of the two doses tested had consistently better outcomes than patients receiving the same doses as add-on to anti-dementia treatments. These effects remained significant after correction for any potential effects of differences at baseline in patients taking or not taking approved anti-dementia treatments. The confirmation of the same pattern of results in the second independent study argues against either set of findings being the result of chance in small subgroups, although the monotherapy subgroups remain small (15% and 20% in Studies 015 and 005, respectively). It is also unlikely that the earlier findings are explicable by inclusion of non-western geographies, since the second study was conducted in north America, western Europe, and Australia. A clinical placebo effect in patients coming into a trial setting after previously not receiving active treatment cannot explain the same pattern of results seen in both the MRI brain atrophy and glucose uptake data as seen in the clinical data. A difference in withdrawal rates between patients taking or not taking standard AD treatments is also unlikely, since the overall retention rates over 18 months were similar in monotherapy (65%) and add-on (69%) treatment groups in Study 005. The pattern of atrophy determined by MRI at baseline in patients receiving LMTM as monotherapy was typical of mild AD and significantly different from a cohort of well characterized normal elderly controls [57]. The annualized rate of whole brain atrophy in these patients over the first 6 months was also similar to that reported for mild AD and significantly different from normal elderly controls [58]. Likewise glucose uptake in inferior temporal gyrus was comparable in both monotherapy and add-on patients to that reported for mild AD [59] and significantly different from MCI or normal elderly controls [59]. There is no reason, therefore, to assume that patients not treated with approved AD treatments were anything other than typical mild AD patients. When the analyses were corrected for potential differences in baseline severity and a range of other baseline parameters, the results again remained robustly significant. The potential for LMTM to be active at the low dose of 8 mg/day and the lack of dose-response was unexpected given the results of an earlier Phase II placebo-controlled study using MTC. However, as indicated, LMTM is now known to have a 20-fold better red cell uptake than MTC in vivo [51] and also better brain uptake [26]. A population pharmacokinetic analysis using blood samples collected in the course of the second study indicate that the higher dose produced higher plasma levels of MT. Using data from rat and pig to estimate brain levels from the plasma data obtained in the trial, the estimated brain concentration of MT at the 8 mg/day dose was in the range 0.05-0.2 M and 2.0-3.8 M at the 100 mg twice a day dose. The brain concentration estimated at the 8 mg/day dose is similar to the minimum effective concentration estimated from the earlier Phase II clinical trial using MTC [50,51]. Although this difference in dosage requirement between LMTM and MTC is consistent with the 20-fold difference in cell uptake, this was not known at the time the Phase III studies were designed and initiated. The lack of doseresponse may well be explained by a similar lack of dose-response for oligomer disaggregation in vitro, and higher doses of LMTM do not result in greater reduction in tau pathology in transgenic mouse models [26]. This suggests that there may be a critical threshold for the catalytic action of MT in the dissolution of PHFs and oligomers, and the effect of higher doses on pathology may plateau or may even become negative at brain concentrations above 1 M [26]. A similar inverse dose-response was also found in a different transgenic model of tau aggregation pathology in which mice received MTC in the drinking water from 1-9 months of age [43]. The negative interaction with symptomatic antidementia treatments is more difficult to explain. We have recently found that the interference is not all-ornone, but depends in part on relative basal forebrain atrophy. Our current working hypothesis is that longterm inhibition of cholinesterase activity (or indirect enhancement of cholinergic activity by memantine) combined with loss of inhibitory modulation from the basal forebrain may result in chronic hyperactivation of pyramidal cells in cortex which are the principal sites of neurofibrillary degeneration in AD [60]. We hypothesize that hyperactivation of cortical pyramidal cells may impair the action of MT even at high dose. It is unknown whether interference of this type is a feature of any treatment aiming to enhance clearance of aggregated tau, or |
whether it is specific to LMTM. As a clinical summary, therefore, the same pattern of results has been seen now in two separate Phase III studies implying that the effects are consistent across studies. They are also internally consistent across a range of clinical and biomarker outcomes. Allowing for the differences in absorption between LMTM and MTC which are now known, the results are also consistent with the earlier Phase II placebo-controlled study supporting potential efficacy of the MT moiety as monotherapy. We believe that the within-and between-study consistency of the results point to clinical and biological effects of LMTM as monotherapy at the safe and well-tolerated dose of 8 mg/day twice a day which could provide a clinically meaningful addition to the available treatment options for AD. This possibility now needs to be confirmed in a further suitably randomized clinical trial in patients not currently receiving the approved anti-dementia treatments. Although the apparent treatment differences in favor of monotherapy do not appear to be the result of measurable differences between the cohorts, it is impossible to exclude unmeasured confounding effects without a further randomized trial comparing 8 mg/day against true placebo. LIFE-COURSE AND PREVALENCE OF TAU PROTEIN AGGREGATION The potential for availability in the near future of a safe tau aggregation inhibitor therapy as monotherapy needs to be considered in the context of the lifecourse and prevalence of tau aggregation pathology. Numerous clinico-pathological studies have demonstrated correlations between tau pathology and the extent of clinical dementia [61][62][63][64][65][66][67][68][69][70]. The staging system for spread of tau aggregation pathology proposed by Braak and Braak [27] has proved a valuable tool in refining these correlations and understanding the prevalence of the process. The pattern of spread of the tau aggregation pathology in the human brain is highly characteristic and stereotyped. Layer II of entorhinal cortex is the first area to be affected in cortex, although there may be earlier involvement in basal forebrain and brainstem structures [2,71]. We reported a study in a prospectively characterized neuropathological cohort in which we examined the sequence of changes in tau aggregation measured biochemically (as proteolytically stable PHF-tau levels) and corresponding changes in synaptic markers occurring in neocortex [68]. The Braak staging "clock" can be defined, at the early stages, on the basis of the pattern of spread of histopathological changes restricted largely to entorhinal cortex and hippocampus (stages 1-3). The sequence of changes in parietal and frontal neocortex, which begin later in terms of histopathology (stages 4-6), can then be analyzed at the molecular level as they develop against an initially clear histopathological background, using the Braak staging clock to order the sequence. These are summarized in Fig. 9. In contrast to tau histopathology (measured as tangle counts) which becomes apparent in neocortex only from Braak stage 4 onwards, accumulation of proteolytically stable PHFs in the neocortex is already significant from Braak stage 2. In the neocortex, therefore, tangles are a relatively late manifestation of tau aggregation pathology. The calculated interval between onset of tau aggregation in neocortex and tangle histopathology is about 35 years. Braak stages 4 -6 represent the more typically recognized stages of pathology, in which the appearance of tau tangles and tau-positive, neuritic plaques occurs at approximately the same time. Braak stage 4 is a point of neuropathological transition that is expressed simultaneously as neurofibrillary tangles and neuritic/amyloid plaques. Further progression in Braak stages 5 and 6 is seen only for the tau and synaptic markers. It is surprising to see that the changes in levels of synaptic proteins measured biochemically in the same brain regions follow a biphasic course, with an initial increase at Braak stage 3, followed by progressive decrease from Braak stage 4 onwards [68]. This implies that the appearance of measurable levels of proteolytically stable aggregated tau in the neocortex at Braak stage 2 is followed by a statistically significant increase in synaptic proteins at Braak stage 3. It is not known whether this increase is a compensatory consequence of a functional impairment in pyramidal transmission, or whether it represents a release phenomenon resulting in loss of inhibition resulting from basal forebrain atrophy where tau aggregation pathology is known to occur early in the sequence. Either way, the increase in synaptic markers suggests hyperactivation which may be accentuated by chronic treatment with cholinesterase inhibitors and memantine, as discussed earlier. Cognitive impairment in this epidemiological cohort was studied using MMSE scores obtained 12-24 months prior to death. From this, it was possible to derive an approximate trajectory linking Braak stage and MMSE score [68] (Fig. 10A). What is now referred to interchangeably as prodromal AD or mild cognitive impairment (i.e., MMSE score >25) occurs roughly between Braak stages 2 and 3. There are similar strong relationships between Braak stage and functional molecular imaging deficits as shown either by HMPAO-SPECT or FDG-PET which have similar ability to demonstrate deficits due to neuropathology [72,73]. Both HMPAO-SPECT [74,75] and FDG-PET [76] are correlated with Braak stage (Fig. 10B). The emergence of tau imaging ligands has made possible the direct imaging of tau aggregation pathology in vivo [77,78]. This has permitted an explicit confirmation of the relationship between aggregation of tau and functional molecular imaging deficits. Functional deficit is strongly correlated with tau aggregation as shown by tau-PET imaging, but not with aggre-gation of amyloid- as shown by imaging with 11 C-PIB [79,80]. Data coming from several clinico-pathological correlation studies are summarized in Fig. 11 showing the evolution of tau aggregation over time in archicortex and neocortex and the relationship to cognitive decline [7,68,81]. As can be seen, the entire sequence occurs over a 50-year time-span. The primary vertical axis shows levels of aggregated tau in the form of proteolytically stable PHFs measured in entorhinal cortex, hippocampus, and neocortex on a logarithmic scale. The progressive accumulation of aggregated tau is exponential over time, consistent with the autocatalytic characteristics of tau aggregation through the repeat domain discussed earlier. There is no evidence of abrupt transition between tau aggregation in medial temporal lobe structures and neocortex, except that aggregation in neocortex lags aggregation in entorhinal cortex and hippocampus. An extremely useful data set from Ohm et al. [82] makes it possible to estimate population prevalence of tau aggregation pathology by Braak stage in Caucasian populations. We have applied the age-dependent Braak stage transition probabilities derived from this data set (Fig. 12A) to estimate the number of affected persons worldwide in 2015 using WHO data (Fig. 12B). For this purpose, we assume that the Ohm et al. data might be applicable also in Asian populations, although there is at present no evidence to support this, except that age-related prevalence of dementia appears to be similar [83]. We calculate that for the population over the age of 45, there is a 50% probability of having some degree of tau pathology in the brain. This can be divided as follows: 25% at Braak stage 1, 10% at Braak stage 2, 10% at Braak stage 3, and 5% at Braak stage 4 or beyond. We estimate therefore that there may well be almost 500 million people worldwide with tau aggregation at Braak stage 2 or beyond in their brains. The transition to Braak stage 2 and beyond is associated with significant impairment that can be measured even on the crude MMSE scale (Fig. 10). Of the people we estimate to be affected, only 12% would be in Europe or North America. Asia would account for an estimated 60% of the affected population. There is therefore an urgent need to develop an effective oral treatment for tau aggregation pathology that is convenient, safe and well-tolerated. If the results seen in two Phase 3 trials are confirmed in a further placebo-controlled trial, they point to the potential for LMTM to fulfil this need. Prognostic value of myocardial perfusion scintigraphy in asymptomatic patients with diabetes mellitus at high cardiovascular risk: 5-year follow-up of the prospective multicenter BARDOT trial Background The Basel Asymptomatic High-Risk Diabetics’ Outcome Trial (BARDOT) demonstrated that asymptomatic diabetic patients with an abnormal myocardial perfusion scintigraphy (MPS) were at increased risk of major adverse cardiovascular events (MACEs) at 2-year follow-up. It remains unclear whether this finding holds true even for a longer follow-up. Methods Four hundred patients with type 2 diabetes, neither history nor symptoms of coronary artery disease (CAD), were evaluated clinically and with MPS. Patients were followed up for 5 years. Major adverse cardiovascular events (MACEs) were defined as all-cause death, myocardial infarction, or late coronary revascularization. Results At baseline, an abnormal MPS (SSS ≥ 4 or SDS ≥ 2) was found in 87 of 400 patients (22%). MACE within 5 years occurred in 14 patients with abnormal MPS (16.1%) and in 22 with normal scan (1.7%), p = 0.009; 15 deaths were recorded. Patients with completely normal MPS (SSS and SDS = 0) had lower rates of MACEs than patients with abnormal scans (2.5% vs. 7.0%, p = 0.032). Patients with abnormal MPS who had undergone revascularization had a lower mortality rate and a better event-free survival from MI and revascularization than patients with abnormal MPS who had either undergone medical therapy only or could not be revascularized (p = 0.002). Conclusions MPS may have prognostic value in asymptomatic diabetic patients at high cardiovascular risk over a follow-up period of 5 years. Patients with completely normal MPS have a low event rate and may not need retesting within 5 years. Patients with an abnormal MPS have higher event rates and may benefit from a combined medical and revascularization approach. Supplementary Information The online version contains supplementary material available at 10.1007/s00259-021-05349-5. Introduction The prospective multicenter Basel Asymptomatic High-Risk Diabetics' Outcome Trial (BARDOT) showed that asymptomatic patients with diabetes mellitus (DM) at high cardiovascular risk suffer from a higher rate of major adverse cardiovascular events (MACEs) within 2 years in case of abnormal myocardial perfusion scintigraphy (MPS) at baseline. In contrast, a normal MPS allows identifying a subpopulation with a very low likelihood to develop MACEs (2.9%) despite a high cardiovascular risk profile [1]. Although some of the traditional cardiovascular risk factors were predictive of abnormal MPS, even highest risk patients with a normal MPS had a benign prognosis without need for invasive evaluation or therapy [2]. Federico Caobelli and Philip Haaf contributed equally to this work. These findings suggest that screening of silent myocardial ischemia in high-risk patients with diabetes mellitus may be useful. To date, screening of all asymptomatic patients with DM remains controversial, as stated in the most recent guidelines [3]. While a meta-analysis including 3299 asymptomatic subjects with DM showed that screening with noninvasive imaging for CAD did not significantly reduce event rates of nonfatal myocardial infarction (MI) and hospitalization for heart failure (HF) [4], the rate of cardiac death and revascularization is higher in patients with abnormal MPS [1]. The relatively low rate of MACEs at short follow-up is conceivably the main reason why the noninvasive assessment of CAD provides controversial benefit on screening asymptomatic patients with diabetes. As such, there is the need for further evidence based on a longer observation. We therefore aimed to investigate the prognostic value of MPS in asymptomatic patients with DM for a 5-year follow-up. The impact of a comprehensive therapeutic approach in these patients was also evaluated. Materials and methods Patients Four hundred patients with type 2 diabetes and neither history nor symptoms of CAD were prospectively recruited in the present study as described previously [1]. In short, the high risk of CAD in these patients was documented by end-organ damage (peripheral or carotid occlusive disease, retinopathy, microalbuminuria, and autonomic cardiac neuropathy as measured by Ewing et al. [5]) or by the composite of age older than 55 years, a diabetes duration longer than 5 years, and at least 2 cardiac risk factors (smoking, hypertension, hypercholesterolemia, or positive family history of CAD) in addition to diabetes. Patients older than 75 years, with a life expectancy of less than 3 years, or New York Heart Association (NYHA) functional class IV were excluded. All patients gave written informed consent, and the study protocol was approved by the ethics committee of all 4 participating centers of the Basel Asymptomatic High-Risk Diabetics' Outcome Trial (BARDOT). Study design The design of the present study has been previously described [1] and is shown in Fig. 1. In short, patients underwent clinical |
visits and rest/stress MPS at baseline and after 2 years and a clinical follow-up after 5 years. If baseline MPS was normal, patients were followed without specific CAD therapy. Patients with abnormal MPS findings were randomly assigned 1:1 to an optimal medical or an optimal medical and whenever possible revascularization strategy. Myocardial perfusion scintigraphy All MPS examinations were performed at the core laboratories of the University Hospital Basel, Switzerland. A single day rest/stress protocol was performed, with the rest examination always performed first, using 400 MBq/800 MBq of 99m Tc sestamibi as described earlier [1]. A stress test with a symptom-limited exercise (n = 305) or adenosine (n = 95) stress and electrocardiographic monitoring was used. Reconstructed and re-oriented images were visually scored by two experienced readers blinded to clinical data using a 17-segment model with a 5-point scale according to American Society of Nuclear Cardiology guidelines (0 = normal perfusion, 1 = mild reduction in counts but not definitively abnormal, 2 = moderate reduction in counts and definitively abnormal, 3 = severe reduction in uptake, and 4 = absent uptake) [6]. Summed scores were calculated globally in the myocardium, summarizing the perfusion scores of the 17 segments. The summed stress score (SSS) equals the sum of the scores for all segments in the stress scan, the summed rest score (SRS) equals the sum of the scores in the rest scan, and the summed difference score (SDS) equals the sum of the differences between SSS and SRS in each segment [7]. We firstly compared patients with unremarkable vs. pathologic MPS, using either SSS of ≥4 or SDS ≥ 2 or both as threshold for CAD [1]. For an exploratory analysis, we further compared patients with a completely normal scan (both SSS and SDS = 0) with the remaining patients with perfusion abnormalities of any degree (SSS > 0 or SDS > 0 or both > 0). Endpoints The endpoint was defined by the occurrence of either all-cause death or of a MACE (i.e., a composite of all-cause death, nonfatal myocardial infarction, and/or revascularization without index revascularization). MI was defined according to current definitions [8] and revascularization as late symptom-driven revascularization (i.e., revascularizations necessary in patients who became symptomatic and remained so despite medical therapy). In patients with multiple or recurrent events (i.e., death, myocardial infarction, revascularization without index revascularization), only the first event was counted as MACE with its respective point in time. Statistical analysis Baseline characteristics of all patients, as well as separately survivors and non-survivors, and patients who were revascularized again during follow-up were compared by unpaired t test after normal distribution verification by means of the Kolmogorov-Smirnov test. If the distribution was not normal, the Mann-Whitney U test was used. The Fisher exact test was used to compare binary variables. The rate of death and MACE was compared using Cox proportional hazard models to estimate hazard ratios (HRs) with 95% confidence intervals (CIs) and by Kaplan-Meier curves. The main analysis for the randomized pilot treatment study part was intention to treat. Differences across groups were assessed by means of Kaplan-Meier analysis. Differences between Kaplan-Meier curves were assessed by using the logrank test. An "on-treatment" analysis was performed to account for patients in the invasive treatment group who were not revascularized. This is a descriptive, exploratory analysis. Multiple analyses have been performed with the data set, and it is not clear how to calculate the exact family-wise error rate. Consequently, we did not use explicit means to control the family-wise error rate. Accordingly, we did not treat p values as having a threshold indicating "significance," but rather as a tool, supplementary to the effect estimates (hazard ratios) and their confidence intervals. Conclusions are drawn not for each "statistical test" based on p < 0.05 but on the cumulating evidence and effect sizes from all the models. Analysis was performed with SPSS for Microsoft Windows v. 22 (IBM, USA). Characteristics of patients Baseline characteristics of the 400 patients are shown in Table 1. Enrolled patients were predominantly male (69%) and had a median diabetes duration of 9 years, and 85% presented with more than one diabetic end-organ damage. Patients who died over the follow-up period of 5 years more often presented with shortness of breath, higher resting heart rates, ECG changes during ergometry, and perfusion abnormalities on MPS. There was a tendency to higher occurrence of autonomic neuropathy in patients who died. There were no differences between survivors and deceased patients regarding age, gender, diabetes duration/HbA1c end-organ damage, medication, smoking, or lipid status (Table 1). Higher SSS and SRS were found in patients who died during follow-up, while SDS were not different. Conversely, higher SDS (but not SSS and SRS) were reported in patients undergoing revascularization during the 5-year follow-up. Death, myocardial infarction, and revascularization during 5-year follow-up During the 5-year follow-up period (median 1840 days [IQR 1817-1896]), 15 deaths (3.8%) were recorded and 11 patients (2.8%) suffered from MI (1 STEMI, 10 NSTEMI). Twelve patients experienced more than one event during the 5-year (1), 87 patients had an abnormal baseline MPS and were randomized to a medical strategy (n = 41) or invasive strategy arm (n = 46, intention to treat). Thirty patients (65%) of the invasive strategy arm of the study had been successfully revascularized at baseline, while none of the medical strategy arm underwent an early revascularization. Overall median time between MPS and index revascularization amounted to 42 days [IQR 27-54]; there was no significant difference between index percutaneous coronary intervention and index bypass surgery (p value for comparison = 0.081). In addition to these index revascularizations, 23 more coronary revascularizations have been performed during the 5year follow-up period. Fourteen of these revascularizations were done in patients with normal baseline MPS (14/313, 4.5%) and 9 with abnormal baseline MPS (9/87, 10.3%; p value 0.037). Of these 9 patients, 7 were in the medical strategy arm. Two of these 9 patients were in the invasive strategy arm and were thus twice revascularized (index revascularization and true follow-up revascularization). For a juxtaposition of (1) all patients, (2) patients who survived (n = 385), and (3) patients who died (all-cause mortality, n = 15) regarding the occurrence of death, myocardial infarction, revascularization, and cardiac hospitalizations during the 5-year follow-up period, see also Supplement, Table 1. Prognostic value of MPS for the prediction of all-cause death during 5-year follow-up Eighty-seven patients (22%) showed perfusion defects of various degree (SSS ≥ 4 and/or SDS ≥ 2), while 313 (78%) had a normal baseline perfusion scintigraphy scan (SSS < 4, SDS < 2); 285 (71%) patients had a completely normal scan (SSS = 0 and SDS = 0), which made up the majority (285/313, i.e., 91%) of all normal scans. There was an overall tendency to better survival in patients with normal and a better survival in patients with completely normal baseline MPS (Fig. 2a, b, Table 2). This results in a total 5-year death rate of 2.9% for patients with normal MPS vs. 6.9% with abnormal MPS (p = 0.081), respectively, and 2.5% of patients with completely normal scans vs. 7.0% with perfusion abnormalities of any degree (i.e., with either SSS > 0 or SDS > 0 or both, p = 0.032, Fig. 2). The average death rate per year was 0.6% in both normal and completely normal MPS patients, while patients with abnormal scan had an average death rate of 1.8% per year (Fig. 3). Cox proportional hazard analysis (Supplement, Table 2) displayed that baseline SRS and SSS were predictors of all-cause death (p = 0.048) and a completely normal scan is consistent with a lower risk of death (p = 0.040) (Supplement, Table 2, Fig. 2b). The prognostic accuracy of an abnormal MPS (SSS ≥ 4 and SDS ≥ 2) to predict all-cause death did not reach statistical significance (p = 0.090) (Supplement, Table 2, Fig. 2). Prognostic value of MPS for the prediction of all-cause death, myocardial infarction, or revascularization (without index revascularization) during 5-year follow-up Thirty-six patients did not survive free from myocardial infarction or revascularization (without index revascularization) during 5-year follow-up. A normal MPS during follow-up was associated with a lower rate of MACEs compared to patients with evidence of perfusion abnormalities (22/313, 7.0% vs. 14/87, 16.1%, p = 0.009). The same held true for patients with a completely normal scan (20/285, 7.0% vs. 16/115, 13.9%, p = 0.029, Fig. 2c, d, Table 2). Consistently, Cox proportional hazard analysis (Supplement, Table 2) showed that patients with an abnormal MPS (SSS ≥ 4 and/or SDS ≥ 2) had a higher risk of all-cause death, myocardial infarction, or revascularization (p = 0.011), while a completely normal scan was associated with a very low probability of MACEs (p = 0.032). Impact of therapeutic strategy on prognosis Thirty patients (65%) of the invasive strategy arm of the study (n = 46) had been successfully revascularized (21 by percutaneous coronary intervention, 9 by bypass surgery); 16 patients (35%) of the invasive strategy arm either refused the angiography or revascularization had not been feasible because of unfavorable anatomy [1]. In an intention-to-treat Kaplan-Meier curve analysis, patients with abnormal MPS randomized to medical strategy had worse outcome with respect to death, MI, or revascularization (without index revascularization) compared to both patients with normal MPS and patients with abnormal MPS and subsequent invasive strategy (p = 0.008) (Fig. 4a). For overall survival, the difference between the three groups did not reach statistical significance (p = 0.234) (Fig. 4b). In an as-treated Kaplan-Meier curve analysis, patients with abnormal MPS who had undergone revascularization had a lower mortality rate and a better event-free survival from MI and revascularization than patients who had undergone medical therapy only and patients who either refused invasive evaluation or in patients in whom revascularization was not feasible (p = 0.007, Fig. 4c). Of note, no deaths were recorded among those patients with abnormal MPS in the invasive strategy arm and successful index revascularization (Fig. 4d). Discussion The BARDOT trial showed that MPS allows for robust risk stratification in asymptomatic diabetic patients at high cardiovascular risk up to 2 years after testing [1]. Patients with a normal MPS at baseline had similar mortality rates as the normal population. In contrast, patients with an abnormal MPS had significantly higher event rates. In patients with abnormal MPS, patients who underwent protocol revascularization in addition to optimal medical therapy had lower event rates than patients with medical therapy only. The recently published guidelines of the European Society of Cardiology (ESC) do not recommend routine screening of MPS, myocardial perfusion scintigraphy; MI, myocardial infarction; SRS, summed rest score; SSS, summed stress score; SDS, summed difference score asymptomatic diabetic patients, since the impact of routine screening of CAD in asymptomatic DM and no history of CAD has shown no differences in cardiac outcomes [3]. Our work expands the current knowledge, providing insights into the long-term predictive role of MPS in the assessment of asymptomatic high-risk diabetic patients. findings can be summarized, when patients are followed up for at least 5 years. First, it was confirmed that a reduced rate of MACEs in the selected populations also pertains to a longer follow-up if baseline MPS is unremarkable. The clinical implications of these findings are relevant, as the role of MPS as a screening test to identify those patients at increased risk of developing MACEs on a relatively long follow-up is controversial. The DYNAMIT trial [9] showed no significant difference between the screening and the usual care group for the primary outcome, defined as all-cause death, myocardial infarction, or heart failure. The DIAD trial showed no difference in the occurrence of cardiac death or nonfatal myocardial infarction between patients screened and not screened with MPS [10]. The controversy may be related to the difference in the study design and to the different patients' population. In fact, patients in the DIAD study had a lower cardiovascular risk compared to our population: besides having a lower rate of end-organ damage, only 6% of patients in the DIAD trial had perfusion defects of at least 5% of the myocardium which was required in all BARDOT patients. Moreover, the randomization in the DIAD study was performed to select those patients willing to undergo an MPS, while our randomization followed the results of MPS, thus comprising all patients with perfusion abnormalities. Then, |
the therapy decision in case of perfusion abnormalities in the DIAD trial was left at the discretion of the treating physician, while the decision algorithm in our study was established per protocol [1]. Finally, outcome measures of DIAD were restricted to cardiac death or MI, while we also included revascularization as cardiac event, which also needs to be considered if CAD progression is assessed. As such, we confirm the complementarity of our and previous published studies: a general screening of all asymptomatic patients with diabetes may not be needed but is of prognostic value in asymptomatic patients with diabetes at high coronary risk, as also underlined in the most recent guidelines [3]. Of note, scintigraphic data showed a prognostic significance in our patients' population, while other important clinical variables did not. Specifically, shortness of breath was one of the few clinical variables associated with a worse survival rate, while, e.g., autonomic impairment and higher heart rate showed, if at all, only a weak tendency toward a worse outcome. These results are consistent with a previous report on 1737 patients with diabetes mellitus, wherein the rate of death and/or myocardial infarction was three times worse in diabetic patients with shortness of breath and MPS findings were strongly predictive of outcome [11]. The second point is the warranty period of a completely normal MPS in asymptomatic diabetic patients at high cardiovascular risk. When to (re)-evaluate cardiac risk is an important question. When should a diabetic patient with a normal scan be retested? In this context, a first retrospective study postulated a warranty period of 1 to 3 years in patients with a normal MPS [12]. Acampa et al. [13] also expanded on this topic in a population of both symptomatic and asymptomatic diabetic patients, showing that even in case of a normal MPS diabetic patients are at higher risk for cardiac events and that the warranty period of a normal stress MPS varies according to diabetic status and post-stress LVEF. The same group [14] also showed that in asymptomatic diabetics, post-stress LVEF ≤45% and a large stress-induced ischemia are predictors of a worse risk over time at long-term follow-up. Our study provides more evidence on this important topic. Independently from diabetic status and clinical manifestations, MPS proved effective in predicting a more favorable outcome, and patients with a completely normal MPS had an excellent prognosis over 5 years with mortality rates (0.6%/year) similar to that of the normal population. As such, it may be maintained that there is no need for retesting for CAD within 5 years even in patients with diabetes at high risk in case of a completely normal scan. Third, we confirm the better outcome of patients treated with a combined medical and invasive approach also for a longer follow-up. The question as to whether an invasive approach should be pursued in patients with detectable ischemia is a matter of debate. While some reports showed a benefit of the invasive strategy over medical therapy alone [15,16], the recent ISCHEMIA Trial [17] reported no evidence of benefit of an initial invasive strategy over a conservative one with regard to the occurrence of MACEs or death from any cause in patients with stable angina. It should be noted that none of these papers focused on diabetic patients at high cardiovascular risk. Conversely, the BARI-2D trial, focused on diabetic patients, showed reduced rate of MACEs in patients revascularized with CABG (22.4%) compared to those treated with medical therapy approach (30.5%, p = 0.01), thus suggesting a benefit from the revascularization strategy in diabetic patients [18]. Furthermore, a retrospective study featuring asymptomatic diabetic patients showed an improved survival rate in patients undergoing revascularization compared to those treated medically [19]. The results of our study support the concept that an invasive/revascularization strategy may be preferred in asymptomatic diabetic patients with scintigraphic evidence of CAD in view of their better outcome. In fact, patients undergoing revascularization in our population had a favorable outcome, which was equivalent to those patients with an unremarkable MPS, thus bearing importance in clinical practice for the choice of the most appropriate therapeutic option. Limitations First, the study was planned before calcium scoring and CTbased coronary angiography (CCTA) were routinely used, as such the impact of coronary calcification and/or significant stenosis as detected on CCTA cannot be assessed. Furthermore, MPS protocol did not use the most recent technological improvements on image reconstruction such as attenuation and scatter correction. However, prone images were employed to increase the specificity of the technique, and the observers' experience (>10 years) makes it unlikely that the use of the most modern protocols would significantly have modified our results. Conclusion MPS has prognostic value in asymptomatic diabetic patients at high cardiovascular risk over a follow-up period of 5 years. Patients with a completely normal MPS have a low event rate and do not need retesting within 5 years. Patients with an abnormal MPS have higher event rates and may benefit from a combined medical and revascularization approach. Author contribution All authors have read and approved the manuscript and agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Funding Open Access funding provided by Universität Basel (Universitätsbibliothek Basel). Declarations All the authors declare no conflicts of interest. All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the principles of the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. A formal approval from the local Ethical Board was obtained for the present study. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Comparison of Clinical Characteristics and Outcomes Between Positive and Negative Blood Culture Septic Patients: A Retrospective Cohort Study Background Few studies have studied the relationship between blood culture and mortality in sepsis patients. The aim of this study was to compare the characteristics and outcomes of positive and negative blood culture sepsis. Methods We performed a study on 640 patients suffering from sepsis in Beijing Chao-Yang Hospital from October 2017 to December 2019. The primary findings revolved around length and expenditure of hospital stay, the possibility of suffering from acute respiratory distress syndrome (ARDS), and any requirements for mechanical ventilation. The secondary findings revolved around whether the patient died early (28-day) or late (28-to-90-day). Results A total of 592 of the 640 patients met the inclusion criteria for sepsis, with 274 of them having culture-positive results. The culture-positive patients were mostly elderly suffering from diabetes and at risk of cancer, with a higher white blood cell count, and higher procalcitonin. Additionally, they scored higher in their acute physiology and chronic health evaluation II score (15 vs.11, P=0.010), as well as in their predisposition, infection, response, and organ dysfunction (17 vs 11, P<0.001) than the individuals in the culture-negative group. Culture-positive patients had a longer duration of hospital stay (14 vs 6, P<0.001) and higher in-hospital mortality (14.6% vs 8.5%, P=0.019) than culture-negative ones. No significant difference in intensive care unit (ICU) mortality (45.7% vs.36.4%, P=0.254) or early mortality (9.5% vs 7.2%, P=0.321) was noted between the two groups. However, the culture-positive patients had increased late mortality (15.7% vs.6.9%, P=0.001), when compared with those with culture-negative results in the cohort. Furthermore, the culture-positive patients who received the appropriate antibiotics early had a lower mortality rate than the culture-negative patients (7.3% vs.14.2%, P=0.008). Conclusion Culture-positive patients had higher in-hospital mortality, comparable early mortality, and worse late mortality than the culture-negative patients. Early appropriate use of antibiotics might reduce mortality and improve clinical prognosis. Introduction Sepsis is a major cause of morbidity and mortality across both developed and developing nations. 1 Over the past decade, the incidence of sepsis has been increasing worldwide, and its morbidity and mortality are still unbelievably high. 2 In the United States, severe sepsis and septic shock remain the dominating causes of ICU deaths, with about 90-300 million people per year dying as a result. 3 ICU expenditure is therefore far above the affordable rate for the country. 4 So, minimizing patient costs and reducing hospital mortality are the goals that doctors currently strive for. It is well-known that bacteria are the main cause of sepsis pathogens 5 and that early selection of appropriate antibiotics can improve chances of survival. 6 There are several guidelines that widely recommend empirical application of broad-spectrum antibiotics, demonstrating that a timely and effective course of antibiotics can reduce mortality. 7 Blood culture can be used to guide the adjustments of an empiric antibiotic treatment regimen, 8 with positive blood culture having been suggested as a surrogate marker for bacteria load. 9 Culture-positive patients are often considered to have a higher infection load and suffer from worse outcomes. 10,11 Early and appropriate use of antibiotics can reduce mortality. However, microorganisms are unable to be cultivated in about one third to two thirds of sepsis patients, 12 making it impossible to accurately apply antibiotics in the early stage, and therefore increasing the risk of death. Recent studies have shown that culture-negative and culture-positive sepsis patients are comparable in both characteristics and outcomes. 13,14 Only a few studies have shown the epidemiology and outcomes of culturenegative sepsis. 3,12 Few studies have studied the relationship between blood culture and mortality in sepsis patients. There is almost no published research discussing the distribution of pathogenic bacteria in different areas of the hospital and its impact on the mortality of patients with sepsis. Herein, we performed a retrospective study to compare the characteristics and outcomes of positive and negative blood culture in septic patients, study the characteristics of pathogenic bacteria in the different areas of the hospital and analyse early and late mortality in blood culture sepsis. Methods and Materials Study Design This was a retrospective cohort study conducted in Beijing Chao-Yang Hospital. We included all 640 patients admitted to our hospital for sepsis with blood culture during the period October 2017 to December 2019. Sepsis with blood culture was defined according to The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). 15 Patients with fungal, viral, or parasitic infections, or tuberculosis were excluded. We only made a record of the bacteria infection. We also excluded those patients who refused to be treated or were transferred to other hospitals. Finally, we compared and analysed the differences between the blood culturepositive and blood culture-negative septic patients. Data Collection and Definition of Variables All patients with blood culture were recorded in the hospital system. An infection had to be clinically defined by at least two specialists. The SOFA (Sequential Organ Failure Assessment) score was used to evaluate sepsis in each patient with a suspected infection. According to The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3), an infection was defined as sepsis if the SOFA score was equal to or more than 2. The remaining 592 septic patients with blood culture met the inclusion criteria for sepsis and were ultimately included. According to local practices, blood cultures were obtained within 3 hours of recognition from samples collected at two or more different anatomical sites. 16 The blood culture bottles used were BD BACTEC 23F (aerobic medium) and 22F (anaerobic medium). Each bottle was incubated into the BacT/ALTER 3D instrument and waited for atleast 5 days. All isolated bacteria were identified using growth on differential agar and biochemical tests and identification with Phoenix 100 (Becton Dickinson, Franklin Lakes, USA). Clinical bloodstream infection-(BSI) was defined as at least two sets of positive |
blood cultures from separate sites, one set positive for a Grampositive pathogen or one set positive for a Gram-negative pathogen. The contamination was regarded as coagulase negative which isolated from only one of at least two sets of blood cultures. When indwelling catheters were used, one blood sample was obtained through the catheter, with the remainder taken from different peripheral venous sites. The major infection sites were grouped as the lower respiratory tract, urinary tract and abdominal infection, and the minor sites were grouped as isolated blood stream infection, skin and soft tissue infection, and the central nervous system. 17 The collected data include demographics, underlying diseases, initial vital signs, infection sites, and clinical outcomes, such as ICU admission, duration of ICU stay and expenditure, and mechanical ventilation requirements. The date of the patient's death was obtained from the hospital's electronic medical record system. Early https://doi.org/10.2147/IDR.S334161 DovePress Infection and Drug Resistance 2021:14 4192 mortality was defined as 28-day mortality and late mortality was defined as 28-to-90-day mortality. The information on in-hospital mortality, ICU mortality, and early or late mortality was extracted. The proportion and fatality of the different pathogens were also recorded. Laboratory examinations, including white blood cell (WBC) counts, platelet (PLT), albumin (ALB), C-reactive protein (CRP), procalcitonin (PCT) and lactate (Lac) were also extracted from the data. When the initial antibiotics were changed to cover more extensive pathogens, an escalation of the antibiotics occurred. SOFA scores, Acute Physiology and Chronic Health Evaluation II (APACHE II) scores, Mortality in Emergency Department Sepsis (MEDS) scores and Predisposition, Infection, Response, and Organ dysfunction (PIRO) scores were calculated from the clinical data and used to assess the severity of the infection. Additionally, the microbiological culture results and information on the required antibiotics were extracted from the electronic medical records. In the case of a disagreement concerning the discrimination of the exact pathogen, the final decision was taken by three experienced infection specialists after cautious discussion. All pathogenic bacteria included in the cohort were obtained in strict accordance with blood culture standards. Furthermore, receiving appropriate antibiotic prescriptions meant that the antibiotics could effectively treat the pathogens in time. The primary outcomes were ICU mortality, ICU stay duration, and expenditure, as well as mechanical ventilation requirements. The secondary outcome variables were early mortality and late mortality between culture-positive and culture-negative sepsis patients. Statistical Analysis We classified the patients into two groups: positive and negative blood culture groups. We expressed the categorical variables as numbers (percentages). After using the Kolmogorov-Smirnov test and examining histograms to verify whether the normality and homogeneity assumptions had been satisfied, we expressed the normally distributed numerical variables as a mean (95% confidence interval (CI)) and the other numerical variables as the median (inter-quartile range). We compared the categorical variables using the χ 2 test or Fisher exact test, the normally distributed quantitative variables with the t-test, and the other quantitative variables with the Mann-Whitney U-test. We used the Bonferroni correction for pairwise comparisons. In order to identify the independent predictors for culture-positive or culture-negative mortality, we performed a logistic regression analysis. The Kaplan-Meier survival curves with the Log rank test were stratified by the culture results. We used SPSS 25.0 (IBM Corp., USA) for statistical analyses, with a P value < 0.05 considered significant. Study Cohort and Patient Characteristics In this cohort, 640 patients with blood culture were defined as having sepsis. 275 of these (43.0%) had severe sepsis and 108 (16.9%) had septic shock. We only recorded bacterial infections. Patients (n=36, 5.6%) with fungal, viral, or parasitic infections were excluded, as were those with tuberculosis. We also excluded patients who refused to be treated (n=4, 0.6%) and those transferred to other hospitals (n=8, 1.2%). Of the 592 patients that met the inclusion criteria, 274 (46.3%) were identified as culture-positive sepsis patients and 318 (53.7%) were identified as culture-negative sepsis patients. The majority of culture-positive patients were elderly and male (63.9%), and were more likely to have chronic obstructive pulmonary disease (COPD), hypertension, congestive heart failure (CHF), diabetes mellitus (DM) and tumours. In the culture-negative patients meanwhile, cerebrovascular disease (CVD) and chronic renal disease (CRD) were more common (Table 1 and Figure 1). When evaluating the source of the infections, the most frequent sites were the lower respiratory tract and urinary tract, in both the culture-positive and culture-negative groups. The differences between the two groups were obvious in lower respiratory tract infections (58.5% vs 45.9%, P=0.002) and urinary tract infections (23.0% vs 14.8%, P=0.01) (Table 1 and Figure 2). Clinical Characteristics and Severity of Illness We compared the vital signs, laboratory examination results and severity scores between the culture-positive and culturenegative sepsis patients. Culture-positive patients had higher heart rates and respiratory rates, and a lower mean blood pressure (MBP) than the culture-negative patients. Culturepositive patients were also more likely to develop severe sepsis or septic shock. Culture-positive patients commonly had higher infection markers in their WBC counts and PCT, as well as having lower ALB. All these findings suggest that Table 2). Multiple Highly Pathogenic Bacteria Aggravate the Poor Outcome of Culture-Positive Patients We also studied the culture-positive pathogens throughout the hospital, ICU, and emergency department (ED), and found that Gram-negative bacteria surpassed Grampositive bacteria in the throughout hospital, whereas the opposite results were found in ICU and ED. Of the total 274 culture-positive patients, 147 cases (53.6%) had Gram-negative bacteria and 127 cases (46.4%) had Grampositive bacteria. Escherichia coli (16.8%) was the most commonly found Gram-negative bacteria, followed by Klebsiella pneumoniae (12.8%), Pseudomonas aeruginosa (3.3%) and Acinetobacter baumannii (2.6%). Among the Gram-positive bacteria, Enterococcus faecium (8.8%), Staphylococcus epidermidis (8.0%), Staphylococcus hominis (7.3%) and Staphylococcus aureus (5.5%) were the four most common. Of the 274 culture-positive cases, 69 patients died, where the total mortality caused by Klebsiella pneumoniae (26.1%), Escherichia coli (20.3%) and Staphylococcus aureus (15.9%) was higher than from other pathogenic bacteria. When comparing the net mortality, we found that Staphylococcus aureus had the highest net mortality (73.3%) in the throughout hospital, followed by Klebsiella pneumoniae (51.4%), Pseudomonas aeruginosa (44.4%) and Acinetobacter baumannii (42.9%) ( Table 3 and Figure 3). When studying the bacteria in the ICU, the results showed that 37 patients, out of the total 81 patients there, had died. The proportion of Gram-positive bacteria (56.8%) was higher than Gramnegative bacteria (43.2%). Klebsiella pneumoniae (11.1%), Acinetobacter baumannii (8.6%) and Escherichia coli (7.4%) were the three most common Gram-negative bacteria, while Staphylococcus hominis (12.3%), Enterococcus faecium (9.9%) and Staphylococcus epidermidis (8.6%) were the three most common Gram-positive bacteria. When comparing total mortality, Klebsiella pneumoniae and Acinetobacter baumannii both had high mortality in the ICU. Although the (Table 4 and Figure 4). This result between the throughout hospital and ICU was similar. Although the data seemed to be different in Tables 3 and 4, the above four pathogens were similar in terms of high net mortality. The bacteria in the ED were also analysed, with the results showing that the quantity of Gram-positive bacteria was almost two times that of the Gram-negative bacteria. Different types of Staphylococci accounted for the vast majority of Gram-positive bacteria, with Staphylococcus epidermidis and Staphylococcus human accounting for the highest proportion. Although the proportion of Staphylococcus aureus was small, its mortality was very high. The highest proportions of Gram-negative bacteria remained Klebsiella pneumoniae, Escherichia coli and Acinetobacter baumannii, all of which resulted in a high mortality rate (Table 5 and Figure 5). Clinical Outcomes and Poor Prognosis Between Culture-Positive and Culture-Negative Sepsis With regards clinical outcomes, the culture-positive group had a higher occurrence of ICU admission (29.6% vs 20.8%, P=0.013) and ICU length of stay (14 vs 6, P<0.001) than the culture-negative patients. There was no difference in ICU cost Figure 6). We plotted out the Kaplan-Meier survival curve to facilitate a visual comparison between the two groups ( Figure 7). Since there were many confounding factors between both groups, it was impossible to intuitively compare the factors affecting mortality. A repeated regression analysis was carried out to analyse the factors affecting culturepositive and culture-negative mortality. Age, WBC, Lac, CRP, PCT, MEDS and PIRO were all risk factors for culture-positive mortality, while ALB was the protective factor. Of these, PIRO was the independent predictor (P=0.010). It was also determined that gender, age, Lac, PCT, MEDS and SOFA were all risk factors for culture-negative mortality. Age and ALB were seen to be the independent predictors for culturenegative sepsis (P<0.05) (Figure 8). We further performed a subgroup analysis on the culture-negative, culture-positive appropriate antibiotics and culture-positive inappropriate antibiotics groups. All 274 culture-positive patients received an antibiotics prescription on the first day of admission. The culture-positive subgroup that received an appropriate antibiotics prescription had a significantly lower mortality rate than both the culture-negative group (7.3% vs 14.2%, P=0.008) and the culture-positive subgroup that did not receive an appropriate antibiotics prescription (7.3% vs 17.9%, P<0.001). The culture-positive subgroup that did not receive an appropriate antibiotics prescription had a higher mortality rate than the culture-negative group, but this was not statistically significant (17.9% vs 14.2%, P=0.216) ( Table 6 and Figure 9). Discussion This cohort study shows that culture-positive patients are more likely to be admitted into an ICU and have a longer ICU stay than culture-negative patients. Culture-positive patients have a higher comorbidity burden, higher clinical severity, and higher in-hospital mortality rate than culture-negative patients. Additionally, they have comparable early mortality (28day) but worse late mortality (28-to-90 day). Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Staphylococcus aureus all have strong mortality and aggravate poor prognoses in the ICU. The culture-positive subgroup that received an appropriate antibiotics prescription on the other hand, had a significantly lower mortality than the culture-negative group in this study. The differences between these two groups are likely due to differences in patient populations, proportions of infection sites and resistance to antibiotics. 18 The long periods under mechanical ventilation, including under invasive ventilators and non-invasive ventilators, as well as the length of stay in the ICU, and the higher in-hospital mortality rate that was observed in the culture-positive patients were likely attributed to the greater occurrence of risk factors. These risk factors included patients being older, and having more severe infections, worse malnutrition, and higher proportion of malignancies, as well as higher SOFA score, APACHE II score, MEDS score and PIRO score than the culture-negative patients. Previous retrospective studies have shown that culturepositive patients with intra-abdominal infections and lung infections are associated with poor clinical outcomes. 19,20 Urinary tract infections on the other hand, are related to better clinical outcomes than other infections. 21 However, the most commonly seen infection sites for both groups in our study were in the lower respiratory tract and urinary tract. The reason for this difference could be the different research scope in the studies. Previous studies included a wider scope for the culture patients, including blood, urine, stool, sputum, and pus, while our research only focused on the blood culture aspect. We also found that culture-negative patients with lung or urinary tract infections had lower mortality. This was consistent with the result that culture negativity might imply susceptibility to the initially prescribed antibiotic regimens, leading to lesser severity of the disease. In addition, the clinical outcomes could be associated with the infection sources as well as the management of the sepsis patients. 18 Early comprehensive treatments, such as fluid resuscitation, appropriate use of antibiotics, nutritional support, and cleaning and care of infected sites, played a vital role in reducing mortality and improving clinical prognosis. Differently to culture-positive patients, the clinical prognosis of culture-negative patients was also not good despite their late mortality being lower. One reason for this might be the failure to cultivate special pathogenic bacteria in time, thus delaying the early use of antibiotics. However, why should patients presenting clinical sepsis have a culture-negative infection? There were five main reasons. First, cultures lack the sensitivity to identify all bacteria, 22 with possible reasons including sampling error, insufficient volume for blood cultures, poor transport conditions, and slow-growing or fastidious bacteria. Second, the patients may have been prescribed empirical antibiotics at local clinics before the sepsis or septic shock developed. 23 Third, the proportion of sepsis or septic shock caused by atypical pathogens, including fungal, parasites and viral infections, might be increasing in patients. 24,25 In terms of effective definitive antimicrobial therapy, these atypical pathogen infections might be |
similar to culture-positive infections. Common microbiological methods usually fail to identify the microorganism. Fourth, some patients suffering with culture-negative sepsis or septic shock might have got it from non-infectious causes, such as metabolic disorders, tissue injuries, inflammatory diseases, adverse effects from drugs, malignancies, or subarachnoid haemorrhages. 26,27 Fifth, certain infections are less common in culture-negative patients than in culture-positive patients. This is in part due to the nature of some infections, for example, liver abscesses are less likely to be negative. 28 In our research, we also further investigate the influence of different pathogenic bacteria on mortality, something which has rarely been studied or analysed in previously published studies. We found that Gram-positive and Gram-negative bacteria roughly equalled the proportions found in the throughout hospital's culturepositive bacteria. Of the total 147 Gram-negative bacteria, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii accounted were the four most prevalent. For the Gram-positive bacteria, Enterococcus faecium and different kinds of Staphylococcus were the main pathogenic bacteria. Although appropriate antibiotics were used during the early stages based on the blood culture results, the late mortality and total mortality of the culture-positive group were still relatively high. The reasons behind the high mortality, such as older age, severity of illness, malignancies, and even antibiotic resistance, could be complex. Resistant Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, Enterococcus faecium and Staphylococcus aureus could all aggravate the late mortality of patients with sepsis. These results were similar to those found among the patients in the ICU. The appropriate use of antibiotics significantly reduced the mortality, especially when compared to the inappropriate use of antibiotics or culture- negative sepsis, but the total and net mortality of the sepsis patients in the ICU remained high, which is also related to older age, illness severity, malignancies, and antibiotic resistance. However, in the hospital's ED, the number of Gram-positive bacteria was found to be almost double that of Gram-negative bacteria. Of which various kinds of Staphylococci, such as Staphylococcus epidermidis, Staphylococcus hominis, Staphylococcus capitis, Staphylococcus longum and Staphylococcus haemolyticus, accounted for the vast majority of Gram-positive bacteria. The proportion of Staphylococcus aureus that accounted for high mortality was only 6.5%, while the frequency of other kinds of Staphylococcus and Enterococcus faecium that accounted for lower mortality was as high as 50.7%. Due to the blood culture time being long and the results not being reported quickly enough, there was no evidence of using appropriate antibiotics against Gram-positive bacteria in the early stages as this may have delayed working in the golden period of treatment. Thus, although some Staphylococcus and Enterococcus faecium were deemed less lethal, the delay in the use of antibiotics against Grampositive cocci increased the early mortality of septic patients. In addition, the severity of the patients' conditions in the ED also increased mortality and poor prognosis. More importantly, our aim was to make a pathogen spectrum as soon as possible by studying the distribution characteristics of pathogens, so as to provide guidance for early appropriate use of antibiotics, improve treatment plans, strengthen patients care to reduce cross-infection, and even prevent the drug-resistant. The distribution characteristics of these pathogen samples were very important data, which could be expanded and made a blood culturepositive pathogen spectrum. For critically ill patients with sepsis, antibiotics could be used empirically based on this pathogen spectrum before blood culture results were obtained. For those who had obtained blood culture results, the appropriate use of antibiotics could be instructed, thereby avoiding the inappropriate use of antibiotics, significantly reducing mortality and improving prognosis. These were essential to improve clinical treatment capabilities and save patients' lives. What are the implications of our study? We compared and analysed the clinical characteristics, illness severity, and early or late mortality between blood culture-positive and blood culture-negative sepsis patients. We found that elderly males with culture-positive sepsis were more likely to have chronic diseases and tumours, as well as more likely to suffer malnourishment and severe infections. We also found that Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii and different kinds of staphylococcus composed the majority of culture-positive bacteria and posed a higher mortality rate. Despite the timely use of appropriate antibiotics and other comprehensive treatments for cultured special pathogens, culture-positive septic patients still displayed a higher mortality rate. This might be related to older age, illness severity, malignancies, or antibiotic resistance. Previous studies have shown that in an effort to improve outcomes in culture-negative or culturepositive sepsis, the "Surviving Sepsis Campaign" guidelines recommend early administration of broad-spectrum antibiotics. 6 From the onset of septic shock, every hour of delay in the administration of effective antibiotics results in increased mortality. 29 Our research also confirmed this fact. For those septic patients admitted to the ED, failure to cultivate specific Gram-positive cocci in the early stages delayed the timing for the prescription of appropriate antibiotics, and thereby increased the mortality rate. Meanwhile, both the culture-negative septic patients and the culture-positive patients who did not receive appropriate antibiotics had a high mortality rate. Therefore, early and appropriate antimicrobial therapy is shown to be necessary for these patients, and aids the improvement of clinical outcomes. Our study has several limitations. First, some culturenegative results came from inappropriate sampling. In retrospective studies, improper operation by the staff of the microbiology laboratory, contamination caused by incomplete environmental disinfection, and even quality problems of certain blood culture reagents and so on might all lead to improper handling of samples. This might be the cause of possible contamination. However, the majority of the samples were obtained by experienced physicians and nurses, and this is less likely to be a significant contributing factor to our study. Second, our study was composed of single-centre retrospective research, and therefore cannot represent the universality of all studies. Third, there was heterogeneity among our cohort study and some underlying confounders may have influenced on our results. We should therefore carry out further research to reduce any confounding factors in the future. Our study also had some strengths. We analysed the distribution and characteristics of the pathogenic bacteria in different areas of the hospital, and explained in detail how pathogenic bacteria affect mortality and clinical outcomes. This may be helpful for prescribing appropriate antibiotics. We also used a logistic regression analysis to determine the influencing factors for culture-positive and culturenegative patients, and drew a forest plot to facilitate intuitive research; something which has rarely been seen before. Conclusion We found that culture-positive patients were more likely to be admitted to an ICU, have longer ICU lengths of stay, higher mechanical ventilation requirements and more likely to merge with ARDS than the culture-negative patients. Culture-positive patients had a higher comorbidity burden, higher clinical severity, and higher in-hospital mortality, as well as comparable early mortality (28-day) but worse late mortality (28-to-90 day) than culturenegative patients. Additionally, early blood culture results could provide a basis for the appropriate use of antibiotics, and early appropriate use of those antibiotics might reduce mortality and improve clinical prognosis. Large scale studies are still required in order to confirm these results. Highlights • Studies on the comparison of characteristics and outcomes between positive and negative blood culture septic patients are rare. Our research provides guidance for reducing mortality and improving clinical prognosis. • The distribution and characteristics of pathogenic bacteria in different areas of the hospital may be helpful for prescribing appropriate antibiotics. • A forest plot was drawn to facilitate intuitive research for culture-positive and culture-negative patients which has rarely been seen before. Data Sharing Statement The dataset that was used to support the finding of this study will be made available from the corresponding author upon reasonable request. Ethics Approval and Consent to Participant This study was approved by the Institutional Review Board of affiliated hospital of Capital Medical University, Beijing, China (CCMU-R2021077) and conducted in accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants. Clear cell adenocarcinoma of the uterine cervix in a 24-year-old woman. Case report and review of the literature Carcinoma of the uterine cervix is the most common gynecologic malignant neoplasm all over the world [1, 2], but the second one in Poland after carcinoma of the endometrium [3]. In 2009 in Poland the number of its new cases was 3102, and the age-adjusted incidence rate was 10.2 per 100 000 women. In the age group 20-24 year the age-adjusted incidence rate of the cervical cancer was 0.4 per 100 000, and there were 6 new cases noted in Poland. It constituted 1.86% of the cancer incidence rate of all localizations in this age group in Poland [3]. The most common histological type of malignant cervical neoplasms is squamous cell carcinoma. Adenocarcinomas account only for approximately 15% of malignant cervical tumors [1, 2, 4, 5]. The screening based on exfoliative cytology introduced in the 1950s by Papanicolau, followed by colposcopy in appropriate patients, is an effective method for identifying squamous intraepithelial lesions [1, 2]. low doses of oral contraception. She had a history of numerous consultations with an internist, gynecologist, and psychiatrist as well, because of the symptoms described above. In December 2004, during gynecological examination, a cervical lesion 1.8 cm × 1.2 cm × 1.0 cm in size was diagnosed, and the Pap-smear was taken. The lesion was described as soft, fragile and hypertrophic. The cytological specimen was classified according to the Bethesda score as adequate for the assessment, with the presence of atypical glandular cells of undetermined significance (AGUS), and it corresponded to Pap III. A biopsy was recommended. The histopathological specimen taken from the uterine cervix showed polypoid tissues with inflammatory changes, glandular hypertrophy and the Arias-Stella reaction. The glandular cells showed signs of macronucleosis and little proliferative activity (measured by Ki-67). Diagnostics to check for endocervical pathology or ectopic pregnancy were recommended. The patient was referred to the gynecological unit with suspected ectopic pregnancy. She was not admitted to the hospital because of lack of clinical, sonographic and hormonal symptoms (low serum β-human chorionic gonadotropin [β-HCG] concentration) of ectopic pregnancy. The patient was hospitalized after 2 weeks in the gynecological unit of another hospital with suspected ectopic pregnancy. In gynecological examination the presence of the cervical lesion was confirmed, and again a Pap-smear and a biopsy were taken. Other pathological findings were not observed. The serum concentrations of β-HCG on consecutive days were all normal (< 0.1 mIU/ml). The sonographic examination showed the uterus with regular shape, sized 43 mm × 31 mm × 46 mm, with the endometrium of 10 mm thickness. No pathological findings in both adnexa were found. In the sonographic examination, a layer of fluid in the recto-uterine pouch of thickness 11 mm was visualized. She was discharged from the hospital. The cytological specimen was classified according to the Bethesda system as adequate for the assessment, but limited by inflammation and the numerous metaplastic cells, and it corresponded to Pap II. In the biopsy taken from the cervical erosion clear cell adenocarcinoma stage Ib according to the FIGO classification was diagnosed, and the patient was sent to the oncological unit. On admission to the Department of Gynecologic Oncology, the concentrations of tumor markers in blood were in the normal range, and their values were as follows: AgSCC = 5.0 ng/ml; β-HCG ≤ 0.1 mIU/ml; AFP = 1.6 IU/ml; CEA = 1.19 ng/ml; CA 125 = 20.98 IU/ml; CA 19.9 ≤ 0.6 IU/ml; CA 72.4 = 0.826 IU/ml; CA 15.3 = 18.41 IU/ml; CYFRA 21.1 = 0.464 ng/ml. The laboratory blood tests, including morphology, electrolytes, creatinine, urea, serum proteins and total bilirubin, presented normal values. The patient was scheduled for a laparotomy. During the operation total hysterectomy with bilateral salpingooophorectomy, appendectomy and radical pelvic lymphadenectomy was performed. No signs of extra-uterine spread of the neoplastic disease was macroscopically observed. Histologically the initial diagnosis of primary cervical clear cell carcinoma stage Ib was confirmed. The postoperative period was uncomplicated, and the patient was discharged from the hospital. After several weeks she was qualified for successive adjuvant radiation therapy (teletherapy and brachytherapy). The patient, 88 months after the surgical treatment, is still under observation in our department. No signs of recurrence have been detected since then. The incidence of malignant neoplasms of the genital organs in young women under 25 years old is relatively low [2,3]. The presence of non-specific symptoms, |
as in our patient, makes the diagnosis more difficult. Additionally, when the cancer is of a rare localization, the popular diagnostic methods could be less effective [4]. These factors together could delay the correct diagnosis and worsen the prognosis for patients [5]. Additionally, we have to emphasize the negative familiar history of cancer, and the lack of epidemiological risk factors of cervical cancer, such as HPV infection, multiple sexual partners, smoking and low socioeconomic status, in the presented case [1,5]. No history of exposure to diethylstilbestrol (DES) was noted as well, although it is known that clear cell adenocarcinoma is rare in women without in utero DES exposure and in such cases it concerns in most cases postmenopausal women [7]. The only risk factor present in our patient, but typical for this age group in the population, was the history of oral contraceptive use, which was suggested by some authors to increase the incidence of cervical adenocarcinoma, especially in the group of recent and current users [4,5]. The only presented clinical manifestations of the pathological transformation on the uterine cervix in our patient were abnormal vaginal bleeding, according to many authors the most common symptom of cervical adenocarcinoma, and the presence of cervical erosion [6,8]. It is important to note the presence of atypical glandular cells of AGUS in the cytological smear, and the Arias-Stella reaction in the cervical biopsy. It is known that designation of AGUS applies to glandular cells which demonstrate changes beyond those encountered in benign reactive processes, yet which are insufficient for a diagnosis of a preinvasive or invasive glandular neoplasm [1]. Only a minority of women with such findings are at risk for significant lesions, and many of them are evaluated and treated unnecessarily. The coexistence of AGUS in the smear with the Arias-Stella reaction might be a sign of developing cervical glandular pathology [9,10]. The Arias-Stella effect is known as a benign, proliferative change, which occurs in the Mullerian epithelium in response to hyperprogestational status. The reaction was first described by Javier Arias-Stella in 1954 as striking cellular and nuclear atypia of endometrial secretory glands [9,10]. These changes can typically occur with ectopic as well as intrauterine pregnancies, but it has been described involving endometriosis and various sites in addition to the endometrium, including the endocervical glands and polyps, vaginal adenosis, paratubal and ovarian cysts, and fallopian tube epithelium [9]. When the effect occurs in an unusual localization such as the cervix, the nature of the changes may not be attributed to the Arias-Stella reaction, and the possibility of a malignant process, especially with the presence of clear cell adenocarcinoma, is often raised. It concerns both the cytological and histological specimen [9,10]. According to Nucci and Young [9], as well as Yates et al. [10], despite the large similarities between the cytological appearance of clear cell adenocarcinoma and the Arias-Stella changes, in most cases two important distinguishing features can be seen. The first is the frequent presence of intranuclear inclusions in cases of Arias-Stella change, which has not been described in clear cell adenocarcinoma. The second is the lack of prominent eosinophilic nucleoli in the Arias-Stella change, which is characteristically connected to cervical clear cell adenocarcinoma [9,10]. According to Shizuko et al., cytological findings of clear cell adenocarcinomas with a predominantly papillary growth pattern are characterized by 1) amorphous substances (substances in the basement membrane) pale green in color at the center of the cluster and 2) a mirror ball or a rod-like cluster and a floret-like small cluster. Therefore, in those cases where the cytological characteristics of clear cell adenocarcinoma are observed, it is possible to predict the histological diagnosis of clear cell adenocarcinoma in the uterine cervix [11]. These signs of the developing cancer are not always seen, unfortunately. In these cases the differential diagnosis can be difficult. Laboratory blood tests for tumor markers, as well as imaging examinations, are only of limited value, as was confirmed in our patient, and a biopsy in each case has to be done. In the described case, the first biopsy, which was taken from the cervical erosion, did not show any signs of malignancy, while the second one showed the presence of cancer. Both biopsies were taken unfortunately without the use of colposcopy. We hold the opinion that in each suspected feature which concerns the uterine cervix, even in young women, biopsies during colposcopic assessment of the uterine cervix should be taken. The data from the literature indicate that in primary clear cell adenocarcinoma, either radiation therapy or radical hysterectomy and bilateral lymph node dissection, by an experienced professional, results in cure rates of 85% to 90% for patients with small volume disease [4]. The mode of treatment depends on patient factors and available local experience. The size of the primary tumor is an important prognostic factor and should be carefully evaluated in choosing optimal therapy [2,8]. For adenocarcinomas that expand the cervix greater than 3 cm, the primary treatment should be radia-Leszek Gottwald, Jerzy Korczyński, Ewa Góra, Renata Kusińska, Ewa Rogowska, Katarzyna Wójcik-Krowiranda, Andrzej Bieńkiewicz tion therapy. In smaller foci, as in our patient, initial surgery followed by radiation therapy should be performed [2,6]. The American Brachytherapy Society has published guidelines for the use of low-dose rate (LDR) and high-dose rate (HDR) brachytherapy as components of cervical cancer treatment [12]. It is recommended in surgical treatment of cervical cancer that if the depth of invasion is less than 3 mm, no vascular or lymphatic channel invasion is noted, and the margins of the cone are negative, conization alone may be appropriate in patients wishing to preserve fertility [13]. Unfortunately in the present case because of the higher local advanced disease, the radical hysterectomy was done. The U.S. National Cancer Institute recommends for patients with cervical cancer stage IA and tumor invasion more than 3 mm, as well as cervical cancer stage IB, radical hysterectomy with pelvic node dissection [13]. Survival of patients with cervical adenocarcinoma was recently reported in five randomized phase III trials to be improved when combination of postoperative radiation and platinum-based chemotherapy is applied [4,8,14,15], while one trial examining this regimen demonstrated no benefit [16]. The mode of treatment depends in most cases on the experience of the oncology center. In the Regional Center for Oncology in Lodz in cervical adenocarcinoma stage IB according to the FIGO classification, only radiation therapy following radical hysterectomy is a treatment of choice. The question whether cervical clear cell adenocarcinoma and adenocarcinoma have worse prognosis than squamous cell carcinoma of the uterine cervix remains open [4,17,18]. Korhonen suggested, after the analysis of 163 cases of primary cervical adenocarcinomas of different subtypes, that the prognosis of clear cell carcinomas is similar to that of non-clear cell cervical adenocarcinomas [17]. Reich et al. did not find a statistically significant difference in the prognosis of surgically treated patients with stage IB-IIB clear cell carcinomas, squamous cell carcinomas and non-clear cell adenocarcinomas [18]. However, Niibe et al., based on a literature review, suggested that the 5-year survival rate in cervical adenocarcinoma is worse than the 5-year survival rate in cervical squamous cell carcinoma [14]. A similar opinion was presented by Quinn and Freitag et al. [4,6]. All authors agree that among the major factors that influence prognosis of each histopathological type of cervical cancer, the most important is the stage of the disease [1,2,4,6,14,18]. Re f e r e n c e s Cortical Representation and Excitability Increases for a Thenar Muscle Mediate Improvement in Short-Term Cellular Phone Text Messaging Ability Cortical representations expand during skilled motor learning. We studied a unique model of motor learning with cellular phone texting, where the thumbs are used exclusively to interact with the device and the prominence of use can be seen where 3200 text messages are exchanged a month in the 18–24 age demographic. The purpose of the present study was to examine the motor cortex representation and input–output (IO) recruitment curves of the abductor pollicis brevis (APB) muscle of the thumb and the ADM muscle with transcranial magnetic stimulation (TMS), relative to individuals’ texting abilities and short-term texting practice. Eighteen individuals performed a functional texting task (FTT) where we scored their texting speed and accuracy. TMS was then used to examine the cortical volumes and areas of activity in the two muscles and IO curves were constructed to measure excitability. Subjects also performed a 10-min practice texting task, after which we repeated the cortical measures. There were no associations between the cortical measures and the FTT scores before practice. However, after practice the APB cortical map expanded and excitability increased, whereas the ADM map constricted. The increase in the active cortical areas in APB correlated with the improvement in the FTT score. Based on the homogenous group of subjects that were already good at texting, we conclude that the cortical representations and excitability for the thumb muscle were already enlarged and more receptive to changes with short-term practice, as noted by the increase in FTT performance after 10-min of practice. Introduction The topography, or distribution of a muscle's cortical neurons in primary motor cortex (M1), is important in motor skill learning where there is an orderly relationship between the neurons and the external input/output [1]. There is re-organization with motor learning that results in a change in the topographic motor 'map' or the distribution and connectivity of M1 neurons where representative areas expand or contract [2]. This has been shown directly in rats trained to perform reaching movements where the intrinsic horizontal synaptic connections within layers II/III of M1 were strengthened [3]. The evidence of LTP-like plasticity in the forelimb region of M1 is similar to what is observed in humans performing repetitive motor tasks (piano exercises) where there is an increase in the cortical representation when mapped with transcranial magnetic stimulation (TMS) [4]. Motor skill learning and plasticity in M1 have to be considered relative to the practice duration as it has been established that there are two-phases to motor skill learning, each driven by individual physiological adaptations [5][6][7]. The initial phase of adaptation can occur in as little as 5-10 min of practice, though it is more commonly observed with a longer durations [8], and can be due to the disinhibition of intracortical inhibitory circuits [6] or Brain Sci. 2021, 11, 406 2 of 10 the unmasking of existing subthreshold excitatory connections [2]. Alternatively, the later phase of motor skill adaptation requires repeated practice over several days or more and can be due to intracortical synapses being maximally strengthened [9], a greater transfer of information between M1-basal ganglia-cerebellum [4], and/or synaptogenesis [10]. Depending on the phase of motor skill learning, there are different mechanisms in place for the nervous system to adapt and consolidate practice of a task to improve performance. A novel way of studying motor skill learning and associated M1 plasticity is with cellular phone text messaging, where in the United States alone over 94% of adults ages 18-24 own smartphones; this demographic averages more than 3200 text messages exchanged a month (pewinternet.org). Given the design and orientation of the standard smartphone, all typing is accomplished by moving the thumb(s) repeatedly over the screen surface. This creates a unique model where the thumb is used excessively in daily living, presumably enlarging the cortical representation in muscles controlling that digit, similar to what has been shown in the first dorsal interosseus muscle (controlling the index finger) in experienced braille readers [11]. However, along with enlargement of the representation in first dorsal interosseus, Pascual-Leone et al. found a reduction in the size of the representation of the abductor digiti minimi (ADM) muscle, which is not typically used in braille reading. These findings suggest that highly specialized sensorimotor skills cause cortical reorganization that may be necessary for task proficiency, and the reorganization can lead to a use-dependent plasticity in the intracortical networks. The purpose of the present study was to examine the motor cortex representation and input-output (IO) recruitment curves of the abductor pollicis brevis (APB) muscle of the thumb and the ADM muscle with transcranial magnetic stimulation (TMS), relative to individuals' texting abilities on a cellular phone. Towards this purpose, a functional texting task (FTT) was devised to study individual texting performance. A functional keyboard task (FKT) was also developed as a way to study general |
typing abilities and what may be a confounding factor in focal development of the APB representation. A practice FTT was then performed for 10-min and the mapping and input-output curves were repeated to examine short-term plasticity in the cortex of the subjects. The hypothesis was that the motor map of the thumb would be more extensive, and there would be more stimulus-intensity dependent recruitment of corticospinal projections to the thumb [12], in those individuals with accomplished texting ability. Additionally, we expected that these cortical changes would be more prominent following the short-term practice of the FTT. Finally, we expected these changes in the APB to be accompanied by decreases in map representation size and excitability for the ADM, though less so for individuals with higher FKT scores due to the distribution of intracortical networks being divided among all digits involved in typing. Participants Eighteen healthy individuals participated in the study (24.1 ± 4.0 years old; range: 20-34). Subjects self-reported no history of psychiatric disease, neurological problems, history of seizures or epilepsy, recent history of injury or disease involving the upper dominant extremity, pacemaker or other metal implants in the upper body, and negative pregnancy test (for women of childbearing potential). Subjects completed an Edinburgh Handedness Inventory [13], with 16/18 being identified as right-handed. The Indiana University Human Subjects IRB Committee approved the protocol (#1703811075) and all subjects provided informed consent before participating. Experimental Setup Subjects were given instructions on the FTT, the FKT, and were briefed on the TMS procedures. Subjects performed a timed FTT where they completed as many 45-character long, random phrases as possible in 2-min on a cellular phone and were scored for their pre-test (see Figure 1). Subjects then performed an FKT in which they completed an additional 45-character long, random phrases on a traditional computer keyboard as possible. The subjects were next seated comfortably in an upright position with the right arm resting on a padded table and placed in 60 • shoulder abduction and 90 • elbow flexion. Transcranial magnetic stimulation (TMS) was used to examine the cortical representations and IO recruitment curves for the APB and ADM muscles. When the initial cortical stimulation was complete, subjects performed a 10-min practice FTT. The 10-min practice FTT was self-paced, but subjects were again presented with random 45-character long phrases and were encouraged to complete as many as possible in the 10-min period. After the 10-min practice FTT, the TMS procedures were repeated to examine any short-term changes that may have occurred with practice of the FTT. Finally, the subjects completed a final 2-min FTT to determine performance effects of the 10-min of texting practice. The post-test FTT was performed at least 10 min after the practice FTT, so the subject had sufficient time to recover. Experimental Setup Subjects were given instructions on the FTT, the FKT, and were briefed on the TMS procedures. Subjects performed a timed FTT where they completed as many 45-character long, random phrases as possible in 2-min on a cellular phone and were scored for their pre-test (see Figure 1). Subjects then performed an FKT in which they completed an additional 45-character long, random phrases on a traditional computer keyboard as possible. The subjects were next seated comfortably in an upright position with the right arm resting on a padded table and placed in 60° shoulder abduction and 90° elbow flexion. Transcranial magnetic stimulation (TMS) was used to examine the cortical representations and IO recruitment curves for the APB and ADM muscles. When the initial cortical stimulation was complete, subjects performed a 10-min practice FTT. The 10-min practice FTT was self-paced, but subjects were again presented with random 45-character long phrases and were encouraged to complete as many as possible in the 10-min period. After the 10-min practice FTT, the TMS procedures were repeated to examine any short-term changes that may have occurred with practice of the FTT. Finally, the subjects completed a final 2-min FTT to determine performance effects of the 10-min of texting practice. The post-test FTT was performed at least 10 min after the practice FTT, so the subject had sufficient time to recover. Functional Texting Task and Functional Keyboarding Task Subjects performed the FTT using their own personal, modern, touch-screen cellular phone with a full keyboard, and the phone oriented vertically (Android or iPhone, ≥4in screen). The 'auto-correct' feature was turned off prior to using the phone for the task. A custom written program in MATLAB (Mathworks, Natick, MA, USA) would display the random 45-character phrases and the subjects were asked to enter those phrases as accurately and quickly as possible. After each phrase, they would click the 'send' button and then move on to the next phrase. Subjects were informed to ignore capitalization and not to delete or go back when they made an error. Each subject was given an absolute texting score based on the total number of correct characters produced. Relative accuracy was also calculated by dividing the number of correct characters entered by the total number of characters entered. The FKT was performed with the subjects using a desktop computer keyboard on a blank Microsoft Word document. Random 45-character sentences were again displayed for the subjects, and at the end of each sentence the subjects would hit enter and proceed to the next sentence. The FKT was scored in the same way as the texting task. Electromyographic Recordings Electromyographic (EMG) activity resulting from the TMS procedures was collected from the APB and ADM muscles of the dominant hand. A single differential detection electrode was placed over the muscle belly of each muscle. The skin overlying each muscle was cleaned and lightly abraded prior to affixing the electrode. A single common ground Functional Texting Task and Functional Keyboarding Task Subjects performed the FTT using their own personal, modern, touch-screen cellular phone with a full keyboard, and the phone oriented vertically (Android or iPhone, ≥4 in screen). The 'auto-correct' feature was turned off prior to using the phone for the task. A custom written program in MATLAB (Mathworks, Natick, MA, USA) would display the random 45-character phrases and the subjects were asked to enter those phrases as accurately and quickly as possible. After each phrase, they would click the 'send' button and then move on to the next phrase. Subjects were informed to ignore capitalization and not to delete or go back when they made an error. Each subject was given an absolute texting score based on the total number of correct characters produced. Relative accuracy was also calculated by dividing the number of correct characters entered by the total number of characters entered. The FKT was performed with the subjects using a desktop computer keyboard on a blank Microsoft Word document. Random 45-character sentences were again displayed for the subjects, and at the end of each sentence the subjects would hit enter and proceed to the next sentence. The FKT was scored in the same way as the texting task. Electromyographic Recordings Electromyographic (EMG) activity resulting from the TMS procedures was collected from the APB and ADM muscles of the dominant hand. A single differential detection electrode was placed over the muscle belly of each muscle. The skin overlying each muscle was cleaned and lightly abraded prior to affixing the electrode. A single common ground electrode was placed over the acromion process of the dominant side of the body. The signals were amplified and conditioned (Bagnoli EMG System, Delsys Inc. MA, USA) with highand low-pass cut-off frequencies of 20 Hz and 1000 Hz, respectively, before being stored at a final gain of 2000x with Spike2 software (CED, Cambridge, UK) for subsequent analysis. TMS Procedures Single transcranial magnetic stimuli were delivered using a standard Magstim 200 2 stimulator (Magstim Company LTD, UK) with a 70 mm figure-of-eight shaped coil. The coil handle was pointing backwards and laterally~45 • to the interhemispheric line while the subject wore a tight-fitting nylon cap. Stimulation was delivered over the left or right hemisphere, contralateral to the dominant hand. With the subject relaxed, supra-threshold stimulation was used to determine the optimal position for stimulation of the APB cortical representation. After determining the optimal position, the resting motor threshold (RTh) was determined with step-wise increases in stimulator output. Threshold was determined when motor-evoked potential (MEP) responses were greater than 50 µV in 5 out of 10 consecutive stimuli. The site was marked on the cap and a 5 × 6 cm grid with 1 cm grid spacing was placed on the cap with the center of the grid matched with the marked optimal stimulation site. The grid size was chosen to completely encompass the APB and ADM representations based on the size of the motor areas and the amount of overlap between the two areas as reported by Wilson et al. [14]. TMS intensity during the mapping protocol was set at 120% RTh based on the response at the optimal stimulation site for APB. Three stimuli were delivered at each grid site with an inter-stimulus interval of at least 2 s, and the average response was recorded. Three stimuli are considered sufficient to develop a reliable cortical map [15]. The mapping procedures were performed at least 5 min after the initial FTT and FKT, and at least 2 min after the practice FTT. Data Analysis The maximum peak-peak amplitude was determined from the average of the 3 MEP responses at each grid point stimulation site where the MEP was evident. Map volume was then determined as the sum of the responses at all of the active sites [16,17]. The map area was determined as the number of active sites in the grid. In addition, the center-of-gravity (CoG), or the position of the motor map that demonstrated the highest amplitude response to stimulation [18], was examined before and after the practice FTT. The cortical mapping site that had the highest combined response between the pre-test and post-test stimulation in APB was examined further. For this stimulation site, we also compared the responses at 120% RTh before and after practice for both the APB and ADM muscles. Statistical Analysis Paired t-tests were used to compare the FTT and FKT scores and accuracy. T-tests were also used to compare the FTT scores, accuracy, and the cortical stimulation variables before and after practice. Pearson's r correlation was used to determine the similarity between the texting variables (score and accuracy) and the mapping variables (normalized map volume and number of active sites) and 120% RTh responses before the 10-min practice. Finally, correlations were also used to examine the percent change from pre-post practice in the FTT with the percent change in the cortical variables. Significance level was set at p < 0.05. All statistical tests were performed with the Statistics Toolbox in MATLAB. Results All FTT and FTK scores showed a normal distribution. Subjects' scores averaged 346.6 ± 69.5 characters correctly typed in the FTT pre-test. The number of characters in the FKT (563.6 ± 89.4) was significantly higher than the FTT (p < 0.001), and the accuracy was better as well (98.5 ± 2.3%, vs. 97.9 ± 2.3%, p = 0.04, Figure 2). After the 10-min practice FTT, the texting score went up to 386.9 ± 71.2 characters, which was significantly different than the pre-test FTT (p = 0.047). Texting accuracy before and after the practice was not different (p = 0.38). Interestingly, as an aside, there was a negative correlation between the pre-test FTT and age (r = −0.74, p = 0.005). Figure 2. Score and accuracy of the FTT for pre and post practice, in comparison to the pre-test of the FKT. Scores significantly increased in the FTT from pre to post, but were significantly lower than the FKT during the pre-testing period. Subjects were more accurate with the FKT than the pre-test FTT. However, the FTT accuracy did not change after practice. * denotes significance (p < 0.05). There were no correlations between any of the cortical mapping variables (volume, area) or the 120% RTh MEPs for the APB and the pre-test score (initial 2-min test) on the FTT. Similarly, there were no correlations with the cortical testing procedures for either APB or ADM and the FKT. The main results from the cortical mapping procedures were observed after the 10min FTT practice session. The cortical volume for APB significantly decreased |
(p = 0.001) after the practice period, while the area increased from 15.8 ± 5.7 active sites before practice to 19.6 ± 5.5 after practice (p = 0.004, Figure 3). A difference was also observed with an increase for the APB in the 120% RTh MEPs after practice (p = 0.042, Figure 4). With the ADM, the cortical volume decreased after practice (p = 0.002), but the area also decreased (10.3 ± 5.7 to 6.8 ± 4.6; p < 0.001). The 120% RTh MEPs for ADM did not change after practice. Figure 2. Score and accuracy of the FTT for pre and post practice, in comparison to the pre-test of the FKT. Scores significantly increased in the FTT from pre to post, but were significantly lower than the FKT during the pre-testing period. Subjects were more accurate with the FKT than the pre-test FTT. However, the FTT accuracy did not change after practice. * denotes significance (p < 0.05). There were no correlations between any of the cortical mapping variables (volume, area) or the 120% RTh MEPs for the APB and the pre-test score (initial 2-min test) on the FTT. Similarly, there were no correlations with the cortical testing procedures for either APB or ADM and the FKT. The main results from the cortical mapping procedures were observed after the 10-min FTT practice session. The cortical volume for APB significantly decreased (p = 0.001) after the practice period, while the area increased from 15.8 ± 5.7 active sites before practice to 19.6 ± 5.5 after practice (p = 0.004, Figure 3). A difference was also observed with an increase for the APB in the 120% RTh MEPs after practice (p = 0.042, Figure 4). With the ADM, the cortical volume decreased after practice (p = 0.002), but the area also decreased (10.3 ± 5.7 to 6.8 ± 4.6; p < 0.001). The 120% RTh MEPs for ADM did not change after practice. There was a significant correlation between the percent change in APB area and the percent change in pre-post FTT scores (r = 0.61, p = 0.007, see Figure 5). None of the other changes in APB cortical measures (volume, 120% RTh) correlated with the percent change in FTT. Similarly, the change in ADM cortical measures did not correlate with the percent change in FTT. There was a significant correlation between the percent change in APB area and the percent change in pre-post FTT scores (r = 0.61, p = 0.007, see Figure 5). None of the other changes in APB cortical measures (volume, 120% RTh) correlated with the percent change in FTT. Similarly, the change in ADM cortical measures did not correlate with the percent change in FTT. Discussion The main finding of the present study is that individuals are proficient at cellular phone text messaging, though significantly slower than traditional keyboard typing. As keyboard typing still involves the use of all digits of both hands, this may explain why there were no associations present between cellular phone texting ability and the cortical variables for the thumb muscle that we measured before practice. However, it was shown that short-term plasticity in the APB representation occurred with practice of the texting task where the map volume decreased, but the area (number of stimulation sites) and MEP size at 120% RTh both increased while the subjects improved at the FTT. Along with this result, the increases in the FTT scores were correlated with the increases in the APB area. Combined with the decreasing area of ADM, it appears short-term practice of the texting task does alter the representation size and recruitment of corticospinal projections to the two small hand muscles in this study. The conception of this study was based on the fact that cellular phone texting is such a prevalent means of communication in the current society. In the present iteration of cell phone design, the thumbs are solely used as the digits that interact with the virtual keyboard on touch screens. We hypothesized that this would result in enlarged cortical representations for the thumb, as seen in the FDI of proficient braille readers [11]. However, one confounding factor we did not anticipate is that all of our subjects were proficient texters (range 201-456 characters in two-minute FTT). An average keyboard typing speed on a computer is ~190 characters per minute (livechatinc.com), which shows our subjects were nearly as proficient on the cell phone as the average population is on a computer. With such a homogenous group, it could be expected that all of our subjects already had enlarged cortical representations and greater recruitment of corticospinal projections for the thumb. Identifying a control group in this study was not realistic for this subject population, as nearly everyone text messages on their cell phone. Several years prior, we had Discussion The main finding of the present study is that individuals are proficient at cellular phone text messaging, though significantly slower than traditional keyboard typing. As keyboard typing still involves the use of all digits of both hands, this may explain why there were no associations present between cellular phone texting ability and the cortical variables for the thumb muscle that we measured before practice. However, it was shown that short-term plasticity in the APB representation occurred with practice of the texting task where the map volume decreased, but the area (number of stimulation sites) and MEP size at 120% RTh both increased while the subjects improved at the FTT. Along with this result, the increases in the FTT scores were correlated with the increases in the APB area. Combined with the decreasing area of ADM, it appears short-term practice of the texting task does alter the representation size and recruitment of corticospinal projections to the two small hand muscles in this study. The conception of this study was based on the fact that cellular phone texting is such a prevalent means of communication in the current society. In the present iteration of cell phone design, the thumbs are solely used as the digits that interact with the virtual keyboard on touch screens. We hypothesized that this would result in enlarged cortical representations for the thumb, as seen in the FDI of proficient braille readers [11]. However, one confounding factor we did not anticipate is that all of our subjects were proficient texters (range 201-456 characters in two-minute FTT). An average keyboard typing speed on a computer is~190 characters per minute (livechatinc.com), which shows our subjects were nearly as proficient on the cell phone as the average population is on a computer. With such a homogenous group, it could be expected that all of our subjects already had enlarged cortical representations and greater recruitment of corticospinal projections for the thumb. Identifying a control group in this study was not realistic for this subject population, as nearly everyone text messages on their cell phone. Several years prior, we had collected preliminary data for this study [19], and with only the 5 years that had elapsed, the subject population studied became significantly faster and more accurate at the FTT (See Table 1). Not only had the group gotten much better, the range of scores was much wider, suggesting that we missed the time when we could have seen associations between texting scores and our cortical measures. In addition, the fact that FTT scores were inversely correlated with age, a wider age range or older population may show less of a representation change and strength of projections for APB. An alternative explanation is that because all of our subjects were proficient in the keyboard task (FKT), a dexterous task using all the digits, the representations for all distal limb muscles are enlarged [20,21]. This would obscure any increases (APB) or decreases (ADM) we would have observed at the pre-test. To achieve high-performance in a given skill, it is suggested that the cortical maps and underlying excitability (via corticospinal and intracortical connections) have to already be supported [9,20,22,23]. Given the proficiency of our subject population for texting, it is expected that the neural substrates in the brain for those specific thumb movements are already present and contributing to increased motor learning abilities [24]. This could also be an explanation for the short-term improvement observed in the FTT after only 10 min of practice. After practice, the cortical volume decreased, but the area of activity increased, showing a spread of activity throughout the digit representation of M1. Furthermore, the expansion of the area was correlated with the texting improvement, suggesting that the enlargement of the map drives the task improvement. There is evidence that the mechanisms underlying this spread of activity are from strengthening horizontal connections in M1 [3] from suppressing intracortical inhibitory circuits [6] or activating existing subthreshold excitatory connections [2]. However, the MEP size at 120% RTh also increased showing that the excitability of the corticospinal projections for the active cortical neurons increased. As this measure is not limited to just the excitability of the cortical neurons, but also the spinal motor neurons they are projected to, it is difficult to ascribe the short-term effects to just the cortex. Regardless, the mechanisms must be in place to allow the increase in texting performance. One of the secondary hypotheses of this study was that the representation of ADM would be decreased in those individuals that were proficient at texting due to devoting more intracortical networks towards the thumb muscle and away from a control muscle on the opposite side of the hand [11]. The limiting factor between our study and that of the Braille readers by Pascual-Leone et al. was that our subjects were also very good at typing on a computer keyboard-a task that involves a high-level of sensorimotor control of the ADM muscle, along with other muscles controlling the digits. However, when the FTT was practiced for 10 min and the ADM was presumably not needed, the cortical measures of ADM decreased. It is unclear if we practiced the keyboard-typing task, instead of the texting task, if the decreased excitability and representations in ADM would have been prevented, or if they even would have shown the opposite change. This finding, however, coupled with the changes observed in APB after practice, do show the short-term reorganization that can occur in neighboring cortical networks for the improvement of a specific task. There is also the issue of the accuracy of the skill being performed, as this influences the cortical representations more than simply increased use alone [4,25,26]. In the design of this study, this was addressed by turning off the 'autocorrect' feature on the cell phones. We expected more variable accuracy scores with the autocorrect off, but the combination of the very high accuracy (~98%) and the texting speed showed that the subjects really did learn the skill of texting. Even though all of our subjects had the autocorrect feature turned on when we got their cell phones, they did not seem to rely on it so much that it prevented the cortical representation changes and skill learning. Conclusions In conclusion, we presented a unique scenario where in healthy subjects the thumb is used excessively for a specific motor task, for a vast majority of the population. The use of the thumb in this way does change the motor cortex to enable the learning of the skill (text messaging). We do not know the long-term effects of this focused use of the thumbs, though it would not be surprising to start observing dystonia's similar to those in musicians (involuntary thumb flexion) from the repetitive movements. This would be in addition to musculoskeletal issues such as tendinitis, myofascial pain syndrome and many others [27]. Early diagnosis of bladder cancer by photoacoustic imaging of tumor-targeted gold nanorods Detection and removal of bladder cancer lesions at an early stage is crucial for preventing tumor relapse and progression. This study aimed to develop a new technological platform for the visualization of small and flat urothelial lesions of high-grade bladder carcinoma in situ (CIS). We found that the integrin α5β1, overexpressed in bladder cancer cell lines, murine orthotopic bladder cancer and human bladder CIS, can be exploited as a receptor for targeted delivery of GNRs functionalized with the cyclic CphgisoDGRG peptide (Iso4). The GNRs@Chit-Iso4 was stable in urine and selectively recognized α5β1 positive neoplastic urothelium, while low frequency |
ultrasound-assisted shaking of intravesically instilled GNRs@Chit-Iso4 allowed the distribution of nanoparticles across the entire volume of the bladder. Photoacoustic imaging of GNRs@Chit-Iso4 bound to tumor cells allowed for the detection of neoplastic lesions smaller than 0.5 mm that were undetectable by ultrasound imaging and bioluminescence. Introduction Bladder cancers (BC) confined to the mucosa and invading the lamina propria are classified as stage Ta and T1, respectively, according to the Tumour, Node, Metastasis (TNM) classification system [1]. Intra-epithelial, high-grade tumors confined to the mucosa are classified as carcinoma in situ (CIS). Approximately 75% of patients with BC present with a disease confined to the mucosa (stage Ta, CIS) or submucosa (stage T1) [2]. All of these tumors can be treated by transurethral resection of the bladder (TURB), eventually in combination with intravesical instillations and are grouped as non-muscle invasive bladder cancer (NMIBC) for therapeutic purposes. Bladder CIS is characterized by a small number of high-grade neoplastic cells that create a reddish area, indistinguishable from inflammation, and have a flat appearance in the urothelium. It can be missed or misinterpreted as an inflammatory lesion during cystoscopy if not biopsied. The management of patients with bladder CIS still represents a challenge in the onco-urological field [3,4]. Several imaging methods such as computed tomography urography (CT urography), intravenous urography (IVU), ultrasound (US), multiparametric magnetic resonance imaging (mpMRI) and cystoscopy have been used to attempt the diagnosis of bladder cancer. However, major remaining limitations of diagnostic imaging involve the size of the tumor and the dimensional limit of detectability of any method, with US and CT resulting in very poor detection rates for bladder cancers < 5 mm in size [5]. Cystoscopy remains the gold standard diagnostic method for patients with the suspicion of bladder cancer [6]. Indeed, even cystoscopy, including photodynamic diagnosis performed using violet light after intravesical instillation of 5-ALA or hexaminolaevulinic acid, has limited diagnostic utility for CIS. In fact, during cystoscopy and TURB several biopsies from suspicious urothelium should be usually taken to detect and diagnose CIS on surgical tissue specimens [3]. Still, residual high-grade lesions are found in 40% of patients after the first TURB [7]. Due to these technological limitations, patients with bladder CIS experience very high frequencies of relapse following the first diagnosis, thus undergoing frequent and endless follow-up with poorly effective treatments, resulting in a poor quality of life and the highest cost per patient among all cancers [8]. To overcome the limitations of the imaging methods currently used in clinics for bladder CIS, we aimed to develop approaches and technologies for a non-invasive early diagnosis of in vivo orthotopic bladder cancer, by exploiting an imaging modality based on the photoacoustic (PA) imaging (PAI) approach. PAI is a hybrid imaging modality that combines the high contrast of optical absorption and the high spatial resolution of US generated by chromophores after irradiation by a nonionizing pulsed laser. As acoustic waves generally undergo less scattering and tissue attenuation compared to light, PAI can provide higher resolution images than traditional US, and achieve deeper penetration than purely optical imaging systems [9,10]. PAI also allows for the collection of functional and molecular information in real time by employing non-ionizing radiation to reach clinically relevant imaging depths [11]. Endogenous contrast agents, such as melanin, oxy and deoxy hemoglobin, lipids, collagen and water [12], and pulsed laser light in the near-infrared (NIR) spectral range have been exploited in PAI of melanoma [13], the tumour microenvironment [14], atherosclerotic plaque [15] and injuries [16], respectively. Exogenous contrast agents can also be used to enhance the sensitivity and spectroscopic specificity of PA signals. Targeted contrast agents can also be exploited to extend the range of applications of PAI to molecular imaging [17,18]. Among the various contrast agents developed so far, gold nanoparticles are of particular interest for their versatility, unique optical and physicochemical properties, relatively inert nature, and successful use in many biomedical applications. In particular, gold nanorods (GNRs) show the highest extinction coefficient in the NIR range and high PA conversion efficiency. Furthermore, tuning the shape of GNRs allows the best wavelength of light stimulation to be selected, thereby enabling the use of these nanoparticles for the needed PAI application [17]. Integrins represent a potential target for human bladder cancer, because they are involved in almost every step of cancer progression from the primary tumor to late stage metastasis development [19]. Among the various integrins that play a role in cancer progression [20], we investigated the expression of the α5β1 integrin, whose overexpression has been reported in high-grade bladder cancer [21,22] and as a marker of unfavorable prognosis for BC patients [23,24]. Based on these premises, we have developed a new technological platform based on the use of i) GNRs that have been chemically engineered with chitosan (Chit) and the peptide Iso4 (head-to-tail cyclized c (CphgisoDGRG) peptide, selective for the α5β1 integrin (ki=15 nM) [25]) to enable tumor targeting; ii) the intravesical instillation of urine-stable targeted GNRs (called GNRs@Chit-Iso4); iii) a technique of US-assisted shaking of GNRs@Chit-Iso4, to prevent nanoparticle sedimentation in the bladder; and, iv) the multimodal imaging of cancer lesions with PAI. We show that this platform is feasible and that it can be used to detect orthotopic murine bladder cancer lesions < 0.5 mm, undetectable by US imaging and bioluminescence. Functionalization of GNRs@Chit with Iso4 or Cys GNRs@Chit was prepared from cetyltrimethylammonium bromide (CTAB)-coated GNRs (GNRs@CTAB; synthesis and characterization detailed in the Supplementary Information). To functionalize GNRs@Chit with Iso4, 30 ml of Maleimide-PEG 12 -NHS (1 mg/ml in ultrapure water, 35 µmol = 29.7 mg) were mixed with 30 ml of GNR@Chit (1 mM of Au, 30 µmol = 5.909 mg Au) under stirring to achieve a final weight ratio of Maleimide-PEG 12 -NHS:Au = 5:1. The mixture was then left to incubate overnight at room temperature and then dialyzed against ultrapure water using a 3.5 kDa cut-off dialysis tube for 24 h, at room temperature, to remove the excess crosslinker. The product (65 ml), consisting of activated GNRs@Chit-PEG 12 -maleimide, was then mixed with the Iso4 peptide (21 mg, 34 µmol, 10 mg/ml in ultrapure water) and left to react for 24 h at room temperature. The unreacted maleimide groups were then quenched by adding an excess of cysteine hydrochloride (18 mg, 102 µmol). The product, called GNRs@Chit-Iso4, was then dialyzed against ultrapure water, the Au content quantified and the product aliquoted in vials containing 50 µg of Au was freeze-dried and stored at − 80 • C. In parallel, control nanoparticles with cysteine instead of Iso4 were prepared as described above, but using an excess of cysteine (36 mg, 204 µmol) instead of the Iso4 peptide. This product was called GNRs@Chit-Cys. About 50 vials of both products were prepared. Characterization of the physicochemical properties of GNRs@CTAB, GNRs@Chit and functionalized GNRs@Chit-Iso4. Gold concentration was determined by flame atomic absorption spectroscopy (FAAS) using a SpectraAA 100 Varian spectrometer (Agilent Technologies, Santa Clara, USA). Gold nanorods (100 μl) were dissolved in aqua regia (3 ml) and diluted to 10 ml with ultrapure water prior to analysis. For the calibration of the FAAS analysis, Au standard solutions at 1, 2, 5 and 10 mg/L were prepared by diluting the appropriate amounts of 1000 mg/ml TraceCERT® solutions in 30% aqua regia. Transmission Electron Microscopy (TEM) was performed using a TEM/ STEM FEI TECNAI F20 operating at 200 keV equipped with a probe for energy-dispersing x-ray spectroscopy (EDX), selected-area electron diffraction (SAED) and High Angle Annular Dark Field Detector (HAADF). Before the analysis, samples were placed on a continuouscarbon film, supported on a copper grid and dried at 120 • C. 1 H NMR spectra were obtained using a Varian Inova NMR spectrometer (14.09 T, 600 MHz). The chemical shifts were reported in ppm of frequency relative to the residual solvent signals ( 1 H NMR: 4.80 ppm for heavy water). Viscosity measurements were performed using an MCR102 (Anton-Parr, Graz, Austria) modular compact rheometer with a DPP25-SN0 geometry, i.e. a double plate geometry with a diameter of 25 mm. Zeta potential measurements were performed using a Zetasizer-nano-S (Malvern Panalytical, Malvern, UK) in DTS1060C-Clear disposable zeta cells, at 25 • C. Thermogravimetric analysis (TGA) was performed using a Q600 thermoscale (TA Instruments, New Castle, USA) working in nitrogen atmosphere from room temperature to 600 • C with a heating ramp of 20 • C/min, then switched to air and kept at 600 • C for 15 min Stability of GNRs@Chit and GNRs@Chit-Iso4 in human urine The stability of GNRs@Chit-Iso4 in human urine was assessed by diluting the GNR solution (0.725 mM of Au in 10 ml of water) with human urine samples (10 ml) collected from 10 healthy adult volunteers (4 males and 6 females) and placed under stirring in a water bath at 37 • C. At various time points, 1 ml of the mixture was withdrawn, diluted in 10 ml of cold water (+ 4 • C) and subjected to VIS-NIR. A urine solution (50% in water) was used as the blank reference in the spectrometric analysis. Cell lines Two human primary bladder epithelial cells (ATCC catalog number PCS-420-010; CELLnTEC catalog number HBLAK) were cultured according to the manufacturer's instructions and used at passage four. Human bladder cancer cell lines RT4, 5637, and HT-1376 were from ATCC (catalog number HTB-2™, HTB-9™, HTB-4™, CRL-1472™, respectively), RT112 cell line was from Merck (catalog number 85061106). These cell lines were cultured in RPMI medium (Gibco; Thermo Fisher Scientific) with standard supplements. Murine bioluminescent MB49-Luc cells were kindly provided by Prof. Carla Molthoff (VU University Medical Center, The Netherlands) and cultured in DMEM medium (Gibco; Thermo Fisher Scientific) with standard supplements. For this cell line, a cell bank was prepared and authenticated for lack of cross-contamination by analyzing 9 short tandem repeats DNA [27] (IDEXX Bioanalytics, Ludwigsburg, Germany). A vial of cell bank was used to start a new experiment. The cells were routinely tested for mycoplasma contamination and cultured for not more than 4 weeks before use. Human data collection Human data collection followed the principles outlined in the Declaration of Helsinki. Patients signed an informed consent agreeing to supply their own anonymous information and tissue specimens for future studies. The study was approved by the Institutional Review Board (Ethic Committee IRCCS Ospedale San Raffaele, Milan, Italy). All methods were carried out in accordance with the approved guidelines. Surgical specimens were staged according TNM classification [28]. Paired non-tumoral and tumoral bladder areas were from the same bladder of an individual submitted to TURB or radical cystectomy for bladder cancer; six TURBs with a histological diagnosis of CIS and two bladders with non-muscle invasive bladder cancer (NMIBC; CIS, pTa, pT1) and muscle invasive bladder cancer (MIBC; pT2-pT4) were used. Immunohistochemical analysis Tissue samples, fixed in 10% buffered formalin for 24-48 h at room temperature and then embedded in paraffin, were stained as previously reported [29]. Briefly, 3 µm tissue sections were dehydrated according to standard procedures and boiled twice in 0.25 mM EDTA pH 8.0 for 5 min using a microwave oven (780 W). After washing with PBS, and quenching the endogenous peroxidase with 3% H 2 O 2 , tissue sections were incubated with anti-α5 or -β1 rabbit monoclonal antibodies (Supplementary Table S1) for 2 h at room temperature. After washing, the binding of rabbit primary antibodies was detected using the Universal HRP-Polymer Biotin-free detection system (MACH4, BioCare Medical, USA) and 3,3-diaminobenzidine free base (DAB) as a chromogen. Tissue samples were then counterstained with Harris' hematoxylin. FACS analysis The staining of α5 and β1 integrins expressed on the cell surface was carried out as described [30] using 5 µg/ml of the monoclonal antibodies listed in Supplementary Table S2. Isotype-matched antibodies were used as negative controls. The binding of primary antibodies was detected using Alexa Fluor 488-labeled goat anti-mouse or -hamster secondary antibodies according to their animal species. Binding assays of Iso4-Qdot to MB49-Luc and 5637 cell lines Iso4 and ARA were coupled to amino-modified quantum dots nanoparticles, Qdot 605 ITK Amino PEG (Thermo Fischer) as previously described [30]. The binding of Iso4-Qdot and ARA-Qdot to MB49-Luc and 5637 cells was assessed through FACS and fluorescence microscopy experiments. FACS analysis was carried out as follows: the cells were detached with DPBS containing 5 mM EDTA pH 8.0 (DPBS-E), washed with DPBS, and suspended in 25 mM Hepes |
buffer, pH 7.4, containing 150 mM sodium chloride, 1 mM magnesium chloride, 1 mM manganese chloride , 1% BSA (binding buffer-1) and Iso4-or ARA-Qdot (range 30-0 nM, 5 ×10 5 cells/100 μl tube). After 2 h of incubation at 37 • C, the cells were washed with binding buffer-1 without BSA and fixed with 4% formaldehyde. Bound fluorescence was detected using a CytoFLEX S cytofluorimeter (Beckman Coulter). The binding of Iso4--Qdot and ARA-Qdot to living 5637 cells was analyzed as follows: 5637 cells were cultured in a 96-well clear bottom black plate (5 ×10 4 cells/ well) for 48 h, 5% CO 2 , 37 • C. The plates were washed with binding buffer-1 and incubated with Iso4-Qdot or ARA-Qdot solution (30 nM in binding buffer-1) for 2 h at 37 • C, 5% CO 2 . The cells were then washed with binding buffer-1, and fixed with 3% paraformaldehyde and 2% sucrose for 20 min. Bound fluorescence was acquired using the Cellomics ArrayScan XTI Studio Scan (Thermo Fischer Scientific) system. α5β1 integrin binding assay Iso4 and ARA were chemically conjugated to maleimide-activated HRP (InnovaBioscience, cat. 401-0002), via thiol group, as follows: a vial of the lyophilized product was suspended in 1 ml of PBS (10 mM sodium phosphate buffer, pH 7.4, 138 mM sodium chloride, 2.7 mM potassium chloride, Sigma, P-3813) containing 5 mM EDTA (PBS-E); the solution was then divided into 2 aliquots and mixed with Iso4 or ARA peptide, using a 3:1 peptide: enzyme ratio (mol/mol). The final products were called Iso4-HRP and ARA-HRP. The conjugates were diluted (range 0-400 nM) in 25 mM Tris-HCl, pH 7.4, containing 150 mM sodium chloride, 1 mM magnesium chloride, 1 mM manganese chloride and 1% BSA (binding buffer-2) and added to 96-well plate polyvinyl chloride (PVC) microtiter plates (Carlo Erba, cod. FA5280100) coated with or without α5β1 (4 μg/ml) and left to incubate for 2 h. The plates were washed with 25 mM Tris-HCl, pH 7.4, containing 150 mM of sodium chloride, 1 mM of magnesium chloride, 1 mM of manganese chloride, and bound peroxidase was detected by adding a chromogenic solution (o-phenylenediamine dihydrochloride, OPD). The chromogenic reaction was stopped by adding 1 N sulfuric acid. The absorbance at 490 nm was then measured using a microtiter plate reader. The effect of human urine (from a healthy donor) on the binding of Iso4-HRP was studied as described above by mixing Iso4-HRP (300 nM final concentration) and various amounts of urine diluted in binding buffer-2. Cell adhesion assays 96-well PVC microtiter plates were coated with Iso4-HSA or GNRs@Chit-Iso4 in 50 mM sodium phosphate, pH 7.3, containing 150 mM sodium chloride, (overnight incubation at 4 • C). The plates were washed and blocked with 2% BSA in DMEM or RPMI-1640 (200 μl/well, 1 h). MB49-Luc and 5637 cells were detached with DPBS-E, washed twice with DPBS, and suspended in DMEM or RPMI-1640 containing 0.1% BSA (binding buffer- 3), and added to the coated-plates (1.5 ×10 5 cells/well, 100 μl). After 1-2 h of incubation at 37 • C, 5% CO 2 , the plates were washed with binding buffer-3. Adherent cells were fixed and stained with 0.5% crystal violet in 20% methanol. After washing with water, the dye was extracted from cells using a 10% acetic acid solution (140 μl/ well) and the absorbance at 570 nm was measured using a microplate reader. The effect of urine on the pro-adhesive properties of GNRs@Chit-Iso4 was investigated as described above, except that the cells were seeded in binding buffer-3 or binding buffer-1 and various amounts of human urine (obtained from a healthy volunteer). Quantification of Iso4 peptide bound to GNRs@Chit The amount of Iso4 loaded on GNRs@Chit-Iso4 was quantified by measuring the total aminoacidic contents after acidic hydrolysis of the nanoparticles by Alphalyse Inc., Denmark. Murine orthotopic bladder tumor model All procedures and studies involving mice were approved by the Institutional Animal Care and Use Committee of San Raffaele Scientific Institute and performed according to the prescribed guidelines (IACUC, approval number 942). Female albino C57BL/6 J mice (9 weeks old, weighing about 20 g, Charles River Laboratories, Italy) were anesthetized with ketamine (80 mg/kg) and xylazine (15 mg/kg) and kept in dorsal position. Using a 24-gauge catheter, the bladder of each mouse was emptied and instilled with or without MB49-Luc cells (10 5 cells/ 100 μl in DPBS). Thirty minutes later the catheter was removed, and mice were allowed to recover and returned to their cage. Tumor growth was monitored by measuring the tumor volume through US imaging (see below) and in vivo bioluminescent quantification after administration of luciferin (15 mg/kg, intra peritoneum) using the non-invasive In Vivo Imaging System (IVIS, PerkinElmer, USA). US and PAI of GNRs@Chit and GNRs@Chit-Iso4. High-resolution US and PA imaging have been acquired using the Vevo LAZR-X platform (FUJIFILM VisualSonics, Inc.,Toronto, ON, Canada). The imaging platform includes a high frequency US system (Vevo 3100) combined with an Nd:YAG nano-second pulsed laser with repetition rate of 20 Hz. The linear US transducer array Mx 550D consists of 256 elements with a nominal center frequency of 40 MHz (25-55 MHz bandwidth) and a spatial resolution of 40 µm with a maximum imaging depth of 15 mm. Light from the laser is delivered to the tissue through optical fibers mounted on either side of the transducer. During volumetric US-PA acquisitions, a stepper motor is used for the linear translation of the US transducer and optical fibers along the sample. The linear stepper motor moves in steps of a minimum of 0:1 mm while capturing 2-D parallel images, for a maximum 3D range distance of 6.4 cm. 3D B mode scan was carried out for in vitro (drop) and in vivo (mouse bladder) studies. The photoacoustic spectra between 680 nm and 970 nm were scanned with a step size of 5 nm; for the in vivo studies (murine bladder) the 3D multispectral PA scans were acquired selecting PA spectral curve of tissue components melanin, deoxy-and oxy-genated blood, and GNRs; the processed wavelengths (680; 722; 764; 810; 924; 970 nm) were automatically selected from the spectral curve used to spectrally unmix the GNRs signal from other endogenous tissue chromophore signals such as oxy, deoxy hemoglobin. The algorithm reported by Luke et al. [31] was used to select these wavelengths which is ideal for separating the signal from GNRs from other endogenous absorbers. For the in vitro studies (agar drops embedded in slime) the 3D multispectral PA scans were acquired selecting the PA spectral curve of slime and GNRs (processed wavelengths 680; 782; 810 nm). Data analyses were conducted using the Vevo®Lab software; volumes of interest were obtained by manually drawing Volumes of Interest (VOIs) on 3D B-mode images. GNRs, melanin, oxy-and deoxyhemoglobin content were estimated through spectral unmixing analyses of the spectroscopic data. Light attenuators. Since the GNRs are susceptible to change in shape at the higher laser threshold, light attenuators were prepared to reduce the laser fluence to avoid GNRs reshaping. Light attenuators were prepared as follows: agar powder (cat. A9539, Sigma) was suspended in deionized and distilled water (1% final concentration), melted at 95 • C, and mixed with different concentration of Intralipid (cat. I141, Sigma). The mixtures (3 ml) were poured into Disposable Base Molds (30×24×5 mm, Bio-Optica, Milan, Italy) ( Supplementary Fig. S1A), left to solidify for 2 min at room temperature, and stored in a humidified chamber until used. The light attenuator was then sliced and mounted in contact with the optical fibers. In vitro PAI of GNRs was carried out as follows: GNRs (30 μl in DPBS with calcium and magnesium) were mixed with a 1% agar solution (30 μl), the mixture was then poured on Parafilm® M (Sigma) and left to solidify in a humidified chamber ( Supplementary Fig. S1B). The solidified product (called "agar drop") was then placed on an ultrasound gel pad (Aquaflex, Parker), embedded in slime made of polyvinyl alcohol polymer crosslinked with sodium tetraborate (Barrel of slime) (Supplementary Fig. S1C) and PAI was performed using the two optical fiber bearing light attenuators. The transducer was perpendicularly placed on the object under investigation previously covered with ultrasound transmission gel (Aquasonic 100, Parker). Axial sections were acquired using the following settings for B-Mode: 2D Power 100%; 2D Gain 13 dB; for PA-mode: Pa Power 100%; PA gain 44 dB; TGC and depth were maintained identical for all drops. PA and US data have been analyzed using VevoLab 3.2.5 software ( Supplementary Fig. S1D). Light fluence. The energy of the laser at the wavelength of 750, 800 and 850 nm was measured for 2 min using a laser energy meter (PE50BF-DIFH-C, P/N 7Z02943, Ophir, Germany). The laser beam size was assessed by shooting the laser for 5 s onto a piece of photographic paper (Kodak Linagraph Type 1895, Eastman Kodak Company, New York, USA) placed 8 mm from the light source. The resulting burned area was then quantified with a ruler (Supplementary Fig. S1E) and the light fluence was calculated by dividing the light energy by the light beam size. Low frequency US-assisted shaking of GNRs and in vivo PAI. GNRs (100 μl equivalent to 3 nmol) were instilled in the murine bladder that was identified by US imaging using the MX550D transducer placed perpendicular to the abdomen. Next, the shaking was performed by using the in vitro medical device Waver designed and produced by Freedom Waves, composed by a piezoelectric matrix array transducer (cod. 2048P1002, manufactured by Vermon, France) connected to a digital ultrasound power supply and amplifier manufactured by SYES, Italy. Mice were exposed to 3 cycles of shaking (3 min of shaking followed by 1 min of stop) using 1 MHz ultrasound with a duty cycle of 20% and 51 Joule of energy. After the shaking period the bladder was emptied from GNRs and washed twice with DPBS, and the PA acquisitions were performed. Axial sections were acquired using the following settings for B-Mode: 2D Power 50%; 2D Gain 23 dB; for PAmode: Pa Power 100%; PA gain 39 dB. TGC and depth were maintained identical for all acquisitions. All imaging experiments on mice were conducted under gaseous anesthesia (Isoflurane/air 4% for induction and 1.5% thereafter). Velocity and volumetric flow rate of the GNRs. The velocity and volumetric flow rate of the bladder content (i.e. instilled with or without GNRs) was measured by simultaneously placing the piezoelectric matrix array transducer and the MX550D transducer on the abdomen of a mouse, at 45 degrees from each other ( Supplementary Fig. S2). B-mode US (300 frames equal to 5 s) was acquired at 25% of transmitted power, to reduce the impact of the ultrasound wave on the velocity and distribution of the GNRs. Acquisitions were taken in the median part of the bladder corresponding to the section with the largest size and volume. Acquired Avi data were then used for particle image velocimetry analysis using the PIVlab 2.45 software [32]. Simulation of the energy transport in the murine bladder. A numerical simulation of the light fluence was performed to estimate the energy distribution within the tissue domain. The light energy distribution was obtained by implementing the Monte Carlo model of light transport, based on the MCXLAB computer simulation. The optical properties (the absorption coefficient (µ a ), the scattering coefficient (µ s ), the scattering anisotropic factor (g), and the refractive index (n)) of the skin, tissue surrounding the bladder, urine and GNRs used for the simulation were recently described [33], and reported in Supplementary Table S3. Fluence simulation was carried out with 10 9 photons at 800 nm, considering a Gaussian light source within a 120 × 120 pixel domain of tissue. Human bladder CIS, but not non-neoplastic bladder epithelium, expresses α5β1 integrin The expression of the α5β1 integrin in non-neoplastic and neoplastic bladder tissues was evaluated through immunohistochemical analysis of tissue sections obtained from TURB specimens with a histological diagnosis of CIS. The α5 subunit was not expressed by the non-neoplastic urothelial cells, while membrane staining was observed in the CIS; stromal cells in the lamina propria of non-neoplastic and neoplastic bladder tissues showed similar expression (Fig. 1A). The β1 subunit was strongly expressed by non-neoplastic urothelial cells and stromal cells, as well as by the CIS (Fig. 1A). Lack of α5 subunit expression in the normal urothelium was also observed |
in the Von Brunn's Nests and the expression of the α5 subunit in CIS was confirmed in five out of six TURBs ( Supplementary Fig. S3), while the β1 subunit was always expressed by the normal urothelium and stromal cells. In one out of two radical cystectomies we confirmed the expression of the α5 subunit in the CIS and a zonal expression in non-infiltrating papillary, while little or no expression was observed in the infiltrating tumor pT1, pT2 and pT4 ( Supplementary Fig. S4). Therefore, α5β1 might represent a potential receptor for targeting non-infiltrating tumors such as the noninfiltrating papillae and CIS. Next, we checked the expression of the α5β1 integrin on two nontumoral human primary urothelial cells (PCS-420-010 and HBLAK) and on four bladder cancer cell lines (RT4, RT112, 5637 and HT1376) derived from human tumors of different stage and grade [34] through flow cytometry analysis using a different set of anti-integrin antibodies. The results showed that human bladder cancer cell lines express more α5 and β1 than human primary urothelial cells (Supplementary Table S4). Taken together these results suggest that the expression of α5β1 by human bladder CIS may represent a potential target for the development of new tumor targeted diagnostic tools based on α5β1 targeting. MB49-Luc murine orthotopic bladder tumor, but not normal bladder epithelium, expresses α5β1 We investigated whether MB49-Luc tumor bearing-mice, a widely used syngeneic model in orthotopic bladder cancer [35], could recapitulate the α5β1 expression pattern observed in the human bladder CIS. The results showed that the α5 subunit was expressed by MB49-Luc tumor cells, but not by the non-neoplastic adjacent epithelial cells. In contrast, stromal cells of both neoplastic and non-neoplastic tissues showed a similar level of expression (Fig. 1B). The β1 subunit was expressed by the basal urothelial cells in the non-neoplastic and neoplastic tissue (Fig. 1B). Accordingly, flow cytometry analysis confirmed that MB49-Luc cells express the α5β1 integrin (Supplementary Table S5). Therefore, mice bearing the MB49-Luc derived orthotopic tumor could be used as a preclinical model for the development of new tumor targeted strategies based on α5β1 targeting. MB49-Luc and 5637 cells can be efficiently targeted by Iso4 peptide To assess whether Iso4 can recognize α5β1-positive bladder cancer cells, we coupled Iso4 to fluorescent nanoparticles (Quantum Dots, Qdot) via the sulfhydryl group of the cysteine, and evaluated the binding of this conjugate (Iso4-Qdot) to MB49-Luc and 5637 cells. An irrelevant head-to-tail cyclized c(CGARAG) peptide was also coupled to Qdot (ARA-Qdot) and used as a negative control. Flow cytometry and fluorescence microscopy experiments showed that Iso4-Qdot, but not the ARA-Qdot, bound these cells with a potency that correlates with the expression level of α5β1 on these cells ( Fig. 2A and B). Next, given that peptides containing isoDGR coupled to human serum albumin (HSA) can promote and support endothelial cell adhesion [25,36], we coupled Iso4 to HSA and tested the conjugate (Iso4--HSA) in cell adhesion assays using MB49-Luc and 5637 cells. The results showed that Iso4-HSA, but not the activated HSA lacking the peptide (*HSA), promoted and supported cell adhesion (Fig. 2C), suggesting that both cell lines express functional Iso4 receptors, likely α5β1. Taken together, these results suggest that Iso4 can be coupled with different compounds in a functional manner and exploited to target α5β1-positive bladder cancer cells. Conjugation of Iso4 to GNRs@Chit To have GNRs on hand that can be exploited for the PAI of α5β1positive tumors, we functionalized Chitosan-coated GNRs (GNRs@Chit) that were prepared from CTAB-coated GNRs (GNRs@CTAB) having a longitudinal surface plasmon resonance peak centred at 800 nm (detailed methods in Supplementary Material and Supplementary Fig. S5-S8). GNRs@Chit was functionalized with cyclo-CphgisoDGRG (Iso4), a selective ligand of the α5β1 integrin. To this aim, we exploited a heterobifunctional crosslinker reagent, composed of an ethylene oxide spacer (PEG 12 ) bearing a N-hydroxysuccinimidyl (NHS) ester to its extremities and a maleimide functional group (NHS-PEG 12 -maleimide). The NHS ester terminus reacts with the free amino groups on chitosan ensuring the binding of the linker to the chitosan, while the maleimide group is available to react in a further step with the sulfhydryl group of Iso4. Iso4 was then coupled with activated GNRs@Chit, and control GNRs with cysteine (Cys) in place of Iso4 were also prepared. The resulting product was called GNRs@Chit-Iso4 and GNRs@Chit-Cys (Fig. 3A). Next, we assessed the physical-chemical properties of the metal core of GNRs@Chit-Iso4, determining the longitudinal-LSPR to peak at 802 nm (Fig. 3B), shape and dispersion (Fig. 3C), and aspect ratio of 3.62 ± 0.67 (length 90.2 ± 7.2 nm, width 24.9 ± 2.6 nm, Fig. 3D). These findings show that conjugation of Iso4 does not modify the physical-chemical properties of GNRs, with only small and gradual variation of the longitudinal-LSPR peak vs GNRs@Chit (800 nm) and GNR@CTAB (798 nm) that is representative of the variation of the chemical environment surrounding the GNRs. Both the Cys-and the Iso4-conjugated nanosystems displayed a reduction in the Z-potential (+ 10.3 mV and + 10.6 mV for GNRs@Chit-Iso4 and GNRs@Chit-Cys, respectively, vs. + 40 mV measured for GNRs@Chit), according to the reduced amount of free amino groups on chitosan due to the presence of the PEG linker. Moreover, the crystallinity and the composition of the GNRs@Chit-Iso4 was proven to be conserved after the consecutive conjugation steps, additionally revealing no detectable Br atoms from CTAB (Supplementary Fig. S9A). GNRs@Chit-Iso4 was therefore aliquoted in vials, freezedried and vacuum sealed to achieve 50 sterile single use vials containing the lyophilized product which results in a GNRs@Chit-Iso4 concentration of 1 mM when dissolved in 500 μl of water (Fig. 3E). The stability of GNRs@Chit-Iso4 in human urine was then investigated at 37 • C for up to 2 h of incubation. No significant change in the shape of the LSPR spectrum occurred upon incubation in urine up to 2 h (Fig. 3F), with a 14% reduction of the absorbance at ~800 nm observed in the first 40 min, and a further 7% reduction in the following 80 min of incubation (Fig. 3F). These results suggest that GNRs@Chit-Iso4 can be incubated at 37 • C in urine for at least 2 h without a dramatic loss of its optical properties in the NIR. The same techniques were employed for the characterization of GNRs@Chit-Cys, revealing no appreciable discrepancies with respect to GNRs@Chit-Iso4 (Supplementary Table S6). Biochemical and biological characterization of GNRs@Chit-Iso4 and GNRs@Chit-Cys To quantify the amount of peptide loaded onto GNRs@Chit-Iso4, we measured the total amino acid composition present in the supernatant of GNRs@Chit-Iso4 after acidic hydrolysis. Hydrolysed GNRs@Chit-Cys was used as a negative control since it is expected to be an "amino acid-free" compound ( Supplementary Fig. S10). The results of the quantification of GNRs@Chit-Iso4 revealed that ~1 × 10 11 nanoparticles are loaded with about ~ 0.5 mg peptide, which corresponds to ~ 6 × 10 6 peptides per GNR (Supplementary Table S7). Next, to demonstrate the presence of functional Iso4 on GNRs, we measured the capability of GNRs@Chit-Iso4 and GNRs@Chit-Cys to promote cell-adhesion. To this aim, microtiter plates were coated with various amounts of GNRs@Chit-Iso4 or GNRs@Chit-Cys and seeded with MB49-Luc and 5637 cells. GNRs@Chit-Iso4, but not GNRs@Chit-Cys, induced cell adhesion and spreading of both cell lines (Fig. 4A), suggesting that the conjugation of Iso4 to GNRs@Chit does not affect the peptide function. Of note, the effective concentration 50 (EC 50 ) of GNRs@Chit-Iso4 for both cell lines was similar, being 0.73 ± 0.05 µg/ml for MB49-Luc cells and 1.3 ± 0.6. µg/ml for 5637 cells (Fig. 4A). The Fig. 3. Synthesis and characterization of GNRs@CTAB, GNRs@Chit and GNRs@Chit-Iso4. A) Steps for the synthesis of GNRs@Chit-Iso4. Chemical modification of chitosan via EDC-coupled amidation of thioglycolic acid with chitosan amino groups; removal of CTAB by the thiolated chitosan that binds GNRs; attachment of the bifunctional PEG linker to the NHS ester terminus to the free amino groups on chitosan; conjugation of Iso4 by exploiting its cysteine residue that is reactive towards the maleimide terminus of the linker. B) VIS-NIR spectra GNRs@Chit-Iso4 compared to the VIS-NIR spectra of GNRs@CTAB and GNRs@Chit. C) Shape of GNRs@Chit-Iso4 by TEM analysis (scale bar = 50 nm). D) Distribution of width and length of the nanorods present in the nanosystem GNRs@Chit-Iso4, and the corresponding Gaussian fit (mean ± SD and R 2 for length 90.2 ± 7.2 nm and 0.86; mean ± SD and R 2 for width 24.9 ± 2.6 nm and 0.93. n = 300 by TEM). E) Aliquots of GNRs@Chit-Iso4 during the freeze-drying process. F) VIS-NIR spectra and absorption intensity of GNRs@Chit-Iso4 in the presence of human urine over time. (caption on next page) E. Alchera et al. addition of an excess of free Iso4 peptide completely inhibited cell adhesion, suggesting that the adhesion was specific and dependent on the Iso4 peptide being coupled with GNRs (Fig. 4B). Effect of urine on the binding of GNRs@Chit-Iso4 to the α5β1 integrin and MB49-Luc cells Intravesically administered GNRs@Chit-Iso4 is expected to target bladder tumor cells in a harsh environment characterized by the presence of urine and a broad variety of metabolites [37], bacteria [38], bacteria-derived mucus and floating urothelial cells that might impair the binding capability of GNRs@Chit-Iso4 to α5β1. With the intention of using targeted GNRs in the bladder with a protocol similar to that used for the photodynamic diagnosis performed using Hexvix [39], we envisaged bladder draining before the intravesical instillation of GNRs, thus expecting that instilled GNRs would mix with increasing amounts of urine over time. Thus, we first investigated the impact of human urine on the binding of Iso4 to purified α5β1. To this aim, Iso4 was coupled with maleimideactivated horseradish peroxidase (HRP) to produce an Iso4-HRP conjugate to be used as a probe in direct binding assays with microtiter plates coated with α5β1. An HRP control conjugate using the ARA peptide instead of Iso4 was also prepared (ARA-HRP). As expected, Iso4-HRP, but not ARA-HRP, could bind α5β1 in a dose dependent manner ( Fig. 4C), suggesting that the probe is functional. Of note, to recapitulate the urine environment we omitted the addition of any detergent in the binding and washing buffers. The effects of various amounts of human urine (range 11.5 -90%) were then tested. The results showed that urine partially inhibited the binding of Iso4-HRP, with the overall recovery of binding being about 55% in 90% of urine (Fig. 4D), suggesting that Iso4 can still bind to α5β1 even in this unfavorable condition. We further investigated the effects of human urine on the capability of GNRs@Chit-Iso4 to bind to MB49-Luc cells. To this aim, the effects of various amounts of urine on MB49-Luc cell adhesion to GNRs@Chit-Iso4-coated plates was tested. In parallel, GNRs@Chit-Cys-coated plates were used as negative controls to monitor the unspecific cell adhesions. Surprisingly, when MB49-Luc cells were seeded in DMEM medium containing 25-75%urine, a significant increase (~20%) of cell adhesion to GNRs@Chit-Iso4, but not to GNRs@Chit-Cys, or to the control plate (lacking nanoparticles), was observed (Fig. 4E). The gain of cell adhesion to GNRs@Chit-Iso4 caused by the low concertation of urine was even more marked when the assays were carried in Hepes buffer supplemented with divalent ions (Mg 2+ /Mn 2+ ) (Fig. 4F). These results suggest that urine does not prevent the capability of Iso4 grafted onto GNRs to bind to bladder cancer cells. Set up for in vitro detection of the PA signal of GNRs Since GNRs are susceptible to shape change and a consequent loss of photoacoustic properties when stimulated with pulsed light above a certain energy threshold, light attenuators were used to reduce laser fluence to avoid the reshaping of the GNRs. The in vitro PA properties of the GNRs were investigated using agar drops containing GNRs@Chit-Iso4 or GNRs@Chit-Cys (15 nmol Au), and 0.6% Intralipid (IL) based light attenuators mounted on the tip of the optical fibers of the Vevo LAZR-X ( Supplementary Fig. S1). The results showed similar PA signals and spectrum for GNRs@Chit-Iso4 or GNRs@Chit-Cys, with maximum peaks at 810 nm ( Fig. 5A and 5B), and about 0.2 nmol of Au was detected using 0.6% IL (Fig. 5C). Next, we assessed the minimum amount of IL required for the detection of the highest PA signal and the correct spectra of GNRs in vitro. Using light attenuators containing 0.2%, 0.4% and 0.6% IL, we found that the PA signal intensity of |
GNRs@Chit-Iso4 was inversely proportional to the amount of IL (Fig. 5D). As expected, GNRs@Chit-Iso4 analyzed using light attenuators without IL underwent reshaping, as observed by the change of shape of the PA spectrum (Fig. 5E) and further supported by the transition from the rod-like (Fig. 3) to a spherical shape (Fig. 5F). In the absence of light attenuators, the energy fluence at the wavelength of 750, 800 and 850 nm (i.e., optical absorption of deoxy-blood, GNR@Chit-Iso4 and oxy-blood) was 30-35 mJ/cm 2 . In the presence of 0.2% IL the energy fluence dropped to 9 mJ/cm 2 and further decreased with higher concentrations of IL (Fig. 5G). These findings indicate that the maximum PA signal from GNRs is obtained by irradiation with energy fluence of 9 mJ/cm 2 . In consideration of using the GNRs in vivo, because of the presence of tissues surrounding the murine bladder, we considered to use light attenuators with lower amount of IL. Using a Monte Carlo simulation we estimated the light energy at 800 nm wavelength that reaches the murine bladder, considering a distance of 0.3 cm from the skin to the bottom of the bladder. We considered the light energy that was measured for estimating the light fluence in Fig. 5G, and at a depth of 0.3 cm the energy value in the absence of light attenuators was estimated to be 5.3 mJ, while using the light attenuator made of 0.1% IL the energy value was 2.458 mJ (Fig. 5H, Supplementary Fig. S11). Setup for the detection of the PA signal of GNR in the murine bladder Light attenuators containing 0.1% IL were selected for imaging GNRs@Chit-Iso4 instilled in the murine bladder. A "dotted-like" PA signal was clearly visible in the murine bladder instilled with GNRs@Chit-Iso4 (3 nmol Au) but not with a 100 μl vehicle (saline solution) (Fig. 5I). The PA spectrum shape of these "dotted-like" structures was similar to that observed in vitro, i.e., with a peak of 810 nm (Fig. 5J). This result suggests that GNRs@Chit-Iso4 can be easily detected in vivo without any significant changes in the PA properties of the nanoparticles. We identified that 2.458 mJ represents the energy value that allows to obtain the maximum PA signal of GNRs in the murine bladder in the absence of reshaping. Fig. 4. GNRs@Chit-Iso4, but not GNRs@Chit, promotes MB49-Luc and 5637 cell adhesion and spreading. A) Adhesion of MB49-Luc and 5637 cells to microtiterplates coated with various amounts of GNRs@Chit-Iso4 or GNRs@Chit-Cys. Representative images of cell adhesion to 250 µg/ml of gold nanorods (according to dry matter content) and the quantification of cell adhesion are shown (Circles, mean±SE, n = 3). The EC 50 values reported in each plot are the result of 3-4 independent experiments (mean±SE). B) Effect of free Iso4 on MB49-Luc and 5637 cell adhesion to microtiterplates coated with 250 µg/ml of GNRs@Chit-Iso4 or GNR@Chit-Cys. MB49-Luc and 5637 cells were mixed with the indicated amount of free Iso4 and left to adhere to microtiter plates coated with GNRs. A representative experiment out of three independent experiments is shown (Circles, mean±SE, n = 2). C) Binding of various amounts of Iso4-HRP or ARA-HRP to microtiter plates coated with or without α5β1 as detected with OPD chromogenic substrate (Circles, mean±SE, n = 2).D) Effect of human urine on the binding of Iso4-HRP to microtiter plates coated with or without α5β1. Iso4-HRP (300 mM) was mixed with the indicated amount of urine, and the mixtures were added to the plates. After washing, bound peroxidase was detected by OPD chromogenic substrate (Bars, mean±SE, n = 2). E) Effect of human urine on MB49-Luc cell adhesion to solid-phase coated with GNRs@Chit-Iso4 or GNRs@Chit-Cys. Cells were suspended in DMEM containing 0.1% BSA (upper panel) or in 25 mM Hepes buffer, pH 7.4, containing 150 mM sodium chloride, 1 mM magnesium chloride, 1 mM manganese chloride and 0.1% BSA (lower panel) and spiked with the indicated amounts of human urine. The mixtures were added to microtiter plates coated with 250 µg/ml of GNRs and left to incubate for 1-2 h at 37 • C, 5% CO 2 . After washing, the adherent cells were fixed and stained with crystal violet. Representative images of cell adhesion to wells coated with 250 µg/ml of gold nanorods and the quantification of cell adhesion are shown (Bars, mean±SE, n = 3). * , P < 0.05; * *, P < 0.01; * ** , P < 0.001 by two tailed t-test as determined using the GraphPad Prism software. (caption on next page) E. Alchera et al. GNRs settle to the bottom of the bladder Time-course PAUS analysis of GNRs@Chit-Iso4 (3 nmol) at 0, 5, 10, 20 and 30 min after installation showed a progressive signal accumulation toward the bottom bladder (Fig. 5K). In particular, starting from 5 min after installation only ~25% of PA signal could be detected in the upper half of the bladder, and most of the signal remained stacked in the lower half of the bladder (Fig. 5L), a condition that did not allow for the detection of a tumor that was located in the upper/lateral part of the bladder (Fig. 5M). Of note, no settlement of GNRs was observed upon storage at 37 • C up to 2 h, suggesting that GNRs maintain their colloidal properties outside of the bladder. Low frequency US-assisted shaking keeps GNR@Chit-Iso4 in suspension within the bladder With the intention of providing a technological platform for the early diagnosis of cancer located everywhere in the bladder, we aimed to deliver a strategy for keeping GNRs in suspension in the bladder using low frequency US-assisted shaking. Low frequency US stimulation increased the velocity of urine from 2.9 ± 0.2 mm/sec to 10.4 ± 0.5 mm/sec (Fig. 6A) and of GNRs@Chit-Iso4 from 2.6 ± 0.1 mm/sec to 11 ± 0.5 mm/sec (Fig. 6B). Furthermore, the velocity of urine remained constant (Fig. 6A) while GNRs showed a bimodal distribution according to the 1 s impulse and the fraction of period in which the signal was active (duty cycle 20%) (Fig. 6B). US-assisted shaking increased the velocity and volumetric flow rate of GNR@Chit-Iso4 by at least 6-fold in all bladder regions, while maintaining the difference between different bladder areas (Supplementary Fig. S12). This strategy was sufficient to suspend the GNR@Chit-Iso4 in the entire volume of the bladder (Fig. 6C). Feasibility of the technological platform for the specific recognition of bladder cancer We verified whether the PAI of US-assisted shaking of urine stable GNRs@Chit-Iso4 could be exploited for the diagnosis of the wellestablished orthotopic α5β1 + bladder tumor (i.e., the murine MB49-Luc derived tumor) (Fig. 6D). To this aim, PAI was performed after the intravesical instillation of GNRs@Chit-Iso4 or GNRs@Chit-Cys, followed by three cycles of US-assisted shaking and two intravesical washes to remove the unbound GNRs. We observed that the binding of GNR@Chit-Iso4 was limited to the tumor cells, and not present in nonneoplastic tissue (Fig. 6E). Of note, five days later we confirmed the tumor growth only in the bladder region that was previously indicated by the GNR@Chit-Iso4 (Fig. 6F). Accordingly, no binding of GNR@Chit-Iso4 was observed in healthy mice or of GNR@Chit-Cys in tumor bearing mice ( Supplementary Fig. S13, S14), suggesting that the Iso4 peptide was crucial for the efficient recognition of α5β1 + tumor cells. Interestingly, the binding of GNR@Chit-Iso4 to MB49-Luc tumors was reduced by co-administration of an excess of free Iso4 peptide, but not ARA peptide ( Supplementary Fig. S15), confirming that the binding of GNR@Chit-Iso4 to α5β1 + cells was mediated by the Iso4 peptide. Early diagnosis of bladder cancer Next, we verified whether our technological platform could be exploited to detected small superficial tumors. To this aim, we analyzed the binding of GNR@Chit-Iso4 in a mouse bearing a small orthotopic tumor (i.e., 4 days after MB49-Luc cell implantation) which was undetectable by bioluminescence (Fig. 6G). The axial (Fig. 6H) and longitudinal US scans revealed only two potential neoplastic regions of about 500 µm in 1 single frame (Fig. 6I), but they were not appreciable in the 3D reconstruction (Fig. 6J). On the contrary, the PA signal of GNR@Chit-Iso4 allowed for the visualization of several neoplastic areas in the axial and longitudinal scans and 3D reconstruction (Fig. 6K-M). This finding was next confirmed by US imaging three days later, showing the presence of a well-established tumor in the same areas previously recognized by GNR@Chit-Iso4, i.e., the upper and lower part of the bladder (Fig. 6N-P). These data suggest that our technological platform allows for the recognition of small and flat bladder cancers that are not detectable using bioluminescence or US imaging. The technological platform does not induce bladder inflammation or disease spreading The safety of our technological platform was then assessed at the local and distant level seven days after treatments. The histological analysis of healthy mice bladders instilled with GNR@Chit-Iso4 (30 nmol Au), containing 27 mEU/ml of endotoxin showed no signs of inflammation or cell proliferation (Fig. 7A), while control mice intravesically instilled with 5 EU of lipopolysaccharides (LPS) showed strong inflammation characterized by the presence of an inflammatory infiltrate in the lamina propria, hyperplasia of the urothelium and apoptotic bodies (Fig. 7B). Furthermore, whole-body in vivo bioluminescent imaging of orthotopic MB49-Luc tumor bearing-mice showed that the tumor remained confined to the bladder and did not spread (Fig. 7C), even after three cycles of US-assisted shaking. Discussion With the aim of providing a technological platform for the early Fig. 5. In vitro and in vivo PAI of GNRs@Chit-Iso4. A) PAI of agar drop containing GNR@Chit-Iso4 (15 nmol Au) and its associated PA spectrum using 0.6% Intralipid (IL) light-attenuators. The echogenic signal (gray) is generated by the slime in which the agar drop is embedded. The violet ROI delineates the PA signal of GNRs from which the PA spectrum was derived; the PA images were acquired and spectrally unmixed with VevoLab software to separate the contribution of the slime and GNRs (the green signal corresponds to the PA signal of GNRs). B) Normalized PA spectra of GNRs@Chit-Cys and GNRs@Chit-Iso4 (15 nmoli of Au) embedded in agar drop (one representative experiment of five). C) 3D distribution of the GNRs@Chit-Iso4 signal in agar drops acquired using the light attenuators made of 0.6% IL. D) Dose-response plot of the PA signal of GNRs@Chit-Iso4 in agar drop analyzed using light attenuators prepared with the indicated concentration of IL; linear dynamic range from 0 to 3.75 nmol Au, and trend towards plateau from 3.75 to 15 nmol Au (mean±SEM of duplicates are shown). E) Overlayed PA spectra of GNRs@Chit-Iso4 (3.75 nmol Au) acquired using light attenuators prepared with the indicated concentration of IL. F) TEM analysis of GNRs@Chit-Iso4 recovered from an agar drop after PA analysis conducted with a light attenuator prepared without IL. The results show that the combination of PAI with low frequency USassisted shaking of intravesically instilled GNRs@Chit-Iso4 in an orthotopic model of bladder cancer is capable of revealing the presence of lesions undetectable with US imaging and bioluminescence. Of note, with this technological platform we could detect neoplastic lesions smaller than a half millimeter, with a sensitivity that far exceeds that of the US and CT urography for bladder carcinoma [5]. Some of the clinical practices currently in use for the management of bladder cancer (i.e., bladder draining, incubation time for the intravesical instillation of drugs for diagnostic purposes or adjuvant treatment for NMIBC, such as 5-ALA and Hexviv® or Mytomycin C and BCG, and electromotive administration of Mytomycin C to increase drug distribution) were adapted to this new technological platform (called EDIT; Early DIagnosis of Tumor). This platform involves minimally invasive procedures, consisting of catheterization for bladder washing and the intravesical instillation of GNRs, the application of non-ionizing US for maintaining GNRs in suspension, and the use of pulsed laser light in the near-infrared biological window to obtain molecular imaging from targeted GNRs and 3D morphological reconstructions of the bladder. As a contrast agent for diagnostic imaging we opted for the use of targeted GNRs, designed with a diameter of 10 nm and aspect ratio of 3.6 in order to have a peak light absorption at 808 nm, to leverage the optical window that allows for deeper tissue penetration [40,41] and to overcome the different endogenous contrast molecules present in tissues [18]. We established the PA |
dynamic range of the above GNRs and identified the maximum fluence and energy of the pulsed laser light to obtain diagnostic imaging using targeted GNRs avoiding reshaping of the nanostructure. The urinary bladder environment offers the possibility to exploit the intravesical instillation of GNRs, which is characterized by pro and cons compared to systemic delivery. Intravesical instillation allows for the avoidance of off target effects and off-target accumulations, such as the accumulation of gold in the liver, spleen, kidney, testis and brain, as has been observed in cases of systemic instillation [42,43]. On the other hand, intravesical delivery of the treatment i) must content with urine, which contains a broad variety of byproducts from the metabolism of endogenous and exogenous substances [37], bacteria [38,44], bacteria-derived mucus and floating urothelial cells, ii) is characterized by temporary retention, and iii) cannot exploit the enhanced permeability of the tumor vasculature and retention effects of the neoplastic vasculature to accumulate the intravenously injected GNRs in the neoplastic environment [45][46][47]. Moreover, as recently reported for the intravesical instillation of 100 µm silicon dioxide microparticles [48], the absence of a flow carrying the molecule allows for the quick deposition of GNRs on the bottom of the organ. Among the several pros of the PAI is the co-registration of US and PA signal, which allow to detect the organ of interest (US imaging) and the localization of the molecule under investigation (with PA property, i.e., molecular imaging). In the case of hollow organs as the bladder, the delivery of the nanoparticles does not take advantage of a flow carry the molecule, and their investigation with PA imaging subjects the particles to pressure exerted by ultrasounds that are used for ultrasound imaging. The most likely explanation why GNRs@Chit-Iso4, and microparticles, are settling to the bottom of the bladder during PAI, is that ultrasounds applied to the abdomen exert pressure on the urine contents toward the bottom of the bladder (Supplementary videos SV1 and SV2). Supplementary material related to this article can be found online at doi:10.1016/j.pacs.2022.100400. This phenomenon prevented the detection of tumors located at the top or lateral sides of the bladder. We solved this bias by applying a technique of non-invasive low-frequency US-assisted shaking of GNRs that increased the velocity and distribution of the nanoparticles in every region of the bladder, and prevented their precipitation to the lower half of the organ. We have established the parameters that permit to increase GNRs@Chit-Iso4 distribution on the top and lateral sides of the bladder, ensuring that targeted GNRs come into contact with any urothelial area in which the tumor might be located. Compared to other protocols such as the electromotive drug administration used to improve bladder wall penetration of Mytomycin C [49,50] or the use of a magnetic field to move silicon dioxide microparticles [48], US-assisted shaking from the abdomen is a safe, non-invasive protocol. We identified integrin α5β1 as being expressed by the human bladder CIS and human bladder cancer cell lines, as well as expressed by the murine MB49-Luciferase (MB49-Luc) cell line and the MB49-Luc derived orthotopic syngeneic murine bladder cancer [51], but not by both the non-neoplastic human and murine urothelium. We investigated the use of the Iso4 peptide that we have previously reported to selectively recognize the α5β1 integrin [25], and designed functionalized GNRs (GNRs@Chit-Iso4). The results of the present study also demonstrate that the peptide Iso4 maintains its functional properties (i.e. α5β1 integrin recognition) after coupling to GNRs@Chit and in the presence of urine, and that upon coupling to GNRs it does not modify the PA spectra of the nanoparticles. This was observed with two batches of GNRs@Chit-Iso4 loaded with 8.1 ± 10 6 and 4.2 ± 10 6 peptides/GNRs (Supplementary Table S7), or with aliquots stored at − 80 • C for > 1 year, suggesting that these nanoconstructs are reproducible and stable. We demonstrated the safety and feasibility of the EDIT platform to detect α5β1 integrin positive bladder tumors, such as the human bladder CIS. The main clinical limitations of the EDIT approach for tumor imaging is related to the heterogeneity of tumor markers expressed among bladder cancer patients and the depth reached by the PAI. We found Fig. 6. Early diagnosis of bladder cancer. A) Velocity of urine in unshake and shake condition (one representative experiment of four). B) Velocity of GNRs@Chit-Iso4 (3 nmol Au) in unshake and shake condition (one representative experiment of four). C) 3D distribution of the GNRs@Chit-Iso4 (3 nmol Au) PA signal in murine bladder in the unshake and shake condition (one representative experiment of four); the green signal corresponds to the PA signal of GNRs after unmixing the PA signal of melanin, deoxy-and oxy-genated blood and GNRs. D) Axial frame of a murine bladder with an US recognizable tumor nine days after intravesical instillation of MB49-Luc cells (one representative experiment of six); axial diameter of the bladder lumen = 4.8 mm. E) Axial frame of PAI of the same animal shown in panel D after the intravesical instillation of GNRs@Chit-Iso4 (3 nmol Au), followed by 3 cycles of shaking, removal of the GNRs and 2 washes with saline solution (one representative experiment of six); axial diameter of the bladder lumen = 3.7 mm. F) PAI of the same animal used in panel D-E 5 days after the instillation of the GNRs@Chit-Iso4 (one representative experiment of six); axial diameter of the bladder lumen = 4.2 mm. G) Time course bioluminescence of 12 animals without or with orthotopic bladder tumors derived from intravesical instillation of MB49-Luc cells (mean±SEM); the arrow indicates the day when the PAI was acquired to diagnosis the orthotopic bladder tumor in the experiment reported in panel H-M. Axial (H; diameter of bladder lumen= 5.5 mm) and longitudinal (I; diameter of bladder lumen = 11 mm) frames and 3D reconstruction (J) of US imaging of the murine bladder 4 days after the intravesical instillation of MB49-Luc cells (one representative experiment of four). Axial (K; diameter of bladder lumen = 6.5 mm), longitudinal (L; diameter of bladder lumen = 11 mm) and 3D distribution (M) of the GNRs@Chit-Iso4 (3 nmol Au) PA signal in the murine bladder with tumor not detectable by US imaging and bioluminescence (day 4 after intravesical instillation of MB49-Luc cells) (one representative experiment of four). Axial (N; diameter of bladder lumen = 6.2 mm) and longitudinal (O; diameter of bladder lumen = 12 mm) frames, and 3D reconstruction (P) of US imaging of bladder and orthotopic tumor three days after tumor recognition by GNRs@Chit-Iso4 (one representative experiment of four). Vol: Volume. α5β1 expression in six out of eight (75%) specimens from patients with a diagnosis of bladder CIS, similar to what was previously reported for Cytokeratin 20 [52] in the bladder CIS or for EPCAM and uPAR in MIBC [53]; the combination of 2 or more targeting ligands, either coupled to the same or different GNRs, might be exploited to reach all bladder CIS. In this preclinical study a transducer with center frequency 40 MHz was used, which facilitates a spatial resolution of 40 µm and an imaging depth of 15 mm; to move to the clinic, lower frequency transducers will be investigated to achieve the imaging depth required for the human studies. Conclusions The feasibility of the EDIT platform in an animal model of bladder cancer identifies a new avenue for the early detection of bladder lesions < 1 mm in size in patients. Due to the heat releasing properties of the GNRs, this study also opens novel avenues for the early detection and therapy of bladder cancer [33,54]. The results of this study show the feasibility of the early diagnosis of bladder cancer using the α5β1-targeted GNRs@Chit-Iso4 conjugate as a photoacoustic contrast agent. Considering that the α5β1 integrin is also expressed by endometrial tumors [55], gastric cancer [56], breast cancer [57], and by the tumor neovasculature [58,59], the photoacoustic imaging approach described here could be potentially exploited in the diagnosis of other solid neoplasia. Ethics approval and consent to participate Human data collection followed the principles outlined in the Declaration of Helsinki. Patients signed an informed consent agreeing to supply their their own anonymous information and tissue specimens for future studies. The study was approved by the Institutional Review Board (Ethic Committee IRCCS Ospedale San Raffaele, Milan, Italy). All methods were carried out in accordance with the approved guidelines. All procedures and studies involving mice were approved by the Institutional Animal Care and Use Committees of San Raffaele Scientific Institute and performed according to the prescribed guidelines (IACUC, approval number 942). Funding This study has received funding from the European Union's Horizon 2020 research and innovation program under grant agreement No 801126 (https://cordis.europa.eu/project/id/801126). The funding source had no role in the design of this study, data interpretation, writing of the report. Declaration of Competing Interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Massimo Alfano reports financial support was provided by EU Framework Programme for Research and Innovation Future and Emerging Technologies. His research activity is focused on the role of chromogranins and cytokines in angiogenesis and tumor vascular biology, and on the development of peptide-based cytokine delivery systems, including gold nanoparticles functionalized with NGR or isoDGR peptides that target the tumor vasculature. Among his achievements, he and his group have demonstrated that an NGR peptide-TNF fusion protein (called NGR-TNF) can be exploited to break the blood brain tumor barrier in patients with primary central nervous system lymphomas (PCNSL) and, consequently, to enhance the efficacy of chemotherapy. Jithin Jose, obtained his Master of Science degree in Photonics from Cochin University of Science and Technology. During his research towards his PhD thesis at the University of Twente, he developed a Computed tomography photoacoustic imager to enable molecular imaging of tumors in small animals. He has been working at FUJIFILM VisualSonics since 2012 and as a Research and Market development Manager he is responsible for different photoacoustic projects with European research groups. Mauro Comes Franchini, Professor of Material Organic Chemistry at the Department of Industrial Chemistry "Toso Montanari. Long standing expertise and research interests in the field of functional metallic nanostructures for Theranostic application and in the synthetic modification and use of biomaterials derived from natural resources. Other interests are: medicinal synthetic organic chemistry and 3D-printing. Flavio Curnis, doctorate in Biological Sciences in 1996 (University of Milan, Italy). He is: i) the inventor of 8 international patent applications in the therapeutic field for cancer treatment based on vascular and tumor targeting approaches using NGR, isoDGR and RGD motives; ii) author of 67 publications in peer-reviewed international scientific journals (total impact factor: >510; impact factor average: 7.8; H-index: 35; total citations: >4850, (google scholar)); adjunct professor (since 2003) at the University Vita-Salute San Raffaele, Milan. Dr. Curnis is responsible for the biochemical and biological characterization of gold nanorods functionalized with isoDGR and RGD peptides. Massimo Alfano, group leader of the Extracellular Microenvironment Unit at IRCCS Ospedale San Raffaele. Master's degree of Science and PhD degree at the University of Milan. The focus of his research is to apply knowledge from basic science to techniques and tools that may really address clinical unmet needs. From a prospective standpoint, the identification of changes occurring in the extracellular matrix and in the tissueassociated microbiome will ideally support the identification of new extracellular targets for the delivery of more targeted interventions. Identifying and Controlling the Wrong Sitting Posture Sitting is one of the relaxing actions in our daily life. This paper proposes an experimental setup to find best sitting postures and also to analyze the appropriate time required for a particular sitting posture using IR sensors. IR sensors are used to find the posture of a human being, the sensors senses and send signals to AVR Microcontroller for analyzing the input and also it sends the output to another Microcontroller through wireless communication for correcting the posture. KeywordsSitting Posture, Sitting Time Limit, AVR, RF Module, Sensor I. INTRODUCTION There have been demands in recent years for utilizing information technology to amend the quality of our circadian life. Sitting, standing and slumbering are the frequent reposing actions in our quotidian life. Sitting is one of the most mundane postures of human beings in life and receives incrementing attention in the medical community due to its extensive applications |
and paramount impacts. A traditional method to analyze sitting posture is to let a patient sit on a hospital chair, and a therapist or a nurse observes the patient's sitting posture and ask questions about his feeling. In general, the mundane diagnostic process will take half to one hour. However, it is still too short to obtain enough information for precise diagnosis. Furthermore, the diagnostic result has low reliability and can be partial by subjective factors from medicos to patients. For the sake of reliable diagnosis, medicos are alacritous to obtain more comprehensive information from patients. Ergo, it is indispensable to monitor patients 24/7 and offer the most comprehensive information for medicos. Camera is commonly used sensor for sitting posture analysis 1.1. Existing methodology In the Existing methodology, the pressure sensors in the form of the cushion are used. The cushion was placed on the seat. When the people sit on the chair the cushion senses the input.The input sensed is depended on the threshold value. If the force is greater than the threshold value it is written as logic '1', if not then logic '0'.It is an iterative process. The sensor used is simple binary value pressure sensor. II. PROPOSED METHODOLOGY The proposed model of a design involves sensors and AVR microcontroller. The sensors senses and gives the input to AVR microcontroller and this controller analyze the sensed data and give output to another microcontroller which is placed in front of a human. At the Transmitter side the digital IR sensors sense the input and give output (1 or 0) to AVR microcontroller and it does analysis and gives output to the encoder and to RF module. At middle position, there is a wireless Transmission communication. At the Receiver side, the RF module receives the signal sent by the transmitter, which decodes the input and gives decoded output to AVR Microcontroller for analysis. This further sends the data to display it on LCD. III. PROPOSED ALGORITHM Step1: Sit in a comfortable manner as you like. Step3: It checks your Posture. Step4: System will verify time limit and display what to do. Step5: Sensors on the chair Senses temperature. Step6: Recognize the muscle stress and the whole process will be repeated. IV. RESULT AND ANALYSIS The experiment of proposed system analysis is done on 3 different persons; their stress level is analyzed with the help of temperature sensor. The persons are sitting at different postures for 1to 2 hours and measurement of their temperature at that position is done.In this study, we recognized that temperature (or stress level) depends on their doing work. If your work is critical you feel more stress. The data was drawn between different person's temperature at different positions with and without experimental setup. The main focus is on how the temperature is related to muscle stress and how it relates to blood pressure. V. Conclusion From above analysis, we reached the conclusion that in which postures a person is sitting, body temperature with and without my system and we also related temperature with muscle stress. If the temperature is increasing the stress on that part is high. Time to rectify each posture is also specified. Average values of the maximum and minimum time range of each posture are calculated. The maximum time is for how long a person can sit on a chair without any adverse effects and the minimum time specifies the time after which a person should change the posture. Future Scope In this paper posture of human being and muscle stress from temperature is analyzed. The scope of this experiment can be extended to find the health issues caused by a wrong sitting posture as well as sleeping posture. Atrial natriuretic peptide orchestrates a coordinated physiological response to fuel non shivering thermogenesis Atrial natriuretic peptide (ANP) is a cardiac hormone controlling blood volume and arterial pressure in mammals. It is unclear whether and how ANP controls cold-induced thermogenesis in vivo. Here we show that acute cold exposure induces cardiac ANP secretion in mice and humans. Genetic inactivation of ANP promotes cold intolerance and suppresses about half of cold-induced brown adipose tissue (BAT) activation in mice. While white adipocytes are resistant to ANP-mediated lipolysis at thermoneutral temperature in mice, cold exposure renders white adipocytes fully responsive to ANP to activate lipolysis and a thermogenic program, a physiological response which is dramatically suppressed in ANP null mice. ANP deficiency also blunts liver triglycerides and glycogen metabolism thus impairing fuel availability for BAT thermogenesis. ANP directly increases mitochondrial uncoupling and thermogenic genes expression in human white and brown adipocytes. Together, these results indicate that ANP is a major physiological trigger of BAT thermogenesis upon cold exposure in mammals. transcriptional activation of thermogenic genes was suppressed by ~40% in iWAT (Fig. 3e) 198 and eWAT (Fig. 3f), and severely impaired in rpWAT (Fig. 3g) of ANP null mice compared 199 to wild type mice. The GCA-to-NPRC mRNA ratio was robustly induced in all WAT depots 200 with a more pronounced induction in rpWAT (~24 fold) compared to iWAT (~1.75 fold) and 201 eWAT (~2.25 fold) upon cold exposure (Supplementary Fig. 3b). Moreover, rpWAT is 202 sensitive to browning 30 and anatomically close to the kidneys, one main physiological site of 203 action of ANP 13 . Thus, our data show that ANP-mediated browning is WAT depot dependent 204 with rpWAT being the most responsive depot. Along with PGC1α and UCP1, we observed a 205 significant reduction of PR domain containing 16 (PRDM16) mRNA levels. The thermogenic 206 activity of brown and beige adipocytes is conferred by a core gene program controlled by the 207 master transcriptional regulator PRDM16 shown to physically interact with PGC1α to 208 transactivate UCP1 transcription 31 . Consistent with cold-induced thermogenic gene 209 expression, wild-type mice exposed to acute cold showed augmented iWAT browning 210 compared to mice housed at thermoneutrality as evidenced by increased emergence of smaller 211 adipocytes containing multilocular lipid droplets and Hematoxylin/Eosin (H&E) staining, a 212 physiological response that was suppressed in ANP null mice (Fig. 3h). Similarly to BAT, we 213 did not find significant changes in the level of expression of cold-regulated genes involved in 214 the control of beige adipocyte thermogenesis such as β1ar (Supplementary Fig. 3l), β2ar 215 ( Supplementary Fig. 3m), β3ar (Supplementary Fig. 3n) and Serca2b 10 (Supplementary 216 iWAT, eWAT and rpWAT were noted at thermoneutrality (Supplementary Fig. 4e) and RT 220 (Supplementary Fig. 4f) between Nppa+/+ and Nppa-/-mice. Overall, our data emphasizes 221 5h), Acly (Supplementary Fig. 5i), Elovl3 (Supplementary Fig. 5j), and Fas 273 ( Supplementary Fig. 5k) that was similar in control and ANP deficient mice. 274 Because lipolysis-derived NEFA availability is also a strong determinant of 275 endogenous glucose production in mice 35 , we investigated glucose metabolism in cold-276 exposed mice. Remarkably, ANP null mice were not able to maintain their blood glucose 277 levels in a normal physiological range (Fig. 4h). This phenomenon was independent of 278 changes in glucose-6-phosphatase (G6pase) (Fig. 4i) and phosphoenolpyruvate carboxy-279 kinase-1 (Pck1) (Fig. 4j) mRNA levels, protein content (Fig. 4k, l) and G6Pase activity (Fig. 280 4m) in liver of ANP KO mice versus control. Importantly, we observed a strong liver 281 glycogen depletion upon acute cold exposure (~70%) in control mice , while cold-induced 282 glycogen depletion was strongly blunted in Nppa-/-mice (Fig. 4n), thus coinciding with the 283 inability to maintain normal blood glucose levels during cold exposure. In summary, our data 284 together indicate that ANP deficiency impairs liver TG and glycogen metabolism thus 285 contributing to reduced substrate availability to fuel BAT thermogenesis. 286 287 Cold induces ANP and GC-A is associated with brown/beige thermogenic markers in 288 human subcutaneous abdominal WAT in humans 289 To further examine if ANP could play a role in cold-induced activation of BAT in humans, 290 we determined circulating plasma NP levels in human volunteers exposed to mild cold. Thus, 291 recent studies using 18 F-FDG PET/CT revealed that acute cold exposure readily activates 292 BAT in humans 36,37 , however the physiological cues orchestrating hBAT activation are still 293 unclear. In a study in which 1h cold exposure at 16°C increased mean blood pressure, BAT 294 activity and systemic lipolysis in lean healthy male volunteers (Fig. 5a) 38 , we measured a 295 significant increase of plasma ANP levels by 1.7 fold (Fig. 5b) whereas plasma BNP 296 human primary BAT-derived adipocytes, this suggests that ANP is a cold-induced endocrine 298 activator of BAT function in humans. Thus in agreement with mice data, this implies that 299 ANP behaves as the physiological endocrine ligand of GCA in response to cold stress in 300 humans. 301 There is a large variability of white fat browning/beige-ing in human individuals 302 particularly those with obesity 24 . We next investigated the relationship between mRNA levels 303 of GCA and markers of browning/beige-ing in subcutaneous abdominal adipose tissue in a 304 cohort of middle-aged individuals with a wide range of body mass index selected for a high 305 baseline expression of UCP1 (n=79). Correlation matrix analysis revealed that GCA was 306 highly correlated with previously reported brown/beige-specific markers involved in 307 mitochondrial oxidative metabolism, mitochondrial biogenesis, glucose and FA metabolism 24 308 (Fig. 5d). An optimal re-ordering of the correlation matrix based on hierarchical clustering 309 revealed that GCA clustered with several brown/beige-specific gene markers such as PPARα, 310 Sirtuin 3 (SIRT3), Carbonic Anhydrase 4 (CA4), Forkhead Box K2 (FOXK2) and PPARγ co-311 activator 1β (PPARGC1B) (dotted line box Fig. 5d). The top-ranking genes displaying the 312 highest correlations with GCA were the beige-specific marker CA4 (Fig. 5e), the lipid droplet-313 associated protein Perilipin 5 (PLIN5) (Fig. 5f), the transcription factor PPARα (Fig. 5g), and 314 the brown-specific mitochondrial SIRT3 (Fig. 5h), all genes highly expressed in BAT and 315 . Here we differentiated adipocytes derived from hBAT (prevertebral) or human WAT 326 (hWAT) (neck) in vitro from the same subject using four independent donors as previously 327 described 5,42 . mRNA expression levels of UCP1, PRDM16, Cell Death-Inducing DFFA-Like 328 Effector A (CIDEA) and Nuclear respiratory factor 1 (NRF1) were significantly higher in 329 brown/beige compared to white adipocytes (Supplementary Fig. 6a). Thus, we also observed 330 a higher gene expression level of the NP-signaling components NPRC, PRKGI and 331 Phosphodiesterase 5A (PDE5A) in BAT biopsy-derived adipocytes ( Supplementary Fig. 332 6b). We next measured mitochondrial oxygen consumption under ATP synthase inhibition by 333 oligomycin treatment to focus on mitochondrial uncoupled respiration (state 4). We have 334 previously shown that β-adrenergic stimulation leads to pronounced mitochondrial 335 uncoupling in human primary brown/beige adipocytes which is markedly less in human 336 primary white adipocytes, illustrating the unique feature of human adipocytes derived from 337 the neck region 42 . Interestingly, we here show that ANP dose-dependently activates 338 uncoupled mitochondrial respiration to about 50% of the effect of norepinephrine (NE) in 339 human brown/beige adipocytes (Fig. 6a, b). This effect was markedly lower in WAT-derived 340 adipocytes (Fig. 6c, d). ANP at the lowest dose of 100 nM nearly doubled maximal 341 uncoupled respiration measured under carbonilcyanide p-triflouromethoxyphenylhydrazone 342 (FCCP) in human brown/beige adipocytes (Fig. 6e). A similar but weaker effect was observed 343 in hWAT adipocytes (Fig. 6f). This reveals that ANP can directly activate mitochondrial 344 uncoupling and respiration in human primary brown/beige adipocytes. We next examined if 345 ANP could induce a transcriptional thermogenic program in human brown/beige and white 346 levels of UCP1 both in human WAT and BAT adipocytes (Supplementary Fig. 6c). A peak 348 was observed after 3h treatment with levels returning to baseline after 48h and 72h treatment 349 for UCP1 and CPT1B in human brown/beige adipocytes (Supplementary Fig. 6d, e) and 350 white (Supplementary Fig. 6f, g) adipocytes. Interestingly, acute treatment (3h) with ANP at 351 100 nM increased to a variable degree (from 1.5 to 50-fold) a number of brown markers such 352 as UCP1 and deiodinase type 2 (DIO2), beige markers such as Cbp/P300 Interacting Transcription Factor A, Mitochondrial (TFAM) in brown/beige adipocytes (Fig. 6g) and white 357 adipocytes (Fig. 6h). Taken together, these results indicate that ANP has the capacity to 358 activate a thermogenic program in human primary brown/beige and white adipocytes, and 359 mitochondrial |
uncoupling in brown/beige adipocytes. This implies that ANP mimetics and/or 360 pharmacological compounds able to increase ANP/GCA-signaling may be attractive 361 strategies to activate BAT in humans. 362 The current classical view in mammals is that brown/beige fat is primarily activated 364 by norepinephrine released from sympathetic nerves upon cold exposure. However, the fact 365 that the non selective β-agonist isoproterenol fails to activate BAT in humans 43 combined to 366 the observation that β 3 -adrenergic receptor is dispensable for cold-induced thermogenic gene 367 activation in mice 11 , points toward the existence of alternative non-adrenergic regulatory 368 systems that control BAT activation and function in response to cold. We here show that 369 ANP, a cardiac hormone controlling blood volume and pressure, is necessary and required for 370 cold-induced brown/beige adipocyte activation (Fig. 7). We further show that ANP is 371 physiologically released upon cold exposure and activates mitochondrial uncoupling and a 372 thermogenic program in human brown/beige adipocytes. 373 Previous work demonstrated that ANP contributes to cold-induced diuresis in healthy 374 humans 44 . In response to cold, contraction of superficial blood vessels will limit heat loss, 375 and as a consequence, blood will be shunted away toward deeper large blood vessels that will 376 increase cardiac filling pressure of the right atrium, i.e. increased cardiac preload. As a result, 377 ANP secretion will be induced to normalize the increase in cardiac preload by enhancing 378 diuresis. Herein, we demonstrate that ANP released upon cold exposure, but not BNP, will 379 activate BAT to produce heat and maintain euthermia. BNP, the product of Nppb, is 380 marginally expressed in the right atria of the heart compared to ANP 13 . This likely explains 381 why cardiac BNP expression and circulating levels are poorly affected by changes in cardiac 382 filling pressure such as induced by cold exposure in this study. 383 In previous studies, the complete lack of all three β-adrenergic receptor (β-less mice) 384 β-adrenergic receptors. In this study, we show for the first time using 18 F-FDG PET/CT that 389 the lack of ANP abrogates about half of BAT activity and >60% of transcriptional activation 390 of Ucp1 and Pgc1α in BAT in response to acute cold exposure. The accumulation of multiple 391 lipid droplets in cold-exposed BAT, i.e. BAT steatosis, of ANP null mice is a sign of 392 dysfunctional BAT as observed in other mouse models 9,12,31 . A failure to adequately activate 393 BAT and UCP1 in ANP-deficient mice will lead to fat storage within lipid droplets in face of 394 increased FA supply. This phenomenon is not observed at room temperature for which the 395 cold stress represents a too moderate challenge to unmask prototypical BAT-related 396 phenotypes. 397 Recent studies indicate that BAT activation upon cold exposure is intimately linked to 398 WAT lipolysis in fasted mice 9,10 , thus highlighting the need for a thermogenic factor to 399 activate lipolysis. Although ANP is a powerful lipolytic hormone in human adipocytes, 400 previous studies could not reveal a lipolytic effect of ANP in mouse adipocytes 32 . We here 401 reconcile these studies demonstrating that cold exposure briskly increases ANP receptor GCA 402 gene and protein expression in WAT, thus rendering mouse adipocytes responsive to ANP-403 mediated lipolysis. Importantly, we here demonstrate a cell-autonomous up-regulation of 404 GCA in primary mouse WAT adipocytes cultured at 31°C instead of 37°C. This indicates that 405 acute cold is sufficient to up-regulate GCA expression in white adipocytes independently of 406 systemic neuro-endocrine factors. We next show that cold-induced systemic lipolysis, 407 reflected by increased plasma glycerol levels, and HSL activation by phosphorylation in 408 eWAT is blunted in ANP null mice. 409 Besides NEFA derived from WAT lipolysis, circulating TG have been shown as major 410 BAT substrates during cold exposure 6 . We here unravel a strong defect in plasma TG 411 clearance in Nppa-/-mice during cold exposure despite a robust induction of Lpl in BAT of 412 observed drastic changes in expression of lipid metabolism genes in liver of cold-exposed 414 mice. Cold exposure turns on FA oxidative gene networks while down-regulating lipid 415 synthesis gene programs such as de novo lipogenesis. This leads to substantial FA utilization 416 by the liver thus producing ketone bodies. Remarkably, cold-induced up-regulation of Cpt1a, 417 a rate-limiting enzyme in mitochondrial FA oxidation, and ketone bodies production was 418 impaired in Nppa-/-mice. This together with a reduced cold-induced lipolysis in Nppa-/-419 mice largely contributes to this observed hepatic phenotype. 420 Previous works also highlighted that glucose is an important substrate for BAT during 421 cold exposure in mice 6 and humans 46 . Of importance, we observed that Nppa-/-mice fail to 422 maintain their blood glucose levels during acute cold exposure when compared to wild-type 423 mice. This effect appears independent of changes in protein content and enzyme activity of 424 PEPCK and G6Pase that are rate-limiting enzymes in hepatic glucose production. Thus this 425 could be reasonably explained by a reduced glycogenolysis during cold exposure due to 426 reduced liver glycogen content in Nppa-/-mice. In addition, a blunted ANP-mediated 427 lipolysis in WAT during cold exposure reduces NEFA availability and therefore liver 428 endogenous glucose production 35 . Our findings are consistent with a previous work which 429 showed a stimulatory effect of ANP on gluconeogenesis in perfused rat livers 47 . Thus the 430 absence of ANP will likely result in blunted gluconeogenesis in cold-exposed mice. 431 Collectively, a reduced availability and utilization of circulating NEFA, TG and glucose 432 largely contributes to impaired BAT thermogenesis in cold-exposed Nppa-/-mice. 433 In summary, we identify cardiac ANP as a physiological endocrine activator of non-434 shivering thermogenesis in mammals. These data uncover an intriguing evolutionary 435 interconnection between cardiac activity and non-shivering thermogenesis. While the 436 To investigate the effect of acute cold on circulating NP levels, each subject underwent a mild 457 cold experiment. This experiment started with one-hour baseline measurements during 458 thermoneutral conditions. Subsequently, subjects were exposed to one hour of mild cold 459 exposure, in which a standardized cooling protocol was used. The mild cold experiment was 460 conducted in a specially equipped air-permeable tent (Colorado altitude training, USA), in 461 which ambient temperature could be tightly controlled. During baseline and the mild cold 462 period, subjects wore standardized clothing (shorts and a t-shirt; 0.19 clo). Energy 463 expenditure was continuously measured while body temperatures, skin perfusion 464 (vasoconstriction) and heart rate were sampled each minute. Blood pressure was measured 465 each 15 minutes as well as thermal comfort and thermal sensation via Visual Analog Scales 466 means of EMG and VAS scales. Venous blood samples were taken during baseline and one 468 hour after the onset of cold exposure. 469 470 Mouse models and handling 471 Eight weeks old Nppa-/-male mice (B6.129P2-Nppa tm1Unc /J mice were backcrossed to 472 C57BL/6J mice for at least ten generations) and their littermate control Nppa+/+ were used. 473 Mice were fed with a normal chow diet (Ssniff) and were housed in a pathogen-free barrier 474 facility (12h light/dark cycle) with ad libitum access to water and food in standard animal care 475 facility rooms at 21°C (RT). For cold exposure experiments, at 7 a.m. animals were placed 476 singly and exposed for 5 hours at 4°C with water access but without food. For acclimation to 477 thermoneutrality, mice were transferred to a chamber with controlled ambient temperature at 478 30°C for 4 consecutive weeks. Rectal temperature was monitored using an EcoScan Temp4/5/ 479 thermometer (Eutech Instruments) each hour during cold exposure or at indicated time points. 480 At the end of the protocol, mice were decapitated and blood was collected into EDTA tubes 481 containing protease inhibitors. Organs and tissues were rapidly excised and either snap frozen 482 in liquid nitrogen before being stored at -80°C or processed for histology. All experimental 483 procedures were approved by our institutional animal care and use committee CEEA122 484 new-born calf serum)). After filtration, red blood cells lysis and centrifugation, the pellet was 507 resuspended in proliferative medium. SVF cells were then counted, plated at 10000 cells/cm² 508 and rinsed in PBS 3 hours after plating. Cells were maintained at 37°C (5% CO 2 ) and re-fed 509 every 48h. Adherent cells were grown to 80% confluency in proliferative medium. Cells were 510 then exposed to an adipogenic cocktail (proliferative medium supplemented with 5 μg/ml 511 insulin, 2 ng/ml T3, 33.3 nM dexamethazone, 10 μg/ml transferrin and 1 μM rosiglitazone) 512 and used after 8 days of differentiation. G6Pase activity 590 Frozen tissues were homogenized using Fast Prep ® in 10 mM HEPES and 0.25 M sucrose, pH 591 7.4 (9 vol./g tissue). G6Pase activity was assayed in homogenates for 10 min at 30°C at pH were tested using Shapiro-Wilk and F tests, respectively. Student's t-tests, Mann-Whitney test 658 or one-way ANOVA were performed to determine differences between groups/treatments. 659 Two-way ANOVA followed by Bonferonni's post hoc tests were applied when appropriate. 660 Univariate linear regressions were performed on parametric data. The false discovery rate for 661 multiple testing was controlled by the Benjamini-Hochberg procedure with p adj. values ≤ 0.05. 662 set at P < 0.05. 664 665 Data availability 666 The data that support the findings of this study are available from the corresponding author 667 upon reasonable request. Functional gastrointestinal disorders and smartphone use in adolescents To the editor, Functional gastrointestinal disorders (FGIDs) are common in children and they represent an important social and medical burden.1) A recent systematic review determined that overall FGIDs prevalence in children and adolescents ranged from 9.9% to 29% and reached as high as 87% in clinical samples.1) Several studies have investigated different risk factors, such as genetics, psychosocial characteristics, dietary habits, physical exercise, among others.2-4) However, no studies have assessed the association between FGIDs, lifestyle habits and smartphone addiction. The present study aimed to assess the prevalence of FGIDs in children aged 11–14 years using the new Rome IV Diagnostic Criteria in a large sample and to investigate their association with lifestyle and smartphone addiction. Our cross-sectional observational study, conducted between March and May 2019, involved students aged 11–14 years of 7 middle schools in Verona (Italy). We chose these schools because they could be representative of the different habits existing between the city, suburbs, and province. An invitation to participate to a completely anonymous questionnaires was sent to the parents of all school children. School children whose parents refused to participate were excluded from the analysis. In total, we collected 1,706 completed questionnaires. We used a questionnaire comprising 4 parts: the first part was the Italian version of the Smartphone Addiction Scale Short Version for Adolescents and Young Adults (SAS-SV), for each item, participants expressed their opinion on a 6-point scale ranging from 1 (strongly disagree) to 6 (strongly agree). It identifies the different range for males and females. Males are addicted to scores higher than 31, with high risk of addiction with scores between 22 and 31 and females are addicted to scores higher than 33, with high risk of addiction on scores between 22 and 33. The second part included some questions from the Harvard Youth/Adolescent Food Frequency Questionnaire. The third part investigated physical activity using some questions from the rapid assessment of physical activity questionnaire. The fourth part was the official version of the Rome Foundation questionnaire for children and adolescents to investigate FGIDs. We added a question from the Short Form 36 health survey questionnaire. A member of our team brought the questionnaire to each class, and an explanation was provided to the school children regarding answering the questions. Questionnaires with ≥2 blank or illegible answers were excluded. Continuous variables total, we collected 1,706 completed questionnaires. We used a questionnaire comprising 4 parts: the first part was the Italian version of the Smartphone Addiction Scale Short Version for Adolescents and Young Adults (SAS-SV), for each item, participants expressed their opinion on a 6-point scale ranging from 1 (strongly disagree) to 6 (strongly agree). It identifies the different range for males and females. Males are addicted to scores higher than 31, with high risk of addiction with scores between 22 and 31 and females are addicted to scores higher than 33, with |
high risk of addiction on scores between 22 and 33. The second part included some questions from the Harvard Youth/Adolescent Food Frequency Questionnaire. The third part investigated physical activity using some questions from the rapid assessment of physical activity questionnaire. The fourth part was the official version of the Rome Foundation questionnaire for children and adolescents to investigate FGIDs. We added a question from the Short Form 36 health survey questionnaire. A member of our team brought the questionnaire to each class, and an explanation was provided to the school children regarding answering the questions. Questionnaires with ≥2 blank or illegible answers were excluded. Continuous variables the nonconsumption of fruit The first important result was the high prevalence of pediatric FGIDs in our population as determined according to the Rome IV criteria. Studies with prevalence of >30.0% have not been previously published; our sample reported a prevalence of 30.9%. Our results should be considered by pediatricians in their daily clinical practice as well as for public health in general because FGIDs can influence the psychosocial life of people affected and they could affect the quality of life of children. 5) The difference in prevalence among the 3 studies we have shown in Table 1 should be linked to many factors. In particular, it is important to take into account the difference in weather, diet (different diets have different levels of FODMAP [fermentable, oligo-, di-, mono-saccharides and polyol]) and social economic level (that influence the life style) between the 3 different countries. [6][7][8] FGIDs are associated with several risk factors. In fact, dietary habits can influence the onset of these disorders, also physical activity is correlated with these disorders. These findings have public health relevance with regard to the global increase in consumption of unhealthy foods and sedentary behavior. Therefore, initiatives aimed at promoting healthier lifestyles are reported as medians with interquartile ranges, and categorical variables are reported as the frequency and percentage. Chisquare tests (or Fisher exact test, where needed) were used to assess dependence between categorical variables. The logistic regression results are presented in the form of odds ratio (ORs) with 95% confidence intervals and probability values. The results were considered statistically significant when P value was ≤0.05. A total of 1,594 school children were included. The mean± standard deviation age of the participants was 12.87±1.92 years; 50.9% were boys (812 of 1,594) Having breakfast is the most significative dietary factor among those we have studied, because it is associated with FGIDs in students who never had it or had it less than once a week (OR, 1.50; 95% CI, 1.09-2.05; P=0.011), instead, students who had breakfast every day present lower prevalence of FGIDs (OR, 0.73; 95% CI, 0.57-0.90; P=0.004). The participants who performed only some light activities during the week had 1.47 times higher odds of experiencing FGIDs (95% CI, 1.06-2.03; P=0.02). Based on the SAS-SV questionnaire, 22.4% participants were addicted (358 of 1,594) to smartphones. Participants with FGIDs demonstrated a higher prevalence of smartphone addiction than those who did not meet the criteria for FGIDs (29.6% vs. 19.3%, P<0.001) (Fig. 1) among students should be encouraged and planned. Finally, the most significant element of our investigation is the association between smartphone use and FGIDs prevalence. A new data, never investigated in the literature, were the association between FGIDs and smartphone addiction. As the number of smartphone users increases, problems related to smartphone use also become more serious. This phenomenon can have negative consequences on a psychological and social level and could result in health issues. A limitation of the study is the use of questionnaires: in fact, the information provided by individual students may be inaccurate. Another possible limitation is that the survey by questionnaire does not consider any organic disturbance underlying the reported gastrointestinal symptoms. If casual relationships are present within the population, then this type of study cannot provide any information about that relationship. New Perspectives on Antimicrobial Agents: Remdesivir Treatment for COVID-19 Remdesivir was recently approved by the Food and Drug Administration for the treatment of hospitalized patients with coronavirus disease 2019 (COVID-19). Remdesivir is the prodrug of an adenosine analogue that inhibits viral replication of several RNA virus families, including Coronaviridae. Preclinical data in animal models of coronavirus diseases, including COVID-19, have demonstrated that early treatment with remdesivir leads to improved survival, decreased lung injury, and decreased levels of viral RNA. ANIMAL STUDIES Given the promising antiviral effects of remdesivir in vitro, the drug was tested in a number of animal models in efforts to advance its development as a therapeutic option for a wide range of viral diseases. In a mouse model of SARS-CoV-1, prophylactic subcutaneous administration of remdesivir was associated with reduced lung virus titers at days 2 and 5 postinfection, reduced lung pathology, reduced intra-alveolar edema, and improved pulmonary function compared to untreated SARS-CoV-1 mice (22). Therapeutic administration of subcutaneous remdesivir, 1 day postinfection, showed similarly improved pulmonary function and reduced viral lung titers when the drug was administered within 1 day of infection, before the peak of SARS-CoV-1 replication. In a MERS-CoV mouse model, the same research group demonstrated that prophylactic subcutaneous remdesivir administered 1 day prior to infection significantly reduced virus-induced weight loss, pulmonary hemorrhage, lung viral load, and mortality at days 4 and 6 after MERS-CoV infection (25). Therapeutic administration of subcutaneous remdesivir, 1 day postinfection, in the same model demonstrated effects similar to those seen with prophylactic dosing. The therapeutic efficacy of remdesivir against MERS-CoV has been demonstrated in a rhesus macaque model (26). That study evaluated the effect of intravenous prophylactic and therapeutic remdesivir boluses administered over ϳ5 min in a rhesus macaque model of MERS-CoV over the course of 6 days. Prophylactic remdesivir was administered 1 day before inoculation and was continued once daily for 6 days. Remdesivir administration was associated with lower respiratory rates, fewer pulmonary infiltrates on X-ray, lower lung viral loads, and absent gross lung lesions on necropsy compared to the results seen with vehicle-treated subjects. When therapeutic remdesivir was administered 12 h after inoculation and continued once daily for 6 days, the treatment was found to be associated with mildly elevated respiratory rates but at levels significantly lower than those seen in the vehicle-treated group, as well as with fewer lung infiltrates on X-ray, lower viral loads, and smaller areas of gross lung lesions on necropsy than in the untreated group. More recently, the activity of remdesivir in rhesus macaques infected with SARS-CoV-2 was demonstrated (27). Administration of intravenous therapeutic remdesivir over ϳ5 min was initiated close to the peak of viral replication, 12 h after inoculation with SARS-CoV-2, and was continued once daily for 6 days. Animals treated with remdesivir lacked clinical evidence of respiratory disease and had less-severe radiographic pulmonary infiltrates and pathological pulmonary lesions on necropsy than vehicle-treated controls. These findings support administration of remdesivir early in the course of COVID-19 to achieve the maximum treatment effect. Additionally, viral load was significantly lower in the lungs, while viral replication was reduced in the lower but not the upper respiratory tract after remdesivir treatment, suggesting that a clinical improvement should not be interpreted as necessarily representative of a lack of infectiousness (27). PHARMACOKINETICS Remdesivir is not suitable for oral administration due to complete first-pass metabolism through the liver. Consequently, intramuscular (i.m.) and intravenous (i.v.) administration of remdesivir was evaluated in male rhesus monkeys (21). The i.m. administration was suboptimal due to slow and variable release of remdesivir from the muscle, and the pharmacokinetics of subcutaneous administration has not been evaluated in humans. In contrast, the remdesivir administered via i.v. was rapidly eliminated and converted to the nucleoside analogue (GS-441524), indicating a more consistent and rapid delivery of remdesivir and higher maximal levels of the nucleoside analogue than were seen with the i.m. administration. Following i.v. administration, remdesivir has a short plasma half-life (t 1/2 ) of ϳ1 h, as it is quickly metabolized by carboxylesterase 1 (CES1) to the intermediate alanine metabolite (GS-704277), followed by the predominant GS-441524 metabolite (t 1/2 of 24.5 h) (28)(29)(30). CES1 expression is high in the liver, with minimal expression in the type II pneumocytes in the lung, which could result in the GS-441524 metabolite being present in serum at concentrations 1,000-fold higher than remdesivir throughout a 7-day treatment course (29). The GS-441524 metabolite is then converted into the active triphosphate metabolite of GS-443902, which has a prolonged plasma t 1/2 of over 35 h, supporting the idea of once-daily administration of the drug (30,31). Given the prolonged t 1/2 of the GS-441524 and triphosphate metabolites, steady state is usually achieved after approximately 5 days, hence the need for a loading dose to facilitate a faster achievement of steady state. Table 1 shows a summary of the pharmacokinetics of remdesivir and its metabolites (GS-441524 and GS-443902). Interestingly, remdesivir 75 mg administered over 30 min provided a higher peripheral blood mononuclear cell (PBMC) concentration of the triphosphate active metabolite than remdesivir 150 mg administered over 2 h (area under the concentration-time curve from 0 h to infinity [AUC inf ], 394.3 h · ng/ml versus 294.7 h · ng/ml, respectively) (30,31). Thus, shorter infusion times of remdesivir may optimize its pharmacokinetics parameters and achieve the highest intracellular concentration of the active triphosphate metabolite. Remdesivir has moderate protein binding, with a free fraction in humans of 12.1%. In contrast, the metabolites GS-704277 and GS-441524 exhibit very low protein binding in plasma, with mean free fraction values ranging from 85% to 127% (28). In vivo studies demonstrated that remdesivir rapidly distributes to most tissues following i.v. administration (21,28). Remdesivir levels were highest in the kidney, liver, and arterial wall (28). Remdesivir and its metabolites were also detected at various levels in the testes, epididymis, eyes, and brain of rhesus macaques within 4 h of administration. Interestingly, the levels in the brain were around 8% of plasma levels at 4 h postadministration but remained quantifiable and higher than the plasma levels at 168 h postdose (21). Remdesivir is metabolized by cytochrome P450 (CYP450). Metabolism of its metabolites has not yet been characterized (see Drug interactions section below). DOSAGE AND DRUG ADMINISTRATION Remdesivir is currently supplied as two different preservative-free formulations containing 5 mg/ml remdesivir, including a water-based concentrated solution and a lyophilized powder formulation, both provided in 100-mg vials. The recommended dosing for adults and for pediatric patients weighing Ն40 kg is a single loading dose of 200 mg on day 1, followed by a daily maintenance dose of 100 mg. For pediatric patients weighing more than 3.5 kg and less than 40 kg, the lyophilized formulation is preferred. A single loading dose of 5 mg/kg of body weight should be administered on day 1 followed by a maintenance dose of 2.5 mg/kg. Doses should be administered intravenously and infused over 30 to 120 min (33); however, we prefer administration over 30 min whenever possible to achieve higher intracellular concentrations of the active metabolite (30,31). Adult and pediatric patients with moderate or severe COVID-19 can receive a treatment duration of up to 5 days, which can be extended for up to 10 days if patients do not demonstrate clinical improvement (33,34). Although rare to date, in some patients with severe immunocompromising conditions, especially those who receive combined T-cell-depleting and B-cell-depleting agents for hematological malignancies or autoimmune diseases, we have had to administer additional courses of remdesivir over time for recrudescent clinical disease (35,55,56). DRUG INTERACTIONS Drug-drug interactions of remdesivir in humans have not been reported and their clinical relevance has not yet been established. As remdesivir is a prodrug, the potential for significant drug-drug interactions is limited due to the transient exposure of intact remdesivir following i.v. administration. However, in vitro studies demonstrated that remdesivir is a substrate for the CYP450 enzymes (CYP2C8, CYP2D6, and CYP3A4), organic anion-transporting polypeptide 1B1 (OAPT1B1), and P-glycoprotein (P-gp) proteins. In addition, remdesivir can act as an inhibitor of CYP1A2, CYP2C9, CYP2C19, CYP2D6, and CYP3A4; of OAPT1B1 and OATP1B3; of multidrug resistance-associated protein 4 (MRP4), and of sodium-taurocholate cotransporting polypeptide (NCTP) (33). In vitro data demonstrated an antagonistic effect of chloroquine on the intracellular activation and antiviral activity of remdesivir. Thus, coadministration of remdesivir and chloroquine or hydroxychloroquine is not recommended as it may result in reduced antiviral activity of remdesivir (33). CLINICAL DATA The first randomized, double-blind, placebo-controlled trial |
evaluating administration of remdesivir in hospitalized patients with severe COVID-19 included 236 participants in China enrolled between early February and mid-March 2020 (158 were randomized to remdesivir and 78 to placebo) (36). Remdesivir was administered intravenously over 30 to 60 min as a 200-mg loading dose on day 1, followed by a 100-mg daily maintenance dose on days 2 through 10. The primary clinical endpoint was time to clinical improvement, defined as a two-point reduction in patients' baseline clinical ordinal scale (Table 2), or live discharge from the hospital, within 28 days after randomization (37). The median time from symptom onset to starting study treatment was 10 days (interquartile range [IQR], 9 to 12 days). More patients in the remdesivir arm than in the placebo arm had a baseline respiratory rate of more than 24 breaths per min (23% versus 14%), and more patients in the control group than in the remdesivir arm had been symptomatic for Յ10 days at the time of starting remdesivir or placebo. The time to clinical improvement in the remdesivir group (median, 21 days; IQR, 13 to 28) was not significantly different from that in the placebo group (median, 23 days; IQR, 15 to 28; hazard ratio [HR], 1.23 [a HR value of Ͼ1 indicates shorter time to clinical improvement with remdesivir]; 95% confidence interval [CI], 0.87 to 1.75). Levels of nasopharyngeal virus load reduction and rates of day 28 mortality (14% in the remdesivir arm versus 13% in the placebo arm) were similar in the two groups. In a subgroup analysis of patients enrolled within 10 days of symptom onset, there was no statistically significant difference in 28-day mortality rates (11% among those treated with remdesivir versus 15% among those who received placebo) or in the time to clinical improvement (hazard ratio, 1.52; 95% CI, 0.95 to 2.43). Importantly, this trial failed to complete enrollment, due to steep reductions in COVID-19 incidence in China as the trial proceeded, and had low statistical power (58%), which may explain in part why it was unable to demonstrate any statistically significant clinical benefits of remdesivir. Unlike subsequent clinical trials of remdesivir for COVID-19 published to date, 66% of patients in that study also received corticosteroids, though there was no difference in the proportions of administration between the remdesivir and placebo arms (Table 3). Subsequently, the international double-blind, randomized, placebo-controlled trial known as the Adaptive Covid-19 Treatment Trial (ACTT-1) met its primary endpoint of a faster time to recovery in patients who received remdesivir than in those who received placebo (38). That study included 1,062 patients enrolled between late February and mid-April 2020, with 541 allocated to the remdesivir group and 521 allocated to placebo. Remdesivir was administered intravenously over 30 to 120 min as a 200-mg loading dose on day 1, followed by a 100-mg daily maintenance dose on days 2 through 10 or until hospital discharge or death. The primary outcome was initially defined as the difference in clinical status, as ascertained by an eight-category ordinal scale, among patients treated with remdesivir compared with those treated with placebo at day 15. However, on 22 March 2020, trial statisticians, who were unaware of treatment assignments and had no knowledge of outcome data, suggested changing this primary outcome to time to clinical recovery based on the evolving understanding that severe COVID-19 often has more a prolonged clinical course than many other acute respiratory viral infections (38). Overall, the baseline characteristics were balanced between the two groups. The median duration of symptoms before initiation of study drug was 9 days in both groups (IQR, 6 to 12 days). At baseline, 131 (24.2%) patients were receiving mechanical ventilation or extracorporeal membrane oxygenation (ECMO) in the remdesivir group, compared to 154 (29.6%) in the placebo arm. Remdesivir was superior to placebo in shortening the time to recovery by day 29 (median, 10 days versus 15 days; rate ratio [RR] for recovery, 1.29 [a RR of Ͼ1 indicates faster time to recovery with remdesivir]; 95% CI, 1.12 to 1.49). This benefit was most apparent in patients requiring supplemental oxygen by nasal cannula at treatment initiation (RR, 1.45; 95% CI, 1.18 to 1.79). The benefit of remdesivir was greater when it was given earlier in the illness. Patients who received remdesivir within the first 10 days of symptom onset had a rate ratio for recovery of 1.37 (95% CI, 1.14 to 1.64); in comparison, patients who received remdesivir more than 10 days after the onset of symptoms had a rate ratio for recovery of 1.20 (95% CI, 0.94 to 1.52). The rate ratio of recovery for patients who began remdesivir within 6 days from symptom onset was Hospitalized, on noninvasive ventilation or high-flow oxygen devices 3 5 Hospitalized, requiring low-flow supplemental oxygen 4 4 Hospitalized, not requiring supplemental oxygen, but requiring ongoing medical care (related or not to COVID-19) Hospitalized, not requiring supplemental oxygen or requiring ongoing medical care (other than that specified in the protocol for remdesivir administration) 6 1-2 Not hospitalized 7 Perspective Antimicrobial Agents and Chemotherapy in the remdesivir group than in the placebo group. A lower mortality rate was particularly apparent in patients requiring supplemental oxygen at baseline (HR, 0.3; 95% CI, 0.14 to 0.64). Interestingly, remdesivir was associated with a lower incidence of new oxygen use among patients who had not been receiving oxygen at baseline (36% versus 44%). Treatment with remdesivir was also associated with fewer days of subsequent oxygen use for patients receiving oxygen at enrollment (13 days versus 21 days) and with a shorter subsequent duration of mechanical ventilation or ECMO for those receiving these interventions at baseline (17 days versus 20 days). The incidences of adverse events were similar between the remdesivir group and the placebo group ( Table 3). The duration of remdesivir treatment in hospitalized patients with severe COVID-19 was evaluated in a randomized, open-label, phase 3 trial ( the SIMPLE Severe Trial) (39). A total of 402 patients were enrolled in the randomized part of the study (200 patients started a 5-day course, and 197 started a 10-day course). Overall, baseline characteristics were comparable between the two groups. However, the 10-day group had a larger proportion of patients in the two highest disease severity groups than the 5-day group (5% versus 2% were receiving mechanical ventilation or ECMO, and 30% versus 24% were receiving noninvasive ventilation or high-flow oxygen). The median durations of symptoms before initiation of remdesivir were 8 days in the 5-day group and 9 days in the 10-day group. Of the 200 patients in the 5-day group, 172 (86%) completed the full course of trial treatment, with a median duration of 5 days. Reasons for early termination of remdesivir treatment included hospital discharge (8%) and adverse events (4%). Of the 197 patients in the 10-day group, 86 patients (44%) completed the full course of treatment, with a median duration of 9 days. The proportions of patients who experienced clinical improvement of at least 2 points on the study's 7-point clinical ordinal scale at day 14 were not significantly different between the 5-day and 10-day groups (65% versus 54%). There was no significant difference in the median time to recovery between the 5-day group and 10-day group (10 days versus 11 days, similar to the 10 days in the ACTT-1 trial), in the median duration of hospitalization among patients discharged on or before day 14 (7 days versus 8 days), or mortality (8% versus 11%). Interestingly, among patients receiving mechanical ventilation or ECMO on day 5, mortality by day 14 occurred in 40% (10 of 25) in the 5-day group, compared with 17% (7 of 41) in the 10-day group. However, this benefit was not seen in patients receiving noninvasive ventilation or high-flow oxygen on day 5; mortality by day 14 occurred in 10% in the 5-day group compared with 15% in the 10-day group. Discharge rates were higher among patients who were symptomatic Ͻ10 days before initiating remdesivir than among those who had symptoms for Ͼ10 days prior to their first dose (62% versus 49%). There was no difference in the rate of adverse events in the two groups (Table 3). Additionally, the effect of remdesivir in hospitalized patients with moderate COVID-19 pneumonia was evaluated in a randomized, open-label, phase 3 trial (the SIMPLE Moderate Trial) (40). A total of 584 patients were enrolled in the randomized part of that study (193 received a 10-day course, 191 received a 5-day course, and 200 received standard care). The median duration of symptoms before initiation of remdesivir was 8 days in the 5-day and 10-day groups, compared with 9 days in the standardof-care group. On day 11, patients in the 5-day remdesivir treatment group had significantly higher odds of a better clinical status distribution on the 7-point ordinal scale than those in the standard-of-care group (odds ratio [OR], 1.65 [an OR of Ͼ1 indicates a difference in clinical status toward discharge between the remdesivir group and the standard-of-care group]; 95% CI, 1.09 to 2.48). There was no significant difference observed in the odds of improvement in clinical status with the 10-day treatment course of remdesivir compared to the standard of care (P ϭ 0.18). The results corresponding to the primary endpoint did not change in post hoc analyses, adjusting for day 1 clinical status score, symptom duration, inputting patients with missing status as dead, and using the intention-to-treat population. Interestingly, by day 14, the clinical statuses of the 5-day group and 10-day group were significantly different from those of patients receiving the standard of care (P ϭ 0.03), with 76% of patients being discharged in the 5-day and 10-day groups and 67% in the standardof-care group. The difference in clinical status by day 28 remained significant for the 10-day group (P ϭ 0.03), with 90% of those patients not being hospitalized compared with 83% in the standard-of-care group. The lack of difference in clinical status observed in the 10-day group was possibly due to the open-label design of the study and the requirement for intravenous dosing of remdesivir, which could have influenced discharge (Table 3). On 15 October 2020, an interim report of a randomized open-label adaptive trial sponsored by the World Health Organization evaluating remdesivir, hydroxychloroquine, lopinavir/ritonavir, and interferon-beta versus standard of care (the SOLIDARITY Trial) was posted as a preprint manuscript (41,42). A total of 11,266 patients from 405 centers in 30 countries were included in the study, among which 2,750 patients were allocated to the remdesivir group and compared with 2,708 patients who were allocated to receive the standard of care. Overall rates of in-hospital mortality, the trial's primary endpoint, were similar between the remdesivir arm and the standard-of-care arm (11% versus 11.2%; rate ratio [RR], 0.95; 95% CI, 0.81 to 1.11; P ϭ 0.50). In-hospital mortality among patients on any form of supplemental oxygen at enrollment was 12.2% in the remdesivir group compared to 13.8% in the standard-of-care arm (RR, 0.85; 95% CI, 0.66 to 1.09); the mortality rates among patients ventilated at enrollment were 43.0% and 37.8% (RR, 1.20; 95% CI, 0.80 to 1.80), respectively. It is hard to draw conclusions on the effect of remdesivir in that trial, despite its larger sample size, with the information currently available (41). Major issues include the open-label design of the SOLIDARITY Trial, which places the study results at increased risk of bias compared to the double-blind, placebo-controlled design of ACTT-1 (43). Furthermore, it was up to the local physician to decide which of the four treatment arms the patient could be randomized to (i.e., the decision was based on the availability of particular drugs, and the trial instructions did not provide protocolspecific criteria for eligibility). There is no specific definition of COVID-19 or description of how the presence of SARS-CoV-2 infection was to be assessed to make a patient eligible for the study-bias toward no-effect data would increase with the proportion of patients without confirmed SARS-CoV2 infection. No specification of time from symptom onset to randomization and treatment is provided, an important covariate in assessing antiviral treatment effects. The trial data state that patients stopped being followed at discharge, even though possible outcomes included transfer to other facilities or hospice discharge, making in-patient mortality data potentially biased; in ACTT-1, all patients were followed through study day 29 whether discharged or not (44). There are additional |
ongoing trials of remdesivir for COVID-19 that have yet to report results. These include DisCoVeRy, a randomized open-label trial sponsored by INSERM across seven European countries and assessing the same treatments as the SOLIDARITY Trial (ClinicalTrials registration no. NCT04315948; accessed 13 June 2020); ACTT-2, a randomized double-blind trial sponsored by NIAID evaluating administration of remdesivir and baricitinib versus remdesivir alone (ClinicalTrials registration no. NCT04401579; accessed 13 June 2020); ACTT-3, a randomized double-blind trial sponsored by NIAID evaluating administration of remdesivir and interferon beta-1a versus remdesivir alone (ClinicalTrials registration no. NCT04492475; accessed 8 October 2020); REMDACTA, a randomized, double-blind, multicenter study sponsored by Hoffmann-La Roche evaluating the efficacy and safety of remdesivir plus tocilizumab compared with remdesivir and placebo in patients (ClinicalTrials registration no. NCT04409262; accessed 13 June 2020). SPECIAL POPULATIONS Pregnancy and lactation. There is currently limited information on the use of remdesivir during pregnancy and lactation. Remdesivir has not shown genotoxicity in vitro or adverse embryo-fetal developmental effects in animal models (33). Pregnant patients and nursing mothers have been excluded thus far from clinical trials evaluating remdesivir treatment against SARS-CoV-2. A case series of three pregnant patients with severe COVID-19 pneumonia who required supplemental oxygen demonstrated resolution of this requirement after initiation of remdesivir. In this series, remdesivir was well tolerated overall, with only one patient experiencing elevation in the levels of liver function enzymes that required discontinuation of remdesivir (45). Another report of 67 pregnant patients who received remdesivir through the compassionate use program demonstrated that 93% recovered within 28 days. Pregnant women not requiring invasive ventilation at baseline had the highest rates of recovery (98%) and shortest median time to recovery (5 days); among those women, 98% recovered and 95% were discharged. Treatment with remdesivir was well tolerated; no new safety signals were detected among pregnant patients (46). Overall, remdesivir should be used during pregnancy only if the potential benefit justifies the potential risks for mother and fetus. Additionally, remdesivir has been used without reported fetal toxicity in six pregnant women with Ebola (47). Moreover, given that remdesivir has poor oral absorption due to extensive first-pass metabolism, infants are unlikely to absorb a clinically important amount of the drug from breastmilk. Newborn infants who received remdesivir for the treatment of Ebola did not experience any adverse events (47,48). As a result, it does not appear that remdesivir should be avoided in the setting of lactation. However, careful infant monitoring during breastfeeding is warranted. Pediatrics. As of June 2020, only two of the three randomized, controlled trials evaluating administration of remdesivir in COVID-19 included patients who were Ն12 years of age. In the phase 3 trial of remdesivir in Ebola virus disease, 43 patients who were Յ18 years of age, including two neonates, received remdesivir, with no serious adverse events reported (47). The Pediatric Infectious Diseases Society currently recommends the use of remdesivir as the preferred antiviral agent for patients with severe COVID-19 when antiviral use is indicated (49). Renal dysfunction. Safety data of remdesivir in patients with estimated glomerular filtration rate (eGFR) values of Ͻ30 ml/min per 1.73 m 2 and in those requiring renal replacement therapy (RRT) are lacking, as these patients have been excluded from clinical trials to date. Available data from published controlled trials in COVID-19 do not demonstrate an increased risk of renal adverse events in patients who received remdesivir compared to placebo (36,38). In addition, significant adverse renal events were not reported when remdesivir was used in the phase 3 Ebola clinical trial (47). Concerns of using remdesivir in patients with renal dysfunction may arise from the presence of the excipient sulfobutylether--cyclodextrin (SBECD). Each 100 mg of lyophilized powder and aqueous solution of remdesivir contains 3 and 6 g of SBECD, respectively, which is below the maximum recommended safety threshold dose of 250 mg/kg/day (for patients weighing over 24 kg) (50). Animal studies showed an association of SBECD accumulation with renal tubular obstruction at doses 50 to 100 times higher than that of remdesivir (51). Given the short remdesivir treatment duration, and the relatively low daily amounts of SBECD administered, we think that its benefit outweighs the risk for patients with eGFR values of Ͻ30 ml/min per 1.73 m 2 , especially for patients with severe COVID-19. Moreover, SBECD is readily removed by continuous RRT and hemodialysis (52). Thus, RRT would keep SBECD exposure within a limit that is generally considered safe, and significant accumulation occurs only if dialysis is held for prolonged periods. A recent report demonstrated that around 59% Perspective Antimicrobial Agents and Chemotherapy of the GS-441524 metabolite was removed after a 4-h hemodialysis session in a patient with COVID-19 treated with remdesivir (53). A case series of 46 patients with acute or chronic renal disease who received remdesivir demonstrated that it was well tolerated. These patients did not experience worsening renal function or clinically significant elevations in liver function enzymes that were attributed to remdesivir (54). Renal experts of the American Society of Nephrology suggest that patients without underlying liver disease who are expected to undergo continuous or intermittent dialysis or those with acute kidney injury that is expected to be transient may be the best initial candidates to receive remdesivir (50). Immunocompromised hosts. Although immunocompromising conditions, including solid-organ or hematopoietic cell transplantation, hematological malignancies, and autoimmune or rheumatologic diseases, have not been exclusionary factors in the controlled remdesivir trials published to date, there have not been specific reports on the effects of remdesivir in these populations that participated in those trials. Recent reports of chronic COVID-19 in two immunocompromised patients with lymphoma and associated B-cell immunodeficiency illustrated prolonged viral replication and shedding (55,56). Those patients required additional courses of remdesivir over time and received convalescent plasma, with eventual resolution of symptoms. We have encountered patients that developed COVID-19 during chemotherapy for B-cell malignancies (with agents that also affect T cells) who experienced similar protracted courses of Covid-19 requiring additional courses of remdesivir due to recrudescent disease. Solidorgan and hematopoietic cell transplant recipients whom we have treated to date have responded to single courses of treatment without recrudescent disease. ADVERSE EVENTS There are limited data evaluating the adverse-event profile of remdesivir. Although relatively rare, hypersensitivity reactions, including infusion-related and anaphylactic reactions, have been observed during and following administration of remdesivir (33). In phase 1 studies of 138 healthy volunteers, transient elevations in aminotransferases were observed with remdesivir administration (33). The Ebola phase 3 trial reported one serious adverse effect, a fatal episode of peri-infusional hypotension, deemed potentially related to remdesivir administration (47). In clinical trials, the adverse-event profile of remdesivir has been favorable overall. Wang et al. reported that 102 patients (66%) in a remdesivir group experienced at least one adverse event compared with 50 patients (64%) in the placebo arm (36). The proportion of serious adverse events reported was 18% in the remdesivir arm compared with 26% in the control group. The most common adverse events reported were constipation (14% versus 15% in the remdesivir group versus the placebo group, respectively), hypoalbuminemia (13% versus 15%), hypokalemia (12% versus 14%), and elevation in total bilirubin (10% versus 9%). Remdesivir discontinuation due to adverse events occurred in 18 patients arm (12%) compared with 4 patients (5%) in the placebo arm. In the ACTT-1 trial, serious adverse events occurred in 24% of patients in the remdesivir group versus 32% in the placebo group. The most common serious adverse event was respiratory failure, which occurred in 7.3% of patients treated with remdesivir and 12.8% of patients treated with placebo (38). Nonserious grade Ն3 adverse events occurred in 52% in the remdesivir group versus 57% in the placebo group. The most common nonserious adverse events reported in the remdesivir group versus the placebo group were anemia (16.5% versus 21.7%), decrease in renal function (16.0% versus 20.3%), hyperglycemia (13.7% versus 11.8%), and increased levels of liver aminotransferases (6.0% versus 10.7%). In addition, in the SIMPLE Severe Trial, the proportions of patients who experienced adverse events were similar in the two groups (70% in the 5-day group versus 74% in the 10-day group) (39). The proportions of serious adverse events were 21% in the 5-day group and 35% in the 10-day group. The most common adverse events overall were nausea (10% in the 5-day group versus 9% in the 10-day group), acute respiratory failure (6% versus 11%), increased alanine aminotransferase (6% versus 8%), and constipation (7% in both groups). Discontinua-tion rates due to adverse events were similar in the 5-day and 10-day groups (4% and 10%, respectively), and discontinuation rates due to aminotransferase elevations were 2.5% and 3.6%, respectively. In the SIMPLE Moderate Trial, the proportions of patients who experienced adverse events were similar in 5-day group and the standard-of-care group (51% and 47%, respectively) (40). However, the proportion of adverse events was significantly higher in the 10-day group versus the placebo group (59% versus 47%, respectively). The most common adverse events in the remdesivir groups were nausea (9.6% in the remdesivir groups versus 3% in the standard-of-care group), hypokalemia (6% versus 2%), and headache (1.3% versus 2.5%). Serious adverse events were reported in 5% of patients in the remdesivir groups and 10% in the standard-of-care group. FUTURE DIRECTIONS There are currently no approved treatments for COVID-19 patients who are not hospitalized. A trial has opened recently comparing remdesvir to placebo for early outpatient treatment of COVID-19 in patients with comorbidities that increase their risk of hospitalization and death (ClinicalTrials registration no. NCT04501952). The pharmacokinetics of an inhaled version of remdesivir is currently being evaluated in a phase 1a trial (ClinicalTrials registration no. NCT04539262). The availability of a nebulized or dry powder formulation of remdesivir could provide more-targeted delivery of the drug and potentially lower levels of systemic exposure and toxicity, as has been demonstrated with the inhaled formulation of the neuraminidase inhibitor zanamivir for influenza A and B virus (57). Moreover, a single rapidly administered bolus of remdesivir that resulted in a high intracellular concentration of remdesivir triphosphate could theoretically be enough treat patients who present earlier on in the course of diease. Other ways to potentially expand the use of remdesivir to the outpatient setting include evaluation of the pharmacokinetics of subcutaneous administration of remdesivir in humans. Subcutaneous remdesivir was used successfully in mouse models with SARS-CoV-1 and MERS-CoV. Expanding access to the outpatient setting could potentially enable studies of the use of remdesivir as a postexposure prophylaxis to prevent symptomatic infection or reduce the infectious burden after exposure to COVID-19. Additionally, given the limited data on remdesivir in pregnancy and pediatrics, future studies evaluating the safety and efficacy of remdesivir should consider inclusion of these patient populations to prevent delays associated with drug acquisition through the compassionate use programs. We favor confirmation of the subgroup findings of the ACTT-1 trial in at least an additional double-blind, placebo-controlled trial that explicitly targets and is powered to demonstrate a benefit of remdesivir in different strata of COVID-19 severity. Further studies are needed to assess remdesivir in combination with other antiviral drugs and immunomodulatory agents such as dexamethasone (the one treatment to demonstrate a mortality benefit to date in patients with severe or critical COVID-19 disease) (58). EXPERT OPINION Remdesivir is currently indicated for adults and for pediatric patients 12 years of age or older weighing Ն40 kg for the treatment of COVID-19 requiring hospitalization (11). Based on overall current trial results and clinical experience, remdesivir treatment should be considered as early as clinically possible to prevent progression of COVID-19 pneumonia and other complications in patients who are hospitalized. A new trial is evaluating remdesivir treatment of outpatients who are at higher risk of hospitalization and death to prevent progression to severe disease (ClinicalTrials registration no. NCT04501952; accessed 20 September 2020). A sizeable proportion of patients in the trials to date who received treatment early have not needed to complete a treatment course of 5 days and had a shorter duration of hospitalization. Additionally, the largest benefit of remdesivir seems to occur among patients who require supplemental oxygen at baseline, as this is the group that had the most mortality We favor a 30-min infusion time to maximize the intracellular concn of the pharmacologically active metabolite; from clinical trials data and our experience, patients in general wards can recover quickly (no longer need oxygen, no constitutional symptoms) and are ready for discharge before |
5 days of treatment; these patients do not need to complete 5 days of treatment Pharmacokinetics Absorption: remdesivir is not suitable for oral administration due to extensive first-pass metabolism resulting in poor bioavailability and low systemic absorption; metabolism: remdesivir is a substrate of metabolizing CYP450 enzymes (CYP2C8, CYP2D6, and CYP3A) and transporters OATP1B1 and P-gp; distribution: remdesivir is widely distributed into tissues but has poor blood-brain barrier penetration; elimination: 74% excreted renally and 18% in the feces Remdesivir should be administered only via the i.v. route (Continued on next page) Perspective Antimicrobial Agents and Chemotherapy benefit based on results from ACTT-1 (38). Older patients hospitalized with moderate COVID-19 (not requiring supplemental oxygen at rest) and those with comorbidities and who are at higher risk for mortality likely benefit from early remdesivir administration (40); thus, we do not think that waiting for clinical deterioration before deciding on antiviral treatment is a prudent or practical approach. While critically ill patients requiring mechanical ventilation or ECMO could benefit as well, given the advanced lung damage sustained on presentation due to acute respiratory distress syndrome, recovery would likely take longer and depend on additional interventions other than remdesivir. Detailed remdesivir characteristics and authors' recommendations are presented in Table 4. CONCLUSION Remdesivir seems to be the most promising antiviral currently available for the treatment of moderate and severe COVID-19 pneumonia based on preclinical and clinical data and represents the only treatment currently approved by the FDA for COVID-19. Further studies are needed to evaluate shorter and earlier courses of remdesivir, as well as to assess remdesivir in combination with other antiviral drugs and immunomodulatory agents. Discordant indigenous and provider frames explain challenges in improving access to arthritis care: a qualitative study using constructivist grounded theory Introduction Access to health services is a determinant of population health and is known to be reduced for a variety of specialist services for Indigenous populations in Canada. With arthritis being the most common chronic condition experienced by Indigenous populations and causing high levels of disability, it is critical to resolve access disparities through an understanding of barriers and facilitators to care. The objective of this study was to inform future health services reform by investigating health care access from the perspective of Aboriginal people with arthritis and health professionals. Methods Using constructivist grounded theory methodology we investigated Indigenous peoples’ experiences in accessing arthritis care through the reports of 16 patients and 15 healthcare providers in Alberta, Canada. Semi-structured interviews were conducted between July 2012 and February 2013 and transcribed verbatim. The patient and provider data were first analyzed separately by two team members then brought together to form a framework. The framework was refined through further analysis following the multidisciplinary research team's discussions. Once the framework was developed, reports on the patient and provider data were shared with each participant group independently and participants were interviewed to assess validity of the summary. Results In the resulting theoretical framework Indigenous participants framed their experience with arthritis as 'toughing it out’ and spoke of racism encountered in the healthcare setting as a deterrent to pursuing care. Healthcare providers were frustrated by high disease severity and missed appointments, and framed Indigenous patients as lacking 'buy-in’. Constraints imposed by complex healthcare systems contributed to tensions between Indigenous peoples and providers. Conclusion Low specialist care utilization rates among Indigenous people cannot be attributed to cultural and social preferences. Further, the assumptions made by providers lead to stereotyping and racism and reinforce rejection of healthcare by patients. Examples of 'working around’ the system were revealed and showed potential for improved utilization of specialist services. This framework has significant implications for health policy and indicates that culturally safe services are a priority in addressing chronic disease management. Introduction In Canada, 4.3% of the population reports Indigenous identity representing First Nations, Inuit and Métis ancestry [1]. Arthritis is the most common chronic disease experienced by Indigenous populations in Canada, and population-based studies estimate that the prevalence of many arthritis conditions is at least 1.3-1.6 times more frequent than that of the non-Indigenous population [2] with high rates of disability observed [3] including rates in the [25][26][27][28][29][30][31][32][33][34][35][36][37][38][39][40][41][42][43][44] year age group [4]. A significant rise in the prevalence of arthritis conditions in the general population is anticipated over the next 30 years [5] and given that approximately half of the Indigenous population is currently under the age of 25 years [1], there will be a great increase in need for arthritis care. It is critical for the musculoskeletal healthcare provider community and healthcare administration to address future capacity issues now, and strategize on how they will increase access to and provide adequate care for an increasing number of Indigenous peoples with arthritis. Limited work has been done to map current patterns of healthcare utilization for arthritis by Indigenous populations. In one of the few studies, Métis people in Manitoba, Canada were shown to have higher rates of physician visits, hospitalizations and surgeries for osteoarthritis or musculoskeletal disease compared to the general population [6]. Analysis of provincial administrative data in Alberta, Canada, however, revealed that despite a two-fold increase in the prevalence of osteoarthritis, and a two-fold higher use of primary care services for the condition, First Nations people had reduced utilization of orthopedic consultations (standardized rate ratio 0.39, 95% CI 0.38-0.40, p < 0.001) and hip or knee arthroplasty (standardized rate ratio 0.30, 95%CI 0.27-0.33) compared to the general population [7]. The reasons for these patterns remain unexplored to date. Potential reasons for disparate healthcare utilization for Indigenous peoples have been proposed, although not specifically for arthritis. Because health services are the responsibility of provinces but Indigenous peoples living on reserve are the responsibility of the federal government [8] the focus is often on patient location. The need to travel for services and the lack of provision of more specialized care in rural locations have been identified as concerns [9]. Indigenous peoples in the Northwest Territories, for instance, demonstrated higher use of nursing and social services compared to physician services, reflecting delivery of health services by non-physicians in remote and isolated locations [10]. Data based on a wider population from the 1991 Aboriginal Peoples Survey also revealed that Indigenous peoples, particularly those living on-reserve, were less likely to use physician services compared to the general Canadian population [11]. This may drive low use of specialist care, as physician-to-physician referrals are usually required. Disparities in healthcare utilization thus underscore the complexities of equity [12]. Racher and Vollman [13] demonstrate that definitions of access to healthcare vary and include multiple dimensions, including potential and realized access; equitable and inequitable; effective and efficient; initiated and continuous; and spatial and aspatial. Thus several issues require consideration when studying access to health services for Indigenous peoples, such as, supply and use; use over time; the fit between consumer and service; the geography of service; subjective and objective data; user and non-user perspectives; definitions of need; the role of outcomes of care; and the interaction of these many factors which creates feedback loops. Kleinman's seminal model of the health system provided insight into these loops and a way to "make sense of the social and cultural context of healthcare" [14]. He drew our attention to how external social, political and economic factors influence health and the internal structure of local health care systems. Kleinman divided the health care system into 3 sectors: popular, professional and folk. He defined the popular sector as including lay persons, non-professional and non-specialists, constituting the popular culture arena in which illness is first defined and health care activities initiated. The professional sector was characterized as organized healing professions, and includes the medical systems that provide hegemonic evaluative criteria for what makes up a good system. The folk sector is where therapies that are non-allopathic, that is, alternative and complementary, are delivered. Thus, while documenting the differences in rates of healthcare utilization is important for identifying where gaps exist, understanding how to address those gaps requires a more in-depth knowledge of the processes occurring at individual and system levels. The purpose of this qualitative study was to develop a theoretical framework that would advance understanding the processes, barriers and facilitators to arthritis care, at individual and system levels, for Indigenous peoples in Alberta, Canada. In so doing, we aimed to identify what changes are required to improve delivery of arthritis specialist services to the population at highest risk of the disease and its consequences. Study design This qualitative study employed a constructivist grounded theory approach. This methodology was appropriate to this study as it sees knowledge as socially constructed with multiple viewpoints acknowledged among research participants as well as researchers [15]. The research team was multidisciplinary and included specialization in rheumatology, physiotherapy, family medicine, Indigenous health, population health promotion, health services research, and epidemiology. Two members were Indigenous. This was our first project as a team so a methodology that allowed our various viewpoints to be incorporated and reflected upon was important [15]. In addition, data was collected and analyzed to make participants "actions, interpretations, and influences" explicit [15] as was necessary to understanding their healthcare utilization. The methodology was also respectful of Indigenous perspectives on research in that it allowed individuals to tell their own stories and to reflect on the conclusions drawn [16]. Study participants Following standard grounded theory methodology, data collection (recruitment and interviews) and data analysis occurred iteratively. Based on Kleinman's model we considered it necessary to collect data from both people with arthritis and arthritis care providers (hereafter referred to as patients and providers respectively). In order to ensure that we broadly considered viewpoints based on location of residence or practice respectively (urban or reserve), system characteristics, and tribal affiliation were included it was necessary to recruit from more than one region in the province and from a reserve site. Initial recruitment of Indigenous patients took place at various centers in Alberta, Canada, including urban academic practice locations in the two major cities of Calgary (the University of Calgary Division of Rheumatology Clinic) and Edmonton (University of Alberta Hospital Rheumatology Clinic and the Alberta Hip and Knee Clinic), an urban primary care clinic for Indigenous patients (the Elbow River Healing Lodge) and a rural reserve health centre (Siksika Health and Wellness Centre). Calgary and Edmonton are about 300 kilometers apart; Siksika is about 129 km east of Calgary. Indigenous peoples with arthritis were approached by clinic staff for permission to have researchers contact them about the study. Recruitment was also encouraged with posters at the clinics. Eligible participants were ≥18 years of age, and self-identified their Indigenous status and arthritis diagnosis. Healthcare providers were recruited through the clinical members of the research teams' peer networks. These providers were from a variety of disciplines, including physiotherapy, nursing, primary care physicians, and specialty care physicians (rheumatologists and orthopaedic surgeons). All participants' identities were anonymous in that the research coordinator did not report to the team the content of their study interview. Theoretical sampling techniques guided recruitment. We wanted to include patients with a variety of conditions and lengths of illness, and who had experienced different aspects of the continuum of care possible for arthritis patients so that we could explore if there were barriers at different stages. During the analysis additional participants with specific characteristics were sought as the theory emerged and different perspectives were hypothesized [15]. For instance, it was thought that there might be important differences between patients actively engaged in care as compared to those who were not. Recruitment was then expanded outside healthcare facilities to 6 community organizations in Edmonton that did not directly deliver healthcare services. After preliminary data analysis of the healthcare provider interviews, gaps in key arthritis care service areas were identified and further family and specialist physicians were recruited at their respective clinics. Preliminary analysis also showed that many healthcare providers in Calgary and Edmonton in fact had limited experience serving Indigenous peoples. It was hypothesized that providers with more extensive experience with this population may hold different perspectives, and these participants were sought at a family practice, and a physiotherapy clinic in communities other than Calgary, Edmonton and Siksika. Data collection, analysis and recruitment continued in this way until saturation was reached in the analysis; that is, no new information was being identified [17][18][19]. Interviews and data |
analysis Individual, face-to-face, semi-structured interviews were based on interview guides created for each participant group. The interview guide for patients was focused on the participants' story about their disease, causes, progression, and their history of seeking health services. The interview guide for providers investigated their experiences in serving Indigenous people with arthritis, their ideas about gaps in health service utilization, as well as their thoughts on the barriers and facilitators to healthcare access for Indigenous peoples. Interviews were conducted by three research assistants and one of the authors [SC] who received training in qualitative interview methodology [20]. The interviewers explained the study purpose and design to participants during the informed consent process, in person, immediately proceeding the interview. Interviews took place between July 2012 and February 2013 at the clinics or a location of the participants' choosing. Each interview was recorded and transcribed verbatim; a 10% sample was randomly selected and the audiotape and transcribed versions compared as a quality insurance measure of transcription accuracy. Interview transcripts were uploaded to NVivo 9© for analysis and a separate project file was created for the patients and providers. Field notes, written during and after interviews, were included in the project files. Coding of the data followed standard procedures for grounded theory (i.e., open coding, axial coding to cluster codes into categories, and selective coding to develop themes and concepts) [15]. Initial analysis was performed in parallel by separate researchers [WT & SC] to allow for contrast and comparison. After a draft model was developed the entire research team reviewed the description and debated the interpretations [21]. This was done in videoconferences, teleconferences, in face-to-face meetings and through email with attendance varying. When needed, WT and SC would return to the data to respond to questions and concerns. Several iterations of the model were produced before the results were presented back to the participants. The final model was also provided to the directors and managers of those clinical recruitment sites for which existing long term research agreements with study team members were in place. Rigor Several aspects of the methodology ensured rigor in the study. Analysis was triangulated by having two researchers work separately and then together. This was augmented by having a multidisciplinary team work on analysis and writing with access only to anonymous data. Differences in interpretation were debated and consensus achieved. Member checking was used to validate the analysis. The patient and provider contributions to the model were compiled in separate summary reports and returned to the participants in that group. This was done so as not to engage each group in debating the validity of the other group's perspectives when they had not seen the data. Rather we wanted to know if the representation of each group's collective response was seen by the members as accurate. Patients were sent the reports using mail or email based on their preference. Providers were emailed the report. Attempts were made to contact all participants to ask whether the report aligned with their views, if they disagreed with anything, and if there was anything that needed to be emphasized or clarified. Participant feedback was collected by one author [SC] during phone conversations or by email. The feedback was read and discussed by two researchers [SC & WT]. Feedback on the preliminary report was received from 5 patients and 5 providers. All responded positively to the contents relevant to them and did not suggest changes or reemphasis except in one case. One patient said they would not use the phrase 'toughing it out' but then later in the phone call discussed using this process. Since others had used this phrase we decided to keep it. Multiple providers asked to see the patients' view but this was not provided until the study was completed. Literature, including Kleinman [14], was consulted during the analysis to aid in interpretation [15] and strengthen the reliability and validity of the study. To ensure transparency, quotes from the research participants were used to illustrate key components of the model and demonstrate how perspectives of participants were included in analysis and interpretation. Ethics Ethical approval was granted by the Health Research Ethics Board at the University of Alberta (Pro00022623) and the Conjoint Health Research Ethics Board at the University of Calgary (E-24575). The two researchers who accessed the primary data were not clinicians and this ensured that no patient or provider could be identified by the rest of the team. Care was taken not to reveal identities in the quotations selected for reporting of results. A unique identifier for each participant is used for quotations with IP representing Indigenous Patient and HP, Healthcare Provider. Participants Indigenous Patients (IP): Sixteen self-identified Indigenous people with arthritis participated, the majority of whom (n = 13) were recruited from the specialty clinics. Three participants were recruited through organizations that did not provide healthcare directly, and 2 of these were not actively receiving care. Our sample included participants from urban and rural areas of both southern and northern Alberta, including 5 males and 10 females, ranging in age from 30 to 73 years. According to patients they had been living with either osteoarthritis or rheumatoid arthritis for <1 year to >20 years. Interviews were 24 to 97 minutes in duration. Healthcare Providers (HP): Fifteen healthcare providers were recruited in total, including physiotherapists, occupational therapists, nurses (registered nurse, licensed practical nurse, nurse practitioner and case manager), general medical practitioners, orthopaedic surgeons, and rheumatologists. Providers were at various stages of their career, having practiced for anywhere from 3 to 46 years. Interviews with health providers lasted 34 to 90 minutes. The conceptual framework The theoretical framework resulting from the study is depicted graphically in Figure 1. We will begin with an overview and then present the results in more detail. Consistent with Kleinman [14] the providers and patients described different social contexts that affect how they understand and describe the experience of seeking care for arthritis by Indigenous peoples. For Indigenous patients, interactions directly experienced between themselves and providers, and indirectly experienced between their family members or friends and providers, inform their decisions about accessing various parts of the healthcare system or individual providers. Healthcare providers are largely informed about Indigenous peoples' experiences with arthritis through their past interactions with patients. The complexity in the provision and governance of healthcare for Indigenous peoples in Canada creates another barrier to care. When providers are able to work around existing systems and structures and create innovative access models that embrace culturally safe environments, utilization can be improved substantially. The indigenous patients' frame: 'tough it out' When asked about their disease, patients gave vivid descriptions of the symptoms of arthritis, predominately pain, stiffness and reduction in physical mobility. The following quote from a patient in the early stages of rheumatoid arthritis illustrates the all-encompassing impact of the disease: "I needed help to get up from bed......I need help to go to the washroom. I need help to bathe myself, like I was literally falling apart I thought I was eh....and, and it was all happening just (snapping fingers) so fast. (30IP)" The emotional impact of the symptoms and lifestyle changes that impacted them and their family were also evident in the majority of the interviews. The patients described frustration, anger, and depression as a result of their experiences and often, associated with onset of disease. When the patients discussed their arthritis symptoms and complications of the disease the phrase "toughing it out" was often used. Going to the doctor as soon as one felt pain in one's joints would not be expected, and delays in seeking medical care were often attributed to this 'toughing it out' frame. Patients reported that they continued to use 'toughing it out' as a coping mechanism through the course of the disease. Living with arthritis was predominately described as hard but there was a common story of perseverance, for instance, "the guy [father] showed up what, what strong meant, you know, you gotta, you gotta be strong. You gotta, you never give up" (33IP). One patient also articulated 'toughing it out' as a traditional teaching that guided life generally. This illustrates that the social context in which the Indigenous patients make their decisions is informed by present day as well as historic factors: "You know and Kokum used to tell us this story. Indians said in life it's like going through the trees, the bushes and that and you stumble and you trip over these logs that have fallen and you get scratched and you break this and that and then all of a sudden you come to a clearing, but that's life, you're going through this forest and you know this happens, that happens. It's just, it's just part of life. It is, you know. And then you come to a clearing, not that that's the end of it but at least you got through that hardship. That's just it, everybody has to go through it. Like it or not, you have to go through it. (32IP)" As the disease progressed, 'toughing it out' eventually became too difficult. The patients articulated that family members were often influential in the early decision to seek care and in managing their condition. Some people sought relief through traditional medicine and allopathic health care, how this did not seem to play a large role in arthritis care for the majority of participants. Social context and comorbidities Patients in this study were also 'toughing out' many comorbidities (e.g., diabetes, amputated feet, heart disease, eczema) and not just the pain from arthritis. Additionally, socially and emotionally they were 'toughing out' painful life events and challenges. The inclusion of side comments about traumatic events was common, revealing families and communities with addictions, mental health issues, physical disability, cancer and other diseases. These were not described as unexpected or unusual events, but were normalized in conversation. Thus, family members may be requiring the patient's social support at the same time the patient has an appointment or has to make some other decision around treatment of their arthritis. In one case a participant described challenges determining optimal medication for arthritis management while at the same time she battling cancer and was assisting her nephew with stressful financial challenges. Eleven of the patients named a relative that also had arthritis, in fact, naming more than one was common and 3 people named five or more family members. Sometimes these family members were also 'toughing out' arthritis symptoms. Thus, arthritis was constructed as a disease that was so common that it was normalized, as were other sources of suffering. The provider frame: lack of 'buy in' All of the professionals were trained and had practiced a minimum of three years. They exemplified the professional sector as described by Kleinman [14]. They were working in complex health care systems that were regularly under evaluation and scrutinized by government and non-government organizations for efficiency and competency. Attention to the needs of Indigenous peoples was covered by a relatively small portfolio in the provincial health system called the Aboriginal Health Program that had only recently begun education in cultural safety. Thus, the practice frame was based on expectations developed primarily for non-Indigenous patients, and professional expectations from professional bodies and governance structures. Most providers who saw a large number of Indigenous patients described an increased severity of arthritis in them compared to non-Indigenous patients: "I find that they often present with more severe disease, ah, more advanced disease, untreated disease" (08HP). From the provider point of view, patients lacked 'buy in' and they often stated that if the patients had more knowledge of arthritis and potential therapies their 'buy in' would increase. Providers believed that Indigenous peoples didn't understand the value of health services, or believe that treatments would improve their quality of life, and didn't trust the recommendations of providers: "I think it might have to do with access [to health services] but even if the access were there, it, it might also have to do with their own buy in. Um, like do they, do they feel that the health professionals that are, that they do see are actually going to be helping them, will they seek the help? (02HP)" Providers reflected on the impact of delayed presentation of illness on their role as care |
providers. They saw living with the disability of pain and joint dysfunction as unnecessary and unacceptable. The poor condition of patients at presentation was perceived as a preventable result of patients' actions and inactions. This created frustration for well-intentioned providers that would become a source of tension between them and Indigenous peoples from the first appointment. Professional expectations and training Most providers thought that much of Indigenous peoples' lack of 'buy in' could be resolved by education to ensure Indigenous peoples understand the inherent value of specialists and services in improving their quality of life or alleviating their symptoms. The following quote exemplifies the argument that knowledge will lead to what are viewed as rational decisions: "I think there's a huge educational component to it and I don't mean teaching physicians how to spot arthritis. I think teaching Aboriginal individuals that there is better treatment available and using it is, is not a submission to anything other than smart behavior. (43HP)" Except for those professionals working in an Indigenous health centre, participants placed less emphasis on the historic, social, and cultural factors that differentiate Indigenous patients from non-Indigenous patients. Health systems: experiences with care The interactions between patients and providers that informed their framing of Indigenous experience with access to arthritis care took place within health systems. Past experiences with providers were mentioned by more than a third of patients, and patients recruited from the community were particularly vocal about the racism they had experienced in those encounters. Once patients sought care, their arthritis stories evolved as an interaction between their experience of symptoms and treatment received (both medical treatment and behaviour of providers). Once in care their assessments of their arthritis and their views of healthcare depended on the responses they received from providers. Some patients discussed positive relationships with family physicians who had facilitated referral to arthritis specialists and ironically, given the more advanced state of their disease and lack of cultural safety in the system, most of the participants were satisfied with the care they were currently receiving. This could rapidly change, however, as one participant explained that having seen a rheumatologist twice she missed appointments because of her job and that doctor then refused to see her again. She waited until moving to another city to get a new referral to another rheumatologist. Another patient described the impact of a negative interaction with a provider who offended them: "I find the best thing for me to do is just walk away because Lord knows I don't, I don't take kindly to people that treat me that way or anybody else for that matter and the best thing was just to walk off. (32IP)" Among providers, the most salient evidence of lack of 'buy in' experienced through missed appointments, a topic that was commonly raised. Not surprisingly, appointments were much more salient issues for providers than for patients, as appointments are also a means of ordering provider work. Appointments were discussed by providers along the pathway of arthritis services (primary care, allied health and specialists) who shared perceptions that Indigenous peoples more frequently miss appointments: "I guess the fact is for a certain segment of our population, you cannot assume that they're going to come back, you know, so if you have something that you need to tell them, you know, it's very problematic. (29HP)" Providers discussed the perceived consequences of missed appointments. Often viewed as a missed opportunity for health provision, a loss of continuity of care, or a miscommunication between patients and providers, missed appointments caused frustrations for providers that became linked to stereotypes. The consequence may be a subtle change in how Indigenous peoples are viewed as articulated by a participant from a primary care service: "Lots of people don't understand it so our patients are a no show, the non-compliant word comes out and, ah, and they won't rebook them so we have to try to rebook them somewhere else, like there's no flexibility within the system. That's the big thing. I guess is another big thing is there's no flexibility. (28HP)" This is reinforced by the response from one provider when asked about the influence of health attitudes on arthritis care: "Yes I think because of historically there have been so many challenges, that, that you start to develop an impression and, and that's a barrier" (02HP) to arthritis care provision. Influences on health systems for indigenous people in Canada External political factors influence health and the internal structure of local health care systems [14]. Although participants did not describe this concept explicitly, the research team recognized in the stories and in the provider interviews that these systems contribute to complexities in arthritis care provision. It is beyond the scope of this paper to describe the funding structures and policy mechanisms that are in play, however, at the patient and system level they result in confusion over how services will be paid for. Provincial governments provide universal insured health services to all citizens to cover hospital and some outpatient services. First Nations living on-reserve and Inuit are provided some medical supplies, some prescription drugs and medical transportation as specified by the Non-Insured Health Benefits program. First Nations patients living off-reserve and Metis populations can only acquire these benefits by purchasing them independently or through their employer or school [8]. The actual provision of services on-reserves is variable, as is the actual provision of uninsured benefits and Indigenous people who are unregistered, Métis, or living in a city have an even more complex environment [9]. Although many providers did recognize geographic, financial or social barriers to accessing care, they realized that the structure and expectations of the health systems did not allow them to take these into account in providing Indigenous peoples care: "And sometimes I think, you know, is it time, is it, you know, because we schedule 15 minute or 30 minute appointments? Is it not enough time to explain or listen to the story correctly? (41HP)" Two clinics that focused uniquely on Indigenous care described taking the opportunity to work around the systems to try new ways to improve access. The clinic in Siksika, for instance, made 'drop-in' or unscheduled appointments available partially to offset the emphasis on appointments, and the Elbow River Healing Lodge had an outreach worker who was available to address the needs of clients in the community. Discussion The strengths of this study include the methodological coherence and attention to rigor. The multidisciplinary team was a real strength in triangulating the analysis. In addition, sampling from more than one site, with two cities, including both patient and provider views, and covering more than one reserve in Alberta helped ensure there is greater transferability of results. Of course, the alternative weakness is that the research took place within one provincial health system and a context where access to health care is universally available and these may not represent other locales. This is the major weakness of the study but we tried to provide as much information as possible, within the limitations of space, for others to assess the applicability of the results to their locales. Many procedures were employed to ensure participant comfort; however, the limited discussion of use of traditional medicines may indicate that they did not feel completely free to discuss openly. On the other hand, many sensitive topics were discussed, so the alterative explanation is that traditional medicines are not widely used. We do not feel that this information was critical to our model; however, a new study by team members will more thoroughly investigate the question of traditional medicine use. This study makes an important contribution to the scant literature examining arthritis healthcare utilization for Indigenous peoples. The results can also be useful in understanding access for other chronic diseases requiring involvement of specialists. Arthritis is a chronic disease that can lessen quality of life directly through the pain and disability experienced, and indirectly through limitations on the ability to work and to enjoy other activities. While the biomedical disease may follow similar paths in Indigenous and non-Indigenous peoples of a similar age and background, in the Indigenous population the imbalance in social determinants of health are factors that create additional complexity in management. The tendency to place responsibility on patient attitudes is not helpful when it is systemic factors that create barriers to relationship development among patients and health care providers. The results help explain low utilization rates for specialist care among Indigenous people within the context of a continuum of care. It appears this is not driven by cultural and social preferences for non-specialist care, but rather by prior negative experiences with racism in the healthcare system. Others have shown that health sector discourses and practices around evidence-based practice in medicine, have contributed to colonization and marginalization [22]. Methodological biases in research preclude evidence based on "tradition, convention, belief, or anecdotal evidence" [22]. In addition, based on western traditions of science and evidence, evidence-based practices have rarely been tested with Indigenous populations, yet when they don't respond like non-Indigenous people, they are viewed as having deficits. A general criticism of health system reform from a health promotion perspective is that risk factor epidemiology continues to be the dominant paradigm in North America, with a focus on changing individual behaviors rather than addressing the social and structural determinants of health [23]. We have shown that models of care that assure innovation around colonial systems and cultural safety are valued by both patients and providers and provide a means to achieve equitable health outcomes. In fact, the reports of some participants suggested that policies around creating culturally safe relationships and environments in health care settings may be the priority for simultaneously engaging and retaining patients in care. Families emerged as an important factor in utilization of arthritis care. The Indigenous peoples in this study revealed families and communities with many other health conditions, and as found by others Indigenous people may prioritize family, friends and community needs over their own health [24]. Participants described some circumstances (e.g., a funeral in the community) in which the Indigenous patients chose to attend to those social obligations over an appointment with a healthcare provider. It is also important to note that the cultural values of putting family and community first are among those that have kept Indigenous peoples resilient in the face of repression, oppression and repeated attempts to assimilate them. This highlights that arthritis care strategies must incorporate a broader view of the 'patient' to include the familial support systems. In Kleinman's model [14] the professional sector has a strong influence on how health and health care are understood and valued and this was illustrated by the assumptions about accessing allopathic health care that were implicit in the study and deserve the label hegemonic. The first assumption was that allopathic health was acceptable and desired. The second was that appointments with specialists were valued resources. The healthcare provider frame was centered on the idea that the 'buy in' of Indigenous peoples' had to be fixed. The providers assumed that Indigenous peoples had knowledge deficits (not knowing enough about arthritis as a disease or of the effectiveness of certain treatments), cultural deficits (not appreciating the value of an appointment), and resource deficits (transportation), among others. This frame borrows from the deficit model, placing the responsibility on individual limitations, and assuming weaknesses in individuals or communities [25]. This bias towards individual patient level rather than systemic solutions was reported in another study where providers who were asked about barriers to renal transplantation focused on language issues and cultural factors [26]. As reported, "this propensity to locate the problems with the patients rather than in the interaction with the system or the system itself might de-emphasize modifiable factors that may be hindering Aboriginal patients from engaging in their treatment" [26]. It is notable that the healthcare providers did not query what the deficits were in their various health professions (family physician, surgeon, physiotherapist, pharmacist, and so on) that may account for their failure to attract Indigenous peoples to their practice. Examination of the provider frame based on hegemonic assumptions points to underlying ability expectations held by health providers. Wolbring discusses how ideas, described by the deficit model, can form ability expectations that become normative and slide |
into ableism, which is associated with prejudice and discrimination [27]. For example, when wanting people to keep an appointment morphs into viewing this as an essential ability, the result is ableism. This ability expectation lens aids in understanding how inequities can be reinforced within the healthcare system and the building up of stereotypes of Indigenous patients as disrespectful, unreliable, and so on. It is easy then to generalize these characteristics to all Indigenous peoples, thus reinforcing racism. This is made more possible in a provider culture where failed appointments are seen as a drain on scarce resources [28]. A negative impact of nonattendance by patients on the patient-provider relationship has been demonstrated in other contexts [29]. The type of personally-mediated racism described in the study is often unconscious and unintentional [30]. Healthcare settings provide conditions for stereotyping of minority members even by well-intentioned health providers [31]. Stereotyping, bias and uncertainty have been found to contribute to health disparities for other minority populations, and were also linked to healthcare systems and the legal and regulatory processes surrounding health services [32]. The deficit model is actually detrimental to Indigenous peoples because it can reinforce existing apathy and neglect by providers [25]. Thus, utilization is better explained by biases, stereotyping and discrimination experienced. Therefore, achieving equity in arthritis care will depend on the broader availability of culturally safe systems, rather than changes in individual Indigenous peoples or providers. Indigenous people in New Zealand face similar patterns of health disparities in both health status and access which have been linked to privilege and deprivation [33]. Improving access to arthritis services is not just a task for health systems, but calls for other systems (e.g., education, legal, social welfare) to remove differences in privilege and deprivation. As health promoters have found, this call for interdisciplinary work across sectors is common, but little success has been achieved in the efforts [34]. Nevertheless, the Ottawa Charter for Health Promotion [35] remains the best framework for facing these dilemmas with recommendations for building healthy public policy; creating supportive environments; strengthening community action; developing personal skills; and reorienting health services. Conclusion This qualitative study improves understanding of arthritis healthcare use among Indigenous peoples, and adds to scant literature in this field. Analysis of qualitative interviews showed how hegemonic assumptions around healthcare can lead to stereotyping. The resulting framework reveals how low specialist care use by Indigenous patients may be driven by prior experiences of racism. Although 'toughing it out' may be an important survival skill for marginalized and oppressed peoples, providing arthritis services that incorporate the family in a patient care plan and ensure cultural safety may facilitate the care pathway for Indigenous patients. Health systems must be re-oriented to keep the patients as the centre of focus of care, in order to achieve their aim of optimal health outcomes. Addressing arthritis care reform will necessarily require improvements in social determinants of health for Indigenous population. Abbreviations IP: Indigenous patient; HP: Health provider. The role of plain radiographs in the diagnosis of chronic maxillary rhinosinusitis in adults Background: Computed tomography is currently the gold standard for the diagnosis of chronic rhinosinusitis. However, this facility is not readily available in many developing countries. Thus, plain sinus radiography is still widely in use in our practice. Objectives: To assess the diagnostic value of plain radiographs in adult patients with uncomplicated chronic maxillary rhinosinusitis. Methods: This study was carried out at a tertiary health facility in Northern Nigeria. All adult patients with clinical and radiological diagnosis of chronic maxillary rhinosinusitis were included. Results: A total of 88 patients were recruited into the study. There were 51 males (58.0%) and 37 (42.0%) females. Their ages ranged from 18 to 60 years; with a mean age of 31.7+ 9.20 years. Mucosal thickening was the commonest diagnostic plain radiographic feature, and fluid level was the least. Maxillary antra with diagnostic plain radiographic interpretations of fluid level, haziness and opacity had high specificities (100%, 95.2%, and 85.7%) and high positive predictive values (100%, 75%, and 70%) respectively. Conclusions: Plain radiographs are relevant in the diagnosis of chronic maxillary rhinosinusitis in our locality only when they show features of fluid level: findings of haziness and opacity are of less diagnostic value. Introduction Chronic rhinosinusitis is still a common health problem encountered by many physicians: particularly, the Otolaryngologists worldwide [1][2][3][4] . Although this disease is associated with few complications nowadays, the complicated ones are still considered potentially fatal 5,6 . Computed Tomography (CT scan) is currently reputed to be the radiographic gold standard for the diagnosis of patients with this disease [7][8][9][10][11] . Also, it provides a navigational guide of the surgical anatomy of the paranasal sinuses -a prerequisite for Functional Endoscopic Sinus Surgery. 7 Magnetic Rasonance Imaging (MRI) is however of limited value in this condition, being only useful when intracranial complication or allergic fungal rhinosinusitis is suspected. [11] CT Scan is still not routinely applied in the diagnosis of chronic rhinosinusitis in Nigeria for obvious reasons of high cost,. and also the health risk (high radiation dose) 7,9 . Moreover, this facility is not readily available in many developing countries including Nigeria. 2 Consequently, plain radiography is still in use in our practice for the diagnosis of this disease. Unfortunately, plain radiography lacks reliability even in experienced hands, while also issues of observer error are some of its setback. On the other hand, it has the advantage of easy interpretation, lower radiation dose, and is cheap in comparison with CT scan and MRI. Nevertheless, is the continued use of these plain radiographs in the diagnosis of chronic maxillary rhinosinusitis in our environment justifiable? Previous studies were done decades ago, and to the author's best knowledge, very few were in our setting. 2,12 A study on this will help to update, and also bridge the gap in the current literature in our locality. Uncomplicated chronic rhinosinusitis is defined as inflammation of the nasal cavity and the paranasal sinuses without any clinically evident extension of inflammation outside these areas for at least 12 weeks. 4,10,13 The treatment of this condition is initially medical; surgery is indicated when medical treatment fails, and when there are anatomical predisposing factors. This study was intended to access the diagnostic value of plain radiographs in adult patients with uncomplicated chronic maxillary rhinosinusitis. It was limited by the obser ver error in the interpretation of plain radiographs and maxillary antral effluents. Methods This is part of an on-going prospective hospital based study of all consecutive adult patients who presented with clinical features of chronic rhinosinusitis at the Ear, Nose, and Throat (ENT) clinics of Aminu Kano Teaching Hospital, Northern Nigeria. The study was approved by the Institutional Review Board of the hospital and an informed consent was obtained from all eligible patients. Inclusion criteria Patients were recruited into the study, if they were 18 years and above, and had a clinical diagnosis of chronic rhinosinusitis. A clinical diagnosis of chronic rhinosinusitis was made, if there were at least any two or more of the following symptoms and signs for a period not less than eight weeks: 2] Nasal obstruction: Post-nasal drip, Rhinorrhea which may be mucoid, mucopurulent or purulent, Halithosis/ malodorous breath and persistent headache Exclusion criteria Patients who suffered complications of chronic rhinosinusitis were excluded from the study. Others excluded were those with:Previous paranasal sinus surgery or trauma and previous antral lavage. For those patients that met the inclusion criteria, a questionnaire was used to obtain their bio-data, relevant medical history, and detailed clinical examinations were carried out on them. Subsequently, the patients did a standard plain X-ray of the paranasal sinuses -occipitomental, occipitofrontal and lateral views. However, only the occipitomental view (better for analyzing the maxillary sinus) was interpreted in this study. The radiographs were taken at the radiology department of the hospital by an experienced radiographer. The radiographs were interpreted by the author using a viewing box (Kenex-Electro medical Hd, Essex, England). A radiographic diagnosis of chronic maxillary rhinosinusitis was made; if there was any one of the following in the maxillary sinus radiographs: 2 Gross mucosal thickening (>5mm), fluid level, haziness and opacity. They were considered normal if none of the above was present. Subsequently, those patients with a radiographic diagnosis of chronic maxillary rhinosinusitis had an antral lavage at the earliest opportunity. The procedure was performed as described by Mackay et el. 14 In patients with unilateral disease confirmed radiologically, the two antra were lavaged. The presumed normal sides (with negative radiographic findings) were considered to have undergone a proof puncture. However, if both antra turned out to be radiologically normal, no antral puncture was performed. The lavage was reported as negative if the saline effluent was clear, and positive if it was purulent, mucopurulent, turbid or contained debris. Data analysis Data obtained were recorded in a specialized form and analyzed using Statistical Package for Social Sciences (SPSS version 13) computer soft ware program. The plain radiographic interpretations and their corresponding antral lavage results were recorded and analyzed. Test of validity of plain radiograph of the maxillary sinus was determined by calculating the sensitivity, specificity and predictive values using antral lavage findings as a gold standard. Results A total of 97 consecutive patients presented with clinical features of chronic rhinosinusitis. Nine patients were excluded because they had recent history of antral lavage -leaving 88 patients for the study. Their general characteristic is represented in table 1. Of the 88 patients studied, 68 (77.3%) did plain Xray of the paranasal sinuses: these resulted in a total of 136 maxillary antra for radiological analysis. Their various diagnostic plain radiographic interpretations are shown in table 2. Twenty patients (22.7%) did not have their plain radiographs because they could not afford the cost. Of the 68 patients who had plain X-rays of the paranasal sinuses, 31 (45.6%) had antral lavage. Thirtyseven (54.4%) did not because they either withdrew consent for antral lavage (8 patients) or had normal radiographic interpretations on both sides (29 patients). These antral lavages were done on both sides in 30 patients, while 1 patient had it on one side; the other side was abandoned due to severe pain. Therefore, a total of 61 lavages were performed. Table 3 shows the various diagnostic plain radiographic interpretations and their corresponding antral lavage results. Discussion Chronic maxillary rhinosinusitis still constitutes a disease burden in most developing countries including Nigeria. In addition, CT scan is generally accepted as the diagnostic gold standard for this disease. 7-10 However, the author could not use this facility in this study because like in most developing countries, it was not readily available and the high cost was a limitation. Hence, the use of maxillary antral lavage findings as a confirmatory test for the presence of chronic maxillary rhinosinusitis. This procedure has been used for diagnostic and therapeutic purposes in cases of chronic maxillary rhinosinusitis (especially those with retained secretions) for at least a century. 3 Although mucosal thickening was found to be the commonest diagnostic plain radiographic feature of chronic maxillary rhinosinusitis in this study, it was the least predictor of this disease. Similarly, Ezeanolue et al, 2 buttressed this in a related study. However, it is note worthy that in their study, gross mucosal thickening was defined as a value >4mm, while in this study, >5mm was used. Meanwhile, some authors considered only values 6 -8mm as diagnostic. 7] This study also found that maxillary antra with plain radiographic interpretations of fluid level, haziness and opacity had high specificities and high positive predictive values. This is particularly true for maxillary antra with fluid levels where 100% positive antral effluents were observed. In other words, plain radiographic diagnostic findings in chronic maxillary rhinosinusitis correlated well with antral lavage findings only where there are fluid levels suggestive of retained secretions. Likewise, other workers had reported similar findings in a related study. 2 In other words, they found that fluid level and opacity each had a specificity of 92.3% and positive predictive values of 87.5% and 96.0% respectively. 2 On the contrary, this study found a low to fair degree of sensitivity for all the various diagnostic plain radiographic interpretations (7.5% to 60.0%). In agreement, Patel et al, had highlighted the low sensitivity of plain radiographs in the diagnosis of this disease. 15 Furthermore, this study found |
that normal plain radiographic finding was an unreliable predictor of the absence of chronic maxillary rhinosinusitis. For instance, 8 of the 13 antra with normal features gave positive lavage results. On the other hand, some authors had found nor mal maxillary plain radiographic feature to reasonably represent the absence of this disease. 2,16] Conclusion Plain radiographs are relevant in the diagnosis of chronic maxillary rhinosinusitis in our locality only when they show features of fluid level: findings of haziness and opacity are of less diagnostic value. However, these findings might be biased because of the relatively small size of the study population. A large multi-center prospective study is recommended in order to validate these findings. Preferably, using CT scan as a gold standard to test for validity of plain maxillary radiographs. Comparative Transcriptomic and Epigenomic Analyses Reveal New Regulators of Murine Brown Adipogenesis Increasing energy expenditure through brown adipocyte recruitment is a promising approach to combat obesity. We report here the comprehensive profiling of the epigenome and transcriptome throughout the lineage commitment and differentiation of C3H10T1/2 mesenchymal stem cell line into brown adipocytes. Through direct comparison to datasets from differentiating white adipocytes, we systematically identify stage- and lineage-specific coding genes, lncRNAs and microRNAs. Utilizing chromatin state maps, we also define stage- and lineage-specific enhancers, including super-enhancers, and their associated transcription factor binding motifs and genes. Through these analyses, we found that in brown adipocytes, brown lineage-specific genes are pre-marked by both H3K4me1 and H3K27me3, and the removal of H3K27me3 at the late stage is necessary but not sufficient to promote brown gene expression, while the pre-deposition of H3K4me1 plays an essential role in poising the brown genes for expression in mature brown cells. Moreover, we identify SOX13 as part of a p38 MAPK dependent transcriptional response mediating early brown cell lineage commitment. We also identify and subsequently validate PIM1, SIX1 and RREB1 as novel regulators promoting brown adipogenesis. Finally, we show that SIX1 binds to adipogenic and brown marker genes and interacts with C/EBPα, C/EBPβ and EBF2, suggesting their functional cooperation during adipogenesis. Author Summary Obesity and its related metabolic diseases are growing problems worldwide. Brown adipose tissue (BAT) with its capability of burning off fat to generate heat is now at the center of research interest as target of therapeutic intervention for obesity treatment. In order to get a better understanding of the molecular mechanisms and transcriptional programs underlying brown adipocyte differentiation, we profiled the epigenomic and Introduction Obesity and its associated metabolic complications such as diabetes are increasingly responsible for significant economic and social burdens in many countries worldwide. Physiologically, obesity develops when energy intake exceeds energy expenditure, and the current treatments of obesity have been primarily focused on reducing energy intake. Unfortunately, these measures were largely inefficient in maintaining long-term weight loss [1]. The recent discovery of thermogenic adipocytes [2][3][4][5] capable of burning fat in adult humans has provided an exciting new therapeutic approach for the treatment or prevention of obesity by increasing energy expenditure [6]. Fat cells are derived from multipotent mesenchymal stem cells (MSCs), which can give rise to muscle, adipose, bone, or cartilage cells when given appropriate environmental cues. These cells can be broadly divided into fat storage cells, such as white adipocytes (WA); and fat burning cells, which include classical and inducible brown adipocytes (BA) (also known as beige or brite adipocytes) [7]. Brown cells contain high density of mitochondria and dissipate chemical energy as heat through the action of the mitochondrial protein UCP1 (uncoupling protein 1). It is evident that increased activity of thermogenic brown cells has beneficial effects on whole body metabolic homeostasis [3,5,8] and various environmental cues such as cold exposure and chemical activation of the β-adrenergic pathway can significantly up-regulate BAT activity [2,9]. Over the last couple of years, a number of protein factors as well as long non-coding RNAs (lncRNAs) and microRNAs have been identified as regulators in this process. For example, the members of the bone morphogenetic protein (BMP) family, the PPARγ co-factor PGC1α, the transcription factors (TFs) PRDM16, EBF2, KLF11, the protein deacetylase SIRT1, the secreted factors IRISIN and FGF21 as well as lncRNAs Blnc1, lncBATE1, and microRNAs miR193/365 have been shown to be essential for thermogenic fat cell recruitment [6,[10][11][12][13]. To promote thermogenic adipocyte recruitment, it is necessary to have a fundamental understanding of the gene regulation networks that control brown and white adipogenesis and identify the key differences between these two morphologically similar but functionally distinct cell types. Gene regulation networks are composed of cis-regulatory elements and transregulatory protein factors. In response to environmental stimuli, trans-factors bind to cis-elements such as enhancers or silencers to modulate gene expression. Given the large size and complexity of mammalian genomes, it has been difficult to systematically identify cis-regulatory elements at the genome-wide level. The recent discovery of signature histone modifications for these cis-elements (eg. H3K27 acetylation for active enhancers) and the advance in massive parallel DNA sequencing facilitated to comprehensively define these elements. In addition to typical enhancers, a group of so-called super-enhancers was discovered recently. These super-enhancers are large enhancer clusters containing high-density transcription factor binding and are associated with cell type specific genes [14]. They are also stronger in terms of gene activation ability and play key roles in controlling cell identity in mammals. Trans-regulatory factors are mainly identified through differential gene expression and genetic analyses. For example, the prominent adipogenic factors PPARγ and C/EBPα are novel regulators, resulting in the identification of four activators of BA differentiation in this study. Results Comprehensive profiling of the transcriptome and epigenome during murine brown adipogenesis To examine the molecular control of cell fate transitioning from uncommitted progenitor cells to BAs, we used C3H10T1/2 MSCs and differentiated them into BAs, following a previously established protocol [24], where the multipotent progenitors were first committed to the brown lineage by BMP7 treatment before differentiation was triggered using a chemical cocktail ( Fig 1A). In addition, the well-established WA differentiation model 3T3-L1 was included in this study for comparison of events during differentiation. We first confirmed the efficiency and specificity of our differentiation systems by visual inspection of cell morphology, by qRT-PCR, and Western blot analyses of lineage marker gene expression (S1 Fig). The differentiation process for both lineages was highly efficient, as virtually all cells accumulated lipid droplets by day 7 of differentiation (S1A and S1B Fig). As expected, Pparg2, the master regulator of adipocyte differentiation, and other adipogenic marker genes such as Fabp4, CD36, Lpl, Adipoq and Cebpa were strongly up-regulated in both lineages in response to differentiation signals. In contrast, BA marker genes including Ucp1, Cidea, Elovl3, Ppara and Prdm16 were activated only in mature BAs, and the mitochondrial marker genes Cox7a1 and Cox8b were expressed much higher in mature BAs (S1C and S1D Fig). Corresponding expression patterns were also detected at the protein levels for PPARγ, UCP1, PPARα and CIDEA (S1E Fig). These data indicated that our differentiation processes were specific and efficient. Next we profiled the transcriptome and epigenome during murine brown adipogenesis at five key time points: (1) day -3 (d-3, uncommitted progenitors); (2) day 0 (d0, end of brown lineage commitment by BMP7 treatment); (3) 6 hours (6h, end of epigenomic transition [23]); (4) day 2 (d2, early BA differentiation) and (5) day 7 (d7, mature BAs) (Fig 1A). For transcriptome profiling, we used RNA-seq for mRNAs and lncRNAs, and an array-based method for microRNAs. To validate our transcriptomic analysis during brown adipogenesis, a second replicate of the RNA-seq experiment was performed and the results indicated that the data were highly reproducible (S1 Table). In parallel, we also profiled the transcriptome using RNA-seq for mRNAs and lncRNAs, and microarray for microRNAs during 3T3-L1 WA differentiation. When compared with the transcriptomes of mouse adipose tissues, we found that our in vitro BA and WA systems are closely related to their corresponding in vivo tissues (S1 Table). To complement the analysis of transcriptional changes during brown adipogenesis, we also performed a comprehensive profiling of the dynamically changing chromatin landscape during BA differentiation by ChIP-seq. In this effort, we mapped a number of key chromatin marks including H3K4me1, H3K4me3, H3K9ac, H3K27ac and H3K27me3 during BA differentiation. We also performed replicates at two key time points (d0 and d7) for all histone marks and the results showed that our ChIP-seq data were highly reproducible (see S1 Table and S2A-S2C Fig). In addition, we profiled PPARγ binding using ChIP-seq in mature BAs where it is highly expressed. Examples of the epigenomic and transcriptomic landscapes as well as PPARγ binding during BA differentiation at the brown selective genes Cidea, Ucp1 and Ppara are shown in Fig 1B and S3 Fig. A corresponding epigenomic dataset for WA differentiation has been generated previously [15] and was used for subsequent comparative analyses. Prior to further analysis we validated our ChIP-seq datasets by examining the correlations between gene expression and various histone modifications. As expected, we found that highly transcribed genes were marked by active chromatin marks (H3K9ac, H3K4me1, H3K4me3, and H3K27ac) but not the repressive mark H3K27me3 at their promoters (S1 Table and S2D Fig). Together, these datasets constituted comprehensive reference maps of the epigenome and transcriptome for both BA and WA differentiation. Stage-and lineage-specific gene expression during BA and WA differentiation We first focused on genes that were dynamically regulated at different stages during adipogenesis, following the rationale that differentiation stage-specific expression mirrors functional roles for those genes. To this end, we systematically examined coding genes, lncRNA genes, and micro-RNA genes (Fig 2, S4 and S5 Figs, S2 Table). Using an entropy based method (See "Materials and Methods" section for details), we identified a total of 2277 (BA) and 1513 (WA) differentiation stage-specific coding genes (FPKM>5), which were 26.2% and 16.0% of the expressed genes in the respective lineages. The higher number and proportion of genes with dynamic expression in BA are in agreement with the requirement of executing additional gene programs to commit MSCs into the adipogenic lineage before differentiation. We noted a clear separation into five stages with little overlap of stage-specifically expressed genes in WAs indicating a strictly step-wise differentiation process. Specifically, 3T3-L1 cells are at the proliferation stage at d-4; at d0, these cells have been under growth arrest for 2 days [25]; after the adipogenic induction, the arrested cells re-enter the cell cycle and undergo an epigenomic transition stage at 6h [23]; while at d2, these cells are arrested again and start to differentiate [25]; finally at d7, 3T3-L1 cells are fully differentiated into mature adipocytes. In contrast, in BAs we observed a more substantial transition in gene expression between 6h and d2, whereas the time points before (d-3, d0, 6h), and after (d2, d7) showed a certain overlap of gene expression. This differentiation stage-specific gene expression pattern is likely derived from the fact that C3H10T1/2 cells continuously proliferate from d-3 to 6h without the contact inhibition and growth arrest stages observed in 3T3-L1 cells, and these cells start to accumulate fat earlier than 3T3-L1 cells (S1A and S1B Fig) at d2. To analyze our observations more systematically, we performed gene ontology (GO) analysis of stage-specific genes. The top category of enriched genes before differentiation (d-3/d-4) was "cell cycle" in both lineages, whereas the transient enrichment of "chondrocyte differentiation" was only found in BA after lineage commitment. Strikingly, the same enriched gene categories topped the list in BA at d2 and d7, i.e. "brown fat cell differentiation", "mitochondrion", and "lipid metabolic process"; but in WAs "fat cell differentiation" tops the list not before d7. This correlates with a well advanced differentiation status and accumulation of lipid droplets by d2 in BA, but not WA (see S1A and S1B Fig), and may explain similar gene expression pattern between d2 and d7 in BA. We also examined lncRNA genes that are dynamically regulated during adipogenesis (S4B Fig and S2 Table). Using the NONCODE database [26], we found in total 1985 and 2796 expressed putative lncRNA genes during BA and WA differentiation (FPKM>0.5), respectively. Among them, 857 (BA) and 1135 (WA) lncRNAs showed a stage-specific expression pattern, which were 43.2% and 40.6% of the expressed lncRNAs, respectively. The proportions of stage-specific lncRNAs in BA and WA were therefore considerably higher than the ones for mRNAs which were 26.2% and 16.0%, suggesting lncRNA genes were regulated more dynamically during |
adipogenesis than coding genes. This trend was maintained even when the comparison was limited to lowly expressed mRNAs with similar expression levels as lncRNAs, which turned out to be the least dynamic between stages (15.5% and 10.8%). In addition, we also found a previously identified lncRNA (Blnc1) that drives thermogenic adipocyte differentiation [11] to be specifically expressed in mature BAs (S4B Fig). Finally, we profiled micro-RNA gene expression along the same process, leading to the identification of known general adipogenic microRNAs (e.g. miR-378), brown lineage-specific microRNAs (miR-193), as well as several microRNAs not implicated in adipogenesis so far (S5 Fig and S2 Table). To identify lineage-specific genes, we compared the 431 genes that were stage-specifically expressed in mature BAs (d7, Fig 2A) to those 420 genes that were specifically expressed in mature WAs (d7, Fig 2B). Among them, we found that 121 genes were robustly expressed specifically in mature BAs but not WAs, and 132 genes were only expressed in mature WAs ( Fig 2C). To further compile a list of putative lineage-specific markers for BA and WA, we selected the genes showing a similar lineage-specific expression pattern both in mouse BAT/WAT tissues and primary brown/white adipocytes, according to previously published data [27] (See S4A Fig for examples). The list for BA-specific genes contained a number of classic BA markers, such as Ucp1, Elovl3, Ppara and Cidea. In addition, Slc36a2 (also known as Pat2), recently described as a brown/beige-specific surface marker [28]; Cpt1b, the rate-controlling enzyme for long-chain fatty acid β-oxidation and several other mitochondrial protein genes (Chcd10, Sirt3, Mtfp1, Aspg and Adssl1) were also identified in this list. This observation is consistent with increased number and activity of mitochondria in BAs. Of note, we also found the gene encoding the kinase PIM1 that was specifically expressed in BAs, primary BAs, and BAT. In addition, we also noticed increased Pim1 expression upon cold exposure and chemical activation of the β-adrenergic pathway ( Fig 2D). PIM1 belongs to a group of constitutively active serine/threonine kinases and has been implicated in a number of biological functions such as apoptosis and cell cycle regulation. Recent reports suggested that PIM1 might play a role in cellular metabolism by modulating the phosphorylation status of AKT [29] and AMPK [30]. Based on this evidence, we selected PIM1 for further functional analysis as a potential regulator of BA differentiation (detailed below). For WAs, only few markers were established before, of which we rediscovered Nrip1 (also known as Rip140), a co-repressor that plays an important role in repressing a number of brown selective genes [31]. Another WA-specific gene, Trem2, was recently shown to enhance adipogenesis, promote glucose and insulin resistance, and diminish energy expenditure. Several other genes identified, such as the nuclear receptor Ear2 (Nr2f6), the ubiquitin gene Ubd (Fat10), the free fatty acid receptor Ffar2, and the insulin-like growth factor Igf1, were shown to be involved in metabolism without a clear role in white adipogenic differentiation. Finally, we also provide a list of lineage-specific lncRNAs (S2 Table, for examples). Together, this transcriptomic dataset provides a valuable resource for the identification and further characterization of novel regulators for brown and white adipogenesis. To ask how the lineage-specific and the commonly expressed genes in BA and WA are regulated at the chromatin level, we examined the histone modification dynamics at the gene promoters throughout both BA and WA differentiation. As expected, chromatin marks for active promoters such as H3K4me3 and H3K27ac correlate well with gene activity at the promoter regions in both lineages. Given that a recent study [32] suggested that the removal of H3K27me3 is required for brown gene expression, it was not surprising to observe a decrease of this mark at the promoters of brown specific genes in BA ( Fig 2E). Surprisingly, in WA, where these BA selective genes were not expressed, we also found a significant decrease in H3K27me3 at their promoters ( Fig 2E and S6A Fig), suggesting that the removal of H3K27me3 is not sufficient to induce the expression of these brown specific genes. Intriguingly, in contrast to WA, we found significantly higher levels of H3K4me1 at the promoters of BA specific genes throughout BA differentiation (Fig 2E and S6B Fig). This observation suggested that the pre-deposition of H3K4me1 at the early stages of brown adipogenesis was required for efficient expression of these genes at the late stage, while the removal of H3K27me3 was necessary but not sufficient to promote brown gene expression. In parallel, we found that general adipogenic genes are only marked by H3K4me1 but not H3K27me3 during both brown and white adipogenesis, suggesting their activation does not involve H3K27 demethylation. TF binding motif analysis in stage-specific enhancers during BA and WA differentiation Enhancers are cis-regulatory elements that can activate gene expression over distance. It has been shown that enhancers are highly dynamic and play an important role in cell fate transitions [21]. To examine the dynamic regulation of enhancers during BA and WA differentiation, we identified stage-specific enhancers based on the enrichment of H3K27ac, a histone mark for active enhancers and promoters [33], and the lack of H3K4me3, a histone mark present at active promoters. We employed a similar entropy-based method as for the identification of stage-specific genes and found 24,002 and 13,429 genomic loci acting as putative stage-specific enhancers throughout BA and WA differentiation (Fig 3A and 3B). Again the higher number of dynamic enhancers in BA is in agreement with the additional commitment step in the differentiation of MSCs into the brown lineage, as compared to white adipogenesis starting from committed 3T3-L1 preadipocytes. Moreover, we observed the emergence of a distinct group of stage-specific enhancers after BMP7 treatment (compare d-3 to d0, Fig 3A), which suggested an epigenomic reprogramming during the process of brown lineage commitment. Consistent with a previous report [23], we also observed an epigenomic transition as evidenced by the formation of a new group of stage-specific enhancers within 6 hours after adipogenic induction (compare d0 to 6h, Fig 3A), while from d2 to d7, there are less changes as compared to the earlier stages ( Fig 3A). During white adipogenesis, the stage-specific enhancers at the early (d-2, d0) and late stages (d2, d7) show a certain overlap, while between d0 and d2, there is a relatively more drastic transition in enhancer formation. This pattern can be explained as at d-2 and d0, 3T3-L1 cells are under the growth arrest state [25]; after adipogenic induction, these cells go through clonal expansion between d0 and d2 [25]; beyond d2, the epigenomic reprogramming has been completed and the cells start to accumulate fat and subsequently enter the end differentiation stage at d7. To validate our analysis, we surveyed the levels of H3K4me1, another enhancer-associated epigenetic mark, at those loci and found a high concurrence between H3K27ac and H3K4me1 ( Fig 3A and 3B and S1 Table). Analysis of the genes present in the proximity of stage-specific enhancers showed that they fall into similar GO categories as the stage-specific genes analyzed earlier. This observation suggests that the stage-specific gene expression was likely regulated by the stage-specific enhancers, further confirming the role of enhancers in cell fate transitions [21]. Enhancers often serve as hubs for TFs. To identify potential TFs that bind to these stagespecific enhancers, we carried out motif analysis of enhancer associated sequences. De novo motif search led to the identification of several enriched binding motifs at each stage of BA and WA differentiation (S7 Fig). While some of the motifs are closely related to known TF binding motifs, (e.g. PPARγ in mature BA and WA) most of the motifs could not be assigned to known TFs due to our limited knowledge of the DNA binding motif for most TFs. Therefore, we examined these enhancers for the enrichment of known TF binding motifs derived from previous genome wide TF binding studies [34]. TFs with enriched motifs and robust expression at the corresponding stages are shown in Fig 3C and 3D. We found that motifs for well-known adipogenic regulators such as PPARγ, RXR, C/EBPα and FOXO1 were highly enriched in mature brown as well as white adipocytes. At the early stages, motifs for early adipogenic regulators including PBX1, KLF4 and STATs were enriched in either white or brown lineages (Fig 3C and 3D). Interestingly, the binding motif for SIX1, a homeobox transcription factor not previously implicated in the development of BAs was significantly enriched in mature BAs, but not WAs, suggesting a role for this factor in BA differentiation. To validate our finding in an in vivo setting, we also analyzed active enhancers in BAT and WAT tissue (using previously released datasets from ENCODE [35]) for enrichment of the SIX1 motif. Indeed, the SIX1 motif was found to be enriched at a much higher level in BAT than in WAT (S3 Table). Super-enhancers mark key regulators of BA differentiation It has been shown that key cell identity genes are often associated with super-enhancers (SEs) [36], a cluster of enhancers that are enriched for binding of TFs, mediator, and chromatin marks such as H3K27ac [14]. To search for novel regulators of BA differentiation, we sought to map the SEs and define SE-associated genes in both brown and white lineages and identify common as well as lineage specific SE genes. We employed the H3K27ac ChIP-seq data to define SEs because this allowed us to monitor SEs throughout the whole process of BA as well as WA differentiation and determine the SEs present specifically at the late (d2 and d7) but not the earlier stages (d-3 to 6h). To identify genes which are potentially regulated by these SEs, we filtered for those (1) within 100 kb of the SE and (2) whose gene expression patterns correlated with SE occurrence throughout differentiation. Through this approach, we identified 419 SEassociated genes for mature BAs and 417 SE genes for mature WAs (S4 Table), of which 324 were BA selective and 322 were WA selective (Fig 3E), respectively. As expected, well-known general adipogenic marker genes such as Cebpa, Fabp4 and Scd were associated with SEs in both lineages. And SE genes at late stages of BA differentiation included most key regulators of brown adipogenesis (Ucp1, Cidea, Fgf21 and Ppara) (Fig 3E and S8A Fig). Moreover, these TF binding motif analysis of stage specific enhancers and identification of super-enhancer associated genes during brown adipogenesis. (A) and (B) Differentiation stage-specific enhancers (defined as H3K27ac positive and H3K4me3 negative regions) are also marked by H3K4me1 and associate with genes reflecting their developmental stages. (C) and (D) TF binding motif analysis of stage specific enhancers with HOMER. "Site" indicates the bound TF(s), "Gene" indicates the corresponding gene coding for (one of) the TF(s). Expression of genes was determined using RNA-seq data. Sites with enriched motifs and correspondingly expressed genes were shown in the list. In differentiated BAs and WAs, the binding motifs for PPARγ, RXR and C/EBP were enriched, whereas the SIX1 motif was only enriched in BAs at late stage. (E) Genes associated with super-enhancers (SEs) in mature BAs and WAs. A subset of SE associated genes is shared between BAs and WAs, including established adipogenic markers such as Cebpa and Fabp4, whereas known brown and brite selective genes are specifically associated with SEs in BAs. (F) The Rreb1 gene was significantly up-regulated during brown adipogenesis and is associated with a SE in BAs. doi:10.1371/journal.pgen.1006474.g003 genes tended to get transcriptionally activated (S8B Fig). Notably, Fabp3, Pdk4, Cpt1b and Cpt2, which were recently identified as putative SE associated genes in a human cell culture model of browning [10], were associated with SEs only in brown cells. Intriguingly, the TF RREB1 whose gene locus has been linked to metabolic traits like T2D susceptibility, fasting glucose levels, and body fat distribution [37][38][39] through genome-wide association studies (GWAS), was up-regulated during brown adipogenesis and also associated with a SE defined by H3K27ac enrichment (Fig 3F). This SE encompasses the entire promoter region of Rreb1. Using PPARγ binding as alternative method to define SEs in mature BAs, we found that Rreb1 was associated with one of the top SEs in BAs due to robust PPARγ binding upstream of its transcriptional start site. In addition to Rreb1, other SE genes determined by PPARγ binding signals include a whole panel of key brown cell markers such as Ucp1, Pgc1a, Cidea, Fgf21 and Ppara, |
and interestingly, Pim1 (S8C Fig). Based on the above observations, we selected Rreb1 for further functional analysis in BA development and function (detailed below). BMP7 activates sox genes via a p38-dependent signaling pathway during BA lineage commitment BMP7 strongly promotes brown lineage commitment and differentiation in vitro and in vivo [24]. However, the detailed molecular mechanism underlying BMP7 function and its downstream targets during BA lineage commitment have not been thoroughly characterized. Therefore, we profiled the epigenomic and transcriptomic landscape in C3H10T1/2 cells treated with or without BMP7. To determine the molecular targets of BMP7, we compared the transcriptomic profiles between BMP7 treated and untreated C3H10T1/2 cells. On top of that, we also included the corresponding dataset from 3T3-L1 cells for comparison. To identify potential BMP7 targets, we focused on a specific group of 89 genes which showed a robust but transient induction after 3 days of BMP7 treatment (Fig 4A). Amongst those genes are modulators of WNT (Fzd9, Frzb) and TGFβ (Bambi, Scube3) signaling pathways, which were known to be involved in regulating adipogenesis (see S5 Table). In addition, the single most interesting group of genes consisted of two members of the SOX family of transcription factors, Sox8 and Sox13. Using slightly relaxed cutoff criteria, we noticed that five out of the total 20 Sox genes behave as putative BMP7 targets: Sox5, 6, 8, 9 and 13 ( Fig 4B). This observation suggested that at least part of the BMP7 response is mediated by the action of SOX proteins. Sox genes have been implicated in the regulation of embryonic development and in the determination of cell fate [40]. Sox9 expression in rat MSCs increases Cebpb expression and favors adipogenesis [41] and Sox5, 6, and 9 play important roles in chondrogenesis. Consistent with this, we observed a transient boost of chondrogenic gene expression after BMP7 treatment and enrichment of related GO categories (Fig 4C). BMP7 activates two major signaling pathways, the SMAD, and the p38 MAPK pathways. Previous studies suggested that p38 signaling is more important for the formation of thermogenic cells and the activation of β-adrenergic pathway [24,42]. To determine if Sox genes are downstream targets of either the SMAD or the p38 pathway, we pre-incubated C3H10T1/2 cells with p38 inhibitors prior to treatment with BMP7, and surveyed their expression. As shown in Fig 4D, Sox gene activation was strictly dependent on p38 signaling as the treatment of p38 inhibitors PD169316 (PD) or SB202190 (SB) completely abolished the activation of all five Sox genes by BMP7. We also examined 27 additional genes from the list of BMP7 targets and found their expression was also dependent on p38 signaling (Fig 4E), which seemed to be the major transmitter of the BMP7 signal. Notably, at least two of those genes (Col11a2 and Col9a1) are well-known targets of Sox9. From the list of five Sox genes, we selected Sox13 for further functional studies (detailed below). In another effort to identify relevant targets from our list of 89 candidates, we defined SEs according to the H3K27ac ChIP-seq data and generated a list containing genes associated with SEs at d0 upon BMP7 treatment. When we intersected both lists we found that 14 BMP7 induced genes were indeed associated with SEs (S9A Fig) and those genes might constitute another set of important targets of the cellular response to BMP7 activation. Amongst them, we found the fibroblast growth factor receptor Fgfr3, which is one of the receptors for FGF21 that promotes both BAT activation and subcutaneous WAT (scWAT) browning [43]. In addition to its robust induction by BMP7, we also observed significantly elevated levels of H3K4me1, H3K9ac and H3K27ac at the upstream enhancer region and increased H3K4me3 at the promoter of Fgfr3 gene (S9B Fig), underscoring its epigenetic regulation upon BMP7 treatment. Using different approaches of bioinformatics analysis, we identified a number of putative regulators for brown adipogenesis. From these candidates, we selected and validated the following four factors: (i) the kinase PIM1, found to be lineage-specifically expressed in mature BAs but not WAs (Fig 2C and 2D), and three TFs, (ii) SIX1, of which the binding motif was enriched in late stage BA enhancers (Fig 3C), (iii) RREB1, associated with a SE in BAs (Fig 3F and S8C Fig), and finally (iv) SOX13, which is transiently induced by BMP7 during brown lineage commitment ( Fig 4B). We first performed gain-of-function analysis of those factors during brown adipogenesis, by lenti-virally over-expressing the corresponding genes in the MSC line C3H10T1/2 before adipogenic induction without BMP7 treatment. As shown in Fig 5A, over-expression of each candidate, or EBF2, a known regulator of brown adipogenesis [16], significantly increased the differentiation efficiency of the C3H10T1/2 cells as monitored by Oil-Red-O (ORO) staining. Importantly, we also detected higher levels of brown / mitochondrial marker gene expression in the cells over-expressing the four candidate genes. These genes include the brown cell key regulators Prdm16 and Ppara, genes involved in brown cell function (Cidea and Elovl3), and genes essential for mitochondrial activity (Cox7a1 and Cox8b) ( Fig 5B). Moreover, Ucp1, the key thermogenic gene in BAs, was also up-regulated in cells expressing the four candidate genes with or without forskolin treatment (Fig 5C). And these mRNA expression changes were reflected at the protein levels as both CIDEA and PPARα proteins were up-regulated by the over-expression of the four candidates ( Fig 5D). In parallel, we also detected increased expression of general adipogenic genes such as Pparg2, Fabp4 and CD36 upon over-expression of the candidate genes, or Ebf2 (Fig 5E). This observation was consistent with increased lipid accumulation in the corresponding cells as determined by ORO staining (Fig 5A). Increased mitochondria activity leads to up-regulated oxygen consumption rate (OCR), and this is a key feature of thermogenic brown cells. To examine the effects of Pim1, Six1, Sox13, and Rreb1 over-expression on mitochondria activity, we measured the OCR in the corresponding cells 7 days after adipogenic induction. We found that both OCRs (Fig 5F) and other cellular metabolic parameters including basal respiration, proton leak, ATP production and maximal respiration ( Fig 5G) were significantly increased upon candidate over-expression. In addition, we also noticed a shift towards uncoupled respiration (Fig 5H), suggesting enhanced thermogenesis. The chemical activation of the β-adrenergic pathway by drugs such as norepinephrine can significantly stimulate BAT activity. To examine the effects of candidate over-expression on the response to β-adrenergic activation, we measured the OCR in corresponding cells after norepinephrine treatment. The results showed that cells over-expressing Pim1, Six1, Sox13, Rreb1, or Ebf2 (Fig 5J) were more susceptible to β-adrenergic activation than control cells ( Fig 5I), indicating enhanced thermogenic capability. Taken together, these results suggested that all four candidates either facilitate the commitment or the differentiation process from MSCs to functional BAs. We showed that Pim1, Six1, Sox13 and Rreb1 were sufficient to promote brown adipogenesis. To test whether they were also necessary for BA differentiation, we performed loss-offunction analysis using Stromal Vascular Fraction (SVF) cells isolated from BAT transfected with LNA longRNA GapmeR oligonucleotides to knock down the genes of interest before adipogenic induction. As shown in Fig 6A, cells transfected with a scramble oligo (Scr) readily differentiated into mature BAs, whereas knock-down of either the candidate genes using two independent GapmeRs or Pparg led to severely reduced capabilities to differentiate as demonstrated by ORO staining. In addition, prominent brown / mitochondrial regulators and (Fig 6B), as well as Ucp1 (Fig 6C) were down-regulated in cells with Pim1, Six1, Sox13, and Rreb1 knock-down. Consistent with the ORO staining results, adipogenic markers including Pparg2, Fabp4 and CD36 were also reduced (Fig 6D) by the knock-down of the candidate genes (Fig 6E). We also validated the function of the four candidates in SVF cells isolated from posterior scWAT. Those cells have a certain capacity to "brown" [44] and over-expression or knock-down of the four candidates resulted in similar outcomes as observed in the MSC and BAT SVF cell systems (S10 and S11 Figs). SIX1 binds to brown marker genes and interacts with key regulators of brown adipogenesis To gain further mechanistic insight into the mode of action for one of the identified factors, SIX1, we mapped its genomic localization via ChIP-seq in mature BAs. We found in total 7366 binding peaks for SIX1 with most of them located at intergenic regions, introns and promoters (Fig 7A), which is typical for TFs [45]. GO analysis of the SIX1 binding genes revealed that "regulation of generation of precursor metabolites and energy", "negative regulation of TGFβ receptor signaling pathway" and "brown fat cell differentiation" were amongst the most significantly enriched categories (Fig 7B). We detected SIX1 binding at the cis-regulatory regions (marked by H3K27ac) of brown markers such as Cidea and Ucp1 (Fig 7C). Moreover, we observed partial overlap of SIX1 binding to PPARγ binding at these regions. In a more quantitative analysis we measured the strength and proximity of SIX1 binding at brown-specific, white-specific and commonly expressed (i.e. white and brown) genes. We found that SIX1 bound preferentially around brown-specific and commonly expressed genes as compared to white-specific genes, suggesting a role for this factor in regulating brown selective as well as general adipogenic gene expression (Fig 7D). To decipher the molecular mechanism underlying SIX1 function, we performed a motif analysis of SIX1 bound regions. As expected, the most enriched binding motif was for SIX1 itself, which was followed by motifs for C/EBP, EBF, and NF1 TFs (Fig 7E). PPARγ and RXR binding motifs were only mildly enriched. The enrichment of C/EBP and EBF binding motifs at SIX1 binding sites suggested physical interactions between these TFs. Indeed, we verified the direct interactions between SIX1 and C/ EBPα, C/EBPβ, as well as EBF2 using co-IP assays (Fig 7F). Finally, using luciferase activity assay, we found that an upstream enhancer element of the Cidea gene harboring a SIX1 motif (S12 Fig) promotes expression in a SIX1-dependant manner (Fig 7G). Together, our findings corroborate a model in which SIX1 can be recruited to brown-specific or general adipogenic genes through either direct DNA binding (via the SIX1-binding motif) or recruitment by EBF2 and C/EBP proteins (at regions with no SIX1-binding motif). Discussion Promoting energy expenditure through thermogenesis is of significant interest as potential therapy for obesity and related diseases. It requires the recruitment of thermogenic fat cells such as brown and beige/brite adipocytes. Existing evidence suggests that the majority of these thermogenic cells are recruited de novo in response to environment cues [43,[46][47][48]. Therefore, to promote thermogenic adipocyte recruitment, it is essential to have a fundamental understanding of the gene regulation network that governs brown adipogenesis, especially at the lineage commitment step. In this study, we provide comprehensive profiles of the transcriptome and epigenome at five key developmental stages throughout the differentiation of murine multi-potent MSCs into mature BAs. Through in-depth bioinformatics analyses, we identified and functionally validated PIM1, SIX1, RREB1, and SOX13 as novel regulators promoting brown cell differentiation and function. Differential gene expression analysis is a classic approach for the identification of regulators of cell type specification. A number of adipogenic and brown fat cell regulators including PPARγ, C/EBPα and PRDM16 were identified through this approach. In our study, we also used this analysis to identify brown selective genes but added additional criteria for the selection of candidates: these genes must be dynamically regulated during adipogenesis and stage-specifically expressed only in mature adipocytes (Fig 2). As the result, our list of 121 brown selective genes contains brown markers such as Cidea (#1), Elovl3 (#3), Ucp1 (#24) and Ppara (#61), as well as a number of mitochondrial genes including Cpt1b (#4). From this list, we specifically looked for factors that could potentially be involved in gene regulation or signal transduction, and we selected the kinase PIM1 (#53) for further analysis. Moreover, the Pim1 gene was later found to be associated with a SE in brown cells (S8C Fig). In our study, over-expression of Pim1 in both C3H10T1/2 cells and the scWAT SVF cells up-regulated a number of key brown cell marker genes as well as general adipogenic genes (Fig 5B-5E and S10B-S10D Fig). In addition, over-expression of this kinase also promoted the mitochondrial respiration in general and specifically uncoupled respiration, a feature of thermogenic fat cells (Fig 5F-5H and S10F and S10G Fig). In contrast, knock-down of Pim1 by GapmeRs reduced the expression of brown marker |
genes and adipogenesis efficiency in both primary brown cells (Fig 6) and subcutaneous white cells (S11 Fig). Therefore our analysis clearly implicates Pim1 in brown adipogenic differentiation, although future experiments will have to address if its role is solely restricted to the brown lineage. With our experimental model we cannot rule out that enhanced brown differentiation is partially caused by an increase in adipogenic differentiation in general. However, the lineage specific expression of Pim1 in BAT vs WAT, together with its increased expression in BAT upon cold exposure (Fig 2D), point towards a more specific role in BAT for this kinase. It will be interesting to investigate the functional significance and molecular mechanism of PIM1 in different tissues and under different metabolically challenging conditions such as diet induced obesity or cold exposure in vivo, especially the direct targets of this kinase. Enhancer binding motif analysis is another powerful tool to identify novel TFs involved in specific cell differentiation processes [15,16]. In our study, we first defined stage-specific enhancers during both white and brown adipogenesis, then surveyed the enrichment of TF binding motifs at early and late stages of differentiation. While enrichment for several wellknown adipogenic factors at late stages of both brown and white adipogenesis was expected, our finding that the motif for the TF SIX1 was enriched during late brown adipogenesis was surprising (Fig 3C), since SIX1 has not been implicated in brown cell differentiation so far. Six1 belongs to the Sine Oculis Homeobox family of genes and has been reported to play a crucial role in muscle cell lineage decision as well as muscle development. Through gain-and loss-of-function assays, we confirmed that Six1 was required for the expression of brown selective and adipogenic marker genes in both the C3H10T1/2 cells and the SVF cells from scWAT and BAT. Moreover, over-expression of Six1 enhanced the mitochondrial uncoupled respiration in differentiated C3H10T1/2 cells (Fig 5H). In an attempt to decipher SIX1's mode of action, we performed genome-wide binding profiling of SIX1 in mature BAs. Strikingly, we found that SIX1 bound to brown as well as general adipogenic genes, some of whose expression were affected by the modulation of the Six1 gene, suggesting that these genes are direct targets of SIX1. Through binding motif analysis of SIX1 occupied regions and subsequent co-IP assay, we confirmed that SIX1 directly interacts and may cooperate with C/EBPα, C/EBPβ and EBF2 in regulating the transcription network during differentiation. Therefore the role of SIX1 seems not to be restricted to the regulation of BA differentiation, but it may act as a more general activator of the adipogenic transcriptional program. Again, in vivo studies to investigate the physiological role of Six1 in different adipogenic tissues will be instrumental to fully understand its biological function. Super-enhancers are big clusters of enhancers and are often associated with genes specifying cell identity [14]. It can be defined by either mediator or TF binding or the enrichment of chromatin marks such as H3K27ac. Through analysis of super-enhancer associated genes, KLF11 was identified as an important factor promoting the browning of human mature white fat cells [10]. In our study, we profiled the stage-specific super-enhancers in a distinct process: i.e. the differentiation of brown adipocytes from multi-potent progenitor cells. That way we identified 419 genes associated with mature BA specific super-enhancers, including most brown marker genes. From this gene list, we selected the TF RREB1 for further functional analysis on the basis of its link to metabolic traits and association with one of the highest ranking SEs (#8) in BAs as defined by PPARγ binding. In our functional studies, over-expression of Rreb1 led to increased expression of brown marker genes and enhanced mitochondrial respiration in both C3H10T1/2 cells and SVF cells from scWAT. On the other hand, knock-down of Rreb1 resulted in reduced brown marker expression and impaired adipogenesis of SVF cells from BAT and scWAT. Moreover, RREB1 was very recently identified as a positive regulator of brown adipogenesis via a distinct bioinformatics approach [32] during the preparation of this manuscript. Further physiological studies on the role of Rreb1 in insulin sensitivity and energy homeostasis using corresponding gain-and loss-of-function animal models will be necessary to fully characterize the function of this positive regulator of brown adipogenesis. BMP7 was recently established as a key factor that specifies the brown lineage from MSCs [24]. Mechanistically, BMP7 acts through either the SMAD or the p38 MAPK signaling pathway to induce its downstream target genes governing the adipogenic or thermogenic program. In order to gain an in-depth understanding of the brown lineage commitment from multipotent progenitor cells (as exemplified by BMP7 signaling), we systematically compared the gene expression profiles of C3H10T1/2 cells with or without BMP7 treatment. We found that 89 genes were transiently induced by BMP7 treatment, amongst which we identified a panel of Sox genes. We found that those genes were all p38/MAPK dependent, suggesting their involvement in promoting the thermogenic rather than the general adipogenic program. Subsequent functional analysis confirmed that one candidate gene, Sox13, promotes adipogenic differentiation, brown marker gene expression, and mitochondrial respiration. Our current results suggest that BMP7 triggers an early p38 dependent response, including the activation of Sox gene expression, important for the lineage commitment of brown cells from multi-potent progenitor cells. Clearly, future work is needed to dissect the exact contribution of the different Sox genes during this process and to define their downstream target genes. Transcriptomic profiles and epigenomic landscapes are important resources for understanding the gene regulation network in a certain cell type or in a specific cell differentiation process. Analysis of those datasets has led to the identification of numerous novel regulators in various cellular processes. Seminal works in the field have provided valuable resources for further investigation of the molecular control of fat cell differentiation [10,15,23,[49][50][51][52][53]. Here we add a comprehensive study of the epigenomic and transcriptomic transitions at five key developmental stages throughout the process of murine brown adipogenesis. Our dataset comprises a high temporal resolution of the differentiation process as well as a broad coverage of chromatin marks. Through comparative analyses of white and brown datasets using various bioinformatics tools, we identified many potential candidates and validated four factors that promote thermogenic adipocyte differentiation in various cellular models including C3H10T1/2 cells, SVF cells from subcutaneous WAT and interscapular BAT. Moreover, through analyzing the chromatin dynamics at the promoters of lineage-specific and commonly expressed adipogenic genes in BA and WA, we found that, in addition to the mechanism proposed by a recent study [32], which suggested that the removal of H3K27me3 is required for brown gene expression, the pre-deposition of H3K4me1 at these genes during early stages of brown adipogenesis is essential for poising them for expression at a later stage. For general adipogenic genes, we found they are only marked by H3K4me1 but not H3K27me3 during both brown and white adipogenesis, suggesting their activation does not involve H3K27 demethylation. Based on these observations, we propose that the pre-deposition of H3K4me1 at brown specific genes is a critical step in the chromatin remodeling during the process of brown adipocyte lineage commitment, while the full activation of these genes is only possible once the "stop sign" (H3K27me3) is removed. Besides proposing this conceptual model for the epigenetic regulation of brown lineage specific genes, we anticipate additional factors (including lncRNAs and miRNAs), promoting or inhibiting brown cell differentiation to be identified through analyzing these datasets and further insights to be gained from these resources. Cellular flux assay To determine cellular oxygen consumption rates, we used the Seahorse XFe24 Extracellular Flux Analyzer. Cells were seeded on gelatinized XFe24 cell culture microplates (100777-004) at 4,000 cells/well and differentiated one day post confluency following the procedures described above. The XF Cell Mito Stress Test Kit (103015-100) was used to determine basal respiration, ATP production, proton leak, maximal respiration, and spare respiratory capacity. Concentrations of the added chemicals were: 40 μM oligomycin, 0.15 μM FCCP, 1 μM rotenone / 1 μM antimycin A. To activate the β-adrenergic pathway before measurement, cells were treated with 10 μM norepinephrine (Sigma Aldrich, A0937). Gene expression analysis Cells were harvested with TRIzol reagent (Ambion, 15596018) and total RNA was extracted following the manufacturer's protocol. RNA was treated with Amplification Grade DNase I (Invitrogen, 18068-015) before the generation of either RNA-seq libraries or cDNA to assess expression of individual genes. RNA-seq libraries were generated by BGI, China, following standard procedures. For cDNA generation, 500 ng of total RNA were reverse transcribed using random 9-mers and M-MLV Reverse Transcriptase (Invitrogen, 28025-021). Target gene expression was determined via quantitative Real-Time PCR analysis using Power SYBR Green PCR Master Mix from Applied Biosystems (4367659) on a 7900HT Fast Real-Time PCR machine (Applied Biosystems). All gene expression data in this study was normalized to the expression of the riboprotein gene 36B4 unless indicated differently. Primers were listed in S6 Table. ChIP-seq Chromatin immunoprecipitation was performed as described earlier [54]; antibodies used in this study were listed in S6 Table. To construct ChIP-seq libraries, we employed a method described previously [55]. In short, 5ng of ChIP DNA were used as starting material. After an end repair step, terminal addition of poly-dCs, and ligation of linkers, the DNA was amplified in a two-step PCR procedure. The final product was loaded onto a 2% agarose gel and fragments between 200bp and 500 bp were cut from the gel, purified and sequenced at BGI China. Luciferase assay A 222 bp fragment corresponding to the region -13,982 to -13,761 from the Cidea transcription start site (TSS) was PCR-amplified from mouse genomic DNA and cloned into pGL3-Basic plasmid (Promega) to yield pGL3-Cidea-Enh1. For the luciferase assay, HEK293 cells were transfected with pGL3-Cidea-Enh1 (or equal amounts of pGL3-Basic) and pCMV6-hSix1: myc:DDK from OriGene (RC203465) (or equal amounts of pCMV6:myc:DDK) using Lipofectamine 2000 (Invitrogen). 48h after transfection cells were lysed and Firefly luciferase activity was measured on a GloMax Multi luciferase reader using the Dual-Glo luciferase assay kit (Promega) following the manufacturer's recommendations. ChIP-seq data analysis All ChIP-seq datasets were aligned using Bowtie (version 2.0.4) to build version mm9 of the murine genome. Alignments were performed with the following additional parameters: -t -q -p 8 -N 1 -L 25. To visualize the ChIP-seq signals for each histone modification and PPARγ, we extended each read to 300 bp and counted the coverage of each read for each base, which was shown as the UCSC genome browser tracks. For the downstream analysis, we normalized the read counts for the ChIP samples by computing the numbers of Reads Per Kilobase of bin per Million reads sequenced (RPKM). To minimize the batch and cell type variation, the RPKM values were further normalized through Z-score transformation. MACS [56] was used to identify histone modification regions and PPARγ binding peaks by default settings. RNA-seq data analysis All RNA-seq datasets were aligned using Tophat (version 2.0.6) to build version mm9 of the murine genome. Alignments were performed with the following additional parameters:-p 2-solexa1.3-quals. The mapped reads were further analyzed by Cufflinks (v 2.1.1) [57] and the expression levels for each transcript were quantified as Fragments Per Kilobase of transcript per Million mapped reads (FPKM) based on refFlat database. Identification of differentiation stage-specific coding genes, lncRNAs and microRNAs To identify differentiation stage-specific coding genes, we used a strategy described previously based on the Shannon entropy to compute a stage-specificity index to all expressed coding genes [58][59][60] using the averages of two RNA-seq replicates. The entropy score for each gene was defined as described as follows [61]: for each gene, we defined its relative expression in a cell type i as Ri = Ei /∑E, where Ei is the FPKM value for gene expression in the cell type i; ∑E is the sum of FPKM values in all cell types; N is the total number of cell types. Then the entropy score for this gene across cell types can be defined as H = -1 à ∑Ri à logRi (1 i N), where the value of H ranges between 0 to log2(N). An entropy score close to zero indicates the expression of this gene is highly stage-specific, while an entropy score close to log2(N) indicates that this gene is expressed ubiquitously. Based on an examination of the entropy distribution genes with entropy less than 2 were selected as the candidate stage specific genes. |