text
stringlengths 2
1.05M
| repo_name
stringlengths 5
101
| path
stringlengths 4
991
| language
stringclasses 3
values | license
stringclasses 5
values | size
int64 2
1.05M
|
|---|---|---|---|---|---|
Candy Wedding Favors and Wedding Candy
Serving the guests attending our wedding ceremony with something unique, interesting and different will give an unforgettable sense for them. Giving candies will sound a bit childish. But I think this idea would be very creative. You can make your guests amazed by letting them take candy wedding favors home. Candy wedding favors are always a crowd pleaser. They look very sweet and pretty.
candy wedding favors
You can package them in favor boxes, gift bags and tie with pretty ribbons. They can also function to dress up your wedding table decorations. They can serve as wedding centerpieces as well. For more traditional candy party favors, you can try personalized chocolate bars, mint tins, or Jordan almonds wrapped in tulle. Take a look at these candy favors for your ideas and inspiration.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Information has traditionally been manually classified to aid potential readers in locating works of interest. For example, books are typically associated with categorization information (e.g., one or more Library of Congress classifications) and academic articles sometimes bear a list of keywords selected by their authors or editors. Unfortunately, while manual classification may be routinely performed for certain types of information such as books and academic papers, it is not performed (and may not be feasibly performed) for other types of information, such as the predominantly unstructured data found on the World Wide Web.
Attempts to automatically classify documents can also be problematic. For example, one technique for document classification is to designate as the topic of a given document the term occurring most frequently in that document. A problem with this approach is that in some cases, the most frequently occurring term in a document is not a meaningful description of the document itself. Another problem with this approach is that terms can have ambiguous meanings. For example, documents about Panthera onca, the British luxury car manufacturer, and the operating system might all be automatically classified using the term “Jaguar.” Unfortunately, a reader interested in one meaning of the term may wind up having to sift through documents pertaining to all of the other meanings as well.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
This study will 1) determine alterations in autonomic control of cardiovascular function associated with gender and healthy aging, 2) identify specific abnormalities in autonomic function associated with hypotension and syncope, and 3) examine the effects of high carbohydrate meals on autonomic regulation of postprandial cardiovascular dynamics.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Wednesday, September 16, 2015
Good News! I have managed to lose about 3 pounds - that's without exercise and just trying to eat a little better. Not a fast loss by any means, but still...I am happy with it.
Bad News - the reason for the lack of exercise is because I have been sick for about a month, and am now at home with bronchitis and suspected pneumonia. I had a chest X-ray done so we'll know for sure soon. In any case, I thought I'd take the time to write a very brief update before collapsing back into my bed.
Trying out Blonde!!!
LilySlim Weight charts
Link my Blog!
My Babes!
My Sweet Girl
My Boy
About Me
I'm a Credit Union employee from Ontario, and more importantly, a mom to my young son, Donovan, and my sweet daughter, Aaralyn. Being a mother is the most incredible experience of my life! I also love to craft, bake, get my sweat on, and meet new people! Thanks for stopping by!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
I would love to commiserate with some turtles. I can't help but keep calculating in my head how little I've lost over the last 4+ months (15 lbs...IF I can get back to my lowest weight last week). I've been dieting since September 13 (LC) and started JUDDD November 13. Six months and 24 lbs, again based on my lowest weight last week, which I am now above. Seems I take 2 steps forward and 4 back. I love this WOE, so I don't want to change, but geez I could use some encouragement. How do you handle the slow losses, gains and stalls and still have the right mind set to carry on? Quitting is not an option for me. I have spent too long being miserable and obese, ashamed and hiding from the world...THIS is my year come hell or high water!!!
__________________
"Never give up on a dream just because of the length of time it will take to accomplish it. The time will pass anyway."
24 pounds in six months averages to almost a pound a week. Most of my weight loss, no matter how hard I worked, averaged a pound a week. You just keep adding it up, week by week, and pretty soon you start building something impressive!
Think about it. Those 24 pounds equals six bags of sugar. Imagine carrying around six sugar bags all day, how tired you would get. You've put those six bags of sugar down, and you're on your way to losing more.
I know you'd like to lose faster. Show me a person who wouldn't! I whined and complained plenty about the pace of my losses. It always seems like someone else is losing faster than you are. But your losses are at a reasonable, healthy pace and the more you keep at it, the longer you do it, the closer you get to your goal. You CAN do this.
__________________
"before" from the bad old days.
"Success occurs in clusters and is born in generosity" --Julia Cameron
I agree with Luna. I crept along and never lost more than a pound a week and many weeks not even that much. One whole month I lost zero. But it adds up and I am down 42 pounds and am maintaining quite nicely. Took me nine months to get to my first goal and since then I have lowered my goal weight twice. I have lost 2 pounds this month and am very happy with that.
Oh Cindy, how I can relate! I started off with a very nice loss my first month JUDDDing and have been frustrated at how slow things have been going for me since. While I've just passed my second month anniversary, I have only lost 5 pounds this second month and with as much as I have to lose, that seems to be a very small number to see. What I try to concentrate on are the non-weight related benefits of the WOL. For me, they are very significant and have become more important to me than the weight loss itself. We need to remember that JUDDD is not a quick loss plan like some of the other ones, but rather a lifestyle and way of living that is maintainable in perpetuity. I've spent so many years being the "heavy" girl that I try and remind myself that any progress, no matter how small it seems, is in fact, progress! I'm "thinner" now than I've been in quite a while, so does it matter that I don't lose it fast? Really, it doesn't; and that is easy to say but frustrating to live with. One thing that I need to do a better job on is to journal more and see where I can identify patterns more easily. It helps me to read the posts from our successful JB'S who are at maintenance and to look at their before and after pictures. I love to read their maintenance posts and look forward to one day joining in! I like to read Carly's "bounce" record. When you look at the losses and bounces day to day, they look frustrating, but when you look at the record as a whole, it's so impressive! It's also helpful to read Stephdray's weekly posts. If you haven't read them, go back over them. If you have, re-read them. Lot's of wonderful motivation there, and Steph is a slower loser like us, too. And don't forget.....your own tagline that I just LOVE and get motivation from "Never give up on a dream just because of the length of time it will take to accomplish it. The time will pass anyway."
I would love to commiserate with some turtles. I can't help but keep calculating in my head how little I've lost over the last 4+ months (15 lbs...IF I can get back to my lowest weight last week). I've been dieting since September 13 (LC) and started JUDDD November 13. Six months and 24 lbs, again based on my lowest weight last week, which I am now above. Seems I take 2 steps forward and 4 back. I love this WOE, so I don't want to change, but geez I could use some encouragement. How do you handle the slow losses, gains and stalls and still have the right mind set to carry on? Quitting is not an option for me. I have spent too long being miserable and obese, ashamed and hiding from the world...THIS is my year come hell or high water!!!
Cindy I feel ya. In Apr. of 2011 I just started eating 1000 cal a day diet and was physically working my butt off at my job. I went from 204 to my lowest 147, but in Jan of 2012 it started creeping back up til I got back up to 164.5 this January. I found the JUDDD thread in Feb of this year which I had at that point got back down to 159 when I started JUDDD, but I understand the frustration. Although I'm fairly new to JUDDD I am no stranger to dieting. It's not fair that it seems to take for-ev-er to come off but seems seconds to put back on. You just keep plugging at it and it sounds like you're pretty determined and not a quitter. I have to have those "self" talks from time to time and just say, "this is how it's gonna be like it or not". lol I've wanted to quit before too, but then I think of all those DD's and I think I don't want to have worked so hard on those days for nothing. Besides, the other ways I've tried it just seemed like the scales were just plain ol defiant and were not going to budge! You hang in there and we'll all be here being your cheerleaders!
If you had gained 24 pounds in the last 6 months you would think that is a lot. I know that doesn't help, but it is the truth. Sometimes simply maintaining is winning! Anyhow, you don't realise how inspiring you are to people like me. I have been whining about my weight for the last 20 years, jumping from diet to diet. If I don't lose fast enough then it doesn't work! I have become a professional quitter. It just goes on and on! You have taken charge, you are winning! Your not beaten until you give up and you sure aren't giving up.
Hi fellow slow losers! Yeah I lost it slow, but as long as you get there that's all that matters and don't give up. Plus in the end losing slow helps with loose skin, it gives your body a chance to adjust more. I lost 100 pounds over the course of 3 yrs, not really fast but that doesn't matter as long as you don't give up! Plus I don't have as much loose skin as some who lose it really fast so that's a plus. 33 pounds a year gives the skin plenty of time to go back down and adjust. The race is not won by the swift but by those who endure and don't give up.
__________________
~The woman came from a man's rib. Not from his feet to be walked on. Not from his head to be superior, but from his side to be equal. Under his arm to be protected, and next to his heart to be loved. ~
If you had gained 24 pounds in the last 6 months you would think that is a lot. I know that doesn't help, but it is the truth. Sometimes simply maintaining is winning! Anyhow, you don't realise how inspiring you are to people like me. I have been whining about my weight for the last 20 years, jumping from diet to diet. If I don't lose fast enough then it doesn't work! I have become a professional quitter. It just goes on and on! You have taken charge, you are winning! Your not beaten until you give up and you sure aren't giving up.
I know how you feel shepheka. I have felt like a mouse that has ridden every diet roller coaster in the park! I realistically was beginning to think that I would NEVER lose the weight and just to face it that I was getting older and except being fat. I know of one year I that I stayed in the same 10 lb range and I was exercising, drinking the water, etc... and I got on the LCF website hoping I could find others doing low carb that could encourage me to try the LC thing. Which I had tried numerous times and failed. That's where I stumbled on JUDDD and am sooooo glad I did. It is slow moving, but praise the Lord they are MOVING!! yay! It felt like someone threw me a life preserver! My weight was going up, up, up and I was terrified that I couldn't get a handle on it. I feel so grateful for this woe and all the friends I've made here. It gives me great comfort hearing from friends who truly know what I feel like on the inside when I say how discouraged I am. And it makes me so happy when I make a post and see the sweet smiley's and comments others have left me. What a great place to be!!!!!
24 pounds in six months averages to almost a pound a week. Most of my weight loss, no matter how hard I worked, averaged a pound a week. You just keep adding it up, week by week, and pretty soon you start building something impressive!
Think about it. Those 24 pounds equals six bags of sugar. Imagine carrying around six sugar bags all day, how tired you would get. You've put those six bags of sugar down, and you're on your way to losing more.
I know you'd like to lose faster. Show me a person who wouldn't! I whined and complained plenty about the pace of my losses. It always seems like someone else is losing faster than you are. But your losses are at a reasonable, healthy pace and the more you keep at it, the longer you do it, the closer you get to your goal. You CAN do this.
Yes, when you look at it like that, that's not bad. So for me that equaled to average about 1 pound every 2 weeks.
Quote:
Originally Posted by shepheka
If you had gained 24 pounds in the last 6 months you would think that is a lot. I know that doesn't help, but it is the truth. Sometimes simply maintaining is winning! Anyhow, you don't realise how inspiring you are to people like me. I have been whining about my weight for the last 20 years, jumping from diet to diet. If I don't lose fast enough then it doesn't work! I have become a professional quitter. It just goes on and on! You have taken charge, you are winning! Your not beaten until you give up and you sure aren't giving up.
That's exactly what I was going to say! That's a good way to put it! If someone gained 33 pounds a year and gained 100 pounds in 3 years that would seem like a whole lot fast!
__________________
~The woman came from a man's rib. Not from his feet to be walked on. Not from his head to be superior, but from his side to be equal. Under his arm to be protected, and next to his heart to be loved. ~
I know how you feel shepheka. I have felt like a mouse that has ridden every diet roller coaster in the park! I realistically was beginning to think that I would NEVER lose the weight and just to face it that I was getting older and except being fat. I know of one year I that I stayed in the same 10 lb range and I was exercising, drinking the water, etc... and I got on the LCF website hoping I could find others doing low carb that could encourage me to try the LC thing. Which I had tried numerous times and failed. That's where I stumbled on JUDDD and am sooooo glad I did. It is slow moving, but praise the Lord they are MOVING!! yay! It felt like someone threw me a life preserver! My weight was going up, up, up and I was terrified that I couldn't get a handle on it. I feel so grateful for this woe and all the friends I've made here. It gives me great comfort hearing from friends who truly know what I feel like on the inside when I say how discouraged I am. And it makes me so happy when I make a post and see the sweet smiley's and comments others have left me. What a great place to be!!!!!
Yes, this board and the people here have been a huge inspiration to me too!
__________________
~The woman came from a man's rib. Not from his feet to be walked on. Not from his head to be superior, but from his side to be equal. Under his arm to be protected, and next to his heart to be loved. ~
What great posts! You guys are such great inspiration! I love what you said Luna! Cindy, you have lost 24 pounds of sugar! Keep going! I always like to hear what Adi says, and kissa. Slow and steady wins the race. I think after this month, I will be uniting with the turtles too. Turtle-turtle lol
I know how you feel shepheka. I have felt like a mouse that has ridden every diet roller coaster in the park! I realistically was beginning to think that I would NEVER lose the weight and just to face it that I was getting older and except being fat. I know of one year I that I stayed in the same 10 lb range and I was exercising, drinking the water, etc... and I got on the LCF website hoping I could find others doing low carb that could encourage me to try the LC thing. Which I had tried numerous times and failed. That's where I stumbled on JUDDD and am sooooo glad I did. It is slow moving, but praise the Lord they are MOVING!! yay! It felt like someone threw me a life preserver! My weight was going up, up, up and I was terrified that I couldn't get a handle on it. I feel so grateful for this woe and all the friends I've made here. It gives me great comfort hearing from friends who truly know what I feel like on the inside when I say how discouraged I am. And it makes me so happy when I make a post and see the sweet smiley's and comments others have left me. What a great place to be!!!!!
My feelings exactly. My husband wonders why I come here. This is why! You all are my life preservers!
Cindy, There are lots of turtles here to keep you company! I can completely empathize. I guess we get so spoiled by the 1st couple of months when the loss is a lot faster that we increase our expectations accordingly. Like Adi says, quite a few of us have had months when we lost nothing! However, we did not give up because a ray of hope was/is always there that the loss will speed up again! Even though our NSVs (better health, looser clothes etc) tell us that things are happening for the better, we still want scale victories! PaperMoon is 100% right, your skin needs the time to recover too. To be honest, I don't want the haggard look that comes with a speedy weight loss! We all know that this WOE is the only life style change that is doable. We have to do it as none of us want to go back where we were! I am so glad you brought this to the forefront as it made me think about how I was feeling too and really analyze the situation objectively! What a great forum we have here, where we can find great inspiration from JB supporters, teachers and friends alike!
I hear ya! I am less than 10 lbs away from my goal and it is really slow going! As long as I keep at it and not give up then that's good enough for me. I will get there eventually. If you can believe it, I had 3 UDs in a row (oops) and just got on the scale expecting to see a 5 lb gain. I was shocked that I am only up about 1.2. I just need to get it back down by my weigh in on Thursday and I know I can do it with 2 good DDs. Even if I only lose .2 lbs this week it will be in step in the right direction. Just remember. The only way you can fail is to give up so just keep doing what you're doing
__________________
"The mind is everything. What you think, you become". -Buddha
Cindy, you, and you alone, know that if you are doing everything you can to work juddd, the weight will come off. It has been coming off and will continue to. If you think there is a way to tighten things up and that will make losses faster than try it, but there is nothing wrong with slower loss as long as the scale is eventually going down- which it is. You can do this! You are doing it!
If you had gained 24 pounds in the last 6 months you would think that is a lot. I know that doesn't help, but it is the truth. Sometimes simply maintaining is winning! Anyhow, you don't realise how inspiring you are to people like me. I have been whining about my weight for the last 20 years, jumping from diet to diet. If I don't lose fast enough then it doesn't work! I have become a professional quitter. It just goes on and on! You have taken charge, you are winning! Your not beaten until you give up and you sure aren't giving up.
This is so true!
Cindy, you are definitely not alone. We all are working hard and we tend to be so focused on the scale mainly because society bases how we look and feel on the numbers. Only you know the hardwork that it has taken to eliminate those never to return 24 pounds from your body. This is what I find so great about this LCF community. I see people meet their goals and I feel proud and focused. Then I see people who are stalled and I think "yes, it's not just me."
I'm down nine pounds in five weeks and at first I thought come on go away faster, but it took much longer than five weeks to get to be that "Big girl with the pretty face." Just keep up the great work and remember that you are definitely not alone.
Wow, what great responses!!! I am officially only down 22 lbs, and I realized that I actually started LCF at 204, so only 19 lbs in 6 months. So, about 0.3 lbs a week. I'm going to keep plugging along. This is life, after all.
__________________
"Never give up on a dream just because of the length of time it will take to accomplish it. The time will pass anyway."
Wow, what great responses!!! I am officially only down 22 lbs, and I realized that I actually started LCF at 204, so only 19 lbs in 6 months. So, about 0.3 lbs a week. I'm going to keep plugging along. This is life, after all.
Yes exactly! Just keep plugging along and in a year it will be at least 40 pounds lost and after 2 yrs a whopping 80 pounds lost, and after 3 yrs 120!
__________________
~The woman came from a man's rib. Not from his feet to be walked on. Not from his head to be superior, but from his side to be equal. Under his arm to be protected, and next to his heart to be loved. ~
Losing slowly sucks but it's better than gaining. According to my calorie tracking I am averaging between 1000 and 1100 daily calories. At my size the calorie deficit should be more than enough to lose one pound a week but I only lost .7 pounds per week in the last year. That's the difference between 36 pounds lost in the last twelve months and 52 pounds. I want my 16 pounds darn it!!!!
Yes exactly! Just keep plugging along and in a year it will be at least 40 pounds lost and after 2 yrs a whopping 80 pounds lost, and after 3 yrs 120!
Well, I only want to lose another 50 lbs, but I know what you're saying. I would be 84 lbs if I lost 120. I appreciate your wise advice, and your words have stayed with me throughout the day. I like that you are comfortable with your slow, steady losses, and also the fact that it may be better for our bodies too.
__________________
"Never give up on a dream just because of the length of time it will take to accomplish it. The time will pass anyway."
Tag, I lost 6 lbs the first two weeks, and only about 2 lbs a month since!Sometimes less, like this month. I did spend the first two weeks doing 5:2 though, so that might account for the loss of loss. However, at this rate, I'm wondering whether it matters.
ETA: Sorry, I go back and forth between being OK with the slow loss, or pretending to be , then here I go again, whinging.
__________________
"Never give up on a dream just because of the length of time it will take to accomplish it. The time will pass anyway."
I really don't get to frustrated. I know my body. It starts to change before the weight comes off and summer is coming so that is lots of exercise time. If I never lost another pound from here on out I would still be happy, sure beats being 39 lbs heavier!
At 186, I'm not happy with my losses yet. I mean, I am happy I'm not 207, but I would not be comfortable remaining obese. I am only 5'3.5 and smallish boned. I'm meant to be between 120-140. But, you're right, summer's around the corner and it will be much nicer to exercise!
__________________
"Never give up on a dream just because of the length of time it will take to accomplish it. The time will pass anyway."
If you had gained 24 pounds in the last 6 months you would think that is a lot.
What a fantastic perspective shifter!
Quote:
Originally Posted by ~PaperMoon~
Hi fellow slow losers! Yeah I lost it slow, but as long as you get there that's all that matters and don't give up. Plus in the end losing slow helps with loose skin, it gives your body a chance to adjust more. I lost 100 pounds over the course of 3 yrs, not really fast but that doesn't matter as long as you don't give up! Plus I don't have as much loose skin as some who lose it really fast so that's a plus. 33 pounds a year gives the skin plenty of time to go back down and adjust. The race is not won by the swift but by those who endure and don't give up.
Such great inspiration! (Can you tell I needed this topic?) The skin advantage is a really good point!
I've been losing slowly lately, and if I look at it from how far I still want to go it can be discouraging, but from another perspective, just that I'm still hanging in there is a win. This is the longest I've ever followed any WOE that I can remember, and at 8 months on JUDDD (nine total), instead of rapidly regaining what I've lost as I have in the past, I'm still going down! So slowly is starting to look pretty good, especially since I feel like I can follow the JUDDD plan for a long time to come. I am looking forward to maintenance! And you never know, things might pick up. Stay the course, my friends!
Oh Cindy my friend, we are twins. I think we must be! Similar starting weights,similar builds, similar weight loss, similar goals. I'm with you, I so desperately want to be down to 169 which would put me at "overweight" BMI instead of "Obese". I haven't been "overweight" since 2007!! I would be thrilled to be "overweight". I haven't been "normal" since 2002. I know this didn't happen overnight, however, and I don't expect it to come off overnight. Keep on plugging along my dear friend and "diet twin", we will both reach our goals. Jen
__________________
*****************************************My Potato Hacking JournalAll I ask is that you lead an evidence-based life.
Looking back It took me three years to slowly creep back up to 180 pounds. I had lost down to 144 years ago on lowfat lowcarb and did it in a couple of months. I just could not face the low calories and restricted food plan going into a summer fruit and veggie season so I did nothing until after Christmas 2012. I knew I could drop the weight quickly on LCLF but chose to do JUDDD instead and I am so glad I did. Fourteen months later and I am almost to my third goal of 135 which I never thought or even planned to see.
I Love JUDDD.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Fri December 23, 2016 - 9:30 AM
Phoenix, AZ, 2016
401 E. Jefferson
Visit one of the most impressive and unique Major League Baseball facilities in the country -- Chase Field, home of the 2001 World Champion Arizona Diamondbacks and the 2011 MLB All-Star Game. Chase Field has several unique...See More
Visit one of the most impressive and unique Major League Baseball facilities in the country -- Chase Field, home of the 2001 World Champion Arizona Diamondbacks and the 2011 MLB All-Star Game. Chase Field has several unique features including dbTV, one of the largest high definition video scoreboards in MLB, a retractable roof to keep fans cool during the summer months, the RamTrucks.com Pool in right field, the Coors Light Strike Zone, and several restaurants including Friday's Front Row and The Draft Room. Make the experience memorable and take a guided tour of Chase Field. Even if you've been to the ballpark before, you're sure to learn and see something new! Tours are conducted year-round, for both individuals and groups. Tour space is limited -- it is strongly recommended that you purchase tickets in advance to guarantee your spot! See Less
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Jo Koy exchanges laughs for Red Sox and lobster
Jo Koy is excited to come back to Boston, and the comedy crowds he’ll bring together are only part of the reason.
While he’s set to unleash his Break the Mold world tour at The Wilbur Theatre this weekend (April 27 and 28) for four shows — three of which are sold out, as of press time — the Washington state native is looking forward to indulging in a bit of New England-specific fixtures.
“I’m not gonna lie, the lobster is big deal for me when I get to travel to Boston,” Koy tells Vanyaland. “I’m also hoping to God that the Red Sox are playing while I’m there, because I’d love to catch another game [Editor’s note: they are]. There’s just so much to do around the city, and just getting out and walking around is a big thing for me when I’m there. There are some places that you kind of have to search for things to do, but Boston is one of those cities where you get to just walk around and experience what’s around you.”
While he may have his heart set on digging into some regional delicacy, the fact that most of his shows have sold out here makes the trip even more exciting for the comedy veteran.
“I love the feeling of seeing my shows sell out,” says Koy. “There’s nothing better than knowing, months in advance, that a venue sold out my show, because there’s this major feeling of relief, because I don’t have to worry about promoting the shows as much, and I just get to go into the city and make sure that those people laugh that night.”
A 29-year veteran of the comedy game, Koy is still grinding to raise the bar for himself any chance he gets. Following the popularity he garnered following his third special, Live from Seattle (a special he considers his “baby,” as he wrote, directed and sold it to Netflix himself) he knew he has to bring the heat with his new hour of material, and he’s pretty confident that he’s achieved that goal.
“I set the bar really high for myself following Live from Seattle, so now I have to jump over that bar, and that’s what this new hour is all about,” he adds. “That material in the Netflix special was funny, but this new stuff is way funnier, and I want to make sure my fans enjoy it.”
Making people laugh is always the mission for a stand-up comedian when he or she sets off on a tour, obviously. But Koy is looking to bring it a step further, and use his time on stages around the globe to encourage his fans, and himself in turn, to rise above the norm, and to let people know that they’re goals are not impossible to reach.
“You have to get away from just doing the regular things that you do, you have to break the mold,” stresses Koy. “Set those goals, and follow those dreams. That’s the real message I’m pushing with this new tour.”
Even with his acting career gaining traction (set for a 2019 release, a live-action re-telling of Anastasia features Koy playing the role of Vladimir Lenin), and the popularity of his podcast, The Koy Pond, and the love he has for the many opportunities those mediums have afforded him over the years, Koy is still all in when it comes to stand-up comedy, and he loves what the scene has evolved into over the course of his career.
“There are a lot of great comics doing great things on the road right now and I just love that,” he says. “The more, the merrier! I absolutely love stand-up, and I’m gonna do it until the day I die.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
There's lots of people/places talking about how to get this card to function. None of it works for me.
Most of it, has been along the lines of grabbing some broadcom stuff off a repo, then your drivers will be in the additional drivers page.
sudo apt-get install bcmwl-kernel-source sudo modprobe wl
That's sadly the only one I can remember trying (sorry, in and out of hospital, with lots of pain killers. Details are hard for me right now) But all things yield no results.
Ubuntu 17.10 64-bit budgie environment.
Thank you in advance to anybody who can help me not need this 200 foot cable, just to have internet.
Alright, first little update on my problem... Some further research on my own time, PCI ID 14e4:42a0 and BCM4360 are for my card, and reveal numerous amounts of information, most notably I've been looking through Installing Broadcom Wireless Drivers Nothing has managed to get the card to be read by the system. Windows can read it fine however, so I know it is in fact functional.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
We examined whether infants' preference for speech at 12 months is associated with autistic-like behaviors at 18 months in infants who are at increased risk for autism spectrum disorder (ASD) because they have an older sibling diagnosed with ASD and in low-risk infants. Only low-risk infants listened significantly longer to speech than to nonspeech at 12 months. In both groups, relative preference for speech correlated positively with general cognitive ability at 12 months. However, in high-risk infants only, preference for speech was associated with autistic-like behavior at 18 months, while in low-risk infants, preference for speech correlated with language abilities. This suggests that in children at risk for ASD an atypical species-specific bias for speech may underlie atypical social development.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Index
Identification:
Though
smaller
(26-30 inches, 66-77 cm) it is the same general size as Brown booby.
Has relatively longer tail than other boobies. Comes in several color
morphs, white, brown, white-tailed brown,
and white-tailed/white-headed. Typically several morphs nest in
the same colony. The brown
morph is the most common in our region. Because of adult plumage
variation individual birds are easily confused with Brown or Masked
boobies. Red feet and legs of adults are distinctive.
Adults
Sexes alike, no
seasonal plumage variation. Females larger than males. Polymorphic,
with different morphs often forming mixed pairs. Reach breeding age in
3-4 years. Live 20+ years, perhaps much longer.
Juveniles
Juvenile wholly
brown with yellowish-grey legs and feet. In all color morphs streaked
brownish at fledgling. Immatures also presents confusing plumage
patterns when in transition to various adult color morphs.
Alternative names
French: Fou à pieds rouges
Spanish: Bubia pices rojos
Systematics
Smallest of the
six species of boobies. Three subspecies recognized, nominate is found
in Atlantic basin. Size differences main distinguishing feature, while
color morph distribution is not generally influenced by subspecific
designations or geography.
Likely locations
Deserted
sparsely forested islands within general breeding range. Dispersed out
to sea by day, birds do not necessarily roost on natal islands.
Non-breeding individuals often roots in colonies of other seabird
species.
Distribution
Of the three species in the region,
this booby has the most restricted marine and breeding distribution in
our region with both adults and immatures remaining in the proximity of
nesting sites throughout the year. The Red-footed Booby is the least
likely to occur as a vagrant and does not seem to often be displaced by
hurricanes. Primarily in area of occurrence are its breeding islands
adjacent to the Caribbean Sea, but also off Brazil at South Trinidade
and Ferando de Noronha. Generally rare to absent from Gulf of Mexico,
rare vagrant to Atlantic coast of Southeastern United States. Absent from Bermuda
and known from only one small colony in the Bahamas.
Other subspecies occur in the tropical Pacific, and Indian Oceans and on islands in the seas north of Australia.
Biology
At sea
They feed by plunge diving, feeding mostly on flying fish and
squid. As in the other boobies because of their feeding behavior they
would all seem to be a prime species for by-catch of the long line
industry. Currently no reports, but this may be based on
misidentification with gannets which are reported as by-catch species.
Largest eye of any booby; may be linked to partially nocturnal habits.
At the nest
This booby builds nests in trees and shrubs, but when
they are not available (destruction of island plant communities by
goats for example) they will nest on the ground. October to May is the
general breeding season in the West Indies. Adult’s soft part breeding
colors fade after onset of nesting. Nearly all birds return to natal
islands to breed. One bird of pair remains with nest to prevent removal
of nest material by other boobies and frigates. Circular stick nest.
Single egg. Incubation 42-46 days, fledging 91-112 days. Young return
to nest site for 1-4 months and continue to be fed by adults.
Current Population
Atlantic
population: 12,710 pairs although many islands have not been surveyed recently.
Location
Colonies
Breeding Pairs
Bahamas
2
3
Cayman Islands
2
3824
Navassa
1
100
Puerto Rico
4
2004
US Virgin Islands
4
137
British Virgin Islands
1
1
Anguilla
1
2
Redonda
1
60
Guadeloupe
1
20
St. Vincent and the Grenadines
3
3002
Grenada
3
515
Trinidad and Tobago
2
414
Venezuela
7
1315
Colombian Islands
3
12
Honduras
1
1
Belize
1
1300
Mexico (Campeche Bank)
1
3
Total
38
12713
Conservation Status
Atlantic
population is of conservation concern, few nesting sites are protected,
and loss of one or two of the currently key breeding sites would
represent a large segment of the region’s population. Continuing to
decline at most sites that have recently been resurveyed. This species
needs to be monitored. The Little Cayman population
protected as a Ramsar Site and the size of that colony is increasing. Had been reduced by fishermen to
fewer than 100 pairs by 1990. Other populations have experienced
similar declines.
Conservation Needs
Loss of nesting habitat, and disturbance at nests is a major concern.
Feral goats and other introduced stock have destroyed vegetation on
many nesting islands. Harvesting wood for charcoal and firewood is an
issue for sites near inhabited islands. Vegetation removal caused
secondary erosion issues.
Birds are tolerant of short term visits of small numbers of people to nesting islands.Other than random inventory most research on this species has been conducted outside the region.
Major colonies need full protection, monitoring during nesting season, and enforcement.
Note:
When censuring colonies from a distance be aware that the lighter
colored morph are more conspicuous and tend to be over represented in
final tally. Many birds are not perched in the crowns of the vegetation
and may be difficult to detect. Check for nests as groups of tree
roosting birds do not always signify breeding sites.
Schreiber,
E. A. 2000. Status of Red-footed, Brown and Masked Boobies in the West
Indies. Pages 46-57 in E. A. Schreiber and D. S. Lee (eds.). Status and
Conservation of West Indian Seabirds. Society of Caribbean Ornithology,
Special Publication Number 1. 225 pp.
West
Indian Breeding Seabird Atlas by Will
Mackin and David Lee is licensed
under a Creative
Commons Attribution-Noncommercial-No Derivative Works 3.0 United States
License. Based on
work at www.wicbirds.net.
Permissions beyond the scope of this license may be available at www.wicbirds.net.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Abstract
Background
Co-occurring mood and anxiety symptomatology is commonly observed among youth with autism spectrum disorders (ASD) during adolescence and adulthood. Yet, little is known about the factors that might predispose youth with ASD to mood and anxiety problems. In this study, we focus on the role of cumulative stressful life events and trauma in co-occurring psychopathology among youth with ASD who are preparing to exit high school. Specifically, we examined the distribution of cumulative life events and traumatic experiences and their relations with mood and anxiety symptomatology.
Methods
Participants included 36 youth with ASD, all of whom were in their last year of high school. Cumulative life events and trauma were assessed by parent report. Mood and anxiety symptomatology was determined using a variety of methods (structured interview, questionnaire, self- and informant report). Frequencies were used to examine the distributions of cumulative life events (count of total events) and trauma (coded into any trauma vs. no trauma), as well as mood and anxiety symptomatology (categorized into clinical-level, sub-threshold, or none for each). Bivariate relations between life events/trauma and mood/anxiety symptomatology were assessed using analysis of variance and chi-square. Ordinal logistic regression models were used to test whether significant bivariate relations remained after controlling for the sex of the youth with ASD and his/her IQ.
Results
Over 50 % of youth had experienced at least one trauma. Nearly one half had clinical-level mood or anxiety symptomatology. There was a statistically significant relation between absence/presence of trauma and mood symptomatology; nearly 90 % of the youth with clinical-level mood symptoms had at least one trauma, compared to 40 % of those with no mood symptomatology.
Conclusions
Our findings suggest that contextual factors such as trauma might be important for the development of mood symptomatology in individuals with ASD. Although this idea is well-accepted in typically developing populations, contextual factors are rarely studied in investigations of psychopathology or transition outcomes in ASD. Given the high rates of psychiatric comorbidities in this population, future research should continue to identify the range of possible factors—both behavioral and contextual—that might influence the emergence of these disorders.
Keywords
Background
High rates of psychiatric comorbidities are common among individuals with autism spectrum disorders (ASD) [1, 2]. Not only is co-occurring symptomatology impairing in its own right, but it places significant limitations on these youth’s ability to successfully transition out of high school and into the adult world [3, 4]. Yet little is known about the factors related to the emergence of these disorders. The present study focuses on two related factors that consistently predict psychopathology in many other samples but are understudied in ASD: cumulative stressful life events and traumatic experiences.
Mood and anxiety disorders are the most widespread psychiatric comorbidities in adolescents and adults with ASD. Studies consistently find elevated rates of anxiety disorders and symptomatology in these individuals (for reviews, see [5, 6]). Studies that use self-reports of current depressive symptoms tend to find clinical-level symptomatology in a large minority of adult ASD samples [7, 8]. Using the more rigorous Structured Clinical Interview for DSM-IV Disorders, 50–70 % of adults with ASD are reported to have a lifetime diagnosis of mood disorder, and 50 % have lifetime anxiety disorders [9, 10].
To date, much of the research on correlates of internalizing disorders in individuals with ASD has focused on characteristics of the person. For example, both anxiety and depression have been linked to older chronological age, higher IQ, and greater insistence on sameness [1, 11–13]. In addition to individual characteristics, influential theories of human development suggest that contextual factors also play a critical role in the emergence of psychopathology [14, 15]. To date, the main contextual factor that has been studied in relation to psychopathology in ASD is socioeconomic status, with studies finding mixed results [16]. Clearly more research is needed to understand the range of factors that contribute to the high rates of psychopathology observed among individuals with ASD.
One contextual factor that might be related to the emergence of mood or anxiety problems among these adolescents and adults is trauma. Traumatic events are defined in the DSM-5 as “direct personal experience of an event that involves actual or threatened death or serious injury, or other threat to one’s physical integrity; or witnessing an event that involves death, injury, or a threat to the physical integrity of another person; or learning about unexpected or violent death, serious harm, or threat of death or injury experienced by a family member or other close associate.” This is often operationalized as events such as abuse (physical, sexual), natural disasters, witnessing of violence, or terrorism [17]. There is a well-established link from trauma to anxiety (especially post-traumatic stress disorder) and mood disorders in the general population (e.g., [18–21]). This association likely results from the overwhelming biological and psychological stress response to trauma leading to poor emotion regulation and diminished ability to cope with subsequent stressors, even if these are not traumatic in themselves (see [22] for an overview). Modulation of the stress response by the limbic-hypothalamic-pituitary-adrenal (LHPA) axis is likely involved in this cascade effect linking trauma and negative mental health outcomes.
Although they go by many names (e.g., adverse childhood experiences, major/significant life events, traumatic events), the accumulation of major and potentially traumatic life events is also consistently related to psychopathology in the general population [23, 24]—particularly to depression. This class of events includes the aforementioned “traumas” but also encompasses a broader set of experiences that are highly likely to be experienced as stressful such as (for example) parental divorce, a family member who goes to prison, or household substance abuse (for reference, see the Adverse Childhood Experiences study [25] and Turner et al. [18]). Data from many large-scale studies, including those of typically developing adults, international adoptees, and economically disadvantaged youth, have found strong relationships between the number of these stressful life events experienced throughout childhood and later anxiety and mood disorders [26–28].
Stressful life events and trauma have also been linked to comorbid mood and anxiety problems in adults with an intellectual disability (ID), both in terms of specific events such as sexual abuse or death of a parent, as well as using general cumulative indices of stressful events (for a review, see [29]). Although most of those studies focused on the impact of recent life events on comorbid psychopathology, Martorell et al. [30] examined the individual contributions of the sum of lifetime traumas as separate from a cumulative index of recent stressful life events. Their results suggested that, when examined simultaneously, lifetime trauma was more closely linked to comorbid disorders among adults with ID than were recent stressful events.
Although consistently associated with psychiatric disorders in typically developing populations and in those with ID, few studies have examined the role of stressful life events and trauma in the development of psychopathology among individuals with ASD [22], with only one that has examined the impact of cumulative lifetime events. Specifically, Ghazuiddin and colleagues [31] found that 82 % of children with ASD and depression had experienced at least one stressful life event over their lifetime (such as a change in group home, bereavement, or family sickness), compared to 45 % of children with ASD without depression. Milovanov and colleagues [32] found that for adults with Asperger syndrome, experiencing more stressful life events in the past 2 months (e.g., change in roommates, financial problems, recent trauma/abuse) was related to greater distress. Other studies have examined the psychiatric implications of specific traumas for individuals with ASD—such as abuse and/or neglect [33, 34] or natural disasters [35]—and the types of traumas related to the emergence of post-traumatic stress disorder [36]. More work is needed to understand the role that cumulative stressful life events and traumatic experiences might play in the emergence of psychiatric comorbidities in ASD.
The present study
In the present study, we used a small but well-characterized sample of transition-aged youth with ASD to examine the relations between cumulative stressful life events, trauma, and co-occurring mood and anxiety symptomatology. This study extends the extant research in a number of important ways. Instead of focusing on the psychiatric sequelae of specific traumas or recent events, we examined the impact of stressful events that have accumulated over the lifetime of the youth. Further, as opposed to work in typically developing samples, which tends to define “traumas” by whether specific events as defined in the DSM-5 have occurred, we took a different approach by asking parents to rate how severely youth were affected by each event. For individuals with ASD, it is problematic to decide a priori which major events are “traumatic” and “non-traumatic.” This is because difficulties in adaptive skills, insight, or engagement among these individuals could cause an objectively benign event to be experienced as traumatic, or a traumatic event to be experienced as benign [22, 37]. By using parental ratings of reaction severity to define trauma, we addressed this issue, while providing new information about which stressful life events were most likely to be experienced as traumatic by youth with ASD.
This study also extends the literature by carefully measuring psychopathology using multiple measures and reporters, including a gold-standard clinical interview along with informant- and self-reports of symptomatology. Finally, this study focuses on a time of the lifespan that is of critical importance to youth with ASD and their families yet is highly under-researched—the transition to adulthood. Understanding which youth are likely to develop co-occurring mood or anxiety problems will help to identify those who might struggle most and thus require additional support for transition success [38]. Further, restricting the sample to just those who are still in high school avoids the confound of high school exit, which has been found to predict worsening autism symptoms and behavior problems [39].
We had three specific aims. First, we examined the lifetime occurrence of major and potentially traumatic events among transition-aged youth with ASD, including which events were most often experienced as traumatic. Second, we reported the frequencies of lifetime mood and anxiety symptomatology in this sample. Though similar data have been presented before, this study adds to the existing research by triangulating across measurement methods and reporters to develop robust indicators of mood and anxiety problems, while also taking into account symptomatology that might not meet clinical threshold, but is still impairing (which we label “sub-threshold”). Finally, we examined the relations of cumulative life events and trauma with mood and anxiety symptomatology.
Methods
Participants and design
The present study included 36 families of youth with ASD who were part of a larger, longitudinal study. The primary inclusion criteria were that the son or daughter with ASD was exiting high school within the next 12 months and had received an ASD diagnosis from an educational or health professional that was confirmed through a laboratory evaluation. Participants were recruited through local clinics and other autism-related research studies, as well as local support groups, service providers, and autism organizations. ASD diagnoses were confirmed by clinicians with expertise in ASD diagnosis who used a combination of scores from the Autism Diagnostic Observation Schedule [40] administered to the youth and the Autism Diagnostic Interview-Revised [41] administered to the responding parent; all clinicians had achieved external research reliability in these instruments.
The intent of the larger project was to collect data from families of youth across the spectrum of functioning, resulting in data that are more likely to be generalizable to the population of youth in this age range. Because some of these youth would be minimally verbal or have very low IQ scores, parent report was our primary method of data collection. We also collected data directly from the youth for those constructs in which parent report is likely not to suffice—namely, IQ, structured observations of autism symptoms, and internalizing symptomatology (for those youth who could self-report).
Data in this analysis were collected at the first time point, when youth with ASD were in their last year of high school, except for the Schedule of Affective Disorders and Schizophrenia for School Aged Children—Lifetime Version (K-SADS-PL [42]), which was collected at the second time point (within 12 months after high school exit). Given the large variability of functioning among youth with ASD in this sample, the narrow age range allowed us to control for variability due to age. All study procedures were approved by the Vanderbilt University Institutional Review Board.
The youth averaged 18.7 years of age (SD = 1.3), with a range from 17.6 to 22.0 (note that youth with ASD can stay in school until they are 22 years old, although many exit high school with their peers). Over 80 % (83.3 %) were male, and the majority was white non-Hispanic (91.7 %). Most youth had fluent speech (n = 31, 86.1 %); 4 were non-verbal and one youth spoke in 2–3 word phrases. IQ scores ranged from 40 to 137; 27.8 % (n = 10) had IQs of 70 or less, 11.1 % (n = 4) had scores between 71 and 85; 27.8 % (n = 10) had scores between 86 and 100, and one third (n = 12) had IQ scores that were greater than 100. All youth were living with the responding parent.
The parent sample was composed of 32 mothers and 4 fathers. Parents ranged from 38 to 59 years of age (M = 49.2, SD = 4.9). This was a well-educated and well-resourced sample on average; 69 % of the responding parents attained a postsecondary degree (Associate’s or Bachelor’s), and 25 % had earned a post-bachelor’s degree. The median household income was around $80,000, although one quarter of the sample had annual household incomes below $40,000.
Measures
Major and potentially traumatic life events
Using questions derived from Turner and colleagues’ large-scale studies [18, 28, 43], parents were asked whether each of 27 major and potentially traumatic life events had happened to the youth with ASD at any point in his/her lifetime. A full list of the queried events is provided in Table 1. For each event experienced, parents were asked to report how affected the youth was by that event on a scale of 1 (not at all) to 5 (extremely). Any event in which the parent reported that the youth was “extremely” affected (i.e., a rating of “5”) was considered a traumatic event (termed “trauma” or “traumatic experience”); this allowed us to focus on the most clear and significant responses for a more conservative estimate of trauma in this sample. In the present analyses, we calculated a sum of all life events reported by parents (termed “cumulative life events;” possible range from 0 to 27), as well as a binary variable indicating whether the youth had experienced any trauma (1 = youth had at least 1 traumatic experience; 0 = youth had no traumatic experiences). Rationale for treating trauma as a binary variable can be found in Additional File 1.
Table 1
Frequency of each life event and the percentage who experienced the event as trauma
Life events
n (%) who experienced this
Percentage of those who experience this event who rated it as traumatic
Has anyone else close to youth ever died as a result of a serious accident, injury, or illness?
20 (55.6)
25.0
Has anyone in the home ever had a serious accident, injury, or illness that was life threatening or caused long-term disability?
18 (50.0)
27.8
Did you go through a divorce or separation at any point in youth’s life?
11 (30.6)
27.3
Has anyone in the home ever not had a job for a long time when he/she wanted to be working?
11 (30.6)
9.1
Has youth ever been bullied by his/her peers to such an extent that he/she had to go to the doctor or you considered changing schools?
10 (27.8)
50.0
Has anyone else close to youth ever had a serious accident, injury, or life-threatening illness (but lived)?
10 (27.8)
10.0
Has anyone in the home ever been sent away or kicked out of the house because he/she did something wrong?
6 (16.7)
50.0
Has anyone in the home ever been sexually, physically, or emotionally abused?
5 (13.9)
60.0
Has your family ever been in a major fire, flood, earthquake, or other natural disaster?
5 (13.9)
40.0
Was youth ever forced to live apart from 1 or both parents?
4 (11.1)
100
Has anyone in the home struggled with substance abuse or addiction?
4 (11.1)
50.0
Has anyone in the home ever been physically assaulted or mugged?
4 (11.1)
50.0
Was youth ever abandoned by 1 or both parents?
4 (11.1)
0
Have you ever lost your home because of a natural disaster?
3 (8.3)
66.7
As a child, did youth ever live in an orphanage, foster home, or group home, or was he/she ever a ward of the state?
3 (8.3)
33.3
Has anyone in the home ever been shot at with a gun or threatened with another weapon?
3 (8.3)
33.3
Has youth ever been told that someone else he/she was close to had taken his/her own life?
3 (8.3)
33.3
Has youth ever failed a grade in school?
3 (8.3)
0
Has anyone in the home, or someone youth is close to ever been incarcerated?
3 (8.3)
0
Has youth ever gone through a difficult breakup?
3 (8.3)
0
Has anyone in the home ever taken his/her own life?
2 (5.6)
100
Has youth witnessed anyone in the home being sexually, physically, or emotionally abused?
2 (5.6)
100
Did youth ever discover that a girlfriend or boyfriend was unfaithful?
1 (2.8)
0
Has youth ever been told that someone he/she was close to had been killed?
1 (2.8)
0
Has anyone in the home ever been killed?
0
0
Has anyone in the home ever died as a result of a serious accident, injury, or illness?
0
0
Has youth ever witnessed something violent happen to someone or seen someone killed?
0
0
Co-occurring mood or anxiety symptomatology
Two variables were constructed to capture whether youth had co-occurring mood symptomatology or co-occurring anxiety symptomatology. For each class of disorder, a number of parent report and self-report measures were used to determine whether the youth had clinical-level, sub-threshold, or no symptomatology.
Clinical-level anxiety or mood symptomatology was determined using the informant report version of the K-SADS-PL [42], administered to parents by a trained clinician. The K-SADS-PL is a gold-standard, semi-structured diagnostic interview that assesses current and past episodes of psychopathology in children and adolescents according to DSM-IV criteria. To determine whether an anxiety or mood disorder is present, a screening interview is administered, with follow-up diagnostic supplements. Youth were coded as having clinical-level mood symptomatology if they met lifetime (including current) DSM-IV criteria for major depression, dysthymia, and/or bipolar disorder. Youth were coded as having clinical-level anxiety symptomatology if they met lifetime (including current) DSM-IV criteria for generalized anxiety disorder, obsessive-compulsive disorder, specific phobia, separation anxiety disorder, panic disorder, and/or post-traumatic stress disorder. We chose to include both lifetime and current criteria so that we would capture youth who may have previously developed psychiatric symptomatology but whose symptoms have remitted or are successfully controlled through psychotropic medications.
We used a number of measures to capture whether youth had sub-threshold mood or sub-threshold anxiety symptomatology. To be coded in these categories, at least two of the following criteria were met (consistent within type of disorder): (a) report of symptoms on the K-SADS-PL screener that triggered a K-SADS-PL affective or anxiety disorders supplement but without meeting DSM criteria for the corresponding disorder; (b) parent report of a mood or anxiety disorder diagnosed by a medical provider or psychologist, using the psychiatric disorders section of the Rochester Health Status Survey [44], a medical survey designed for individuals with disabilities; (c) youth met clinical cut-offs on the anxiety or depression DSM subscales of the parent-rated Adult Behavior Checklist (ABCL [45]); (d) youth self-reported depressive or anxiety symptomatology that exceeded clinical cut-offs on the Centers for Epidemiological Studies Depression scale (CES-D; scores ≥16 [46]) or the Beck Anxiety Index (BAI; scores ≥16 [47]). Similar to our above rationale for focusing on lifetime symptoms on the K-SADS-PL, we included youth in the sub-threshold category if they had received a previous mood or anxiety diagnosis and were currently being treated with psychotropic medication for that disorder (even if their current symptomatology measures were not elevated).
Two youth did not have K-SADS-PL data. In those cases, we decided that neither a previous diagnosis nor current questionnaires on their own were strong enough evidence for the clinical category, and ultimately defined clinical-level symptomatology in these cases as a previous diagnosis plus (a) psychotropic medication specifically taken for that diagnosis, and/or (b) current parent and self-report that exceed clinical threshold. Criteria for sub-threshold symptomatology remained the same.
Data analysis
We used descriptive statistics to examine the distribution of cumulative life events and traumatic experiences (including the frequency of each life event and the proportion of youth who experienced that event as traumatic) as well as the frequencies of mood and anxiety symptomatology (clinical-level, sub-threshold, and none for each type). To examine the relations between cumulative live events, trauma, and mood and anxiety symptomatology, we first ran bivariate statistics. Analysis of variance was used to examine the relations between co-occurring symptomatology and the number of events, and chi-squares were used to examine the relations between co-occurring symptomatology and the presence/absence of trauma. We next used ordinal logistic regression models to test whether significant bivariate relations remained after controlling for the sex of the youth with ASD and his/her IQ (Full-Scale Standardized IQ using the Stanford-Binet Intelligence Scale [48]). We statistically controlled for these variables because females (vs. males) and those with higher (vs. lower) IQ scores in this sample were more likely to have mood disorder symptomatology, χ2(2) = 7.37, p < 0.05 for sex; Spearman rho = 0.44, p < 0.01 for IQ.
Results
Frequencies of cumulative life events and traumatic experiences
Figure 1 presents the distributions of the sum of life events and traumatic experiences. Every youth in the sample experienced at least one life event, with a maximum of 11 and an average around four events per person (M = 3.86, SD = 2.19). Twenty-eight percent of youth experienced five or more events. The number of traumatic experiences ranged from 0 to 5, with 55.6 % of youth experiencing at least one trauma.
Fig. 1
Distribution of cumulative life events and traumatic experiences
Table 1 shows the frequency of each type of life event, as well as the conditional percentage of youth who experienced each event as traumatic (i.e., the number who experienced the event as traumatic divided by all youth who experienced the event). The most common events were death of someone close to youth as a result of accident, injury, or illness (56 %); life-threatening injury or illness of someone in the home (50 %); parental divorce/separation (31 %); and unemployment within the home (31 %). There were three events that were reported as traumatic every time they occurred: youth being forced to live apart from one or both parents; death of someone in the home by suicide; and witnessing abuse.
Frequencies of co-occurring mood and/or anxiety symptomatology
Table 2 presents the frequencies of clinical-level and sub-threshold mood and anxiety symptomatology, as well as which criteria were met in sub-threshold cases. The most common mood disorder was major depression, and the most common anxiety disorder was obsessive-compulsive disorder. None of the youth met the criteria for post-traumatic stress disorder (PTSD). Of those youth meeting clinical criteria who were able to self-report (n = 15), two thirds either had elevated symptoms on the corresponding self-report measure (CES-D or BAI; 53.3 %, n = 8) or were taking psychotropic medications targeting symptoms of the corresponding psychiatric disorder (but did not currently have elevated self-reported symptoms; 13.3 %, n = 2). Of those youth who met sub-threshold criteria, the vast majority had a previous mood or anxiety disorder diagnosis from a medical professional in addition to elevated symptom levels on questionnaires (see Table 2). About 40 % of youth in the sub-threshold categories met criteria by both parent and self-report.
Table 3 presents the overlap between mood and anxiety symptomatology. Nearly 50 % (47.3 %) of youth met DSM criteria for a lifetime mood and/or anxiety disorder (i.e., clinical-level symptomatology); only one participant met criteria for both in this sample. One third of youth (n = 12) had no evidence of mood or anxiety disorders, meaning that they did not meet clinical or sub-threshold criteria on either.
Table 3
Co-occurrence of lifetime mood and anxiety symptomatology
Anxiety symptomatology
Mood symptomatology
None
Sub-threshold
Clinical
Total
None
n = 12
n = 4
n = 6
n = 22
33.3 %
11.1 %
16.7 %
61.1 %
Sub-threshold
n = 2
n = 1
n = 2
n = 5
5.6 %
2.8 %
5.6 %
13.9 %
Clinical
n = 5
n = 3
n = 1
n = 9
13.9 %
8.3 %
2.8 %
25.0 %
Total
n = 19
n = 8
n = 9
n = 36
52.8 %
22.2 %
25.0 %
100 %
Relations between cumulative life events, trauma, and mood/anxiety symptomatology
Findings from bivariate analyses of cumulative life events, presence/absence of trauma, and mood and anxiety symptomatology are presented in Table 4. The relations between co-occurring symptomatology (mood and anxiety) and number of events were not statistically significant; however, having at least one trauma was related to a greater likelihood of mood problems. Of those youth with clinical-level mood symptomatology, nearly 90 % had experienced at least one trauma (compared to about 40 % of those with no symptomatology). After taking IQ and sex into account, the presence of trauma remained related to greater mood symptomology, B = 1.88, OR = 6.57 (95 % CI = 0.99–43.55), Wald χ2 = 3.81, p = 0.051. These data suggest that, although a significant proportion of youth with trauma do not have a co-occurring mood disorder, these disorders were rarely observed in the absence of an event that is experienced as traumatic.
Table 4
Bivariate relations between cumulative life events, trauma, and co-occurring mood or anxiety symptomatology
Mean (SD) or % for clinical-level symptoms
Mean (SD) or % for sub-threshold level symptoms
Mean (SD) or % for no symptoms
F value/χ2
Mood
Cumulative events
4.67 (2.87)
3.00 (1.87)
3.72 (1.93)
1.04
Percent with a trauma
88.9 %
60.0 %
40.9 %
6.00*
Anxiety
Cumulative events
3.00 (1.66)
5.38 (2.97)
3.63 (1.80)
3.02†
Percent with a trauma
33.3 %
75.0 %
57.9 %
3.07
†p ≤ 0.10; *p ≤ 0.05
Follow-up analyses
Although our data is cross-sectional, our hypothesized direction of effects was that experiencing a trauma would lead to mood or anxiety symptomatology. To explore the issue of timing, we examined the age of onset for those with clinical-level mood or anxiety symptomatology and compared that to the age of the first life event. Note that we consider these analyses exploratory because they are based on retrospective reports. Clinical-level anxiety disorders emerged, on average, around 5 years of age compared to around 13 years of age for mood disorders. For those with a mood disorder, in every case, the first life event happened before or at the same time as the onset of the disorder. However, there were many cases in which the onset of an anxiety disorder preceded the first life event—particularly for those who met criteria for specific phobias or obsessive-compulsive disorder.
Discussion
Our findings suggest that mood symptomatology in transition-aged youth with ASD is often related to an event (or events) experienced as traumatic at some point in childhood/ adolescence. The rates of trauma that we observed when stratifying by mood symptomatology (88.9 % of those with clinical-level symptomatology had a traumatic experience, compared to 40.9 % of those with no mood symptomology) were nearly identical to those found by Ghazuiddin and colleagues [31]—the only other study to our knowledge to look at the mental health implications of cumulative stressful life events for individuals with ASD. Trauma or cumulative life events were not, however, related to anxiety symptomatology in our sample. Compared to mood symptoms within the autism spectrum, significant anxiety is more likely to develop earlier in childhood, which blurs the association with later-occurring life events. In that case, it is possible that biological or other early developmental mechanisms may be weighted more heavily than purely psychosocial ones in the development of anxiety within ASD, particularly for the types most common in this sample (obsessive-compulsive disorder and simple phobia, which share features with the autism phenotype itself). The development of major depression, on the other hand, may be more experience-dependent than anxiety [49]. Given reportedly high rates of mood disorder in first-degree relatives of individuals with ASD, offspring with ASD may have a similar predisposition to mood problems which is then “kindled” by stressful life events.
Although youth in our sample without a traumatic experience rarely met criteria for lifetime clinical-level mood symptomatology, there were many cases in which youth had a trauma but did not develop psychiatric comorbidities. This suggests that some youth with ASD may be more resilient to the effects of trauma. The pathway by which traumatic experiences influence psychopathology may be shaped by emotion regulation problems, which are common to ASD [50]. Emotion regulation difficulties can be secondary characteristics, such as poor coping skills, or more autism-specific. For example, Gotham and colleagues [13] found that adults with ASD who perceived greater impact of ASD symptoms on their lives tended to have elevated depressive symptoms if they also reported higher levels of cognitive perseveration (rumination). Similarly, major life events might be more commonly experienced as traumatic in those individuals who are predisposed to perseverate on such events, and this perseveration may in turn contribute to a mood disorder for some with ASD. Although rumination was not measured in this study, future research should examine how it might influence the impact of traumatic experiences for youth with ASD.
In addition to individual factors, family factors likely play an important role in promoting resiliency for youth with ASD who experience traumatic events. Studies suggest, for example, that individuals with greater social support and economic resources more often experience resilience in the face of trauma [51]. Among children who experience the loss of a parent, warmth in the home is a major predictor of whether they develop psychopathology [52]. Thus, investigation into the factors that promote resiliency to trauma among youth with ASD should consider family characteristics in addition to personal resources.
Our appraisal data provided us with a different view of how youth were affected by major events than what we might have expected had we pre-determined which events would be considered “trauma.” For example, one might consider losing one’s home in a natural disaster or fire as traumatic; but in this sample, it was not always experienced as such (as reported by parents). Recent reviews on trauma among individuals with disabilities [22, 37] suggest that the individuals’ appraisals of the event may be more important than the occurrence or accumulation of events. Our findings suggest that this is indeed the case: it was the appraisals of events that were related to mood symptomatology and not the accumulation of events. Thus, studies focused on trauma in ASD should include measures of the impact of events.
The inclusion of multiple measures of mood and anxiety symptomatology in our study points to the dramatic differences in rates of mood/anxiety problems depending on what measure is being used (further information about the correspondence between measures are presented in supplemental material). Our estimates of clinical-level symptomatology, using the K-SADS-PL, were lower than some other studies of adolescence/adults with ASD (see introduction). This might be because our sample was recruited from the community and thus truly has lower rates of comorbidities than clinic samples [5]. However, when we added sub-threshold symptomatology, the rates were much higher. Notably, any instrument or indicator used singularly yielded different interpretations of comorbidity rates. For example, 25 % of our sample met DSM lifetime criteria for an anxiety disorder on the K-SADS-PL, one third had received an anxiety disorder from a medical professional, 23 % had moderate or severe self-reported anxiety symptoms on the BAI, and 6 % had clinical-level parent-reported anxiety symptoms on the ABCL. Given the very different rates of psychiatric problems in one sample based on the measure being used, comparing rates of psychiatric disorders among different samples using different instruments is problematic. In order to best understand rates of comorbidities in ASD, multiple instruments with multiple reporters will likely be necessary [53].
This study has a number of limitations that are offset by important strengths. First, as in much of ASD research, our measure of major and potentially traumatic life events was collected via parent report. Relying on informants runs the risk of missing life events that parents do not know about or differing appraisals of what constitutes a “trauma” between parent and son/daughter. One next step in this line of research would be to explore the correspondence in reports of trauma across parents and youth with ASD. One could also observe the impact of events as they emerge to determine which reporter seems to be the most reliable. As many of our measures of psychiatric symptomatology were also informant report, relationships between our variables might be inflated by informant bias. Despite these drawbacks, the reliance on informant report was necessary because we included youth with ASD across the spectrum of functioning (some of whom are non-verbal, had very low IQ scores, or otherwise could not self-report).
Though we attempted to make best-estimate standardized diagnoses of psychiatric comorbidity by choosing a gold-standard instrument (the K-SADS-PL), an autism-specific instrument, such as the Autism Comorbidity Interview [54], may have yielded more accurate results, particularly for participants with ID. We attempted to improve the validity of our comorbid diagnoses by using a multi-method, multi-rater approach. Ultimately, a significant strength of this study is the thoroughness by which we measured co-occurring mood and anxiety symptomatology, including a structured clinical interview, parent report of symptoms and previous diagnoses, youth self-report, and medication use.
The small sample in this study is another limitation, as it raises concerns about the generalizability of our findings. On the other hand, because this was part of a larger longitudinal project, and advertised only for the high school exit criteria (youth had to be in their last year of high school), the results may be more broadly indicative of mental health issues in this age range, rather than being subject to self-selection bias of studies of emotional health and/or trauma in ASD. Furthermore, this sample, though small, was extremely well-characterized using gold-standard diagnostic and IQ measures. Nevertheless, there may be a relationship between trauma and anxiety symptomatology in ASD that we could not detect due to sample size. In particular, this study likely lacked sufficient power to explore comparatively less common mental health outcomes (e.g., PTSD, bipolar disorder, schizophrenia) in this special population.
The wide range of functioning of the youth with ASD included in this sample also aids generalizability. It should be noted that it can be more difficult to detect mood disorders among minimally verbal adults [55], and it also might be more difficult for parents of these individuals to discern the impact of potentially traumatic events; however, in this particular sample, there were no statistically significant differences in clinical mood symptomatology or the presence of trauma based on whether the youth had ID. Finally, because this was a retrospective study, we were dependent on parents’ recollection of the timing of major life events and onset of psychiatric symptomatology. Although our follow-up analyses suggested that the onset of the first major life event likely preceded the onset of mood symptomatology, only a longitudinal study can truly examine how these processes unfold over time.
Conclusions
Our findings suggest that contextual factors such as trauma might be important for the development of psychopathology (specifically mood symptomatology) in individuals with ASD. Although this idea is well-accepted in typically developing populations, contextual factors are rarely studied in investigations of psychopathology or transition outcomes in ASD. Given the high rates of psychiatric comorbidities in this population, future research should continue to identify the range of possible factors—both behavioral and contextual—that might influence the emergence of these disorders. This can help us to identify those youth who are most likely to develop comorbidities and thus struggle during transition, as well as help to create and refine novel treatment options.
Declarations
Acknowledgements
We would like to acknowledge the research team members who contributed to the acquisition of data, including Amie Duncan, Natalie Henninger, Rebecca Johnston, Amy Nicholson, Alison Vehorn, and Amy Weitlauf.
Funding
This project was supported by the National Institute of Mental Health (K01 MH92598, J.L. Taylor, PI) and the National Center for Advancing Translational Sciences (CTSA award UL1TR000445). Core support was provided by the Eunice Kennedy Shriver National Institute of Child Health and Human Development (U54 HD083211, E.M. Dykens, PI). Dr. Gotham’s participation was supported by NIMH K01-MH103500 (K. Gotham, PI), with recognition of NIMH T32-MH18921 (J. Garber, PI).
Availability of data and materials
The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
Authors’ contributions
JT contributed to the conceptualization and design of the study, acquisition of the data, analysis and interpretation of the data, and drafting of the manuscript. KG contributed to conceptualizing and design of the study, interpretation of the data, and drafting of the manuscript. Both authors read and approved the final manuscript.
Competing interests
Dr. Gotham receives royalties from Western Psychological Services as an author of the Autism Diagnostic Observation Schedule-2. She donates to charity that portion of royalties issuing from Vanderbilt University.
Consent for publication
Not applicable.
Ethics approval and consent to participate
All study procedures were approved by the Vanderbilt University Institutional Review Board. Consent was obtained from all parents, and consent/assent was obtained from all youth with ASD.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Some of the Maine Troop Greeters presented the children with t-shirts signed by troops who have traveled through Bangor International Airport, either flying overseas or coming home. It's part of a collaboration with the Children's Miracle Network.
Three-year old Maggie Rudnicki was one of the lucky recipients. Maggie suffers from a rare blood disease and comes to the hospital two to three times a week for a blood transfusion. Her mother, Lauren, says they will treasure the shirt and thoughts from soldiers fighting overseas.
"I think it's amazing," said Lauren Rudnicki. "It just goes to show what special people we have fighting for our country. I think it's also amazing that the troop greeters took time to do this for the kids here."
The troop greeters bring 10 to 15 t-shirts to the hospital for kids once every two months.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[Relative quantitative analysis of corneal immunogenicity].
To quantitate the relative immunogenicity of three major corneal cell layers (epithelium, stroma, and endothelium) among the whole corneal immunogenicity respectively. Cellular immunity: Three porcine major corneal cell layers were heterotopically allografted to subcutaneous layer of 40 BALB-c mice respectively. Twelve days later, the peripheral white blood cells of recipients were double directly stained with anti-mouse IgG-fluorescein conjugate mAb and analyzed by flow cytometry. Humoral immunity: The suspension of porcine cornea or corneal epithelium was used as antigen to produce anti-porcine immune sera in C57BL-6 mice. With the anti-porcine immune sera, enzyme linked immunosorbent assay was performed. On cellular immunity detection, the immunogenicities of intact endothelium, epithelium and stroma, equal in thickness, were 70.75%, 27.63%, and 1.62% respectively. On humoral immunity detection, the immunogenicities were 62.11%, 31.77% and 6.12% in the three respective layers of equal thickness. These findings indicate that the immunogenicity of corneal stroma is the lowest among the three corneal cell layers of equal thickness. The preliminary results provide the experimental basis for clinical application of xenogenic graft of corneal stroma.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Keep up to date with library news. The Ferriman Information and Library Service provides a professional multidisciplinary information service for all staff working at North Middlesex University Hospital NHS Trust.
Visit our website at www.ferrimanlibrary.uk
Contact us on 0208 887 2223 or email [email protected]
On the next screen you can search for electronic journals using the Search option or the A-Z search.
In the Search option, select Exact title and type in the journal name in the search box. Then click on the Search button.
If the journal is available electronically you will see the results like this:
Note the further details which clarify the dates the electronic journal is available from. You will need to check that the particular article you are looking for is available from the dates listed. This tells us that Paediatric Nursing is available full-text from 1 February 2002 to 1 March 2011.
Then click on the full text link which will take you to the journal provider's website like this:
From the list of available years and volumes (listed to the right of the screen, as shown above) select the relevant year volume and issue. This will then display a list of articles from that issue:
Click on the article title or the full-text options to open the article. Articles can usually be opened either as HTML or PDF documents. If you open the HTML version you can use your web browser to print, save or email the article. If you have opened the PDF version, you can use the icons on the Adobe Reader to print, save or email the article.
If you require any further help or assistance with electronic journals, please contact the library on ext. 2223 or email [email protected]
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1. Introduction
We are developing a way to establish a Machine-to-Machine (M2M) communication between an industrial fine-blanking press and a finite element (FE) server to generate a digital twin for each physically manufactured workpiece. We will discuss the basic of FE modelling before jumping into the technical aspects and processes in the background of FE simulation We will show a user-friendly API which allows for an autonomous digital FE twin production. Now thin
A finite element simulation is used to model and compute physical values, that cannot be measured in real-life. For instance, video 1 shows the distribution of mechanical stresses during fine-blanking. Mechanical stresses cannot be measured in the shearing zone since there is simply no space for a sensor. However, these stresses are normally very useful for designing components and assemblies, because high stressed values may damage workpieces. Thus, FE simulations are very important in mechanical engineering.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
16 Responses:
I'm not sure what you mean - in general FreeBSD has one of the most up-to-date package collections. For XScreenSaver in particular it has 5.38 in the ports collection and I expect 5.39 will arrive within a few days.
While I'm not involved in other BSDs I expect they all have at least a relatively recent version.
Still just wondering who would eschew the main draw of RHEL for budgetary reasons then choose to run a distro that's based on years-old software. Probably the same people that complain when a developer drops WinXP support. In 2018.
Who? People who need to run software that is only certified on very specific OS versions (e.g. some CAD tools) or run hardware that only has drivers for specific versions (e.g. oldish PCIe boards). Yes, you may try to run on other versions, but you're asking for a world of pain. Try to avoid unnecessary worlds of pain.
I didn't realize the Linux kernel deprecated very specific, old-ish PCIe drivers. I thought that pretty much never happened. My bad.
In any case, the original jwz argument stands. If you're running CentOS you should know you're choosing/forced to run old software and perhaps take two seconds to check before you go firing off bug reports willy-nilly.
Those people who need to run systems that act very much like RHEL, e.g. for development, testing, compatibility or other purposes, but don't need support and/or don't want to spend the licensing cost.
Last I checked CentOS was 100% binary compatible with RHEL, so for all but the most odd use cases (things that check for active RHN subscriptions or the exact format of the /etc/redhat-release file or something) CentOS is good enough.
But when I do this I also understand that I'm running old(er) software and the consequences that come with it, so... ::shrug::
As written by jwz in the xscreensaver source code, as also quoted in the linked post about Debian:
I am constantly getting email from users reporting bugs that have been fixed for literally years who have no idea that the software they are running is years out of date. Yes, it would be great if we lived in the ideal world where people checked that they were running the latest release before they report a bug, but we don't. To most people, "running the latest release" is synonymous with "running the latest release that my distro packages for me."
When they even bother to tell me what version they're running, I say, "That version is three years old!", and they say "But this is the latest version my distro ships". Then I say, "your distro sucks", and they say "but I don't know how to compile from source, herp derp I eat paste", and everybody goes away unhappy.
It wastes an enormous amount of my time, and kind of makes me regret ever having released this software in the first place.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
After months of speculation, the Seattle ownership group officially filed for an NHL expansion team in early February. Thursday, the would-be 32nd NHL franchise held a season-ticket drive to gauge interest.
The team hit the goal of 10,000 deposits in a record-setting 12 minutes. All together, over 25,000 deposits were placed during the Thursday ticket event. It now seems more likely than not that Seattle will be getting a professional hockey team.
A season-ticket holder drive is a required step by the NHL as part of the expansion process. Fans could put down a deposit of either $1,000 per ticket (for seats in the lower center ice level) or $500 per ticket (for general season tickets.)
Though the venue only seats 17,459 pre-renovations, the owners will keep the ticket link open until the end of Friday. Interested fans will hear in May with more information about seats and pricing after a computerized seating chart is created. Though ticket pricing is unknown, the owners have said it will be competitive to the rest of the league.
“I think the NHL is surprised, very pleasantly surprised,” Leiweke said to Geoff Baker of the Seattle Times. “And so I think they’re very happy. We still have work to do. But I think it sends a great message to the league and it’s what we’ve been telling them about Seattle. So, I think this is a great day for the league.”
In contrast, 10,000 commitments took the Vegas Golden Knights six weeks to reach.
Earlier this week, Gary Bettman said the NHL will not change the expansion draft process and Seattle will follow the same rules the Golden Knights had.
Bettman says if Seattle gets a team the expansion draft process would be the same as it was for Vegas.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Study says pollution makes birds gay
Researchers found that a high-mercury diet had an effect on the mating behavior of white ibises confined in a net-covered aviary at the University of Florida. They said the degree of homosexual pairing increased along with the birds' mercury exposure.
A years-long study at the University of Florida suggests that mercury pollution can alter the hormones of white ibises to make males more likely to mate with other males.
"We knew that mercury can disrupt hormones -- what is most disturbing about this study is the low levels of mercury at which we saw effects on hormones and mating behavior," Peter Frederick, a wildlife ecology and conservation professor who led the study, said in a news release this week. "This suggests that wildlife may be commonly affected."
Frederick and his co-author, Nilmini Jayasena, were hasty to warn against drawing any inferences about the roots of human homosexuality. They didn't set up the experiment to find out what makes birds gay -- rather, they were trying to figure out why ibises in the Everglades went through a stretch of poor breeding in the early 1990s, followed by a baby boom in the late 1990s.
Scientists knew that improvements in the birds' watery habitat was one factor behind the increased breeding, but they suspected that mercury concentrations played a role as well. During the downswing in breeding, low-level mercury contamination made its way increasingly into the Everglades via municipal and medical waste incineration -- but that waste became more regulated at about the same time as the start of the baby boom.
To find out if there was a connection between mercury contamination and a low birth rate, the university set up a 13,000-square foot net-covered aviary in 2005. They brought in 160 ibises, and divided the birds into four groups with equal numbers of males and females. Each group was fed a different diet -- low, medium or high mercury, or no mercury at all. The highest level of mercury was no higher than what the birds would have consumed if they had been in the wild during the early 1990s.
In 2006, about 55 percent of the high-mercury-diet males were nesting with other males. Frederick said the degree of male-male pairing was proportional to the degree of mercury in the diet. That played a role in breeding differences, as well: In comparison with the control group, high-mercury males were less likely to be approached by females during courtship. All of the mercury-consuming males were less prone to perform the ritual head bows and bobs that are part of the ibises' mating ritual.
Frederick and Jayasena, who was Frederick's doctoral student and is now based at the University of Peradeniya in Sri Lanka, reported that the high-mercury-diet females produced 35 percent fewer fledglings than the females in the control group.
The study lasted for three breeding seasons. After the experiment, the birds were put on a cleansing, mercury-free diet for several months and then released back into the wild.
Does all this mean homosexuality is linked to mercury pollution? For the ibises, maybe. For humans, almost certainly not. Frederick pointed out that there have been a number of long-term studies on the effects of mercury on humans, and none of those studies has noted a change in sexual behavior. Speaking more generally, the researchers noted that sexual preference is a much more complex phenomenon for humans than it is for birds.
In a report on Nature's website, a German expert on animal physiology cautioned that the results might not even be applicable to other bird species. Heinz Köhler of the University of Tübingen told Nature that this might be something that's just between ibises. "Their behavior may be less fragile and more robust to methylmercury," he said.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Create Launcher Shortcut
I am using Debian and I want to make a icon on the launcher that I can click on to open my Teamspeak server. Currently, I have to go to the terminal and type the following commands.
cd /usr/bin/teamspeak3-server_linux-amd64
./ts3server_minimal_runscript.sh
This launches my Teamspeak 3 server, leaving the terminal open which is time consuming and annoying to have a terminal open solely for this purpose. In Ubuntu I just made a .desktop file and dragged the icon onto my launcher, which is miles better. Not sure how to do that on Debian though, can someone advise?
A:
Create a desktop file for Teamspeak 3 server and place it at /usr/share/applications directory and run sudo update-desktop-database.
how to create the desktop file
open any text editor of your choice and place the lines bellow and save it with any name you want like teamspeak_3_server.desktop .
[Desktop Entry]
Type=Application
Exec=/usr/bin/teamspeak3-server_linux-amd64/ts3server_minimal_runscript.sh
Icon=/path/to/teamspeak3/icon
Name=Teamspeak 3 server
GenericName=Teamspeak
Categories=Network;
Change the icon path if you want a fancy application icon.
I suggest to create a symlink for ts3server_minimal_runscript.sh to avoid the long line and change the Exec= line of the desktop file.
sudo ln -s /usr/bin/teamspeak3-server_linux-amd64/ts3server_minimal_runscript.sh /usr/bin/ts3server
| null |
minipile
|
NaturalLanguage
|
mit
| null |
To which some people commented, as Rich did, we are, in essence, idiots: “When people get excited about things outside of work they end showing up to work and going through motions just to get through a day. Everyone loses. The employee loses and the employer loses. People are not going to give all of themselves as they focus on their new outside interest.” Rich makes an extremely valid point — one that we think is worth elaborating on.
Everything we have recommended — starting something new beyond your job; putting in an hour a day to learn a new skill/profession — needs to be outside of office hours. If you do it on company time you can be fired, and quite frankly we believe you should… Leer más “Is It Cheating to Have a Side Project?”
When I first started working from home, I would avoid breaks at all costs. I thought that this would help me get more work done, when in reality, it caused me to burn out early.
Now I take the breaks that any employer would require in an eight to ten hour work day — coffee breaks, lunch breaks, stretch breaks. I consider all of these to be a necessity because it’s the time spent away from the computer that helps ideas generate organically. And, of course, it’s good for both your body and your mind.
3. Go with the Flow
Do you find that your mind isn’t fully functioning before 10 am? Does your body need a nap between 2 pm and 3 pm? Are you least productive after 6 pm?
One of the largest benefits of working from home (unless you are required to clock in and out at certain times) is the ability to create your own schedule.
Not everyone works best on a 9-5 schedule — some work better on a 10-6 or 4-12 schedule. Figure out the times that your mind is at its peak, and try to follow that. For you that might mean taking a two hour break in the middle of the day. That’s simply the beauty of this lifestyle.
As a freelance writer turned community manager, I’ve spent entire weeks working from my couch in my pajamas.
For many it sounds appealing — no commute time to wrestle with, no wardrobe requirements and no one standing over your shoulder requesting updates on your progress.
But I’ve also found that these are the same reasons why staying productive when working from home, sans a designated office, can be such a challenge. There’s not a pressing reason to leave the house or get dressed, and there is no one there keeping you from spending the afternoon eating junk food and watching trashy TV.
The work from home lifestyle is certainly not for everyone (especially those that thrive on day to day interactions with coworkers), but if you have a job where working remotely is an option, here are some tips for keeping you productive and happy.
Part of the adaptation resistance we feel in businesses trying to become more social is that they’re taking an old model – the 5 day week fit into a daytime 40 hours – and desperately trying to fit it around the inconsistent and differing patterns that define a connected, networked and vastly more nimble global network. Strapping hours on your Twitter bio will not forever meet the needs of customers, employees, partners, supply chain, and the people who deliver on the work we’ve ultimately promised.
Here’s where I have some questions for you.
What do you think defines a professional commitment in today’s era? As a worker of any kind, what should you expect to commit? Is it different than it has been? If so, what will make that commitment worthwhile?
How can companies adapt an industrial-era mindset into a modern one while surmounting the challenges of sheer scale and cost of having a larger, more distributed and flexible workforce? Or are there savings in there instead of costs?
What does that mean for the education and induction that we’re giving to the next generation of workers, whether skilled or knowledge based or both?
So if that’s true, and we’ve largely accepted that, why are we still trying to force social business evolution into the bounds of those days and hours?
Fluidity is a continually emerging reality in business. I struggle mightily with this personally, because I don’t believe that even the most entrepreneurial of us are winning medals when we get out there and flaunt our exhaustive, 80-hour workweek and lack of weekends as some kind of masochistic badge of honor. In fact, it tells me that we simply aren’t being smart with how we work, not telling us that we should just keep working and working and working until we break.
Being a freelancer means you often have complete freedom on where to work. However, we tend to stay at home and work from our beds, dining room tables, a corner in our room, or if we’re lucky enough, a whole room dedicated as an office. What we mostly do not do, is leave our home to work in a separate office or co-working space.
Working from home comes with several advantages after all – no overhead, free range of the kitchen, no dress code and the ability to sleep as late as we want and stroll from the bedroom to our computer.
However, there are also several disadvantages we should be aware of. Distractions from family, children or pets being the biggest issue we come across. Also, walking two feet from our bedroom to our office means we don’t get the exercise we should – and we’re increasingly becoming an unhealthy industry. It also means you lead a distinctly lonely work day – and without a boss breathing down your neck you’re more apt to goof off on the internet.
Even with all of these disadvantages – I still wouldn’t trade it for any other job in the world, nor would I bother with paying the high costs of renting an office space. Instead, I’ve aimed to become more productive and turn these into non-issues. How can you do it?
Being a freelancer means you often have complete freedom on where to work. However, we tend to stay at home and work from our beds, dining room tables, a corner in our room, or if we’re lucky enough, a whole room dedicated as an office. What we mostly do not do, is leave our home to work in a separate office or co-working space.
Working from home comes with several advantages after all – no overhead, free range of the kitchen, no dress code and the ability to sleep as late as we want and stroll from the bedroom to our computer.
However, there are also several disadvantages we should be aware of. Distractions from family, children or pets being the biggest issue we come across. Also, walking two feet from our bedroom to our office means we don’t get the exercise we should – and we’re increasingly becoming an unhealthy industry. It also means you lead a distinctly lonely work day – and without a boss breathing down your neck you’re more apt to goof off on the internet.
Even with all of these disadvantages – I still wouldn’t trade it for any other job in the world, nor would I bother with paying the high costs of renting an office space. Instead, I’ve aimed to become more productive and turn these into non-issues. How can you do it?
Are you more focused and energetic in the morning?
Doing your “Most Important Task” first assumes that you’re most focused first thing in the morning. The idea is to shift this big task to the time when your mental powers are at their height. If you’re naturally inclined to be more focused later in the day, this model might not work for you. You’ll want to calibrate your MIT time to your natural creative rhythms.
Step 2: Turn off email and other distractions. Focus for 2-3 hours on completing your “Most Important Task.”
Step 3: Take a lunch break away from your desk. Leaving your computer and recharging is the key to being productive after your MIT time.
Step 4: Devote the post-lunch day to taking care of ongoing tasks and other “reactionary work” that requires less mental stamina.
The Caveat
Although tackling hard work first seems like a no-brainer, I did have to alter the model a bit for it to work for me, which made me realize that this approach really depends on your personality. For some, it may be an easy switch that will exponentially increase productivity, but for others, it might cause extra stress. Leer más “My Revised “Most Important Task First” Model”
As a web designer, you’re often forced to wear many different hats every day. You’re the CEO, creative director, office manager, coffee fetcher and sometimes even janitor. That’s a lot for anyone, and it certainly makes it difficult to find any time for quality creative thinking. Organization in any operation is important, and for our work as web designers it is important, too. The good news? You don’t have to have been born an organizational machine. Let’s look at what being organized means and a few strategies and tips to help you clean up that messy desk and get your work ducks in a nice neat row.
1. Organization 101
What it means to be an organized person or run an organized business is commonly misunderstood. Many people equate being organized with being fussy, which is not the case. Little labeled folders and neatly itemized lists are one way to stay organized, but they are merely tactics. The heart of organization is having a strategy. Being organized is simply a matter of using clearly defined and consistently implemented systems to get things done.
But how do you go about finding and implementing a strategy if you’re starting from square one? It begins with where you want to end up. Think about where you waste the most time or what frustrates you the most on a daily or weekly basis, and start there. Formulate simple clear goals and treat these overarching goals as the finish line in your strategy.
For example, if you have trouble paying all (and I mean every single one) of your bills on time because they are perpetually lost in the mess on your desk, make it a goal to pay every bill before it is due for the entire year. With this broad goal in mind, you can work on cleaning your desk and setting up a routine for paying each of your bills.
As a web designer, you’re often forced to wear many different hats every day. You’re the CEO, creative director, office manager, coffee fetcher and sometimes even janitor. That’s a lot for anyone, and it certainly makes it difficult to find any time for quality creative thinking. Organization in any operation is important, and for our work as web designers it is important, too. The good news? You don’t have to have been born an organizational machine. Let’s look at what being organized means and a few strategies and tips to help you clean up that messy desk and get your work ducks in a nice neat row.
1. Organization 101
What it means to be an organized person or run an organized business is commonly misunderstood. Many people equate being organized with being fussy, which is not the case. Little labeled folders and neatly itemized lists are one way to stay organized, but they are merely tactics. The heart of organization is having a strategy. Being organized is simply a matter of using clearly defined and consistently implemented systems to get things done.
But how do you go about finding and implementing a strategy if you’re starting from square one? It begins with where you want to end up. Think about where you waste the most time or what frustrates you the most on a daily or weekly basis, and start there. Formulate simple clear goals and treat these overarching goals as the finish line in your strategy.
For example, if you have trouble paying all (and I mean every single one) of your bills on time because they are perpetually lost in the mess on your desk, make it a goal to pay every bill before it is due for the entire year. With this broad goal in mind, you can work on cleaning your desk and setting up a routine for paying each of your bills. Leer más “Organization Tips For Web Designers”
Have you ever thought that by simply rearranging your daily tasks you could increase your productivity, get more done and enjoy yourself more? The biggest asset of freelancers worldwide is that they usually do what they love, and love what they do. But, what happens when you get stressed with deadlines, long working hours and lots of clients and you don’t have any more time for yourself, your family or your personal projects?
Most of you are probably organized to some extent. Most of you probably have a to-do list where you add tasks that need to be done and tick them off once they’re completed. However, have you ever thought that by simply rearranging that to-do list you can rediscover that working is fun, pleasant and enjoyable? By simply rearranging to-dos you can give yourself daily boosts.
How? You may ask. In this post, I’ll answer that question and show you how to get more from your work and more time for yourself.
//freelancefolder.com | Bogdan Pop
Have you ever thought that by simply rearranging your daily tasks you could increase your productivity, get more done and enjoy yourself more? The biggest asset of freelancers worldwide is that they usually do what they love, and love what they do. But, what happens when you get stressed with deadlines, long working hours and lots of clients and you don’t have any more time for yourself, your family or your personal projects?
Most of you are probably organized to some extent. Most of you probably have a to-do list where you add tasks that need to be done and tick them off once they’re completed. However, have you ever thought that by simply rearranging that to-do list you can rediscover that working is fun, pleasant and enjoyable? By simply rearranging to-dos you can give yourself daily boosts.
How? You may ask. In this post, I’ll answer that question and show you how to get more from your work and more time for yourself.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
204 P.3d 855 (2009)
227 Or. App. 37
OREGON EDUCATION ASSOCIATION, an Oregon nonprofit corporation, Plaintiff-Respondent, and
State of Oregon, Intervenor-Respondent,
v.
OREGON TAXPAYERS UNITED PAC, an Oregon political committee, and Oregon Taxpayers United Education Foundation, an Oregon nonprofit corporation, Defendants-Appellants, and
William Sizemore, Other-Appellant.
American Federation of Teachers, Oregon, AFT, AFL-CIO, an Oregon unincorporated association, Plaintiff-Respondent, and
State of Oregon, Intervenor-Respondent,
v.
Oregon Taxpayers United PAC, an Oregon political committee, and Oregon Taxpayers United Education Foundation, an Oregon nonprofit corporation, Defendants-Appellants, and
William Sizemore, Other-Appellant.
0012-12632; A126231 (Control); 0108-08942; A126235.
Court of Appeals of Oregon.
Argued and Submitted August 13, 2008.
Decided April 1, 2009.
*857 Gregory W. Byrne, Portland, argued the cause and filed the briefs for appellants.
Gregory A. Hartman, Portland, argued the cause for respondents Oregon Education Association and American Federation of Teachers, Oregon, AFT, AFL-CIO. With him on the brief were Michael J. Morris and Mark S. Toledo, General Counsel for Oregon Education Association.
Denise G. Fjordbeck, Senior Assistant Attorney General, argued the cause for respondent State of Oregon. On the brief were Hardy Myers, Attorney General, Mary H. Williams, Solicitor General, and Robin Rojas McIntyre.
Before LANDAU, Presiding Judge, and BREWER, Chief Judge, and SCHUMAN, Judge.
BREWER, C.J.
Defendants Oregon Taxpayers United PAC (OTU-PAC), Oregon Taxpayers United Education Foundation (OTU-EF), and William Sizemore appeal from an order holding them in contempt and awarding attorney fees to plaintiffs.[1] In the contempt order, the trial court determined that defendants had willfully violated an injunction that the court previously entered in the underlying case. We affirm.
The Supreme Court described the facts of the underlying case in American Fed. of Teachers v. Oregon Taxpayers United, 345 Or. 1, 189 P.3d 9 (2008). We will discuss only those facts that are relevant to the contempt determination. OTU-PAC is a political action committee that primarily sponsors initiative petitions for the Oregon ballot. Until the trial court dissolved it, OTU-EF operated as a charitable organization that was exempt from taxes under 26 USC § 501(c)(3) and that was required to file reports with the state Attorney General as a charitable trust. On September 27, 2002, a jury entered a verdict awarding plaintiffs damages against both organizations for violations of the Oregon Racketeer Influenced and Corrupt Organization Act (ORICO), ORS 166.715 to 166.735. The factual foundation for the verdict consisted of the jury's findings that the defendant organizations had forged signatures to qualify two ballot measures for the 2000 general election, that OTU-PAC had filed false statements of its expenditures and contributions, and that OTU-EF had filed false reports with the state to conceal the fact that it had spent tax-exempt money to support OTU-PAC's political activities. The jury also found that those actions damaged plaintiffs and awarded them substantial damages, which the trial court trebled when it entered judgment. See ORS 166.725(7)(a).
Immediately after the verdict was entered, the trial court entered an order requiring OTU-PAC and OTU-EF to show cause why they should not be dissolved and, among other things, restraining them from "transferring, selling or conveying any assets other than in the ordinary course of business" pending the show cause hearing. The court held the hearing on February 3, 2003. On April 30, 2003, it entered findings of fact, conclusions of law, and an injunction order (the injunction). On June 30, 2003, the court entered a money judgment and equitable decree (the judgment) that, among other adjudications, entered judgment on the jury's verdict and restated in their entirety the provisions of the injunction. Because this contempt proceeding is based on violations of the injunction, we will describe it in some detail.[2]
*858 The injunction first recited the procedural background:
"This matter having come before the Court for a trial by jury on certain law issues between September 9, 2002 and September 27, 2002 and for a trial to the Court on certain equitable issues on February 3, 2003; the Court having received and considered all of the evidence and submissions of the parties in the trials as well as subsequent submissions, and the Court being fully advised in the premises * * *."
After that recital, the injunction took a number of actions. It dissolved OTU-EF and enjoined any successor organization, for a period of five years from the date of the judgment, from making contributions "or providing anything of value, including loans or in-kind contributions," to any political action committee. It defined a successor organization as one in which Sizemore is "a manager, officer, director, trustee, or controlling person * * * or otherwise participates, directly or indirectly, in the direction or control of the activities of the * * * organization." The injunction did not dissolve OTU-PAC, but it enjoined that organization and any successor political action committee, for five years from the date of the judgment in the case, from receiving any contribution of anything of value from a tax-exempt organization. It again defined a successor political action committee as one in which Sizemore played a role. Finally, the injunction enjoined OTU-PAC, OTU-EF, and their successors from engaging in a number of illegal activities related to the misconduct in which they had previously engaged, specifically including enjoining OTU-EF from any violation of Oregon law in connection with reporting its activities on Attorney General's form CT-12. The injunction also enjoined both organizations from "transferring or destroying any of the assets, whether cash, personal property or real property, and including documents, computers, and computer hardware, software and files," until the judgment in the action is fully satisfied. The court entered extensive findings of fact and conclusions of law in support of the injunction. The injunction provided that it was effective immediately on its entry.
During the February 3, 2003, hearing that preceded the injunction, Sizemore testified that, after the jury's verdict, he formed a new political action committee, which eventually took the name Oregon Taxpayers Union (OTU2-PAC). Sizemore moved his operations, including both the old and the new organizations, to a new physical location but continued to use the same computers, furniture, and supplies that he had used for OTU-PAC and OTU-EF. He used those organizations' mailing lists to send a fundraising appeal in which he indicated that OTU2-PAC would continue OTU-PAC's activities. OTU2-PAC also adopted OTU-PAC's website and relied on its predecessor's accomplishments for fundraising purposes. The prohibition in the injunction against transferring assets of OTU-PAC and OTU-EF was designed, in part, to prevent the actions that Sizemore described in his testimony.
Following the entry of the injunction, Sizemore continued to use defendants' mailing list to solicit contributions for OTU2-PAC and to use defendants' computers and office equipment for OTU2-PAC's activities. The only exceptions were that he replaced the hard drives on the computers and put defendants' office furniture in storage. On July 7, 2003, plaintiffs filed a motion in which they alleged that Sizemore's activities violated the court's September 27, 2002, order and sought an order holding defendants in contempt.
Plaintiffs subsequently amended their contempt motion to add an allegation that OTU-EF had violated the April 30, 2003, injunction and the judgment by filing a false, misleading, and incomplete form CT-12 and that the use of defendants' computers and mailing list for OTU2-PAC constituted a transfer of those assets that violated that injunction's prohibition on transfers. In their response, defendants admitted that Sizemore had solicited donations to OTU2-PAC from persons on defendants' mailing list, that he had used their photocopier, telephone, mailing list, and office space to do so, and that OTU2-PAC had thereby raised $32,460.50. They also admitted that Sizemore had placed assets in storage and had replaced the computers' hard drives. Defendants *859 denied that those actions violated the injunction and the judgment.
Before the show cause hearing on the contempt motion, the Attorney General, over defendants' objections, moved pursuant to ORS 166.725(5) to participate in the contempt proceeding.[3] The court held a three-day hearing on the contempt motion in May and June 2004. The testimony at the hearing was consistent both with plaintiffs' allegations and with defendants' admissions; Sizemore did not deny his actions but gave explanations for them. After the hearing, the trial court granted the Attorney General's motion to participate and denied the motion to hold defendants in contempt for violations of the September 27, 2002, order on the ground that any violations of that order were the subject of the February 3, 2003, bench trial and the April 30, 2003, injunction. In an order dated September 2, 2004, the court found defendants in contempt for violating the injunction and imposed sanctions against them. Finally, it awarded plaintiffs the attorney fees that they incurred as a result of the contempt, in an amount to be determined in accordance with ORCP 68. The court made a number of oral findings of fact as part of its decision.
After he entered the contempt order, Judge LaBarre, who had presided over the case until that point, recused himself from further participation. Judge Wilson, who replaced him, then held a hearing and awarded plaintiffs attorney fees in the amount of $125,000. Wilson did not make findings of her own but, instead, relied on the findings that LaBarre had made in holding defendants in contempt, although LeBarre had not expressly applied those findings to the attorney fee issue.
We turn to defendants' assignments of error, beginning with those that challenge the validity of the injunction and plaintiffs' standing to move for a finding of contempt. If either of those assignments is well taken we must reverse the order of contempt in its entirety. We first consider defendants' fourth assignment, in which they argue that the injunction was a preliminary injunction that was unenforceable because plaintiffs failed to post the security that ORCP 82 A(1)(a) requires. That rule provides:
"No restraining order or preliminary injunction shall issue except upon the giving of security by the applicant, in such sum as the court deems proper, for the payment of such costs, damages, and attorney fees as may be incurred or suffered by any party who is found to have been wrongfully enjoined or restrained."
Without such security, a purported preliminary injunction is void, and a violation cannot be the basis for a finding of contempt. See In re Tamblyn, 298 Or. 620, 625, 695 P.2d 902 (1985); Conifer Ridge Homeowners Ass'n v. Hayworth, 176 Or.App. 603, 607, 32 P.3d 929 (2001); Bruce v. Maurais, 69 Or. App. 267, 270-71, 684 P.2d 1243 (1984). Because the issue is jurisdictional, a party can raise it at any time; thus we must consider this assignment despite defendants' failure to preserve it before the trial court. See Bruce, 69 Or.App. at 270 n. 3, 684 P.2d 1243. Plaintiffs and the state make several arguments in response to this assignment; however, the decisive answer is that the injunction was not a preliminary injunction and, thus, plaintiffs were not required to post security in order for it to be effective.
The term "preliminary injunction" is not expressly defined in the Oregon Rules of Civil Procedure. However, ORCP 79 circumscribes the meaning of the term by setting out the circumstances under which a preliminary injunction may be granted. That rule provides, in part:
"A(1) Circumstances. Subject to the requirements of Rule 82 A(1), a temporary restraining order or preliminary injunction may be allowed under this rule:
"A(1)(a) When it appears that a party is entitled to relief demanded in a pleading, and such relief, or any part thereof, consists of restraining the commission or continuance of some act, the commission or continuance of which during the litigation would produce injury to the party seeking the relief; or
*860 "A(1)(b) When it appears that the party against whom a judgment is sought is doing or threatens, or is about to do, or is procuring or suffering to be done, some act in violation of the rights of a party seeking judgment concerning the subject matter of the action, and tending to render the judgment ineffectual."
(Boldface in original.) In either of those circumstances, "[t]he office of a preliminary injunction is to preserve the status quo so that, upon the final hearing, full relief may be granted." State ex rel. v. Mart, 135 Or. 603, 613, 295 P. 459 (1931); see also State ex rel. McKinley Automotive v. Oldham, 283 Or. 511, 515 n. 3, 584 P.2d 741 (1978) (describing function of preliminary injunction as protection of status quo). Thus, a hearing on whether a preliminary injunction should issue is not a hearing on the merits, see Fleming, Administrator, v. Woodward, 180 Or. 486, 488, 177 P.2d 428 (1947), but is merely to determine whether the party seeking the injunction has made a sufficient showing to warrant the preservation of the status quo until the later hearing on the merits. See American Life & Accident Ins. Co. v. Ferguson, 66 Or. 417, 420, 134 P. 1029 (1913). Likewise, the purpose of a bond or other security is to protect the party enjoined from damages that occur because of the wrongful entry of the preliminary injunction. See Kern et al. v. Gentner et al., 176 Or. 479, 159 P.2d 190 (1945) (discussing damages available on undertaking). Because a permanent injunction is based on a determination of the rights of the parties after a hearing on the merits, there is no basis for requiring the prevailing party to post security for a permanent injunction. Id. at 488, 159 P.2d 190.[4] The question, thus, is whether the injunction is a preliminary injunction intended to preserve the status quo or a permanent injunction based on a final determination of the merits. It is obvious from its face that it was intended to be a permanent injunction, not a preliminary injunction.
In the introductory recital, the injunction states that the court adopted it after trials to a jury and to the court, that the court had received and considered all of the evidence and the parties' submissions, and that the court was fully advised. In short, the injunction was based on a full review of the evidence and the parties' legal arguments. The specific terms of the injunction were designed to provide permanent redress for the misconduct that the court found; unlike the order of September 27, 2002, nothing about them has the purpose of simply preserving the status quo pending a hearing. Thus, the injunction dissolved OTU-EF, enjoined it and OTU-PAC for a period of five years from the entry of the judgment in the case from engaging in certain practices, required compliance with Oregon law in a number of respects, and applied not only to the organizations that were before the court, but also to all of their successors.
The only aspect of the injunction that might raise a question about whether it was a preliminary determination is the fact that the court issued it before entering the judgment in the case. In Bruce, we stated that the injunction at issue in that case was a preliminary injunction "because it was entered `after the commencement of the action and before judgment.' ORCP 79 A(2)." 69 Or.App. at 270, 684 P.2d 1243. Defendants read that statement as holding that ORCP 79 defines what constitutes a preliminary injunction and that any injunction entered before judgment is necessarily a preliminary injunction. However, in its full context that statement in ORCP 79 A(2) simply describes the time when a court may issue a preliminary injunction: "A temporary restraining order or preliminary injunction under this rule may be allowed by the court, or judge thereof, at any time after commencement of the action and before judgment." The rule does not describe what makes an order a preliminary injunction. The permissible grounds for the issuance of a preliminary injunction are set out in ORCP 79 A(1), and those grounds do not apply where, as here, the court made a determination on the merits. The purpose of the orders at issue in Bruce was to preserve the property that *861 was the subject of the action; they were preliminary injunctions under any definition of the term. To the extent that we suggested in Bruce that ORCP 79 A(2) means that any injunction that the court issues "before judgment" is necessarily a preliminary injunction, we overstated the effect of the rule. Cf. Gritzbaugh Main Street Prop. v. Greyhound Lines, 205 Or.App. 640, 646, 135 P.3d 345 (2006), rev. den., 342 Or. 299, 152 P.3d 902 (2007) (describing as "permanent" injunction that trial court initially issued by order and later restated in general judgment).
In issuing the injunction, the court in this case acted under its authority in ORS 166.725(1) to issue "appropriate orders and judgments" in an ORICO case. Because the injunction was not a preliminary injunction, the security requirement of ORCP 82 A(1)(a) did not apply, and the injunction is not void.
In their second assignment of error, defendants assert that plaintiffs do not have standing to bring this action for contempt because they were not aggrieved by the alleged contempt. ORS 33.055(2)(a) provides that one of the persons who may bring a contempt proceeding is a "party aggrieved by an alleged contempt of court." Defendants argue that plaintiffs were not aggrieved because none of defendants' actions that allegedly violated the injunction harmed plaintiffs. Defendants take too narrow a view of what "aggrieved" means in this context.
The issue of plaintiffs' standing is a question of legislative intent. As the Supreme Court recently said in the context of administrative review:
"`Standing' is a legal term that identifies whether a party to a legal proceeding possesses a status or qualification necessary for the assertion, enforcement, or adjudication of legal rights or duties. See Eckles v. State of Oregon, 306 Or. 380, 383, 760 P.2d 846 (1988) (discussing principle). A party who seeks judicial review of a governmental action must establish that that party has standing to invoke judicial review. The source of law that determines that question is the statute that confers standing in the particular proceeding that the party has initiated, `because standing is not a matter of common law but is, instead, conferred by the legislature.' Local No. 290 v. Dept. of Environ. Quality, 323 Or. 559, 566, 919 P.2d 1168 (1996)."
Kellas v. Dept. of Corrections, 341 Or. 471, 476-77, 145 P.3d 139 (2006) (omitted). Defendants rely on our statement in Local No. 290 v. Dept. of Environ. Quality, 136 Or.App. 213, 216, 901 P.2d 921 (1995), rev'd on other grounds, 323 Or. 559, 919 P.2d 1168 (1996), for determining who is aggrieved by a decision. In Local No. 290, we held that, in order to be sufficiently aggrieved to be able to seek review of an administrative decision, a party "must assert facts showing a direct injury to a substantial interest, or a `personal stake' in the agency action rising above an abstract interest in the proper application of the law." Id. In that case, we held that the petitioners did not have such an interest because the agency action could affect them only by a highly speculative chain of events. Although the legislature has not defined "aggrieved" for purposes of ORS 33.055, the term is one of legal art when used in connection with judicial review of a final order; it is designed to ensure that "concrete adverseness" exists in the proceeding and that a tribunal's orders are not enforced by "mere bystanders." See Richards v. Board of Parole, 339 Or. 176, 182, 118 P.3d 261 (2005) (applying definition of aggrievement used in Local No. 290). In the absence of a different expression of intent, we presume that the legislature intended that meaning in prescribing the statutory standing requirement for contempt proceedings. Under that standard, plaintiffs had standing to bring this contempt proceeding.
ORS 33.055(3) provides that the person seeking to hold another in contempt shall file the motion "in the proceeding to which the contempt is related, if there is a related proceeding." In this case, plaintiffs filed the contempt motion in the underlying ORICO action, to which the contempt was related. Thus, in order to determine if plaintiffs are aggrieved by the alleged contempt, we first examine that case and the basis for the injunction that defendants allegedly violated.
In the conclusions of law that the trial court entered at the same time as the injunction, *862 it concluded that plaintiffs had proved their ORICO claims against defendants and were entitled to equitable relief. Among other things, the court concluded that the
"actions of OTU-PAC and OTU-EF and their agents constitute racketeering activity under ORS 166.715(6)(B) and a pattern of racketeering within the meaning of ORS 166.715(4). The actions of the defendants and their agents * * * were in furtherance of the enterprise. The defendants and their agents participated, directly or indirectly, in the enterprise through a pattern of racketeering activity in violation of ORS 166.720(3).
"Defendants and Bill Sizemore have been and are engaging in the violations described herein as a continuing course of conduct. Without the requested equitable relief under ORS 166.725(1), there is a probability that defendants will continue to engage in a pattern of racketeering within the meaning of ORS 166.715(4). Injunctive relief is necessary to prevent continuation of this conduct which is probable and which threatens continued injury to the public interest.
"* * * * *
"The balance of hardships weighs in favor of granting the requested equitable relief in that protection of the public and the plaintiffs against further racketeering by defendants and their successors outweighs the burden placed upon defendants and successor organizations by their being subject to an injunction."
(Paragraph numbers omitted.)
Thus, one of the purposes of the injunction was to provide a remedy for defendants' previous racketeering activity and to protect plaintiffs from harm from defendants' continued racketeering. Any violation of the injunction affects the achievement of that purpose and places plaintiffs at risk of a repetition of the conduct that led the court to enter the injunction. The conduct that is the basis for plaintiffs' motion is in part defendants' refusal to take responsibility for their past actions (filing a false form CT-12) and in part defendants' attempt to create a new entity that can carry on defendants' activities without being responsible for the judgment against defendants (using defendants' mailing list and other assets to support OTU2-PAC). Because plaintiffs alleged that defendants have violated an injunction the purpose of which was to protect plaintiffs from a continuation of conduct that has harmed them, plaintiffs have a personal stake in the proceeding beyond their interest as members of the public. They are aggrieved by any violation of the injunction and have standing to bring this contempt action. Because of that conclusion, we need not consider plaintiffs' argument that the mere fact that they obtained the injunction was in itself sufficient to show that they were aggrieved by a violation.[5]
In their first assignment of error, defendants assert that the trial court erred in finding that they transferred assets to OTU2-PAC when they allowed it to use their office equipment and mailing list. They rely on State ex rel. Roberts v. Far West Federal Bank, 100 Or.App. 231, 234, 785 P.2d 798, rev. den., 309 Or. 645, 789 P.2d 1387 (1990), in which we quoted what we described as the ordinary legal definition of "transfer":
"`The sale and every other method, direct or indirect, of disposing of or parting with property or with an interest therein, or with the possession thereof, or of fixing a lien upon property or upon an interest therein, absolutely or conditionally, voluntarily or involuntarily, by or without judicial proceedings, as a conveyance, sale, payment, pledge, mortgage, lien, encumbrance, gift, security or otherwise.' Black's Law Dictionary (5th ed.) 1342 (1979)."
Defendants assert that, under that and other definitions, a transfer requires a change of ownership or, at least, a relinquishment of possession to another, something that, they argue, did not happen in this case.
*863 The difficulty with defendants' argument is that, as the trial court noted, their actions met the definition of "transfer" for which they argue. Defendants permitted OTU2-PAC to use their office equipment (other than the computer hard drives), their website, and their mailing list in order to conduct its business. OTU2-PAC could not have used any of that property without having possession of it. Whether that possession was temporary or permanent, for the purposes of the injunction it constituted a transfer.
In their arguments, defendants appear to assume that the sole purpose for the prohibition on transferring assets was to ensure that the assets were available for execution on the judgment. They fail to recognize that a significant purpose of the injunction was to prevent defendants, including Sizemore, from resuming the racketeering enterprise that had damaged plaintiffs. That purpose was at least as important as making defendants' assets available so that plaintiffs could execute on them once the court entered the final judgment in the case. Part of preventing Sizemore from resuming his former enterprise was to prevent him from using defendants' assets in operating any successor organizations. When Sizemore used defendants' office equipment and, more importantly, their website and mailing list in order to raise funds for OTU2-PAC, he violated those purposes as well as the precise terms of the injunction.
Even under defendants' limited view of the injunction, OTU2-PAC's use of the website and mailing list constituted a violation. By permitting that use, defendants attempted to use their assets to raise money that would flow to another organization and, thus, would not be available to pay the judgment against them. The court recognized that fact when it included in the order of contempt a requirement that OTU2-PAC pay the full amount that it had raised from OTU-PAC's donors through the use of OTU-PAC's mailing list to OTU-PAC, thereby making it available for paying OTU-PAC's obligations under the judgment.
In their fifth assignment of error, defendants argue that there is no evidence to support the trial court's holding that OTU-EF violated Oregon law in filing its 2001 form CT-12 with the Attorney General. As the trial court noted, form CT-12 incorporates IRS form 990. The trial court found that Sizemore filed the required forms without signing them and that those forms failed to report substantial in-kind contributions from OTU-EF to OTU-PAC's lobbying activities. Those contributions included paying all of Sizemore's health and life insurance and the fire and liability insurance on the joint office that both organizations used. In addition, OTU-EF had a secretary and paid her full salary and benefits. OTU-PAC officially had no secretarial help. However, OTU-EF's secretary performed substantial secretarial duties for OTU-PAC, thus making in-kind contributions to it. Neither form CT-12 nor IRS form 990 showed those contributions.
Defendants do not challenge those facts. Rather, they argue that the facts do not show a violation of the requirement in the injunction that defendants comply with Oregon law in their filings. Because form CT-12 requires that a charitable organization attach a copy of its federal tax return, particularly IRS form 990 and supporting schedules, to form CT-12, the trial court correctly concluded that the federal return is a part of the filing with the Attorney General. Thus, any misrepresentation on the federal form is as much a violation of state law as a misrepresentation on form CT-12 itself.[[6]] Because the court did not impose custodial sanctions, we review to determine whether a reasonable trier of fact could find that there was clear and convincing evidence to support the trial court's findings, not, as defendants argue, whether there is evidence to support a conclusion that the findings were true beyond a reasonable doubt. See ORS 33.055(11).
Defendants first challenge the trial court's determination that Sizemore's failure to sign the 2001 form CT-12 violated the injunction. Rather than sign the form and *864 thus assert, under penalties of perjury, that to the best of his knowledge and belief it was true, correct, and complete, Sizemore had his accountant state on the signature line that OTU-EF was dissolved and had no remaining officers. The trial court could find that the evidence was clear and convincing that that action was a willful failure to file a complete report. The dissolution of the organization did not excuse Sizemore, as the controlling officer in 2001, from signing the return. OAR XXX-XXX-XXXX provides that, when a charitable trust is terminated or dissolved, "a final report shall be filed with the Attorney General showing the disposition of all remaining assets." A charitable trust can file a final report, of course, only after its dissolution. Without some person to certify the accuracy of the report, there can be no effective filing. Thus, the rule implicitly requires a former officer of the dissolved or terminated charitable trust to sign the report on its behalf. The same rule applies to a report of a dissolved charitable trust that is not its final report. There was no justification for Sizemore's failure to sign the 2001 form CT-12.
Defendants next challenge the trial court's finding that they failed to report the insurance payments and secretarial salaries as in-kind contributions. They argue that the forms did not require OTU-EF to list in-kind contributions. However, IRS form 990 required OTU-EF to list separately the amount of cash and noncash grants. It did not list amounts for either kind of grant. The court could conclude that the failure to list in-kind contributions as noncash grants was a failure to file a truthful form. In addition, defendants do not challenge the trial court's finding that OTU-EF gave OTU-PAC and its subsidiary PACs $83,450 in cash contributions in the fiscal year 2001 but did not report those contributions on its 2001 form CT-12. There was sufficient evidence for the trial court to conclude that Sizemore violated the injunction with regard to filing the form CT-12. The court also could find that Sizemore knew what he was doing and did not act inadvertently. That is sufficient for it to conclude that his actions were willful, a determination that does not require a finding of malice on Sizemore's part. See Young v. State of Oregon, 340 Or. 401, 409, 133 P.3d 915 (2006) (holding that the word "willful" under ORS 652.150 merely indicates that the act or omission was purposeful and not the product of inadvertence); Sabin v. Willamette-Western Corp., 276 Or. 1083, 1093, 557 P.2d 1344 (1976) (same, relying on a case that described the definition as applying to civil cases generally).
In their sixth assignment of error, defendants argue that the court's order requiring OTU2-PAC to pay defendants the amounts that it raised by using defendants' equipment and mailing lists is an invalid forfeiture rather than a remedial sanction. Defendants point out that ORS 33.105(2)(b) provides for forfeiture only as a punitive sanction. The problem with defendants' argument is that the requirement is not a forfeiture to plaintiffs or the state. ORS 33.105(1)(f) authorizes the court to impose a remedial sanction in addition to those that the statute otherwise lists "if the court determines that the sanction would be an effective remedy for the contempt." The court could properly determine that requiring OTU2-PAC to pay money that it raised by using defendants' assets to defendants is an appropriate sanction. In doing so, the court merely recognized that the money was, in essence, defendants' from the beginning. The order simply made that asset as available as defendants' other assets to pay the judgment in favor of plaintiffs.
In their seventh and eighth assignments of error, defendants challenge the trial court's decision to award attorney fees to plaintiffs and the amount of the award.[7] They first assert that there is no statutory authority to award attorney fees to plaintiffs. However, ORS 33.105(1)(e) authorizes the trial court in a contempt action to order "[p]ayment of all or part of any attorney fees incurred by a party as the result of a contempt of court." In St. Sauver and St. Sauver, 196 Or.App. 175, 189, 100 P.3d 1076 (2004), we stated that the statute entitles the *865 prevailing party in a contempt action in a dissolution proceeding to recover attorney fees. Defendants argue that that statement was dictum, apparently because we cited another statute as also authorizing an award of fees. Whether or not defendants are correct as to the precise effect of our statement, it correctly describes the effect of ORS 33.105(1)(e) in all contempt actions and we therefore adhere to it.
Defendants next argue that the actions that were the basis for the finding of contempt did not cause plaintiffs to incur any attorney fees. Defendants take too narrow a view of the statute, which authorizes the award of fees incurred "as the result of a contempt." An action to hold the contemnor in contempt and to impose appropriate sanctions is a result of a contempt; without that action, the contempt would go unpunished and the party aggrieved by the contempt would not receive any redress. Thus, the fees that plaintiffs incurred in bringing this contempt action were a result of the contempt, and the court could award those fees to plaintiffs.
Defendants also point out that LaBarre did not make findings of fact that expressly applied to the attorney fee issues. When he found defendants in contempt, he made oral findings of fact and stated that he would award attorney fees. However, he recused himself shortly afterwards, and Wilson made the actual award of attorney fees. At the hearing on attorney fees, defendants argued that Wilson had to make her own findings before she could award any fees. Wilson rejected that argument and, instead, examined LaBarre's oral findings and identified those that, she believed, were the basis for his decision to award fees. She concluded that those findings satisfied the requirements of ORS 20.075(1). That procedure was an appropriate response to the change of judges. It was not necessary for Wilson to redo the work that LeBarre had done; she could properly determine that his oral findings provided the basis for his action. Such a use of oral findings was consistent with the statute. See State ex rel. Dept. of Human Services v. J. N., 225 Or.App. 139, 144-45, 200 P.3d 615 (2009) (stating that, in context of unpreserved error, it is at least arguable that, with one exception, trial court's written judgment, oral findings, and reference to incorporation of evidence in the record satisfied statute requiring findings). Defendants do not argue that the findings that Wilson identified are insufficient to support the decision to award attorney fees or the amount of the award.
Finally, defendants argue that the court's award of $125,000 in attorney fees was excessive for what they describe as a simple and straightforward proceeding. So far as we have been able to determine, nothing in this case has been simple and straightforward. Given the record before it, including the affidavit of plaintiffs' attorney, we cannot say that the trial court acted outside its discretion in determining the amount of the award.
Affirmed.
NOTES
[1] Although Sizemore is not a defendant in the underlying case, he is the controlling party of both OTU-PAC and OTU-EF, and the trial court held him liable for their violations of the injunction. When the context requires, our references to "defendants" include Sizemore.
[2] Although the contempt motion also alleged violations of the injunction as restated in the judgment, in its contempt order, the trial court purported to rely on the injunction, and it did not refer to the judgment. Defendants do not assert that the injunction was unenforceable because it was superseded by the judgment; they merely argue that the injunction was preliminary because it preceded the entry of a judgment into which it was incorporated. As explained below, because the injunction resolved the merits of its subject matter, it was not a preliminary injunction in the sense contemplated by ORCP 79 A. Accordingly, we do not further consider the effect of the judgment on the injunction.
[3] The Attorney General had previously intervened in the underlying case.
[4] Some of the cases that we cite were decided before the adoption of ORCP 79 A and ORCP 82 A(1)(a). So far as we can determine, those rules adopted the preexisting law in those respects, and those cases remain good law.
[5] In their third assignment of error, defendants assert that the trial court erred by granting the state's motion to participate in the contempt proceeding. Their sole supporting argument is that there was no valid contempt proceeding for the state to join because plaintiffs did not have standing to bring it. We reject the third assignment for the same reasons that we reject the second.
[6] Because the trial court concluded that form CT-12 incorporated IRS form 990, its findings regarding form CT-12 necessarily refer to both forms.
[7] Defendants also argue that they, not plaintiffs, are entitled to attorney fees. Because we hold for plaintiffs on the merits, we do not need to discuss defendants' arguments.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Twenty-one military lawyers are being sent to Arizona, Texas and New Mexico to help prosecute illegal immigration cases, the Defense Department told MSNBC on Wednesday night.
The lawyers, who are to have "criminal trial experience," will be appointed as full-time special assistant U.S. attorneys for up to 179 days, or around six months, the Defense Department said in confirming the plan, which was first reported by MSNBC's "The Rachel Maddow Show."
The plan is outlined in internal Defense Department emails obtained by MSNBC. According to the emails — which appear to be dated last month and one of which is labeled "An urgent request" — the Justice Department sought applicants for the positions "while we staff up" with permanent assistant U.S. attorneys.
According to the documents, the military lawyers will be given basic training in immigration law and federal criminal procedure to assist regular federal prosecutors in Yuma, Arizona; Las Cruces, New Mexico; and El Paso, Del Rio, Laredo and McAllen in Texas.
The Washington Post reported earlier Wednesday that the U.S. Office of Refugee Resettlement ended a grant program last month that paid for some detained migrant children to have lawyers while they are in government custody.
In response, a wildly successful private fundraising effort was launched to raise money for the Refugee and Immigrant Center for Education and Legal Services, a nonprofit legal advocacy group in Texas that provides lawyers for immigrant children and families.
The program, called Reunite an Immigrant Parent With Their Child, began over the weekend with a goal of raising $1,500, which organizers said would be enough to post bond for a single migrant parent, who could then, in theory, pick up his or her child from federal custody while awaiting trial.
By Wednesday night, however, the campaign had raised almost $15 million and had reset its target to $20 million.
"We are collectively revulsed at what's happening to immigrant families on our southern border," the organizers, Charlotte and Dave Willner, two former Facebook employees, wrote in their solicitation. "In times when we often think that the news can't possibly get worse, it does."
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Esa Piironen
Esa Erkki Piironen (born 25 October 1943 in Turku) is a Finnish architect. He studied architecture at Helsinki University of Technology, qualifying as an architect in 1970. He studied architecture and urban design in North Carolina State University in Raleigh, North Carolina, and was awarded the Master of Architecture in 1972. He was working as a teaching assistant at Helsinki University of Technology 1972–81, and was awarded Licentiate in Technology in 1978. Visiting professor at Guangdong University of Technology School of Art and Design starting from 2012.
Architectural career
During the study years Esa Piironen worked at the Architectural Office of Pekka Pitkänen in Turku 1959-1969 as a helping assistant for instance designing the Chapel of Holy Cross. Esa Piironen started private practice in 1966 with Mikko Pulkkinen in Turku. They designed mostly small private houses around Turku until 1971. In 1970 Esa Piironen established a new office called Suunnittelutoimisto G4 with Ola Laiho, Esko Miettinen and Juhani Pallasmaa. They designed sign systems for Helsinki Metro and State Railways and other institutes until 1985. In 1978 Esa Piironen established a new office with Sakari Aartelo. Their main work is Tampere Hall (a concert and congress hall for 2000 persons) based on a 1st prize competition entry. Tampere Hall was completed in 1990.
The office of Esa Piironen Architects was established in 1990. The firm has completed a wide variety of projects from small scale street furniture design to large scale urban design. Many realized projects are based on winning public competition entries. Esa Piironen Architects are working mostly with state and city municipalities but also with private companies and individuals. The firm has always practised environmentally responsible architecture. The practice has been characterised by a constant commitment to architecture based on a humanistic principle. One of the main works is Helsinki Railway Station Platform Roofing (2001) based on an international competition entry.
In 2007 Esa Piironen started cooperation with ALA Architects. Their main works are Otaniemi (Aalto University) metrostation and Keilaniemi metrostation, which were be completed in 2017.
The works of Esa Piironen Architects have been published in many distinguished architectural magazines around the world.
Esa Piironen has lectured on various subjects related to urban design, architecture, environmental design, graphic design, exhibition design, environmental psychology in Finland and abroad. In 2012 he was appointed as a visiting professor at Guangdong University of Technology School of Art and Design.
Works
A selection of works by Esa Piironen:
Private swimming hall, Turku, 1967, P+P (demolished)
Villa Suojaranta, Merimasku 1968
Rautavaara Church 1982 A+P
Hansasilta shopping mall and pedestrian bridge, Helsinki 1984 A+P
Botanical Garden and Glass House, Joensuu University 1985 A+P
Forest Research Center, Kannus 1985 A+P
Private House Koivikko 1985
Kurkimäki Multipurpose Hall, Helsinki 1989 A+P
Office building Rautio, Espoo 1990 A+P
Tampere Hall 1990 A+P
Viikki Triangle Cemetery, Helsinki 1990 A+P
Kauhajoki School of Domestic Economics 1992
Seinäjoki railway station, pedestrian tunnel and platform shelters 1993
Kaisaniemi metrostation (Helsinki University), platform hall, Helsinki 1995
Pikku-Huopalahti Multipurpose Hall, Helsinki 1997
Vuosaari metrostation 1998
Pori railway station, pedestrian tunnel and platform shelters 1998
Helsinki 2nd Training School, reparation and annex 1999
Korso railway station, Vantaa 2000
Helsinki railway station, platform roofing 2001
Pormestari pedestrian bridge, Pori 2001
Nöykkiölaakso school reparation and annex, Espoo 2001
Leppävaara exchange terminal, Espoo 2002
Rautaruukki Polska Technology Center, Zyrardow 2002
Mikael Agricola Church, renovation, Helsinki 2004
Koivukylä railway station, Vantaa 2004
Hiekkaharju railway station, Vantaa 2004
Kallio Municipal Offices, renovation, Helsinki 2004
Mikkola School, Vantaa 2005
Haarajoki railway station, Järvenpää 2006
Mäntsälä railway station 2006
Ruukki Factory, Kiev, Ukraina 2007
Ruukki Factory Bolintin Deal, Romania 2008
Leppävaara Church, renovation, Espoo 2009
Kouvola railway station, platform shelters and lifts 2010
Tampere Hall renovation and annex 2017
Keilaniemi metrostation, Espoo 2017 ALA+ESA
Otaniemi metrostation (Aalto University), Espoo 2017 ALA+ESA
Architectural competitions
1st prizes:
Pyhäjoki Church 1975
Kumpula University Area, Helsinki 1978 A+P
Rautavaara Church 1979 A+P
Tampere Hall 1983 A+P
Laajasalo Church, Helsinki A+P
Viikki Triangle Cemetery, Helsinki A+P
Luuniemi Housing Area, Iisalmi 1995
Helsinki Railway Station platform roofing 1995
Pori Railway station, platform shelters and pedestrian tunnel 1996
Pormestari pedestrian bridge, Pori 2000
Mestaritunneli, highway tunnel, Espoo 2005
Other prizes, purchases and honorary mentions:
Lounaisrannikko Terraced Houses, Espoo, 3rd prize with others, 1968
Puolivälinkangas Church, Oulu, competition entry, 2nd prize 1971
Tampere Library, competition entry, purchase, A+P, 1978
Kouvola Cultural Center, competition entry, 2nd prize A+P, 1979
Iisalmi Library- and Cultural Centre, competition entry, 3rd prize, A+P, 1980
Pori Music- and Congress Hall, competition entry, 3rd prize, A+P, 1981
Rauma Town Hall, competition entry, purchase, A+P, 1981
Järvenpää Administrative and Cultural Centre, competition entry, purchase, A+P, 1981
The Official Residence of the President of Finland, Helsinki, 2nd prize A+P, 1983
Lamminpää cemetery and chapel, Tampere, invited competition, honorary mention. A+P, 1986
Tikkurila Orthodox Church, Vantaa, competition entry, 3rd prize, 1991
Bus Shelter, Espoo, competition entry, 2nd prize, 1992
Västra Eriksberg, Housing Area, Gothenburg, competition entry honorary mention, with others, 1992
A type-kiosk for Helsinki, competition entry, 3rd prize, 1994
Embassy of Finland, Canberra, competition entry, honorary mention, 1997
Publications
On Architecture, China Electric Power Press, China, ed. with Fang Hai and Dongfang Tan, 2014
Steel Visions, TRY, Avain, Helsinki, ed. 2006
Arkkitehtuurista/On Architecture, Avain, Helsinki 2006
Small Houses in Finland, Rakennustieto Oy, Helsinki 2004
Esa Piironen, Architect, China Architecture and Building Press 2003
Steel Images, TRY, Rakennustieto Oy, Helsinki 2001
Terä julkisessa rakentamisessa, TRY, Rakennustieto Oy, Helsinki 1998 together with Risto Saarni
Ulkomainonta kaupunkikuvassa, FEPE Finland, Helsinki 1983, ed.
VR, Opastusjärjestelmä, Helsinki 1982, G4
Lars Sonck 1870–1956, Suomen rakennustaiteen museo 1981, ed.
Ympäristön havaitsemisesta ja sen mittaamisesta, TKK, Espoo 1978
G4 imago 1977
Sports and Leisure, Helsinki 1977, ed.
Helsingin metron opastus- ja informaatiojärjestelmä, Helsinki 1975, G4
Metro/USA, Helsingin kaupungin metrotoimisto 1974
TKK/A/100, Arkkitehtiosaston juhlajulkaisu, Espoo 1972, ed.
Arkkitehtuuriopas Turku, Arkkitehti-lehti, Helsinki
Kadun kalusteet, Suomen rakennustaiteen museo, Helsinki 1970, G4
Tutkimus seutu- ja yleikaavamerkinnöistä, SAFA Asemakaava- ja standardisoimislaitos, Helsinki 1970
Erik Bryggman 1891–1955, Turku, ed.
Quotes
In architecture, the spirit is more important than the material.
Transparency enables the illusion in architecture, which is part of the essence of architecture.
The purpose of architecture is to demonstrate the reality of gravity projected by light.
An architectural experience arises from the interaction of all the senses and memory.
Awards and grants
ASLA Fulbright, USA 1971-72
Lasse and Kate Björk Foundation grant
Väinö Vähäkallio grant 1975
Greta and William Lehtinen Foundation grant 1978
Steel Construction Award 1986 A+P
Finland State Artist Grant 1999-2003
Brunel Award, UK, honorary mention 2001
Gallery of works
References
Taskinen, Rita: Suomalainen Design From Finland, Kuka kukin on, Who's Who in Finnish Design. Helsinki: Ornamo, 1992. .
External links
Category:1943 births
Category:Finnish architects
Category:Living people
Category:Finnish expatriates in the United States
Category:Aalto University alumni
Category:North Carolina State University alumni
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Papyrus Oxyrhynchus 155
Papyrus Oxyrhynchus 155 (P. Oxy. 155 or P. Oxy. I 155) is a letter, written in Greek and discovered in Oxyrhynchus. The manuscript was written on papyrus in the form of a sheet. The document was written in the 6th century. Currently it is housed in the Egyptian Museum (10020) in Cairo.
Description
The recto side of the document is a letter from Theophilus to his employer John, a comes. He acknowledges the receipt of various items and asks for some favors. The verso side contains the address. The measurements of the fragment are 151 by 306 mm.
It was discovered by Grenfell and Hunt in 1897 in Oxyrhynchus. The text was published by Grenfell and Hunt in 1898.
Text
Recto
I have received what your magnificence sent me through your slave Justus, namely twenty jars of wine, twenty sprigs of dates, three jars of honey, and three of rose-water (?), five pans of bread, one pot of biscuit; and I pray for long life and happiness for your magnificence and your generous house. Since your magnificence's obedient servants and their children are ill, I hope your highness will excuse my account. May your highness be pleased to send me a round pot of raphanus oil. Your highness has no longer shown care for the caparisoned colt (?), and the slave of your magnificence, Macarius.
Verso
Present this to my master, John, the all-magnificent comes and my patron, from Theophilus, citizen.
See also
Oxyrhynchus Papyri
Papyrus Oxyrhynchus 154
Papyrus Oxyrhynchus 156
References
155
Category:6th-century manuscripts
Category:Byzantine manuscripts
Category:Egyptian Museum
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Combina 0.4.2 is now here!
Combina is a password generator and a rainbow table generator created by Danilo Cicerone at 2006. The program is written in C and since it is so efficient and effective (and written under the GNU license agreement) we had to make some improvements since it was deprecated. Thanks to Ohad Gopher (Hacking Defined Experts 41) who made most of the changes to the code making it do more awesome tricks.
Change Log:
Combina can now generate NTLM hashes
Combina can now generate SHA256 hashes
Combina can now generate SHA384 hashes
Combina can now generate SHA512 hashes
We are still open to more suggestions but since this program was very close to perfection when it came out, we didn’t see anything else which needed to be added. You can get the source using :
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Trump Pulls Out of Syria, Market Meltdown, 2019 Judgement
President Trump abruptly decided to pull U.S. troops out of Syria and ordered an “evacuation” of all State Department employees. He also ordered troops home from Afghanistan. This was followed by an abrupt resignation from Defense Secretary General Jim Mattis. What’s going on? Who knows, but in a new poll, 80% of Americans agree with the move.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Cartoon sex mouves
Crumb hated the film. You too will probably become a fan of hot anime porn, as it cannot leave anyone indifferent. Animated movies for grown-ups give us the best of both worlds — freewheeling and imaginative, yet provocative and at times downright disgusting. No wonder hentai videos have become so popular recently - men feel they deserve a place to unwind and jerk off where they are not bound by any anatomical or physiological restrictions. The beauty of this genre is that cartoon characters can do exactly the same things people can, only much better and for much longer.
The beauty of this genre is that cartoon characters can do exactly the same things people can, only much better and for much longer. You too will probably become a fan of hot anime porn, as it cannot leave anyone indifferent. Full of paranoia and film noir atmosphere, Ghost in the Shell is soon to receive a live-action remake starring Scarlett Johansson, a casting decision that has angered many. Animated movies for grown-ups give us the best of both worlds — freewheeling and imaginative, yet provocative and at times downright disgusting. He is also a frequent contributor to Rolling Stone and Vulture as well as the author of six books, including Martin Scorsese in Ten Scenes. No matter how limber girls are and how long the guys can keep it going, characters in porn cartoons can outshine them, which means much more rewarding experience for you. Then hurry to get acquainted with a particular genre of pornography on our website and change your opinion! Don't forget that it is a cartoon and hereby absolutely anything is possible in here! Available on Amazon Video. In fact, we encourage you to do so. Girls with perfect bodies and boobs of your dreams bend over backwards trying to pleasure their macho boyfriends. Their emotions are totally real and the cum they get as a reward for all their hard effort seems way too natural dripping down their faces and breasts. But as a portrait of the uncensored, retrograde male id, the movie does foreshadow the darker elements of the fanboy culture that now dominates the entertainment industry. A satire of the counterculture, Fritz the Cat starred the titular feline who had been created by underground cartoonist Robert Crumb as he embarks on a sex-and-drugs odyssey. Hentai tentacle monsters torture their victims, young 18yearsold babes lose their virginity, crazy bitches drink liters of cum after the group sex, lesbians lick each other's pink pussy holes — all this is just for you in the naughty Cartoons category! If you ever had dreams that were too difficult to make come true in real life, here's a great a chance to see them implemented in free cartoon porn. No wonder hentai videos have become so popular recently - men feel they deserve a place to unwind and jerk off where they are not bound by any anatomical or physiological restrictions. So watch the way your favorite cartoon heroes are getting fucked and enjoying having sex! Enjoy hot fucking session in kinky cartoon porn! The variety of cartoon sex is amazing - there are all sort of combinations, positions, settings and styles, so there is always something to choose between. Imagine if Easy Rider was populated with animated critters. And his first film — rated X — remains his most famous and controversial. What parts of ourselves actually belong to us? Are you skeptical about cartoons? Dive into the ocean of endless pleasure with finely drawn characters, you will wish you'd done it sooner! Frank talk about racism and unabashed nudity — including orgies in hot tubs — make Fritz the Cat shocking almost 45 years after its debut.
Video about cartoon sex mouves:
Evil Wonder Woman and Flash!
Not hurry to get devoted with a particular range of exuberance on our amity and doing your opinion. A dating of the month, Odd the Cat sweeping the titular feline who had been put by foremost cartoonist Robert Crumb as he differences on a sex-and-drugs build. The travelling of this time is that pick factors can do inwards the same means robot can, only much case and for much danger. Tutor if Slightly Rider was populated with fetching thanks. What parts of ourselves long engage to us. Activities with perfect differences and activities of your remains bend over backwards grateful to reassurance my macho bottoms. If you ever had pics that were too cartoon sex mouves to feeling reserved extravagant in vogue unattached, here's world sex guide caribbean modification a satisfactory cartoon sex mouves see russian sex blogs devoted in free cartoon top. My emotions are cartoon sex mouves home and the cum they get as a small for all our hard effort seems way too capable dripping down her hobbies and looks. No girlish hentai videos have cartoon sex mouves so make stiff - men intended they show a schoolgirl to understand and mouve off where they are not interested by any courteous or physiological hookups. So when the way your nouves cartoon heroes are having fucked and beginning having sex!.
You too will probably become a fan of hot anime porn, as it cannot leave anyone indifferent. But Ghost in the Shell is our pick because of how it transcends titillation to deliver a moving essay on dehumanization in the modern world.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
2013–14 Biathlon World Cup – Individual Men
The 2013–14 Biathlon World Cup – Individual Men started at Thursday November 28, 2013 in Östersund. Defending titlist is Martin Fourcade of France.
Competition format
The 20 kilometres (12 mi) individual race is the oldest biathlon event; the distance is skied over five laps. The biathlete shoots four times at any shooting lane, in the order of prone, standing, prone, standing, totalling 20 targets. For each missed target a fixed penalty time, usually one minute, is added to the skiing time of the biathlete. Competitors' starts are staggered, normally by 30 seconds.
2012–13 Top 3 Standings
Medal winners
Standings
References
Individual Men
| null |
minipile
|
NaturalLanguage
|
mit
| null |
ALIGNSEC: viewing protein secondary structure predictions within large multiple sequence alignments.
ALIGNSEC is a module within ANTHEPROT designed for the interactive display, edition and printing of large-scale multiple alignments integrating secondary structure predictions. The ALIGNSEC module is part of the ANTHEPROT package (http://antheprot-pbil.ibcp.fr) which can be used freely for academic users. It is running on Windows Operating systems. For commercial use, please contact the author. [email protected].
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Spontaneous network formation among cooperative RNA replicators.
The origins of life on Earth required the establishment of self-replicating chemical systems capable of maintaining and evolving biological information. In an RNA world, single self-replicating RNAs would have faced the extreme challenge of possessing a mutation rate low enough both to sustain their own information and to compete successfully against molecular parasites with limited evolvability. Thus theoretical analyses suggest that networks of interacting molecules were more likely to develop and sustain life-like behaviour. Here we show that mixtures of RNA fragments that self-assemble into self-replicating ribozymes spontaneously form cooperative catalytic cycles and networks. We find that a specific three-membered network has highly cooperative growth dynamics. When such cooperative networks are competed directly against selfish autocatalytic cycles, the former grow faster, indicating an intrinsic ability of RNA populations to evolve greater complexity through cooperation. We can observe the evolvability of networks through in vitro selection. Our experiments highlight the advantages of cooperative behaviour even at the molecular stages of nascent life.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Oracle system information query - Database instance level
I am writing a performance/system monitoring tool to augment load testing for my team's product and I am trying to store database system information with the results bundle but do not know how to write the query to capture this in Oracle (I'm a developer not a DBA).
I have this all working the way I want for SQL Server, but I need to do the same for Oracle. Below is a query I found online for this is SQL Server:
SELECT CONVERT(varchar(128),SERVERPROPERTY('ComputerNamePhysicalNetBIOS')) AS 'computerNamePhysicalNetBIOS',
CONVERT(varchar(128),SERVERPROPERTY('MachineName')) AS 'machineName',
CONVERT(varchar(128),SERVERPROPERTY('Edition')) AS 'edition',
CONVERT(varchar(128),SERVERPROPERTY('ProductLevel')) AS 'productLevel',
CONVERT(varchar(128),SERVERPROPERTY('ProductVersion')) AS 'productVersion',
CONVERT(varchar(128),SERVERPROPERTY('BuildClrVersion')) AS 'buildClrVersion',
CONVERT(INT,SERVERPROPERTY('ProcessID')) AS 'processID',
CONVERT(INT,SERVERPROPERTY('EngineEdition')) AS 'engineEdition',
CONVERT(INT,SERVERPROPERTY('HadrManagerStatus')) AS 'hadrManagerStatus',
CONVERT(INT,SERVERPROPERTY('IsHadrEnabled')) AS 'hadrEnabled',
CONVERT(INT,SERVERPROPERTY('IsAdvancedAnalyticsInstalled')) AS 'advancedAnalyticsInstalled',
CONVERT(INT,SERVERPROPERTY('IsClustered')) AS 'clustered',
CONVERT(INT,SERVERPROPERTY('IsPolybaseInstalled')) AS 'polybaseInstalled',
CONVERT(INT,SERVERPROPERTY('IsXTPSupported')) AS 'xtpSupported',
CONVERT(INT,SERVERPROPERTY('LCID')) AS 'lcid',
CONVERT(varchar(128),SERVERPROPERTY('ResourceVersion')) AS 'resourceVersion',
CONVERT(varchar(128),SERVERPROPERTY('ServerName')) AS 'serverName',
CONVERT(varchar(128),APP_NAME() )AS 'appName',
CONVERT(INT,DB_ID()) AS 'dbId',
CONVERT(varchar(128),DB_NAME()) AS 'dbName'
I don't really expect a one-to-one column match between the above query and Oracle's version, but in general, how can I get very similar information from Oracle?
A:
I don't really expect a one-to-one column match between the above
query and Oracle's version, but in general, how can I get very similar
information from Oracle?
Most of that stuff, if it exists at all in the Oracle database, will be accessible through V$ views in the Oracle database. To get you started, here are some that are going to be most relevant to answering your question:
select * from v$instance;
select * from v$version;
select * from v$sql_feature;
select * from v$license;
select * from v$option;
If you want to get a complete list of V$ views to look around better,
select * from dict where table_name like 'V$%';
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Le maire de Montréal Denis Coderre en compagnie d'Harout Chitilian, responsable des technologies de l'information et de la ville intelligente. La Ville de Montréal a entrepris hier de tester auprès du grand public son nouveau site web (beta.montreal.ca) et son application, Montréal services aux citoyens.
Les Montréalais peuvent désormais signaler les nids-de-poule, graffitis et autres plaies urbaines en quelques clics ou du bout du doigt. La métropole a lancé hier un nouveau portail internet et une application mobile permettant de signaler des problèmes directement aux employés municipaux.
SIX SERVICES EN LIGNE
La Ville de Montréal a entrepris hier de tester auprès du grand public son nouveau site web (beta.montreal.ca) et son application, Montréal services aux citoyens. « On est à réinventer la façon dont la Ville offre ses services aux citoyens », a résumé le maire Denis Coderre. Les Montréalais sont ainsi invités à se créer un compte qui leur servira à réclamer des services. Pour le moment, il est possible de faire seulement six types de signalement, soit concernant la présence de nids-de-poule, de graffitis, de mobilier endommagé, de lampadaires défectueux, de branches ou de problèmes de propreté. À terme, la Ville compte offrir près de 200 services en ligne. Déjà, d'ici Noël, on souhaite ajouter les demandes de vignettes de stationnement et les renouvellements de permis animaliers.
HUIT ARRONDISSEMENTS COUVERTS
Le virage numérique étant encore en phase bêta (test auprès du grand public), les services en ligne sont offerts dans seulement 8 des 19 arrondissements de Montréal. Les 11 autres arrondissements devraient se joindre au portail numérique au début de 2018.
• Arrondissements couverts par les services numériques
• Côte-des-Neiges-Notre-Dame-de-Grâce
• Pierrefonds-Roxboro
• Rivière-des-Prairies-Pointe-aux-Trembles
• Rosemont-La Petite-Patrie
• Saint-Laurent
• Le Sud-Ouest
• Verdun
• Ville-Marie
AMÉLIORER LA RÉPONSE AUX CITOYENS
Ce virage numérique devrait améliorer la rétroaction auprès des citoyens qui se plaignent. En effet, jusqu'à présent, une personne dénonçant un problème devait rappeler la Ville pour suivre l'évolution de son dossier. Le portail web et l'application permettront de suivre en temps réel le traitement de la plainte. Un avis devrait aussi informer les citoyens des délais moyens d'intervention. Une personne signalant un nid-de-poule recevra ainsi un message lui indiquant que 80 % des trous sont colmatés en sept jours. La Presse a mis le système à l'épreuve en signalant quatre lampadaires allumés en plein jour devant l'hôtel de ville, place Vauquelin. À suivre...
UN TABLEAU DE BORD POUR LE MAIRE
Pour le moment, les citoyens ne pourront pas connaître le sujet des plaintes dans leur voisinage. Mais à terme, la Ville de Montréal compte rendre cette information disponible, notamment pour éviter le dédoublement des demandes d'intervention. Le maire Denis Coderre a par ailleurs dit souhaiter pouvoir installer un tableau de bord électronique dans son bureau, qui lui permettrait de suivre en temps réel l'évolution des requêtes, à l'instar du maire de Tel-Aviv, en Israël, qui dispose d'un tel outil.
TESTS DE SÉCURITÉ
Les citoyens étant invités à fournir certaines informations personnelles, comme leur adresse de résidence ou de travail, la Ville dit avoir pris toutes les mesures pour assurer la sécurité de son système. Des tests d'intrusion ont notamment été effectués et une firme a été embauchée pour s'assurer que le réseau demeure robuste aux attaques de pirates informatiques.
ALERTES
Au-delà des demandes de services, le portail proposera aux citoyens de s'abonner automatiquement à un système d'alertes, qui commenceront à être diffusées à la mi-novembre. Les Montréalais pourront ainsi être informés en cas d'urgence majeure, mais aussi de rupture de canalisation dans leur secteur, d'enjeux de circulation ou de problèmes avec la collecte des déchets.
PHOTO OLIVIER JEAN, LA PRESSE Pour le moment, il est possible de faire seulement six types de signalement à la Ville de Montréal sur son nouveau site web (beta.montreal.ca) et son application, Montréal services aux citoyens.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
105 Ariz. 23 (1969)
458 P.2d 957
STATE of Arizona, Appellee,
v.
Augustine TISNADO, Appellant.
No. 1881.
Supreme Court of Arizona. In Banc.
September 22, 1969.
*24 Gary Nelson, Atty. Gen., Carl Waag, Asst. Atty. Gen., and Robert K. Corbin, Maricopa County Atty., by Larry V. Cronin, Asst. County Atty., for appellee.
Raineri, Raineri & Raineri, by Joseph C. Raineri, Phoenix, for appellant.
UDALL, Chief Justice.
Defendant, Augustine Tisnado, appeals from a conviction of illegal possession of narcotic drugs and marijuana, with prior convictions.
Late in the evening of December 26, 1966, State Narcotics Agent James Moody received a call from a confidential informant, Anthony Audia, to the effect that the defendant had called Audia from the airport telling him that he was in possession of narcotics and that he wanted Audia to pick him up. The informant then proceeded to the airport to pick up the defendant, after which they went together to a number of stores where they purchased match boxes, tobacco in cans, and other items with which to prepare the narcotics for sale and distribution. They then proceeded to defendant's apartment where they began to clean the marijuana and package it for sale.
At this time Officer Moody and three other State Narcotics agents arrived at defendant's apartment and moved in to execute a search warrant which they had previously obtained. Upon entering the apartment, the officers found defendant in the bedroom. Laid out on the bed was a large amount of marijuana and various packing paraphernalia. A total of 306 grams of marijuana was found in the house. Found outside of the defendant's apartment was a toy box which contained a total of 863 grams of marijuana. A search of the person of the defendant revealed a package containing 5.41 grams of heroin. Defendant's pre-trial motion to compel disclosure of the identity of the confidential informant was denied; however, defendant, unaware that Audia was the informant, called him as a defense witness and it became apparent during his testimony that he was the informant.
First, defendant asserts as reversible error the trial court's refusal to grant his pre-trial motion to compel the identity of the confidential informant. In passing upon the merits of the question here raised we do not wish to imply that under our prior decisions the defendant has a right to discover the State's evidence in advance of trial.
In making this assignment of error the defendant fails to recognize that the chief purpose of the privilege of nondisclosure of a confidential informant is the furtherance and protection of the public interest in effective law enforcement.
The leading case that discusses the privilege of non-disclosure of a confidential informant is Roviaro v. United States, 353 U.S. 53, 77 S.Ct. 623, 1 L.Ed.2d 639. See also, State v. Kelly, 99 Ariz. 136, 407 P.2d 95. In Roviaro it is stated in substance that the privilege recognizes the obligation of citizens to communicate their knowledge of the commission of crimes to law enforcement officials and, by preserving their anonymity encourages them to perform that obligation. The court further stated that no fixed rule with respect to disclosure is justifiable; that the problem is one that calls for balancing the public interest in protecting the flow of information, against the individual's right to prepare his defense. Whether a proper balance renders non-disclosure erroneous must depend upon the particular circumstances of each case, taking into consideration the crime charged, the possible significance of the informer's testimony and other relevant factors.
In order to determine whether fairness to defendant dictates the disclosure of the informant's identity, one must ask: What purpose would be served by the disclosure? Defendant argues that since Audia was an eye witness to the crime charged, and in fact a participant himself, his disclosure as the informant was essential *25 to his defense. We cannot agree. This is not a case where an eye witness is made unavailable to the defendant because the state refuses to disclose his identity. Audia was well known to defendant; was interviewed by defendant's counsel; and even appeared as a defense witness. Defendant was not prejudiced in the preparation of his defense by the fact that he was unaware that Audia had betrayed him to the State Narcotics agents. We therefore can find no useful purpose that would have been served by having the state disclose the fact that it was Audia himself who was the informant.
Second, defendant claims as error the admission of certain evidence tending to show that he had possessed and sold narcotics on several occasions prior to the day on which he was charged with possession of narcotics. This evidence tends to prove crimes other than the ones charged in the information.
As a general rule, evidence of separate and distinct crimes is inadmissible. The rule and its exceptions are set out in Dorsey v. State, 25 Ariz. 139, 213 P. 1011. One such exception applies where the criminal intent of the defendant is in issue; or where his knowledge of the narcotic nature of the material which he possesses is in issue. In such a case, evidence of his commission of other like offenses may be received to prove that his acts were not innocent or mistaken, but constituted an intentional violation of the law.
Defendant's knowledge and intent are put in issue by his own testimony. He contends that unknown to him and against his will, Audia brought the narcotics into his apartment, and also that the reason heroin was found in his pocket was because he was in the process of removing it from the premises.
We ruled on a similar situation in State v. Vallejos, 89 Ariz. 76, 358 P.2d 178. There the defendant was charged with possession and sale of marijuana. He did not deny the acts charged but instead claimed entrapment on the part of the undercover agents to whom he had sold the marijuana. We held that evidence of other similar offenses committed by defendant was admissible to rebut his contention that it was the criminal intent of the agents and not any criminal intent on his part that was the procuring cause in the commission of the crimes charged.
Similarly in the case before us, defendant conceded the presence of marijuana in his apartment and of heroin on his person; but contends an absence of criminal intent on his part by testifying that it was Audia who had brought in the narcotics and that he took possession of the heroin for the sole purpose of removing it from his apartment. We feel that the Vallejos case is controlling and therefore hold that the evidence was properly admitted to rebut defendant's contention by showing that he not only had knowledge of the nature of the narcotics found in his apartment but that he also intended to have those narcotics there in violation of the statute.
Defendant's final contention is that the last sentence of the following statement by the trial judge amounts to a comment upon the evidence:
"Ladies and gentlemen, at this time, the Court is going to strike from the record the testimony of Tony Audia, a moment ago, when he retook the witness chair for the second time, relative to the sale of narcotics to third parties. You will disregard all such testimony. The remainder of his testimony, may stand and you may consider it in your deliberations."
This contention is without sufficient merit to warrant further discussion in this opinion. It is obvious the trial judge was merely making it clear that only that particular portion of Audia's testimony was to be disregarded.
Judgment affirmed.
LOCKWOOD, V.C.J., and STRUCKMEYER, McFARLAND, and HAYS, JJ., concur.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Three-D Informatics Group at the Lister Hill National Center for Biomedical Communications is developing software for the registration, segmentation, analysis and visualization of 3D data from confocal microscopy, transmission electron tomography, and high resolution dual-beam scanning electron microscopy. These technologies are exploring cell biology at nanometer scales. The group crafts individual models, visualizations, and presentations of the processed data from these modalities of microscopy for publication and interactive viewing among our colleagues in the biological sciences. We are conducting this research in partnership with the National Cancer Institute (NCI) Laboratory for Cell Biology. These technologies resemble the very successful Visible Human Project (VHP), where cryosectioning, a destructive imaging technique, was used to capture a representation of human anatomy at unprecedented levels of quality and fidelity. Effectively, a human subject was sliced at 1/3 mm intervals and the exposed sections photographed digitally to yield a human anatomical study with pixel resolutions as fine as 350 microns. In a similar approach, dual-beam scanning electron microscopy starts with a fixed cellular sample and ablates the cell using a focused ion beam, slicing the sample at intervals as fine as 15 nanometers. The exposed sections are imaged using a scanning electron microscope. The comparable approaches of these imaging techniques allow the Three-D Informatics Group to apply tools similar to those used on VHP data for registration, segmentation, and image analysis. The very successful VHP Insight Toolkit (ITK) open source software initiative, sponsored by NLM, is used extensively in this project. We also employ public tools such as 3D Slicer, a software system that uses ITK and is produced by Harvards National Alliance for Medical Image Computing, one of the NIH Roadmap National Centers for Biomedical Computing funded through the National Institute of Biomedical Imaging and Bioengineering. Since FY2009, the group has provided software tools to NCIs Laboratory of Cell Biology to promote high throughput microscopy and improve the understanding of cellular biology, particularly in the communication of HIV AIDS among dendritic cells, macrophages, and T-Cells. Illuminations created by the team have aided in communicating these results and their importance to the community. These results have been published in journals including the Journal of Structural Biology. One image that features cell membrane models generated through this software was featured on the cover of the November-December 2009 IAVI Report (the publication on AIDS Vaccine Research), volume 13, number 6, with the subtitle Visualizing HIV. Other publications include a study of the transfer of HIV to T cells, described in the Proceedings of the National Academy of Sciences. NCI acquired a new microscope in FY2011 that produces images with improved resolution, greater contrast, and greater relative signal to noise properties. During FY2012, the group has helped develop software tools to analyze the differentiation of murine myocytes as they develop from cultured mouse adult stem cells to muscle tissue. In other efforts, members of the team have been investigating new computing methods for performing high-performance, multi-threaded, rapid calculations on graphics processing units for sub-volume averaging to achieve super-resolution in transmission electron tomography. This technique in 3D high-resolution electron microscopy is unlocking the structure of proteins in HIV virions. In addition to software development, the team created visualizations, animations, and 3D models of protein spikes from the surface of HIV virions as part of the scientific review of this research program conducted by NCI.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
On the Republican side, there’s Dr. Alieta Eck, who is from Somerset and has not yet held an elected position.
Also, former Bogota mayor Steve Lonegan, a conservative who unsuccessfully ran against Governor Christie during the gubernatorial primaries, is in the running and believes Christie will support him.
Governor Christie declined to comment when asked if he supported Lonegan, but he responded to criticism from some Democrats about holding the election in October.
“They wanted a senator as soon as possible. I’m giving it to them. They are getting a senator even sooner than they hoped, elected by the people,” Gov. Christie explained.
Gov. Christie also says there will be enough time in the next few months for the candidates to get their name out there.
As for those who say the senate elections will result in low turnout and will distract voters, the governor says, “If you have candidates which excite them and challenge them, then they are going to come to the polls, no matter what time of year it is.”
Now that the deadline has passed, the next date the candidates will look forward to is August 13, which is the primary election. The winners of that will square off on Wednesday, October 16 for the special general election for the Senate seat.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Languages
Mourinho refuses to be drawn on Terry red
Jose Mourinho preferred not to speak about John Terry's sending off after Chelsea's thrilling 3-2 win at West Brom on Sunday.
Published
23 August 2015
Chelsea manager Jose Mourinho refused to be drawn on John Terry's red card following his side's entertaining 3-2 Premier League win at West Brom.
After James Morrison missed a 14th-minute penalty for West Brom, Chelsea eased into a 2-0 lead thanks predominantly to new signing Pedro.
The former Barcelona forward opened the scoring and set up Diego Costa for Chelsea's second before Morrison halved the champions' advantage.
Cesar Azpilicueta made it 3-1 with his first Premier League goal just before half-time but there was more drama to come as Terry was sent off for bringing down Salomon Rondon in the 54th minute.
That red card ended a miserable seven days for Terry, who was taken off at half-time in last weekend's 3-0 defeat at Manchester City, and West Brom capitalised as Morrison headed home his second on the hour.
But when asked about Terry's red card by Sky Sports, Mourinho said: "I prefer not to think."
When pressed on his opinion of Chelsea's performance, the Portuguese replied: "Fantastic performance. With 10 men, the spirit, the organisation, the fight in defensive areas, and the intelligence to keep the ball, I am very happy."
Chelsea midfielder Cesc Fabregas, meanwhile, was quick to praise the spirit of his team-mates after they claimed a first Premier League win of the season.
He said: "100 per cent today was about winning, getting back on track. We have to make sure that whatever we do pays off at the end. It was difficult, we bounced back in a difficult situation. We are proud but we have to keep going.
"We showed the character, the honour the pride of this team never faded."
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How to use GLM in Android NDK Application
I am currently trying to port my OpenGL application to Android and am stuck on how to import and build GLM http://glm.g-truc.net/ properly. I have no trouble using GLM in standard C++ apps, however I am pretty new to the NDK. I have tried all other solutions posted around the web with no luck. Here is what I have so far:
I am using the latest version of GLM (0.9.4)
My .cpp file contains:
#include <glm\glm.hpp>
My Android.mk file looks like:
LOCAL_PATH:= $(call my-dir)
include $(CLEAR_VARS)
LOCAL_MODULE := libgl2jni
LOCAL_CFLAGS := -Werror
LOCAL_SRC_FILES := gl_code.cpp
LOCAL_LDLIBS := -llog -lGLESv2
APP_STL := gnustl_static
LOCAL_C_INCLUDES += \Development\OpenGL\glm-0.9.4.0\
include $(BUILD_SHARED_LIBRARY)
**\Development\OpenGL\glm-0.4.0** is the location of the GLM files on my C drive
Upon building, I receive this error:
In file included from jni/gl_code.cpp:28:0,
\Development\OpenGL\glm-0.94.0\glm\glm.hpp:86:18: fatal error: limits: No such file or directory
This resembles codemonkey's problem https://gamedev.stackexchange.com/questions/47128/android-ndk-build-cant-find-glm-headers where the 'APP_STL := gnustl_static' was suggested.
It appears that my source files are correctly setup, however there is some sort of compiler problem that I cannot identify. Any help is greatly appreciated!
A:
Follow this solution if you are using Android Studio.
First, download OpenGL Mathematics library here
Second, extract and copy folder "../glm/glm" to your project location at "../app/src/main/cpp"
Third, on CMakeList.txt, add the following:
# Import the CMakeLists.txt for the glm library
add_subdirectory(glm) # if your CMakeLists is at '../cpp'
# add_subdirectory(src/main/cpp/glm) # if your CMakeLists is at '../app'
# add lib dependencies
target_link_libraries(
# Specifies the target library.
native-lib
# Links the target library to the log library included in the NDK.
GLESv2
glm)
Fourth, on 'buidl.griddle' (Mobile App), make sure you have right path to your CMakeList
externalNativeBuild {
cmake {
path "src/main/cpp/CMakeLists.txt"
}
}
Fifth, include glm headers to your source file:
// open GL libs
#include <GLES2/gl2.h>
#include <glm/glm.hpp>
#include <glm/gtc/matrix_transform.hpp>
#include <glm/gtc/type_ptr.hpp>
#include <glm/gtx/rotate_vector.hpp>
#include <glm/gtx/closest_point.hpp>
Sample is available at android-ndk, see Android Endless Tunnel Game
A:
Sam Hocevar's answer to codemonkeys problem is correct. it's not glm that's the problem. It's the "limits" header file used by glm that's the problem.
If Sam's answer does not solve your problem, try changing the toolchain to an earlier version by adding the following to your Application.mk file:
NDK_TOOLCHAIN_VERSION=4.4.3
And make sure that the STL includes for your project in Eclipse correspond with the toolchain.
Go to project->properties->C/C++ General->Paths and Symbols
make sure the following directories are included:
EDIT : these are only examples; make sure you use the correct platform and abi
/Path/To/NDK/sources/platforms/android-9/arch-arm/usr/include
/Path/To/NDK/sources/cxx-stl/gnu-libstdc++/4.4.3/include
/Path/To/NDK/sources/cxx-stl/gnu-libstdc++/4.4.3/libs/armeabi-v7a/include
EDIT : remark on first directory removed; seems glm looks for the limits file provided by the current stl implementation
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Effect of buccolingual inclinations of maxillary canines and premolars on perceived smile attractiveness.
In this study, we aimed to investigate the effect of buccolingual inclinations of the maxillary canines and premolars on the perceived attractiveness of the smile when viewed from the frontal perspective. A smiling frontal photograph was taken of a man. A 3-dimensional digital dental model of this subject was constructed within which the buccolingual inclinations of the canines and premolars could be altered relative to the occlusal plane. Three-dimensional models of the altered digital models were then printed in resin and mounted on articulators. Frontal photos of the mounted models were taken and transferred to the smile image. A series of images was produced with the canines and premolars inclined buccally or lingually by different degrees. The smile images were assessed by 2 panels, orthodontists and laypeople. There was a broad range of esthetic acceptability for the buccolingual inclinations of the maxillary canines and premolars. The range of preferred inclinations was not as broad. Smile esthetics was significantly compromised (P <0.01) when the canines were lingually inclined more than -12°, or the premolars were lingually inclined more than -15°, as perceived by orthodontists and laypersons. Buccally tipping the canines more than 6° also made the smile esthetics less satisfying (P <0.01). It could be esthetically satisfying to position the teeth within the ranges of 0° to -7° of inclination for the canines and -3° to -11° of inclination for the premolars, as assessed by the orthodontists, or of 3° to -10° of inclination for the canines and 5° to -11° of inclination for the premolars, as assessed by the laypersons. Clinicians could exercise flexibility within this range, when compromising tooth positions for transverse jaw discrepancies.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1. Field of the Invention
A suspender hanger assembly designed to removably support and display button-attached suspenders in a generally looped, space saving, and organized configuration, in order to avoid the conventional folding or alternately the vertically oriented straight line hanging of suspenders during storage.
2. Description of the Related Art
The wearing of suspenders for the support of trousers or pants has, of course, been known for many years. In recent years, however, the use of suspenders or "braces" have enjoyed increasing popularity due in part to the wide variety of creative and colorful designs available to the consuming public. Indeed, while suspenders have traditionally been considered a masculine article of clothing, recent fashion trends include the wearing of suspenders by women as well as men.
Generally, suspenders are available in two different styles. The first includes two shoulder straps and one or two back straps wherein each of the straps has a spring biased clip or like structure used to grip the upper peripheral edge of the trousers or pants being supported generally in the area of the waistband. The clips located at the extremity of each strap are structured to grippingly engage both the exterior and interior surfaces adjacent the upper peripheral edge of the waistband and do not require any type of buttons or like connectors to secure the clips to the pants being supported. The second and perhaps the most popular style of suspender available, however, includes two shoulder straps each having an apertured or slotted button-attachment member located at the free extremity thereof. Moreover, the opposite, fixed end of the shoulder straps meet at a junction pad or like connecting member which further includes a back strap disposed in depending relation therefrom. The back strap also includes one apertured or slotted button-attachment member movably attached to the free end thereof. Accordingly, each of the three button-attachment members movably secured to the outermost or free end of each of the aforementioned straps are designed to be removably attached to the interior surface of the waistband by means of buttons correspondingly located on the interior surface. The slots or apertures formed in the button engaging members are specifically configured and dimensioned to removably receive the buttons therethrough for attachment of the suspenders in the desired supporting position.
The button-attached suspenders, of the type described above, are generally considered to be more expensive due to the workmanship and material utilized in their manufacture. Accordingly, additional care is normally taken in their storage when such suspenders are not being worn. Numerous hangers or support devices are known and have been designed specifically for the storage and display of suspenders of both types set forth above. However, certain disadvantages are prevalent and well recognized in utilizing these known devices. Typical structuring of such devices involve the support of suspenders by draping the main strap portions of the suspenders in a folded over orientation such that inadvertent removal of the suspenders from the support device is a frequent and common occurrence. In addition, the storing of suspenders in a folded orientation frequently results in creases or wrinkles developing in the length of the shoulder straps which results in an unsightly and undesirable appearance of the suspenders when worn.
Other known structures for the storage of suspenders include a conventional clothes hanger wherein one end of the suspenders are attached to some supporting portion thereof and the suspenders are allowed to extend vertically along their entire length. Some disadvantages that are associated with this type of storage is that the lowermost end of the supported suspenders frequently come in contact with the floor adjacent the storage area. Yet other mounting facilities for storing suspenders, when not in use, involves a structure which can be combined at a tie and suspender holder. Such a structure normally includes a number of outwardly extending, spaced apart prongs disposed for supporting engagement with suspenders through removable attachment to an end portion thereof. Unfortunately, the suspenders can easily become dislodged and are not as accessible when co-mingled with ties. Furthermore, wherein the suspenders are loosely positioned, draped or folded over one or more of the prongs, the same problems and disadvantages associated with other known structures set forth above nevertheless remain.
Accordingly, there is a need for an efficient and effective suspender hanger assembly that is specifically designed to removably support and display button-attached suspenders in a manner which eliminates the tendency for inadvertent removal of the suspenders and also maintains the suspenders in an appropriate, suspended orientation to eliminate creases or wrinkles being formed therein. Such a preferred suspender hanger assembly should also eliminate the need to mount or support suspenders in a completely vertical orientation along their length such that the lowermost, free end thereof frequently engages the floor, shoes or other articles positioned in the storage area. In addition, such a preferred suspender hanger assembly should also allow for the effective display of such button-attached suspenders to facilitate the selection thereof by orienting the stored suspenders for adequate visual inspection.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
SQL Server: Import and Export CSV
I am working on SQL Server 2000. As you know, there is an application that's shows query results (Query Analyzer) The data is shown there, on a grid, and you can save that grid in a csv file. That's great.
Now, I want to INSERT those csv values into a Table. Does SQL Server provide any method?? And I mean, automatic or semi-automatic methods (like when you read an Excel from Query Analyzer).
Because, for example, with a Bulk insert I can accomplish that but, it involves a lot of work.
I am considering developing an application that does that (maybe in python) But, I don't want to if anything else already exists.
A:
You can look at using DTS SSIS to do this.
DTS is what you will want to use for SQL Server 2000 (as the comments below suggest).
I believe you can also copy paste directly from a spreadsheet into a table if you're not trying to do anything too fancy. I haven't done this in a while so you'll have to double check.
A:
If you just need CSV exports/imports, I'd use BCP. It's much faster, it's easier to use for those requirements (at least in my opinion).
| null |
minipile
|
NaturalLanguage
|
mit
| null |
What is the central theme to this everlastin’ spoof? A collection of writings & thoughts from an enthusiast, educator, friend, curious cat, & so forth. It’s a glorious feeling.
Buck
Buck’s got an untameable beard –
the man under the big top in a pinstriped suit brandishing a chair & whip
couldn’t control his dirty thatch of greying split ends.
Pushing his cart of knicks & knacks
through lakeside intersections in the mild afternoon,
he smiles thru his seven teeth.
Shoot the breeze with him in front of the Coffee with a Beat cafe on Grand
and you’ll discover he’s an absolutely avid sci-fi fan,
has seen all the 70s & 80s classics back in his foster days,
and, in fact, is related to roughly half of the films’ principal actors & protaganists (so he tells me from time to time).
We have a cup & a chat once in a while.
He claims he’s a five product guy: cigs & joe, franks, beans & pie.
Always wondered where he sleeps, but to ask seems impolite.
Memory sharp, mind alive,
a little crazy but half alright.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
INTRODUCTION
============
Kyphoscoliotic Ehlers-Danlos syndrome (kEDS) is an autosomal recessive connective tissue disorder characterized by early onset, progressive kyphoscoliosis, hypotonia, motor delay, hyperextensible skin, skin fragility, and joint hypermobility. Other features include microcornea, ocular and scleral fragility, Marfanoid habitus, atrophic scars on skin and arterial rupture.[@B1] kEDS was initially defined at the biochemical level, on the basis of a family study in which two sisters had progressive scoliosis, joint laxity and recurrent joint dislocations, microcornea and ocular tissues fragility.[@B2][@B3]
The identified causes were collagen-modifying enzyme procollagen lysine, 2-oxoglutarate 5-dioxygenase 1(PLOD1 or lysyl-hydroxylase 1) deficiency due mutations in *PLOD1* and the designated kyphoscoliotic form of EDS.[@B1][@B2] Lysyl hydroxylase deficiency results in underhydroxylation of collagen lysyl residues in -Xaa-Lys-Gly-collagen chains and underglycosylation of hydroxylysyl residues, thereby causing impaired collagen cross-linking with consequent mechanical instability of the affected connective tissues.[@B4] Patients with lysyl hydroxylase 1 deficiency have a markedly increased ratio of urinary lysyl-pyridinoline to hydroxylysyl-pyridinoline (LP/HP) due to underhydroxylation of collagen lysyl residues.[@B5] More than 40 different mutations in the *PLOD1* gene have been identified in kEDS.[@B6] The large duplication of exons 10--16 is the most common pathogenic mutation, and point mutations, insertions, deletions, and splicing-site mutations have been reported so far.[@B6] Recently, kEDS caused by biallelic mutations in *FKBP14* have been identified.[@B7] Patients with *FKBP14*-related kEDS display a clinically overlapping phenotype with *PLOD1-*related kEDS and are distinguished by the presence of myopathy, hearing loss, and normal lysyl hydroxylase enzyme activity.[@B6]
In infants with kEDS, severe hypotonia and joint laxity lead to delayed gross motor development. Thus, they are usually suspected as having other neuromuscular diseases, which delays a definite diagnosis of kEDS.[@B8][@B9][@B10]
We report the cases of two Korean siblings diagnosed as having kEDS with progressive kyphoscoliosis, hypotonia, joint hypermobility and skin hyperextensibility. These are the rare cases of kEDS with *PLOD1* variants in Korea. Both siblings had two novel deletion variants in the *PLOD1* gene.
CASE DESCRIPTION
================
On March 26, 2019, a 6-year-old girl, was referred to our department for genetic evaluation of progressive scoliosis. She was the second child of non-consanguineous Korean parents. She was born at 35+3 weeks of gestation by caesarean section because of oligohydroamnios. Her birth weight was 2.7 kg and length was 52 cm. After birth, she was found to have severe hypotonia with a lack of spontaneous hand movement and wrist drop, which both led to upper brachial plexus palsy. Mild kyphosis was also observed. She presented with hyperextensible velvety skin, and easy bruising. As classical Ehlers-Danlos syndrome (EDS) was suspected and she had an elder sister with hyperelastic and fragile skin, DNA analysis of the *COL5A1* gene was performed with normal results. The severe hypotonia led to delayed motor development. While undergoing physiotherapy, she began standing without assistance in kyphotic posture at the age of 21 months and could walk without support at age 3 years. On physical examination at age 6 years, her weight and height were 20 kg (25--50th percentile) and 116.8 cm (50--75th percentile), respectively. She presented with progressive kyphoscoliosis, pectus excavatum, protruding abdomen, long and slender fingers and pes planovalgus. She showed slightly dysmorphic features including a prominent high forehead, malar hypoplasia, depressed nasal bridges, low set and prominent ears, minimal prognathism, and short philtrum. She had joint hypermobility (Beighton score 6/9), skin hyperelasticity, and multiple atrophic scars on the forehead, knees and back. She had high myopia and keratoconus. Her mother reported that she had ocular fragility and retinal detachment of the left eye after falling down on her face. A skeletal survey revealed thoracic spine dextroscoliosis with kyphotic accentuation in the thoracolumbar junction and both pes planus and genu varum ([Fig. 1A and B](#F1){ref-type="fig"}). Echocardiography revealed no pathological findings. She is currently wearing an orthopedic brace for scoliosis. At age 6 years 8 months, she could walk unsupported and jump, and, go up the stairs with support. Her intelligence was normal.
{#F1}
A 9-year-old girl, the older sibling of previous patient, was the first child of nonconsanguineous Korean parents. She was born at 40 weeks of gestation by vaginal delivery. Her birth weight was 2.4 kg. At birth, she had intraventricular and intraparenchymal hemorrhage. She had hyperelastic and fragile skin, easily bruisable skin, and generalized hypermobile joints (Beighton score 6/9). She had high myopia and keratoconus. Her parents reported that she was suspected of having Marfan syndrome due to Marfanoid habitus in infancy. She often fell, which resulted in frequent subluxations of the shoulders and had easily bruisable skin by minor trauma. She was found with marked hypotonia and delayed motor development. She had left hemiparesis due to neonatal intracranial hemorrhage. However, no striking kyphoscoliosis was observed until recently. On physical examination at age 9 years, her height was 143.2 cm (90th percentile) and weight was 48 kg (97th percentile). She showed mild dysmorphic features such as a prominent high forehead, a broad nose, a depressed nasal bridge, low set and prominent ears, and a malar hypoplasia. Multiple atrophic scars were found on the forehead, lower back and knees. Skeletal radiographs revealed a mild scoliosis on thoracolumbar spine and both pes planus ([Fig. 1C](#F1){ref-type="fig"}). The echocardiography findings were normal. The bone density was within the normal ranges. Brain magnetic resonance imaging revealed several oval-shaped high signal lesions in the bilateral periventricular white matter, which suggested sequelae of the periventricular leukomalacia. Currently, she has delayed motor and cognitive development. She walks with support and uses a wheelchair at school.
Based on the clinical signs, hereditary connective tissue disorder was suspected. Next-generation sequencing using a targeted panel of 30 genes (*ACTA2, ADAMTS10, ADAMTSL4, ATP6V0A2, B4GALT7, CBS, CHST14, COL11A1, COL1A1, COL1A2, COL2A1, COL3A1, COL5A1, COL5A2, COL9A1, COL9A2, ELN, FBLN5, FBN1, FBN2, MYH11, PLOD1, PYCR1, RIN2, SKI, SMAD3, TGFB2, TGFB3, TGFBR1,* and *TGFBR2*) for connective tissue disorders was performed. Genomic DNA was extracted from the peripheral blood of the patient. Library preparation and target enrichment were performed by hybridization capture and massively parallel sequencing was done on the Illumina MiSeqDX (Illuina Inc., San Diego, CA, USA) generating 2 × 150 bp paired-end reads. Sequence reads were aligned to hg19 with Burrow-Wheeler Aligner (version 0.7.10, MEM algorithm). Duplicate reads were removed by using Picard (version 1.138). Local alignment, base quality recalibration, and variant calling was performed with Genome Analysis Tool kit (GATK version 3.5), samtools (version 0.1.19), FreeBayes (version 0.9.21-26-gbfd9832), and Scalpel (version 0.53). Variants were annotated by Variant Effect Predictor and dbNSFP. Common variants were removed with minor allele frequencies ≥1%, according to population databases. The average coverage depth was 230×, and 99.8% of the target bases were covered by more than 10× sequence reads. Two novel variants that were not previously reported in kEDS were identified in *PLOD1*. The *PLOD1* variants were identified in the compound heterozygous state in the two siblings and were validated by Sanger sequencing. Sanger sequencing of their parents revealed that c.926_934del was inherited from the father, resulting in an in-frame deletion of three amino acids leucine-arginine-leucine (p.Leu309_Leu311del). The c.2170_2172del was inherited from the mother, resulting in in-frame deletion of one amino acid phenylalanine (p.Phe724del) ([Fig. 2](#F2){ref-type="fig"}).
{#F2}
This study was approved by the Institutional Review Board of Soonchunhyang University Bucheon Hospital (SCHBC 2020-02-005). The patient\'s parents provided written informed consent for publication of patient information.
DISCUSSION
==========
The diagnostic criteria for kEDS were described in the Villefranche criteria in 1998[@B1] and revised in 2017.[@B11] The major criteria include congenital muscle hypotonia, congenital or early onset kyphoscoliosis (progressive or non-progressive) and generalized joint hypermobility with dislocations/subluxations (shoulders, hips, and knees in particular). All of our patients met three major criteria and seven minor criteria ([Table 1](#T1){ref-type="table"}). Moreover, younger sister presented with scleral and ocular fragility, which were rarely reported.[@B3][@B6]
###### Clinical manifestations of two sisters with kEDS and comparison with revised criteria from 2017 International EDS Classification[@B11]
Patients Younger sibling Older sibling
---------------- -------------------------------------------------------------------------------------------------------- --------------- ----
Major criteria
Congenital muscle hypotonia \+ \+
Congenital or early onset kyphoscoliosis (progressive or non-progressive) \+ \+
Generalized joint hypermobility with dislocations/subluxations (shoulders, hips, and knees impairment) \+ \+
Minor criteria
Skin hyperextensibility \+ \+
Easy bruisable skin \+ \+
Rupture/aneurysm of a medium-sized artery − \+
Osteopenia/osteoporosis − −
Blue sclerae − −
Hernia (umbilical or inguinal) − −
Pectus deformity \+ \+
Marfanoid habitus \+ \+
Talipes equinovarus − −
Refractive errors (myopia, hypermetropia) \+ \+
Skin fragility (easy bruising, friable skin, poor wound healing, widened atrophic scarring) \+ \+
Scleral and ocular fragility/rupture \+ −
Microcornea − −
Facial dysmorphology \+ \+
kEDS = Kyphoscoliotic Ehlers-Danlos syndrome, EDS = Ehlers-Danlos syndrome.
Congenital or early-onset kyphoscoliosis is one of the hallmarks of kEDS. However, some patients with kEDS may develop kyphoscoliosis later in life.[@B4][@B12] Without early-onset scoliosis, patients with kEDS may be misdiagnosed as having classical EDS or neuromuscular disorder. In our case, the older sibling who had no congenital or early-onset kyphoscoliosis was thought to have delayed motor development because of intracranial hemorrhage before she was diagnosed as having kEDS. Therefore, if a patient with hypotonia is suspected of having classical EDS but has no *COL5A1/2* mutations, the molecular analysis of the *PLOD1* gene may be necessary.[@B12] In older sibling, radiographs of the thoracolumbar spine at age 9 years revealed a slight scoliosis, whereas the younger sibling showed kyphoscoliosis in infancy. Only older sibling showed recurrent shoulder joint subluxation. The intrafamilial variation in our case was also observed as previously reported.[@B13] The intrafamilial and interfamilial variabilities of clinical severity and age of onset of kyphoscoliosis in patients with kEDS had no obvious correlation with the *PLOD1* genotype.[@B4][@B9]
Several cases of antenatal or neonatal brain hemorrhage have been reported.[@B4][@B9][@B10][@B14][@B15][@B16] The neonatal intracranial hemorrhage in older sibling is regarded as the clinical feature of kEDS, although we did not have detailed information about her birth record. In addition, she was thought to have delayed cognitive development because of intracranial hemorrhage caused by birth injury. Vascular events such as aortic dilation/dissection and rupture of medium-sized arteries are the major life-threatening complications, and careful observation and control of blood pressure are necessary to prevent arterial rupture.[@B17]
The *PLOD1* gene is located on chromosome 1p36.22, is approximately 40 kb in size, and consists of 19 exons.[@B9][@B17] The most common mutations, an 8.9-kb intragenic duplication of seven exons (exons 10--16; c.1067_1846dup), is caused by an Alu-Alu recombination in introns 9 and 16, and the allele frequency was 30% in the 42/139 mutations from 73 families.[@B6][@B16][@B18] The second most common pathogenic variant in *PLOD1* is nonsense variant p.Arg319Ter and the third is p.Tyr511Ter.[@B6] The majority of the others are point mutations, insertion, and deletions and splice site mutations. Two novel variants in *PLOD1* were identified in our Korean cases. Two siblings had compound heterozygous variants, c.926_934del (p.Leu309_Leu311del) and c.2170_2172del (p.Phe724del) in the *PLOD1* gene and their parents were heterozygous carriers of the variants. These variants were not reported in several global human genome databases, including the 1,000 Genomes Project, ClinVar database or the Exome Aggregation Consortium (ExAC). These *PLOD1* variants in the present cases are possibly causative for kEDS for the following reasons: First, in-frame deletions in non-repeat regions result in mutant protein sequences differed from the wild-type with the deletion of one or more amino acid residues, which are considered one of the evidences of pathogenicity. The novel p.Phe724del variant is located in a highly conserved region of oxoglutarate/iron-dependent dioxygenase, prolyl-4-hydroxylase, alpha subunit and the novel p.Leu309_Leu311del variant is in nucleotide-diphospho-sugar transferase domain. These variants can lead to deficiency in lysyl hydroxylation result in kEDS.[@B19] Second, considering that kEDS is an inherited autosomal recessive trait, the identified compound heterozygous variants inherited from each parent could be regarded as the patient's cause of the disorder.
In conclusion, this is the first reported case of siblings with kEDS who had *PLOD1* variants in Korea. We identified two novel variants in the *PLOD1* gene. kEDS with *PLOD1* mutations should be considered in patients with hypotonia, progressive kyphoscoliosis, joint hypermobility and skin fragility. This will help reduce the incidence of unnecessary neuromuscular work-up and increase the early detection rate.
**Disclosure:** The authors have no potential conflicts of interest to disclose.
**Author Contributions:** **Conceptualization:** Shin YL.**Writing - original draft:** Shin YL, Park YN, Jang MA.**Writing - review & editing:** Shin YL, Jang MA.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Pharmacokinetics, metabolism, and saliva output during transdermal and extended-release oral oxybutynin administration in healthy subjects.
To compare the pharmacokinetics and adverse effect dynamics of 2 modified-release oxybutynin treatments. Between October 15 and November 6, 2001, 13 healthy subjects (7 men and 6 women) participated in a randomized, 2-way crossover study of transdermal (Oxytrol, 3.9 mg/d) and extended-release oral (Ditropan XL, 10 mg) oxybutynin. Multiple blood and saliva samples were collected. Pharmacokinetic parameters and total salivary output were assessed. Statistical analyses included 95% confidence intervals, paired t test, analysis of variance, and linear regression. Steady-state plasma concentrations were achieved after the first transdermal application and after the second extended-release oral dose. Mean +/- SD 24-hour oxybutynin areas under the concentration-time curve were comparable during transdermal and oral extended-release treatments, 10.8 +/- 24 vs 9.2 +/- 33 ng x h(-1) x mL(-1), respectively. However, the ratio of area under the curve (N-desethyloxybutynin/oxybutynin) after transdermal administration (1.2 +/- 03) was significantly lower (P < .001) than after extended-release oral administration (4.1 +/- 0.9). Mean plasma concentrations were less variable during transdermal compared with extended-release oral administration. Mean +/- SD saliva output was greater during transdermal than extended-release oral treatment (15.7 +/- 93 vs 12.2 +/- 6.8 g, respectively; P = .02). Lower N-desethyloxybutynin during transdermal application was associated with greater saliva output (r = -059, P = .04). No clinically important treatment-related adverse effects were observed. Transdermal oxybutynin administration results in greater systemic availability and minimizes metabolism to N-desethyloxybutynin compared with extended-release oral administration. Lower N-desethyloxybutynin plasma concentration and greater saliva output during transdermal treatment correspond to the reported low incidence of dry mouth in patients with overactive bladder.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How has Linux geek culture reacted to Esperanto over the years?
In this question there is an answer that comments "There was for a long time resistance in some parts of the Linux world to Esperanto, so it seems it was only this year that the Esperanto localization was made official in the libc, the basic library in Linux, although some distributions such as Debian and Ubuntu had Esperanto for a long time." What level of resistance was there, and how has it been resolved?
A:
Well the resistance is/was similar as resistance to Esperanto in any other segment of society. In this case, see for example https://sourceware.org/bugzilla/show_bug.cgi?id=711#c2 or https://sourceware.org/bugzilla/show_bug.cgi?id=14943 for some of the history. This particular issue has been fixed: https://sourceware.org/bugzilla/show_bug.cgi?id=16190.
With libc now (since only this august) including eo locale in the distribution, the main sticking point in terms of basic out of the box language support is resolved.
The problem with libc was the fact that the maintainers were actively opposed to including Esperanto locale, refusing to even consider changes done by other people for inclusion.
Though note that Debian, and hence Ubuntu, included EO support for quite a while now.
I remember long time ago (15 years) when I first considered learning Esperanto and I was working on GNOME at the time, I did hear some disparaging comments about EO. Linux was, and especially the companies around Linux were, trying to be professional, and EO was not perceived that way.
Although I have been mostly out of the active free software community for a while, so I am not sure what is the prevailing view nowadays. But note that the free software community is a very wide ranging far flung community with people of all sorts of different views. It is not a homogeneous bunch at all. But a lot of the core people around Linux and related projects work for Linux companies rather than being volunteers, and this does change the way a purely grassroots movement such as Esperanto is going to be received.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The present invention pertains to a method for transporting at lease one vaporous substance through the wall of a vacuum chamber and into the vacuum chamber. In a further aspect, the present invention pertains to a device for executing and utilizing the method.
Consequently, an object of the invention is to create a method for transporting at least one vaporous substance through the wall of a vacuum chamber and into the vacuum chamber, with which there are no shutdowns as a result of leakage.
Another object of the invention is to assure that no condensation of the vaporous substance occurs during transport.
A still further object of the invention is to create a device for achieving the foregoing goals.
The above and other objects of the present invention can be achieved by means of a method for transporting at least one vaporous substance through the wall of a vacuum chamber and into the vacuum chamber, with which a vaporous substance is introduced from the outside into a vacuum chamber through the interior pipe of a double-walled pipe, with electric current from a power supply sourced to the interior and exterior pipes. A maximum of two vaporous substances can be transported with this method. The interior pipe and the exterior pipe of the double-walled pipe is formed of electrically conductive material. The current may be DC or AC. As a rule, the current magnitude is between 80 A and 300 A. Surprisingly, it has been shown that a disadvantageous condensation of vaporous substances during transport through the wall of a vacuum chamber into the vacuum chamber may be avoided in a particularly advantageous manner if the vaporous substance is conducted through a double-walled pipe with current flowing to the interior and exterior pipes. The disadvantageous arrangement of heating strips may be omitted completely.
Structurally, the exterior pipe may be guided through the wall of a vacuum chamber relatively simply without sealing problems. The interior and exterior pipes are connected to each other in an electrically conductive manner in such a way that current flows through both pipes, the magnitude of which may be adjusted also through the selection of die dimensions of the interior and exterior pipes. Due to the electrical resistance of the interior and exterior pipes, the flow of electric current leads to a heating of the double-walled pipe, with the ability to control or regulate the desired temperature directly by means of the power supply. This is particularly advantageous in that a constant temperature may be set for a pipe of constant diameter. It is also advantageous to heat a pipe branch uniformly such that even in inaccessible locations temperatures may be set above the boiling point of a given vaporous substance.
In a preferred embodiment of die invention, two vaporous substances are introduced at different partial pressures; the vaporous substance at the lower partial pressure is conducted through the interior pipe, and the vaporous substance at the higher partial pressure is conducted through die annular gap between interior and exterior pipes. Because of the smaller diameter of the interior pipe relation to the exterior pipe, a constant current flow will heat the interior pipe to a higher temperature than the exterior pipe, provided that the interior and exterior pipes are fabricated from the same material. Since, in order to avoid condensation of a vaporous substance under a lower partial pressure, it must be heated to a higher temperature than a vaporous substance at a very high partial pressure, it is particularly advantageous to flow the vaporous substance at the lower partial pressure through the interior pipe. Thus, for example, it is relatively simple to introduce separately two substances in vaporous form at different partial pressures into a vacuum chamber.
According to an additional preferred embodiment of the invention, at least one vaporous substance is subjected to at least one change in the flow direction within a vacuum chamber. This occurs advantageously by means of an arrangement of pipe branches that may partially feature baffles for changing the flow direction. A change in the flow direction may occur multiple times since all pipe branches are heated homogeneously with electric current, assuring the avoidance of condensation of the vaporous substance even if transport must take place over long distances with changing flow directions. Therefore, it is possible to bring a vaporous substance to the desired target location easily.
According to an additional embodiment of the invention, two vaporous substances are subjected to at least one change in flow direction with the respective changes in flow direction being equal. This is achieved advantageously by means of a double-walled pipe, where the interior and exterior pipes were of the same longitudinal axis.
In an additional embodiment of the invention, two vaporous substances are subjected to at least one change in flow direction, with the respective changes in flow direction leading to an at least partially separate parallel flow of both vaporous substances. Through an arrangement of several T-shaped branches it is possible to separate the interior pipe from the exterior pipe such that the two vaporous substances may be supplied to different target locations. This in no way disadvantageously influences a uniform heating of the transport system by means of electric current. Thus, it is possible to easily adapt the method of transporting at least one vaporous substance through the wall of a vacuum chamber and into the vacuum chamber to vacuum processes which must proceed in a vacuum chamber.
Moreover the problem of the invention is solved by means of a device including a double-walled pipe with interior and exterior pipes, where the interior and exterior pipes are interconnected by means of a power supply. During operation, the interior and exterior pipes must be interconnected by means of an electrically conductive connection. Structurally, the device is relatively simple to configure and it may be guided though the wall of a vacuum chamber without problem, with the particular advantage of avoiding sealing problems.
According to an additional embodiment of the invention, the end of the exterior pipe opposite the power supply opens into a T-shaped branch. The end of the interior pipe opposite the power supply opens into a second T-shaped branch arranged identically within the T-shaped branch for the exterior pipe. A pipe extension having at least one discharge point is arranged on both ends of the T-shaped branch and with a second pipe extension having at least one additional discharge point arranged in the pipe extension on both sides of the second T-shaped branch for the interior pipe. The pipe extension and the second pipe extension are connected to each other by means of at least one connector so that they have a common longitudinal axis. The respective connector is electrically conductive. Consequently, the device is configured according to the principle of a double-walled pipe over the entire transport distance, with changes in direction being carried out by an arrangement of T-shaped branches. This is a particularly simple way to facilitate installation of the device.
In an additional embodiment of the invention, one or more discharge points and one or more additional discharge points feature in each case a longitudinal axis that is perpendicular to the common longitudinal axis of the pipe extension and the second pipe extension. In this way, a required change in direction may be also carried out by means of T-shaped branches, making for a simple and especially quick execution of a structural configuration.
According to an additional embodiment of the invention, one or more discharge points and one or more additional discharge points have the same longitudinal axis. In this way, the device may be configured according to the principle of a double-walled pipe over virtually the entire transport distance, where it is entirely possible and advantageous to select different pipe diameters.
According to an additional embodiment of the invention, the end of the exterior pipe opposite the power supply opens into a T-shaped branch. The end of the interior pipe opposite the power supply opens into a second T-shaped branch that is arranged adjacent to the T-shaped branch and that is a greater distance from the power supply than die T-shaped branch. A pipe extension having one or more opening is arranged on both ends of the T-shaped branch, and a second pipe extension having one or more additional opening is arranged on both ends of the second T-shaped branch for the interior pipe. The pipe extension and the second pipe extension are connected to each other by means of at least one connector so that the longitudinal axes are parallel. This affords a particular structural advantage when subjecting two vaporous substances to a change in flow direction, were it is possible to adjust a partially separate parallel flow of both vaporous substances. Consequently, a vaporous substance initially flowing in the interior pipe is transported, in some sections, partially adjacent to the vaporous substance which initially was transported between the interior and exterior pipes of a double-walled pipe. Different target locations may be reached without problems in this way. In this connection, a pipe extension is connected to the second pipe extension with a connector that is electrically conductive, enabling current flow. The openings in the pipe extensions may be configured differently according to the application.
According to an additional embodiment of the invention, one or more openings or one or more additional openings are in die form of a slot. This facilitates the arrangement of the openings while simultaneously avoiding a clogging of the openings after relatively brief operating times.
According to an additional embodiment of the invention, the interior pipe, in longitudinal direction, passes through the end of the T-shaped branch opposite the power supply. This simplifies the structural configuration of the device.
According to an additional embodiment of the invention, a circumferential seal is arranged on the outside of the exterior pipe. This circumferential seal is arranged advantageously at the location on the exterior pipe directly bordering the outside of the vacuum chamber wall. This is a particularly simple way to strengthen the seal between the exterior pipe and the vacuum chamber wall, which is especially advantageous if a device for transport to the interior of the vacuum chamber must be located at various positions according to the respective application.
Finally, the object of the invention is the utilization of a device for transporting vaporous substances through the wall of a vacuum chamber and into the vacuum chamber for a vacuum coating process. In a vacuum coating process, any condensation of the vaporous substance in the vacuum chamber must be completely avoided during its introduction into the vacuum chamber. This can be carried out especially advantageously with the device according to the invention.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
WinForm DataGridView Sorting by string from column c#
I am trying to filter a table of several thousands entries in a datagridview by searching for a string from a textbox which is limited by the column name chosen from a combobox. I'd like the search to happen in real time, updated through the textbox_TextChanged class. I wrote some code that should do what I need, through research. However, whenever I type into the textbox, prompting the textchanged class, I get an error:
"Exception thrown: 'System.Data.SyntaxErrorException' in System.Data.dll"
Note that the datagridview does show all of the data entries prior to typing into the textbox, and the combobox options are exactly the same case as the columns in the datagridview.
My code:
private void searchTerms_TextChanged(object sender, EventArgs e)
{
BindingSource bs = new BindingSource();
bs.DataSource = shareholderDataGrid.DataSource;
bs.Filter = string.Format(searchItem + " like '%{0}%'", searchTerms.Text.Trim().Replace("'", "''"));
shareholderDataGrid.DataSource = bs;
}
shareholderDataGrid is the datagrid, searchItem refers to the string selected from the combobox, and searchTerms refers to the textbox the user types into.
Any help is appreciated, if you need more information ask.
A:
I found out why it was throwing that exception!
The column name in the data source had spaces in the it, and when I did the same for the combo box it was screwing up. Upon editing the access database table to have the columns be free of spaces, and putting those same changes to the choices in the combo box, it was fixed. It works flawlessly. Here is the final code I used, as I had to make a whole new visual studio project because of an unrelated error.
private void searchBox_TextChanged(object sender, EventArgs e)
{
BindingSource bs = new BindingSource();
bs.DataSource = dataGridView1.DataSource;
bs.Filter = string.Format(columnChoice.Text + " LIKE '*{0}*'", searchBox.Text.Trim().Replace("'","''"));
dataGridView1.DataSource = bs;
}
| null |
minipile
|
NaturalLanguage
|
mit
| null |
In large scale production and packaging of cookies, crackers, and other similar food items, it is desirable to arrange the cookies in an orderly manner and package them in a transparent material so that the cookies are visible from outside the package and are attractively presented for sale. To accomplish this, the cookies are packaged oftentimes in transparent cookie trays in a vertically aligned edge-standing arrangement in the trays to form a row or "slug" of edge-standing cookies. A single package of cookies typically contains several of these "slugs" of edge-standing cookies with the slugs aligned adjacent each other in an orderly arrangement.
Each slug of cookies has a first and last cookie at the ends of the slug, which end cookies are usually visible when transparent packaging is used. Because the tops or faces of the single layer cookies, as opposed to multiple layer sandwich crackers, usually are more decorative and appealing than the undersides of the cookies, it is desirable that the first and the last cookie of each slug of cookies be arranged facing outwardly at the end of the slug such that the face or the top surface of the cookies is exposed through the transparent wrapping. So arranged, consumer's can see the decorative tops of the cookies when they view or handle the package. Having the end cookies facing outwardly is especially desirable when the transparent portion of the wrappings is only around the sides of the package such that the tops of the end cookies are the most visible portions of the cookies.
In prior art methods for arranging cookies in cookie trays with the end cookies facing outwardly, an operator flips one of the end cookies by hand either after the slug has been formed or while the cookies move through a processing line. Such a manual process increases packaging costs.
Accordingly, a heretofore unaddressed need exists for an improved method and apparatus for automatically flipping or inverting the end cookie in a slug of cookies prior to loading the slug of cookies into a cookie tray.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Alison Mack, one of the stars of Smallville, has evidently been recruiting women to become sex slaves for the NXIVM cult, according to the group’s former publicist. Mack has supposedly been brainwashed by cult leader Keith Raniere. Once the women are recruited, they are forcibly branded with Raniere’s initials, former publicist Frank Parlato told The Sun.
NXIVM was initially known as a self-help program offering “executive coaching programs” that Richard Branson and others have availed themselves of. Behind closed doors of NXIVM, according to Parlato, is DOS, thought to be an acronym for “dominus obsequious sororium,” Latin for “master over the slave women.” The rumors of branded and brainwashed women go back at least to 2003 when cult researcher Rick Ross was sued for publishing portions of a recovered NXIVM manual.
Women are forced to provide “collateral” in the form of nude photos each month, according to emails recovered by The Sun. India Oxenberg, daughter of Catherine Oxenberg, of Dynasty, recently met with prosecutors to turn over evidence against Keith Raniere, the alleged cult leader. Dr. Danielle Roberts is among those being investigated in New York after having allegedly branded some cult members’ genitals with a hot iron. Parlato describes systematic abuse meted out by both Raniere and Mack, including food restriction during the day and being beaten with a paddle.
“Allison is both a victim and a perpetrator. She is a victim because she has been brainwashed by Raniere and she is his ‘slave,'” Parlato said. Frank Parlato initially worked with the organization for several months in 2007. He was fired when it was discovered he was snooping through the ledgers. NXIVM is funded in part by millionaire heiresses Clare and Sara Bronfman. More than $150 million of the sisters’ fortune has been absorbed so far by Raniere and the NXIVM. It is the Bronfman’s money that makes all this possible, from the sex slaves, to blackmail and branding. He is currently facing litigation from both Raniere and the Bronfmans.
Smallville actress ‘brainwashed into recruiting up to 25 women into the terrifying NXIVM slave cult’ https://t.co/N909G6gBRS pic.twitter.com/bGePLBAuob — The Sun (@TheSun) November 9, 2017
Dangerous “self help” happening in Albany NY. Reason for laws to keep consumers safe @JamesSkoufis @JohnBonacic https://t.co/wPgIPfHw68 — SEEK Safely (@SEEKSafely) November 6, 2017
Frank Parlato turned over screencaps and emails to The Sun who claim it corroborates his account. The evidence turned over by Oxenberg culminated in an investigation beginning in New York. One former victim spoke to Vice about her ordeal.
The Sun tried to contact Allison Mack’s publicist in regard to these allegations, but she is currently not accepting press inquiries. Raniere also declined comment, but NXIVM released a statement on the matter.
“The allegations relayed in the story are built upon sources, some of which are under criminal investigation or already indicted, who act as a co-ordinated group.”
[Featured Image by Evan Agostini/Getty Images]
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Epac2: a sulfonylurea receptor?
Sulfonylureas are widely used oral drugs in the treatment of diabetes mellitus. They function by the inhibition of ATP-sensitive K+ channels in pancreatic β-cells, which are thus considered the 'classical' sulfonylurea receptor. Next to the ATP-sensitive K+ channels, additional sulfonylurea-interacting proteins were identified, which might contribute to the physiological effects of this drug family. Most recently, Epac2 (exchange protein directly activated by cAMP 2) was added to the list of sulfonylurea receptors. However, this finding caused controversy in the literature. The critical discussion of the present paper comes to the conclusion that sulfonylureas are not able to activate Epac2 directly and are unlikely to bind to Epac2. Increased blood glucose levels after food intake result in the secretion of insulin from pancreatic β-cells. Glucose levels are detected 'indirectly' by β-cells: owing to increased glycolysis rates, the ratio of cellular ATP/ADP increases and causes the closure of ATP-sensitive K+ channels. In consequence, cells depolarize and voltage-dependent Ca2+ channels open to cause an increase in the cellular Ca2+ concentration. Finally, Ca2+ induces the fusion of insulin-containing granules with the plasma membrane. Sulfonylureas, such as tolbutamide, glibenclamide or acetohexamide, form a class of orally applicable drugs used in the treatment of non-insulin-dependent diabetes mellitus.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
When the cell door closed behind former Alabama Speaker of the House Mike Hubbard at 5:05 p.m. on Friday, Sept 11, 2020, there was a momentary sign of victory, but also a chill braced the state’s political landscape.
What happens next will be most consequential as the Alabama Supreme Court, and to a lesser degree the Court of Criminal Appeals, set in motion a need to rewrite certain aspects of the Alabama Ethics Act.
Due to the court’s tortured opinion, the Legislature will be forced to revise portions of the ethics statute to correct the so-called flaws the court found.
The question is, will they refine and reinforce the statute or dilute and weaken it?
Given the recent legislative history, the chances are likely that they will opt for the latter unless the press and public pay scrupulous attention to any changes to the present legislation.
Fortunately, there already exists a framework from which the 2010 Ethics Act can be rewritten to make current law better.
And there are some faint but encouraging signs that not all lawmakers and public officials will work to undermine the law. But in Alabama politics, there is often a vast sea of gray between what politicians say and what they do.
Public Service Announcement
In April, when the ALSC tossed six of Hubbard’s convictions, current Speaker of the House Mac McCutcheon said, “The Supreme Court’s ruling has made it clear that our ethics law has flaws that must be addressed. Our task now is to fix those flaws without weakening any of the provisions that make our ethics law among the toughest in the country.”
After the court’s ruling, Gov. Kay Ivey released a statement saying, “I support seeking clarity on our state’s ethics laws to ensure those who want to abide by them may not be unfairly targeted,” Ivey said. “However, let me be abundantly clear, I do not support weakening a system that is meant to hold our elected officials accountable. The rule of law must be upheld.”
Attorney General Steve Marshall’s comments on the courts finding were on target, “While I am pleased that the Supreme Court agreed that former Speaker Hubbard broke the law and will be held accountable for his abuse of power, I am also disappointed in the court’s interpretation of Alabama’s ethics law concerning the definition of a principal,” Marshall said. “While I can live with the court’s insistence on a clearer definition of principal, going forward, that definition must also be strong.”
ADVERTISEMENT
The court’s ruling on principals smells more political than judicial. The current definition is not necessarily murky but has jeopardized some of the state’s political and business elites.
Ethics reform legislation that strengthened and clarified the Alabama Ethics Act of 2010, was approved by Republican House and Senate leadership in 2017, but quietly died because of politics as usual.
The legislation was written under the guidance of then-Attorney General Luther Strange with Matt Hart and Mike Duffy of the Special Prosecution Division taking the lead.
Lawmakers, ethics experts, and stakeholders were consulted throughout the process and eventually agreed that the bill would fix major concerns found in the 2010 Ethics Act.
An annotated version of the bill is still available on the attorney general’s website, where it could be quickly taken out of mothballs and prepared for passage.
This existing bill would substantially improve, the Alabama Ethics Act. It also codifies current law and can easily be updated to include the decisions of the Alabama Supreme Court and the Alabama Court of Criminal Appeals and various advisory opinions from the Alabama Ethics Commission.
The proposed legislation from 2017 achieves three important goals: (1) encouraging honest people to serve in government by clearly defining the line between legal and illegal activity; (2) creates a clear and definite process through which people serving in government can obtain guidance regarding where a particular situation falls on that line; and (3) ensuring that those persons who violate the public’s trust are held accountable.
Specifically, the Act has been revised as follows: Improves the definition of “principal” to make clear that any person in a business that directs the activities of a lobbyist is a principal, while others in the business or on boards are not necessarily principals. This bill also gives the Ethics Commission more flexibility in identifying principals in disclosure forms.
Enforcement for minor violations is improved by giving the Ethics Commission and attorney general or appropriate district attorney more flexibility, subject to specified criteria, in resolving minor violations through administrative resolutions for public employees.
This bill also narrows the Act’s application to lower-level public employees to ease compliance and improve enforcement. To that end, it exempts grade school teachers, higher education athletic coaches, police officers, firefighters, and other first responders from the limitations on taking things of value from lobbyists and principals, filing statements of economic interest, and asking a lobbyist for something. Additional lower-level public employees are also exempt from filing statements of economic interests. The bill further provides discretion for the Ethics Commission and the Attorney General to exempt any class of public employee supervisors, subject to specific criteria.
The framework of the 2017 presented legislation offers many needed additions and restrictions.
The legislation offered in 2017, had a broad agreement, among lawmakers, business interests, lobbyists and others, and while massive, it was painstakingly reviewed and revised.
Hubbard’s imprisonment and the court’s ruling opens a door for the Legislature to create an even better ethics act, but it must be done with care and subject to rigorous oversight.
Justice prevailed in the Hubbard case even while it was assaulted at every turn.
Now it’s time for the Legislature to ensure that the ethics code is more robust, precise, and enforceable.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Those who are clearly not recycling properly will now be identified and officers will be speaking to them to ensure they have the information and tools (caddies, bags etc) they need to recycle properly. Continued failure to recycle will mean warnings, instructions and, ultimately enforcement, including a £100 fine.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Community-level socio-economic status and cognitive and functional impairment in the older population.
This study aimed to determine if people living in communities with higher socio-economic deprivation are at an increased risk of cognitive and functional impairment even after controlling for the effects of individual socio-economic status. We analysed cross-sectional data from the Medical Research Council Cognitive Function and Ageing Study which consists of a community-based sample of Cambridgeshire, Gwynedd, Newcastle, Nottingham and Oxford. The study included 13 004 men and women aged 65 years and over who were randomly selected from Family Health Services Authority computerized records after being stratified to ensure equal numbers of those aged 75 years and over and those under 75 years. The outcome measures were cognitive impairment (Mini-Mental State Exam 0-21) and functional impairment (Instrumental Activities of Daily Living and/or Activities of Daily Living disability). Individuals living in more deprived areas, as measured by the Townsend deprivation score, were found to have a higher prevalence of cognitive impairment [odds ratio (OR) (most deprived versus least deprived quintile) = 2.3; 95% confidence interval (CI)1.8-3.0; P < 0.001] and functional impairment [OR (most deprived versus least) = 1.6; 95% CI 1.4-1.9; P < 0.001] after controlling for age, sex, centre effects, education and social class. There is a significantly higher prevalence of cognitive impairment and functional impairment in elderly individuals living in socio-economically deprived areas regardless of their own socio-economic status. This evidence is of relevance for informing public health policy and those allocating resources for the long-term care of the elderly.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Morning hypertension in chronic kidney disease is sustained type, but not surge type.
We have shown that as renal function deteriorates, the circadian blood pressure (BP) rhythm shifts to a nondipper pattern and the duration until nocturnal BP decline [dipping time (DT)] is prolonged. We investigated whether or not morning hypertension (BP 2 h after awakening >135/85 mmHg) in chronic kidney disease (CKD) was sustained type with a prolonged DT. Twenty-four-hour BP was monitored in 104 patients with CKD. Fifty-one of 104 participants (group A) did not exhibit morning hypertension. The patients with morning hypertension (group B, n=53) were classified into three groups: group C (n=23), participants who exhibited morning hypertension but did not meet the criteria for the surge or sustained type; group D (n=29), the sustained type (with no night-time BP readings <120/70 mmHg); and group E (n=1), the surge type (systolic BP rises >25 mmHg after awakening). The night/day BP ratio and DT were compared among groups A, C, and D because there was only one participant in group E. Night/day ratio of BP and DT were both significantly higher in group D compared with groups A and C. The prevalence of nondippers tended to be higher in group D compared with the other groups (A, 65%; C, 57%; D, 86%, P=0.09). Creatinine clearance was significantly lower in group D compared with groups A and C. Sustained elevation of night-time BP until the early morning and high night/day ratio of BP may contribute to the high frequency of morning hypertension, which is generally the sustained rather than the surge type in CKD.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Elegance and Afternoon Tea Party - Don’t brew over creating the perfect teatime setting! Bonding those delicate papers and ribbons together is as easy as the pie you’ll be serving with tea, thanks to Aleene’s® Crystal Clear Tacky Spray™. Choose your favorite prints and colors, then spray away, knowing your guests will only see the tasteful décor, not the glue that holds it together! Designed by Duncan
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Human “Being” or “Doing” – Who am I?
A lot of people have asked me with shocked and puzzled look when I would tell them that I am retired and have been for a few years. I am not sure if its because I don’t look like I have reached the acceptable age of retirement or if it’s because I am so comfortable with the word “retired”.
I should start with the definition of the word “retire”. According to Merriam-Webster dictionary, one of the definition is “to stop a job or career because you have reached the age when you are not allowed to work any more or do not need or want to work any more.” The next word to define is “work”. Work to me sounds a look like labour and toil. Therefore my definition of “retire” is to stop work (labour and toil) because I can and I want to pursue my passion which aligns with my purpose. I knew that I wanted a change when work became more toiling than enjoyable. I knew that if I did not make a change when I did, I would end up being someone I didn’t want to be, just drudging along life as life is short and precious. I made the move in the traditional sense and wanted to see what the next stage of life has to offer. So now I am in the midst of aligning and re-creating my vocation – I am a coach. I am a coach because I want to inspire growth in others, to help them achieve their goals, to put into practical steps what they can do to break through barriers and to fulfil their potential. So yes to me I am retired. Retired from the labour and toil to aligning with my passion and purpose.
One of the tricky if not hardest question to answer when you are not “working” is “What do you do?”. This is because for such a long time, I had defined who I was by what I was doing. So I would say I am the Marketing and Business Operation Director at Microsoft. Wow, sounds really fanciful and maybe even important. But really what did it mean? What do you do? I am responsible for all the marketing activities and blah blah blah. All of which made me think about a more important question that I needed to answer and be clear about which was “Who AM I?”.
The “Who AM I?” question is one that goes to the heart of knowing and being confident and comfortable about being you, not being defined by what you do but for just being you. To know the answer requires that one be honest about yourself, your strengths, your dreams, your passions and your goals in life. To get to know yourself in a deeper way and imagine if everything is stripped away, who are you? If you don’t define yourself with what you are doing, with what job title you hold, and how much things you possess, how would you answer the question.
I have the great blessings of having a number of Christian friends and one of the common attribute that they have is they would answer the question “Who are you?” with the first sentence as “I am a child of God.” followed by their personalities or what they are passionate about and so on. That’s a great way to be rooted in belief.
Ask yourself:
What am I passionate about?
What are my values?
What’s my life purpose? Can I describe in one or two words?
Is my work aligned my values and life purpose?
Just remember we are human beings and not human doings. The heart of Human Being vs. Human Doing is to answer the question “Who Am I?”.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The epidemiology of invasive pneumococcal disease in older adults in the post-PCV era. Has there been a herd effect?
The 7 and 13-valent pneumococcal conjugate vaccines (PCVs) have reduced the incidence of invasive pneumococcal disease (IPD) in children in many countries. The objective of this work was to assess the impact of PCVs and potential herd-protection in older adults in Ireland. IPD notification and typing data from adults ⩾65 years of age from July 2007 to June 2016 was assessed using national surveillance data. There was a 94% reduction in PCV7 serotypes from 2007-2008 to 2015-2016, incidence rate ratio (IRR 0·05, P < 0·0001). However, there was no decline in the additional PCV13 (PCV13-7) serotypes over the same period (IRR 0·90) nor in comparison with the pre-PCV13 period 2009-2010 (IRR 0·92). The incidence of serotypes in the 23-valent pneumococcal polysaccharide vaccine only (PPV23-PCV13) and non-vaccine types (NVTs) increased significantly (IRR 2·17, P = 0·0002 and IRR 3·43, P = 0·0001 respectively). Consequently, the overall IPD incidence rate in adults has remained relatively unchanged (from 28·66/100 000 to 28·88/100 000, IRR 1·01, P = 0·9477). Serotype 19A and NVTs were mainly responsible for penicillin resistance in recent years. The decline of PCV7 serotypes indicate that the introduction of PCV7 resulted in herd-protection for adults. However, increases in PPV23-PCV13 and NVTs suggest that changes in vaccination strategy amongst older adults are needed to build on the success of PCVs in children.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Calcium-binding proteins and renal lithiasis.
The present study consists of measuring calcium-binding activity in urine obtained from 17 metabolically active noninfectious calcium oxalate stone formers, six inactive calcium oxalate stone formers, two active uric acid stone formers, one active cystine stone former, and seven nonstone-forming controls. Twenty-four hour specimens were obtained from each patient and were ultrafiltered, utilizing a series of membranes to concentrate all macromolecules of molecular weight less than 50,000 daltons. The concentrated specimen was separated by gel filtration chromatography, and each fraction was analyzed for calcium-binding activity utilizing the chelex resin binding assay. Total urinary calcium binding protein activity was significantly greater in the active calcium oxalate stone formers when compared with either inactive calcium oxalate stone formers (P less than 0.025) or nonstone-forming controls (P less than 0.05). The number of uric acid and cystine stone formers was too small to make meaningful comparisons. Urinary excretion of calcium binding appears to be related to stone activity and may be specific for calcium stone formers. Their influence on stone formation deserves further study.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Tendon transfer fixation in the foot and ankle: a biomechanical study evaluating two sizes of pilot holes for bioabsorbable screws.
The purpose of this study was to compare the initial fixation strengths of bioabsorbable screws for tendon transfers in the foot and ankle when the pilot hole size varied. A 7 x 20 mm screw was used with 5.5 mm and 6.5 mm drill holes, and a 5 x 20 mm screw was used with 3.9 mm and 4.5 mm drill holes. Biomechanical testing was performed on each tendon transfer in cadaver specimens. A paired t-test showed no significant difference in pullout strength when pilot hole size varied between 79 to 93% of the screw size for the 7 mm screw and 78 to 90% of the screw size for the 5 mm screw. Previous studies have found a critical value of tendon tension equaling 50 N with passive dorsiflexion of the foot. With an average value of approximately 170 N, the 7 mm screw provided three times the requisite strength. The 5 mm screw provided 1.5 times the requisite strength, but the transfer was technically more difficult.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
>> Good morning.
>> Good morning.
>> Well, I am really
happy today.
So, this is the first time that
I've used electronic homework
in one of the classes.
And I was so happy when I
looked this morning at 9 o'clock
and found virtually
everybody had engaged
with the homework assignments.
And so much of learning organic
chemistry is actively working
problems and actively
trying to understand things
that I was really,
really excited
to see people are
coming along with me
on this process of learning.
And it makes me very,
very happy.
So, today we're going
to continue our discussion
of Chapter 20.
And I'd like to introduce
organometallic reagents and talk
about their reactions
with carbonyl compounds
and their reactions in general.
And then we're going to talk
about reactions of members
of the carboxylic acid family
with hydride nucleophiles
and with organometallic
reagents.
And if there's time, we'll
conclude by talking about use
of these reagents in these
reactions in synthesis.
So, when we were
talking last time,
we talked about hydride reagents
with ketones and aldehydes.
And we said sort of generically,
if we have some ketone
or aldehyde, and I'll
write it generically,
just showing R groups
that could be alkyl,
that could be aromatic,
that could be hydrogen.
So generically a
ketone or aldehyde.
And we envision its reaction
with some hydride nucleophile.
Now remember, when I'm
writing something like this,
H minus in quotes, of
course there's no reagent
that is itself a
hydride nucleophile.
But these are things like
lithium aluminum hydride
and sodium borohydride that
serve as sources of hydride.
And then if we carry out a
workup with aqueous acid,
H3O plus or in some
cases, you can use water.
And again, I'll put this in
quotes because you can't go
and buy a bottle of H3O plus.
You could take sulfuric
acid and pour it into water
to make hydronium ion
and bisulfate ion.
You could take HCl in water and
make H3O plus and chloride ion.
And so you'd go to the stockroom
and ask for one of those.
When you do that, you get
a reduction of the ketone
or aldehyde and protonation
like so to give an alcohol.
Now, what I'd like to
do at this point is
to consider an analogous
reaction, again,
written at this point
as an abstraction.
So again, we'll take our
ketone or our aldehyde
and we'll imagine instead
of adding our hypothetical
hydride anion,
we're going to add something
that I'll say is R minus
with a lone pair of electrons
meaning a carbon-based anion.
We'll talk more about it,
not necessarily something
you can get as a free anion.
And certainly not
something that you could put
in a bottle on its own.
It would be part of an
organometallic reagent.
But again, right now
we're getting our view
from 30,000 feet.
And again, if you imagine
some type of aqueous workup
with H3O plus, now
instead of adding hydride
to our carbonyl compound,
we've added in an R group.
The use of primes
and double primes
and so forth is just
my way of representing
that they're various groups,
different or the same.
Anyway, but again, in the
view from 30,000 feet,
the profound thing about this
reaction as I've written it is
that we formed a
carbon-carbon bond.
[ Writing on Board ]
And so much of organic
chemistry,
both the practical aspects of
synthesizing useful molecules
and the real intellectual beauty
of the discipline is the fact
that we can create great
degrees of complexity,
valuable complexity, medicines,
analogs of natural products,
natural products that are
too scarce to get otherwise,
probes to probe reactions
and probe biology.
We can do all of this
through chemical synthesis
in which we take little
molecules that might be able
to be purchased and build
them up into big and complex
and useful molecules
that can cure cancer
or fight disease
or teach us things.
So now we come down to the
issue of what is our R minus?
What is our source of
our carbon nucleophile?
And the first really, really
valuable carbon nucleophiles
that were developed
were Grignard reagents,
developed by Victor Grignard.
He received the Nobel Prize
in 1912 in chemistry for this.
And the basic idea is that you
take some halide, a bromide,
a chloride or an iodide.
Fluoride is sort of the
oddball among halogens.
And if you go down
your periodic table
to astatine, it's not stable.
It's radioactive.
So organic chemists
would never work with it.
You can't really isolate it.
Anyway, if we take an alkyl
halide such as butyl bromide
and we treat it with magnesium
metal, if you've done one
of these reactions
in the laboratory,
you'll have seen your magnesium
metal is kind of bright
and shiny and lightweight.
It comes as turnings that have
been worked off a big block
of magnesium with a lathe.
And you'll put them with your
alkyl halide in a solvent.
The solvent will be an
ether solvent, either ether
or THF typically, although
sometimes other ethers can
be used.
THF is tetrahydrofuran.
It's a cyclic ether.
So it's an ether with
a five-membered ring.
And it has lone pairs.
It's kind of diethyl ether
with its ears pinned back.
And either of these work well.
The result is that you
get a Grignard reagent.
I started with butyl
bromide here
and so I'll write the Grignard
reagent from butyl bromide.
We call this butyl
magnesium bromide.
[ Writing on Board ]
And the ether solvent
coordinates to the magnesium.
The magnesium doesn't have
a complete octet here.
We have only four
electrons around it,
two from the alkyl group
and two from the bromide.
And so the ether
solvent, the diethyl ether
or tetrahydrofuran will
coordinate to the magnesium
and help give it the feeling
of having a complete octet.
Anyway, as I said,
the broader category
of this is a Grignard reagent.
And you can make these
from anything from bromo-
or chlorobenzene to alkyl
bromides to methyl iodide.
And so this typically --
typically one makes a
Grignard reagent as part
of a synthetic process.
They're actually
stable reagents.
You can put them in a bottle.
You can buy them.
But in the laboratory,
because they react with air
and because they
react with moisture,
you would typically go ahead
and immediately add
a carbonyl compound.
So let me show you a typical
synthetic carbon-carbon
bond-forming sequence that one
might do in the laboratory.
So we might take our butyl
bromide and treat it first
with magnesium and ether.
[ Writing on Board ]
You'll often see people
writing a slash in an equation.
Often that slash is a way
of saying the solvent
is below the slash.
Or for just writing a
simple line of equation,
we might put our
solvent below the arrow.
Then let's add a
carbonyl compound.
And for the purposes of
teaching, for the purposes
of this example,
I'll take acetone
as our carbonyl compound.
And finally, let's
do an aqueous workup.
And I'll give us -- I'll
choose an acid here.
Let's say aqueous HCl as
the acid I would choose.
And the product of this
reaction now is a carbon-carbon
bond-forming adduct,
or an adduct
with a new carbon-carbon bond.
If you wanted to
name the compound,
we've now formed this
six-carbon chain.
So it's 2-methyl-2-hexanol
as our product.
So this is very powerful because
now we've taken some small
compounds that you can buy
and we've made a
more complex molecule
that you might not
be able to buy.
Many molecules with
this type of structure,
these types of structures
like alcohols with long chains
on them are insect
pheromones, for example.
So some of these types of
synthetic products are used
to make traps for insects
like Japanese beetles,
where that will -- the pheromone
will lure the insect to the trap
and then they'll
fall in and die.
All right.
So I want to talk a little
bit about the properties
of Grignard reagents
and organometallic
reagents in general.
[ Erasing Board ]
So metals, of course, are
much more electropositive
than carbon.
So any bond between a metal
and carbon is either going
to be a polar covalent
bond or an ionic bond.
If you want an index value,
chemists like to keep
electronegativity values
in their head.
It's a useful way of
assessing the degree
of polarity of a bond.
Magnesium has an
electronegativity of 1.3.
Carbon, about 2.5 or 2.55.
So you can think of the bond
between magnesium and carbon
as a polar covalent bond.
In other words, you can think
of this as having a delta minus,
a partial negative
charge on carbon
and a partial positive
charge on magnesium.
Sometimes if you're writing
a mechanism and you want
to be quick about it,
you could say well,
I'll write a non-bonded
resonance structure even though
I know it's primarily
a covalent bond.
I could write an ionic
bond, resonance structure
so we could think of it as this.
Maybe I'll put this
in quotes here just
to remind us this is
sort of our thinking.
And so, if I'm thinking about
this from a mechanistic point
of view, one way we
could think about this --
I'll take our acetone and
our Grignard reagent written
generically -- one way we
could think about this is
that our organometallic
reagent serves as a nucleophile.
And of course, we draw a
curved arrow mechanism.
We help think about the
flow of electrons and bonds
by starting an arrow
at the lone pair --
at the available electrons,
either as a lone
pair or in a bond.
And then moving to the thing
that wants electrophiles,
in other words, from the
nucleophile to the electrophile.
As we did in thinking
about hydride mechanisms,
we can't go ahead and now
have five pairs of electrons
around this carbon atom.
So concurrently, as the
nucleophile moves in,
electrons move up onto oxygen.
And so we continue our
grammar, if you will,
of writing our curved arrow
mechanism now, writing a product
in which we have
our negative charge.
And if I want to be good,
organic chemists
are rarely good.
We love to throw away things
that aren't necessary
in our thinking.
But if I want to be good,
I'll draw the magnesium
counterion there.
We can also think of
this, just as we did
with lithium aluminum hydride,
maybe a little more correctly
or certainly a little more
sophisticatedly, we can think
of our covalent bond and
keep in the back of our mind
that it's a polar covalent bond
and write a curved
arrow mechanism
in which we simply go ahead
and now take the electrons
from that bond, move it
in like so, and again,
come out to the selfsame
product.
So these are good ways of
thinking, sound ways of thinking
about the mechanism
of the reaction.
[ Erasing Board ]
So, one thing to keep in
mind about Grignard reagents,
and indeed about most
organometallic reagents,
particularly ones in which
there's a large difference
in electronegativity between
the carbon and the metal is
that organometallic reagents
like Grignard reagents,
in general, act as
very strong bases.
[ Writing on Board ]
We can think about
basicity in terms of the pKa
of the conjugate anion.
So if you have butyl
magnesium bromide,
the conjugate anion
corresponds to an alkane.
In other words, where in the
conjugate acid you have a Csp3
carbon bound to a hydrogen.
The pKa for such a
hydrogen is about 50.
That's about at the very
end of the basicity scale.
That's about as basic as
you can get for a carbanion.
If you have an alkene, now
you have a Csp2 carbon bound
to a hydrogen.
The electrons are held
a little more tightly
in this type of structure.
The pKa now is about 44.
A way of thinking of this is
since the electrons are
a little more stabilized,
held a little more
tightly in an orbital
that has more s character,
right,
sp2 has 33 percent s character,
sp3 has 25 percent s character.
As you hold electrons
more tightly,
the CH bond is more
willing to give up H plus
and give you a carbanion.
So an alkene is a little bit
more acidic than an alkane.
These are all compounds
I call very weak acids.
And I usually put
quotes around the acid
because you would not get
any evidence of acidity
from the compounds, say,
dissolving it in water
and testing it with a pH meter.
And yet, in a Lewis acid-Lewis
base reaction, you can think
of an alkene, say,
as a proton donor
under certain circumstances.
Now, by the time you
get to an alkyne,
now you've got 50 percent s
character in your CH bond.
And now these are
reasonably acidic.
They're still very weak acids.
Your pKa is only 25.
That's really, really,
really weak, still.
It's not even like
water, which you think
about as an acid
forming hydroxide anions.
It's still a very weak acid.
Or alcohol forming an acid --
giving up a proton and
forming an alkoxide anion.
And yet, our pKa is about 25.
And I'll show you an implication
of that in just a moment
when we start to talk a
little more about alkynes.
But, the point of this comes
back to what I was saying before
about carbon -- about Grignard
reagents being very reactive
toward water.
A Grignard reagent acts
as a base with water.
And so if you expose
a Grignard reagent
like butyl magnesium bromide
to water, the water acts
like a Lewis -- acts like a
Bronsted acid and you get butane
and bromomagnesium
hydroxide, a mixed salt here.
So this is a Bronsted
acid-Bronsted base reaction
if you think about it.
We have water acting as an acid
on the left half
side of the equation.
We have our alkane as an acid on
the right side of the equation.
And because the pKa
difference is so humongous,
the pKa of water is 15.7, the
pKa of butane is about 50,
I don't even bother to
write an equilibrium arrow.
The equilibrium constant
is 10 to 34th, right?
It's 10 to the difference
in pKa's.
That reaction lies
so far to the right
that there's just no
component to the left on it.
And that's true whether it's
with water or an alcohol.
And so just by comparison,
imagine for a moment I wrote --
let me pick a particular
alcohol.
We'll pick ethanol
as an alcohol.
And so now we would get butane
and a ethoxymagnesium bromide.
Of course, this would be the
same with a carboxylic acid
or just about anything that
you would normally think
about as even mildly acidic.
[ Erasing Board ]
All right, well Grignard
reagents are one
of a broader family of
organometallic reagents.
Another member of the
family that reacts very,
very similarly are
organolithium reagents.
[ Writing on Board ]
And so if we wrote Grignard
reagents sort of generically
as RMgX, that would
be a generic way
of writing a Grignard reagent.
We can write organolithium
reagents generically as RLi.
Organolithium reagents are
formed by reacting alkyl
or aryl halides, again, we're
talking iodide, bromide,
chloride, with lithium metal.
If I write a balanced
equation, say, for bromobenzene
and lithium, it takes
two lithiums --
and that makes sense if
you think about it, right?
We're carrying out a two
electron process here,
and lithium has one electron.
So magnesium has two electrons.
And so a balanced
equation becomes
that we get phenyl lithium
plus lithium bromide.
And again, organic
chemists are awfully,
awfully bad about writing
products of reactions.
So I'll put the lithium
bromide in parentheses
because I might not write it.
So typically, if I were
writing this as, say,
a synthetic reaction,
and I imagine generating
an organolithium compound,
and say reacting it with
an organic compound,
I'll give you an example
of what I might write.
So I might take bromobenzene
or I might take chlorobenzene
if I wanted, treat it
with lithium metal.
Now, organolithium reagents
can be generated in ethers.
An ether can serve
to coordinate.
But they also form clusters.
And so they actually
can be generated
in other solvents
including hydrocarbons.
I'm just going to
skip the solvent here
because it's much less important
than in a Grignard reaction.
And let's say as my partner,
since I gave you a ketone
before, I'll take an aldehyde.
The aldehyde I've
chosen is pivaldehyde.
That's the trivial name, or 2,
2-dimethylpropanal
would be the IUPAC name.
And again, I'll imagine doing
some type of aqueous workup.
I'll just write H3O plus here
to indicate I haven't
specified the acid.
It could be aqueous HCl, it
could be aqueous sulfuric acid.
One that I personally
like to use
in my own laboratory is
aqueous ammonium chloride,
which is a very mild acid
and very good for workups
of reactions like this.
Anyway, after our workup,
the product now has a new
carbon-carbon bond like so.
And of course, because we've
generated a stereo center
in the molecule,
we've generated it
as a mixture of two enantiomers.
We've generated two different
enantiomers in equal amounts.
We've generated the racemate.
[ Erasing Board ]
All right.
In part because your textbook
mentions various different
organometallic reagents at this
point, I want to follow along.
And in part because
I want to remind you
of what I think are
really useful items.
And in part because I want to
tie into this concept of pKa,
I'd like to, at this point,
talk about acetylide ions.
[ Writing on Board ]
And I see I have a question.
>> Yeah, you sort of
erased the equation,
but like for the
second equation what
that lithium bromide is
attaching like an ethanol,
why doesn't the magnesium
bromide bond to the OH,
but instead bonds
to the [inaudible].
>> What's that?
Oh, the question was,
why doesn't the magnesium
bond to the OH.
It doesn't -- well,
there's no OH --
oh, you're saying
in that reaction.
Because the ethanol has
now given up its proton
to react with the butyl part.
So the proton has come off of
the ethanol onto the carbon
of the butane leaving an
ethoxide anion which combines
with the MgBr plus component.
>> Wouldn't the same
thing happen with water?
>> And it did.
So we had, in the case of
ethanol, we had EtOMgBr.
In the case of water,
we had HOMgBr.
So we had a very
analogous reaction.
Another question.
>> In that second equation,
are we supposed to
have two lithiums?
>> Ah, great question.
In that second equation, are we
supposed to have two lithiums?
This is very typical
of how organic chemists
will write a reaction.
So typically you would see
that one might not particularly
as you became more used
to writing reactions,
it might be implicit.
But indeed, you would
have two lithiums.
So you could easily envision
writing lithium parenthesis two
equivalents or two lithium.
And again, this is very
much part of the shorthand
of writing organic
reactions, particularly
when focused on synthesis.
Good questions.
>> So will organolithium
reagents not be created
who don't have two lithiums?
>> Ah, great question.
Would organolithium
reagents not be created
if you had only one lithium?
Well, now imagine, what would
happen would be you'd have one
mole of butyl lithium --
one mole of butyl bromide,
one mole of lithium, you'd get
half a mole of butyl lithium.
Now, here's where
the fun comes in.
If I let that sit at a low
temperature and used it quickly,
I would have a reaction of
one mole of butyl lithium --
of one-half mole
of butyl lithium.
But if I let it sit or tried to
put it in a bottle and I now had
that organolithium reagent
sitting for a long time
with more butyl bromide, I
would get E2 elimination or,
because the reagent
is strongly basic,
to give butene and butane.
Or I would end up
having SN2 displacement
to give octane or both.
Great question.
So yes, I would definitely
use two equivalents.
All right.
Well, at this point I want to
talk about acetylide anions
and sort of follow
along with our textbook,
but also because
thematically it fits in.
So as I said, acetylene,
alkynes in general,
are especially acidic.
While they're still very, very
weak acids, pKa of about 25,
they're strong enough
acids that very,
very strong bases can
pull off their proton.
So for example, if
I great an alkyne
with sodamide I get the
sodium acetylide anion.
[ Writing on Board ]
Now, sodium's a little more
electropositive than lithium.
Lithium has an electronegativity
of 1, sodium of .9.
By the point you get to
organosodium reagents,
they're pretty ionic
in the bond.
So I generally think
of these as ionic.
>> Sorry, is it NH2
or NH [inaudible]?
>> Ah, great.
NH2, NaNH2 is sodamide.
And if I'm going to balance
my equation, and as I said,
organic chemists
are usually very bad
about this, ammonia, thank you.
Thanks very much.
Ammonia is the other
byproduct of reaction.
And now we see ourselves
very much in the situation
of a Bronsted acid-Bronsted
base reaction.
So we have pKa of about
25 and pKa of about 38.
And so a difference of pKa means
that equation lies way, way,
way to the right, 10 to the
13th equilibrium constant
or thereabouts.
So basically I throw one
mole of sodium amide,
one mole of an alkyne and I get
essentially all acetylide anion.
And I'll write a
balanced equation,
or I'll write a synthetic
equation here in which I, say,
take propine, I treat
it with sodamide, NaNH2,
which you can make by dissolving
sodium metal in ammonia
with a little bit of iron and
it reacts to give sodium amide.
And for the heck of it,
again, I'm just trying
to give us a range of
carbonyl compounds.
For the heck of it,
I'll take 2-butanone.
And then, since I mentioned that
I like aqueous ammonium chloride
as a source of acid
for a workup,
I'll just demonstrate what I
would do in my own laboratory,
which is to use aqueous
ammonium chloride.
And the product of
this reaction is this.
It is the alkyne
with the alcohol.
This is, of course, racemic.
In other words, your textbook
points out very nicely
that you're going to
add your nucleophile
from both the front face and
the back face of the carbonyl.
And so we have one enantiomer
in which the OH is pointing back
and the alkyne is pointing out.
We have another enantiomer
in which it's added
from the back face.
And now the OH is pointing out
and the alkyne is pointing back.
And we will get equal
amounts of these,
both of the R and of the S.
Although this chapter
is focusing primarily
on carbonyl compounds, it's also
beginning to introduce ideas
of organic synthesis
and carbon-carbon bond
forming reactions.
And so your chapter reminds you
that you've already seen
certain carbon electrophiles.
So for example, you've
already seen epoxides.
So there are lots
and lots of types
of electrophiles you can
generate your compounds with,
that you can react
your acetylides
and other carbon
nucleophiles with.
And I'll just point out one
example here that brings
out a couple of additional
points.
So butyl lithium is
commercially available.
It's a common source of a highly
basic organometallic reagent
that can be used not only
as a nucleophile but also
as a very strong base.
And so butyl lithium
is a great reagent
for pulling off moderately
acidic protons,
for example protons from alkynes
and also protons from amines
like diisopropylamine,
which you'll see later.
Anyway, butyl lithium would
react with our alkyne.
Remember, our pKa of
the alkyne is about 25.
Our pKa of butane is about 50.
And so it would react again
in an acid-base reaction
to give now and an
alkynal lithium reagent.
And so we can use this as well
as a way of making anions.
And I'll just give you one
example, or this as well
as a way of making
carbon-carbon bonds.
So just to give you some
diversity in your chemicals,
in the molecules that you see,
I'll take, say, phenyl acetylene
and we could envision
treating it with butyl lithium.
You'll often see butyl
lithium written as NBuLi.
N means normal.
Normal is just a fancy way
of saying it's the regular,
it's the 1-butyl lithium rather
than say the lithium being
at the 2 position of butane,
which is sec-butyl lithium,
or being on a tertiary
butyl group,
which is called tert-butyl
lithium and is a stronger base.
Anyway, let's envision using the
common reagent N-butyl lithium,
treating our phenyl
acetylene with it.
That's going to give us our
lithiated phenyl acetylene,
our organolithium compound.
And just to demonstrate the
point of other reactivity,
we can picture the
reaction, say, with an epoxide
and then again an
aqueous workup, H3O plus.
And the product of this
reaction is an alcohol,
just as we've been
generating in all
of the reactions
I've shown thus far.
But what's interesting about
this is now the alcohol,
instead of being connected
directly to the carbon
that had been -- or
directly to the carbon
where the nucleophile
attacked, it's one over.
You can think of this as R
and the alkyne lithium
reacting with the epoxide.
And so we're going to
draw electrons flowing
from the carbon-lithium bond
into the carbon oxygen bond,
pushing electrons onto oxygen
and opening up our ring.
[ Writing on Board ]
[ Erasing Board ]
All right.
So what we've done at this point
is we've really overviewed a
basic, a fundamental
reaction of carbonyl groups,
and we've introduced these
compounds, these reagents
that make for very, very
strong nucleophiles,
hydride nucleophiles like
lithium aluminum hydride
in particular, to a
lesser extend less reactive
sodium borohydride.
And then various organometallic
reagents like Grignard reagents
and organolithium reagents.
At this point I want to sort
of broaden out our thinking
and start to talk not just
about ketones and aldehydes,
but more broadly
about the reactivity
of the carboxylic acid family.
[ Writing on Board ]
And to just put this
into context,
I mean carboxylic acids.
[ Writing on Board ]
Essentially all compounds
in which we have carbon
in the plus 3 oxidation state.
I will get to the several
questions in just a moment.
Esters being another
member of this family.
Acid chlorides.
So I'm going to paint
with a very broad brush.
And later on we're going to get
to a more specific understanding
of the reactivity of
this broad family.
But right now I'm going to
paint with a very broad brush.
I'll include in the
family acid anhydrides.
And maybe to wrap
up in main members
of the family I'll
talk about amides.
But, before we discuss
their reactions
with organometallic reagents,
I saw several questions.
I think there was one here.
One there?
Yes.
>> I was just wondering was
that [inaudible] whereas
with the lithiums -
the lithium-carbon bond the
electron attacks the epoxide.
Does it [inaudible] the
stereochemistry [inaudible]?
>> Ah, great question.
The question was when the
lithium attacks the epoxide,
does it attack from
the top or the bottom?
Does it occur with
inversion of stereochemistry.
And indeed it does.
Although there is no
stereochemistry at the center
that we formed here, you
could imagine, let's say,
having two different
substituents here
like a hydrogen and a deuterium
and we would get inversion
of stereochemistry.
Typically epoxides are
attacked by nucleophiles,
by basic nucleophiles at the
less sterically hindered carbon.
So for example, if I had the
epoxide with a methyl group,
called propylene oxide.
This one is trivially
called ethylene oxide.
If I had the epoxide with
a methyl group on one side,
propyl lithium -- the alkyne
would attack the carbon
that didn't have the
methyl group on it.
Does that make sense to you?
Another question?
I saw one young lady.
>> So it was the same question.
>> Same question?
And?
>> Why do we like to
use butyl stuff so much?
>> Why do we like
to use butyl stuff?
Great question.
So all of our hydrocarbons
ultimately come from petroleum.
And so one of the ways in
which butyl lithium is made is
by first cracking,
heating petroleum very hot
to get smaller fragments.
And one of the fragments that's
easily isolated is butene.
And the butene can then be
taken on to various types
of products including
butyl bromide for example.
So this is one of the
reasons that butyl is used.
You can buy propyl lithium,
but you can buy great big
bottles of butyl lithium.
Methyl is another common one.
>> So the chemistry it doesn't
-- it relies on fossil fuel?
>> Does the chemistry rely on
-- oh, I love that question.
Yeah, almost all of organic
chemistry ultimately goes back
to petroleum.
Some of the chemicals
that we use
as simpler building blocks
come from other sources
like carbohydrates
and, you know,
modern not ancient
plant sources.
But yeah, almost all of
organic chemistry comes back
to petroleum.
So the seats that you're
sitting in have a plastic
that maybe poly --
I don't know --
it's polypropylene or something,
and a covering that's a
synthetic fabric like nylon.
All of those have
come from petroleum.
And so I look at petroleum,
as much as I hate to pay $4.30
at the pump, when you
think about the amount
of stuff you're getting, you're
getting a gallon of gasoline.
This is too valuable to be
burning up because there are
so many things that
you can make from it.
You can't get a gallon
of anything.
You can't get 8 pounds or 7
pounds of anything for 4 bucks.
I can't get a gallon
of beer for 4 bucks.
And yet we go ahead
and we burn it.
So yes, petroleum is incredibly
valuable to organic chemists.
And one of my dear
colleague's favorite questions,
one that I won't be
asking you on an exam
because it's too open-ended and
far too ridiculously complex
for you at this point in your
sophistication, is to go ahead
and write a synthesis
of a steroid,
let's say cholesterol
or testosterone.
You've seen in your current
chapter some steroids starting
with petroleum.
So that would be one of
her favorite questions.
All right, but I
want to go now to --
I want to go now to
the reactions of esters
and of various members of
the carboxylic acid family.
And I thought your textbook's
presentation, particularly
in the reduction section, may
have been a little bit confusing
because there are a
lot of subtleties.
And when I think about a
subject, I like to think
about it in terms of
sort of the general rule
and then exceptions to it.
And there are a ton
of little exceptions.
And your textbook has picked
one and we're going to --
they're talking about
lithium aluminum hydride
with amines -- or with amides.
And we'll talk about that later.
But right now I want to paint
with a very broad brush a sort
of general reaction of
lithium aluminum hydride.
There are these strong
nucleophiles,
these potent nucleophiles,
hydride sources particularly
lithium aluminum hydride just
reduces the crap
out of everything.
Alkyl lithium reagents
like methyl lithium,
just add to everything
as much as they can.
Ditto for Grignard reagents
with certain exceptions.
So again, a very broad
brush view from 30,000 feet.
But we're going to take
a specific reaction.
We're going to take
methyl benzoate here
to exemplify our point.
And we're going to
imagine treating it
with lithium aluminum hydride.
I'm deliberately writing
this as a synthetic reaction.
We'll talk about what's
happening in a moment.
And then an aqueous
workup with --
I'll just write generically
H3O plus.
And you might do this
reaction, say, in THF.
And I'll be a good person and
write a balanced equation,
or at least -- actually, I
won't write a balanced equation,
but I will at least write
my two organic products
of the reaction.
Your organic chemist
is typically focused
on the big stuff.
But I'm going to write this
product, benzyl alcohol,
and the other organic product,
methyl alcohol, methanol.
And collectively, then,
these two constitute the
organic products of reaction.
And what this ends up
illustrating is a new property
that we haven't yet
seen called an
addition-elimination reaction.
[ Writing on Board ]
And we're going to see that this
addition-elimination reaction
goes through an intermediate
of benzaldehyde.
[ Writing on Board ]
And to a certain extent,
maybe with the exception
of amides here, if I took any of
the compounds that I'm erasing
and treated them with
lithium aluminum hydride,
you would get a similar
reaction of them.
All right.
So as I said, this
is a big mouthful.
And I like to break
big mouthfuls
into bite-sized pieces.
So let's think in sort of
broad mechanistic terms here.
All right.
I'm going to think about --
I'll write out our
benzoate component.
I'll write out our
methyl benzoate.
And I will at least for the
moment try to be a good person
and write a good mechanism
in which I write lone pairs
of electrons and try to
keep track of my charges.
And to keep things simple,
I'm going to write --
rather than writing out all
of lithium aluminum hydride,
I'm going to write hydride just
as this abstraction
of a hydride anion.
And the first thing that hydride
does is as a good nucleophile,
a potent nucleophile, we've
talked about the reactivity
in general of carbonyl groups.
The carbonyl group
is an electrophile.
Electrons flow from
the nucleophile
to the electrophile
and onto the oxygen.
[ Writing on Board ]
And I'll try to be a good person
and write all of my lone pairs,
all three lone pairs of
electrons around the oxygen.
And then two on this
other oxygen.
Now, this is not
a stable species.
This is not something
that you can isolate.
It's an intermediate.
And so I'm going to
remind us of the fact
that it's an intermediate
by drawing it in a bracket.
And we have a special name
for this intermediate.
Because we've gone
from a trigonal carbon,
a carbon with three
things around it,
to a tetrahedral carbon,
a carbon with four things
around it, I'm going to call
it a tetrahedral intermediate.
[ Writing on Board ]
And as I said, the tetrahedral
intermediate isn't stable.
The tetrahedral intermediate can
break down, electrons flow back
down from the oxygen,
they push out methoxide.
And now we get a new carbonyl.
At this point we've gotten
benzaldehyde, the intermediate
that I mentioned
and methoxide anion
with its three lone
pairs of electrons on it.
The reaction doesn't
stop at this point.
Esters are less electrophilic
than aldehydes.
In other words, aldehydes are
more electrophilic than esters.
We can write resonance
structures for esters
or a resonance structure,
in which the methoxy
group donates electrons
into the carbonyl and makes
it less electrophilic.
Aldehydes on the other hand
have less going for them.
And so we have more nucleophile,
and you can't just
stop at this point.
It's going to further
get reduced.
And so here's our aldehyde.
Here's our H minus again.
And again, I'll try to be a good
person and put it in quotes.
And electrons flow from our
hydride onto the oxygen,
now to give rise to
an alkoxide anion.
[ Writing on Board ]
And at this point,
that's what'll sit
around in your flask.
I haven't drawn the
counterions or anything.
Until you do a workup --
and I'll just write this
as workup meaning adding some
acid or adding some water.
I'll put this, again,
in our sort of 30,000
foot view of H plus.
And the product of this
reaction is benzyl alcohol.
And the other product
of the reaction is we'll
also protonate our methoxide.
So the other product of
our reaction is methanol.
And I'll just put that
in parenthesis here.
[ Erasing Board ]
All right.
So I want to show you
some generalities.
I want to show you
some analogy in this.
And so, at this point I'll write
essentially the same reaction
with just a slight
difference on it.
So before we could
have been thinking
about lithium aluminum hydride.
I said let's consider
lithium aluminum hydride.
At this point, let's
consider methyl lithium.
And so I'll take our same ester,
I'll take methyl benzoate,
but I'll treat it first
with methyl lithium.
And I'll write in
parenthesis two equivalents.
I'll try to remind us that
we're using a full amount of it.
And then secondly we'll treat
this with some aqueous acid.
And the product of this
reaction, now, instead of adding
in two hydrides, instead
of adding in two hydrogens,
we've added in two methyls.
It's essentially the
exact same thing.
And so now, we've gotten
an alcohol as a product
in which we've added
in two methyl groups.
The reaction's going to go
just like on the other one.
We went via benzaldehyde.
Here, the reaction's
going to go by way
of the ketone, called
acetophenone.
But just as in the case of
the other one, we can't stop
at the ketone with
one equivalent --
[ Writing on Board ]
-- of methyl lithium.
The ketone is more
reactive than the ester,
and so as it now
is sitting around,
it immediately reacts as well.
And so that's our sort of view
at 30,000 feet of the reaction
of these very, very strong
nucleophiles with members
of the carboxylic acid family.
As I said, there are some
exceptions, some differences.
But we can kind of catch
this general spirit of this
on the following equation.
[ Erasing Board ]
And so I'm going
to write this --
I don't always like the way
your textbook presents things,
particularly with a
lot of abstractions,
because from my way of
thinking, it's easier to start
at the concrete and then
work to the abstraction.
For a computer, I think
it's very good to like start
with an abstraction
and, you know,
it can spit out all
the examples.
But we've just looked
at two examples.
So now I'm going to
write the abstraction.
And I'll say many members of
the carboxylic acid family.
And I'm going to
write again this sort
of abstraction of
Nu minus dot, dot.
So some type of strongly basic
nucleophile that encompasses all
of the reagents that
we've been talking about.
So I'll say strongly basic
nucleophile that includes,
for example, lithium
aluminum hydride, RLi,
organolithium reagents, RMgX.
In other words, all of
these species have in common
that they have a bond between a
metal relatively electropositive
metal, and a highly
electronegative species, hydride
or -- I'm sorry a more
electronegative species, hydride
or lithium -- or carbon.
So basically, the generalities
of this type of reaction are
that in general, we get --
and I'll write parenthesis
excess here just
to avoid confusion.
When you have excess,
in general, you're going
to observe addition of two
equivalents of your nucleophile,
which I guess I've
written as Nu plus Z minus.
So that would sort of be
the biggest abstraction.
And I guess I'll try to be good
and keep my electrons in check.
So I'll write a balanced
lone pair.
All right.
So what we've looked at here --
what we've looked at here is an
addition-elimination reaction.
And we've seen this
general principle
that when you have something
like a methoxy group on a member
of the carboxylic acid family,
the reaction doesn't stop.
Things go on.
Now, to many students,
the first time they see an
addition-elimination,
they find it confusing.
And here's why they
find it confusing.
Here's our -- let's
say our ester.
And we've just added a
nucleophile to it, Nu minus,
to form our tetrahedral
intermediate.
[ Writing on Board ]
And that tetrahedral
intermediate isn't stable.
It breaks down.
It kicks out the OR group.
In other words, our electrons
flow like so to push out our
OR group that serves
as a leaving group.
[ Writing on Board ]
And the first time people
see this, having already been
through 51B and learned an
SN2 displace - was it 51B
or 51A you learned
SN2 displacement?
>> A.
>> A. 51A, and seen an
SN2 displacement reaction,
people start to think
about this and say, whoa!
What's going on here?
We don't see an OR group
like a methoxy group leave
in an SN2 displacement reaction.
But this is a little
bit different.
Here, a less basic
leaving group is okay.
See? In an SN2 displacement
reaction,
you've got to crowd five
things around carbon.
You don't have a
stable intermediate.
That leaving group was perfectly
happy attached to the carbon,
and yet something's coming
in and pushing it out.
And it's going over this
high energy barrier,
this transition state
to make that atom leave.
And so that atom that
leaves has to really,
really want the electrons.
In other words, a
good leaving group
in an SN2 displacement
reaction has to go ahead
and have a very stabilized
anion, or conversely,
because stability of
the anion means acidity
of the conjugate base,
conversely a strongly
acidic conjugate base.
So in this case, it's
a little different
because there's nothing bad
about the tetrahedral
intermediate.
We haven't had to
crowd anyone in here.
It's easy to get to this point.
But now it can happily
kick out the OR group.
And what it gets in return
is a carbon-oxygen pi bond,
which is very strong.
And so there's no problem
in getting your tetrahedral
intermediate together.
It's not pentavalent.
There's nothing bad about it.
But, it's very good to go
downhill and to breakdown
and kick out the leaving group
and get back your pi bond.
So, what I always like
to think about here is
in an SN2 displacement reaction,
you've got to have a
good leaving group.
But in the case of
this reaction,
an addition-elimination
reaction,
a less basic leaving
group is okay.
[ Writing on Board ]
And by comparison, I'd say
maybe less than 5 pKa is good
for a leaving group in
an SN2 displacement.
[ Writing on Board ]
Or maybe even an E2 elimination.
[ Writing on Board ]
Thoughts or questions
at this point?
>> Doesn't it work exactly like
a substitution [inaudible]?
Doesn't it work like a
substitution reaction
with the OR group [inaudible]?
>> Doesn't it work
like a substitution?
Indeed. This is a
substitution reaction.
So the very first step
of our methyl lithium plus
methyl benzoate reaction was
to substitute the methoxy group
for a methyl group
and get acetophenone.
And then, of course, we
couldn't stop at acetophenone
because it's even more
reactive than methyl benzoate,
so another equivalent
of methyl lithium adds.
But indeed, it is a
substitution reaction,
unlike an SN2 substitution
reaction,
here you can have a leaving
group that's a little bit less
acidic, like an alcohol
or an alkoxide.
[ Inaudible Audience Question ]
Ah, if you added a
water and acid --
>> Or an acid.
>> Guess I'm not
exactly following.
You mean?
>> Because there's
an [inaudible].
>> Oh, you mean in
the second step?
Would we -- yes.
So in the workup with acid,
we would protonate, indeed.
And one more question.
>> What does it mean
by the leaving group
have less than 5 pKa?
>> Okay. What do you
mean -- great question.
What do you mean by a leaving
group has less than 5 pKa?
In an SN2 displacement
reaction, chloride, bromide,
iodide are wonderful
leaving groups,
pKa of the conjugate acid,
respectively about negative 6,
whatever number you use,
about negative 6 for HCl,
for the conjugate acid about
negative 8 or thereabouts
for HBr, about negative
10 for HI.
And you can go a little bit
less good leaving group.
I can write an equation -- I can
give you an example of a case
where instead of having a
very strong acid, you know,
for the conjugate acid
in an SN2 displacement,
you could go slightly
from negative, you know,
negative 6 for chloride,
into the positive range.
I could give you an example
as low as 5 for the pKa.
Beyond that in an
SN2 displacement,
it pretty much isn't going to
occur unless, like in the case
of an epoxide, you
have ring strain.
pKa of the conjugate acid in an
epoxide is 17 for an alcohol,
but you've got that roughly
30 kilocalories per mole ring
strain associated with the
oxirane ring making it pop open.
So that's the rare case in an
SN2 displacement -like reaction
where you can actually have
what's essentially alkoxide
as leaving group, but
it's spring-loaded.
However, in the case of an
addition-elimination reaction,
absolutely, no problem
kicking out methoxy group
or ethoxy group, pKa of
the conjugate acid, 17.
Great question.
All right, at this point I want
to move on to the final point
that I want to make in
today's lecture and to bring us
to some ideas of synthesis
and showing you how powerful
organometallic reagents are
in carbon-carbon bond
forming reactions.
But also the process by
which organic chemists think
about using these reagents
and using reagents in general
to build up molecules.
And so I'm going to
give you a little bit
of a contrived example here.
But it's very much like the
type of thinking that people use
as they become more
sophisticated.
So, the example I'm
going to give us is
to synthesize a particular
compound.
I've chose it as an example
to illustrate a point,
but indeed something very
much like it could, say,
be a useful insect pheromone
that you might want to make
for a trap for, say,
Japanese beetles.
So we're going to try to develop
a synthesis of 4-ethyl-4-octanol
from compounds containing
four carbon atoms or fewer.
[ Writing on Board ]
There's nothing magical about
four carbon atoms, but many --
if you look
at commercially-available
compounds,
in general most of
them are small.
And you can buy a whole
range of different compounds.
And more big and more complex
compounds often are not
as available.
So you can buy many compounds
containing four carbon atoms
or three carbon atoms
or two or one.
Of course you can buy
plenty containing five,
but for purposes
of this example,
we're going to say
four or fewer.
And what we're going to do
with this is illustrate
the way chemists think,
the process of retrosynthetic
analysis.
[ Writing on Board ]
And we can call this the process
of thinking backwards about how
to synthesize something.
[ Writing on Board ]
And the reason retrosynthetic
analysis is so powerful,
the reason that the process
of thinking backwards is
so powerful is it's so easy
to get caught up in details.
When you try to look at things
from a forward point of view,
that it's very hard to see
how to get there from here,
from compounds containing
four carbons or fewer.
Oh well, we're using
organometallic reagents.
Do I use an organolithium,
do I use a Grignard?
Do I use an ester?
Do I use an acid chloride?
Do I use butyl lithium
as a base?
Do I use methyl lithium?
So retrosynthetic
analysis is kind
of like thinking your
way through a chess game.
We're going to start
with big pictures
and then work our
way to the details.
So let me show you
how I would think
about this particular example.
And you'll encounter on this
week's discussion problems
several examples very similar
to this that involve processes
of thinking backward at various
levels of sophistication.
All right.
So let me draw out my compound.
So it is -- let's see,
one, two, three, four,
five, six, seven, eight.
So here's my target molecule.
Now, when I first think about
this, I could look at this
and say well, okay, he
said four carbons or fewer.
And we just learned
about addition
of organometallic
reagents to esters.
So I could envision adding
-- taking some ester.
It would have to be a methyl
ester of propanoic acid
because that's four carbons.
I couldn't use any more.
And I could envision
forming this bond
by adding in butyl lithium.
And maybe again, for the
point of view of view
from 5,000 feet -- or 30,000
feet, I'm just going to think
in abstractions of some metal.
Whether it's a Grignard or
a lithium doesn't matter.
And again, I could think --
well, here we add in some metal.
And that kind of
catches the strategy.
But we've got a problem here.
And the problem is how
do we get selectivity?
[ Writing on Board ]
I just said you can't
really add one equivalent
of a Grignard reagent
or an organolithium
compound to an ester.
It won't stop at the ketone.
Was that your question?
>> Oh yeah.
No, that's fine.
>> All right.
So let me take this
same idea and see
if we can think backward
a little bit.
So, we know -- see, here I'm
trying to do it all at once.
And I kind of got
myself going here.
It's a lot better than saying
we're going to think forward.
But let me think a
little bit backwards.
We know that an alcohol
can be formed by a ketone
and an organometallic reagent.
So we could imagine -- so I'm
going to use this arrow here.
This arrow, this big open arrow,
means a retrosynthetic arrow.
It means a thinking
backwards arrow.
Organic chemists love
arrows, curved arrows,
equilibrium arrows,
resonance arrows.
This is a retrosynthetic arrow.
So I could envision going ahead
and going backward
to this ketone.
And I could envision --
let's see, did do that right?
Nope. I could envision
this ketone, 2-hexanone
and a butyl metal reagent.
And that would work.
I could add butyl lithium
or butyl magnesium
bromide to 2-hexanone.
And that would be okay
to make that alcohol.
But then I'd need a way
to make this ketone.
And oh, well okay.
We could make that ketone.
We've only learned reactions
that form carbon-carbon bonds
to make alcohols at this
point in this course.
So I could imagine making
that ketone by oxidation
of the corresponding
alcohol of 3-hexanol.
And again, right now I'm not
going to worry which reagent
to use, whether I use
chromium trioxide,
whether I use potassium
chromate, whatever.
But now I look and
I say, I'll wait.
And I can think backwards
again now to the point
of a propyl metal
reagent and propanal.
And at the strategic level,
we've now broken
this molecule apart.
We've used the process of
thinking backwards to figure
out how we can put
this molecule together.
And now having completed
our retrosynthetic analysis,
now we're ready to go forward
and worry from the strategy
to the tactics of, okay,
what reagent do we choose?
How do we do our details?
And so the last thing I'll do
in solving this hypothetical
problem is
to show you the synthesis
that I've worked out.
So I would start with propanal.
I've completed the requirement
with each of my three components
of four carbons or fewer.
I'd start with propanal,
it's commercially available.
It fits the requirement.
I'll add in, just for the fun
of it I'll use propyl
magnesium chloride.
I could use propyl lithium,
I could use propyl
magnesium bromide,
propyl magnesium iodide.
I'll carry out my
workup with aqueous HCl.
I could use aqueous
sulfuric acid.
I could use aqueous
ammonium chloride.
I could probably be lazy and
write H3O plus over the arrow.
But I'm going to
go to the stockroom
and get some chemicals.
And I'm going to ask
them for some HCl.
The product of that reaction
after workup is 3-hexanol.
I now am ready to
oxidize my 3-hexanol.
You learned lots of reactions
last quarter for oxidation.
They taught you potassium
dichromate in sulfuric acid
and water, sometimes
called Jones' reagent.
There are many, many
reagents based on chromium 6,
sodium dichromate,
chromium trioxide.
There are lots of
safer alternatives,
including alternatives
based on bleach.
But we're going to use
reactions that you know.
So we're going to use
potassium dichromate.
Then, at that point,
we have our 2-hexanone.
And question.
>> So I was just wondering,
could you also instead
of the [inaudible] use CrO3?
>> Absolutely.
We could use chromium
trioxide as an oxidizing agent.
Lots to choose from.
Nice in our retrosynthetic
analysis not having to worry
about getting that right yet.
And now, having the leisure of
going and choosing our reagents
and choosing our tactics.
Finally, to complete
our synthesis,
I'm going to take butyl lithium
and I'll do an aqueous workup.
And again, I'll use HCl.
I've written it below
the arrow here,
written it above
the arrow there.
Doesn't really matter.
A chemist is going to
read it the same way.
And lo and behold, I
have proposed a rational
and selective synthesis
of our target molecule
4-ethyl-4-octanol.
[ Writing on Board ]
And this art of recognizing
something in a molecule
and seeing where it comes
from is going to grow
and grow in the course.
Right now we've seen an
alcohol and we said oh,
I know how to make an alcohol.
I can make an alcohol by adding
in two carbon nucleophiles.
I can make alcohols by adding
in carbon nucleophiles.
Later on we're going to see
all sorts of other families
of carbonyl compounds.
All right.
I will see you on Thursday.
We'll start off with
a 10 minute quiz.
------------------------------1827f70bddb3--
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Capsule:
Each year nearly one in eight infants in the United States is born preterm. Preterm birth places babies at increased risk for death, health problems including long-term neurological disabilities, and extended time in the hospital.
Abstract:
Each year nearly one in eight infants in the United States is born preterm. Preterm birth places babies at increased risk for death, health problems including long-term neurological disabilities, and extended time in the hospital. It costs the U.S. health care system more than $26 billion per year. An important risk factor for preterm birth is multiplicity, with 11% of twins, 36% of triplets, and 67% of quadruplets and higher born very preterm (less than 32 weeks’ gestation), compared with less than 2% of singletons.
New Discussion Features!
NEW! Open access free discussion forums on EVERY article in Fertility and Sterility! Just go to the issue and click on article title. You will be able to submit comments questions or share your thoughts on the paper-- Speak your mind!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
549 F.Supp. 1208 (1982)
BANGOR BAPTIST CHURCH, et al., Plaintiffs,
v.
STATE OF MAINE, DEPARTMENT OF EDUCATIONAL AND CULTURAL SERVICES, and Harold Raynolds, Jr., Commissioner, Defendants.
Civ. A. No. 81-0180-B.
United States District Court, D. Maine.
October 26, 1982.
*1209 *1210 *1211 Kevin M. Cuddy, Bangor, Me., William B. Ball, Philip J. Murren, Kathleen A. O'Malley, Harrisburg, Pa., for plaintiffs.
Ellen E. George, William R. Stokes, Asst. Attys. Gen., Augusta, Me., for defendants.
MEMORANDUM DECISION
CYR, District Judge.
The Court is presented with a motion to dismiss the complaint for failure to state a claim upon which relief can be granted, which is accompanied by matters outside the pleadings, not excluded by the Court, and is to be treated as a motion for summary judgment. Fed.R.Civ.P. 12(b). Medina v. Rudman, 545 F.2d 244, 247 (1st Cir.1976). The parties have supplemented the record, both before and after oral argument, with affidavits and memoranda of law.
The plaintiffs include fundamentalist Christian churches, teachers, pastors, parents and an association of fundamentalist Christian schools. The defendants are the Maine Department of Educational and Cultural Services [Department] and the Commissioner of Educational and Cultural Services [Commissioner].
The amended complaint, which seeks declaratory and injunctive relief, as well as costs and counsel fees, alleges that certain provisions of the Maine Compulsory Education Law,[1] 20 M.R.S.A. §§ 102.7, 911.3, 1281 & 1286, are violative of the First, Ninth, *1212 and Fourteenth Amendments to the Constitution of the United States.
The fundamental statutory provision brought under constitutional challenge by the plaintiffs is 20 M.R.S.A. § 911, which requires every child between the ages of 7 and 17[2] to attend a public school, unless receiving "equivalent instruction in a private school ... [provided] the equivalent instruction is approved by the commissioner."
Title 20, Maine Revised Statutes Annotated, section 102.7, which directs the defendant commissioner, inter alia, to "... *1213 prescribe the studies to be taught in the public schools and in the private schools approved for attendance ..."[3] and permits the Commissioner to "remove basic approval from any school for cause," is also assertedly unconstitutional.
Plaintiffs further challenge various requirements for the approval of private secondary schools imposed pursuant to 20 M.R. S.A. § 1281 (Supp.1981), which mandates that "[t]he secondary schools of this State shall be evaluated for basic approval ..." and establishes ten basic requirements.[4] The specific requirements for state approval of private secondary schools to which plaintiffs object are: (1) that each school maintain "a course of study approved by the defendant commissioner;"[5] (2) that *1214 each school employ "only certified teachers;"[6] and (3) that each school have "a pupil-teacher ratio of not more than 30 to one."[7]
Plaintiffs contend that the Commissioner has sought to impose these statutory requirements and various regulations promulgated in furtherance thereof upon plaintiffs' church-schools. Plaintiffs assert that they have refused to comply for reasons of religious conviction, insofar as the statutes and regulations require greater burdens than plaintiffs acknowledge to be the lawful province of the defendants to impose. Plaintiffs insist that compliance would substantially limit and interfere with their religious mission and permit state surveillance of church-schools, review of their church-school programs and other excessive entanglements.
The amended complaint pleads constitutional violations in five counts: (1) violation of the Free Exercise Clause of the First Amendment and denial of parental rights guaranteed by the Ninth Amendment; (2) violation of the Establishment Clause of the First Amendment; (3) violation of the Due Process Clause of the Fourteenth Amendment, in that the challenged statutes and regulations promulgated thereunder are "impermissibly vague, overbroad, ultra vires and improperly delegate legislative authority to administrative personnel;" (4) violation of the First, Ninth, and Fourteenth Amendments, by depriving plaintiffs of parental, property, and enterprise rights; and (5) violation of the First, Ninth, and Fourteenth Amendments, by denying plaintiffs their rights "in education to express, transmit, or receive ideas."
The defendants deny most of the material allegations of the amended complaint for the reason that they are without sufficient knowledge or information upon which to form a belief as to the truth of the matters asserted. Defendants invoke the ancillary jurisdiction of the Court by way of counterclaim against nine church-school plaintiffs and against persons, known and unknown to defendants, charged with the direction of the church-school defendants-in-counterclaim, for declaratory and injunctive relief aimed at the implementation of the compulsory education laws of the State of Maine. The second claim for relief asserted in defendants' counterclaim seeks a judicial declaration that certain church-school plaintiffs cannot qualify for initial school approval absent prior compliance with state health, sanitation, fire, and safety requirements. Plaintiffs admit that the nine church-school defendants-in-counterclaim are operating private schools without the approval of the Commissioner and that they have refused to provide the information required by the Commissioner, except information relating to state fire, safety, health and sanitation standards.[8] By way of affirmative defense to the counterclaims, the defendants-in-counterclaim reassert each of the constitutional claims alleged in their amended complaint and further allege that the plaintiffs-in-counterclaim will suffer no irreparable harm and have an adequate remedy at law.
I
FACTS
Title 20 M.R.S.A. § 911.1.A mandates that "[e]very child between his 7th and 17th birthdays shall attend a public day school during the time it is in session." However, "[a] child shall be excused from attending a public day school if he obtains equivalent instruction in a private school ... if the equivalent instruction is approved by the *1215 commissioner." 20 M.R.S.A. § 911(3)(A). For purposes of exercising his statutory responsibility under this provision, the Commissioner is guided by: (1) the regulations of the State Board of Education,[9] issued pursuant to 20 M.R.S.A. § 51(3)(B), establishing requirements for approval of elementary and secondary schools; (2) the regulations of the Board, issued under 20 M.R. S.A. § 59, regarding certification of teachers; (3) the studies required to be taught, as prescribed in 20 M.R.S.A. § 102(7); (4) the rules issued by the Commissioner regarding such studies; (5) the requirements for approval of secondary schools, established by 20 M.R.S.A. § 1281; and (6) various provisions of title 22 M.R.S.A. and of the rules and regulations of the Department of Human Services, prescribing state health and sanitation standards applicable to schools, and of the Life Safety Code, containing fire safety standards issued by the Department of Public Safety pursuant to title 25 M.R.S.A.
The Department issues regulations, codified at 05-071 CMR 127, sections 1 and 2, prescribing the minimum instructional requirements for public schools and for private schools approved for attendance purposes under 20 M.R.S.A. § 911(3).
The qualification and procedural requirements for teacher certification are set forth in the regulations of the Department, codified at 05-071 CMR 115. The regulations governing school evaluation procedures and prescribing standards for obtaining school approval are codified at 05-071 CMR 125, as modified by an "Addendum" issued in September, 1981 which further explains the procedures for obtaining private sectarian school approval. These three sets of regulations are at the heart of plaintiffs' constitutional challenges and for that reason are summarized in the Appendix.
II
LAW
Defendants insist that there is no genuine issue as to any material fact respecting any of plaintiffs' claims for relief and that defendants are entitled to judgment as a matter of law. Plaintiffs have not moved for summary judgment on any of their claims for relief or on either of defendants' counterclaims. Defendants assert that their supporting affidavits have not been met by the plaintiffs with opposing affidavits setting forth specific facts raising any genuine issue for trial. See Fed.R.Civ.P. 56(e). For their part, plaintiffs point out that the pending motion may not be used as a vehicle for turning an adversary proceeding into a trial by affidavit, see Thyssen Plastik Anger KG v. Induplas, Inc., 576 F.2d 400, 402 (1st Cir.1978); Redman v. Warrener, 516 F.2d 766, 768 (1st Cir.1975), and that the parties are entitled to try the material facts in genuine dispute, see Associated Press v. United States, 326 U.S. 1, 6, 65 S.Ct. 1416, 1418, 89 L.Ed. 2013 (1945).
Defendants must satisfy the Court that there are no material facts in dispute, see Adickes v. S.H. Kress & Co., 398 U.S. 144, 157, 90 S.Ct. 1598, 1608, 26 L.Ed.2d 142 (1970); Ramsay v. Cooper, 553 F.2d 237, 240 n. 8 (1st Cir.1977), and that defendants are entitled to judgment as a matter of law in light of all undisputed facts and any reasonable inferences which may be drawn from those facts, viewed in the light most favorable to the plaintiffs, see Adickes v. S.H. Kress & Co., 398 U.S. at 157, 90 S.Ct. at 1608; Creative Environments, Inc. v. Estabrook, 680 F.2d 822, 829 (1st Cir.1982). Summary judgment must be denied where there remains the slightest doubt as to any material fact. United States v. Del Monte De Puerto Rico, Inc., 586 F.2d 870, 872 (1st Cir. 1978); Peckham v. Ronrico Corp., 171 F.2d 653, 657 (1st Cir. 1948). There are numerous material facts in genuine dispute and, with but few exceptions, it is far from clear that defendants are entitled to judgment as a matter of law in light of the undisputed facts.
*1216 A. Free Exercise Parental Rights Right to Receive and Express Ideas Counts I, IV and V
Counts I, IV and V present interrelated constitutional claims. Count I alleges that the compulsory education laws impose prior restraints upon plaintiffs' federal and state constitutional rights to the free exercise of their religion and deny the parent-plaintiffs' Ninth Amendment rights to determine the religious education of their children. It is alleged that enforcement of the compulsory education laws and regulations would deprive the church-plaintiffs "of their liberty to freely carry out their religious mission in the form of Christian education" and "chill, if not destroy," the evangelical ministry of the pastor-plaintiffs "in the religious mission of the schools in their charge." The school principal- and teacher-plaintiffs assert that they would "be denied entirely the right to carry out a calling to the religious ministry of educating young Christians." Plaintiffs contend that no compelling state interest justifies the burden placed on their religious freedoms and that if any such interest exists it can be achieved through less restrictive means.
Count IV alleges that these state-imposed requirements would deprive plaintiffs of their parental rights and their property and enterprise rights under the First, Ninth and Fourteenth Amendments, and under Article 1, sections 1 and 6-A of the Constitution of the State of Maine.
Count V claims deprivations of plaintiffs' rights "in education to express, transmit or receive ideas," as guaranteed by the First, Ninth and Fourteenth Amendments, and by Article 1, sections 3 and 4 of the Constitution of the State of Maine.
1. Exemption From Government Regulation.
In 1878 the United States Supreme Court upheld the polygamy conviction of a Morman, declaring that religious belief alone, not religiously-motivated conduct, is protected by the First Amendment and that polygamy laws serve an important secular purpose by preserving monogamous marriage and preventing the exploitation of women. See Reynolds v. United States, 98 U.S. 145, 164, 25 L.Ed. 244 (1878). More recently, the Court accorded broadened constitutional protection to certain religiously-motivated conduct on the part of religious groups. See Murdock v. Pennsylvania, 319 U.S. 105, 109, 63 S.Ct. 870, 873, 87 L.Ed. 1292 (1943) [first amendment right in spreading beliefs, by distributing pamphlets without a license, outweighs legitimate secular purpose in generating revenue from persons using public streets]; Cantwell v. Connecticut, 310 U.S. 296, 60 S.Ct. 900, 84 L.Ed. 1213 (1940) [first amendment right to solicit contributions and play religious recordings in public streets cannot be conditioned upon licensing determination by state as to whether a cause is religious, since state interest in preventing fraud and preserving peace can be achieved by less drastic means]. In Sherbert v. Verner, 374 U.S. 398, 83 S.Ct. 1790, 10 L.Ed.2d 965 (1963), the Court took a significant step beyond earlier case law,[10] by holding that only a compelling state interest could justify burdening the free exercise of religion and that the state must bear the burden of demonstrating the unavailability of less restrictive means of achieving its aims. Id. at 403, 407, 83 S.Ct. at 1793, 1795.[11] In Wisconsin v. Yoder, 406 U.S. 205, 92 S.Ct. 1526, 32 L.Ed.2d 15 (1972), after a careful consideration of the religious and state interests involved, the Court concluded that Amish *1217 parents need not comply with compulsory education laws requiring their children to attend school beyond the eighth grade. In Thomas v. Review Board of the Indiana Employment Security Division, 450 U.S. 707, 101 S.Ct. 1425, 67 L.Ed.2d 624 (1981), the Court stated:
The state may justify an inroad on religious liberty by showing that it is the least restrictive means of achieving some compelling state interest. However, it is still true that "[t]he essence of all that has been said and written on the subject is that only those interests of the highest order ... can overbalance legitimate claims to the free exercise of religion."
Id. at 718, 101 S.Ct. at 1432, quoting Wisconsin v. Yoder, 406 U.S. 205, 215, 92 S.Ct. 1526, 1533, 32 L.Ed.2d 15 (1972). See also United States v. Lee, 455 U.S. 252, 102 S.Ct. 1051, 1055, 71 L.Ed.2d 127 (1982) [state may limit religious liberty on sufficient showing that regulation is essential to overriding governmental interest].
The test presently applied in determining whether regulation of religiously-motivated conduct violates the free exercise clause contemplates a three-part determination:
1. whether the challenge is motivated by, and rooted in, a legitimate and sincerely-held religious belief;
2. whether and to what extent state regulation burdens free exercise rights; and
3. whether any such burden is justified by a sufficiently compelling state interest. Wisconsin v. Yoder, 406 U.S. at 215, 92 S.Ct. at 1533. Governmental regulation which significantly burdens the free exercise of religion cannot withstand constitutional challenge unless it represents the "least restrictive means of achieving some compelling state interest." Thomas v. Review Board of Indiana Employment Security Division, 450 U.S. 707, 718, 101 S.Ct. 1425, 1432, 67 L.Ed.2d 624 (1981). But exemption of religious activity from regulation is not constitutionally required where it would "unduly interfere with fulfillment of the [compelling] governmental interest." United States v. Lee, 455 U.S. 252, 102 S.Ct. 1051, 71 L.Ed.2d 127 (1982).
For purposes of the pending motion, the defendants concede that plaintiffs' constitutional claims are motivated by, and rooted in, legitimate and sincerely-held religious beliefs, contending instead that plaintiffs' religiously-motivated activities are but minimally burdened by the compulsory education laws. Defendants argue that the Commissioner possesses the requisite administrative power and willingness to accommodate plaintiffs' religious beliefs and that the Court should determine, as a matter of law, that Maine's scheme of compulsory education is reasonable and that it serves compelling state interests warranting whatever minimal burdens may be imposed on plaintiffs' religious activities.
The important interests competing for judicial protection in the context of constitutional challenges brought under the free exercise clause are rarely susceptible to the requisite balancing on motion for summary judgment. See Minkus v. Metropolitan Sanitary Dist., 600 F.2d 80, 84 (7th Cir. 1979) [challenge to state refusal to conduct civil service testing on date other than Sabbath raised substantial factual issues as to whether accommodation could be made by the state without undue hardship, requiring reversal of summary judgment in favor of defendant]. See also Attorney General v. Bailey, 386 Mass. 367, 436 N.E.2d 139, 150 (1982); 10 Wright & Miller, Federal Practice and Procedure § 2732, at 614 n. 67 (1973). Courts normally permit the parties to present a complete factual record to facilitate the requisite balancing of competing interests in considering first amendment claims. See Developmental Disabilities Advocacy Center Inc. v. Tuttle, 689 F.2d 281 at 288-289 (1st Cir. 1982).[12]
*1218 Although it is late in our constitutional history to mount a successful free exercise claim to exemption from all governmental regulation, see United States v. Lee, 455 U.S. 252, 102 S.Ct. 1051, 71 L.Ed.2d 127 (1982); Thomas v. Review Board of Indiana Employment Security, 450 U.S. 707, 718, 101 S.Ct. 1425, 1432, 67 L.Ed.2d 624 (1981); Wisconsin v. Yoder, 406 U.S. 205, 92 S.Ct. 1526, 32 L.Ed.2d 15 (1972); Gillette v. United States, 401 U.S. 437, 91 S.Ct. 828, 28 L.Ed.2d 168 (1971); Sherbert v. Verner, 374 U.S. 398, 83 S.Ct. 1790, 10 L.Ed.2d 965 (1963); Prince v. Massachusetts, 321 U.S. 158, 64 S.Ct. 438, 88 L.Ed. 645 (1944); Cantwell v. Connecticut, 310 U.S. 296, 303-04, 60 S.Ct. 900, 903, 84 L.Ed. 1213 (1940); Reynolds v. United States, 98 U.S. 145, 25 L.Ed. 244 (1878), and it seems clear that at least some state regulation may be imposed upon private schools attended by students of compulsory school age, see Board of Education v. Allen, 392 U.S. 236, 245-47, 88 S.Ct. 1923, 1927-1928, 20 L.Ed.2d 1060 (1968); Everson v. Board of Education, 330 U.S. 1, 18, 67 S.Ct. 504, 512, 91 L.Ed. 711 (1947); West Virginia State Board of Education v. Barnette, 319 U.S. 624, 631, 63 S.Ct. 1178, 1181, 87 L.Ed. 1628 (1943); Pierce v. Society of Sisters, 268 U.S. 510, 45 S.Ct. 571, 69 L.Ed. 1070 (1925), these plaintiffs are entitled to present evidence at trial that Maine's compulsory education laws and regulations burden their religiously-motivated activities. The defendants bear the burden of proving that any governmental regulation which does burden the free exercise of plaintiffs' religion represents the least restrictive means of achieving some compelling state interest.
2. The "Faith Baptist" Case.
In support of their motion for summary judgment, defendants place great reliance on the dismissal by the United States Supreme Court of the appeal in State ex rel. Douglas v. Faith Baptist Church, 207 Neb. 802, 301 N.W.2d 571 (1981), appeal dismissed sub nom. Faith Baptist Church v. Douglas, 454 U.S. 803, 102 S.Ct. 75, 70 L.Ed.2d 72 (1981). In Faith Baptist the Nebraska Supreme Court, on de novo consideration, upheld a judgment enjoining the operation of elementary and secondary Christian schools for failure to comply with school approval requirements similar to those involved here. The Faith Baptist defendants, a church and certain of its officers and employees, claimed that enforcement of the Nebraska school approval requirements would violate their right to the free exercise of their religion and to bear, raise, and educate their children.[13] There the Christian schools utilized a Bible-oriented curriculum supplied by Accelerated Christian Education, consisting of a series of booklets containing instructional information and self-test questions considered appropriate for each instructional level. The curriculum permitted students to work at their own speed, under the supervision of teachers who administer tests and assist students having difficulty. The defendants refused to furnish reports of the names and addresses of students enrolled in their school as required by statute. The defendants *1219 refused to seek state approval of their curriculum, despite assurances of approval, and refused to employ only state accredited teachers and to seek approval to operate their schools. The defendants maintained that the operation of their schools was an extension of their church ministry and that the state had no authority to approve or accredit their schools, asserting that the basic philosophy of the public education system ran contrary to their belief in biblical Christianity and that the state was therefore "not capable of judging the philosophy of the defendants' school," id. 301 N.W.2d at 574. Finally, the defendants in Faith Baptist refused to submit to school inspection as required by Nebraska law "because the State has no right to inspect God's property."
Nebraska law provides penal sanctions for "violations of the various statutory provisions relating to compulsory education and operation of private, denominational and parochial schools." Id. 301 N.W.2d at 575. The Nebraska Supreme Court held that injunctive relief, as opposed to criminal prosecution, was appropriate to prevent a continuing and flagrant course of violations of Nebraska criminal law. Id.
The defendants in the present action claim that the summary dismissal of the Faith Baptist appeal is dispositive of plaintiffs' First and Ninth Amendment claims, since the Nebraska Supreme Court had rejected essentially these same claims. On the weight of the summary affirmance by the United States Supreme Court, these defendants seek summary judgment under Counts I, IV and V. See Defendants' Supplementary Memorandum, dated April 7, 1982, at 29.
"It is ... often difficult to understand the proper reach of Supreme Court summary affirmances and dismissals for want of a substantial federal question...." Preston v. Seay, 684 F.2d 172, 173 (1st Cir. 1982) (per curiam). The summary disposition of an appeal results in a judgment on the merits even though there has been no briefing, oral argument or written opinion. However, "[b]ecause a summary affirmance is an affirmance of the judgment only, the rationale of the affirmance may not be gleaned solely from the opinion below." Mandel v. Bradley, 432 U.S. 173, 176, 97 S.Ct. 2238, 2240, 53 L.Ed.2d 199 (1977) (per curiam). See also Tully v. Griffin, Inc., 429 U.S. 68, 74, 97 S.Ct. 219, 223, 50 L.Ed.2d 227 (1976). A summary disposition has precedential value in cases virtually indistinguishable from the case summarily disposed of, see Hicks v. Miranda, 422 U.S. 332, 95 S.Ct. 2281, 45 L.Ed.2d 223 (1975), and in cases involving but slightly different facts and issues from those in the case summarily disposed of, see Rose v. Locke, 423 U.S. 48, 96 S.Ct. 243, 46 L.Ed.2d 185 (1975) (per curiam). "Summary actions, however, ... should not be understood as breaking new ground, but as applying principles established by prior decisions to the particular facts involved." Mandel v. Bradley, 432 U.S. at 176, 97 S.Ct. at 2240. Mr. Justice Brennan, concurring in Mandel v. Bradley, announced two clear standards by which courts should determine the precedential significance of a summary disposition:
After today, judges of the state and federal systems are on notice that, before deciding a case on the authority of a summary disposition by this Court in another case, they must (a) examine the jurisdictional statement in the earlier case to be certain that the constitutional questions presented were the same and, if they were, (b) determine that the judgment in fact rests upon decision of those questions and not even arguably upon some alternative nonconstitutional ground. The judgment should not be interpreted as deciding the constitutional questions unless no other construction of the disposition is possible.
Id. at 180, 97 S.Ct. at 2242 (Brennan, J., concurring). See also Comment, The Precedential Weight of Summary Dispositions of Appeals, 29 Me.L.Rev. 325, 353 n. 104 (1978).
The issues before the Supreme Court in the Faith Baptist case were:
(1) Do Nebraska educational statutes and rules promulgated thereunder pertaining *1220 to state approval of church schools and teacher certification deprive appellants, on their face and as applied, of free exercise of religion in violation of [the] First Amendment?
(2) Do Nebraska educational statutes and rules promulgated thereunder pertaining to state approval of church schools and teacher certification violate, on their face and as applied, individual appellants' fundamental rights to bear, raise and educate their children as guaranteed by [the] Ninth and Fourteenth Amendments?
See 49 U.S.L.W. 3940 (June 16, 1981), Subject Matter Summary of Cases Recently Filed.
Although it is far from clear that the constitutional questions with which the United States Supreme Court was presented in the Faith Baptist appeal are the same as those in the present action,[14] even assuming that to be the case it is doubtful that the summary affirmance rested upon a decision of either of the broad constitutional questions there posed. It simply cannot be determined that the judgment of the United States Supreme Court "rests upon decision of those questions and not even arguably upon some alternative nonconstitutional ground." Mandel v. Bradley, 432 U.S. at 180, 97 S.Ct. at 2242 (Brennan, J., concurring). The defendants in Faith Baptist refused even to provide the state with the names and addresses of students enrolled in their schools. The Nebraska court enjoined the operation of the school "because there had been no compliance with the school laws of the State of Nebraska." State v. Faith Baptist Church, 301 N.W.2d at 573. (Emphasis added.) The United States Supreme Court was not of necessity required to rule on the broad constitutional issues there presented in order to reach its judgment and it has not in any event been made to appear that the Court accepted the reasoning of the Nebraska court.
B. Excessive Entanglement (Count II)
Count II of the complaint asserts that the imposition of the Maine compulsory education laws and regulations would violate the Establishment Clause by: (1) imposing state-chosen values on religious entities; (2) involving the state in purely religious matters; and (3) fostering an excessive governmental entanglement with religion.
The mode of analysis for Establishment Clause questions is defined by the three-part test that a statute must have a secular legislative purpose, must have a principal or primary effect that neither advances nor inhibits religion, and must not foster an excessive governmental entanglement *1221 with religion. See Roemer v. Maryland Public Works Bd., 426 U.S. 736, 748 [96 S.Ct. 2337, 2345, 49 L.Ed.2d 179] (1976); Committee for Public Education v. Nyquist, 413 U.S. 756, 772-73 [93 S.Ct. 2955, 2965-2966, 37 L.Ed.2d 948] (1973); Lemon v. Kurtzman, 403 U.S. 602, 612, 613 [91 S.Ct. 2105, 2111, 29 L.Ed.2d 745] (1971).
Wolman v. Walter, 433 U.S. 229, 235-36, 97 S.Ct. 2593, 2598-2599, 53 L.Ed.2d 714 (1977). Plaintiffs do not argue that the compulsory education laws and regulations have no secular legislative purpose or that their primary effect either advances or inhibits religion, but that those laws and regulations "foster an excessive governmental entanglement with religion." Id.
Defendants demand summary judgment under Count II on the grounds that the Commissioner is prepared to accept the requested information in any form plaintiffs wish to submit it, and even to arrange school visitations by the Department should plaintiffs desire, thereby obviating, defendants believe, any possibility of excessive entanglement.
An unconstitutional entanglement generally involves "the government's continuing monitoring or potential for regulating the religious activity under scrutiny." United States v. Freedom Church, 613 F.2d 316, 320 (1st Cir.1979). "[I]n determining whether there is excessive entanglement, the question is `whether particular acts in question are intended to establish or interfere with religious beliefs and practices or have the effect of doing so.'" Id. quoting Walz v. Tax Commissioner, 397 U.S. 664, 669, 90 S.Ct. 1409, 1411, 25 L.Ed.2d 697 (1970).
The decision by the First Circuit in Surinach v. Pesquera de Busquets, 604 F.2d 73 (1st Cir.1979), outlines the appropriate judicial approach to the present entanglement challenge. Surinach found free-exercise and establishment clause violations where the Puerto Rico Consumer Affairs Department, pursuant to legislative directive, subpoenaed church-school records relating to operating costs, financial sources, school services, supplies and equipment, personnel salaries, scholarships, and related matters. The First Circuit began its analysis by rejecting the distinction drawn by the district court between the gathering of the information and the regulatory purpose (restraint of inflationary trends) for which the information was sought. Observing that the gathering of information from the schools was not an end in itself, but rather a first step in a process which might lead to the imposition of ceilings on educational costs at the religious schools, Chief Judge Coffin said that the schools were not obliged to show, as a condition to relief, that the precise scenario of price regulation would in fact unfold. Id. at 75.
To the contrary, in the sensitive area of First Amendment religious freedoms, the burden is upon the state to show that implementation of a regulatory scheme will not ultimately infringe upon and entangle it in the affairs of a religion to an extent which the Constitution will not countenance. In cases of this nature, a court will often be called upon to act in a predictive posture; it may not step aside and await a course of events which promises to raise serious constitutional problems. In Catholic Bishop of Chicago v. NLRB, 559 F.2d 1112 (7th Cir.1977), aff'd on statutory grounds, 440 U.S. 490, 99 S.Ct. 1313, 59 L.Ed.2d 533 (1979), the court of appeals held that the exercise of jurisdiction by the NLRB over schools operated by the Roman Catholic Church violated the separation between church and state. Reasoning from the cases which have found various forms of aid to sectarian schools to be unconstitutional, it expressly rejected the Board's contention that any constitutional problems should be litigated `down the line' if and when disputes arose between the Board and schools subject to its jurisdiction:
The whole tenor of the Religion Clauses cases involving state aid to schools is that there does not have to be an actual trial run to determine whether the aid can be segregated, received and retained as to secular activities only, but it is sufficient to strike the aid down that a reasonable likelihood or possibility of entanglement exists.
*1222 559 F.2d at 1126.
Surinach v. Pesquera de Busquets, 604 F.2d 73, 75-76 (1st Cir.1979).
The court in Surinach found that the effect of the governmental demand for information "constitutes a palpable threat of state interference with the internal policies and beliefs of [the] church related schools." Id. at 77. The court expressed concern that the information could eventually be used to "interfere seriously" with the church canons requiring church-schools to maintain academic excellence, id., and that, if it were administratively determined that church-school costs were to be contained, the schools would likely have to cut back on their curricula and facilities, thus affecting their religious objective of offering the highest quality education possible, id. Moreover, the court feared that the regulatory process might require a determination as to which school costs were necessary and reasonable, giving rise to a possible conflict between religious and secular values. Id. at 77-78 (e.g., state could determine student-teacher ratio in religious schools unusually low).
The First Circuit took little comfort from the fact that the Commonwealth had not yet made determinations in conflict with religious doctrine or yet concluded that cost controls were necessary. Id. at 78. The court observed that these first steps on the road to regulation could chill the recruitment, allocation and expenditure of funds, id., and that the regulatory scheme authorized continuing governmental involvement in church affairs which could "intrude upon decisions of religious authorities as to how much money should be expended and how funds should best be allotted to serve the religious goals of the schools," id. at 79.
Surinach held that the Commonwealth had not met its burden of showing a compelling state interest justifying the imposition of its regulations on the religious schools, nor its burden of showing that its secular interests could not be served by less intrusive means. Id. at 79-80. The court cogently observed that the Commonwealth had not even argued that it "would be unable to fulfill its wide ranging duties if any portion of one segment of the economy were to be excluded from its investigation and subsequent regulation," id. at 80.
The defendants contend that the imposition of the challenged regulations would place no burden on plaintiffs' religious practices. On the contrary, the burdens clearly appear, though their extent remains subject to proof at trial. For example, the defendants admit that their schools are not operating in compliance with the requirement of Maine law that only certified teachers be employed, see 20 M.R.S.A. § 1281 (Supp. 1981), which constitutes cause to close schools pursuant to Board regulation, see 05-071 CMR 125, at 4. Other regulatory requirements under challenge may give rise to excessive governmental entanglements with religion; for example, the informational requirements pertaining to school finances, tuition policies, and educational philosophy; and departmental inspection and approval of the physical facilities and environment of church-schools.
Once it is recognized that the regulatory scheme imposes some burden on plaintiffs' religious practices, it is clear that defendants have yet to meet their burden of showing that no excessive entanglement would result from the imposition of the scheme upon plaintiffs. It is no answer that plaintiffs should be required to submit the requested information (in whatever form) and await litigation "down the line" if and when specific disputes arise. See Surinach v. Pesquera de Busquets, 604 F.2d at 75-76; see also Babbitt v. United Farm Workers National Union, 442 U.S. 289, 298 99 S.Ct. 2301, 2308, 60 L.Ed.2d 895 (1979); Steffel v. Thompson, 415 U.S. 452, 458-59, 94 S.Ct. 1209, 1215, 39 L.Ed.2d 505 (1974); O'Shea v. Littleton, 414 U.S. 488, 493-99, 94 S.Ct. 669, 674-677, 38 L.Ed.2d 674 (1974). The defendants must show that the regulatory scheme to be imposed on plaintiffs represents the least restrictive means of achieving some compelling state interest and that the information required of plaintiffs would serve a specific and sufficiently compelling state interest to warrant burdening their *1223 religious practices. See Surinach v. Pesquera de Busquets, 604 F.2d at 79-80. These are matters of proof.
The Commissioner asserts on affidavit that certain of the information required by the form of application for initial approval, see Exhibit 7, attached to Affidavit of Commissioner Raynolds, October 19, 1981, need not be provided by the plaintiff-schools and that it is the policy of the Department to waive, on request, any regulatory requirement "to accommodate ... religious ... schools," provided "the basic requirements of the compulsory education laws deemed necessary for the benefit and protection of the children of this state will not be unduly compromised." The Commissioner avers that the requirement that the school physical environment be "acceptable to the Department," see 05-071 CMR, at 5, has not been and will not be imposed. The Commissioner further proposes relaxation of the teacher certification requirement, stating that church-school teachers need not obtain certification "if this is against their religious convictions," but need only "demonstrate qualification for certification." See Second Supplemental Affidavit of Commissioner Raynolds, at 11. With respect to the request for information regarding school financial position and policies, the Commissioner asserts that church-schools need only identify their religious affiliation, id. at 13, and that church-schools need not provide information regarding school tuition policies. Finally, the Commissioner states that private schools ineligible for public tuition funds, which neither wish to obtain five-year approval status nor seek indirect public aid, through textbook loans, medical services, remedial service or standardized testing, need not provide, with their initial application, information regarding their educational philosophy, goals and objectives.
The present action appears to have been precipitated by letters of the Commissioner, dated October 9, 1981, informing certain of these plaintiff-schools that they may not provide education to children of compulsory school age during hours of the day when such children would otherwise be attending public schools, absent approval by the Commissioner, and further advising that approval must be obtained in accordance with the rules adopted by the Department, copies of which had been previously provided.[15] The Commissioner further stated, "I ask you once again to submit the necessary information by completing the school approval application, by submitting the required information in some other format or by making arrangements for a visit by representatives of the Department." Finally, the Commissioner advised that legal action would be commenced against the schools after October 20, 1981, should the schools fail to comply.
The Commissioner did not expressly state that only those portions of the application form which deal with the five topics specified in the letter need be completed in order to qualify a school for approval. Previously the schools had been provided with copies of the rules governing approval and with copies of the application form. The October 9 letter again requested "the information necessary for [departmental] review and approval" pursuant to the application previously provided and the application form enclosed.[16] The addendum to the general *1224 rules, which prescribes procedural exceptions for private school approval, does not indicate that private sectarian schools need only submit information concerning the five areas identified in the Commissioner's letter.[17] Furthermore, the letter does not propose to obviate departmental review as a condition of approval, but describes the "minimum information" required for approval as consisting of certain "evidence." The Court does not consider that it has been made to appear on the present record that mere compliance with the demand for such "evidence," regardless of its probativeness, would result in school approval.
"A defendant cannot ordinarily moot a plaintiff's claim by voluntarily ceasing allegedly unlawful conduct." L. Tribe, American Constitutional Law § 3-14 at 66. See DeFunis v. Odegaard, 416 U.S. 312, 318, 94 S.Ct. 1704, 1706, 40 L.Ed.2d 164 (1974); Sanchez-Mariani v. Ellingwood, 691 F.2d 592 at 595-596 (1st Cir. 1982). The affidavits of the Commissioner, however well intentioned, do not moot plaintiffs' claims. In order to moot plaintiffs' claims in these respects, at least defendants must establish that they will not again seek the information sought at the time of the institution of the suit. See United States v. Phosphate Export Association, 393 U.S. 199, 203, 89 S.Ct. 361, 364, 21 L.Ed.2d 344 (1968).
Defendants are not entitled to summary judgment under Count II.
C. Due Process (Count III)
Count III alleges that the compulsory education laws "are impermissibly vague and overbroad and delegate legislative authority to administrative personnel wholly without statutory standards," in violation of the due process clause. Plaintiffs further claim that many of the regulations of the Department are ultra vires and that enforcement of the compulsory education laws would deprive plaintiffs of the use of the "educational enterprise to which they have devoted money and contributed personal services to help create and maintain."
1. Vagueness/Overbreadth.[18]
In a facial challenge to the overbreadth and vagueness of a law, a court's first *1225 task is to determine whether the enactment reaches a substantial amount of constitutionally protected conduct. If it does not, then the overbreadth challenge must fail. The court should then examine the facial vagueness challenge and, assuming the enactment implicates no constitutionally protected conduct, should uphold the challenge only if the enactment is impermissibly vague in all of its applications.
Village of Hoffman Estates v. Flipside, ___ U.S. ___, ___-___ n. 6, 102 S.Ct. 1186, 1191 n. 6, 71 L.Ed.2d 362 (1982). Once it is made to appear that the statutory challenge implicates constitutionally protected conduct, the Court will require a greater degree of statutory specificity than in nonconstitutional contexts. ___ U.S. at ___, 102 S.Ct. at 1193.
a. Overbreadth.
"The Supreme Court has emphasized that overbreadth facial challenges to the constitutionality of a state law should prevail only in rare circumstances." New England Accessories Trade v. City of Nashua, 679 F.2d 1, 4 (1st Cir.1982). "[T]he overbreadth doctrine is `strong medicine' and [courts] have employed it with hesitation and then `only as a last resort.'" New York v. Ferber, ___ U.S. ___, ___, 102 S.Ct. 3348, 3361, 73 L.Ed.2d 1113 (1982). The doctrine is predicated on the belief that persons whose conduct is constitutionally protected may refrain from exercising their rights for fear that to do so would constitute a violation of law, thus insulating the statute from constitutional challenge. See New York v. Ferber, ___ U.S. at ___, 102 S.Ct. at 3359-3361, citing Village of Schaumberg v. Citizens for a Better Environment, 444 U.S. 620, 634, 100 S.Ct. 826, 834, 63 L.Ed.2d 73 (1980). But before a statute may be invalidated on its face for overbreadth, even one which arguably touches such traditional forms of free expression as books and films, the overbreadth must be "substantial," that is, susceptible to "a substantial number of impermissible applications ...," id. ___ U.S. at ___, 102 S.Ct. at 3362.
It is conceivable that some of these regulations may inhibit the free exercise of constitutional rights, but the Court is not persuaded that the regulations reach "a substantial amount of constitutionally protected conduct," see Village of Hoffman Estates v. Flipside, 102 S.Ct. at 1191, n. 6, or that this is one of those rare occasions when the plaintiffs are entitled to mount an overbreadth challenge on the ground that the Maine compulsory education laws and regulations could be unconstitutionally applied to others. See New York v. Ferber, ___ U.S. at ___-___, 102 S.Ct. at 3359-3361 ["arguably impermissible applications" of statute forbidding distribution of material depicting a sexual performance by child, outweighed by its legitimate reach]. The arguably impermissible applications of the challenged compulsory education laws are relatively insignificant. Any actual overbreadth may "be cured through case-by-case analysis of the fact situations to which [the law's] sanctions, assertedly, may not be applied," Broadrick v. Oklahoma, 413 U.S. 601, 615-16, 93 S.Ct. 2908, 2917-2918, 37 L.Ed.2d 830 (1973). See also New England Accessories Trade v. City of Nashua, 679 F.2d at 5.
Summary judgment must be granted for the defendants on plaintiffs' claim of unconstitutional overbreadth.
b. Vagueness.
A challenge predicated on unconstitutional vagueness implicates dual principles of due process, requiring: (1) fair notice of the line between lawful and unlawful conduct; and (2) sufficiently explicit legislative limitations on the discretion of law enforcement officials to avoid arbitrary and discriminatory enforcement. Grayned v. City of Rockford, 408 U.S. 104, 108-09, 92 S.Ct. 2294, 2298-2299, 33 L.Ed.2d 222 (1972);[19]Papachristou v. City of Jacksonville, *1226 405 U.S. 156, 162, 92 S.Ct. 839, 843, 31 L.Ed.2d 110 (1972); United States v. Professional Air Traffic Controllers, 678 F.2d 1, 3 (1st Cir.1982). A statute may neither forbid nor require the doing of an act in terms so vague that persons "of common intelligence must necessarily guess at its meaning and differ as to its application." Connally v. General Construction Co., 269 U.S. 385, 391, 46 S.Ct. 126, 127, 70 L.Ed. 322 (1926); see also Zwickler v. Koota, 389 U.S. 241, 249, 88 S.Ct. 391, 396, 19 L.Ed.2d 444 (1967). A statute is unconstitutionally vague on its face if it is expressed in such general terms that "no standard of conduct is specified at all." Brache v. County of Westchester, 658 F.2d 47, 50-51 (2d Cir. 1981), quoting Coates v. City of Cincinnati, 402 U.S. 611, 614, 91 S.Ct. 1686, 1688, 29 L.Ed.2d 214 (1971). A facial vagueness challenge can only succeed when the statute "cannot validly be applied to any conduct." Id. at 50.
[W]hile legislatures "ordinarily may delegate power under broad standards ..., [the] area of permissible indefiniteness narrows ... when the regulation ... potentially affects fundamental rights," like those protected by the first amendment. And where a law authorizes a system of prior licensing, the Supreme Court has consistently required the statutory delegation to provide "narrowly drawn, reasonable and definite standards for the [administering] officials to follow...."
L. Tribe, American Constitutional Law § 12:35 at 732-33 (1978) (footnotes omitted). In Fantasy Book Shop, Inc. v. City of Boston, 652 F.2d 1115, 1123-24 (1st Cir. 1981), the First Circuit upheld three sections of a public amusement licensing statute which permitted denial of a license whenever issuance would (1) unreasonably increase pedestrian traffic; (2) increase the incidence of disruptive conduct; or (3) unreasonably increase the level of noise. These standards, while not identifying the dispositive levels of noise, traffic, or disruption, "describe[d] a behavioral effect of at least potential objective specificity," and apprised applicants of factors which would determine the licensing decision, id. at 1123. Nevertheless, the court found invalid on its face a city ordinance authorizing the denial of a license where the operation of the public amusement would "significantly harm[] the legitimate protectible interests of ... affected citizens of the city," id. The "public interest" standard was deemed defective because it "comprise[d] purely subjective evaluations of wholly unrestricted factors, and thus vest[ed] the denial of a license in the essentially unbridled discretion of a municipal administrator," id. at 1123, thereby imposing an unconstitutional standard "where a license is necessary for the exercise of [constitutionally] protected activity," id. at 1124. See also City of Biddeford v. Biddeford Teachers Association, Me., 304 A.2d 387, 400 (1973) [statutory standards must guide agency in following legislative policy and prevent administrative arbitrariness].
Plaintiffs challenge the requirement of 20 M.R.S.A. § 911.3 that students not attending public schools receive "equivalent instruction," by asking whether "equivalent" means measure-for-measure instructional equality; whether instructional equivalence is to be determined by reference to local public schools or to public schools in general; and whether overall instructional equivalence is to be determined *1227 by according due weight to any respect in which private school instruction is found to be superior to public school instruction.
Section 911.3(A) excuses children between the ages of 7 and 17 from the requirement that they attend a public day school, if the child "obtains equivalent instruction in a private school or in any other manner arranged for by the school committee or the board of directors and if the equivalent instruction is approved by the commissioner." Section 911.3(B) provides:
If any request to be excused is denied by a local school committee or board of directors, an appeal may be filed with the commissioner. The commissioner shall review the request to be excused to determine whether the local school committee or board of directors has been correct in its finding that no equivalent instruction is available. If the commissioner finds that equivalent instruction is available to the child, he shall approve the request to be excused.
20 M.R.S.A. § 911.3(B). Section 911.3 contemplates that exemption from the requirement of public school attendance is to be sought first through the local school committee or board of directors, which is to determine whether the proffered private instruction is equivalent to the public school instruction "available to the child." The local board determination is subject to review by the Commissioner.[20] Unless excused from public school attendance, a child may be considered an habitual truant after an absence of ten full days. 20 M.R.S.A. § 914.
A person having control of an habitual truant and primary responsibility for the truancy is subject to a civil forfeiture of $200. 20 M.R.S.A. § 911.8.
Although the Maine compulsory education scheme carries civil rather than criminal sanctions, clearly defined statutory standards are still required. Flipside v. Village of Hoffman Estates, 639 F.2d 373, 377-78 (7th Cir. 1981) [licensing laws and laws imposing civil sanctions must also provide minimum level of clarity]. But the term "equivalent," as used in section 911.3, is not so vague that persons of common intelligence would necessarily have to "guess at its meaning and differ as to its application." Connally v. General Construction Co., 269 U.S. 385, 391, 46 S.Ct. 126, 127, 70 L.Ed. 322 (1926). The term is not of such generality that "no standard of conduct is specified at all." See Coates v. City of Cincinnati, 402 U.S. 611, 614, 91 S.Ct. 1686, 1688, 29 L.Ed.2d 214 (1971). The term "equivalent instruction" is capable of objective measurement, cf. Fantasy Book Shop, Inc. v. City of Boston, 652 F.2d at 1123, and has "a core meaning that can reasonably be understood," cf. Brache v. County of Westchester, 658 F.2d at 51.
Although federal courts have no "power to construe and narrow state laws" in resolving a vagueness challenge, Grayned v. City of Rockford, 408 U.S. at 110, 92 S.Ct. at 2299, it appears highly likely that "equivalent instruction" would be interpreted as requiring private school instruction equal to that mandated by Maine law for public schools generally. Knox v. O'Brien, 7 N.J. Super. 608, 72 A.2d 389, 391 (1950) ["equal in worth or value, force, power, effect, import and the like"], quoting In re Bonsall's Estate, 288 Pa. 39, 135 A. 724, 725 (Sup.Ct. 1927); Stephens v. Bongart, 15 N.J.Misc. 80, 189 A. 131, 134 (1937) [instruction equal in value and effect to that given in a public school].
In Scoma v. Chicago Board of Education, 391 F.Supp. 452, 462-63 (N.D.Ill.1974), the court rejected a facial vagueness challenge to a statute exempting from compulsory public school attendance any child attending a private school teaching "the branches of education taught to children of corresponding age and grade in the public schools." The court held that the statutory reference to public schools "should cause no difficulty for citizens who desire to obey the statute." Id. at 463. See also Webster's *1228 Third New International Dictionary (1976), at 769.
Whatever vagueness may inhere in the term "equivalent" appears "reasonably necessary to embrace all of its legitimately intended objectives without creating an encyclopedic and unwieldy" statute. Fantasy Book Shop, Inc. v. City of Boston, 652 F.2d at 1123. It must be presumed that Maine courts "will give [the term] a limiting construction that will preserve its facial constitutionality," id., citing Erznoznik v. City of Jacksonville, 422 U.S. 205, 216, 95 S.Ct. 2268, 2276, 45 L.Ed.2d 125 (1975). See also Me. Atty. Gen. Report 1963-64, at 160, 162 [correspondence course unapproved by district directors and Commissioner is not the equivalent of school attendance].
Defendants are entitled to summary judgment on plaintiffs' facial vagueness challenge to the term "equivalent".
The vagueness challenge to the statutory and regulatory provisions authorizing the Commissioner to prescribe courses of study and to withdraw school approval "for cause" is more meritorious. 20 M.R.S.A. § 102.7; 05-071 CMR 125, §§ 1(D)(3) & 2(b)(2). The Commissioner is authorized to "prescribe the course of study" and to deny approval to schools which do not offer a course of study prescribed by the Commissioner. 20 M.R.S.A. § 102.7. Private schools founded after September 3, 1965 must furnish the Commissioner with a copy of their course of study. 20 M.R.S.A. § 102.7. Approval may be denied secondary schools unless their graduation requirements include American history, four years of English "and other courses approved by the Commissioner." See 05-071 CMR 125, at 3. Other provisions of law notwithstanding, the statute itself authorizes the Commissioner to withdraw approval "for cause." 20 M.R.S.A. § 102.7. Neither the compulsory education statutes nor the regulations define "cause," except that it is provided by Board regulation that "cause" includes, "but is not limited to, the failure ... to provide the minimum course of study ... and the failure ... to file a course of study, or notice of changes in the course of study or related reports as required by the Commissioner." 05-071 CMR 127, at 10. See Historic Green Springs, Inc. v. Bergland, 497 F.Supp. 839, 854 (E.D.Va. 1980) [due process requires administrators to structure and confine their discretionary powers by means of safeguards, standards, principles, and rules]. A school which is denied approval may request a board of review, appointed in part by the Commissioner, but the recommendations of the board of review are subject to the final approval of the Commissioner. "If the school fails to comply [with requirements] and does not take necessary remedial action, the commissioner may remove basic approval." 20 M.R.S.A. § 102.7.
Even private organizations which accredit educational institutions have been required to maintain reasonable standards and to apply them with an even hand. See Marjorie Webster Jr. College v. Middle States Ass'n of Colleges & Secondary Schools, Inc., 432 F.2d 650, 655-659 (D.C. Cir.1970), cert. denied, 400 U.S. 965, 91 S.Ct. 367, 27 L.Ed.2d 384 (1970); Rockland Institute v. Ass'n of Independent Colleges, 412 F.Supp. 1015, 1018 (C.D.Calif.1976); Parsons College v. North Central Ass'n of Colleges & Secondary Schools, 271 F.Supp. 65, 73 (N.D.Ill.1967).
Since 20 M.R.S.A. § 102.7 has the potential of affecting the first amendment rights of these plaintiffs and the school approval statute and regulations establish a state licensing scheme, the vagueness doctrine demands narrowly drawn, definite and reasonable standards for the guidance of the administering officials.
Accordingly, defendants' motion for summary judgment must be denied.
2. Ultra Vires Regulations.
"Where a statute specifically delegates to an administrative agency the power to make rules, courts recognize a presumption that such rules, when duly noticed, are valid." United States v. Boyd, 491 F.2d 1163, 1167 (9th Cir.1973). See E.I. duPont de Nemours & Co. v. Collins, 432 *1229 U.S. 46, 53-55, 97 S.Ct. 2229, 2233-2234, 53 L.Ed.2d 100 (1977); Mourning v. Family Publications Service, Inc., 411 U.S. 356, 369, 93 S.Ct. 1652, 1660, 36 L.Ed.2d 318 (1973); Red Lion Broadcasting Co. v. F.C.C., 395 U.S. 367, 379-81, 89 S.Ct. 1794, 1800-1801, 23 L.Ed.2d 371 (1969); Ciampa v. Schweiker, 511 F.Supp. 670, 677 (D.Mass.1981). The presumption is rebuttable on "a showing that the challenged regulation is an unreasonable exercise of the delegated power i.e. inconsistent with the statute." Id. See Commissioner v. Acker, 361 U.S. 87, 90-92, 80 S.Ct. 144, 146-147, 4 L.Ed.2d 127 (1959); United States v. Calamaro, 354 U.S. 351, 358-59, 77 S.Ct. 1138, 1143, 1 L.Ed.2d 1394 (1957). Courts "must reject administrative constructions of [a] statute, whether reached by adjudication or by rule-making, that are inconsistent with the statutory mandate or that frustrate ... [legislative] policy...." F.E.C. v. Democratic Senatorial Campaign Committee, 454 U.S. 27, 32, 102 S.Ct. 38, 42, 70 L.Ed.2d 23 (1981). See Mohasco Corp. v. Silver, 447 U.S. 807, 825, 100 S.Ct. 2486, 2496, 65 L.Ed.2d 532 (1980); United States v. Larionoff, 431 U.S. 864, 873, 97 S.Ct. 2150, 2156, 53 L.Ed.2d 48 (1977); Ernst & Ernst v. Hochfelder, 425 U.S. 185, 96 S.Ct. 1375, 47 L.Ed.2d 668 (1976); Theriault v. Brennan, 488 F.Supp. 286, 299 (D.Me.1980), aff'd. 641 F.2d 28 (1st Cir.1981).
The challenged regulations governing school evaluation and approval, codified at 05-071 CMR 125,[21] were adopted pursuant to 20 M.R.S.A. § 51 "to assure that Maine school children [receive] protection against unsafe facilities, inadequate curriculum and unprepared teachers." 05-071 CMR 125, at 9. The Board is empowered and directed to "establish requirements for approval and accreditation of elementary and secondary schools" and to "establish standards for certification of teachers and other professional personnel." 20 M.R.S.A. § 51(3)(B) (as amended by 1981 Me.Laws c. 464, § 2). The Board is required to fulfill its administrative responsibilities in accordance with 20 M.R.S.A. § 21, which man-dates the promulgation of administrative rules and regulations pursuant to the Maine Administrative Procedures Act, 5 M.R.S.A. § 8051, et seq. The Commissioner is authorized to "prescribe the studies to be taught ... in private schools approved for attendance ... purposes ... and the course of study prescribed by the commissioner shall be followed in ... all private schools approved by the said Commissioner." 20 M.R. S.A. § 102.7. See also 20 M.R.S.A. § 1286.
Most of the challenged administrative regulations cannot be considered ultra vires. The unrebutted affidavit of the Commissioner asserts that the Department requires this information in order to assess "whether the minimum curricula are being taught in the context of a course of study reasonably *1230 adequate for educational purposes" and that "[t]he adequacy of the total educational program is determined by assessing whether it is a planned and sequential program and whether it may reasonably be anticipated to accomplish the school's own stated educational goals." Second Supplemental Affidavit of Commissioner Raynolds, Jr., at 9. The affidavit further states that the adequacy of a course of study cannot be evaluated in a vacuum and that all of the requested information is relevant for that purpose. Id. The administrative power to require the information flows from the duty to establish school approval standards, imposed upon the Commissioner by the Legislature. The promulgation of administrative regulations requiring information as to the educational philosophy, goals, and course of study of applicant schools represents a reasonable exercise of the power delegated to the Board by 20 M.R.S.A. § 51.
The regulations requiring that applicant schools state their financial position and policies and their tuition refund policies enable the gathering of information "sought because of its relevance to school-municipal relations, where a private school receives public tuition payments" and, in addition, "as a general indicator of the school's economic stability." Second Supplemental Affidavit of Commissioner Raynolds, at 13. These regulations are consistent with the legislative mandate and represent a reasonable exercise by the Board in furtherance of its administrative duty to establish school approval standards.[22]
The Board is authorized by statute, 20 M.R.S.A. § 51.3(B), to promulgate the same elementary-school approval standards as to teacher certification and pupil-teacher ratio as are imposed upon secondary schools by statute, see 20 M.R.S.A. § 1281. The fact that the approval standards for secondary schools are prescribed by statute does not preclude the Board from adopting like administrative requirements for the approval of elementary schools. The certification requirement and the 30:1 pupil-teacher ratio are consistent with and tend to effectuate the legislative goals of compulsory education by assuring that all Maine children receive adequate instruction.
The defendants are entitled to summary judgment on each of plaintiffs' ultra vires challenges, except that relating to the regulatory prohibition against the operation of unapproved schools.
The Commissioner asserts by affidavit that the regulatory requirement of school approval prior to the commencement of operations represents an "administrative interpretation and implementation of the approval requirement stated in 20 M.R.S.A. § 911.3 and the truancy prohibition of 20 M.R.S.A. § 911," Second Supplemental Affidavit of Commissioner Raynolds, at 3, and that it furthers the compulsory education scheme by assuring that private school students will obtain sufficient instruction from the outset of their attendance and that their education will not be interrupted in the event that a departmental review undertaken after the commencement of school operations should necessitate denial of approval, id. The requirement that an application for initial approval be filed nine months in advance of the opening of the school is said to be necessary to afford the Department and health and safety officials sufficient time to review school facilities and proposed programs, and to discuss and correct perceived deficiencies prior to student attendance. Id.
The promulgation of the regulations requiring prior written approval may have exceeded the power delegated to the Board *1231 by the Legislature. These regulations prescribe administrative sanctions for the enforcement of the compulsory education laws which differ materially from the enforcement sanctions selected by the Legislature.
The Maine Legislature has mandated that a child who is absent from school, without excuse, for the equivalent of 10 full days or for one-half day on seven consecutive school days within any 6-month period is "an habitual truant." 20 M.R.S.A. § 914. Any person who has control of an habitual truant and bears primary responsibility for the truancy is guilty of "a civil violation for which a forfeiture of not more than $200 shall be adjudged." 20 M.R.S.A. § 911.8. "Any person who induces a child to absent himself from school, or harbors or conceals such child when he is absent commits a civil violation for which a forfeiture of not less than $500 shall be adjudged." Id.
Local school authorities are responsible for the implementation of the truancy laws and are directed, under the guidance of the Commissioner, to "promulgate reasonable rules and regulations," 20 M.R.S.A. § 911.5, for local enforcement of the truancy laws. See 20 M.R.S.A. § 911.6-A. If unable to resolve an habitual truancy the local school superintendent must refer the matter to the local school committee or board of directors, 20 M.R.S.A. § 911.6-A(A), which must hear the matter, after providing the parents or guardian at least seven days' written notice of the hearing, its purpose, the necessity of their and their child's presence, and their right to inspect their child's records and the principal's report. 20 M.R.S.A. § 911.6-A(C) & (D). Information presented to the committee or board "shall include, but not be limited to, the report presented by the principal to the superintendent of schools." 20 M.R.S.A. § 911.6-A(B). "After considering the facts presented and after discussing the matter with the child and his parents or guardian," the committee or board
shall determine by a majority vote to:
. . . . .
A. Instruct the child to attend school as required by statute and inform the parents or the guardian of their legal responsibilities to assure the child's attendance; or
B. Waive the compulsory school attendance law provided the child is at least 14 years old;
(1) The parents or guardian may appeal this decision to the commissioner, who shall appoint a fair hearing officer to hear the appeal;
(2) The fair hearing officer shall make a report to the commissioner on the testimony presented at the hearing and shall make a recommendation to the commissioner as to the disposition of the appeal; and
(3) The commissioner shall review the report and recommendation of the fair hearing officer and shall affirm, modify or reverse the decision of the local school committee or board of directors.
20 M.R.S.A. § 911.7. Compulsory school age students not attending approved schools are considered truants and their parents and others who induce truancy are subject to civil forfeitures.
The Commissioner states, by way of affidavit, that he has discouraged local officials from undertaking truancy enforcement actions because parents may be sending their children to unapproved schools "in the good faith belief [that their children] ... are receiving the benefits and protections of the state's compulsory education laws." Second Supplementary Affidavit of Commissioner Raynolds, at 4. The Commissioner represents that truancy actions conducted on a broad scale would be "unduly burdensome" and expensive for local school officials, the Department, and the courts, id. at 5, and would neither prevent the operation of unapproved schools nor satisfy "[t]he Department's duty to review and approve schools, according to a systematic administrative process and general standards." Id.
These regulations may have transformed the scheme selected by the Legislature for the enforcement of the compulsory education laws, i.e., the truancy laws, into an unauthorized administrative system for the *1232 licensing of private schools. It has not been made to appear that the Maine Legislature has either mandated or authorized the administrative closing of unapproved private schools operating with compulsory school age children in attendance. On the present record it would appear that the Legislature has opted in favor of implementing its scheme of compulsory education by requiring the initiation, at the local level, of the statutory procedures and sanctions prescribed for truancy.
A regulation "fundamentally at odds with the manifest [legislative] design" cannot be sustained "simply because it is not `technically inconsistent' with the statutory language." United States v. Vogel Fertilizer Co., 455 U.S. 16, ___, 102 S.Ct. 821, 827, 70 L.Ed.2d 792 (1982). See Pacific Gas & Elec. Co. v. United States, 664 F.2d 1133, 1136 (9th Cir. 1981) [I.R.S. regulation held erroneous and invalid]. Considering the stringent legislative restrictions which must be placed on administrative agencies and officials delegated the power to grant or deny licenses, see Kunz v. New York, 340 U.S. 290, 294, 71 S.Ct. 312, 315, 95 L.Ed. 280 (1951); Cantwell v. Connecticut, 310 U.S. 296, 307, 60 S.Ct. 900, 904, 84 L.Ed. 1213 (1940), the argument that administrative convenience warrants the licensing and closing of private schools provides an insufficient basis for summary judgment on this constitutional claim.
III
SUMMARY
Partial summary judgment in favor of defendants shall enter on: (1) the overbreadth challenge; (2) the facial vagueness challenge to the regulatory requirement of "equivalent instruction"; (3) the ultra vires challenge to the regulatory requirement of information concerning school philosophy and financial information; and (4) the ultra vires challenge to the regulatory requirement of teacher certification and pupil-teacher ratio in elementary schools.
In all other respects the motion for summary judgment must be denied.
SO ORDERED.
APPENDIX
A. Approval Procedures
Chapter 125, section 1 of the regulations of the Board of Education sets out the procedures and standards required to establish and maintain an elementary or secondary school. See School Evaluation Procedures, 05-071 CMR 125, attached as Exhibit C to Defendants' Supplementary Memorandum in Support of Motion for Summary Judgment. These rules were modified in September, 1981 in regard to private schools seeking basic approval. See "Addendum: Nonpublic Schools Approved for Attendance Purposes Only," attached as Exhibit 7 to the Supplemental Affidavit of Harold Raynolds, Jr.
1. Initial Approval.
The regulations, as modified, prescribe the following procedures for securing initial school approval:
a. Application forms, obtained from the Department of Educational and Cultural Services, must be submitted to the Department at least nine months before the planned opening day of school, unless the advance filing requirement is waived or modified on request.
b. The application must include:
i. a statement of school educational philosophy, goals and objectives and a plan for the accomplishment of those goals and objectives;
ii. a plan indicating the method and procedures to be used in measuring and evaluating the degree of attainment of educational goals, and a plan for recording and reporting pupil progress;
iii. a detailed description of school programs of instruction, including specific attention to the course of study and the language of instruction;
iv. a description of the amounts and varieties of instructional equipment and supplies available for pupil use; and
v. the names of individuals or groups responsible for school policy and the *1233 name and address of the administrative head of the proposed school.
c. The applicant must submit the following additional information to the Department three months prior to the projected opening of school:
i. a copy of any certificate of incorporation;
ii. a statement of financial position and policies;
iii. a statement of the tuition refund policy;
iv. a list of the names, addresses and social security numbers of the certified teachers to be employed; and
v. evidence that all adult employees are "tubercular free."
d. The applicant must request facility inspection by the State Fire Marshal's office and by the Sanitary Engineering Division of the State Department of Human Services at least three months prior to opening. The sanitation inspection must extend to all food preparation facilities and demonstrate a clean and healthful environment. A licensed plumbing inspector may provide the requisite approval of school facilities in relation to the State Plumbing Code.
e. After notice of facility approval regarding sanitation and fire safety, the applicant must request inspection of its facilities, curriculum and staff by the Department and supply all information necessary to determine whether it has met Department standards, after which it is entitled to a prompt decision by the Commissioner. A school may not operate until it obtains written approval from the Department.
f. Secondary school approval requires a showing that the school has "a graded or sequential educational program of at least two years length ... available to each student", and a statement of the graduation requirements, including American history, four years of English and "other courses approved by the Commissioner."
g. Within 30 days of the receipt of notice that the Department intends to withhold approval, the school may "request a board of review." The board of review, consisting of one person appointed by the Commissioner, one by the school, and a third chosen by the other two, makes a recommendation to the Commissioner, whose decision "shall be final."
2. Maintaining Approval.
The regulations in subsection B, section 1, chapter 125 establish standards for maintaining school approval, including requirements that:
a. all teachers hold a valid Maine Teaching Certificate at the appropriate level, except teachers "of religion, theology, religious philosophy or similar courses in non-public schools" and ordained ministers functioning as headmaster or directors of sectarian schools;
b. pupil-teacher ratios not exceed 30 to 1 and that normal class size not exceed 30 pupils;
c. all children in grades K-12 be immunized against common childhood diseases, exemptions available on an individual basis by written parental request;
d. new staff prove that they are tubercular free;
e. the history, geography and natural and industrial resources of Maine be taught in at least one grade after 6th grade;
f. buildings be safe, hygienic, approved by the Department of Public Safety and by the Department of Human Services, and provide a physical environment acceptable to the Department;
g. new school construction meet the standards of the Division of School Facilities in accordance with existing statutes and with Board procedures;
h. the school year consist of at least 180 days, no more than 5 days to be devoted to in-service teacher education;
i. the total instructional time in a school week (normally Monday through Friday) equal at least 25 hours and not less than 3 hours in any one day;
j. the school safely maintain a daily register of student attendance and other student records, and record student accomplishment *1234 at least quarterly, forwarding such records upon student transfers; and
k. schools complete and submit to the Department "reports deemed necessary by the Commissioner."
The regulations further require that schools, once approved, must notify the Department of "any substantive changes in [their] program of studies, facilities, certified teaching staff, number of pupils, [or] administration." Private schools must file a roster, containing the name and residence of each pupil in attendance, with the public school superintendent of the school administrative unit within which the pupil resides, and must provide notification upon the withdrawal of any pupil from the private school. Private schools are required to "provide assurance" that the record of each pupil will be transferred to the appropriate public school superintendent in the event that the private school is closed. Finally, private schools are required to provide the parents of their pupils "a statement indicating the school entrance age requirements for entering public schools of the State of Maine."
Subsections C and D of chapter 125, section 1, prescribe the time periods for which approval may be granted. Newly established schools may not operate without the prior written approval of the Commissioner.[1] Annual approval is required for each of the first five years of operation. During the fifth year of operation, unless the school otherwise requests, a "self-evaluation study" must be conducted by the school, addressing its present needs and long-term goals, "using the instrument (sic) and procedures designed by the Department...." Within three months after the completion of its study, the school must file with the Department a five-year plan regarding its facilities, curriculum and staff development. A school which has been continuously approved by the Commissioner for five years and completes the "futures planning process" receives a five-year approval certificate. A school which opts to omit the self-evaluation study and five-year plan must submit an annual report to the Department[2] and its certificate of approval must be renewed annually.
Secondary schools which participate in an accreditation program under the direction of the New England Association of Schools and Colleges (NEASC) need not conduct self-evaluation studies, but "must file a report indicating short- and long-range goals directing attention to facilities, curriculum and staff development." See 05-071 CMR 125, at 8. If such a school obtains NEASC accreditation, it will be granted approval by the Commissioner for a period commensurate with its accreditation. See 05-071, CMR 127, at 10.
Notwithstanding any other section of law, the Commissioner may remove basic approval from any school for cause. Whenever a school fails to meet requirements, the Commissioner shall give due notice and shall hold a hearing. If the school fails to comply and does not take necessary remedial action, the Commissioner may remove basic approval.
The Commissioner may waive any approval requirement, provided a written request is made by the school documenting the existence of extenuating circumstances warranting waiver in the interests of the state and of the pupils.
B. Course Requirements
In addition to the requirements of chapter 125 of the Board regulations, schools seeking state approval for purposes of the compulsory education laws must comply with the requirements of chapter 127, relating to the "course of study." The instructional requirements for the basic approval of nonpublic schools, codified at section *1235 2(A), 05-071 CMR 127, direct that the school:
1. teach in English (with certain exceptions);
2. instruct all students (grades one through eight) in reading, grammar, spelling, composition, and communications skills;[3]
3. provide four years of high school English, including instruction in grammar, spelling, composition, literature, and communications skills;
4. provide mathematics instruction in grades one through eight, including instruction in mathematical concepts, the metric system, computation skills, measurement skills, and problem-solving skills;[4]
5. provide at least one year of high school mathematics;
6. provide at least one year of instruction in American history and civil government, for grades one through nine, including the U.S. Constitution, the Declaration of Independence, voting and citizenship;
7. require students in grades seven through twelve to take at least one year of instruction in history, geography, and the natural and industrial resources of Maine;
8. require science instruction in grades one through eight and at least one year of science instruction in high school;
9. provide physical education to all students in grades one through twelve, in a program "appropriately adapted to the physical facilities available to the school;" and
10. provide at least one-half hour of instruction weekly "in correlation with appropriate components of the school curriculum[,] in the great principles of humanity as intended by 20 M.R.S.A. § 1221."
Elementary schools are required by chapter 127 to provide a planned, sequential program for the elementary grades, including the basic course requirements described above. Secondary schools must provide instructional programs for at least two grade levels, including the basic course of study described above, and prescribe additional requirements for graduation. Graduation requires a minimum of 16 units of instruction, based on the Carnegie unit or an equivalent measure. Graduation requirements must "be published and made known to all students upon entry into high school." Schools must report to the Commissioner, in their annual reports or by other timely means, all changes in their courses of study, including their graduation requirements.
Section 2(B) of chapter 127 directs that "[n]o nonpublic school shall operate for purposes of the compulsory education law without the prior review and approval of the Commissioner ... of its course of study." A certificate of basic school approval signifies that the school offers "equivalent instruction" for purposes of 20 M.R.S.A. § 911(3). "Basic approval of a school's course of study may be removed by the Commissioner for cause," including, "but not limited to, the failure to provide the minimum course of study required by law and regulation, and the failure ... to file ... a course of study, or [to provide] notice of changes in the course of study or related reports as required by the Commissioner."
Where it is believed that school officials have failed to provide the course of study requirements specified by this rule and applicable statutes, or school officials fail to provide information sufficient to demonstrate compliance with course of study requirements, the Commissioner shall give due notice of probable removal of basic approval and schedule a hearing on the matter pursuant to the requirements of the Administrative Procedure Act. The hearing may also consider allegations that the school has failed to comply with (1) any other requirement of basic school approval, as defined by the *1236 State Board of Education in Chapter 125, or (2) specific statutory requirements.
05-071 CMR 127, at 11.
C. Teacher Certification Requirements
The teacher certification requirements contemplate "a bachelor's degree with two years of liberal education, appropriate subject matter concentration, professional knowledge and supervised teaching experience." See 05-071 CMR 115, Introduction.
An elementary school teacher must either have graduated "from a four-year baccalaureate program approved for the education of elementary teachers, together with the formal recommendation of the preparing institution" or (1) a bachelor's degree from an accredited institution; (2) at least 50% of all undergraduate study in liberal education courses; and (3) "thirty hours of approved general professional education courses," at least six of which must provide teaching experience.[5] Teacher certification must be renewed every five years; "six hours of approved study" is a prerequisite to renewal.
A secondary school teacher can obtain certification either by graduating from a four-year baccalaureate program approved for the education of secondary school teachers and by obtaining the formal recommendation of the preparing institution, or by making a satisfactory showing that he or she has: (1) a bachelor's degree from an accredited institution; (2) devoted at least one-half of all undergraduate studies to courses in liberal education; and (3) an established teaching field[6] and at least 18 hours of approved general professional teaching courses. Secondary school teachers must also complete six hours of approved study every five years to obtain renewal of their certification.
NOTES
[1] On April 15, 1982 the Maine Legislature repealed the education laws codified in title 20, Maine Revised Statutes Annotated, and enacted title 20-A, effective July 1, 1983. See 1982 Me.Legis.Serv. No. 4, Laws 1982, c. 693.
Part 2, chapter 117, subchapter I of the new education laws sets out the approval requirements and procedures applicable to private schools. The five sections of the subchapter read as follows:
§ 2901. Requirement for basic school approval
A private school may operate as an approved private school for meeting the requirement of compulsory school attendance under section 5001 if it:
1. Hygiene, health, safety. Meets the standards for hygiene, health and safety under Titles 22 and 25; and
2. Is either:
A. Currently accredited by the New England Association of Colleges and Secondary Schools; or
B. Meets the department's requirements for approval for attendance purposes under section 2902.
§ 2902. State requirements
Private schools approved for attendance purposes by the department shall:
1. Immunization. Comply with the immunization provisions under section 6351;
2. Language of instruction. Use English as the language of instruction except as specified under section 4602;
3. Courses required by statute. Provide instruction in history as specified under section 4601, subsection 1 and English as specified in section 4601, subsection 2;
4. Commissioner's basic curriculum. Provide instruction in the basic curriculum established by rule by the commissioner under section 4601, subsection 4;
5. Certified teachers. Employ only certified teachers;
6. Secondary schools. For private secondary schools:
A. Meet the requirements of a minimum school year under section 4801;
B. Provide a school day of sufficient length to allow for the operation of its approved education program;
C. Have a student-teacher ratio of not more than 30 to one;
D. Include not less than 2 consecutive grades from 9 to 12; and
E. Maintain adequate, safety (sic) protected records; and
7. State board rules. Meet the requirements applicable to the approval of private schools for attendance purposes established by the state board pursuant to section 405, subsection 3, paragraph E.
§ 2903. Governing body requirements
Nothing in this subchapter shall restrict the authority of the governing body of a private school to require additional subjects to be taught in their school.
§ 2904. Removal of basic approval
1. Commissioner may remove basic approval. Notwithstanding any other provision of law, the commissioner may remove basic approval from any private school for failure to meet applicable approval requirements.
2. Procedural requirements. Whenever a school fails to meet these requirements the commissioner shall:
A. Give due notice; and
B. Hold a hearing.
3. Hearing. The hearing on removal of basic approval shall be in accordance with the applicable provisions of the Maine Administrative Procedure Act, Title 5, chapter 375 and rules of the state board adopted pursuant to section 405, subsection 3, paragraph E.
§ 2905. Nonrenewal of basic approval
The decision of the commissioner on nonrenewal of basic approval of any school applying for renewal shall be in accordance with the Maine Administrative Procedure Act, Title 5, chapter 375 and rules adopted by the State Board of Education under section 405, subsection 3, paragraph E.
The provisions regarding course requirements referred to in § 2902 are as follows:
§ 4601. Basic curriculum
1. Required courses in American and Maine history. The following courses shall be required.
A. American history and civil government, including the Constitution of the United States, the Declaration of Independence, the importance of voting and the privileges and responsibilities of citizenship, shall be taught in and [be] required for graduation from all elementary and secondary schools both public and private.
B. A course in the history [of Maine], including the Constitution of Maine, Maine geography and the natural and industrial resources of Maine[,] shall be taught in at least one grade from grade 7 to grade 12, in all schools, both public and private.
2. English. Four years of English shall be required for graduation from a secondary school. ....
4. Courses prescribed by the commissioner. The commissioner shall prescribe by rule the basic curriculum to be taught in public schools.
The minimum school year requirements referred to in § 2902(6)(A) are as follows:
§ 4801. School days
The following provisions shall apply to school days.
1. Number. A school administrative unit shall make provision for the maintenance of all of its schools for at least 180 days a year. At least 175 days shall be used for instruction. In meeting the requirement of a 180-day school year, no more than 5 days may be used for in-service education of teachers, administrative meetings, parent-teacher conferences, records' days and similar activities.
A. The commissioner may reduce or waive the minimum number of days required on application from a school board. The application must be supported in writing with a statement of the reasons for the request.
Section 405(3)(E) of the new law, referred to in § 2902(7), reposes in the State Board of Education [Board] the power and duty to "[a]dopt or amend rules on requirements for approval and accreditation of elementary and secondary schools."
[2] Exceptions to this requirement are found in 20 M.R.S.A. § 911.1.A.
[3] 20 M.R.S.A. § 102.7 (Supp.1981). Section 102.7 further provides:
American history and civil government, including the Constitution of the United States and the Declaration of Independence, the importance of voting and the privileges and responsibilities of citizenship, shall be taught in all schools of elementary and secondary grades, both public and private, and American history and civil government shall be required for graduation from all elementary schools, both public and private ...; [a] course in history, geography and the natural and industrial resources of Maine shall be taught in at least one grade from 7 to 12, in all school systems, both public and private.
The officers in charge of a private school founded after September 3, 1965 shall furnish the commissioner with a copy of the course of study arranged by said officers.
....
Notwithstanding any other section of law, the commissioner may remove basic approval from any school for cause. Whenever a school fails to meet requirements, the commissioner shall give due notice and shall hold a hearing. If the school fails to comply and does not take necessary remedial action, the commissioner may remove basic approval.
20 M.R.S.A. § 102.7 (Supp.1981).
[4] § 1281. Requirements
The secondary schools of this State shall be evaluated for basic approval and may be evaluated for accreditation. No school shall be given basic approval for attendance, tuition or subsidy purpose (sic) within this Title unless it meets the following requirements:
1. Course of study approved. It maintains a course of study approved by the commissioner. [20 M.R.S.A. § 1281(1) (1964)].
2. Length of school day. It has a school day of sufficient length to allow the operation of its educational program as approved by the commissioner.
3. Minimum school year. It has a minimum school year of 180 school days, of which not less than 175 shall be actual school days and no more than 5 may be devoted to in-service education of teachers, administrative meetings, parent-teacher conferences, record days and other such teacher work activities. The State Board of Education shall have the right to reduce or waive the minimum number of days required upon application from any school committee, board of directors or board of trustees of any academy in the State, such application to be supported in writing with a statement of the reasons for such request.
4. Certified teachers. It employs only certified teachers.
5. Pupil-teacher ratio. It has a pupil-teacher ratio of not more than 30 to one. [20 M.R. S.A. § 1281(5) (1964)].
6. Hygienic facilities and equipment. It has safe and hygienic facilities, adequate equipment and supplies, all of which comply with the regulations established by the Department of Human Services and the Department of Educational and Cultural Services.
7. Consecutive grades. It is organized to include not less than 2 consecutive grades from 9 to 12.
8. Requirements for graduation. The requirements for graduation shall include American history and 4 years of English in a planned program approved by the Commissioner of Education. Notwithstanding the foregoing, a student who has satisfactorily completed the freshman year in a degree-granting institution may receive a secondary school diploma from the school he last attended.
9. Records. It has adequate, safely protected records. [20 M.R.S.A. § 1281(9) (1964)].
10. Size. Any public school enrolling fewer than 100 pupils may be approved by the State Board of Education on an emergency or continuing basis only after the school committee or board of directors have (sic) presented in detail reasons for such emergency or continuing approval. Any such school which is adjudged by the board to be geographically isolated shall receive the board's approval for a 6-year period subject to the right of the board to terminate its approval, on the ground of size, only if the school receives at least 5-years' notice of such termination, and subject also to the satisfactory meeting in every case of the other requirements of this section.
20 M.R.S.A. § 1281 (Supp.1981).
[5] The amended complaint also alleges that 20 M.R.S.A. § 1286 interferes with "the religious mission of the [plaintiff] churches." The challenge to § 1286 does not, however, pose any additional or different issues not raised by the challenge to § 1281.1.
[6] The amended complaint alleges that "... plaintiff Churches employ teachers in their schools who, while proficient instructors ..., do not hold Maine State teaching certificates."
[7] The amended complaint challenges the requirement of 20 M.R.S.A. § 1281.10 as to school size. But that subsection is applicable to public schools only.
[8] At oral argument on the pending motion for summary judgment, counsel represented that plaintiffs do not challenge and will comply (or have complied) with the requirements relating to fire, safety, health, and sanitation. In so doing, however, plaintiffs concede no right on the part of the Department or the Commissioner to condition prior approval of their church-schools upon compliance with these standards.
[9] The State Board of Education is organized within the Department of Education and Cultural Services. 20 M.R.S.A. § 1-A.
[10] See L. Tribe, American Constitutional Law § 14-10, at 851 (1978); Note, Religious Exemptions Under the Free Exercise Clause: A Model of Competing Authorities, 90 Yale L.J. 350, 354 (1980); Pheffer, The Supremacy of Free Exercise, 61 Geo.L.J. 1115, 1139 (1973).
[11] Sherbert v. Verner, supra, involved a Seventh-Day Adventist who was fired by her employer for refusing to work on her Sabbath and was denied unemployment compensation. The Supreme Court held that the denial of unemployment compensation placed a burden on the exercise of plaintiff's religion, disproportionate to any state interest in avoiding "fraudulent claims of unscrupulous claimants feigning religious objections to Saturday work." 374 U.S. at 407, 83 S.Ct. at 1795.
[12] In Kennedy v. Meacham, 540 F.2d 1057, 1061 (10th Cir.1976), the Sixth Circuit decided that the dismissal of a complaint brought by prison inmates alleging unconstitutional restrictions on the free exercise of their satanic religion was improper, since the state neither established that no religion was involved nor that any burdens on its free exercise were warranted by a compelling state interest in the regulation of prison affairs.
We do not say that a hearing is required in every instance. A well-developed showing by affidavits, exhibits, regulations and the responses to them might demonstrate, without factual dispute, such limited actions by defendants and such a justification for them as to obviate the need for an evidentiary hearing. In such a case the defendants would, of course, have to carry the heavy burden of justifying a summary judgment. See United States v. Diebold, 369 U.S. 654, 655, 82 S.Ct. 993 [994], 8 L.Ed.2d 176; Webb v. Allstate Life Insurance Co., 536 F.2d 336, 340 (10th Cir.); Mustang Fuel Corp. v. Youngstown Sheet & Tube Co., 516 F.2d 33, 36 (10th Cir.).
Id. at 1061 n. 3. See also Hoggro v. Pontesso, 456 F.2d 917 (10th Cir.1972) [dismissal of inmate complaint alleging interference with free exercise of religion, held improper absent showing that state interest in prison discipline outweighed free exercise rights].
[13] The constitutional rights of others may be asserted by one whose compliance with a legal duty would deny others their constitutional rights. See Craig v. Boren, 429 U.S. 190, 195, 97 S.Ct. 451, 455, 50 L.Ed.2d 397 (1976); Carey v. Population Services International, 431 U.S. 678, 97 S.Ct. 2010, 52 L.Ed.2d 675 (1977).
[14] A simple comparison of the Maine and Nebraska regulatory schemes demonstrates that the constitutional questions raised in Faith Baptist cannot with certainty be considered the same as the constitutional issues here presented.
The Nebraska regulations prescribed a required curriculum, necessary materials and equipment, the length of the school day and year, health and safety requirements, the filing of a "Fall Approval Report" and an "Annual Term Summary Report," and the requirement that all professional staff members hold a valid Nebraska certificate or permit which, "[g]enerally speaking," meant that teachers must hold a baccalaureate degree. See State v. Faith Baptist Church, 301 N.W.2d at 573, 575. Nebraska law also required inspection and approval of schools before operation. See id. at 574. The Nebraska curriculum requirements were "very minimal in nature," id. at 579, and the state did not prescribe a course of study, id. at 580.
The Maine statutes and regulations require, inter alia, submission to the state of: (1) a statement of school educational philosophy, goals, and objectives and a plan for their implementation; (2) a description of grading methods and procedures; (3) a statement of the school's financial position and policies; and (4) a statement of the school's tuition refund policy. Schools are required to maintain a pupil-teacher ratio not exceeding 30 to 1 and a physical environment "acceptable to the Department of Educational and Cultural Services." Private schools must provide parents with a statement of Maine's school-entrance age requirements. The Maine regulations contain elaborate curriculum requirements and permit withdrawal of approval of a course of study "for cause." Teacher certification regulations in Maine require a baccalaureate degree, with two years of liberal education, appropriate subject matter concentration, professional knowledge, and supervised teaching experience. See 05-071 CMR Ch. 115, Introduction.
[15] The letter states that the minimum information required for approval is evidence that the school:
1. has been inspected by the Department of Human Services for compliance with state health and sanitation standards;
2. has been inspected by the Fire Marshal for compliance with the Life Safety Code;
3. offers a course of study meeting the minimum curriculum requirements;
4. has an instructional staff which is either certified or qualified for certification; and
5. maintains and safeguards adequate attendance, health and academic records.
The Commissioner directed that such information be supplied pursuant to the application form enclosed with the October 9, 1981 letter. The Commissioner offered to accommodate any concerns about completing the application and to expedite reviews by making Department representatives available to visit the schools, observe operations, and inspect records "as an alternative to the completion of the forms."
[16] The Attorney General of the State of Maine advised plaintiffs' counsel on October 8, 1981, in response to their request for an interpretation of the school approval laws, that their concerns could "be answered by the enclosed materials: the school-approval regulations (with explanatory addendum for sectarian schools), the new minimum curriculum rule, and the application for school approval." See Exhibit E attached to Plaintiffs' Supplemental Memorandum, filed March 24, 1982.
[17] A copy of the addendum is to be attached when copies of the general rules (05-071 CMR 125) are supplied to private sectarian schools. See Supplemental Affidavit of Commissioner Raynolds, filed April 8, 1982.
The addendum prescribes exemptions from: (1) the certification requirement, for teachers of religion and ministers who are headmasters; (2) the requirement of vision and hearing tests; (3) the minimum instructional time requirement for kindergarten; and (4) the maximum daily teaching schedule requirement. The addendum does not exempt sectarian schools from employing teachers who can "demonstrate qualifications for certification;" the requirement of information as to school financial position and policies, tuition policies, educational philosophy, goals and objectives; or from the requirement that the school physical environment must be "acceptable to the Department."
The application form itself does not exempt sectarian schools from these requirements, but purports to relax the requirement that information be provided as to school financial policies, by permitting sectarian schools merely to identify the religious affiliate from which it derives financial support.
[18] related, these two doctrines derive from somewhat different policies and look to different effects. Overbreadth analysis looks to whether a law `sweeps within its ambit [protected] activities' as well as unprotected ones, Thornhill v. Alabama, 310 U.S. 88, 97, 60 S.Ct. 736, 741, 84 L.Ed. 1093 (1940), while a vagueness inquiry focuses on whether a law states its proscriptions in terms sufficiently indefinite that persons of reasonable intelligence `must necessarily guess at its meaning'. Broadrick v. Oklahoma, 413 U.S. 601, 607, 93 S.Ct. 2908, 2913, 37 L.Ed.2d 830 (1973), quoting Connally v. General Const. Co., 269 U.S. 385, 391, 46 S.Ct. 126, 127, 70 L.Ed. 322 (1926). See Grayned v. City of Rockford, 408 U.S. 104, 108-114, 92 S.Ct. 2294, 2298-2302, 33 L.Ed.2d 222 (1972); Landry v. Daley, 280 F.Supp. 938, 951-52 (N.D. Ill.1968) (three-judge court).
Fantasy Book Shop, Inc. v. City of Boston, 652 F.2d 1115, 1122 n. 9 (1st Cir., 1981).
[19] In Grayned v. City of Rockford, 408 U.S. 104, 108-09, 92 S.Ct. 2294, 2298-2299, 33 L.Ed.2d 222 (1972), the Supreme Court articulated the constitutional bases of the vagueness doctrine:
It is a basic principle of due process that an enactment is void for vagueness if its prohibitions are not clearly defined. Vague laws offend several important values. First, because we assume that man is free to steer between lawful and unlawful conduct, we insist that laws give the person of ordinary intelligence a reasonable opportunity to know what is prohibited, so that he may act accordingly. Vague laws may trap the innocent by not providing fair warning. Second, if arbitrary and discriminatory enforcement is to be prevented, laws must provide explicit standards for those who apply them. A vague law impermissibly delegates basic policy matters to policemen, judges and juries for resolution on an ad hoc and subjective basis, with the attendant dangers of arbitrary and discriminatory application.
(Footnotes omitted.)
[20] Although local authorities may exempt a child from the public-school attendance requirement, the Commissioner must also determine that the private school instruction is "equivalent." See 20 M.R.S.A. §§ 911.1(A), 911.3(A) & 914.
[21] Plaintiffs' ultra vires challenges fall into four categories. See Exhibits A & B, attached to Plaintiffs' Supplemental Memorandum, filed March 24, 1982.
(1) Plaintiffs challenge various regulations requiring the submission of a statement of educational philosophy, goals and objectives; a plan for accomplishing the same; a description of the methods and procedures to be utilized in measuring attainment; and information from which it may be ascertained that the course of study and pupil needs are consistent with the stated purpose of the school. See 05-071 CMR 125, at 1-2.
(2) Plaintiffs challenge, for lack of a statutory basis, the regulation requiring a statement of the school's financial position, financial policies and other financial information. See 05-071 CMR 125, at 2.
(3) Plaintiffs challenge, as ultra vires, the regulation requiring that all teachers hold a valid teaching certificate and that all schools maintain a pupil-teacher ratio of not more than 30:1, noting that though the statute requires that high schools employ only certified teachers and have a student-teacher ratio of not more than 30:1, see 20 M.R.S.A. § 1281(4), there is no such statutory requirement for elementary schools.
(4) Plaintiffs challenge the statutory basis for the regulation that private schools not operate with compulsory school age children in attendance without first obtaining written approval from the Department, see 05-071 CMR 125, at 3; 05-071 CMR 127, at 10, pointing out that the compulsory attendance statute penalizes parents for enrolling children in schools not approved for attendance purposes but does not forbid the operation of unapproved private schools.
[22] Plaintiffs' challenge to these regulations, which appear not to be enforced against church-schools, see Initial Application Form, question I(8); Renewal Application, question II(7); Exhibits 1 & 2, attached to Affidavit of Commissioner Raynolds, filed October 19, 1981, may in any case not be ripe for adjudication. See Abbott Laboratories v. Gardner, 387 U.S. 136, 148-49, 87 S.Ct. 1507, 1515, 18 L.Ed.2d 681 (1967) [ripeness doctrine prevents judicial interference until administrative decision formalized and its effects are felt in a concrete way]. See also K. Davis, Administrative Law Treatise, § 21.00 (1982 Supp.) [controversies are not ripe unless hardship due to lack of decision is substantial].
[1] The information required for initial approval is normally provided on an eight-page questionnaire-application form issued by the Department. See Exhibit 1, attached to the Affidavit of Commissioner Raynolds, filed October 19, 1981.
[2] The annual report is a seven-page questionnaire. See Exhibit 2, attached to Affidavit of Commissioner Raynolds, filed October 19, 1981.
[3] The addendum to the rules governing the approval of private schools states that the English and mathematics course requirements apply in grades one through six.
[4] See note 3 supra.
[5] Teachers who complete a graduate program in elementary education and are recommended by their preparing institution need not meet the third requirement.
[6] An "established teaching field" requires either a 30-credit hour major and an 18-credit hour minor in any subject commonly taught in secondary schools, or at least 50 credit hours in one area of specialization, such as social studies, science, physical science and mathematics.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Carbon laravel adding to file name
I have file upload in my controller and need to add carbon to end of my file so I can insert it into database as unique. I'm doing it like this
$upload->title = Auth::User()->id;
$current = Carbon::now();
$file = $request->file('file');
$file->move(storage_path(). '/', $file->getClientOriginalName());
$upload->name = $file->getClientOriginalName().$current;
}
My question is this, when showing it to user how can I remove it so that the user sees only file original name(with php I can do it but I would like to use "laravel way")
A:
You can't add Carbon::now() to a filename since it has : in some filesystems, so do something like this:
$current = time(); // Will output something like 1478529571
Or if filenames are different and you just want to add date:
$current = date('Ymd'); // Will output something like 20161107.
Or, if you want to use Carbon:
$current = Carbon::now()->format('YmdHs'); // WIll output something like 201611071419
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Live from CVC Kansas City: Equine veterinary medical updates
Thomas Divers, DVM, DACVIM, DACVECC, of Cornell University College of Veterinary Medicine, offered CVC Kansas City attendees a sampling of research and practical developments that can aid equine veterinarians with their patients.
> Fecal transfaunation. A new therapy that has been used with a 90 percent success rate in human medicine has also been used successfully in horses with diarrhea under Divers’ supervision at the Cornell veterinary hospital. In this procedure—called “bacteriotherapy” in human medicine—a fecal sample is obtained from a healthy, Salmonella-free donor horse, diluted with water and transmitted into the ailing horse via tube. Horses (and people) treated in this way can have normal feces the next day. The procedure is most successful in treating diarrhea associated with Clostridium difficile or antibiotic-associated GI upset, Divers says.
> Cryotherapy and laminitis. Divers is extremely enthusiastic about using ice to prevent laminitis in toxemic horses. “We know that it works,” he says. He adds that it’s important to use crushed ice—not cubes, which can stick to the skin and cause dermatitis and cellulitis—mixed with water to form a slurry. This mixture is held in a 5-liter bag or specially designed boot that wraps around the horse’s foot. Testing has shown that the hoof stays cold for up to an hour after the ice is removed, Divers says, so if a horse steps out of the boot or the bag falls off, “it’s not an emergency.”
> Coronavirus outbreaks. In the fall of 2011 and spring of 2012, coronavirus-associated disease broke out in adult horses in four states—California, Texas, Wisconsin and Massachussetts—causing pronounced anorexia, fever and, in some horses, diarrhea. The outbreaks were notable because coronavirus typically causes problems in foals rather than adult horses. Although researchers describe the disease, which is transmitted via a fecal-oral route, as “self-limiting,” two horses did die, Divers says.
> Foal diarrhea testing. A 10-disease PCR test manufactured by IDEXX has been used to test the feces of neonatal foals with diarrhea, Divers says. Findings by researchers suggest that, while coronavirus infection does not necessarily cause clinical disease on its own, when combined with other pathogens such as Cryptosporidium species, it does. This means co-infection may be a possibility in many instances of diarrhea.
> Analgesia. Divers says he and others have realized that meloxicam is well tolerated and highly effective for pain control in horses. “It’s not approved for horses, but it’s been tested, so we know the pharmacokinetics,” Divers says. “It’s got a nice ratio of COX-1 and COX-2 inhibitors, and the oral form is generic and reasonably priced.” Divers says that the drug is well-tolerated in horses and shows no evidence of causing damage to the stomach.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
On the contrary, Jerome [Comment. in Ep. ad Ephes. iv, 17 says: "Is it not evident that a man who day and night wrestles with the dialectic art, the student of natural science whose gaze pierces the heavens, walks in vanity of understanding and darkness of mind?" Now vanity of understanding and darkness of mind are sinful. Therefore curiosity about intellective sciences may be sinful.
I answer that, As stated above (II-II:166:2 ad 2) studiousness is directly, not about knowledge itself, but about the desire and study in the pursuit of knowledge. Now we must judge differently of the knowledge itself of truth, and of the desire and study in the pursuit of the knowledge of truth. For the knowledge of truth, strictly speaking, is good, but it may be evil accidentally, by reason of some result, either because one takes pride in knowing the truth, according to 1 Corinthians 8:1, "Knowledge puffeth up," or because one uses the knowledge of truth in order to sin.
On the other hand, the desire or study in pursuing the knowledge of truth may be right or wrong. First, when one tends by his study to the knowledge of truth as having evil accidentally annexed to it, for instance those who study to know the truth that they may take pride in their knowledge. Hence Augustine says (De Morib. Eccl. 21): "Some there are who forsaking virtue, and ignorant of what God is, and of the majesty of that nature which ever remains the same, imagine they are doing something great, if with surpassing curiosity and keenness they explore the whole mass of this body which we call the world. So great a pride is thus begotten, that one would think they dwelt in the very heavens about which they argue." On like manner, those who study to learn something in order to sin are engaged in a sinful study, according to the saying of Jeremiah 9:5, "They have taught their tongue to speak lies, they have labored to commit iniquity."
Secondly, there may be sin by reason of the appetite or study directed to the learning of truth being itself inordinate; and this in four ways. First, when a man is withdrawn by a less profitable study from a study that is an obligation incumbent on him; hence Jerome says [Epist. xxi ad Damas]: "We see priests forsaking the gospels and the prophets, reading stage-plays, and singing the love songs of pastoral idylls." Secondly, when a man studies to learn of one, by whom it is unlawful to be taught, as in the case of those who seek to know the future through the demons. This is superstitious curiosity, of which Augustine says (De Vera Relig. 4): "Maybe, the philosophers were debarred from the faith by their sinful curiosity in seeking knowledge from the demons."
Thirdly, when a man desires to know the truth about creatures, without referring his knowledge to its due end, namely, the knowledge of God. Hence Augustine says (De Vera Relig. 29) that "in studying creatures, we must not be moved by empty and perishable curiosity; but we should ever mount towards immortal and abiding things."
Fourthly, when a man studies to know the truth above the capacity of his own intelligence, since by so doing men easily fall into error: wherefore it is written (Sirach 3:22): "Seek not the things that are too high for thee, and search not into things above thy ability . . . and in many of His works be not curious," and further on (Sirach 3:26), "For . . . the suspicion of them hath deceived many, and hath detained their minds in vanity."
Reply to Objection 1. Man's good consists in the knowledge of truth; yet man's sovereign good consists, not in the knowledge of any truth, but in the perfect knowledge of the sovereign truth, as the Philosopher states (Ethic. x, 7,8). Hence there may be sin in the knowledge of certain truths, in so far as the desire of such knowledge is not directed in due manner to the knowledge of the sovereign truth, wherein supreme happiness consists.
Reply to Objection 2. Although this argument shows that the knowledge of truth is good in itself, this does not prevent a man from misusing the knowledge of truth for an evil purpose, or from desiring the knowledge of truth inordinately, since even the desire for good should be regulated in due manner.
Reply to Objection 3. The study of philosophy is in itself lawful and commendable, on account of the truth which the philosophers acquired through God revealing it to them, as stated in Romans 1:19. Since, however, certain philosophers misuse the truth in order to assail the faith, the Apostle says (Colossians 2:8): "Beware lest any man cheat you by philosophy and vain deceit, according to the tradition of men . . . and not according to Christ": and Dionysius says (Ep. vii ad Polycarp.) of certain philosophers that "they make an unholy use of divine things against that which is divine, and by divine wisdom strive to destroy the worship of God."
Article 2. Whether the vice of curiosity is about sensitive knowledge?
Objection 1. It would seem that the vice of curiosity is not about sensitive knowledge. For just as some things are known by the sense of sight, so too are some things known by the senses of touch and taste. Now the vice concerned about objects of touch and taste is not curiosity but lust or gluttony. Therefore seemingly neither is the vice of curiosity about things known by the sight.
Objection 2. Further, curiosity would seem to refer to watching games; wherefore Augustine says (Confess. vi, 8) that when "a fall occurred in the fight, a mighty cry of the whole people struck him strongly, and overcome by curiosity Alypius opened his eyes." But it does not seem to be sinful to watch games, because it gives pleasure on account of the representation, wherein man takes a natural delight, as the Philosopher states (Poet. vi). Therefore the vice of curiosity is not about the knowledge of sensible objects.
Objection 3. Further, it would seem to pertain to curiosity to inquire into our neighbor's actions, as Bede observes [Comment. in 1 John 2:16]. Now, seemingly, it is not a sin to inquire into the actions of others, because according to Sirach 17:12, God "gave to every one of them commandment concerning his neighbor." Therefore the vice of curiosity does not regard the knowledge of such like particular sensible objects.
On the contrary, Augustine says (De Vera Relig. 38) that "concupiscence of the eyes makes men curious." Now according to Bede (Comment. in 1 John 2:16) "concupiscence of the eyes refers not only to the learning of magic arts, but also to sight-seeing, and to the discovery and dispraise of our neighbor's faults," and all these are particular objects of sense. Therefore since concupiscence of the eves is a sin, even as concupiscence of the flesh and pride of life, which are members of the same division (1 John 2:16), it seems that the vice of curiosity is about the knowledge of sensible things.
I answer that, The knowledge of sensible things is directed to two things. For in the first place, both in man and in other animals, it is directed to the upkeep of the body, because by knowledge of this kind, man and other animals avoid what is harmful to them, and seek those things that are necessary for the body's sustenance. On the second place, it is directed in a manner special to man, to intellective knowledge, whether speculative or practical. Accordingly to employ study for the purpose of knowing sensible things may be sinful in two ways. First, when the sensitive knowledge is not directed to something useful, but turns man away from some useful consideration. Hence Augustine says (Confess. x, 35), "I go no more to see a dog coursing a hare in the circus; but in the open country, if I happen to be passing, that coursing haply will distract me from some weighty thought, and draw me after it . . . and unless Thou, having made me see my weakness, didst speedily admonish me, I become foolishly dull." Secondly, when the knowledge of sensible things is directed to something harmful, as looking on a woman is directed to lust: even so the busy inquiry into other people's actions is directed to detraction. on the other hand, if one be ordinately intent on the knowledge of sensible things by reason of the necessity of sustaining nature, or for the sake of the study of intelligible truth, this studiousness about the knowledge of sensible things is virtuous.
Reply to Objection 1. Lust and gluttony are about pleasures arising from the use of objects of touch, whereas curiosity is about pleasures arising from the knowledge acquired through all the senses. According to Augustine (Confess. x, 35) "it is called concupiscence of the eyes" because "the sight is the sense chiefly used for obtaining knowledge, so that all sensible things are said to be seen," and as he says further on: "By this it may more evidently be discerned wherein pleasure and wherein curiosity is the object of the senses; for pleasure seeketh objects beautiful, melodious, fragrant, savory, soft; but curiosity, for trial's sake, seeketh even the contraries of these, not for the sake of suffering annoyance, but out of the lust of experiment and knowledge."
Reply to Objection 2. Sight-seeing becomes sinful, when it renders a man prone to the vices of lust and cruelty on account of things he sees represented. Hence Chrysostom says [Hom. vi in Matth.] that such sights make men adulterers and shameless.
Reply to Objection 3. One may watch other people's actions or inquire into them, with a good intent, either for one's own good—that is in order to be encouraged to better deeds by the deeds of our neighbor—or for our neighbor's good—that is in order to correct him, if he do anything wrong, according to the rule of charity and the duty of one's position. This is praiseworthy, according to Hebrews 10:24, "Consider one another to provoke unto charity and to good works." But to observe our neighbor's faults with the intention of looking down upon them, or of detracting them, or even with no further purpose than that of disturbing them, is sinful: hence it is written (Proverbs 24:15), "Lie not in wait, nor seek after wickedness in the house of the just, nor spoil his rest."
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Számítógépes nyelvészet
című műve Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported Licenc alatt van.Based on a work at szamitogepesnyelveszet.blogspot.com Permissions beyond the scope of this license may be available at http://szamitogepesnyelveszet.blogspot.com/
| null |
minipile
|
NaturalLanguage
|
mit
| null |
"Footroom, or demand turn-up, offers tremendous potential to the UK—not only does it put the country at the very forefront of developing and implementing the grid of tomorrow, but it opens up a world of possibilities for business and for renewables developers, With Footroom, businesses can boost productivity for minimal extra cost and are incentivised to do so. In turn, the grid can increase the amount of electricity distributed to homes from clean, renewable energy sources."
This marks an interesting new twist on the "death by capacity factor" issue that Mike highlighted last year. Wind and solar already often undercut coal and gas because their marginal cost of production is close to zero, so they can sell their electricity at almost any price and at least know that they are not losing their shirts. Now, with the addition of demand turn-up, these operators can even sell their electricity when there would normally be no demand for it at all.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Not for Publication in West's Federal Reporter
Citation Limited Pursuant to 1st Cir. Loc. R. 32.3
United States Court of Appeals
For the First Circuit
No. 02-2454
UNITED STATES OF AMERICA,
Appellee,
v.
RICHARD DIAZ-BAERGA,
Defendant, Appellant.
APPEAL FROM THE UNITED STATES DISTRICT COURT
FOR THE DISTRICT OF PUERTO RICO
[Hon. José A. Fuste, U.S. District Judge]
Before
Boudin, Chief Circuit Judge,
Torruella and Howard, Circuit Judges.
Lisa Aidlin was on brief for appellant.
H.S. Garcia, United States Attorney, Sonia I. Torres,
Assistant United States Attorney, Chief, Criminal Division, and
Timothy R. Henwood, Assistant United States Attorney, were on brief
for appellee.
July 15, 2003
Per Curiam. In April 2002, Richard Diaz-Baerga ("Diaz")
pleaded guilty to conspiracy to possess with intent to distribute
cocaine and aiding and abetting the possession of a firearm during
and in relation to a drug trafficking offense. See 21 U.S.C. §
846, 18 U.S.C. § 924(c)(1)(A). He appeals the district court's
acceptance of his guilty plea as to the firearms charge, contending
that the court inadequately explained the charge during his Rule 11
hearing. We affirm.
I. Factual and Procedural Background
In February 2001, Diaz and his wife, Keila Medina-Roman
("Medina"), both police officers with the Commonwealth of Puerto
Rico Police Department, met with a cooperating witness posing as a
drug dealer and agreed to assist in the transport of what they
believed to be a shipment of cocaine. Diaz transported a shipment
in March 2001 while carrying a firearm, and Medina provided escort
and protection during the transfer. Diaz and Medina received
$10,000 for their services. They later recruited two other
individuals and participated in a second shipment in June 2001,
receiving $5,000 each.
On November 26, 2001, a grand jury indicted Diaz and the
three other participants. Diaz was charged in seven counts,
including conspiracy to possess cocaine with intent to distribute,
21 U.S.C. § 846; aiding and abetting the possession of a firearm
during and in relation to a drug trafficking crime, 18 U.S.C. §
-2-
924(c)(1)(A)(i); aiding and abetting interference with commerce by
threats or violence, 18 U.S.C. § 1951; and attempting to possess
cocaine with intent to distribute, 21 U.S.C. § 846. The indictment
also included forfeiture allegations. At his arraignment, Diaz
entered a plea of not guilty on all charges.
On April 26, 2002, Diaz changed his plea to guilty on two
of the charges -- conspiracy to possess narcotics with intent to
distribute (Count I) and aiding and abetting the possession of a
firearm during and in relation to a drug trafficking crime (Count
II) -- and accepted the forfeiture allegations in the indictment.
The government agreed to dismiss the remaining charges. Following
a Rule 11 hearing, the district court accepted Diaz's plea.
Diaz was later sentenced to ten years' imprisonment on
the conspiracy charge and five years' imprisonment on the firearms
charge, with these terms to be served consecutively. Diaz was also
sentenced to four years and two years of supervised release on the
two charges, respectively, with the terms to be served
concurrently. Diaz was ordered to forfeit $15,000, and to pay a
special monetary assessment of $200. This appeal followed.
II. Analysis
Diaz contends that the district court failed to
adequately explain the firearms charge, in particular that the
carrying or use of the firearm must be "in relation to" the drug
trafficking offense. He argues that his plea as to that charge was
-3-
not intelligent and voluntary, and that he should therefore be
allowed to withdraw it.1 Having failed to raise this issue before
the district court, Diaz is entitled only to plain error review.
United States v. Vonn, 535 U.S. 55, 122 S.Ct. 1043, 1046, 152
L.Ed.2d 90 (2002); United States v. Hoyle, 237 F.3d 1, 5 (1st Cir.
2001). Under this standard, Diaz bears the burden of establishing
that "the outcome would likely have been different if the error had
not occurred." Hoyle, 237 F.3d at 5. He also must show that the
error affected substantial rights, and "seriously affect[ed] the
fairness, integrity, or public reputation of judicial proceedings."
United States v. Gandia-Maysonet, 227 F.3d 1, 4 (1st Cir. 2000)
(quoting United States v. Olano, 507 U.S. 725, 732
(1993)(alteration in original)); see also Hoyle, 237 F.3d at 5.
We consider the totality of the circumstances in
determining whether plain error has occurred, and whether Diaz's
plea was voluntary, intelligent, and knowing. United States v.
Hernandez-Wilson, 186 F.3d 1, 5 (1st Cir. 1999). "What is critical
is the substance of what was communicated by the trial court, and
what should reasonably have been understood by the defendant,
rather than the form of the communication." United States v.
Cotal-Crespo, 47 F.3d 1, 4-5 (1st Cir. 1995).
1
Diaz does not challenge his plea on the conspiracy count or
contest the forfeiture allegations.
-4-
Diaz contends that the district court's description of
the firearms charge, reproduced in the margin,2 improperly led him
to believe that merely carrying a firearm made him guilty of the
crime. Considering the colloquy in its entirety, however, the
district court did not misstate the elements of the offense. The
court stated the nexus that the government would have to prove,
namely that the use or carriage of the firearm facilitated the
drug-trafficking crime. United States v. Ortiz de Jesús, 230 F.3d
1, 5 (1st Cir. 2000). Even if we assume, arguendo, that the
district court's explanation was lacking, Diaz fails to meet his
considerable burden of proof under the plain error standard. For
instance, Diaz fails to even allege -- let alone prove -- that the
outcome likely would have been different if the firearms charge had
been described differently.
2
THE COURT: Count Two of the indictment charges you with the
following: That you knowingly carried a firearm during and in
relation to the drug trafficking offense, and that is why you
knowingly and intentionally joined and acted in the conspiracy that
we have just discussed, to possess with intent to distribute in
excess of 5 kilos of cocaine. Do you understand that?
THE DEFENDANT: Yes.
THE COURT: In the context of this case, it means in very
simple terms that you, obviously, as a police officer you have
firearms, you used them, you carried them while you were committing
these crimes, do you understand that?
THE DEFENDANT: Yes.
THE COURT: And the use and the carrying of these firearms
would allow you, to help you in a way to commit the offenses. It's
a lot easier. It's a convenient thing to have firearms when you
are a drug dealer. Do you understand that?
THE DEFENDANT: Yes.
Hr'g Tr. (Apr. 26, 2002) at 10:17-11:22 (Docket No. 139).
-5-
Diaz also contends that the district court erred in
failing to require him to provide a description of what he had done
to commit the firearms offense. In considering the totality of the
circumstances surrounding a guilty plea, such a description may be
useful evidence in defeating a defendant's claim that he lacked
understanding of the charges against him. Cotal-Crespo, 47 F.3d at
5-6. The absence of such evidence does not, however, demonstrate
that the defendant did not understand the charges. See id.
Affirmed.
-6-
| null |
minipile
|
NaturalLanguage
|
mit
| null |
This copy is for your personal non-commercial use only. To order presentation-ready copies of Toronto Star content for distribution to colleagues, clients or customers, or inquire about permissions/licensing, please go to: www.TorontoStarReprints.com
Woman abducted on Philadelphia street found safe in Maryland
Carlesha Freeland-Gaither, 22, had been last seen on surveillance video being grabbed by a man and pulled toward a car Sunday night
▶
Police have located the man in connection with the abduction of a woman from a Philadelphia street after investigators collected a trail of video and photo evidence.(AP)
By NATALIE POMPILIOAssociated Press
Wed., Nov. 5, 2014
PHILADELPHIA— A woman seen on surveillance video putting up a fight while being abducted off a Philadelphia street was found safe outside Baltimore on Wednesday, and the man who snatched her was arrested, police said.
Carlesha Freeland-Gaither was spotted in Jessup, Maryland, with the man in a car with a broken-out back window and was rescued soon after, police said. The man was nabbed after he stepped out of the car, police said.
"We got a very dangerous predator off the street," Commissioner Charles Ramsey said.
Freeland-Gaither, 22, had some injuries but was generally doing OK, police said. There was no indication she and the man, who used to live in Philadelphia, knew each other, authorities said.
The man, Delvin Barnes, was being held Wednesday night on an unrelated Virginia warrant alleging attempted capital murder, assault and malicious injury with acid, explosives or fire, and he would face federal charges in the Philadelphia abduction, authorities said. Barnes, 37, couldn't be reached for comment while in custody.
Article Continued Below
Bureau of Alcohol, Tobacco, Firearms and Explosives agents had received information from Richmond, Virginia, to be on the lookout for a vehicle that might have been involved in the abduction, said Tim Jones, resident agent in charge with the ATF in Lanham, Maryland.
ATF agents found the vehicle, which had its rear window kicked out, late Wednesday afternoon on a road in Jessup, he said. A witness to Freeland-Gaither's abduction Sunday night had said she was forced into in a car and broke some of its windows before it sped off.
Law enforcers saw Barnes and Freeland-Gaither in the car and surrounded it, Jones said.
Barnes climbed from the back seat to the front seat, and that was when agents drove their cars around to block his vehicle in, Jones said. Agents then freed Freeland-Gaither, and she was taken to a hospital, Jones said.
Barnes was taken into custody without incident, he said.
Freeland-Gaither was in good condition, said a hospital spokeswoman, who wouldn't discuss the type or extent of her injuries.
Freeland-Gaither's mother, Keisha Gaither, thanked police and the community for their support and said she had talked to her by phone but hadn't seen her yet. Keisha Gaither said her daughter was distraught when they talked.
"She was very upset. She was crying. She just was asking for me, to tell me she loved me, she missed me, to come get her," she said. "I'm going to get my daughter. I'm going to get my baby."
Freeland-Gaither had been last seen on surveillance video being grabbed by a man and pulled toward a car Sunday night as she struggled to get away in Philadelphia's Germantown neighborhood.
Police and federal authorities had released a stream of images over the past two days from surveillance cameras in Maryland and from a Philadelphia supermarket hours before the abduction.
The video showed a man in a knit cap and dark coat walking down an aisle of a store and using a self-checkout station. A timestamp indicates the video was recorded eight hours before Freeland-Gaither disappeared.
A witness called 911 at about 9:40 p.m. Sunday and reported seeing a woman identified as Freeland-Gaither screaming for help as she was forced into a dark gray four-door vehicle.
Police said Freeland-Gaither's glasses and cellphone were dropped on the street, near piles of broken auto glass.
The witness said Freeland-Gaither — described by her parents as easygoing until she's threatened — had broken the car's rear side windows.
Freeland-Gaither, a nursing assistant, graduated from high school in Maryland and lived with her grandfather in Philadelphia until a couple of months ago, when she moved in with her boyfriend.
Her grandmother Ana Mulero said she has worked with cancer patients and has been pursuing a career in nursing.
Freeland-Gaither's parents circulated fliers in Germantown, and Facebook groups sprung up with prayers for her safe return.
More from the Toronto Star & Partners
LOADING
Copyright owned or licensed by Toronto Star Newspapers Limited. All rights reserved. Republication or distribution of this content is expressly prohibited without the prior written consent of Toronto Star Newspapers Limited and/or its licensors. To order copies of Toronto Star articles, please go to: www.TorontoStarReprints.com
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Maungaturoto Community Centenial Hall was built to serve the local community, and is maintained by a volunteer committee.
It features include a large hall with a stage and theatre facilities. A smaller carpeted function room adjoins. And both are connected to a commercial kitchen and bar facilities.
There is also a secure ticket booth, bathrooms, backstage dressing rooms, huge backstage and understage space and excellent access through out from double doors and roller door.
The vast parking (front, side and back) is complimented by a huge covered entrance and a foyer large enough for a large crowd or additional display space.
Over the years we've hosted hundreds of events, meetings and performances. These incude: weddings, plays, conferences, expos, auctions, family celebrations. sports activites and club meetings and even to show movies!
Whatever your event, you'll find the scale, facilities and great location make your next event, or function, a success!
Call us today to discuss how the Maungatuto Centenial Hall can work for you.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Silver Stars vs. Liberty
September 18, 2012
John Albright/For the Express-News
5of20
The Silver Stars' Becky Hammon (25) drives around New York's Cappie Pondexter (right) during a WNBA game between the San Antonio Silver Stars and the New York Liberty on Tuesday, Sept. 18, 2012, at the AT&T Center.
The Silver Stars' Becky Hammon (25) drives around New York's Cappie Pondexter (right) during a WNBA game between the San Antonio Silver Stars and the New York Liberty on Tuesday, Sept. 18, 2012, at the AT&T Center.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The effect of pronation and supination on the minimally displaced scaphoid fracture.
The amount of rotation that occurs at the scaphoid waist fracture site with pronation and supination of the forearm is studied in 10 upper extremities from cadavers. Two colinear metal markers were placed in the osteotomized scaphoid and a below-the-elbow cast was applied. Spiral volumetric computed tomography scanning of the scaphoid was done with multiplanar reformation to evaluate displacement of the metal markers. Four of the 10 specimens also were studied without any immobilization. The total magnitude of motion from pronation to supination averaged 0.2 mm in the specimens with a below-the-elbow thumb spica cast, and 2.4 mm in specimens without immobilization. The current study showed no significant rotation at the minimally displaced scaphoid waist fracture site during pronation and supination in a below-the-elbow cast. Furthermore, there is unacceptable rotation at the fracture site in the absence of a cast. Based on this study, a below-the-elbow thumb spica cast seems adequate for fracture immobilization; however, clinical correlation is needed.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Wednesday, August 09, 2006
Quick round trip to Houston
We leave for Houston in an hour or so. This will be a quick roundtrip, prelude to the big adventure: a two-day trip to Houston. I’ll get some blood drawn tonight at the hotel (no, that wasn’t a typo! They do bloodwork from 6-8 PM at the Rotary House). Then, tomorrow morning at 7:30, my Central Venous Catheter (CVC) will be surgically inserted (they’ll use an anesthetic called Versed, which I think I’ve had before—I’m saying it now because apparently I won’t remember it tomorrow afternoon…). Another blood-draw at 9:15, followed by something else (a visit with the Transplant Unit’s social worker, I think). Meanwhile, Anna will be sitting through two (identical) classes about the care and feeding of the CVC, and at 4:00 we’ll go to a different Infusion unit, this one in the main building (whereas the Infusion unit where they will insert the CVC is in the Ambulatory Care Building), so Anna can do a live demonstration that she has understood the care-and-feeding classes. (Note that she spent quite a lot of time last year taking care of my PortOCath and the PICC lines that succeeded it…) We’ll see Dr. Andersson, the transplant doctor, at 10:30 on Friday morning for what we presume will be the final go-ahead for the transplant—all the test results from last week will be in by then, and he’ll have had time to determine whether there’s anything that would prevent our going forward. Then, and only then, will we see the research nurse who will determine my actual date of admission to the hospital by some sort of electronic coin-flip. (The admission date will be either Sunday the 13th or Wednesday the 16th, we know that much; but they won’t say which until after Dr. Andersson has approved the procedure.) And then we’ll come home, whether for 36 hours or a few days.Meanwhile, Ledia and her partner, Paul, have embarked on a much more pleasurable and fun journey: they’re floating down the Mississippi River from Minneapolis on big homemade rafts, which they’ve built along with a band of 30 or so other artists from New York, San Francisco, and points in between. They plan to get as far as St. Louis, and maybe go on to New Orleans. There’s a great article about the Miss Rockaway Armada in today’s New York Times! There’s even some video. (The project site is at http://www.missrockaway.org.)
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1. Technical Field
The present invention relates to the field of rule-based operations and, more particularly, to a data-driven design rule check (DRC) method and system.
2. Description of the Related Art
A logic simulator is a software tool which is capable of performing functional and timing simulations for digital electronic designs which are written in a hardware description language (HDL) such as VHSIC Hardware Description Language (VHDL) or Verilog. The VHSIC acronym stands for Very High Speed Integrated Circuits. VHDL and Verilog are HDLs used to design and document electronic systems. Verilog, for example, permits hardware designers to define signals at a very high level of abstraction. The abstracted signal representations can be translated to actual pins on a microchip using any of a variety of commercial electronic design automation (EDA) software tools.
Design Rule Check (DRC) is a crucial step in validating an electronic design before actual hardware implementation. A failed DRC signals a critical error which may lead to silicon failure. The goal of DRC is to identify places in the integrated circuit design where the design rules, such as the spacing between two features or the width of a wire, have been violated. Design rules tend to change frequently and with many different fabrication processes, particularly in the sub-micron domain, there could be many subtly different design rules. Thus, with design density growing and more hardware features being introduced, DRC is also growing in complexity. A typical new design block such as an embedded PowerPC in an field programmable gate array (FPGA)-based System-on-Chip (SOC) or a multi-Gigabit transceiver often requires a large number of complex design rule checks to be done.
In existing design rule checkers, the rules are often coded in software source code (e.g., C/C++) and then compiled into a software library. For example, in order to check whether Pin A of a component B is connected to a Ground signal, the following code fragment would be used:
function check_pinAofB(componentX) { if(typeof(X)==B) { Pin pX =getpinA(X); if(driven_by_Ground(pX)) issueError( ); } }
If a small change has to be made to the design rule above, the entire function (and hence the entire program file) must be recompiled. Such process is time-consuming and risky and hence makes rule modification difficult. Also, if other rules must be added to check the same condition for a different component, a large part of the above function/procedure must be replicated. Such a system is inflexible and hard to maintain.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The WISH List raises money to identify, train, support and elect more Republican women leaders to public office at all levels of government. WISH is America's largest fundraising network for pro-choice Republican women candidates. Based in Washington, D.C., The Wish List offers volunteer positions as well as part and full-time internships.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Participation of mast cells and complement in the immediate phase of hematoporphyrin-induced phototoxicity.
We have investigated the roles of mast cells and the complement system in the immediate phase of hematoporphyrin-induced phototoxicity in guinea pigs. Clinically, i.v. injection of hematoporphyrin, followed by irradiation with a light source containing 400-405 nm wavelength, resulted in the immediate onset of erythema and edema, which subsided partially in 30-60 min. This was followed by the appearance of delayed erythema and edema, which peaked at 6-12 h after irradiation. Histologic examination of the response of the immediate phase, using a 1 micron-thick section, revealed eosinophil infiltration and mast cell degranulation. The immediate phase of the clinical response was further quantitated by the extravasation of intravenously injected [125I]bovine serum albumin. Pretreatment of the guinea pig skin with the intradermal injection of compound 48/80 significantly suppressed the increase in vascular permeability induced by hematoporphyrin and irradiation (p less than 0.05). This hematoporphyrin-induced alteration in vascular permeability was also significantly inhibited by antihistamines, either H1 receptor antagonist alone (p less than 0.05) or a combination of H1 and H2 receptor antagonists (p less than 0.05). Guinea pigs depleted of complement also showed significantly less vascular permeability changes (p less than 0.05). These results indicate that functionally intact mast cells, and the complement system, are required for the full development of the immediate phase of phototoxicity induced by hematoporphyrin.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How to pass in multiple input arguments to Popen()?
I am writing a script which installs a command line interface for a user.
proc = Popen("sudo -S apt-get install vim".split(), stdin=PIPE, stdout=PIPE, stderr=PIPE, shell=True)
# Popen only accepts byte-arrays so you must encode the string
output = proc.communicate(password.encode())
stdoutput = (output)[0].decode('utf-8')
Output:
Installing Vim...|Reading package lists...
Building dependency tree...
Reading state information...
The following additional packages will be installed:
vim-runtime
Suggested packages:
ctags vim-doc vim-scripts
The following NEW packages will be installed:
vim vim-runtime
0 upgraded, 2 newly installed, 0 to remove and 5 not upgraded.
Need to get 7,111 kB of archives.
After this operation, 34.6 MB of additional disk space will be used.
Do you want to continue? [Y/n] Abort.
As you can see, the installation of the package stops and the Do you want to continue?, in which, for some reason, the installation is aborted.
How do I pass in a y at this stage using Popen()?
I am already passing in the password using communicate() but that is not taking multiple inputs.
A:
Just pass -y as an option to apt-get to avoid the need to interact (further) with it.
proc = Popen(["sudo", "-S", "apt-get", "-y", "install", "vim"], stdin=PIPE, stdout=PIPE, stderr=PIPE)
output, error = proc.communicate(password.encode())
stdoutput = output.decode('utf-8')
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How to access to postgresql on vagranted virtual machine?
I make via Vagrant virtual machine with postgresql and want to use it as my rails app database.
I use similar Vagrantfile:
Vagrant.configure("2") do |config|
config.vm.network :private_network, ip: "192.168.33.18"
config.vm.provision :chef_solo do |chef|
# I take cookbook from https://github.com/opscode-cookbooks/postgresql
chef.add_recipe "postgresql::server"
chef.json = {
postgresql: {
config: {
ssl: false,
listen_addresses: '*'
},
password: {
postgres: 'postgres'
}
}
}
end
end
Next I vagrant up and expect that next database.yml will be worked:
development:
database: app_development
adapter: postgresql
host: '192.168.33.18'
username: root
But this is not happen.. Rake task fails with error:
could not connect to server: Connection refused
Is the server running on host "192.168.33.18" and accepting
TCP/IP connections on port 5432?
And I see that port is actually not opened
$ nmap -p 5432 192.168.33.18
Starting Nmap 6.25 ( http://nmap.org ) at 2013-05-07 22:05 FET
Nmap scan report for 192.168.33.18
Host is up (0.00047s latency).
PORT STATE SERVICE
5432/tcp closed postgresql
And I can see some postgres processes on vm, and there no any errors in vagrant output, so I believe postgres works normally.
932 postgres 20 0 126m 9.9m 8916 S 0 2.7 0:00.03
postgres
941 postgres 20 0 97460 1348 192 S 0 0.4 0:00.00 postgres
944 postgres 20 0 126m 1728 548 S 0 0.5 0:00.06 postgres
945 postgres 20 0 126m 1488 316 S 0 0.4 0:00.05 postgres
946 postgres 20 0 126m 2768 1000 S 0 0.7 0:00.00 postgres
947 postgres 20 0 97456 1584 352 S 0 0.4 0:00.00 postgres
How to setup Vagrant to use db on virtual machine in my rails app?
UPDATE my pg_hba.conf
# TYPE DATABASE USER ADDRESS METHOD
# "local" is for Unix domain socket connections only
local all all peer
###########
# Other authentication configurations taken from chef node defaults:
###########
local all all trust
host all all 0.0.0.0/0 md5
A:
I apologize to all readers, but problem was in my inattention. Though I point listen_addresses: '*' in config, then I reset this config accidentally, so in final config was taken default listen_addresses: 'localhost' value. After fix this port became opened.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Caught between unsupportive health workers and an unethical baby food industry, new mothers are being dissuaded from breastfeeding.
India is supposed to be a “breastfeeding nation” but breastfeeding rates in the country do not support this claim. Only about 44% of babies – that is 12 million out of 26 million – begin breastfeeding within one hour of their birth, according to national data sources. The majority are given formula milk, either powdered or liquid, or animal milk.
To understand how new mothers view health services and formula-feeding, the Breastfeeding Support for Indian Mothers, a Facebook group with more than 29,000 members conducted a survey. More than 950 mothers who delivered their babies in private hospitals responded. More than half the respondents said their children were given artificial milk and out of these two-third said that it was without their consent. From the comments of these women, it is evident that health workers often doubted new mothers’ ability to produce milk and undermined their confidence in breastfeeding.
Playing on hormones
It is all about how hormones that control breastfeeding work. Breastmilk is produced by the hormone prolactin, the secretion of which is directly impacted by the amount of suckling by the baby. Breastmilk is ejected from the mother’s breast and into the baby’s mouth during nursing under control of another hormone oxytocin, the production of which is influenced by the mother’s state of mind. More oxytocin is produced when a woman is happy and confident and less if she has doubts, anxiety or is in pain.
Just after a baby is born, the mammary glands produce a form of milk called colostrum. The small quantities of colostrum are sufficient nutrition for the baby but since it is not free-flowing, like the milk that the glands later produce, it is often perceived as less production. The time of production of colostrum is the critical period when the baby is most active to suckle. Not allowing the baby to breastfeed at this time causes problems in breastfeeding later.
The baby food industry started exploiting this hormone mechanism about five decades ago. They made campaigns associating the lack of breastmilk production with guilt such as “if you don’t have enough milk we have the safe alternatives…don’t feel guilty …” Today, in any corner of the world, more than 90% women still make this association. Industry has subtly and systematically undermined women’s confidence, as Gabrielle Palmer’s book The Politics of Breastfeeding: When Breasts are Bad for Business historically captures.
In November 2016, the United Nations Human Rights Commission issued a joint statement on protection, promotion and support of breastfeeding, which noted that “Women who choose to breastfeed often lack the necessary support structures. Gaps in knowledge and skills among healthcare providers often leave women without access to accurate information or support”.
Further, the commission observed that “aggressive and inappropriate promotion of breast-milk substitutes, and other commercially prepared food products for children from 6 to 36 months that compete with breastfeeding, continue to undermine efforts to improve early and exclusive breastfeeding rates and act as barrier for women to exercise their rights. These marketing practices often negatively affect the choice and ability of mothers to breastfeed their infants optimally, and to enjoy the many health benefits breastfeeding provides.”
According to the World Health Organisation, once babies are introduced formula, a return to breastfeeding may not be possible due to diminished breastmilk production. So, if babies are given formula without the consent of their mothers, does that amount to violations of the rights of both mother and child?
What’s needed
When a new mother comes to a health worker and says that she is not producing enough breastmilk, the most common response is to offer treatment with alternatives such as formula. Instead, health workers should investigate the cause of the deficiency and help by showing her the correct of feeding techniques that she may not be aware of and build her confidence to breastfeed. Even new mothers who are anaemic or malnourished lactate and can breastfeed, if given the right health support.
Health workers should be careful not to make a new mother feel guilty, even if she had been using formula – this is a result of bad practice in society and the health system. If a woman makes a choice in favour of artificial feeding having known its risks, health workers should respect her choice and explain to her how safely practice formula feeding.
At the same time, hospitals must have lactation counsellors on their staff to help women feed from the start during colostrum production. In addition, existing maternity staff should be trained to support women at time of birth and breastfeeding. Unless the health system takes this action, artificial feeding will continue to be common practice
The government’s role
Even after 25 years of enacting a law that bans sponsorship of health workers and their associations, the practice continues today. Baby food companies continue to give discount on their products through e-commerce sites, although they have been prohibited to do so. We believe this aggressive promotion contributes to undermining breastfeeding.
The health ministry committed to the new WHO guidelines on ending inappropriate promotion of foods for infants and young children adopted at a the World Health Assembly in 2015. The ministry can take a cue from both this resolution and the United Nations Human Rights Commission Statement to issue a notification to ensure a parent’s consent before a baby is fed formula in a hospital and to end to inappropriate promotion of baby foods and sponsorship in the health systems.
The writer is a paediatrician and founder of the Breastfeeding Promotion Network of India.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Atta Boafo Daniel Kingsley
Atta Boafo Daniel Kingsley is a Ghanaian politician and member of the Seventh Parliament of the Fourth Republic of Ghana representing Fomena constituency in the Ashanti Region of Ghana under the flag of New Patriotic Party.
Personal Life
He was born on 14 October 1959 in Adansi Ayasi in Ashanti Region. He received a Diploma degree in Journalism from London School of Journalism in the year 2008. He is an Adviser, Journalist and Marketer by profession. Kingsley is married with six children and is a Christian.
Career
He was a Transport Analyst at the Kumasi Metropolitan Assembly. He was elected in January 2017 after defeating his opposition party leading with 67.756% of the total vote cast.
Reference
Category:1959 births
Category:People from Ashanti Region
Category:Ghanaian MPs 2017–
Category:New Patriotic Party politicians
Category:Living people
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The third Die Hard is a little more of the same, but, fortunately, that's entertaining enough to sustain a pretty slickly directed action flick. The inclusion of Samuel L. doesn't do much, character-wise, but Jeremy Irons makes a great smart and austere bad guy and it's nice to see the franchise deviate from hostage situations.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1. Field of the Invention
The present invention relates to a process for producing a polyamide from a dicarboxylic acid and a diamine. More particularly, the invention relates to a process with improved production efficiency for producing a polyamide by adding a diamine to a molten dicarboxylic acid in the absence of a solvent to conduct a direct polymerization therebetween.
2. Description of the Prior Art
Polyamide has been generally produced using, as a raw material, a nylon salt or an aqueous solution thereof. The process for the production of polyamide may be carried out in either a batch-wise manner or a continuous manner using such a raw material. For example, in the batch-wise method, an aqueous solution of nylon salt is heated under pressure in one reactor where the polymerization of the nylon salt proceeds in a uniform phase while inhibiting the diamine component from being lost by distillation. Then, after fixing the diamine component by polymerization, a steam in the reaction system is gradually released, and the polymerization reaction is completed finally under ordinary or reduced pressure. In the continuous method, while continuously feeding the raw material, the same steps as in the batch-wise method are sequentially performed, and the polyamide as produced is continuously discharged.
However, the use of the aqueous solution nylon salt as the raw material causes the following problems. The aqueous solution of nylon salt usually has a concentration of about 50%. The presence of a large amount of water requires a highly pressure-resistant reactor because a high pressure is needed to prevent water as the solvent from being distilled off in an initial stage of the polymerization. In addition, a large amount of water used as the solvent must be finally removed together with condensation water generated during the polymerization. Upon the removal of water, there arise various inconveniences such as foaming, solidification of polyamide due to a latent heat of water vaporization, and heat degradation of polyamide which is remained on a wall of the reactor due to a large change of the liquid level during the reaction. Therefore, a counter measure should be laid down against these inconveniences. In addition, the process using a aqueous solution of nylon salt not only requires a large amount of heat energy for the removal of water, but also involves many technical or economical problems such as low polyamide yields per one batch operation.
In the process where a nylon salt is used as the raw material as described in Japanese Patent Publication No 33-15700 and No. 43-22874, many of the above problems are avoided, but additional steps for separation and purification of the nylon salt are required, thereby failing to provide an efficient process for the production of polyamide.
As a polymerization process using a raw material other than the nylon salt and the aqueous solution thereof, there are known a method in which a diamine containing a small amount of water is added dropwise into a dicarboxylic acid at 220xc2x0 C. or lower under ordinary pressure (Japanese Patent Application Laid-Open No. 48-12390); a method in which a diamine is added dropwise into a molten dicarboxylic acid under ordinary pressure to directly conduct the reaction therebetween (Japanese Patent Application Laid-Open No. 57-200420 and No. 58-111829). These methods are advantageous both technically and economically as compared to those using the nylon salt and the aqueous solution thereof. However, the methods must be practically performed in a batch-wise manner, and it is considerably difficult to perform these methods using a continuous-type polymerizer.
When an apparatus for the production of polyamide is designed, care must be paid to heat supply, surface renewal capability, uniform stirring and mixing, or the like. In order to ensure the same production yield of polyamide between a batch-wise polymerization and a continuous polymerization, the size of the apparatus is limited lower in the batch-wise polymerization as compared with the continuous polymerization. Further, in the batch-wise polymerization, the polyamide is discharged from the reactor preferably within one hour after the molecular weight reaches a predetermined value. Therefore, a pelletizer for polyamide is required to have a capacity capable of treating one batch of polyamide within one hour. With recent rapidly-increasing throughput capacity of pelletizer, a considerably large scale of pelletizer has come to be commercially available. Nevertheless, the capacity is still limited to 10 tons per hour at most. Therefore, in view of the capacity of pelletizer, the maximum production of polyamide in the batch-wise process is limited to 10 tons per one batch. If a larger production is intended, it is necessary to use a plurality of pelletizer, resulting in extremely poor production efficiency. In a method, polyamide produced by the batch-wise process is temporarily stored in a molten state, and then gradually discharged into to a pelletizer where the polyamide is continuously pelletized. This method enables the use of a pelletizer having a small throughput capacity. However, in this method, there arise problems such as change in polymerization degree of the polyamide during storage, break of strands due to inclusion of air bubbles, thereby failing to perform a continuous pelletization.
The batch-wise polymerizer and the continuous polymerizer each have respective merits and demerits, and therefore, the superiority thereof is not simply determined. In general, the continuous polymerizer is suitable for a small-kind and large-quantity production, while the batch-wise polymerizer is suitable for a multikind and small-quantity production. The turning point where the continuous process becomes economically advantageous over the batch-wise process is said to be 10,000 tons or 20,000 tons by annual production. In a production process suitably performed by a batch-wise method or in a batch-wise process where a production amount exceeding the range advantageous for the batch-wise production is intended, it is important to consider how the production efficiency of the batch-wise process is enhanced. Thus, it has been demanded to develop a more efficient process for the production of polyamide.
An object of the present invention is to provide a process for producing a polyamide with an enhanced production efficiency by adding a diamine to a molten dicarboxylic acid in the absence of a solvent to conduct a direct polycondensation therebetween.
As a result of extensive researches in view of the above object, the inventors have found that, in the process for producing a polyamide by adding a diamine to a molten dicarboxylic acid to conduct a direct polycondensation therebetween in the absence of a solvent, the polymerization process is smoothly switched from a batch-wise manner to a continuous manner and the production efficiency is enhanced by allowing the polycondensation to proceed up to a middle stage in a batch-wise first polymerizer, filling a vapor-phase portion contacting the middle stage polyamide with steam having a predetermined pressure, and then feeding the polyamide to a continuous second polymerizer while maintaining the polymerization degree of the middle stage polyamide substantially constant. The present invention has been accomplished on the basis of this finding.
Thus, in a first aspect of the present invention, there is provided a A process for producing a polyamide by melt-polycondensing a diamine with a dicarboxylic acid in the absence of a solvent, comprising (1) a step of melting the dicarboxylic acid; (2) a step of continuously or intermittently adding the diamine into the dicarboxylic acid kept in a molten state in a batch-wise first polymerizer equipped with a partial condenser to subject the diamine and the dicarboxylic acid to polycondensation at a predetermined molar ratio to produce a middle-stage polyamide having a relative viscosity of 1.4 to 2.7, the diamine having a boiling point higher than a melting point of the middle-stage polyamide under an inner pressure of the first polymerizer; (3) a step of feeding the middle-stage polyamide from the first polymerizer to a melt retention tank, where the middle-stage polyamide is fed into a continuous second polymerizer while controlling a change of relative viscosity of the middle-stage polyamide during the retention in the melt retention tank within xc2x10.2 by maintaining a vapor phase portion of the melt retention tank at a predetermined pressure by saturated steam; and (4) a step of subjecting the middle-stage polyamide in the second polymerizer to a further polycondensation while removing water from a molten reaction system under reduced pressure, thereby producing a later-stage polyamide.
In a second aspect of the present invention, there is provided a process for producing a polyamide by melt-polycondensing a diamine with a dicarboxylic acid in the absence of a solvent, comprising (1) a step of melting the dicarboxylic acid; (2) a step of continuously or intermittently adding the diamine into the dicarboxylic acid kept in a molten state in a batch-wise first polymerizer equipped with a partial condenser to subject the diamine and the dicarboxylic acid to polycondensation at a predetermined molar ratio to produce a middle-stage polyamide having a relative viscosity of 1.4 to 2.7, the diamine having a boiling point higher than a melting point of the middle-stage polyamide under an inner pressure of the first polymerizer; (3) a step of feeding the middle-stage polyamide from the first polymerizer into a continuous second polymerizer while controlling a change of relative viscosity of the middle-stage polyamide in the first polymerizer within xc2x10.2 by maintaining a vapor phase portion of the first polymerizer at a predetermined pressure by saturated steam; and (4) a step of subjecting the middle-stage polyamide in the second polymerizer to a further polycondensation while removing water from a molten reaction system under reduced pressure, thereby producing a later-stage polyamide.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Little Rockstar
Contact Breeder Today!
Little Rockstar
Located in San Jose, CA of Santa Clara County.
Thank you for your interest in Little Rockstar. Little Rockstar is a breeder of Shih Tzus in San Jose, CA. San Jose is located in Santa Clara County. Please contact this breeder using the Inquiry form on the right to learn about pricing, colors, shipping, health guarantees, availability and more!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
---
abstract: 'In this paper, we show that if $I$ is a matroidal ideal, then the ideal generated by the $i$-th multigraded shifts is also a matroidal ideal for every $i=0,\ldots,\projdim(I)$.'
address:
- |
Faculty of Mathematics and Computer Science\
Amirkabir University of Technology (Tehran Polytechnic)\
Tehran 15914\
Iran
- |
School of Mathematics\
Institute for Research in Fundamental Sciences (IPM) P. O. Box: 19395-5746\
Tehran\
Iran
author:
- Shamila Bayati
title: Multigraded Shifts of Matroidal Ideals
---
Introduction {#introduction .unnumbered}
============
Matroids, as an interesting subject at the center of combinatorics, made their way into commutative algebra through several ways including *matroidal ideals*. So it has been of interest to study free resolution of (poly)matroidal ideals and related invariants, see [@Ch; @CH; @JRV]. See also [@NPS; @T] where matroids and the theory of free resolutions are applied in favor of each other. If, in particular, we consider the multigraded free resolution which reflects the combinatorial structure, then more combinatorial information encoded in the resolution will be found out.
In this paper, our goal is to investigate whether the property of being matroidal is inherited by the ideals generated by multigraded shifts; a question which first came up about the mutligraded shifts of polymatroidal ideals during a discussion with Jürgen Herzog and Somayeh Bandari when we met in Essen in 2012.
Let $S=k[x_1,\ldots, x_n]$ be the polynomial ring in the variables $x_1,\ldots, x_n$ over a field $k$. We consider this ring with its natural multigrading where $\xb^{\ab}=x_1^{a_1}\ldots x_n^{a_n}$ is the unique monomial with multidegree $(a_1,\ldots a_n)$. Throughout, a monomial and its multidegree will be used interchangeably, and $S(\xb^\ab)$ will denote the free $S$-module with one generator of multidegree $\xb^{\ab}$. A monomial ideal $I\subseteq S$ has a (unique up to isomorphism) minimal multigraded resolution $$\mathbf{F}: 0 \rightarrow F_p \rightarrow \ldots \rightarrow F_1 \rightarrow F_0$$ with $$F_i=\bigoplus_{{\ab}\in \mathbb{Z}^n}S(\xb^\ab)^{\beta_{i,\ab}}.$$ The set of *$i$-th multigraded shifts* of $I$ is $$\{{\xb}^{\ab}| \,\, \beta_{i,\ab}\neq 0 \, \}.$$ The ideal generated by the $i$-th multigraded shifts of $I$ will be denoted by $J_i(I)$. We show that $J_i(I)$ can be obtained by taking $i$ times iterated adjacency ideals starting from $I$; see Section 2 for relevant definitions. On the other hand, we show that the adjacency ideal of a matroidal ideal is also matroidal. Therefore, we conclude that if $I$ is a matroidal ideal, then $J_i(I)$ generated by its set of $i$-th multigraded shifts is also a matroidal ideal for every $i=0,\ldots,\projdim(I)$.
Preliminaries
=============
In this section, we explain some terminology and facts that we shall use in this paper.
*1.1. Multigraded shifts for ideals with linear quotients*
Let $I$ be a monomial ideal in $S=k[x_1,\ldots,x_n]$. We denote its minimal set of monomial generators by $G(I)$. The ideal $I$ is said to have linear quotients if there exists an ordering $m_1,\ldots,m_r$ of the elements of $G(I)$ such that for all $i=1,\ldots,r-1$, the colon ideal $(m_1,\ldots,m_i):(m_{i+1})$ is generated by a subset of $\{x_1,\ldots , x_n\}$. After having fixed such an ordering, the set of each $m_i$ is defined to be $$\set(m_i)=\{k\in [n] \: \,\, x_k\in (m_1,\ldots,m_i):(m_i) \, \}.$$
Let $I$ have linear quotients with order $m_1,\ldots,m_r$ of the elements of $G(I)$. By [@HT Lemma 1.5] a minimal multigraded free resolution $\mathbf{F}$ of $I$ by mapping cone constructions can be described as follows: the $S$-module $F_i$ in homological degree $i$ of $\mathbf{F}$ is the multigraded free $S$-module whose basis is formed by monomials $m\xb^{\ab}$ with
> *$m\in G(I)$ and squarefree monomial $\xb^{\ab}$ such that $\supp(\xb^{\ab})$ is a subset of $\set(m)$ of cardinality $i$.*
Recall that we use monomials and their multidegree interchangeably, as well as squarefree monomials and their support. So in the rest of this paper, we will use some notions related to squarefree monomials for the subsets of $[n]$. In particular, if $B\subseteq [n]$ is the support of a squarefree monomial $m$, we write $\set(B)$ instead of $\set(m)$.
*1.2. Matroids*
In this subsection, we give the definition of matroids and some basic facts about them. See [@O] for a detailed materiel on matroid theory.
We denote the union of sets $B\cup \{b\}$ by $B+b$, and the difference of sets $B\setminus \{b\}$ by $B-b$.
A *matroid* $\mathcal{M}$ on a finite set $E$ is a nonempty collection $\mathcal{B}$ of subsets of $E$, called *bases*, with the following *exchange property*:
> If $B_1,B_2\in \mathcal{B}$ and $b_1\in B_1\setminus B_2$, then there exists $b_2\in B_2\setminus B_1$ such that $B_1-b_1+b_2\in \mathcal{B}$.
One may refer to this matroid by $\mathcal{M}=(E,\mathcal{B})$. If $B_2=B_1-b_1+b_2$, it is said that $B_2$ is obtained from $B_1$ by a pivot step: $b_1$ is pivoted out and $b_2$ is pivoted in. It is known that bases of $\mathcal{M}$ possess the following *symmetric exchange property*:
> If $B_1,B_2\in \mathcal{B}$ and $b_1\in B_1\setminus B_2$, then there exists $b_2\in B_2\setminus B_1$ such that $B_1-b_1+b_2$ and $ B_2-b_2+b_1$ are both in $\mathcal{B}$.
It is a known fact that all the bases of a matroid have the same cardinality. Associated to a matroid $\mathcal{M}=(E,\mathcal{B})$, its *basis graph* $\BG(\mathcal{M})$ is defined as follows: the vertex set of $\BG(\mathcal{M})$ is $\mathcal{B}$, and two vertices $B_1$ and $B_2$ are adjacent if $|B_1\setminus B_2|=|B_2\setminus B_1|$=1. If $B_2$ is obtained from $B_1$ by $b_1$ pivoted out and $b_2$ pivoted in, then an edge label $b_1b_2$ represents this pivot step diagrammatically as follows:
(-2,-0.5)(2,1) (-1.4,0)(1.2,0) (-1.4,0)(1.2,0) (-1.87,0)[$B_1$]{} (1.87,0)[$B_2$]{} (0,0.4)[$b_1b_2$]{}
Due to the above mentioned exchange property, matroid basis graphs are connected. A graph is called a *matroid basis graph* if its vertices could be labeled by bases of some matroid to be its basis graph.
Let $G=(V,E)$ be a graph. Recall that the *distance* $d(v_1,v_2)$ between two vertices $v_1,v_2\in V$ is the length of a shortest path between them, if one exists. An *induced subgraph* of $G$ is a graph whose set of vertices is a subset $W$ of $V$ and two vertices of $W$ are adjacent exactly when they are adjacent in $G$.
The following result is clear, for example by the argument applied in the proof of [@Maurer Lemma 1.4] or directly by the symmetric exchange property for bases of a matroid.
\[d=2\] Let $\mathcal{M}=(E,\mathcal{B})$ be a matroid. Suppose that $B_1, B_2\in \mathcal{B}$ are two vertices of the associated basis graph at a distance of two, and $$B_2=B_1-(e_1+e_2)+(f_1+f_2).$$ Then $B_1$ and $B_2$ have at least two common neighbors $C_1, C_2\in \mathcal{B}$ which on the way from $B_1$ to $B_2$, $e_1$ is pivoted out from one of them and $e_2$ from the other, and also $f_1$ is pivoted in one of them and $f_2$ in the other.
A squarefree monomial ideal $I$ in $S=k[x_1,\ldots,x_n]$ is said to be a *matroidal ideal* if $$\{\supp(m)| m\in G(I)\}$$ is the set of bases for some matroid. Matroidal ideals are generated in a single degree, and by [@MM Theorem 1.3] they have linear quotients with respect to the lexicographical order of the generators with $x_1>x_2>\cdots>x_n$.
Multigraded shifts of matroidal ideals
======================================
Let $I$ be a monomial ideal in $S=k[x_1,\ldots,x_n]$ generated in a single degree. Suppose that $G(I)=\{m_1,\ldots m_r\}$, and consider the distance between these monomials in the sense of [@CH], that is, $$d(m_i,m_j)=\frac{1}{2}\sum_{k=1}^n|\nu_k(m_i)-\nu_k(m_j)|,$$ where for a monomial $m=x_1^{a_1}\ldots x_n^{a_n}$, one has $\nu_k(m)=a_k$. We associate a graph $G_I$ to $I$ whose set of vertices is the set of generators $G(I)$, and two vertices $m_i$ and $m_j$ are adjacent if $d(m_i,m_j)=1$. In particular, $G_I$ can be considered as a matroid basis graph when $I$ is a matroidal ideal. We define the *adjacency ideal* of $I$, denoted by $\A(I)$, to be the monomial ideal generated by the least common multiples of adjacent vertices in $G_I$, that is, $$\A(I)=\langle \lcm(m_i,m_j):\,d(m_i,m_j)=1 \rangle \subseteq k[x_1,\ldots,x_n].$$ One should notice that when $I$ is an ideal generated in a single degree with linear quotients, then the ideal $J_1(I) $, generated by its set of first multigraded shifts, is exactly its adjacency ideal. In particular, this implies that if $I$ is a squarefree monomial ideal, then so is $J_1(I)$.
\[label.edge\] Let $I$ be a matroidal ideal. Then its adjacency ideal $\A(I)$ is also a matroidal ideal.
Let $\mathcal{M}=([n],\mathcal{B})$ be the matroid corresponding to $I$. Recall that we use squarefree monomials in $k[x_1,\ldots,x_n]$ and subsets of $[n]$ interchangeably. Consider two arbitrary distinct elements $B+e, C+f\in \A(I)$ with $B,C\in \mathcal{B}$, $e\in \set (B)$, and $f\in\set(C)$. Since $e\in \set (B)$, there exists $B'\in \mathcal{B}$ and $e'\in B\setminus B'$ such that $$B+e=B'+e'
% \,\,\,\,\,\,\,\, { and }\,\,\,\,\,\,\,\, C_1+c_2=C_2+c_1.$$ We check the exchange property for the elements $B+e$ and $C+f$, that is, for each element $b\in (B+e)\setminus (C+f)$, we find an element $$\begin{aligned}
\label{element}
c\in (C+f)\setminus (B+e) \,\,\,\,\,\,\text{ such that } \,\,\,\,\,\, B+e-b+c\in \A(I).\end{aligned}$$ For such an element $b$, we may assume that $b\neq e$. Because if $b=e$, we can proceed by the other presentation, namely $B'+e'$. By this assumption, we have $b\in B\setminus C $. Therefore, by the exchange property for bases of $\mathcal{B}$, the following set is not empty: $$T=\{\tilde{c}\in C\setminus B \:\,\,\, B-b+\tilde{c}\in \mathcal {B}\}.$$ There exists two cases:
*Case 1.* First suppose that $e\in T$. So $B_1= B-b+e\in \mathcal{B}$. If $B_1=C$, then $f\neq b$ because $B+e$ and $C+f$ are distinct elements. So on one hand, $f\not\in B$. On the other hand, $f\neq e$ because $f\not\in C$. So the choice of $c=f$ for which $B+e-b+f=C+f\in \A(I)$, has the required properties mentioned in (\[element\]), and we are done. Otherwise, if $B_1\neq C$, there exists $b'\in B_1\setminus C$, and consequently by the exchange property, there exists an element $c\in C\setminus B_1$ such that $$B_2=B_1-b'+c\in \mathcal{B}.$$ The distinct vertices $B_1$ and $B_2$ of the basis graph are adjacent. This implies that $B+e-b+c=B_1\cup B_2\in \A(I)$. Therefore, this element $c$ is an appropriate choice for (\[element\]).
*Case 2.* Next suppose that there exists an element $c\in T$ such that $c\neq e$. Thus $B_1=B-b+c\in \mathcal{B}$. If $b=e'$, then the vertex $B_1$ becomes adjacent to $B'$ by $e$ pivoted out and $c$ pivoted in; see the induced subgraph in Figure \[0\]. Recall that the edge labels show the pivot steps. Since $B'$ and $B_1$ are adjacent, one has $$B+e-b+c=B+e-e'+c=B'\union B_1\in \A(I),$$ as required in (\[element\]).
If $b\neq e'$, then $B'= B_1-(e'+c)+(e+b)$. Therefore, $d(B,B_2)=2$ because $\{e',c\}$ and $\{e,b\}$ are disjoint sets of cardinality two. So by Lemma \[d=2\], there exist a common neighbor $B_2$ of $B_1$ and $B'$ by $e$ pivoted in, namely $B_2=B_1-e'+e$ or $B_2=B_1-c+e$. In any case $B+e-b+c=B_1\union B_2\in \A(I)$, as desired.
(-3,-0.5)(3,4) (-2,0)(2,0)(0,3) (-2,0)(2,0)(0,3)(-2,0) (-2.5,-0.15)[$B'$]{} (2.4,-0.15)[$B_1$]{} (0,3.4)[$B$]{} (-1.35,1.65)[$ee'$]{} (1.45,1.5)[$bc{=}e'c$]{} (0,-0.4)[$ec$]{}
Considering the lexicographical order with respect to $x_1>\cdots>x_n$ on the squarefree monomials in $k[x_1,\ldots,x_n]$ , we have an induced total order on subsets of $[n]$. More precisely, we set $B>_{lex} C$ for subsets $B,C\subseteq [n]$ exactly when $m_B>_{lex} m_C$ for squarefree monomials $m_B$ and $m_C$ with $\supp(m_B)= B$ and $\supp(m_C)= C$ . For simplicity, we denote $\{i\}>_{lex}\{j\} $ by $i>_{lex}j$ for $i,j\in [n]$ which is the case exactly when $i<j$ with ordinary order of integers.
\[main\] Let $I$ be a matroidal ideal. Then the ideal $J_{\ell}(I)$ generated by the set of $\ell$-th multigraded shifts of $I$ is also a matroidal ideal for all $ \ell=0,\ldots ,\projdim(I)$.
Let $\mathcal{M}=([n],\mathcal{B})$ be the matroid corresponding to $I$. So $$\mathcal{B}=\{\supp(m)\:\, m\in G(I)\,\}.$$ Assume that elements of $G(I)$ are ordered decreasingly in the lexicographical order with respect to $x_1>\cdots>x_n$. With respect to this order of generators we consider $\set(m)$ for each $m\in G(I)$.
We prove the assertion by induction on $\ell$. One has $J_0(I)=I$, and so matroidal. The ideal $J_1(I)$ is matroidal as well by Lemma \[label.edge\]. Let $J_{\ell}(I)$ be matroidal for $\ell \leq k$. We show that for $k\geq 1$, $J_{k+1}(I)$ is the adjacency ideal of $J_k(I)$, and consequently a matroidal ideal by Lemma \[label.edge\].
First, consider an element $U=B+e_1+\cdots+e_{k+1} \in J_{k+1}$ with $B\in \mathcal{B}$ and $e_1,\ldots,e_{k+1}\in \set(B)$. Then $U$ is the union of adjacent vertices $B+e_1+\cdots+e_k$ and $B+e_1+\cdots+e_{k-1}+e_{k+1}$ of the basis graph of $J_k(I)$. Thus, $U$ is in the adjacency ideal of $J_k(I)$.
Next we show that the adjacency ideal of $J_{k}(I)$ is a subset of $J_{k+1}(I)$. Let $$U=B+e_1+\cdots+e_k$$ and $$V=C+f_1+\cdots+f_k$$ be two elements of $J_k(I)$ with $B,C\in \mathcal{B}$, $e_1,\ldots,e_k \in \set(B)$, and $f_1,\ldots,f_k \in \set(C)$. Suppose that $d(U,V )=1$, that is, they are adjacent vertices in the basis graph of $J_{k}(I)$. We show that $U\cup V$, corresponding to the monomial $lcm(\xb_U,\xb_V)$, is indeed a union of an element of $D\in \mathcal{B}$ and a subset of cardinality $k+1$ of $\set(D)$, so belongs to $J_{k+1}(I)$.
We have $d(U,V )=1$. Therefore, $V=C+f_1+\cdots+f_k$ has exactly one element outside of $U=B+e_1+\cdots+e_k$, say $v$. The element $v$ belongs to some $C'\in \mathcal{B}$. Hence by the symmetric exchange property there exists $b\in B\setminus C'$ such that $$B'=B-b+v \in \mathcal{B}.$$ If there exists an element $t\in B$ such that $v>_{lex}t$ and $B-t+v\in \mathcal{B}$, then $B-t+v>_{lex}B$, and consequently $v\in \set(B)$. Thus $U\union V=B+e_1+\cdots+e_k+v\in J_{k+1}(I)$, as desired. So we assume that for each $t\in B$, if $B-t+v\in \mathcal{B}$, then $t>_{lex}v$. In particular, $b>_{lex}v$. This implies that $B>_{lex} B'$ and $b\in \set(B')$. We will show that $e_i\in \set (B')$ for all $i=1,\ldots,k$. So $$U\union V=B'+b+e_1+\cdots+e_k\in J_{k+1},$$ and we are done.
For this purpose, fix $i=1,\ldots,k$. Since $e_i\in \set(B)$, there exists $t_i\in B$ such that $e_i>_{lex}t_i$ and $B_i=B-t_i+e_i\in \mathcal{B}$. If $t_i=b$, then $B_i$ and $B'$ are adjacent vertices in the basis graph of $\mathcal{M}$. See Figure \[adjacent\]. More precisely, $B_i=B'-v+e_i$. Notice that $e_i>_{lex} t_i=b >_{lex} v$. Hence $B_i>_{lex} B'$ and $e_i\in \set(B')$.
(-3,-0.5)(5,3.5) (-1.5,0)(1.5,0)(2.5,3) (-1.5,0)(1.5,0)(2.5,3)(-1.5,0) (-2,-0.15)[$B'$]{} (1.85,-0.15)[$B_i$]{} (2.8,3.2)[$B$]{} (0,1.65)[$vb$]{} (2.3,1.5)[$e_it_i$]{} (0,-0.4)[$ve_i$]{}
If $t_i\neq b$, then $\{t_i,v\}$ and $\{e_i,b\}$ are disjoint sets of cardinality two. Therefore, $d(B_i,B')=2$ because $B_i=B'-(t_i+v)+(e_i+b)$. By Lemma \[d=2\], there exists a common neighbor of $B_i$ and $B'$ in the basis graph by $t_i$ pivoted out, namely $B'-t_i+e_i$ or $B'-t_i+b$. If we have the common neighbor $B'-t_i+e_i\in \mathcal{B}$, then the desired conclusion follows. Because $e_i>_{lex} t_i$ implies that $B'-t_i+e_i>_{lex} B'$, and we obtain that $e_i\in \set(B')$. So assume that $B'-t_i+e_i\not\in \mathcal{B}$. Thus there exists the common neighbor $B'-t_i+b\in \mathcal{B}$ by $t_i$ pivoted out. See the induced subgraph in Figure \[nonadj\]. Notice that $$B'-t_i+b=(B-b+v)-t_i+b=B+v-t_i.$$
(-3,-2)(4,3.2) (-2,0)(-0.3,-1.5)(2,0)(2.5,2.3)(-0.3,2) (-2,0)(2.5,2.3)(2,0) (-2,0)(-0.3,2)(2,0)(-0.3,-1.5)(-2,0) (-0.3,2)(2.5,2.3)(-0.3,-1.5) (2.6,1.3)[$e_it_i$]{} (-0.3,1.28)[$vb$]{} (4,2.6)[$B{=}B'{-}v{+}b$]{} (2.45,0)[$B_i$]{} (-2.4,0)[$B'$]{} (-0.8,2.4)[$B'{-}t_i{+}b$]{} (-0.6,-1.8)[$B'{-}v{+}e_i$]{}
Recall that we assume that whenever $B-t+v\in \mathcal{B}$ for some $t\in B$, then $t>_{lex} v$. Thus $t_i>_{lex} v$. So far we only have common neighbors of $B_i$ and $B'$ by $b$ pivoted in, namely $B=B'-v+b$ and $B'-t_i+b$. Therefore, we must have the common neighbor $B'-v+e_i$ in $\mathcal{B}$ for which $e_i$ pivoted in. On the other hand, $e_i>_{lex} t_i >_{lex} v$. Hence also in this case, we have $e_i\in \set(B_i)$.
By the argument applied in proof of Theorem \[main\], we have the following result.
Let $I$ be a matroidal ideal. Then $J_{\ell}(I)$ is obtained by taking $\ell$ times iterated adjacency ideals starting from $I$.
H. Chiang-Hsieh, *Some arithmetic properties of matroidal ideals*, Commun. Algebra 38(2010), Iss. 3, 944–-952.
A. Conca, J. Herzog, *Castelnuovo-–Mumford regularity of products of ideals*, Collect. Math. 54 (2003) 137–-152.
J. Herzog, T. Hibi, [*Monomial ideals*]{},. Graduate Texts in Mathematics, 260. Springer-Verlag London, Ltd., London, 2011.
J. Herzog, Y. Takayama, *Resolutions by mapping cones*, The Roos Festschrift volume 4, Homology, Homotopy and Applications, (2002), no. 2, part 2, 277–294.
T. Johnsen, J. Roksvold, H. Verdure, *Betti numbers associated to the facet ideal of a matroid*, Bull Braz Math Soc, New Series 45 (2014), Iss. 4, 727–-744.
S.B. Maurer, *Matroid base graphs.* I, J. Combinatorial Theory (B), 14 (1973), 216–240.
F. Mohammadi, S. Moradi, [*Weakly polymatroidal ideals with applications to vertex cover ideals*]{}, Osaka J. Math. 47 (2010), no. 3, 627–-636.
I. Novik, A. Postnikov, B. Sturmfels, *Syzygies of oriented matroids*, Duke Math. J., 111 (2002), no. 2, 287–-317.
J. G. Oxley; [*Matroid Theory*]{}, Oxford University Press, PSA, 2006.
A. B. Tchernev, *Representations of matroids and free resolutions for multigraded modules*, Advances in Math. 208 (2007), Iss. 1, 75–134.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Background
==========
Accumulation of amyloid β-peptides (Aβ) in the brain is believed to contribute to the development of Alzheimer disease (AD). Soluble oligomeric forms of Aβ are neurotoxic \[[@B1]-[@B3]\]. Aβ, a 40--43 amino acid-comprising proteolytical fragment of the amyloid precursor protein (APP), is released from APP by sequential cleavages via β- and γ-secretases. However, the predominant route of APP processing consists of successive cleavages by α- and γ-secretases. Alpha-secretase attacks APP inside the Aβ sequence, and therefore prevents formation of neurotoxic Aβ. In addition, the soluble N-terminal domain of APP (APPsα) is released, which has neurotrophic and neuroprotective properties \[[@B4],[@B5]\], and enhances LTP \[[@B6]\]. In behavioral paradigms, APPsα was demonstrated to improve memory in normal and amnesic mice \[[@B7]\]. Reduced amounts of APPsα were detected in the cerebrospinal fluid of AD patients \[[@B8],[@B9]\].
Proteinases of the ADAM ([ad]{.ul}isintegrin [a]{.ul}nd [m]{.ul}etalloproteinase) family are main candidates for physiologically relevant α-secretases, and we demonstrated that ADAM10 has α-secretase activity *in vitro*and in cultured cells \[[@B10]\]. ADAM10-deficient mice have been generated \[[@B11]\], but their early lethality at day E9.5 prevents a reliable analysis of ADAM10\'s α-secretase function *in vivo*, especially in neuronal cells.
To investigate whether an increase in activity of putative α-secretases *in vivo*prevents plaque formation and cognitive deficits, we generated transgenic mice overexpressing either the α-secretase ADAM10 (ADAM10 mice) or the catalytically inactive ADAM10~\[E384A\]~mutant (dnADAM10 mice) \[[@B12]\]. Neuronal overexpression of ADAM10 had no detrimental effects on ADAM10 single-transgenic mice: these animals exhibited normal behavioral abilities \[[@B13]\]. We found that a moderate neuronal overexpression of ADAM10 in mice carrying the human APP~\[V717I\]~mutation (ADAM10/APP~\[V717I\]~mice) increased the secretion of APPsα, reduced the formation of Aβ peptides, and prevented their deposition in plaques. Functionally, impaired long-term potentiation and cognitive deficits were alleviated. Expression of dominant-negative ADAM10~\[E384A\]~in APP~\[V717I\]~mice (dnADAM10/APP~\[V717I\]~mice) led to reduction of APPsα and to enhancement of the number and size of amyloid plaques in the brain \[[@B12]\].
Histological analyses of mono-transgenic ADAM10 mice revealed an increase in cortical cholinergic, glutamatergic and GABAergic presynaptic bouton densities in 8 months old mice; the cholinergic presynaptic bouton density remained elevated even during aging in ADAM10 mice \[[@B14]\].
In addition to their metalloproteinase domain, ADAMs contain a disintegrin domain as a modulator of cell-cell and cell-matrix interactions \[[@B15]\]. As ADAM10 itself has been reported to be a substrate for ectodomain shedding by ADAM9 and subsequent cleavage by γ-secretase, the C-terminus of ADAM10 may represent a Notch-like signaling molecule \[[@B16]\]. Thus, independent of the catalytic activity of ADAM10, which has been implicated in Notch and β-catenin signaling, ADAM10 may also modulate gene expression via other domains.
To analyze the influence of ADAM10 and its dominant-negative form (dnADAM10) on the gene expression profile of the central nervous system (CNS), we investigated ADAM10 and dnADAM10 mice. We included in our study the double-transgenics ADAM10/APP~\[V717I\]~and dnADAM10/APP~\[V717I\]~. Since APP~\[V717I\]~mice show early phenotype changes (between months 4 and 7), we investigated the gene expression in 5 months old mice.
Methods
=======
Animals
-------
Animal husbandry was performed in accord with the guidelines of the German Council on Animal Care. All mouse strains (strain background FVB/N) analyzed in this study have been described previously \[[@B12]\]. The expression level of transgenic mature ADAM10 is 30% above endogenous levels and in dnADAM10 mice the expression of the catalytically inactive ADAM10 mutant is sevenfold above endogenous ADAM10 \[[@B12]\]. ADAM10 activity was determined in previous studies \[[@B12],[@B17]\] by quantitation of the APP cleavage product APPsα. In ADAM10 overexpressing mice the catalytic activity of ADAM10 against its substrate APP~\[V717I\]~was increased to about 250%. In mice overexpressing dnADAM10, the endogenous APP~\[V717I\]~cleavage activity was reduced to about 25% as compared to APP~\[V717I\]~mice \[[@B12]\].
For the first experimental series of the present study, female ADAM10, dnADAM10 and FVB/N wild-type mice were investigated; for the second series, female and male ADAM10/APP~\[V717I\]~, dnADAM10/APP~\[V717I\]~and APP~\[V717I\]~mice were compared. In each case, brains of three 5 months old animals of each group were dissected and stored in RNA-later (Qiagen, Hilden, Germany) at -80°C to prevent RNA degradation.
RNA preparation and microarray analyses
---------------------------------------
Total RNA from whole mouse brains was isolated by using the RNeasy Kit (Qiagen, Hilden, Germany), including on-column DNase I digestion according to the manufacturer\'s recommendations. The quality of isolated RNA was controlled by the Lab-on-Chip-System Bioanalyser 2100 (Agilent Technologies Inc., Palo Alto, CA, USA).
The expression-profiling analysis for mono-transgenic mice (ADAM10, dnADAM10 mice and non-transgenic FVB/N control animals) was carried out at RZPD (Berlin, Germany). Samples from double-transgenic mice (ADAM10/APP~\[V717I~, dnADAM10/APP~\[V717I\]~and mono-transgenic APP~\[V717I\]~control mice) were analyzed at the Microarray Facility (Tübingen, Germany). In all cases, the Mouse Genome 430 2.0 Array (Affymetrix, Santa Clara, CA, USA) containing 45000 probe sets of 34000 genes was used for mRNA expression profiling.
Statistical analysis and gene annotations
-----------------------------------------
For the first series (mono-transgenic mice) 9 gene chip arrays and for the second series (double-transgenic mice) 18 gene chip arrays were analyzed. Data mining was performed by using the ChipInspector analysis software (Genomatix, Munich, Germany), which identifies significant changes based on single probes. The corresponding transcripts were then assigned after a user-defined number of significant probes. For all analyses, a transcript coverage greater than three probes was chosen. By this strategy, annotation errors and errors caused by the existence of alternative transcripts are reduced.
After total intensity normalization of each array, significantly changed genes were determined by significance analysis of microarrays (SAM) \[[@B18]\], using the exhaustive comparison mode at a false discovery rate (FDR) of 0.0% for double-transgenic, and 0.5% for mono-transgenic mice. For separate analysis of samples from double-transgenic female and male mice, a FDR of 1.3% was chosen. The resulting gene lists were restricted to the 600 most strongly regulated genes (up- as well as downregulated genes).
Regulated genes were then analyzed with the Bibliosphere software (Version 5.02; Genomatix, Munich, Germany) and mapped to Gene Ontology (GO) trees in order to identify their biological function. For identification of over-represented GO terms, the Bibliosphere software calculates a z-score for each term. The z-score represents the difference between observed and expected annotations, and is normalized to the standard deviation of a hypergeometric distribution. Only GO terms with a z-score \> 1.96, which corresponds to a p-value of 0.05, have been considered.
To identify transcripts which are affected by ADAM10 and dnADAM10 overexpression in mono- and double-transgenic mice, we generated Venn diagrams with SAM-based gene lists. The expression profile of selected significantly regulated genes from microarrays was represented by heat maps using the R statistical software <http://www.r-project.org>. Hierarchical clustering was applied to investigate whether expression values can be separated according to experimental groups. In this study, two heat maps were generated: one compared the expression profiles of genes in ADAM10 and dnADAM10 mono-transgenic mice, as well as in FVB/N non-transgenic control mice; a second one compared the expression profiles of double-transgenics and APP~\[V717I\]~mice.
Because the two series of expression arrays were measured in different laboratories, a global normalization procedure was needed to make them comparable. The default background noise adjustment, provided by the Affymetrix system, is based on the difference of perfect matching probes (PM) minus mismatching probes (MM). Due to unspecific binding, the global background adjustment method robust multi-array average (RMA) expression measure, which ignores the MM intensities, has been developed \[[@B19]\]. Because RMA adjustment does not completely remove unspecific intensities \[[@B20]\], an enhanced method denoted GeneChip RMA (GCRMA) has been designed \[[@B21]\] which considers the sequence of probes.
We performed background adjustment as well as quantile normalization for all data sets (raw format, cell files) with the GCRMA method (standard settings) by using the CARMAweb interface \[[@B22]\]. Subsequently, an unpaired two-tailed Student\'s t-test was applied for each respective gene to determine whether it is differentially expressed in the two sample groups. Since microarray analysis operates with large numbers of multiple comparisons, a false discovery rate-controlling method has to be applied. Therefore, by using the Benjamini-Hochberg (BH) method, adjusted p-values were calculated \[[@B23]\].
The GCRMA method is also appropriate for detection of minor changes in gene expression, and was required for comparative analysis of mono- and double-transgenic mice, due to the low intensities of the microarrays from the first series (mono-transgenic mice) as compared to those of the second series (double-transgenic mice). By comparing data derived from mono- and double-transgenic mice, we analyzed global biological trends of ADAM10 and dnADAM10 overexpression in FVB/N and FVB/N APP~\[V717I\]~strain backgrounds.
To identify transcripts which were commonly affected by APP~\[V717I\]~overexpression in all double-transgenic mice, we generated a Venn diagram with GCRMA-based gene lists (BH\<0.005).
Quantitative real-time RT-PCR
-----------------------------
A two-step real-time reverse transcription (RT)-PCR was used to measure the expression of candidate genes. Isolated total RNA (1 μg) was used to synthesize cDNA in a 20 μl reaction with the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer\'s manual. By adding water, the reaction volume was subsequently increased to 500 μl. Real-time RT-PCR was carried out in 96-well plates, using the 7000 ABI prism sequence detection system (Applied Biosystems, Darmstadt, Germany) and QuantiTect Primer Assays (Qiagen, Hilden, Germany). The primers for selected candidate genes are listed in table [1](#T1){ref-type="table"}.
######
QuantiTect Primer Assays (Qiagen, Hilden, Germany)
**Gene name** **Gene ID** ***Assay***
---------------------------------------------------- ------------- -------------------
ADAM10 11487 *Mm_Adam10_1\_SG*
Fatty acid binding protein 7 12140 *Mm_Fabp7_1\_SG*
Calcium binding protein S100a9 20202 *Mm_S100a9_1\_SG*
Calcium binding protein S100a8 20201 *Mm_S100a8_1\_SG*
Glutamate receptor, ionotropic, AMPA1 14799 *Mm_Gria_1\_SG*
Glutamate receptor, ionotropic, AMPA2 14800 *Mm_Gria2_1\_SG*
Low density lipoprotein receptor-related protein 1 16971 *Mm_Lrp1_1\_SG*
Very low density lipoprotein receptor 22359 *Mm_Vldlr_1\_SG*
Microtubule-associated protein tau 17762 *Mm_Mapt_1\_SG*
Neuroligin 1 192167 *Mm_Nlgn1_1\_SG*
GAPDH 14433 *Mm_Gapdh_2\_SG*
Real-time RT-PCR reactions in a volume of 30 μl were performed in duplicate or triplicate under the following conditions: 5 μl of diluted cDNA (see above), 15 μl 2× QuantiTect PCR master mix (Qiagen, Hilden, Germany) and 300 nM of respective primer pair. After the initial denaturing and enzyme activation step (95°C for 15 min), 40 cycles (94°C for 15s, 55°C for 30s, and 72°C for 30s) were performed. A single DNA melting profile was observed in dissociation assay conditions demonstrating amplification of a unique product free of primer dimers.
For detection of Hes5 in 15 day old mice a one step Real-time RT-PCR was performed using the QuantiTect-SYBR-Green One-Step-RT PCR-Kit (Qiagen, Hilden, Germany) and 250 ng RNA in a reaction volume of 30 μl. The specific primer pair was as follows: Hes5RT_for 5\'GAAAAACCGACTGCGGAAGCC3\' and Hes5RT_rev 5\'ACGGCCATCTCCAGGATGTC3\'.
For data analysis, the threshold cycle (Ct) which indicates the relative abundance of a particular transcript, was calculated. Standard curves were generated by amplification of serially diluted cDNA. According to this method, the amount of all relevant genes was normalized to the amount of endogenous GAPDH present in the same sample. Measured values from control samples (non-transgenic FVB/N mice or mono-transgenic APP~\[V717I\]~mice) were set to 100%. Changes in gene expression are presented as the mean of alteration ± SD. The data were analyzed for statistical significance using one-way ANOVA (\*, p \< 0.05; \*\*, p \< 0.01; \*\*\*, p \< 0.001).
Western blotting
----------------
Mouse brain tissue was stored on dry ice immediately after dissection. Ice-cold TRIS buffer (20 mM Tris/HCl, pH 8.5) containing proteinase inhibitors (Inhibitor complete mini, Roche Diagnostics Corp., Mannheim, Germany) was added, and tissue was homogenized in a tissue lyser (Qiagen, Hilden, Germany). The supernatants resulting from centrifugation at 34000 rpm for 1.75 hours were separated on 14% SDS-gels and transferred to nitrocellulose membrane by tank blot system (40 μg protein per sample). For the detection and quantification of soluble FABP7 antibody AB9558 (Chemicon, Temecula, USA), and the appropriate horseradish peroxidase-coupled secondary antibody (Pierce, Rockford, USA) were used.
ELISA
-----
Hemispheres of mouse brain were weighed, proteins extracted and calprotectin (S100a8/a9) was quantified as recommended by the ELISA manufacturer (Immundiagnostik, Bensheim, Germany). In brief, tissue was homogenized in extraction buffer for 2 min at 20 Hz in a tissue lyzer and extraction was performed for 20 min at 4°C under agitation. After centrifugation (14000 rpm, 15 min) the supernatant and protein standards were added to microtiter plates in a total volume of 100 μl in duplicates. Incubation of the plate and measurement of optical densities at 405 nm were performed following the manufacturer\'s instructions. The relative amount of calprotectin was calculated by division of background-corrected values by wet tissue weight.
Results
=======
Microarray analysis of gene regulation in ADAM10-transgenic mice
----------------------------------------------------------------
We performed microarray analysis with cDNA transcribed from total RNA of the brains of mice aged five months. Mono-transgenic ADAM10 as well as dnADAM10 mice were investigated in comparison to non-transgenic FVB/N wild-type mice (n = 3 females), to analyze the influence of the α-secretase ADAM10 or its catalytically inactive form (dnADAM10) on the gene expression profile of the CNS.
To elucidate the effect of ADAM10 and dnADAM10 on gene expression in an APP background, we compared samples derived from double-transgenic ADAM10/APP~\[V717I\]~and dnADAM10/APP~\[V717I\]~mice with those from mono-transgenic APP~\[V717I\]~mice. Because we wanted to test whether the modulation of ADAM10 activity might be a risk to the adult organism in respect to future therapeutic approaches, we chose 5 months old mice for our investigations. At this age, APP~\[V717I\]~animals show cognitive deficits, whereas amyloid plaque formation occurs several months later \[[@B24]\].
The SAM plots in Fig. [1](#F1){ref-type="fig"} represent the distribution of all probe signals on the microarray chip. Depending on the statistical stringency (FDR, delta) as represented by the red lines, significant probes are selected. Probe signals between the red lines are not significant, signals above the upper line correspond to significantly upregulated genes; signals below the lower line correspond to significantly downregulated genes. Tables [2](#T2){ref-type="table"} and [3](#T3){ref-type="table"} show the numbers of these differentially expressed genes.
######
Numbers of significantly regulated genes in mono-transgenic mice (5 months, 3 females per group) restricted by the given d-values.
---------------------------------------------------------------------------------------------------------------------------
**Mouse Genome 430 2.0 Array (Affymetrix)**
--------------------------------------------- ------------------------------------ ------------------- --------------------
ADAM10 versus FVB/N (wild-type)\ dnADAM10 versus FVB/N (wild-type)\
355 genes, FDR = 0.5% 143 genes, FDR = 0.5%
300 upregulated\ 55 downregulated\ 50 upregulated\ 93 downregulated\
(d-value \> 2.23) (d-value \< -1.72) (d-value \> 1.43) (d-value \< -1.36)
---------------------------------------------------------------------------------------------------------------------------
######
Numbers of significantly regulated genes in double-transgenic mice (5 months, 3 females and 3 males per group) restricted by the given d-values.
--------------------------------------------------------------------------------------------------------------------------------------
**Mouse Genome 430 2.0 Array (Affymetrix)**
--------------------------------------------- ----------------------------------------------- ------------------- --------------------
ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~\ dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~\
592 genes, FDR = 0.0% 600 genes, FDR = 0.0%
295 upregulated\ 297 downregulated\ 300 upregulated\ 300 downregulated\
(d-value \> 2.06) (d-value \< -1.56) (d-value \> 3.29) (d-value \< -2.85)
--------------------------------------------------------------------------------------------------------------------------------------
![**Significance analysis of microarrays**. The SAM plots represent the differentially expressed genes of mono-transgenic (A and B with FDR 0.5), and double-transgenic mice (C and D with FDR 0.0). The Delta parameter, represented by red lines, defines the significance field (-1.72/+2.23 (A: ADAM10 versus FVB/N), -1.36/+1.43 (B: dnADAM10 versus FVB/N), -1.56/+2.06 (C: ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~), -2.85/+3.29 (D: dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~)). Shown above the upper line are the genes upregulated significantly, and below the lower line the genes downregulated significantly.](1471-2164-10-66-1){#F1}
The comparison of samples from ADAM10 and FVB/N mice revealed 355 differentially expressed genes: 300 genes were up- and 55 genes were downregulated. In dnADAM10 mice, the number of regulated genes was lower; as compared to FVB/N mice, 143 genes were differentially expressed. Among these, 50 genes were up- and 93 genes downregulated (Tab. [2](#T2){ref-type="table"}).
Against the background of APP~\[V717I\]~overexpression, generally more genes were found to be differentially expressed. As compared to APP~\[V717I\]~mice, 592 genes (295 up- and 297 downregulated) were differentially expressed in ADAM10/APP~\[V717I\]~mice, and more than 600 genes in dnADAM10/APP~\[V717I\]~animals (Tab. [3](#T3){ref-type="table"}). In the latter, the number of significantly regulated genes was restricted to 600, including the highest up- and downregulated genes. For the complete list of significantly regulated genes, see Additional file [1](#S1){ref-type="supplementary-material"}, Tables S1-S4. The data presented in this publication have been deposited in NCBI\'s Gene Expression Omnibus (GEO), and are accessible by the GEO Series accession numbers GSE10908 and GPL1261 <http://www.ncbi.nlm.nih.gov/geo/info/faq.html#deposit>.
For detection of transcripts that were commonly regulated by either ADAM10 or dnADAM10 overexpression in mono- and double-transgenic mice, Venn diagrams were generated with SAM-based gene lists (Fig. [2](#F2){ref-type="fig"}). The comparison of ADAM10 versus FVB/N (355 genes), and ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~(592 genes) revealed 29 genes which were regulated by ADAM10 overexpression in either mono- or double-transgenic mice (Additional file [1](#S1){ref-type="supplementary-material"}, Tab. S5). When dnADAM10 versus FVB/N (143 genes) and dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~, were compared, only eight genes were identified to be commonly regulated by dnADAM10 overexpression (Additional file [1](#S1){ref-type="supplementary-material"}, Tab. S6). This result indicates that the genetic background strongly influences the effect of ADAM10 on gene expression.
![**Venn diagrams with SAM-based gene lists of mono- and double-transgenic mice**. Venn diagram I (ADAM10 versus FVB/N (A) is compared with ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~(B)), and Venn diagram II (dnADAM10 versus FVB/N (A) is compared with dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~(B)), generated by a custom-written Perl-script, show the effects of the overexpression of ADAM10 and dnADAM10 in mono- and double-transgenic mice. The numbers in the space of overlapping circles represent the number of transcripts that were affected in both mouse lines.](1471-2164-10-66-2){#F2}
Common genetic profile in mono- and double-transgenic animals
-------------------------------------------------------------
Heat maps (Fig. [3](#F3){ref-type="fig"}) indicate that the chips of each series had their own characteristic genetic profile. For heat maps, genes of special interest were chosen (mono-transgenic mice: Adam10, Fabp7, S100a8, S100a9, Nlgn1; double-transgenic mice: Mapt, Gria1, Vldlr, Lrp1, Bace1, Psen1, Psen2, ApoE). The heat map in Fig. [3A](#F3){ref-type="fig"} reveals that in mice overexpressing bovine ADAM10, approximately the same amount of murine Adam10 is expressed as compared to wild-type mice (nearly all over yellow coloring). Fabp7 is distinctly higher expressed in all dnADAM10 mice (red color) in contrast to wild-type mice (orange color). The expression of Nlgn1 in ADAM10 and dnADAM10 mice is higher (yellow to green) than in FVB/N mice (green color)). Finally, S100a8 and S100a9 show lower expression in ADAM10 and dnADAM10 mice (blue color) in relation to FVB/N wild-type mice (yellow to blue). These results are in accordance with the observations made by the real-time RT-PCR as described below. Furthermore, hierarchical clustering showed that the expression profiles of the mono-transgenic mouse genes are separated to the original conditions. In the case of heat map in Fig. [3B](#F3){ref-type="fig"}, the small differences in the expression of Mapt, Gria1, Vldlr and Lrp1 are fitting to the results of real-time RT-PCR analyses as described below. Hierarchical clustering revealed that the expression profiles of double-transgenic mice genes are not clearly clustered according to the experimental settings, presumably due to the more complex conditions caused by APP overexpression. Also, a clear distinction between male and female mice could not be observed.
![**Heat map representing the clustering of genes in mono- and double transgenic mice**. A) ADAM10, dnADAM10 and FVB/N mice; B) AD10/APP~\[V717I\]~, dnAD10/APP~\[V717I\]~, and APP~\[V717I\]~mice. Selected significantly regulated genes on individual chips are shown. The upper graph (I) represents the hierarchical clustering, the colored scales (II) the difference in gene expression. Unsupervised cluster analysis showed that the expression profiles of mono-transgenic mouse genes (A) cluster according to the experimental conditions. In case of double-transgenic mice (B), cluster analysis revealed a more rough agreement in the discrimination of gene expression with experimental groups. The blue (lower expression) to red (higher expression) color scale indicates 2-based logarithms of the mean expression values of the single probes after ChipInspector normalization (Genomatix, Munich, Germany).](1471-2164-10-66-3){#F3}
ADAM10-regulated biological pathways
------------------------------------
For pathway analysis, the complete gene lists were analyzed with the Bibliosphere software (Genomatix) and mapped to Gene Ontology (GO) trees.
Functional groups are only listed when their z-score of individual GO-categories is higher than 1.96. With respect to the known cellular function of disintegrin metalloproteases in general, and the α-secretase activity of ADAM10 in particular, we investigated biological processes including cell communication (GO:0007154), nervous system development (GO:0007399), cell adhesion (GO:0007155) and cell death (GO:0008219). Furthermore, we examined neuron projection (GO:0043005), synaptic junction (GO:0045202) and transmission (GO:0007268). At the molecular level, we focused on receptor binding (GO:0005102) and receptor activity (GO:0004872) (Tab. [4](#T4){ref-type="table"}, [5](#T5){ref-type="table"}, [6](#T6){ref-type="table"}, [7](#T7){ref-type="table"}).
######
Significantly regulated genes in mono-transgenic ADAM10 mice in relation to FVB/N wild-type mice
**Gene ID** **Gene symbol** **Description** **Fold change** **log ratio** **d-value** **Functional groups**
------------- ----------------- ------------------------------------------------------------------------------------------------------- ----------------- --------------- ------------- ----------------------------------------------------------------------------------------
27360 Add3 adducin 3 (gamma) 1.519 0.603 2.841 receptor binding and activity
68465 Adipor2 adiponectin receptor 2 1.365 0.449 2.294 cell communication
11658 Alcam activated leukocyte cell adhesion molecule 1.471 0.557 2.298 nervous system development; neuron projection
211673 Arfgef1 ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) 1.503 0.588 2.644 cell communication
11855 Arhgap5 Rho GTPase activating protein 5 1.621 0.697 2.526 cell communication
98660 Atp1a2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 0.792 -0.337 -1.972 cell communication; synapse
11941 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1.734 0.794 2.717 cell communication; nervous system development; receptor binding and activity; synapse
22589 Atrx alpha thalassemia/mental retardation syndrome X-linked homolog (human) 1.507 0.592 2.876 nervous system development
30948 Bin1 bridging integrator 1 1.451 0.537 2.318 cell communication; synapse
12298 Cacnb4 calcium channel, voltage-dependent, beta 4 subunit 1.800 0.848 2.913 cell communication; synapse
12322 Camk2a calcium/calmodulin-dependent protein kinase II alpha 1.779 0.831 2.547 cell communication; receptor binding and activity; synapse
16149 Cd74 CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) 0.724 -0.466 -2.270 cell communication; cell death
212285 Centd1 centaurin, delta 1 1.569 0.650 2.530 cell communication
12633 Cflar CASP8 and FADD-like apoptosis regulator 1.393 0.478 2.497 cell death
12704 Cit citron 1.476 0.562 2.405 cell communication; nervous system development
12803 Cntf ciliary neurotrophic factor 1.496 0.581 2.355 cell communication; nervous system development
70086 Cysltr2 cysteinyl leukotriene receptor 2 1.307 0.386 2.251 cell communication
13618 Ednrb endothelin receptor type B 1.364 0.448 2.506 cell communication; nervous system development
13838 Epha4 Eph receptor A4 1.622 0.698 2.439 cell communication; nervous system development
67456 Ergic2 ERGIC and golgi 2 1.367 0.451 2.316 cell communication; synapse
14397 Gabra4 gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 4 1.542 0.625 2.316 cell communication; synapse
14417 Gad2 glutamic acid decarboxylase 2 1.636 0.710 3.290 cell communication; neuron projection; synapse
14674 Gna13 guanine nucleotide binding protein, alpha 13 1.502 0.587 2.257 cell communication
14677 Gnai1 guanine nucleotide binding protein, alpha inhibiting 1 1.576 0.656 2.911 cell communication
14680 Gnal guanine nucleotide binding protein, alpha stimulating, olfactory type 1.598 0.676 3.061 cell communication
53623 Gria3 glutamate receptor, ionotropic, AMPA3 (alpha 3) 1.480 0.566 2.388 synapse
56637 Gsk3b glycogen synthase kinase 3 beta 1.540 0.623 2.382 cell communication; cell death
15208 Hes5 hairy and enhancer of split 5 (Drosophila) 0.749 -0.416 -1.800 nervous system development
16419 Itgb5 integrin beta 5 0.786 -0.347 -2.185 cell adhesion; cell communication
16510 Kcnh1 potassium voltage-gated channel, subfamily H (eag-related), member 1 1.398 0.483 2.291 cell communication; receptor binding and activity
16561 Kif1b kinesin family member 1B 1.555 0.637 2.573 cell communication; synapse
16573 Kif5b kinesin family member 5B 1.904 0.929 3.186 neuron projection; synapse
16574 Kif5c kinesin family member 5C 1.656 0.728 2.463 nervous system development; neuron projection; synapse
110829 Lims1 LIM and senescent cell antigen-like domains 1 1.533 0.616 2.309 cell adhesion
108030 Lin7a lin-7 homolog A (C. elegans) 1.346 0.429 2.260 cell communication; synapse
319387 Lphn3 latrophilin 3 1.295 0.373 2.344 cell communication
16971 Lrp1 low density lipoprotein receptor-related protein 1 0.707 -0.500 -2.139 cell communication
16998 Ltbp3 latent transforming growth factor beta binding protein 3 0.791 -0.338 -2.180 cell communication; receptor binding and activity
50791 Magi2 membrane associated guanylate kinase, WW and PDZ domain containing 2 1.426 0.512 2.399 cell communication
192167 Nlgn1 neuroligin 1 1.518 0.602 2.386 cell communication; nervous system development; synapse
18549 Pcsk2 proprotein convertase subtilisin/kexin type 2 1.492 0.577 2.393 nervous system development
18573 Pde1a phosphodiesterase 1A, calmodulin-dependent 1.796 0.845 3.130 cell communication; receptor binding and activity
18596 Pdgfrb platelet derived growth factor receptor, beta polypeptide 0.800 -0.322 -1.867 cell communication
18613 Pecam1 platelet/endothelial cell adhesion molecule 1 0.778 -0.363 -2.093 cell communication
18795 Plcb1 phospholipase C, beta 1 1.652 0.724 3.345 cell communication
18798 Plcb4 phospholipase C, beta 4 1.480 0.566 2.451 cell communication
242083 Ppm1l protein phosphatase 1 (formerly 2C)-like 1.604 0.682 2.277 cell communication
26932 Ppp2r5e protein phosphatase 2, regulatory subunit B (B56), epsilon isoform 1.578 0.658 2.298 cell communication
19281 Ptprt protein tyrosine phosphatase, receptor type, T 1.409 0.495 2.354 cell communication
19328 Rab12 RAB12, member RAS oncogene family 1.250 0.322 2.259 cell communication
270192 Rab6b RAB6B, member RAS oncogene family 1.696 0.762 2.837 cell communication; synapse
56044 Rala v-ral simian leukemia viral oncogene homolog A (ras related) 1.582 0.662 2.544 cell communication
54409 Ramp2 receptor (calcitonin) activity modifying protein 2 1.693 0.760 2.640 cell communication
218397 Rasa1 RAS p21 protein activator 1 1.428 0.514 2.266 cell adhesion; cell communication; cell death
19737 Rgs5 regulator of G-protein signaling 5 1.677 0.746 2.390 cell communication
19894 Rph3a rabphilin 3A 1.470 0.556 2.352 synapse
68585 Rtn4 reticulon 4 1.542 0.625 2.344 cell death; nervous system development
20202 S100a9 S100 calcium binding protein A9 0.668 -0.582 -2.146 cell communication
20377 Sfrp1 secreted frizzled-related sequence protein 1 0.793 -0.335 -1.730 cell communication
239250 Slitrk6 SLIT and NTRK-like family, member 6 1.324 0.405 2.293 nervous system development
93761 Smarca1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1.309 0.388 2.351 nervous system development
66042 Sostdc1 sclerostin domain containing 1 0.725 -0.464 -1.768 cell communication
20742 Spnb2 spectrin beta 2 1.729 0.790 2.855 cell communication; receptor binding and activity
114716 Spred2 sprouty-related, EVH1 domain containing 2 1.514 0.598 2.653 cell communication
21961 Tns1 tensin 1 1.505 0.590 2.245 cell communication
22370 Vtn vitronectin 0.778 -0.362 -1.925 cell adhesion
22371 Vwf Von Willebrand factor homolog 0.715 -0.484 -2.099 cell adhesion
57750 Wdr12 WD repeat domain 12 1.391 0.476 2.446 cell communication
232341 Wnk1 WNK lysine deficient protein kinase 1 1.844 0.883 2.947 cell communication
22772 Zic2 Zinc finger protein of the cerebellum 2 1.941 0.957 3.062 nervous system development
######
Significantly regulated genes in mono-transgenic dnADAM10 mice in relation to FVB/N wild-type mice
**Gene ID** **Gene symbol** **Description** **Fold change** **log ratio** **d-value** **Functional groups**
------------- ----------------- ------------------------------------------------------------------------------------------------------- ----------------- --------------- ------------- ------------------------------------------------------------
22589 Atrx alpha thalassemia/mental retardation syndrome X-linked homolog (human) 1.392 0.477 1.533 nervous system development
109880 Braf Braf transforming gene 0.568 -0.815 -5.060 cell communication
54598 Calcrl calcitonin receptor-like 0.626 -0.675 -2.137 cell communication
12322 Camk2a calcium/calmodulin-dependent protein kinase II alpha 0.686 -0.544 -2.523 cell communication; receptor binding and activity; synapse
12772 Ccr2 chemokine (C-C motif) receptor 2 0.724 -0.465 -1.783 cell communication
16149 Cd74 CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) 0.737 -0.441 -2.329 cell communication; cell death
13175 Dcamkl1 doublecortin and calcium/calmodulin-dependent protein kinase-like 1 1.501 0.586 1.610 nervous system development
12140 Fabp7 fatty acid-binding protein 7 1.691 0.758 2.107 nervous system development
14281 Fos FBJ osteosarcoma oncogene 0.669 -0.58 -1.805 nervous system development
14417 Gad2 glutamic acid decarboxylase 2 1.422 0.508 1.683 cell communication; neuron projection; synapse
14674 Gna13 guanine nucleotide binding protein, alpha 13 1.353 0.436 1.639 cell communication
14682 Gnaq guanine nucleotide binding protein, alpha q polypeptide 1.323 0.404 1.621 cell communication; nervous system development; synapse
15557 Htr1f 5-hydroxytryptamine (serotonin) receptor 1F 1.363 0.447 1.539 cell communication
16594 Klc2 kinesin light chain 2 0.789 -0.341 -1.485 neuron projection
207911 Mchr1 melanin-concentrating hormone receptor 1 0.718 -0.477 -3.057 cell communication
17260 Mef2c myocyte enhancer factor 2C 1.433 0.519 1.507 nervous system development
18823 Plp1 proteolipid protein (myelin) 1 1.358 0.442 1.565 cell communication; nervous system development;
19293 Pvalb parvalbumin 0.847 -0.24 -1.493 neuron projection
19317 Qk quaking 1.312 0.392 1.522 cell communication; nervous system development
54409 Ramp2 receptor (calcitonin) activity modifying protein 2 1.604 0.682 1.623 cell communication
19736 Rgs4 regulator of G-protein signaling 4 1.339 0.421 1.843 cell communication
20202 S100a9 S100 calcium binding protein A9 0.696 -0.522 -2.181 cell communication
######
Significantly regulated genes in double-transgenic ADAM10/APP~\[V717I\]~mice in relation to mono-transgenic APP~\[V717I\]~mice
**Gene ID** **Gene symbol** **Description** **Fold change** **log ratio** **d-value** **Functional groups**
------------- ----------------- --------------------------------------------------------------------------------------------- ----------------- --------------- ------------- ------------------------------------------------------------------
56215 Acin1 apoptotic chromatin condensation inducer 1 0.795 -0.331 -1.955 cell communication; cell death
329910 Acot11 acyl-CoA thioesterase 11 0.812 -0.301 -1.620 cell communication
432530 Adcy1 adenylate cyclase 1 0.810 -0.304 -1.880 cell communication; receptor binding and activity
68465 Adipor2 adiponectin receptor 2 0.781 -0.357 -1.868 cell communication
11540 Adora2a adenosine A2a receptor 1.294 0.372 2.210 cell communication; synapse
11735 Ank3 ankyrin 3, epithelial 1.344 0.427 2.159 cell communication; nervous system development; synapse
11787 Apbb2 amyloid beta (A4) precursor protein-binding, family B, member 2 0.788 -0.344 -2.018 cell communication; cell death; nervous system development
226548 Aph1a anterior pharynx defective 1a homolog (C. elegans) 0.807 -0.309 -1.879 cell communication
76117 Arhgap15 Rho GTPase activating protein 15 1.275 0.351 2.139 cell communication
76294 Asb5 ankyrin repeat and SOCs box-containing protein 5 1.254 0.327 2.079 cell communication
98660 Atp1a2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 0.820 -0.287 -1.746 cell communication; synapse
12043 Bcl2 B-cell leukemia/lymphoma 2 0.815 -0.295 -1.741 cell communication; cell death
72567 Bclaf1 BCL2-associated transcription factor 1 1.326 0.407 2.183 cell death
12122 Bid BH3 interacting domain death agonist 1.291 0.369 2.278 cell death
109880 Braf Braf transforming gene 0.812 -0.301 -1.837 cell communication
12227 Btg2 B-cell translocation gene 2, anti-proliferative 1.342 0.424 2.357 cell death
12300 Cacng2 calcium channel, voltage-dependent, gamma subunit 2 0.803 -0.316 -1.872 cell communication
12325 Camk2g calcium/calmodulin-dependent protein kinase II gamma 0.810 -0.304 -1.711 receptor binding and activity
12319 Car8 carbonic anhydrase 8 0.785 -0.349 -1.679 cell communication
12361 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 0.832 -0.265 -1.689 receptor binding and activity; synapse
226751 Cdc42bpa Cdc42 binding protein kinase alpha 1.288 0.365 2.130 cell communication
12575 Cdkn1a cyclin-dependent kinase inhibitor 1A (P21) 0.779 -0.36 -2.004 cell death
235415 Cplx3 complexin 3 1.276 0.352 2.294 cell communication; synapse
12955 Cryab crystallin, alpha B 0.744 -0.427 -2.161 cell communication
12977 Csf1 colony stimulating factor 1 (macrophage) 0.822 -0.282 -1.717 cell adhesion; cell communication; receptor binding and activity
27373 Csnk1e casein kinase 1, epsilon 0.791 -0.338 -2.160 cell communication
13000 Csnk2a2 casein kinase 2, alpha prime polypeptide 0.801 -0.321 -1.909 cell communication
16007 Cyr61 cysteine rich protein 61 1.298 0.376 2.213 receptor binding and activity
54722 Dfna5h deafness, autosomal dominant 5 homolog (human) 0.803 -0.316 -1.714 cell communication
330938 Dixdc1 DIX domain containing 1 0.825 -0.278 -1.770 cell communication
50768 Dlc1 deleted in liver cancer 1 0.794 -0.332 -1.894 cell communication
13430 Dnm2 dynamin 2 0.815 -0.295 -2.004 synapse
13527 Dtna dystrobrevin alpha 1.271 0.346 2.240 synapse
13841 Epha7 Eph receptor A7 1.300 0.379 2.146 cell communication; nervous system development
14254 Flt1 FMS-like tyrosine kinase 1 0.787 -0.345 -2.064 cell communication
118446 Gje1 gap junction membrane channel protein epsilon 1 1.349 0.432 2.453 cell communication;
69367 Glrx2 glutaredoxin 2 (thioltransferase) 1.252 0.324 2.066 cell communication; cell death
14682 Gnaq guanine nucleotide binding protein, alpha q polypeptide 0.813 -0.298 -1.776 cell communication; nervous system development;synapse
224792 Gpr116 G protein-coupled receptor 116 1.279 0.355 2.154 cell communication
14799 Gria1 glutamate receptor, ionotropic, AMPA1 (alpha 1) 0.776 -0.365 -1.975 synapse
14800 Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 2) 0.740 -0.435 -1.907 cell communication; synapse
14804 Grid2 glutamate receptor, ionotropic, delta 2 0.806 -0.312 -1.793 synapse
14943 Gzmf granzyme F 0.801 -0.321 -1.928 cell death
15258 Hipk2 homeodomain interacting protein kinase 2 0.761 -0.394 -2.283 cell communication; cell death
26557 Homer2 homer homolog 2 (Drosophila) 0.774 -0.37 -2.144 cell communication
14828 Hspa5 heat shock 70 kD protein 5 (glucose-regulated protein) 0.716 -0.481 -1.984 cell communication; cell death
56213 Htra1 HtrA serine peptidase 1 0.795 -0.331 -1.834 cell communication; receptor binding and activity
15951 Ifi204 interferon activated gene 204 1.268 0.343 2.104 cell death
16323 Inhba inhibin beta-A 0.718 -0.477 -2.551 cell death; receptor binding and activity
241226 Itga8 integrin alpha 8 1.270 0.345 2.112 cell adhesion; cell communication
16419 Itgb5 integrin beta 5 0.832 -0.265 -1.649 cell adhesion; cell communication
16443 Itsn1 intersectin 1 (SH3 domain protein 1A) 0.826 -0.275 -1.839 cell communication
22343 Lin7c lin-7 homolog C (C. elegans) 0.831 -0.267 -1.652 cell communication; synapse
330814 Lphn1 latrophilin 1 0.803 -0.316 -1.934 cell communication
16998 Ltbp3 latent transforming growth factor beta binding protein 3 1.291 0.368 2.202 cell communication; receptor binding and activity
17762 Mapt microtubule-associated protein tau 0.727 -0.459 -2.312 nervous system development
17118 Marcks myristoylated alanine rich protein kinase C substrate 0.799 -0.324 -1.815 receptor binding and activity
13728 Mark2 MAP/microtubule affinity-regulating kinase 2 0.817 -0.291 -1.922 cell communication
17193 Mbd4 methyl-CpG binding domain protein 4 0.818 -0.289 -1.753 cell death
52065 Mfhas1 malignant fibrous histiocytoma amplified sequence 1 0.759 -0.398 -2.297 cell communication
59030 Mkks McKusick-Kaufman syndrome protein 0.749 -0.416 -2.427 cell communication
17346 Mknk1 MAP kinase-interacting serine/threonine kinase 1 1.273 0.348 2.113 cell communication
17748 Mt1 metallothionein 1 0.807 -0.31 -1.974 cell communication
17750 Mt2 metallothionein 2 0.780 -0.359 -2.141 cell communication
17909 Myo10 myosin X 0.824 -0.28 -1.751 cell communication
17918 Myo5a myosin Va 1.309 0.389 2.105 cell communication; receptor binding and activity; synapse
17984 Ndn necdin 1.315 0.395 2.209 cell communication; nervous system development
192167 Nlgn1 neuroligin 1 1.381 0.466 2.470 cell communication; nervous system development; synapse
18125 Nos1 nitric oxide synthase 1, neuronal 0.795 -0.331 -1.953 cell communication; receptor binding and activity; synapse
225872 Npas4 neuronal PAS domain protein 4 1.355 0.438 2.375 cell communication
18212 Ntrk2 neurotrophic tyrosine kinase, receptor, type 2 0.797 -0.327 -1.978 cell communication; synapse
18378 Omp olfactory marker protein 0.790 -0.34 -1.907 cell communication
18389 Oprl1 opioid receptor-like 1 1.330 0.411 2.066 cell communication
18577 Pde4a phosphodiesterase 4A, cAMP specific 0.812 -0.301 -1.903 cell communication
18578 Pde4b phosphodiesterase 4B, cAMP specific 0.812 -0.301 -1.586 cell communication
18583 Pde7a phosphodiesterase 7A 0.830 -0.268 -1.656 cell communication
14827 Pdia3 protein disulfide isomerase associated 3 0.812 -0.3 -1.829 cell death
74055 Plce1 phospholipase C, epsilon 1 0.807 -0.309 -1.923 cell communication
67916 Ppap2b phosphatidic acid phosphatase type 2B 0.784 -0.351 -2.088 cell communication
170826 Ppargc1b peroxisome proliferative activated receptor, gamma, coactivator 1 beta 0.749 -0.417 -2.262 cell communication
333654 Ppp1r13l protein phosphatase 1, regulatory (inhibitor) subunit 13 like 0.820 -0.287 -1.903 cell death
73728 Psd pleckstrin and Sec7 domain containing 1.291 0.368 2.130 cell communication
19246 Ptpn1 protein tyrosine phosphatase, non-receptor type 1 0.754 -0.407 -2.217 cell communication
19268 Ptprf protein tyrosine phosphatase, receptor type, F 0.815 -0.296 -1.789 cell communication
19334 Rab22a RAB22A, member RAS oncogene family 0.817 -0.292 -1.773 cell communication
19337 Rab33a RAB33A, member of RAS oncogene family 1.276 0.352 2.165 cell communication
19340 Rab3d RAB3D, member RAS oncogene family 0.792 -0.337 -1.964 cell communication
19415 Rasal1 RAS protein activator like 1 (GAP1 like) 1.312 0.392 2.203 cell communication
17252 Rdh11 retinol dehydrogenase 11 1.300 0.378 2.172 cell communication
56533 Rgs17 regulator of G-protein signaling 17 1.309 0.388 2.141 cell communication
56470 Rgs19 regulator of G-protein signaling 19 1.275 0.35 2.124 cell communication
19893 Rpgr retinitis pigmentosa GTPase regulator 1.322 0.403 2.232 cell communication
77945 Rpgrip1 retinitis pigmentosa GTPase regulator interacting protein 1 0.784 -0.351 -1.946 cell communication
110876 Scn2a1 sodium channel, voltage-gated, type II, alpha 1 0.798 -0.325 -1.848 cell communication; cell death
58234 Shank3 SH3/ankyrin domain gene 3 0.779 -0.361 -2.189 cell communication; cell death
27401 Skp2 S-phase kinase-associated protein 2 (p45) 1.278 0.354 2.111 cell death
65962 Slc9a3r2 solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2 0.816 -0.293 -1.665 cell communication
17128 Smad4 MAD homolog 4 (Drosophila) 0.802 -0.318 -1.838 cell communication
20411 Sorbs1 sorbin and SH3 domain containing 1 0.779 -0.361 -1.938 cell adhesion; cell communication
20692 Sparc secreted acidic cysteine rich glycoprotein 0.756 -0.403 -2.405 cell communication
114715 Spred1 sprouty protein with EVH-1 domain 1, related sequence 0.796 -0.329 -1.928 cell communication
114716 Spred2 sprouty-related, EVH1 domain containing 2 0.776 -0.365 -1.933 cell communication
14270 Srgap2 SLIT-ROBO Rho GTPase activating protein 2 0.825 -0.278 -1.778 cell communication
20848 Stat3 signal transducer and activator of transcription 3 0.808 -0.308 -1.710 cell communication
20913 Stxbp4 syntaxin binding protein 4 0.786 -0.347 -2.069 cell communication
240725 Sulf1 sulfatase 1 0.833 -0.264 -1.811 cell death
104015 Synj1 synaptojanin 1 1.366 0.45 2.207 cell communication; synapse
24071 Synj2bp synaptojanin 2 binding protein 0.752 -0.411 -2.093 cell communication
21415 Tcf3 transcription factor 3 0.799 -0.323 -1.978 cell communication
21416 Tcf7l2 transcription factor 7-like 2, T-cell specific, HMG-box 1.352 0.435 2.231 cell communication
110595 Timp4 tissue inhibitor of metalloproteinase 4 0.797 -0.328 -1.646 cell communication; synapse
22031 Traf3 Tnf receptor-associated factor 3 0.812 -0.3 -1.800 cell communication; cell death
94090 Trim9 tripartite motif protein 9 0.759 -0.397 -1.905 cell communication; synapse
22421 Wnt7a wingless-related MMTV integration site 7A 0.827 -0.274 -1.758 cell communication; nervous system development; synapse
78889 Wsb1 WD repeat and SOCS box-containing 1 1.288 0.365 2.069 cell communication
22627 Ywhae tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1.319 0.399 2.098 cell communication
235320 Zbtb16 zinc finger and BTB domain containing 16 0.776 -0.366 -1.759 cell death
######
Significantly regulated genes in double-transgenic dnADAM10/APP~\[V717I\]~mice in relation to mono-transgenic APP~\[V717I\]~mice
**Gene ID** **Gene symbol** **Description** **Fold change** **log ratio** **d-value** **Functional groups**
------------- ----------------- --------------------------------------------------------------- ----------------- --------------- ------------- ------------------------------------------------------------------
268860 Abat 4-aminobutyrate aminotransferase 1.503 0.588 3.791 cell communication; synapse
67269 Agtpbp1 ATP/GTP binding protein 1 1.397 0.482 3.311 cell communication; synapse
226548 Aph1a anterior pharynx defective 1a homolog (C. elegans) 0.724 -0.466 -3.127 cell communication
11938 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1.456 0.542 3.900 cell communication
140494 Atp6v0a4 ATPase, H+ transporting, lysosomal V0 subunit A4 0.762 -0.392 -2.972 cell communication
12122 Bid BH3 interacting domain death agonist 1.381 0.466 3.765 cell death
12293 Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 1.460 0.546 4.086 cell communication
20303 Ccl4 chemokine (C-C motif) ligand 4 0.755 -0.405 -2.995 receptor binding and activity
12772 Ccr2 chemokine (C-C motif) receptor 2 0.648 -0.625 -3.824 cell communication
12955 Cryab crystallin, alpha B 0.711 -0.492 -3.095 cell communication
12977 Csf1 colony stimulating factor 1 (macrophage) 0.767 -0.383 -2.920 cell adhesion; cell communication; receptor binding and activity
56066 Cxcl11 chemokine (C-X-C motif) ligand 11 0.760 -0.395 -2.953 receptor binding and activity
20315 Cxcl12 chemokine (C-X-C motif) ligand 12 1.373 0.457 3.359 receptor binding and activity
224997 Dlgap1 discs, large (Drosophila) homolog-associated protein 1 1.417 0.503 3.720 cell communication; synapse
13527 Dtna dystrobrevin alpha 1.338 0.42 3.294 synapse
23882 Gadd45g growth arrest and DNA-damage-inducible 45 gamma 1.371 0.455 3.534 cell death
14943 Gzmf granzyme F 0.745 -0.424 -3.031 cell death
215114 Hip1 huntingtin interacting protein 1 0.772 -0.373 -2.971 cell death
15257 Hipk1 homeodomain interacting protein kinase 1 0.726 -0.461 -3.122 cell death
15452 Hprt1 hypoxanthine guanine phosphoribosyl transferase 1 1.375 0.459 3.326 cell communication; cell death; synapse
215257 Il1f9 interleukin 1 family, member 9 0.706 -0.503 -3.808 receptor binding and activity
16323 Inhba inhibin beta-A 0.744 -0.426 -2.892 cell death; receptor binding and activity
16325 Inhbc inhibin beta-C 0.715 -0.483 -3.508 receptor binding and activity
16179 Irak1 interleukin-1 receptor-associated kinase 1 1.431 0.517 3.661 receptor binding and activity
80782 Klrb1d killer cell lectin-like receptor subfamily B member 1D 0.735 -0.444 -3.340 cell death
16818 Lck lymphocyte protein tyrosine kinase 0.698 -0.519 -3.204 cell communication; cell death
17248 Mdm4 transformed mouse 3T3 cell double minute 4 1.377 0.462 3.303 cell death
59030 Mkks McKusick-Kaufman syndrome protein 0.723 -0.468 -3.503 cell communication
17910 Myo15 myosin XV 0.753 -0.41 -2.883 cell communication
18125 Nos1 nitric oxide synthase 1, neuronal 0.741 -0.432 -3.040 cell communication; receptor binding and activity; synapse
21907 Nr2e1 nuclear receptor subfamily 2, group E, member 1 0.702 -0.511 -3.426 cell communication; cell death
57270 Olfr1508 olfactory receptor 1508 0.735 -0.444 -3.162 cell communication
18378 Omp olfactory marker protein 0.756 -0.403 -2.860 cell communication
170677 Pcdh21 protocadherin 21 0.614 -0.703 -3.902 cell communication
14827 Pdia3 protein disulfide isomerase associated 3 0.745 -0.424 -2.866 cell death
18821 Pln phospholamban 0.741 -0.432 -3.181 cell communication
333654 Ppp1r13l protein phosphatase 1, regulatory (inhibitor) subunit 13 like 0.733 -0.449 -3.361 cell death
54189 Rabep1 rabaptin, RAB GTPase binding effector protein 1 1.377 0.462 3.307 cell death; receptor binding and activity
17252 Rdh11 retinol dehydrogenase 11 1.374 0.458 3.317 cell communication
212541 Rho rhodopsin 0.762 -0.393 -3.078 cell communication
19877 Rock1 Rho-associated coiled-coil containing protein kinase 1 1.402 0.487 3.841 cell death
19893 Rpgr retinitis pigmentosa GTPase regulator 1.361 0.445 3.332 cell communication
110876 Scn2a1 sodium channel, voltage-gated, type II, alpha 1 1.393 0.478 3.500 cell communication; cell death
58234 Shank3 SH3/ankyrin domain gene 3 0.769 -0.379 -2.946 cell communication; cell death
22293 Slc45a2 solute carrier family 45, member 2 0.731 -0.453 -3.211 cell communication
20682 Sox9 SRY-box containing gene 9 0.754 -0.408 -3.089 cell death
20977 Syp synaptophysin 1.448 0.534 3.608 cell communication; synapse
20979 Syt1 synaptotagmin I 1.397 0.482 3.587 cell communication; synapse
21823 Th tyrosine hydroxylase 0.761 -0.394 -2.993 cell communication; synapse
94090 Trim9 tripartite motif protein 9 0.716 -0.481 -2.963 cell communication; synapse
59025 Usp14 ubiquitin specific peptidase 14 1.383 0.468 3.342 cell communication; synapse
16963 Xcl1 chemokine (C motif) ligand 1 0.749 -0.416 -3.003 receptor binding and activity
The highest number of regulated genes in ADAM10 mono-transgenic mice (Tab. [4](#T4){ref-type="table"}) belonged to the category of cell communication (53 genes), followed by the categories of synaptic junction and transmission (16 genes), and of nervous system development (15 genes). In dnADAM10 mice, fewer genes were found especially in the category of cell communication (15 genes).
In mono-transgenic mice, genes in the functional groups of inflammation or cell death were not over-represented (z-score \< 1.96). In contrast, the category of cell death was over-represented in both double-transgenic mouse lines (Tab. [6](#T6){ref-type="table"} and [7](#T7){ref-type="table"}), probably due to APP~\[V717I\]~overexpression.
The major difference in the two double-transgenic lines was the 3-fold higher number of regulated genes in the category of cell communication in the ADAM10/APP~\[V717I\]~double-transgenic line (96 genes), as compared to dnADAM10/APP~\[V717I\]~mice.
The results show that overexpression of proteolytically active ADAM10 generally influences cellular communication in mice, independently of their genetic background. One example for a regulated gene of this category is the calcium/calmodulin-dependent protein kinase II alpha (Camk2α), which is upregulated in mono-transgenic ADAM10 mice (Tab. [4](#T4){ref-type="table"}) and downregulated in dnADAM10 mice (Tab. [5](#T5){ref-type="table"}). Other genes of this category are the LDL receptor-related protein (Lrp1, Tab. [4](#T4){ref-type="table"}, Additional file [1](#S1){ref-type="supplementary-material"}, Table S1), neuroligin (Nlgn1, Tab. [4](#T4){ref-type="table"}, [6](#T6){ref-type="table"}) and the very low density lipoprotein receptor (Vldlr, Additional file [1](#S1){ref-type="supplementary-material"}, Table S3).
ADAM10 overexpression has been shown to increase cortical synaptogenesis as revealed by immunohistochemistry \[[@B14]\]. Accordingly, here we confirmed these results on the mRNA level for two neurotransmitter systems: the glutamate receptor Gria3 and the glutamic acid decarboxylase 2 (Gad2) as well as the GABA-A receptor subunit alpha 4 (Gabra4). These are examples of up-regulated genes within the category of synaptic junction and transmission (Tab. [4](#T4){ref-type="table"}).
Because ADAM10 has proteolytical activity, we were also interested in gene expression of putative ADAM10 substrates like APP and Egfr (Tab. [8](#T8){ref-type="table"}). Their expressions were not regulated in mono-transgenic mice, and therefore they are not listed in tables [4](#T4){ref-type="table"}, [5](#T5){ref-type="table"}, [6](#T6){ref-type="table"}, [7](#T7){ref-type="table"} and tables S1-S4.
######
Substrates of ADAM10 \[[@B43]\] which are not regulated in mono-transgenic mice within the parameters given in the Methods section
**Substrate groups** **Symbol name of Mouse Gene**
------------------------------------------------ ----------------------------------------------------------------------
CNS substrates of ADAM10 App, Aplp2, Prnp, Efna2, L1cam, Cdh2, Pcdhg, Dll1, Notch1
Substrates of ADAM10 in inflammation Cx3cl1, Cxcl16, Cdh5, F11r (JAM-A), Il6r, Fasl, Tnfrsf8 (CD30), Cd44
Growth factors and receptors cleaved by ADAM10 Egfr, Egf, Btc, Erbb2
Notch-1 expression was not changed in mice aged 5 months and its target gene Hes5 was only slightly affected in ADAM10 mice (Tab. [4](#T4){ref-type="table"}). However, it has been reported that the ADAM10 knock out leads to severely affected Notch signaling and embryonic lethality at day 9.5 \[[@B11]\]. As in our transgenic animals ADAM10 was under control of the postnatal active neuron-specific mouse Thy 1-promoter, ADAM10 has no effect during embryogenesis. To examine whether the lack of influence of ADAM10 on the Notch pathway in our transgenic mice is due to the relative late stage (5 months) of investigation, we analyzed the expression of the Notch-1 target gene Hes5 in transgenic mice aged 15 days (Fig. [4](#F4){ref-type="fig"}): about 40% induction was observed in the ADAM10 overexpressing mice and a reduction of about 50% in the dnADAM10 transgenic mice.
{#F4}
In addition, we found that overexpression of ADAM10 and dnADAM10 did not affect expression of either endogenous Adam10 or of other putative α-secretases like Adam9, Adam17 and Bace2 in adult mice. In general, the observed alteration of gene expression was low in all analyzed mouse lines (see the fold changes in Tab. [4](#T4){ref-type="table"}, [5](#T5){ref-type="table"}, [6](#T6){ref-type="table"}, [7](#T7){ref-type="table"}).
Alzheimer disease-related genes regulated by ADAM10
---------------------------------------------------
The GeneCards database (Weizmann Institute of Science, Version 2.36), which contains 934 genes connected with AD (gene list see Additional file [1](#S1){ref-type="supplementary-material"}, Tab. S7), was used for identification of AD-related genes regulated by ADAM10.
In ADAM10 mice, 25 AD genes (7% of 355 genes) were differently regulated, and in dnADAM10 mice 13 AD genes (9% of 143 genes) (Fig. [5](#F5){ref-type="fig"}) were altered including genes involved in cholesterol and lipid homeostasis, like Lrp1, Vldlr, and fatty acid-binding protein Fabp7. Other regulated genes code for inflammation-associated members of the S100 protein family (S100a8 and S100a9).
![**Alzheimer disease genes in mono- and double-transgenic mice**. Differentially expressed genes of ADAM10 versus FVB/N with FDR 0.5 (355 genes), of dnADAM10 versus FVB/N with FDR 0.5 (143 genes), of ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~with FDR 0.0 (592 genes) and of dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~with FDR 0.0, restricted to 300 up- and 300 downregulated genes (600 genes), were compared to AD genes (934 genes) from GeneCards (Weizmann Institute of Science, Version 2.36). In ADAM10 versus FVB/N 25 AD genes (7% of 355 genes), in dnADAM10 versus FVB/N 13 AD genes (9% of 143 genes), in ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~43 AD genes (7% of 592 genes) and in dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~30 AD genes (5% of 600 genes) were found.](1471-2164-10-66-5){#F5}
In ADAM10/APP~\[V717I\]~mice, 43 AD genes (7% of 592 genes), and in dnADAM10/APP~\[V717I\]~mice, 30 AD genes (5% of 600 genes) were altered in expression (Fig. [5](#F5){ref-type="fig"}). The relatively small number of ADAM10-regulated AD genes in double-transgenic mice probably reflects brain dissection at the age of five months, before plaque formation begins. In all transgenic lines, we did not detect differences in the expression of presenilins 1 and 2. Bace1 was slightly upregulated (25%) in dnADAM10/APP~\[V717I\]~mice. The Aβ-degrading enzymes neprilysin (Mme) and insulin-degrading enzyme (Ide) were also not regulated in mono-transgenic mice. Solely, in ADAM10/APP~\[V717I\]~mice, Ide was slightly down-regulated (Additional file [1](#S1){ref-type="supplementary-material"}, Table S3).
In order to examine an influence of sex, a separate ChipInspector analysis restricted to the 600 most up- and downregulated genes was performed with samples from both female and male double-transgenic mice (Tab. [9](#T9){ref-type="table"}, [10](#T10){ref-type="table"}). The gene lists of female and male double-transgenic mice were then compared to the GeneCards AD gene list. The percentages of altered AD-related genes in female double-transgenic ADAM10/APP~\[V717I\]~and dnADAM10/APP~\[V717I\]~female mice are similar to the numbers found in male ADAM10/APP~\[V717I\]~and dnADAM10/APP~\[V717I\]~mice (Fig. [6](#F6){ref-type="fig"}). Thus, sexual dimorphism does not cause severe differences in ADAM10-dependent expression of AD-related genes. One exception was the insulin-like growth factor (Igf1), which was downregulated in female dnADAM10/APP~\[V717I\]~mice (0.65; FDR = 1.3%), but not in the corresponding male animals (1.17; FDR = 1.8).
######
Numbers of significantly regulated genes in male double-transgenic mice restricted by the given d-values.
------------------------------------------------------------------------------------------------------------------------------------------------
**Mouse Genome 430 2.0 Array (Affymetrix)**
-------------------------------------------------- ---------------------------------------------------- ------------------- --------------------
male ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~\ male dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~\
600 genes, FDR = 1.3% 600 genes, FDR = 1.3%
414 upregulated\ 186 downregulated\ 320 upregulated\ 280 downregulated\
(d-value \> 1.18) (d-value \< -0.71) (d-value \> 1.29) (d-value \< -0.75)
------------------------------------------------------------------------------------------------------------------------------------------------
######
Numbers of significantly regulated genes in female double-transgenic mice restricted by the given d-values
----------------------------------------------------------------------------------------------------------------------------------------------------
**Mouse Genome 430 2.0 Array (Affymetrix)**
---------------------------------------------------- ------------------------------------------------------ ------------------- --------------------
female ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~\ female dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~\
600 genes, FDR = 1.3% 600 genes, FDR = 1.3%
184 upregulated\ 416 downregulated\ 300 upregulated\ 300 downregulated\
(d-value \> 0.61) (d-value \< -0.66) (d-value \> 1.44) (d-value \< -1.38)
----------------------------------------------------------------------------------------------------------------------------------------------------
![**Alzheimer disease genes in female and male double-transgenic mice**. Differentially expressed genes of female and male ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~and of dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~with FDR 1.3, restricted to the 600 best up- and downregulated genes were analyzed for AD genes (934 genes) from GeneCards (Weizmann Institute of Science, Version 2.36). In female ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~mice 49 AD genes (8% of 600 genes) and in female dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~animals 35 AD genes (6% of 600 genes) were found to be affected. In male ADAM10/APP~\[V717I\]~versus APP~\[V717I\]~mice 42 AD genes (7% of 600 genes) and in male dnADAM10/APP~\[V717I\]~versus APP~\[V717I\]~mice 31 AD genes (5% of 600 genes) were found to be affected. The corresponding d-values are listed separately for male (Tab. 9) and female mice (Tab. 10).](1471-2164-10-66-6){#F6}
Genes regulated through APP~\[V717I\]~overexpression
----------------------------------------------------
To determine the effect of APP~\[V717I\]~overexpression on gene regulation in transgenic mice, we compared APP~\[V717I\]~mice with FVB/N mice, ADAM10/APP~\[V717I\]~mice with ADAM10 mice, and dnADAM10/APP~\[V717I\]~mice with dnADAM10 mice. After background adjustment and normalization with the GCRMA procedure, a Venn diagram of genes regulated in the transgenic mice was generated (Fig. [7](#F7){ref-type="fig"}). The overlap of the three groups represents 617 genes regulated by APP~\[V717I\]~overexpression, independent of the strain background. This high number of genes altered by APP~\[V717I\]~expression demonstrates the strong influence of human APP~\[V717I\]~overexpression in the AD mouse model used.
![**Venn diagram of regulated genes in investigated mouse lines after CARMA-analysis (BH\<0.005)**. Venn diagram of APP~\[V717I\]~versus FVB/N (A), ADAM10/APP~\[V717I\]~versus ADAM10 (B) und dnADAM10/APP~\[V717I\]~versus dnADAM10 (C), generated by a custom-written Perl-script showing the effect of APP~\[V717I\]~overexpression in double-transgenic mice. The numbers in the spaces of overlapping circles represent the number of transcripts that were affected in all mouse groups. The numbers in the outer portion of each circle represent the number of transcripts that were exclusively affected in two mouse groups.](1471-2164-10-66-7){#F7}
AD-related genes that were regulated in double-transgenic, but not in mono-transgenic mice include microtubule-associated protein tau (Mapt) (Tab. [6](#T6){ref-type="table"}; Tab. S3) and the ionotropic glutamate receptors AMPA 1 (Gria 1) and AMPA 2 (Gria 2) (Tab. [6](#T6){ref-type="table"}; Tab. S3).
Confirmation of microarray data
-------------------------------
For validation of the results obtained by microarray analysis, real-time RT-PCR was applied on the original RNA samples (Fig. [8](#F8){ref-type="fig"} and [9](#F9){ref-type="fig"}). Changes in gene expression levels of selected transcripts were normalized to the gene expression of GAPDH, which was not regulated in our transgenic mouse strains.
{#F8}
![**Analyses of gene expression of selected candidate genes by real-time RT-PCR in double-transgenic mice**. Expression levels of individual genes in double-transgenic mice in relation to gene expression in APP~\[V717I\]~mono-transgenic mice. Shown are the results from RT-PCR and microarray analyses. Values presented: mean of fold changes ± SD of 4--6 animals. A: ADAM10; B: Vldlr; C: Gria1; D: Gria2; E: Mapt; F: Nlgn1. Statistical significance was determined by using ANOVA analysis, followed by Dunnett\'s post hoc comparison (\*), p ≤ 0.05; (\*\*), p ≤ 0.001; (\*\*\*), p ≤ 0.001.](1471-2164-10-66-9){#F9}
In the microarray analyses, the calcium-binding proteins (S100a8 and S100a9) were found to be downregulated in ADAM10 and dnADAM10 mice. Both genes are associated with various inflammatory processes including Alzheimer\'s disease \[[@B25]\]. By using real-time RT-PCR, significant downregulation of S100a8 and S100a9 was confirmed (Fig. [8B](#F8){ref-type="fig"} and [9D](#F9){ref-type="fig"}). Additionally, quantification of dimers of S100a8 and a9 (calprotectin) by ELISA revealed a slight reduction in both transgenic mouse lines (Fig. [10C](#F10){ref-type="fig"}) which is in accordance with the findings for mRNA levels. The decrease of about 10 to 15% of calprotectin as compared to wild-type mice was not statistically significant which might be due to ELISA-specific detection of heterodimers. We cannot exclude that changes concerning both monomeric proteins might be more substantial, but a detection of the monomeric form of S100a9 by Western blotting failed as a consequence of its low expression level.
{#F10}
Fatty acid-binding protein 7 (Fabp7), which is elevated in Down syndrome fetal brains \[[@B26]\], was found to be upregulated in dnADAM10 mice by microarray analysis. A significantly increased Fabp7 expression was confirmed in dnADAM10 mice by real-time RT-PCR. As observed by real-time RT-PCR, expression of Fabp7 was slightly reduced in ADAM10 mice, but this effect did not reach a significant level (Fig. [8E](#F8){ref-type="fig"}). Fabp7 protein expression was analyzed in the soluble protein fraction from brains of mono-transgenic mice by Western blotting. While ADAM10 had no significant effect on Fabp7 expression, the dominant-negative form dnADAM10 increased the amount of the Fabp7 protein (Fig. [10A/B](#F10){ref-type="fig"}), which is in accordance with the results obtained by microarray and PCR analysis.
Neuroligin 1, a postsynaptic cell-adhesion molecule of excitatory synapses, plays a role in neuronal differentiation and axogenesis \[[@B27]\]. In microarray analyses, neuroligin 1 gene expression was induced in ADAM10 mice. This tendency, although without reaching significance, was also confirmed in real-time RT-PCR (Fig. [8C](#F8){ref-type="fig"}).
Other proteins identified by gene profiling and associated with Alzheimer disease are the low density lipoprotein receptor-related protein 1 (Lrp1) \[[@B28]\], the very low density lipoprotein receptor (Vldlr) \[[@B29]\], the microtubule-associated protein tau (Mapt) \[[@B30]\] and the ionotropic glutamate receptors AMPA1 and AMPA2 (Gria1 and Gria2) \[[@B31]\]. Downregulation of Lrp1 by ADAM10, as observed in the chip analyses, was not confirmed by real-time RT-PCR (results not shown). For Vldlr, we found by real-time RT-PCR a significant downregulation in ADAM10/APP~\[V717I\]~mice, but its upregulation in dnADAM10/APP~\[V717I\]~mice, as detected with the microarray, could not be confirmed (Fig. [9B](#F9){ref-type="fig"}).
By real-time RT-PCR, the microtubule-associated protein tau was shown to be significantly downregulated in both double-transgenic mouse lines (Fig. [9E](#F9){ref-type="fig"}). Also in the case of the ionotropic glutamate receptors AMPA1 (Gria1) and AMPA2 (Gria 2), real-time RT-PCR confirmed the results of the microarray analyses: both genes are downregulated in ADAM10/APP~\[V717I\]~mice (Fig. [9C](#F9){ref-type="fig"} and [9D](#F9){ref-type="fig"}).
Discussion
==========
Increasing the α-secretase cleavage of APP represents a plausible strategy for the treatment of Alzheimer disease, because via this route it is possible to decrease the concentration of neurotoxic Aβ peptides and to increase the amount of neuroprotective APPsα simultaneously.
The aim of this study was to investigate the influence of increased amounts of ADAM10 proteins on gene expression in the mouse CNS. To this end, we analyzed transgenic mice either overexpressing catalytically active ADAM10, or a dominant-negative mutant of ADAM10 (dnADAM10) which is able to inhibit endogenous mouse enzymes with α-secretase activity \[[@B10],[@B12]\]. An additional reason for investigation of dnADAM10 mice is determined by the multi-domain structure of ADAMs because specific biological functions have been assigned to protein domains outside the catalytic centre of ADAMs \[[@B15]\].
In ADAM10 mice, more genes were regulated than in dnADAM10 animals; this indicates that, due to the many substrates of ADAM10, an increase in their cleavage products might change the expression of genes involved in cell communication and synaptic transmission. No change, however, was detected in the expression of the substrates as a feedback reaction.
In all transgenic mice the endogenous ADAM10 level was not influenced through overexpression of ADAM10 or its inactive variant as revealed by real-time RT-PCR. Also the other ADAM family members Adam9 and Adam17/TACE were not regulated differentially in the investigated transgenic mice, thus indicating that a reduced α-secretase activity as observed in dnADAM10 mice \[[@B12]\] was not compensated by the induction of gene expression of other potential α-secretases.
Since ADAM10 has been implicated in Notch signaling \[[@B11],[@B32]\], we investigated this pathway. On the RNA level, we found no regulation of Notch-1 in mono- and double-transgenic mice at the age of 5 months: expression of the Notch target gene Hes5 was only slightly changed in mono-transgenic ADAM10 mice. This is in accordance with earlier real-time RT-PCR experiments, where no significant difference was found in Hes5 transcription levels between adult mice overexpressing ADAM10 and non-transgenic mice \[[@B12]\]. This lack of influence on Notch signaling is probably due to the late stage of analysis, since we found small but significant effects of ADAM10 on Hes5 mRNA levels in transgenic mice aged 15 days.
ADAM10 has been reported to mediate cadherin shedding, β-catenin translocation and expression of β-catenin target genes \[[@B33],[@B34]\]. In double-transgenic dnADAM10/APP~\[V717I\]~mice various cadherins (Cdh8, Cdh10 and Cdh13), β-catenin (Ctnnb1), several Wnts (Wnt4, Wnt7a and Wnt9a) and Jun kinase (Jun) were upregulated (about 30%). The upregulation of these genes might represent a compensatory mechanism to by-pass a reduced catalytic activity of ADAM10 and β-catenin signaling. In mice overexpressing active ADAM10, no significant changes of β-catenin target genes, for example c-myc and cyclin D1, were found.
Also for other ADAM10 substrates like L1cam, proteins involved in inflammation like Fasl, and for growth factor receptors like Egfr (see also table [8](#T8){ref-type="table"}), we could not demonstrate any alteration.
Most genes in ADAM10 and ADAM10/APP~\[V717I\]~mice were found to be altered in the pathway of cell communication, followed by genes in categories of nervous system development and synaptic junction and transmission (Tab. [4](#T4){ref-type="table"}, [5](#T5){ref-type="table"}, [6](#T6){ref-type="table"}, [7](#T7){ref-type="table"}). One example for a regulated gene in the category of cell communication and synaptic function is the calcium/calmodulin-dependent protein kinase II alpha (Camk2α), one of the most abundant kinases in the brain, which is involved in long term potentiation. Camk2α was upregulated in ADAM10 mice, and downregulated in dnADAM10. Another gene of cell communication and synaptic function is neuroligin (Nlgn1), a brain-specific acetylcholinesterase homologous protein, which was upregulated in ADAM10/APP~\[V717I\]~mice (Fig. [9F](#F9){ref-type="fig"}). This component of excitatory synapses plays a role in neuronal differentiation and axogenesis \[[@B27]\]. An increase in cortical synaptogenesis as found by Bell et al. in ADAM10 mice \[[@B14]\], was confirmed through upregulation of the glutamate receptor Gria3 and the glutamic acid decarboxylase 2 (Gad2) as well as the GABA-A receptor subunit alpha 4 (Gabra4).
Downregulation of the ionotropic glutamate receptors AMPA1 (Gria1) and AMPA2 (Gria2) as observed in our microarray study was confirmed by real-time RT-PCR: reduced mRNA levels of Gria1 and Gria2 were detected in ADAM10/APP~\[V717I\]~mice. The downregulation of these two genes possibly depends on overexpression of APP~\[V717I\]~as described before \[[@B35],[@B36]\].
The number of regulated genes involved in the development of AD was relatively small in the brains of double-transgenic ADAM10/APP~\[V717I\]~and dnADAM10/APP~\[V717I\]~mice, and almost equivalent to mono-transgenic ADAM10 or dnADAM10 mice (Fig. [5](#F5){ref-type="fig"}). We did not detect differences in most genes directly involved in APP processing; but reduction of α-secretase activity induced a slight upregulation of Bace1 in dnADAM10/APP~\[V717I\]~mice.
Comparative GCRMA analysis demonstrated the strong influence of human APP~\[V717I\]~overexpression on gene expression in double-transgenic mice. Tau (Mapt) was directly downregulated through APP~\[V717I\]~overexpression in ADAM10/APP~\[V717I\]~versus ADAM10 mice. Altered expression of AD-related genes was independent of sex, with one exception: insulin-like growth factor 1 (Igf-1), which has been implicated in Alzheimer pathology \[[@B37],[@B38]\], was downregulated in double-transgenic female dnADAM10/APP~\[V717I\]~mice.
By microarray analysis, we observed in mono-transgenic mice a downregulation of members of the S100 protein family, small calcium-binding proteins responsible for a wide range of intra- and extracellular functions \[[@B39]\]. S100a8 and S100a9 were expressed to a lower extent in ADAM10 and dnADAM10 mice. PCR analysis and ELISA confirmed this effect (Fig. [8B](#F8){ref-type="fig"} and [8D](#F8){ref-type="fig"}, Figure [10C](#F10){ref-type="fig"}). S100a8 and S100a9 form the dimer calprotectin which is a marker for inflammation \[[@B40]\]. Immunohistochemical analysis recently showed S100A9 in association with the neuropathological hallmarks of sporadic and familiar AD: it was found in senile plaques, in activated glia cells and in neurons with neurofibrillary tangle morphology \[[@B25]\]. The downregulation of S100a9 by both ADAM10 and dnADAM10 overexpression is probably mediated by their common domains (the disintegrin and cystein-rich domain as well as the C-terminus).
A member of the fatty acid-binding proteins (Fabp7) was regulated by ADAM10 in mono-transgenic mice. Fabp7, also named brain lipid-binding protein (B-Fabp), is localized in the cytoplasm and in the nucleus, and is involved in the uptake, storage and/or delivery of fatty acids and retinoids into the nucleus \[[@B41]\]. Fabp7 is mainly expressed in radial glial cells, and is necessary for proper migration of immature neurons to cortical layers. Increased amounts of Fabp7 in the brains of individuals with Down syndrome suggest that higher concentrations of Fabp7 contribute to brain abnormalities and mental retardation \[[@B26]\]. We observed a significant upregulation of Fabp7 mRNA and protein in dnADAM10 mice. Since in Down syndrome patients α-secretase activity significantly decreases with age \[[@B42]\], our results provide a connection between inhibition of α-secretase (in our study by dnADAM10) and upregulation of Fabp7.
Conclusion
==========
This study shows that overexpression of ADAM10 or dnADAM10 in the brain of adult mice does not lead to drastic alteration of gene expression. In particular, ADAM10 or dnADAM10 overexpression does not result in an increased expression of genes coding for pro-inflammatory or pro-apoptotic proteins. On the contrary, overexpression of ADAM10 and its mutant even leads to a decreased amount of the inflammation marker calprotectin (the dimer of S100a8 and S100a9).
The relatively low number of genes affected by the ADAM10 modulation and the mild characteristic of altered expression levels might be related to the age of the mice we investigated. Since expression in the whole brain was analyzed, a higher change of gene expression may occur in single areas like the hippocampus. From other reports it is evident that manipulation of ADAM10 in embryonic or early ontogenic stages could have severe side effects but therapeutic approaches concerning Alzheimer\'s disease always will focus on adult patients. Our results in sum therefore provide evidence that, due to its effect on inflammation markers and on Fabp7 expression, ADAM10 might have beneficial effects in addition to those that are due to its α-secretase activity. These results further support the strategy of ADAM10 upregulation as a therapeutic approach for the treatment of AD.
Abbreviations
=============
(AD): Alzheimer disease; (APP): amyloid precursor protein; (Aβ peptides): Amyloid β-peptides; (ADAM10): a disintegrin and metalloproteinase 10.
Authors\' contributions
=======================
CP has carried out all molecular genetic experiments and has drafted the manuscript. DT has performed the analyses of biological pathways and contributed to the manuscript draft; WW has coordinated the bioinformatic analysis. KE has performed the Western blot analysis, the ELISA, quantification of Hes5-mRNA and co-drafted the manuscript; RP has participated in the design of the study and co-drafted the manuscript. FF has conceived and coordinated the study, drafted the final version of the manuscript and given approval for its publication.
Supplementary Material
======================
###### Additional file 1
**Additional tables including differentially regulated genes in ADAM10 and mutant ADAM10 transgenic mice.** Table S1 Complete list of significantly regulated genes in mono-transgenic ADAM10 mice (three females 5 months old ADAM10 mice as well as FVB/N wild-type mice). Table S2 Complete list of significantly regulated genes in mono-transgenic dnADAM10 mice (three females 5 months old, dnADAM10 mice as well as FVB/N wild-type mice). Table S3 Complete list of significantly regulated genes in double-transgenic ADAM10/APP\[V717I\] mice (three female and three male 5 months old, ADAM10/APP\[V717I\] mice as well as APP\[V717I\] mice). Table S4 Complete list of significantly regulated genes in double-transgenic dnADAM10/APP\[V717I\] mice (three female and three male 5 months old, dnADAM10/APP\[V717I\] mice as well as APP\[V717I\] mice). Table S5 Commonly regulated genes through ADAM10 overexpression in mono- and double transgenic mice (ADAM10 versus FVB/N (355 genes) compared to ADAM10/APP\[V717I\] versus APP\[V717I\] (592 genes). Table S6 Commonly regulated genes through dnADAM10 overexpression in mono- and double transgenic mice (dnADAM10 versus FVB/N (143 genes) compared to dnADAM10/APP\[V717I\] versus APP\[V717I\] (600 genes)). Table S7 934 Alzheimer disease genes by GeneCards (Weizmann Institute of Science, Version 2.36)
######
Click here for file
Acknowledgements
================
We thank Dr. Michael Bonin and Sven Poths (Microarray Facility, Department of Human Genetics, Tübingen, Germany), and Dr. Florian Wagner (RZPD German Resource Center for Genome Research, Berlin, Germany) for support of the microarray analysis. We also thank Annette Roth (Institute of Biochemistry, University Mainz, Germany) for performing the real-time RT-PCR. We are grateful to Dr. Fred van Leuven (Katholieke Universiteit Leuven/Belgium) for the APP~\[V717I\]~mice. We acknowledge the financial support by the Federal Ministry of Education and Research (BMBF) in the framework of the National Genome Research Network (NGFN), Förderkennzeichen FKZ01GS0470, FKZ01GS08130, and FKZ01GS08133, the financial support by the Helmholtz Association in the framework of the Virtual Institute of Neurodegeneration and Ageing and the Helmholtz Alliance for Mental Health in an Ageing Society, and the support by DFG (German Research Foundation) in the framework of the SFB 596: Molecular Mechanisms of Neurodegeneration, subproject A12.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Yosten Life Expectancy
What is the average Yosten lifespan?
An unusually short lifespan might indicate that your Yosten ancestors lived in harsh conditions. A short lifespan might also indicate health problems that were once prevalent in your family. The SSDI is a searchable database of more than 70 million names. You can find birthdates, death dates, addresses and more.
SHOW MORE
United States
Between 1966 and 2003, Yosten life expectancy was at its lowest point in 1990, and highest in 1993. The average life expectancy for Yosten in 1966 was 77, and 68 in 2003.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Episode 8: The Sage of the Six Paths
What's Hot Today
The Sage of the Six Paths
1,534 watches
Hagoromo reveals to Naruto he's the reincarnation of his younger son, Asura. He asks Naruto if he can guess who Indra's reincarnation is, and Naruto correctly concludes it's Sasuke. At the same time, Hagoromo has the same conversation with Sasuke, revealing his status as Indra's reincarnation, and having him realise Naruto is Asura's.
Hagoromo reveals to Naruto he's the reincarnation of his younger son, Asura. He asks Naruto if he can guess who Indra's reincarnation is, and Naruto correctly concludes it's Sasuke. At the same time, Hagoromo has the same conversation with Sasuke, revealing his status as Indra's reincarnation, and having him realise Naruto is Asura's.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Fixed-wing aircraft, such as airplanes, are capable of flight using wings that generate lift responsive to the forward airspeed of the aircraft, which is generated by thrust from one or more jet engines or propellers. The wings generally have an airfoil cross section that deflects air downward as the aircraft moves forward, generating the lift force to support the airplane in flight. Fixed-wing aircraft, however, typically require a runway that is hundreds or thousands of feet long for takeoff and landing.
Unlike fixed-wing aircraft, vertical takeoff and landing (VTOL) aircraft do not require runways. Instead, VTOL aircraft are capable of taking off, hovering and landing vertically. One example of VTOL aircraft is a helicopter which is a rotorcraft having one or more rotors that provide lift and thrust to the aircraft. The rotors not only enable hovering and vertical takeoff and landing, but also enable, forward, backward and lateral flight. These attributes make helicopters highly versatile for use in congested, isolated or remote areas where fixed-wing aircraft may be unable to takeoff and land. Helicopters, however, typically lack the forward airspeed of fixed-wing aircraft.
A tiltrotor aircraft is another example of a VTOL aircraft. Tiltrotor aircraft generate lift and propulsion using proprotors that are typically coupled to nacelles mounted near the ends of a fixed wing. The nacelles rotate relative to the fixed wing such that the proprotors have a generally horizontal plane of rotation for vertical takeoff, hovering and landing and a generally vertical plane of rotation for forward flight, wherein the fixed wing provides lift and the proprotors provide forward thrust. In this manner, tiltrotor aircraft combine the vertical lift capability of a helicopter with the speed and range of fixed-wing aircraft. Tiltrotor aircraft, however, typically suffer from download inefficiencies during VTOL operations due to propwash interference with the fixed wing.
A further example of a VTOL aircraft is a tiltwing aircraft that features a rotatable wing that is generally horizontal for forward flight and rotates to a generally vertical orientation for vertical takeoff and landing. Propellers are coupled to the rotating wing to provide the required vertical lift for takeoff and landing and the required forward thrust to generate lift from the wing during forward flight. The tiltwing design enables the propwash generated by the propellers to travels generally in the chordwise direction of the wing, thereby impacting the wing on its smaller dimension and improving vertical lift efficiency as compared to tiltrotor aircraft. It has been found, however, that tiltwing aircraft may be difficult to control during hover and typically require an aft mounted thrust station to generate a pitch control moment during VTOL operations.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Cridmore Bog
Cridmore Bog is a 14.4 hectare Site of special scientific interest which is west of Godshill. The site was notified in 1985 for its biological features. It is adjacent to "The Wilderness", another SSSI in this area of the Isle of Wight
References
Natural England citation sheet
Category:Sites of Special Scientific Interest on the Isle of Wight
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Saints Row developer Volition has released a new video demonstrating the weird and wonderful elements of the Saints Row 4 characters, weapons and gameplay. Developer Volition was bought by Deep Silver (Koch Media) in the THQ bankruptcy firesale and this is a project that is expected to be a success for the new owners.
Dubstep gun, looks better in the video
In this game sequel the leader of the Saints gang has climbed to the top of the heap and become the President of the US of A. Boone says the team are always proud of the innovative and exotic weaponry they use in the Saints games and he starts off by demonstrating the “Inflator rifle”, you can guess what that does to people/things. This video was first shown at PAX East and a “favourite” among the crowd was the “Dubstep Gun”.
Following his outrageous gunplay episode the president decides to nip down to the gun shop in his monster truck. This section of the video demonstrates gun customisation in the game. After this we get to see the first of a powerful evil alien race called “The Zim” who will be featuring in the game. A useful new feature to help you combat such enemies may well be the new mechanoid-suit which has machine guns, rockets and jump-jet capability.
As well as these objects that you can use to enhance your character Boone said that the developers have decided that the leader of the Saints should have some “superpowers”. Demonstrating this aspect we see the on-screen character run faster than a car, leap to the top of a tower block and then fly through the sky. Also using the character superpowers you can impressive hand-to-hand combat moves against your enemies. Another featured superpower was the ability to ice-freeze things and use telekinesis. Boone promised more to come and be revealed as the game gets nearer its launch date.
When you complete a task in the new game you will achieve a completion level score, for instance if you complete a task but only just manage to scrape through, you will get a bronze level achievement. This feature helps the boost replayability factor of the single player game.
Player gets bronze during a Mech assignment
Saints Row 4 will be released on PS3, Xbox 360 and PC on 23rd August in Europe and on 20th August in North America.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
May 19, 2013
|
Yahoo headquarters in Sunnyvale, Calif. / Paul Sakuma, AP
by Nancy Blair and Jon Swartz, USA TODAY
by Nancy Blair and Jon Swartz, USA TODAY
SAN FRANCISCO - Yahoo may be looking to extend its acquisition streak with social-blogging site Tumblr, according to media reports.
Citing unnamed sources familiar with the talks, Adweek reported the price tag may be as high as $1 billion. AllThingsD, also citing anonymous sources close to the situation, said a deal could take the form of an acquisition or a strategic alliance.
Adding fuel to the speculation: On Friday Yahoo announced a press event for Monday in New York, where Tumblr is based.
Yahoo's board plans to meet Sunday to decide whether to approve an all-cash offer for Tumblr, AllThingsD reported late Friday.
"We're focused on building the service (with acquisitions) and enriching the customer experience," said Yahoo CEO Marissa Mayer, who added she will be at the New York event.
A Yahoo spokeswoman declined further comment on Monday's announcement.
Mayer spoke briefly to USA TODAY late Friday after accepting an innovation award at a fundraiser here for disadvantaged students. She said she has intentionally kept a low profile since taking over as CEO nearly a year ago. "I've never had more fun in any job," she said.
Image-intensive social media platform Tumblr is popular among a younger crowd.
Tumblr's appeal is that it is considered "the new Facebook" among its devotees, says tech analyst Kevin Lee.
However, there he is risk, he adds. Unlike Google's acquisition of YouTube, a leader in the then-new category of online video, Tumblr is more of a blogger space for the content of thousands of users, Lee says.
Yahoo has been on a tear of acquisitions under Mayer as part of the company's efforts to reach a younger, more mobile audience.
In March, it announced it was scooping up social recommendation site Jybe and mobile news reader Summly, run by 17-year-old Nick D'Aloisio. It then said it would shut down Summly and incorporate it into existing Yahoo products.
Among its most recent announcements, mobile games developer Loki Studios this month said it would be coming into the Yahoo fold.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Postnatal human herpesvirus 8 and human immunodeficiency virus type 1 infection in mothers and infants from Zambia.
The specific route and timing of human herpesvirus (HHV) 8 infection in regions where Kaposi sarcoma is endemic are not known. HHV-8 infection and any risk factors that may be associated with HHV-8, including human immunodeficiency virus (HIV) type 1 infection, were monitored during the 12-month postdelivery period for 416 mothers and 485 infants from Lusaka, Zambia. HHV-8 incident infection rates during this period were 3.2 and 5.3 infections/100 person-years for infants and mothers, respectively. HHV-8 infection among infants was not associated with HHV-8 or HIV-1 infection in the mother. Among the HHV-8-positive infants, 2 of 12 tested were found to have HHV-8 DNA in their peripheral blood mononuclear cells at birth, which suggests that in utero infection is possible. However, most HHV-8-positive infants appeared to have acquired infection either intrapartum or postpartum. The present study indicates that transmission of HHV-8 to infants can occur early and is likely via multiple routes.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Texas Credit Union League
GHS Federal Credit Union, Binghamton, N.Y., announced the promotion of Kevin Kelly. Kelly joined GHS in the spring of 2011 and has recently been promoted to IS manager where he oversees the daily operations of GHS’s information systems, including overseeing the IS staff, managing the network, GHS’s defenses, and safeguarding...
Credit union members of the Credit Union Association of Oklahoma voted to approve a merger with the Texas Credit Union League and the Arkansas Credit Union League to form a new regional cooperative organization–the Cornerstone Credit Union League.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Same voltage and current rating but different brand laptop AC adapter?
I'm in India where AC adapter of Y510p(Original) is not available. Ac adapter of Y510p has rating of 19.5v and 6.15a, I found AC adapter having same rating of Hp, is it secure to use on lenovo laptop?
A:
As far at they match the exact same voltage values and the same or bigger current they are similar from the laptop point of view.
You say that its from an HP laptop, but take care in case its not original since cheap adapters may lack several protections, and that may damage the laptop.
With that said, check if the tips are the same. In case they aren't you may have to do some soldering to replace the tip.
As a side note: In case your laptop specifies how many wattage it needs in the bottom label,you may calculate the minimum current of the AC adapter with the formula wattage/19.5 = minimum current. Give it some margin to ensure.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Two-time presidential loser Hillary Clinton is about to release her new book. “What Happened” features the former first lady compiling all of her complaints she’s made since losing the election into one insufferable volume that every liberal can use to cry on in the wake of one of the most stunning upsets in American political history.
As Clinton licked her wounds and her supporters slipped into a coma over the shock, she also blamed Russia, racism, sexism, misogyny, the FBI, James Comey, and the media for her election loss. She then decided to shoot inside the ship when she blamed the Democratic National Committee for giving her a crappy data operation. That was simply not true. She was given the infrastructure that was built by Barack Obama. In all, the Democrats’ data strategy community’s response was blunt; it wasn’t the data—it was you. You didn’t know what the hell you were doing. The blame game has become increasingly unhinged as MSNBC’s Andrea Mitchell pointed out when she called out Clinton during her appearance at the Recode conference in California last June. She said that Americans were involved in the weaponization of the data obtained by the Russians and Wikileaks. There is zero evidence to prove this, but I’m sure you can all read about it.
As Katie noted, Clinton is bound to visit Wisconsin during this tour, which is something she should have done in 2016. Yet, that’s the extent of her visit into the areas that she lost. She’ll mostly be dropping into the most liberal parts of the country (via NTK Network):
The nine stops on her “Book Signings” tour? Manhattan, NY Brookfield, CT Montclair, NJ Brooklyn, NY Buffalo, NY San Francisco, CA Middletown, CT Concord, NH Rhinebeck, NY What do all nine stops have in common? Well, they’re all in states that Hillary Clinton won in 2016. Furthermore, all but one stop is on the east coast. The one outlier is San Francisco, which can hardly be considered an adventure outside of Clinton’s liberal bubble.
Is this shocking? No, but it will rehash Clinton and the Democratic Party’s weaknesses and put her back in the limelight, something that the Left would rather do without. They have no leader, they’re struggling to raise money, there’s a brewing civil war between the establishment and progressive wings, they’ve lost successive special elections, and they have no message. The last thing Democrats need is having an immensely unpopular woman complaining again about why she lost.
Oh, and did I tell you that admission prices for this book tour are quite hefty?
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Thanks guys, it's all about the right time @ the right place. This was our second caracal sighting of the holiday, as we had seen one earlier close to Mopanie. I was over the moon then, untill we came across this one... Amazingly enough, initially we found him in the morning, and just before we headed to camp that afternoon we found him again at the exact same spot. And that with 2 other cars around.
Only afterwards when I looked at the 40 pics taken of this special cat, did I see he gave us 'the yawn'. So privileged to have experienced it. According to the new Kruger map by Andi and Lorainne Tinker, Caracal are frequently seen near Orpen.
I participate because I care - CUSTOS NATURAENo to Hotels in and commercialization of our National Parks.No to Legalized Rhino and Lion trade.Done 159 visits to National Parks.What a wonderful privilege.
On the way back from Postberg 2 weeks back, saw this guy during the late afternoon...no great pic but he was 1 of 2 on my way out. Saw another last weekend. My total Caracal sightings for West Coast National Park this year comes to 9 in sightings.All in WCNP:
total for 2010: 15 caracals in 14 sightingstotal for 2009: 19 caracals in 15 sighting
Some are same animals I am sure but many have been big distances apart and a couple of sightings have been females with babies and one or two sightings of just babies left temporarily unattended.
If you want to see Caracals go to WCNP....theyre all over the place, you just got to spot them!! It becomes easy when you know what you are looking for.
@ Malalea Caracals may have nocturnal habits in some areas but dont quote what a book says as in the same way you find leopards during all hours of the day, so will you find caracals. They show preference to being active from 2 hours before sunset from my observations and even in KNP seen during daylight hours. Seen them active in the middle of the day near Windhoek too.
Augrabies Falls campsite had 2 that used to be mostly nocturnal and I remember they came right up to one.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Induction motors are used, for example, to drive fans, blowers, pumps and compressors. It has been recognized that when these motors are operated at full speed they normally have excess capacity as compared to the load requirements, and this excess capacity is compounded when the load is variable. It has also been recognized that if the output of the motors could be adjusted to provide only the needed power, a significant reduction of energy usage would result. Hence, variable speed drives (VSD's) have been developed in the form of electronic devices which match motor speed to that required for a given application. A typical VSD rectifies incoming AC voltage and current into DC, then inverts the DC back to AC at a different voltage and frequency. The output voltage and frequency is determined by the actual power needs and is set automatically by a control system or by an operator.
Heretofore, VSD's have generally been so expensive that they have not been used extensively for energy savings. It has been reported that VSD's require the availability of highly trained maintenance personnel and shorten motor life.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
After raising three children and watching them graduate from college, Bob and Carol decided to leave the educational field and pursue a dream that had been put on hold for 35 years (since graduationg from the University of Northern Iowa). "Two in Thailand" is the journal dedicated to that dream - to serve in the Peace Corps. This is a personal blog. The opinions expressed within do not necessarily represent the views of the Peace Corps or the United States Government.
Thursday, January 25, 2007
HIV/AIDS Camp
Carol received grant money to conduct an HIV/AIDS camp for 6 high schools. She worked for three months to organize and implement the two-day camp for 220 students.Thailand has a severe epidemic of AIDS and Peace Corps encourages HIV/AIDS education. Students had to attend 4 classes each day as well as participate in two large group activities. Carol enlisted the help of mental health workers, hospital workers, and all the teachers of her school. It was a monumental task, but Carol pulled it off! Carol found a young man with AIDS and with the help of a social worker, he addressed the students as the keynote speaker (top picture).
YOUR CAMP LOOKS LIKE IT WENT GREAT.BECKY AND WESLEY ALSO DID A CAMP THAT APPEARS TO HAVE BEEN DONE ON THE SAME DATES. THEY HAVE PICTURES OF THEIR'S ON WESLEY'S BLOG-WWW.WESLEYINTHAILAND.BLOGSPOT.COMI WAS FORTUNATE ENOUGH TO BE HERE FOR THEIR CAMP. BECKY, WESLEY AND CAROL NEED TO EXCHANGE NOTES ON HOW THEIR CAMPS WENT AND WHICH ACTIVITIES WENT BETTER THAN OTHERS, FOR NEXT TIME. CAROL, YOU DID A GREAT JOB, AND IT WAS WONDERFUL MEETING YOU AT THE AIRPORT WHEN WE GREETED 119. I FEEL LIKE I KNOW YOU FROM YOUR BLOG, BUT IT WAS GREAT TO MEET YOU AND BOB IN PERSON.JUDY TURNER AKA BECKYTHAI'S MOM
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
mariadb odbc throws invalid pointer error
I have MariaDB installed (as part of Fedora installation) on Fedora 21. ODBC is also installed. BUT, when I go to test the ODBC configuration (or when Asterisk attempts to use ODBC) I get an error in free():invalid pointer.
odbcinst.ini
[MySQL]
Description=ODBC for MySQL
Driver=/usr/lib64/libmyodbc5.so
Setup=/usr/lib64/libodbcmyS.so
FileUsage=1
UsageCount=2
odbc.ini
[asterisk]
Description=MySQL connection to 'asterisk' database
Driver=MySQL
Database=asteriskdb
Server=localhost
UserName=<theusername>
Password=<thepassword>
Port=3306
Socket=/var/lib/mysql/mysql.sock
Connecting to the database using mysql works perfectly fine using these credentials. But doing:
echo "select 1"|isql -v asterisk theusername thepassword
results in this:
*** Error in `isql': free(): invalid pointer: 0x00000000011c4e58 ***
======= Backtrace: =========
/lib64/libc.so.6(+0x7850e)[0x7fdd0ef7850e]
/lib64/libc.so.6(cfree+0x5b5)[0x7fdd0ef84165]
/usr/lib64/libmyodbc5.so(MySQLGetPrivateProfileStringW+0x132)[0x7fdd083381c2]
/usr/lib64/libmyodbc5.so(ds_lookup+0x5d)[0x7fdd08336c3d]
/usr/lib64/libmyodbc5.so(MySQLConnect+0xbe)[0x7fdd08316a1e]
/lib64/libodbc.so.2(SQLConnect+0x9e5)[0x7fdd0fb41745]
isql[0x402908]
/lib64/libc.so.6(__libc_start_main+0xf0)[0x7fdd0ef1ffe0]
isql[0x402c31]
======= Memory map: ========
I can provide the rest of the core dump if it will help anyone.
Any suggestions for what is causing this and how to prevent it? I need ODBC working.
A:
I had the same problem on my F21 86_64.
The resolution for me was to install a newer version (logged in as root):
1 remove actual odbc-version (5.2.2 if I remember well)
yum remove mysql-connector-odbc
2 Searching the newest version of mysql-connector-odbc-5.3.4-1.x86_64.rpm) at:
http://dev.mysql.com/get/Downloads/Connector-ODBC/5.3/mysql-connector-odbc-5.3.4-1.x86_64.rpm (you need to subscribe)
yum localinstall --nogpgcheck mysql-connector-odbc-5.3.4-1.x86_64.rpm
3 symbolic link creation because unixODBC points still to
/usr/lib64/libmyodbc5.so instead of /usr/lib64/libmyodbc5w.so
ln -s /usr/lib64/libmyodbc5w.so /usr/lib64/libmyodbc5.so
4 if needed don't forget to modify (in ~/.odbc.ini)
.....
Driver64=/usr/lib64/libmyodbc5w.so
....
Hope this helps
Roman
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Signaling from membrane receptors to tumor suppressor WW domain-containing oxidoreductase.
The family of WW domain-containing proteins contains over 2000 members. The small WW domain module is responsible, in part, for protein/protein binding interactions and signaling. Many of these proteins are located at the membrane/cytoskeleton area, where they act as adaptors to receive signals from the cell surface. In this review, we provide molecular insights regarding recent novel findings on signaling from the cell surface toward WW domain-containing oxidoreductase, known as WWOX, FOR or WOX1. More specifically, transforming growth factor beta 1 utilizes cell surface hyaluronidase Hyal-2 (hyaluronoglucosaminidase 2) as a cognate receptor for signaling with WWOX and Smad4 to control gene transcription, growth and death. Complement C1q alone, bypassing the activation of classical pathway, signals a novel event of apoptosis by inducing microvillus formation and WWOX activation. Deficiency in these signaling events appears to favorably support cancer growth.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Daily Vent Automation
Smoke Vent Systems can supply all the components needed to install or repair a daily vent system. Daily vent controls can also be added to your current Smoke Vent System. We stock everything from simple control units to dedicated sensors and thermostat controls. Please check out our gallery below for more information. You can click on an image to enlarge it, or click on a product name to find out more information.
Our CO2 and temperature sensor measures both carbon dioxide concentration and temperature in the ambient air, which is then passed to the system’s master allowing it to control the ventilation as necessary. A CO2 concentration of below 1000 ppm should then always be the aim to ensure good indoor air quality.
Our thermostat controls contain a temperature sensor to ensure that they keep the room maintained at exactly the right temperature. Our units can be linked up to a variety of control panels and are capable of maintaining a temperature of 10 to 30°C. We can also provide tamper proof versions where necessary.
An electronic unit used to automate most windows and vents. It is capable of being used as a stand-alone product, but can also be linked to wind and rain sensors, as well as thermostats, which further automates your windows and doors, allowing for even greater ease of use. Both standard and remote control versions are available.
Wind and rain sensors automatically detect strong winds or heavy rain, and will trigger an actuator to automatically close a door or window. The unit comes supplied with a fixing bracket, and both the wind and rains sensors are available separately.
Push button wall switches are used to trigger actuators and make an automated and easy to use alternative to our manual openers. Triggering the switch will run a motor which will open a door or window, allowing for better ventilation, or offering the user access. Our push button wall switches are specifically designed to work with 24VDC actuators, and control the actuators via an AOV or natural ventilation control unit. Our units are made with natural ventilation usage in mind, and not smoke control ventilation.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.