Datasets:

katphlab
/

pubtables-latex

Dataset card Data Studio Files Files and versions Community

Subset (6)

train_120000 · 60k rows

Split (1)

train · 60k rows

image imagewidth (px) 205 980	latex stringlengths 132 39.9k	filename stringlengths 18 19
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multirow{2}{}{\textbf{Rice group (n = 152)}} & \multirow{2}{}{\textbf{Both group (n = 87)}} & \multirow{2}{}{\textbf{Bread group (n = 51)}} & \multirow{2}{}{\textbf{Pa}} \\ \hline \\ \hline & \textbf{\textbf{\textbf{Mean (SD)}}} & \textbf{\textbf{\textbf{Range}}} & \textbf{\textbf{\textbf{Mean (SD)}}} & \textbf{\textbf{\textbf{Range}}} & \textbf{\textbf{\textbf{Mean (SD)}}} & \textbf{\textbf{\textbf{Range}}} \\ \hline GMR & 0.521 (0.017) & 0.486–0.578 & 0.516 (0.018) & 0.477–0.580 & 0.512 (0.018) & 0.469–0.587 & ,0.01b \\ \hline WMR & 0.290 (0.012) & 0.257–0.315 & 0.290 (0.012) & 0.260–0.323 & 0.293 (0.012) & 0.264–0.331 & n.s. \\ \hline Full-scale IQ & 103.7 (12.52) & 77–136 & 102.0 (11.90) & 77–137 & 99.9 (12.21) & 71–129 & n.s. \\ \hline Verbal IQ Performance IQ & 104.7 (13.93) 102.1 (12.25) & 76–143 73–136 & 103.7 (13.93) 99.5 (12.64) & 67–152 62–134 & 100.3 (11.91) 99.6 (14.32) & 67–129 71–132 & n.s. n.s. \\ \hline VCI & 104.6 (14.75) & 73–145 & 103.2 (13.82) & 64–151 & 100.3 (11.75) & 65–126 & n.s. \\ \hline POI & 102.3 (13.71) & 68–146 & 100.3 (12.72) & 69–131 & 97.9 (14.30) & 74–134 & n.s. \\ \hline WMI & 99.3 (14.16) & 69–138 & 100.4 (11.66) & 81–135 & 98.9 (12.64) & 71–121 & n.s. \\ \hline PSI & 103.1 (12.58) & 72–136 & 100.4 (12.96) & 66–136 & 104.8 (14.95) & 69–133 & n.s. \\ \hline \end{tabular} \end{table}	PMC2999543_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{c\|}{\textbf{All taxa}} & \multicolumn{2}{c\|}{\textbf{Without apogamous taxa}} & \multicolumn{2}{c\|}{\textbf{Without infraspecific taxa}} & \multicolumn{2}{c\|}{\textbf{Sexual diploids only}} \\ \hline \textbf{Region} & \textbf{\textbf{\textbf{\textbf{N}}}} & \textbf{\textbf{\textbf{\textbf{Fail rate (\%)}}}} & \textbf{\textbf{\textbf{\textbf{N}}}} & \textbf{\textbf{\textbf{\textbf{Fail rate (\%)}}}} & \textbf{\textbf{\textbf{\textbf{N}}}} & \textbf{\textbf{\textbf{\textbf{Fail rate (\%)}}}} & \textbf{\textbf{\textbf{\textbf{N}}}} & \textbf{\textbf{\textbf{\textbf{Fail rate (\%)}}}} \\ \hline trnH-psbA & 598 & 34.95 & 527 & 30.36 & 559 & 29.87 & 225 & 16.89 \\ \hline rbcL & 684 & 22.08 & 604 & 18.71 & 637 & 17.43 & 253 & 7.91 \\ \hline rbcL-a & 684 & 29.09 & 604 & 25.17 & 637 & 25.27 & 253 & 10.67 \\ \hline + rbcL-a trnH-psbA & 597 & 20.27 & 526 & 16.54 & 558 & 15.77 & 225 & 4.44 \\ \hline + rbcL trnH-psbA & 597 & 16.25 & 526 & 12.36 & 558 & 12.37 & 225 & 3.56 \\ \hline \end{tabular} \end{table}	PMC2999545_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Family} & \textbf{Number of taxa listed in Table S1} & \textbf{Rate of apogamous taxa (\%)} & \textbf{Rate of sexual diploids (\%)} & \multicolumn{5}{c\|}{\textbf{Fail rate (\%)}} \\ \hline & & & & \textbf{rbcL} & \textbf{rbcL}-a & \textbf{trnH-psbA} & + \textbf{rbcL} \textbf{trnH-psbA} & + \textbf{rbcL}-a trnH- psbA \\ \hline Ophioglossaceae & 21 & 0 & 38.1 & 28.57 & 42.86 & 27.78 & 11.11 & 11.11 \\ \hline Hymenophyllaceae & 34 & 8.82 & 50.00 & 17.65 & 17.65 & 17.39 & 17.39 & 17.39 \\ \hline Pteridaceae & 57 & 21.05 & 17.54 & 16.07 & 23.21 & 32.7 & 13.46 & 13.46 \\ \hline Aspleniaceae & 42 & 9.52 & 14.29 & 4.76 & 14.29 & 11.43 & 0 & 5.71 \\ \hline Woodsiaceae & 111 & 9.90 & 27.93 & 31.53 & 39.64 & 34.38 & 12.5 & 19.79 \\ \hline Thelypteridaceae & 46 & 2.17 & 26.09 & 17.77 & 24.44 & 45.24 & 19.51 & 19.51 \\ \hline Dryopteridaceae & 161 & 28.57 & 39.13 & 32.92 & 42.86 & 53.52 & 30.28 & 36.62 \\ \hline Polypodiaceae & 60 & 1.67 & 45.00 & 8.33 & 8.33 & 24.14 & 3.45 & 3.45 \\ \hline \end{tabular} \end{table}	PMC2999545_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Publication} & \textbf{Minimum fail rate} & \textbf{Barcode region} & \textbf{Sampling} & \textbf{Definition of ‘success’} \\ \hline Present study & 16.25\% & + rbcL trnH-psbA & 597 individuals/597 taxa/60 genera of pteridophytes & Species matching 100\% over the entire sequence length with their own reference sequence only \\ \hline Kress and Erickson (2007) [13] & 12.50\% & + rbcL trnH-psbA & 96 individuals/96 species [2 species per genus] of land plants & Proportion of genera in which species could be differentiated \\ \hline Fazekas et al. (2008) [14] & 36\% & + rbcL trnH-psbA & 251 individuals/92 species/32 genera of land plants & Inclusion of query sequence in any conspecific monophyletic group \\ \hline Liu et al. (2010) [15] & 11\% & rbcL-a & 100 individuals/58 taxa/53 genera of mosses & Inclusion of query sequence in any conspecific monophyletic group \\ \hline \end{tabular} \end{table}	PMC2999545_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Code} & \textbf{Sequence} \\ \hline 4561 & GGAATTCTTACCACTCGATATTAAATGATGCAT \\ \hline 5113 & GACCATGGCCACTAAAGATTTTAAGATCAGTGTCTC \\ \hline 5114 & GGAATTCTTACCACTCGATATTAAATGATGCGT \\ \hline 5115 & GACCATGGCCACTAAAGATTTTAAGATCAGTGTCTC \\ \hline 5491 & AACAGGCGATGCTTCTGTTGCAATTGGTCCTTTA \\ \hline 5492 & GCAACAGAAGCATCGCCTGTTGCAATTGAACCAGC \\ \hline \end{tabular} \end{table}	PMC2999546_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Dataset/cell type} & \textbf{SETDB1/ K562} & \textbf{KAP1/ K562} & \textbf{H3K9me3/ K562} & \textbf{ZNF274/ K562} & \textbf{ZNF274/ HepG2} & \textbf{ZNF274/ GM12878} & \textbf{ZNF274/ HeLa} \\ \hline Number of peaks: & 3,238 & 3,085 & 16246 & 337 & 469 & 336 & 220 \\ \hline Average peak height: & 27 & 30.07 & 18.14 & 49 & 42 & 43 & 38 \\ \hline Median peak height: & 25 & 25 & 16 & 34 & 29 & 31 & 33 \\ \hline Highest peak: & 102 & 185 & 141 & 195 & 195 & 166 & 117 \\ \hline Lowest peak: & 14 & 16 & 14 & 17 & 16 & 15 & 16 \\ \hline Average peak width: & 547 & 385.16 & 1151.44 & 649 & 551.86 & 604.62 & 469 \\ \hline # uniquely mapped reads & 21,434,178 & 26,458,932 & 43,691,075 & 18,856,543 & 22,363,343 & 10,487,897 & 18,852,757 \\ \hline \end{tabular} \end{table}	PMC2999557_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Strain} & \textbf{Relevant genotype and features} & \textbf{Reference} \\ \hline E. coli JM109 & K-12 l-, supE44 thi1 mcrA recA1 endA1 hsdR17 gyrA96 relA1 Dlac-proAB, F’ (traD36 proAB lacIq lacZDM15)/cloning strain & [69] \\ \hline EPEC E2348/69 & wild type enteropathogenic EPEC O127:H6 & [12] \\ \hline EPEC DescN & E2348/69 DescN::Km/mutant lacking EscN ATPase of the T3SS & [37,70] \\ \hline EHEC EDL933stx & wild type enterohaemorragic EHEC O157:H7 stx1- stx2- & [13,70] \\ \hline EHEC DescN & EDL933stx DescN::Km/mutant lacking EscN ATPase of T3SS & [70] \\ \hline quad mutant & E2348/69 Deae Dtir Dmap DespF/attenuated strain & [34] \\ \hline \end{tabular} \end{table}	PMC2999559_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Name} & \textbf{Relevant features and application} & \textbf{Reference} \\ \hline pSA10 & Apr, lacIq/expression pUC-ori, Ptac promoter, vector & [72] \\ \hline pT3sVamy & pSA10 derivative/expression of T3sVamy & This work \\ \hline pT3sVgfp & pSA10 derivative/expression of T3sVgfp & This work \\ \hline pDsVgfp & pSA10 derivative/expression of DsVgfp; lacks T3 signal (EspF20) & This work \\ \hline pCX340 & Tcr, pBR-ori; Ptrc promoter, ‘blaM (TEM-1)/ vector for b-lactamase fusions & [26] \\ \hline pT3s-Bla & pCX340 derivative/expression of T3s-Bla fusion & This work \\ \hline pT3sVgfp-Bla & pCX340 derivative/expression of T3sVgfp-Bla fusion & This work \\ \hline pT3sVamy-Bla & pCX340 derivative/expression of T3sVamy-Bla fusion & This work \\ \hline pEGFP-N1 & Kmr, pUC/pSV40-ori, PCMV promoter, enhanced GFP & Clontech \\ \hline pCS2+MT & Apr, pUC-ori, PCMV promoter, 6xmyc-tag, vector & [74] \\ \hline \end{tabular} \end{table}	PMC2999559_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Name} & \textbf{Sequence (59-39)} \\ \hline RI-Xb-SD-espF & CCGGAATTCTCTAGAAAGAGGCATAAATTATGCTTAATGGAATTAGTA \\ \hline SfiI-espF & CTGCACCTGAGCCATGGCCGGCTGGGCCGCTGCGATACCTACAAGCTGCCGCCCTA \\ \hline SfiIVamy & CTTGTAGGTATCGCAGCGGCCCAGCCGGCCATGGCTCAGGTGCAGCTG \\ \hline RI-stop-E & CCGGAATTCTCATTAGGCCGGTTCCAGCGGATCCGGATACGGCAC \\ \hline Vhh-SfiI2 & GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCTCAGGTGCAGCTGGTGGA \\ \hline Vhh-NotI2 & GGACTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT \\ \hline NdeI-espF & CCGGATCCATATGCTTAATGGAATTAGTAACGCTGCTTCT \\ \hline EcoRI-espF & GGTGCGAATTCGCTGCGATACCTACAAGCTGCCGCCCTA \\ \hline EcoRI-TEM & GCGGCAGCTTGTAGGTATCGCAGCGAATTCGCACCCAGAAACGCTGGTGA \\ \hline BamHI-tetra & ATGCGTCCGGCGTAGAGGATCCACAGGACGGGT \\ \hline NdeI-espFVamy & GGGAATTCCATATGCTTAATGGAATTAGTAACGCTGCT \\ \hline EcoRIVamy-espF & CCGGAATTCGCGGCCGGTTCCAGCGGATCCGGATA \\ \hline \end{tabular} \end{table}	PMC2999559_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{Mean} & \textbf{SD} \\ \hline PANAS positive & 33.18 & 5.67 \\ \hline PANAS negative & 17.55 & 5.72 \\ \hline Age & 37.75 & 17.28 \\ \hline Estimated Full Scale IQ & 118.68 & 8.82 \\ \hline Beck Depression Inventory II & 6.93 & 4.78 \\ \hline Spielberger Trait Anxiety & 37.49 & 10.65 \\ \hline Human inequitable offer rejection rate & 60\% & 37\% \\ \hline Computer inequitable offer rejection rate & 50\% & 39\% \\ \hline Human equitable offer rejection rate & 1\% & 5\% \\ \hline Computer equitable offer rejection rate & 3\% & 15\% \\ \hline Proposals offered to future players & £4.60 & £1.08 \\ \hline Anger to human inequitable offers & 33.16 & 29.83 \\ \hline Anger to computer inequitable offers & 21.53 & 26.76 \\ \hline Anger to human equitable offers & 2.52 & 10.04 \\ \hline Anger to computer equitable offers & 2.55 & 9.86 \\ \hline \end{tabular} \end{table}	PMC2999560_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{PA} & \textbf{NA} & \textbf{Anger unfair} \\ \hline Unfair rejections & .48 & 2.42 & .09 \\ \hline Human unfair rejections & .50 & 2.35 & .20 \\ \hline Computer unfair rejections & .34* & 2.38** & 2.03 \\ \hline Human fair rejections & 2.03 & .04 & .17 \\ \hline Computer fair rejections & .03 & 2.10 & .32* \\ \hline Proposals & .05 & 2.21 & .13 \\ \hline \textbf{Anger unfair} & .03 & .36* \\ \hline \end{tabular} \end{table}	PMC2999560_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & & & \multicolumn{2}{c\|}{\textbf{Hotspot Activity (cM)}} \\ \hline \textbf{Name} & \textbf{Position of the centromere-proximal marker (Mb, B37)} & \textbf{Hotspot Size (kb)} & \textbf{Female} & \textbf{Male} \\ \hline Egfr-1 & 16.748792 & 7.212 & 0.10 & 0.04 \\ \hline Egfr-2 & 16.756004 & 1.824 & 0.10 & 0.04 \\ \hline Egfr-3 & 16.763416 & 3.313 & 0.50 & 0.25 \\ \hline Peli1-1 & 20.779098 & 0.509 & 0.00 & 0.07 \\ \hline Peli1-2 & 20.790039 & 6.308 & 0.03 & 0.28 \\ \hline Tekt3-1 & 62.88897 & 3.089 & 0.00 & 0.07 \\ \hline Tekt3-2 & 62.892059 & 3.213 & 0.10 & 1.23 \\ \hline Ankfn1 & 89.470824 & 4.518 & 1.27 & 1.30 \\ \hline Tmem106a & 101.45505 & 1.536 & 0.17 & 0.25 \\ \hline 1700012B07Rik & 109.645559 & 6.291 & 0.00 & 0.11 \\ \hline GP112-1* & 112.206482 & 1.755 & 0.10 & 0.07 \\ \hline GP112-2* & 112.273362 & 3.862 & 0.50 & 0.21 \\ \hline Slc9a3r1 & 115.039527 & 1.983 & 0.03 & 0.25 \\ \hline \end{tabular} \end{table}	PMC2999565_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \multicolumn{5}{c\|}{\textbf{Number of Crossovers per Chromosome}} \\ \hline & & \textbf{0} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{Total} \\ \hline \multirow{\textbf{2}}{}{Female} & Number & 97\textbf{3} & \textbf{1}\textbf{4}89 & 5\textbf{2}9 & \textbf{1}\textbf{0} & \textbf{1} & \textbf{3}\textbf{0}\textbf{0}\textbf{2} \\ \hline Frequency & \textbf{0}.\textbf{3}\textbf{2}\textbf{4} & \textbf{0}.\textbf{4}96 & \textbf{0}.\textbf{1}76 & \textbf{0}.\textbf{0}\textbf{0}\textbf{3} & \textbf{0}.\textbf{0}\textbf{0}\textbf{0}\textbf{3} \\ \hline \multirow{\textbf{2}}{}{Male} & Number & 96\textbf{1} & \textbf{1}\textbf{4}96 & \textbf{3}98 & \textbf{1} & \textbf{0} & \textbf{2}856 \\ \hline Frequency & \textbf{0}.\textbf{3}\textbf{3}6 & \textbf{0}.5\textbf{2}\textbf{4} & \textbf{0}.\textbf{1}\textbf{3}9 & \textbf{0}.\textbf{0}\textbf{0}\textbf{0}\textbf{4} & \textbf{0} \\ \hline \end{tabular} \end{table}	PMC2999565_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & & \multirow{2}{}{\textbf{N (\%) with missing data}} & \multirow{2}{}{\textbf{Boys N = 2413}} & \multirow{2}{}{\textbf{Girls N = 2700}} & \multirow{2}{}{\textbf{P value for sex interaction between BMI trajectories and outcomes}} \\ \hline \\ \hline Birth weight (kg) & Mean (SD) & 68 & 3.49 (0.49) & 3.39 (0.49) \\ \hline Gestational age (complete weeks) & Mean (SD) & 0 & 39.40 (1.87) & 39.60 (1.68) \\ \hline Age at clinic attendance (months) & Mean (SD) & 0 & 185.39 (3.87) & 185.86 (4.55) \\ \hline Puberty (Tanner stage) & N (\%) & 659 \\ \hline Stage 1/2 & & & 21 (1.0) & 7 (0.3) \\ \hline Stage 3 & & & 136 (6.7) & 130 (5.6) \\ \hline Stage 4 & & & 1360 (66.7) & 1635 (69.8) \\ \hline Stage 5 & & & 521 (25.6) & 569 (24.3) \\ \hline (kg/m2) BMI at clinic attendance & Median (IQR) & 297 & 21.01 (3.84) & 21.81 (3.84) \\ \hline DXA-assessed fat mass (kg) & Median (IQR) & 336 & 8.60 (5.87 to 13.74) & 17.37 (13.32 to 22.52) & ,0.001 \\ \hline Systolic blood pressure (mmHg) & Mean (SD) & 390 & 125.97 (10.36) & 120.56 (10.49) & 0.91 \\ \hline Diastolic blood pressure (mmHg) & Mean (SD) & 390 & 68.29 (9.11) & 66.97 (8.33) & 0.53 \\ \hline Fasting LDL cholesterol (mmol/l) & Mean (SD) & 1865 & 1.99 (0.52) & 2.18 (0.57) & 0.59 \\ \hline Fasting HDL cholesterol (mmol/l) & Mean (SD) & 1865 & 1.21 (0.27) & 1.35 (0.30) & 0.77 \\ \hline Fasting triglycerides (mmol/l) & Median (IQR) & 1865 & 0.73 (0.57 to 0.97) & 0.77 (0.62 to 1.00) & 0.38 \\ \hline Fasting glucose (mmol/l) & Mean (SD) & 1865 & 5.30 (0.39) & 5.14 (0.38) & 0.001 \\ \hline Fasting insulin (IU/l) & Median (IQR) & 1869 & 8.20 (6.01 to 11.16) & 9.87 (7.41 to 13.15) & 0.26 \\ \hline C-reactive protein (mg/l) & Median (IQR) & 1865 & 0.38 (0.22 to 0.90) & 0.40 (0.22 to 0.90) & 0.17 \\ \hline \end{tabular} \end{table}	PMC2999567_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Query name (domain)} & \textbf{Fungusa} & \textbf{Templateb (identity)} & \textbf{c E-value} & \textbf{Estimated precision} & \textbf{Fold/PDB descriptor} \\ \hline FPR1 (HMG) & P. anserina & d2lefa (24\%) & 2.8e214 & 100\% & HMG \\ \hline mat a-1 (HMG) & N. crassa & d2lefa (18\%) & 1.5e214 & 100\% & HMG \\ \hline MAT1-2-1(HMG) & C. heterostrophus & d2lefa (19\%) & 5.6e214 & 100\% & HMG \\ \hline MAT1-2-1 (HMG) & M. graminicola & d2lefa (30\%) & 8.7e215 & 100\% & HMG \\ \hline SMR2 (HMG) & P. anserina & d2lefa (25\%) & 1.1e214 & 100\% & HMG \\ \hline mat A-3 (HMG) & N. crassa & d2lefa (20\%) & 9.9e214 & 100\% & HMG \\ \hline MAT1-1-3 (HMG) & G. zeae & d2lefa (19\%) & 1.8e213 & 100\% & HMG \\ \hline MAT1-1-3/phb1 (HMG) & P. brassicae & d2lefa (23\%) & 4.9e215 & 100\% & HMG \\ \hline FMR1 (a1) & P. anserina & d1qrva (12\%) & 0.005 & 95\% & HMG \\ \hline mat A-1 (a1) & N. crassa & d1qrva (11\%) & 0.028 & 95\% & HMG \\ \hline SMT A-1 (a1) & S. macrospora & d1qrva (11\%) & 0.0043 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & M. oryzae & d1qrva (14\%) & 0.026 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & C. parasitica & d1qrva (10\%) & 0.017 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & D. sp & d2gzka2 (14\%) & 0.0022 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & G. fujikuroi & d1qrva (18\%) & 0.014 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & G. zeae & d1qrva (15\%) & 0.0052 & 95\% & HMG \\ \hline MAT1-1-1/pad1 (a1) & P. brassicae & d1qrva (18\%) & 0.0025 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & A. fumigatus & d1qrva (15\%) & 0.012 & 95\% & HMG \\ \hline MAT1-1/MATB (a1) & A. nidulans & d1qrva (15\%) & 0.0016 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & H. capsulatum & d1qrva (14\%) & 0.014 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & C. heterostrophus & d1qrva (15\%) & 0.0013 & 95\% & HMG \\ \hline MAT1-1-1 (a1) & M. graminicola & d1qrva (19\%) & 0.0059 & 95\% & HMG \\ \hline Mata1p (a1) & S. cerevisiae & d1k99a (12\%) & 0.0086 & 95\% & HMG \\ \hline Pc (HMG) & S. pombe & d2lefa (14\%) & 4 & 45\% & HMG \\ \hline \end{tabular} \end{table}	PMC2999568_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Case} & \textbf{Sex} & \textbf{Age} & \textbf{Handedness} & \textbf{Duration of symptoms} & \textbf{Diagnosis} & \textbf{Clinical Pattern} \\ \hline 1 & F & 64 & R & 21 yr & WC R & R 3rd digit flexion during writing and typing \\ \hline 5 & M & 46 & R & 6 yr & WC R & R grip, wrist extensor spasms during writing/typing \\ \hline 9 & M & 42 & R & 14 yr & MD R & 2nd/3rd digit spasm during typing and classical guitar playing \\ \hline 10 & M & 55 & L & 9 yr & MD L & L 2nd digit flexion playing piano \\ \hline 13 & F & 55 & R & 12 yr & WC R & R hand abnormal flexion/tremor during writing/mousing/pinching \\ \hline \end{tabular} \end{table}	PMC2999570_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Patient No.} & \textbf{Dose increase factor} & \textbf{Administration interval (days)} \\ \hline 3 & 2.5 & 15 \\ \hline 5 & 2.3 & 17 \\ \hline 7 & 3.2 & 16 \\ \hline 12 & 2.7 & 16 \\ \hline 14 & 1.5 & 21 \\ \hline 18 & 2.1 & 18 \\ \hline 20 & 27.9 & 1 \\ \hline 21 & 5.0 & 12 \\ \hline 22 & 5.08 & 12 \\ \hline \end{tabular} \end{table}	PMC2999571_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Parameter} & \textbf{Definitiona} & \textbf{Value} & \textbf{Units} & \textbf{References} \\ \hline ki & Rate of DC maturation following vaccine uptake & 0.06 & h21 & [48] \\ \hline nV & Number of vaccine cells required to induce maturation of one DC & 1 & – & [49–51] \\ \hline Vp & Natural influx of mature DCs & 0 & cells & Estimate \\ \hline km & Rate of DC migration from skin to lymph node & 0.027 & h21 & [52] \\ \hline al & Fraction of antigen-presenting DCs entering the lymph node & 0.03 & – & [52] \\ \hline kCR & Rate of exhaustion of mature DCs & 0.027 & h21 & [53] \\ \hline mD & Death rate of exhausted DCs & 0.014 & h21 & [54] \\ \hline aR & Rate of inhibitory cell recruitment by exhausted DCs & 361023 & h21 & [55] \\ \hline mR & Death rate of inhibitory cells & 0.03 & h21 & [56] \\ \hline aC & Rate of effector cell recruitment by mature DCs & 0.38 & h21 & [49] \\ \hline mC & Effector cell death rate & 0.007 & h21 & [41] \\ \hline kR & Rate of effector cell inactivation by inhibitory cells & 661027 & cell216h21 & [57] \\ \hline r & Tumor growth rate & Patient specific & h21 & - \\ \hline ap & Maximal PCa cell killing efficacy & Patient specific & cell216h21 & [58–59] \\ \hline hP & Effector cell efficacy damping coefficient & 108 & cells & [58–59] \\ \hline \end{tabular} \end{table}	PMC2999571_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Patient} & \textbf{Age} & \textbf{Gender} & \textbf{Allergic Rhinitis} & \textbf{Asthma} & \textbf{Eos per HPF} & \textbf{Elimination Diet} & \textbf{Swallowed steroids} \\ \hline A & 48 & M & Yes & No & 50 & Yes & No \\ \hline B & 43 & M & Yes & Yes & >25 & No & No \\ \hline C & 71 & M & Yes & Yes & >25 & Yes & No \\ \hline D & 34 & M & Yes & No & >25 & No & No \\ \hline E & 33 & F & Yes & Yes & >25 & Yes & No \\ \hline F & 39 & F & Yes & No & >150 & No & Yes \\ \hline G & 47 & F & Yes & Yes & >25 & No & Yes \\ \hline H & 42 & F & Yes & Yes & >25 & No & No \\ \hline I & 36 & M & Yes & No & >25 & No & Yes \\ \hline J & 51 & F & Yes & Yes & >25 & Yes & Yes \\ \hline K & 56 & F & Yes & No & >25 & Yes & No \\ \hline L & 30 & M & Yes & Yes & >25 & Yes & Yes \\ \hline M & 32 & M & Yes & No & >25 & No & Yes \\ \hline N & 38 & M & Yes & No & >25 & No & No \\ \hline O & 39 & F & Yes & No & >25 & No & No \\ \hline \end{tabular} \end{table}	PMC2999581_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Allergen} & \textbf{Positive/Positive1} & \textbf{Positive/Negative} & \textbf{Negative/Positive} & \textbf{Negative/Negative} \\ \hline Cat & 7 & 0 & 3 & 2 \\ \hline Bermuda grass & 11 & 0 & 0 & 1 \\ \hline Blue grass & 10 & 0 & 1 & 1 \\ \hline Dust mite & 11 & 0 & 1 & 0 \\ \hline Ragweed & 12 & 0 & 0 & 0 \\ \hline Maple tree & 7 & 3 & 2 & 0 \\ \hline Wheat & 5 & 0 & 7 & 0 \\ \hline Whole milk & 4 & 0 & 6 & 2 \\ \hline Shrimp2 & 1 & 0 & 0 & 0 \\ \hline Peanut & 5 & 2 & 0 & 5 \\ \hline Almond3 & 7 & 0 & 3 & 1 \\ \hline Whole egg & 1 & 4 & 2 & 5 \\ \hline \end{tabular} \end{table}	PMC2999581_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Pedigree} & \textbf{Trait} & \textbf{N} & \textbf{Mean} & \textbf{SD} \\ \hline French & birth weight (kg) & 1052 & 1.25 & 0.27 \\ \hline French & weaning weight (kg) & 1052 & 5.46 & 1.13 \\ \hline French & teat number & 1046 & 14.82 & 1.56 \\ \hline French & carcass weight (kg) & 529 & 59.11 & 10.48 \\ \hline French & BFT (mm) & 521 & 17.00 & 5.00 \\ \hline French & LD depth (mm) & 521 & 35.00 & 9.00 \\ \hline French & meat percentage (\%) & 521 & 50.44 & 3.66 \\ \hline French & LWG (kg/day) & 960 & 0.49 & 0.10 \\ \hline French & IMF (\%) & 248 & 1.69 & 0.54 \\ \hline French & X2 (mm) & 521 & 17.80 & 5.22 \\ \hline French & shoulder weight (kg) & 489 & 4.71 & 0.84 \\ \hline French & midriff weight (kg) & 489 & 1.16 & 0.33 \\ \hline French & ham weight (kg) & 489 & 5.79 & 0.92 \\ \hline French & loin weight (kg) & 489 & 8.07 & 1.46 \\ \hline French & leaf fat weight (kg) & 489 & 0.42 & 0.23 \\ \hline French & foot weight (kg) & 489 & 1.03 & 0.22 \\ \hline French & belly weight (kg) & 489 & 2.96 & 0.65 \\ \hline French & kidney weight (kg) & 487 & 0.11 & 0.02 \\ \hline French & head weight (kg) & 481 & 4.81 & 0.82 \\ \hline Dutch & birth weight (kg) & 867 & 1.22 & 0.22 \\ \hline Dutch & weaning weight (kg) & 864 & 8.23 & 2.00 \\ \hline Dutch & teat number & 869 & 15.42 & 1.20 \\ \hline Dutch & carcass weight (kg) & 548 & 70.24 & 9.59 \\ \hline Dutch & BFT (mm) & 565 & 22.19 & 5.70 \\ \hline Dutch & LD depth (mm) & 563 & 40.82 & 6.72 \\ \hline Dutch & meat percentage (\%) & 565 & 48.53 & 4.25 \\ \hline Dutch & LWG (kg/day) & 551 & 0.53 & 0.08 \\ \hline Dutch & IMF (\%) & 557 & 1.87 & 0.88 \\ \hline Dutch & pH_24 (LD) & 565 & 5.67 & 0.27 \\ \hline Dutch & L* & 563 & 53.85 & 4.73 \\ \hline Dutch & a* & 565 & 17.13 & 1.83 \\ \hline Dutch & b* & 565 & 9.52 & 1.91 \\ \hline Dutch & pH_24 (ham) & 565 & 5.83 & 0.32 \\ \hline Dutch & driploss (\%) & 563 & 2.68 & 1.52 \\ \hline Dutch & cookloss (\%) & 564 & 26.35 & 3.46 \\ \hline Dutch & shear force (\textbf{N}) & 564 & 39.20 & 10.75 \\ \hline \end{tabular} \end{table}	PMC2999584_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Pedigree} & \textbf{Trait} & \textbf{SSC} & \textbf{Position (cM)} & \textbf{LRT} & \textbf{Threshold} & \textbf{Number of segregating sires} & \textbf{QTL effect} & \textbf{References} \\ \hline French & BFT & 2 & 0 [0-8] & 47.2 & + & 2 & + 0.25 & [8] \\ \hline French & loin & 2 & 0 [0-3] & 58.4 & & 3 & - 0.30 & [8] \\ \hline French & IMF & 4 & 0 [0-12] & 37.0 & + & 3 & - 0.009 & / \\ \hline French & BFT & 4 & 61 [55-66] & 45.5 & + & 4 & + 0.19 & [8] \\ \hline French & LWG & 4 & 66 [56-71] & 69.6 & & 2 & - 0.18 & [6] \\ \hline French & x2 & 4 & 14 [6-23] & 47.0 & + & 2 & - 0.006 & / \\ \hline French & head weight & 4 & 42 [17-49] & 44.6 & + & 3 & - 0.25 & / \\ \hline French & birth weight & 4 & 53 [45-58] & 61.3 & & 4 & - 0.07 & [6] \\ \hline French & belly weight & 4 & 55 [48-61] & 56.9 & & 2 & - 0.04 & [8] \\ \hline French & teat number & 6 & 110 [98-130] & 46.0 & + & 3 & + 0.03 & [15] \\ \hline French & loin weight & 6 & 99 [92-108] & 46.6 & + & 3 & + 0.22 & / \\ \hline French & midriff weight & 6 & 144 [137-150] & 59.1 & & 4 & - 0.15 & / \\ \hline Dutch & weaning weight & 2 & 21 [17-24] & 46.2 & + & 5 & + 0.03 & / \\ \hline Dutch & BFT & 2 & 28 [18-46] & 60.4 & & 9 & + 0.22 & [11] \\ \hline Dutch & meat & 2 & 30 [19-47] & 63.8 & ** & 8 & - 0.31 & / \\ \hline Dutch & a* & 2 & 26 [19-36] & 51.2 & * & 10 & + 0.02 & [10] \\ \hline Dutch & IMF & 4 & 0 [0-6] & 47.0 & + & 9 & + 0.14 & [11] \\ \hline Dutch & birth weight & 6 & 136 [130-144] & 47.4 & + & 8 & - 0.13 & / \\ \hline Dutch & teat number & 6 & 154 [146-161] & 47.5 & + & 8 & - 0.05 & / \\ \hline Dutch & L* & 6 & 103 [91-118] & 61.3 & ** & 7 & + 0.20 & / \\ \hline Combined & BFT & 2 & 1 [0-5] & 95.6 & * & 12 & + 0.34 \\ \hline Combined & meat & 2 & 32 [25-46] & 97.8 & ** & 10 & - 0.32 \\ \hline Combined & IMF & 4 & 0 [0-5] & 84.0 & * & 12 & + 0.11 \\ \hline Combined & teat number & 4 & 46 [37-51] & 75.7 & + & 10 & - 0.04 \\ \hline Combined & birth weight & 4 & 53 [49-57] & 82.1 & * & 9 & - 0.10 \\ \hline Combined & LWG & 4 & 83 [59-90] & 98.6 & ** & 11 & - 0.30 \\ \hline Combined & teat number & 6 & 104 [94-113] & 84.8 & * & 11 & - 0.01 \\ \hline \end{tabular} \end{table}	PMC2999584_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Cofactor} & \textbf{Concentrations} & \textbf{Original source} \\ \hline ADP & 0.595 mM & [8] \\ \hline AMP & 0.955 mM & [8] \\ \hline ATP & 4.27 mM & [8] \\ \hline CoA & 0.001mM \\ \hline NAD & 1.47 mM & [8] \\ \hline NADH & 0.1 mM & [8] \\ \hline NADP & 0.195 mM & [8] \\ \hline NADPH & 0.062 mM & [8] \\ \hline P & 10 mM & [40] \\ \hline \end{tabular} \end{table}	PMC2999585_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & & \textbf{Total group} & \textbf{Treatment- naive group} & \textbf{Pre- treated group} \\ \hline & & N = 197 & N = 106 & N = 91 \\ \hline \multirow{2}{}{Gender} & Female (\%) & 151 (76.6) & 81 (76.4) & 70 (76.9) \\ \hline Male (\%) & 46 (23.4) & 25 (23.6) & 21 (23.1) \\ \hline Age (years) & Mean (SD) & 38.6 (9.6) & 38.5 (9.9) & 38.8 (9.2) \\ \hline Disease duration (years) & Mean (SD) & 4.3 (4.7) & 2.7 (4.0) & 6.3 (4.8) \\ \hline GNDS score* & Mean (SD) & 10.34 (5.56) & 8.75 (4.60) & 12.19 (6.01) \\ \hline EDSS score & Mean (SD) & 2.5 (1.42) & 2.2 (1.14) & 2.9 (1.65) \\ \hline ARR & Mean (SD) & 1.15 (0.62) & 1.13 (0.50) & 1.18 (0.73) \\ \hline \end{tabular} \end{table}	PMC2999586_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Time points and periods} & \textbf{Parameters} & \textbf{Total group} & \textbf{Treatment-naive group} & \textbf{Pre-treated group} \\ \hline \multirow{3}{}{Baseline (B)} & Mean (SD) & 19.51 (4.19) & 19.54 (4.26) & 19.47 (4.12) \\ \hline Median & 19.00 & 20.00 & 19.00 \\ \hline 95\% CI (mean) & 18.92; 20.10 & 18.72; 20.36 & 18.61; 20.33 \\ \hline \multirow{3}{}{Month 6 (M6)} & Mean (SD) & 20.95 (4.63) & 21.35 (4.63) & 20.48 (4.61) \\ \hline Median & 21.00 & 22.00 & 21.00 \\ \hline 95\% CI (mean) & 20.26; 21.65 & 20.40; 22.31 & 19.45; 21.51 \\ \hline \multirow{3}{}{Month 12 (M12)} & Mean (SD) & 20.94 (4.69) & 21.73 (4.76) & 19.98 (4.43) \\ \hline Median & 21.00 & 21.50 & 20.00 \\ \hline 95\% CI (mean) & 20.25; 21.63 & 20.78; 22.69 & 19.00; 20.96 \\ \hline \multirow{3}{}{Change B to M6} & Mean (SD) & 1.41 (3.97)* & 1.90 (4.08)* & 0.82 (3.77) \\ \hline Median & 1.00 & 1.00 & 1.00 \\ \hline 95\% CI (mean) & 0.81; 2.00 & 1.06; 2.74 & -0.02; 1.67 \\ \hline \multirow{3}{}{Change B to M12} & Mean (SD) & 1.33 (4.24) & 2.10 (4.56)* & 0.40 (3.64) \\ \hline Median & 1.00 & 1.00 & 1.00 \\ \hline 95\% CI (mean) & 0.70; 1.96 & 1.19; 3.02 & -0.41; 1.20 \\ \hline \end{tabular} \end{table}	PMC2999586_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{LMS-QoL} & \textbf{Parameters} & \textbf{Total group completers} & \textbf{Total group non- completers} & \textbf{Treatment-naive completers} & \textbf{Treatment-naive non- completers} \\ \hline \multirow{3}{}{Baseline (B)} & Mean (SD) & 19.84 (4.15) & 18.66 (4.20) & 19.59 (4.23) & 19.35 (4.49) \\ \hline Median & 20.00 & 19.00 & 19.00 & 20.00 \\ \hline 95\% CI (mean) & 19.15; 20.54 & 17.54; 19.79 & 18.67; 20.51 & 17.41; 21.29 \\ \hline \multirow{3}{}{Change B to M12} & Mean (SD) & 1.76 (4.25)* & -0.21 (3.91) & 2.52 (4.72)* & -0.06 (2.91) \\ \hline Median & 1.00 & 0.00 & 2.00 & 0.00 \\ \hline 95\% CI (mean) & 1.05; 2.47 & -1.47; 1.06 & 1.49; 3.56 & -1.61; 1.49 \\ \hline Improved M12 & n (\%) & 59 (42.1) & 5 (12.8) & 40 (48.8) & 2 (12.5) \\ \hline Unchanged & n (\%) & 65 (46.4) & 25 (64.1) & 34 (41.5) & 10 (62.5) \\ \hline Worsened & n (\%) & 16 (11.4) & 9 (23.1) & 8 (9.8) & 4 (25.0) \\ \hline \end{tabular} \end{table}	PMC2999586_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Time points and periods} & \textbf{Parameters} & \textbf{Total Group} & \textbf{Treatment-naive group} & \textbf{Pre-treated group} \\ \hline \multirow{3}{}{Baseline (B)} & Mean (SD) & 60.53 (34.24) & 56.25 (32.65) & 65.51 (35.54) \\ \hline Median & 59.00 & 55.00 & 70.00 \\ \hline 95\% CI (mean) & 55.72; 65.34 & 49.97; 62.54 & 58.10; 72.91 \\ \hline \multirow{3}{}{Month 6 (M6)} & Mean (SD) & 51.15 (35.35) & 45.68 (33.33) & 57.79 (36.76) \\ \hline Median & 44.50 & 40.00 & 50.00 \\ \hline 95\% CI (mean) & 45.83; 56.47 & 38.81; 52.54 & 49.36; 65.83 \\ \hline \multirow{3}{}{Month 12 (M12)} & Mean (SD) & 54.07 (35.18) & 47.97 (33.78) & 61.46 (35.62) \\ \hline Median & 49.00 & 43.50 & 63.00 \\ \hline 95\% CI (mean) & 48.88; 59.26 & 41.20; 54.74 & 53.58; 69.33 \\ \hline \multirow{3}{}{Change B to M6} & Mean (SD) & -9.17 (27.08)* & -11.33 (27.67)* & -6.62 (26.32)* \\ \hline Median & -6.00 & -7.00 & -3.00 \\ \hline 95\% CI (mean) & -13.24; -5.09 & -17.03; -5.64 & -12.51; -0.73 \\ \hline \multirow{3}{}{Change B to M12} & Mean (SD) & -6.04 (29.04)* & -8.50 (29.35)** & -3.06 (28.57) \\ \hline Median & -5.00 & -8.00 & -3.00 \\ \hline 95\% CI (mean) & -10.32; -1.76 & -14.38; -2.62 & -9.38; 3.25 \\ \hline \end{tabular} \end{table}	PMC2999586_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \multicolumn{2}{c\|}{Category (n)} & Examples of Core Indicators & Source of data \\ \hline \multirow{3}{}{Inputs (31)} & Health Human Resources & • \% of qualified health care providers (physicians, nurses, nurse practitioners) in CHS & Health authority records \\ \hline Material Resources & • \% of sub-districts who have at least one community health center & Health authority records \\ \hline Fiscal Resources & • Amount of financial investment for capital infrastructure & Health authority records \\ \hline \multirow{3}{}{Activities (64)} & Policy and governance level & • The percentage of CHS facilities that can be reimbursed through publicly funded health insurance & Health authority records \\ \hline Health care management level & • \% of PHC providers who completed a two-way referral of patients-a patient is referred for more specialized services or services unavailable through the CHS and that more specialized services (e.g., internal medicine) refer patients to CHS facilities as their place of first contact with the health system & Health authority records \\ \hline Clinical level & • \% of CHS facilities who can offer Chinese traditional medicine & Health authority records \\ \hline \multirow{3}{}{Outputs (105)} & Type & • \% of PHC organizations who currently provide the following public health services (health education, illness prevention, etc & CHS facility \\ \hline Volume & • \% of patients with hypertension who have health care coordinated by a case manager & CHS facility \\ \hline Quality & • \% of patients who have a regular doctor • \% of patients who were referred to other doctors and have information back. • \% of patients who report that they were given enough time to discuss their feeling, fears and concerns • \% of patients who rated the quality of CHS good or excellent & Patient survey \\ \hline \multirow{4}{}{Immediate outcomes (65)} & Increased individual capacity & • \% of residents who have increased knowledge, skills, and confidence to manager their health & Patient survey \\ \hline Reduced risk of ill-health and duration and effects of acute conditions & • Incidence rate of 0-3 year old children with low weight & CHS facility \\ \hline Stabilization of Chronic Conditions & • Control rate of patients with chronic diseases (such as hypertension) & CHS facility \\ \hline Maintain or improve satisfaction of health care workforce & • CHS provider satisfaction with CHS sector & Provider survey \\ \hline \multirow{4}{}{Intermediate outcomes (15)} & Healthy Choices and Behaviors & • \% of population who currently engage in regular physical activity & Patient survey \\ \hline Improve prevention of complications and acute exacerbations & • Hospitalization rate of patients with chronic diseases & Patient survey \\ \hline Public acceptability of CHS & • Patients’ satisfaction with CHS & Patient survey \\ \hline Appropriateness of place and provider & • \% of patients who first see a CHS physician & Patient survey \\ \hline \multirow{4}{}{Final outcomes (7)} & Better health outcome & • Decreased premature mortality & National reports (government) \\ \hline Health care system equity & • Distribution of health outcome among different populations & National reports (government) \\ \hline Lower costs of health system & • Health expenditure per capita in international dollars & National reports (government) \\ \hline Public satisfaction with health system & • Residents’ satisfaction with health system & Patient survey \\ \hline \end{tabular} \end{table}	PMC2999588_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{\textbf{Variable}} & \textbf{\textbf{N}} & \textbf{\textbf{\%}} & \textbf{\textbf{Variable}} & \textbf{\textbf{N}} & \textbf{\textbf{\%}} \\ \hline Child’s sex & & & Maternal tobacco status in early pregnancy \\ \hline Male & 1613 & 51.1 & \textbf{\textbf{N}}on smoker & 2250 & 72.0 \\ \hline Female & 1545 & 48.9 & Former smoker & 442 & 14.1 \\ \hline Missing & 1 & & Smoker & 433 & 13.9 \\ \hline Level of urbanization & & & Missing & 34 \\ \hline Urban & 660 & 20.9 & Maternal alcohol consumption in early pregnancy \\ \hline Rural & 2499 & 79.1 & \textbf{\textbf{N}}ever/occasionally & 2661 & 85.2 \\ \hline Districts of inclusion & & & $\leq$ 1 drink/day & 405 & 13.0 \\ \hline Ille-et-Vilaine & 2076 & 65.7 & > 1 drink/day & 56 & 1.8 \\ \hline Côtes d’Armor - Finistère & 1083 & 34.3 & Missing & 37 \\ \hline Year of inclusion & & & Parity \\ \hline 2002 & 388 & 12.3 & 0 & 1406 & 44.6 \\ \hline 2003 & 1203 & 38.1 & 1 & 1171 & 37.2 \\ \hline 2004 & 1110 & 35.1 & $\geq$ 2 & 572 & 18.2 \\ \hline 2005 - beginning 2006 & 458 & 14.5 & Missing & 10 \\ \hline Gestational age at inclusion (weeks of amenorrhea) (mean (min-max)) & \multicolumn{2}{c\|}{11.7 (3.0- 19.0)} & Marital status \\ \hline & & & Couple & 3079 & 97.6 \\ \hline Season in early pregnancy & & & Single & 75 & 2.4 \\ \hline Spring & 768 & 24.3 & Missing & 5 \\ \hline Summer & 880 & 27.9 & Gestational or preexisting diabetes \\ \hline Fall & 737 & 23.3 & \textbf{\textbf{N}}o & 2981 & 96.3 \\ \hline Winter & 774 & 24.5 & Yes & 116 & 3.7 \\ \hline Maternal age at inclusion (years) & & & Missing & 62 \\ \hline < 25 & 345 & 10.9 & High blood pressure during pregnancy \\ \hline 25-29 & 1259 & 39.9 & \textbf{\textbf{N}}o & 2931 & 94.4 \\ \hline 30-34 & 1113 & 35.2 & Yes & 174 & 5.6 \\ \hline 35 $\geq$ & 442 & 14.0 & Missing & 54 \\ \hline (kg/m2) BMI before pregnancy & & & Delivery with cesarean section \\ \hline < 18.5 & 235 & 7.5 & \textbf{\textbf{N}}o & 2553 & 82.6 \\ \hline 18.5-25 & 2339 & 74.6 & Yes & 536 & 17.4 \\ \hline 25-30 & 402 & 12.8 & Missing & 70 \\ \hline 30 $\geq$ & 159 & 5.1 \\ \hline Missing & 24 \\ \hline Maternal educational level \\ \hline Primary education & 578 & 18.3 \\ \hline Some secondary education & 579 & 18.5 \\ \hline High school completed or higher & 1995 & 63.3 \\ \hline Missing & 7 \\ \hline \end{tabular} \end{table}	PMC2999589_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & & \multicolumn{2}{c\|}{\textbf{a Birth weight (g)}} & \multicolumn{4}{c\|}{\textbf{b FGR (n = 172)}} \\ \hline \textbf{Variable} & \textbf{N} & \textbf{N}umber of municipalities & \textbf{Mean (95\% CI)} & \textbf{\textbf{P-trend}} & \textbf{Control} & \textbf{Case} & \textbf{OR (95\% CI)} & \textbf{\textbf{P-trend}} \\ \hline Level of urbanization \\ \hline Urban & 660 & 7 & 3399 (3343-3455) & 0.28 & 616 & 28 & Ref & 0.15 \\ \hline Rural & 2499 & 529 & 3381 (3332-3430) & & 2314 & 144 & 1.4 (0.9-2.1) \\ \hline & & \multicolumn{2}{c\|}{In rural municipalities} \\ \hline \multicolumn{2}{c\|}{Percentage of area used} \\ \hline Low & 1039 & 177 & 3381 (3325-3438) & 0.36 & 956 & 65 & Ref & 0.87 \\ \hline Medium & 817 & 174 & 3375 (3317-3433) & & 759 & 43 & 0.9 (0.6-1.4) \\ \hline High & 643 & 178 & 3363 (3303-3423) & & 599 & 36 & 1.0 (0.6-1.5) \\ \hline \multicolumn{2}{c\|}{Percentage of area used} \\ \hline Low & 990 & 183 & 3382 (3325-3438) & 0.35 & 913 & 59 & Ref & 0.61 \\ \hline Medium & 816 & 172 & 3375 (3316-3433) & & 759 & 45 & 1.0 (0.7-1.6) \\ \hline High & 693 & 174 & 3364 (3305-3423) & & 642 & 40 & 1.1 (0.7-1.7) \\ \hline \multicolumn{2}{c\|}{Percentage of area used} \\ \hline Low & 769 & 186 & 3375 (3319-3432) & 0.66 & 714 & 45 & Ref & 0.66 \\ \hline Medium & 842 & 172 & 3382 (3325-3439) & & 777 & 50 & 1.2 (0.8-1.8) \\ \hline High & 888 & 171 & 3368 (3311-3424) & & 823 & 49 & 1.1 (0.7-1.7) \\ \hline Colza crop \\ \hline \textbf{N}o & 387 & 95 & 3391 (3327-3454) & 0.35 & 364 & 19 & Ref & 0.14 \\ \hline Yes & 2112 & 434 & 3370 (3316-3424) & & 1950 & 125 & 1.5 (0.9-2.5) \\ \hline Pea crop \\ \hline \textbf{N}o & 962 & 273 & 3381 (3325-3437) & 0.47 & 895 & 50 & Ref & 0.12 \\ \hline Yes & 1537 & 256 & 3369 (3314-3425) & & 1419 & 94 & 1.3 (0.9-1.9) \\ \hline Potato crop \\ \hline \textbf{N}o & 1340 & 282 & 3374 (3318-3430) & 0.95 & 1239 & 74 & Ref & 0.94 \\ \hline Yes & 1159 & 247 & 3375 (3319-3431) & & 1075 & 70 & 1.0 (0.7-1.4) \\ \hline Vegetable crop \\ \hline \textbf{N}o & 904 & 211 & 3389 (3331-3447) & 0.19 & 846 & 46 & Ref & 0.59 \\ \hline Yes & 1595 & 318 & 3368 (3314-3423) & & 1468 & 98 & 1.1 (0.8-1.6) \\ \hline \end{tabular} \end{table}	PMC2999589_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & & \multicolumn{2}{c\|}{\textbf{a Head circumference (cm)}} & \multicolumn{4}{c\|}{\textbf{b SHC (n = 102)}} \\ \hline \textbf{Variable} & \textbf{N} & \textbf{N}umber of municipalities & \textbf{Mean (95\% CI)} & \textbf{\textbf{P-trend}} & \textbf{Control} & \textbf{Case} & \textbf{OR (95\% CI)} & \textbf{\textbf{P-trend}} \\ \hline Level of urbanization \\ \hline Urban & 660 & 7 & 34.9 (34.7-35.1) & 0.04 & 627 & 16 & Ref & 0.06 \\ \hline Rural & 2499 & 529 & 34.8 (34.6-35.0) & & 2374 & 86 & 1.8 (0.9-3.1) \\ \hline & & \multicolumn{2}{c\|}{In rural municipalities} \\ \hline \multicolumn{2}{c\|}{Percentage of area used} \\ \hline Low & 1039 & 177 & 35.0(34.7-35.1) & 0.36 & 986 & 39 & Ref & 0.35 \\ \hline Medium & 817 & 174 & 34.9 (34.7-35.1) & & 772 & 31 & 1.1 (0.6-1.8) \\ \hline High & 643 & 178 & 34.9 (34.7-35.0) & & 616 & 16 & 0.7 (0.3-1.2) \\ \hline \multicolumn{2}{c\|}{Percentage of area used} \\ \hline Low & 990 & 183 & 35.0 (34.7-35.1) & 0.38 & 939 & 35 & Ref & 0.94 \\ \hline Medium & 816 & 172 & 34.9 (34.7-35.1) & & 777 & 29 & 1.1 (0.6-1.8) \\ \hline High & 693 & 174 & 34.9 (34.7-35.0) & & 658 & 22 & 1.0 (0.5-1.7) \\ \hline \multicolumn{2}{c\|}{Percentage of area used} \\ \hline Low & 769 & 186 & 35.0 (34.8-35.1) & 0.10 & 740 & 21 & Ref & 0.17 \\ \hline Medium & 842 & 172 & 35.0 (34.7-35.1) & & 794 & 33 & 1.6 (0.8-2.7) \\ \hline High & 888 & 171 & 34.9 (34.7-35.0) & & 840 & 32 & 1.5 (0.8-2.7) \\ \hline Colza crop \\ \hline \textbf{N}o & 387 & 95 & 35.0 (34.8-35.2) & 0.14 & 372 & 8 & Ref & 0.13 \\ \hline Yes & 2112 & 434 & 34.9 (34.7-35.0) & & 2002 & 78 & 1.8 (0.8-3.7) \\ \hline Pea crop \\ \hline \textbf{N}o & 962 & 273 & 35.1 (34.9-35.2) & 0.0002 & 927 & 20 & Ref & 0.004 \\ \hline Yes & 1537 & 256 & 34.9 (34.6-35.0) & & 1447 & 66 & 2.2 (1.2-3.6) \\ \hline Potato crop \\ \hline \textbf{N}o & 1340 & 282 & 35.0 (34.7-35.1) & 0.38 & 1274 & 40 & Ref & 0.07 \\ \hline Yes & 1159 & 247 & 34.9 (34.7-35.0) & & 1100 & 46 & 1.5 (0.9-2.4) \\ \hline Vegetable crop \\ \hline \textbf{N}o & 904 & 211 & 35.0 (34.8-35.1) & 0.12 & 860 & 27 & Ref & 0.40 \\ \hline Yes & 1595 & 318 & 34.9 (34.7-35.0) & & 1514 & 59 & 1.2 (0.7-1.9) \\ \hline \end{tabular} \end{table}	PMC2999589_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Variable}} & \multirow{2}{}{\textbf{Definition}} & \multirow{2}{}{\textbf{Levels}} & \multirow{2}{}{\textbf{Cases 654}} & \multirow{2}{}{\textbf{Controls 1085}} \\ \hline \\ \hline Age & & & 42.5 +/- 5.7 & 42.6 +/- 5.7 \\ \hline \multirow{2}{}{Family history} & first-degree relatives with breast cancer & none & 87.80\% & 94.80\% \\ \hline & at least 1 & 12.20\% & 5.20\% \\ \hline \multirow{3}{}{statusa Menopausal} & & premenopausal & 78.70\% & 80.60\% \\ \hline & postmenopausal & 6.30\% & 6.50\% \\ \hline & unknown & 15.00\% & 12.90\% \\ \hline Smoking & packyears over a lifetime & & 8.27 +/- 12.20 & 6.96 +/- 10.88 \\ \hline \multirow{3}{}{NAT1} & number 10 alleles & 0 & 64.10\% & 68.60\% \\ \hline & 1 & 32.30\% & 28.60\% \\ \hline & 2 & 3.70\% & 2.90\% \\ \hline \multirow{3}{}{CYP1B1} & number 3 alleles & 0 & 31.00\% & 28.90\% \\ \hline & 1 & 51.70\% & 50.90\% \\ \hline & 2 & 17.30\% & 20.20\% \\ \hline \multirow{2}{}{NAT2} & presence of at least one 4 allele & fast acetylator & 43.70\% & 39.80\% \\ \hline & slow acetylator & 56.30\% & 60.20\% \\ \hline \multirow{2}{}{CYP1A1} & homozygote for 1 allele & Yes & 75.80\% & 75.10\% \\ \hline & No & 24.20\% & 24.90\% \\ \hline \multirow{2}{}{GSTT1} & absence of gene product & No & 84.30\% & 81.90\% \\ \hline & Yes & 15.70\% & 18.10\% \\ \hline \multirow{2}{*}{GSTM1} & absence of gene product & No & 45.70\% & 48.80\% \\ \hline & Yes & 54.30\% & 51.20\% \\ \hline \end{tabular} \end{table}	PMC2999590_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Variable} & \multicolumn{3}{c\|}{\textbf{Logistic regression}} & \multicolumn{4}{c\|}{\textbf{BMA}} \\ \hline & \multirow{2}{}{\textbf{Pointwise OR (95\% CI)}} & \multirow{2}{}{\textbf{a Modelmain OR (95\% CI)}} & \multirow{2}{}{\textbf{b Modelall OR (95\% CI)}} & \multirow{2}{}{\textbf{CI)& OR (95\%}} & \multirow{2}{}{\textbf{CI)$ OR\|I = 1 (95\%}} & \multirow{2}{}{\textbf{Prpost}} & \multirow{2}{}{\textbf{BF(I = 1)}} \\ \hline \\ \hline packyears & 1.08 (1.00-1.16) & 1.08 (1.01-1.16)* & 1.09 (1.01-1.17)* & 1.01 (1.01-1.01) & 1.08 (1.08-1.08) & 0.13 & 0.43 \\ \hline NAT1 10 & 1.21 (1.01-1.44) & (0.98-1.42)# 1.18 & (1.00-1.46)# 1.21 & 1.05 (1.05-1.05) & 1.19 (1.19-1.20) & 0.26 & 1.05 \\ \hline fast1 slow vs NAT2 & 0.86 (0.70-1.04) & 0.90 (0.73-1.11) & 0.89 (0.72-1.09) & 0.98 (0.98-0.98) & 0.87 (0.87-0.88) & 0.13 & 0.45 \\ \hline 12 CYP1A1 & 0.96 (0.77-1.21) & 0.94 (0.74-1.18) & 0.92 (0.73-1.16) & 1.00 (1.00-1.00) & 0.96 (0.96-0.97) & 0.06 & 0.19 \\ \hline GSTT1 deletion & 0.84 (0.65-1.10) & 0.86 (0.66-1.12) & 0.86 (0.66-1.13) & 0.98 (0.98-0.98) & 0.86 (0.86-0.86) & 0.12 & 0.42 \\ \hline GSTM1 deletion & 1.13 (0.93-1.37) & 1.15 (0.94-1.40) & 1.16 (0.95-1.42) & 1.01 (1.01-1.01) & 1.12 (1.12-1.13) & 0.09 & 0.31 \\ \hline CYP1B1 3 & 0.90 (0.78-1.03) & 0.90 (0.78-1.04) & 0.90 (0.78-1.04) & 0.99 (0.99-0.99) & 0.91 (0.90-0.91) & 0.09 & 0.31 \\ \hline packyears × NAT2 & 1.19 (1.03-1.38)* & & 1.20 (1.03-1.40)* & 1.00 (1.00-1.00) & 1.19 (1.18-1.20) & 0.01 & 0.30 \\ \hline packyears × GSTM1 & 1.11 (0.96-1.28) & & 1.11 (0.96-1.29) & 1.00 (1.00-1.00) & 1.10 (1.08-1.12) & 0.00 & 0.07 \\ \hline \end{tabular} \end{table}	PMC2999590_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Model M} & \textbf{Posterior1} & \textbf{Prior2} & \textbf{3 BFall} & \textbf{4 BF0} \\ \hline NULL & 0.59 & 0.154 & 3.8 & 1.0 \\ \hline packyears & 0.067 & 0.047 & 1.4 & 0.1 \\ \hline NAT1 & 0.159 & 0.047 & 3.4 & 0.3 \\ \hline NAT2 & 0.063 & 0.047 & 1.3 & 0.1 \\ \hline CYP1A1 & 0.024 & 0.047 & 0.5 & 0.0 \\ \hline GSTT1 & 0.054 & 0.047 & 1.1 & 0.1 \\ \hline GSTM1 & 0.038 & 0.047 & 0.8 & 0.1 \\ \hline CYP1B1 & 0.044 & 0.047 & 0.9 & 0.1 \\ \hline NAT1, GSTT1 & 0.021 & 0.015 & 1.4 & 0.0 \\ \hline NAT1, GSTM1 & 0.017 & 0.015 & 1.1 & 0.0 \\ \hline NAT1, CYP1B1 & 0.017 & 0.015 & 1.1 & 0.0 \\ \hline \end{tabular} \end{table}	PMC2999590_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \multicolumn{4}{c\|}{\textbf{Variation of pν:}} \\ \hline \textbf{E(pmain)} & \textbf{0.10} & \textbf{0.25} & \textbf{0.50} \\ \hline E(pint) & \textbf{0.25} & \textbf{0.50} & 0.75 \\ \hline Variation of ψint: \\ \hline μint & 2.3 & 3.0 & 4.6 \\ \hline s2: Variation of \\ \hline scale(s2) & 25 & 100 \\ \hline \end{tabular} \end{table}	PMC2999590_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Group} & \textbf{no.} & \textbf{DEN} & \textbf{dose (g/kg of b.w.)} & \textbf{no.} of rats with nodules/total \textbf{no.} of rats & \textbf{nodule incidence (\%)} & \textbf{liver index (g/100 g b.w.) (mean $\pm$ S.D.)} \\ \hline High & 20 & + & 3.0 & 1/20 & 5.0** & 2.61 $\pm$ 0.49 \\ \hline Middle & 20 & + & 1.5 & 5/20 & 25.0* & 2.66 $\pm$ 0.18 \\ \hline Low & 20 & + & 0.75 & 8/20 & 40.0 & 2.78 $\pm$ 0.50 \\ \hline Control - & 20 & - & - & 0/20 & 0.0 & 2.90 $\pm$ 0.78* \\ \hline Control + & 20 & + & - & 9/20 & 45.0 & 2.54 $\pm$ 0.23 \\ \hline \end{tabular} \end{table}	PMC2999596_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{group} & \textbf{animal (n)} & \textbf{no. of rats with nodules (n)} & \textbf{hyperplasia (n) (\%)} & \textbf{fibrosis (n) (\%)} & \textbf{hepatocellular carcinoma (n) (\%)} \\ \hline High & 20 & 1 & 1 (100.0) & 0 (0.0) & 0* (0.0) \\ \hline Middle & 20 & 5 & 1 (20.0) & 2 (40.0) & 2 (40.0) \\ \hline Low & 20 & 8 & 2 (25.0) & 4 (50.0) & 2 (25.0) \\ \hline Control - & 20 & 0 & 0 (0.0) & 0 (0.0) & 0 (0.0) \\ \hline Control + & 20 & 9 & 2 (22.2) & 2 (22.2) & 5 (55.6) \\ \hline \end{tabular} \end{table}	PMC2999596_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Strongly \textbf{Disagree}} & \textbf{Disagree} & \textbf{Neutral} & \textbf{Agree} & Strongly \textbf{Agree} \\ \hline 1. It is part of my job as an internist to advocate for populations’ health needs within society. & 1 & 2 & 3 & 4 & 5 \\ \hline 2. I feel that my role as a health advocate extends beyond the individual patient(s) I am treating. & 1 & 2 & 3 & 4 & 5 \\ \hline 3. I am able to identify the health needs of an individual patient during patient care (beyond biomedical needs). & 1 & 2 & 3 & 4 & 5 \\ \hline 4. I can describe the health needs of the communities that I serve. & 1 & 2 & 3 & 4 & 5 \\ \hline 5. I can identify the determinants of health (psychological, biological, social, cultural and economic aspects) of patients in my community. & 1 & 2 & 3 & 4 & 5 \\ \hline 6. I can describe how public policy impacts on the health of populations that I serve. & 1 & 2 & 3 & 4 & 5 \\ \hline 7. I can describe the requirements inherent in health advocacy (e.g. altruism, social justice, autonomy, integrity and idealism), as described by the Royal College of Physicians and Surgeons of Canada. & 1 & 2 & 3 & 4 & 5 \\ \hline 8. I understand the opportunities available for internists to function as health advocates. & 1 & 2 & 3 & 4 & 5 \\ \hline 9. I am able to help my patient(s) navigate the health care system. & 1 & 2 & 3 & 4 & 5 \\ \hline 10. My current competence in being a health advocate has increased compared to 1 month ago. & 1 & 2 & 3 & 4 & 5 \\ \hline 11. My current knowledge about health advocacy has increased compared to 1 month ago. & 1 & 2 & 3 & 4 & 5 \\ \hline 12. Compared to 1 month ago, I feel more able to practice health advocacy in ways I would not have otherwise done during a regular clinical rotation. & 1 & 2 & 3 & 4 & 5 \\ \hline 13. The current likelihood of my engaging in health advocacy activity/activities has increased compared to 1 month ago. & 1 & 2 & 3 & 4 & 5 \\ \hline 14. I am more likely to recommend health advocacy activity/activities to others compared to 1 month ago. & 1 & 2 & 3 & 4 & 5 \\ \hline 15. I engage(d) in health advocacy activities during (check all that apply): \\ \hline __ High school & \multicolumn{2}{c\|}{__ Medical school} \\ \hline __ University/College & \multicolumn{2}{c\|}{__ Residency} \\ \hline __ Graduate studies \\ \hline 16. I am currently engaging in health advocacy activities & __Yes & __ No \\ \hline 17. I plan to engage in health advocacy activities \\ \hline a. in my remaining time as a resident & __Yes & __ No & \multicolumn{2}{c\|}{__ Undecided} \\ \hline b. in fellowship & __Yes & __ No & \multicolumn{2}{c\|}{__ Undecided} \\ \hline c. post-fellowship & __Yes & __ No & \multicolumn{2}{c\|}{__ Undecided} \\ \hline If Yes to 17 a), b), or c), please answer the following two optional questions. \\ \hline What population(s) or patient group(s) would benefit from your advocacy efforts? \\ \hline How would you hope to see them benefit, in both the short and long term? \\ \hline 18. Comments? \\ \hline \end{tabular} \end{table}	PMC2999597_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Experiment} & \textbf{Number of eggs (control)} & \textbf{\% first instar larvae (control)} & \textbf{\% pupae (control)} & \textbf{\% adults (control)} \\ \hline 1 & 135 (38) & 6.7 (44.7) & 4.4 (36.8) & 4.4 (31.6) \\ \hline 2 & 123 (42) & 13.0 (42.9) & 7.3 (28.6) & 4.1 (28.6) \\ \hline 3 & 441 (68) & 32.1 (58.8) & 15.9 (51.5) & 14.3 (47.1) \\ \hline \end{tabular} \end{table}	PMC2999598_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Experiment} & \textbf{Number of eggs injected} & \textbf{Number of G0 adults} & \textbf{Number of fertile G0 adults} & \textbf{Number of G1 individuals screened} & \textbf{Number of G0 transformants} & \textbf{Transformation efficiency (\%)} & \textbf{Transformationrate (\%)} \\ \hline 1 & 135 & 6 & 2 & 323 & 1 & 50 & 0.74 \\ \hline 2 & 123 & 5 & 3 & 34 & 0 & 0 & 0 \\ \hline 3 & 441 & 63 & 45 & 4934 & 1 & 2.2 & 0.23 \\ \hline TOTAL & 699 & 74 & 50 & 5291 & 2 & 4 & 0.28 \\ \hline \end{tabular} \end{table}	PMC2999598_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Line} & \textbf{Cross} & \multicolumn{2}{c\|}{\textbf{G3 larvae}} & \multicolumn{4}{c\|}{\textbf{Sex of surviving G3 offspring}} \\ \hline & & \textbf{\textbf{EGFP positive}} & \textbf{\textbf{EGFP negative}} & \multicolumn{2}{c\|}{\textbf{\textbf{EGFP positive}}} & \multicolumn{2}{c\|}{\textbf{\textbf{EGFP negative}}} \\ \hline & & & & \textbf{\textbf{Male}} & \textbf{\textbf{Female}} & \textbf{\textbf{Male}} & \textbf{\textbf{Female}} \\ \hline 17.1 & EGFP+♂ × wt ♀ & 98 & 111 & 0* & 60 & 101 & 2 \\ \hline 17.1 & EGFP+♀ × wt ♂ & 81 & 79 & 28 & 26 & 29 & 30 \\ \hline 17.2 & EGFP+♂ × wt ♀ & 27 & 38 & 0* & 24 & 19 & 3 \\ \hline 17.2 & EGFP+♀ × wt ♂ & 32 & 46 & 11 & 10 & 11 & 14 \\ \hline \end{tabular} \end{table}	PMC2999598_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Fly} & \textbf{Sex} & \multicolumn{2}{c\|}{\textbf{G2 larvae}} & \multicolumn{4}{c\|}{\textbf{Sex} of surviving G2 offspring} \\ \hline & & \textbf{\textbf{EGFP positive}} & \textbf{\textbf{EGFP negative}} & \multicolumn{2}{c\|}{\textbf{\textbf{EGFP positive}}} & \multicolumn{2}{c\|}{\textbf{\textbf{EGFP negative}}} \\ \hline & & & & \textbf{\textbf{Male}} & \textbf{\textbf{Female}} & \textbf{\textbf{Male}} & \textbf{\textbf{Female}} \\ \hline 34.3 & ♀ & 12 & 20 & 3 & 3 & 1 & 2 \\ \hline 34.4 & ♀ & 52 & 74 & 22 & 20 & 16 & 15 \\ \hline 34.5 & ♂ & 12 & 33§ & 1 & 6 & 10 & 10 \\ \hline 34.6 & ♂ & 50 & 71 & 13 & 17 & 22 & 16 \\ \hline 34.7 & ♂ & 65 & 172§ & 0* & 32 & 70 & 38 \\ \hline 34.8 & ♀ & 24 & 47§ & 7 & 13 & 8 & 15 \\ \hline 34.9 & ♀ & 7 & 11 & 5 & 2 & 1 & 2 \\ \hline 34.10 & ♀ & 15 & 103§ & 4 & 6 & 26 & 35 \\ \hline 34.11 & ♂ & 30 & 100§ & 0* & 14 & 27 & 6 \\ \hline 34.14 & ♂ & 96 & 215§ & 0* & 72 & 41 & 17 \\ \hline 34.15 & ♂ & 10 & 43§ & 0* & 5 & 5 & 6 \\ \hline \end{tabular} \end{table}	PMC2999598_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Characteristics} & \textbf{Sarcoidosis} & \textbf{PPD-} & \textbf{NTM} & \textbf{p value} \\ \hline Number & 31 & 14 & 9 & NS \\ \hline Sex, female/male & 19/12 & 11/3 & 5/4 & NS \\ \hline Age (yr), median (min, max) & 47 (25,64) & 49 (24,61) & 67 (51,75) & NS \\ \hline Race & 8AA:22C:1H/AA & 3AA:10C:1A/S & 1AA:8C & NS \\ \hline Stage 0/I/II/III/IV & 1/12/17/1/0 & ND & ND \\ \hline IS at Bronch & 12/19 & ND & ND \\ \hline Lym (\%), median (min, max) & 15 (1, 59) & 7 (1, 37) & 14 (3, 66) \\ \hline Extrapulmonary disease, yes/no & 7/24 & ND & ND \\ \hline Smoking status & 3AS:11EX:17NS & 1AS:5EX:8NS & 1AS:5EX:3NS \\ \hline CD4/CD8 ratio, median (min,max) & 2.87 (0.56,70.54) & 1.30 (0.14,36.57) & 2.95 (0.49,9.1) \\ \hline \end{tabular} \end{table}	PMC2999599_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \multicolumn{2}{c\|}{\textbf{Peptide}} & \textbf{Sequence} \\ \hline \textbf{Esat-6} & \textbf{14} & \textbf{NNALQNLARTISEAG} \\ \hline & 15 & NLARTISEAGQAMAS \\ \hline \multirow{2}{}{KatG} & 31 & WTNTPTKWDNSFLEI \\ \hline 32 & TKWDNSFLEILYGYE \\ \hline \multirow{5}{}{Ag85A} & & Whole protein \\ \hline a & LQVPSPSMGRDIKVQFQSGG \\ \hline b & DWYQPACGKAGCQTYKWETL \\ \hline 3 & DIKVQFQSGGANSPALYLLD \\ \hline 6 & WDINTPAFEWYDQSGLSVVM \\ \hline \multirow{4}{*}{SodA} & 31 & LGIVPLLLLDMWEHA \\ \hline 33 & MWEHAFYLQYKNVKV \\ \hline 36 & DFAKAFWNVVNWADV \\ \hline 38 & NWADVQSRYAAATSQ \\ \hline HSP70 & & Whole protein \\ \hline \end{tabular} \end{table}	PMC2999599_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{Sarcoidosis} & \textbf{PPD-} & \textbf{NTM} & \textbf{P-value} \\ \hline Total Subjects & 31 & 14 & 9 \\ \hline CD4+ Response to any mycobacterial antigen & 22 & 2 & 5 & 0.0008* \\ \hline CD4+ Response to multiple mycobacterial antigens & 16 & 2 & 4 & 0.02* \\ \hline CD8+ Response to any mycobacterial antigen & 18 & 2 & 3 & 0.009* \\ \hline CD8+ Response to multiple mycobacterial antigen & 12 & 2 & 3 & 0.12* \\ \hline \end{tabular} \end{table}	PMC2999599_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \multirow{2}{}{\textbf{PCOS N = 24}} & \multirow{2}{}{\textbf{Control N = 12}} & \multirow{2}{*}{\textbf{P-value}} \\ \hline \\ \hline Age (years) & 22.87 $\pm$ 4.28 & 21.66 $\pm$ 5.15 & P = 0.46 \\ \hline BMI (weight/m2) & 31 $\pm$ 7.0 & 25.16 $\pm$ 6.97 & 0.02a P = \\ \hline Waist/Hip ratio (WHR) & 0.87 $\pm$ 0.15 & 0.84 $\pm$ 0.12 & 0.00a P = \\ \hline \end{tabular} \end{table}	PMC2999603_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \multirow{2}{}{\textbf{PCOS N = 24}} & \multirow{2}{}{\textbf{Control N = 12}} & \multirow{2}{*}{\textbf{P-value}} \\ \hline \\ \hline Fasting blood glucose (mg/dl) & 86.29 $\pm$ 9.90 & 82.08 $\pm$ 5,12 & P = 0.17 \\ \hline Fasting insulin (mUI/ml) & 22.0 $\pm$ 12.0 & 7.65 $\pm$ 5.48 & <0.001a P = \\ \hline HOMAIR & 4.54 $\pm$ 2.77 & 1.82 $\pm$ 1.17 & <0.05a P = \\ \hline Total cholesterol (mg/ml) & 183.4 $\pm$ 30.35 & 168.6 $\pm$ 29.30 & P = 0.17 \\ \hline HDL cholesterol (mg/ml) & 51 $\pm$ 8,67 & 59,16 $\pm$ 9,19 & a P = <0.05 \\ \hline PAI-1 (ng/ml) & 37,80 $\pm$ 20,98 & 17.2 $\pm$ 18.2 & 0.007a P = \\ \hline F von Willebrand (\%) & 86,86 $\pm$ 34,25 & 103,65 $\pm$ 27,75 & P = 0.15 \\ \hline Adiponectin & 6,05 $\pm$ 3,84 & 24 $\pm$ 4,26 & 0.000a P = \\ \hline \end{tabular} \end{table}	PMC2999603_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \multirow{2}{}{\textbf{PCOS N = 24}} & \multirow{2}{}{\textbf{Control N = 12}} & \multirow{2}{*}{\textbf{P-value}} \\ \hline \\ \hline FSH (U/l) & 4,77 $\pm$ 1,24 & 4,47 $\pm$ 1,48 & P = 0.52 \\ \hline LH (U/l) & 5,61 $\pm$ 3,44 & 3,17 $\pm$ 1,26 & 0.02a P = \\ \hline E2 (pg/ml) & 41 $\pm$ 35,56 & 39,05 $\pm$ 22,38 & P =0.86 \\ \hline A (ng/ml) & 3,09 $\pm$ 1,33 & 1.67 $\pm$ 0.83 & a P = 0.002 \\ \hline T (ng/ml) & 0,65 $\pm$ 0,50 & 0.22 $\pm$ 0.08 & a P = 0.006 \\ \hline SHBG (nmol/l) & 44,05 $\pm$ 2,27 & 54,55 $\pm$ 19,40 & a P = 0.01 \\ \hline DHEA-S (mg/m) & 2,19 $\pm$ 0,69 & 1.61 $\pm$ 0.96 & a P = 0.04 \\ \hline 17 0H P (ng/ml) & 1,54 $\pm$ 1,87 & 0.74 $\pm$ 0.53 & P = 0.15 \\ \hline \end{tabular} \end{table}	PMC2999603_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \multirow{2}{}{\textbf{Control N = 12}} & \multirow{2}{}{\textbf{PCOS N = 24}} & \multirow{2}{*}{\textbf{P-value}} \\ \hline \\ \hline (cm3) Ovarian Volume & 4.98 $\pm$ 2.91 & 9.13 $\pm$ 3.98 & <0.01a P = \\ \hline (cm2) Ovarian Area & 41.3 $\pm$ 16.3 & 47.4 $\pm$ 17.4 & P = 0.31 \\ \hline (cm3) Stromal Volume & 0.59 $\pm$ 0.66 & 11.4 $\pm$ 4.57 & a P = <0.001 \\ \hline (cm2) Stromal Area & 8.12 $\pm$ 5.46 & 13.9 $\pm$ 6.10 & a P = <0.01 \\ \hline S/A ratio & 4.37 $\pm$ 1.58 & 7.49 $\pm$ 4.45 & a P = <0.05 \\ \hline \end{tabular} \end{table}	PMC2999603_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{OV (cm3)} & \textbf{OA (cm2)} & \textbf{SV (cm3)} & \textbf{SA (cm2)} & \textbf{S/A ratio} \\ \hline BMI (weight/m2) & 0.02a P = & P = 0.45 & P = 0.31 & P = 0.37 & P = 0.84 \\ \hline Waist/Hip ratio (WHR) & a P = 0.01 & a P < 0.01 & P = 0.77 & P = 0.07 & P = 0.77 \\ \hline HOMA test & P = 0.14 & P = 0.14 & P = 0.17 & P = 0.53 & P = 0.43 \\ \hline FSH (U/l) & P = 0.73 & P = 0.87 & P = 0.72 & P = 0.58 & P = 0.72 \\ \hline LH (U/l) & P = 0.24 & P = 0.51 & P = 0.62 & P = 0.31 & P = 0.13 \\ \hline A (ng/ml) & P = 0.66 & P = 0.15 & P = 0.55 & P = 0.81 & a P < 0.05 \\ \hline T (ng/ml) & P = 0.76 & P = 0.14 & P = 0.97 & P = 0.74 & a P = 0.03 \\ \hline SHBG (nmol/l) & P = 0.94 & P = 0.43 & P = 0.38 & P = 0.83 & P = 0.77 \\ \hline DHEA-S (mg/m) & P = 0.44 & P = 0.35 & P = 0.82 & P = 0.89 & P = 0.64 \\ \hline 17 0H P (ng/ml) & P = 0 & P = 0.56 & P = 0.78 & P = 0.31 & P = 0.19 \\ \hline Cholesterol (mg/dl) & a P < 0.05 & P = 0.17 & P = 0.92 & P = 0.77 & P = 0.56 \\ \hline \end{tabular} \end{table}	PMC2999603_table_4
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{OV (cm3)} & \textbf{OA (cm2)} & \textbf{SV (cm3)} & \textbf{SA (cm2)} & \textbf{S/A ratio} \\ \hline PAI-1 (ng/ml) & P = 0.29 & P = 0.21 & a P = 0.000 & a P = 0.000 & a P = 0.000 \\ \hline F von Willebrand (\%) & P = 0.15 & P = 0.31 & a P = 0.000 & a P = 0.000 & a P = 0.000 \\ \hline Adiponectine & P = 0.45 & P = 0.21 & a P = 0.001 & a P = 0.000 & P = 0.08 \\ \hline IMT & a P = 0.000 & a P = 0.000 & P = 0.007 & a P = 0.000 & a P = 0.000 \\ \hline \end{tabular} \end{table}	PMC2999603_table_5
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{#} & \textbf{Primers} & \textbf{Sequences} & \textbf{Position} & \textbf{Tm (°C)} \\ \hline \multirow{2}{}{1} & PF356 & 5’ TGACGCAGTACAGACCGACGAGA 3’ & 356 & 60 \\ \hline PR1197 & 5’ AATGCAAGTGCAAGCCACCTTTT 3’ & 1197 \\ \hline \multirow{2}{}{2} & PF1050 & 5’ AGTAATCTGGTAATCGCTGTTCG 3’ & 1050 \\ \hline PR1942 & 5’ ATGTTAGTCTTTCCTGTTGTGGC 3’ & 1942 \\ \hline \multirow{2}{}{3} & PF1568 & 5’ GCTGGTGGATAACAACATCTGCT 3’ & 1568 \\ \hline PR2553 & 5’ GTTTCTTCTTTCTCGGTGCTTCT 3’ & 2553 \\ \hline \multirow{2}{}{4} & PF2530 & 5’ AAGAAGCACCGAGAAAGAAGAAA 3’ & 2530 \\ \hline PR3413 & 5’ AAATCTAAGGGACAAGGCAAACG 3’ & 3413 \\ \hline \multirow{2}{}{5} & PF3363 & 5’ AGATACTAAGAAAGACAAGG TGGAG 3’ & 3363 \\ \hline PR4263 & 5’ AATAATAGAAGGTATAG CGTCTCCA 3’ & 4263 \\ \hline \multirow{2}{}{6} & PF3918 & 5’ ACCTGCTCCTCCATCTTCTCCAC 3’ & 3918 \\ \hline PR4897 & 5’ GGCCGTCATCATACATTCTGCTC 3’ & 4897 \\ \hline \multirow{2}{}{7} & PF4219 & 5’ ACTTACTGTTCTATGATGTCTGGAG 3’ & 4219 \\ \hline PR5862 & 5’ ATATCATCTGCGGTGTCTGGG 3’ & 5862 \\ \hline \end{tabular} \end{table}	PMC2999605_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{6}{c\|}{\textbf{Number of meetings (\%) within different age groups}} \\ \hline \textbf{1 ICPC chapters:} & \textbf{All ages} & \textbf{0-19 years} & \textbf{20-39 years} & \textbf{40-59 years} & \textbf{60-79 years} & \textbf{$\geq$80 years} \\ \hline A - General and unspecified & 10187 (10.5) & 1223 (11.2) & 3663 (11.3) & 3393 (10.6) & 798 (7.3) & 1101 (10.4) \\ \hline K - Cardiovascular & 4903 (5.1) & 81 (0.7) & 235 (0.7) & 953 (3.0) & 1393 (12.7) & 2241 (21.1) \\ \hline L - Musculoskeletal & 11937 (12.3) & 446 (4.1) & 3048 (9.4) & 5789 (18.1) & 1528 (13.9) & 1126 (10.6) \\ \hline N - Neurological & 5528 (5.7) & 1098 (10.0) & 1412 (4.4) & 1696 (5.3) & 936 (8.5) & 386 (3.6) \\ \hline P - Psychological & 52113 (53.7) & 6451 (58.6) & 21835 (67.3) & 17497 (54.6) & 3771 (34.4) & 2559 (24.1) \\ \hline All other diagnoses & 12423 (12.7) & 1702 (15.4) & 2248 (6.9) & 2716 (8.4) & 2550 (23.2) & 3206 (30.2) \\ \hline Sum & 97091 (100) & 11011 (100) & 32441 (100) & 32044 (100) & 10976 (100) & 10619 (100) \\ \hline \end{tabular} \end{table}	PMC2999607_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{4}{c\|}{\textbf{MDMs1 Frequency of attendance in}} \\ \hline & \textbf{Low} & \textbf{Medium/low} & \textbf{Medium/high} & \textbf{High} & \textbf{p-value} \\ \hline Number of GPs & 795 & 795 & 795 & 794 \\ \hline Mean annual rate per 1000 patients (min-max) & 4 (0-7)2 & 12 (7-17) & 24 (17-35) & 54 (35-170) \\ \hline GP characteristics: \\ \hline GP age, mean & 52.2 & 50.0 & 48.5 & 47.3 & < 0.001 \\ \hline GP gender: percent male & 70.5 & 69.3 & 68.2 & 74.7 & 0.026 \\ \hline GP practice characteristics: \\ \hline diagnosis3,\% Consultations with psychological & 8.6 & 9.7 & 10.5 & 11.8 & < 0.001 \\ \hline years4 Rate MDMs, patients $\geq$67 & 0.6 & 0.8 & 1.0 & 1.6 & < 0.001 \\ \hline List characteristics: \\ \hline Mean list size & 1367 & 1283 & 1225 & 1077 & < 0.001 \\ \hline Percentage of lists open to new patients & 32.7 & 28.6 & 26.9 & 37.0 & < 0.001 \\ \hline List population characteristics: \\ \hline Persons $\geq$67 years on the list, \% & 12.9 & 12.3 & 12.1 & 13.0 & 0.014 \\ \hline Men in the list, \% & 49.4 & 49.2 & 49.2 & 51.1 & < 0.001 \\ \hline years5, Education 9 \% $\leq$ & 14.1 & 14.4 & 14.6 & 15.9 & < 0.001 \\ \hline (NOK1000)5 Mean annual income & 266 & 248 & 241 & 226 & < 0.001 \\ \hline pensioners6, Disability \% & 9.5 & 10.1 & 10.7 & 11.7 & < 0.001 \\ \hline recipients7, Social assistance \% & 3.6 & 4.1 & 4.6 & 5.6 & < 0.001 \\ \hline \end{tabular} \end{table}	PMC2999607_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Antibiotic} & \textbf{MIC (μg/ml)} \\ \hline Ampicillin & 64 \\ \hline Amoxicillin & 256 \\ \hline Carbenicillin & 64 \\ \hline Ceftazidime & 32 \\ \hline Imipenem & 4 \\ \hline Meropenem & 0.75 \\ \hline Ciprofloxacin & 0.5 \\ \hline Norfloxacin & 8 \\ \hline Clindamycin & > 1024 \\ \hline Clarithromycin & 128 \\ \hline Erythromycin & 128 \\ \hline Gentamicin & 0.125 \\ \hline Kanamycin & 0.25 \\ \hline Streptomycin & 8 \\ \hline Doxycycline & 4 \\ \hline Tetracycline & 8 \\ \hline Trimethoprim & 0.125 \\ \hline Polymyxin B & > 1024 \\ \hline Zeocin & 256 \\ \hline \end{tabular} \end{table}	PMC2999611_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Variable} & \multicolumn{2}{c\|}{\textbf{Control (n = 96)}} & \multicolumn{2}{c\|}{\textbf{HCC (n = 124)}} & \multicolumn{2}{c\|}{\textbf{P-value (vs. control)}} \\ \hline & \textbf{Chronic Hepatitis (n = 49)} & \textbf{Cirrhosis (n = 47)} & \textbf{AFP 20 ng/mL $\leq$ (n = 61)} & \textbf{AFP > 20 ng/mL (n = 63)} & \textbf{AFP-Low HCC} & \textbf{AFP-high HCC} \\ \hline Age & 42.4 $\pm$ 14.9 & 53.8 $\pm$ 9.2 & 55.8 $\pm$ 14.6 & 53.5 $\pm$ 12.9 & 0.0008 & 0.0127 \\ \hline Gender (M:F) & 25:24 & 31:16 & 41:20 & 51:12 & 0.2659 & 0.0030 \\ \hline Etiology (\%) & & & & & 0.0124 & 0.2458 \\ \hline HBV & 69.4 & 48.9 & 47.5 & 66.7 \\ \hline HCV & 30.6 & 36.2 & 19.7 & 28.6 \\ \hline Non HBV-non-HCV & 0 & 14.9 & 32.8 & 4.8 \\ \hline AST (IU/mL) & 32.5 (12-194) & 42 (16-110) & 91 (5-714) & 138 (9-945) & 0.0026 & < 0.0001 \\ \hline ALT (IU/mL) & 32.5 (6-868) & 32 (15-63) & 46 (8-363) & 65 (6-347) & < 0.0001 & < 0.0001 \\ \hline \end{tabular} \end{table}	PMC2999612_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Marker} & \textbf{Cut-off} & \textbf{Sensitivity} & \textbf{Accuracy} & \textbf{PPV} & \textbf{NPV} \\ \hline \multicolumn{2}{c\|}{All HCC (n = 124)} \\ \hline AAG & 800 & 71 & 82 & 95 & 72 \\ \hline DCP & 4.5 & 74 & 83 & 95 & 74 \\ \hline AFP-low HCC & (n = 61) \\ \hline AAG & 800 & 82 & 90 & 91 & 89 \\ \hline DCP & 4.5 & 57 & 80 & 88 & 78 \\ \hline AFP-high HCC & (n = 63) \\ \hline AAG & 800 & 62 & 82 & 89 & 79 \\ \hline DCP & 4.5 & 90 & 93 & 92 & 94 \\ \hline \end{tabular} \end{table}	PMC2999612_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{1996} & \textbf{1997} & \textbf{1998} & \textbf{1999} & \textbf{2000} & \textbf{2001} & \textbf{Total} \\ \hline Number of patients & 71 & 568 & 2275 & 2537 & 2853 & 1614 & 9918 \\ \hline Failed treatment cases & 2 & 12 & 45 & 65 & 121 & 59 & 304 \\ \hline Rate (\%) & 2.81 & 2.11 & 1.98 & 2.56 & 4.24 & 3.67 & 3.07 \\ \hline \end{tabular} \end{table}	PMC2999615_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline Accession & Gene symbol & Gene name & fold change \\ \hline BC010288 & Psp & parotid secretory protein & 313.4 \\ \hline NM_007446 & Amy1 & amylase 1, salivary & 242.1 \\ \hline BC011134 & Chia & chitinase, acidic & 226.6 \\ \hline NM_011422 & Smr1 & submaxillary gland androgen regulated protein & 209.7 \\ \hline NM_008843 & Pip & prolactin induced protein & 71.9 \\ \hline AF108501 & Clca1 & chloride channel calcium activated 1 & 42.7 \\ \hline BG862223 & Camk2b & Calcium/calmodulin-dependent protein kinase II, b & 39.5 \\ \hline NM_009323 & Tbx15 & T-box 15 & 38.3 \\ \hline NM_009638 & Crisp1 & cysteine-rich secretory protein 1 & 35.4 \\ \hline BB795585 & Ntrk2 & neurotrophic tyrosine kinase, receptor, type 2 & 21.7 \\ \hline NM_013605 & Muc1 & mucin 1, transmembrane & 17.2 \\ \hline BF119305 & Csn1s2a & casein alpha s2-like A & 13.8 \\ \hline NM_008109 & Gdf5 & growth differentiation factor 5 & 10.9 \\ \hline NM_053134 & Pcdhb9 & protocadherin beta 9 & 9.7 \\ \hline AK007630 & Cdkn1a & cyclin-dependent kinase inhibitor 1A (p21) & 8.8 \\ \hline AF059567 & Cdkn2b & cyclin-dependent kinase inhibitor 2B (p15) & 8.5 \\ \hline BF683028 & Gyk & glycerol kinase & 7.2 \\ \hline NM_011709 & Wap & whey acidic protein & 7.1 \\ \hline C86550 & Dcpp & demilune cell and parotid protein & 6.7 \\ \hline NM_007554 & Bmp4 & bone morphogenetic protein 4 & 6.1 \\ \hline BF456404 & Pak1 & p21 (CDKN1A)-activated kinase 1 & 5.4 \\ \hline AV246759 & Tgfb2 & transforming growth factor, beta 2 & 5.2 \\ \hline NM_007865 & Dll1 & delta-like 1 (Drosophila) & 5.0 \\ \hline NM_010669 & Krt6b & Keratin 6B & 5.0 \\ \hline BQ032637 & Jak1 & Janus kinase 1 & -3.5 \\ \hline BG064038 & Arhgap12 & Rho GTPase activating protein 12 & -3.5 \\ \hline BC021401 & Muc10 & mucin 10, submandibular gland salivary mucin & -3.9 \\ \hline AK020693 & Acpp & acid phosphatase, prostate & -4.1 \\ \hline BB524685 & Tmprss11a & transmembrane protease, serine 11a & -5.6 \\ \hline NM_009973 & Csn1s2b & casein alpha s2-like B & -5.9 \\ \hline U82380 & Smr2 & submaxillary gland androgen regulated protein 2 & -6.0 \\ \hline NM_013655 & Cxcl12 & chemokine (C-X-C motif) ligand 12 & -6.4 \\ \hline BF011461 & Rbbp4 & retinoblastoma binding protein 4 & -6.4 \\ \hline BB745167 & Ppargc1a & PPAR, gamma, coactivator 1 alpha & -7.2 \\ \hline NM_011271 & RNase 1 & ribonuclease, RNase A family, 1 (pancreatic) & -9.4 \\ \hline BB760085 & Eya1 & eyes absent 1 homolog (Drosophila) & -9.4 \\ \hline AV334599 & Tcfap2b & transcription factor AP-2 beta & -33.6 \\ \hline AV275795 & Plb1 & phospholipase B1 & -47.4 \\ \hline BC021770 & Cldn10 & claudin 10 & -81.2 \\ \hline \end{tabular} \end{table}	PMC2999618_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{ER Positive (n = 285)}} & \multirow{2}{}{\textbf{BCSS HR (95\% CI)}} & \multirow{2}{}{\textbf{\textbf{p}}} & \multirow{2}{}{\textbf{OS HR (95\% CI)}} & \multirow{2}{*}{\textbf{\textbf{p}}} \\ \hline \\ \hline SNAS & Univariate & & Univariate \\ \hline low & 1 & & 1 \\ \hline high & 2.01(1.14 - 3.54) & 0.014 & 1.57(1.14 - 2.16) & 0.005 \\ \hline SNAS & Multivariate & & Multivariate \\ \hline low & 1 & & 1 \\ \hline high & 1.38(0.71 - 2.66) & 0.335 & 1.36(0.90 - 2.06) & 0.140 \\ \hline SNAS & Multivariate + treatment adjusted & & Multivariate + treatment adjusted \\ \hline low & 1 & & 1 \\ \hline high & 1.87(0.71 - 4.88) & 0.194 & 1.92(0.98 - 3.78) & 0.055 \\ \hline CNR & Univariate & & Univariate \\ \hline low & 1 & & 1 \\ \hline high & 0.52(0.29 - 0.94) & 0.032 & 0.85(0.61 - 1.13) & 0.320 \\ \hline CNR & Multivariate & & Multivariate \\ \hline low & 1 & & 1 \\ \hline high & 0.805(0.52 - 1.22) & 0.315 & 0.54(0.27 - 1.10) & 0.094 \\ \hline CNR & Multivariate + treatment adjusted & & Multivariate + treatment adjusted \\ \hline low & 1 & & 1 \\ \hline high & 0.41(0.15 - 1.13) & 0.087 & 0.44(0.23 - 0.87) & 0.018 \\ \hline \end{tabular} \end{table}	PMC2999619_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Site} & \textbf{Cases (n = 291)} & \textbf{Nodule Controls (n = 565)} & \textbf{Smoker Controls (n = 470)} & Total/\textbf{Site} \\ \hline BS & 43 & 0 & 63 & 106 \\ \hline RPCI & 72 & 66 & 110 & 248 \\ \hline NYU & 88 & 238 & 172 & 498 \\ \hline PITT & 88 & 261 & 125 & 474 \\ \hline \end{tabular} \end{table}	PMC2999620_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \multicolumn{3}{c\|}{\textbf{Training Set (n = 985)}} & \multicolumn{3}{c\|}{\textbf{Verification Set (n = 341)}} \\ \hline & & \textbf{\textbf{Cases}} & \textbf{\textbf{Controls}} & \textbf{\textbf{p-value1}} & \textbf{\textbf{Cases}} & \textbf{\textbf{Controls}} & \textbf{\textbf{p-value1}} \\ \hline Individuals, no. (\%) & & 213 (21.6) & 772 (78.4) & & 78 (22.9) & 263 (77.1) \\ \hline \multirow{2}{}{Sex (\%)} & Male & 51.2 & 47.4 & & 43.6 & 47.9 \\ \hline Female & 48.8 & 52.6 & 0.3305 & 56.4 & 52.1 & 0.5015 \\ \hline Age, mean (SD) & & 67.6 (9.8) & 59.0 (10.2) & ,0.0001 & 68.3 (10.2) & 58.8 (9.6) & ,0.0001 \\ \hline \multirow{3}{}{Control Nodule Status, no. (\%)} & Benign nodule & n/a & 420 (54.4) & & n/a & 145 (55.1) \\ \hline No nodule & n/a & 222 (28.8) & & n/a & 75 (28.5) \\ \hline Unknown & n/a & 130 (16.8) & & n/a & 43 (16.4) \\ \hline \multirow{4}{*}{Smoking Status, no.} & Current & 54 & 421 & ,0.0001 & 25 & 150 & ,0.0001 \\ \hline Ex & 85 & 310 & ,0.0001 & 31 & 108 & ,0.0001 \\ \hline Never & 11 & 6 & ,0.0001 & 7 & 3 & ,0.0001 \\ \hline Unknown & 63 & 35 & ,0.0001 & 15 & 2 & ,0.0001 \\ \hline (SD){ Smoking (PKY), mean & & 47.1 (33.7) & 42.3 (24.2) & 0.0258 & 40.9 (30.8) & 42.3 (24.6) & 0.7003 \\ \hline \end{tabular} \end{table}	PMC2999620_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & & \textbf{Training Cases, n = 213, no. (\%)} & \textbf{Verification Cases, n = 78, no. (\%)} \\ \hline \multirow{4}{}{NSCLC1 Stage} & I & 99 (46.5) & 38 (49) \\ \hline II & 32 (15.0) & 11 (14) \\ \hline III & 82 (38.5) & 27 (35) \\ \hline Not reported & - & 2 (2) \\ \hline \multirow{4}{}{Histology} & Adenocarcinoma & 120 (56.3) & 49 (62.8) \\ \hline Squamous & 71 (33.3) & 18 (23.1) \\ \hline Large cell & 2 (1.0) & 2 (2.6) \\ \hline NSCLC NOS & 20 (9.4) & 9 (11.5) \\ \hline \end{tabular} \end{table}	PMC2999620_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{#} & \textbf{Protein Name} & \textbf{UniProt ID} & \textbf{KS} & \textbf{q-value} & \textbf{NB Freq} \\ \hline 1 & BCA-1 & O43927 & 0.34 & 2.51E-17 & 1 \\ \hline 2 & BMP-1 & P13497 & 0.35 & 3.49E-18 & 10 \\ \hline 3 & C1s & P09871 & 0.29 & 3.92E-13 & 1 \\ \hline 4 & C9 & P02748 & 0.41 & 1.33E-24 & 6 \\ \hline 5 & Cadherin-1 & P12830 & 0.32 & 1.47E-15 & 206 \\ \hline 6 & Calpain I & P07384 P04632 & 0.4 & 8.46E-24 & 72 \\ \hline 7 & Catalase & P04040 & 0.32 & 1.21E-15 & 2 \\ \hline 8 & CD30 Ligand & P32971 & 0.28 & 1.22E-12 & 51 \\ \hline 9 & CDK5/p35 & Q00535 Q15078 & 0.27 & 1.34E-11 & 31 \\ \hline 10 & CK-MB & P12277 P06732 & 0.33 & 2.51E-16 & 19 \\ \hline 11 & Contactin-5 & O94779 & 0.29 & 1.67E-13 & 3 \\ \hline 12 & Endostatin & P39060 & 0.28 & 8.48E-13 & 33 \\ \hline 13 & ERBB1 & P00533 & 0.46 & 6.32E-31 & 136 \\ \hline 14 & FGF-17 & O60258 & 0.31 & 6.12E-15 & 6 \\ \hline 15 & FYN & P06241 & 0.13 & 5.19E-04 & 14 \\ \hline 16 & HSP 90a & P07900 & 0.51 & 7.86E-37 & 85 \\ \hline 17 & HSP 90b & P08238 & 0.39 & 1.50E-22 & 7 \\ \hline 18 & IGFBP-2 & P18065 & 0.36 & 1.87E-19 & 54 \\ \hline 19 & IL-15 Ra & Q13261 & 0.29 & 2.62E-13 & 4 \\ \hline 20 & IL-17B & Q9UHF5 & 0.28 & 1.07E-12 & 1 \\ \hline 21 & Importin b1 & Q14974 & 0.4 & 1.31E-23 & 30 \\ \hline 22 & Kallikrein 7 & P49862 & 0.31 & 1.79E-14 & 43 \\ \hline 23 & LDH-H 1 & P07195 & 0.3 & 8.64E-14 & 3 \\ \hline 24 & Legumain & Q99538 & 0.28 & 2.52E-12 & 1 \\ \hline 25 & LRIG3 & Q6UXM1 & 0.34 & 1.13E-17 & 25 \\ \hline 26 & Macrophage man- nose receptor & P22897 & 0.37 & 6.21E-21 & 21 \\ \hline 27 & MAPK13 & O15264 & 0.34 & 4.66E-18 & 1 \\ \hline 28 & MEK1 & Q02750 & 0.29 & 2.62E-13 & 5 \\ \hline 29 & MetAP2 & P50579 & 0.44 & 3.40E-28 & 7 \\ \hline 30 & Midkine & P21741 & 0.11 & 1.67E-03 & 7 \\ \hline 31 & MIP-4 & P55774 & 0.29 & 2.69E-13 & 43 \\ \hline 32 & MIP-5 & Q16663 & 0.31 & 1.53E-14 & 27 \\ \hline 33 & MMP-7 & P09237 & 0.38 & 1.67E-21 & 36 \\ \hline 34 & NACa & Q13765 & 0.33 & 7.57E-17 & 5 \\ \hline 35 & NAGK & Q9UJ70 & 0.37 & 1.25E-20 & 5 \\ \hline 36 & Pleiotrophin & P21246 & 0.29 & 5.02E-13 & 107 \\ \hline 37 & PRKCI & P41743 & 0.41 & 3.81E-25 & 97 \\ \hline 38 & Renin & P00797 & 0.25 & 1.69E-10 & 2 \\ \hline 39 & RGM-C & Q6ZVN8 & 0.27 & 5.43E-12 & 84 \\ \hline 40 & SCF sR & P10721 & 0.35 & 6.97E-19 & 107 \\ \hline 41 & sL-Selectin & P14151 & 0.29 & 7.88E-13 & 57 \\ \hline 42 & Ubiquitin+1 & P62988 & 0.33 & 4.09E-17 & 1 \\ \hline 43 & VEGF & P15692 & 0.29 & 5.47E-13 & 1 \\ \hline 44 & YES & P07947 & 0.28 & 1.73E-12 & 47 \\ \hline \end{tabular} \end{table}	PMC2999620_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Criteria} & \textbf{Minimum Performance} & \textbf{# Classifiers} \\ \hline Biomarker frequency in greedy algorithm classifiers & 10 & 250 \\ \hline + Sensitivity (Stage I-III) Specificity & 1.7 & 94 \\ \hline Stage I Sensitivity & 0.85 & 80 \\ \hline Cross-validation Sensitivity I-III)+ (Stage Specificity & 1.7 & 50 \\ \hline Cross-validation Stage I Sensitivity & 0.85 & 50 \\ \hline Severe COPD Specificity & 0.65 & 45 \\ \hline \end{tabular} \end{table}	PMC2999620_table_4
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & & \textbf{Sensitivity (\%), (95\% CI)} & \textbf{Specificity (\%), (95\% CI)} \\ \hline \multirow{5}{}{NSCLC Cases} & Training Stage I-III & 91 (87-95) \\ \hline Training Stage I & 90 (84-96) \\ \hline 10-fold Cross Validation & 91 (87-95) \\ \hline Verification Stage I-III & 89 (81-96) \\ \hline Verification Stage I & 87 (78-96) \\ \hline \multirow{5}{}{Controls} & Training All Controls & & 84 (81-86) \\ \hline Training Benign Nodules & & 82 (78-85) \\ \hline 10-fold Cross Validation & & 83 (80-86) \\ \hline Verification All Controls & & 83 (79-88) \\ \hline Verification Benign Nodules & & 85 (79-91) \\ \hline \end{tabular} \end{table}	PMC2999620_table_5
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Biomarker} & \textbf{UniProt ID} & \textbf{Direction*} & \textbf{Description} \\ \hline Cadherin-1 & P12830 & down & cell adhesion, transcription regulation \\ \hline CD30 Ligand & P32971 & up & cytokine \\ \hline Endostatin & P39060 & up & inhibition of angiogenesis \\ \hline HSP 90a & P07900 & up & chaperone \\ \hline LRIG3 & Q6UXM1 & down & protein binding, tumor suppressor \\ \hline MIP-4 & P55774 & up & monokine \\ \hline Pleiotrophin & P21246 & up & growth factor \\ \hline PRKCI & P41743 & up & serine/threonine protein kinase, oncogene \\ \hline RGM-C & Q6ZVN8 & down & iron metabolism \\ \hline SCF sR & P10721 & down & decoy receptor \\ \hline sL-Selectin & P14151 & down & cell adhesion \\ \hline YES & P07947 & up & tyrosine kinase, oncogene \\ \hline \end{tabular} \end{table}	PMC2999620_table_6
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \textbf{Cases} & \textbf{Controls} & \textbf{Sensitivity (\%) (95\%CI)} & \textbf{Specificity (\%) (95\%CI)} & \textbf{Accuracy (\%) (95\%CI)} & \textbf{AUC} \\ \hline \multirow{2}{}{Age} & #61 & 57 & 467 & 84 (75-94) & 89 (86-92) & 88 (85-91) & 0.91 \\ \hline .61 & 156 & 304 & 93 (89-97) & 76 (71-80) & 82 (78-85) & 0.89 \\ \hline \multirow{2}{}{Smoking Status} & Current & 54 & 421 & 93 (86-100) & 86 (83-90) & 87 (84-90) & 0.91 \\ \hline Ex & 85 & 310 & 91 (84-97) & 85 (80-89) & 86 (82-89) & 0.93 \\ \hline \multirow{2}{*}{Pack Years} & #40 & 84 & 381 & 91 (84-97) & 86 (83-90) & 87 (84-90) & 0.93 \\ \hline .40 & 76 & 347 & 97 (94-100) & 84 (81-88) & 87 (84-90) & 0.94 \\ \hline \end{tabular} \end{table}	PMC2999620_table_7
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Airflow Obstruction1} & \textbf{FEV1 \% Predicted} & \textbf{Number of Patients} & \textbf{Specificity (\%), (95\% CI)} \\ \hline GOLD 0/I & .80\% & 411 & 89 (86-92) \\ \hline GOLD II & 50–80\% & 167 & 84 (78-89) \\ \hline GOLD III/IV & ,50\% & 32 & 72 (56-87) \\ \hline \end{tabular} \end{table}	PMC2999620_table_8
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Protein} & \textbf{UniProt ID} & \textbf{Avg. KS} \\ \hline C3 & P01024 & 0.7 \\ \hline C3a & P01024 & 0.71 \\ \hline C3adesArg & P01024 & 0.64 \\ \hline iC3b & P01024 & 0.66 \\ \hline C3b & P01024 & 0.59 \\ \hline BMP-14 & P43026 & 0.45 \\ \hline Coagulation Factor IXab & P00740 & 0.42 \\ \hline \end{tabular} \end{table}	PMC2999620_table_9
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Increased} & \textbf{Decreased} \\ \hline Tidal volume & Functional residual capacity \\ \hline Minute ventilation & Residual volume \\ \hline Alveolar-arterial O2 gradient & Diffusion capacity \\ \hline Oxygen partial pressure & PaCO2 \\ \hline pH, normal or slightly elevated (respiratory alkalosis) \\ \hline Respiratory rate unchanged \\ \hline \end{tabular} \end{table}	PMC2999828_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{c\|}{\textbf{Tissue (correlation group, mean)}} & \multicolumn{2}{c\|}{\textbf{ANOVA}} \\ \hline \textbf{Trait (m/z)} & \textbf{Root} & \textbf{Stem} & \textbf{F} & \textbf{p-value1} & \textbf{name2 Compound} \\ \hline 41 & IV, 0.64 & III, 0.29 & 6452.05 & 0.00002 & nonspecific fragment from protein or sugar \\ \hline 43 & IV, 4.93 & III, 2.80 & 2764.50 & 0.00002 & nonspecific peak for polysaccharides \\ \hline 57 & IV, 141 & III, 130 & 38.43 & 0.00002 & nonspecific peak for polysaccharides \\ \hline 58 & IV, 0.73 & III, 0.73 & 1.08 & 0.3420 & nonspecific peak for polysaccharides \\ \hline 60 & IV, 1.70 & III, 1.35 & 84.92 & 0.00002 & nonspecific peak for polysaccharides \\ \hline 73 & IV, 1.94 & III, 1.43 & 221.05 & 0.00002 & nonspecific peak for polysaccharides \\ \hline 85 & IV, 2.66 & III, 2.78 & 21.05 & 0.0000+ & nonspecific peak for polysaccharides \\ \hline 94 & II, 0.63 & III, 0.42 & 330.58 & 0.00002 & phenol \\ \hline 97 & IV, 1.19 & III, 1.24 & 9.06 & 0.0027+ & di or tri substituted aromatic \\ \hline 98 & IV, 1.26 & III, 1.71 & 973.50 & 0.0000+ & 2,5-dihydro-5-methylfuran-2-one, furfuryl alcohol \\ \hline 114 & IV, 1.37 & III, 1.44 & 11.24 & 0.0009+ & 3-hydroxy-2-penteno-1,5-lactone \\ \hline 120 & II, 0.26 & I, 0.18 & 1065.55 & 0.00002 & acetophenone, 4-vinyl-phenol \\ \hline 124 & II, 1.25 & I, 0.87 & 861.17 & 0.00002 & guaiacol \\ \hline 126 & IV, 1.36 & III, 1.24 & 143.76 & 0.00002 & dimethyldihydropyranone, 5-hydroxymethyl-2- furaldehyde \\ \hline 137 & II, 2.01 & I, 1.45 & 774.02 & 0.00002 & ethylguaicol, homovanillin, coniferyl alcohol \\ \hline 138 & II, 1.39 & I, 0.85 & 1840.53 & 0.00002 & methylguaiacol \\ \hline 144 & IV, 0.40 & III, 0.35 & 44.25 & 0.00002 & 1,4-dideoxy-D-glycero-hex-1-enopyranose-3-ulose \\ \hline 150 & II, 0.70 & I, 0.76 & 62.30 & 0.0000+ & vinylguaiacol, coumaryl alcohol \\ \hline 154 & II, 0.91 & I, 1.45 & 1887.95 & 0.0000+ & syringol \\ \hline 164 & II, 0.58 & I, 0.55 & 27.94 & 0.00002 & allyl propenyl guaiacol \\ \hline 167 & II, 1.61 & I, 1.87 & 103.49 & 0.0000+ & ethylsyringol, syringylacetone, propiosyringone \\ \hline 168 & II, 0.76 & I, 0.88 & 176.55 & 0.0000+ & 4-methyl-2,6-dimethoxyphenol \\ \hline 178 & II, 0.40 & I, 0.47 & 376.77 & 0.0000+ & 2-methoxy-4(prop-2-enal)phenol \\ \hline 180 & II, 1.41 & I, 2.12 & 961.37 & 0.0000+ & coniferyl alcohol, vinylsyringol, a-D-glucose \\ \hline 182 & II, 0.50 & I, 0.89 & 1756.66 & 0.0000+ & syringaldehyde \\ \hline 194 & II, 0.47 & I, 0.77 & 1262.78 & 0.0000+ & 4-propenyl syringol, ferulic acid \\ \hline 208 & II, 0.23 & I, 0.47 & 2190.09 & 0.0000+ & sinapylaldehyde \\ \hline 210 & II, 0.54 & I, 1.58 & 2895.33 & 0.0000+ & sinapylalcohol \\ \hline lignin content & II, 2.22 & I, 2.43 & 215.61 & 0.0000+ & lignin (\% dry weight) \\ \hline S/G ratio & II, 1.42 & I, 2.01 & 1093.42 & 0.0000**+ & syringyl to guaiacyl ratio \\ \hline \end{tabular} \end{table}	PMC2999904_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multirow{2}{*}{\textbf{TCI}} & \multicolumn{3}{c\|}{\textbf{(cm-1) Wave number}} \\ \hline & \textbf{1518} & \textbf{1607} & \textbf{1646} \\ \hline High lignin fiber & 0.85 $\pm$ 0.025 & 0.187 $\pm$ 0.008 & 0.273 $\pm$ 0.010 & 0.160 $\pm$ 0.006 \\ \hline Low lignin fiber & 0.71 $\pm$ 0.018 & 0.129 $\pm$ 0.007 & 0.203 $\pm$ 0.009 & 0.194 $\pm$ 0.008 \\ \hline Palm date fiber before hydrolysis & 0.79 $\pm$ 0.022 & 0.169 $\pm$ 0.008 & 0.261 $\pm$ 0.011 & 0.188 $\pm$ 0.012 \\ \hline Palm date fiber after hydrolysis & 1.1 $\pm$ 0.023 & 0.279 $\pm$ 0.012 & 0.318 $\pm$ 0.010 & 0.219 $\pm$ 0.009 \\ \hline \end{tabular} \end{table}	PMC3000082_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Hypodiploid (2C)} & \textbf{Diploid (2C)} & \textbf{S1 Phase (2C 4C) } & \textbf{Tetraploid (4C)} & \textbf{S2 Phase (4C 8C) } & \textbf{Octoploid (8N)} \\ \hline Control & 0.54 & 13.0 & 1.1 & 78.35 & 2.62 & 4.35 \\ \hline Control Gd & 0.70 & 17.86 & 0.9 & 72.17 & 4.60 & 3.72 \\ \hline TA 24 & 2.80 & 42.76a & 10.01a & 40.2ª & 6.72ª & 0.30 \\ \hline TA-Gd 24 & 1.36 & 26.15ab & 17.17ab & 50.96ab & 4.32 & 0.32 \\ \hline TA 48 & 1.66 & 50.86a & 14.45a & 23.66a & 9.18a & 0 \\ \hline TA-Gd 48 & 2.35 & 42.77a & 14.92a & 28.0a & 10.25ª & 1.70 \\ \hline TA 72 & 4.08ª & 46.11a & 6.89a & 36.32ª & 4.49ª & 2.12 \\ \hline TA-Gd 72 & 2.86ab & 47.98a & 1.74b & 40.61ª & 6.26 & 0.53 \\ \hline TA 96 & 1.17 & 23.94a & 4.98a & 60.56 & 9.06ª & 0.29 \\ \hline TA-Gd 96 & 1.15 & 28.56a & 0 & 63.65 & 6.62 & 0.02 \\ \hline \end{tabular} \end{table}	PMC3000091_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Subject(a)} & \textbf{Age} & \textbf{Cigarettes/Day} & \textbf{Duration(b) Smoking} & \textbf{Stick-year(c)} \\ \hline \textbf{1} & \textbf{35} & \textbf{20} & \textbf{1}5 & \textbf{300} \\ \hline 2 & 36 & \textbf{1}4 & 23 & 322 \\ \hline 3 & 38 & \textbf{20} & \textbf{1}5 & \textbf{300} \\ \hline 4 & 5\textbf{1} & \textbf{1}4 & \textbf{20} & 280 \\ \hline 5 & 36 & \textbf{1}4 & \textbf{1}5 & 2\textbf{1}0 \\ \hline 6 & 54 & \textbf{20} & 30 & 600 \\ \hline 7 & 38 & \textbf{20} & \textbf{1}7 & 340 \\ \hline 8 & 54 & 30 & 30 & 900 \\ \hline 9 & 39 & \textbf{20} & \textbf{20} & 400 \\ \hline \textbf{1}0 & 39 & \textbf{20} & 25 & 500 \\ \hline \textbf{1}\textbf{1} & 48 & 24 & \textbf{1}7 & 408 \\ \hline \textbf{1}2 & 40 & \textbf{1}4 & \textbf{1}5 & 2\textbf{1}0 \\ \hline \end{tabular} \end{table}	PMC3000095_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Group} & \textbf{MDA (nmol/mg prot)} & \textbf{SOD (U/mg prot)} & \textbf{GSH-Px (U/mg prot)} & \textbf{T-AOC (U/mg prot)} \\ \hline \textbf{Group} 1 & \textbf{a 3.85 $\pm$ 0.69} & \textbf{c 101.44 $\pm$ 1.78} & 100.362 $\pm$ 1.22 & \textbf{c 3.00 $\pm$ 0.04} \\ \hline \textbf{Group} 2 & c 10.98 $\pm$ 2.29 & a 70.92 $\pm$ 4.05 & 91.768 $\pm$ 2.53 & a 1.18 $\pm$ 0.07 \\ \hline \textbf{Group} 3 & b 5.99 $\pm$ 0.12 & b 85.77 $\pm$ 4.34 & 97.689 $\pm$ 1.69 & b 2.16 $\pm$ 0.06 \\ \hline \end{tabular} \end{table}	PMC3000102_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Group} & \textbf{Protein} & \textbf{DNA} & \textbf{RNA} \\ \hline \textbf{Group} 1 & \textbf{a 50.66 $\pm$ 3.26} & \textbf{a 1.08 $\pm$ 0.10} & \textbf{a 2.01 $\pm$ 0.16} \\ \hline \textbf{Group} 2 & b 61.65 $\pm$ 5.13 & b 1.30 $\pm$ 0.12 & b 3.46 $\pm$ 0.33 \\ \hline \textbf{Group} 3 & a 51.96 $\pm$ 3.56 & a 1.12 $\pm$ 0.10 & a 2.18 $\pm$ 0.21 \\ \hline \end{tabular} \end{table}	PMC3000102_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Group} & \textbf{Amylase} & \textbf{Lipase} & \textbf{Trypsin} \\ \hline \textbf{Group} 1 & \textbf{b 0.65 $\pm$ 0.02} & \textbf{b 57.13 $\pm$ 1.32} & \textbf{c 154.43 $\pm$ 1.81} \\ \hline \textbf{Group} 2 & a 0.43 $\pm$ 0.01 & a 40.41 $\pm$ 0.89 & a 67.64 $\pm$ 0.64 \\ \hline \textbf{Group} 3 & a 0.58 $\pm$ 0.01 & b 52.79 $\pm$ 2.71 & b 84.95 $\pm$ 2.97 \\ \hline \end{tabular} \end{table}	PMC3000102_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Group} & \textbf{prot） Somatostatin (U/mg} & \textbf{prot） Insulin (pg/mg} \\ \hline \textbf{Group} 1 & a 47.82 $\pm$ 1.33 & a 46.70 $\pm$ 1.76 \\ \hline \textbf{Group} 2 & c 83.11 $\pm$ 2.20a & c 55.91 $\pm$ 2.93 \\ \hline \textbf{Group} 3 & b 63.49 $\pm$ 2.08 & b 50.85 $\pm$ 2.43 \\ \hline \end{tabular} \end{table}	PMC3000102_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{EBC Collection System (Manufacturer)} & \textbf{Advantages} & \textbf{Disadvantages} & \textbf{References} \\ \hline ECoScreen I and ECoScreen II (Viasys, U.S., Europe) & The most commonly applied EBC collection system. More often used in European countries. There is an optional package for determining the total exhaled volume. & Not readily portable. Cleaning between patients may need to be extensive to abide by standard respiratory care practices. No way of controlling condensation temperature (Eco1). & [13,29,44,49,62–63] \\ \hline Rtube (Respiratory Research, U.S.) & More total EBC collections than other systems. Multiple collections can be performed concurrently. Most commonly applied in North American centers. No cleaning between patients is necessary. Portable. Can be prepared for use in a standard freezer. & Choice and maintenance of set condensing temperature requires an optional cooling unit, otherwise the condensation temperature is chosen by cooling the sleeve preparation temperature and rises during collection. & [64–66] \\ \hline Anacon (Biostec, Valencia, Spain) & Temperature of collection can be controlled. Designed for use on ventilated patients & Only a few publications are available. & [67,68] \\ \hline TurboDeccs (ItalChill, Parma, Italy) & Has both non-disposable and disposable portions. Controllable collection temperature. Moderately portable. Readily cleanable because components are disposable. & Very few publications exist. Only one collection at a time is possible. & [69] \\ \hline Polish Patent & Constant maximum contact between the test-tube and the cooling agent. Possibility of inserting different sizes of test tubes. & Dismantling and cleaning after use is necessary. & [70] \\ \hline \end{tabular} \end{table}	PMC3000105_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Analytical Technique} & \textbf{Sample Preparation} & \textbf{LOD} & \textbf{Ref.} \\ \hline \multirow{2}{}{RIA} & standard curves obtained using phosphate buffer 0.025 mol/L, pH 7.5, more similar to EBC matrix & 10 pg/mL & [91] \\ \hline samples stored at −80 °C before analysis & 10 pg/mL & [36] \\ \hline \multirow{2}{}{EIA} & after sampling no further preparation of the sample is necessary, samples stored at −80 °C before analysis & 4–5 g/mL & [25,46,63, 92–95] \\ \hline SPE of pooleed sample (35.5 mL), HPLC purification & 10 pg/mL & [90] \\ \hline \multirow{3}{*}{LC-MS/MS} & samples pretreated with 50 µL of immunoaffinity sorbent for 60 min & 1 pg/mL & [17] \\ \hline after collection sample spiked with 8-isoPGF2α-d4, stored at −80 °C, lyophilization, redissolved in 50 µL of water/methanol (1:1) & 8 pg/mL & [85] \\ \hline sample spiked with 8-isoPGF2α-d4, pretreated with 50 µL of immunoaffinity sorbent for 60min at 20 °C, centrifuged (3000 rpm for 5 min), immunoaffinity sorbent flushed twice with water, elution with methanol, methanol evaporated, redissolved in 50 µL of mobile phase & 1 pg/mL & [14] \\ \hline LC-MS & immunoaffinity separation & 1 pg/mL & [16] \\ \hline \end{tabular} \end{table}	PMC3000105_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Specimen} & \textbf{Determined Analyte} & \textbf{Column} & \textbf{Eluents} & \textbf{Ref.} \\ \hline EBC & 8-iso-PGF2α & Hypercarb Thermo 100 mm × 2.1 mm × 5 µm & A: acetonitrile B: water (pH 11) isocratic elution A:B (7:3) flow rate 250 µL/min & [14,17] \\ \hline EBC & 8-iso-PGF2α o-Tyr 8-OHdG & Hypercarb Thermo 100 mm × 2.1 mm × 5 µm & A: aqueous solution of ammonium hydroxide pH 10.5 B: methanol:acetonitrile 60:40 (v/v) + 0.1\% of ammonium hydroxide gradient elution & [85] \\ \hline Urine Plasma & 8-iso-PGF2α & Symmetry C8 150 mm × 3.9 mm × 5 µm & A: 0.1\% acetic acid (pH 3) B: acetonitrile isocratic elution A:B (7:3) & [8] \\ \hline Urine & 8-iso-PGF2α & YMC ODS-AQ 50 mm × 2.0 mm × 3 µm & A: methanol: acetonitrile 5:95( v/v) B: 2 mM ammonium acetate gradient elution flow rate 0.2 mL/min & [7] \\ \hline Urine & 8-iso-PGF2α & Phenomenex Gemini C 18 110 Å, 50mm × 2.0 mm × 3 µm & A: 0.1\% aqueous solution of ammonium hydroxide B: 0.1\% ammonium hydroxide in acetonitrile gradient elution & [9] \\ \hline Plasma & 8-iso-PGF2α 8-iso-15(R)PGF2α 11β-PGF2α 15(R)-PGF2α PGF2α & Synergi Hydro-RP 250 mm × 2.0mm & A: water + 0.01\% acetic acid B: methanol gradient elution & [10] \\ \hline Urine & 8-iso-PGF2α 8-iso-15(R)-PGF2α 8-iso-PGF2β PGF2α & Hypercarb, 5 µm, 1 mm × 150 mm, porous graphitic carbon column & A: water + 0.5\% aqueous solution of ammonium hydroxide (pH 9.5) B: acetonitrile:methanol 40:60(v/v) + 0.5\% aqueous solution of ammonium hydroxide flow rate 50 µL/min gradient elution & [6] \\ \hline \end{tabular} \end{table}	PMC3000105_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Classes} & \textbf{Amino Acids} & \textbf{Criteria} \\ \hline \multirow{5}{}{1} & ALI & ALA, ILE, GLY, PRO, VAL, LEU & aliphatic side chain \\ \hline AROM & TYR, PHE, TRP & aromatic side chain (absorbs UV) \\ \hline SULFUR & CYS, MET & side chain containing a sulfur atom \\ \hline POL & SER, THR, ASN, GLN & polar side chain \\ \hline CAR & ASP, GLU, HIS, LYS, ARG & charged side chain \\ \hline \multirow{4}{}{2} & HF & SER, THR, ASN, GLN, ASP, GLU, HIS, LYS, ARG & hydrophilic \\ \hline HB & ALA, VAL, LEU, ILE, MET, PHE, TRP & hydrophobic \\ \hline NHF & GLY, CYS, TYR & weakly hydrophilic \\ \hline NHB & PRO & weakly hydrophobic \\ \hline \end{tabular} \end{table}	PMC3000107_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{SCOP Superfamily} & \textbf{SCOP Class} & \textbf{SCOP Fold} & \textbf{Dominant Secondary Structure} & \textbf{Disulfide Bond Propensity#} & \textbf{Total Number of PDB Structures} & \textbf{Total Number of Disulfide Bonds} & \textbf{Total Number of Residues} \\ \hline Crisp & \textbf{Small proteins} & \textbf{Crisp domain-like} &  & 5.3\% & 6 & 54 & 1367 \\ \hline Cystine- Knot & \textbf{Small proteins} & Cystine- Knot cykotines &  & 3.7\% & 13 & 112 & 3131 \\ \hline Defensin- like & \textbf{Small proteins} & Defensin- like &  & 7.4\% & 15 & 47 & 730 \\ \hline EGF- Laminin & \textbf{Small proteins} & Knottins &  & 6.4\% & 27 & 121 & 2253 \\ \hline Omega toxins & \textbf{Small proteins} & Knottins &  & 8.9\% & 28 & 88 & 992 \\ \hline Plant lectins & \textbf{Small proteins} & Knottins &  & 9.9\% & 8 & 100 & 1045 \\ \hline Small snake toxins & \textbf{Small proteins} & Snake toxins-like &  & 6.5\% & 40 & 209 & 3279 \\ \hline Scorpion- like toxins & \textbf{Small proteins} & Knottins &  & 7.9\% & 70 & 247 & 3303 \\ \hline BBI & \textbf{Small proteins} & Knottins &  & 9.6\% & 5 & 33 & 371 \\ \hline BPTI-like & \textbf{Small proteins} & BPTI-like &    & 5.1\% & 12 & 42 & 814 \\ \hline Kringle-like & \textbf{Small proteins} & Kringle-like &  & 3.7\% & 12 & 53 & 1771 \\ \hline Thioredoxin- like & Alpha and beta proteins & Thioredoxin &  & 0.8\% & 43 & 66 & 10616 \\ \hline Most frequent motif & \textbf{Small proteins} & Knottins &  & [6.7\%, 7.3\%]* & - & - & - \\ \hline \end{tabular} \end{table}	PMC3000107_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Risk factors} & \textbf{Number of patients} & \textbf{Percentage (\%)} \\ \hline \textbf{Age over 70} & \textbf{17} & \textbf{68} \\ \hline Severe cardiac impairment: cardiac valvulopathy, previous coronary bypass and/or MI & 12 & 48 \\ \hline Chronic pulmonary disease: (FEV1 1l) $\leq$ & 10 & 40 \\ \hline Neurological dysfunction & 3 & 12 \\ \hline Surgery on thoracic aorta & 7 & 28 \\ \hline \end{tabular} \end{table}	PMC3000108_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Device} & \textbf{Patients treated, \%( n)} & \textbf{Proximal bare spring} & \textbf{Deployment strategy} \\ \hline \textbf{Talent (Medtronic, minneapolis, Minn)} & \textbf{32 (8)} & \textbf{With} & \textbf{pullback} \\ \hline Ankura (Lifetech, Shenzhen, China) & 24 (6) & \textbf{With} & \textbf{pullback} \\ \hline Zenith TX2 (Cook, Bjaeverskov, Denmark) & 44 (11) & without & Pullback and then release of trigger wire \\ \hline \end{tabular} \end{table}	PMC3000108_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{Covered length} & \textbf{Proximal diameters} & \textbf{Distal diameters} & \textbf{Graft number} \\ \hline \textbf{aneurysm} & \textbf{280.33 $\pm$ 82.34 (184–388)} & \textbf{43.33 $\pm$ 2.07} & \textbf{38.00 $\pm$ 2.19} & \textbf{2.5 $\pm$ 1.05} \\ \hline dissection & 223.33 $\pm$ 111.01 (113–335) & 43.33 $\pm$ 2.31 & 42.00 $\pm$ 2.00 & 2 $\pm$ 1 \\ \hline \end{tabular} \end{table}	PMC3000108_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \multicolumn{10}{c\|}{\textbf{Model with Full Terms}} \\ \hline \multirow{2}{}{\textbf{Run Order}} & \multicolumn{3}{c\|}{\textbf{Variable Code Levels}} & \multirow{2}{}{\textbf{Measured}} & \multirow{2}{}{\textbf{Predicted}} & \multirow{2}{}{\textbf{Residual}} & \multirow{2}{}{\textbf{hi}} & \multirow{2}{}{\textbf{Cook’s}} & \multirow{2}{*}{\textbf{DFFITS}} \\ \hline \textbf{x1 [NO3 −]} & \textbf{x2 [Ca2+]} & \textbf{x3 [sucrose]} \\ \hline R1 & −1 & −1 & −1 & 43.8 & 43.9 & −0.1 & 0.8 & 0.0 & −0.4 \\ \hline R2 & 1 & −1 & −1 & 56.8 & 57.5 & −0.7 & 0.8 & 0.5 & −2.5 \\ \hline R3 & −1 & 1 & −1 & 46.8 & 47.5 & −0.7 & 0.8 & 0.5 & −2.4 \\ \hline R4 & 1 & 1 & −1 & 70.8 & 72.0 & −1.3 & 0.8 & 1.7 & −5.6 \\ \hline R5 & −1 & −1 & 1 & 51.2 & 49.8 & 1.4 & 0.8 & 2.0 & 6.5 \\ \hline R6 & 1 & −1 & 1 & 65.2 & 64.4 & 0.8 & 0.8 & 0.7 & 2.8 \\ \hline R7 & −1 & 1 & 1 & 55.2 & 54.4 & 0.8 & 0.8 & 0.7 & 2.9 \\ \hline R8 & 1 & 1 & 1 & 86.2 & 86.0 & 0.2 & 0.8 & 0.1 & 0.7 \\ \hline R9 & −1.52 & 0 & 0 & 50.0 & 50.9 & −0.9 & 0.6 & 0.1 & −1.0 \\ \hline R10 & 1.52 & 0 & 0 & 83.6 & 83.0 & 0.7 & 0.6 & 0.1 & 0.8 \\ \hline R11 & 0 & −1.52 & 0 & 62.3 & 63.1 & −0.8 & 0.6 & 0.1 & −0.9 \\ \hline R12 & 0 & 1.52 & 0 & 80.6 & 79.9 & 0.7 & 0.6 & 0.1 & 0.7 \\ \hline R13 & 0 & 0 & −1.52 & 66.7 & 64.8 & 1.8 & 0.6 & 0.4 & 2.7 \\ \hline R14 & 0 & 0 & 1.52 & 75.5 & 77.5 & −2.0 & 0.6 & 0.5 & −3.1 \\ \hline R15 & 0 & 0 & 0 & 103.8 & 104. 8 & −1.0 & 0.2 & 0.0 & −0.3 \\ \hline R16 & 0 & 0 & 0 & 104.7 & 104.8 & −0.0 & 0.2 & 0.0 & 0.0 \\ \hline R17 & 0 & 0 & 0 & 105.1 & 104.8 & 0.3 & 0.2 & 0.0 & 0.1 \\ \hline R18 & 0 & 0 & 0 & 106.4 & 104.8 & 1.6 & 0.2 & 0.0 & 0.5 \\ \hline R19 & 0 & 0 & 0 & 103.8 & 104.8 & −1.0 & 0.2 & 0.0 & −0.3 \\ \hline R20 & 0 & 0 & 0 & 104.9 & 104.8 & 0.1 & 0.2 & 0.0 & 0.0 \\ \hline & & \multicolumn{2}{c\|}{Model} & \multicolumn{2}{c\|}{Only Significant} & \multicolumn{2}{c\|}{(Equation} \\ \hline R4 & 1 & 1 & −1 & 70.8 & 74.8 & −4.0 & 0.6 & 0.9 & −4.7 \\ \hline R8 & 1 & 1 & 1 & 86.2 & 83.2 & 2.3 & 0.5 & 0.5 & 2.4 \\ \hline R14 & 0 & 0 & 1.52 & 75.5 & 77.5 & −2.0 & 0.6 & 0.5 & −2.2 \\ \hline \end{tabular} \end{table}	PMC3000111_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Peak No.} & \textbf{RT (min)} & \textbf{λmax (nm)} & \textbf{Product Ions (ESI−, m/z)} & \textbf{Product Ions (ESI+, m/z)} & \textbf{Identification Compounds} & \textbf{Content mg/g DM} \\ \hline 1 & 12.85 & 264, 347 & 609 & 611, 449, 287 & kaempferol-3,7-di-O-β-D-glucoside & 0.155 \\ \hline 2 & 19.81 & 254, 356 & 609 & 611, 465, 303 & quercetin-3-O-rutinoside & 0.053 \\ \hline 3 & 20.96 & 256, 354 & 463 & 465, 303 & quercetin-3-O-β-D-glucoside & 0.038 \\ \hline 4 & 21.61 & 265, 346 & 593 & 595, 449, 287 & kaempferol-3-O-robinobioside & 0.040 \\ \hline 5 & 22.86 & 265, 347 & 593 & 595, 449, 287 & kaempferol-3-O-rutinoside & 0.102 \\ \hline 6 & 24.59 & 265, 347 & 447 & 449, 287 & kaempferol-3-O-β-D-glucoside & 0.423 \\ \hline 7 & 39.46 & 266, 367 & 285 & 287 & kaempferol & 0.018 \\ \hline \end{tabular} \end{table}	PMC3000113_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Case number} & \textbf{Sex} & \textbf{Gestational age (week)} & \textbf{Birthweight (g)} & \textbf{Stage of ROP right/left} & \textbf{Type of ROP} & \textbf{Surgery received} & \textbf{Operation} \\ \hline \textbf{1} & \textbf{M} & \textbf{27} & \textbf{1},084 & \textbf{4A/4A} & \textbf{classic ROP} & \textbf{both eyes} & \textbf{buckling} \\ \hline 2 & \textbf{M} & 25 & 972 & 5/5 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline 3 & F & 26 & 906 & \textbf{4A/4A} & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline 4 & \textbf{M} & 23 & 596 & \textbf{4A/4A} & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline 5 & F & 29 & \textbf{1}2\textbf{1}2 & 4A/3 & AP-ROP & right eye & vitrectomy \\ \hline 6 & \textbf{M} & 23 & 5\textbf{1}2 & 5/5 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline 7 & F & 23 & 642 & 5/5 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline 8 & \textbf{M} & 24 & 670 & 4A/5 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline 9 & \textbf{M} & 23 & 542 & 5/5 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline \textbf{1}0 & F & 24 & 588 & 4A/3 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline \textbf{1}\textbf{1} & \textbf{M} & 23 & 747 & 4A/3 & AP-ROP & right eye & vitrectomy \\ \hline \textbf{1}2 & \textbf{M} & \textbf{27} & 998 & \textbf{4A/4A} & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline \textbf{1}3 & \textbf{M} & 23 & 458 & 5/5 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline \textbf{1}4 & \textbf{M} & 23 & 560 & 4B/4A & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline \textbf{1}5 & \textbf{M} & 23 & 676 & 5/3 & \textbf{classic ROP} & right eye & vitrectomy \\ \hline \textbf{1}6 & F & 23 & 708 & 5/5 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline \textbf{1}7 & \textbf{M} & 24 & 576 & 5/5 & AP-ROP & \textbf{both eyes} & vitrectomy \\ \hline \end{tabular} \end{table}	PMC3000231_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Name} & \textbf{Primer sequence (5′> 3′)} & \textbf{Product size (bp)} \\ \hline \multirow{2}{}{NDP-1} & \multirow{2}{}{F: CGCCTGATTGATATATGACTGCAATGGC R: GCTCGGTTTGGAAAGAAGCGATTTCCT} & \multirow{2}{}{322} \\ \hline \\ \hline \multirow{2}{}{NDP-2} & \multirow{2}{}{F: TTCTGGGTAAATAATTCTGGGG R: GTTTCTGAGGGAAATGCTCTCCTCACA} & \multirow{2}{}{471} \\ \hline \\ \hline \multirow{2}{}{NDP-3} & \multirow{2}{}{F: TAAGGTTGTGGCATGCCCACAGAGTAA R: CAGAAGATGTCCCAGGAAAAGCTGGGCTTT} & \multirow{2}{}{690} \\ \hline \\ \hline \multirow{2}{}{FZD4-1A} & \multirow{2}{}{F: ATAATTTTAGCGCCGCGAGCCTCCAG R: GAAATCACTTTTCCAGGAGAGCTGTCTCC} & \multirow{2}{}{771} \\ \hline \\ \hline \multirow{2}{}{FZD4-1B} & \multirow{2}{}{F: CAAACTGGGGGTGTCTGCCAGAGCA R: GAAATCACTTTTCCAGGAGAGCTGTCTCC} & \multirow{2}{}{475} \\ \hline \\ \hline \multirow{2}{}{FZD4-2A} & \multirow{2}{}{F: GGGAGCATTTGGTCAAACTTCCAAGTC R: GAGTGTCAGAATAACCCACCAAATGGAGCT} & \multirow{2}{}{757} \\ \hline \\ \hline \multirow{2}{}{FZD4-2B} & \multirow{2}{}{F: CCTGTTCTCATCCAAGAAGGACTTAAGAA R: TTCAAAATGAAGAAAGCATGGAGGCTGACT} & \multirow{2}{*}{781} \\ \hline \\ \hline \end{tabular} \end{table}	PMC3000231_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Name} & \textbf{Forward sequence (5′→3′)} & \textbf{Reverse Sequence (5′→3′)} & \textbf{Product size (bp)} \\ \hline Exon 1 & TCCTCCCCGTCGTCCTG & ATTGTCCGAGCAACCCG & 269 \\ \hline Exon 2 & CTTAGCCAGTGGCCCTCA & AGAGAGAGATGGTGACACT & 496 \\ \hline Exon 3 & TCTGTGTTAGCTGCTTCTCTT & CCAGGACTGCGTGGGTA & 259 \\ \hline Exon 4 & GATGGCTCCTCCACCCCGCT & GCGCCCCAGCCGGCACT & 250 \\ \hline Exon 5 & CTCATTCAGAAACAAGTGACGGTCCTC & GTCCCGTCCCACCGCCT & 216 \\ \hline Exon 6 & CTGCTGCAGGCCCTTGA & TCTCCCTCTCGCCTGTG & 506 \\ \hline Exon 7 & GTCATGGACTTCTGCTTCTT & TGGCCTCCTGGATCAAAC & 235 \\ \hline Exon 8 & TGGCCCATCCAGACCTAT & CAAGTCTGCATGGCTGAG & 298 \\ \hline Exon 9 & GCATTCATTGTGTGGCTTG & AAGCCTTTGAGGCAGGA & 446 \\ \hline Exon 10 & CTTTTCCTCCTCACCTGCT & GGTGAACACAAGGACGC & 289 \\ \hline Exon 11 & AGACTCACTGAGCCTGC & GCCCTCCATGACCAGAAG & 261 \\ \hline Exon 12 & CCTTTGCTGACACCGTG & GAAGCTCCTTTCAGCGT & 440 \\ \hline Exon 13 & CCTGCAGCCCTGTCTTT & GCCTTGGGAAGCACACC & 271 \\ \hline Exon 14 & CTCAGGAGTCTTGGTTTCTTT & GCATTCGGCAGAAGACAC & 308 \\ \hline Exon 15 & CCCACACCCGTCCTTCA & GGGTGTCTGCGGTTAGG & 263 \\ \hline Exon 16 & GAGGTCAGCACTGCTCA & GGTCGGGTTTAGAGGCCA & 301 \\ \hline Exon 17 & AGAGCCTGACCTCTGTTT & TACCTGTCCATCACCCCAA & 206 \\ \hline Exon 18 & GGCTGCGTGTGATGTTC & GGTCTTGGCAGAGCCTTGA & 307 \\ \hline Exon 19 & AGCCTCTCTGAGTGCAT & TAAACTCCACGTTCCTGGG & 208 \\ \hline Exon 20 & GGCCACCTCTTTCTGTTT & AGATCATTCCATATCTCAGGCTC & 294 \\ \hline Exon 21** & GAGTCTCGTGGGTAGTGGGA & AGAAAGCAAGGCATGCCTCAGAG & 245 \\ \hline Exon 22 & CTGGCGAGGCTCTAAGT & CCCAATGGCCATGGAGG & 174 \\ \hline Exon 23A* & CTCCTCTGTGTGTGTCCC & TCAGGATGAGTCCGTGC & 286 \\ \hline Exon 23B* & CTACTTCCATCTCTTCCCGC & CGAAAGAATGGCAGTTCTGTT & 271 \\ \hline \end{tabular} \end{table}	PMC3000231_table_2
	\begi\textbf{n}{table} \ce\textbf{n}teri\textbf{n}g \label{tab:tablelabel} \begi\textbf{n}{tabular}{\|l\|l\|l\|l\|l\|} \hli\textbf{n}e \textbf{Group} & \textbf{Mo\textbf{n}ths of diabetes} & \textbf{n} & \textbf{Bodyweight (g)} & \textbf{GHb (\%)} \\ \hli\textbf{n}e Co\textbf{n}trol & \textbf{n}a & \textbf{9} & 337$\pm$3.\textbf{9} & \textbf{5.3$\pm$0.1} \\ \hli\textbf{n}e STZ & 1 & \textbf{9} & 238$\pm$8.7 & 20.8$\pm$0.8 \\ \hli\textbf{n}e Co\textbf{n}trol & \textbf{n}a & 10 & 41\textbf{9}$\pm$6.8 & 6.4$\pm$0.3 \\ \hli\textbf{n}e STZ & 2 & 6 & 2\textbf{9}8$\pm$15.8 & 1\textbf{9}.5$\pm$1.3 \\ \hli\textbf{n}e Co\textbf{n}trol & \textbf{n}a & 10 & 438$\pm$8.2 & 6.4$\pm$0.2 \\ \hli\textbf{n}e STZ & 3 & 10 & 286$\pm$12.5 & 20$\pm$1 \\ \hli\textbf{n}e Co\textbf{n}trol & \textbf{n}a & 10 & 431$\pm$\textbf{9}.4 & 6.4$\pm$0.1 \\ \hli\textbf{n}e STZ & 4 & \textbf{9} & 287$\pm$\textbf{9}.4 & 18.\textbf{9}$\pm$1.2 \\ \hli\textbf{n}e \e\textbf{n}d{tabular} \e\textbf{n}d{table}	PMC3000235_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Gene} & \textbf{Forward primer (5′-3′)} & \textbf{Reverse primer (5′-3′)} & \textbf{Accession number} \\ \hline VEGFA & CCCACTGAGGAGTCCAACAT & TTTCTTGCGCTTTCGTTTTT & NM_001025366.2 \\ \hline IL-6 & TACCCCCAGGAGAAGATTCC & TTTTCTGCCAGTGCCTCTTT & NM_000600.3 \\ \hline TNFα & AACCTCCTCTCTGCCATCAA & CCAAAGTAGACCTGCCCAGA & NM_000594.2 \\ \hline β-actin & AGAGCTACGAGCTGCCTGAC & AGCACTGTGTTGGCGTACAG & NM_001101.3 \\ \hline \end{tabular} \end{table}	PMC3000235_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{6}{c\|}{\textbf{Visit}} \\ \hline \textbf{Procedure} & \textbf{Baseline} & \textbf{I-III} & \textbf{IV-V} & \textbf{VI} & \textbf{VI}I-XI & \textbf{XII} \\ \hline \textbf{BCVA (ETDRS)} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} \\ \hline Tonometry & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} \\ \hline Slit-lamp examination and indirect ophthalmoscopy & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} \\ \hline OCT & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} \\ \hline FA & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & - & - & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & - & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} \\ \hline Ranibizumab injection & - & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{+}}}}}} & optional & optional & optional & - \\ \hline \end{tabular} \end{table}	PMC3000236_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Primary Myelofibrosis (Fibrotic Stage) (n = 106)} & \textbf{Prefibrotic Myelofibrosis (n = 49)} & \textbf{Polycythemia Vera or Essential Thrombocythemia (n = 59)*} \\ \hline Age, y, mean (range) & 53.5 (21–83) & 44.5 (22.72) & 44.1 (17–86) \\ \hline Male sex, male, n (\%) & 63 (59) & 22 (40) & 27 (45) \\ \hline Time from diagnosis (months), mean (range) & 57.1 (0–336) & 60.3 (0–314) & 36.2 (0–324) \\ \hline Hemoglobin (g/dl), mean (range) & 11.9 (5.1–18.3) & 12.9 (8.8–16.7) & 14.2 (11.1–18.1) \\ \hline (6109/L), White blood cell count mean (range) & 11.6 (1.2–55) & 7.8 (2.6–25.1) & 10.9 (3.1–32.7) \\ \hline (6109/L), Platelet count mean (range) & 368 (32–1186) & 442 (22–909) & 655 (110–1890) \\ \hline CD34+ (6106/L), Circulating hematopoietic cells mean (range) & 84.8 (0.3–1948) & 14.9 (0.4–165) & 5.8 (0.6–26) \\ \hline cm2, Spleen index, mean (range) & 232 (90–1026) & 151 (90–600) & 114 (90–360) \\ \hline Serum lactate dehydrogenase (units/L), mean (range) & 903 (156–2588) & 587 (214–1786) & 365 (159–586) \\ \hline JAK2 V617F mutational status, n (\%): wild type heterozygous homozygous & 42 (40) 37 (35) 27 (25) & 17 (35) 28 (57) 4 (8) & 14 (24) 30 (51) 15 (25) \\ \hline IWG-MRT risk score, n (\%): low intermediate-1 intermediate-2 high & 74 (70) 16 (15) 12 (11) 4 (4) & 40 (82) 5 (10) 4 (8) 0 (0) & NA \\ \hline Bone marrow fibrosis, n (\%)1: grade 0 grade 1 grade 2 grade 3 & 0 (0) 23 (32) 24 (33) 25 (35) & 19 (62) 7 (22) 3 (10) 2 (6) & NA \\ \hline History of splanchnic vein thrombosis, n (\%) Portal or mesenteric vein thrombosis Budd-Chiari syndrome & 11 (10) 10 (9) 1 (1) & 20 (41) 16 (33) 4 (8) & 4 (7) 3 (5) 1 (2) \\ \hline Mean time from SVT thrombosis to sample collection, months, (range) & 97.2 (2–288) & 47.5 (4–168) & 24.5 (0–60) \\ \hline Patients in whom SVT was diagnosed at the time of diagnosis of myeloproliferative neoplasm, n (\%) & 9 (82) & 18 (90) & 4 (100) \\ \hline Patients with history of arterial thrombosis (stroke, infarction, peripheral artery disease), n (\%) & 3 (3) & 1 (2) & 0 (0) \\ \hline Patients with history of deep vein thrombosis, n (\%) & 2 (2) & 0 (0) & 1 (2) \\ \hline \end{tabular} \end{table}	PMC3000318_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Variable} & \textbf{Patients, n/n} & Patients with \textbf{Variable} when Increased ECFCs Frequency is Present, n & \multicolumn{2}{c\|}{\textbf{Univariate analysis}} & \multicolumn{2}{c\|}{\textbf{Multivariate analysis}} \\ \hline & & & \textbf{Unadjusted Odds Ratio for Increased ECFCs Frequency (95\% CI)} & \textbf{\textbf{P value}} & \textbf{Adjusted Odds Ratio for Increased ECFCs Frequency (95\% CI)} & \textbf{\textbf{P value}} \\ \hline Female sex & 102/214 & 29 & 2.24 (1.09–4.69) & 0.026 \\ \hline Age lower than 50 years & 99/214 & 17 & 2.72 (1.28–5.68) & 0.008 \\ \hline Diagnosis of prefibrotic myelofibrosis & 56/214 & 21 & 2.84 (1.36–5.81) & 0.005 \\ \hline Phenotype of non-active disease & 27/214 & 13 & 4.67 (1.81–11.94) & 0.001 & 4.43 (1.45–13.49) & 0.008 \\ \hline History of splanchnic vein thrombosis & 35/214 & 20 & 7.63 (3.34–17.91) & ,0.001 & 6.61 (2.54–17.16) & ,0.001 \\ \hline \end{tabular} \end{table}	PMC3000318_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Marker} & & & \textbf{Sensitivity (95\% CI), \%} & \textbf{Specificity (95\% CI)\%} & \textbf{Positive LR (95\% CI)} & \textbf{Negative LR (95\% CI)} & \textbf{Positive Predictive Value,\%} \\ \hline & History of splanchnic vein thrombosis, n & No history of splanchnic vein thrombosis, n \\ \hline ECFCs.0.59/ 107 MNCs & 20 & 25 & 57.1 (40.0–73.7) & 86.4 (80.6–91.0) & 4.2 (2.6–6.7) & 0.5 (0.3–0.7) & 44.4 (29.6–60.0) \\ \hline \multirow{2}{*}{ECFCs,0.59/ 107 MNCs} & 15 & 159 \\ \hline Phenotype of non-active disease & Phenotype of active disease \\ \hline ECFCs.0.59/ 107 MNCs & 13 & 33 & 48.1 (28.7–68.0) & 80.8 (74.1–86.4) & 2.5 (1.5–4.1) & 0.6 (0.4–0.9) & 28.2 (16.0–43.4) \\ \hline ECFCs,0.59/ 107 MNCs & 14 & 139 \\ \hline \end{tabular} \end{table}	PMC3000318_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Parameter} & \textbf{Sensitivity \%} & \textbf{Specificity \%} & \textbf{Cut-off value} & \textbf{AUC (95\% CI)} & \textbf{P level} \\ \hline Hemoglobin, g/dL & 85 & 36 & #13.8 & 0.59 (0.52–0.66) & 0.037 \\ \hline 109/L White blood cell count, & 70 & 61 & #7.8 & 0.67 (0.61–0.74) & ,0.001 \\ \hline 109/L Platelet count, & 66 & 53 & #400 & 0.57 (0.49–0.64) & 0.045 \\ \hline \end{tabular} \end{table}	PMC3000318_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Control} & \textbf{Hyperoxia} & \textbf{21\%} & \textbf{40\%} & \textbf{100\%} \\ \hline Weight (g) & 1858(130) & 1870 (143) & 1873 (108) & 1842 (108) & 1852 (117) \\ \hline Age (h) & 35.5 (1) & 35.1 (2.8) & 35.1 (2.1) & 32.8 (4) & 32.8 (5.8) \\ \hline Gender M/F & 3/3 & 5/6 & 5/5 & 6/6 & 5/5 \\ \hline Hb g/100 mL start & 7.2 (0.8) & 7.3 (1.5) & 7.1 (0.9) & 6.9 (1.3) & 6.9 (1) \\ \hline End & 6.5 (1.5) & 6.2 (1.5) & 6.4 (1.4) & 6.1 (1.3) & 6.1 (1.0) \\ \hline Hypoxia (min) & 0 & 0 & 33.7 (8.4) & 37.8 (15.3) & 42.3 (15.2) \\ \hline pH start & 7.44(0.05) & 7.40 (0.05) & 7.41 (0.06) & 7.43 (0.05) & 7.44 (0.06) \\ \hline end hypoxia & 7.42 (0.03) & 7.39 (0.2) & 6.91 (0.09) & 6.91 (0.1) & 6.94 (0.9) \\ \hline end resuscitation & 7.43 (0.04) & 7.46 (0.06) & 7.17 (0.09) & 7.18 (0.06) & 7.25 (0.11) \\ \hline 2h.resuscitation & 7.45(0.05) & 7.42 (0.08) & 7.37 (0.05) & 7.37 (0.05) & 7.40 (0.08) \\ \hline 5h. & 7.45(0.06) & 7.38 (0.09) & 7.35 (0.06) & 7.37 (0.06) & 7.43 (0.07) \\ \hline 9h. & 7.42(0.08) & 7.39 (0.11) & 7.33 (0.06) & 7.36 (0.08) & 7.38 (0.11) \\ \hline BE mmol/L start & 1.1 (2.9) & 1.5 (3.2) & 20.1 (3.6) & 0.6 (5.7) & 2.3 (5.2) \\ \hline end hypoxia & 2.4 (3.7) & 1.6 (5.7) & 219.7 (4.2) & 220 (3.7) & 218.5 (4.7) \\ \hline end resuscitation & 0.72 (3.9) & 0.9 (5.3) & 214.7 (4.5) & 213.9 (4.1) & 211.7 (5.7) \\ \hline 2h. & 4.2 (4.5) & 0.8 (6) & 23.5 (5.8) & 25.3 (3.9) & 22.5 (7.7) \\ \hline 5h. & 1.2(4.9) & 20.6 (7.3) & 22.7 (5.2) & 24.7 (4.5) & 20.1 (5.8) \\ \hline 9h. & 2.1(6.1) & 24.2 (7.2) & 26.1 (4.8) & 26.3 (5.2) & 22.8 (7) \\ \hline MABP mmHg start & 43.3(3.4) & 42.6 (17.3) & 49.0 (8.4) & 47.5 (7.8) & 51.4 (8.3) \\ \hline end hypoxia & 42.3 (2.9) & 44.1 (4.8) & 22.5 (15) & 22.8 (10.8) & 22.0 (15.5) \\ \hline endResuscitation & 43.2 (2.7) & 45.6 (9.6) & 40.0 (15.8) & 41.6 (12.1) & 40.0 (11.7) \\ \hline 2h. & 42.6(5.1) & 44.8 (8.5) & 41.8 (12.2) & 36.8 (11.7) & 40.5 (10.3) \\ \hline 5h. & 45.7(16.4) & 39.4 (9) & 42.8 (10) & 38.4 (10) & 44.0 (9) \\ \hline 9h. & 38.1 (7.1) & 40.1 (14.7) & 35.2 (6.7) & 39.0 (10) & 39.4 (14.7) \\ \hline Heart rate start & 137 (27) & 149 (34) & 153 (31) & 165 (34) & 151 (30) \\ \hline end hypoxia & 136 (34) & 150 (32) & 154 (34) & 143 (35) & 165 (37) \\ \hline endResuscitation & 138 (32) & 140 (28) & 177 (31) & 192 (36) & 170 (33) \\ \hline pO2 kPa start & 10.6 (1.4) & 12.7 (1.9) & 11.6 (1.6) & 12.0 (1.3) & 11.8 (2.0) \\ \hline end hypoxia & 11.3 (1.2) & 12.8 (1.3) & 5.3 (1.4) & 5.0 (0.8) & 5.1 (0.7) \\ \hline endResuscitation & 11.5 (1.2) & 61.4 (8.3) & 12.4 (2.0) & 25.8 (2.7) & 52.2 (15.4) \\ \hline pCO2 kPa start & 5.3 (0.8) & 4.9 (0.7) & 5.3 (0.4) & 5.1 (0.6) & 5.2 (0.8) \\ \hline end hypoxia & 5.0 (0.6) & 4.9 (0.8) & 8.9 (1.6) & 8.8 (2.1) & 8.6 (1.7) \\ \hline endResuscitation & 5.0 (0.6) & 4.7 (0.7) & 5.0 (0.7) & 5.2 (0.8) & 4.8 (1.3) \\ \hline \end{tabular} \end{table}	PMC3000320_table_0

Subsets and Splits