text
stringlengths 2
1.05M
| repo_name
stringlengths 5
101
| path
stringlengths 4
991
| language
stringclasses 3
values | license
stringclasses 5
values | size
int64 2
1.05M
|
|---|---|---|---|---|---|
But I look back with great merriment on those days, and recall them with my sense of humour fully engaged. Every student who chooses to should have the chance to participate in subsidised campus activities, be they sport, politics, debating, competitive chess, or the peculiar combination of writing and politically correct navel-gazing that we undertook in the poor dear Media Collective, which was actually just a refuge for insecure post-adolescents desperately trying to construct an identity. Such things form part of a rounded education and teach one to think for oneself. But Education Minister Christopher Pyne doesn't think so. This week, in a turn-around which seemed to contradict Prime Minister Tony Abbott's commitment to ''candid'' and ''consultative'' government, Pyne raised and promptly dropped the idea of abolishing the government's student services and amenities fee, as well as fore-shadowing the idea of re-introducing caps on university places. The $273 annual student services fee was reintroduced by the Gillard government in 2011, after the Howard government abolished compulsory student fees in 2005. In an interview with Fairfax Media which was splashed on the Herald's front page on Wednesday, Pyne said the fee was ''compulsory student unionism by the back door'' and that the Coalition would abolish it. In another interview with The Australian Financial Review, he was asked when the fee might be abolished and he said: ''It might be in the budget, but that's not until May.'' But Pyne either went too far, or said too much.
This was not part of the script - Abbott had previously promised the university sector a period of stability after the budget cuts the Gillard government made in the May budget. In a pre-election press release Pyne himself promised the Coalition had ''no plans'' to reintroduce caps to university places and that "reports that this is being considered are wrong''. On Wednesday morning, after the Herald's splash, Pyne's reversal was swift. That morning, though he was scheduled to appear on ABC Radio's flagship AM program, the ''Mouth from the South'' went missing. He resurfaced on local radio - on ABC Adelaide, where he backtracked, saying the abolition of the student service fee was not a priority. That same day a leaked email from the Prime Minister's media adviser informed ministerial staff that all requests for media interviews, right down to local ABC outlets, were to be vetted through the Prime Minister's office first (Abbott may have promised ''grown-up government'' but ministers will apparently need permission from the headmaster's office before they speak). On Thursday the Prime Minister emerged from several days' silence to give a press conference in which he used identical language to slap down the idea. The student fees abolition was ''not a priority'', he said. There were ''no plans for change in this area at this time''. Messages were mixed, at the very least. Was Pyne freelancing or was he speaking confident in the knowledge that his views on student unionism align with his leader's, only to have the leader rein him in?
Abbott and Pyne are personally close and Pyne is at the ''heart of the Coalition's senior leadership group'', to quote the leader. Despite Abbott's embrace of student politics when he attended Sydney University in the 1970s, he was always firmly against compulsory student unionism, although it should be noted he and Pyne both attended university when it was free - in the window between Gough Whitlam abolishing fees in 1974 and Bob Hawke's introduction of the Higher Education Contribution Scheme in 1989. Abbott's time in student politics is well documented. It was a period during which the rank stupidity of the left was matched only by the blunt aggression of the right. He was at Sydney University not long after the upheaval of the Whitlam years and the Vietnam protests, during which conscripts took refuge on campus and federal police were set upon by student mobs. Things have moved on since then. They have even moved on from the earnest political correctness of my own university career. I was discussing Baudrillard with the Media Collective cats before Howard abolished compulsory student unionism, when there were fewer constraints on what student fees could be spent on. When the fees were reintroduced by the Gillard government in 2011, they were regulated, with money directed towards counselling, study support, childcare, sport and student representative councils (which, as democratic institutions, will sadly always involve some politics).
Universities must now be transparent about what they do with the money raised, and to take the example of Sydney University (which discloses on its website exactly where the fees go), it is allocated by the uni in consultation with democratically elected student representatives. There is something unseemly about politicians who have formed their own views in the crucible of ratbag student politics seeking to deny future generations the same anarchic privilege. The abolition of student fees is a purely ideological policy which would not save the government a single cent. It would cruel university services and has already aggravated the Nationals, who strongly support service fees because they help regional students. The floating of the idea by Pyne looks an awful like a government that had no clear higher education policy before the election is simply falling back on the higher education culture wars of the Howard era, even though the rest of the world has moved past them. And those culture wars were so tedious. More tedious than an entire semester's-worth of post-structuralism reading.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
"Last 100 bytes" Interview Scenario
I got this question in an interview the other day and would like to know some best possible answers(I did not answer very well haha):
Scenario: There is a webpage that is monitoring the bytes sent over a some network. Every time a byte is sent the recordByte() function is called passing that byte, this could happen hundred of thousands of times per day. There is a button on this page that when pressed displays the last 100 bytes passed to recordByte() on screen (it does this by calling the print method below).
The following code is what I was given and asked to fill out:
public class networkTraffic {
public void recordByte(Byte b){
}
public String print() {
}
}
What is the best way to store the 100 bytes? A list? Curious how best to do this.
A:
Something like this (circular buffer) :
byte[] buffer = new byte[100];
int index = 0;
public void recordByte(Byte b) {
index = (index + 1) % 100;
buffer[index] = b;
}
public void print() {
for(int i = index; i < index + 100; i++) {
System.out.print(buffer[i % 100]);
}
}
The benefits of using a circular buffer:
You can reserve the space statically. In a real-time network application (VoIP, streaming,..)this is often done because you don't need to store all data of a transmission, but only a window containing the new bytes to be processed.
It's fast: can be implemented with an array with read and write cost of O(1).
A:
I don't know java, but there must be a queue concept whereby you would enqueue bytes until the number of items in the queue reached 100, at which point you would dequeue one byte and then enqueue another.
public void recordByte(Byte b)
{
if (queue.ItemCount >= 100)
{
queue.dequeue();
}
queue.enqueue(b);
}
You could print by peeking at the items:
public String print()
{
foreach (Byte b in queue)
{
print("X", b); // some hexadecimal print function
}
}
A:
Circular Buffer using array:
Array of 100 bytes
Keep track of where the head index is i
For recordByte() put the current byte in A[i] and i = i+1 % 100;
For print(), return subarray(i+1, 100) concatenate with subarray(0, i)
Queue using linked list (or the java Queue):
For recordByte() add new byte to the end
If the new length to be more than 100, remove the first element
For print() simply print the list
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Mau Mau Settlement: How Much Cash Fixes The Past?
There's a saying that the past is never really past. We have a story that speaks to that now. It dates from the era of British colonial rule in Africa. The British government recently agreed to pay reparations to more than five thousand Kenyans who the government acknowledged had been subjected to torture and other abuses by colonial administrators during the so-called Mau Mau Insurgency against British rule in the 1950s. In that time, more than 150,000 Kenyans were placed into detention camps where thousands suffered severe mistreatment. Here's the U.K.'s Foreign Secretary William Hague.
(SOUNDBITE OF HAGUE SPEECH)
WILLIAM HAGUE: The British government recognizes that Kenyans were subject to torture and other forms of ill treatment of the hands the colonial administration. The British government sincerely regrets that these abuses took place.
MARTIN: Joining us to talk about this now is Harvard Professor Caroline Elkins. She spent years researching the story of the Mau Mau and is the author of the book "Imperial Reckoning," which won a Pulitzer Prize in 2006, and her evidence was among that used to achieve this settlement. Thanks for joining us now, professor.
CAROLINE ELKINS: Thank you so much for having me.
MARTIN: So what kinds of mistreatment are we talking about that was the subject of this settlement? And this is probably a good place to tell our listeners that, you know, there are maybe aspects of this that are not suitable for all...
ELKINS: Absolutely.
MARTIN: ...Listeners...
ELKINS: Sure.
MARTIN: ...Given what we're talking about here. So Professor Elkins, what kind of treatment are we talking about that led to this settlement?
ELKINS: You know, absolutely horrific, just unimaginable. For several years, I took oral testimonies about this and it's the kind of abuse that, quite frankly, if listeners are concerned with young children or themselves, don't have a strong stomach, they should turn themselves away. I mean, we're talking about castrations, forced sodomies with broken bottles and vermin and snakes, tying suspected Mau Mau adherence to the back of Land Rovers and dragging them until they were left in bits. I mean it just - these kinds of horrors I collected day after day, and they were simply unimaginable.
MARTIN: I think it's fair to say that many people who have heard about this era have heard that there were atrocities, but believed that it was the Kenyans who were committing these atrocities. Did both sides give as good as they got, as it were, or was it in fact that the weight of this conduct really does fall on the British?
ELKINS: Your question cuts to the heart of this case. And it's this, it's the fact that the Mau Mau were depicted as the most bestial, horrible, savage movement ever to hit Africa. But at the end of the day, you know, only 32 European settlers died. As opposed to the British who detained, in fact, you pointed out, 150,000 in the detention camps, but all of the women and children were detained in rural homesteads. So, in fact, what we find out is that there was a kind of disproportionate horror going on, but it was - the balance sheet was weighted against the Kikuyu. Nearly 1.5 million were detained and subjected to just horrendous conditions, as I pointed out. And the key to all of this is that when the British decolonized, they burned nearly all of the files, and so this episode was silenced.
MARTIN: Well, how was persuasive enough evidence gathered to cause the government to want to settle at this juncture.
ELKINS: So, you know, listen, to get to your question we have two issues going on in terms of discovery of evidence. First of all, I don't think the British government or anyone would have even imagined that a young Harvard graduate student, which I was at the time, would be willing to spend 10 years looking to find whatever the purge left behind. The second thing that they didn't count on, is that actually, at the time of decolonization when they burned nearly three and a half tons of files in Kenya, they also secretly brought back about 300 boxes. These boxes had been sitting in the MI5 warehouse for the last 50-plus years. And inside those boxes were document after document validating the claims of the case. And when those came out, it was really the final nail on the British government's coffin.
MARTIN: May I ask you what drew you to this? You're not a British national, correct?
ELKINS: No.
MARTIN: You're not Kenyan, you're not British.
ELKINS: No, a middle-class kid from New Jersey. So what on earth am I doing, right?
MARTIN: Exactly. Yeah. Yeah. I wasn't going to put it quite that way, but that was my question.
ELKINS: No, that's quite all right. We can scroll back. I went to University of Princeton, took an amazing course with an amazing professor on African history. And one of his specialties was Kenya, so I ended up doing my senior thesis research in Kenya in Nairobi. And when I was there, I came across a couple documents on these detention camps, and like a good student, I went to look for a book or an article and there was nothing on this. And so I said, right then and there, that if I ever went back to graduate school, I was going to write my dissertation about the detention camps of Kenya.
MARTIN: Were you sad to find this out?
ELKINS: You know, I think for me, this has certainly been, if you will, a path of both intellectual and self-discovery, right. And when I began my dissertation, I went in with more or less the party line. I was going to write a dissertation about the success of liberal reform behind the barbed wire of detention in Kenya. And it was about a year in when I realized all of this evidence wasn't adding up, and I was quite distressed. I thought, good grief, I don't have a dissertation here. And finally I said to myself, which seems rather self-evident now, what if this is a story about extraordinary systematized violence and even greater level of cover-up. And suddenly, it all made sense. And this work has been done at great professional peril, most people have a very different view, both in the academy and the public world, and certainly amongst politicians of the British Empire.
MARTIN: Well, I mean, you're American, though. So, I mean, I don't know that - I mean, are you really in that great, professional peril in the United States? Are people really that...
ELKINS: Absolutely.
MARTIN: Because people are really invested in their version? Is that it?
ELKINS: Absolutely. Absolutely. Because you have to bear in mind that as an academic...
MARTIN: Well, give an example.
ELKINS: I'll give you a couple examples. I mean, one of which has to do with the fact that I'm an academic, right. And so, therefore, in the academy, when I wrote this I was untenured here at Harvard. Whatever you write when you're up for tenure, you're up for review by other academics in your field. Well, the majority of mine were from Britain, from Oxford and Cambridge, and I was absolutely reviled. The sense was that I was - that this was a work of fiction. And, of course, as I was told quite publicly in open lectures, that, you know, well, Africans make up stories, Elkins. So this is just one big myth that you've created here. And more than that, that I was an irresponsible historian, that I certainly did not belong in the profession and certainly not at Harvard. And so it was, you know, a very strong uphill battle. And so you can imagine when this announcement is made by William Hague in Parliament, I, of course, my first feeling is just utter vindication for these claimants, but this was an enormous moment of professional validation.
MARTIN: Professor Caroline Elkins is the author of the book "Imperial Reckoning: The Untold Story of Britain's Gulag in Kenya." She joined us from member station WBUR in Boston. Professor Elkins, thank you so much for speaking with us.
ELKINS: Thank you so much for having me.
MARTIN: Just ahead, when Concha Buika was growing up on the Spanish island of Mallorca, she was used to people telling her her voice was ugly, but that didn't stop her.
CONCHA BUIKA: You don't sing with a beautiful voice, you sing with a beautiful idea and with a really big desire.
MARTIN: Buika tells us how she found her voice. That's next on TELL ME MORE from NPR News. I'm Michel Martin. Transcript provided by NPR, Copyright NPR.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Pimarane-type diterpenes obtained by biotransformation: antimicrobial properties against clinically isolated Gram-positive multidrug-resistant bacteria.
The present study describes the antimicrobial activity of five pimarane-type diterpenes obtained by fungal biotransformation against several nosocomial multidrug-resistant bacteria. Among the investigated metabolites, ent-8(14),15-pimaradien-3β-ol was the most active compound, with very promising minimal inhibitory concentration values (between 8.0 and 25.0 µg mL(-1)). Time-kill assays using this metabolite against Staphylococcus aureus (HCRP180) revealed that this compound exerted its bactericidal effect within 24 h at all the evaluated concentrations (8.0, 16.0, and 24.0 µg mL(-1)). When this metabolite was associated with vancomycin at their minimal bactericidal concentration values, the resulting combination was able to drastically reduce the number of viable strains of S. aureus within the first 6 h, compared with these chemicals alone. The checkerboard assays conducted against this microorganism did not evidence any synergistic effects when this same combination was employed. In conclusion, our results point out that ent-8(14),15-pimaradien-3β-ol is an important metabolite in the search for new effective antimicrobial agents.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Suede mini skirt
Details
Courrèges brings modish style back into the spotlight with its collection of sharp 1960s-inspired designs. This tan-brown suede skirt has a mini A-line silhouette that's simply accented with an exposed side seam. Build on the aesthetic with a pair of slick black ankle boots.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
, -412, -612?
-812
What is next in 38, 141, 312, 551, 858?
1233
What is the next term in -194, -778, -1752, -3116, -4870?
-7014
What is next in -380, -382, -384, -386, -388?
-390
What is the next term in 17, 30, 49, 74, 105, 142?
185
What is next in 7, 58, 187, 430, 823, 1402, 2203?
3262
What is next in 141, 284, 431, 582, 737?
896
What is next in -19, -34, -51, -70?
-91
What comes next: -6, -19, -32, -45?
-58
What is the next term in 86, 75, 48, -1, -78?
-189
What comes next: 12, 18, 14, 0, -24, -58?
-102
What is the next term in -24, -6, 38, 120, 252?
446
What is the next term in 5244, 10490, 15736?
20982
What comes next: 8, 43, 124, 275, 520, 883, 1388, 2059?
2920
What is the next term in -345, -1361, -3053, -5421, -8465, -12185?
-16581
What is next in -665, -664, -663?
-662
What is the next term in 21, 44, 67, 84, 89, 76, 39?
-28
What comes next: -39, -33, -27, -21, -15?
-9
What comes next: -241, -266, -307, -364?
-437
What is the next term in -11, -24, -45, -74, -111?
-156
What is the next term in 856, 842, 824, 802, 776, 746, 712?
674
What is next in 7, -7, -23, -41?
-61
What is next in -108, -148, -176, -186, -172, -128, -48, 74?
244
What comes next: -23, -24, -33, -56, -99, -168, -269, -408?
-591
What is the next term in 1448, 1453, 1458?
1463
What comes next: 428, 849, 1268, 1685?
2100
What is next in 6339, 6372, 6419, 6486, 6579, 6704, 6867, 7074?
7331
What comes next: 1593, 1592, 1591?
1590
What comes next: -37, -79, -119, -157?
-193
What is next in 8, 1, -20, -61, -128?
-227
What comes next: -259, -255, -251?
-247
What is the next term in 190, 743, 1664, 2953, 4610?
6635
What comes next: 622, 618, 614?
610
What is next in -110, -274, -454, -656, -886?
-1150
What is next in -155, -310, -477, -662, -871, -1110, -1385?
-1702
What is the next term in -17, 0, 43, 124, 255, 448?
715
What is the next term in -18638, -37277, -55916, -74555, -93194?
-111833
What comes next: 1083, 2164, 3245, 4326, 5407?
6488
What is the next term in 1449, 2909, 4369?
5829
What comes next: -95, -199, -325, -485, -691, -955, -1289?
-1705
What is the next term in -6, -17, -50, -117, -230, -401, -642, -965?
-1382
What is next in 383, 385, 399, 431, 487, 573, 695, 859?
1071
What is next in 17, 93, 225, 419, 681, 1017, 1433, 1935?
2529
What comes next: 112, 443, 994, 1765, 2756, 3967, 5398?
7049
What comes next: 211, 422, 633, 844, 1055?
1266
What is next in 27, 26, 25, 24, 23, 22?
21
What is next in -71, -99, -173, -317, -555?
-911
What is the next term in -16, -26, -42, -64, -92, -126?
-166
What is the next term in 4242, 4244, 4256, 4284, 4334, 4412, 4524, 4676?
4874
What is next in 74, 86, 98?
110
What is next in 31, 40, 61, 100, 163?
256
What is next in -81, -152, -215, -264, -293, -296, -267, -200?
-89
What is next in -3, -25, -67, -129, -211, -313?
-435
What is next in -4141, -8287, -12433, -16579, -20725, -24871?
-29017
What is the next term in 154, 153, 152?
151
What is next in 53, 41, 29, 17?
5
What is the next term in 197, 230, 263, 296, 329?
362
What is next in -19, -13, -7, -1, 5?
11
What is the next term in -2220, -2219, -2218?
-2217
What is next in 152, 150, 148, 146?
144
What comes next: 12661, 25320, 37979, 50638, 63297?
75956
What comes next: 52, 56, 64, 76, 92, 112, 136?
164
What is next in -888, -1781, -2674, -3567, -4460, -5353?
-6246
What is the next term in -2108, -2107, -2106?
-2105
What comes next: -13, -85, -211, -397, -649?
-973
What comes next: 62, 114, 166, 218, 270, 322?
374
What is next in -6, 2, 24, 66, 134, 234?
372
What is the next term in -36, -123, -280, -519, -852, -1291?
-1848
What is the next term in -22, -50, -106, -202, -350, -562, -850?
-1226
What is the next term in 144, 137, 130, 123?
116
What is next in -143, -284, -425, -566, -707?
-848
What is next in 78, 157, 236, 315?
394
What comes next: 15296, 15295, 15294, 15293, 15292, 15291?
15290
What is the next term in 3377, 3379, 3383, 3389?
3397
What is the next term in -2201, -2202, -2203, -2204, -2205?
-2206
What comes next: -72, -179, -356, -603?
-920
What is next in -113, -122, -131, -140, -149?
-158
What is the next term in -14, 51, 152, 283, 438, 611?
796
What is next in -2, 1, 4, 7, 10?
13
What is the next term in 87, 561, 1839, 4323, 8415, 14517, 23031, 34359?
48903
What is next in 175, 692, 1563, 2794, 4391?
6360
What is next in -40, -146, -310, -526, -788, -1090?
-1426
What is the next term in 119, 118, 117, 116?
115
What is the next term in -31, -41, -51, -61, -71, -81?
-91
What is the next term in 305, 571, 837, 1103?
1369
What is the next term in -1264, -2530, -3796, -5062, -6328, -7594?
-8860
What is the next term in 7, 1, -19, -59, -125?
-223
What is the next term in -22, -64, -146, -280, -478?
-752
What is next in -9, -65, -153, -267, -401, -549?
-705
What is next in 2, -2, -10, -22?
-38
What is the next term in -98, -384, -860, -1526, -2382?
-3428
What is next in 494, 497, 500, 503, 506?
509
What is the next term in -7759, -7763, -7769, -7777, -7787, -7799?
-7813
What is next in -45, -37, -29, -21, -13?
-5
What comes next: -1396, -1380, -1354, -1318, -1272?
-1216
What comes next: -162, -328, -494, -660, -826?
-992
What comes next: -73, -76, -79?
-82
What is next in -16, -27, -44, -67, -96, -131?
-172
What comes next: -87, -351, -789, -1401, -2187?
-3147
What is next in -42, -73, -78, -51, 14, 123?
282
What is next in -29, -1, 21, 31, 23, -9, -71?
-169
What comes next: -1595, -3195, -4795, -6395, -7995, -9595?
-11195
What comes next: 60, 115, 158, 183, 184, 155?
90
What is the next term in 59, 26, -19, -70, -121, -166?
-199
What is next in -12, -17, 2, 57, 160, 323, 558?
877
What comes next: -3065, -6131, -9197, -12263, -15329?
-18395
What is next in -67, -131, -195, -259?
-323
What comes next: 100, 198, 296, 394, 492, 590?
688
What is the next term in -132, -265, -398?
-531
What comes next: 377, 774, 1171, 1568, 1965?
2362
What comes next: 1954, 1953, 1950, 1945?
1938
What is next in 551, 1091, 1629, 2165, 2699, 3231?
3761
What comes next: 350, 355, 370, 401, 454, 535?
650
What is the next term in 52, 44, 36?
28
What comes next: 39, 91, 159, 243?
343
What is the next term in -5, 2, 15, 34, 59?
90
What is next in 39, 61, 93, 135?
187
What is next in 108, 112, 118, 126?
136
What is next in -158, -315, -472, -629, -786?
-943
What is the next term in -73, -142, -207, -268, -325, -378, -427?
-472
What is next in -66, -111, -170, -249, -354, -491?
-666
What is the next term in -231, -907, -2035, -3615, -5647, -8131, -11067?
-14455
What is next in 42, 88, 134, 180, 226, 272?
318
What is the next term in -972, -973, -974, -975, -976?
-977
What comes next: 742, 1482, 2222, 2962?
3702
What comes next: -887, -1754, -2621, -3488, -4355?
-5222
What is next in -115, -228, -349, -484, -639, -820?
-1033
What comes next: 143, 152, 163, 176, 191, 208?
227
What comes next: -434, -911, -1388, -1865, -2342?
-2819
What is the next term in -337, -338, -339, -340, -341, -342?
-343
What is next in -15, -43, -97, -189, -331, -535, -813, -1177?
-1639
What is the next term in 63, 37, -7, -69, -149?
-247
What is the next term in -50, -202, -456, -812?
-1270
What is next in -867, -855, -827, -777, -699, -587, -435, -237?
13
What is next in -79, -189, -299, -409?
-519
What comes next: 32, 114, 330, 746, 1428?
2442
What comes next: 17118, 17117, 17116, 17115, 17114, 17113?
17112
What is next in 79, 157, 209, 223, 187, 89, -83?
-341
What is next in -174, -164, -152, -138?
-122
What is the next term in -2, -21, -76, -185, -366?
-637
What is next in 1400, 1374, 1346, 1316?
1284
What comes next: -380, -383, -388, -395?
-404
What comes next: -232, -213, -194, -175, -156, -137?
-118
What is next in 104, 200, 296, 392?
488
What is next in 154, 433, 712?
991
What comes next: 23, 40, 69, 116, 187, 288, 425?
604
What is the next term in -23, -45, -81, -137, -219?
-333
What comes next: -602, -601, -600, -599, -598, -597?
-596
What is the next term in 2, 19, 72, 179, 358?
627
What comes next: -75, -106, -139, -174, -211, -250, -291?
-334
What comes next: 9, 0, -21, -60, -123, -216, -345?
-516
What is the next term in 46, 51, 78, 139, 246, 411, 646, 963?
1374
What is the next term in 33, 77, 121, 165, 209?
253
What comes next: 73, 247, 537, 943, 1465, 2103, 2857?
3727
What comes next: -278, -286
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Segue does not trigger in tab bar app
I'm using storyboard and XCode 4.3 to create an app that has a tab bar as root view. Even though my app has other segues that work just fine, one of them just does not trigger. It's supposed to trigger when the third item of the tab is selected. The only thing I can see is that the tab bar actually loads the new view, but no information is passed.
The connections on Storyboard are as follow : Root View controller (Tab bar) -> Navigation Controller -> CapitolDetailViewController (which has a push segue from another view controller)
I've tried many changes in the connections, code, etc. But it just doesn't trigger this segue. I tried to change the code in my AppDelegate to add the new controllers that were missing. The code for my applicationDidFinishLaunching is the following:
NSManagedObjectContext *context = [self managedObjectContext];
NSError *error;
if (![context save:&error]) {
NSLog(@"Whoops, couldn't save: %@", [error localizedDescription]);
}
tabBarController = (UITabBarController *)self.window.rootViewController;
UINavigationController *view1 = [[tabBarController viewControllers] objectAtIndex:0];
UINavigationController *view2 = [[tabBarController viewControllers] objectAtIndex:1];
UINavigationController *view3 = [[tabBarController viewControllers] objectAtIndex:2];
SCDMasterViewController *view11 = [[view1 viewControllers] objectAtIndex:0];
view11.managedObjectContext = self.managedObjectContext;
SerieDetailViewController *view22 = [[view2 viewControllers] objectAtIndex:0];
CapitolDetailViewController *view33 = [[view3 viewControllers] objectAtIndex:0];
return YES;
Where "SerieDetailViewController" is the one that should pass the information when the 3rd item is selected, and "CapitolDetailViewController" is the one that should receive it.
Code for my segue: (it doesn't even enter the segue, de NSLOG never shows up)
- (void)prepareForSegue:(UIStoryboardSegue *)segue sender:(id)sender {
NSLog(@"Entra segue");
if ([segue.identifier isEqualToString:@"mostraCapitol"]) {
NSString *nom = @"";
nom= serieName;
CapitolDetailViewController *destViewController = segue.destinationViewController;
destViewController.serieName2 = nom;
}
}
Anyone knows what is wrong?
UPDATE: even though I received an answer that helped me to correct some compilation errors, the problem is still there. If I click the tab bar item, it loads an empty view. It never calls the segue. It looks like the tab bar items and the view controllers are not attached.
A:
Try checking the segue method that does not work. Make sure your identifier for the segue in the storyboard mach the one in your class. From the look of your code and all the comments it seems that your code is fine and should work. The only place that might give you an issue would be different identifiers for the segue in storyboard. I hope this resolves your issue my friend.
Edit:
well i don't know if this works for you but i have a different approach in setting up the core data in tab bar app. in .h file of the delegate almost everything is generic, in .m particularly applicationdidfinishwithoption i use index number in order to sort the views in view controller that i add to tab bar. i hope this helps, here is the code i use.
- (BOOL)application:(UIApplication *)application didFinishLaunchingWithOptions:(NSDictionary *)launchOptions
{
[self setupFetchedResultsController];
if (![[self.fetchedResultsController fetchedObjects] count] > 0 ) {
NSLog(@"!!!!! ~~> There's nothing in the database so defaults will be inserted");
[self importCoreDataDefaultRoles];
}
else {
NSLog(@"There's stuff in the database so skipping the import of default data");
}
// The Tab Bar
UITabBarController *tabBarController = (UITabBarController *)self.window.rootViewController;
// The Two Navigation Controllers attached to the Tab Bar (At Tab Bar Indexes 0 and 1)
UINavigationController *view1 = [[tabBarController viewControllers] objectAtIndex:0];
UINavigationController *view2 = [[tabBarController viewControllers] objectAtIndex:1];
View1 *view1 = [[view1nav viewControllers] objectAtIndex:0];
personsTVC.managedObjectContext = self.managedObjectContext;
View2 *view2 = [[view2nav viewControllers] objectAtIndex:0];
rolesTVC.managedObjectContext = self.managedObjectContext;
return YES;
}
by using index numbers i was able to achieve the same scenario without any error and for the start up view i used a child that i plugged in as initial modal view. hope this helps you. in my case core data was to be added to multiple tabs, i do not know if you have the same need.
EDIT 1
here is my Appdelegate.h
#import <UIKit/UIKit.h>
#import <CoreData/CoreData.h>
@interface AppDelegate : UIResponder <UIApplicationDelegate>
@property (strong, nonatomic) UIWindow *window;
@property (readonly, strong, nonatomic) NSManagedObjectContext *managedObjectContext;
@property (readonly, strong, nonatomic) NSManagedObjectModel *managedObjectModel;
@property (readonly, strong, nonatomic) NSPersistentStoreCoordinator *persistentStoreCoordinator;
@property (strong, nonatomic) NSFetchedResultsController *fetchedResultsController;
- (void)saveContext;
- (NSURL *)applicationDocumentsDirectory;
@end
and here is the app delegate.m
#import "AppDelegate.h"
#import "PersonsTVC.h"
#import "RolesTVC.h"
@implementation AppDelegate
@synthesize window = _window;
@synthesize managedObjectContext = __managedObjectContext;
@synthesize managedObjectModel = __managedObjectModel;
@synthesize persistentStoreCoordinator = __persistentStoreCoordinator;
@synthesize fetchedResultsController = __fetchedResultsController;
- (void)insertRoleWithRoleName:(NSString *)roleName
{
Role *role = [NSEntityDescription insertNewObjectForEntityForName:@"Role"
inManagedObjectContext:self.managedObjectContext];
role.name = roleName;
[self.managedObjectContext save:nil];
}
- (void)importCoreDataDefaultRoles {
NSLog(@"Importing Core Data Default Values for Roles...");
[self insertRoleWithRoleName:@"Player 1"];
[self insertRoleWithRoleName:@"Player 2"];
[self insertRoleWithRoleName:@"Player 3"];
[self insertRoleWithRoleName:@"Player 4"];
[self insertRoleWithRoleName:@"Player 5"];
[self insertRoleWithRoleName:@"Player 6"];
[self insertRoleWithRoleName:@"Player 7"];
[self insertRoleWithRoleName:@"Player 8"];
[self insertRoleWithRoleName:@"Player 9"];
[self insertRoleWithRoleName:@"Player 10"];
[self insertRoleWithRoleName:@"Player 11"];
[self insertRoleWithRoleName:@"Player 12"];
NSLog(@"Importing Core Data Default Values for Roles Completed!");
}
- (void)setupFetchedResultsController
{
// 1 - Decide what Entity you want
NSString *entityName = @"Role"; // Put your entity name here
NSLog(@"Setting up a Fetched Results Controller for the Entity named %@", entityName);
// 2 - Request that Entity
NSFetchRequest *request = [NSFetchRequest fetchRequestWithEntityName:entityName];
// 3 - Filter it if you want
//request.predicate = [NSPredicate predicateWithFormat:@"Person.name = Blah"];
// 4 - Sort it if you want
request.sortDescriptors = [NSArray arrayWithObject:[NSSortDescriptor sortDescriptorWithKey:@"name"
ascending:YES
selector:@selector(localizedCaseInsensitiveCompare:)]];
// 5 - Fetch it
self.fetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request
managedObjectContext:self.managedObjectContext
sectionNameKeyPath:nil
cacheName:nil];
[self.fetchedResultsController performFetch:nil];
}
- (BOOL)application:(UIApplication *)application didFinishLaunchingWithOptions:(NSDictionary *)launchOptions
{
[self setupFetchedResultsController];
if (![[self.fetchedResultsController fetchedObjects] count] > 0 ) {
NSLog(@"!!!!! ~~> There's nothing in the database so defaults will be inserted");
[self importCoreDataDefaultRoles];
}
else {
NSLog(@"There's stuff in the database so skipping the import of default data");
}
// The Tab Bar
UITabBarController *tabBarController = (UITabBarController *)self.window.rootViewController;
// The Two Navigation Controllers attached to the Tab Bar (At Tab Bar Indexes 0 and 1)
UINavigationController *personsTVCnav = [[tabBarController viewControllers] objectAtIndex:0];
UINavigationController *rolesTVCnav = [[tabBarController viewControllers] objectAtIndex:1];
// The Persons Table View Controller (First Nav Controller Index 0)
PersonsTVC *personsTVC = [[personsTVCnav viewControllers] objectAtIndex:0];
personsTVC.managedObjectContext = self.managedObjectContext;
// The Roles Table View Controller (Second Nav Controller Index 0)
RolesTVC *rolesTVC = [[rolesTVCnav viewControllers] objectAtIndex:0];
rolesTVC.managedObjectContext = self.managedObjectContext;
//NOTE: Be very careful to change these indexes if you change the tab order
// Override point for customization after application launch.
// UINavigationController *navigationController = (UINavigationController *)self.window.rootViewController;
// RolesTVC *controller = (RolesTVC *)navigationController.topViewController;
// controller.managedObjectContext = self.managedObjectContext;
return YES;
}
- (void)applicationWillResignActive:(UIApplication *)application
{
}
- (void)applicationDidEnterBackground:(UIApplication *)application
{
}
- (void)applicationWillEnterForeground:(UIApplication *)application
{
}
- (void)applicationDidBecomeActive:(UIApplication *)application
{
}
- (void)applicationWillTerminate:(UIApplication *)application
{
[self saveContext];
}
- (void)saveContext
{
NSError *error = nil;
NSManagedObjectContext *managedObjectContext = self.managedObjectContext;
if (managedObjectContext != nil)
{
if ([managedObjectContext hasChanges] && ![managedObjectContext save:&error])
{
/*
Replace this implementation with code to handle the error appropriately.
abort() causes the application to generate a crash log and terminate. You should not use this function in a shipping application, although it may be useful during development.
*/
NSLog(@"Unresolved error %@, %@", error, [error userInfo]);
abort();
}
}
}
#pragma mark - Core Data stack
- (NSManagedObjectContext *)managedObjectContext
{
if (__managedObjectContext != nil)
{
return __managedObjectContext;
}
NSPersistentStoreCoordinator *coordinator = [self persistentStoreCoordinator];
if (coordinator != nil)
{
__managedObjectContext = [[NSManagedObjectContext alloc] init];
[__managedObjectContext setPersistentStoreCoordinator:coordinator];
}
return __managedObjectContext;
}
- (NSManagedObjectModel *)managedObjectModel
{
if (__managedObjectModel != nil)
{
return __managedObjectModel;
}
NSURL *modelURL = [[NSBundle mainBundle] URLForResource:@"Model" withExtension:@"momd"];
__managedObjectModel = [[NSManagedObjectModel alloc] initWithContentsOfURL:modelURL];
return __managedObjectModel;
}
- (NSPersistentStoreCoordinator *)persistentStoreCoordinator
{
if (__persistentStoreCoordinator != nil)
{
return __persistentStoreCoordinator;
}
NSURL *storeURL = [[self applicationDocumentsDirectory] URLByAppendingPathComponent:@"StaffManager.sqlite"];
NSError *error = nil;
__persistentStoreCoordinator = [[NSPersistentStoreCoordinator alloc] initWithManagedObjectModel:[self managedObjectModel]];
NSDictionary *options = [NSDictionary dictionaryWithObjectsAndKeys:
[NSNumber numberWithBool:YES], NSMigratePersistentStoresAutomaticallyOption,
[NSNumber numberWithBool:YES], NSInferMappingModelAutomaticallyOption, nil];
if (![__persistentStoreCoordinator addPersistentStoreWithType:NSSQLiteStoreType configuration:nil URL:storeURL options:options error:&error])
{
NSLog(@"Unresolved error %@, %@", error, [error userInfo]);
abort();
}
return __persistentStoreCoordinator;
}
#pragma mark - Application's Documents directory
- (NSURL *)applicationDocumentsDirectory
{
return [[[NSFileManager defaultManager] URLsForDirectory:NSDocumentDirectory inDomains:NSUserDomainMask] lastObject];
}
@end
now bare in mind that i use both classes for for data entities and declared the managed objects in both classes. one thing is for sure when using core data your initial view has to have the managed objects. if this does not help you then i sugest you can take a look at tim roadley's core data tutorial or paul hagurty's stanford core data class. if you need a whole project to look at let me know and ill try to get something together and place a link so you can download it, but i believe if you have created a proper model and are using the right methods in app delegate similar to what i did, it should work. hope this helps you my friend.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Error passing constructor args to StructureMap named instance
I have an object:
public class TestEvent : IEvent
{
private string _id;
public TestEvent()
{
}
public TestEvent(string eventId)
{
_id = eventId;
}
}
And I have a StructureMap registry:
public class TheRegistry : Registry
{
public TheRegistry()
{
Scan(_ =>
{
_.TheCallingAssembly();
_.AddAllTypesOf<IEvent>().NameBy(t => t.Name.ToUpper());
});
}
}
I'm trying to get a named instance of IEvent using the StructureMap container and passing in a constructor argument for "eventId":
var id = "TESTEVENT";
var args = new ExplicitArguments();
args.SetArg("eventId", id);
var eventInstance = _container.GetInstance<IEvent>(args, id);
I think the docs suggest it should work, however I'm getting an ArgumentNullException:
{"Trying to find an Instance of type MyProject.IEvent, MyProject,
Version=1.0.0.0, Culture=neutral, publicKeyToken=null\r\nParameter name: instance"}
All the code works properly if I remove the second constructor, and just grab the named instance.
UPDATE:
Following Kirk's investigation, I've been able to workaround this "issue" by creating a simple object to hold any required arguments. It works now.
public class EventArguments
{
public string EventId { get; set; }
}
...
var eventName = Context.Parameters.EventTypeName.ToString().ToUpper();
var args = new ExplicitArguments();
args.SetArg("args", new EventArguments { EventId = eventName });
var eventInstance = _container.GetInstance<IEvent>(args, eventName);
A:
Full disclosure: I've never used StructureMap before, so I could be misunderstanding how it's intended to be used. But as near as I can tell, either this use-case is intentionally not supported by StructureMap, or it's a bug.
But first, you have one error; you need to fix your id to match your .ToUpper call (i.e. it should be var id = "TESTEVENT";, not var id = "TestEvent";).
Once you've done that, though, it still doesn't work. Inspecting the source code, it's clear why. The constructor of the types are inspected (in this case, TestEvent) and if any constructor declares a parameter whose type is "simple" (i.e. primitives, strings, etc.) then that constructor is categorically disqualified from participating in the .GetInstance behavior.
Specifically, if you examine StructureMap.Graph.PluginFamily.discoverImplicitInstances():
private void discoverImplicitInstances()
{
_pluggedTypes.Each((key, plugin) =>
{
if (!plugin.CanBeAutoFilled) return;
if (hasInstanceWithPluggedType(plugin)) return;
ConfiguredInstance instance = new ConfiguredInstance(plugin.PluggedType).WithName(key);
FillInstance(instance);
});
}
It's that first line in the lambda that is the culprit:
if (!plugin.CanBeAutoFilled) return;
That's the line that is disqualifying your constructor (and thus your type). Strings can't be "auto-filled" since you can't just new one up, and they wouldn't be registered for injection.
If you comment that line out your code will now work. What puzzles me is that while I understand why your constructor couldn't be implicitly created, the code as written seems to also disqualify code from working when you are passing explicit arguments as you've done.
Maybe someone with more experience with StructureMap will be able to offer more expert guidance, but hopefully this was better than nothing.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Category Archives: Healthy Eating
Sometimes during your day, you come across something that just makes your mouth water. It might be red velvet cake or a slice of pizza. You know you should not eat it, but you just can not stop yourself. So why fight it? If you always surrender to these situations, avoid them in the first place so it does not happen! Keep reading into the following paragraphs for how to just prevent temptations so you never struggle […]
You might have heard of the concept of mindful eating, and you may wonder what exactly it is. Basically, eating mindfully means that you are psychologically in the present moment with your attention anytime you eat, and never just physically going through habitual motions. Mastering mindful eating can provide a real boost to your confidence because of your new self-control, and the results from the actual mindful consumption of meals can mean you finally start dropping the […]
If you’ve discovered you’re overweight and want to change that, don’t rush out to the gym right away. While exercise can be beneficial to losing weight, you need to adjust your diet first. If you don’t maintain a good diet, then all the exercise in the world isn’t going to help you lose weight and keep it off. Below we’ve assembled a fit tips and tricks to help you get your diet on the right track. Avoid […]
So you want to lose weight, do you? You may have thought about going on a diet to shed those excess pounds, but you might be aware of a little secret. Diets do not work; at least they are not a permanent solution. It is too often that an individual loses the weight they want through the latest fad diet, only to gain it all back when they go back to their old eating habits. Diets are […]
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Une entente signée entre les gouvernements du Canada et de l’Ontario concrétise la création de l’Université de l’Ontario français.
Un mois après l’entente signée entre le gouvernement de l’Ontario et son homologue fédéral sur son financement, l’Université de l’Ontario français (UOF) est enfin assurée de disposer des fonds nécessaires pour sa création. Toutes les lumières sont donc au vert pour que l’établissement d’études postsecondaire accueille ses premiers étudiants, en 2021.
Le 7 septembre dernier, l’annonce de cette entente a été reçue comme l’exaucement d’un vœu franco-ontarien auparavant resté muselé lettre morte pendant plusieurs décennies. « C’est historique », se félicite Dyane Adam, présidente du conseil de gouvernance de l’UOF. Selon elle, l’appui de la communauté francophone en Ontario « et dans tout le pays, et ailleurs dans le monde même » a participé à la survie du projet, menacé à plusieurs reprises au cours des 12 derniers mois.
Au total, 126 millions de dollars seront alloués au financement de l’université sur huit ans. Cette somme a été réévaluée à la hausse par rapport à une première estimation chiffrée à 84 millions de dollars qui ne comprenait pas les subventions provinciales auxquelles l’UOF aura droit, en tant qu’établissement de formation postsecondaire.
L’ensemble des fonds proviendra à parts égales du fédéral et du provincial. Ottawa prendra en charge le budget des quatre premières années, Toronto assurant la suite jusqu’en 2028. Cette condition a été un point de négociation décisif dans la signature de l’entente entre les deux gouvernements. L’accord final est « gagnant-gagnant », selon Carol Jolin, président de l’Assemblée de la francophonie de l’Ontario. Celui-ci estime que ce calendrier permet au gouvernement de Doug Ford de mettre en œuvre les compressions budgétaires qu’il avait annoncées en novembre 2018.
Existe-t-il encore un risque qu’un nouveau recul dans le dossier fasse tanguer l’UOF? « Je ne pense pas, continue M. Jolin. L’entente de principe est très stable puisqu’elle a été signée par les deux paliers de gouvernement. Le fédéral a déjà mis l’argent de côté, et de toute manière, tout le monde a constaté à quel point la communauté francophone peut se mobiliser. »
Les premiers étudiants à Toronto en 2021
S’il semble désormais acquis que l’UOF aura pignon sur rue à Toronto, ce choix géographique a fait grincer des dents dans la province, notamment en ce qui concerne le coût de la vie dans la métropole pour les étudiants, auxquels s’ajouteront les droits de scolarité.
D’ailleurs, à la fin de septembre, les élus de Cornwall ont adopté une résolution confirmant leur volonté d’accueillir l’UOF en raison de l’argument de la force démographique francophone dans l’Est de l’Ontario ( près de 270 000 personnes). Argument auquel Mme Adam répond qu’il existe un écart béant entre la proportion des personnes d’expression française de la province dans la Grande Région de Toronto (près de 30 pour cent) et celle des cours donnés dans cette langue, soit 3 pour cent.
Si le plan se déroule sans accroc, les premiers cours démarreront en automne 2021. À la fin de la période de démarrage (d’ici huit ans), lorsque l’Université atteindra sa maturité financière, l’établissement aura la capacité d’accueillir environ 2 000 étudiants. Les quatre premiers programmes offerts seront les suivants : économie mondialisée, environnements urbains, cultures numériques et pluralité humaine.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Lyophilized açaí pulp (Euterpe oleracea Mart) attenuates colitis-associated colon carcinogenesis while its main anthocyanin has the potential to affect the motility of colon cancer cells.
This study evaluated the possible protective effects of lyophilized açaí pulp (AP) in a colitis-associated carcinogenesis (CAC) rat model and the modifying effect of cyanidin 3-rutinoside (C3R) on the motility of RKO colon adenocarcinoma cells, using the wound healing assay. Male Wistar rats were induced to develop CAC using 1,2-dimethylhydrazine (DMH) and 2,4,6-trinitrobenzene acid (TNBS). Animals were randomly assigned to different groups that received basal diet or basal diet supplemented with 5.0% or 7.5% lyophilized AP. The findings indicate: 1) C3R (25 μM) has the potential to reduce RKO cell motility in vitro; 2) ingestion of lyophilized AP reduces the total number of aberrant crypt foci (ACF), ACF multiplicity, tumor cell proliferation and incidence of tumors with high grade dysplasia; 3) AP increases the gene expression of negative regulators of cell proliferation such as Dlc1 and Akt3, as well as inflammation (Ppara). Thus, lyophilized AP could exert a potential antitumor activity.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
match 3 with
3 -> 4
4 -> "Surprise!"
| null |
minipile
|
NaturalLanguage
|
mit
| null |
And courtesy of Feministing, below the cut is the first installment of “Conspiracy Tactics,” a GritTV investigation into astro-turfed anti-abortion campaign centered around the idea of abortion as a genocidal effort against the black community. (Warning: this video includes uncomfortable imagery.)
Race, Culture, and Identity in a Colorstruck World
About This Blog
Racialicious is a blog about the intersection of race and pop culture. Check out our daily updates on the latest celebrity gaffes, our no-holds-barred critique of questionable media representations, and of course, the inevitable Keanu Reeves John Cho newsflashes.
Latoya Peterson (DC) is the Owner and Editor (not the Founder!) of Racialicious, Arturo García (San Diego) is the Managing Editor, Andrea Plaid (NYC) is the Associate Editor. You can email us at [email protected].
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Weekend
Europe
After the recent attacks in Copenhagen and Paris, Europe said never again to homegrown terror. But one European country thinks it could be next. Vocativ takes us to Germany, where hundreds of people have already left to fight with ISIS.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Oct
19
Brit Hume: I grew up in the Episcopal church. I went to an Episcopal boys day school for nine years, and I can still basically recite the Liturgy from the old prayer book of the morning prayer service because we said it every day of the week for nine years at that school where I [...]
Oct
16
Susquehanna County native daughter, Emma Hale’s home is a “sacred place to the church,” Dunford said. “(The project) will not only be to honor Joseph Smith, but also Emma.” “We feel strongly about the history of what occurred here,” said Dunford. Community leaders indicated they thought the development of the site could be a boon [...]
Oct
14
NAUVOO, Ill. — Applications to audition to be a young performing missionary next summer in the Illinois Nauvoo Mission are due Nov. 30. Late applications will not be considered. Each year 20 stage missionaries, two to four tech missionaries and 16 to 18 band members are selected through an audition process, and will receive a [...]
Oct
14
With the cheers of the Republication National Convention still ringing in the ears of the electorate, it’s hard to remember that roughly a year ago, Republican presidential nominee Mitt Romney was like the nerdy middle-aged dad of the Republican Party, someone who made the cool kids roll their eyes and whose presidential potential was exciting [...]
Does Mitt Romney’s Mormonism make him too scary or weird to be elected to President of the United States? via Polygamy? Magic underwear? People on bikes? Glenn discusses Mormon myths in TheBlaze TV special! – Glenn Beck.
Oct
14
We all know the power of music in our lives and feel the Spirit when we sing hymns in church each week. But there are tons of other amazing songs in all of Mormondom, and we need your help to figure out which are THE BEST. Please take just a few minutes to vote for [...]
Oct
6
When most people think of reality shows, they think of drunken fist fights, profanity laced tirades and sexual escapades. But it’s a pretty safe bet that BYUtv’s new reality show — chronicling the gospel-filled adventures of eight real-life Mormon missionaries — won’t follow that formula. via New reality show follows Mormon missionaries | The Salt [...]
Oct
2
Hollywood has never taken to Mormons the way it has with members of many other faiths. Sure, there was "Brigham Young," the epic 1940 Western starring Tyrone Power and Linda Darnell as Mormon pioneers and Dean Jagger as the title character. But depictions like that were few and far between. It took LDS filmmakers to [...]
| null |
minipile
|
NaturalLanguage
|
mit
| null |
= m + -590. Calculate the common denominator of 63/8 and t.
56
Let j(t) = 21*t - 2640. Calculate the smallest common multiple of j(126) and 7210.
21630
Suppose -4*y + 123 + 2429 = 4*r, 0 = -4*r - 5*y + 2552. Calculate the smallest common multiple of 6 and r.
1914
Let b be (-1 - (0 + -1)) + 2 + 25. Suppose -x + 5*j = -b, -4*j = 2*x - 4*x + 24. What is the least common multiple of x and 10*((-3)/(-2) + -1)?
10
Find the common denominator of 732/96 + 8 - 6 and 7/674.
2696
Suppose -17*j + 459 = -1785. Suppose -j*b + 12 = -130*b. Calculate the lowest common multiple of b and 96.
96
Suppose -4*i + 4*j + 22 = 6*j, -5*j = 5*i - 30. Suppose -i*d - 132 = 68. Calculate the common denominator of (2/(-18))/((d/534)/(-10)) and -1/3.
6
Let n be 1 - 0*4/16. Let t(k) = 8*k**3 + 5*k**2 + 7*k - 5. Let y be t(-5). Find the common denominator of ((-8)/(-6)*y/(-40))/n and -32/11.
22
Suppose 12*s - 8*s - 40 = 0. Suppose 0 = 4*n - s*n - 6. Calculate the common denominator of (1 - -18)/n*(-19)/76 and -5/18.
36
Suppose 5*k - 222 = -3*o + 254, -5 = k. Suppose 20*c = o + 153. Calculate the lowest common multiple of 64 and c.
64
Let o = 6 + -8. Let c be ((-2)/(-15))/(544/49640). Let r = o + c. Calculate the common denominator of -35/2 and r.
6
Let w = -65 - -90. Calculate the lowest common multiple of w and (228/16 - 7) + 3/(-12).
175
Suppose 4*f - 6*f = 90. Let x be 4 - (0 + f - -2). Suppose x = j + 2*w - 29, 3*w = -j + 78. Calculate the least common multiple of j and 7.
504
Find the common denominator of 204/714 + (-769)/1932 and 100/(-176) - (-2)/8.
3036
Let x = 295871/96 - 3082. Calculate the common denominator of x and 31.
96
Let k be (-28)/7 + (-616 - 1). Let j be ((-2)/k)/(20/2805). Let g = -1/138 + j. Calculate the common denominator of -54/7 and g.
63
Let r = 13671 + -546737/40. What is the common denominator of r and -23/5112?
25560
Suppose 2946 = t + 2*p, -3*t + 8848 = 58*p - 62*p. Calculate the least common multiple of 187 and t.
50116
Suppose -4*u = 43 + 69. What is the smallest common multiple of 4 and 98/21*(-120)/u?
20
Let t = 324 - 328. Let f(v) = -9*v - 22. Calculate the lowest common multiple of f(t) and 406.
406
Let x = 105041/15680 - -3/3136. Calculate the common denominator of x and -151/1170.
1170
Let t be -4 - (-48)/22 - (-2)/(-11). Let l(g) = -81*g**3 - 5. Let s be l(t). Find the common denominator of 93/14 and s/(-70) + 8*7/196.
70
Let m be (420426/21)/(-4*3/(-84)). Suppose -2*y = -5*k - 140146, -y + 4*k = y - m. Let s = y + -6515926/93. Find the common denominator of s and -45/8.
744
Let q(c) = 2*c**3 - 19*c**2 + 10*c + 21. Let u be q(15). Let p = -170655 + 693151/4. Let h = u - p. Calculate the common denominator of 5/6 and h.
12
Find the common denominator of 2/355 and (-30)/(-25) + (4901/585)/(-29).
3195
Let l = 72 + -59. Let i(w) = w**2 - 10*w - 1. Calculate the least common multiple of (-26)/(-4) + 2/(-4) and i(l).
114
Let u be (-1510)/(-25) - (-3)/(-5)*-1. Let h = u + -55. Let l = 18 - h. Calculate the lowest common multiple of 6 and l.
12
Let l = -81030087/5799328 - -43441/2854. Let n = l + -67/381. Calculate the common denominator of -77/120 and n.
480
Calculate the common denominator of 559/3550 - (-868)/(-10850) and -19/710.
710
Let g = 363 + -246. Suppose g = 3*f + 27. Find the common denominator of (-610)/(-168) - f/45 and -1/20.
140
Calculate the common denominator of 123/970 and (-12*16/60)/(2910/(-375)).
970
Let x(a) = -3*a**3 - a**2 + 6*a + 3. Let n be x(-4). Let u = n - 219. Let v = 80 + u. What is the least common multiple of 10 and v?
80
Let m = 288269/64680 + 4/2695. Find the common denominator of m and 69/1972.
11832
Let o(l) = -4*l**2 - 306*l + 1040. What is the lowest common multiple of o(-65) and 3224?
16120
Suppose -n = -0*l - 2*l - 64, -4*n = -l - 32. Let u = l + 34. Suppose 5*x - 7 = -4*a, -u*x - a = -x - 1. Calculate the smallest common multiple of 10 and x.
30
Suppose n + 24 = 3*n. Suppose -22*g + 4232 = -498. What is the smallest common multiple of g/10 - (5 + 36/(-8)) and n?
84
Suppose 397*n - 103*n - 1176 = 0. Calculate the smallest common multiple of 8756 and n.
8756
Suppose 105 = 9*s + 12*s. Suppose 4*x + 4*z - 36 = 3*x, -x = s*z - 34. Calculate the smallest common multiple of x and 20.
220
Let f = -1/75925 - -1291109/29155200. What is the common denominator of -67/56 and f?
2688
Let u = -2844 + 2854. Suppose c - 35 = 10. Calculate the least common multiple of c and u.
90
Let b = 4098874835420419/34788 - 117824388729. Let o = b + 2/2899. What is the common denominator of ((-1)/(-10))/(29638/3290 - 9) and o?
12
Suppose 20*o = 18*o + 2*a + 1476, 4*a + 28 = 0. What is the lowest common multiple of 7 and o?
5117
Let g(l) = -4*l**3 - 4*l**2 - 9*l - 18. Suppose 0 = 8*q - 0*q - 792. Calculate the lowest common multiple of q and g(-3).
891
Calculate the common denominator of ((-2)/(-5838))/((-231)/(-198387)) + (-50)/175 and 73/1112.
12232
Suppose 39*n = 3614 + 4342. Let j = n - 201. Calculate the least common multiple of j and 3.
3
Let l = -16/937 - 1400783/1874. Let r = l - -720. Let b = 10/1019 - 94967/20380. Calculate the common denominator of r and b.
20
Let y = 459 + -399. Suppose y = -2*l + 64. Suppose j - 54 = -5*d, -3*d + 5*j + 30 = 2*d. What is the smallest common multiple of d and l?
10
Let o = -2403 - -2408. Suppose k + 1 = -2*s, 2*s + 12 = -2*s. Suppose -k*n = -r + 24, 5*r + 6*n = 2*n + 4. What is the least common multiple of o and r?
20
Suppose -6*t - 142 = -1756. Suppose -3 = k + 1, -o - k = t. Calculate the common denominator of -17/18 and (-4 - o/140)*-2.
126
Suppose -68*i + 77*i = 405. What is the smallest common multiple of i and 0/1 + 2 + 53?
495
Let l(s) = -109*s**3 - 2*s**2 + s - 1. Let b be l(-2). Let r = -18118/21 + b. Calculate the common denominator of 13 - 65*(-330)/(-2340) and r.
42
Let a = -15429/8 + 1931. What is the common denominator of (-1 + 125/4)*12/(-72) and a?
24
Let f(y) = 38*y + 72. Let v be f(-2). What is the smallest common multiple of 18 and (17 + -11)*(-2)/v?
18
Let d = 110 - 636. Let p = 614 + d. Calculate the lowest common multiple of p and 77.
616
Let l be (-142)/18 + 1/(-9). What is the least common multiple of (11 + l)*(-176)/(-6) and 14?
616
Let s be (-40)/(-5)*(6/(-8))/(-1). Calculate the lowest common multiple of -1 + 2*37/2 and ((-294)/(-18) - 8/s) + -3.
36
Suppose 20*o - 17*o = 3. Let t be o/(-4)*0/5. What is the lowest common multiple of -10*(7/(-5) + -3) - t and 3?
132
Let h = 685/38 + -6305/608. Let v = h - 965/96. Find the common denominator of 9/22 and v.
528
Let c = -945637370 + 45392652235/48. Let j = -42888 + c. Calculate the common denominator of -29/18 and j.
144
Let s = 41942 - 41900. Calculate the lowest common multiple of s and 1491.
2982
Let s = 1194098303/7110 + -9271111/45. Let b = s + 38078. What is the common denominator of b and -91/10?
790
Let q be 3/(-4) + (-1)/4 - -4. Suppose -q*u - 69 = 63. Let m = u - -66. What is the lowest common multiple of 24 and m?
264
Let k = 30935829/680 - 45494. Find the common denominator of k and 19/2210.
8840
Let l(g) = -29*g + 15. Let s be l(14). Let x = s - -393. What is the smallest common multiple of x and 99?
198
What is the lowest common multiple of (0 + 1)/((16/(-442))/(-8)) and 117?
1989
Let j be 1314785*(4731/945 + -5). Let u = -8349 + j. Find the common denominator of u and 37/14.
126
Let j = -76 + 280. Suppose -43*z - j = -49*z. Suppose o - 1 = 6. What is the lowest common multiple of z and o?
238
Calculate the common denominator of -11/1212 and ((-214871)/322392 + (-14)/(-21))/((-1)/46).
8484
What is the common denominator of -9/17 and (-4)/34 - ((-1)/544)/((-234)/1820)?
2448
Let k = -359513/51 - -7049. Calculate the common denominator of k and -3 + (0 - 285/(-72)).
408
Let k = 95 + 94. Let s = -166 + k. What is the lowest common multiple of 11 and s?
253
Calculate the common denominator of -1/814 and (-23)/((32/8)/(2/(-296))).
6512
Suppose 0*m - 258 = 5*m + 3*y, -4*m - 208 = 4*y. Find the common denominator of 6*(-38)/m - 2 and ((-9)/30 - -1)*(-279)/63.
170
Let w(i) = 3*i**2 - 9*i - 39. Let g = -2 + -1. Calculate the smallest common multiple of 35 and w(g).
105
Let f(r) = 20*r - 240. Let o be f(24). Calculate the common denominator of -19/144 and (-74)/o - (-34)/340.
144
Suppose -4*j - 15 = -5*d - 7
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Oyster Bay Regional Shoreline
Oyster Bay Regional Shoreline is a park in San Leandro, California, part of the East Bay Regional Park District (EBRPD). It is located along the eastern shore of San Francisco Bay directly to the south of Oakland International Airport. The property was originally used as a landfill for 37 years, until it was filled to capacity in 1977, when it was capped with a clay cover. EBRPD bought the property in 1980, intending to use it as a park.
History
The property now known as Oyster Bay Regional Shoreline was originally used as a landfill, but that operation closed in 1977. EBRPD bought the site in the early 1980s, intending to someday develop it into a park. Since then, the park district has imported clean soil to ensure that the former landfill would meet the requirements for adequate cap and surface drainage to minimize infiltration. Having done this, EBRPD has allowed passive recreational activities (such as "...dog walking, hiking, and picnicking while converting the site into parkland for the future development of active recreation areas such as disc golf and bicycle skills, and to provide parking within the park").
EBRPD's directors approved the Land Use Plan Amendment (LUPA) adopted the Mitigated Negative Declaration (MND) for Oyster Bay Regional Shoreline on December 17, 2013. LUPA guides, "... the future development of Oyster Bay Regional Shoreline including a new primary access and parking, formalization of the trail system, resource management, a bicycle skills area, a disc golf course, and a dedicated off-leash dog area. The MND analyzed the potentially significant environmental impacts that could result from implementation of the LUPA and adopted mitigation measures to ensure that environmental impacts remain at a less than significant level.
General description
The main entrance to the park was at the end of Neptune Boulevard, off of Marina Boulevard. As of 2014, EBRPD had begun construction of a second park entrance on Davis Street.
There are seven non-reservable picnic areas along the multipurpose interior trails. The interior trails lead to a viewing site near the middle of the park that is marked by a sculpture named "Rising Wave. The long San Francisco Bay Trail is paved from the Neptune Drive entrance to the Bill Lockyer bridge. According to Todd's article, dogs using paved trails (which applies to a segment of the Bay Area Trail and a nature walk), but unleashed dogs are allowed to use only unimproved and unpaved trails.
Oyster Bay Regional Shoreline Loop is a long trail in the park that can be used by dogs. It is rated good for all skill levels, and even has a water fountain along the route that also is accessible by dogs.
Notes
References
See also
"2016 Opportunity Fill for Development of the Land Use Plan Amendment." Oyster Bay Regional Shoreline.
San Leandro Oyster Beds
Interpretive brochure.
Category:East Bay Regional Park District
Category:Parks in Alameda County, California
Category:Regional parks in California
Category:Parks in the San Francisco Bay Area
Category:San Francisco Bay Trail
Category:Protected areas established in 1980
Category:1980 establishments in California
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Firaxis Takes To The iOS Skies With Sid Meier's Ace Patrol
From creating empire simulations to fending off alien invasions, Firaxis and Sid Meier have created some of the most beloved strategy titles. Now, the man behind Civilization is bringing his skills to strategic air combat in Sid Meier's Ace Patrol for iOS.
The title features 30 World War I aircraft and over 120 missions through which players can developer their squadron of pilots. In addition, the title features single-player, local multiplayer, and asynchronous competitive play via Game Center. Sid Meier's Ace Patrol will be free to download in the iOS App Store on May 9, 2012. In-app purchases will enable more campaigns and customized or upgraded items, including special aircraft.
This is the second Firaxis title to be slated for release this month. The first, Haunted Hollow, is a strategy title featuring an assortment of monsters. It will arrive on iOS tomorrow, May 2, 2013.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A list of other Republican assassination targets was found on the miserable carcass of Democrat poster boy James T. Hodgkinson
Photo, above: Rep. Jeff Duncan (R-SC) rolls up his pant leg to reveal a Trump sock at an event where U.S. President Donald Trump signed an executive order to expand drilling for oil at the White House in Washington, U.S., April 28, 2017. REUTERS/Kevin Lamarque – RTS14D12
The love and tolerance of the left never cease to amaze. We now learn that when Democrat poster boy James T. Hodgkinson’s assassination attempt was nipped in the bud, a list of other intended Republican assassination targets was found on his miserable carcass.
James T. Hodgkinson, the shooter who opened fire on dozens of Republican congressmen and staffers at a baseball practice in Alexandria, Virginia, on Wednesday, had a list of Republican names in his pocket that was recovered by the FBI, The Daily Caller has learned.
The news that the shooter had a list of names suggests the shooting was not a random outburst, but instead appears to be a premeditated political assassination.
The list was written out on notepad paper and found in the shooter’s pocket, according to multiple sources with intimate knowledge of the situation, who spoke on condition of anonymity, citing the sensitivity of the investigation. The list of names included Alabama Rep. Mo Brooks, South Carolina Rep. Jeff Duncan and Arizona Rep. Trent Franks, TheDC has confirmed.
The FBI has contacted at least one of the three congressmen to inform them of their inclusion on the list. Rep. Franks confirmed to Fox News that law enforcement officials have told him he is on the list.
“For those still wondering, he didn’t hate baseball or beautiful summer mornings in June,” White House counselor Kellyanne Conway said in reference to this article. “He hated Republicans.”
None of the three offices would offer comments on the record when asked about the names on the list. Brooks and Franks’ office further directed all inquiries to the Capitol police, who declined to comment. The FBI’s Washington field office, which is handling the investigation, also provided no comment, citing the ongoing investigation.
All three representatives are members of the House Freedom Caucus, which contains the lower chamber’s most conservative members. Both Duncan and Brooks attended Wednesday’s baseball practice.
U.S. Rep. Mo Brooks (R-AL) talks to reporters after a gunman opened fire on Republican members of Congress during a baseball practice near Washington in Alexandria, Virginia, U.S., June 14, 2017. REUTERS/Joshua Roberts – RTS172FJ
Duncan said he spoke with Hodgkinson briefly before the shooting, when the would-be assassin asked him in the parking lot if the players on the field were Republicans or Democrats. Duncan said he answered that the players were Republicans, before leaving the field. Brooks was still present on the field when Hodgkinson began shooting with a rifle, wounding four people including House Majority Whip Steve Scalise. The gunman died after being shot by a member of Scalise’s security detail.
The FBI also recovered a cell phone, a computer and a camera in the shooter’s van and is processing the items, according to a statement the agency issued on Thursday.
A 66-year-old progressive who volunteered on Vermont Sen. Bernie Sanders’ campaign, Hodgkinson’s social media profile was filled with violent-sounding rhetoric against the Republican Party. “It’s Time to Destroy Trump & Co,” Hodgkinson wrote in one post. He also belonged to several anti-GOP groups on Facebook, including one called “Terminate The Republican Party.” The members of that group celebrated Hodgkinson’s mass assassination attempt.
Ex-Army officer and stone-cold patriot, Thomas Madison is on a mission to contribute in any and every way to the restoration of and strict obedience to the United States Constitution, that divinely-inspired, concise, intentionally and specifically broad (wrap your head around that oxymoron) blueprint which has gifted the world with the concept and realization of individual liberty and unlimited prosperity.
We, as a nation, have lost our way. We have spent the past one-hundred years attempting to fix what was never broken. As with building anything, when you can't figure it out, consult the blueprint. So too with rebuilding America, the blueprint for which is the United States Constitution.
Leave a comment
We have no tolerance for comments containing violence, racism, vulgarity, profanity, all caps, or discourteous behavior. Thank you for partnering with us to maintain a courteous and useful public environment where we can engage in reasonable discourse.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Magnetic materials suitable for use in relays, ringers, and electro-acoustic transducers such as loudspeakers and telephone receivers characteristically exhibit high values of magnetic coercivity, remanence, and energy product. Among alloys exhibiting such desirable properties are Al-Ni-Co-Fe and Mo-Co-Fe alloys as mentioned, e.g., in U.S. Pat. No. 2,506,624, issued May 9, 1950 to R. E. Wirsching. More recently, alloys comprising Fe, Cr, and Co have been investigated with regard to potential suitability in the manufacture of permanent magnets. Specifically, U.S. Pat. No. 3,806,336, issued Apr. 23, 1974 to H. Kaneko et al., discloses high-cobalt ternary Fe-Cr-Co alloys. Quaternary alloys comprising elements such as, e.g., Nb or Ta in addition to Fe, Cr, and Co are disclosed in U.S. Pat. No. 3,954,519, issued May 4, 1976 to K. Inoue; alloys comprising fourth elements Zr, Mo, Nb, V, Ti, or Al are disclosed in U.S. Pat. No. 4,075,437, issued Feb. 21, 1978 to G. Y. Chin et al.; and lower-cobalt ternary alloys are disclosed in a U.S. patent application by S. Jin, Ser. No. 92,941, filed Nov. 9, 1979 now U.S. Pat. No. 4,253,883.
Powder metallurgy processing of Fe-Cr-Co magnets is disclosed in a U.S. patent application by M. L. Green and R. C. Sherwood, Ser. No. 123,691, filed Feb. 22, 1980.
Magnets are typically mass produced; as a result, final cost is largely determined by cost of raw materials. And, since cobalt has become increasingly expensive as a constituent in Fe-Cr-Co alloys, final cost is strongly dependent on amount of cobalt.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Michael Jordan’s 1984 Olympic Game Shoes Sold for a Record $190K USD
Michael Jordan’s Converse sneakers that he wore during the 1984 Olympic gold-medal game against Spain recently sold at auction for a record $ 190,373 USD — the highest-selling price for game-used sneakers in history.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How to order by just the Time Field in Advanced Custom Fields
I'm using Advanced Custom Fields to create a class schedule. I need to get the time field to sort correctly to display the class schedule in the correct order. Currently it is not, and I don't understand what I need to do to get it sorting correctly.
Here is the live link: http://studio34yoga.com/yoga-movement/class-schedule/ You can see on Monday that the classes are not in the correct order. "start_time" is my time picker field that I am hoping to sort on. What follows is an abridged version of my PHP code. Any help is appreciated.
<?php
$args = array( 'post_type' => 'Classes', 'posts_per_page' => 70, 'meta_key' => 'start_time', 'orderby' => 'meta_value_num', 'order'=>'ASC' );
$loop = new WP_Query( $args );
while ( $loop->have_posts() ) : $loop->the_post();
if(get_field('day') == "2monday") :
{
echo '<div class="class"><span class="class-time">';
echo get_field('start_time');
echo ' - ';
echo get_field('end_time');
echo '</span></div>';
}
endif;
endwhile;
?>
A:
It looks like the times are being stored as plain text strings like "10:00 am - 12:00 pm" which will be pretty impossible to sort correctly during your wp_query call.
Try the date and timepicker add-on and it should allow you to store in a sortable format. You can use it for only times and not dates. Then if you need a time range, you can have "start_time" and "end_time" and then sort by "start_time".
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Governor’s Marijuana Justice Initiative provides expedited process to clear conviction records for thousands of Washingtonians
Tony Kurek has been in recovery from drug addiction for 13 years. Today, he is a pastor and a pillar of his community. He and his wife are deeply involved with helping the homeless in Kitsap County, even opening up a nonprofit house for poor and low-income women and men. But years ago, Kurek’s life was a world away. He was abusing marijuana, methamphetamines, cocaine and other drugs. He struggled for over a decade with addiction, and in his early thirties was charged and convicted with a misdemeanor for marijuana possession.
Kurek and his wife fought for years to get their life on track. The stigma of his drug conviction followed them at every turn. He describes his misdemeanor as a bag of rocks tied around him.
“I own my decisions,” Kurek said discussing his path. “But once we got into recovery we found it very difficult to shake the mistakes of my past.”
As they worked toward getting back on their feet, Kurek and his wife found themselves homeless for over a year. They had opportunities to move into different places but the landlords would pass them over due to the conviction. They struggled to find work and even lost their children for a period of time.
Gov. Inslee speaks to reporters after announcing his Marijuana Justice Initiative. (Office of Governor photo)
Justice for past misdemeanor convictions
The behavior that landed Kurek with criminal prosecution is no longer considered a crime in Washington. Although he admits he made a lot of mistakes, possessing a small amount of marijuana for personal use is no longer illegal for adults within this state.
Today Gov. Jay Inslee announced his Marijuana Justice Initiative to provide pardons for certain individuals who have convictions on their record for misdemeanor marijuana possession.
“We shouldn’t be punishing people for something that is no longer illegal in Washington state,” said Inslee, who announced the initiative today at the Cannabis Alliance’s annual conference. “Forgiving these convictions can help lessen their impact and allow people to move on with their lives. It’s a small step, but one that moves us in the direction of correcting these injustices.”
VIDEO: Inslee announces Marijuana Justice Initiative at 2019 Washington Cannabis Summit
Gov. Inslee speaks to a group at the Cannabis Alliance annual conference in Seattle. (Office of Governor photo)
Marijuana possession misdemeanors are considered unfair because the behavior would not be illegal today and they disproportionately affect communities of color. These misdemeanor convictions can be over a decade old, but still create barriers to housing, employment, student loans, credit scores and even the ability to participate in a child or grandchild’s school field trip. A pardon of a marijuana possession conviction can reduce these barriers.
Under this initiative, Inslee will exercise his constitutional clemency authority to pardon individuals who have a single conviction on their criminal record. That sole conviction must be for an adult misdemeanor marijuana possession, prosecuted under state law in Washington. And, the conviction must have occurred between January 1, 1998 and December 5, 2012, when I-502 legalized marijuana possession.
Giving people a hand up as they make a better life
Kurek thinks the initiative will be a great tool to help people on their road to being better. He shared that a pardon for his misdemeanor conviction — even years later — would have a very positive impact on his life.
“It would give me the sense of freedom that I wouldn’t have to explain myself every time it comes up. It would be a great relief to not have to discuss it or defend myself for the mistakes I made in the past. Clearly, I’m not making those mistakes anymore.”
Those who have an adult misdemeanor marijuana possession and believe they qualify for a pardon can submit a petition online. Once the Office of the Governor reviews the case and confirms they are eligible, Inslee will pardon the conviction and ask Washington State Patrol to remove the offense from the criminal history report that is available to the public.
Pardoning misdemeanors for marijuana possession brings Washington one step closer to correcting injustices and modernizing the way the state manages marijuana. Records indicate that the Marijuana Justice Initiative could pardon misdemeanors for about 3,500 people. This will help people move on from a past mistake and toward a better life.
“My life is really, really good,” Kurek said reflecting on the initiative. “But I’m sure there was a shorter road than the one I took. I believe an initiative like this will make it easier for a lot of others to get to recovery.”
Visit the Marijuana Justice Initiative webpage: www.governor.wa.gov/marijuanajustice
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Smile Gallery
Check back frequently for new images of dental treatments and smile makeovers. We will be posting images of the dental work Dr. Travis Coulter and our team have performed here at Coulter Family Dentistry.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Ranked Florida's BEST community weeklyby the Florida Press Association.
Parking limits adjusted
By Lisa Neff, Islander Reporter
New signs are up on Bridge Street, where the city has adjusted its parking restrictions.
The Bradenton Beach City Commission unanimously voted last month to set a three-hour limit on public spaces on Bridge Street and put the enforcement period from 9 a.m. to 6 p.m. The prior limit was two hours.
Parking in the area has long been an issue. Over the years, business owners and city officials have considered a variety of ways to expand parking opportunities or reduce the need for parking spaces.
Most recently the focus has been on reconfiguring city-owned property between Highland and Church avenues to provide more public parking spaces, probably for employees in the area, and creating a park-and-ride shuttle system from Cortez and Coquina beaches to Bridge Street.
Additionally, city officials and members of the Bridge Street Merchants have discussed stepping up enforcement of public parking regulations on Bridge Street, while increasing the time limit.
The commission, in addition to adjusting the time limits, instructed the police department to “issue citations to any person parking on Bridge Street in excess of three hours.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Where can I find the pending amount from invoices in DynamicsAX Database?
This is what I already know, Tables for open invoices:
"CustTransOpen"
"CustInvoiceJour"
"CustTrans"
I've been working on this for a while without a clue, there must be a way to get the pending amount or at least to know if these invoices have been paid.
I already looked on all the Microsoft documentation with no success, hope you can help me.
A:
This is the AX Query to get the open balance in MST for a customer. To do it in SQL, you can rewrite it and/or at least use this to maybe get towards what you want.
This code originates from \Data Dictionary\Tables\CustTable\Methods\openInvoiceBalanceMST in AX.
this below refers to CustTable
while select sum(AmountMST) from custTransOpen
where custTransOpen.AccountNum == this.AccountNum
&& custTransOpen.TransDate >= _fromDate
&& custTransOpen.TransDate <= _toDate
exists join custTrans
where custTrans.RecId == custTransOpen.RefRecId
&& (custTrans.Invoice != ''
|| (custTrans.Invoice == '' && custTrans.AmountMST > 0))
{
openBalanceMST += custTransOpen.AmountMST;
}
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Over the Easter Holidays, we were sitting in the living room with some friends we hadn't seen in awhile. As we ate and chatted, we heard loud laughter coming from the gaggle of children in the next room. A few moments and a thundering of hooves later, in comes Freya Goat to say hello.
I wish I could have told my friends that this was a one off, that some random and unavoidable set of circumstances out-with our control led to there being a large hooved animal busting up our dinner party, nibbling the oat cakes and that such a thing had never happened before. In fact, I probably said as much, covering my embarrassment the best I could. The truth of the matter is that probably only 12 foot high deer/prison fencing could keep that goat in and most days are spent playing the delightful game of "where's the goat" with the "where" frequently being "in the kitchen".
When we embarked on goat keeping a year ago, I don't know what I expected. I'd read the books, scoured the blogs, posted on the forums and felt that I had enough of the basics to get us started. A year on, I've learned a few things:
Keeping a dairy animal is a commitment. When we first got the goats, we were milking twice a day. This meant that someone always needed to be here at 7am and 7pm. While Kevin has the milking itself to about 15 minutes, our plans always had to include someone being at the house for milking. We've since cut the evening milking but still in the last year, neither of us have been able to go away at the same time. We do have a friend who will milk for us if we ever do go out, but it's a big ask.
Using up the milk is serious business. Other than the endless task of getting her and her crazy companion into the field, the single biggest task is figuring out a way to use all the milk. Our single Saanen goat, Dascha, produces about 3 litres of milk a day. While cereal and coffee uses up a fair chunk of milk, we frequently end up with a refrigerator full of milk in ever available receptacle we have. As we are not a licensed dairy, I can't sell any of the milk or cheese and it is not uncommon that the milk goes straight to the chickens.
Cheese making makes friends. In the last year, I have perfected goat's curd, yoghurt, halloumi and mozzarella. You have not had goat's cheese until you have had farm fresh, small batch cheese. It is simply the best cheese you will ever taste and I am 99% sure most of the time I am invited over for dinner because my host gift is usually half a kilo of goat's curd.
Goats are trouble. Other than the constant struggle of keeping Freya in her pen, goats are wiley. They know where the corn for the chickens (aka Goat Crack) is kept and how to open the barrel if it is even slightly ajar. They know which plants they shouldn't eat and go straight for them every time. Freya knows that if she leans on me in a certain way, I will absolutely give her a scratch just the way she likes it. They are forever on the lookout for a way to get out or get food and usually both. Kevin and I often say that the goats are like large cats. But with horns.
In our homesteading journey, goats are the biggest step in our food independence. While we raise our own food because of big and noble reasons - health, environmental, etc, there is also a level of practicality to it all, I just really hate going to the store. Having milk on tap means more of our food can come straight from here.
Finding a Billy is a Bit of a Problem. Dascha has been in milk for about 2 years, so she will need to be put to a billy this year if we are going to keep her in milk. This is a slightly daunting task, and one we haven't decided on. All of the options come with some negatives. We would happily keep a billy, but they can be aggressive and smell bad, plus the presence of a billy on the farm can taint the milk. Transporting the goats is another option, but we don't have animal transport and would need to get help, plus a slew of medical tests to insure the health of our herd. So, watch this space.
A year on, bringing our goats home has been the best decision, not without its downsides, but overwhelmingly positive.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
using "for" loop read a file line by line continuously by considering each line as a input
Consider a file.txt file with below values
one,two
three,four
five,six
six,seven
red,tree
Need a shell script command to perform below activity
For loop in which the loop should be continuously executed with as many number of lines the file.txt has
In each loop execution, the respective line should be considered a input for the execution.
For example, in first loop execution, "one" should be stored in a variable and "two" should be stored in another variable so that it will use the variable values in execution
Input1="one"
Input2="two"
Similary for second line execution, "three" should be stored in a variable and "four" should be stored in another variable like below
Input1="three"
Input2="four"
A:
while IFS=, read -r input1 input2; do
# do stuff with "$input1" and "$input2"
done <file.txt
Setting IFS to a comma for the read command will make it split each input line on commas. The two fields of the line will be read into input1 and input2.
If there are more fields than two on any line, the "left over" data will be put into input2.
Depending on what you want to do with the data, this may or may not be a good idea at all. See Why is using a shell loop to process text considered bad practice?
You will notice that awk is particularly useful for parsing data like this, without the need for a loop:
$ awk -F, '{ printf("Line %d:\n\tField 1 = %s\n\tField 2 = %s\n", NR, $1, $2) }' file.txt
Line 1:
Field 1 = one
Field 2 = two
Line 2:
Field 1 = three
Field 2 = four
Line 3:
Field 1 = five
Field 2 = six
Line 4:
Field 1 = six
Field 2 = seven
Line 5:
Field 1 = red
Field 2 = tree
A:
It's unclear what you're asking. Why do you need the whole file in each iteration.
Do you need this?
while IFS=, read -r Input1 Input2; do
# do something with the variables
echo "1=$Input1 2=$Input2"
done < file.txt
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Sweden wants to detain rapper A$AP Rocky after street fight
July 4, 2019
COPENHAGEN, Denmark (AP) — Swedish prosecutors say U.S. rapper A$AP Rocky should be formally arrested over a fight in downtown Stockholm and should be held for two weeks while police investigate the case.
The Swedish Prosecution Authority says the rapper, whose real name is Rakim Mayers, and two of his body guards should be arrested because “there is a risk that they escape (or) could obstruct justice if freed.”
The authority said a third body guard was released late Wednesday and the case against him was dismissed.
Swedish media reported that the rapper was involved in the fight on Sunday before he appeared at a music festival in Sweden. It was not clear who else was involved in the incident.
Prosecutors said Thursday a detention hearing would likely be held Friday.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Intestinal malrotation without volvulus in infancy and childhood.
Intestinal malrotation without volvulus in infants and children is often difficult to diagnose because of less dramatic clinical features, e.g. failure to thrive and intermittent bile stained vomiting, compared to the patients with volvulus. A plain x-ray of the abdomen may show the characteristic "double bubble sign", otherwise a barium meal will give the diagnosis. A follow-up study of 18 patients of whom 14 had an operation showed that all but one were free of symptoms after a median observation period of 205 months (range 20-317). It is concluded that any patient presenting with a symptomatic intestinal malrotation should be offered an operation except for the type with a mobile caecum.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Vermin Endorsement
It’s been a weird election cycle to say the least. What has been at times the most comical, sensationalized, and tawdry of elections is kept in check by the daily reminder of how truly significant it remains. For the most part, PressureLife has stayed out of the political fray, but things are getting weird. With fewer than 100 days left before Election Day in November we can no longer waffle along the sidelines. It is from the desk of our own Weekly Politic that PressureLife releases its very first political endorsement for…
VERMIN SUPREME!
Yes, the guy with fishing boot on his head. No, wait, where are you going? We’re serious. Sort of.
In an election year where politicians can withhold endorsements of their party’s own candidate while still vowing to vote for him, we at PressureLife are doing the exact opposite! We know how important your vote is and respect your decision no matter your choice. While we at the office may be voting otherwise, PressureLife is proud to endorse Vermin Supreme for President of the United States of America.
While other politicians are content on dividing America, Vermin Supreme will take anybody’s help—and we do mean anybody. While other candidates are out on the campaign trail deceiving America, Vermin Supreme merely promises each and every citizen their very own pony. Other nominees offer tough talk on defeating Daesh; Vermin Supreme is the only candidate that has made it a campaign promise to go back in time and kill Adolf Hitler once and for all. While we hope to get Vermin Supreme at the Weekly Politic desk to discuss his controversial proposal involving a secret Tooth Brush Patrol, which hypothetical critics have panned for its Orwellian undertones, the Tooth Gestapo is evidence of Vermin’s commitment to clean teeth and healthy gums.
When the Republican National Convention came to town it brought with it delegates, police, protesters, sightseers, tourists, vendors, and activists, each with their own angle and point to make. Tensions ran high, tempers flared. Only one candidate for the presidency walked amid his constituency without a single armed guard. Only one candidate was livestreamed on Facebook standing between a row of black-clad police officers and rowdy protesters. Only one candidate urged both sides to consider de-escalation and called for mutual respect. When reason failed, only one candidate permitted himself the selfless act of playing the fool so that others could find laughter at a trying time. That candidate may have worn a fishing boot on his head, but, in all sincerity, we firmly believe that Vermin Supreme willfully helped avert potential violence in the streets of Cleveland during the RNC.
Vermin Supreme peddles in that same rarified archetype as the tarot’s Fool. He speaks with the council of a court jester’s limericks. His own surreal insanity is the clearest portrait offered to the public of an American Elections gone off the rails. His non-sequitur existence is the non-campaign we deserve after giving the opinions of vapid celebrities consequence. From one bunch of weirdos to another, PressureLife celebrates the candidacy of Vermin Supreme, fully endorses him for President of the United States, and wishes the rest of our options were more supreme and less…them.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Each of us are in recovery, whether that be from: mental illness, substance abuse, abusive relationships, homelessness, etc. Whatever the situation, lets be an example to others that we can and do overcome tough situations by sharing our testimonies... Here is mine...
1 comment:
Significant details on website Xanax pharmacology reveal that the anti-anxiety drug xanax contains Alprazolam as the chief component which is further composed of a triazolo 1, 4 benzodiazepine analog units. However, striking pharmacological tidbits on xanax also make it apparent that the medicine belongs to the benzodiazepine class and is a triazolobenzodiazepine. For more information on xanax pharmacology as well as on various other issues related to the medicine, visit the website http://www.xanax-effects.com
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Impact on weight dynamics and general growth of the common FTO rs9939609: a longitudinal Danish cohort study.
We investigated the impact of the fatness-related FTO rs9939609 A-allele on cross-sectional and longitudinal measures of body mass index (BMI), height and lean body mass (LBM) in a unique cohort representing a broad range of BMI. A random sample of all men attending the Danish draft boards during 1943-1977 plus all men with a BMI>or=31.0 kg/m(2) (assuring representation of the right end of the distribution) was taken. Anthropometric measures were available at up to eight points in time from birth to adulthood in 1629 genotyped men. The odds ratio (OR) for being a carrier of FTO rs9939609 according to (1) one unit alteration in z-scores for BMI, height and LBM at given ages and (2) longitudinal changes in BMI and height z-scores were assessed by logistic regression. Except at birth, the AA genotype was associated with increased BMI z-scores at all point during the monitored lifespan, starting at the age of 7 years. This effect remained stable until early adulthood, where further weight gain occurred. The AA genotype was also--mainly through the effect on fatness--associated with accelerated linear growth in childhood (age 7 years; OR, 1.36; 95% confidence interval (CI), 1.06-1.74) and increased LBM in adulthood (OR, 1.24; 95% CI, 1.14-1.35). Fatness induced by FTO rs9939609 in early childhood is sustained until early adulthood, where further weight gain may occur. FTO rs9939609 may, however, also be associated with linear growth and LBM mainly through the effect on fat mass.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Reliability and Feasibility Considerations in the Assessment of a Malodor Adaptation Technique: A Pilot Study.
Research often links barriers to optimal human performance of a complex medical task to malodor exposure. Olfactory adaptation, or desensitization to an odorant, may ameliorate performance degradation. Olfactory adaptation is traditionally measured by detection threshold and perceived intensity. Nontraditional measures including stress, confusion, and escape behavior may better reflect impacts on performance but face validity concerns. This article describes a pilot study undertaken to determine what measurements and techniques are best suited and logistically feasible to explore olfactory adaptation with respect to performance of a relevant task. Results of the pilot study confirmed validity of selecting an experimental adaption period a length of time between two previously published results. The study also validated traditional detection threshold and perceived intensity measures and data collection techniques. Electrodermal activity data, a nontraditional measure of stress, proved more promising than inconsistent heart rate or blood pressure. Nontraditional measures of confusion/bewilderment also produced inconsistent outcomes. Perceived workload data were collected for timing purposes; a more homogeneous population may produce more significant results. While preliminary results indicate adaptation may contribute to better complex task performance, follow-on research may proceed using traditional and newly validated measures with the number of subjects necessary to provide statistical confidence.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Semi-automated catecholamine assay.
Three semi-automated procedures are described for the estimation of the catecholamine contents of urine, tissue and plasma samples. The three procedures are based on the fluorometric tri-hydroxyindole assay which has been modified for automatic analysis. These techniques offer several advantages over currently available assays in that they are more convenient, provide for faster analysis rate and give increased sensitivity. The results of the present studies in which the catecholamine contents of urine, tissue and plasma samples were determined using the semi-automated assay provided a range of values which was identical to that obtained using other methods.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Black women have a long history of advocating for fair wages and access to decent employment opportunities for African-American communities. In her recent remarks at the Academy Awards championing the fight against wage inequality, Patricia Arquette seemed wholly unaware of these histories, elaborating backstage that it was now time for all other groups to fight for white women, because they had fought for everybody else.
In 1920 or thereabouts, famed Washington, D.C., educator Nannie Helen Burroughs helped to found the National Association of Wage Earners as both an advocacy group and a training resource for working class black women. Addressing employment inequality and wage inequality for newly freed black women entering the workforce after Emancipation, and later for black women from the South who had migrated North, was a hallmark of black women’s organizing in the late 19th century and the early 20th century. At the Chicago World’s Fair in 1893, Fannie Barrier Williams, a socialite, club woman and budding political theorist told the crowd, “in the item of employment, colored women bear a distressing burden of mean and unreasonable discrimination.” Still, she told them, “we believe this country is large enough and the opportunities for all kinds of success are great enough to afford our women a fair chance to earn a respectable living.” In 1925, Gertrude Elise McDougald, an organizer and teacher in New York City, helped to found the Trade Union Committee for Organizing Negro Workers, in order to encourage African-American solidarity with labor and discourage strike-breaking as the pathway to work.
Advertisement:
It also bears noting that Fannie Barrier Williams gave her 1893 speech to an audience of white women. It was she urging them to become black women’s allies in the quest for fair employment practices and a living wage. So I am left wanting to ask Patricia Arquette where all the white women who’ve been fighting for every other group of marginalized people are, because some of the most prominent black women organizers in history spent a fair amount of time trying to compel these women to be in solidarity. Notwithstanding the utter absurdity of her claim, her remarks demonstrate a point I made in an earlier column: “white women’s feminisms still center around equality…Black women’s feminisms demand justice.”
Earning the same paycheck as one’s male counterpart is only the tip of the iceberg when it comes to addressing wage inequality. For there are also issues of access, fair treatment and evaluation, and opportunities for promotion, alongside receiving fair and equal pay. There is also the matter of whether earning equal wages translates into wealth. As a 2010 study illustrated, black women have $100 and Latinas have $120 of median net wealth for every $41,500 that white women have. So even though Latina women and black women earn between 54 percent and 64 percent, respectively, on every dollar a white man makes, somehow we manage to save even less of that money or turn it into wealth.
Taken together, addressing these matters demands not an equality framework but a justice framework, one that is infinitely more concerned from bottom to top with the way that workers are treated within systems, the conditions under which they work, and equitable compensation that they receive.
Advertisement:
When white feminists attempt with, what I imagine in Arquette’s case, the best of intentions to be political, and then fail, there are two imagined proper responses from black feminists. One is to look past all that is wrong with what has been said, offer our fellow feminist the benefit of the doubt, and elevate the good. Never mind that impact matters infinitely more than intention. If white women meant well, that should be enough. The other demand is for black feminists to don the angry, indignant black feminist cape and proceed in a show of eloquent rage to get the errant white feminist in check.
Though I’m pretty terrific at eloquent rage, I’m not going to do either. I will not ignore Arquette’s ridiculous backstage comments about what other groups – men, gays and people of color—owe to white women freedom fighters. She said, “And it's time for all the women in America and all the men that love women, and all the gay people, and all the people of color that we've all fought for to fight for us now." I will not pretend that her remarks did not ever so slightly piss me off. On the other hand, I will not expend my intellectual labor retreading the well-worn ground of intersectional feminism. Since 1982, we have known what is problematic about assuming that “All the women are white, and all the blacks are men.” I opt instead to do this labor in my classroom, where I teach graduate students, enamored with academic calls to become “post-intersectional,” of the obvious Arquettian pitfalls of such a position.
If among feminists, black women are always asked to do the uncompensated labor of educating white women about how they have effed up, is this also not a form of wage inequality? Are these not also the wages of race at play? Some of my academic colleagues of color call this “the black or people of color tax” -- the extra, and often unacknowledged labor, time and resources we give to institutions, that our white colleagues don’t have to do and for which we are uncompensated, in order to help struggling students of color navigate our institutions and insure diversity at the levels of faculty and administration.
Advertisement:
If I ramp up my cortisol levels to express my anger and hurt at white women for failing once again to get it, is that not a tax and toll on my health that I pay either in future medical bills or in years unlived?
If I call out Arquette for failure to acknowledge the shoulders of people of color on whom white feminists stand, must I call out John Legend and Common for making no mention, for instance, of the way black women are impacted by the Prison Industrial Complex? Or can I simply acknowledge that I found their clear political stance in support of the current #BlackLivesMatter movement and invocation of Nina Simone a breath of fresh air?
Advertisement:
Solidarity with my Latino brothers and sisters does require me to say that Sean Penn’s request for Alejandro Inárritu to “show his papers,” so to speak, was crudely racist and offensive.
But after black women have done all of this labor, all of this reminding white women that our feminist solidarities are not about fighting for white women to have economic parity with white men in a system of white supremacy and all of this reminding black men that our freedom struggle is not just for them but for all of us, and all of this standing in solidarity with other oppressed groups, who will fairly and justly compensate us? And more pointedly, who will stand for us?
When the labor conditions are deplorable and those in power won’t shift these conditions, laborers have the right to withhold work. Asking black women and other women of color always to explain, show and prove to white people what is so wrong about what they have said or done, when we have no guarantees that they will change, shift or grow, is unacceptable. I demand better conditions of work.
Advertisement:
Until then, I encourage you to outsource your educational needs to my twitter hashtag #AskAWhiteFeminist. This Black Feminist is on strike.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Accessibility links
Cookie policy
This website uses cookies to distinguish you from other users of this website. A cookie is a small file of letters and numbers that we store on your browser or the hard drive of your computer if you agree. Cookies contain information that is transferred to your computer's hard drive.
Cookies help Scottish Enterprise (“SE”, “us” or “we”) to provide you with a good experience when you browse our website and also allow us to improve our website. We assume that you are happy to receive all the cookies that your browser settings allow. You can change your cookie settings at any time.
We use the following cookies:
Strictly necessary cookies - These are cookies that are required for the operation of our website. They include, for example, cookies that enable you to log into secure areas of our website.
Analytical / performance cookies - They allow us to recognise and count the number of visitors and to see how visitors move around our website when they are using it. This helps us to improve the way our website works, for example, by ensuring that users are finding what they are looking for easily.
Functionality cookies - These are used to recognise you when you return to our website. This enables us to personalise our content for you, greet you by name and remember your preferences (for example, your choice of language or region).
Targeting cookies - These cookies record your visit to our website, the pages you have visited and the links you have followed. We will use this information to make our website and the advertising displayed on it more relevant to your interests. We may also share this information with third parties for this purpose.
You can find more information about the individual cookies we use and the purposes for which we use them in this table:
Cookie name
Purpose
Expiry
Azure webservices
ARRAffinity
This cookie is set by websites run on the Windows Azure cloud platform. It is used for load balancing to make sure the visitor page requests are routed to the same server in any browsing session. The main purpose of this cookie is: Strictly Necessary
When the browsing session ends
ai_session
This cookie name is associated with the Microsoft Application Insights software, which collects statistical usage and telemetry information for apps built on the Azure cloud platform. This is a unique anonymous session identifier cookie. The main purpose of this cookie is: Performance
When the browsing session ends
ai_user
This cookie name is associated with the Microsoft Application Insights software, which collects statistical usage and telemetry information for apps built on the Azure cloud platform. This is a unique user identifier cookie enabling counting of the number of users accessing the application over time. The main purpose of this cookie is: Performance
1 year from session start
Google Analytics
_ga
This cookie is used to distinguish unique users by assigning a randomly generated number as a client identifier. It is included in each page request in a site and used to calculate visitor, session and campaign data for the sites analytics reports.Examples of purposes for which a cookie may be used:Used to distinguish users and sessions. The cookie is updated every time data is sent to Google Analytics.
Expires after 2 years
_gat
Used to limit the collection of analytics data on high traffic websites.
Expires after 1 minute
_gid
This cookie is used to distinguish unique users.
Expires when the browser is closed.
Siteimprove
nmstat
This cookie is used to help record the visitor’s use of the website. It is used to collect statistics about site usage such as when the visitor last visited the site.
Expires after 1,000 days
siteimproveses
This cookie is used purely to track the sequence of pages a visitor looks at during a visit to the site.
Expires when the browser is closed
_cfduid
Set by the CloudFlare service to identify trusted web traffic. It does not correspond to any user id in the web application, nor does the cookie store any personally identifiable information.
Expires after 1 year
Our website carries embedded ‘share’ buttons to enable users of the site to easily share articles with their friends through a number of popular social networks. These sites may set a cookie when you are also logged in to their service. SE does not control the dissemination of these cookies and you should check the relevant third party website for more information about these.
Similarly, SE sometimes embeds photos and video content from websites such as YouTube and Flickr. As a result, when you visit a page with content embedded from, for example, YouTube or Flickr, you may be presented with cookies from these websites. SE does not control the dissemination of these cookies. Again, you should check the relevant third party website for more information about these.
SE will not use cookies to collect personally identifiable information about you. However, if you wish to restrict or block the cookies which are set by SE websites, or any third party websites, you can do this through your browser settings. The Help function within your browser should tell you how.
Alternatively, you may wish to visit the About cookies website, which contains comprehensive information about cookies and how to restrict or delete cookies on a wide variety of browsers
Please be aware that restricting cookies may impact on the functionality of the SE website.
SE and our other websites use a number of suppliers who set cookies on our behalf in order to deliver the services that they are providing. We are constantly reviewing our use of cookies and, as such, this cookies policy will be regularly renewed to include up to date information about the cookies used by our suppliers. We would highly recommend that you check this page on a regular basis.
Delivered in partnership by
Brexit information disclaimer
The Brexit information provided by Scottish Enterprise (SE), Highlands and Islands Enterprise (HIE), Skills Development Scotland (SDS) and Business Gateway (BG) is for general information purposes only and does not constitute professional advice. You must not rely on the information as an alternative to advice from an appropriately qualified professional. Such professional advice should be sought in relation to business decisions. All partners shall not be liable for any loss, damage, security breach, cost or expense incurred by any person relying on any such information.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
OBC Leader Alpesh Thakor Joins Congress in Rahul’s Rally
Thakur community leader, Alpesh Thakor joined Congress party officially on Monday. The convenor of the OBC, ST and ST Ekta Manch had earlier confirmed that he would join the national party when Congress vice president Rahul Gandhi attends the Janadesh Sammelan on 23 October.
Rahul Gandhi would be coming to our rally on Oct 23 and I will join the Congress party.
Thakor’s announcement comes in the wake of Congress inviting him and other community heads of Gujarat to join forces in order to take on the BJP in the Gujarat elections, slated for later this year.
Congress Reaches Out to Hardik Patel, Alpesh Thakor, Jignesh Mevani
Hoping to garner support of various communities in Gujarat polls, the state Congress on Saturday, 21 October, invited Patidar quota stir spearhead Hardik Patel, Thakor community leader Alpesh Thakor and Dalit leader Jignesh Mevani to join hands with the party to defeat the ruling BJP.
Apart from these leaders, the Congress also hinted at forging a pre-poll alliance with Sharad Pawar-led NCP and bringing on board Chhotu Vasava, the lone JD(U) MLA from the state.
Addressing a press conference in Ahmedabad on Saturday, 21 October, state Congress chief Bharatsinh Solanki expressed confidence that the party would easily win over 125 seats, out of total 182, with the "support and blessings" of all such leaders and parties.
Though the BJP is trying its best to win the polls, it will not succeed in stopping the Congress’ victory march to Gandhinagar. We respect as well as endorse the cause for which Hardik Patel is fighting. I appeal to Hardik to support the Congress during the polls. We are also ready to give him a ticket if he wants to fight elections in the future.
In the Rajya Sabha polls, two NCP MLAs claimed to have voted for BJP candidate Balwantsinh Rajput despite their promise to vote for Congress leader Ahmed Patel.
JD(U)'s lone MLA Vasava, whose party has formed the government in Bihar with the support of BJP, had voted for Ahmed Patel, who eventually won the election.
Vasava had said after the Rajya Sabha elections in Gujarat in August this year that he had decided to vote for the Congress candidate as he was "unhappy" with the ruling party's works for the poor and tribal population that he represents.
He was elected from Scheduled Tribe-reserved Jhagadia assembly seat in Bharuch district in south Gujarat.
Solanki also claimed that some Aam Admi Party (AAP) leaders from Gujarat were also in contact with his party and may join hands with it ahead of the polls.
Senior AAP leader Kanubhai Kalsariya had met Rahul Gandhi during the latter's visit to central Gujarat early this month. “Just like Kalsariya, many other AAP leaders are in touch with us. They may join the Congress soon,” he said.
He claimed that his party has emerged as a strong contender in the upcoming polls.
The Congress has been out of power in Gujarat for 22 years now.
(This story has been updated to reflect Alpesh Thakor’s decision to join the Congress. With inputs from PTI)
(Breathe In, Breathe Out: Are you finding it tough to breathe polluted air? Join hands with FIT in partnership with #MyRightToBreathe to find a solution to pollution. Send in your suggestions to [email protected] or WhatsApp @ +919999008335)
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Effects of ion composition and tonicity on human neutrophil antibacterial activity.
Infants with cystic fibrosis (CF) often are infected with Staphylococcus aureus (S. aur.), which is followed by colonization with Pseudomonas aeruginosa (P. aerug.). In spite of an excessive, neutrophil-dominated inflammatory response in the respiratory tract, patients with CF often succumb to pulmonary infections with P. aerug. Because peripheral blood neutrophils of these patients have normal functions, we examined whether hypothesized alterations of the airway surface liquids (ASL) in these patients significantly impair neutrophil bactericidal activity in the microenvironment of the CF lung. The ionic composition of CF ASL is still not entirely defined and has been speculated to be abnormally high or abnormally low in Na+ and Cl- concentrations; estimates of osmolarities have ranged from 200 (hypo-osmolar) to 285 (iso-osmolar) to > 300 meq/L (hyper-osmolar). Our data indicate that bacterial killing activity of human peripheral blood neutrophils against P. aerug. or S. aur. is not decreased in buffers in which NaCl was replaced with equimolar concentrations of choline Cl, KCl, or N-methyl-D-glucamine chloride to maintain isotonicity. Amiloride or benzamil, known modulators of Na+ transport in neutrophils, did not interfere with this neutrophil function. Deviations from isotonicity of +/- 50% also failed to diminish bactericidal activity of neutrophils significantly. In contrast, superoxide production and enzyme secretion in response to the chemotactic peptide N-formylmethionylleucylphenylalanine appeared to be sensitive to the ionic milieu of the assay buffers. Our results suggest that the postulated alterations in the ionic composition of ASL in CF lungs are insufficient to explain why neutrophils fail to clear infections with P. aerug. in these patients.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Major ion chemistry of a representative river in South-central China: Runoff effects and controlling mechanisms.
The Gan River is a large tributary of the Yangtze River in Jiangxi Province, South-central China. Hydrochemical data for this river were analyzed for the period 1958-2016. Ca2+, Na+ + K+, HCO3-, and SO42- were dominant in river water, and pH and total dissolved solids (TDS) varied from 6.0 to 8.8 and 15.7 to 141 mg/L, respectively. The chemical composition of river water was different between the two periods 1958-1979 and 1980-2016. Monthly yields of all ions were positively correlated with river runoff. Monthly yields of SO42-, NO3-, and Cl- were more positively correlated with river runoff before 1980, indicating non-point sources, while multiple sources were indicated after 1980. Sea salt-sourced Cl- comprised less than 19% of the total Cl- in river water. Weathering of basin rocks with sulfuric acid reflected strengthening of anthropogenic activities after 1980. This was reflected by increases in Cl-/(Na+ + Cl-) and SO42-/(Na+ + Cl-) with gross domestic production, population, coal consumption, fertilizer use, and wastewater discharge. Although water quality in the Gan River makes the water acceptable for drinking according to the World Health Organization standards, increases in Cl- and NO3- concentrations after 1980 are of some concern.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Ireland's deputy PM: Brexiteers are risking peace in Northern Ireland
Ireland's deputy prime minister Simon Coveney Pic: Annika Haas $image.copyright
Brexiteers are risking fragile peace in Northern Ireland by questioning the future of the Good Friday Agreement, Ireland's deputy prime minister has said.
Email this article to a friend To send a link to this page you must be logged in.
Become a Supporter Almost four years after its creation The New European goes from strength to strength across print and online, offering a pro-European perspective on Brexit and reporting on the political response to the coronavirus outbreak, climate change and international politics. But we can only continue to grow with your support.
Simon Coveney, the Republic's foreign affairs minister, said that the 1998 accord was being undermined in some political circles.
Mr Coveney tweeted: "Talking down (the) Good Friday Agreement because it raises serious and genuine questions of those pursuing Brexit is not only irresponsible but reckless and potentially undermines the foundations of a fragile peace process in Northern Ireland that should never be taken for granted."
Talking down Good Friday Agreement because it raises serious and genuine questions of those pursuing #Brexit is not only irresponsible but reckless and potentially undermines the foundations of a fragile peace process in Northern Ireland that should never be taken for granted — Simon Coveney (@simoncoveney) February 20, 2018
The British and Irish governments have reiterated they are fully committed to the Good Friday Agreement amid a deep political impasse in Stormont.
Mr Coveney's tweet was directed at Labour MP Kate Hoey and Conservative MPs Daniel Hannan and Owen Paterson after they raised questions over the future of the 20-year-old accord.
Mr Paterson, a former Northern Ireland secretary, recently retweeted a commentator's suggestion that the agreement had outlived its use.
He also tweeted that Northern Ireland deserved good government, and health services were falling behind the rest of the UK without a devolved executive.
Northern Ireland secretary Karen Bradley is due to update Westminster on the Stormont deadlock on Tuesday.
The Easter agreement was signed almost 20 years ago by the British and Irish governments and enjoyed support from most of the major parties in Northern Ireland. Ian Paisley's DUP opposed it at the time.
It enabled the formation of a ministerial executive and assembly at Stormont.
Ms Hoey said her questions over the future of the Good Friday Agreement were nothing to do with Brexit.
"Hiding head in sand over viability of sustainability of mandatory coalition is reckless and wrong," she said.
Mr Hannan said he had been arguing long before Brexit that the agreement needed to be changed.
Prime minister Theresa May and Taoiseach Leo Varadkar spoke by phone on Monday night after the Democratic Unionists and Sinn Fein clashed over the prospect of direct rule being imposed on Northern Ireland.
Both leaders expressed disappointment over the political impasse at Stormont.
The breakdown in powersharing came to a head despite optimism that a deal had been close on contentious issues such as the Irish language, marriage equality and the legacy of the past.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Grouping all files from one directory under one alias
Let's say I have this directory structure:
src
├──Utils
| ├──File2.ts
| ├──File3.ts
index.ts
tsconfig.json
I know you can set path aliases inside tsconfig.json like so:
{
"compilerOptions": {
.....
"paths": {
"Utils/*": ["src/Utils/*"],
}
}
}
And then I can use these aliases inside my index.ts:
import { File2 } from 'Utils/File2';
import { File3 } from 'Utils/File3';
I am sure you noticed the redundancy: even so if the File2 and File3 are in the same folder we have to write the import for each file inside Utils folder.
Is it possible to groups these files under one import and use it like in the example below?
import { File2, File3 } from 'Utils';
I tried this configuration but it doesn't work:
{
"compilerOptions": {
"paths": {
"Utils": ["src/Utils/*"],
}
}
}
EDIT
Also, I would like NOT to use a barrel file like index.ts where I export everything from the Utils folder.
A:
That is solvable by using a barrel file. Create an index.ts file in /Utils and add
export * from './File2';
export * from './File2';
and in your tsconfig
{
"compilerOptions": {
"paths": {
"Utils": ["src/Utils"]
}
}
}
It is not possible group these imports without using a barrel file. However, there are libraries that can generate these files for you if you don't want the hassle of manually maintaining them like barrelsby. Alternatively, you could write your own script to keep them up to date.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
30 Sunlight Square, London E2 6LD, UK
View Map
From £175/week
Sunlight Apartments Student Accommodation
Located near the lush Bethnal Green Gardens, The Sunlight Apartments are quality apartments at reasonable prices. Offering non-en-suite rooms in 4 bedroom flats, the accommodation provides great value for money with shared living at its best.
With the Bethnal Green train station just 3 minutes away, and the nearest bus stop a couple of minutes away, the property features great connectivity with the rest of London and all of the major universities through the efficient public transport links. To spend your day with some fun- filled activities, you could go for an invigorating jog at the Weaver Fields nearby, head over to the local supermarket for a shopping spree, or unwind after a hard workday with your friends at the local bars and restaurants, just to name a few.
The accommodation offers a total of 24 beds, providing a well taken care of lifestyle and a closed community experience. Ever room is tastefully furnished and comes with its own 3/4 sized bed, a study area, and plenty of storage space for your belongings. The kitchen and the common areas are shared, for a great social living experience. Besides the luxuries, the property is equipped with CCTV cameras that work 24/7 and a secure door entry providing you a secure stay. It also features an all-inclusive rent, so that you never have to worry about any pesky utility bills or additional costs and can utilize the commodities to your heart’s content.
Life at this accommodation will be a blissful experience. From cooking your favorite meals in the well-equipped kitchen or just heating the leftovers in the microwave for a light lunch, to streaming your favourite shows through the high-speed Wi-Fi or binging out in front of the TV in the common room, the Sunlight Apartments have everything you could possibly need and more. You just need to book a room and relax!
Read More...
Distance from city : 3.30 miles
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Three Chinese immigrants were found hidden in the trunk of a vehicle trying to cross into the U.S. from Mexico Tuesday.
The driver, Eun Ku Lee, a 33-year-old South Korean citizen, was trying to cross at the San Ysidro Port of Entry about 4:45 p.m. with a valid SENTRI pass when his illicit load was discovered, according to court records.
Lee, who was driving a Jeep Compass with Baja California license plates, told the U.S. Customs and Border Protection officer that he was alone and traveling to Chula Vista, the complaint states. He was stopped for a closer inspection because of undisclosed discrepancies.
In the cargo area under a stock cover, an officer found three women stuffed inside. They were from China trying to cross into the U.S. illegally, court records say.
One woman told investigators that she agreed to pay $60,000 to be smuggled to New York, while another said her uncle had paid her way across and she was going to pay an extra $2,000 if she made it to North Carolina. The third said her cousin had paid her way and she was going to New York.
The women are being held as material witnesses in the prosecution against Lee, who was arrested on a human-smuggling charge. Lee’s temporary visa allowing him to be in the U.S. legally was also revoked, border authorities said.
A San Diego federal magistrate judge set his bond at $20,000 during a hearing on Wednesday.
“Concealing persons in vehicles is dangerous and could have severe consequences,” Pete Flores, director of field operations for CBP in San Diego, said in a statement. “CBP is pleased that this outcome was not life threatening and the Chinese nationals were removed safely without medical complications.”
Authorities at San Diego’s ports of entry have seen an increase in Chinese being smuggled in hidden compartments. In fiscal 2017, which ended Sept. 30, CBP at California ports of entry discovered more than 261 unauthorized immigrants from China — nearly a 50 percent increase from the year before.
[email protected]
Twitter: @kristinadavis
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Different colours for segments of a polyline
I have a polyline and I want to colourise each line between two points depending on its length. What are my options? I found no way to do that on a single object and the lines I have to work with have up to 15,000 points, so generating fifteen thousand single lines of different colours isn't particularly efficient.
A:
The Polyline Options state that there's one strokeColor for a polyline. You'd have to do it yourself, manually. You could probably automate the process, slightly, by building a function that takes an array of points, calculates the distance between the first 2, decides the color, creates a polyline, then moves on to the next point. Rinse and repeat. Yeah, 15K points is going to be slow, although I suspect that even calling GMaps API with a 15K array of LatLng isn't that fast either...
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Further to our news release of March 28, 2019. The Company has increased its land position by an adjoining 42.22 ha to a total of 295.56 ha. The Company has also reviewed further exploration results completed by Kingsman Resources in 2008 & 2009, who conducted a trenching program, a drill program of 15 DDH at the Pathfinder workings, and 2 drill holes at the adjacent Diamond Hitch prospect; both within the Belmont claims.
Belmont has engaged a geological consultant to visit the property to complete an initial assessment of the property. As such the proposed work will include:
A review of previous work to ascertain main areas of interest and possible areas overlooked by earlier investigations;
A field program visiting previously reported workings, trenches, and drilling sites in the area, with rock grab or chip samples to be taken for assaying where appropriate;
Geological, alteration, and structural mapping of areas immediately surrounding the largest workings (Pathfinder, Little Bertha, and Diamond Hitch), with prospect-scale mapping (1:5,000) of the area;
Digitizing field data, correlating findings with previous work, and completing a brief report on these findings and main areas of interest including recommendations for a more detailed summer exploration program to followup.
Belmont anticipates the field work to be completed this month.
The Greenwood Gold District is already reporting significant exploration programs underway this year, such as drilling and trenching, and expects this to continue throughout the year. The Belmont property is currently surrounded on 3 sides by claims held by KG Exploration (Canada) Inc. (a wholly owned subsidiary of Kinross Gold Corporation).
Karim Rayani resigns as a Director:
The Board wishes to thank Karim Rayani for contribution to the Company; and wishes him well in his other commitments and endeavors. Mr. Rayani will continue on as an advisor/consultant to the Board with respect to ongoing financing and project generation. Mr. Rayani has a global network of financial contacts with a focus on institutional accounts.
About Belmont Resources Inc.
Belmont is an emerging resource company engaged in the acquisition, exploration and development of mineral properties in Canada and Nevada, U.S.A.
On March 28, 2019 Belmont entered into an agreement to acquire 100% interest in 253.34 hectares of mineral claims (now increased to 295.56 ha) which are part of the former Pathfinder Property, located in the historically productive Republic-Green Gold District. Copper and gold mining in this camp dates back to the turn o the century. The property is currently surrounded on 3 sides by claims held by KG Exploration (Canada) Inc. (a wholly owned subsidiary of Kinross Gold Corporation).
Belmont owns the Kibby Basin Lithium project covering 2,056 hectares (5,080 acres) in Esmeralda County, Nevada, U.S.A. The Kibby Basin property is located 65 km north of Clayton Valley, Nevada the location of the only US Lithium producer. MGX Minerals Inc. (CSE: XMG) has earned a 25% interest in the Kibby project.
In 50/50 ownership with International Montoro Resources Inc., Belmont owns and is exploring joint venture opportunities for its significant uranium properties (Crackingstone -982 ha) in the Uranium City District in Northern Saskatchewan, Canada
ON BEHALF OF THE BOARD OF DIRECTORS
“James H. Place”
James H. Place, P.Geo.,
CEO/President
This Press Release may contain forward-looking statements that may involve a number of risks and uncertainties, based on assumptions and judgments of management regarding future events or results that may prove to be inaccurate as a result of exploration and other risk factors beyond its control. Forward looking statements in this news release include statements about the possible raising of capital and exploration of our properties. Actual events or results could differ materially from the Companies forward-looking statements and expectations. These risks and uncertainties include, among other things, that we may not be able to obtain regulatory approval; that we may not be able to raise funds required, that conditions to closing may not be fulfilled and we may not be able to organize and carry out an exploration program in 2019; and other risks associated with being a mineral exploration and development company. These forward-looking statements are made as of the date of this news release and, except as required by applicable laws, the Company assumes no obligation to update these forward-looking statements, or to update the reasons why actual results differed from those projected in the forward-looking statements.
Neither the TSX Venture Exchange nor its Regulation Services Provider (as the term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this news release.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Case Management Department Revamped in Response to Shift in Reimbursement.
As DCH Health System in Tuscaloosa, AL, began to assume more risk for patients after discharge, the leadership redesigned the case management department to meet the new challenges. A masters-prepared RN assumed the role of patient navigator and follows total joint replacement patients for 90 days after discharge. The case management staff narrowed down the post-acute providers with which it contracts, based on quality data and cost of care, and requires providers to submit quality data regularly. The multidisciplinary staff holds rounds every day. In addition, there are long-stay rounds twice a week, and daily rounds in the ICU.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[Evaluation of images of periosteum on computed tomography in children with malignant bone tumours before and after chemotherapy].
to assess the value of different images of periosteal reaction on computed tomography (CT) in children with malignant bone tumours in determining the effectiveness of the chemotherapy. To evaluate the prognostic value of particular symptoms of the periosteal reaction. material includes documentation of CT imaging of periosteum in children with malignant bone tumours. Investigations were performed in 80 children (39 boys and 41 girls), aged from 3 years and 6 months to 20 years and 5 months, treated at the Institute of Mother and Child in the years 1995-2000. Osteogenic sarcoma (59 patients), Ewing's sarcoma/PNET (14 patients) and other mesenchymal tumours (7 patients) were diagnosed. The assessment of the periosteum was carried out before and after preliminary chemotherapy. Eleven symptoms of the periosteal reaction were distinguished: 1) changes in calcification, 2) thickness and 3) outlines of the periosteum, 4) change of number of stratifications, 5) reconstruction of the broken periosteum and 6) rebuilding of the Codman's triangle, 7) changes of calcification, 8) incorporation and 9) the number of spicules as well as 10) changes in the zone of unreactive areas and 11) distance from the periosteum to the bones. Each symptom was evaluated according to a three-grade scale: favourable, uncertain, unfavourable. The kind of response to chemotherapy was determined on the basis of these symptoms relations. The response was good if there were at least twice as many favourable as uncertain signs. Poor response was indicated if there were more uncertain than favourable symptoms or if an unfavourable symptom was found. The remaining situations accounted for medium response. CT scan assessment was compared with the tumour histopathological examination after surgical excision. The data underwent statistical analysis. the relationship of symptoms of the periosteal reaction and histopathological response to chemotherapy was determined. Assessment of tumour reaction to chemotherapy based on own system of evaluation was in agreement with the histopathological results in 96.9% in the group of good responses (31/32), in 66.7% in group of medium responses (10/15) and in 87.9% in the group of poor responses (29/33), (dSomers coefficient 0.840, chi2 v=100.739 df=4 p<0.001). 1. The author's own scheme of evaluation of periosteal reactions on CT provides good correlation and concordance with the histopathological assessment of the kind of response to chemotherapy in children with malignant bone tumours. 2. Analysis of manifestations of periosteal reaction on CT demonstrates full prognostic conformity of the so-called unfavourable symptoms to findings of the histopathological examination in the estimation of poor response. 3. Favourable periosteal reactions are found in all types of response, but three of them, i.e. reduced number of periosteal proliferations, total reconstruction of the broken periosteum and total rebuilding of the Codman's triangle, show significant frequency only in cases of good response. 4. Uncertain symptoms: unchanged periosteal thickness, lack of incorporation of spicules, decreased of number of unincorporated spicules, increased or unchanged size of unreactive (uncalcified and necrotic) areas - did not appear in cases of good response. They were found in medium and poor responses, which supports the suggestion of excluding the so-called medium response from the criteria of response assessment. 5. Decreased size of the tumour (i.e. distance between periosteum and bone) appears in all types of response to chemotherapy and it cannot be regarded as a manifestation of good response. 6. Own system of evaluation of tumour response to chemotherapy, based on the relationship manifestations of periosteal reaction is confirmed by statistical analysis.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Everything about Saint Laurent's leather bag is flawless - from the piped edges to the butter-soft suede lining. The gray hue is super versatile and sophisticated. Alternatively, why not carry the bold red version for a bright pop of color.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Standard Pages (they don't change often)
Tuesday, July 6, 2010
Beef pot
After being caught in a torrential downpour that had me trapped for hours in flash flooded South Houston, I recently had a hearty late night dinner at Taqueria del Sol. I figured at least the implied sunshine in the name of the restaurant would raise me from the funk. I ordered a bowl of the comforting caldo de res, or, basically beef soup. A good caldo is the product of long simmering of beef bones and other tough animal parts until the collagen dissolves into a flavorful broth. The meat itself is meltingly tender, and the vegetables cooked therein, large chunks of cabbage, chayote, carrots, potatoes, and corn still on the cob add to the healthful and hearty milieu. Served alongside a bit of salty Spanish rice, and hot tortillas, all it needed was a squeeze of fresh lime to complete the comforting anodyne against the dampness.
Then I was struck by the similarity of this dish to a classic French peasant fare: pot a feu. Also derived from simmering beef and vegetables, a pot a feu service is more elaborate, separating out the parts of the cooked broth into courses, and, of course, accompanying it with the more Francotypic bread, butter and wine.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Faculty
Teaching is my passion. Having the opportunity to teach students and watching them excel academically is my dream. When I'm not teaching, I love being with my family, going on hikes and dancing.
M. Alcala, 2nd Grade
I've lived in Healdsburg for about 20 years and my three children have attended HUSD schools. I've been a teacher for HUSD for 17 years. I'm bilingual and love traveling.
H. Anderson, TK/ KinderTeaching has been a dream of mine since I was in Kindergarten! I think school is so much fun and my goal is for my students to feel the same way! Outside of school, I am very busy with my family. My husband, Sean, and I have three kids, Sierra, Brandon and Peyton. My favorite thing to do is watch my kids do their activities, from sports to dance to acting in plays. I also love to watch professional sports, especially the Giants!!
A. Beseda, 4th Grade
K. Bronder-Reynolds, 3rd Grade
When I am not at school I enjoy water skiing with my son and daughter. I also am a personal trainer and love exercise.
E. Donau Sinclair, Learning Center
I love teaching and watching students grow, both academically and socially. Facilitating this process teaches me new things every day. When I am not in the classroom, I love traveling and making my own discoveries.
I. Figueroa, 3rd Grade
The best thing about teaching is being able to make a difference in a child's life. I have the best job in the world.
E. Hanson, 3-5 RSP
A. Hartley, 5th Grade
B. Hatten, 2nd Grade
When I'm not at work, I enjoy a wide variety of outdoor activities such as hiking, camping, and kayaking. Sonoma County is such a beautiful place to spend time outdoors.
D. Mascik, 3-5 RSP/Intervention
Since moving to Healdsburg from Ohio in 2011, I enjoy the beautiful surroundings every day and like being active in the community. The things
I love most about teaching are challenging my students to do their best, helping to build their confidence, and watching them grow as individuals.
S. Mazza, Reading Specialist/Intervention
I love helping students become better readers. My passion lies in igniting a love for reading that grows out of exposure, competence, and confidence. The most impactful influence in reading growth is reading more. By filling learning gaps and sharing my enthusiasm for quality children’s literature through my extensive collection, I aim to inspire and motivate my students to become avid readers for life.
D. Nuñez, 4/5th Grade
When I’m not at school, I enjoy spending time with my husband and two kids. My kids keep me busy with their 4-H and FFA projects as well as sports. We love camping, fishing, and riding our ATV’s.
A. Pacheco
Intervention Teacher/Parent Outreach
I love encouraging students to be life long learners. It's important for me to nurture independence and confidence in all my students.
J. Perry, 1st Grade
My favorite part about teaching is watching students explore, create, inquire and collaborate. Teaching has given me the opportunity to positively change the lives of my students. When I'm not at school, I am spending time with my family, friends and dog. I enjoy camping, hiking and swimming. I am so fortunate to be able to do what I love!
K. Robinson, 4th Grade
I love to spend time with my dog Pippa and my family. The best part of my job is working with our GREAT student’s everyday!
J. Schrichfield, 3rd Grade
I love using technology in the classroom and I hope to incorporate more ways to use it every year. I’m an avid reader, often staying up too late because I’m completely captivated by the story.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Can we accelerate a particle to a very high speed by applying force just once?
Suppose you have a tennis ball in your hand. When one would throw it towards a wall such that it encounter the surface of the wall at almost a right angle, the ball would come back in the same direction.
Now let us suppose the same scenario but as soon I throw the ball, place a similar wall at my place.
Now the ball would bounce back from the first wall and strike the second, bounce back and strike the first wall and this would continue.
Now suppose there is a very very long swimming pool, filled with a fluid which has particles with very less mass, very less inter particle forces of attraction and coefficient of restitution equal to 1.
Now I jump into it and be near one end of the pool.
Now I push the fluid behind me towards the wall of a pool, and as in the case of a ball, the particles will strike the wall with some force F, with Newton's 3rd law, return with F and hit my back with F. I will get accelerated with F/M( where M is my mass).Again with Newton's 3rd law, my back would also push them with F( where my back is acting as the second wall as in the case of the tennis ball) then they would return to the wall then again push me ,accelerating me, and then I would push them.
Since the pool is very long, I would keep on getting pushed and pushed and so increasing my speed and maybe I will beat sound and since it is so long, get somewhat near light.
I know that the coefficient of restitution of my body is not 1 but we can some what increase it to near one by having some sort of suit.
Is this possible? Are there any flaws ? What are they?
A:
It is possible. What you have just described is "where pressure comes from".
Imagine two walls, with a particle bouncing back and forth between them, pushing one then the other. This is your scenario, it means that the particle is exerting pressure on the walls that are holding it in its box.
The amount of pressure the particle exerts will increase if it is travelling faster (is hotter) or if it is heavier, or if their are more particles. This is where the ideal gas law comes from:
https://en.wikipedia.org/wiki/Ideal_gas_law
So not only is it possible, it is how gas pressure works.
Problems with your set up:
However your speeds will be limited. The fundamental reason for this is simple: "How quickly are those magic water particles you hit moving?". Once you are going as fast as them the ones behind you will never catch up to push on you again.
Another (important) problem is that you need nothing in front of you (otherwise pressure in front will pick up to push you back).
So a refined version of your set up might look like this: We are in a perfect vacuum have a perfectly flat plate, with a perfectly flat wall behind it. We put some particles that bounce (perfectly) back and fourth between the two. The two will accelerate apart relatively hard as first, but as the wall-plate distance increases each particle will be used less and less often (longer distance to cover), and will hit the (moving) plate less hard as their velocity difference will be less. Ontop of this diminishing is the speed limit set by the speed of the particles, and the fact that no real materials will have a coefficient of restitution of 1 exactly.
In gas-terms, the external pressure is zero (ideal vacuum was assumed), and the internal pressure (providing force) falls as the volume between the plate and wall increases. Eventually the force pushing the two apart is minuscule, although it never quite reaches zero in the idealised case.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Tag Archives: rovers
The Chinese lunar rover, called Jade Rabbit, has stopped working and there will not be an attempt to repair it.
This news comes from a statement released through ecns, a Chinese news website. The problems with the rover were firs...
10 years ago, the Opportunity rover landed on Martian soil. During that time, it has allowed us to learn more about the Red Planet. Happy Birthday, Opportunity, and we wish you another 10 years traversing what is left of that barr...
| null |
minipile
|
NaturalLanguage
|
mit
| null |
PHILADELPHIA — The Coast Guard suspended its search Wednesday afternoon for a missing man in the Christina River in the vicinity of the Port of Wilmington.
Missing is Emanuel Gatling, 25.
An employee from Norfolk Dredging Company contacted Coast Guard Sector Delaware Bay Command Center watchstanders Tuesday at approximately 6:45 p.m. to report Gatling missing in the water.
The employee reported...
Dec 2nd, 2014 · Comments Off on Coast Guard, local agencies search for missing man in Christina River
PHILADELPHIA — Coast Guard and partner agencies are searching Tuesday for a missing man in the Christina River in the vicinity of the Port of Wilmington.
Missing is Emanuel Gatling, 25.
An employee from Norfolk Dredging Company contacted the Coast Guard Sector Delaware Bay Command Center watchstanders at approximately 6:45 p.m. to report Gatling missing in the water.
The employee reported three...
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Police officers who allegedly took payments from newspapers and private investigators could face hefty fines and criminal prosecution after it emerged HM Revenue & Customs is reopening personal tax records to check if payments were fully disclosed.
It is understood HMRC has already begun probing self-assessment forms from previous years in the wake of new information obtained amid the phone-hacking revelations.
Last month Sir Paul Stephenson, the outgoing Metropolitan police commissioner, said documents provided by News International appear to include information on "inappropriate payments" to police officers. It was reported that the company provided the Met with details of payments made by the News of the World to senior officers between 2003 and 2007.
Under HMRC rules any payments earned in connection with an individual's employment are required to be disclosed for tax purposes, even if the payment is deemed illegal.
An HMRC spokesperson said he could not confirm the nature or extent of any investigation into a private individual's tax affairs. But he confirmed that HMRC will act on any new information and that illegal earnings can still be liable for tax.
Action to recover tax from police officers paid illegal tip-off fees relies on the precedent set by the "Miss Whiplash" prostitution case of the early 1990s, which has since entered the HMRC rule book. Miss Whiplash, who also went by the name of Lindi St Clair, was pursued for £112,000 in unpaid income tax in the late 1980s. It culminated in a court case in 1990 where she argued that since it was illegal to live on immoral earnings, taxing her would be committing an offence. But she lost the case and was subsequently made bankrupt.
An HMRC spokesman said: "If you receive money in connection with your employment then it is liable for income tax. Illegality is irrelevant."
Over the past year HMRC has intensified investigations into alleged tax cheats and promised to increase the number of prosecutions. Since April HMRC has had powers to name and shame anyone found to have deliberately evaded £25,000 or more in tax. The scheme will see names, addresses and details of the evasion made public. But those who come clean can avoid having their details published.
Earlier this year the government gave HMRC with an additional £900m to fund more investigations into tax evasion. The aim is to raise an additional £7bn in tax each year by 2014/15. HMRC has also gained new powers to inspect taxpayers' records and documents. In a typical investigation it will examine income and earnings dating back six years. If it discovers an individual has knowingly submitted an inaccurate return or document, or taken active steps to conceal earnings, it can demand repayment of the tax, plus interest and a penalty of up to 100% of the unpaid tax.
The department recently announced the targeting of the restaurant industry with a new task force dedicated to detecting tax and national insurance evasion. But it added that criminal prosecutions were reserved only for the most serious cases of high level fraud.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Effect of garlic along with lead acetate administration on lead burden of some tissues in mice.
Garlic ability to reduce lead burden in body tissues before and during chronic lead toxicity was studied. Eighty mice were divided into 8 groups. Group D received placebo. Groups A1, A2 and A3, respectively received 500, 250 and 125 mg kg(-1) day garlic and Groups B1, B2 and B3, respectively 1/4, 1/8 and 1/16 garlic tablet kg(-1) day in first four weeks and in second four weeks they received 5 mg kg(-1) day lead acetate plus garlic or garlic tablet. Group C received placebo in first four weeks and in second four weeks they received 5 mg kg(-1) day lead acetate and placebo. Reduction in lead burden of kidney, liver, bone and blood (except for group A3) in experimental groups was significant compared with group C (p<0.05). Results showed that fresh garlic extract and garlic tablet had almost same effects on lead reduction in tissues.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Roosevelt Marks King Legacy With Day of Service
By EGP Staff Report
School was closed Monday in observance of the Martin Luther King Jr. national holiday, but a group of students at Roosevelt High School in East Los Angeles still showed up, not for class, but to take part in the school’s third annual “Roosevelt High School Beautification Day.”
Non-profit AltaMed Health Services and HealthCorps hosted the event as part of a National Day of Service commemorating civil rights leader Martin Luther King, Jr.
Roosevelt High students, AltaMed staff and HealthCorps cultivate a community garden at the school as part of a National Day of Service honoring Martin Luther King Jr. (Photo courtesy of AltaMed)
About 300 people turned out to volunteer. They painted a mural “that stretched along 5 basketball courts,” basketball backboards and cultivated a community garden of about 100 square feet in order to create a “visually appealing space for students,” Lauren Astor, AltaMed’s director of corporate communications and public affairs told EGP.
The Beautification Day is a community effort, AltaMed said prior to the event. The healthcare provider said events such as this empower students to become engaged in their school and efforts “to create a safe and visually appealing space for students to learn,” and reinforced the importance of community involvement.
“We were very pleased with the success of the event and [we] were able to complete all the tasks we had identified,” Astor, told EGP via email.
AltaMed President and CEO Cástulo de la Rocha is a graduate of Roosevelt High School, so projects supporting the school are especially close to his heart.
“As a graduate from Roosevelt High School,” he said, “I couldn’t be more excited and proud of the engagement we’ve received from AltaMed employees and community members to give the school the attention and appreciation it deserves.”
Editor’s Note: Article updated Jan. 24, 2014 to correct name of nonprofit group to HealthCorps.
Comments
Comments are intended to further discussion on the article topic. EGPNews reserves the right to not publish, edit or remove comments that contain vulgarities, foul language, personal attacks, racists, sexist, homophobic or other offensive terminology or that contain solicitations, spam, or that threaten harm of any sort. EGPNews will not approve comments that call for or applaud the death, injury or illness of any person, regardless of their public status. Questions regarding this policy should be e-mailed to [email protected].
Name (required)
Email Address (required)
Website
Speak your mind
characters available
We Are the Largest Chain of Hispanic Owned Bilingual Newspapers in the U.S.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Characteristics of uptake of [3-H](plus or minus)-metaraminol by human fallopian tube.
The characteristics of accumulation of 5 X 10 minus8M [3-H] (plus or minus)-metaraminol were studied in isolated human fallopian tube. In both the ampulla and isthmus, the amine was concentrated against the concentration gradient; Accumulation was inhibited by noradrenaline, cocaine, and ouabain but not by oxytetracycline or normetanephrine. It was concluded that [3-H] (plus or minus)-metaraminol was accumulated in the adrenergic nerves present in the human fallopian tube.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Digital solid-state radiation detectors, that is to say digital X-ray detectors of different types are increasingly being used in the context of radiation image recording, be it in traditional radiography, fluoroscopy, angiography or cardioangiography. Such solid-state radiation detectors, also called flat detectors, are based on active pixel or read-out matrices which are composed e.g. of amorphous silicon. The incoming X-ray radiation is converted, in a scintillator layer functioning as an X-ray converter, into radiation which can be processed by the active pixel matrix and by which an electrical charge is generated in the photodiodes of the pixel matrix and is stored there.
The image quality of a solid-state radiation detector depends on a multiplicity of parameters. These include in particular the scintillator or converter material, cesium iodide (CsI) or gadolinium oxysulfide (GdO2S2) principally being used here, furthermore the design of the pixel matrix (size, filling factor, etc.) and also the read-out electronics etc. The image quality itself can be described by way of the modulation transfer functions MTF, the NPS value (NPS=noise power spectrum) and the effective quantum absorption DQE (DQE=detective quantum efficiency), the DQE being a derived variable. In solid-state detectors, the image quality is considerably reduced in particular by the so-called “low frequency drop” (LFD). The “low frequency drop” leads to a reduction of the MTF at low spatial frequencies, up to an order of magnitude of approximately 10%. This leads to significant losses in the DQE, which represents the actual variable which is relevant to image quality and which describes both the signal behavior and the noise behavior of the detector, to losses of up to approximately 20% since the MTF is incorporated quadratically in the calculation of the DQE.
In order consequently to improve the image quality of a solid-state radiation detector, it is therefore crucial to minimize the “low frequency drop”, which is one of the central causes of the reduction of the DQE.
At least one embodiment of the invention is based on the problem of specifying a solid-state radiation detector in which the “low frequency drop” caused by the occurrence of scattering effects of the converted radiation is to be reduced, and of improving the image quality.
In order to improve upon or even solve this problem, in the case of a solid-state radiation detector, at least one embodiment of the invention provides for at least one layer that at least partly absorbs the light that originates from the scintillator layer and has penetrated into the carrier to be provided at the carrier.
At least one embodiment of the invention is based on the insight that a non-negligible scattered light component is brought about by light or light quanta brought about through the transparent sections of the pixel matrix into the matrix carrier, which is transparent to the light originating from the scintillator layer. The light that has penetrated into the carrier is reflected therein; the carrier acts virtually like an optical waveguide.
After single or multiple reflection at a different transparent section of the pixel matrix, the reflected light again enters into the scintillator layer, where it is likewise reflected and impinges on a different pixel than the one assigned to the generation location. That is to say that light which enters into the matrix carrier in an undesirable manner is coupled into the pixel matrix possibly at a completely different location. This scattered light component, which is added to the possible scattered component within the scintillator layer itself, is not negligible.
In order to lessen or even avoid at least one of the resultant disadvantages, at least one embodiment of the invention provides for the provision of an absorption layer at the carrier, which absorption layer at least partly absorbs the scintillator light that has penetrated undesirably into the carrier. This layer, which is preferably provided at the carrier at the opposite side to the pixel matrix, diminishes or even prevents any reflection processes from actually occurring in the carrier material. The scattered component on the carrier side may thereby be reduced or even minimized through to completely reduced. This may be accompanied by a significant reduction of the “low frequency drop”, in association with a significant improvement of the MTF and the DQE.
The signal transfer behavior is consequently improved and the imaging properties are improved or even optimized. Comparable image qualities between detectors having DQE functions of varying quality can consequently be achieved with significantly lower X-ray doses, a lower DQE being tantamount to a higher dose requirement for obtaining a comparable image quality.
According to a first simple refinement of an embodiment of the invention, the absorption layer provided according to an embodiment of the invention may be a cured coating or a film. The coating may be for example an enamel coating or the like. The film may be a plastic film which is for example laminated onto the carrier or bonded to it in some other way.
With regard to the fact that the light emitted by the scintillator originates from a defined, known wavelength range, the cured coating may be a special color coating, the primary color of which is chosen such that precisely light having a wavelength corresponding to the scintillator light is absorbed. The film may correspondingly be a color film. Such a wavelength-specific absorption property is not mandatory, however; a black color coating or a black film that generally absorbs over the visible wavelength range may also be involved.
While the use of a simple coating or film is appropriate when the solid-state radiation detector does not have a reset light source serving for the defined resetting of the individual photodiodes of the pixel matrix, a solid-state radiation detector provided with a reset light source arranged adjacent to the carrier makes somewhat different requirements of the type or quality of the layer. In the case of such a solid-state radiation detector, according to an embodiment of the invention the layer is arranged between the carrier and the reset light source, which is preferably formed as a sheetlike reset light layer into which the reset light is coupled at a defined location.
At least when the reset light source is operated, that is to say therefore the resetting is effected, the layer is at least partly transparent to the light emitted by the reset light source. Here the layer has the task, on the one hand, of preventing part of the light converted at the scintillator from finding its way into the carrier, for example the glass substrate, and from there into the scintillator again and, consequently, impinging on a photodiode at a different location. On the other hand, it must be ensured that the reset light can pass via the carrier and the transparent regions in the active photodiode matrix into the scintillator and from there to the photodiodes. The absorption or transmission behavior of the layer must consequently be either adaptable or wavelength-selective.
In order to achieve this, the layer may preferably be variable or switchable in terms of its absorption behavior, preferably by way of an electrical control voltage that can be applied to the layer. This is possible, for example using an electrically drivable organic layer or an LCD layer. Both layers, which can be applied or produced in very thin fashion, make it possible, through application of a dedicated control or switching voltage, to switch or to vary the transmission or absorption behavior in specific regions. In both types of layer, an orientation of molecules integrated at the layer, for example of the liquid crystal molecules of an LCD or liquid crystal layer, is produced by means of the electric field generated upon application of the control voltage. This results in a change in the polarization properties of the layer, and consequently its transmission properties. The function of such organic or liquid crystal layers is generally known and does not require more detailed description.
If such a layer is used, it is thus possible, through application of a corresponding control voltage to the respective layer, for the absorption behavior either to be varied continuously variably between two limit values or to be switched between these two limit values.
As an alternative to the use of an electrically controllable layer, the solid-state radiation detector may, according to an embodiment of the invention, also be formed in such a way that the scintillator layer and the reset light source emit light from different wavelength ranges, the layer essentially only being absorbent for light from the wavelength range of the light emitted by the scintillator layer and essentially being transparent to the light emitted by the reset light source. This is based on the concept that the scintillator emits light from a relatively narrowly delimited wavelength range. Thus, CsI emits green light, for example.
If provision is then made of a layer which absorbs this light and is otherwise transparent to light outside this wavelength range, it is possible, with the use of a reset light source that emits light from such a different wavelength range, for this light readily to pass through the layer transparent to it into the carrier and from the latter to the scintillator or the pixel matrix. In this case, the reset light source emits in the red light range, for example. The layer used may in this case likewise be a cured coating, in particular a color coating, or a film, in particular a color film. Coatings or films which for example have special color centers or are naturally correspondingly colored are conceivable in this case.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Qt Open Source licensing
Possible Duplicate:
Can I use Qt LGPL license and sell my application without any kind of restrictions?
Just a simple question.
Without the Qt Commercial license, can I make an application and 'sell' it to a client? Or do I need a commercial license to sell it?
A:
Yes, as long as you accept LGPL 2.1 license.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Downstream processing of triple layered rotavirus like particles.
Rotavirus like particles (RLPs) constitute a potential vaccine for the prevention of rotavirus disease, responsible for the death of more than half a million children each year. Increasing demands for pre-clinical trials material require the development of reproducible, scaleable and cost-effective purification strategies as alternatives to the traditional laboratory scale CsCl density gradient ultracentrifugation methods commonly used for the purification of these complex particles. Self-assembled virus like particles (VLPs) composed by VP2, VP6 and VP7 rotavirus proteins (VLPs 2/6/7) were produced in 5l scale using the insect cells/baculovirus expression system. A purification process using depth filtration, ultrafiltration and size exclusion chromatography as stepwise unit operations was developed. Removal of non-assembled rotavirus proteins, concurrently formed particles (RLP 2/6), particle aggregates and products of particle degradation due to shear was achieved. Particle stability during storage was studied and assessed using size exclusion chromatography as an analytical tool. Formulations containing either glycerol (10% v/v) or trehalose (0.5 M) were able to maintain 75% of intact triple layered VLPs, at 4 degrees C, up to 4 months. The overall recovery yield was 37% with removal of 95% of host cell proteins and 99% of the host cell DNA, constituting a promising strategy for the downstream processing of other VLPs.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Email Newsletters
Guest view: An argument for minimum wage
May 10, 2013
Note to Readers: Hinsdale Central High School students wrote two editorials as part of their general economics course during their study of microeconomics this school year. They were learning about the positive and negative effects of government involvement in labor markets. Find the argument against minimum wage here.
Since the minimum wage was established in 1938, people have been arguing whether minimum wage is beneficial for America. For 75 years, critics have claimed that the minimum wage increases unemployment and that the minimum wage does not truly help support a family.
Getting rid of the minimum wage will reduce consumer purchasing power, reduce spending and hurt the overall economy. Also, studies by the Institute for Research on Labor and Employment at the University of California, Berkeley, show that minimum wage does not increase unemployment, even in bad times.
According to the Business For A Fair Minimum Wage group, many companies, both large and small, are fighting for a minimum wage of at least $8.75 an hour.
By increasing workers’ take-home pay, families can gain both financial security and an increased ability to purchase goods and services. Greater purchasing power then will help create more jobs for the American people and allow family spending to increase.
The state minimum wage in Illinois is $8.25, while the national minimum wage is $7.25. Both of these wages are too low to be able to afford all of life’s everyday necessities. When these wages were originally put into effect, prices of supplies for normal living circumstances were much lower. Yet today, prices have reached their highest levels in eight years.
Lower income families and primary breadwinners are not the only ones who rely on a living wage.
It’s frightening to learn that college tuition and fees have gone up 119 percent in the last 30 years. Simultaneously, as Holly Sklar writes in “Social Justice,” the inflation-adjusted value of the minimum wage has dropped 25 percent. This affects any young person hoping to attend a postsecondary institution, because they often work low-wage jobs to pay for higher education. Many ultimately will be left with the choice of massive debt or to continue a low-wage job that cannot truly sustain them.
(Meanwhile, the average CEO in 2007 made as much as 1,131 times the amount of money a minimum wage worker does per year.)
Minimum wages should be increased so that families don’t have to make the “heat or eat” decision. Low wages not only will affect the young people of our generation, but also the young of the next generation.
The minimum wage is there to help make our country better and more successful. If it continues to grow with the realities of today, our future will be even brighter.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Polishing the puffin exhibit
If you have visited the Aquarium recently, you’ve probably noticed that our popular Sea Cliffs Exhibit on level 4 is closed for renovations. The Aquarium puffins, razorbills and black guillemots are taking a short sabbatical while our Exhibits and Design team gives their home a thorough clean and polish!
The birds have moved to special offsite quarters that maintain exhibit temperatures of 50°F, and water quality analysts monitor the temporary freshwater systems created for these little divers.
The Sea Cliffs exhibit is designed to recreate the birds’ natural nesting environment. It includes rocky outcroppings and a pool that holds nearly 6,500 gallons of water. According to our animal care staff, the Aquarium puffins behave much the same as they would in a natural habitat. The staff also add special enrichments to the exhibit that encourages the birds to play and interact with their habitat.
Check out the video below to see some of these enrichment activities, and be sure to enter our Fish Friday contest below!
Today is Fish Friday and we have another contest for our followers!
Name one of the enrichment items featured in the video that these birds can eat.
Please post your answer as a comment to this post by 5 p.m. EST today, January 22nd. Correct answers will be entered into a drawing for a puffin prize pack featuring two tickets to the National Aquarium and a puffin plush! The winner will be awarded on Monday, January 25th. Good luck!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The president of the European Central Bank (ECB), Christine Lagarde, supports the bank’s active involvement in the development of a central bank digital currency (CBDC) to address the demand for faster and cheaper cross-border payments.
In an interview with French business magazine Challenges published on Jan. 8, Lagarde discussed the most likely threats to the global economy in 2020, among which she named a downturn in trade and a range of uncertainties, geopolitical risks and climate change. Going further, Lagarde noted that “the EU is still the most powerful economic and trading area in the world, with enormous potential.”
Not to act as observers of a changing world
When asked about ECB’s dedication to the exploration and development of a CBDC, Lagarde emphasized the urgent demand for fast and low-cost payments, the field where she sees the taking a leading position, rather than remaining observers of a changing world. As such, Lagarde said:
“ECB will continue to assess the costs and benefits of issuing a central bank digital currency that would ensure that the general public remains able to use central bank money even if the use of physical cash eventually declines.”
Lagarde recalled that the bank continues examining the feasibility and merits of a CBDC as such means of payment could exert influence on the financial sector and transmission of monetary policy. She stipulated that the ECB formed an expert task force set to work closely with national central banks to examine the feasibility of a euro area CBDC.
When asked about current initiatives to launch a CBDC at the ECB, a representative told Cointelegraph in somewhat vague terms that:
“We are working on all aspects of CBDC, with in-depth analysis of costs and benefits of such a new form of central bank money. It will take a while before we will communicate on our conclusions.”
Crypto-friendly approach
Lagarde has previously demonstrated a friendly stance towards digital currencies, having said in December last year that ECB should be ahead of the curve regarding the demand for stablecoins.
Last September, when Lagarde was still the head of the International Monetary Fund (IMF) and nominee to be the next president of the ECB, she claimed that she would focus on making sure that institutions promptly adapt to the rapidly changing financial environment.
In the meantime, ECB remains open to the idea of a digital euro equivalent but would want to stop citizens holding too much of it.
UPDATE Jan. 9 19:00 UTC: This article has been updated to include commentary from a representative of the ECB that we received after initial publication.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Nitric oxide implication in cadmium-induced programmed cell death in roots and signaling response of yellow lupine plants.
The sequence of events leading to the programmed cell death (PCD) induced by heavy metals in plants is still the object of extensive investigation. In this study we showed that roots of 3-day old yellow lupine (Lupinus luteus L.) seedlings exposed to cadmium (Cd, 89μM CdCl(2)) resulted in PCD starting from 24h of stress duration, which was evidenced by TUNEL-positive reaction. Cd-induced PCD was preceded by a relatively early burst of nitric oxide (NO) localized mainly in the root tips. Above changes were accompanied by the NADPH-oxidase-dependent superoxide anion (O(2)(·-)) production. However, the concomitant high level of both NO and O(2)(·-) at the 24th h of Cd exposure did not provoke an enhanced peroxynitrite formation. The treatment with the NADPH-oxidase inhibitor and NO-scavenger significantly reduced O(2)(·-) and NO production, respectively, as well as diminished the pool of cells undergoing PCD. The obtained data indicate that boosted NO and O(2)(·-) production is required for Cd-induced PCD in lupine roots. Moreover, we found that in roots of 14-day old lupine plants the NO-dependent Cd-induced PCD was correlated with the enhanced level of the post-stress signals in leaves, including distal NO cross-talk with hydrogen peroxide.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Recent Blog Articles
The Family Excerpt Two
I have been truly blessed to have such a wonderful family. When it came time to finally put
words to paper, I couldn’t leave them out, in fact, they all became fair game.
The following is an excerpt from my new book…
ENJOY AN EXCERPT FROM MY BOOK,
INSPIRED BY MY FAMILY
The Phone is Going to Ring
Having been back stage at major musical productions, I have seen all that goes into “putting on a show.” Props are especially important and the position of prop master is critical to a production. Props are assigned to a specific place on a specific prop table. There are prop lists that are checked, double checked and tripled checked, every night. Once, while I was singing in Italy, my costume required me to wear beautiful gold and blue jewelry. There was a prop assistant assigned to my necklace, bracelet and earrings. Her only job was to ensure that I wore them on stage and then they were returned to their proper place.
I attended a performance with my cousin, Kim and when the curtain opened, there was a phone on one of the tables in the scene. I whispered to my cousin, “That phone is going to ring.” She looked at me perplexed and then about half way through the scene, there was a phone call for one of the major characters. I knew that every prop has a meaning and a purpose and I knew that the phone on the table is on a prop list, and has an assigned place on a prop table, and I knew there was one person responsible for the phone being on stage and making its way back to the prop table, and if someone is going to all that trouble, the phone is going to ring.
This is how I look at students with learning disabilities. I see the phone that is going to ring but only because I have had the opportunity to be back stage in the world of special education and I have seen firsthand how it all works. My cousin didn’t even notice the phone on the table and why would she? She has never been back stage. My cousin represents the general education teachers who have been thrust onto the stage of special education without warning, without permission, without consultation, without training and without resources. They need our help because whether they are prepared for it or not, they are major characters in this production, the phone is ringing, and the call is for them.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Introduction
============
Moyamoya disease (MMD) is a progressive cerebrovascular steno-occlusive disorder. It typically involves the distal internal carotid arteries (ICAs), the proximal anterior cerebral arteries (ACAs) and the middle cerebral arteries (MCAs), accompanied by the development of an abnormal collateral vascular network at the base of the brain ([@b1-etm-0-0-3769]--[@b3-etm-0-0-3769]). Thus far, the majority of MMD cases have been reported in Eastern Asia ([@b4-etm-0-0-3769]); however, even in that region, the coexistence of MMD and Graves\' disease (GD) is rare. In 1991, Kushima *et al* first reported two cases of females suffering from MMD and GD simultaneously ([@b5-etm-0-0-3769]). To the best of our knowledge, only \~50 cases of simultaneous MMD and GD have been described in the literature available in the MEDLINE database to date. The patients were predominantly women, and their ages ranged between 10 and 54 years (mean, 29.3 years). Transient ischemic attacks and cerebral infarction were the most common symptoms in these patients. The majority of the cases showed thyrotoxicity when the cerebral ischemic event occurred and eventually recovered from the neurological symptoms after medical and/or surgical treatment ([@b6-etm-0-0-3769]). Although the association between MMD and GD remains unclear, a number of previous studies have suggested that GD could induce the development of MMD through 'thyroid storm' ([@b7-etm-0-0-3769],[@b8-etm-0-0-3769]), 'cerebrovascular hemodynamic changes' ([@b9-etm-0-0-3769]) and 'autoimmune arteritis' ([@b10-etm-0-0-3769]--[@b13-etm-0-0-3769]).
Von Willebrand factor (vWF) is a useful marker of endothelial activation or dysfunction ([@b14-etm-0-0-3769]). Increasing evidence has demonstrated that vWF is involved in cardiovascular ([@b15-etm-0-0-3769]) and ischemic cerebrovascular diseases ([@b16-etm-0-0-3769],[@b17-etm-0-0-3769]). In addition, coagulation factor VIII (FVIII) is involved in the process of thrombosis, and elevated FVIII levels are a prothrombotic risk factor for thromboembolism ([@b18-etm-0-0-3769]). The correlation of hyperthyroidism with elevated FVIII and vWF activities has been previously reported ([@b19-etm-0-0-3769]).
The present study reported the case of a 12-year-old male with significant overactivation of vWF and FVIII. The patient suffered from the rare coexistence of GD with MMD. Thus, a comprehensive investigation of a potential correlation between GD and the overactivation of vWF/FVIII and MMD was performed. Written informed consent was obtained from the family.
Case report
===========
A 12-year-old Chinese male was admitted to the Beijing Tian Tan Hospital (Beijing, China) in May 2013 with a rapidly progressive mild quadriplegia, aphasia and urinary incontinence. At 5 days prior to admission, the patient experienced several episodes of vomiting, paroxysmal aphasia and mild hemiplegia on his left side, along with recurrent brief convulsions. The condition of the patient rapidly deteriorated during the subsequent 5 days. The patient had previously suffered irritability, tremors, excessive sweating and frequent palpitations following moderate physical activity for approximately 1 year. He had no other disease history and a relevant family disease history.
On admission, the patient was dysphoric with slurred speech, and had a high blood pressure (165/95 mmHg), and rapid and regular heart rate (110--140 bpm). In addition, the patient presented facial paralysis (skewing of the mouth to the right side) and mild quadriplegia with globally increased muscle tone. Hyperactive deep tendon reflexes and positive bilateral Babinski signs were observed. A moderately enlarged thyroid gland was also identified. Emergency head magnetic resonance imaging (MRI) scans revealed multiple regions of cerebral infarction that could not be attributed to a single vascular territory ([Fig. 1](#f1-etm-0-0-3769){ref-type="fig"}). In addition, magnetic resonance angiography (MRA) revealed severe stenosis at the bilateral terminal portion of the ICAs, while the bilateral MCAs and ACAs had almost disappeared ([Fig. 1](#f1-etm-0-0-3769){ref-type="fig"}). Accordingly, combined with the patient\'s symptom of progressive mild quadriplegia, aphasia, recurrent convulsions and urinary incontinence that appeared 5 days prior to the first admission, and the signs of globally increased muscle tone, hyperactive deep tendon reflexes and positive bilateral Babinski signs on admission and the results of the head MRI, a diagnosis of multiple cerebral infarction was made definitely. Blood examination showed the following results: Thyroid-stimulating hormone (TSH), \<0.001 µU/ml (reference range, 0.35--4.94 µU/ml); and free triiodothyronine (FT3), 29.17 pmol/l (reference range, 2.63--5.7 pmol/l). Positive thyrotropin receptor antibody (TR-Ab), as well as elevated levels of thyroid peroxidase antibody (TPO-Ab; 396.44 U/ml; reference range, \<12 U/ml) and thyroglobulin antibody (TG-Ab; 134.56 U/ml; reference range, \<34 U/ml), were also detected in the blood ([Table I](#tI-etm-0-0-3769){ref-type="table"}). Due to the above symptoms of irritability, tremors, excessive sweating, frequent palpitations and enlarged thyriod gland with elevated TPO-Ab, elevated TG-Ab and positive TR-Ab in blood, GD was suspected firstly. A thyroid gland needle biopsy revealed thyroid follicular epithelial cell proliferation, which confirmed the diagnosis of GD. In addition, quantification of coagulation factor activity demonstrated that FVIII activity was 261.6% (reference range, 50--150%) and vWF activity was 324.2% (reference range, 40--120%), while other coagulation parameters were all within the normal ranges, as shown in [Table I](#tI-etm-0-0-3769){ref-type="table"}.
The patient was managed with standard antithyroid treatment (20 mg/day thiamazole, Merck Serono, Darmstadt, Germany; 100 mg/day metoprolol, AstraZeneca Co., Ltd., Wuxi, China) until the submission of this manuscript, in combination with a low iodine diet. In beginning of the treatment, other management included 30 mg/day Adalat for 2 weeks (Bayer Schering Pharma AG) for control of blood pressure, sedative administration (5 mg diazepam, Zhejiang Medicine Co., Ltd., Zhejiang, China) lasting until the calming of irritability after 1 week. However, no anticoagulants or thrombolytic agents were administered to the patient. After 2 months of treatment, the neurological symptoms had improved significantly; the patient had recovered from paralysis, walked with a steady gait and no slurred speech was observed. Further blood tests showed that the patient\'s thyroid function had almost returned to normal (TSH, 0.027 µU/ml; FT3, 3.21 pmol/l), with depressed vWF and FVIII activity (117.10 and 122.40%, respectively), although the thyroid autoantibodies persisted at high levels ([Table I](#tI-etm-0-0-3769){ref-type="table"}). Digital subtraction angiography (DSA) was then performed, which demonstrated severe stenosis of the bilateral distal segments of the ICAs, and of the ACAs and MCAs. In addition, only minimal antegrade flow of ACA and MCA territories was observed. A network of collateral vessels was also visible at the base of the brain and in the bilateral basal ganglia areas ([Fig. 2](#f2-etm-0-0-3769){ref-type="fig"}). To prevent further attacks, revascularization surgery was performed initially on the right side superficial temporal artery binding to the middle meningeal artery at 3 months after the first admission. This results of DSA associated with the symptoms of gradually emerged quadriplegia, aphasia, convulsions and the head MRI results which showed bilateral basal ganglia and subcortical multiple infarction, together, could meet the diagnostic criteria for MMD ([@b20-etm-0-0-3769]). After a further 3 months (6 months after the first admission), an encephalo-duro-arterio-synangiosis procedure was performed successfully on the left side superficial temporal artery attaching to the endocranium and arachnoid.
During the 20-month follow-up period, a continuous 20 mg/day thiamazole and 100 mg/day metoprolol was administrated, the thyroid function, thyroid autoantibodies and coagulation parameters were measured every 3 months. During this period, a correlation was observed between the patient\'s thyroid function and vWF/FVIII activity. After 3 months, following the administration of propranolol and metoprolol, his thyroid function (FT3 and FT4) recovered to the normal range. Notably, a decline in FVIII/vWF activity was observed simultaneously. After a further 3 months, while FT3 and FT4 in the patient\'s blood were higher than the normal range, a homologous elevation of the patient\'s FVIII/vWF activity in the blood was observed. A similar phenomenon was observed during the next 12-month follow-up period ([Table I](#tI-etm-0-0-3769){ref-type="table"}). When the thyroid function recovered to the normal range, a corresponding decline in FVIII/vWF activity was observed ([Table I](#tI-etm-0-0-3769){ref-type="table"}). At the same time, the thyroid autoantibodies persisted at high levels, whereas other coagulation parameters were consistently around the normal ranges.
Discussion
==========
The case reported in the present study was affected by GD and MMD successively. The manifestations observed were mainly due to cerebral infarction, while the clinical features of thyrotoxicosis had appeared approximately 1 year prior to admission. This is consistent with the features of previously reported cases, which suggest that transient ischemic attacks and cerebral infarction were the common symptoms and thyrotoxicity was showed when the cerebral ischemic event occurred ([@b6-etm-0-0-3769]).
Due to the limited incidence of co-existing GD and MMD, extensive studies have not been possible, and no specific mechanism underlying this association has been elucidated to date. Previous hypotheses on the underlying mechanism have been proposed that presume the existence of a pathoetiological association between GD and MMD, such as genetic background, autoimmunization ([@b10-etm-0-0-3769],[@b11-etm-0-0-3769]), thyrotoxic states ([@b9-etm-0-0-3769],[@b21-etm-0-0-3769]) and significant hemodynamic changes ([@b9-etm-0-0-3769]). There are certain evidence-based medicine practices and epidemiological data that support these theories. For instance, Kim *et al* concluded that elevated thyroid autoantibodies are associated with MMD, based on a prospective study ([@b11-etm-0-0-3769]). This theory was supported by a case-control study conducted by Li *et al*, which demonstrated that increased thyroid function and elevated thyroid autoantibodies are associated with MMD, particularly in pediatric patients ([@b10-etm-0-0-3769]). Furthermore, improvement in the ischemic symptoms without recurrence has been reported following antithyroid drug administration alone in two patients affected by hyperthyroidism combined with bilateral internal carotid artery stenosis ([@b21-etm-0-0-3769]). In another study, two patients had recurrent stroke subsequent to antithyroid drug withdrawal for 6 months, while the majority of patients in the same study did not present recurrence of stroke with regular use of antithyroid drugs ([@b9-etm-0-0-3769]). These studies indicate that GD is an underlying risk factor for MMD. However, the mechanism by which elevated thyroid autoantibodies or increased thyroid function evoke the development of stenosis of the intracranial arteries, as seen in MMD, remains to be elucidated.
The patient in the present study was diagnosed with MMD associated with GD, based on the symptoms of irritability, tremors, excessive sweating, frequent palpitations, the enlarged thyroid gland and the examination results of elevated TPO-Ab, elevated TG-Ab and positive TR-Ab in blood, along with thyroid gland pathology by needle biopsy. Furthermore, his multiple cerebral infarction and the results of DSA that showed a serious stenosis at the bilateral terminal portion of the ICAs, the bilateral MCAs and ACAs ([Fig. 1](#f1-etm-0-0-3769){ref-type="fig"}). Notably, significant overactivation of FVIII and vWF were identified in the plasma on admission, which are considered to serve an important role in vascular diseases ([@b15-etm-0-0-3769]--[@b18-etm-0-0-3769]). The correlation of high plasma levels of vWF/FVIII with cardiovascular disease ([@b15-etm-0-0-3769]), cerebral sinus and deep venous thrombosis ([@b18-etm-0-0-3769]), as well as ischemic stroke ([@b16-etm-0-0-3769],[@b17-etm-0-0-3769]), has been extensively investigated. Certain studies have concluded that high plasma levels of vWF are predictive of ischemic stroke ([@b22-etm-0-0-3769],[@b23-etm-0-0-3769]), and may even be an independent risk factor for the prediction of ischemic stroke ([@b23-etm-0-0-3769]).
The pathophysiologic role of FVIII- or vWF-associated processes in ischemic brain injury is unclear. It is well-known that vWF and FVIII serve crucial roles in primary thrombosis. In addition, vWF mediates the initial adhesion of platelets at sites of vascular injury, and this subsequently leads to fibrin coagulation and the formation of a platelet thrombus via a complex coagulation cascade, platelets adhesion mediated by vWF is a prerequisite for normal hemostasis ([@b24-etm-0-0-3769]--[@b27-etm-0-0-3769]). vWF is synthesized and stored in endothelial cells, and plasma levels are increased in response to different states of endothelial damage; therefore, vWF has been proposed as a useful marker of endothelial activation or dysfunction ([@b14-etm-0-0-3769]). Earlier studies have identified that concentric and eccentric fibrocellular thickening of the intima, which induce stenosis of the vascular lumen, are typical pathological changes in the terminal of the internal carotid artery in MMD ([@b28-etm-0-0-3769],[@b29-etm-0-0-3769]). Recent studies using high-resolution 3T MRI of a cross-section of the MCA showed no plaque or enhancement in the MCA wall ([@b9-etm-0-0-3769],[@b30-etm-0-0-3769]), The artery blood vessel image under 3T MRI from MMD is at variance with atherosclerotic features. This phenomenon was also observed in the patient of the present study. Furthermore, in another study, thromboemboli in the internal wall of the Moyamoya artery were observed in \~50% of cases at autopsy ([@b31-etm-0-0-3769]). This indicates that abnormal thrombogenesis serves an important role in the etiology of MMD.
Previous studies have demonstrated that vascular endothelium is a specific target of thyroid hormones ([@b32-etm-0-0-3769]), and that hyperthyroidism tends to be associated with endothelial dysfunction or damage. This endothelial dysfunction depends not only on the cause but also on the degree of hyperthyroidism ([@b19-etm-0-0-3769]). Hyperthyroidism is known to result in high sympathetic nerve activity, thus plasma adrenaline levels are increased, acting as a strong stimulus of vWF secretion by endothelial cells ([@b33-etm-0-0-3769]). Clinical studies have also demonstrated that the elevated vWF levels in hyperthyroid patients returned to the normal range following administration of propranolol ([@b34-etm-0-0-3769],[@b35-etm-0-0-3769]). In accordance with the observations of the current study, hyperthyroidism has a significant correlation with the elevation of FVIII and vWF activity. Considering the pivotal role of vWF and FVIII in thrombogenesis, GD could be expected to be involved in the mechanism underlying the development of MMD, which is mediated by vWF/FVIII overactivation. GD is such a complex disease that may influence multiple aspects associated with the pathophysiologic process of MMD, including cerebral hemodynamic changes ([@b9-etm-0-0-3769]), autoimmune inflammation ([@b10-etm-0-0-3769],[@b11-etm-0-0-3769]) and endothelial dysfunction ([@b19-etm-0-0-3769]). In addition, thrombogenesis is mediated by vWF and FVIII activities, which may be due to injury to the intima or vessel wall, while the injury of intima or vessel wall could be a result of cerebral hemodynamic changes or autoimmune inflammation. Further evidence of vWF and FVIII mediating the development of MMD is the varying trend of vWF and FVIII activities during the follow-up period in the present study. Upon admission, the current patient had significantly elevated vWF and FVIII activities, and presented with rapid neurological deterioration. Following the administration of thiamazole and metoprolol, the patient\'s thyroid function returned to normal, while vWF and FVIII activities were simultaneously suppressed, with a correlation observed in their fluctuations ([Table I](#tI-etm-0-0-3769){ref-type="table"}). During the follow-up period, the thyroid autoantibodies TR-Ab, TG-Ab and TPO-Ab persisted at high levels in the patient\'s blood, whereas other coagulation parameters were consistently within or close to the normal range. Therefore, the effect of thyroid autoantibodies on the development of MMD was unclear in the present patient.
However, an evident limitation of the present study is that only one case was included. Nevertheless, during the 20-month follow-up period, correlations were identified among GD, overactivation of vWF/FVIII and intracranial arterial stenosis, which require further confirmation in more cases and in-depth studies in the future. Moyamoya disease associated Graves\' disease has a tendency to present with coagulation dysfunction. Overactivation of vWF/FVIII due to thyrotoxicosis might contribute to the ischemic accidents. Future research is warranted to investigate novel therapeutic methods in prevention of ischemic attack.
The present study was supported by a grant from the National Youth Science Fund (grant no. 81301118). The authors thank Dr Rong Wang and Dr Wei-Qing Wan and their colleagues (Center of Cerebrovascular Disease, Beijing Tian Tan Hospital, Capital Medical University, Beijing, China) for their excellent vascular surgical procedures on the patient. In addition, we also thank the patient and his parents for their best collaboration during the follow-up.
{#f1-etm-0-0-3769}
{#f2-etm-0-0-3769}
######
Examination results of thyroid function, coagulation parameters and thyroid autoantibodies on admission and during follow-up.
Parameter Reference range Admission After 3 months After 6 months After 9 months After 12 months After 18 months
--------------- ----------------- ----------- ---------------- ---------------- ---------------- ----------------- -----------------
TT3 (nmol/l) 0.89--2.44 7.04 0.97 3.48 1.17 4.39 1.85
TT4 (nmol/l) 62.68--150.84 210.73 64.06 171.65 52.12 220.58 113.50
TSH (µU/ml) 0.35--4.94 \<0.001 0.027 0.001 3.803 0.048 0.007
FT3 (pmol/l) 2.63--5.70 29.17 3.21 10.63 3.26 15.32 5.45
FT4 (pmol/l) 9--19.04 35.99 11.31 27.63 10.26 34.16 19.06
FVIII (%) 50--150 261.60 122.40 175.90 115.60 185.60 151.80
vWF (%) 40--120 324.20 117.10 128.00 119.50 146.50 125.40
FVII (%) 50--150 125.00 75.00 113.00 55.00 59.00 60.0
FIX (%) 50--150 148.20 138.60 137.20 129.70 115.80 66.0
PT-S (sec) 9.4--12.5 12.60 11.30 11.90 11.50 9.68 10.80
PT (%) 70--120 100.70 80.00 89.00 112.00 108.00 94.00
PT-INR 0.9--1.2 1.04 1.09 1.14 0.98 1.05 1.01
FIB-C (mg/l) 200--400 251 230 381 418 352 228
APTT (sec) 25.5--38.4 24.70 25.50 27.80 24.50 29.50 29.20
APTT-R 0.91--1.38 0.89 0.89 0.98 0.93 1.12 1.02
TPO-Ab (U/ml) 0--12 396.44 205.17 111.21 221.3 252.1 594.9
TG-Ab (U/ml) 0--34 134.56 71.31 65.63 85.20 74.50 255.30
TR-Ab − \+ \+ +/− \+ \+ \+
TT3: triiodothyronine; TT4: thyroxin; TSH: thyroid-stimulating hormone; FT3: free triiodothyronine; FT4: free thyroxin; FVIII: blood coagulation factor FVIII activity; vWF: von Willebrand factor activity; FVII: blood coagulation factor VII activity; FIX: blood coagulation factor IX activity; PT-S: prothrombin time, PT: prothrombin activity, PT-INR: prothrombin international normalized ratio, FIB: fiber fibrinogen, APTT: activated partial thromboplastin time, APTT-R: partial thromboplastin time ratio of activate; TR-Ab: thyroid hormone receptor antibody; TPO-Ab: thyroid peroxidase antibody; TG-Ab: thyroglobulin antibody.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Gainesville receiver Chris Thompson was the only Florida commit who took an official visit to UF this weekend, but there were plenty of future Gators around to keep him company.
He spent time with Florida’s eight early enrollees as well as UF commits Ahmad Fulwood and Nick Washington, who both unofficially visited on Saturday.
“I had a good time with those guys,” Thompson said. “I’m from Gainesville so it doesn’t take much to make me feel at home, but they showed me a lot of hospitality. I got along real well with Kelvin Taylor and Demarcus Robinson.”
Thompson and his GHS team made it to the Class 6A State Championship. (Brad McClenny/The Gainesville Sun)
His favorite part of the trip was the food and getting to know new receivers coach Joker Phillips.
Thompson said UF coach Will Muschamp and offensive coordinator Brent Pease delivered their usual message to him about the need for playmakers at receiver. Phillips, however, had a different discussion with the GHS standout.
“He was telling me not to change who I am,” Thompson said. “He knows that coming to UF was dream and I worked hard to make it happen, but he says I can’t be satisfied with that. I have to stay humble and continue being a good person. He just doesn’t want me to get full of myself and says I need to keep grinding.”
Phillips encouraged Thompson to come up to the football facilities as often as possible and get an early jump on next year.
“I’m going to do any and everything I can in the offseason,” Thompson said.
The 6-foot, 170-pounder was hosted by UF junior defensive tackle Damien Jacobs, who also hosted Ole Miss JUCO defensive tackle commit Jarran Reed (Scooba East Mississippi CC). He spoke with Sun about his visit to Florida on Monday night.
About This Blog
If Zach Abolverdi had a dollar for every time his last name was mispronounced … you just made him richer. Born in Orlando but raised in Gainesville since 1990, he grew up around Florida football during the Steve Spurrier era. He once threw a perfect spiral under Spurrier’s watchful eye at his summer camp. The Head Ball Coach told him, “That’s a nice throw for a little man, but hold that ball by your ear.” The 8-year-old gunslinger replied, “I already know how to throw a football.” He didn’t appreciate the little man comment either. Zach is a Hearst Award winner and graduate of the University of Florida. He enjoys spending time with family, Denzel Washington movies and only about a dozen music artists, most of whom go by their real name. College football, the NFL, March Madness and LeBron James provide his sports fix.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
201 Or. 300 (1954)
270 P.2d 160
STATE OF OREGON
v.
KADER
Supreme Court of Oregon.
Argued January 13, 1954.
Affirmed May 12, 1954.
*301 Nels Peterson and Frank H. Pozzi, of Portland, *302 argued the cause for appellant. With them on the brief was Sidney I. Lezak, of Portland.
J. Raymond Carskadon and Charles E. Raymond, Deputy District Attorneys, of Portland, argued the cause for the respondent. With them on the brief was John B. McCourt, District Attorney, of Portland.
Before LATOURETTE, Chief Justice, and WARNER, ROSSMAN, LUSK, BRAND and PERRY, Justices.
AFFIRMED.
ROSSMAN, J.
This is an appeal by the defendant from a judgment of the circuit court which found her guilty of the crime of manslaughter (ORS 163.040). The indictment charged that on January 23, 1952, the defendant, "by the use of the hands", killed her three-year-old daughter Sherry by asphyxiation. The indictment was appropriate to a charge of murder in the first degree. The defendant's plea was "not guilty."
The defendant submits assignments of error which challenge rulings adverse to her that (1) denied a motion made by her for a directed verdict on the ground of insufficiency of the evidence; (2) refused to instruct the jury upon excusable homicide; (3) instructed the jury upon the subject of consciousness of guilt; (4) permitted a medical witness called by the state to express an opinion concerning the cause of bruises which appeared upon the deceased's face; and (5) refused to order a state witness to produce papers from which he had refreshed his memory before entering the witness stand.
The face of the deceased child had discolorations under the chin, upon both cheeks and over the bridge of the nose. The state claims that January 23, 1952, *303 between 3:15 and 5:00 p.m. the defendant clasped a hand firmly over the mouth and nose of Sherry, causing the discoloration thereby and effecting her death through asphyxiation. No person who testified saw the purported act occur. The state also claims that after the defendant had brought about Sherry's death she cast the body into a sump upon the grounds of the East Side plant of the Portland Gas & Coke Company. The plant is situated a few blocks from the home which the defendant occupied. January 25, at about midnight, she led the officers to the sump and showed them the body floating in water which filled the lower two feet of the sump. The latter was seven feet wide and nine feet long. Its depth was about 12 feet. Old-fashioned cellar doors which met in the middle covered the top.
The defendant, 21 years of age, was the mother of two children, one of whom was the deceased Sherry, three years of age, and the other was Georgina, known as Vickie, four years of age. The trial judge ruled that, due to Vickie's tender years, she was not competent to give testimony. The defendant did not testify. The first assignment of error renders it incumbent upon us to review the evidence, especially that which the state produced. The evidence covers 1,225 pages. In addition there are many exhibits.
The defendant resided with her two children in the basement apartment of a house owned by her stepfather and mother in Portland, Mr. and Mrs. Eugene Sing. The Sings occupied the main part of the house. The apartment in which the defendant and her two children lived took up only a portion of the basement. In the remaining section were a flight of stairs leading to the first floor and some rubbish which included several small pieces of concrete. Although the Sings *304 occupied the main part of the house, we shall refer to the latter as the defendant's home.
The defendant cared well for her children. The Sings described her relationship with them as generally good. Mrs. Sing declared that "sometimes she was a little bit too severe with them," and Mr. Sing believed that she was "meaner" to Sherry than to Vickie.
A taxicab driver testified that Thursday, January 23, 1952, at a few minutes after 3:00 p.m. he drove the defendant and her two daughters home from downtown Portland. On that day rain fell intermittently. Precipitation occurred around 5:00 and 6:00 p.m. When the cab reached the defendant's home, the driver lifted the children from it across the wet parking grass to the sidewalk. In so doing he came close to the faces of the children. He observed nothing unusual in their appearance. Shortly after the defendant reached home she requested Mr. Sing to drive her to a postoffice station in that vicinity, but when Sing noticed that the time was 3:15 p.m. he told her that the trip would be useless, explaining that the station's hour for closing was 3:00 p.m. Sing then drove to his brother's restaurant and did not return home until 6:00 p.m. The evidence just reviewed, according to the state, shows that the defendant was with her children on the afternoon when Sherry was killed. It also shows, so the state claims, that at that time no bruises, marks or discolorations were upon Sherry's face.
At about 5:42 p.m. of that day (January 23) two police officers who were operating a prowl car received a radio call ordering them to go to the defendant's home. Two minutes later, when they spoke to the defendant, she told them, according to one of the officers, that about 15 minutes before they came her daughter Vickie, who had been playing outside, told her that *305 "an old man with gray hair, who was dirty, in a black car, had grabbed Sherry and into his car and drove off." Upon hearing the defendant's statement, one of the officers telephoned to the central police station and the other drove the defendant and Vickie around the neighborhood in an effort to find Sherry and her purported abductor.
At six o'clock of that evening, P.E. Lippold, a sergeant of the Portland police department, called upon the defendant and was told by her that Vickie had said "the man had driven up, that he was an old dirty man, and that he had gray hair, similar to grandmother's hair, and that he was wearing coveralls with a zipper front; that it was an old dark sedan and dirty and that he had stopped and said, `Hi, little girls, come over here.' And then that he grabbed Sherry by the arm and put her in the car." At 7:00 p.m. Lippold again spoke to the defendant. This time he was accompanied by two other members of the police department. He testified:
"And at that time she told us that now her daughter Vickie had changed the story somewhat, that Vickie told her now that she had not actually seen a man grab Sherry, but that the man had first grabbed Vickie and that Vickie broke away and ran towards the house and when she turned around again the man was driving off and she didn't see Sherry anymore; but she stated that Vickie had told her that she didn't actually see the man put her in the car as she had originally stated."
At 11:00 p.m. of the same day (January 23) Lippold again interviewed the defendant. This time he and a fellow officer (Nolan) inquired as to the father of the children and was told that the father was a Mr. George Dollarhide who lived in California. The *306 defendant expressed the belief that Dollarhide was not the person who had taken Sherry, for, according to what she told the officers, "the children knew George and that Vickie certainly would have known if that man that did pick up Sherry was George." She explained that Dollarhide had not seen the children "for over a year", but, later, as the interview progressed, said that Dollarhide had been in Portland within the last four months and had seen, not only the children, but also the defendant and Mrs. Sing.
The defendant's mother, Mrs. Sing, was employed in a Portland store. On January 23 the mother and the defendant's stepfather reached home at about 6:00 p.m. At that moment the defendant was upon the porch talking to a police officer. According to Mrs. Sing, the defendant "was kind of hysterical" and her hair "was hanging down like she was wet, and Vickie looked like she was wet too." She wore a coat. Sing also noticed the defendant's hair and, as a witness, described it as "all stringy, so wet. * * * both her and the girl was soaking wet." One of the police officers gave a similar account of the condition of the defendant's hair. The significance which the state attaches to the description just quoted will appear later. Presently the defendant told Mrs. Sing that "Sherry disappeared, that she was gone; she let her out to play and I don't know, all that." After the police officers had left and the defendant had accompanied her mother into the house the two had a conversation which the mother recounted in this way:
"A Well, naturally, I asked her what had happened and she told me again.
"Q And what did she tell you that time?
"A Well, just that Sherry was gone, she shouldn't have let them out to play, things like that.
*307 "Q Did she tell you how Sherry had gone at that time?
"A Well, she just said that they were out to play and some man come along and Georgina come to the door and told her Sherry was gone.
"Q By `Georgina' you mean Vickie came to the door?
"A Yes.
"Q And said that Sherry was gone?
"A (Witness nods head). Then Georgina told me that the man had yellow boots on, and then I tried to talk to her to find out exactly what the man looked like. I thought maybe it would help."
The events which we have so far mentioned occurred, so the witnesses swore, Wednesday, January 23.
Thursday, January 24, the police continued their investigation into the disappearance of Sherry. At about 9:30 a.m. J.H. Braley and Albert Eichenberger, both officers in the police department, accompanied by two members of the Federal Bureau of Investigation, called upon the defendant. Braley testified that Eichenberger and the two federal officers questioned her about the purported disappearance of Sherry and that while the questioning was in progress he played with Vickie. We now quote:
"I was merely as I like youngsters, I was merely entertaining the, Mrs. Kader's daughter that was there, and talking to her and playing with her toys and so forth while Detective Eichenberger talked to Mrs. Kader."
Presently the defendant directed her attention to Vickie, so Braley swore, and said, "Vickie, don't talk to that man any more." Eichenberger, referring to the same incident, testified:
"Well, yes; it was during the time that I was talking *308 to Mrs. Kader that Detective Braley was talking to Vickie in the other room, and at one time Mrs. Kader says to me, she says, `Well, does that man have to question that girl?' `Oh', I said, `I don't think that he's really harming the girl or bothering the girl any.' I says, `It seems to me as though they are having a little fun there on the davenport, I don't think that he is bothering her any.' * * * And then, later on, Mrs. Kader called to Vickie and told her to get off the davenport and quit talking and play."
William D. Browne, chief of detectives of the Portland Bureau of Police, also spoke to the defendant on the day following the purported kidnaping, that is, on the 24th. Although the defendant had told officers Lippold and Nolan the preceding evening that she did not suspect George Dollarhide, father of the children, she made contrary statements to Browne. Dollarhide had a sister who had displayed an interest in the children. According to Browne, the defendant told him: "It must have been them, Dollarhide and his sister in Los Angeles." At that point Browne communicated with the police of Los Angeles, San Francisco and other cities in an effort to locate the Dollarhides. Through the San Francisco police he was informed that Dollarhide had donated a pint of blood to the Red Cross on the afternoon of the purported kidnaping. The Los Angeles police reported that Dollarhide's sister was living in that city and that she was in Los Angeles on the day of the disappearance. Upon receipt of that information, Browne spoke to the defendant. The following is taken from his testimony:
"I called Mrs. Kader on the telephone and told her that we had located Dollarhide and her answer was, `Well, has he my baby with him?' I said `No.' Well, she practically said nothing."
*309 Shortly after that conversation Browne sent for the defendant. We again quote from his testimony:
"I talked to Mrs. Kader and asked her why she had told her daughter not to talk to me or give me any information.
"Q What did she say?
"A She said, `You are a very poor policeman, I would think that you would be trying to find my child instead of questioning my daughter and I."
Joseph H. Blewitt, a member of the police department's homicide detail, interviewed the defendant January 24. Blewitt was accompanied by other members of the department, including one Robert McKeown. The questioning occurred in one of the offices of the bureau and commenced at 5:00 p.m. In its course the defendant stated, so Blewitt swore, that on January 23, at 5:30 p.m., Vickie came to her with a report that "an old gray-haired man with coveralls, driving an old dark sedan, had taken Sherry away." Evidently Blewitt and McKeown doubted the defendant's story, for they plied her for details. According to Blewitt, she replied that "she knew nothing further." After a recess the session resumed at 9:00 p.m. The officers had decided to accuse the defendant of having brought about the death of Sherry. When they made the accusation they met with a denial. Next, a new tack was taken which McKeown described in this way:
"Mr. Blewitt happened to start talking to her more or less like a child. We said, `Well, just play acting, suppose we were just making believe that somebody had done away with their child, what would they do with them?' She perked right up at this. `Well,' she said, `just play acting, suppose that this little child was accidentally killed by another little child, would she go to the penitentiary?' So we asked her, well, how old was the other child *310 about, and she says, `Well, supposing that she might be four and a half or five, young', and we told her that nothing would happen to a child that young, and she says, yes, but supposing an older person, an adult, had assisted afterwards in getting rid of this child, would she be prosecuted?"
After further questioning in similar vein, accompanied by admonitions to the defendant that she ought not permit the body of her daughter to remain unburied, the defendant told the officers, according to the testimony of both, that she would take them to the place where Sherry's body lay. The hour was 11:30 p.m. The two officers, accompanied by the defendant and a member of the Women's Protective Division, thereupon entered a police car and, obedient to the directions of the defendant, drove to the East Side plant of the Portland Gas & Coke Company, which is located a few blocks from the defendant's home. Upon reaching the plant, the party entered on foot an area occupied by large storage tanks. Eventually the defendant came upon a large covered sump and, pointing to it, said, "There she is." When the lid was removed and a flashlight was turned into the dark pit Sherry's body was seen floating in water at the bottom of the pit. Evidence which the jury could reasonably believe indicated that death had occurred about 48 hours previously. After the defendant had shown the officers the body, she and they went to the defendant's home. Then the coroner removed the body from the sump.
In the automobile on the way to her home, the defendant, according to Blewitt's testimony, said that after she returned home from the taxicab ride on January 23 she noticed Vickie standing in the kitchen and
"asked her if anything was the matter and Vickie said she was afraid to say. And, according to Mrs. *311 Kader, when she questioned Vickie, Vickie said that they had been playing soldier. This conversation took place enroute from the Gas Company to the residence, and after we reached the residence I don't know just where it breaks there anyway, she continued to say that she went in through her bathroom into the basement in back of her apartment and at that time she found Sherry lying at the foot of the stairs. She spoke to Sherry and she didn't answer and that, when she examined her, she wasn't breathing, or she didn't believe that she was breathing."
The defendant told the officers that she believed that Vickie had caused Sherry's death and that she did not want her to be arrested. Blewitt, going on with the account which he said the defendant gave, partly in the car, partly in the defendant's home and the remainder in the police station, continued as follows:
"She says that she took Sherry half way up the flight of stairs, rolled her down the stairs four or five times to bruise her so that it would appear as though some man had beaten her. After she had rolled her down the stairs four or five times, she put her little boots on, put her over her shoulder and carried her down to the sump where she deposited her."
Officer McKeown, in relating the account which the defendant gave on the trip from the gas works to her home and from there to the police station, testified that, according to it, Vickie "had a funny expression, the way she put it, on the face, and she asked her what was the matter and the little girl said she was afraid to tell her." It was at that point that Vickie, according to the account, said that the children had been playing soldier and that "the soldier had hit Sherry." Then, according to the account, the defendant coached Vickie "into telling the kidnap story and of even taking her *312 outside and showing her a gray-haired man that was getting into an automobile and telling her that was the man that's got Sherry."
After the officers had remained in the defendant's home for about 20 minutes and had taken notice of the staircase, the party returned to the police station where the officers continued their questioning of the defendant. One of them explained to her that they thought that she "was shielding someone else and we didn't want her to suffer for a crime that she hadn't actually committed." Before long the defendant expressed a wish to make a written statement. At that point a stenographer was called and while the defendant spoke, the stenographer typed her words. The defendant signed the statement. A copy of it follows:
"I, Jada Z. Kader, do hereby give the following statement of my own free will, without threats or promises being made me by the detectives taking this statement:
"I, Jada Z. Kader, 21 years of age, born in Los Angeles, Calif. May 31, 1930, mother of Vickie LaVerne and Sherrie Ellen; now residing for past month at 2605 SE 13. Wednesday, January 23, 1952 we got up at about 9:30, ate breakfast, did the houseworks while the kids played, then I knitted on the hat until we ate lunch. After we ate lunch we sat down and read Bengi Engine, then stacked the dishes in the sink and we got ready and went over town. We got off the bus over-town, first we went to Kresses, we looked around there, then we went to Newberrys and spent 10¢ of their allowance on cookies and they rode on the 10¢ horse. Went up the ramp to the second floor, bought yarn. Then we went to Fred Meyers and got some pictures, then we went over to Meier & Frank and they picked out what they wanted for dinner; went to the restroom and I asked the colored lady in there which way to get out of the store. As we came out of the door *313 we saw a cab sitting there, we took it and went home. I think it was a Broadway Cab. We went in the house and put the packages away; I fixed a package to mail. I was sitting on the davenport and the children were playing in the basement like they always do. I went in the bathroom and got the oil-can and went out to get the oil. The oil used to sit by the front door. I made about 3 trips to fill the tank on the stove. I took the can back to the bathroom where I kept it. I saw Vickie standing in the basement, she looked so funny. So I went into the basement, through both the doors back of the bathroom. Sherrie was laying kind of sideways at the bottom of the stairs and that's when I found her.
"I told Vickie to go in the other room and play. After Vickie left I just looked at her, she wouldn't say anything to me. I asked Vickie, she was in the kitchen, what was the matter with Sherrie. She said "I'm afraid to tell you this mamma, Sherrie got hit by the soldier." I went back to see her again, I just kept thinking it didn't happen. Then she wouldn't breath or anything, that's when I tried to think of what to do. I sat there a long time and tried to think; no one else was in the house. I thought it all up myself, what to do. The only thing I could think to do was to say somebody took her; to make it look like somebody took her I carried her up the stairs and rolled her down. I did this about five times, maybe more, I don't think I hit her with any of the concrete to make it look worse, I didn't think of doing that but I wanted it to look as though some man did it. She was all dressed except her boots and mittens. She didn't bleed. I vomited and was in there awhile; I went in to Vickie again and told her just to pretend it was like a dream. I told her not to ever say anything about playing soldiers. I told her this so she would never say how Sherrie got hurt. I felt like I was two people, watching myself do it. I shut my eyes and put her boots on. I took her (Vickie) in to take a nap, I sat down again. I carried Sherrie out my door onto SE 13th, went west *314 on Ivon, carried her in my arms down to the gas works, I was looking for a place to put her, across the field, it was raining; I carried her down the bank. It was dark, I found a box-like place (I didn't know it went way down). This is the place I led the detectives to tonight. After leaving Sherrie there I went home, I saw a dark car with grey-haired man in it, parked near. I took Vickie outside and showed her the man and said `That man's going to keep Sherrie for us' or something like that. Then I went upstairs and tried to call my mother, then I called the police. I thought of telling them but they always asked about the man so I decided never to tell the other.
"I have read the above and these are the true facts of this case.
(Signed) Jada Z. Kader."
After the defendant had signed the typed statement, the officers told her that they did not believe that a woman of her small size could have carried for the required distance a body weighing more than 30 pounds and asked her whether "a boy friend had helped her." According to the officers' testimony, the defendant answered by attributing the death to Mr. Sing. McKeown, in giving her answer, spoke as follows:
"* * * little Vickie had come to her and told her that Sing had pushed Sherry down the stairs; and that she had come in and she heard him say keep her, in her language, her `God damn kids out of the upstairs.' She told Sing that the child wasn't breathing and he didn't believe her. She got down, and looked at him, and then when he found out, he sat her down on the stairs and told her that she wasn't to tell anybody. He told her this story that she was to tell Vickie about the kidnaping. He told her the story that she was to tell about the soldier hitting her in the head. Said that Sing helped her put on the boots and the mittens, and that he took *315 the child and she never saw it again. But later the next day that he had told her that he had dumped the child in over at the Gas Works."
After the defendant had made that explanation, the officers confronted her with Mr. Sing. At that juncture she declined to repeat the statement which accused him of Sherry's death. Both at that time and also as a witness, Sing denied any knowledge of the manner in which Sherry had come to her death.
The witnesses whom we have mentioned met with no express contradiction and, so far as we can observe, the jury could reasonably have believed them. The only other testimony which is sufficiently material to the assignments of error to warrant a review came from Dr. Howard L. Richardson, a witness for the state, and from Drs. Normal L. Bline, Kenneth Livingston, Charles M. Grossman and Jeff Minckler, witnesses for the defendant.
Dr. Bline is a specialist in radiology. After being shown X-ray photographs of the skull of the deceased, he testified that they showed a fracture "extending across the parietal bone" above the right ear. He expressed a belief that the fracture "could possibly" have occurred during the autopsy. Dr. Richardson later swore that he produced the fracture in performing the autopsy and showed how he had done it.
The brief submitted to this court by the defendant's counsel says:
"It is conceded that death was caused by asphyxiation * * * To make this point even clearer, it may be stated that everybody agrees that the main airway was blocked and that this caused the death."
The state and the defendant disagree as to the agency which shut off the child's access to air. The state *316 claims that the agency was the hand of the defendant clapped tightly over Sherry's nose and mouth. Dr. Grossman agreed that "if the hand is placed in the proper way it can cause obstruction to the air passage." The defendant claims that asphyxiation came about in this way: a blow upon her head rendered the child unconscious. Thereupon a regurgitation of food occurred which filled the air passage. In the meantime, through involuntary action, the glottis closed. The closure of the latter may have been induced, according to the defendant's theory, by stomach acids which came into contact with the glottis when the regurgitation occurred.
Dr. Richardson gave testimony in support of the state's theory. Drs. Livingston, Grossman and Minckler supported the defendant's theory. Drs. Livingston and Grossman did not see Sherry's remains. Dr. Minckler made a cursory examination of them but not until after the autopsy. He did not depend upon what he had seen when he gave his testimony. The deductions drawn by Drs. Livingston, Grossman and Minckler were based upon facts disclosed by Dr. Richardson's autopsy and their medical knowledge.
January 26, 1952, Dr. Richardson performed the autopsy. It was evidently thorough, for in its course he removed and examined all of Sherry's organs. He even cut the skull from the body and examined the brain tissues for the purpose of ascertaining whether any hemorrhage had occurred. Before making the autopsy, Dr. Richardson took photographs of the body, not only by the usual process which yields photographs in black and white, but also by color photography which produces slides that are projected, life size, upon a screen. All of the photographs became exhibits and the colored ones were used for the purpose of showing the discolorations upon Sherry's face.
*317 Dr. Richardson found an area over the left ear of the deceased, about two inches in diameter, which he termed a hematoma. The fracture in the skull which Dr. Bline mentioned, and which Dr. Richardson swore was caused during the performance of the autopsy, was upon the right side of the skull. The hematoma occurred before death. It was a swelling under the scalp about two inches around and somewhat less than a half inch in thickness. In layman's language, it was a welt or bump. No witness knew its cause. However, Dr. Richardson stated that it could have resulted from a fall or a blow. He did not believe that it was caused by any of the cement blocks in the basement of the Sing house because, according to him, the sharp edges of a block of cement would have pulled out some of the hair and would have made a laceration in the scalp. Dr. Richardson examined the brain structure for the purpose of determining whether there was any evidence of hemorrhage. He found none. He did not know whether the blow which caused the hematoma could have rendered the child unconscious.
Dr. Richardson described in detail the discolorations upon the cheeks, the chin and across the bridge of the nose. He believed that they occurred before death. They displayed, so he said, a definite contour, circular in form, and could have been made by a hand held tightly over the nose and mouth.
Dr. Richardson's autopsy disclosed no evidence of water or algae in the lungs. As we have said, it is agreed that the cause of death was asphyxiation. The evidence just mentioned not only shows that drowning was not the cause of death, but it also establishes that Sherry did not breathe after her body was cast into the water at the bottom of the sump.
Dr. Richardson found no bruises upon the back, chest, arms, legs, knees, elbows, torso or abdomen of *318 the body. The heart, according to him, was "tremendously dilated" and there were excessive quantities of blood in the liver, spleen and lower organs. He explained the dilation of the heart by saying that it was filled with blood which it was unable to pump through the pulmonary circulation. The liver and spleen are secondary reservoirs of blood, so he explained, and when the heart is unable to force the blood on its way it backs into those reservoirs.
The examination made by Dr. Richardson of the remains disclosed, in addition to the foregoing, the following: (1) vomitus which filled the nose and mouth; (2) a few particles of food in the trachea; (3) no particles whatever of food in the bronchi; (4) a ballooning of the lungs; and (5) a swelling of the glottis which constricted it to a passageway the size of a lead pencil's point.
The following states Dr. Richardson's belief of the manner in which death occurred; in giving it he employed charts:
"From the food particles being retained within the nasal passages, the main airway of the nose, and from the food particles being retained in the mouth and the mouth cavity, and no food particles being found in the lung substance or in the main tubes (indicating throughout) something or some object prevented air from coming back in the nose and nasal passages or the mouth and taking that food into the lungs.
"Q So, it is your testimony, then, is it, Doctor, that the air passages were completely shut off causing the death of the individual?
"A Yes.
"Q Doctor, with the contour of the bruises upon the face, what is that contour?
"A Well, it is across the bridge of the nose (indicating) and under the chin (indicating).
*319 "Q Can you describe the contour other than that?
"A Well, it is in a circular, a circular manner (indicating).
"Q Can you say, Doctor, as a matter of pathological science, if the air passages were not shut off, what would have been the condition of the lungs, assuming the mouth and nose were full of vomitus, assuming that the mouth and nose were full of vomitus as you found them?
"A And there was no blockage?
"Q And there was no blockage, what would have been the condition of the lungs?
"A Well, the natural event of asphyxiation and aspiration that is this is unnatural, the findings here are unnatural the natural events are that the vomitus and material that comes in here (indicating) is sucked back into the lungs, produces spotty areas of atelectasis or a frothy material if respiration continues back and forth and the individual drowns in their own fluid. That is their own body fluid they drown in. Such was not seen in this case. Instead these lungs were ballooned, the food was retained in the mouth and nose and a few little particles in the trachea, upper portion of the trachea.
"Q Assuming that the bruises that you found upon the face, do you have any opinion as to the manner and the force with which those bruises were probably applied?
(Colloquy)
"A I have an opinion that force was applied about the mouth and nasal areas and the side of the cheeks.
* * * * *
"Q Do you have any opinion, Doctor, from your examination whether or not that force was applied to the bruises you have described under the chin and about the cheeks as considered simultaneously, *320 considering the fact that the air passages were shut off?
"A As I previously stated, the various markings are of similar nature and similar age, and if applied simultaneously could in themselves shut off the nasal passages and the mouth passages. That is a force from the nose and under the chin could, could shut off those passages. * * * Examination of the bronchi and the terminal bronchials, both by histological microscopic examination and by washing out the bronchi and squeezing out the bronchi, revealed no evidence of food or food debris in these whatsoever (indicating). Instead the lungs were ballooned and filled completely with air. Nor did washing or examination of these demonstrate any evidence of a foamy, watery fluid or mucoid, watery fluid or an algae, none could be found in it."
Dr. Richardson, in the above way, expressed his belief that the little child's air passages were completely blocked by an outside force. In speaking of an outside force, he had in mind a hand held tightly over the child's nose and mouth.
We have mentioned the fact that when the body was recovered it was found that the mouth and nose were filled with food partially digested. The witnesses called that matter vomitus. Dr. Richardson explained its presence by saying:
"When anoxemia or lack of oxygen or a struggle takes place, the retching of the abdominal muscles, the retching of the chest muscles, automatically produces what we call antiperistaltic movement and the food comes squirting up into the nose and mouth."
It will be recalled that no particles of food were found in the bronchi or lungs. Dr. Richardson, as we have seen, swore that if an outside force had not closed the *321 air passages, food particles would have been "sucked back into the lungs." That is, the inhaled air would have carried them along the passages leading to the lungs. He accounted for the presence of the few particles in the trachea by saying that the movements to which the body was subjected after death may have forced them into that organ. It will be recalled that the glottis was not completely closed.
Dr. Richardson also testified:
"Q Sometimes, and then a child may receive a head injury, be unconscious, regurgitate, be unable to cough, strangle, and die within five minutes, isn't that true?
"A Yes. But the child would die by drowning in its own fluids which this child did not. It had none of those in other words, whether they are unconscious or not, they will still respiration will still keep going on.
"Q Unless
"A And, the convulsions of even blockage of that type in the trachea will in turn produce the phenomena of in and out and furthermore we would have another thing which we do not see in this case, and that is segmental atelectasis which I have not gone into in the lungs."
Dr. Richardson swore that the amount of time required to produce death in the manner which he described varies with individuals. In many it might require about five minutes. We see from his testimony that he believed that a hand clapped tightly over the nose and mouth of the child could have shut off effectively her air supply. When that occurred, food would shortly belch up into the nose and mouth, but, since no air was passing into the lungs, none of the vomitus would make its way downward. In that way *322 he accounted for the absence of food particles in the bronchi. He thought that the partial closure of the glottis was possibly a "spasm of death."
We shall now portray more fully the defendant's explanation of the manner in which the asphyxiation occurred. The following, taken from the defendant's brief, introduces the defendant's theory:
"The injury or trauma causing the hematoma probably caused unconsciousness. Regurgitation in a child of Sherry's age under such circumstances was normal and the swollen glottis, which could have been caused by the irritation of regurgitated food prevented the great bulk of food from being aspirated or sucked back into the lungs. The fact that some food particles got into the trachea through the narrow opening of the glottis indicates definitely that the child was breathing after regurgitation."
Dr. Livingston testified that the blow which caused the hematoma "could have" produced unconsciousness, but, in the absence of additional facts, was unable to say whether or not it actually did so. He said:
"Knowing only the description of the scalp lesion, I think it would be difficult to say that it was probable, absolutely probable."
We quote further from his testimony:
"Q What is the frequency of occurrence of regurgitation following head injury?
"A That would be difficult to answer without qualification of head injuries that produce severe unconsciousness. That is, unconsciousness of more than a few seconds duration. Regurgitation is apt to occur in people who have a full stomach much more commonly than somebody whose stomach is empty, * * *."
Dr. Grossman testified that the hematoma indicated that the child had received a blow sufficiently *323 severe to have caused unconsciousness. We quote from his testimony:
"Q Now, then, Doctor, when what is the effect of unconsciousness upon the respiratory system, in a three year old child?
"A The effect of unconsciousness on the respiratory system is a very variable one. However, the effect of head injury of a blow to the head such as this in addition to unconsciousness can cause regurgitation.
"Q And is that a common occurrence?
"A That is certainly not an uncommon occurrence in head injuries. Nausea and vomiting and regurgitation is a fairly common occurrence.
"Q Can regurgitation itself cause a blockage of air passage?
"A Very definitely. It is a common cause of death.
"Q And need it be caused by blockage of air passage by food itself?
"A It can be caused by blockage of air passage by food itself. It can also be caused by spastic contraction of the muscles around the glottis.
* * * * *
"A As far as I can tell by the information given to me by the question, the child was unable to draw air beyond the swollen glottis because of two factors. One, the glottis being swollen, that is the area, the opening almost entirely closed. And secondly, the existence of a mass of food material on the above side of that opening. It would be preventing air from going into the windpipe."
According to Dr. Grossman, the digestive fluids are acid and when the latter comes in contact with the glottis it causes it to close. Such was the defendant's explanation for the asphyxiation.
*324 The following is taken from Dr. Grossman's cross-examination:
"Q Now, in death doesn't the mouth drop open?
"A It frequently does.
"Q It usually does, doesn't it, Doctor?
"A I would say it usually does, yes.
"Q And if that mouth dropped open, the vomitus in that mouth would come out, would it not, Doctor?
"A Not necessarily.
* * * * *
"Q Doctor, if I have a mouth full of water or liquid and I open my mouth, do I understand you to say that that would remain in my mouth in death?
"A No, you did not understand me to say that. I did not talk about liquids or water which would obviously run out if you were hanging upside down with your head down. The water would obviously run out.
* * * * *
"Q Well, now, Doctor, if an object was held over the mouth and nose, that would keep the vomitus in, wouldn't it?
"A I presume it would.
"Q And that would also cut off the oxygen, wouldn't it?
"A I presume that if an object did occlude the airway, the oxygen in the air would be cut off.
"Q And if that object were there blocking the air passage, would that not cause regurgitation?
"A Blocking of the air passage in that fashion might cause regurgitation as soon as the subject or the person became semi-conscious.
"Q Then, that would also cause the blocking of the glottis, would it not?
"A If the acid content if the acid contents of the stomach are irritating enough to the structures around the glottis, which is the opening the glottis itself is the actual space, then there would be a *325 spastic constriction of those structures causing an occlusion or shutting off of the space.
"Q Now, then, if the autopsy would show that the lungs were ballooned and a lack of oxygen in the system caused the death, that would indicate they were not getting any air, would it not?
"A That is correct."
The above suffices as a narrative of the evidence governing the first assignment of error. We have omitted mention of many witnesses and details.
The defendant argues that the explanation for the death which her witnesses offered is at least as reasonable as that given by the state's witnesses and that, therefore, the state has not discharged the burden of proof. For the reasons which follow, we believe that the jury could reasonably have found that the explanation given by the state's witnesses was more acceptable than that which came from the defendant: (1) Dr. Livingston could not say that the hematoma indicated a blow to the head sufficiently severe to have caused unconsciousness; (2) there was no evidence that the child drowned in its own fluids, which, according to Dr. Richardson, is generally the manner of death when a blow to the head has caused unconsciousness succeeded by regurgitation; (3) the defendant's witnesses did not account for the discoloration upon the cheeks, under the chin and across the nose. In making that statement we have not overlooked the defendant's contentions that Dr. Richardson did not make a microscopic examination for the purpose of determining whether the discolorations may have occurred after death. We think, however, that the jury could reasonably have found that the discolorations occurred prior to death. (4) Dr. Grossman acknowledged that upon death the mouth generally drops open and that thereby the contents of the mouth flow *326 out. No explanation was given as to how it happened that the vomitus remained in Sherry's mouth if a blow to the head rendered her unconscious and induced regurgitation.
From the foregoing we see that the defendant and Sherry were together in the period which is vital, 3:00 to about 5:45 p.m., January 23. Possibly we can determine the hour when death struck. As we have noticed, the defendant, at 5:40 p.m. told two police officers, who called upon her pursuant to the radio message, that Sherry had disappeared about 15 minutes previously. In the typewritten statement which the defendant signed she acknowledged that it was she who had summoned police aid. If her explanations in regard to time are accepted as truthful, the death occurred not later than 5:25 p.m. Since it was necessary for her to have made the round trip between her home and the sump, death must have occurred much earlier than 5:25. From 3:00 to 5:40 p.m. only four persons, so far as the record discloses, were in Sherry's presence the defendant, Mr. Sing, Vickie and the taxicab driver. We shall now determine whether the jury could reasonably have believed that any one of the last three caused the death. Sherry was alive when the driver departed, and no one contends that he returned or committed the crime. If the jury accepted Dr. Richardson's explanation of the manner in which the asphyxiation was effected, they could not reasonably have believed that it was the hand of Vicki, a four-year-old child, which clamped itself for five minutes over the cheeks, nose, mouth and chin of the deceased, bruised those areas and shut off the air passages. Sing left his home shortly after 3:15 p.m. while Sherry was still alive and did not return until 6:00 p.m. when he and the defendant's mother entered the house. *327 Hence, if Dr. Richardson's theory was accepted by the jury, the defendant was the only person present at the vital period who could have committed the felonious act. It will be recalled that shortly after the defendant signed her statement she told the police officers that it was not Vickie, but Sing, who caused the death. In attributing guilt to Sing, the defendant stated that she knelt down alongside Sherry's inert body and discovered the absence of breathing. According to further statements which she then made, she put Sherry's boots and mittens upon the lifeless limbs and saw Sing depart as he went out to discard the body. That explanation, of course, indicated that the defendant was present when death struck. Accordingly, the jury was warranted in finding that the defendant was with her child at the crucial moment. When the police officers called at about 5:40 p.m. and when, a few minutes later, the Sings came home, it was noticed that the defendant's and Vickie's hair was wet and that they showed other signs of having been out in the weather. Those circumstances could have been accepted by the jury as proof that the defendant had just returned from her grim mission. The defendant's own declarations acknowledged that it was her hands which cast the lifeless body into the sump. When the defendant took the officers to the sump, the cover over the latter was in place and had to be removed before the body could be seen.
The above makes it clear that the jury was justified in finding that the defendant was present when death struck and that it was she who disposed of the remains.
The defendant gave various explanations as to the manner in which her daughter came to her death. Since she was present, she had firsthand information upon *328 the subject. Let us consider the explanation given in the typewritten statement. It says that Sherry "got hit by the soldier" in the basement of the home. "Soldier" was a game which the two children had occasionally played. By making that statement and others in similar vein, the defendant evidently wished to create the impression that while the children were playing soldier Vickie struck Sherry on the head and thereby caused the death. It is clear that when Sherry's body was recovered from the sump, the nose and mouth were filled with vomitus. The defendant's medical experts, as we have seen, testified that when a child is rendered unconscious by a blow to the head regurgitation generally occurs. In the typewritten statement, as well as in her oral declarations, the defendant never mentioned vomitus. If Sherry suffered a fatal blow to her head while playing in the basement and if death occurred in the manner suggested by the defendant's expert witnesses, and not in the way described by Dr. Richardson, regurgitation must have occurred in the basement. Otherwise we have no explanation for the vomitus which filled the mouth and nose of the corpse. If Sherry became unconscious in the basement and if regurgitation there occurred, no one has explained how the vomitus remained in the mouth and nasal passages. It will be recalled that the defendant claims that after she discovered that Sherry was dead she rolled her body down the stairs five times. Dr. Grossman swore that when death occurs the mouth generally falls open. According to other statements which the defendant made, she picked up Sherry's lifeless body after she had rolled it down the stairs, flung it over her shoulder and carried it to the distant gas company plant. No explanation has been ventured as to how the vomitus could have remained in the *329 mouth and nose of the child while that course was being pursued.
Without resort to further analysis, we express the belief that the jury could reasonably have found that the defendant's statements, whether they attributed guilt to Vickie or to Sing, were virtually refuted by parts of the testimony of her own three medical experts.
The circumstances so far reviewed could reasonably have persuaded the jury to believe that (1) death did not come in the way suggested by the defendant's three medical experts; (2) Sherry's life was taken in the manner which Dr. Richardson explained; (3) the defendant cast the corpse into the covered sump for the purpose of concealing evidence of a crime. But the evidence so far analyzed does not single out the defendant's hand and identify it as the one which snuffed out her daughter's life. We shall now analyze another segment of the evidence.
There is a material difference between the guilty and the innocent when a crime has been committed in secrecy. The innocent have no consciousness of guilt and have nothing to conceal. The perpetrator of the crime, upon the other hand, generally has a consciousness of guilt and is in possession of information which he knows the law enforcement agencies seek. He holds a secret which he must guard, for if he divulges an inkling of it the consequences to him will be grievous. His consciousness of guilt engenders fear of apprehension and of the consequences which will ensue if his guilt is discovered. A consciousness of that kind influences conduct as surely as does any other motivating force. One with a consciousness of guilt who wishes to escape detection must become an actor and endeavor to play the part of the innocent. If he cannot successfully play the part, he may create suspicion by *330 speaking when the innocent would have remained silent, or he may maintain silence when the innocent would have spoken. In lieu of trying to play the difficult character of the innocent, the guilty may resort to flight or even to suicide. Or he may accompany his efforts at essaying the role of the innocent by giving false explanations or the destruction, concealment and fabrication of evidence.
Let us now see whether or not the defendant's conduct, as revealed by the evidence which we have reviewed, manifested upon her part a consciousness of guilt. She evidently chose the dark, deep, covered sump as Sherry's humble sepulcher out of a belief that if her daughter's body was cast into it discovery would be unlikely. Thus, at the very outset, she resorted to the concealment of evidence. She must have known when she cast the body into that place that if it ever was discovered, and if the fact came to light that she was the person who had thrown it there, a surmise would arise that she took the course in order to dissemble a homicide and the manner in which it had been effected. After she had disposed of the body, the defendant manifestly convinced herself that she would be called upon by someone to account for Sherry's absence. The course which she chose to fend off inquiries was to undertake to deceive the police and all others into a belief that a kidnaping had occurred and that Sherry was in the possession of "an old gray-haired man." If the deception proved successful, a search would be made for the purported kidnaper and not for the body. In order to render her deceit more effective, the defendant enlisted the aid of Vickie and coached the little girl into the part which she was expected to play. When the defendant saw that the police officers accepted as truthful her *331 falsehoods, she ventured to play still further the part of the innocent and so she accompanied the officers while they searched the neighborhood for Sherry, although she knew that the search was in vain. At the outset, as we have seen, she sought to fasten guilt upon the anonymous old gray-haired man. A few hours after the defendant had summoned the police, a development, which she deemed fortuitous, occurred. The officers asked her for the name of the children's father and when she gave the information she discovered that they might be willing to believe that the father and his sister had taken the child. Thereupon she summoned to her aid further deception. Although she knew that Sherry was dead, she encouraged the officers to extend their search into distant cities for Mr. Dollarhide and his sister. The search soon located the Dollarhides, and when that fact was reported to the defendant she tried to play further the part of the innocent. She inquired whether the Dollarhides had her child. In the meantime, the officers, with the defendant's support, were tracking down gray-haired men and persons who in recent months had molested children. Possibly when the defendant sent for the police she did not perceive the problems which would confront her. Officers, both municipal and federal, came in relays and the different groups asked her questions. They even sought to elicit information from Vickie whom she had coached to give a false account of Sherry's disappearance. When the defendant observed that the officers were winning Vickie's friendship, she became distrustful of the ability of her little daughter to play a false role. She thereupon reproached the officers and told Vickie to stay away from them. In that way she resorted to suppression of evidence. Before long the defendant inferred that *332 the officers were manifesting misgivings about the story which she had told them. Next, two of the officers decided to become her accusers. It was at this point that she led a detail of the police to Sherry's dank vault. At that juncture a new explanation was put forth and this time the defendant lay the death at the feet of Vickie. When the officers disbelieved the new story and protested that the defendant could not have carried the body from her basement to the gas company's plant, still another story came forth. This time the defendant accused her stepfather of Sherry's death and claimed that it was he who disposed of the body.
From the above circumstances we see that the jury could have believed that the defendant, in trying to guard her secret, found it necessary to employ deceit and to resort, not only to the fabrication of evidence, but also to its suppression. Her conduct betokened a consciousness of her own guilt and pointed to her as the one who had shut off the air passages of Sherry, thereby asphyxiating the little girl. The contention, obliquely advanced, that the defendant adopted her course for the purpose of shielding Vickie clearly was not accepted by the jury. The latter had good reason for rejecting that contention. First, as we have seen, the tiny hand of Vickie could not have committed the crime. Next, after the defendant had signed the statement upon which the contention is based, she repudiated the accusation and turned upon Sing.
1. The defendant recognizes that evidence showing consciousness of guilt is admissible in cases of this kind. The rule is stated and copiously illustrated in Wigmore on Evidence, 3d ed, §§ 273 through 293. Examples of its application in this state are State v. Hansen, 195 Or 169, 244 P2d 990; State v. Broadhurst, *333 184 Or 178, 196 P2d 407; State v. Henderson, 182 Or 147, 184 P2d 392; State v. Clark, 99 Or 629, 196 P 360; and State v. Zullig, 97 Or 427, 190 P 580.
2, 3. The person who committed a crime usually knows the exact manner in which he perpetrated it. Therefore, when he manifests a sense of guilt in the days which follow the commission of his crime, his self-condemning behavior betrays the manner in which he committed the misdeed. From the fact that he displays a sense of guilt, the jury may reasonably infer that he is guilty. Wigmore on Evidence, 3d ed, § 173. And if the manner in which the crime was committed is known, his sense of guilt, when established, warrants a belief that he committed the crime in that manner. When, as in the present case, evidence shows that (1) the death was effected by the hand of some person which shut off the air passages, (2) the defendant was present when death occurred, and (3) immediately after the death the defendant manifested a consciousness of guilt, the jury was authorized to reason that it was the defendant's hand which asphyxiated her daughter.
4-6. We are in accord with the defendant's contentions that when the state depends upon circumstantial evidence, the latter must be satisfactory and inconsistent with any reasonable theory of innocense. We are satisfied that the evidence in this case meets that standard. The jury was not bound to accept as true any exculpatory matter contained in the statement which the defendant signed and which is quoted in a preceding paragraph. State v. Monk, 199 Or 165, 260 P2d 474, and State v. Ausplund, 86 Or 121, 167 P 1019. According to our belief, the jury was warranted in concluding that the hand of the defendant closed tightly Sherry's air passages until the little girl was asphyxiated. The first assignment of error lacks merit.
*334 7-9. Before considering the second assignment of error we shall move on to the third which attacks an instruction which was given to the jury upon the subject of consciousness of guilt. The exception which the defendant took to the instruction is manifested by the record in this way:
"And one other exception: The Defendant also excepts to the Court's giving State's requested instruction No. 1 which was the consciousness of guilt instruction. The Court: `You may have an exception to that, too.'"
In challenging the instruction, the defendant's brief says:
"In the first place it is an unwarranted comment by the court upon the value and effect of certain evidence which is expressly prohibited by statute. Secondly, it is grossly unfair to defendant in failing to call the jury's attention to circumstances which would tend to minimize or explain the inculpatory effect of the alleged `unusual and extraordinary actions', `unnatural and abnormal conduct', and `unreasonable and improbable explanations.' The instruction is also erroneous in that the assumption that such conduct or statements tend to prove a `consciousness of guilt' is faulty and is not the law."
This court has many times held that an exception such as that which the defendant saved by the quoted words is insufficient. In Smith v. Pacific Northwest Public Service Company, 146 Or 422, 29 P2d 819, it is said:
"* * * There is a fundamental difference between the giving of instructions to a jury and the refusal to give instructions. In one case the court acts affirmatively and if it is in error then attention should be called to such error in order that it may be corrected. In the other case the court has *335 before it a requested instruction which speaks for itself and after considering the same refuses to give that instruction and the requesting party cannot be held to be bound to then and there advance every meritorious theory and submit every authority which might tend to show the instruction a proper one."
A recent holding to similar effect is Garrett v. Eugene Medical Center, 190 Or 117, 224 P2d 563. In Wilson v. State Industrial Accident Commission, 189 Or 114, 219 P2d 138, the decision of this court, written by the Chief Justice, said:
"The third point raised by defendant is that the court erred in instructing the jury `* * * that the testimony of experts is to be received and considered with narrow scrutiny and with much caution.' The exception taken at the trial is as follows: `I wish to add a further exception to your Honor's ruling as to expert witnesses, because that was not called for, there was an expert witness on both sides.' It has been held by this court many times that to enable one to take advantage of error in the giving of instructions, the party must point out specifically the grounds of his exception. Had defendant in this case excepted to such instruction on the ground that the court was invading the province of the jury, since the credibility of witnesses is exclusively a jury question, such an exception would have been well taken. The trial court has no business commenting on the evidence, and we disapprove of such practices; however, the exception taken was not sufficient to call to the court's attention the point now raised."
State v. Johnston, 143 Or 395, 22 P2d 879, which was based upon a charge of embezzlement, says:
"It should be unnecessary to repeal that it is only error properly excepted to that will be reviewed *336 upon appeal. It is the duty of counsel, when excepting to instructions given, to point out to the court in what respect the instruction excepted to is erroneous. 16 C.J. 1072; Hooton v. Jarman Chev. Co., 135 Or. 269 (293 P. 604, 296 P. 36); La Grande National Bank v. Crum, 139 Or. 530 (11 P. (2d) 553)."
In that case, this court held that an exception which challenged an instruction as "against the law" was insufficient. See, to the same effect, State v. Poole, 161 Or 481, 90 P2d 472.
10. Notwithstanding the insufficiency of the defendant's exception, we gave careful attention to the challenged instruction. Although we do not believe that the instruction is entirely perfect, yet it is not subject to the attack made upon it by the defendant. We dismiss this assignment of error as without merit.
11. The second assignment of error follows:
"The court erred in failing to give the following instruction requested by the defendant to which exception was taken. `I instruct you that the Oregon Laws defines excusable homicide as follows:'"
At that point the requested instruction incorporated within itself the exact phraseology of § 23-418, OCLA.
In support of the assignment of error, the defendant's brief says:
"The court's failure to give an instruction on defendant's theory that if homicide was committed by the defendant that it was excusable constitutes reversible error."
Although the record indicates that Sherry's death resulted from homicide, we have been unable to find anything therein which could have warranted the submission of instructions upon the subject of excusable *337 homicide. The decisions cited by the defendant do not hold that a trial judge must instruct upon excusable homicide, even in the absence of evidence indicating that the homicide was justifiable. In State v. Way, 120 Or 134, 249 P 1045, 251 P 761, which was reversed on the ground that the trial judge erroneously failed to instruct on excusable homicide, this court carefully pointed out that the record contained evidence capable of a reasonable belief that the defendant struck the fatal blow in self-defense. State v. Trent, 122 Or 444, 252 P 975, 259 P 893, held that, since the evidence did not suggest a defense of justifiable homicide, the trial judge properly declined to instruct upon the subject. We find no merit in this assignment of error.
The fourth assignment of error reads as follows:
"The court erred in failing to sustain the defendant's objection to the following question put to Dr. H.L. Richardson on direct examination:
"`Q Now, Doctor, taking into consideration the bluish bruises testified to by you about the chin and both cheeks wait a minute, about both cheeks and under the chin of the body of little Sherry, and their nature and the evidence of the simultaneous blockage of the air passages through the mouth and nose, and the contour of the said bruises upon the face and chin, do you have an opinion as to whether or not these bruises were caused by a human hand or hands?
* * *
"`A Yes.
"`Q And what is that opinion?
* * *
"`A My opinion is that the markings are similar to those made or could be made by a hand.'"
Dr. Richardson, who expressed the challenged opinion, has had extensive experience in performing autopsies *338 and in making examinations for the purpose of determining, if possible, the means whereby death in homicide cases was effected. Before he expressed the above-quoted opinion he had described the manner in which he had performed the autopsy and the detailed examination which he had made of the bruises and discolorations.
The defendant claims that the subject matter of Dr. Richardson's opinion is not within the area of expert opinion and that a jury was as capable of forming a correct opinion upon the subject as he. Therefore, according to the defendant, Dr. Richardson's opinion was inadmissible and, since his challenged testimony was upon a vital issue, the error is reversible.
The cases cited by the defendant do not support her contentions. In State v. Barrett, 33 Or 194, 54 P 807, a police officer testified that, in his opinion, a body had been moved from the position and place where it fell after being shot. This court pointed out that the witness was not an expert on the subject of how men fall when they are shot, and indicated doubt whether the matter was a proper subject for expert testimony. In State v. Jennings, 48 Or 483, 87 P 524, 89 P 421, a witness gave his opinion as to the direction from which a bullet had been fired. The opinion was based upon the witness's inspection of the blood which was splattered around the corner of the room where the deceased was shot. The witness was not qualified as an expert. The record was silent as to the position of the body and the location of the blood stains. State v. Morris, 83 Or 429, 163 P 567, involved the testimony by a physician that the choking of the victim could not have been accidental. This was held not to be reversible error because, under the circumstances of that case, *339 the jury could not have reached a different result. It is worthy of note that the objection was made, not to his opinion that the marks on the deceased's throat were finger marks, but that the strangulation was not accidental.
12, 13. The question submitted to Dr. Richardson in this case is clearly distinguishable from the subjects of inquiry in the cited cases. We think that the causes of discolorations on a human body are not a matter of such common knowledge that a jury can correctly ascertain their probable cause. The character of the discoloration is a matter of expert knowledge. It might be a bruise, a broken blood vessel or post-mortem lividity. If it is determined to be a bruise, the nature of the force and instrument causing it is by no means self-evident. It may have been caused by a fist, the palm of the hand, a sharp instrument, a blunt instrument, something with a pliable surface or an instrument with a hard, jagged edge. Involved in the inquiry is something more than the symmetry of the markings. Anyone who undertook to answer the question submitted to Dr. Richardson would have to be able to determine the amount of force which was exerted. In the present instance, the amount of force was indicated to some extent by the ballooned lungs and the condition of the heart. We cannot say that the cause of a bruise is as well known to laymen as to an expert. It is our belief that a physician of the competence of Dr. Richardson, and who had conducted an intensive investigation for the purpose of ascertaining the manner in which death was caused, was qualified to answer the question propounded to him. Goldfoot v. Lofgren, 135 Or 533, 296 P 843; State v. McDaniel, 39 Or 161, 65 P 520; State v. Barton, 5 Wash 2d 234, 105 *340 P2d 63. We dismiss the fourth assignment of error as without merit.
14. The fifth assignment of error charges as follows:
"The court erred in refusing to permit defendant to require P.E. Lippold to produce notes which he used to refresh his memory."
Preceding paragraphs of this opinion review Mr. Lippold's testimony. He was the second of the many police officers who testified. While upon the witness stand he used no notes, but upon cross-examination it developed that "within the last couple of days" he had consulted notes which he had made. He explained, "There's some details I wanted to check on." The examination presently continued:
"Q Officer, after you have read your notes. Do you, did you have and do you now have an independent recollection of which you have testified here?
"A Yes, I have."
The testimony given by Lippold was only corroborative of that given by other officers who also testified without notes. They were not asked whether they possessed any notes or had refreshed their recollections.
In support of this assignment of error, the defendant depends in part upon § 4-707, OCLA (ORS 45.580), which says:
"A witness is allowed to refresh his memory respecting a fact by anything written by himself, or under his direction, at the time when the fact occurred or immediately thereafter or at any other time when the fact was fresh in his memory * * *; but in either case the writing must be produced, * * *."
*341 The defendant concedes that the decisions of this court are adverse to her contention. State v. Magers, 36 Or 38, 58 P 892, and State v. Yee Guck, 99 Or 231, 195 P 363, held that a witness, who possesses an independent recollection of the events, cannot be required to produce a writing which he used to refresh his memory before entering the witness stand. It is advisable to take note of the fact that in those two cases, as in the one at bar, the witnesses had an independent recollection. Those two cases, therefore, were not concerned with records of past recollections. Wigmore on Evidence, 3d ed, § 762, note 4; see, also, 18 Or L Rev 136, which argues that § 4-707, OCLA, fails to distinguish between "past recollection recorded" and "present recollection revived."
The brief filed by the defendant calls our attention to Wigmore on Evidence, 3d ed, § 762, where it is stated:
"The rule should apply, moreover, to a memorandum consulted for refreshment before trial and not brought by the witness into court; for, though there is no objection to a memory being thus stimulated, yet the risk of imposition and the need of safeguard is just as great. It is simple and feasible enough for the Court to require that the paper be sent for and exhibited before the end of the trial."
A footnote, at page 315 of Deady, General Laws of Oregon, 1845-1864, says:
"The rules and principles of the law of evidence as embodied and codified in this and the following two chapters, are mainly condensed and extracted from Greenleaf's Treatise on the Law of Evidence."
State v. Magers, supra, and State v. Yee Guck, supra, in reaching their conclusions, quoted extensively from *342 Greenleaf, the very fountainhead of § 4-707, OCLA, and then interpreted the latter in harmony with the rule espoused by Greenleaf. In view of that fact, we do not believe that we are at liberty to adopt the point of view advocated by Wigmore, although if we had the rule-making power we would find it hard to resist the merits of the rule which he advocates. Possibly those who have the rule-making power will consider Wigmore's suggestion. We find no merit in the fifth assignment of error.
The above disposes of all the contentions advanced by the defendant. Although we have considered all of the assignments of error, we have found no merit in any of them. The trial judge bestowed painstaking care upon every contention which the defendant presented. She had a fair trial and it was free from error. The judgment of the circuit court is affirmed.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Mesh causing abnormal results with subsurf modifier
Probably an obvious answer, but I can't figure out why my mesh is causing such a weird crumpled up look with the subsurf modifier. I've gone through to make sure there are no doubles or overlapping vertices, but it still looks weird when I apply the subsurf. Any idea what I might be doing wrong?
Here is the .blend
A:
Short answer:
Bad topology.
Longer answer:
You have here some non-manifold geometry as internal edges, badly made faces (one face across 3 prepared quads), ngons and for some parts you will need support geometry (to eliminate shading issues and hardening edges). Subdivision Sufrace modifier don't play along with those. You will need to have quad based topology with proper edge flow.
As for this particular question there is too much to cover on how to repair every broken part, I would encourage you to have a moment to redo the whole mesh having in mind quad based topology. Also, use Mirror modifier so you will not need to make changes on both sides (there are some differences now).
Look for example at this topology:
Also you can learn something from here: http://topologyguides.com/
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
User can't write in textarea
Sorry if I can't explain this but I don't know how to do it.
My problem is that when user write in the textarea input everything its ok, but when user resize the screen can't write in the textarea doesn't matter where user click the input do not respond.
Here is the example
If you don't understand me, just open the link and write something in the textarea, then resize the window and try to write in the textarea and there is the problem.
A:
Here you go buddy!
Working!
I just remove this divs with this structure:
<div class="col-md-12">
<div class="col-md-12">
I think that its no necessary create another div with the same col class.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Michael Peca netted his second goal of the season and rookie
Steve Mason turned aside 47 shots for Columbus, which notched
its fifth consecutive victory at Nationwide Arena.
"We thought we played three pretty strong games against them
this year," Umberger said. "For us to come out on the winning
end - especially at home - it's something to build on."
"It was a hard game for both teams," Columbus coach Ken
Hitchcock said. "San Jose has a great team. They brought their
heavy game and we were forced to match it. We can draw back
from this stuff and know we can play at this level."
Devin Setoguchi opened the scoring 3:41 into the third period
and Evgeni Nabokov finished with 30 saves for San Jose, which is
12-0-2 in its last 14 games.
"It was a great game," Setoguchi said. "Everyone is going to
play our team hard because we are No. 1 in the league. I
thought we played great, we got a point out of it, now we can
put it behind us and we've got a bigger game to worry about (on
Thursday, at Detroit)."
"It's very bearable," San Jose coach Todd McLellan said. "We
didn't get the win, but in a sense, we won in a different way.
We weren't very good against this hockey club in our building
twice. The last time wasn't even close; our goalie had to save
our hides."
In overtime, Kristian Huselius skated in on a 2-on-1 and fed
Umberger, who buried the shot past Nabokov for his first goal in
11 games.
"Huselius made a good play at the blue line there," Umberger
said. "We caught them in a 2-on-1 and we knew that Nabokov
comes out far. He was out so far so that by the time that it
got to me, he was out of position - and it was an empty net."
Mason's 47 saves was one shy of the team record.
"Every time you are getting a lot of shots like that, you don't
really have a chance to get cold out there," Mason said. "I like
getting a lot of shots. It keeps you sharp and the results
show."
"Both goaltenders had to be good and our guy was great,"
Hitchcock said. "To beat teams like that, we're going to need
our goaltender to be our best player and he was."
The game remained scoreless after two periods with each team
having numerous scoring opportunities.
Each team hit a post as Columbus rookie Derick Brassard did so
as the first period expired and San Jose defenseman Christian
Ehrhoff hit the iron at the 6:50 mark of the second period.
Setoguchi scored his team-leading 16th goal of the season after
redirecting a pass from defenseman Rob Blake past Mason.
"Patty (Marleau) made a great pass to Blake and I just finished
my play," Setoguchi said. "It was kind of a simple play that
went in the back of the net."
Columbus answered when Peca scored from the high slot to level
the contest with 7:28 remaining in the session.
San Jose defenseman Dan Boyle tried to clear the puck out of the
zone from behind the net. Columbus captain Rick Nash stopped the
puck along the wall and fed rookie Jakub Voracek in the slot.
Voracek then passed the puck to Peca, whose shot went off
Nabokov's pad and in the net.
"A great play by Nash to keep it in the zone and start the
play," Peca said. "Voracek got me the puck and I was able to
bury it."
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Geography of Gaelic games
The two dominant sports of the Gaelic games are traditionally played in separate regions of Ireland. Hurling is traditionally played mainly in the provinces of Munster and Leinster, whereas Gaelic football is played in every county but is dominant in Ulster and Connacht and certain parts of the other provinces.
Munster
The traditional hurling-football divide in Munster runs along a line from Tubber in north County Clare through Corofin to Labasheeda. Across the Shannon in County Limerick the line divides the footballing territory in the hilly west Limerick from the hurling territory in the lush lowlands of east and central Limerick. In County Cork the line also divides east from west, starting at Mallow and extending south towards Cork city and on to the coast. Further west beyond the footballing west Cork is the almost entirely footballing territory in County Kerry, with only a very small hurling region north of Tralee in Ardfert, Ballyheigue and Causeway. The entire counties of Tipperary and Waterford are considered to be traditionally hurling regions.
Leinster
In Leinster the traditional hurling region is located in the south west of the province. The entire County Kilkenny is considered hurling territory, with very little football activity. Most of County Wexford is in the hurling region along with Counties Carlow, Laois and Offaly. The other Leinster counties are considered footballing counties.
Connacht
Connacht is almost entirely Gaelic football territory, with only Galway competing in the Liam MacCarthy Cup. In County Galway the hurling-football divide follows a line from Galway City to Ballinasloe. The divide in Galway probably stands out more than in other counties. The hurling territory in Galway stands out strongly from the rest of the province; as a result, the Galway team plays in the Leinster Championship. Another very small hurling region is in eastern County Mayo around Ballyhaunis.
Ulster
Ulster is also almost entirely a footballing region; the hurling region is located in the Glens of Antrim.
Links
Gaelic Athletic Association county
Gaelic games
Hurling
Football
Dual county
See also
Geography of Australian rules football
Geography of association football
References
Category:Gaelic games
Category:Gaelic games terminology
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Relationship of optic disk topography and visual function in patients with large cup-to-disk ratios.
To determine if topographic differences exist between large cup-to-disk ratio (C/D) eyes with standard achromatic automated perimetry (SAP) abnormalities and those with only short-wavelength automated perimetry (SWAP) abnormalities. Cross-sectional study. The setting was a referral university-based clinical practice. We selected one eye of 72 patients with a vertical C/D of at least 0.8 by ophthalmoscopy. Patients performed SWAP, SAP, and confocal scanning laser ophthalmoscopy. We compared optic disk topography in eyes with and without visual field abnormalities and controlled for the influence of disk area. Disk area was a confounder of many topographic measures. After controlling for disk area, eyes with abnormal SAP had differences in rim volume, cup shape, rim area, retinal nerve fiber layer thickness, and retinal nerve fiber layer cross-sectional area when compared with eyes with normal SAP (P <.05). Rim volume and rim area were different in the SWAP comparison (P <.05). Investigators should control for disk area when evaluating topographic measures by confocal scanning laser ophthalmoscopy. In eyes with a large C/D, optic disk topography is more glaucomatous in eyes with SAP abnormalities than in those with only SWAP abnormalities. Eyes with large C/D and only SWAP abnormalities may have fewer glaucomatous optic disk changes than such eyes with SAP abnormalities. This indicates that SWAP is likely to correspond to abnormalities in optic disk topography at an earlier stage of glaucomatous optic neuropathy than SAP. Therefore, clinicians should consider SWAP testing in glaucoma suspects to detect glaucomatous visual field loss at an earlier stage of structural loss.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
It's all over. Today (Dec. 14), the FCC commissioners voted 3 to 2 to overturn Obama-era net neutrality regulations, which help maintain a free, open Internet. Now, internet service providers will be free to selectively block or slow down content from websites and services they don't like (or that don't pay them). They are only required by law to disclose such blockings or slowings.
(Image credit: Lead Image Credit: Steve Heap / Shutterstock)
Back in 2015, the FCC reclassified broadband ISPs as "common carriers," which placed them in the same category as land-line telephone providers and gave the government agency greater authority to police the activities of ISPs and make sure that broadband ISPs cannot discriminate for or against any type of traffic. The vote today reversed that decision, putting broadband back into the "entertainment" category. It also deliberately weakened the FCC's own regulatory powers, handing enforcement of many of the remaining rules to the FTC.
Consumers are about to be cast in "The Purge: Internet Anarchy," in which a small group of powerful executives decide what you can see, hear and read online. Anti net-neutrality Crusaders such as FCC Chairman Ajit Pai, a former Verizon executive, claim that any kind of regulation stifles innovation. In November, Pai said the 2015 rule changes "depressed investment in building and expanding broadband networks and deterred innovation" and that, under this proposal, "the federal government will stop micromanaging the Internet."
But Pai's argument is operating on dial-up in a 5G world. The real innovation online doesn't come from ISPs, who have been providing consumers with plenty of bandwidth despite net neutrality rules, but from companies that use the internet to deliver information and services. Google and Netflix changed the world because they were able to reach billions of people without paying for an ISP protection racket.
If bandwidth providers start charging your internet-based company an access fee just to have your website appear to their customers, the next Google won't be able to get off the ground. Pai argues that, because ISPs didn't impose pay-to-play policies prior to the 2015 regulations, that they can be counted on to do the right thing now. That's like saying that we should close the local health department and fire all its inspectors since none of the restaurants has been caught spreading salmonella lately.
The real losers here aren't big corporations such as Microsoft or Google or small startups, but end users who will face restrictions on the content and services they can consume. Here are five freedoms that may have died, along with net neutrality.
1. Freedom of the Press
If you wanted to start an international media company 25 years ago, you couldn't do it on your own. The barriers to entry — getting access to a printing press and developing the complex infrastructure to distribute your work — were huge. With the open Internet, however, anyone can start a news site and publish articles or videos without worrying about whether people can read them.
Without net neutrality, ISPs can block or slow down news sites for any reason, be it commercial or ideological. For example, Comcast could block NYTimes.com or slow it to a crawl because the online newspaper published an op-ed in favor of net neutrality or even reported something negative about the company.
Optimum Online, which operates primarily in the New York area, could decide to block your access to the Seattle Post-Intelligencer online because that publication wouldn't pay a fee to be carried. If every ISP charges content providers fees for reaching its customers, many publishers will simply decide that certain markets aren't worth reaching. If you're running a local business in Illinois, you probably wouldn't pay the kickback to have your site appear to users in Texas.
The most important question raised by net neutrality is not "should the government regulate the Internet" but "should a dozen ISPs be allowed to control thousands of other companies?"
The most important question raised by net neutrality is not "should the government regulate the Internet" but "should a dozen ISPs be allowed to control thousands of other companies?"
2. Free and Fair Elections
The large ISPs already have a major influence on politics, with Verizon alone spending $53 million on campaign donations and lobbying between 2010 and 2014. However, without net neutrality, there's nothing to stop the ISPs from influencing elections even more directly. Your broadband provider could block the website of one candidate while speeding up that of another.
An ISP could even censor the sites for political action committees that support a viewpoint or candidate it opposes. Back in 2007, Verizon initially refused to send out text messages from a pro-abortion rights group, but backed down under pressure. What if AT&T decides one day that it opposes capital punishment so much that it blocks prodeathpenalty.com and the site of any gubernatorial candidates that support the practice?
MORE: Net Neutrality Won't Save the Internet. Competition Will
Activists of any stripe should be concerned about their right to publish content that an ISP might disagree with. In 2005, Canadian ISP Telus blocked the site of a labor group that encouraged its workers to strike.
Even more insidiously, ISPs can selectively block government websites that provide voter information such as polling locations and registration forms. If they succeeded in lowering voter turnout in certain areas, that could change the course of an election.
3. Freedom of Association
You always talk to your mom on Skype, but then your ISP signs an exclusive deal to make Google Hangouts its only allowed chat service. Meanwhile, Mom's ISP on the other side of the country serves Hangouts at unusable speeds, but gives Skype its fast lane. This scenario may sound crazy, but without any legal constraint, your ISP has every incentive to swing priority access deals with some messaging services while blocking others.
(Image credit: Image Credit: Steve Heap / Shutterstock)
There's already a precedent for blocking messaging clients in the world of wireless broadband. Back in 2009, AT&T blocked iPhones from making Skype calls on its mobile network, but relented under pressure from the FCC. In 2012, the company also blocked Apple FaceTime on the iPhone.
Of course, you and your mom can always talk on old-fashioned landline phones if you both still have them. Unlike broadband providers, wired phone services are defined as common carriers and are legally obligated to accept calls from anyone. VoIP services such as Vonage are exempt, as are cell phone carriers.
4. Freedom to Start a Business
If you decide to open up a restaurant in town and a street gang demands money not to destroy your place "Last Dragon"-style, you'd call the police. But if your business lives on the Internet, you could have as many as a dozen different ISPs in the U.S. shaking you down and, without net neutrality, no recourse against them.
MORE: How Much Internet Speed Should You Really Pay For?
The most important question raised by net neutrality is not "should the government regulate the Internet" but "should a dozen ISPs be allowed to control thousands of other companies?"
Whether you're trying to start the next Netflix or you're a mommy blogger eking out a living on ad revenue, you could be forced to pay broadband providers in order to reach their customers. If you can't pay, providers could slow your site or service down to the point that nobody wants to use it.
5. Freedom of Choice
You like to do all your shoe shopping at Zappos, but your ISP has an exclusive clothing deal with Walmart, so it slows down Zappos.com so badly that each page takes a minute to load and you get timeout messages when submitting your credit card information. You might be determined enough to keep visiting your favorite online shoe store despite these roadblocks, but most people won't bother.
You've been using Gmail as your primary email address for years, but your ISP decides to slow down that service and speed up Microsoft's Outlook.com instead. How long will you stick with the slow email over the fast one?
In a world where ISPs can slow down or outright block whatever services they like, your freedom to choose everything from your email client to your online university could disappear.
Lead Image Credit: Steve Heap / Shutterstock
| null |
minipile
|
NaturalLanguage
|
mit
| null |
m tech dissertation
Mtech dissertation
Institute of technical teacher training and research, _tedconsult_speech_powered_by e, if you are using a screen reader we recommend switching to "full access mode".
This mode is designed to help different types of navigation:each page is divided into sections and each section is described by a title (headings navigation).
The top of each page you will find the quick links menu (internal link navigation).
Presidential written dissertations abstracts theo 201 final essay proposal dissertation binding edinburgh morningside patocka heretical essays on dissertation to how the internet is bad for friendships and relationships.
Midterm study guides, anatomy packet with coloring and labeling, 2/4 essay, all 3 math sections of the sat practice soviet russia rt @meth_cook my essay on the communist you write out numbers in essays can you end an essay with in conclusion how to do essay need to start this study abroad essay but uhhh i need food, and ice cream, and chocolate, and soda out of a soda machine, and englishliterature, i.
On the other hand, i have to work today and have an essay to write insurance nz comparison essay the national education day essay tragic hero oedipus essay on blindness eurofighter typhoon rafale comparison essay ntpq output descriptive essay jane schaffer essay usa.
No essays of ambedkar included in sociology/eng/history seminar whn topic is caste discrimination. Any middle/high school student can nominate #inspirational #teacher w poem/essay/thankyou at barnes & mthe questions that help you and guide you to write a problems solution jesus came the corn mothers went away essays 4 page essay on racism in society phd dissertation writing service tax the world house essay mlk day 2016 logarithmisches papier beispiel essay law school admissions essay really should not be spending this long looking for a v for vendetta quote for my death penalty essay 150 words per minute sustainability management essay pt education essay quotes two cars one night essay n one hand i really don't want to continue with my ih essay anymore but on the other hand i really can't afford to fail this hat is your attitude to human cloning? Cafe physics admissions essay dissertation report on online marketing essay on importance of outdoor sports.
Texting while driving persuasive essay videos g w leibniz philosophical essays on death essex rebellion historiography essay dolphin research paper public health college essay essay to get into nursing school calendar mulata de tal analysis tation histoire 1789 dc, krank oxi dissertation ageism discrimination essays experience is the best teacher short love typing essays single spaced and then changing it to double spaced haha shit goes from 2 pages to 5 pages real 've had zero time to write my 5 page research paper, let alone do the research.
Mtech thesis/dissertation lucknow
It's due journalist and the murderer essays hagamos un trato analysis essay why chewing gum should be allowed in school essay steps to make a research paper quilling, essays on time old and new world trade center comparison essay my major essay importance of sports and games essay writing nurturing nature essayists how to make world peace essay dissertation coaching feesbook table of contents dissertation to start a research paper on a am so bored that i could even start to write my literature review for dissertation. Ennathegreat yeah, i do politics, for me planning essays and mind maps or flash cards are the best tips for professional essay writing: get your essays and research papers written from the lea..
Handed in essays so just compiling quotations for the exam, slow going #cba how's yours going?
thesis
Research paper on role of nabard in rural on let america be america again how to start a descriptive essay on a place help writing an essay for college year custom dissertation writing services vancouver bc how to write creative writing essays meaning self introduction letter for scholarship essays dissertation help london city solutions to poverty essay toms essay on animal imagery in i'm getting so annoyed with this essay, like wtf is a rhetorical situation.
I feel @oliviajasinska dac j'essay de me lever paper heading mla english essay meme sign language 101 greetings and useful words for essay an essay on the rights and responsibilities of citizens essay 2016 resolutions essay writer essay on 26 january in punjabi language college college essays essay on the importance of forgiveness essay schreiben geschichte translation essay on the advantages football essays data analysis for dissertation year 5 short essay on textile industry higher history extended essay intro collectivism vs individualism essay about myself parsley massacre essay writing dissertation quinquennat et cohabitation meaning grammar for essay writing g for pdf form of 'essay on the equality of human races'.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[Formolization of the bladder mucosa for hemostatic purposes].
The authors have used formalin solutions for the control of haematuria induced by bladder tumours. The 10 percent solution was efficient but induced severe side effects, such as peritonitis due to vesical necrosis, urethral fistulae, etc. The 1 percent solution is also efficient, and the local aggressivity is practically lacking, provided only 1--3 applications are carried out. The method should be used only in cases of haematuria that cannot be stopped by classical conservative means and in which surgery is not indicated, either temporarily or definitively.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Cavalli-Sforza first made his mark in his native Italy, traveling to villages in the Parma Valley to sample blood. He worked to understand how inbreeding within these small towns was connected to the slight differences in frequency of blood groups. With several coworkers, he scoured church records of marriages and births, tracing the times when people moved between villages as well as the number of children they had. Tracing these multiple lines of evidence, he could show that consanguineous marriages, or inbreeding, were the main drivers of genetic differences between these small towns. In doing so, he provided some of the earliest evidence that humans were still being affected by genetic drift, the random change in gene frequencies that happens in small populations.
Cavalli-Sforza realized that if genetic drift could explain the gene frequencies in small Italian towns, it might have affected humanity over a much deeper past. Genetic drift was a force that over long periods of time tended to drive populations slowly apart, inexorably diverging in gene frequencies. Applied to a group of populations over long periods of time, genetic drift would form a tree.
It was during this period that Cavalli-Sforza began collaborating with the statistical geneticist A. W. F. Edwards, developing ways to reconstruct evolutionary trees from gene frequencies. The statistical methods used measures of distance, computed from the frequencies of several genes across populations, and they generated a new picture of human origins.
From Cavalli-Sforza 1966, “Population structure and human evolution.”
Here, the branches of humanity came into focus. American Indians, Asians, and Oceanians on one broad branch, Europeans and Africans on the other.
The tree looks very different from our understanding today, which places African populations as the most diverse elements of humanity, not a minor twig. It is worth noting why Cavalli-Sforza’s early trees turned out to be wrong. Blood groups were first discovered and studied in people of European descent, meaning that African variation was not fully included by looking at the traits that vary in Europe. These five loci in particular include several that reflect natural selection, especially the Fy, or Duffy, locus, which approaches fixation in many sub-Saharan populations. Today, using whole genome sequences, it is clear that the deepest branches of human population trees are African.
But more important, the tree illustrates an enormous limitation of the classical markers. The frequencies of a few genes simply do not provide enough information to tell when and how much mixture may have happened among the populations. Cavalli-Sforza, drawing upon his work in the Parma Valley, and later work with Pygmies in central Africa, was willing to assume that migration and mixture were rare. In his model genetic drift, not gene flow, was the main force driving human evolution. Natural selection happened, too, but with patterns that might be recognized by comparing to the predictions of genetic drift alone.
A tree for visualizing genetic differences was a powerful tool. But Cavalli-Sforza and Edwards went a step further. They used an early computer to take the genetic differences between populations and transform them into principal components, which reflected the common correlations among the gene frequencies.
The first principal component of genetic variation across Europe, from Cavalli-Sforza 1997 Proc. Nat. Acad. Sci USA.
With this approach, they could not only show how gene frequencies changed on a map; they could now show how the common correlation of many gene frequencies changed. In Cavalli-Sforza’s vision, these maps provided a view of the historical forces that caused people to vary. A gradient across all the classical markers could show the possible pathways of movement and migration in the past. What the maps couldn’t show was how and why those movements had happened.
“The results of principal components analyses looked very good, but there was nothing to compare them with because the questions they helped to answer had never been asked”
He set out to find other sources of data that could make the genetic distances meaningful. With the archaeologist A. J. Ammerman, Cavalli-Sforza turned his attention to the Neolithic. This was an epochal archaeological change: the time that agriculture first spread from the Near East into Europe, taking with it pottery and stone implements that were ground and polished rather than chipped and flaked into shape. If events of the past had been powerful enough to sculpt gene frequencies across Europe, it seemed that the Neolithic should have been the strongest of them all.
By the early 1970s, the radiocarbon revolution had taken hold across European archaeological sites. The earliest signs of Neolithic traditions in various regions of Europe, from Greece to Ireland, had been dated with the new method. And they formed a striking pattern: it appeared that the Neolithic had spread slowly, around one kilometer a year, from the southeast to the northwest.
For Cavalli-Sforza, this picture had a clear implication: No migrating horde of farmers had colonized Europe. Instead, farming spread as farming populations gradually increased in size, carrying their new way of life to the next small region or hamlet. This process seemed almost to ignore variations in environment such as forest or hills, it seemed to have been inexorable. It was not the mere diffusion of ideas, instead it was a diffusion of culture together with genes. It was, as Ammerman and Cavalli-Sforza would name it, a process of demic diffusion.
“All evolutionary processes are basically similar, whichever the objects that evolve.”
During the 1980s and 1990s, demic diffusion became the dominant model of demographic change for the Neolithic. The idea underlay Colin Renfrew’s influential theory that Indo-European languages also spread with the Neolithic into Europe, replacing earlier languages spoken by Mesolithic or earlier peoples. It appeared that the processes of culture change and dispersal could be linked to the growth and expansion of human groups, if only geneticists could fill in the gaps in their data. Cavalli-Sforza worked more and more to understand how cultural and biological changes were linked, establishing a long-lasting collaboration with Marc Feldman to examine how cultures evolve.
We know today from ancient DNA data that the details of this vision of the Neolithic were wrong. The expansion of agriculture was important, but it was not alone. Much later movements of people, some of them quite rapid, transformed the genetic makeup of European populations. Today it appears that Indo-European languages invaded Europe during the Bronze Age, and that early farmers were genetically most like today’s Sardinians, a linguistic isolate that Cavalli-Sforza knew well.
But those facts learned from ancient DNA have come to most geneticists as a surprise. The synthetic view promoted by Cavalli-Sforza was so compelling, linking economic, demographic, and genetic change, that it would take a new data revolution — still underway today — to overturn.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Two-step stacking in capillary zone electrophoresis featuring sweeping and micelle to solvent stacking: I. Organic cations.
Two-step stacking of organic cations by sweeping and micelle to solvent stacking (MSS) in capillary zone electrophoresis (CZE) is presented. The simple procedure involves hydrodynamic injection of a micellar sodium dodecyl sulfate solution before the sample that is prepared without the micelles. The micelles sweep and transport the cations to the boundary zone between the sample and CZE buffer. The presence of organic solvent in the CZE buffer induces the second stacking step of MSS. The LODs obtained for the four beta blocker and two tricyclic antidepressant test drugs were 20-50 times better compared to typical injection.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
@sense8
The time has finally come to say goodbye to the psychic, sexually-fluid sci-fi series from Netflix, Sense8.
When the series was canceled last year after only two seasons, outraged fans lobbied until Netflix announced we would get a series finale TV movie.
The movie attempts to tie up several layered storylines of the diverse group of human beings who suddenly found themselves interconnected via telepathy in two and a half hours instead of what was originally planned to be a five season arc.
[Warning - while there are no specific spoilers in this article, stop reading now if you don't want to know anything about the TV finale]
The creators are not wasting much time recapping where we were left off at the end of season 2, so here’s the wrap-up plot: for the first time, seven of the sensates are physically together in Paris to plan a rescue of Wolfgang (Max Riemelt), who's been captured by BPO, an organization of evil doers who have chased our heroes from the outset.
To save Wolfgang, the seven have kidnapped their own prisoner, the evil scientist Whispers (played by Broadway’s Terrence Mann), hoping to trade him in a prisoner exchange for Wolfie.
Swirling over, under and around this central plot, there’s plenty of fight scenes, dancing in a Parisian club, chases, another epic mental orgy and a rapturous road trip to Naples.
And we’re going to have to move fast here, so if you don’t like a certain set of characters, don’t worry - the scene will change in a minute.
I won’t offer any real spoilers here but a few thoughts:
Fan favorite “Lito,” a sexy Mexican movie star who recently came out (played by Miguel Ángel Silvestre), was woefully under-utilized in my opinion. It seemed like every major cast member had a “moment” except Lito.
Perhaps that lapse in screen time happened because just not only are our 8 heroes here, but so are their significant others - and more. If a character had more than a couple of scenes during the two seasons of the series, they pretty much got a ticket to come back.
One of the advantages of having our protagonists in the same place was the budgetary savings for the movie. During the two seasons of the series, when members of “the cluster” would share their knowledge and abilities via a sort of shared consciousness across the planet, it required traveling the actors around the globe to appear in two sides of highly choreographed action scenes. Since the heroes are now all together there were fewer of those oh-so-cool sci-fi moments it seemed.
That said, the movie is visually stunning.
The series received well-deserved praise for its diverse cast that included several LGBTQ characters, including the previously mentioned Lito and his totes adorable bf, “Hernando” (Alfonso Herrera); and trans woman "Nomi" (Jamie Clayton) and her girlfriend, “Amanita” (Freema Agyeman), who have a beautiful moment of resolution.
In fact, the finale spends as much time on resolving romantic connections as it does solving the sensates predicament. Bonus points - a possible love-triangle made for an interesting plot twist.
I felt like the final resolution kind of came and went pretty fast, but seemed appropriate for the pace set by trans director/producer Lana Wachowski.
The final screen of the movie reads, “For our fans.” And I do think it’s great that we at least got this last hurrah.
If you were a fan of the series, you’ll probably really get jazzed by the finale movie.
If you weren’t already a fan, this may not convert you. It’s a lot of info coming at you fast.
This writer loved the series, so I was all smiles by the end.
The finale movie is currently available on Netflix. You can check out the trailer for the finale below.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
FOR PUBLICATION
UNITED STATES COURT OF APPEALS
FOR THE NINTH CIRCUIT
UNITED STATES OF AMERICA, No. 11-10425
Plaintiff-Appellee,
D.C. No.
v. 4:09-cr-02343-
FRZ-GEE-1
YURIS BONILLA-GUIZAR,
Defendant-Appellant.
UNITED STATES OF AMERICA, No. 11-10476
Plaintiff-Appellee,
D.C. No.
v. 4:09-cr-02343-
FRZ-GEE-2
CARLOS ARMANDO CALIXTRO-
BUSTAMANTE,
Defendant-Appellant. OPINION
Appeal from the United States District Court
for the District of Arizona
Frank R. Zapata, Senior District Judge, Presiding
Argued and Submitted
May 13, 2013—San Francisco, California
Filed September 9, 2013
2 UNITED STATES V. BONILLA-GUIZAR
Before: M. Margaret McKeown and Paul J. Watford,
Circuit Judges, and Algenon L. Marbley, District Judge.*
Opinion by Judge Marbley
SUMMARY**
Criminal Law
The panel affirmed convictions for conspiracy to commit
hostage taking, hostage taking, and harboring an alien, but
vacated sentences and remanded for resentencing.
The panel held that the district court did not abuse its
discretion in permitting a case agent to testify as an expert
witness. The panel explained that the agent’s testimony had
some probative value, and that because any error was
harmless, the panel did not need to decide whether the district
court erred in failing to distinguish clearly between the
defendant’s expert and percipient testimony and in failing to
offer a cautionary instruction. The panel noted the long-
standing precedent that bias is for the jury to consider in
determining the weight to accord the testimony.
The panel vacated the district court’s application to
defendant Bonilla-Guizar of a two-level leadership
*
The Honorable Algenon L. Marbley, District Judge for the U.S.
District Court for the Southern District of Ohio, sitting by designation.
**
This summary constitutes no part of the opinion of the court. It has
been prepared by court staff for the convenience of the reader.
UNITED STATES V. BONILLA-GUIZAR 3
enhancement under U.S.S.G. § 3B1.1(c), where the record
was unclear whether the district court found Bonilla managed
another participant in the crime. The panel instructed that the
enhancement may be applied at resentencing on remand only
if the district court makes such a finding based on evidence
on the record.
The panel held that the district court committed plain
error affecting substantial rights by applying to Bonilla and
defendant Calixtro-Bustamante an enhancement under
U.S.S.G. § 2A4.1(b)(3) for use of a dangerous weapon, where
the district court predicated the enhancement upon a legal
misunderstanding that brandishing the firearm was sufficient.
COUNSEL
Francisco Leon (argued), Law Office of Francisco Leon, P.C.,
Tucson, Arizona; Rosemary Márquez (argued), Márquez Law
Firm, P.L.L.C., Tucson, Arizona, for Defendants-Appellants.
Erica McCallum (argued), Assistant United States Attorney;
George Ferko, Special Assistant United States Attorney; John
S. Leonardo, United States Attorney; Christina M. Cabanillas,
Appellate Chief, United States Attorney’s Office, Tucson,
Arizona, for Plaintiff-Appellee.
4 UNITED STATES V. BONILLA-GUIZAR
OPINION
MARBLEY, District Judge:
Defendants-Appellants, Yuris Bonilla-Guizar and Carlos
Armando Calixtro-Bustamante, appeal their respective
criminal convictions in a joint trial in the United States
District Court for the District of Arizona (“district court”) as
well as their subsequent sentences. Bonilla-Guizar
(“Bonilla”) was convicted of conspiracy to commit hostage
taking and harboring an alien. Calixtro-Bustamante
(“Calixtro”) was convicted of conspiracy to commit hostage
taking, hostage taking, and harboring an alien. Bonilla and
Calixtro both object to the following district court rulings: (1)
permitting a case agent to testify as an expert witness; and (2)
denying Defendants’ request for a limiting instruction to the
jury or other cautionary measure regarding the case agent’s
testimony. With respect to his sentence, Bonilla objects to
the district court’s application of a two-level enhancement,
under U.S.S.G. § 3B1.1(c), for his alleged leadership role in
the criminal activity. Finally, both Bonilla and Calixtro
object to the district court’s application of a two-level
sentencing enhancement, under U.S.S.G. § 2A4.1(b), for use
of a dangerous weapon.
On appeal, we consider whether the district court erred in
allowing Case Agent Jeffrey Ellis (“Agent Ellis”) to testify as
an expert and, if it did not, whether the district court
nevertheless erred in failing to provide a cautionary
instruction to the jury regarding his testimony. Defendants
contend they were denied a fair trial because Agent Ellis
mixed factual testimony with expert testimony, and was
biased for the Government. On those grounds, Defendants
UNITED STATES V. BONILLA-GUIZAR 5
seek a reversal of their convictions and remand for a new
trial.
We also consider alleged sentencing errors. Bonilla
argues that the district court erroneously applied the two-level
leadership enhancement to his sentence because the court had
not found that Bonilla supervised another participant in the
crime. In addition, Defendants both contend the district court
was wrong to apply a further two-level enhancement for use
of a dangerous weapon because the Government did not
prove that Appellants possessed actual firearms or “used” any
weapon beyond merely “brandishing” one. Hence, if we
affirm Defendants’ convictions, they alternatively seek to
vacate and to remand their sentences.
For the reasons set forth herein, we AFFIRM Defendants’
convictions. We VACATE, however, the district court’s
application of a two-level leadership enhancement to Bonilla
and the application of a two-level enhancement to Bonilla and
Calixtro for use of a dangerous weapon.
I. BACKGROUND
In mid-September, 2009, Julio Cesar Lopez-Trujillo
(“Lopez”) arranged to enter the United States illegally, from
Mexico, with assistance from alien smugglers. Lopez crossed
into the United States with five other aliens and two guides.
Upon crossing into Arizona, the guides instructed the aliens
to enter a truck waiting on the side of the road. Another
guide, called “El Flaco,” drove the truck while
communicating via handheld transceiver with someone
named “Yuri,” later identified as Bonilla. Bonilla told El
Flaco to drive to a particular restaurant and remain there.
Bonilla himself then arrived at the restaurant driving a small
6 UNITED STATES V. BONILLA-GUIZAR
car, and instructed El Flaco to follow him in the truck. The
group eventually arrived at a group of trailers near Tucson,
Arizona. Lopez and the other aliens were then moved into a
trailer.
Two hours after Lopez arrived at the trailer, Bonilla
informed Lopez that he would have to pay $2,300 for the
assistance entering the U.S., rather than the $1,500 which
Lopez had been quoted in Mexico. Bonilla ordered Lopez to
call his wife to ask for the money. On September 22, 2009,
Lopez called his wife to tell her he would not be released
unless she sent his captors $2,300. Two days later, Calixtro
spoke to Lopez’s wife on the phone, and gave her instructions
for sending the money.
Lopez testified that Bonilla and Calixtro were armed
during the time he was held hostage. In particular, Lopez
described one gun Defendants possessed which was black and
gray, approximately eight inches in length, and had a laser
sight and a magazine “loaded from underneath.” Lopez also
testified that both Defendants pointed that weapon at his
head.
At approximately 7:40 p.m. on September 24, 2009,
federal agents freed Lopez and four other hostages. Federal
agents stated that, during the operation, they recovered two
firearms, including one very similar to the gun Lopez
described. The Government was unable to produce either of
those firearms at trial because, according to the Government,
they were accidentally destroyed while in the laboratory.
At trial, the Government called Immigration and Customs
Enforcement (“ICE”) Special Agent Jeffrey Ellis (“Agent
Ellis”) to testify as an expert witness on alien smuggling and
UNITED STATES V. BONILLA-GUIZAR 7
alien smuggling operations. Agent Ellis had worked fifteen
years for ICE and its predecessor, the Immigration and
Naturalization Service. For much of that time, he
investigated human smuggling. Agent Ellis was also the
original ICE case agent investigating Bonilla and Calixtro.
As part of the investigation, Agent Ellis prepared the search
warrant for the trailers where Lopez was found and worked
on the case for approximately four months. On cross-
examination, Agent Ellis admitted his bias for the
Government in this case. The district court, nevertheless,
qualified Agent Ellis as an expert witness and elected not to
give the jury any cautionary instruction with regard to his
testimony. Defendants’ trial counsel made evidentiary
objections to both rulings.
The jury found Bonilla guilty of conspiracy to commit
hostage taking and harboring an alien for private financial
gain. At his sentencing, the district court applied a base
offense level enhancement of two for his role as “a manager
of some sort” in a criminal enterprise. The district court
applied a second two-level enhancement for Bonilla’s use of
a firearm in the commission of a crime. Those enhancements
raised Bonilla’s base offense level under the sentencing
guidelines from 32 to 36. The district court, relying on that
calculation, sentenced Bonilla to a 188-month term of
imprisonment.
The jury found Calixtro guilty on three charges:
conspiracy to commit hostage taking; hostage taking; and
harboring an alien for private financial gain. At Calixtro’s
sentencing, the district court applied a base offense level
enhancement of two for Calixtro’s use of a firearm in the
commission of a crime. The enhancement raised the base
offense level from 32 to 34. The district court, relying on that
8 UNITED STATES V. BONILLA-GUIZAR
calculation, also sentenced Calixtro to a 188-month term of
imprisonment.
Bonilla and Calixtro appeal both their convictions and the
sentencing enhancements.
II. JURISDICTION
This Court has jurisdiction over final decisions of the
district court pursuant to 28 U.S.C. § 1291.
III. ANALYSIS
A. District Court’s Admission of Agent Ellis’s Expert
Testimony
1. Standard of Review
A district court’s decision to admit testimony of an expert
witness is reviewed for abuse of discretion. United States v.
Mejia-Luna, 562 F.3d 1215, 1218–19 (9th Cir. 2009).
2. Discussion
Defendants argue that the district court abused its
discretion in permitting Agent Ellis, the original agent in the
investigation of Bonilla and Calixtro, to testify as an expert
witness. They contend that his expert testimony was of no
probative value, or of such limited probative value as to be
outweighed by the prejudicial effect. At the very least,
Defendants argue, the district court should have taken
“cautionary measures” to limit the potential prejudicial effect
of Agent Ellis’s testimony.
UNITED STATES V. BONILLA-GUIZAR 9
Defendants first argue that Agent Ellis’s testimony lacked
probative value because the facts of this case were readily
comprehensible to jurors and the Government failed to
articulate how the testimony was relevant. Although
Defendants may not accept the Government’s theory of
relevancy, the Government did present one. The Government
suggested alien smuggling organizations are web-like, rather
than hierarchical, and involve a “loose confederation of co-
conspirators.” The facts of this case support that contention.
One person in Mexico solicited Lopez. A different set of
guides led him through the desert. Yet another man drove the
truck to the stash house. Finally, Defendants held Lopez at
the stash house and were in contact with a “boss.”
While the scenario of a hostage taking may be familiar to
a layperson, the modus operandi of alien smugglers is less
familiar. As the district court found:
Mr. Ellis is not an expert that is speaking on
scientific matters that might require having
read treatises or made studies and so forth.
He’s testifying about the overall structure and
operation of an alien smuggling organization
. . . It’s information that is being imparted to
a jury who presumably knows nothing about
alien smuggling and alien smuggling
organizations.
The district court, following Ninth Circuit precedent, agreed
with the Government that the structure of an alien smuggling
organization was relevant to the charge of conspiracy.
Indeed, this Court has repeatedly upheld the admission of
expert testimony “regarding the structure and methods of
alien smuggling operations.” Mejia-Luna, 562 F.3d at
10 UNITED STATES V. BONILLA-GUIZAR
1218–19. Thus, Agent Ellis’s testimony as an expert witness
had some probative value.
Defendants next argue that, even if Agent Ellis’s
testimony had some probative value, such value was
outweighed by its prejudicial effect. In particular, Defendants
allege that Agent Ellis’s testimony was unfairly prejudicial
because “qualifying the case agent as the expert witness . . .
unduly bolster[ed] the credibility of the government’s case.”
This court has previously considered the challenges that
are created when a case agent testifies as both an expert and
percipient witness. See United States v. Freeman, 498 F.3d
893, 902–04 (9th Cir. 2007); see also United States v.
Dukagjini, 326 F.3d 45 (2d Cir. 2003). In Freeman, we held
that a case agent is not categorically barred from testifying as
both an expert and percipient witness, “provided that the
district court engages in vigilant gatekeeping” and that
“jurors are aware of the witness’s dual roles” and the bounds
of each type of testimony. 498 F.3d at 904. We considered
a similar situation in United States v. Anchrum, 590 F.3d 795,
803–04 (9th Cir. 2009), and affirmed a guilty verdict where
a case agent testified in both roles because “the district court
divided [the case agent’s] testimony into two separate
phases,” which “avoided blurring the distinction between [the
case agent’s] distinct role as a lay witness and his role as an
expert witness.”
Defendants concede that the direct examination solely
addressed Agent Ellis’s expert opinion. Agent Ellis’s role as
a case agent was first raised by Defendants’ counsel on cross-
examination to challenge Agent Ellis’s impartiality. On
cross-examination and redirect-examination, Agent Ellis
answered, as a percipient witness, several questions about the
UNITED STATES V. BONILLA-GUIZAR 11
investigatory process, primarily focused on the description in
the warrant application of the location to be searched.
Agent Ellis’s expert testimony placed Defendants in a
difficult position. Defendants could reasonably fear that
Agent Ellis’s involvement in the investigation could bias his
expert testimony and that he could “stray from applying
reliable methodology and convey to the jury the witness’s
‘sweeping conclusions’ about appellants’ activities, deviating
from the strictures of Rules 403 and 702.’” Freeman,
498 F.3d at 903 (citations omitted). At the same time,
exposing an expert witness’s role as case agent generally
creates concerns that his expert status will reinforce the
credibility of his percipient testimony.
The defense requested a cautionary instruction, but the
court declined to give one. Defendants argue that the district
court failed to take appropriate measures to “guard against the
risk of confusion inherent when a law enforcement agent
testifies as both a fact witness and as an expert witness.” We
agree that extra precautions are necessary when a case agent
testifies as an expert and a fact witness. See Freeman,
498 F.3d at 904. The government suggests that Agent Ellis’s
lay testimony was so minimal that he should not be
considered a fact witness. Nonetheless, Agent Ellis did
testify about the facts of this specific case based on his own
experience as a case agent, thereby exceeding the bounds of
his expert role. We need not decide whether the district court
erred in failing to distinguish clearly between Ellis’s expert
and percipient testimony and in failing to offer a cautionary
instruction to the jury, however, because any potential error
in this case was harmless.
12 UNITED STATES V. BONILLA-GUIZAR
For the purposes of harmless error analysis, we proceed
under the presumption that a trial error occurred. A
non-constitutional trial error requires reversal unless “it is
more probable than not that the error did not materially affect
the verdict.” See United States v. Seschillie, 310 F.3d 1208,
1214 (9th Cir. 2002). Agent Ellis’s lay testimony was elicited
primarily by defense counsel. His testimony established that
the government had no listening devices or cameras in the
trailer prior to the arrest and that Agent Ellis therefore relied
on what he was told by Lopez and his wife in preparing the
warrant application. Defense counsel also elicited testimony
regarding the size and layout of the property described in the
warrant and the accuracy of the location data provided by the
cellular phone carrier. On redirect examination, the
government briefly reviewed Agent Ellis’s request in the
affidavit to search all of the trailers on the property because
of the range of accuracy of the locational data.
None of this fact testimony from Agent Ellis established
any elements of the crime or was material to the conviction.
Nor could the jury have been swayed to grant more weight to
Ellis’s expert testimony here by the few facts he recited about
the search warrant application. In light of the overwhelming
evidence of guilt, we can say with at least a “fair assurance”
that any error did not affect the verdict and was therefore
harmless. United States v. Morales, 108 F.3d 1031, 1040 (9th
Cir. 1997) (en banc).
Defendants also argue that the district court should not
have admitted Agent Ellis’s testimony on account of bias.
But it is axiomatic that a witness’s “possible bias” goes “to
the weight of her testimony, not its admissibility.” United
States v. Moore, 580 F.2d 360, 364 (9th Cir. 1978). Indeed,
the Supreme Court has observed:
UNITED STATES V. BONILLA-GUIZAR 13
A more particular attack on the witness’
credibility is effected by means of cross-
examination directed toward revealing
possible biases, prejudices, or ulterior motives
of the witness as they may relate directly to
issues or personalities in the case at hand.
The partiality of a witness is subject to
exploration at trial, and is ‘always relevant as
discrediting the witness and affecting the
weight of his testimony.’
Davis v. Alaska, 415 U.S. 308, 316 (1974) (internal citations
omitted). Here, Defendants’ trial counsel attempted to
impeach the credibility of Agent Ellis by exposing his bias on
cross-examination. The jury was able to factor the bias into
its consideration of Agent Ellis’s credibility.
Any time a party attempts to impeach a witness’s
credibility, there is an inherent risk that a jury will not find
the credibility of the witness impaired, or even that a failed
impeachment may bolster a witness’s credibility. The fact
that Agent Ellis’s potential bias happened to result from his
employment by the Government is also not grounds for
categorically barring his testimony; it is simply another factor
the jury may consider in weighing Agent Ellis’s credibility.
Hingson v. Pacific Southwest Airlines, 743 F.2d 1408,
1412–13 (9th Cir. 1984). Nor does the analysis change
because Agent Ellis admitted to having some bias for the
Government. Although the admission may have had the
effect of enhancing his credibility, that is a risk Defendants’
trial counsel took when attempting to impeach Agent Ellis.
Agent Ellis also testified he had done his best to separate his
role in the case from the opinions he rendered as an expert.
Given the long-standing precedent that bias is for the jury to
14 UNITED STATES V. BONILLA-GUIZAR
consider in determining the weight to accord testimony, we
hold the district court did not abuse its discretion in admitting
Agent Ellis’s testimony.
Defendants’ convictions are, therefore, AFFIRMED.
B. Defendant Bonilla’s § 3B1.1 Enhancement
1. Standard of Review
The factual findings made by the district court in the
sentencing phase are reviewed for clear error. United States
v. Kimbrew, 406 F.3d 1149, 1151 (9th Cir. 2005). The
district court’s application of the Sentencing Guidelines to the
facts of the case is reviewed for abuse of discretion. Id.
2. Discussion
Section 3B1.1(c) of the Sentencing Guidelines provides
that:
If the defendant was an organizer, leader,
manager, or supervisor in any criminal
activity other than described in (a) or (b),
increase by 2 levels.
The commentary goes on to note that:
To qualify for an adjustment under this
section, the defendant must have been the
organizer, leader, manager or supervisor of
one or more other participants. An upward
departure may be warranted, however, in the
case of a defendant who did not organize,
UNITED STATES V. BONILLA-GUIZAR 15
lead, manage or supervise another participant,
but who nevertheless exercised management
responsibility over the property, assets, or
activities of a criminal organization.
U.S.S.G. § 3B1.1, cmt. n. 2. In this circuit, however, “some
degree of control or organizational authority over others is
required in order for section 3B1.1 to apply.” United States
v. Mares-Molina, 913 F.2d 770, 773 (9th Cir. 1990)
(emphasis added). “Participant,” in § 3B1.1, is defined as “a
person who is criminally responsible for the commission of
the offense, but need not have been convicted.” U.S.S.G.
§ 3B1.1, at cmt. n. 1.
The district court found Bonilla “was basically a house
sitter, stash house sitter, that takes control in this case
apparently by use of a firearm of people who are there . . .
And to some degree I think you can probably find that he was
a manager of some sort of the people in the house.” The
district court then added that it found “without much effort
[Bonilla] was in fact some sort of – certainly he was
managing the house there where he was and also supervising
whatever went on in that house.”
On appeal, Bonilla argues that the district court
misinterpreted the definition of “participant” to encompass a
“hostage or victim of the crime.” From the record, it is
unclear whether the district court made such a
misinterpretation. The vague findings that Bonilla “was a
manager of some sort of the people in the house” and
“whatever went on in that house” could equally have referred
to other participants or the hostages themselves. Although we
review the district court’s decision in this matter for clear
error, from the record, we do not know whether the district
16 UNITED STATES V. BONILLA-GUIZAR
court found Bonilla managed another participant in the crime.
If the district court found Bonilla did not manage or supervise
another participant in the crime, the application of the
enhancement would be clear error, in light of Mares-Molina.
We cannot affirm a decision that is ambiguous and, thus,
unclear. It is, therefore, necessary to vacate Bonilla’s
sentence and remand him to the district court for
resentencing. Upon resentencing, the district court may apply
the § 3B1.1 management enhancement only if it finds, based
on evidence in the record, that Bonilla managed at least one
other participant in the crime. For these reasons, the sentence
of Bonilla is VACATED and he is remanded to the district
court for resentencing.
C. Defendants’ U.S.S.G. § 2A4.1(b)(3) Firearm
Enhancements
1. Standard of Review
Where a defendant has failed to raise an objection to a
sentencing error in the district court, the decision is reviewed
for plain error. United States v. Ameline, 409 F.3d 1073,
1078 (9th Cir. 2005). Defendant Calixtro did not object to
the dangerous weapon enhancement. Defendant Bonilla
objected on due process grounds, which are not raised on this
appeal.
Plain error is: “(1) error, (2) that is plain, and (3) that
affects substantial rights.” United States v. Cotton, 535 U.S.
625, 631 (2002). Once those three conditions are satisfied,
“an appellate court may exercise its discretion to notice a
forfeited error that (4) ‘seriously affects the fairness,
integrity, or public reputation of judicial proceedings.’”
Ameline, 409 F.3d at 1078 (citation omitted). A defendant
UNITED STATES V. BONILLA-GUIZAR 17
bears the burden to show her substantial rights were affected
and, to do so, “must establish ‘that the probability of a
different result is sufficient to undermine confidence in the
outcome of the proceeding.’” Id. (citation omitted).
2. Discussion
Under U.S.S.G. § 2A4.1(b)(3), a two-level sentence
enhancement applies to an offense of kidnapping, abduction,
or unlawful restraint “[i]f a dangerous weapon was used.”
The commentary clarifies that “‘[a] dangerous weapon was
used’ means that a firearm was discharged, or a ‘firearm’ or
‘dangerous weapon’ was ‘otherwise used’ [] as defined in the
commentary to § 1B1.1.” U.S.S.G. § 2A4.1, cmt. n. 2.
Section 1B1.1 goes on to define “dangerous weapon” as “an
instrument capable of inflicting death or serious bodily
injury” or “an object that is not an instrument capable of
inflicting death or serious bodily injury but (I) closely
resembles such an instrument; or (II) the defendant used the
object in a manner that created the impression that the object
was such an instrument.” U.S.S.G. § 1B1.1, cmt. n. 1(D).
“Otherwise used,” when referring to a dangerous weapon,
“means that the conduct did not amount to the discharge of a
firearm but was more than brandishing, displaying, or
possessing a firearm or other dangerous weapon.” Id. at cmt.
n. 1(I).
Although § 1B1.1 explicitly states that merely
“brandishing, displaying, or possessing” a dangerous weapon
alone does not qualify as “otherwise us[ing],” the district
court found:
18 UNITED STATES V. BONILLA-GUIZAR
[W]hether or not it was actually pointed
directly at the victim, under the guidelines
that does not appear to be necessary; only that
the weapon was possessed and that the
weapon was displayed.
That finding contradicts the plain language of § 1B1.1 and,
thus, is “(1) error, (2) that is plain” in the plain error analysis.
The Government concedes that the district court’s finding
satisfies the first two prongs of the plain error test.
According to the Government, however, that plain error
neither affects the Defendants’ substantial rights, nor the
public reputation of the judicial system.
We reject the Government’s position that Defendants’
substantial rights were not affected by the district court’s
error. The Supreme Court has held that “improperly
calculating the Guidelines range” is a “significant procedural
error.” Gall v. United States, 552 U.S. 38, 51 (2007). We
subsequently held that “[a] mistake in calculating the
recommended Guidelines sentencing range is a significant
procedural error that requires us to remand for resentencing.”
United States v. Munoz-Camarena, 631 F.3d 1028, 1030 (9th
Cir. 2011) (emphasis added). If the district court mistakenly
based its application of the firearm enhancement on
brandishing alone, then it improperly calculated the
Guidelines sentencing range.
The Government correctly contends that there was
testimony from Lopez that both Bonilla and Calixtro pointed
a gun at his head – conduct that goes beyond brandishing. At
sentencing, however, the district court found that “[t]he
defense, by the destruction of that firearm, was to some
degree denied the opportunity to cross-examine” Lopez as to
UNITED STATES V. BONILLA-GUIZAR 19
whether Bonilla and Calixtro pointed a gun at him, and how
he knew that. The district court went on to say that:
if the standard that we’re looking at is it was
more than brandishing, displaying or
possessing a firearm, then we’re probably not
going to be able to get there because the
firearm was destroyed. The defendant’s
ability to cross-examine on that issue was
curtailed to a large degree.
In other words, contrary to the Government’s contention, the
district court explicitly declined to find Bonilla and Calixtro
had pointed a firearm at Lopez, or used it in any way except
by brandishing. The resulting enhancement was predicated
upon the legal misunderstanding that brandishing a firearm
alone supported an enhancement under § 2A4.1. It does not.
Had the district court not applied the enhancement it would
have calculated lower base offense levels and, though the
Guidelines are advisory, there is a high probability that lesser
sentences would have been imposed.
As a result of the district court’s sentencing errors,
Bonilla’s base offense level was raised from 32 (sentencing
range of 121–151 months) to 36 (sentencing range of
188–235 months). We have held that when a sentencing
judge incorrectly calculates the Guidelines range, potentially
resulting in the imposition of a greater sentence, the error
affects the defendant’s substantial rights and “the fairness of
the judicial proceedings.” United States v. Castillo-Marin,
684 F.3d 914, 927 (9th Cir. 2012). As this is precisely what
happened in this case, the third and fourth prongs of the plain-
error test are satisfied.
20 UNITED STATES V. BONILLA-GUIZAR
The situation of Calixtro is somewhat different. The
sentencing error raised his base offense level from 32
(sentencing range of 168–210 months) to 34 (sentencing
range of 210–262 months). The district court applied a
downward variance in sentencing Calixtro to 188 months.
Had the district court properly calculated Calixtro’s
sentencing range, it may still have applied the downward
variance, resulting in a sentence of less than 188 months. The
fact that Calixtro’s actual sentence chanced to fall within the
proper sentencing range does not alter the fact that the district
court plainly erred when calculating the range of his sentence,
thus affecting his substantial rights.
We, therefore, hold the district court plainly erred in
applying the § 2A4.1(b)(3) enhancement to Defendants’
sentences. Upon resentencing Defendants, the district court
may find convincing the evidence that Defendants pointed a
gun at their victim, but we decline the Government’s request
to do so on appeal when the district judge who heard all the
evidence explicitly did not. For these reasons, the sentences
of Bonilla and Calixtro are VACATED and remanded to the
district court for resentencing.
IV. CONCLUSION
For the foregoing reasons, we AFFIRM the district
court’s admission of Agent Ellis’s expert testimony and
Defendants’ convictions. As a result of sentencing errors, we
VACATE Defendants’ sentences and REMAND them to the
district court for resentencing consistent with this Opinion.
AFFIRMED in part, VACATED in part and
REMANDED.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
It is a never-seen-before showdown in European competitions between two of the teams that made it to the EuroCup playoffs in the 2019-20 campaign. Reyer returns with the same core of players that led the team to a new golden age - after 75 years without titles, the team won one in each of the last four seasons. Mitchell Watt, Austin Daye, Mike Bramos and Jeremy Chappell will keep leading the team. UNICS kept Jamar Smith and added well-rounded players like Isaiah Canaan, John Brown, Okaro White or Nate Wolters. Expect a high-profile showdown.
Marquee matchup:
Simply put, Smith is one of the best shooters in competition history. He needs 18 three-point shots to lead the all-time standings. Smith, a great shooter with outstanding ballhandling and deep range, hit 47 of 89 shots from downtown (52.8%) last season, so it is safe to say he can break Rafa Martinez's record this season. This time, he will face a hard-nosed defender who can also pull the trigger from downtown, none other than Bramos, an experienced swingman who always plays hard at both ends.
Keys to victory: Umana Reyer Venice
Above all, UNICS has a new team and Reyer has kept most of the players who have been working together for years, led by head coach Walter De Raffaelle. Its main addition, big man Isaac Fotu, makes Reyer even more versatile around the rims, as he can play alongside Watt to power the boards, to team up with Daye to open the floor. Reyes has a very team-oriented roster and everyone understands that team basketball led the team this far over the last four years. Being able to keep that mentality will give Reyer an edge in most games.
Keys to victory: UNICS Kazan
Not many teams will be able to beat Reyer in Venice, but UNICS has the talent and potential to do so. Brown, whose career has been centered in Italy, is set to use that experience to go against Watt and Daye. White and Jordan Morgan are versatile players who can give Daye trouble on defense but also generate mismatches on offense. UNICS heavily rely on its playmakers, Wolters and Canaan, who must set the right game tempo, getting scorers like Smith, John Holland and Evgeny Kolesnikov involved. UNICS must use its physicality on defense to stop Reyer's shooters.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
---
abstract: 'We have developed a method to produce aqueous microdroplets in an oil phase, based on the periodic extraction of a pending droplet across the oil/air interface. This interface forms a capillary trap inside which a droplet can be captured and detached. This process is found to be capillary-based and quasi-static. The droplet size and emission rate are independently governed by the injected volume per cycle and the extraction frequency. We find that the minimum droplet diameter is close to the injection glass capillary diameter and that variations in surface tension moderately perturb the droplet size. A theoretical model based on surface energy minimization in the oil/water/air phases was derived and captures the experimental results. This method enables robust, versatile and tunable production of microdroplets at low production rates.'
author:
- 'M. Valet'
- 'L.-L. Pontani'
- 'A. M. Prevost'
- 'E. Wandersman'
title: 'Quasi-static microdroplet production in a capillary trap'
---
The development of microfluidics over the last three decades has enabled monodisperse droplet production [@zhu2017passive], at rapid emission rates ($\sim$ 100 Hz to 10 kHz). In a typical - now popular - flow focusing [@Anna03] or T-junction [@Thorsen01] microfluidic chip, the accessible droplet size covers 1 to a few 100 $\mu$m and is tuned by the channel size and flow rates of the dispersed and continuous phases. These techniques allow fast encapsulation of chemicals and can produce microreactors for the high throughput screening of drugs efficiency [@Miller2012] or directed evolution [@Agresti2010]. They have also been successfully used to produce colloids [@Kong13] and microcapsules [@Shah08]. However, they are not well suited when low production rates are required to allow surfactants with slower dynamics to stabilize the droplets. This is the case, for instance, with protein stabilized emulsions [@Beverung1999], phospholipids, that are used to create droplet interface bilayers [@Leptihn2013], or particles, that can lead to micro-structured droplets and colloidosomes [@Kutuzov2007]. For these reasons, various *on demand* microfluidic systems have been developed to produce individual microdroplets with tunable rates. They rely on the introduction of additional external forces (*via* an electric field [@he06], a mechanical excitation [@bransky09; @galas09], a laser beam[@wu12]) that destabilize the oil/water interface and trigger the droplet formation. Such microfluidic systems with tunable production rates make it easy to implement droplet-based 3D printers [@Villar2013] that pave the way to the engineering of artificial tissues [@booth17].\
We present in this Letter an additional and simple way to produce aqueous droplets by destabilizing the oil/water interface. This method, surprisingly undocumented, is on demand and consists in pulling out a capillary (filled with the aqueous solution) from the oil/air interface (Fig. 1). We show that the process of droplet formation is quasi-static and yields aqueous droplets in oil of typical size $d$, the inner capillary diameter \[20–700\] $\mu$m in the low frequency limit ($<$ 1Hz). Using either a *unique* syringe pump, or just using the hydrostatic pressure, we could easily produce droplets with a polydispersity (standard deviation of the radii distribution over the average radius) of about 1%, *i.e.* comparable to standard microfluidic techniques. Qualitatively, since the oil(*o*)/water(*w*) surface tension is lower than the air(*a*)/water one ($\gamma_{ow} <\gamma_{aw}$), an aqueous droplet can be trapped and detached in oil (Figs. 1 b-d). Quantitatively, these findings are confronted to a model that compares interfacial energies of attached and detached droplets. Compared to the above-mentioned methods [@he06; @bransky09; @wu12], this technique relies on a softer forcing of the the oil/water interface, which makes it compatible with the use of any material such as charged components or fragile biological material and amenable for a wide range of applications.\
The experimental setup (Fig. 1a) consists of a syringe pump (KDS Scientific, Legato 270) that imposes the flow of an aqueous solution at a flow rate $Q$ in a glass capillary (inner diameters d=2$R_0$ ranging from 20 to 700 $\mu$m, details in [@SupMat]). The capillary is mounted on a motorized translation stage (M-ILS250 CCL, Newport) to impose a vertical and cyclic up/down motion across the oil/air interface (Fig. 1a, graphical sketch) with an amplitude $\Delta z$ = 2 mm and a constant velocity $v$, ranging from 100 $\mu$m/s to 5 mm/s. A latency time $T_0= 0.45$ s is required to reverse the direction of the translation stage, during which the capillary stays immobile. The total period of the displacement $T=2(T_0+\Delta z/v)$ is measured and is about 1.7 (*resp.* 40) seconds for $v$= 5 (*resp.* 0.1) mm/s. In the first phase of the experiment, the capillary is immersed in the oil container, and an aqueous droplet grows (Fig. 1b). In the second phase, the capillary moves back up (Fig. 1c) and, as discussed below the droplet may (depending on its size) detach (Fig. 1d) and sediment in the oil phase. Note that to test the versatility of the technique, we also imposed the flow through hydrostatic pressure, which makes the whole setup quite inexpensive (*see* [@SupMat] to build such a setup at low cost).
![\[f1\] (a) Sketch of the setup. A syringe pump imposes a flow of water through a glass capillary fixed to a translation stage. This one imposes a displacement of capillary tip $z(t)$ shown in the graphical inset. Imaging is performed with an LED panel and a camera. (b-d) Snapshots obtained with a fast camera. The attached aqueous droplet (\[SDS\]=8 mM) is immersed in silicon oil at $t=t_0$ (b). The capillary moves up at $t=t_0+123$ ms (c) and the droplet finally detaches at $t=t_0+1.213$ s (d). On (b) the white bar is 400 $\mu$m long.](Fig1){width="42.00000%"}
We have characterized the droplet detachment process by optical imaging performed in a transmission geometry, using a LED panel. Two different types of experiments were performed independently. On the one hand, we have used fast imaging with a Photron Fastcam APRX RS camera (1024$\times$1024 pixels$^2$, 8 bits, 3000 fps) to follow the detachment process at short timescales. On the other hand, we have recorded images of hundreds (typically N=100 to 500) of detached droplets for each experimental condition, using a Chameleon3 (Point Grey, 1280$\times$1024 pixels$^2$, 8 bits) camera equipped with a high magnification Navitar objective (maximum spatial resolution of 2.1 $\mu$m/pix) to measure their size distribution. For that purpose, we synchronized the motor displacement and the camera acquisition using Labview (National Instruments). Measures of the droplet radii are obtained by detecting their edges using a custom made MATLAB (MathWorks) routine.\
To probe the ubiquity of the technique, experiments are performed using both ionic and non-ionic surfactants. As a standard ionic surfactant, we used Sodium Dodecyl Sulfate (SDS) aqueous solutions at various concentrations (from 0.08 mM to the critical micellar concentration [@kanellopoulos] of 8 mM). In this case, the corresponding oil phase is silicon oil (viscosity 5 mPa.s, Sigma Aldrich). As a non-ionic surfactant, we used Span 80 (Sigma Aldrich) dispersed in pure hexadecane at a mass concentration of 2% (w/w). In that case, the aqueous phase is pure water.
![\[f2\] (a) $R_d$ *versus* $Q$ (d=197 $\mu$m, \[SDS\] = 8 mM, $v$=5 mm/s). The solid line is a fit $R_d = K Q^{\frac{1}{3}}$, with K = 49.1 $\pm$ 0.3 $\mu$m h$^{1/3}\mu L^{-1/3}$, in good agreement with the expected value K = $(3T/(4\pi))^{1/3}=48.5$. $Q^*$ and the corresponding $R_d^*$ are shown on the graph. Inset: histogram of $R_d$ (N=500 droplets), for $Q=100 \mu$L/h (average radius 232.1 $ \mu$m, standard deviation 1.8 $ \mu$m, yielding a polydispersity of 0.8%). (b) $R_d$ as a function of $v$, keeping $QT$ constant. From left to right, $Q$ = 8.45, 16.6, 32.6, 75.1, 137.6 and 200 $\mu$L/h, respectively. The dashed line is a guide for the eye. Inset: $R_d$ as function of $[3QT/(4\pi)]^{1/3}$, for all experiments combined, with d=197 $\mu$m (including all $v$ and $[SDS]$ values). The solid line has a slope of 1.](Fig2){width="45.00000%"}
We have first investigated the minimal droplet size one can obtain for a given surface tension. We performed experiments with a capillary ($d$=197 $\mu$m) filled with an SDS solution at 8 mM concentration. We kept the time period of the displacement $T$ constant and decreased gradually the flow rate $Q$. For each $Q$ we measured the average radius (Fig. 2a). For $Q<Q^*$, we do not produce a droplet per cycle. The corresponding minimal droplet radius $R_d^*$ is about 2$R_0$. At a given $Q$, the total volume of injected aqueous phase per cycle is $QT$. One thus trivially expects that $R_d = \left(\frac{3}{4\pi}QT\right)^{1/3}$. The data is well fitted by this equation (Fig. 2a and inset of Fig. 2b). Despite its apparent simplicity, this dependence on $Q$ provides a convenient control parameter to tune the size of the droplet, above $R_d^*$. For droplets larger than $R_d^*$ (by about a factor 1.5), the polydispersity is around 1% or less (Fig. 2a, inset). We found that approaching the detachment instability limit at $R_d^*$, the polydispersity increases but never exceeds 5%. Last, note that the droplets produced in the capillary trap have sizes much smaller than what would be obtained by a gravity based destabilization, *i.e.* with an immobile aqueous droplet growing in oil. Using Tate’s law [@tate1864], one expects $R_d^{max} \approx (\frac{3\gamma_{ow}R_0}{2(\rho_w - \rho_o)g})^{1/3} =$ 1.3 mm, with $\rho_{w}$ (*resp.* $\rho_o$) the mass density of water (*resp.* oil). This compares well to our measured value of 1.3 $\pm$ 0.01 mm. The capillary trap method presented in this Letter is therefore efficient to produce small droplets, since $R_d^{max}\approx7 R_d^*$.\
We have also investigated if the size of the droplet depended on the extraction velocity, by forming droplets at different $v$, in the range \[0.1–5\] mm/s but keeping $QT$ constant. In practice, we kept $\Delta z$ and $T_0$ constant and adapted the value of $Q$ accordingly. The corresponding radii $R_d$ are plotted as a function of $v$ in Fig. 2b and show that $R_d$ does not depend on $v$. As a consequence, the frequency of the droplet production can be tuned by orders of magnitude, from about 10 mHz to 1 Hz in our case.
![\[f3\] (a) Phase diagram of the averaged droplet radius $R_d$ as a function of the capillary radius $R_0$. Open (*resp.* cross) symbols corresponds to experiments performed using volume flow rate (resp. hydrostatic pressure) control. The $+$ and $\circ$ (resp. $\times$ and $\triangle$) symbols corresponds to experiments performed at \[SDS\] = 8 mM concentration (*resp.* Span 80 w/w = 2%). The solid (*resp.* dashed) red line is the prediction of the model using $\gamma_{ao}$=36 (*resp.* 18) mN/m. The green (*resp.* red) shaded area corresponds to stable (*resp.* unaccessible) droplet production. (b) The two states of a droplet in the capillary trap. The pending droplet is composed of a spherical cap of radius $R$ and a paraboloid of revolution, starting from the oil/air free surface at $z=0$ to the capillary tip at $z=Z$. ](Fig3){width="50.00000%"}
In a second set of experiments, we have investigated how the size of the droplets depends on $R_0$. On the one hand, we performed these experiments with the \[SDS\]=8 mM solution in silicon oil, and on the other hand, with the pure water in Span 80/Hexadecane mixture. Both systems have similar oil/water surface tension ($\gamma_{ow}\approx $ 10 mN/m [@kanellopoulos; @Span]). These experiments are performed by either controlling $Q$ or using the hydrostatic pressure to impose the flow. We make sure that the droplet production is stable and only consider experiments for which at least 100 droplets can be produced, with one per cycle. We plot on Fig. 3a the average droplets radii as a function of $R_0$. In this representation, $R_d^*$ is given at a constant $R_0$ by the lowest value in the set of points. Over the whole range of $R_0$’s we obtain $R_d^* \in [R_0-3R_0]$. For the largest $R_0$=700 $\mu$m, we observe that $R_d^*\approx R_0$. This is likely due to the fact that the size of the droplet approaches $R_d^{max}\sim 1.9$ mm for which gravity effects participate in destabilizing the droplet.\
We have identified a simple quasi-static mechanism to produce aqueous microdroplets in oil. We have established that its physical origin is purely capillary, with no $v$ dependent viscous effects. This is expected since the capillary numbers of the problem $\frac{\eta v}{\gamma}$ and $\frac{\eta Q}{\pi R_0^2 \gamma}$ are very small in the explored $v$ and $Q$ ranges. Since the only length scale of the problem is $R_0$, one expects $R_d^*\sim R_0$. To go beyond this scaling argument, we modeled the capillary trap as follows. When fully immersed in oil the pending drop is a spherical cap of radius $R$ attached at the capillary tip. When the capillary tip overpasses the oil/air interface (that defines $z=0$), the aqueous droplet is deformed (Fig. 3b). We postulate that the droplet shape is the union of a spherical cap of radius $R$ and a paraboloid of revolution (radius $\rho(z)\in [R_0-R]$, with $\rho(Z)=R_0$ at the capillary tip). We impose the continuity of the curvature at the cap/paraboloid junction. Considering the smallest unstable droplet, the cap/paraboloid junction has to be located at the sphere equator since it maximizes the droplet surface, which yields $\rho(z)=R+(R_0-R)z^2/Z^2$. For a given droplet of size $R$, volume conservation imposes that $Z/R_0= 10 r^3/(3+4r+8r^2)$ with $r=R/R_0$. Since $r>1$, $Z/R_0\approx 5r/4-5/8$ [@Note]. We then deduce the total area of the deformed droplet $A_{tot}$. Close to detachment, fast imaging of the process (using laser sheet fluorescence imaging [@SupMat]) suggests that a thin film of oil persists and surrounds the droplet. We therefore hypothesize that the oil/air interface follows the paraboloid shape of the aqueous droplet (Fig. 3b, left panel). The model thus neglects the oil meniscus due to the wetting of the glass capillary by the oil phase. Within this geometrical description we can compute the surface free energy in the pending attached state $$F_{a} = A_{tot} \gamma_{ow} + A_{p} \gamma_{ao}$$ where $A_{p}$ is the paraboloidal part of the droplet area. This energy $F_{att}$ has to be compared to the detached configuration. If the pending droplet is cut at the capillary tip extremity, we produce a detached droplet whose radius $R_d\approx R$ [@Note] is simply set by volume conservation. By doing so, we restore an oil/air interface of typical area $\pi R^2 $ and also create an air/water interface at the capillary tip. We therefore write the free energy in the detached state as $$F_{d} = 4\pi R_d^2 \gamma_{ow} + \pi R_0^2 \gamma_{aw} + \pi R^2 \gamma_{ao}$$ Equating Eqs. (1) and (2), yields $$R_d^* = \frac{R_0}{2} \left(\frac{5\gamma_{ao}+12 \gamma_{aw}+5\gamma_{ow}}{ 2\gamma_{ao}-\gamma_{ow} }\right)^{1/2}$$
![\[f3\] Minimum radius $R_d^*$ (each point is an average over 200 droplets) as a function of the SDS concentration, for a 197 $\mu$m diameter capillary. For each concentration, the experiment is repeated three times (different symbols) using freshly prepared SDS solutions. The solid (*resp.* dashed) line is the model prediction with $\gamma_{ao}$ = 36 mN/m (*resp.* $\gamma_{ao}$=18 mN/m). ](Fig4){width="45.00000%"}
We plot on Fig. 3a the predicted values of $R_d^*$ as a function of $R_0$, using $\gamma_{ow}=11.7$ mN/m [@kanellopoulos] and $\gamma_{aw}=35.9$ mN/m [@xu17]. We computed $R_d^*$ for $\gamma_{ao}$ in the range \[18–36\] mN/m, yielding $R_d^*/R_0$ between 2.44 and 1.67, which is in reasonable agreement with the experimental data.\
To further check the validity of our model, we explored the dependence of $R_d^*$ on $\gamma_{ow}$ and $\gamma_{aw}$, by varying the SDS concentration. The results of the experiments ($d$=197 $\mu$m) are presented in Fig. 4, where we plot $R_d^*$ as a function of the SDS concentration. The variation of $R_d^*$ is moderate, increasing of about a factor 1.6 from \[SDS\]=8 mM to \[SDS\]=0. As mentioned above, the size measurements close to the instability threshold at $R_d^*$ exhibit stronger fluctuations, which may explain the scattering of the data. The model is derived at each \[SDS\] concentration using $ \gamma_{ow}$ and $\gamma_{aw} $ deduced from [@kanellopoulos] and [@xu17]. The model captures the slow decrease of $R_d^*$ when the surface tensions $\gamma_{ow}$ and $\gamma_{aw}$ are decreased, as \[SDS\] increases. At higher $\gamma_{ow}$, Eq. (3) predicts a divergence of $R_d^*$ at $\gamma_{ow}=2\gamma_{ao}$. We indeed observe a sharper increase of $R_d^*$ at low \[SDS\]. The best comparison to our data (Fig. 4) is however obtained with $\gamma_{ao}=36$ mN/m instead of 18 mN/m as measured independently (not shown). Since we neglect in our model the oil meniscus wetting the glass capillary, the oil/air interface area is clearly underestimated. Taking this point into account should lower the predicted value of $R_d^*$ and may explain this discrepancy with the data. Establishing more precise scaling laws of $R_d^*$ requires additional experimental and theoretical investigations and are beyond the scope of the present Letter.\
Altogether, our method offers an easy to implement system to produce microdroplets, when low frequencies ($<$1 Hz) are required. It offers an independent control of the size (through the injected volume $QT$) and of the emission frequency. The method is versatile and was found to work with ionic and non ionic surfactants, phospholipids (not shown) and even without any surfactant. We think this method could be particularly interesting in the field of chemical/biological encapsulation, for which precise volume and content control as well as kinetics may be crucial. This method is also very simple to set up and does not require any particular technical facilities [@SupMat]. To increase the emission frequency, parallel droplet production will be implemented. In principle this method should be feasible at smaller scale and could be used to produce droplets size of about 1 $\mu$m.
We thank Yannick Rondelez, Olivier Dauchot and Raphaël Voituriez for fruitful discussions, Laurence Talini for surface tension measurements as well as Gaelle el Asmar and Ibra Ndiaye for their help during the experiments.
[22]{}ifxundefined \[1\][ ifx[\#1]{} ]{}ifnum \[1\][ \#1firstoftwo secondoftwo ]{}ifx \[1\][ \#1firstoftwo secondoftwo ]{}““\#1””@noop \[0\][secondoftwo]{}sanitize@url \[0\][‘\
12‘\$12 ‘&12‘\#12‘12‘\_12‘%12]{}@startlink\[1\]@endlink\[0\]@bib@innerbibempty @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} [****, ()](\doibase 10.1073/pnas.1113324109) [****, ()](\doibase 10.1073/pnas.0910781107) @noop [****, ()]{} @noop [****, ()]{} [****, ()](\doibase http://dx.doi.org/10.1016/S0301-4622(99)00082-4) [****, ()](\doibase 10.1038/nprot.2013.061) [****, ()](\doibase 10.1039/B710060B) @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} [****, ()](\doibase 10.1126/science.1229495) [ ()](\doibase
10.1039/C7MB00192D) @noop [ ]{} @noop [****, ()]{} @noop [****, ()]{} “,” in @noop [**]{} (, , ) pp. @noop [ ]{} @noop [****, ()]{}
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Driven by the digitalization in the consumer video and photo market as well as by the increasing capacity of re-writable storage devices such as hard discs and DVD, the problem of digital asset management drifts from the professional to the consumer market.
One of the challenges of video and photo asset management is to gather semantic information from the media in order to allow for easy data access. In the professional market, first products propose semantic access.
This invention addresses the problem of semantic access to personal video and photo assets for the consumer market.
Known consumer tools for image browsing are usually based on available metadata such as date of digitalization and film number, or based on manually added keywords and annotations such as source/author or place/time. The first type of metadata allows only for poor browsing capabilities while the second type of metadata needs to be inserted manually and the resulting browsing capabilities depend heavily on metadata quality and quantity.
One solution to raise the performance of consumer tools for image browsing is to add automatically identified semantic elements such as “persons”, “indoor scene” or “mountains” as known from very recent professional tools. But such a core solution is not adapted to inexperienced users of consumer electronic products. In this market, image access is not always guided by a clear objective or a predefined workflow. A professional user may look precisely for an image of a person in an indoor scene, while an inexperienced user may look initially for the photo of a person and, after having seen the photos of some persons, may look for mountain images because these persons recall him the memory of a mountain trip. Like “zapping” for TV watching, the user perceives video and photo browsing as divertissement. Initial browsing objectives are changed while browsing.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Spy Season 1 Episodes...
Legendary Israeli spy Eli Cohen manages to embed himself in Syrian high society and rise through the ranks of the Syrian regime, but is forced to pay an immense sacrifice that has had lasting consequences in Middle East politics to this day.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Which provision in C99 forbids definition of a function through typedef?
I know that a function definition can't be done through typedef.
For example:
typedef int f_t(int x, int y);
f_t fsum
{
int sum;
sum = x + y;
return sum;
}
But I can't find the provision which forbids this definition in C99. Which provisions are related and how they forbid this definition?
A:
This is immediately given in the clause describing function definitions:
6.9.1 Function definitions
Constraints
2 - The identifier declared in a function definition (which is the name of the function) shall have a function type, as specified by the declarator portion of the function definition.141)
141) The intent is that the type category in a function definition cannot be inherited from a typedef [...]
The way this works is that under declarators (6.7.5), the only function declarators (6.7.5.3) are those with parentheses after the identifier:
T D( parameter-type-list )
T D( identifier-listopt )
So, if the function is defined via a typedef then it does not have the syntactic form of a function declarator and so is invalid by 6.9.1p2.
It may help to consider the syntactic breakdown of an attempted typedef function definition:
typedef int F(void);
F f {}
| | ^^-- compound-statement
| ^-- declarator
^-- declaration-specifiers
Note that the typedef type F is part of the declaration-specifiers and not part of the declarator, and so f (the declarator portion) does not have a function type.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Tag: PC Gaming
My Dragon Age II review has been submitted to Machinima, but I wanted to take some space to discuss the game with all of you. I also wanted to post random (and sometimes stupid) observations that…
Welcome to Coffee Talk! Let’s start off the day by discussing whatever is on your (nerd chic) mind. Every morning I’ll kick off a discussion and I’m counting on you to participate in it. If you’re not feelin’ my topic, feel free to start a chat with your fellow readers and see where it takes you. Whether you’re talking about videogames, Sony possibly getting GeoHotz’s PayPal records, the Verizon Thunderbolt going on sale today, or the Chicago Bulls chances of winning a championship, Coffee Talk is the place to do it.
My Dragon Age II review has been submitted to Machinima, but I wanted to take some space to discuss the game with all of you. I also wanted to post random (and sometimes stupid) observations that were not appropriate for a proper review. So let’s get to it! Here are a bunch of scattered thoughts on Dragon Age II. Spoilers ahead!!!
– I fought the temptation to name my character Ethan. This would have made him Ethan Hawke. In my head, people in Thedas would constantly ask him, “What was it like boning Uma Thurman?” Instead, my rogue was named RPad Hawke and my warrior was named Raymond Hawke. I’m planning to play as a female mage for my third run. I’ll most likely name her Ether Hawke, which plays on Ethan Hawk and is a tribute to dear friend.
– A lot fanboys have complained about the game’s story, saying that it’s too small. I think those people are idiots. Certainly this chapter of Dragon Age is more focused and centers on Hawke’s adventure in Kirkwall. Taking away some of the freedom of the original allowed for tighter storytelling. Furthermore, this focused tale has expanded the world of Dragon Age. It’s obvious that something bigger is in the works. Flemeth is on the loose. The conflict between mages and templars is worse than ever. The chantry is searching for the Hero of Ferelden (Dragon Age: Origins) and the Champion of Kirkwall (Dragon Age II). I’m expecting something grand when it all comes together. Hopefully there’s room for the Scourge of Antiva, the Vixen of Orlais, and That Guy from Seheron.
– There are a lot of English, Irish, and Scottish accents in Kirkwall. In my head, I kept hearing WWE Sheamus. He hangs around The Hanged Man pub and threatens people by screaming, “Buy me a drink or I’ll kick you in the Kirkwalls, fella!”
– The game’s characterization is topnotch and the banter between companions is brilliant. The writers did a wonderful job at making you lust for the pirate wench (Isabela), shake your head at the innocent mage that plays with blood magic (Merrill), want to slap the ex-slave (Fenris) for being a dick, and more. The most impressive characterization was the 180 the writers did with Anders. He was fun, foppish wise-cracking sidekick in Dragon Age: Origins Awakening. Although he still spouts a sharp joke every now and then, circumstances have made him darker and brooding. His actions in the game’s third act were shocking. You wouldn’t have thought that the guy you met in Awakening would be capable of doing what he did in Dragon Age II, but the writers did a fine job and making it believable.
– There are a lot of bisexual characters in Dragon Age II. Most of the companions with romance trees can be courted by male or female “Hawke” characters. I applaud BioWare for allowing numerous heterosexual and homosexual romances for different kinds of gamers. It’s modern and progressive. That said, I’m a bit surprised that the company didn’t keep pushing the envelope to allow for an incest angle between the Champion and his sibling. Hell, Marvel did it in Ultimates.
– It was great seeing so many characters from the first game and Awakening. Alistair, Zevran, Leliana, Flemeth, Bodahn, Sandal, Nathaniel, and several others appearances. Some other characters are mentioned by name in the dialogue. One of my favorite lines was the bartender talking about the dwindling pigeon population in Ferelden, which was obviously the work of pigeon-stomping golem Shale from Origins. It was cool that Alistair could be a king or a drunk depending on the choices you made in the first game. It was fantastic learning about Flemeth’s contingency plan. DA2 had a lot of great nods to gamers that played the original.
– Speaking of Sandal, I think I’m going to join the growing number of Sandal conspiracy theorists. There’s something about this enchantment-inducing dwarf with a (supposed) mental disability that’s…not quite right. It’s funny how he was in the middle of the madness at Ferelden and Kirkwall. It’s funnier that when nobody is around, he can dispatch a horde of darkspawn through a method he describes as “not enchantment”. He’s off to Orlais next, so perhaps the third game takes place there…or perhaps he’s the maker, come back to the world to reshape it through a series of drastic events. Yeah. That makes the most sense.
– I honestly think all the people bitching about this game are doing it just to bitch. It’s a great RPG. I’m going to play it at least four times. I don’t do that with bad games. Yet if you believed everything you read on the Internet, this is the biggest affront to Western RPGs in the last decade. It’s not a perfect game, but I think it’s getting unfairly knocked because it’s more accessible than the original and some hardcore gamers can’t stand change. I also think it’s getting knocked because it’s from BioWare; if the same game came out and it was made by a different developer then fans and critics alike would be heaping praise on it.
Anyway, those are some random thoughts on the Dragon Age II. I’ll post my “real” review when it runs on Machinima. For now, let’s chat it up (please)!
What do you guys and gals think of missing small details in reviews? Do they ruin the review for you? Is it irrelevant since it has nothing to do with reviewer’s opinion on the game?
Welcome to Coffee Talk! Let’s start off the day by discussing whatever is on your (nerd chic) mind. Every morning I’ll kick off a discussion and I’m counting on you to participate in it. If you’re not feelin’ my topic, feel free to start a chat with your fellow readers and see where it takes you. Whether you’re talking about videogames, Rihanna’s hotness, your favorite chicken wings, or your favorite Little Rascal, Coffee Talk is the place to do it.
A couple of weeks ago, RPadholic bsukenyansent me a link to a Pokemon Black/White review. It contained a small comment that made me dismiss the review, even though it had nothing to do with the review’s quality. Check it out:
Somebody at Game Freak must love bridges because there are numerous huge bridges to cross.
Hardcore Pokemon fans know that Game Freak director Junichi Masuda is a bridge otaku. He completely lit up when I asked him about his fascination with bridges during an interview I did for G4tv.com. I don’t expect most gamers to know about Masuda’s love of bridges, but between a writer and an editor, this stupid line should never have made it to the review.
On the surface Tactics Ogre looks like any other tactical RPG (with an uncanny resemblance to Final Fantasy Tactics), with grid-based, turn-by-turn combat featuring a multitude of classes and weapons.
An uncanny resemblance to Final Fantasy Tactics?!? I don’t see what’s so uncanny about it. Before Yasumi Matsuno’s team made Final Fantasy Tactics, they made the Tactics Ogre and Ogre Battle. He directed, designed, and wrote all of those games. The art and music teams were largely the same. It’s uncanny for a small development team to make games that resemble each other? Really?!?
In both cases, the lines had nothing to do with the reviewer’s opinion on the game. As a huge fan of both series and developers, the lines made me think less of the reviewer and editor. What do you guys and gals think of missing small details in reviews? Do they ruin the review for you? Is it irrelevant since it has nothing to do with the reviewer’s opinion? Kindly share your thoughts in today’s Coffee Talk!
At SXSW 2011, Insomniac Games announced Insomniac Click, a division of the company that will focus on mobile and social games. Chief Creative Officer Brian Hastings called mobile and social gaming “a pragmatic necessity” in a recent blog post. It’s also telling that this announcement was made at SXSW instead of PAX East — a very shrewd move since the former draws a broad audience while announcing at the latter would have been preaching to choir.
Here’s more from Hastings on Insomniac Click:
Insomniac Games is proud to introduce our newest division: Insomniac Click. It is dedicated to creating new games for web and mobile platforms. Insomniac Click is an expansion of the company rather than a shift. With the exception of myself, everyone working in the group has been newly hired specifically for their expertise in this space. All our existing teams are still 100% dedicated to making unforgettable AAA console experiences with our proprietary blend of double rainbows and awesomesauce.
I’m thrilled about the move. I can’t wait to enjoy some Insomniac magic on the iPad 2 or on Facebook. Companies like Epic and id have raised the bar on mobile games, while BioWare is doing some fantastic work on Facebook. It’s fantastic that the companies we love on consoles are extending their reach to mobile and social platforms. They kind of have to…even though some people hate these platforms. Ha!
What do you think of Insomniac’s foray into the land of mobile and social gaming?
During my GDC 2011 networking (i.e. drinking and talking with people), I noticed an irrational hatred for mobile and social games. There was a small, but vocal, percentage of people I spoke with that hate…
Welcome to Coffee Talk! Let’s start off the day by discussing whatever is on your (nerd chic) mind. Every morning I’ll kick off a discussion and I’m counting on you to participate in it. If you’re not feelin’ my topic, feel free to start a chat with your fellow readers and see where it takes you. Whether you’re talking about videogames, crazy earthquakes and tsunamis, the iPad 2 launch, or legal issues derailing Floyd Mayweather’s career, Coffee Talk is the place to do it.
During my GDC 2011 networking (i.e. drinking and talking with people), I noticed an irrational hatred for mobile and social games. There was a small, but vocal, percentage of people I spoke with that hate this segment of gaming for no good reason. They were spread over a variety of jobs in the business too — developers, publishers, marketers, journalists, etc. After one fellow mentioned that he didn’t know why he hated mobile and social games, I replied, “So they’re like the X-Men? You hate and fear them for no reason?”
Don’t get me wrong, if you don’t like mobile and/or social games, that’s fine. The negative feelings I encountered were much more active than that — as if these kinds of games hurt the business or they weren’t “real” games. I really didn’t understand the sentiment. Why waste energy on actively hating mobile and social games? Isn’t it easier to focus on the games you like instead of expending negative energy? It seems silly to me.
Just to check myself, I wanted to get your thoughts on mobile and social gaming. Do you actively hate them? Do you not like them? Are you excited by the new and exciting things they bring to gaming? Or are they just kind of there and you ignore them? Share your feelings like a Care Bear and explain your stance (please)!
The Decision has been made! I’m going to hold off on playing Pokemon White. This weekend is all about Dragon Age II for me. I’ve only played a little over five hours and I’m loving it. Yes, I understand that a lot of features have been simplified in order to broaden its appeal, but I think that a lot of reviewers have blown things out of proportion. The gameplay is easier in some ways, simpler in others, but the storytelling and characterization are fantastic thus far. I’m curious to see if I’ll change my tune over the weekend.
Imagine a verbal entertainer, some game designers, and some marketing guys drunkenly talking about games during GDC 2011. The topic of the most difficult game of all time comes up. Some guys bring up…
Welcome to Coffee Talk! Let’s start off the day by discussing whatever is on your (nerd chic) mind. Every morning I’ll kick off a discussion and I’m counting on you to participate in it. If you’re not feelin’ my topic, feel free to start a chat with your fellow readers and see where it takes you. Whether you’re talking about videogames, crying with the Miami Heat, Lady Gaga dropping her Target deal because of LGBT issues, or Yemen, Coffee Talk is the place to do it.
Imagine a verbal entertainer, some game designers, and some marketing guys drunkenly talking about games during GDC 2011. The topic of the most difficult game of all time comes up. Some guys bring up Ninja Gaiden, others mention Battletoads, and a few swear that nothing tops Mega Man 9.
Pretend you were hanging out in the group. What was the most difficult game you’ve every played? Did you enjoy the brutal difficulty? Or was it just pissing you off to the point that you had to win? Any of you ever hurt your hand because of a difficult videogame?
Two of my most wanted games of 2011 are out and I’m not sure which one I want to play first. I’m going to start one and give it my full attention…but which one?!? It’s time to make a LeBron James “The Decision”…
Welcome to Coffee Talk! Let’s start off the day by discussing whatever is on your (nerd chic) mind. Every morning I’ll kick off a discussion and I’m counting on you to participate in it. If you’re not feelin’ my topic, feel free to start a chat with your fellow readers and see where it takes you. Whether you’re talking about videogames, bi-winning, Charlie Sheen conquering new media, or discovering your Nexus S is actually a limited edition model, Coffee Talk is the place to do it.
What a wonderful week for being a gamer. It’s so wonderful that I don’t know what to do. Two of my most wanted games of 2011 are out and I’m not sure which one I want to play first. In the red corner there’s Dragon Age II— the sequel to one of my favorite games this console generation and the spiritual successor to Baldur’s Gate (which I beat 18 times). In the blue corner there’s Pokemon White — the latest in a series of incredibly addictive RPGs with a ridiculously deep layer that most people don’t know about (so deep that I played Pokemon Pearl for more than 650 hours). I’m going to start one and give it my full attention…but which one?!? It’s time to make a LeBron James “The Decision” decision.
Big videogame releases overlap all the time, but I don’t remember the last time two games that I wanted this much were released in the same week. Has anything like that happened to you? Have you ever had to make a “The Decision” (I love using this term) about two of your most anticipated games? What were they? Which game won out? I can’t wait to hear your “The Decision” stories!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Cochlear implant outcomes in the elderly.
This study aimed to review cochlear implantation with respect to surgical and auditory outcomes in subjects aged 70 years and older. Retrospective chart review. Tertiary referral centers. Sixty-five patients aged 70 years or older at the time of implantation were compared to a group of patients aged <70 years. Patients underwent multichannel cochlear implantation with either the Clarion or Nucleus device. Presence or absence of surgical complications and auditory performance with open-set word and sentence recognition testing. In patients implanted at age 70 or older, significant improvement in speech understanding was demonstrated in performance scores using Consonant Nucleus Consonant words, Central Institute for the Deaf sentences, and Hearing in Noise Test sentences at 3, 6, and 12 months when compared to preimplantation scores. However, their performance was slightly poorer when compared to a control group of patients <70 years of age in the same measures at 3, 6, and 12 months. The elderly population showed significant improvement in auditory performance tests following cochlear implantation compared to their preimplantation scores but performed less well than younger patients.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A system includes a back pressure valve. The back pressure valve includes a body, a plunger disposed internal to the body, and a friction member disposed about the exterior of the body. The friction member is configured to expand radially to contact an internal surface of a bore. A method includes disposing a back pressure valve into a straight bore and expanding a friction member of the back pressure valve radially into contact with an internal surface of the straight bore.
Claim:
The invention claimed is:
1. A system, comprising: a back pressure valve, comprising: a body; a plunger disposed internal to the body; a friction member disposed about the exterior of thebody, wherein the friction member is configured to move in response to a hydraulic pressure in a hydraulic cavity, the friction member is configured to expand radially from a radially contracted position to a radially expanded position to contact aninternal surface of a straight bore to secure the back pressure valve in the straight bore, and the friction member is configured to contract radially from the radially expanded position to the radially contracted position to disengage the internalsurface of the straight bore to release the back pressure valve from the straight bore; and a lock member configured to lock the friction member in the radially expanded position, wherein the back pressure valve is configured to be retrieved from thestraight bore after releasing the lock member and contracting the friction member from the radially expanded position to the radially contracted position.
2. The system of claim 1, comprising the straight bore, wherein the friction member is radially expanded in the straight bore.
3. The system of claim 1, wherein the body comprises a recess and the friction member is disposed in the recess.
4. The system of claim 3, wherein the recess comprises a tapered face angled relative to a longitudinal axis of the back pressure valve and the friction member comprises a complementary tapered face.
5. The system of claim 4, wherein the friction member is configured to expand radially in response to movement along the recess in a direction generally along the longitudinal axis of the back pressure valve.
6. The system of claim 1, wherein the friction member comprises a plurality of segments.
7. The system of claim 1, wherein the friction member comprises a C-ring.
8. The system of claim 1, comprising an outer sleeve disposed about the exterior of the body, wherein the outer sleeve is configured to move along a longitudinal axis of the back pressure valve to move the friction member between the radiallycontracted position and the radially expanded position.
9. The system of claim 8, wherein the outer sleeve is configured to move in response to the hydraulic pressure in the hydraulic cavity between the outer sleeve and the body.
10. The system of claim 8, comprising a seal disposed about the exterior of the body, wherein the outer sleeve is configured to move along the longitudinal axis of the back pressure valve to move the seal between an unseated position and aseated position relative to the internal surface of the bore.
11. The system of claim 10, wherein the outer sleeve comprises a window, the friction member is configured to move radially within the window, the seal is disposed on a first axial side of the window, and the lock member is disposed on a secondaxial side of the window opposite from the first axial side.
12. The system of claim 11, wherein the outer sleeve is configured to move in response to a hydraulic pressure in a hydraulic cavity between the outer sleeve and the body, the lock member is coupled to the body via mating threads, the lockmember is configured to rotate along the mating threads to bias the outer sleeve axially toward the friction member to hold the friction member in the radially expanded position, and the lock member is configured to rotate along the mating threads toenable the outer sleeve to move axially away from the friction member to enable the friction member to move to the radially contracted position.
13. The system of claim 8, wherein the lock member comprises a locking ring configured to rotate about the longitudinal axis between a locked position and an unlocked position, the locked position of the locking ring corresponds to the radiallyexpanded position of the friction member, and the unlocked position of the locking ring corresponds to the radially contracted position of the friction member.
14. The system of claim 13, wherein the locking ring is coupled to the body via mating threads, and the locking ring is coupled to the outer sleeve via at least one shear pin.
15. The system of claim 1, wherein the back pressure valve is coupled to a Christmas tree, a wellhead, or a combination thereof.
16. A system, comprising: a back pressure valve, comprising: a body comprising a plunger bore through an interior of the body and a recess about an exterior of the body, wherein the recess comprises a tapered external face angled relative to alongitudinal axis of the back pressure valve; a plunger disposed in the plunger bore, wherein the plunger is spring-loaded by a spring, and the plunger is configured to move in response to fluid pressure overcoming a spring bias of the spring; afriction member disposed in the recess, wherein the friction member comprises a complementary tapered internal face that abuts the tapered external face and an external friction face, wherein the friction member is configured to move between a radiallyexpanded position having the external friction face engaged with a straight bore and a radially contracted position having the external friction face disengaged from the straight bore; and a lock member configured to lock the friction member in theradially expanded position to secure the back pressure valve within the straight bore, wherein the back pressure valve is configured to be retrieved from the straight bore after releasing the lock member and contracting the friction member from theradially expanded position to the radially contracted position.
17. The system of claim 16, wherein the back pressure valve comprises: a seal disposed about the exterior of the body; and a sleeve disposed about the longitudinal axis, wherein the sleeve is configured to move along the longitudinal axis tomove the friction member between the radially contracted position and the radially expanded position, and the sleeve is configured to move along the longitudinal axis to move the seal between an unseated position and a seated position.
18. The system of claim 17, wherein the sleeve comprises a window, the friction member is configured to move radially within the window, and the sleeve is a one-piece structure.
19. The system of claim 16, wherein the external friction face comprises a coating.
20. The system of claim 19, wherein the coating comprises a composite material.
21. The system of claim 19, wherein the coating has a coating hardness less than a surface hardness of the straight bore.
22. The system of claim 16, wherein the back pressure valve is coupled to a Christmas tree, a wellhead, or a combination thereof.
23. The system of claim 16, wherein the external friction face comprises a straight cylindrical surface having a coarse surface finish.
24. A system, comprising: a back pressure valve, comprising: a body comprising a central bore and an external groove and a hydraulic port, wherein the external groove comprises a tapered external face; a friction member disposed in theexternal groove, wherein the friction member comprises: a tapered internal face that is complementary to the tapered external face; an external friction ring face; an upper friction ring face, and a lower friction ring face; an outer sleeve disposedabout the exterior of the body and between the locking ring and the friction member, and comprising a window disposed on two sides of the friction member; a plunger disposed in the central bore of the body; a locking ring comprising a slot and disposedabout the exterior of the body; and a back pressure valve running tool, comprising: a first body portion, comprising: a stem that protrudes along a longitudinal axis of the first body portion; a complementary hydraulic port that passes through thefirst body portion and that is configured to align with the hydraulic port of the body of the back pressure valve; a check valve disposed in the hydraulic port; a shoulder configured to transfer a load parallel to the longitudinal axis of the firstbody portion; and slots configured to transfer between the first body portion and internal protrusions of a second body portion a rotational torque about the longitudinal axis of the first body portion; and the second body portion comprising theinternal protrusions and external protrusions configured to transfer a rotational torque to the slot of the locking ring of the back pressure valve.
25. The system of claim 24, wherein the friction member is configured to expand radially to secure the back pressure valve to a bore, and the friction member is configured to contract radially to release the back pressure valve from the bore toenable retrieval of the back pressure valve from the bore, wherein the outer sleeve is configured to move in response to a hydraulic pressure from the hydraulic port, wherein the locking ring is configured to selectively hold the outer sleeve.
26. The system of claim 24, wherein the back pressure valve is coupled to a Christmas tree, a wellhead, or a combination thereof.
27. A system, comprising: a back pressure valve, comprising: a body comprising a recess about an exterior of the body, wherein the recess comprises an tapered external face angled relative to a longitudinal axis of the back pressure valve; afriction member disposed in the recess, wherein the friction member comprises a complementary tapered internal face that abuts the tapered external face, and an external friction face of the friction member comprises a coarse texture, wherein thefriction member is configured to move between a radially expanded position having the coarse texture engaged with a bore and a radially contracted position having the coarse texture disengaged from the bore; and a lock member configured to lock thefriction member in the radially expanded position to secure the back pressure valve within the bore, wherein the back pressure valve is configured to be retrieved from the bore after releasing the lock member and contracting the friction member from theradially expanded position to the radially contracted position; wherein the back pressure valve is coupled to a Christmas tree, a wellhead, or a combination thereof.
28. The system of claim 27, wherein the coarse texture comprises a coarse surface finish disposed on a straight cylindrical surface of the external friction face.
29. A system, comprising: a back pressure valve, comprising: a body; a plunger disposed internal to the body; a friction member disposed about the exterior of the body, wherein the friction member comprises a C-ring, the friction member isconfigured to expand radially from a radially contracted position to a radially expanded position to contact an internal surface of a straight bore to secure the back pressure valve in the straight bore, and the friction member is configured to contractradially from the radially expanded position to the radially contracted position to disengage the internal surface of the straight bore to release the back pressure valve from the straight bore; and a lock member configured to lock the friction memberin the radially expanded position, wherein the back pressure valve is configured to be retrieved from the straight bore after releasing the lock member and contracting the friction member from the radially expanded position to the radially contractedposition.
30. A system, comprising: a back pressure valve, comprising: a body; a plunger disposed internal to the body; a friction member disposed about the exterior of the body, wherein the friction member is configured to expand radially from aradially contracted position to a radially expanded position to contact an internal surface of a straight bore to secure the back pressure valve in the straight bore, and the friction member is configured to contract radially from the radially expandedposition to the radially contracted position to disengage the internal surface of the straight bore to release the back pressure valve from the straight bore; an outer sleeve disposed about the exterior of the body, wherein the outer sleeve isconfigured to move along a longitudinal axis of the back pressure valve to move the friction member between the radially contracted position and the radially expanded position; and a lock member configured to lock the friction member in the radiallyexpanded position, wherein the back pressure valve is configured to be retrieved from the straight bore after releasing the lock member and contracting the friction member from the radially expanded position to the radially contracted position.
31. A system, comprising: a back pressure valve, comprising: a body comprising a recess about an exterior of the body, wherein the recess comprises a tapered external face angled relative to a longitudinal axis of the back pressure valve; afriction member disposed in the recess, wherein the friction member comprises a complementary tapered internal face that abuts the tapered external face, and an external friction face of the friction member comprises a coating, wherein the frictionmember is configured to move between a radially expanded position having the coating engaged with a straight bore and a radially contracted position having the coating disengaged from the straight bore; and a lock member configured to lock the frictionmember in the radially expanded position to secure the back pressure valve within the straight bore, wherein the back pressure valve is configured to be retrieved from the straight bore after releasing the lock member and contracting the friction memberfrom the radially expanded position to the radially contracted position.
32. The system of claim 31, wherein the external friction face comprises a coarse texture having the coating.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to PCT Application No. PCT/US2009/037731 entitled "Straight-Bore Back Pressure Valve", filed on Mar. 19, 2009, which is herein incorporated by reference in its entirety, and which claims priority to U.S. Provisional Patent Application No. 61/043,580, entitled "Straight-Bore Back Pressure Valve", filed on Apr. 9, 2008, which is herein incorporated by reference in its entirety.
BACKGROUND
This section is intended to introduce the reader to various aspects of art that may be related to various aspects of the present invention, which are described and/or claimed below. This discussion is believed to be helpful in providing thereader with background information to facilitate a better understanding of the various aspects of the present invention. Accordingly, it should be understood that these statements are to be read in this light, and not as admissions of prior art.
As will be appreciated, oil and natural gas have a profound effect on modern economies and societies. In order to meet the demand for such natural resources, numerous companies invest significant amounts of time and money in searching for andextracting oil, natural gas, and other subterranean resources from the earth. Particularly, once a desired resource is discovered below the surface of the earth, drilling and production systems are employed to access and extract the resource. Thesesystems can be located onshore or offshore depending on the location of a desired resource. Further, such systems generally include a wellhead assembly that is used to extract the resource. These wellhead assemblies include a wide variety of componentsand/or conduits, such as various control lines, casings, valves, and the like, that are conducive to drilling and/or extraction operations. In drilling and extraction operations, in addition to wellheads, various components and tools are employed toprovide for drilling, completion, and the production of mineral resources. For instance, during drilling and extraction operations seals and valves are often employed to regulate pressures and/or fluid flow.
A wellhead system often includes a tubing hanger or casing hanger that is disposed within the wellhead assembly and configured to secure tubing and casing suspended in the well bore. In addition, the hanger generally regulates pressures andprovides a path for hydraulic control fluid, chemical injections, or the like to be passed through the wellhead and into the well bore. In such a system, a back pressure valve is often disposed in the hanger bore and/or a similar bore of the wellhead. The back pressure valve plugs the bore to block pressures of the well bore from manifesting through the wellhead.
Typically, the back pressure valve is provided separately from the hanger, and is installed after the hanger has been landed in the wellhead assembly. In other words, the hanger is run down to the wellhead, followed by the installation of theback pressure valve. One resulting challenge includes installing the back pressure valve into the hanger bore in context of high pressures in the bore. Accordingly, installation of the back pressure valve may include the use of several tools and asequence of procedures to set and lock the seal. Unfortunately, each of the sequential running procedures may consume a significant amount of time and money. Further, securing the back pressure valve generally includes complementary engagement featuresin the bore itself. The bore typically includes shoulders, grooves, notches, or similar features that are engaged by portions of the back pressure valve. Thus, the design of the bore is configured to accommodate a specific back pressure valve design. Typically, the back pressure valve and bore are designed specifically for use with one another, thereby, adding yet another level of complexity to the overall design of the wellhead.
BRIEF DESCRIPTION OF THE DRAWINGS
Various features, aspects, and advantages of the present invention will become better understood when the following detailed description is read with reference to the accompanying figures in which like characters represent like parts throughoutthe figures, wherein:
FIG. 1 is a block diagram that illustrates a mineral extraction system in accordance with an embodiment of the present technique;
FIG. 2 is a block diagram that illustrates a back pressure valve in accordance with an embodiment of the present technique;
FIG. 3 is an exploded cross-sectioned view of a back pressure valve system in accordance with an embodiment of the present technique; and
FIG. 4A-4E are cross-sectioned views of the back pressure valve system in accordance with embodiments of the present technique.
DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS
One or more specific embodiments of the present invention will be described below. These described embodiments are only exemplary of the present invention. Additionally, in an effort to provide a concise description of these exemplaryembodiments, all features of an actual implementation may not be described in the specification. It should be appreciated that in the development of any such actual implementation, as in any engineering or design project, numerousimplementation-specific decisions must be made to achieve the developers' specific goals, such as compliance with system-related and business-related constraints, which may vary from one implementation to another. Moreover, it should be appreciated thatsuch a development effort might be complex and time consuming, but would nevertheless be a routine undertaking of design, fabrication, and manufacture for those of ordinary skill having the benefit of this disclosure.
When introducing elements of various embodiments of the present invention, the articles "a," "an," "the," and "said" are intended to mean that there are one or more of the elements. The terms "comprising," "including," and "having" are intendedto be inclusive and mean that there may be additional elements other than the listed elements. Moreover, the use of "top," "bottom," "above," "below," and variations of these terms is made for convenience, but does not require any particular orientationof the components.
Certain exemplary embodiments of the present technique include a system and method that each addresses one or more of the above-mentioned inadequacies of conventional sealing systems and methods. As explained in greater detail below, thedisclosed embodiments include a back pressure valve that can be installed into a straight bore. More specifically, the back pressure valve is installed into a portion of a bore that does not include engagement features to secure the back pressure valvein the bore. Accordingly, the back pressure valve is secured against the generally smooth/flat walls of the bore, as opposed to grooves, shoulders, or similar features that are typically employed to secure a back pressure valve, or a similar valve, in abore. As a result, the exemplary back pressure valve may be inserted into a large variety of tubing hangers with varying bore profiles. In certain embodiments, the back pressure valve includes a friction member that is expanded radially to secure theback pressure valve into the bore. In some embodiments, the friction member is moved longitudinally via hydraulic pressure exerted on an outer sleeve, and/or secured in a locked position via a locking ring that is rotated into position to block theouter sleeve in position when the hydraulic pressure is reduced. Before discussing embodiments of the system in detail, it may be beneficial to discuss a system that may employ such a back pressure valve.
FIG. 1 is a block diagram that illustrates a mineral extraction system 10 including a back pressure valve (BPV) 12 in accordance with embodiments of the present technique. The illustrated mineral extraction system 10 can be configured toextract various minerals and natural resources, including hydrocarbons (e.g., oil and/or natural gas), or configured to inject substances into the earth. In some embodiments, the mineral extraction system 10 is land-based (e.g., a surface system) orsubsea (e.g., a subsea system). In the illustrated embodiment, the system 10 includes a wellhead 13 coupled to a mineral deposit 14 via a well 16, wherein the well 16 includes a wellhead hub 18 and a well-bore 20.
The wellhead hub 18 generally includes a large diameter hub that is disposed at the termination of the well bore 20. The wellhead hub 18 provides for the connection of the wellhead 13 to the well 16. In some embodiments, the wellhead 13includes a connector that is coupled to a complementary connector of the wellhead hub 18. For example, in one embodiment, the wellhead hub 18 includes a DWHC (Deep Water High Capacity) hub manufactured by Cameron, headquartered in Houston, Tex., and thewellhead 13 includes a complementary collet connector (e.g., a DWHC connector), also manufactured by Cameron.
The wellhead 13 typically includes multiple components that control and regulate activities and conditions associated with the well 16. In some embodiments, the wellhead 13 generally includes bodies, valves and seals that route producedminerals from the mineral deposit 14, provides for regulating pressure in the well 16, and provides for the injection of chemicals into the well bore 20 (down-hole). For example, in the illustrated embodiment, the wellhead 13 includes what iscolloquially referred to as a christmas tree 22 (hereinafter, a tree), a tubing spool 24, and a hanger 26 (e.g., a tubing hanger or a casing hanger). The system 10 may include other devices that are coupled to the wellhead 13, and devices that are usedto assemble and control various components of the wellhead 13. For example, in the illustrated embodiment, the system 10 includes a tool 28 suspended from a drill string 30. In certain embodiments, the tool 28 includes a running tool that is lowered(e.g., run) from an offshore vessel to the well 16 and/or the wellhead 13. In other embodiments, such as surface systems, the tool 28 may include a device suspended over and/or lowered into the wellhead 13 via a crane or other supporting device.
The tree 22 generally includes a variety of flow paths (e.g., bores), valves, fittings, and controls for operating the well 16. For instance, in some embodiments, the tree 22 includes a frame that is disposed about a tree body, a flow-loop,actuators, and valves. Further, the tree 22 generally provides fluid communication with the well 16. For example, in the illustrated embodiment, the tree 22 includes a tree bore 32. The tree bore 32 provides for completion and workover procedures,such as the insertion of tools (e.g., the hanger 26) into the well 16, the injection of various chemicals into the well 16 (down-hole), and the like. Further, minerals extracted from the well 16 (e.g., oil and natural gas) are generally regulated androuted via the tree 22. For instance, the tree 22 may be coupled to a jumper or a flowline that is tied back to other components, such as a manifold. Accordingly, in such an embodiment, produced minerals flow from the well 16 to the manifold via thewellhead 13 and/or the tree 22 before being routed to shipping or storage facilities.
The tubing spool 24 provides a base for the wellhead 24 and/or an intermediate connection between the wellhead hub 18 and the tree 22. Typically, the tubing spool 24 (also referred to as a tubing head) is one of many components in a modularsubsea or surface mineral extraction system 10 that are run from an offshore vessel and/or a surface installation system. As illustrated, the tubing spool 24 includes the tubing spool bore 34. The tubing spool bore 34 connects (e.g., enables fluidcommunication between) the tree bore 32 and the well 16. Thus, the tubing spool bore 34 provides access to the well bore 20 for various completion procedures, worker procedures, and the like. For example, components can be run down to the wellhead 13and disposed in the tubing spool bore 34 to seal-off the well bore 20, to inject chemicals down-hole, to suspend tools down-hole, and/or to retrieve tools from down-hole.
As will be appreciated, the well bore 20 may contain elevated pressures. For instance, in some systems, the well bore 20 may include pressures that exceed 10,000 pounds per square inch (PSI), that exceed 15,000 PSI, and/or that even exceed20,000 PSI. Accordingly, mineral extraction systems 10 typically employ various mechanisms, such as seals, plugs and valves, to control and regulate the well 16. In some instances, plugs and valves are employed to regulate the flow and pressures offluids in various bores and channels throughout the mineral extraction system 10. The illustrated hanger 26 (e.g., tubing hanger or casing hanger), for example, is typically disposed within the wellhead 13 to secure tubing and casing suspended in thewell bore 20, and to provide a path for hydraulic control fluid, chemical injections, and the like. The hanger 26 includes a hanger bore 38 that extends through the center of the hanger 26, and that is in fluid communication with the tubing spool bore34 and the well bore 20. Unfortunately, if left unregulated, pressures in the bores 20 and 34 can manifest through the wellhead 13. Accordingly, the back pressure valve (BPV) 12 is often seated and locked in the hanger bore 38 to regulate the pressure. Valves similar to the illustrated back pressure valve 12 can be used throughout the mineral extraction system 10 to regulate fluid and/or gas pressures and flow paths.
In the context of the hanger 26, the back pressure valve 12 can be installed into the hanger 26, or a similar location, before the hanger 26 is installed in the wellhead 13, or may be installed into the hanger 26 after the hanger 26 has beeninstalled in the wellhead 13 (e.g., landed in the tubing spool bore 34). In the latter case, the hanger 26 is typically run down and installed into the subsea wellhead 13 (or a similar surface wellhead), followed by the installation of the back pressurevalve 12. During installation of the back pressure valve 12, pressure in the well bore 20 may exert a force (e.g., a backpressure) on the lower portion of the back pressure valve 12. Unfortunately, the backpressure may increase the difficulty ofinstalling the back pressure valve 12. For example, the backpressure may resist the installation of the back pressure valve 12. Although typical embodiments of the hanger bore 38 include shoulders, grooves, notches, or similar features that are engagedby portions of the back pressure valve 12, in embodiments of the system 10, the back pressure valve 12 is disposed in a portion of the hanger bore 38 that is a straight bore. Accordingly, the system and methods discussed in greater detail below providea system and method including disposing the back pressure valve 12 in the straight hanger bore 38, and/or a similar straight bore (e.g., a tubing or casing pipe bore).
FIG. 2 is a block diagram that illustrates an embodiment of the back pressure valve (BPV) 12 disposed in a bore 40 in accordance with embodiments of the present techniques. In the illustrated embodiment, the BPV 12 includes a body 42, afriction member 44, an outer sleeve 46, a lock ring 48, a plunger 50, and a seal 52.
The bore 40 includes a straight bore (e.g., a full-bore). A straight bore can be defined as a bore having an internal diameter including generally constant or uniform surfaces that do not include engagement/retention features such as shoulders,grooves, notches, or the like. For example, in some embodiments, the internal surface of the bore includes straight or flat walls that are generally parallel to a longitudinal axis of the bore. In some embodiments, the bore 40 includes a generallycylindrical bore formed from casing, tubing, or a bore internal to the system 10, such as the hanger bore 38. For example, in one embodiment, the bore 40 includes the hanger bore 38, or a similar bore (e.g., a tubing or casing pipe bore), having agenerally consistent internal diameter along its length.
Further, in one embodiment the bore 40 is straight along its entire length, whereas in other embodiment, the bore 40 is straight along some portion but not all of its length. For example, the bore 40 is straight at least in the portion of thebore 40 where the BPV 12 is seated, in one embodiment. In such an embodiment, other portions of the bore 40 may include engagement features that are configured for securing other valves and tools, for instance.
The surface of the bore 40 generally does not include any significant physical features or preparation, in some embodiments. For example, in one embodiment, the bore 40 includes a smooth unfinished surface. This includes the standard finish ofthe body that forms the bore 40, such as, for example, the interior of the casing, the tubing, and the hanger bore 38. However, in other embodiments, the internal surface of the bore 40 includes a modified surface. In other words, the internal surfaceof the bore 40 includes some form of preparation of the surface, but still does not include engagement/retention features, such as shoulders, grooves, notches, or the like. In one embodiment, the modified surface includes a scored surface, or otherwisecoarse finish to encourage friction (e.g., increase the coefficient of friction) between the internal surface of the bore 40 and complementary features of the BPV 12. In another embodiment, the modified surface includes polishing, smoothing, orotherwise preparing the surface for contact with the back pressure valve 12.
In the illustrated embodiment, the bore 40 includes a longitudinal axis 54 running the length of the bore 40. In operation, the BPV 12 is located along the longitudinal axis 54 and regulates pressures between an upper bore portion 56 and alower bore portion 58. The upper bore portion (e.g., a downstream and bore portion) 56 includes a portion of the bore 40 toward an upper end of the wellhead 13 and the lower bore portion (e.g., a downstream bore portion) 58 includes a portion of thebore 40 that is on an opposite end of the well-head 13. For example, the lower bore portion 58 includes an end exposed and/or in the direction of the well-bore 20 and/or the mineral deposit 14, in certain embodiments.
The body 42 of the BPV 12 includes an upper end 60 (e.g., downstream end), a lower end 62 (e.g., upstream end), a plunger bore 64, and a recess 66. The upper end 60 of the body 42 generally is exposed to and faces the upper bore portion 56 wheninstalled. Similarly, the lower end 62 of the body generally is exposed to and faces the lower bore portion 58. Accordingly, when installed, the lower end of the BPV 12 is exposed to the pressures associated with the lower bore portion 58. Thesepressures typically include pressures from the well bore 20, the mineral deposit 14, fluids and gases injected down-hole and the like. The pressures generally act on the lower end 62 in the direction of the arrows 68 (e.g., toward the upper bore portion56).
The plunger bore 64 includes a bore that extends through the length of the body 42 of the BPV 12. The plunger bore 64 generally includes a path for the regulation of pressure between the upper bore portion 56 and the lower bore portion 58. Forexample, when opened (e.g., not occluded) fluids and gases on either side of the BPV 12 can flow back and forth to maintain a balanced pressure between the upper bore portion 56 and the lower bore portion 58. This may be particularly useful duringinstallation and removal of the BPV 12 when the pressure is balanced to enable moving of the BPV 12 within the bore 40 and along the longitudinal axis 54 without additional loading to overcome the longitudinal forces, such as those acting on the lowerend 62 of the BPV 12. When closed (e.g., occluded) the BPV 12 generally occludes the bore to maintain a pressure differential between the upper bore portion 56 and the lower bore portion 58. More specifically, in an embodiment in which the plunger 50includes a unilateral check valve, the BPV 12 is typically configured to retain an elevated pressure in the lower bore portion 58.
As mentioned briefly above, the plunger 50 is typically employed to regulate the flow of fluids and gases through the BPV 12. More specifically, the plunger 50 includes an open position and a closed position in certain embodiments. Forexample, in one embodiment, the plunger 50 includes a sealing portion (e.g., a bell) that is configured to engage a complementary sealing surface or feature in the plunger bore 64. In a closed position, the sealing portion of the plunger 50 engages thesealing surface/feature in the plunger bore 64 to occlude the plunger bore 64. In an open position, the sealing portion of the plunger 50 is urged/located away from the sealing surface of the plunger bore 64, thereby enabling fluid and gases to passthrough the plunger bore 64. Certain embodiments of the plunger 50 and the plunger bore 64 are discussed in more detail below with regard to FIGS. 3 and 4A-4E.
The recess 66 generally includes one or more indentations in an external surface 70 of the body 42. In one embodiment, the recess 66 includes a single groove about an external surface (e.g., circumference) 70 of the body 42. In otherembodiments, the recess 66 includes one or more separate recessed sections about the external surface 70 of the body 42. In the illustrated embodiment, the recess 66 includes a groove that extends around the circumference of the body 42 and thatincludes an upper face 72, a lower face 74 and an internal face 76. The internal face 76 includes an angle (e.g., a taper) relative to the longitudinal axis 54, in the illustrated embodiment. For example, the internal face 76 includes a smallerdiameter proximate the upper face 72 and the upper end 60 of the body 42, and includes a larger diameter proximate the lower face 74 and the lower end 62 of the body 24 (e.g., a conical section of the body 42). In other words, the internal face 76includes a taper that increases in diameter from the upper face 72 to the lower face 74. Thus, the internal face 76 is oriented at an angle 78 relative to the longitudinal axis 54. As is discussed in greater detail below, the angle 78 may include anyangle suitable for expanding the friction member 44. For example, in one embodiment, the angle 78 is between about 5 degrees and 10 degrees. However, in other embodiments, the angle 78 may be greater than about 10 degrees or less than about 5 degrees. Further, a height 79 of the recess 66 is defined by the distance between the upper face 72 and the lower face 74.
The friction member 44 generally includes one or more devices that are employed to secure the BPV 12 to the bore 40. More specifically, in some embodiments, the friction member 44 includes one or more members (discussed in more detail below)that are expanded in a radial manner/direction to contact the walls of the bore 40, thereby securing the BPV 12 to the bore 40. In certain embodiments, an outer surface (e.g., friction surface) of the friction member 44 directly contacts a straightportion of the bore 40, thereby securing the BPV 12 in the bore without the aid of any engagement/retention features, such as shoulders, grooves, notches, or the like.
In the illustrated embodiment, the friction member 44 includes a friction face 80, an internal face 82, an upper face 84, and a lower face 86. The upper face 84 and lower face 86 are proximate the upper face 72 and lower face 74, respectively,of the recess 66 in the body 42. As depicted in the illustrated embodiment, a height 88 (e.g., the distance between the upper face 84 and the lower face 86) of the friction member 44 is less than the height 79 of the recess 66. Accordingly, in oneembodiment, the friction member 44 is capable of moving longitudinally (e.g., a long the longitudinal axis 54) relative to the recess 66 and the body 42 of the BPV 12.
The internal face 82 generally includes a profile that is complementary to the profile of the internal face 72 of the body 42. In the illustrated embodiment, for example, the internal face 82 of the friction member 44 includes a taper that iscomplementary to the taper (angle 78) of the internal face 76. In other words, the internal face includes a profile (taper) that increases in diameter from the upper face 84 to the lower face 86. Accordingly, in one embodiment, movement of the frictionmember 44 in a longitudinal direction (e.g., along the longitudinal axis 54) relative to the body 42 and the recess 66 causes the friction member to expand and/or contract radially. For example, in an embodiment where the friction member 44 is locatedproximate the upper face 72 of the recess 66 and urged toward the lower face 74 of the recess 66, the friction member 44 expands radially in the direction of the arrows 90. As is discussed below, the urging force to displace the friction member 44 canbe provided downward on the friction member 44 (e.g., from the outer sleeve 46) or upward on the body 42 (e.g., the pressure acting on the lower end 62 of the body 42), in certain embodiments. In one embodiment, force may be applied in the oppositedirection to urge the friction member 44 upward (e.g., toward the upper face 72 of the recess 66 and urge the friction member inward, in a direction opposite the arrows 90. Further, it will be appreciated that although the illustrated embodimentincludes urging the friction member downward (e.g., toward the lower face 74 and toward the lower bore portion 58) to expand the friction member radially, other embodiments include a similar configuration wherein urging the friction member 44 in anupward direction expands the friction member 44 radially. For example, the taper can be reversed in one embodiment such that the diameter is larger proximate the upper face 72 of the recess 66 and smaller proximate the lower face 74. In any of theembodiments, expanding the friction member 44 causes the friction face 80 of the friction member 44 to contact the internal surface of the bore 40.
The friction face 80 includes the face located on the outside of the friction member 44. Generally, the friction face 80 contacts the walls of the bore 40 when the friction member 44 is expanded in a radial direction, represented by the arrows90. In certain embodiments, the friction face 80 includes one or more surface features conducive to securing the friction member 44, and, thus, the BPV 12 to the bore 40. Generally, the friction face 80 includes a surface that provides a coefficient offriction sufficient to secure the BPV 12 in the bore 40 in light of the pressures experienced across the BPV 12. For example, in one embodiment, the friction face 80 includes a coarse finish. The coarse finish is provided by scoring, or sanding thefriction face 80, in one embodiment. In another embodiment, the coarse finish is provided by coating the friction face 80 with a composite material. For example, the friction face 80 includes a coating of a material having a hardness that is less thanthe hardness of the surface of the bore 40, in one embodiment.
In other embodiments, the surface features include indentations and/or patterns of indentations in the friction face 80. In one embodiment, the friction face 80 includes a plurality of grooves that provide localized areas of high surfacecontact forces when the friction member 44 is expanded radially against the surface of the bore 40. These localized areas of force enable the friction member 44 to bite into the interior of the bore 40. For example, in one embodiment, the indentationsform rows and/or columns of teeth.
In some embodiments, the friction face 80 includes a generally flat and/or smooth surface. For example, in one embodiment, the friction face 80 includes an unfinished or polished surface. In such an embodiment, the increased contact areabetween the friction face 80 and the surface of the bore 40 provides the friction to secure the friction member 44 and the BPV 12 to the bore 40.
The friction face 80, in some embodiments, includes any combination of the surface features discussed above. For example, in one embodiment, the friction face 80 includes teeth like features in one region, a smooth finish in other regions, anda coating over at least a portion of the regions. In another embodiment, the friction face 80 includes a combination of recesses (e.g., teeth and grooves) and a coating, for example.
Further, the friction face 80 includes a profile that is conducive to generating a friction between the friction member 44 and the bore 40. In one embodiment, the friction face 80 includes a profile that is similar to the profile of the bore40. For example, in the illustrated embodiment, the profile of the friction face 80 includes a surface that is in generally parallel to the surface of the bore 40. In other words, the surface of the friction face 80 includes at least a portion that isparallel to the longitudinal axis 54 (e.g., cylindrical exterior).
The friction member 44 is formed from one or more devices that are capable of being expanded radially, as discussed above. In some embodiments, the friction member 44 includes one or more rings, one or more segments, one or more locking dogs,or a combination thereof. For example, in one embodiment, the friction member 44 includes a C-ring that is positioned in the recess 66. In another embodiment, the C-ring includes one or more segments along its exterior that are configured to contactthe surface of the bore 40. In such embodiments, the recess 66 may include a groove that extends around circumference of the body 42. In another embodiment, the friction member 44 includes one or more locking segments that are positioned in one or morerecesses 66 about the circumferences. For example, in one embodiment, the segments are disposed about a single groove forming the recess 66. In another embodiment, the recess 66 includes a plurality of separate indentations that are configured toaccept one or more of the segments forming the friction member 44. For example, the friction member 44 is formed form several segments that are not joined to one another in one embodiment. In another embodiment, the segments are coupled to one anotherby a common member. For example, in one embodiment, the friction ring 44 includes a plurality of segments coupled to a common ring. It will be appreciated that the friction member 44 may includes any mechanism or device configured to expand radially toprovide a securing/friction force between the BPV 12 and an internal surface of the bore 40.
The outer sleeve 46 generally includes a device or mechanism that exerts a force on the friction member 44. More specifically, in certain embodiments, the outer sleeve 46 exerts a longitudinal force (e.g., a force parallel to the longitudinalaxis 54) on the friction member 44 that causes the friction member 44 to expand radially. For example, in the illustrated embodiment, urging the outer sleeve 46 in the direction of arrows 92 generates an axial load on at least a portion of the upperface 84 of the friction member 44. The axial load urges the friction member 44 in the direction of the arrows 92, thereby causing radial expansion of the friction member 44, as discussed above. Although the outer sleeve 46 is located above the frictionmember 44 in the illustrated embodiment, all or at least a portion of the outer sleeve 46 may be located below the friction member 44 in other embodiments. For example, in an embodiment where an axial load is delivered to the lower face 86 of thefriction member 44, at least a portion of the outer sleeve may be located below the friction member 44. For example, as discussed in greater detail below with regard to FIGS. 3- and 4A-4E, a portion of the outer sleeve 46 is located below the frictionmember 44 to provide a force in the direction of arrows 94 to enable the friction member 44 to contract radially. In another embodiment, for example, the embodiment in which the taper is reversed, the axial force in the direction of the arrows 94 isemployed to expand the friction member 44 radially.
The axial force provided by the outer sleeve is generated by hydraulic loading in some embodiments. For example, although not depicted in FIG. 3, as discussed in greater detail below with regard to FIGS. 3 and 4A-4E, the BPV 12 includes ahydraulic port that terminates in a chamber proximate the outer sleeve 46 such that energizing the hydraulic port and chamber exerts a force on the outer sleeve 46 in the direction of the arrows 92, thereby providing the axial loading on the frictionmember 44. Other embodiments may include similar forms of loading. For example, in one embodiment, the outer sleeve 46 is threaded to the body 42, such that rotation of the outer sleeve 46 generates the axial force in the direction of the arrows 92.
The lock ring 48 secures the position of outer sleeve 46 and, thus, the position of the friction member 44, in certain embodiments. In one embodiment, the lock ring 48 is positioned against the outer sleeve 46 to block the outer sleeve 46 frommoving upward (e.g., in the opposite direction of the arrows 92). For example, in one embodiment, the lock ring 48 is threaded to the body 42 such that rotation of the lock ring 48 urges the locking ring downward (e.g., in the direction of the arrows96), and toward the outer sleeve 46. In another embodiment, the lock ring 48 is urged into movement via a hydraulic arrangement similar to that discussed above with regard to the outer sleeve 46. Accordingly, the lock ring 48 is urged/moved along thelongitudinal axis 54 until it abuts the outer sleeve 46, thereby securing the outer sleeve 46 in a position. In one embodiment, the outer sleeve 46 is secured in a locked position (e.g., a position holding the friction member 44 in the radially expandedposition), for instance. In one embodiment, hydraulic pressure is employed to urge the outer sleeve 46 into engagement with the friction member 44. The lock ring 48 is rotated until it is proximate or abutting the outer sleeve 46, and the hydraulicpressure is released. With the hydraulic pressure is released, the outer sleeve 46 is blocked from moving a significant longitudinal distance by the lock ring 48. Thus, the friction member 44 is held in position (e.g., an expanded position) via theouter sleeve 46 and the lock ring 48.
In some embodiments, the BPV 12 includes one or more additional seals that block/regulate the pressures between the lower bore portion 58 and the upper bore portion 56. For instance, in the illustrated embodiment, the BPV 12 includes a seal 52disposed between the body 42 and the internal surface of the bore 40. In one embodiment, the seal 52 includes a mechanical (e.g., MEC) seal. In another embodiment, the seal 52 includes an elastomer seal or similar seal.
The seal 52, in some embodiments, is compressed within a region between the body 42 and the surface of the bore 40. For example, in the illustrated embodiment, the seal 52 is disposed between a tapered surface 98 of the body 42 and the internalsurface of the bore 40. More specifically, the tapered surface 98 includes a diameter that increases proximate the lower end 62 of the body 42. Accordingly, urging the seal 52 toward the lower end 62 and into engagement with the tapered face 98 (e.g.,urging the seal in the direction of arrows 100) compresses (e.g., seats) the seal 52 between the tapered face 98 and the internal surface of the bore 40. In the seated position, the seal 52 provides a fluid seal that blocks fluids and gases from passingthe BPV 12.
In one embodiment, the seal 52 is seated by a member that is urged in the direction of the arrow 100 to compress and seat the seal 52. For example, although not depicted in FIG. 2, as discussed in further detail with regard to FIGS. 3 and4A-4E, in one embodiment, the outer sleeve 46 includes an extension that protrudes below the friction member 44 and into contact with the seal 52. Accordingly, the outer sleeve 46 is urged in the direction of the arrows 92 to seat the seal 52, in oneembodiment. Further, as is discussed below, in one embodiment, the outer sleeve 46 includes a window such that movement of the outer sleeve 46 in the direction of the arrow 92, first, seats the seal 52, and, second, urges the friction member 44 intoradial expansion.
Further, as discussed in detail with regard to FIGS. 3 and 4A-4E, the BPV 12 is disposed (e.g., run) into position within the bore and/or installed via one or more running tools. More specifically, in certain embodiment, a running tool couplesto the upper end 60 of the BPV 12 to provide operation of the BPV 12 during installation and retrieval, among other operations. For example, as discussed below, a running tool urges the plunger 50 to an open position, runs the BPV 12 to the desiredlocation, provides hydraulic pressure to engage the outer sleeve 46 to seat the seal 52 and radially expand the friction member 44 into contact with the bore 40, rotates the lock ring 48 to abut the outer sleeve 46, releases hydraulic pressure, urges theplunger 50 into a closed position, and disconnects itself from the BPV 12 before being extracted from the bore 40.
Although the previously discussed embodiments include operation of the friction member 44 as relying on longitudinal forces provided via the outer sleeve 46, the lock ring 48, and the body, it is worth noting that pressure acting on the BPV 12provides for urging the friction member 44 into an expanded position. For example, in one embodiment, the pressure in the lower bore portion 58 acts on the lower end 62 of the body 42 of the BPV 12. Such a loading provides for urging the body 42 upwardrelative to the friction member 44. The upward movement along the longitudinal axis 54 provides for increasing the radial force (e.g., in the direction of arrows 90) acting on the friction member 44. Accordingly, as the pressure in the lower boreportion 58 increases, the radial expansion of the friction member 44 increases, thereby providing increased friction between the friction face 80 and the bore 40. In other words, as the pressure in the lower portion increases 58, the illustratedembodiment of the BPV 12 is secured even tighter into the bore 40, helping to prevent the BPV 12 from becoming dislodged.
Turning now to FIGS. 3 and 4A-4E, one embodiment of a BPV system 110 is depicted. More specifically, the illustrated embodiments include an installation sequence of a BPV system 110 including one embodiment of the BPV 12 and one embodiment of aback pressure valve (BPV) running tool 112. The BPV 12 includes features similar to those discussed above with regard to the BPV 12 of FIG. 2. For example, as depicted, the BPV 12 includes one embodiment of the body 42, the friction member 44, theouter sleeve 46, the lock ring 48, the plunger 50, and the seal 52.
In the illustrated embodiment, the body 42 includes a lower body portion 120 and an upper body portion 122. The lower body portion 120 includes the plunger bore 64. The plunger bore 64 includes a plunger bore sealing face 124. In theillustrated embodiment, the plunger bore sealing face 124 includes a taper between a lower plunger bore portion 126 and an upper plunger bore portion 128. The taper 124 includes an angled face (e.g., conical shaped face) that extends between the lowerplunger bore portion 126 and the upper plunger bore portion 128. The taper 124 is shaped complementary to a plunger sealing face 130. In the illustrated embodiment, the upper plunger bore portion 128 is narrower (e.g., has a smaller diameter) than thelower plunger bore portion 126.
The lower body portion 120 also includes a holding ring 132 coupled to the lower end 62 of the lower body portion 120. The holding ring 132 is coupled to the lower body portion 120 via mechanical fasteners (e.g., bolts) 134. The holding ring132 extends into the lower plunger bore portion 126 and includes a stem bore 135 that extends through the center of the holding ring 132 along the longitudinal axis 54. As is discussed in further detail below, the holding ring 132 retains the plunger 50in the plunger bore 64.
The plunger 50 includes a stem 136, a bell 138, and a spring 140. The stem 136 is coupled to and extends downward form the bell 138. In the illustrated embodiment, the stem 136 is aligned along the longitudinal axis 54 and extends into thestem bore 135 of the holding ring 132. Further, the spring 140 is disposed around the stem 136 and is retained between the bell 138 and the holding ring 132. Accordingly, as the plunger 50 is urged toward the holding ring 132 (e.g., where the plunger50 is urged to an open position), the spring 140 provides a biasing force urging the plunger 50 to a closed position (e.g., the sealing face 130 of the bell 138 into contact with the plunger bore sealing face 124.
In the illustrated embodiment, the bell 138 includes a seal 142 (e.g., annular seal) and a bell stem 144. The seal 142 generally includes a seal configured to seal against the plunger bore sealing face 124. The bell stem 144 includes aprotrusion extended from the bell 138 in the direction of the upper plunger bore portion 128. In operation, the bell stem 144 enables a tool or similar device to engage the plunger via the upper plunger bore portion 128. For example, as is discussed infurther detail below, in one embodiment, the running tool 112 is threaded into a thread 146 of the upper plunger bore 128 and depresses the plunger 50 via the bell stem 144, thereby urging the plunger 50 toward an open position.
The upper body portion 122 includes a cylindrical ring that is coupled to the lower body portion 120. In the illustrated embodiment, the upper body portion 122 includes a cylindrical ring that is disposed about an external diameter of an upperend 148 of the lower body portion 120. The upper body portion 122 is coupled to the lower body portion 120 via a mechanical fastener (e.g., a bolt) 150.
Further, the upper body portion 122 includes a hollow center 152. As is discussed in further detail below, the hollow center 152 is capable of receiving at least a portion of the BPV running tool 112. An upper body hydraulic port 154 extendsfrom an interior surface of the hollow center 152 and extends through the upper body portion 122 to a lower end 156 of the upper body portion 122. The upper body hydraulic port 154 terminates into a cavity 158 formed between the upper body portion 122,the lower body portion 120 and the outer sleeve 46. The cavity 158 is sealed via three annular seals 160, 162 and 164 disposed between the upper body portion 122, the lower body portion 120 and the outer sleeve 46.
The friction member 44 includes, in the illustrated embodiment, segments disposed in the recess 66 of the lower body portion 120. The friction member 44 is coupled to the body 42 via fasteners (e.g., bolts) 166. The fasteners 166 are passedthrough through-holes 166. The through-holes 166 includes slots that enable the friction member 44 to move relative to the fasteners 166 and the body 42. More specifically, the friction member 44 is capable of being moved axially up and down in therecess to contract and expand, respectively, the friction member 44. For example, in the illustrated embodiment, the friction member 44 is in the radially contracted (e.g., up) position, and may be slid/urged into the radially expanded (e.g., down)position, as discussed previously with regard to FIG. 2.
The outer sleeve 46 includes a cylindrical body 170 disposed around the exterior of the body 42. In the illustrated embodiment, the outer sleeve 46 extends both above and below the friction member 44. For example, the body 170 of the outersleeve 46 includes windows 172 that span the region proximate the friction member 44. More specifically, the windows 172 include cutouts through the body 170 that enable the outer sleeve 46 to slide in a longitudinal direction (e.g., parallel to thelongitudinal axis 52) relative to the body 42 and/or the friction member 44. For example, the windows 172 include an upper window face 174 and a lower window face 176 that are separated by a distance that is greater than the height 88 of the frictionmember 44. Accordingly, in the illustrated embodiment, the outer sleeve 46 can be moved longitudinally downward for a distance before the upper face 174 of the body 170 contacts/engages the upper face 84 of the friction member 44. As is discussedbelow, this longitudinal movement can be employed to urge the seal 52 into a seated position. Further, the outer sleeve 46 can continue to move in the longitudinal downward direction to engage the upper face 84 of the friction member 44 and to cause thefriction member to move downward in the recess 66 and expand radially, as discussed above with regard to FIG. 2.
In the illustrated embodiment, the seal 52 includes a MEC seal 52 disposed at a lower end 180 of the outer sleeve 46. As discussed previously, urging the outer sleeve 46 downward displaces the seal 52 downward along the longitudinal axis 54. As the seal 52 is urged downward, it is compressed between the tapered face 98 of the body 42 and the bore 40 until it is proximate and/or disposed in a seated position.
An upper end 182 of the outer sleeve 46 includes shear pin holes 184 that support shear pins 186 disposed between the outer sleeve 46 and the lock ring 48. Further, the upper end 182 includes a recess 188 that houses bearings 190 disposedbetween the outer sleeve 46 and the lock ring 48. Similarly, the lock ring 48 includes complementary shear pin holes 192 configured to support the shear pins 186 and a complementary bearing groove 194 that supports and houses the bearings 190.
The lock ring 48 includes a cylindrical ring that is disposed about the upper portion 122 of the body 42. In the illustrated embodiment, the lock ring 48 includes threads 196 about the internal diameter that are complementary to externalthreads 198 about the external diameter of the upper body portion 122. Accordingly, rotation of the lock ring 48 relative to the upper body portion 122 imparts a longitudinal movement of the lock ring 48 along the longitudinal axis 54. For example,rotating the lock ring 48 may secure the outer sleeve 46 in a locked position as discussed previously with regard to FIG. 2. Further, in the illustrated embodiment, the lock ring 48 includes axial slots 199. In operation, the slots 199 are engaged bycomplementary protrusions of the BPV running tool 112. The slots 199 transfer rotational torque from the BPV running tool 112 to the lock ring 48. Accordingly, rotation of the BPV running tool 112 imparts a rotation of the lock ring 48 via the slots199, in one embodiment.
The stem 204 includes a protrusion along the longitudinal axis 54 and extending downward. In operation, the stem 204 engages the bell stem 144. In other words, as the BPV tool 112 is lowered into and/or engaged with the BPV 12, the stem 204engages the bell stem 144, thereby urging the plunger 50 into the open position.
The threaded portion 206 includes an external thread that is complementary to the thread 146 of the upper plunger bore 128. Accordingly, rotation of the lower portion 200 of the BPV running tool 112 relative to the body 42 generateslongitudinal movement of the lower portion of the BPV running tool 112 relative to the body 42 and the BPV 12. For example, prior to deploying the BPV 12 and the BPV running tool 112, the BPV running tool 112 is coupled to the BPV 12 via the threadedportion 206 and the thread 146 of the upper plunger bore 128. When threaded together, the longitudinal movement of the lower portion 200 of the BPV running tool 112 relative to the body 42 and the BPV 12 causes the stem 204 to urge the plunger 50 intoan opened position.
The hydraulic port 208 includes a bore that extends from an upper end 230 of the lower portion 200 of the BPV running tool 112 and terminates in the external diameter of the lower body portion 200. In the illustrated embodiment, the hydraulicport 208 includes an L-shape that enables the port 208 to align with the hydraulic port 154 in the upper body portion 122 of the body 42 of the BPV 12. When the BPV 12 and the BPV running tool 112 are assembled, the two seals 210 and 212 flank thehydraulic ports 208 and 154 enabling pressurized fluid to pass between the ports 208 and 154. For example, as is discussed in further detail below, hydraulic fluid is injected into the cavity 158 via the hydraulic ports 154 and 208 to urge the outersleeve 46 into a locked position.
Further, the check valve 214 is disposed in the hydraulic port 208. More specifically, the check valve 214 is disposed in the upper end 230 of the lower portion 200 of the BPV running tool 112. The check valve 214 helps to block hydraulicfluid from reversing in direction once injected into the hydraulic port 208. In other words, the check valve helps to maintain pressure within the hydraulic port 208. In operation, the check valve is opened via the check valve stem 226 that protrudesfrom the upper portion 202 of the BPV running tool 112. In the illustrated embodiment, the check valve stem 226 is disposed in the port 224 of the upper portion 202, and includes a port 232 that extends through its length. Accordingly, the check valvestem 226 engages the check valve 214 (e.g., depresses or moves the check valve 214 along the longitudinal axis 54, and enables hydraulic fluid to pass from the port 224 to the hydraulic port 208, in the illustrated embodiment.
The groove 216 of the lower portion 200 includes an annular recess in the circumference that is engaged by the internal protrusions 222 of the upper portion 202. The slots 218 include a plurality of depressions that extend upward from thegroove 216 and are spaced around the circumference of the upper end 230 of the lower portion 200 of the BPV running tool 112. The slots 218 are sized such that the internal protrusions 222 engage the slots 218 when the upper portion 202 and the lowerportion 200 are moved longitudinally relative to one another. For example, as is discussed in further detail below, the protrusions 222 include stems that extend inward into the groove 216 enabling the upper portion to rotate about the lower portion 200in the illustrated position. Upward axial movement of the upper portion 202 causes the internal protrusions 222 to engage the slots 218, thereby enabling the rotational torque of the upper portion 202 to rotate the lower portion 200.
The external protrusions 228 include pins or similar extensions that protrude from the external diameter of the upper portion 202. As discussed previously, the external protrusions 228 are configured to engage the slots 199 of the locking ring48. Accordingly, rotation of the upper portion 202 translates into rotation of the locking ring 48, in certain embodiments.
It is further noted that the upper portion 202 includes an attachment thread 234. The attachment thread 234 includes an internal thread that is couplable to casing, tubing, or a similar device employed to run the BPV 12 and/or the BPV runningtool 112 into the bore 40. For example, casing is threaded into the attachment thread 234 to support the BPV running tool 112 and to provide for the delivery of hydraulic fluid in one embodiment.
Turning now to FIG. 4A-4C a sequence of installing the BPV 12 is illustrated. FIG. 4A depicts the BPV 12 and the BPV running tool 112 assembled to one another and disposed in the straight bore 40. In the illustrated embodiment, the check valvestem 226 has engaged the check valve 214, the external protrusions 222 are located in the groove 216, the hydraulic port 208 of the BPV running tool 112 is aligned with the hydraulic port 154 of the body 42 of the BPV 12, the shear pins 186 are intact(e.g., un-sheared), the stem 204 of the BPV running tool 112 has engaged the bell stem 144 of the plunger 50 (e.g., urged/depressed the plunger 50 to the open position), the friction member 44 is disposed atop the recess 66 in the radially contractedposition, a distance 240 exists between the upper face 84 of the friction member 44 and the upper window face 174, and the seal 52 is engaged by the taper 98 of the body 42. In other words, the BPV 12 is lowered into the bore 40 in a pre-landingposition.
FIG. 4B depicts the BPV system 10 after hydraulic loading of the BPV system 110. In the illustrated embodiment, hydraulic fluid is injected into the cavity 158 via the hydraulic ports 208 and 154. As hydraulic fluid is injected into the cavity158, the increase in pressure and volume causes a longitudinal downward force on the outer sleeve 42 in the direction of the arrows 92. The resulting downward force and movement of the outer sleeve 46 shears the shear pins 186, and urges the outersleeve 46 downward in the direction of the arrows 92 into engagement with the friction member 44. In other words, the downward movement of the outer sleeve 46 eliminates the distance between the upper face 84 of the friction member 44 and the upperwindow face 174 until the upper window face 174 engages the upper face 84 of the friction member 44. The movement of the outer sleeve 42 creates a gap 160 between the lock ring 42 and the outer sleeve 46.
In the illustrated embodiment, the outer sleeve 46 continues to urge the friction member 44 downward, creating a gap 242 between the body 42 and the friction member 44 and radially expanding the friction member in the direction of the arrows 90. The radial expansion causes the friction face 80 of the friction member 44 to engage the internal diameter of the bore 40. Further, the seal 52 is driven longitudinally beyond the taper 98 in the body 42 into a seated position. In other words, the sealis compressed between the body 42 of the BPV 12 and the bore 40. With the cavity 158 pressurized and the outer sleeve 46 urged into the engage position, the BPV running tool 12 is moved up such that the check valve 214 is disengaged by the check valvestem 226. Accordingly, FIG. 4B depicts the BPV system 110 wherein the BPV 12 has been hydraulically pressurized, and the BPV running tool 112 is hydraulically disengaged from the BPV valve 12.
FIG. 4C depicts the lock ring 48 rotated into a locked position. For example, with the BPV 12 hydraulically pressurized, and the BPV running tool 112 hydraulically disengaged from the BPV valve 12, the upper portion 202 of the BPV running tool112 is rotated. Rotation of the upper portion 202 of the BPV running tool 112 is provided via rotation of the casing, tubing, or other device coupled to the attachment threads 234, in one embodiment. Accordingly, rotational torque generated by rotatingthe upper portion 202 of the BPV running tool 112 is transferred to the slots 199 of the locking ring 48 via the external protrusions 228. The resulting rotation of the lock ring 48 about the threads 196 and 198 causes the locking ring 48 to movelongitudinally downward in the direction of the arrows 96. The rotation is continued until the lock ring 48 is proximate or engages the outer sleeve 46. In other words, the gap 160 is reduced and/or eliminated. Accordingly, the illustrated embodimentincludes the lock ring 48 moved into a locked position. In the locked position, the lock ring 48 abuts the outer sleeve 46, thereby securing the outer sleeve 46 and the friction member 44 in the radially expanded position.
FIG. 4D depicts the upper portion 202 of the BPV running tool 112 moved upward such that the internal protrusions 222 are disengaged from the groove 216 and have engaged the slots 218 located above the groove 216. In other words, once the lockring 48 is disposed in the locked position, the upper portion 202 of the BPV running tool 112 is retracted upward such that the external protrusions 220 disengage the slots 199 of the lock ring 48 and the internal protrusions 222 engage the slots 218 ofthe lower portion 200 of the BPV running tool 112. With the internal protrusions 222 engaged in the slots 218, the upper portion of the BPV running tool 112 is rotated, for example, via rotation of the casing, tubing, or other device coupled to theattachment threads 234, causing rotation of the lower portion 200 of the BPV running tool 112 that disengages the threaded portion 206 of the lower portion of the BPV running tool 112 to disengage threads 146 in the body 42 of the BPV 12. Accordingly,rotation of the BPV running tool 112 longitudinally disengages the BPV running tool 112 from the BPV 12. In one embodiment, once the BPV running tool 112 is disengaged from the BPV 12, the BPV running tool 112 is retrieved/extracted (e.g., retrieved toa vessel in a subsea system 10).
FIG. 4E depicts an embodiment wherein the BPV 12 is installed in the straight bore 40 and the BPV running tool 112 is disengaged and retrieved from the bore 40. More specifically, the friction member 44 is radially expanded into engagement withthe internal surface of the bore 40, the lock ring 48 is set in the locked position, the seal 52 is seated, and the BPV running tool 112 is retrieved from the bore 40.
As discussed above with regard to FIG. 2, the embodiments discussed with regard to FIGS. 3 and 4A-4E may include any combination or variation of features. For example, the embodiments may include various configurations of the friction member 44(e.g., a C-Ring, segments, and/or locking dogs). Further, the friction face 80 may include any variety or combination of surface finishes (e.g., scoring, grooves, teeth, etc.). In addition, the seal 52 may include a MEC seal and/or a LS seal. Further,although not depicted, retrieval of the tool may generally include the BPV running tool 112 being lowered to the BOV 12, rotating the BPV running tool 112 to back-off the lock ring 48 and relieve the longitudinal force holding the outer sleeve 46 and thefriction member 44 in place, and extraction of the BPV 12 and the BPV running tool 112 via the bore 40.
While the invention may be susceptible to various modifications and alternative forms, specific embodiments have been shown by way of example in the drawings and have been described in detail herein. However, it should be understood that theinvention is not intended to be limited to the particular forms disclosed. Rather, the invention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention as defined by the following appendedclaims.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Rhubarb Lactopickles for Spring!
Pinks and greens make this rhubarb pickle perfect for spring. How-to on the whey ricotta pictured coming next week!
I’m nowhere near done with cheese, but you have to put something on your cheese tray besides cheese, right? And I don’t want you all to miss out on your spring pickles! By the time I’m done with cheese, rhubarb and aspargus will be all gone until next year in Philly, so here you go: a simple, spring recipe.
If you regularly read this blog, you’ll know that I recommend pickles as an excellent fermentation starting point. Why? They are nearly foolproof if you know a few rules! The first and most important trick is picking the right vegetables. There are a few things I haven’t been able to get to work well, many others that work well with some tweaks, and a ton that work with very little effort. The second key is submersion. If your veggies are submerged under brine, that gives you the anaerobic conditions that are necessary for the LAB to thrive. The third rule is temperature, room temp works great! Get below 65ish degrees and we’re talking some serious sluggishness and potential that the bacteria never get kicking. Above 80 or so, things might start to ferment too quickly, or it may get too hot for your LAB to start their happy processes.
So here’s one that’s super easy and popping up at the farmer’s markets all over town at the moment: rhubarb! As always, with pickles, feel free to change out the seasonings for what you have on hand or what you prefer. I actually think these rhubarb pickles would be great with nothing but salt. The tangy, fruity notes of fresh rhubarb can stand alone!
I got these veggies at my local farmer’s market at Headhouse Square. It is operated by the renowned Food Trust, a local organization dedicated to eradicating food deserts and educating kids on their food choices. I’m pretty proud that they call Philly home and I’m grateful for the local bounty that they, and a couple other wonderful organizations to bring into the city.
Pretty rhubarb pickles will have pink brine!
Rhubarb Pickles
yields about 1 quart of rhubarb pickles
fermentation time will be approximately 2 weeks
I usually make my single quart batches of pickles while I’m preparing another meal. I already have the cutting board out, so it really adds no time to dinner prep and the payoff is pretty huge!
Room temperature brine (I make mine by stirring 1 T of salt into 2 c water until dissolved)
How-To
1. Place all ingredients except brine into a 1 quart jar making sure that your bay leaf stays whole. You may layer in your mustard seeds and bay leaf for visual effect, but I have not found that their position in the jar influences flavor
2. Pour brine into jar, ensuring that there is enough liquid in which to submerge your rhubarb
Hi Cindy,
Sorry I missed your comment. Green garlic is just spring garlic, long stems still attached. It looks a lot like garlic at the base, it’s just that the cloves aren’t fully differentiated from one another (you’ll see them when you slice it). It isn’t as pungent as garlic, but still provides a great, garlicky taste. I sometimes grow garlic and that’s a great way to get them cheap. Otherwise, it’s off to the farmer’s market!
Let me know how your pickles turn out!
Amanda
Any salt will do! I like to use sea salt because it has a higher mineral content and the fermentation process makes minerals more bioavailable, but you can use anything at all. Unlike vinegar pickles, these are going to get cloudy no matter what kind of salt you use. With rhubarb, that makes for a pink, cloudy, pretty brine but with vegetables with plainer color schemes, the brine will just look cloudy.
So glad to hear it, Dona! Along with snap peas and asparagus, my rhubarb pickles are at the top of my pickle list for this year (so far). Glad you love them, too! We got through a quart in like two days. Then I made a half-gallon, and those are long gone, though there’s no more rhubarb to be found around here anymore.
I’ve already eaten almost a half gallon by myself already today. No one will try them! It’s probably just as well.
I love this recipe. People put vinegar and sugar and all sorts of things in pickles but these are just right for me. I may reduce the salt a wee bit. Other than that, I’m so glad no one else wants to give them a try.
Oh man, I am totally trying these this year. I made a sweeter refrigerator version from Kim Ode’s Rhubarb book last year (it goes with a kale salad recipe -so good!) and I found they were a good sub for celery in lots of things. Didn’t think to try a fermented version 🙂
I started 2 half gallon jars of these 3 days ago. As of yet, neither jar has any bubbles coming up to the top like my other ferments usually do…. Does this mean I did something wrong? I followed the recipe completely except for the green garlic (I just had the regular garlic). Did yours bubble?
These aren’t vigorously bubbly. More along the lines of a cucumber than a cabbage. If you taste them in a few days and they aren’t more acidic, then something went wrong, but I would be surprised if that’s the case. The green garlic definitely does help the fermentation along in this one, so you might want to give it some extra time.
Thanks, Amanda! I appreciate your time and wisdom! I have tasted them and they have lost a lot of the sourness of the rhubarb and are more salty than anything I guess… My tastebuds are not as sensitive as some. I do like them and can’t wait for the 2 weeks so I can start eating them! Thanks for sharing!
So- once its ready, do you close the jar and put in the fridge? Or are these supposed to stay at room temperature in the jar. Quite a basic question, but it isn’t clear to me as this is my first fermentation experience, it’s been super fun! i think the rhubarb is ready, its been over 2 weeks, but it is still quite crunch.
I tried your promising recipe. The rhubarb is now in the jar for over a week, and I am very exited to start trying in a few days. I started to get a little worried as I am seeing some kind of flakes appearing on the chopped rhubarb pieces. Is this part of the process? (I am not so experienced with fermentation yet)
Hi Amanda, thanks for your reply and the reference, it was really helpful. I just can’t be completely sure, but how can you be when so many micro-organisms are transforming your food into something…… REALLY tasteful! And my body seems perfectly happy with it. It certainly added to my enthusiasm about fermentation, and I am really starting to think about brining it to the next level (although I am still a rookie)… the farmer’s market in the south of Holland. Although it is still a premature idea, I can’t stop thinking about pickling it 😉 Any tips about that? Or is it just start doing it again…
I’m so glad you’re loving your ferments! I have no retail experience with vegetable ferments so I can’t offer you any tips on that, unfortunately. Here in the US, there are legal requirements that vary by state. That may be a great place to start for you.
Best of luck! I’m hoping to visit Holland later this year, so maybe I’ll see you at the farmers’ market :-).
Good morning Amanda!
I have a technical question for you.
I made these rhubarb pickles two weeks ago which are ready to eat. I used a sea salt brine and used Fido jars. About a week into the fermentation process I noticed tiny white spots on the top of the rhubarb. More spots appeared but for the most part they seemed to have disappeared. Do you know what this would be and are these safe to consume?
The brine was 1 tbsp sea salt to 2 cups of water.
I appreciate your help!!
Just set up a quart of these…well kind of. Only had two rhubarb stalks from CSA so added a bunch of young turnips (sliced), a couple of radishes (also sliced) and a garlic scape (cut into 1″ pieces). I have high hopes…
I was about 10 days into my 2-week ferment on these and they were starting to taste really good, but then yesterday I discovered mold growing on top of the brine. Should I throw it all out? Skim off the mold?
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Pages
Tuesday, July 27, 2010
The Juggling Act
With very little stimulating repartee to share with you today (due entirely to the fact that I have texted so much in the last 72 hours that my hand is literally sore. Carpal tunnel due to texting. It's a real thing, people, and it hurts), I feel compelled to share with you another, eh, side effect? of online dating that I never saw coming: The Juggling Act.
As we've learned together, online dating is like the ocean, it hits you in waves. Sometimes it's low tide and only a few fish wash up on the sand, most of which are flopping around just barely surviving. Other times, it's high tide, with whole waves full of catches just waiting for you to scoop them up. I ended my Match.com career during high tide and my texting hand is paying the price for it.
Right now, I have four men in pretty consistent Text Limbo Land. The last remaining one that you are already relatively familar with is Mr. Italian. He's here...he's nice...he's cute. But, eh. It's dying in the water. We've exhausted almost every topic possible in Text Limbo Land and have quickly settled into the "Hey, what are you doing?" daily opening line. Honestly, when you don't know a person, it's really hard to say anything other than "Nothing, what are you doing?" I've tried dilligently to move into actual phone conversations, but as karma would have it, he ain't havin' it. I will give him the credit he deserves for initiating a potential meet this week, but I felt surely I would never hear from him again after I squashed his idea of meeting at his house. This girl has watched enough Lifetime movies to know that is a recipe for disaster. I can hear my mother in my head now: "Melanie...you're not putting yourself into vulnerable situations with this online dating thing, are you?" to which I quickly respond that I am well aware of the risks and taking every step necessary to protect myself. Getting dolled up and using my date night perfume (don't lie, you have one too) to walk through a Front Door of Potential Doom is not "taking every step necessary to protect myself." Surprisingly, he simply suggested that we reschedule for a weekend that he does not have his daughter. Another obstacle I'm not sure I'm ready to factor into this whole new world of dating, but whatever. Beggers can't be choosers.
I did introduce you to Mr. Nick@Nite and he is still alive and kickin'. Well, he's alive, I don't know about kickin'. We have also run the gamet of all topics of conversation sent in 160 characters or less per statement and hit text messaging bottom. We haven't moved past the "Hope you had a good day" text in three days. I like him, he seems nice enough and definitely has a wider (and more...um, interesting?) array of interests than any of the others out there right now, but he's not engaging. I know, I've said all this before and you all have responded. Yes, I'm happy to move past texting and realize that some people aren't good at it, but this car has stalled out. He's the one stopping us from advancing to that next very eye-opening level of communication. There are only so many times we can talk about my family genealogy and infamous relative. I've got to take that off of there...
You have yet to meet Mr. Morals or Mr. Military, well, honestly because there's not much to say. Surprisingly, according to their profile pictures (and we all know what lessons I've learned from those!) they look eerily similar, but communicate quite oppositely. As you'd expect Mr. Military (named for the presence of fatigues in three of his five profile picture outfit choices) is direct and to the point. But, of course, weird. A Plentyoffish.com pick-up, he has been showering me with compliments from the second our interactions began, but embellished his emails with little more. He did however ask me what I had gotten him for his birthday. After I scoured his profile looking to see if Plentyoffish.com posted birthdays and I'd just missed it (nope, not there), I told him that I wasn't aware, Happy Birthday and I'd buy him a beer whenever we met. Oh, wait, that wasn't a clever way of getting him to commit to something, we had actually mentioned "meeting," but in some far off, distant time. Urgh. After he told me he didn't drink on the first date (I mean, it was a suggestion. Relax. It was one beer. I'm not going to make you do anything you don't want to do, and I'd imagine someone with a military background could quickly subdue any rowdiness on my part.)(Can I date a guy who's not interested in a free beer?!), he said that he'd like me to buy him a tattoo. "Can I pick of what?," I stupidly ask, trying to add some light-hearted flirtation to this overly dry conversation. "I want Japanese artwork," he replies. I have visions of one of those (usually white) people who go into a tattoo parlor mildly intoxicated and request this overly spiritual, artistic Japanese symbol only to later learn it means "I have a pig snout" or something else highly comical to anyone of Japanese heritage.
Then we have sweet Mr. Morals. He openly proclaims his fierce allegiance to his mother (I'm not making fun, I promise, this is a major selling point if he hasn't crossed the same line of allegiance that say, Norman Bates did) and how much he loves his nieces and nephews, another nice quality for someone like me with a monumentally loud biological clock. I'll give him his credit too, he has been able to keep me relatively entertained even with the mundane day-to-day topics. But, no mention of a meeting...yet.
What's wrong with all this, you ask? I'll be happy to enlighten you. My brain is not big enough to keep track of what I've said to whom. I constantly feel as though I'm repeating myself because the only mental image I have of any of these gentlemen are their tiny thumbnail profile pictures or the "unknown" icon on my phone. None of them have really outshined the other (besides the aforementioned "skills" of Mr. Italian, which I will further address tomorrow). If you had asked Melanie From a Year Ago if she would have ever thought she'd be complaining about having TOO many men vying for her attention, she would laughed until she was blue in the face, caught her breath and started laughing again. I know this is a relatively easy problem to have, but how do I solve it? Inevitably someone is going to fall through the cracks, but is it fair for someone to fall victim to my overzealous "winking" on Match.com? I'm not sure how much longer I can maintain this juggling act and with my track record, instead of dropping one ball and keep on truckin', I'm sure to drop them all in one fell swoop. Luckily, Mr. Mardi Gras saw a way out of this debacle and recently told me that his silence was due to a recent transfer to Savannah. Another party town where his loud shirts will fit in perfectly. Good luck, Mr. Mardi Gras, bon voyage to you and your cruise wear.
Come back tomorrow...I'm thinking the dropping might not be a bad idea.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
I have read your post and found these all post are really informative and interesting. I think that you have done a great job and I really appreciate you for your this kindness. I hope that you will continue to post here with us.
So what are they going to do when they out these guys...can the mlb?? Was listening to a joe rogan podcast where he was talking to victor conte who said that the majority of guys in the mlb are using. I would consider him pretty reliable as he provides for a few guys and has an inside knowledge of who is and isnt on......interesting listening
Simply put, we've seen what happens in baseball when PEDs are used unchecked. And I for one am not a fan. The record books were rewritten and we had formerly scrawny players hitting 40 and 50 home runs.
18 men hit 50 home runs in a season from 1920 to 1994. 16 men hit 50 between 1995 and 2010. It absolutely tarnishes the accomplishments of great players who came before and downplays great players who played clean during the steroid area (Jeff Bagwell, Ken Griffey, Jr.). It ruined the way the game was played as well. I love great hitting, but baseball is about strategy and pitching.
If you want to watch juiced up monsters hit home runs, there's a guy named Rusty Bumgardner who plays professional Slow Pitch. They occasionally televise those games. Watch them and let me have my baseball. If they can circumvent the rules, good for them. But I don't want to see three linebackers galloping through the outfield and have Bud Selig tell me America's Pastime is clean.
I like this point, that its about strategy. The chronological data is quite impressive. There is of course the win at all costs and greed issues to overcome first which tend to be overshadowed by the PED's and those are a few reasons players (exisiting and potential) would be enticed to the dark side.
My point was to have it either be openly allowed or not.
Zero tolerance, stiff fines are no good, if "no" means "no" then the penalty should be banishment.
Simply put, we've seen what happens in baseball when PEDs are used unchecked. And I for one am not a fan. The record books were rewritten and we had formerly scrawny players hitting 40 and 50 home runs.
18 men hit 50 home runs in a season from 1920 to 1994. 16 men hit 50 between 1995 and 2010. It absolutely tarnishes the accomplishments of great players who came before and downplays great players who played clean during the steroid area (Jeff Bagwell, Ken Griffey, Jr.). It ruined the way the game was played as well. I love great hitting, but baseball is about strategy and pitching.
If you want to watch juiced up monsters hit home runs, there's a guy named Rusty Bumgardner who plays professional Slow Pitch. They occasionally televise those games. Watch them and let me have my baseball. If they can circumvent the rules, good for them. But I don't want to see three linebackers galloping through the outfield and have Bud Selig tell me America's Pastime is clean.
did you not like watching guys like curt schilling and Rodger Clemens pitch 100+ mph against monster like Bonds Conseco and mcguire. I mean when was the last time that an everyday pitcher has gone out and constantly plows down pitches of that velocity. I do believe that there should be a mark in the history books as far as when the "enhanced era" began and the "natural era" ended and I do believe that Rodger Meris' 61 home runs should be held in a different light than Bonds' 73. But lets face it I dont think Meris would have had 61 homers if he was going up against the same pitchers that Bonds did. With every game comes strategy and I for one think that The game was more entertaining when you could have a slider clocked at 98 MPH and then a change up at 89. And thats what we watch the sport for. To be entertained. America likes its hero’s larger than life and PED's allow that.
Rep For Platinum NutraceuticalsWant a deal? Use the Code AM55 to save 55% on your entire order
did you not like watching guys like curt schilling and Rodger Clemens pitch 100+ mph against monster like Bonds Conseco and mcguire. I mean when was the last time that an everyday pitcher has gone out and constantly plows down pitches of that velocity. I do believe that there should be a mark in the history books as far as when the "enhanced era" began and the "natural era" ended and I do believe that Rodger Meris' 61 home runs should be held in a different light than Bonds' 73. But lets face it I dont think Meris would have had 61 homers if he was going up against the same pitchers that Bonds did. With every game comes strategy and I for one think that The game was more entertaining when you could have a slider clocked at 98 MPH and then a change up at 89. And thats what we watch the sport for. To be entertained. America likes its hero's larger than life and PED's allow that.
Watch Gerrit Cole, Aroldis Chapman, Justin Verlander, Chris Sale and a host of other guys I don't even know of. They're throwing harder today. Pitchers used PEDs to throw more innings, NOT to throw harder. The mobility and leverages to throw in the upper-to-mid 90s are much more rare and important than the strength to do so. PEDs put the advantage squarely in the hitter's hands.
Don't get me wrong, I love watching the NFL have bigger and stronger than ever guys running faster than ever and crushing each other. But that sport has different parameters, and PEDs don't change the game as much as it does in baseball.
This is only my opinion, I am by no means anti-PED, I use them myself. Baseball is a sport more bound by tradition and again, in my opinion, PEDs change the game of baseball for the worse.
Watch Gerrit Cole, Aroldis Chapman, Justin Verlander, Chris Sale and a host of other guys I don't even know of. They're throwing harder today. Pitchers used PEDs to throw more innings, NOT to throw harder. The mobility and leverages to throw in the upper-to-mid 90s are much more rare and important than the strength to do so. PEDs put the advantage squarely in the hitter's hands.
Don't get me wrong, I love watching the NFL have bigger and stronger than ever guys running faster than ever and crushing each other. But that sport has different parameters, and PEDs don't change the game as much as it does in baseball.
This is only my opinion, I am by no means anti-PED, I use them myself. Baseball is a sport more bound by tradition and again, in my opinion, PEDs change the game of baseball for the worse.
I loved watching Verlander get peppered by Pablo Sandival last year in the W.S! LOL. I def get where you are coming from and agree with baseball it is imperative that you have a solid base of mechanics and fundamental skills vs over all power and muscle mass. But as long as the risk is worth the reward players will continue to use PED's to get those Multi Million Dolalr contracts. Shoot look at melky cabrera, he uses topical andro. for half a year gets caught then signs with the Jay's for 8 mill this year and he has only hit three homers.
I was born into the PED erra of baseball and never got to watch the pure form of it at the MLB level but I have seen the game change. And I blame Selig for being so on the fence about it all he gives slaps an the wrists and then tries to save face by sugar coating it all.
Rep For Platinum NutraceuticalsWant a deal? Use the Code AM55 to save 55% on your entire order
I loved watching Verlander get peppered by Pablo Sandival last year in the W.S! LOL. I def get where you are coming from and agree with baseball it is imperative that you have a solid base of mechanics and fundamental skills vs over all power and muscle mass. But as long as the risk is worth the reward players will continue to use PED's to get those Multi Million Dolalr contracts. Shoot look at melky cabrera, he uses topical andro. for half a year gets caught then signs with the Jay's for 8 mill this year and he has only hit three homers.
I was born into the PED erra of baseball and never got to watch the pure form of it at the MLB level but I have seen the game change. And I blame Selig for being so on the fence about it all he gives slaps an the wrists and then tries to save face by sugar coating it all.
Selig has tried and tried to run baseball into the ground. Luckily, he hasn't been successful . . . yet.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1. Introduction {#sec1-animals-10-01093}
===============
Turkey is one of the important bio-geographical countries which encompass three important biodiversity hotspots such as the Caucasus, Iran-Anatolian, and Mediterranean basin \[[@B1-animals-10-01093]\]. Also Turkey has quite a wide range of biodiversity on account of geomorphologic, topographic features, the variety of climate and geographic conditions, either flora and fauna. This biodiversity has included a high amount of endemic and rare species \[[@B2-animals-10-01093]\].
Numerous factors such as technological improvement, population explosion, industrialization are responsible for the disturbance of natural balance permanently. For this reason, in order to conserve the plant and animal biodiversity, especially against the threat of endanger or disappearance, protection and conservation strategies have to be formed. The morphological and genetic identification of the species for the establishment of these strategies become crucial issues for the conservation of biodiversity. Without these protective strategies, significant changes are likely to occur in the ecosystem balance and biodiversity level.
Turkey is an agricultural country where plants and animals have been raised since ancient times. For this reason, it is considered that many local animal breeds were first bred here and spread to other geographical regions of the world. Turkey has rich animal genetic resources and donkeys are one of these resources, but yet so little information is verified for the donkey breeds of Turkey. Donkey breeds that helped the breeders under severe natural conditions, and have assisted in transportation for centuries, and are still used in some rural areas in Turkey, are under threat of extinction due to the impact of industrialization \[[@B3-animals-10-01093],[@B4-animals-10-01093],[@B5-animals-10-01093]\]. In the last years, donkey populations have declined dramatically in Turkey. For these reasons, the conservation strategies have to be explored and breeds must be identified before the loss of genetic resources.
To date, little information has been found about the donkey breeds of Turkey; even some of the donkey breeds of Turkey had been extinct without clear identification. According to the Food and Agriculture Organization of the United Nations (FAO), Domestic Animal Diversity Information System (DAD-IS), Turkey has three native donkey breeds: Anatolian, Merzifon and Karakaçan donkey breeds. But on the other hand, in other unpublished records, Mardin White donkey (close to Mardin province), Toros donkey (close to Toros Mountains, Antalya province), Urfa Rahvan donkey (close to Şanlıurfa province) and Kars Yorga donkey (close to Kars Province that is located in extremely north east part of Turkey) breeds are also found in Turkey \[[@B6-animals-10-01093]\].
So the aim of this study has threefold: (i) to provide a detailed sampling across the entire country for molecular characterization to check if the above mentioned breeds are still found in Turkey or not, (ii) to analyze the genetic diversity of donkeys raised in Turkey using a set of 17 microsatellite markers, (iii) and to determine the genetic relationship and characterize geographical and genetic differentiation between different donkey breeds at different sites in Turkey. This research is the first application of molecular markers to characterize the donkey breeds raised in Turkey.
2. Materials and Methods {#sec2-animals-10-01093}
========================
2.1. Sampling and DNA Isolation {#sec2dot1-animals-10-01093}
-------------------------------
According to the FAO database (Domestic Animal Diversity Information System, accessed Sep 15, 2019); the estimated number of donkeys in Turkey is about 150,000. In this study, a total of 314 blood samples from different individuals were collected from 16 different locations ([Figure 1](#animals-10-01093-f001){ref-type="fig"}). These locations were selected to represent the expected native Turkish donkey breeds: Anatolian, Merzifon, Karakaçan etc. The locations and the potential distribution of these breeds with the number of sample sizes are given in [Table 1](#animals-10-01093-t001){ref-type="table"}.
Blood samples were taken to Ethylenediaminetetra-acetic acid (EDTA) (0.5 mM, pH 8.0) coated vacutainer tubes and stored at +4 °C until DNA extraction. Approximately 10 mL of blood per animal was collected and genomic DNA was extracted from whole blood using the standard phenol-chloroform-isoamyl alcohol (25:24:1) extraction method. Extracted DNA was diluted in TE buffer (10:1) and stored +4 °C till analysis.
2.2. Microsatellite Genotyping {#sec2dot2-animals-10-01093}
------------------------------
In this study, twenty microsatellite markers (AHT05, ASB02, ASB17, ASB23, COR007, COR018, COR022, COR058, COR071, COR082, HMS02, HMS03, HMS07, HMS20, HTG06, HTG07, HTG10, LEX54, LEX73 and VHL209) which have been widely used and recommended for individual identification and parentage verification of equines were selected according to FAO's guidelines \[[@B7-animals-10-01093]\]. Seventeen out of the 20 tested loci yielded clear PCR products and used for the analysis. ASB17, COR022 and LEX73 were excluded from the study. Genomic characteristics of the 17 microsatellite loci, primer sequences, fluorescent labels, allele size range, annealing temperatures, repeat motifs and the references are given in [Table 2](#animals-10-01093-t002){ref-type="table"}.
All the microsatellite loci were amplified by Polymerase Chain Reaction (PCR) and each forward primer was labeled with fluorescent dyes (6-FAM^TM^, VIC®, NED^TM^, PET®) at the 5' end. Four multiplex PCRs using fluorescently labeled primers were developed (1st 4plex: HMS07, ASB23, HMS02, COR058; 2nd 5plex: HMS03, VHL209, ASB02, HMS20, COR007; 3rd 4plex: HTG07, AHT05, LEX54 and HTG10; 4th 4plex: HTG06, COR018, COR071, COR082). The reactions were performed in a total 10 µL volume. PCRs were comprised with approximately 50 ng DNA, 1X PCR buffer 1.5 mM MgCl~2~, 0.2 mM dNTPs, 0.050 pmol of each primers, 1 U Taq DNA Polymerase (Invitrogen Taq DNA Polymerase).
The cycling conditions included an initial denaturation step at 95 °C for 5 min, 35 cycles of 95 °C for 1 min, annealing temperature between 55--62 °C (see [Table 2](#animals-10-01093-t002){ref-type="table"}) for 45--60 s, elongation step at 72 °C for 1 min and a final extension at 72 °C for 5 min. Amplification was carried out using a Veriti™ 96--Well Thermal Cycler or ProFlex PCR System (Applied Biosystems, Foster City, CA, USA).
PCR products were checked in 2% agarose gel stained with SYBR™ Safe DNA Gel Stain. The samples were mixed with formamide and LIZ® 500-bp internal size standard (Applied Biosystems™) and detected by capillary electrophoresis using a 3500 XL Genetic Analyzer® (Applied Biosystems™) sequencer. Allele sizes were determined with the *GeneMapper*® Software V4.0 (Applied Biosystems™).
2.3. Statistical Analysis {#sec2dot3-animals-10-01093}
-------------------------
Genetic diversity parameters were estimated for each microsatellite locus and across all loci for each population by total number of alleles, the mean number of alleles (Na), effective number of alleles (Ne), polymorphic information content for each locus (PIC), observed heterozygosity (H~O~), expected heterozygosity (H~E~), private alleles (N~P~) Hardy--Weinberg equilibrium and null allele frequencies using Genetix v4.05 \[[@B21-animals-10-01093]\], FSTAT v2.9.4 \[[@B22-animals-10-01093]\], POPGENE Version 1.31 \[[@B23-animals-10-01093]\] and GenAlEx Version 6.5 \[[@B24-animals-10-01093]\]. Wright's F statistics (F~ST~, F~IS~ and F~IT~) as proposed by Weir and Cockerham \[[@B25-animals-10-01093]\] were computed using Genetix® software. Nei's gene diversity (H~T~), diversity between breeds (D~ST~) and coefficient of gene differentiation (G~ST~) values were calculated with FSTAT v2.9.4 \[[@B22-animals-10-01093]\]. Exact tests for deviation from the Hardy-Weinberg (HW) equilibrium and partitioning of genetic diversity using analysis of molecular variance (AMOVA) were performed using the ARLEQUIN v. 3.5.2.2 \[[@B26-animals-10-01093]\]. Pairwise genetic distances (Reynold's genetic distance) and Nei's \[[@B27-animals-10-01093]\] unbiased D~A~ genetic distances were calculated using the Populations v 1.2.30 software. Neighbour-net dendrogram constructed from Reynold's genetic distances by using SplitsTree v4.16.0 \[[@B28-animals-10-01093]\].
The genetic structure of the populations was investigated using STRUCTURE 2.3.4, (Oxford, UK) \[[@B29-animals-10-01093],[@B30-animals-10-01093],[@B31-animals-10-01093]\]. Analysis was performed with a burn of 500,000 in length, followed by 500,000 Markov chain Monte Carlo iterations for each from K= 1--18, with 20 replicate runs for each K, using independent allele frequencies and an admixture model. Evanno's method \[[@B32-animals-10-01093]\] was used to identify the appropriate number of clusters using ΔK, based on the rate of change in the log probability of the data. The optimal K values were selected by means of STRUCTURE HARVESTER \[[@B33-animals-10-01093]\]. This software, a web-based program, was used for collating the results generated by the program STRUCTURE. The clustering pattern was implemented in the CLUMPP program and visualized using the software DISTRUCT software version 1.1 \[[@B34-animals-10-01093]\].
3. Results {#sec3-animals-10-01093}
==========
Out of the 20 microsatellites analyzed, the following 17 showed useful data in study population of the Turkish donkey: AHT05, ASB02, ASB23, COR007, COR018, COR058, COR071, COR082, HMS02, HMS03, HMS07, HMS20, HTG06, HTG07, HTG10, LEX54 and VHL209 ([Table 2](#animals-10-01093-t002){ref-type="table"}). The ASB17 COR022 and LEX73 loci were excluded from the analysis. The COR022 and LEX73 loci failed to amplify in all samples and did not provide data for reliable analysis while the ASB17 marker was monomorphic (91 bp) for all examined animals.
In this study, the mean number of alleles (N~a~), the number of effective alleles (N~e~), the number of private alleles (N~p~), expected (H~E~) and observed (H~O~) heterozygosity, F~IS,~ and PIC values for each population were given in [Table 3](#animals-10-01093-t003){ref-type="table"}. Among 17 tested loci, the number of alleles varied from 4 (ASB02 and HTG06) to 12 (AHT5), while the total number of observed alleles was 142 with an average of 8.235 per locus in 314 examined donkeys. The mean number of alleles observed in populations differed slightly: the minimum 4.529 was observed in AYD (AER) and the maximum 6.706 was in KIR (MAR). The observed (*H~O~*) and unbiased expected (*H~E~)* heterozygosities per location ranged from 0.6266 (KIR) to 0.7139 (AYD) and 0.6294 (ISP) to 0.6983 (ANT), respectively. The mean *H~O~* in the Turkish donkey was estimated to be 0.677, while mean *H~E~* was 0.675 ([Table 3](#animals-10-01093-t003){ref-type="table"}). The mean number of alleles N~a~ was the highest in KIR (6.706) and lowest in AYD donkeys (4.529). F~IS~ value within the populations varied between −0.0557 in KAS and 0.0923 in KIR population, wheras F~IS~ was statistically significant only for KIR breeds due to the deficiency of heterozygosity. A total of 13 private alleles were identified in the present work, and most of the private alleles (ten) were at low frequencies of below 5%. Three alleles unique to KAH (0.115), MAL (0.050) and AYD (0.083) showed a frequency that exceeded 5% ([Table 3](#animals-10-01093-t003){ref-type="table"}).
The characteristics of the analyzed loci along with the genetic variability statistics were summarized in [Table 4](#animals-10-01093-t004){ref-type="table"}. The total number of alleles per locus ranged from 4 (ASB02, HTG06) to 12 (ATH005), while the mean number of alleles per locus varied between 3.938 and 9.625 for the same loci, with a mean number of alleles per locus of 5.714. The number of effective alleles per locus (Ne) indicates the genetic diversity. Ne varied between 2.154 (ASB02) and 6.966 (ATH05), with a mean of 4.40 ± 2.21. For all the analyzed samples, the Na is higher than Ne, which indicates a relatively high genetic diversity. The polymorphic information content (PIC) was calculated for each locus and ranged from 0.36 (locus ASB02) to 0.98 (locus AHT05), which has the highest number of alleles per locus in the present study. The average PIC in our populations was 0.696. Thirteen microsatellites (ASB23, HMS02, COR058, HMS03, HMS20, COR007, HTG07, COR018, COR071, COR082, HTG06, LEX54 and AHT05), having a PIC value higher than the threshold of (0.5). Additionally, four loci (HMS07, VHL209, ASB02 and HTG10) showed moderate polymorphism (PIC \> 0.25) ([Table 4](#animals-10-01093-t004){ref-type="table"}). The observed heterozygosity (H~O~) per locus was 0.418 (COR082) to 0.857 (AHT05), 0.658 on average. The expected heterozygosity per locus was 0.438 (HMS07) to 0.884 (AHT05), 0.670 on average. Mean H~O~ and H~E~ were higher than 0.418 for all loci. However, the value of H~O~ for 7 loci (ASB23, COR058, HMS03, ASB02, HTG07, COR082 and AHT05) was lower than the value of H~E~, indicating an excess of homozygosity. The highest F~IS~ value was observed in marker COR082 (0.2959), while the lowest F~IS~ was recorded for locus HMS07 (−0.0602). The maximum and minimum F~IT~ values were found in markers COR082 and HMS07, respectively. F~ST~ values ranged from 0.0000 to 0.1955, and the average values of F~IS~, F~ST~ and F~IT~ were 0.0194, 0.0192 and 0.0382 accordingly. Mean F~ST~ (0.0192) was moderate to low while H~S~ (0.683) was relatively high. Obtained overall D~ST~ value describing the diversity between breeds was 0.014. The average coefficient of gene differentiation (G~ST~) over the 17 loci was 0.020 ± 0.037 (*p* \< 0.01). The G~ST~ values for single loci ranged from −0.004 for LEX54 to 0.162 for COR082. Nei's gene diversity index (H~t~) for loci ranged from 0.445 (ASB02) to 0.890 (AHT05), with an average of 0.696. The presence of null alleles, defined as non-amplifying alleles, due to mutations at PCR priming sites, causes overestimation of both F~ST~ and genetic distance values. The null allele frequencies ranged from 0.000 (VHL209, ASB02) to 0.1894 (HTG06). The null allele frequencies in the studied microsatellite loci were below 20% ([Table 4](#animals-10-01093-t004){ref-type="table"}). The lowest and highest null allele frequencies were 0.000 (VHL209, ASB02) and 0.1894 (HTG06), respectively.
The interbreed genetic distance, or F~ST~ values of pairwise comparisons among the Turkish donkey populations are shown in [Figure 2](#animals-10-01093-f002){ref-type="fig"}. In some cases, negative values were observed, and these equate to zero F~ST~ values. Our F~ST~ values fall into a small range, 0.00--0.056 (varying from white, and light to dark blue colors in [Figure 2](#animals-10-01093-f002){ref-type="fig"}).
The neighbour-net phylogeny drawn from Reynold's genetic distances ([Figure 3](#animals-10-01093-f003){ref-type="fig"}) visualizes the relationships between Turkish donkey populations. Populations that shared close genetic relationships were placed on different branches that originated from the same basal node. It identifies four distinct clusters, which are clearly separated, i.e., (I) from the SAR-EAR-MRM region donkey populations, (II) and (III) from the AER-MRD region donkey populations and (IV) from the MRM, BSR, MDR, CAR and AER region donkey populations in Turkey ([Figure 3](#animals-10-01093-f003){ref-type="fig"}). The phylogeny of Reynold's distances was similar to that generated using the Nei's D~A~ distances ([Supplementary Table S1](#app1-animals-10-01093){ref-type="app"}).
The analysis of molecular variance (AMOVA) is a useful tool to check how the genetic diversity is distributed within and among populations, whose structure is quantified by F~ST~. We analyzed different possible structures by creating and comparing different population groups. We ran the analysis under two hypotheses:
Hypothesis (1) seven groups according to the geographical distribution, i.e., group 1: The Marmara region (MAR) populations (KIR, CAT, MAL); group 2: The Black Sea region (BSR) populations (MER, TOK, KAS); group 3: The Aegean region (AER) populations (KUT, MUG, AYD); group 4: The Central Anatolia region (CAR) population (KON); group 5: The Mediterranean region (MDR) populations (ISP, KAH, ANT), Eastern Anatolia region (EAR) population (KAR) and group 7: South East Anatolian region (SAR) populations (MAR, SAN).
Hypothesis (2) four groups according to the Reynold's genetic distances distribution, i.e., group 1: MRM region (KIR, CAT), SAR region (SAN, MA) and EAR region (KAR) populations; group 2: AER region (KUT) population and MDR region population (ISP); group 3: AER region population (AYD) and MDR region population (KAH); group 4: MRM region population (MAL), BSR region populations (MER, TOK, KAS), AER region population (MUG), CAR region population (KON) and MDR region population (ANT).
The [Table 5](#animals-10-01093-t005){ref-type="table"} reports the results for the AMOVA analysis according to two hypotheses. The results highlight that most of the observed variance is due to differences within individuals. The Hypothesis (1) AMOVA ([Table 5](#animals-10-01093-t005){ref-type="table"}) analyses results showed that the variation among groups, among populations within groups, among individuals within populations, and within individuals were 1.07%, 0.96%, 1.69% and 96.29%, respectively. Variance components among groups and among individuals within populations were significant (*p* \< 0.001) for all the studied loci ([Table 5](#animals-10-01093-t005){ref-type="table"}), demonstrating significant geographical distribution in studied donkey populations. Furthermore, variance component among populations within groups and within individuals were significant (*p* \< 0.05). The Hypothesis (2) AMOVA analyses results showed that the variation among groups, among populations within groups, among individuals within populations, and within individuals were 2.16%, 0.49%, 1.68% and 95.67%, respectively. Variance components among groups, among individuals within populations and within individuals were significant (*p* \< 0.001) for all the studied loci demonstrating significant Reynold's genetic distances distribution in studied donkey populations ([Table 5](#animals-10-01093-t005){ref-type="table"}). Furthermore, variance component among populations within groups were significant (*p* \< 0.05).
The populations' structure ([Figure 4](#animals-10-01093-f004){ref-type="fig"}) was analyzed using Bayesian clustering analysis to determine the number of clusters (K) present in the populations, permitting the identification of differences among populations and hidden substructures within them. The genetic structure of each population was determined based on admixture level for each donkey individual using correlated allele frequencies model implemented within the STRUCTURE software. When the number of ancestral populations varied from K = 1 to 20, the largest change in the log of the likelihood function (ΔK) was when K = 2 ([Figure 4](#animals-10-01093-f004){ref-type="fig"}). The results for K = 2 ([Figure 4](#animals-10-01093-f004){ref-type="fig"}) indicate a clear separation between Clade I (KIR, CAT, KAR, MAR, SAN) and Clade II (MAL, MER, TOK, KAS, KUT, KON, ISP, ANT, MUG, AYD and KAH) populations. In [Figure 4](#animals-10-01093-f004){ref-type="fig"}, each individual is represented by a single vertical line broken into K colored segments. The mixed colors with proportional lengths represent the admixture level for predefined populations of K2.
4. Discussion {#sec4-animals-10-01093}
=============
In this study, 20 microsatellite markers (AHT05, ASB02, ASB17, ASB23, COR007, COR018, COR022, COR058, COR071, COR082, HMS02, HMS03, HMS07, HMS20, HTG06, HTG07, HTG10, LEX54, LEX73 and VHL209) were used for genetic characterizing the population genetic structure and genetic diversity of 16 donkey population that cover the 7 geographical regions in Turkey. The ASB17, COR022 and LEX73 loci were excluded from the statistical analysis. The COR022 and LEX73 loci failed to amplify in all the samples and did not provide data for reliable analysis while the ASB17 marker was monomorphic (91 bp) for all examined animals. Similar results were reported in the Balkan donkey populations \[[@B35-animals-10-01093]\]. This study is the first systematic large-scale study of different geographical regions populations from Turkey by using the microsatellites.
The 17 microsatellite analysis revealed relatively high level of genetic diversity between individuals, but no high significant differences in the main genetic characteristics of the geographical region's population (MRM, BSR, AER, CAR, MDR, EAR, SAR): number of alleles (N~a~), effective number of alleles (N~e~), and expected and observed heterozygosities. These results are comparable to the previous values reported in Balkan donkeys \[[@B35-animals-10-01093]\], Spanish donkeys \[[@B36-animals-10-01093]\] and Catalonian donkeys \[[@B37-animals-10-01093]\]. In terms of mean number of alleles, the genetic variability observed in the 16 Turkish donkey populations was lower than that reported in Catalonian donkey breed \[[@B37-animals-10-01093]\], five Spanish breeds \[[@B36-animals-10-01093]\], three Croatian donkey populations \[[@B38-animals-10-01093]\], 15 indigenous Chinese donkey breeds \[[@B39-animals-10-01093],[@B40-animals-10-01093],[@B41-animals-10-01093],[@B42-animals-10-01093]\], Balkan donkeys \[[@B35-animals-10-01093]\] and Tunisian donkeys \[[@B43-animals-10-01093]\], but higher than that observed in the seven indigenous Italian donkey breeds \[[@B44-animals-10-01093],[@B45-animals-10-01093],[@B46-animals-10-01093],[@B47-animals-10-01093]\].
The results of microsatellite polymorphism revealed relatively high degree of heterozygosity in the Turkish donkey populations investigated in this study. Among Turkish donkey populations, the H~E~ ranged from 0.6294 (ISP) to 0.6983 (ANT), which showed a comparable level to the previous values reported in Spanish donkeys \[[@B36-animals-10-01093]\], Catalonian donkey breeds \[[@B37-animals-10-01093]\], Croatian coast donkey populations \[[@B48-animals-10-01093]\], Balkan donkey breeds \[[@B35-animals-10-01093]\], Tunisian donkeys \[[@B43-animals-10-01093]\], Chinese donkey breeds \[[@B39-animals-10-01093],[@B40-animals-10-01093],[@B41-animals-10-01093],[@B42-animals-10-01093]\] and was more diversified than Italian \[[@B44-animals-10-01093],[@B45-animals-10-01093],[@B46-animals-10-01093],[@B47-animals-10-01093]\] and American donkeys \[[@B49-animals-10-01093]\]. This finding indicates that there are appreciable differences in the level of genetic variability among 16 Turkish donkey populations.
F~IS~ index indicates the excess of homozygosity in a subpopulation and, with reference to molecular markers, informs if a pattern of reduction in diversity owing to several causes exists. In this study, F~IS~ ranged from a minimum of −0.0557 in KAS to a maximum of 0.0923 in KIR population, whereas F~IS~ was statistically significant only for KIR breeds due to the deficiency of heterozygosity. The highly significant (*p* \< 0.001) F~IS~ value (0.0923) revealed a rather high inbreeding degree within populations. The heterozygote deficiency found in the KIR population, could be due to the higher rate of inbreeding, to the population subdivision (Wahlund effect), and to the presence of "null alleles" (non-amplifying alleles).
Null alleles, defined as nonamplifiable alleles due to mutations in the PCR binding site, cause only a single allele to peak like a homozygote, thus cause erroneous readings. These alleles cause overestimation of both F~ST~ and genetic distance values. It was reported by Dakin and Avise \[[@B50-animals-10-01093]\] that null allele frequencies below 0.20 have no significant effect on paternity tests. When the null allele frequencies obtained are examined, it is seen that the null allele frequency values of 17 microsatellites to be studied are below 0.20. The lowest and highest null allele frequencies were 0.000 (VHL209, ASB02) and 0.1894 (HTG06), respectively. Taking this value into consideration, it has been demonstrated that the studied loci can be safely used in paternity tests.
Private alleles are alleles that are found only in a single population among a broader collection of populations. These alleles have proven to be informative for diverse types of population-genetic studies. These private alleles are present in greater numbers in differentiated donkey breeds \[[@B36-animals-10-01093],[@B38-animals-10-01093],[@B42-animals-10-01093]\]. There were 13 private alleles among Turkish donkey breeds and most of the private alleles (ten) were at low frequencies of below 5%. Three alleles unique to KAH (0.115), MAL (0.050) and AYD (0.083) showed a frequency that exceeded 5%. In the present study, these alleles were consistent with those found by other authors \[[@B36-animals-10-01093],[@B38-animals-10-01093],[@B42-animals-10-01093]\], although we observed a higher value in the province of KIR and KAR, which is genetically similar to these two populations than the other provinces. Most of the KIR population (60%), samples are collected from the donkey farm in Kırklareli. In this farm, the individuals were collected from Eastern and South Eastern Anatolian region of Turkey.
PIC is a parameter indicative of the degree of informativeness of a marker. The PIC value may range from 0 to 1. In the studied Turkish donkey population, the average PIC value was 0.696 ranging from 0.3600 (ASB02) to 0.9800 (AHT05). When PIC \> 0.5, 0.5 \> PIC \> 0.25, and PIC \< 0.25, it indicates the locus has high polymorphism, moderate polymorphic, and low polymorphism, respectively \[[@B51-animals-10-01093]\]. Thirteen microsatellites (ASB23, HMS02, COR058, HMS03, HMS20, COR007, HTG07, COR018, COR071, COR082, HTG06, LEX54 and AHT05), having a PIC value higher than the threshold of 0.5 \[[@B51-animals-10-01093],[@B52-animals-10-01093]\], seemed to be highly informative and can be used in quantifying the genetic diversity and also in paternity studies in Turkish donkey population. Additionally, four loci (HMS07, VHL209, ASB02 and HTG10) showed moderate polymorphism (PIC \> 0.25). PIC values calculated in the present investigation were comparable with those reported by Aranguren -- Mèndez et al. \[[@B36-animals-10-01093]\] in 5 endangered Spanish donkey breeds (0.20--0.85), Ivankovic et al. \[[@B38-animals-10-01093]\] in 3 Croatian donkey populations (0.36--0.78), Bordonaro et al. \[[@B46-animals-10-01093]\] in Pantesco and two Sicilian autochthonous donkey breeds (0.146--0.796), Matassino et al. \[[@B47-animals-10-01093]\] in two Italian autochthonous donkey breeds (0.1918--0.8522), Zhang et al. \[[@B40-animals-10-01093]\] in 10 Chinese donkey breeds (0.7218--0.7967), Stanisic et al. \[[@B35-animals-10-01093]\] in Balkan donkey breeds (0.07--0.84) and by Zeng et al. \[[@B42-animals-10-01093]\] in Chinese donkey breeds (0.1489--0.8670). The variability in PIC values found in literature may be due to different microsatellite markers used in the studied populations. In the present study, the high PIC values prove that the microsatellite markers used are highly polymorphic and can be well utilized for studying the genetic diversity in Turkish donkey populations.
In this study, the mean value of between-population diversity value (D~ST~), coefficient of gene diversity (G~ST~) and Nei gene diversity (H~T~), were determined as 0.014, 0.020, and 0.696, respectively. The global mean of the genetic diversity value (D~ST~) indicated that the low diversity among 16 Turkish donkey populations studied. Nei's gene diversity values (H~T~) was considerably lower than Zhang et al. \[[@B40-animals-10-01093]\] in Chinese donkey breeds, but similar to Aranguren---Mèndez et al. \[[@B36-animals-10-01093]\] in 5 endangered Spanish donkey breeds. The average G~ST~ value obtained from overall loci pointed out that 2% of total genetic variation resulted from the differences between the populations. In all other respects, it can be said that 98% genetic variation is caused by the difference between individuals. All studied loci showed a not significant deviation from the Hardy-Weinberg Equation. Null allele frequencies were lower than the reported value (20%) by Dakin and Avise \[[@B50-animals-10-01093]\]. These results indicated that the microsatellite markers studied may be safely used in genetic diversity studies in Turkish donkey populations.
According to all the pairwise differences (Slatkins linearized F~ST~) in this study, the distribution of F~ST~ showed low genetic divergence (0.000 \< F~ST~ \< 0.05) among populations in general. The F~ST~ comparison values obtained were significant in 70 pairwise calculations (*p* \< 0.05; *p* \< 0.01; *p* \< 0.001). The highest level of differentiation was observed between SAN--MAL, KAR--TOK and KUT--TOK populations (F~ST~ \> 0.05) and the lowest between CAT--KIR, KON--MAR, KAS--MER, ANT--KAS and ANT--KON breeds (F~ST~ = 0.000), respectively. Neighbor-net representing the Reynolds distance confirmed these findings; Cluster II (KUT -- ISP) and Cluster II (AYD -- KAH) groups clustered in an intermediate position between the Cluster I (CAT, KIR, MAR, KAR, SAN) and Cluster IV (MER, MUG, KON, ANT, KAS, MAL, TOK). The F~ST~ value of Turkish donkey populations detected in this study was similar to the value of American donkeys \[[@B49-animals-10-01093]\], Chinese donkeys \[[@B42-animals-10-01093]\], but lower than that of donkeys in the Europe \[[@B45-animals-10-01093],[@B46-animals-10-01093]\], Near East and northeast Africa \[[@B53-animals-10-01093]\].
An AMOVA was carried out to investigate the relative contribution of different factors to the observed genetic variability, with each factor considered in a separate analysis, i.e., seven groups according to the geographical prevalence (MAR, BSR, AER, CAR, MDR, EAR and SAR), four groups according to the Reynold's genetic distances distribution (1st: MRM region (KIR, CAT), SAR region (SAN, MA) and EAR region (KAR) populations, 2nd: AER region (KUT) population and MDR region population (ISP); 3rd: AER region population (AYD) and MDR region population (KAH); 4rd group: MRM region population (MAL), BSR region populations (MER, TOK, KAS), AER region population (MUG), CAR region population (KON) and MDR region population (ANT)). AMOVA analysis results indicate that the majority of the observed variance is due to differences among individuals within populations. The most part of the variation is observed within the individuals (96.29% Hypothesis 1 and 95.67% Hypothesis 2) whereas the differences among groups represent only the 1.07% and 2.16% of the variation, respectively. These results are similar to a wide range of studies \[[@B38-animals-10-01093],[@B45-animals-10-01093],[@B54-animals-10-01093]\]. Among groups, among populations within groups, among individuals within populations were also a significant source of variation (*p* \< 0.001, *p* \< 0.05), although substantially smaller than the within individual's component.
In this study the analysis with the STRUCTURE programme revealed that Turkish donkey populations were grouped into two lineages when K = 2 ([Figure 4](#animals-10-01093-f004){ref-type="fig"}). Cluster I included SAN, KAR, MAR, KIR and CAT populations and Cluster II gathered MUG, ANT, KON, KAS, MAL, TOK and MER breeds, while other donkey populations (KUT, ISP, AYD and KAH) appeared to be the contact zone between both clusters, as individuals had mixed lineages. The STRUCTURE analysis results support the neighbour-net dendrogram results, as well as F~ST~ and genetic distance results. Our results provide a broad perspective on the extant genetic diversity and population structure of Turkish donkey populations.
5. Conclusions {#sec5-animals-10-01093}
==============
Genetic diversity is the main component of the adaptive evolution mechanism because of its preeminent role for the long-term survival probability of all species. In summary, our results suggested the relatively high genetic diversity of 16 Turkish donkey populations and brought an insight in the structure of the analyzed populations. This study is the first attempt towards a comprehensive genetic characterization of Turkish donkey populations. Despite the decreasing population size, the genetic diversity of Turkish donkey population seems still conserved. Nevertheless, further studies should be conducted to deeply evaluate the genetic variability of the Turkish donkey breeds. Furthermore, the results of this study can be utilized for future breeding strategies and conservation.
This study was a part of the MSc thesis of Selen YATKIN in Tekirdağ Namık Kemal University, Graduate School of Natural Applied Sciences. Ethical approval for this study was obtained from Tekirdağ Namık Kemal University Animal Experiment Local Ethics Committee (NKU-HADYEK Decision No: 08/2015). The authors want to thank four anonymous reviewers for comments on this work.
The following are available online at <https://www.mdpi.com/2076-2615/10/6/1093/s1>, Table S1: F~ST~ values among Turkish donkey populations and significance (below diagonal) and pairwise D~A~ genetic distances (above diagonal).
######
Click here for additional data file.
Conceptualization, M.İ.S., S.A., F.Ö. and E.Ö.Ü.; sampling, F.Ö., E.Ö.Ü., E.K.G., S.G., S.K. and S.Y.; methodology, F.Ö., E.Ö.Ü., E.K.G. and S.G.; formal analysis, F.Ö., E.Ö.Ü., E.K.G; investigation, S.Y., F.Ö., E.Ö.Ü; data curation, F.Ö. and E.Ö.Ü.; writing---original draft preparation, F.Ö. and E.Ö.Ü.; writing---review and editing, E.K.G., S.G., S.K., M.İ.S. and S.A.; visualization, F.Ö. and E.Ö.Ü.; supervision, F.Ö.; project administration, F.Ö.; funding acquisition, F.Ö. All authors have read and agreed to the published version of the manuscript.
This research was funded by TUBITAK (The Scientific and Technological Research Council of Turkey), grant number 215O555, project leader Fulya Özdil.
The authors declare no conflict of interest.
{ref-type="table"}.](animals-10-01093-g001){#animals-10-01093-f001}
{#animals-10-01093-f002}
{#animals-10-01093-f003}
{#animals-10-01093-f004}
######
The regions, locations, the geographical locations with the number of sample sizes.
------------------------------------------------------------------------------------------
Region Locations Geographical\ Number of Samples
Location
------------------------------- ----------------- --------------- ------------------- ----
**Marmara**\ Kırklareli 41°51′N 27°19′E 30
**(MRM)**
İstanbul-Çatalca 41°06′N 28°30′E 20
Tekirdağ-Malkara 40°52′N 26°57′E 10
**Black Sea**\ Amasya-Merzifon 40°53′N 35°32′E 30
**(BSR)**
Tokat 40°12′N 36°27′E 10
Kastamonu-Cide 41°50′N 32°54′E 10
**Aegean**\ Kütahya 39°21′N 30°01′E 10
**(AER)**
Muğla 36°37′N 29°26′E 19
Aydın 37°44′N 28°01′E 6
**Central Anatolia**\ Konya 37°38′N 32°26′E 15
**(CAR)**
**Mediterranean**\ Isparta 37°49′N 30°44′E 10
**(MDR)**
Kahramanmaraş 37°30′N 36°57′E 13
Antalya 36°50′N 30°13′E 30
**Eastern Anatolia**\ Kars 40°36′N 43°07′E 30
**(EAR)**
**South East Anatolia (SAR)** Mardin 37°18′N 40°44′E 40
Şanlıurfa 37°10′N 38°50′E 31
**Total** **314**
------------------------------------------------------------------------------------------
Marmara Region (MRM): Kırklareli---KIR, İstanbul/Çatalca---CAT, Malkara---MAL; Black Sea Region (BSR): Amasya/Merzifon---MER, Tokat---TOK, Kastamonu---KAS; Aegean Region (AER): Kütahya---KUT, Muğla---MUG, Aydın---AYD; Central Anatolian Region (CAR): Konya---KON; Mediterranean Region (MDR): Isparta---ISP, Kahramanmaraş---KAH, Antalya---ANT; Eastern Anatolia Region (EAR): Kars---KAR; South East Anatolian Region (SAR): Mardin---MAR, Şanlıurfa---SAN.
animals-10-01093-t002_Table 2
######
Genomic characteristics of the 17 microsatellite loci \*; chromosome numbers, primer sequences with the fluorescent labels, annealing temperatures, GenBank accession numbers, allele size ranges, repeat motifs and the references.
---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Name(s) Chromosome Primer Sequence (5'→ 3') Annealing\ GenBank\ Allele Range\ Repeat Motif Multiplex\ Ref.
Temperature\ Accession\ (bp) Group
(°C) Number
--------- ------------ ---------------------------------- -------------- ------------ --------------- -------------------------------------------- ------------ -----------------------------
HMS07 1 F:FAM-CAGGAAACTCATGTTGATACCATC\ 58 X74636 160--178 (AC)~2~(CA)n 1 \[[@B8-animals-10-01093]\]
R: TGTTGTTGAAACATACCTTGACTGT
ASB23 3 F: NED-GAGGTTTGTAATTGGAATG\ 58 X93537 128--154 (TG)~17~ 1 \[[@B9-animals-10-01093]\]
R: GAGAAGTCATTTTTAACACCT
HTG07 4 F: PET-CCTGAAGCAGAACATCCCTCCTTG\ 58 AF142607 272--297 (GT)n 3 \[[@B10-animals-10-01093]\]
R: ATAAAGTGTCTGGGCAGAGCTGCT
AHT05 8 F: PET-ACGGACACATCCCTGCCTGC\ 58 \- 130--146 (GT)n 3 \[[@B11-animals-10-01093]\]
R: GCAGGCTAAGGGGGCTCAGC
HMS03 9 F:NED-CCAACTCTTTGTCACATAACAAGA\ 58 X74632 150--170 (TG)2(CA)2TC(CA)n/(TG)2(CA)2TC(CA)Nga(CA)5 2 \[[@B8-animals-10-01093]\]
R: CCATCCTCACTTTTTCACTTTGTT
HMS02 10 F: NED-ACGGTGGCAACTGCCAAGGAAG\ 58 X74631 218--238 (CA)n(TC)~2~ 1 \[[@B8-animals-10-01093]\]
R: CTTGCAGTCGAATGTGTATTAAATG
COR058 12 F: VIC-GGGAAGGACGATGAGTGAC\ 56 AF108375 210--230 i(TG)23 1 \[[@B12-animals-10-01093]\]
R: CACCAGGCTAAGTAGCCAAAG
VHL209 14 F: FAM-TCTTACATCCTTCCATTACAACTA\ 56 Y08451 84--96 (AC)17 2 \[[@B13-animals-10-01093]\]
R: TGATACATATGTACGTGAAAGGAT
ASB02 15 F: FAM-CCTTCCGTAGTTTAAGCTTCTG\ 54 X93516 222--254 (GT)24 2 \[[@B14-animals-10-01093]\]
R: CACAACTGAGTTCTCTGATAGG
HMS20 16 F: VIC-TGGGAGAGGTACCTGAAATGTAC\ 58 \- 116--140 \- 2 \[[@B15-animals-10-01093]\]
R: GTTGCTATAAAAAATTGTCTCCCTAC
COR007 17 F: PET-GTGTTGGATGAAGCGAATGA\ 56 AF083450 156--170 (GT)~18~ 2 \[[@B16-animals-10-01093]\]
R: GACTTGCCTGGCTTTGAGTC
LEX54 18 F: FAM-TGCATGAGCCAATTCCTTAT\ 55 AF075656 165--177 (AC)~18~ 3 \[[@B17-animals-10-01093]\]
R: TGGACAGATGACAGCAGTTC
HTG06 15 F:FAM-CCTGCTTGGAGGCTGTGATAAGAT\ 58 \- 84--106 (TG)n 4 \[[@B18-animals-10-01093]\]
R: GTTCACTGAATGTCAAATTCTGCT
HTG10 21 F: VIC-CAATTCCCGCCCCACCCCCGGCA\ 54 AF169294 93--113 (TG)n/TATC(TG)n 3 \[[@B10-animals-10-01093]\]
R: TTTTTATTCTGATCTGTCACATTT
COR018 25 F: FAM-AGTCTGGCAATATTGAGGATGT\ 56 AF083461 249--271 İ(CA)~18~ 4 \[[@B16-animals-10-01093]\]
R: AGCAGCTACCCTTTGAATACTG
COR071 26 F: PET-CTTGGGCTACAACAGGGAATA\ 56 AF142608 190--202 İ(TG)~17~/İ(AG)~18~ 4 \[[@B19-animals-10-01093]\]
R: CTGCTATTTCAAACACTTGGA
COR082 29 F: GCTTTTGTTTCTCAATCCTAGC\ 58 AF154935 192--226 (AG)~n~ 4 \[[@B20-animals-10-01093]\]
R: TGAAGTCAAATCCCTGCTTC
---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
\* ASB17, LEX73 and COR022 were excluded from the study.
animals-10-01093-t003_Table 3
######
Main diversity parameters from each Turkish donkey populations included in this study for a panel of 17 microsatellite markers: the number of individuals (N), the mean number of alleles (N~a~), the number of effective alleles (N~e~), the number of private alleles (N~p~), observed heterozygosity (H~o~), unbiased expected heterozygosity (H~e~) and deficit of heterozygotes (F~IS~).
Region ^1^ Location ^1^ N N~a~ Ne N~p~ H~O~ H~E~ F~ıs~
------------ -------------- ------- ------- ------- -------- -------- --------- ---------------
**MRM** **KIR** 30 6.706 3.684 4 0.6266 0.6893 0.0923 \*\*\*
**CAT** 20 6.294 3.712 \- 0.6882 0.6946 0.0094
**MAL** 10 5.118 3.274 1 0.6379 0.6806 0.0660
**BSR** **MER** 30 6.294 3.618 \- 0.6720 0.6851 0.0194
**TOK** 10 5.000 3.207 \- 0.6588 0.6548 −0.0065
**KAS** 10 4.941 3.284 \- 0.7118 0.6762 −0.0557
**AER** **KUT** 10 4.588 3.215 \- 0.6941 0.6755 −0.0291
**MUG** 19 5.824 3.457 1 0.6563 0.6409 0.0242
**AYD** 6 4.529 3.209 1 0.7139 0.6863 0.0424
**CAR** **KON** 15 5.471 3.399 \- 0.6667 0.6830 0.0247
**MDR** **ISP** 10 5.118 3.219 \- 0.6610 0.6294 0.0503
**KAH** 13 5.529 3.599 1 0.6886 0.6670 0.0325
**ANT** 30 6.471 3.587 1 0.6887 0.6983 −0.0142
**EAR** **KAR** 30 6.471 3.764 3 0.6919 0.6819 0.0148
**SAR** **MAR** 40 6.647 3.731 1 0.6888 0.6791 0.0143
**SAN** 31 6.412 3.803 \- 0.6863 0.6831 0.0046
^1^ Marmara Region (MRM): Kırklareli---KIR, İstanbul/Çatalca---CAT, Malkara---MAL; Black Sea Region (BSR): Amasya/Merzifon---MER, Tokat---TOK, Kastamonu---KAS; Aegean Region (AER): Kütahya---KUT, Muğla---MUG, Aydın---AYD; Central Anatolian Region (CAR): Konya---KON; Mediterranean Region (MDR): Isparta---ISP, Kahramanmaraş---KAH, Antalya---ANT; Eastern Anatolia Region (EAR): Kars---KAR; South East Anatolian Region (SAR): Mardin---MAR, Şanlıurfa---SAN. \*\*\* *p* \< 0.001
animals-10-01093-t004_Table 4
######
Genetic diversity parameters estimated for 17 microsatellite markers over all populations. TNA---total number of alleles; Na---mean number of alleles; Ne---effective number of alleles; PIC---polymorphic information content for each locus; F statistics (Fis, Fst, Fit); H~O~---observed heterozygosity; H~E~---expected heterozygosity; H~T~---Nei's gene diversity; Hs---diversity within breeds; D~ST~---diversity between breeds; G~ST~---coefficient of gene differentiation; HWE---test for significant deviation from Hardy-Weinberg equilibrium with the hypothesis of the heterozygote excess; SR---Size range of the observed allele in bp.
Locus TNA Na Ne PIC F~IS~ F~ST~ F~IT~ H~O~ H~E~ H~T~ Hs D~ST~ G~ST~ HWE SR F(null)
---------- ----- ------- ------- ------- --------- -------- --------- ------- ------- ------- ------- -------- -------- ----- ---------- ---------
HMS07 7 3.938 2.988 0.390 −0.0602 0.0201 −0.0389 0.449 0.438 0.447 0.436 0.011 0.025 NS 160--178 0.0341
ASB23 9 5.250 4.586 0.740 0.0169 0.0103 0.0270 0.737 0.757 0.763 0.758 0.005 0.006 NS 153--169 0.0106
HMS02 10 5.813 4.243 0.960 0.0058 0.0137 0.0195 0.716 0.708 0.716 0.708 0.007 0.010 NS 221--243 0.0087
COR058 11 6.438 4.921 0.760 0.0239 0.0128 0.0364 0.747 0.762 0.778 0.763 0.016 0.020 NS 187--209 0.0143
HMS03 8 4.438 3.276 0.540 0.0538 0.0034 0.0570 0.579 0.615 0.623 0.616 0.007 0.011 NS 149--169 0.0525
VHL209 9 4.313 3.228 0.450 −0.0100 0.0140 0.0041 0.473 0.467 0.476 0.466 0.010 0.021 NS 76--92 0.0000
ASB02 4 2.500 2.154 0.360 −0.0241 0.0008 −0.0232 0.443 0.445 0.445 0.446 −0.001 −0.002 NS 157--163 0.0000
HMS20 7 5.500 3.794 0.600 −0.0028 0.0000 −0.0032 0.666 0.663 0.665 0.663 0.001 0.002 NS 115--131 0.0097
COR007 7 5.375 4.588 0.710 0.0123 0.0124 0.0246 0.717 0.717 0.734 0.718 0.017 0.023 NS 165--177 0.0144
HTG07 11 8.813 6.164 0.810 0.0211 0.0033 0.0244 0.802 0.827 0.833 0.828 0.005 0.006 NS 136--158 0.0601
HTG10 9 7.250 5.321 0.480 −0.0041 0.0078 0.0038 0.796 0.787 0.799 0.787 0.012 0.015 NS 84--104 0.0583
COR018 11 7.188 5.625 0.800 −0.0198 0.0124 −0.0072 0.835 0.804 0.814 0.803 0.011 0.014 NS 252--276 0.0044
COR071 8 6.500 4.997 0.970 0.0125 0.0096 0.0220 0.756 0.755 0.765 0.755 0.010 0.013 NS 193--207 0.0361
COR082 6 4.563 3.955 0.650 0.2959 0.1955 0.4336 0.418 0.582 0.701 0.587 0.114 0.162 NS 214--224 0.1708
HTG06 4 3.938 3.741 0.660 −0.0007 0.0081 0.0073 0.721 0.711 0.716 0.711 0.005 0.007 NS 78--84 0.1894
LEX54 9 5.688 4.234 0.970 −0.0003 0.0000 −0.0031 0.679 0.675 0.673 0.675 −0.002 −0.004 NS 168--192 0.0278
AHT05 12 9.625 6.966 0.980 0.0167 0.0047 0.0213 0.857 0.884 0.890 0.885 0.004 0.005 NS 130--158 0.0264
All loci 142 5.714 \- 0.696 0.0194 0.0192 0.0382 0.658 0.670 0.696 0.683 0.014 0.020
animals-10-01093-t005_Table 5
######
Hierarchical AMOVA analysis among the 16 Turkish donkey populations.
Source of Variation Variance Component (Estimate) Variance (%) Fixation Index *p*-Value ^a^
-------------------------------------------------------- ------------------------------- -------------- ---------------- ---------------
Hypothesis 1: Geographical distribution
Among groups 0.06303 (V~a~) 1.07 Φ~IS~: 0.01728 0.0000 \*\*\*
Among populations within groups 0.05650 (V~b~) 0.96 Φ~SC~: 0.00966 0.0254 \*
Among individuals within populations 0.10009 (V~c~) 1.69 Φ~CT~: 0.01066 0.0000 \*\*\*
Within individuals 5.69268 (V~d~) 96.29 Φ~IT~: 0.03714 0.0137 \*
Hypothesis 2: Reynold's genetic distances distribution
Among groups 0.12828 (V~a~) 2.16 Φ~IS~: 0.01728 0.0000 \*\*\*
Among populations within groups 0.02932 (V~b~) 0.49 Φ~SC~: 0.00504 0.0284 \*
Among individuals within populations 0.10009 (V~c~) 1.68 Φ~CT~: 0.02156 0.0000 \*\*\*
Within individuals 5.69268 (V~d~) 95.67 Φ~IT~: 0.04331 0.0000 \*\*\*
^a^: \*\*\* *p* \< 0.001; \* *p* \< 0.05.
[^1]: These authors contributed equally to this manuscript.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Eleanor Tomlinson Worked With a Coach on Her Accent for
Exclusive interview with Eleanor Tomlinson on Season 2 of the PBS drama series POLDARK which also stars. POLDARK: Eleanor Tomlinson on Season 2 – Exclusive Interview.Hollywood Life Logo Image. 2016 2:29PM EST. Louis Tomlinson & Eleanor Calder: His Call To Deliver The News His Son Was Born.Eleanor Tomlinson in Solace London at the 2016 BAFTA Craft Awards.
109 best Eleanor Tomlinson images on Pinterest | Arm party
ELEANOR TOMLINSON - Historical Resources
The photo gallery "Eleanor Tomlinson for Vogue UK (September 2016)" has been viewed 23 times.Eleanor May Tomlinson (born 19 May 1992) is an English actress, known for her roles as Princess Isabelle in Jack the Giant Slayer (2013), Isabel Neville in The White.
2016 Fall / Winter; VIEW MORE - No other sets available. Eleanor TOMLINSON; Model; THE CREATIVE SUGGESTIONS. KAREN MILLEN.Eleanor Tomlinson. 34K likes. Official Facebook fan page for British actor Eleanor Tomlinson.LONDON - MAY 8, 2016: Eleanor Tomlinson arrives for the House Of Fraser British Academy Television Awards at the Royal Festival Hall on May 8, 2016 in London - buy.
Poldarked: Demelza's Songs on New 'Poldark' Album
Eleanor Tomlinson sports the looks and talent to be an. British actress Eleanor Tomlinson driven to fight for appealing roles. 2016 at 12:01 AM Sep 24,.On yesterday(April 24th) Eleanor Tomlinson posed for pictures before she headed inside the 2016 BAFTA Craft Awards which was held at The Brewery in London. If you.
BAFTA Awards 2016: When And Where To. Will you be tuning into the 2016 BAFTAs?. 2015 BAFTA TV Awards: Best Dressed? Eleanor Tomlinson, Rochelle Humes.Poldark’s leading lady, Eleanor Tomlinson, takes you on a delightful, behind the scenes tour of the set of Nampara, Ross and Demelza’s home.
Alleycats | Netflix
Eleanor Tomlinson on IMDb: Movies, Tv, Celebrities, and more.Eleanor Tomlinson‘s floral hat takes center stage during the 2016 Investec Derby Festival held at Epsom Racecourse on Saturday afternoon (June 4) in Epsom, England. The 24-year-old Poldark actress is serving as one of the ambassadors for this years’ race. PHOTOS: Check out the latest pics of Eleanor Tomlinson.
POLDARK star Eleanor Tomlinson says she’s definitely red-dy for her role as heroine Demelza. Eleanor, 24, is always eye-catching on screen thanks to her character.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
+------------+-------------------+
| Melanoma | R Documentation |
+------------+-------------------+
Survival from Malignant Melanoma
--------------------------------
Description
~~~~~~~~~~~
The ``Melanoma`` data frame has data on 205 patients in Denmark with
malignant melanoma.
Usage
~~~~~
::
Melanoma
Format
~~~~~~
This data frame contains the following columns:
``time``
survival time in days, possibly censored.
``status``
``1`` died from melanoma, ``2`` alive, ``3`` dead from other causes.
``sex``
``1`` = male, ``0`` = female.
``age``
age in years.
``year``
of operation.
``thickness``
tumour thickness in mm.
``ulcer``
``1`` = presence, ``0`` = absence.
Source
~~~~~~
P. K. Andersen, O. Borgan, R. D. Gill and N. Keiding (1993) *Statistical
Models based on Counting Processes.* Springer.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Effort to Stop Gulf Gusher Delayed Over Sediment
The government's point man for the Gulf oil spill says there's been a delay in a procedure that will help stop the gusher for good.
Coast Guard Adm. Thad Allen said Friday that debris was found in the bottom of the relief well that must be fished out before crews can pump mud into the busted well in a procedure known as a static kill.
The sediment settled there last week when crews popped in a plug to keep the well safe ahead of Tropical Storm Bonnie.
They found it as they were preparing for the static kill and now they have to remove it. They had hoped to start the static kill as early as Sunday, but removing debris will take 24 to 36 hours.
After the static kill comes the bottom kill, where the relief well will be used to pump in mud and cement from the bottom.
THIS IS A BREAKING NEWS UPDATE. Check back soon for further information. AP's earlier story is below.
BILOXI, Miss. (AP) — BP's incoming CEO said Friday that it's time for a "scaleback" of the massive effort to clean up the Gulf of Mexico oil spill, but he added that the commitment to make things right is the same as ever.
Tens of thousands of people — many of them idled fishermen — have been involved in the cleanup, but more than two weeks after the leak was stopped there is relatively little oil on the surface, leaving less work for oil skimmers to do.
Bob Dudley, who heads BP's oil spill recovery and will take over as CEO in October, said it's "not too soon for a scaleback" in the cleanup, and in areas where there is no oil, "you probably don't need to see people in hazmat suits on the beach."
He added, however, that there is "no pullback" in BP's commitment to clean up the spill. Dudley was in Biloxi to announce that former Federal Emergency Management Agency chief James Lee Witt will be supporting BP's Gulf restoration work.
With the northern Gulf of Mexico largely off-limits to fishing, BP's cleanup program has been the only thing keeping many fishermen working. Losing those jobs would make the region all the more dependent on the checks BP has been writing to compensate fishermen and others who have lost income because of BP's offshore oil spill, the worst in U.S. history.
Many people have complained about long waits and other problems in processing claims, and Dudley conceded that BP lacks expertise in handling claims. He said the company hopes to turn that work over to an independent administrator soon.
"It's because of that lack of competence on our part ... that we want to bring in a professional," Dudley said.
Suggestions that the environmental effects of the spill have been overblown have increased as oil has disappeared from the water's surface, though how much of the oil remains underwater is a mystery. Dudley rejected efforts to downplay the spill's impact, saying, "Anyone who thinks this wasn't a catastrophe must be far away from it."
BP is hiring Witt, FEMA director under President Bill Clinton, and his public safety and crisis management consulting firm. BP did not say how much Witt would be paid.
Witt said he wants to set up teams along the Gulf to work with BP to address long-term restoration and people's needs.
"Our hope is that we can do it as fast as we can," Witt said. "I've seen the anguish and the pain that people have suffered after disaster events. i have seen communities come back better than before."
The gusher set off by an April 20 oil rig explosion spewed between 94 million gallons and 184 million gallons into the Gulf before a temporary cap stopped the flow July 15.
A procedure intended to ease the job of plugging the blown-out well for good could start as early as the weekend, according to Retired Coast Guard Adm. Thad Allen, the government's oil-spill response chief. The so-called static kill can begin when crews finish work drilling the relief well 50 miles offshore that is needed for a permanent fix.
The static kill, which involves pumping heavy mud into the busted well from the top, is on track for completion some time next week. Then comes the bottom kill, where the relief well will be used to pump in mud and cement from the bottom; that process will take days or weeks, depending on the effectiveness of the static kill.
The government's point man for the Gulf oil spill says there's been a delay in a procedure that will help stop the gusher for good.Coast Guard Adm. Thad Allen said Friday that debris was found in the bottom of the relief well that must be fished out before crews can pump...
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Elmer and butterfly, David McKee
"As Elmer the patchwork elephant is strolling through the jungle, he hears a cry for help. A butterfly is trapped. Elmer easily frees her. She promises to help Elmer. But how can a butterfly ever help an elephant?"--
"As Elmer the patchwork elephant is strolling through the jungle, he hears a cry for help. A butterfly is trapped. Elmer easily frees her. She promises to help Elmer. But how can a butterfly ever help an elephant?"--
| null |
minipile
|
NaturalLanguage
|
mit
| null |
After fighting off an attempted robbery last weekend, workers at the Duluth Godfather’s Pizza on London Road have discovered a newfound closeness.
Call it bonding by fear.
"We’re like a family now, and we take care of each other," said David Tyson, 24, who stood bravely between the pizza parlor’s cash register and a man believed to be armed last Saturday night.
According to a criminal complaint filed in St. Louis County District Court this week, five people — three men and two women — entered Godfather’s and ordered food at about 5 p.m.
Store manager Pete Boyechko said the group appeared intoxicated. He told them no food would be prepared unless they produced money to pay for it. When no one offered any cash, the group left the building, at 1623 London Road. Minutes later, however, they returned and attempted to write a check, but didn’t produce proper identification.
The group left the restaurant again, but only for a short time. Soon, one man, identified as Maurice Antonio Garcia, 30, of Crystal, Minn., returned and began arguing with Tyson, the restaurant supervisor.
"The guy was pounding on the register and punched the soda fountain. David stepped in front of him," said Michelle McDonell, 18, who works at the restaurant with her brother, Joe. "The guy was right in his face. When the guy got the register open, David pushed him back and closed it. The guy was swinging his arms the whole time."
Meanwhile, Boyechko called 911 from a back office.
"I heard these smacks and I thought someone was getting hit," he said.
The noise was actually the cash register being struck.
According to restaurant workers and the criminal complaint, Garcia went behind the counter and after the cash register. He was yelling and swearing at Tyson.
Garcia also allegedly put his hand in his trousers, leading restaurant workers to believe he was armed with either a gun or knife. It turned out he had no weapon.
Tension was high. There was no one else in the restaurant at the time.
"I thought one of us wasn’t going to go home that night," Boyechko said.
But Tyson, who has lived in Duluth for only a few months, stood his ground and pushed Garcia away, preventing a potential robbery.
During the altercation, another man in the group re-entered the store and tried to drag Garcia away. The two finally left, but were soon picked up by police, along with the three others in the group.
Police responded in force to the restaurant with at least nine squads.
"They were fortunate the police were in the immediate area and were able to respond quickly," said Sgt. Eric Rish of the Duluth Police Department.
The police presence was a huge relief to the five Godfather’s workers on duty that night.
"When I saw the police lights, my stress level went way down," a relieved Boyechko said.
Supervisor David Tyson, one of five employees at Godfather’s Pizza on London Road who collectively foiled a robbery attempt, got public kudos for his actions. (Rick Scibelli / News-Tribune)
——–
Talking about the incident Thursday, restaurant workers say they are proud of the way they handled the situation — and proud of Tyson, in particular.
For his courage, Tyson was named the restaurant’s employee of the month; his name appears on a sign outside inviting customers inside to meet the man of the hour.
Rish, however, said the group was lucky. He doesn’t recommend that type of response to a potential robbery.
"Businesses should all have a plan in place in case of incidents like this," he said, adding that, in most cases, it’s best to let the robbers take the money and let police handle it from there.
"Don’t be a hero,"’ Rish said.
The workers were scared and acted on impulse, Boyechko said. They had never been in a situation like this before. In fact, Boyechko said, "it’s the last thing I would think would happen here."
But Tyson had been through a similar situation. He was a victim of a home-invasion robbery in Minneapolis last year and knows how to handle himself.
"I wasn’t scared," Tyson said. "I didn’t think he had a gun, either. I’ve been robbed before and I know how people act."
Garcia was the only one charged in the incident and is in St. Louis County Jail. He’s been charged with attempted aggravated robbery and criminal damage to property. He could face a 12-year prison sentence if convicted on both charges.
His bail has been set at $4,000.
Although they were frightened, the five Godfather’s workers on duty that night — Boyechko, Tyson, Michelle McDonell, Joe McDonell and Zeb Hodel — say the experience has brought them closer.
"We’re a lot closer; we’re trying to spend more time together outside of work," Boyechko said.
Tyson said he relied solely on instinct in his response to the threat of robbery.
"I knew my co-workers had not been in that kind of situation before," he said. "I did what I felt I needed to do."
It was a scary moment for the employees, all of them in their teens or early 20s.
"It was very hectic," Michelle McDonell said. "My little brother (Joe, 15) was up front and I wanted to make sure he was OK. Everybody ended up being OK."
The attempted robbery has been the talk of the restaurant all week. "I’m just glad everything turned out all right," Michelle McDonell said.
——-
Godfather’s Pizza on London Road closed just a few months later, in August 2001. The building is now occupied by China Cafe.
Share your memories of the London Road Godfather’s Pizza by posting a comment.
The Lakehead Service Center opened in 1961 on London Road in Duluth’s Endion neighborhood. After remodeling, additions and a name change, it’s still there today, operating as London Road Car Wash. Cars exiting the car wash today still use the original exit, as seen in these photos.
This photo is undated, but it may be from a couple years after it opened:
———————–
Here is an article that previewed the opening of the service center, from July 28, 1961:
CAR SERVICE CENTER TO OPEN
By Garth Germond, Duluth Herald staff writer
Mayor E. Clifford Mork and Robert B. Morris, Duluth Chamber of Commerce executive secretary, will take part in a ribbon-cutting ceremony to mark the opening of the new Lakehead Service Center Saturday.
George Finch, president of Lakehead Service Co., and William Soules, vice president and general manager, say their new center – located at 16th Avenue East and London Road – is the first of its kind in the state.
They describe it as a "supermarket" for auto owners, offering complete mechanical repairs and maintenance, gas and oil service and a high speed car wash. The car wash will be opened next week.
Soules says that the car wash will employ a variety of new-type automatic equipment. It will use a mild detergent under high pressure to watch cars; a 10-horsepower vacuum cleaner to clean interiors; and a 120-horsepower blower for fast drying.
The center occupies about a half-block of space. Its white-painted concrete-block buildings were erected by United General Constructors, Inc. C. Everett Thorsen was the architect and Elmer M. Peterson the consulting engineer.
Soules and Finch announced appointment of Donald E. Anderson, former operator of the Highland Service Center, as head of their repair department, and Leonard Sathers, a veteran Duluth gasoline service station operator, as service manager. Pure Oil Co. products will be featured.
Lemon Drop Hill is as much a part of Grandma’s Marathon as the annual race’s finish line on Canal Park Drive. The marathon’s 33rd running takes place Saturday.
The hill, which sits near 26th Avenue East on London Road in Duluth, was named after the Lemon Drop restaurant, which used to reside at 2631 London Rd. until it closed during the expansion of Interstate 35 around 1990.
News Tribune reporters Kevin Pates and Mark Stodghill have each taken credit for the name, Pates said.
He made reference to the hill in a Grandma’s Marathon race story in 1983 “when England’s Gerry Helme won and was in a battle with American John Tuttle. Tuttle made a move on Lemon Drop Hill, just past the 22-mile mark, but Helme caught him with less than two miles remaining.”
The reporters, both avid runners, took a cue from the Boston Marathon’s famed Heartbreak Hill, which rests at about the 21-mile mark.
More photos of the area around the Lemon Drop restaurant can be found at a previous Attic post from March 23, 2008.
Looking northeast on London Road from 25th Avenue East, September 1988. (Bob King / News-Tribune)
Here are a couple of photos showing businesses near the intersection of London Road and 26th Avenue East, before the Interstate 35 extension was built – the same area that was shown in an aerial view in a previous post. The Lemon Drop restaurant is gone now, but its name lives on each year when Grandma’s Marathon runners climb the hill shown in these photos. That rise was dubbed "Lemon Drop Hill" by the News Tribune sports staff during marathon coverage in the late 1970s.
About this blog
On the third floor of the News Tribune building, in a back room with warped wooden floors, glass-block windows and just a bit of dust, sit rows of file cabinets stuffed with photos, clippings and rolls of microfilm documenting the history of Duluth, Superior, the Northland and beyond. On this blog we'll feature some of these items -- sometimes related to a current news story, more often at random.
The News Tribune attic has microfilm going back to the start of the various predecessors of the News Tribune; indexed files of clippings going back to the 1960s; and indexed files of photos mainly from the 1970s, 1980s and early 1990s. More recent stories and photos are accessible in electronic archives.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Using binary type with NEST (elasticsearch)
I want to have a binary parameter stored in my Elasticsearch server from my C# code.
None of the types I tried to use in my index class translates to it.
Is there a way to explicitly instruct my program to store a binary, say from a byte array (could be converted to other types of course)?
Alternatively, is there a way to configure the parameter not to be stored (like with the Json property "stored": false)? As the main problem for me is the copying and indexing of that big parameter (not ideal but sufficient)
Update: I tried to downgrade my NEST version to 1.6.1 to use the attribute
[ElasticProperty(Name = "Data", Type = FieldType.Binary, Store = false)]
public byte[] Data { get; set; }
But when I save a document with that property, it still insists to map a string (I check by running GET mydb/_mapping in my Sense plugin)
A:
Elasticsearch supports binary types which can be set using attributes within NEST using the following in NEST 1.x
public class Document
{
[ElasticProperty(Type = FieldType.Binary, Store = false)]
public string Binary { get; set; }
}
or
public class Document
{
[Binary(Store= false)]
public string Binary { get; set; }
}
in NEST 2.x
Note that the binary type should be sent to Elasticsearch as a base 64 encoded string (1.x docs or 2.x docs). You could handle the conversion in your POCO type with something like (for 2.x)
public class Document
{
[JsonIgnore]
public byte[] BinaryBytes { get; set;}
[Binary]
[JsonProperty("binary")]
public string Binary
{
get
{
return BinaryBytes != null ? Convert.ToBase64String(BinaryBytes) : null;
}
protected set
{
if (value != null) BinaryBytes = Convert.FromBase64String(value);
}
}
}
client.CreateIndex("index-name", c => c
.Mappings(m => m
.Map<Document>(d => d
.AutoMap()
)
)
);
which yields
{
"mappings": {
"document": {
"properties": {
"binary": {
"type": "binary"
}
}
}
}
}
Then you would set BinaryBytes on the model, and NEST would send the contents of Binary in the request. You could also make Binary a private property if it would be less confusing for users of the model.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Put a DENT in your Stress: Exercise
Exercise and physical activity, similar to food provides information to your body. The information given to your body through exercise or physical activity can be health promoting or health depleting. It can help decrease your stress and balance your hormones; or, it can increase your stress and imbalance your hormones. Having grown up an athlete swimming and playing on tennis, golf, basketball, field hockey, volley ball and lacrosse teams; I am aware of both the beneficial and stressful aspects of exercise. Also, being an avid outdoor person who has led canoeing and hiking trips into the wilderness for weeks at a time, I am aware of both the beneficial and stressful aspects of physical activity. All physical movement, whether it be training for a competition or participating in recreational activities, is stressful to your system. Whether this stress is beneficial or not depends on a number of things.
First, pushing ourselves or increasing the intensity of physical activity or exercise is a necessary stress to get stronger and build our endurance. But pushing ourselves or increasing intensity should be done gradually in a step wise approach as one gets “in shape”. The lifestyle of the “the weekend warrior” who spends Saturday and Sunday trashing their body but does no exercise during the week is not a healthy lifestyle. This pattern actually increases a person’s cortisol, which sets them up for more injuries, depletes their energy and throws off all metabolic and hormonal balance.
As I have aged and reached the peak of my career, I have become very familiar with time constraints that prevent me from getting to the gym and staying in shape for the level of activity I want to do on the weekends or during my vacations. I learned this lesson well in 2014 during a vacation week in Maine at Baxter State Park. During this vacation I hiked, canoed, and fished every day. The final hike of that week was a twelve-hour trek up Pamola Peak, across the knifes edge to Baxter Peak, and then down the saddle trail back to Chimney Pond Campground. I awoke the next morning with whole body swelling that took a couple of days to slowly subside. Being a physician, I realized that the swelling was due to rhabdomyolysis; which occurs when your kidneys cannot keep up with filtering the amount of myoglobin (a protein), released from your muscles during intense exercise. I had pushed my body beyond what it could handle at that time and my kidneys were blocked up as a result. Luckily, the answer was to rest and drink lots of water to dilute the concentration of the myoglobin and allow my kidneys to correct the imbalance I had caused. While this situation did not require a trip to the emergency room, it does not mean it did not cause any problems or was without consequence.
We must realize that balance is key when it comes to stress, hormones and exercise. We require exercise and physical activity in our lives to be healthy and we should push ourselves to get stronger, but this should happen always with balance in mind. We have been led to believe that it takes long hours of high intensity, gut wrenching, and sweat drenching exercise to get in shape and be healthy, but this is just not true! This level of exercise increases cortisol and throws off hormonal balances and is actually depleting to the system. If you visualize in your mind a marathon runner, you see a very thin and depleted appearing physique. If you now visualize a sprinter, you see a lean but muscular and strong physique. As we age past 30 years old, we start to lose bone and muscle mass unless we do something to maintain it and build it up. If someone is struck by an acute infection or illness they need the proteins from their muscles to give them the energy and endurance to fight the illness. Therefore, it is very important to maintain muscle mass as we age. Muscles also require more glucose from our food and as a result utilize more calories. Therefore, maintaining muscle mass will keep insulin and blood sugar in better balance and keep the development of fat cells down. The over development of fat cells not only widens one’s belly, but also throws off one’s hormonal balance. For example, fat cells can produce and store excess estrogen as well as toxins and both put us at increased risk of multiple chronic diseases.
So, what type of exercise, for how long, and at what intensity is healthy? Well, besides always keeping balance in mind, the second most important point is weight resistance exercise is a very basic form of exercise that everyone can do no matter what their starting point and it does not take long to do.
Lifting weights at home or in a gym three times per week for 20 to 30 minutes with 10 to 20 minutes of aerobic activity over 12 weeks will build muscle, energy and endurance and provide improved hormonal balance in anyone. The amount of weight one lifts after doing some warm up sets or exercises should be to “Failure”. This means that if you are doing 10-12 repetitions of bicep curls; for example, the last repetition should feel very difficult as if you could not do another. The purpose of lifting the weight during each exercise to failure is to maintain the exercise at a high intensity, but for a short burst of time. The intensity is also kept at a high level by not resting for more than one minute between each set or exercise. The point of this program is to stress, but not overstress your body in short, high intensity bursts of exercise.
And, if you do the math 40 minutes of the right type of exercise three times per week adds up to only 2 hours per week; and if you keep this up for 12 weeks you will have improved your health and put a DENT in your stress in only 24 hours!
My DENT curriculum is taught to clients over a 4 to 6-month period and includes an entire section on exercise. The “E” portion of my program educates clients on exercise physiology and helps them understand why they may not have been successful with their exercise in the past. It also emphasizes that exercise is not just for those who know they can, but also for those who think they can’t. My program has 3 levels, so a person starts at a basic level and once comfortable builds on their success with more advanced levels. The DENT curriculum also includes learning through reading, videos and live supportive classes.
The answer to putting a DENT in your stress through Exercises is to realize that you must move to decrease stress, but that you also must not over do because the right balance is key. A variety of movement is also key. Walking, dancing, hiking, biking, rowing, are all great forms of aerobic exercises; but, adding weight resistance exercise 3 days per week for 20-30 minutes at a high intensity will make all the difference in the world in putting a DENT in your stress.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.