text
stringlengths 2
1.05M
| repo_name
stringlengths 5
101
| path
stringlengths 4
991
| language
stringclasses 3
values | license
stringclasses 5
values | size
int64 2
1.05M
|
|---|---|---|---|---|---|
A 6-year-old boy died Thursday after being hit by a rolling schoolyard fence that came off its track at the private Mark Day School in San Rafael, police said.
The fence is used to allow vehicles in and out of the schoolyard, near a large blacktop play area, said San Rafael police Lt. Dan Fink.
The incident appears to have been an accident. The exact circumstances are not yet known and under investigation, Fink said.
“What we’re looking at is the how and why this happened,” Fink said, “so that we can prevent anything like this from happening again.”
The incident was reported at 12:21 p.m. on the campus at 39 Trellis Drive, Fink said.
Members of the staff who witnessed the incident immediately called 911 and provided care to the student, school officials said.
San Rafael police and firefighters responded. The boy was transported to Kaiser Permanente Medical Center in San Rafael, where he died of his injuries.
Classes were in session Friday, but administrators of the K-8 school canceled the morning assembly and have made counselors available for students, Joe Harvey, head of school, said in a statement.
The scene of the accident has been closed off while authorities investigate, Harvey said.
“The safety of our students is so important to all of us, and we want to understand how this could have happened,” Harvey said.
“The death of someone so young is devastating for all of us, and even more so under these circumstances and at this time of year, when we are surrounded by celebrations while we mourn,” he said. “All of us at Mark Day School express our deepest sympathies to his family, classmates and friends.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Reduced DNA flexibility in complexes with a type II DNA binding protein.
We studied internal molecular motions in Bacillus subtilis phage SPO1 DNA using the time-resolved fluorescence polarization anisotropy (FPA) of intercalated ethidium. The torsional flexibility of this (hydroxymethyl)uracil-containing DNA is very similar to that of naturally occurring thymine-containing DNAs, as judged from fits of the time-resolved FPA decay to an elastic DNA model. Binding of transcription factor 1 (TF1), a type II procaryotic DNA binding protein encoded by the phage SPO1, enhances the FPA, indicating a substantial decrease in the average DNA torsional flexibility in the DNA-TF1 complex. The FPA increase is correlated with a reduced ethidium binding affinity. The effects can be noticed at TF1 binding ratios less than 1 TF1 dimer/500 DNA base pairs, and the measured torsional rigidity at high TF1 binding ratios (1 TF1 dimer/15-20 DNA base pairs) is about 7 times greater than in the absence of TF1. On the basis of a discussion of various mechanisms for the observed effect we argue that it is due to protein-induced DNA bending at low binding densities although other explanations are also possible. This interpretation might have implications for understanding the biological function of TF1.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
This is one of eight master prototype of Jumbo size Mazinger Z, approximately over 4 feet tall ( 48" ) made with FRP material with high detailed paint job. It's in a fix pose but this is the second biggest Mazinger Z figure ever made. The original plan was to maunfacture 500 limited exclusive for the Bandai diecast Hover Pileder, but this project was dropped due to license problem with the Bandai's Mazinger Z bust. This is one of the eight very rare piece that can be found . If you have the Bandai soul of Popynica Hover Pileder diecast which will fit perfect for this figure. Mazinger Z approximately weighs 35lbs, oversize box!
Mazinger Z 48" Jumbo (Sold Out) Toei
* Please review store policy agreement prior checking out *
Item without a "order" button is either temporarily sold out, discontinued,
or it is a new merchandise that has not arrived yet. Please check back periodically.
*Prices are subject to change without notice due to fluctuating market
conditions.*
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Call ActionMethod of a Controller in ASP.NET MVC from Javascript that results in Excel Worksheet saved
I would like to call an ActionMethod of a Controller that returns an Excel Worksheet.
I know that I could simply redirect the URL to http://website/Excel/GenerateReport
and it would work.
But I would like to popup a busy spinner right before the call to controller and close the spinner right after.
In the mean time the Controller's ActionMethod would generate Excel Report and return it.
The ActionMethod looks like this:
public ActionResult CreateReport()
{
try
{
// Opening the Excel template...
var fs = new FileStream(Server.MapPath(@"~\Content\Excel\Template.xlsx"), FileMode.Open, FileAccess.Read);
// Getting the complete workbook...
var templateWorkbook = new XSSFWorkbook(fs);
// Getting the worksheet by its name...
//HSSFSheet sheet = templateWorkbook.GetSheet("Sheet1");
var sheet = templateWorkbook.GetSheet("Report");
// Getting the row... 0 is the first row.
//HSSFRow dataRow = sheet.GetRow(4);
var dataRow = sheet.GetRow(4);
dataRow.CreateCell(0, CellType.Numeric);
dataRow.GetCell(0).SetCellValue(11.11);
// Forcing formula recalculation...
sheet.ForceFormulaRecalculation = true;
var ms = new MemoryStream();
// Writing the workbook content to the FileStream...
templateWorkbook.Write(ms);
TempData["Message"] = "Excel report created successfully!";
// Sending the server processed data back to the user computer...
return File(ms.ToArray(), "application/vnd.openxmlformats-officedocument.spreadsheetml.sheet", "Report.xlsx");
}
catch (Exception ex)
{
TempData["Message"] = "Oops! Something went wrong.";
return RedirectToAction("NPOI");
}
}
I tried ajax but not luck...
Here's a general idea what I tried:
showProgress();
$.ajax({
url: ajaxUrl,
type: "get",
data: {
tmoCode: $("#tmoDropDownList").val(),
clientCode: $("#clientDropDownList").val(),
productCode: $("#productDropDownList").val(),
startDateCode: $("#startDateDropDownList").val(),
endDateCode: $("#endDateDropDownList").val()
},
success: function (response, textStatus, jqXHR) {
alert("Success");
},
error: function (jqXHR, textStatus, errorThrown) {
alert("Error Creating Excel Report!");
},
// callback handler that will be called on completion
// which means, either on success or error
complete: function () {
hideProgress();
}
});
Any idea is appreciated!
But please remember that I need to:
1. display the Spinner
2. run the report and return it as excel worksheet
3. hide the Spinner
Thanks in advance!
A:
Check it out - https://github.com/johnculviner/jquery.fileDownload and see a demo - http://jqueryfiledownload.apphb.com/
You can use something like this:
$(function() {
$(document).on("click", "a.downloadFile", function() {
showProgress();
$.fileDownload($(this).prop('href'), {
successCallback: function(url) {
hideProgress();
},
failCallback: function(responseHtml, url) {
hideProgress();
}
});
return false; //this is critical to stop the click event which will trigger a normal file download!
});
});
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Mac Cionnaoith/Mac Cionaodha- usually angl.MacKinn(e)y, MacKenn)y, MacKenna- similar root to no. 1, according to Woulfe. A sept of Monaghan, but also in Roscommon, and thus some transference with no.1
Mac Giolla Choinigh- angl. MacElkenny, MacIlkenny, MacIlhenny etc. also as Kenny and Heaney. According to Woulfe the root is 'servant of St Canice', from whom the town of Kilkenny takes its name. The name was found in the 16th century in Roscommon, Leitrim, Donegal and Down. The same possibility of absorption, transference occurs with No 1.
Most familes of the name would be of Cos Roscommon and Galway. The Ui Maine sept were powerful in the above areas, and were of the same stock as the O Maddens.
A further complication is that an English family of the name were planters in counties Wexford, Galway and Roscommon, from the time of Elizabeth 1st. These Kennys became very influential. The arms illustrated here are those of the English Kennys: i.e. 'per pale or & azure, a fleur-de-lys between three crescents counterchanged'. They are, in fact, the arms of Kenn(e)y (anciently Kenne) of Somerset who arrived in Ireland in the person of Sir Nicholas Kenny, Escheator to Elizabeth 1st, whose progeny settled, coincidentally, in the Uí Maine heartland of the O Kennys! These very arms were registered at Ulster's Office by this English official in 1571. They appear as Kenne/Kenney of Somerset in Burke's 'General Armory' (1883).
There are, incidentally, many Irish names whose anglicised forms are identical to rarer British names that were occasionally borne by settlers or officials in 17th century Ireland. (v. Appendix).
Listed as a 'Principal Irish Name' in Sir William Petty's '1659 Census' there are:
In Co Roscommon 11 families of McKeny and Kenny , Roscommon Barony, and Keny/Kenny with 6 families in Athlone Barony.
In Co Offaly Petty has 9 families of Kyne listed in the Barony of Coolistowne, 7 of Kenny in Garriecastle.
In Co Louth in 1659 there are 4 families of Keny in Drogheda.
In Co Donegal Petty has 6 families of O Kenny in the Barony of Boylagh and Banagh, and 6 of O Kenny in Raphoe.
In Co Kilkenny, 5 families of Kenny appear as a Principal Irish Name in Fassagh Deinin Barony.
There are none listed in Co Leitrim proper; and, unfortunately, records for Galway are missing.
In the Registrar General R.E. Matheson's 'Special Report...' (1894), based on the births distribution figures of 1890, most Kenny births occurred in Cos Galway, Roscommon and Dublin.
R.E.Matheson's 'Varieties & Synonymes of Surnames...in Ireland' (1901) lists the following synonyms of Kenny: Kean(e)y in Co Leitrim, Kilkenny in Banbridge, Co Down, McKinny in Newry, Co Down, and Kinney and McKenny generally. In other words some Kennys in Co Down could really be Mac Giolla Choinigh or Mac Cionnaoith, whilst some Kennys of Leitrim stock could be Ó Ciannaigh/Ó Caoinnigh; see these names above. The same holds for some midland Kennys being Mac Cionnaoith; and persons named Kinney bearing their name as an anglicisation of Ó Cionnaoith. That sounds a bit of a conundrum, but it could prove of value to family researchers.
Three notable Kennys: Peter James Kenny S.J. (1780-1849) doubtless of the O Kenny sept, a Catholic theologian.Rev, Arthur Kenny (1776-1855) anti-Catholic preacher, probably with English antecedents.Enda Kenny (b. 1945) Castlebar, Co Mayo. Fine Gael politician, present Taoiseach of Ireland. He is currently the longest serving member of the Dáil, being T.D. for Mayo since 1975, in which incumbency he followed his father, Henry Kenny.
#5 Caroline Kenny
#4 Kenny
#3 Kenny
Is it correct that the McKenny's of Roscommon were descended from the Kenny clan probably much more so than McKenna clan of Monaghan? According to P. Woulfe, McKenna "family" was a client clan of O'Connor in Roscommon, which hardly sounds like that line would be responsible for any major proliferation.
#2 Kenny
Is it probable that most McKenny's in Roscommon descend from the Kenny clan rather than McKenna clan of Monaghan? Patrick Woulfe stated that a "family" of McKenna's were clients/followers of O'Connor's, which doesn't sound like they would proliferate in big numbers.
#1 jstokes
Looking for family of Marguerite Kenny born 1820 Ireland died 1865 Quebec Canada-wife of William White
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Local Government Act 1888
The Local Government Act 1888 (51 & 52 Vict. c.41) was an Act of the Parliament of the United Kingdom, which established county councils and county borough councils in England and Wales. It came into effect on 1 April 1889, except for the County of London, which came into existence on 21 March at the request of the London County Council.
The Bill
Following the 1886 general election, a Conservative administration headed by Lord Salisbury was formed. However the Conservatives did not have a majority of seats and had to rely on the support of the Liberal Unionist Party. As part of the price for this support the Liberal Unionists demanded that a bill be introduced placing county government under the control of elected councils, modelled on the borough councils introduced by the Municipal Corporations Act 1835.
Accordingly, the Local Government (England and Wales) Bill was introduced to the House of Commons on 19 March 1888, by the President of the Local Government Board, Charles Ritchie. The Bill proposed the creation of elected county councils to take over the administrative functions of the magistrates of the Quarter Sessions courts, that ten large cities should be "counties of themselves" for the purposes of local government and that each county was to be divided into urban and rural districts, based on existing sanitary districts, governed by a district council. The county and district councils were to consist partly of directly elected "elective councillors" and partly of "selected councillors", chosen by the elective councillors in a similar manner to aldermen in municipal boroughs.
The counties to be used for local government were to be the historic counties of England and Wales. A county council was to be formed for each of the ridings of Yorkshire and the three divisions of Lincolnshire (Holland, Kesteven and Lindsey). In addition a new County of London was to be formed from the area of the Metropolitan Board of Works. This would have led to the creation of fifty-seven county councils. The boundaries of the counties were to be those used for parliamentary purposes, adjusted to include urban sanitary districts on county borders within a single county.
The ten cities to be "dealt with as separate counties" were Liverpool, Birmingham, Manchester, Leeds, Sheffield, Bristol, Bradford, Nottingham, Kingston-on-Hull, and Newcastle upon Tyne.
Existing urban and rural sanitary districts, created in 1872, were to be redesignated as urban and rural districts. Urban districts that lay across county boundaries were to be included in the county with the greater part of the population in the 1881 census. Existing rural sanitary districts were to split on county lines to form rural districts.
Passage through Parliament
There were a large number of changes to the Bill as it passed through parliament. The terms administrative county and county borough were introduced to designate the new areas of local government, while the "selected councillors" became "county aldermen". The government withdrew the sections relating to the creation of district councils, which were eventually brought into existence by the Local Government Act 1894.
Members of both houses made representations on behalf of counties and boroughs, and this led to an increase in the number of local authorities.
The eastern and western divisions of Sussex became administrative counties
The Isle of Ely was separated from Cambridgeshire
The eastern and western divisions of Suffolk were divided for local government purposes.
The Soke of Peterborough was separated from the remainder of Northamptonshire.
Attempts to create administrative counties for the Cinque Ports and Staffordshire Potteries were not successful.
The population limit for county boroughs was lowered twice, firstly to 100,000, then to 50,000. A number of smaller counties corporate were also given county borough status. Mr Ritchie conceded on 8 June:
"Now that they had gone down so far in population as 50,000 there arose a question as to the admission of boroughs which had not so large a population as 50,000, but which had very peculiar claims. He referred to the counties of cities. [...] Two or three of these cities had so small a population that he did not propose to deal with them in this way. The best course was to give the names of the cities which he proposed to include. They were Exeter, Lincoln, Chester, Gloucester, Worcester, and Canterbury."
The effect of these changes was to increase the number of county boroughs from ten to fifty-nine. With a population of around 50,000 at the 1881 census, the City of London was initially proposed for county borough status.
County councils
The councils were subject to triennial elections, the first taking place in January 1889. The county councils elected in 1889 were known as "provisional" councils until coming into their powers on 1 April. Every administrative county was divided into electoral divisions, each returning a single councillor. Following the election, the county councillors then elected county aldermen, there being one alderman for every three councillors. The London County Council had a different constitution, with two councillors elected for each parliamentary constituency in the county, and a ratio of one alderman to six councillors. The councillors appointed a chairman and vice chairman, who had a one-year term of office, although they could be reappointed.
Powers
The powers and responsibilities transferred from the quarter sessions to the councils were enumerated in the Act. These included:
Making and levying of rates
Borrowing of money
Passing of county accounts
Maintenance and construction of county buildings such as shire halls, county halls, court houses and police stations
Licensing of places of entertainment and of race courses
Provisions of asylums for pauper lunatics
Establishment and maintenance of reformatory and industrial schools
Repair of county roads and bridges
Appointment, dismissal and setting of salaries for county officers
Division of the county into polling places for parliamentary elections, and the provision of polling stations
Control of contagious diseases in animals, and of destructive insects
Fish conservancy and control of wild birds
Weights and measures
County borough corporations also exercised these powers, in addition to those of a municipal borough.
Standing joint committees
Control of the county police was to be exercised jointly by the quarter sessions and the county council through a standing joint committee. The committees were replaced by police authorities by the Police Act 1964.
Counties for other purposes
The Act also ensured that the boundaries used for what it terms "non-administrative purposes" would be synchronised with the borders between the administrative counties. The non-administrative purposes were stated to be "sheriff, lieutenant, custos rotulorum, justices, militia, coroner, or other", thus approximating to the functions of modern ceremonial counties.
The counties of Cambridgeshire, Lincolnshire, Northamptonshire, Suffolk, Sussex and Yorkshire were undivided so far as they were one county at the passing of the Act. The three ridings of Yorkshire and the three parts of Lincolnshire therefore retained their status.
County boroughs were to be administrative counties of themselves. The Act provided that each county borough that had previously been part of a county (i.e., was not a county corporate) should continue to be part of that county for non-administrative purposes. If a county borough did not have a separate commission of assize, oyer and terminer and jury service, or gaol delivery, it was deemed to be part of one or more adjoining counties for those purposes. The Act also provided for certain financial adjustments between county boroughs and adjoining counties.
The Act did not in terms affect the status of cities and towns which were counties corporate. Most of the counties corporate became county boroughs and therefore administrative counties of themselves, but while other county boroughs continued to be part of their existing counties for all other purposes, that did not apply to existing counties corporate. Those that did not become county boroughs became part of adjacent administrative counties but retained their existing lieutenancies and shrievalties.
Other provisions
Under section 48 of the Act all liberties and franchises, with the exception of those that became separate administrative counties, merged with the county they formed part of for parliamentary elections. The Cinque Ports, together with "the two ancient towns and their members" (which for some purposes, such as lieutenancy, were considered a distinct county), were to become part of the county where they were situated. Section 49 allowed for the creation by provisional order of a council for the "Scilly Islands" to be established as a unitary authority outside the administrative county of Cornwall. This was duly formed in 1890 as the Isles of Scilly Rural District.
List of administrative counties and county boroughs created in 1889
England
† From 1 April 1890 the Isle of Wight was separated from the County of Hampshire to form an administrative county.
†† From 1890 the Scilly Isles were separated from the County of Cornwall for administrative purposes
‡ Newport became a county borough in 1891
Wales
Towns on county boundaries
A number of urban sanitary districts lay in more than one county. In each case, county boundaries were altered so that each town lay entirely within the administrative county that contained the largest part of the district's population in the 1881 census.
See also
History of local government in England
History of local government in Wales
References
Sources
The Local Government Act 1888, 51 & 52 Vict. c. 41
External links
Category:Local government in the United Kingdom
Category:United Kingdom Acts of Parliament 1888
Category:Local government legislation in England and Wales
Category:Roads in the United Kingdom
Category:Transport policy in the United Kingdom
Category:London County Council
Category:Metropolitan Board of Works
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Exploring possibilities for an alternative approach in experimental schistosomiasis mansoni: the peritoneal cavity of mice.
The schistosome oviposition and granuloma constitution in the peritoneal cavity of AKR/J mice were evaluated. Groups of mice intraperitoneally infected with cercariae of Schistosoma mansoni were weekly euthanized during the acute (56 to 84 days post-infection (DPI)) and chronic (147 to 175 DPI) phase of infection. Schistosome developmental stages obtained via peritoneal lavage and perfusion of the portal system were inspected, counted and fixed, and peritoneal granulomata were then processed for histology. The morphological characterization and quantitative analysis of peritoneal schistosome eggs and granulomata were for the first time performed, such as the demonstration of the viability of miracidia obtained there from. Eutopic and ectopic mature schistosomes and normal pattern of worm oviposition were observed in all periods studied. However, the size of schistosome eggs from peritoneal cavity was smaller than observed for eggs laid by female worms from the portal system. The numbers of S. mansoni eggs and/or granulomata recovered from the peritoneal cavity was higher in chronic than acute infection, while the mean diameter of peritoneal chronic granulomata was smaller than for peritoneal acute granulomata. The constitution and evolution of these cellular reactions at histology were similar to that of hepatic granuloma, and peritoneal granulomata were subject to the host immunomodulation. In addition to the standardization of this experimental approach, which allows the obtaining of free schistosomal granulomata from peritoneal cavity of AKR/J mice, the potential use of these granulomata in ex vivo and in vivo studies is discussed.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
If you’re here, you’re either interested in learning more about getting Bio-identical Hormone Replacement Therapy (BHRT) in Apex NC or prepared to jump into it. If you’re prepared to schedule an appointment and get started, setup a neighborhood BHRT appointment now. If information is what you’re after, keep reading!
If you still have questions after reading through our site, please feel free to reach out to us. We’re always happy to answer questions and provide facts about this type of hormone therapy treatment.
Why Would I Want Bioidentical Hormone Replacement Therapy (BHRT)?
If these all these effects are not enough to inspire you, then we really do not know what is! This list isn’t comprehensive, but focuses on the most popular benefits of launching a BHRT program.
Would you be excited about …
Renewed & Increased Energy
Better Focus
Solid Sleep Cycles
Balanced Moods
Weight Loss
Adding muscle mass
Increased workout performances
Increased Immune Functions
Increased libido
Increased sexual function
Regulated body temperature
Stronger bones
Seems pretty great, right? Read on..
Is BHRT For You?
The first place to start is to look at the way you are feeling at this time. Do you have some issues which you may have attributed to “getting old” and are just choosing to live with them? Are you feeling somewhat older than you think you need to? Running errands wears out you before anyone else? Not enjoying life as much you did in the past? Blood sugar & cholesterol moving up even when you seem to be eating well? Don’t feel like you’re able to focus on things like you have in the past? Expected there was nothing you could do about these problems and it is all just part of life? While these symptoms are often pretty broad, when all taken together, they could indicate pretty quickly that it’s time to talk to a Apex BHRT specialist! Here’s some of those kind of issues:
Common Low Hormone Symptoms and Results
Chronic Fatigue
Loss of vitality
Poor concentration
Anxiety
Irritability
Weight gain around the waist
Loss of muscle mass and tone
Reduced sex drive
Man: Erectile dysfunction (ED)
Man: Few nocturnal erections
Women: Hot flashes
Women: Vaginal Infections
Women: Urine Leakage
Loss of confidence
Diabetes
Hypertension
Depression
Arthritis
Heart attack
Stroke
Would A Visit To The Hormone Doctor Be The Solution For YOU?
People all have their own motivations – desire to recapture the energy of earlier days, clear up “brain fog”, improved sex life, better sleep, muscle gains, some weight loss… there are a LOT of reasons to be interested in this kind of hormone therapy. Those mentioned here are only the quickest ones. In the long term, the hormones in your body have a deep effect. Over the course of your life, having the optimal amounts of hormones will help maintain blood lipids properly, help control arrhythmias, reduce your odds of heart attacks and strokes, less prospect of diabetes, lower odds of problems like dementia and Alzheimers occuring.
With a list of benefits like this, however, there is often not just one reason to want BHRT. Most people are overjoyed to turn the hands of time back a few years. Many men and women who have undergone the procedure will agree the life changes can be incredible. While BHRT isn’t a panacea for every bad habit you’ve had over time, getting the body’s amount of hormones back to where it performs optimally is a strong choice to fortify your body in every way. The hormones which course through our own bodies are extremely similar to the mortar that holds together bricks in walls and structures. They function at a cellular level to help different parts of the bodies/organs work more efficiently.Learn more about Youth Institute BHRT treatments.
SCHEDULE YOUR NEW LIFE TODAY
866-789-BHRT
Women’s Bioidentical Hormone Treatment In Apex
While women all understand that they are likely to experience a massive change in their hormonal makeup at some point, it doesn’t necessarily make the situation any more tolerable. Before menopause, hormone levels continue to be often low. After menopause, things go totally blank with a female’s hormones. After spending 30+ years being bombarded daily with hormones controlling a great deal of body activities, the hormones all but disappear from a female’s body. Hot flashes are among the most frequently mentioned unwanted symptoms. With no hormones in the system, women can often feel a general slowdown in the life and activities. Vaginal infections and dryness together with a decreased sex drive can further dampen the excitement that should be life. The impacts of low estrogen levels can be a massive change for any woman. Estrogen pills will likely work wonders for any woman who gives it a try! As an OB/GYN, Dr. Greg Brannon is a fully trained female endocrinologist.
Men’s Bioidentical Hormone Replacement Therapy In Apex
The medical world is just starting to refer to a situation analogous to menopause in men called “andropause.” This is really the male equivalent of menopause – the point at which the testosterone in a man’s body falls noticeably and things just don’t feel the same. Levels might not be a complete zero by any means, but they have fallen to the point where guys will detect life just is not the same. Men will end up often putting on a little extra weight around the middle (think, “the Dad bod”), shed some muscle, may not be nearly as interested in sex as they once were, and have just a general feeling of malaise. This is commonly attributed to low-t, and the best solution in turn would be testosterone pellets. Hormone pellets may sound like something new and scary, but they’re the most effective and safest delivery method. Dr. Brannon has been using them for years! You no longer have to feel like you’re just alive, you can start living again!
The Youth Institute BHRT For Both Men And Women
The great news is the Youth Institute is available to treat women and men from the Apex area. After treating over 3000 patients as of this writing, Dr. Greg Brannon is experienced and knowledgeable in providing the best possible hormone dosages for patients. The Youth Institute uses pellets as a preferred method of hormone delivery to the body. The release is smooth and constant – preventing spikes in daily levels of your hormones. Ending the multiple visits to the physician for ongoing shots and also being able to administer enough hormones to the body to allow patients to get back to OPTIMAL hormone levels. So, do you think HRT (hormone replacement therapy) could be right for you? Let’s find out!
Other Hormone Replacement & Thyroid Treatments
Another possible issue that you could be facing as you age are thyroid disorders. Don’t trick yourself into thinking the chances are so low that you won’t be the one to have it, over 35 million women and 15 million men are affected right now. Thyroid problems can cause you a whole host of issues in your everyday life. Our team at Cary BHRT is well equipped to handle many types of treatments. Not only do we strive to treat your symptoms, but to alleviate the root cause of them. Call or contact us over at The Youth Institute and let’s see how we can get you feeling better as soon as possible!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How to break long strings in python?
I have a list of very long strings, and I want to know if theres any way to separate every string´s element by a certain number of words like the image on the bottom.
List = [“End extreme poverty in all forms by 2030”,
“End hunger, achieve food security and improved nutrition and promote sustainable agriculture”,
“Ensure healthy lives and promote well-being for all at all ages”,
“Ensure inclusive and equitable quality education and promote lifelong learning opportunities for all”,
“Promote sustained, inclusive and sustainable economic growth, full and productive employment and decent work for all”]
Print(list)
Out:
“End extreme poverty in all forms by 2030”,
“End hunger, achieve food security and improved
nutrition and promote sustainable agriculture”,
“Ensure healthy lives and promote well-being for all at all ages”,
“Ensure inclusive and equitable quality education and promote
lifelong learning opportunities for all”,
“Promote sustained, inclusive and sustainable economic growth,
full and productive employment and decent work for all”]
the final result is kinda like the image
A:
You can use textwrap:
import textwrap
print(textwrap.fill(List[1], 50))
End hunger, achieve food security and improved
nutrition and promote sustainable agriculture
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Hazel (disambiguation)
Hazel is a genus of nut-bearing trees and shrubs, including common hazel.
Hazel may also refer to:
Names
Hazel (given name), including a list of people and fictional characters
Hazel (surname), a list of people
Places
Hazel, Kentucky, a city
Hazel, South Dakota, a town
Hazel, Washington, an unincorporated community
Hazel, West Virginia, an unincorporated community
Other uses
Hazel (band), a 1990s American indie rock band
Hazel (comic), a comic strip
Hazel (TV series), a 1960s sitcom based on the comic strip
"Hazel" (song), a song by Bob Dylan
Hurricane Hazel, a 1954 storm
Hazel, an eye color
See also
Hazel dormouse, a species of rodent that feeds on the nuts of hazels
Hazel grouse, a species of grouse often found in hazel woods
Hazell
Tropical Storm Hazel, a list of tropical storms
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Disclaimer: This web site is designed for general information only and does not create attorney-client relationship. Persons accessing this site are encouraged to seek independent counsel for legal advice regarding their individual legal issues.
help me po..gun related case?
good day atty,2 weeks ago i went to a bday party of a friend.As im leaving and about to get inside my car(in front of the gate}may nakita po ako a few meters away a group of 10 na nag wawala and about to approach at the party.3 of them where armed with knives.I had my gun with a ptc and i approached one of the men with knives.Pointing my gun downwards i shouted directly "bitawan mo yan!"he just looked and ignored my purposed of doing that is to restrain him.Suddenly visitors from inside rushed outside and had physical confrontation with them.I went back to my car to go to a police station.As im on my way nakasalubong ko ung mobile with 2 policemen.tinawag ko sabi"sir my mga nangugulo dun sa party my mga kutsilyo sundan natin"sinundan nila ako at nakita namin sila less than 200 meters away from the party's venue.knowing they where armed with knives.I stepped out of the car again with my gun pointing downwards and approached a male that knew has a knife tinaas ko ung damit looking for the knife and asked nasan ung may mga kutsilyo?.A female replied "wala kuya kami nga ang nasaktan at tinutukan"one of the police men said; eh di magreklamo nalang kayo.after that umuwi nako.after 3 days may na received akong invitation letter from barangay due to "panunutok ng baril and pananakit".Complainants where 6 males and a female meron pa daw (male) minor na ihahabol sa women's desk.those men where known for trouble making then "hihingi ng pera para ma areglo"naka 2 barangay hearings na kami and next week is our last.If ever hindi ma resolved sa barangay Ano po pede nilang ikaso sakin?considering my kasama akong pulis ebidensya po ba to na wala akong masamang intensyon?Ano napo dapat kong gawin ngayon?thanks in advance po atty.
[i] Visit our FB Page: FOR MORE LEGAL ADVICE Warning and Disclaimer: I am not your lawyer; and you are not my client. With the limitations of an Internet forum, a thorough review of your concern is not possible. View my comments at YOUR OWN RISK. It is best to actually retain a lawyer for your individual concerns.
this will fall under grave threat because you pointed a gun so it does not have to go through the bgy
_________________
[i] Visit our FB Page: FOR MORE LEGAL ADVICE Warning and Disclaimer: I am not your lawyer; and you are not my client. With the limitations of an Internet forum, a thorough review of your concern is not possible. View my comments at YOUR OWN RISK. It is best to actually retain a lawyer for your individual concerns.
[i] Visit our FB Page: FOR MORE LEGAL ADVICE Warning and Disclaimer: I am not your lawyer; and you are not my client. With the limitations of an Internet forum, a thorough review of your concern is not possible. View my comments at YOUR OWN RISK. It is best to actually retain a lawyer for your individual concerns.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Association between proxy-reported sleep bruxism and quality of life aspects in Colombian children of different social layers.
To describe and explore the association between proxy-reported sleep bruxism (SB) and quality of life (QoL) in a population of Colombian children belonging to different social layers. The parents of 1556, 6-13-year-old school children, were administered the Pediatric Inventory of Quality of Life (PedsQL4.0™) and an evaluation of their sociodemographic and socioeconomic conditions. Associations between such proxy-reported, viz., "possible" SB and QoL features were assessed by means of the linear-by-linear association test on the overall sample and for distinct socioeconomic groups. No significant associations were shown between proxy-reported sleep bruxism and the total and domain PedsQL scores, with the exception of a weak correlation with the School Functioning Score. As for the specific QoL items, only two variables of the Emotional Functioning Scale of the PedsQL4.0 (i.e., "feeling afraid or scared" and "trouble sleeping") and a feature of the School Functioning Scale (i.e., "forgetting things") were weakly correlated with SB, with correlation coefficients ranging from 0.092 to 0.119. Considering the different socioeconomic groups, no associations were found in the low layer. In the medium socioeconomic group, a significant association was pointed out with one emotional functioning aspect, while in the high layer an association was found with two emotional features and three school functioning variables. The results pointed out only a few associations between proxy-reported SB and the emotional and school functioning aspects of children's quality of life, both in the total sample as well as in children belonging to medium and high socioeconomic status, while no associations were found with physical health and social functioning domains. This article gives information to help clinicians evaluating the QoL, sociodemographic, and socioeconomic characteristics in children with possible sleep bruxism.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Table of Contents
Scene queries allow you to specify a geometric object and perform a query if that object intersects or overlaps any physics object in the scene. Most queries also return detailed information about the intersection. All queries are performed through the global Physics interface, accessible through gPhysics().
Here is a short example of a basic query, to give you a better idea:
// Ray starting at origin, traveling towards negative Z
Vector3 origin(0, 0, 0);
Vector3 direction(0, 0, -1);
Ray ray(origin, direction);
PhysicsQueryHit hitInfo;
// Cast a ray into the scene and return information about first object hit
They all share a common interface, where as the first parameter they accept a shape with its starting position and orientation, travel direction, and finally an optional maximum range. They return an array of PhysicsQueryHit objects.
PhysicsQueryHit object contains information about each individual hit, and it contains:
Collider component that was hit
Position and normal of the contact point
Distance of the contact point from the query origin
Index of the triangle that was hit (if hit collider is a MeshCollider)
Barycentric coordinates of the triangle that was hit (if hit collider is a MeshCollider)
Closest hit casts
Closest hit casts are nearly identical to all hit casts, with the main difference is that they return a boolean value if a hit occurred or not, and output a single PhysicsQueryHit object. Hit information returned always concerns the closest found hit.
Checking for closest hit is cheaper than checking for them all, and is usually adequate for most applications. Relevant methods are:
They also share a common interface where as the first parameter they accept a shape with its starting position and orientation, travel direction, reference to a PhysicsQueryHit object to receive the results, and finally an optional maximum range. They return a boolean value that returns true if anything was hit.
// Axis aligned box centered at origin with extents 0.5 in all directions
Any overlap methods
This is a set of overlap methods that returns only a boolean value if the overlap occurred or not, without a list of colliders that are overlapping. This is cheaper than querying for all overlaps. The relevant methods are:
| null |
minipile
|
NaturalLanguage
|
mit
| null |
New York Times attempts to map “cultural buzz”
According to the study the majority of NYC’s cultural production does not occur in Brooklyn, but in the mainstream areas of Lincoln Center and Broadway. The NYT’s arrived at such a conclusion by compiling Getty Images because the study believes cultural buzz is defined by Internet images and not by where artists live and work. It’s doubtful that Richard Florida or any New Yorker would agree with this report. Regardless, the infographics are hot.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1. Field of the Invention
The present invention relates to a driver assistance device and a driver assistance system for assisting a driving operation by a driver of a vehicle. The present invention also relates to a method of controlling a driver assistance device and a computer readable medium that includes instructions including the method of controlling the driver assistance device.
2. Description of the Related Art
JP-A-2009-15110 discloses a driver assistance device that receives traffic signal information including a schedule of lighting colors of a traffic signal from an external device, determines whether a current speed enables a subject vehicle in which the driver assistance device is disposed to cross an intersection on a green light, and outputs a warning when the driver assistance device determines that the current speed does not enable the subject vehicle to cross the intersection.
The above-described driver assistance system outputs the warning only based on whether the current speed enables the subject vehicle to cross an intersection on a green light. Thus, the driver assistance system cannot contribute to improve fuel consumption and to reduce traffic jams.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The charge will appear as Prometheus Global Media on your credit card statement.
Money Back Guarantee
You may cancel at any time during your subscription and receive a full refund for all unmailed copies.
Do you have an iPad?*
YesNo
A digital version of The Hollywood Reporter
will be sent if you do not have an iPad.
Automatic Renewal ProgramYou authorize HOLLYWOODREPORTER.COM to charge your credit/debit card at the 12 months subscription price now and in time to renew your HOLLYWOODREPORTER.COM subscription, without interruption, before the start of each new 12 months term at the subscriber rate then in effect unless you tell us to stop. HOLLYWOODREPORTER.COM will notify you via email approximately one week before your credit card is charged confirming your service and rate. You may cancel at any time by contacting customer service at 866-525-2150 (U.S.) or 845-267-4192 (Outside U.S.). If you do not want your subscription to be automatically renewed, please UNCHECK this box.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Food Additives & Ingredients to Avoid
Manufacturers use food additives for several reasons: to enhance flavor, improve texture and appearance, add nutrients or keep products fresh. While some additives, such as vitamins and minerals, contribute to ongoing good health, other additives, mostly man-made substances, cause concern about potential health risks. Understanding the role of additives and which pose possible health problems can help you make healthy food choices.
Artificial Sweeteners
Controversies concerning artificial sweeteners such as aspartame, saccharin and acesulfame-K, which are used in products such as soft drinks and diet foods, continue to hover over the food industry, but studies are zeroing in on evidence. An article published in the "American Journal of Industrial Medicine" in April 2014 noted that, based on the evidence of aspartame's potential cancer-causing effects, a re-evaluation by regulatory agencies regarding aspartame's safety must be considered an urgent matter of public health. While acesulfame-K and saccharin are linked to cancer in animals, the verdict is still out. The Center for Science in the Public Interest recommends that consumers avoid these ingredients until they are better tested or banned.
Artificial Coloring
While some foods are colored with natural substances, such as beta carotene and carmine, most artificially colored foods, such as candy, soda pop and gelatin, are colored with synthetic dyes. Foods containing these dyes should be avoided, according to the Center for Science in the Public Interest. For example, yellow 5 dye -- the second most widely used coloring -- can cause allergy-like hypersensitivity reactions, particularly in aspirin-sensitive people, and triggers hyperactivity in some children, says CSPI. Red 3, a dye used to color maraschino cherries, is linked to the development of thyroid tumors in rats.
Hydrogenated Vegetable Oil
Hydrogenated vegetable oil, or man-made trans fat, is produced by combining liquid vegetable oil with hydrogen to form a semi-solid or solid fat. Man-made trans fats are found in foods such as margarines, cookies, frozen pies, frozen pizzas, crackers, baked goods and microwave popcorn. Eating trans fat increases "bad" low-density lipoprotein cholesterol, which contributes to the risk of coronary heart disease -- the leading cause of death in the United States, according to the Centers for Disease Control and Prevention. Avoid products containing hydrogenated vegetable oils whenever possible.
Synthetic Antioxidants
Butylated hydroxyanisole, or BHA, and butylated hydroxytoluene, or BHT, are synthetic antioxidants used as food preservatives. They significantly extend the shelf life of foods that contain fats such as vegetable oils, animal fats, flavorings, spices, nuts, processed meats and snack foods, which are susceptible to oxidation's deteriorating effects. Although these substances are believed to be safe, controversy about their use continues, according to Frostburg University. An article published by the United States Department of Health and Human Services' National Toxicology Program in 2011 noted that BHA is potentially a carcinogen.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Krüppel homolog 1 and E93: The doorkeeper and the key to insect metamorphosis.
Insect metamorphosis is regulated by two main hormones: ecdysone (20E), which promotes molting, and juvenile hormone (JH), which inhibits adult morphogenesis. The transduction mechanisms for the respective hormonal signals include the transcription factors Krüppel homolog 1 (Kr-h1) and E93, which are JH- and 20E-dependent, respectively. Kr-h1 is the main effector of the antimetamorphic action of JH, while E93 is a key promoter of metamorphosis. The ancestral regulatory axis of metamorphosis, which operates in insects with hemimetabolan (gradual) metamorphosis and is known as the MEKRE93 pathway, is based on Kr-h1 repression of E93. In the last juvenile stage, when the production of JH dramatically decreases, Kr-h1 expression is almost completely interrupted, E93 becomes upregulated and metamorphosis proceeds. The holometabolan (complete) metamorphosis mode of development includes the peculiar pupal stage, a sort of intermediate between the final larval instar and the adult stage. In holometabolan species, Broad-Complex (BR-C) transcription factors determine the pupal stage and E93 stimulates the expression of BR-C in the prepupa. The MEKRE93 pathway is conserved in holometabolan insects, which have added the E93/BR-C interaction loop to the ancestral (hemimetabolan) pathway during the evolution from hemimetaboly to holometaboly.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Money vs. Land
We live in a world of abundance yet simultaneous poverty. We can no longer blame famine, war, or lack of technological progress for the poverty that remains an inextricable part of human experience. Nor can we blame a debt-based monetary system alone for our state of affairs. Although money buys power, it can only do so, by and large, in an economic system in which wealth cannot easily be created due to the ownership and hoarding of land. Human beings need land even more so than they need money; the monopoly of land—not the monopoly of money—is the primary driver of poverty and inequality.1 Once we understand that the issue is lack of affordable access to land, and therefore to community, we understand why the value of land has to be shared.
Economists worldwide have already laid much of the scientific groundwork for the effectiveness and validity of community land contributions.2 People unfamiliar with land contributions often wonder if these contributions will raise the cost of housing. However, as we shall see in this chapter, land actually becomes more affordable because land will no longer be hoarded. And since revenues from land contributions will diminish or even eliminate the need for conventional taxes, goods and services will become significantly more affordable. The end result is that homeowners are likely to incur net savings due to diminished or eliminated taxes and considerably lower costs of living.
Community land contributions only burden property owners who don’t put land to efficient use. Tenants are unaffected because tenants already pay for the benefits they receive from the communities they’re living in, except that they’re paying their landlords instead of their communities. In other words, since tenants already pay land contributions to property owners, land contributions are already included in landlords’ profits if they rent their properties out; if property owners try to pass community land contributions on to their tenants, and thus charge tenants twice for the community benefits tenants receive, they’ll find that the property rental market will simply accommodate the tenant with another property owner who’s willing to accept less of a profit.3
Nevertheless, community land contributions provide a win-win for everyone, since real-estate developers can still gain from the value of the housing they provide; they just won’t be able to profit as much from land anymore. And because community land contributions will lead to an overall increase in wealth for society while preventing a greater increase in the cost of living, community land contributions are extremely beneficial for tenants as well.
Our current laws and practices don’t support the dream of affordable housing for the average person. Meanwhile, homeowners with expensive mortgages are burdened by their liabilities; our current system doesn’t easily allow them to sell their homes and rent instead. Flawed economic policies meant to encourage homeownership—and thereby land ownership—are rotten at their core because they’re built on the assumption that land ought to be owned and profited from. As a result, such policies gear us to consider short-term self-interest at the expense of common interests, and therefore at the expense of our own long-term self-interest.
Gentrification and Rent Control
Currently, property owners can profit from land while tenants cannot. Because tenants aren’t able to profit from land, they usually end up being gentrified out when rents increase. Unfortunately, in our current economic model there are few things communities can do short of implementing rent control to prevent rents from increasing; higher rents are a natural byproduct of increased affluence for a given area. Because this affluence is only pocketed by property owners and financial institutions and not shared with all residents, rent control often seems like the least bad option in the fight against gentrification. But rent control comes with a host of negative side effects, including a shortage of housing and lower-quality housing, and doesn’t serve the community in the long run.4
Universal Basic Income
What’s required is an entirely new mechanism by which higher rents are shared with all residents—property owners and tenants alike. One effective way to do this is through the issuance of a partial Universal Basic Income to all residents, financed entirely from community land contributions. A Universal Basic Income, only when exclusively derived from community land contributions, has the effect of preventing gentrification: When tenants receive a Universal Basic Income, they’re able to afford the higher rents, which they pay to their landlords, who in turn have to pay more money to their local community and provide better services to their tenants. The community, in turn, then shares that added revenue with all community members—and everyone wins.
Homelessness
Having one’s own home can tremendously ease one’s mind in a way that few other things in life can; the homeless are often painfully aware of this reality because they lack that psychological security. While some people tend to believe that the homeless are either lazy or mentally incapable of earning enough money to afford a place to live, few people consider the principle that land has to be shared with all human beings—regardless of whether a person contributes to society or not. This is because no human being has made land; therefore no human being has a justifiable right to marginalize another person from land. Furthermore, all of us need land, just like we need air to breathe.
Since everyone has a basic right to land, it’s society’s duty to provide a minimum standard of free land access to all its members. It can do this for property owners and tenants by providing them with a Universal Basic Income; the homeless, however, should also be given the option of free public housing (the cost of which can be deducted from their Universal Basic Income share) so that they can have accommodations without living in fear of being evicted. To provide the homeless with free housing also makes sense on a financial basis, since the cost of providing housing for the homeless often tends to be significantly less than the actual welfare costs and societal burdens that are created by homelessness.5
Land is a universal human right. Consider how important it is for the human mind to have a ground to call its own! But in order for everyone to have their own ground, the value of land has to be shared, and housing has to be provided to those who live on the margins.
Land belongs to the people, yet the homeless are not only homeless—they are landless. Their poverty is less a reflection of their inability to sufficiently provide for themselves in a predatory economic system, and much more a reflection of our collective ignorance. Once we realize that everyone has a right to land—and therefore, to shelter—and once we realize how we commoditize this right to the highest bidder, it becomes apparent how we each are complicit in each other’s poverty. It is therefore up to all of us to do our part in alleviating poverty and creating, in the words of Charles Eisenstein, “the more beautiful world our hearts know is possible.”
Footnotes
1The documentary “Real Estate 4 Ransom” poses a rhetorical question that drives this point home: “If you had all the money in the world, and I owned all the land, what would I charge you for your first night’s rent?”
But let the facts speak for themselves: For most of its existence, the U.S. economy operated on sound money prior to the establishment of the Federal Reserve in 1913, yet in settled parts of America people nonetheless experienced extreme wealth inequality as well as economic booms and busts. Not so in frontier towns, however, where land could still be had for very little: Wages there tended to be comparatively high, opportunities for employment were great, and economic booms and busts did not exist.
3 Economists throughout history have clearly stated that land contributions will not raise the rents of tenants but will eat into the profits of landowners, who do little work for the income they receive. Adam Smith recognized this back in 1776 in his work An Inquiry into the Nature and Causes of the Wealth of Nations:
“A tax upon ground-rents would not raise the rents of houses. It would fall altogether upon the owner of the ground-rent, who acts always as a monopolist, and exacts the greatest rent which can be got for the use of his ground… Whether the tax was to be advanced by the inhabitant, or by the owner of the ground, would be of little importance. The more the inhabitant was obliged to pay for the tax, the less he would incline to pay for the ground; so that the final payment of the tax would fall altogether upon the owner of the ground-rent.”
4 This brings to mind an anecdote: A friend of mine paid for a rent-controlled apartment in San Francisco and left it empty while he lived elsewhere for a year. By retaining his rent-control privilege, he was able to avoid paying a higher rent upon his return to San Francisco and ended up saving money despite having paid for two apartments for an entire year. Laws against such behavior are futile; but if we change the underlying economic incentives, we can avoid the need for such laws altogether. For a good microeconomic perspective on the side effects of rent control, see this YouTube video.
5 For example, the annual cost of emergency room visits and jail stays for the homeless in San Francisco was estimated in 2004 to be approximately $61,000 per person, whereas the cost of providing a homeless person with permanent housing, treatment, and care was estimated at only $16,000. See Angela Alioto, et al. “The San Francisco Plan to Abolish Chronic Homelessness,” June 30, 2004, San Francisco Mayor’s Office of Housing and Community Development.
Vandana Shiva, an internationally recognized Indian activist and philosopher, explains that planning for the human being rather than the automobile can liberate space and create community within a city. In her opinion, a sustainable city should operate as a self-reliant and self-sufficient cluster of villages.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
FLINT, MI - Former Maryland Governor Martin O'Malley made a case for presidential candidate Hillary Clinton during a UAW rally in Flint as part of a daylong trek in Michigan where he visited Flint, West Bloomfield, East Lansing and Kalamazoo.
"I'm here because Michigan plays such a critically important role in this presidential contest," said O'Malley regarding his trip to Michigan. O'Malley talked about the job market including wages and the automotive industry in his plea for Clinton's run for president.
O'Malley along with state, local, federal, UAW and community leaders including Congressman Dan Kildee, Flint City Council President Kerry Nelson and council members Scott Kincaid and Eric Mays were at the rally at UAW Local 599 at 812 Leith Street. Former Flint Mayor Dayne Walling and Michigan AFL-CIO president Ron Bieber were also at the event.
Since the water crisis Flint has become a political hotbed drawing presidential hopefuls to the city including Donald Trump who visited Flint last month.
O'Malley said Flint is a city where government failed under Republican leadership pointing to the city's water crisis.
"This is where you see what happens when people are not respected, when people's voices are not heard, when people become anonymous to those that would govern them," said O'Malley. That's not the type of future we want for our country."
Last week, Clinton's daughter, Chelsea Clinton visited a church and a Democratic National Committee office in Flint also campaigning for Clinton. Chelsea Clinton also talked about the city's water crisis and promised that her mother would support Flint if Hilary Clinton wins the president's seat.
Hillary Clinton's officials also announced that former President Bill Clinton will be in Michigan next week campaigning for Hillary Clinton and encouraging people to register to vote before the Oct. 11 voter registration deadline.
The public can register to see Bill Clinton by visiting one of the three links below.
Saginaw
Flint
Rochester Hills
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Tech
Polio Virus May Be Fully Eradicated Within One Year
The World Health Organization is confident that the end of the polio virus is in sight, according to The Guardian.
"We absolutely need to keep the pressure up, but we think we could reach the point where we have truly interrupted the transmission at the end of the year or the end of the low season [winter] next year," said Michel Zaffran, the WHO's director of polio eradication.
Data provided by the WHO says that there have only been nine reported cases of wild polio (as opposed to the vaccine-derived version) so far this year. That's down from 2015, when 22 cases were reported over the same time period. For 2016, two cases have been documented in Afghanistan and seven in Pakistan.
If successful, polio will be the second human-hosted virus to ever be fully eradicated. In 1980, a similar campaign fully wiped out smallpox.
Although the WHO has been fighting to eradicate polio since 1988, the group has seen some challenges in recent years. In Pakistan, community vaccination sites have often been targeted by attacks from the Taliban. The terrorist group has also been known to spread misinformation about the vaccine to civilians. In Afghanistan, Zaffran said the WHO is targeting 47 districts for expanded vaccination programs -- 32 of which are controlled by anti-government forces.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Single sign on with ADFS
I am looking for single sign on for my application which is built on javascript (no server side language).
Requirement:
Agent log in to Windows (user integrated to Active directory)
Open my web page
Based on who logged in to windows, my application goes to AD and pull some user
specify data (eg email, phone)
How shall I go about it?
As per my understanding I will require ADFS for this.
So:
User goes to my web page
My web page calls some Web services or web application (which is build on c#)
That will authenticate against AD FS and get claim
Either get phone number and email in claim or get username and query AD for phone and email
Return the data to my web page (build on javascript)
It seems there something wrong in my understanding!!
Please suggest more appropriate solution based on my requirement
A:
Frankly, I can't think of a way to make it work without a server side processing. This is because the ws-federation protocol ADFS uses is not just about returning claims.
It is about returing a SAML token. The token contains claims but what is most important about it is that it is signed using the XMLDsig. How are you going to validate the token is a first big question. But there are surely external libraries that allow that.
But then, such authentication can easily be bypassed by modifying scripts in the browser. This is because the ws-federation stops where you get the token and then it is up to you to exchange the token for the actual identity. And this won't work when processed only at the client side.
A:
ADFS 3 does not support the OAuth2 implicit profile, which would be an option, but still you would need to verify the token on the server to avoid session fixation.
You can setup something like AuthorizationServer that supports Oauth2/OpenID Connect implicit profile
http://leastprivilege.com/2013/09/19/adding-oauth2-to-adfs-and-thus-bridging-the-gap-between-modern-applications-and-enterprise-back-ends/
Another option is to use something like Auth0 (Disclaimer: I work for Auth0) which also supports OAuth2/OpenID Connect implciit profile. In that case you wouldn't need ADFS, there is a connector/agent that you install on your network that does not require opening firewalls or anything and it supports implicit profile that is suited to JavaScript apps. This is an example of a single page app tutorial (if you create an account it will tailor the doc with your credentials):
https://docs.auth0.com/singlepageapp-tutorial
| null |
minipile
|
NaturalLanguage
|
mit
| null |
50th Congress of the European Regional Science Association: "Sustainable Regional Growth and Development in the Creative Knowledge Economy", 19-23 August 2010, Jönköping, Sweden
Abstract:
The degree of comovement of economic activity across states or regions is an issue of utmost importance to policymakers. Asymmetric business cycles are often seen as an impediment to the formation of a common currency area. However, it has been argued that a common monetary policy in itself could reduce the cyclical asymmetry. We examine real business cycle convergence for 41 euro area regions and 48 US states. By looking at the regional dimension, a larger information set can be exploited and might offer new insights. Regions tend to be more open to trade than countries and the degree of specialisation is usually higher than at the national level. If diverging trends cancel out in the aggregate, policy conclusions based on national evidence could be misleading. Regional comovements may be caused not only by common business cycles, but also by other factors due to location. They can be linked to industrial structures and migration, but can also reflect non-economic factors like habits, heritage, and culture. Spatial spillovers have been largely neglected in previous studies, thereby creating omitted variable bias. A panel model allowing for spatial correlation is a convenient way to capture these effects. This analysis is also relevant from a monetary policy point of view. By comparing the synchronization of economic fluctuations in US states and comparable euro area regions, the perspectives of a common monetary policy in Europe can be assessed. The US provides a natural benchmark in this respect. Both the US and the euro area share similar socio-economic characteristics, regarding the size, the level of development, culture etc. The results obtained by a panel model with spatial effects indicate that the impact of national business cycles for the regional development has been rather stable over the past two decades. Hence, a tendency for convergence in business cycles often detected in country data is not confirmed at the regional level. The pattern of synchronization across the euro area is similar to that across US states. Although cyclical heterogeneity is detected, it does not indicate a serious impediment to a common monetary policy of the ECB.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Man pleads guilty in death of monkey at Boise zoo
BOISE, Idaho—A man charged with beating a monkey to death with a tree branch at Boise's zoo last fall has pleaded guilty to animal cruelty.
Michael Watkins, 22, of Weiser, reached a plea agreement with prosecutors Tuesday for his role in the Nov. 17 death of one of Zoo Boise's two Patas monkeys.
Watkins pleaded guilty to one felony count of attempted grand theft and a misdemeanor count of animal cruelty. In return, Ada County prosecutors dropped felony charges of grand theft and burglary.
Watkins faces up to seven years in prison for the felony and six months incarceration on the animal cruelty charge. He is scheduled to be sentenced May 16 by 4th District Judge Lynn Norton.
Watkins had initially pleaded not guilty. In interviews with police, he said the monkey attacked him as he was trying to set it free after he entered the zoo in the early morning hours. He said he hit the monkey in the head in self-defense.
But prosecutors alleged Watkins tried to steal the monkey after a night of heavy drinking. During earlier court hearings, prosecutors said Watkins manipulated a lock to get into the primate enclosure and removed the monkey by wrapping it in a jacket.
The monkey's death stirred shock and outrage, but it also caused concern among zoo officials about the welfare of the surviving monkey. Patas monkeys are extremely social and the prospect of having it live alone led zoo officials to consider shipping it to another zoo.
Advertisement
Instead, the Rosamund Gifford Zoo in Syracuse, N.Y., donated two companions in December.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The public hearing, which begins at 7 p.m., will be held at the Craven County Courthouse. The Wildlife Resources Commission also has scheduled a staff presentation 30 minutes before the hearing to discuss statewide black bear management objectives. The 6:30 p.m. presentation and discussion will give background information about rule proposals that further objectives in the North Carolina Black Bear Management Plan, 2012-2022. The plan assists the Wildlife Commission in managing bear hunting to maintain healthy bear populations consistent with habitat where bears occur, and balancing the consideration of stakeholders.
Other hunting proposals make changes to the Western Archery Deer Season, and adjust regulations for black powder firearms and crossbows.
Of interest to anglers is a statewide proposed regulation that encourages private landowners to allow public angler access to inland fishing waters through their property under an agreement with the Commission. The proposal provides landowners the ability to prescribe allowable activities on their property. Each area will be clearly marked with signs identifying activities allowed.
Another statewide proposed fishing regulation will provide anglers the option to label trotlines, set hooks and jug hooks with their names and addresses or with their WRC customer numbers. Allowing anglers to use their WRC customer numbers will help protect privacy by limiting the personal information required on the labels.
The “Public Hearings Applying to 2014-2015 Fishing, Hunting and Trapping Seasons” booklet, which provides a detailed list of all 42 proposed regulations, along with a comment form, is available online.
The schedule for the 2014-2015 public hearings is below. Meetings to discuss the six bear proposals begin at 6:30 p.m. Public hearings begin at 7 p.m.
DATE
DISTRICT
CITY
LOCATION
Jan. 7
4
Dublin
Bladen Community College
Auditorium
7418 N.C. Hwy. 41W
Dublin, N.C. 28332
Jan. 8
5
Graham
Courthouse
212 W Elm St.
Graham, N.C. 27253
Jan. 9
6
Norwood
South Stanly High School
40488 South Stanly School Rd. Norwood, N.C. 28128
Jan. 14
9
Murphy
Tri-County Community College
Enloe Multi-purpose Room
21 Campus Circle,
Murphy, N.C. 28906
Jan. 15
8
Newton
1924 Courthouse
Catawba County Museum of History
30 N College Ave.
Newton, N.C. 28658
Jan. 16
7
Wilkesboro
The Walker Center
Wilkes Community College
1328 S. Collegiate Dr.
Wilkesboro, N.C. 28697
Jan. 21
1
Edenton
Swain Auditorium
200 E. Church St.
Edenton, N.C. 27932
Page 2 of 2 - Jan. 22
2
New Bern
Craven County Courthouse
302 Broad St.
New Bern, N.C. 28560
Jan. 23
3
Rocky Mount
Nash Community College
Brown Auditorium
522 North Old Carriage Rd.
Rocky Mount, N.C. 27804
About the N.C. Wildlife Resources Commission
Since 1947, the N.C. Wildlife Resources Commission has been dedicated to the conservation and sustainability of the state’s fish and wildlife resources through research, scientific management, wise use, and public input. The Commission is the state regulatory agency responsible for the enforcement of fishing, hunting, trapping and boating laws and provides programs and opportunities for wildlife-related educational, recreational and sporting activities. To learn more, visit www.ncwildlife.org.
Get N.C. Wildlife Update — news including season dates, bag limits, legislative updates and more — delivered free to your Inbox from the N.C. Wildlife Resources Commission. Go to www.ncwildlife.org/enews.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Removing a 'b' from the Python String
I am currently using the Numpy package (version 1.12.1) in Spyder (Python 3.6).
For some reason I am unable to remove 'b's which appear before strings in the IPython Console.
import numpy as np
student = np.dtype([('name', 'S20'), ('age', 'i1'), ('code', 'i4')])
print (student)
recordsvar = np.array([('Cordelia',28,100),('Cordelia',29,101),
('Cordelia',30,102)], dtype=student)
print (recordsvar)
The output is
[(b'Cordelia', 28, 100) (b'Cordelia', 29, 101) (b'Cordelia', 30, 102)]
How do I remove the 'b' in from of Cordelia?
Thanks in advance
A:
The b' indicates, that your data is stored as bytes, the numpy datatype is S20. If you want to store characters, use unicode as datatype: U20:
student = np.dtype([('name', 'U20'), ('age', 'i1'), ('code', 'i4')])
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
can com.google.gwt.xml.client.XMLParser configured to disallow doctype?
My question is regarding the XML Parser of google: com.google.gwt.xml.client.XMLParser.
Can it be configured to disallow external doctype or doctype at all?
As i understand SAXParser has that option with setFeature("http://apache.org/xml/features/disallow-doctype-decl", true)
Is there such a thing in gwt parser? where can i find the API?
Any help would be appreciated?
thanks,
Tal
Answer:
GWT is translating java code to javscript, so code finally executes on client side. GWT relies on the browser to parse the XML.
Seeking in web, javadocs doesn't seem to have this functionality and this parser is a very simple DOM tool, with no SAX , no external DTD and no XPath ,and so will not have external entities issues.
A:
GWT is translating java code to javscript, so code finally executes on client side. GWT relies on the browser to parse the XML. Seeking in web, javadocs doesn't seem to have this functionality and this parser is a very simple DOM tool, with no SAX , no external DTD and no XPath ,and so will not have external entities issues.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[Hemorrhagic shock due to splenic rupture in non-severe acute pancreatitis].
A 54-year old man was hospitalized for a non severe acute pancreatitis of alcoholic aetiology. Four days after his admission, whilst symptoms and laboratory findings were on the mend, he suddenly presented with acute shock. A CT-scan demonstrated a massive haemoperitoneum due to splenic rupture which necessitated an emergency splenectomy. The causes of shock in acute pancreatitis and the factors that may lead to splenic rupture are discussed. In this patient, a possible role of the non-steroidal anti-inflammatory treatment remains undetermined.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The invention concerns a roller used in a device for processing a filter material ribbon in the tobacco-processing industry, the roller including a roller core and a covering for the roller core. The invention further concerns the use of such a roller. In addition, the invention concerns a device and a method for processing at least one filter material ribbon in the tobacco-processing industry with at least one roller having a roller core and at least one covering for the roller core.
A device of this type is disclosed in European Patent document No. EP 654 224 B1. For the production of filter rods in the tobacco-processing industry, a filter-material ribbon, the so-called filter tow, of a composite fiber material such as cellulose acetate is continuously pulled from a supply, for example a bale. The tow is then spread out, is stretched and sprayed with a solvent, for example triacetin, is subsequently gathered on the side, conveyed to a blast air nozzle and then supplied to a funnel. The processed and compacted filter tow is supplied from there to a filter strand-forming machine. In the filter strand-forming machine, the ribbon that is shaped into a filter strand is continuously enveloped with an enveloping material tape and is compacted further. The filter rods are subsequently cut from the enveloped filter strand.
Known processing devices of the above-described type are manufactured and sold by the assignee of the present application under the designation AF 1, AF 2 and AF 3. Further, known filter strand-forming machines of the above-described type are manufactured and sold by the assignee of the present application under the designation KDF 2 and KDF 3.
In the filter-processing device, the filter tow is transported, stretched and gathered with the aid of roller pairs. In the process, the filter tow is guided between the contacting rollers of a roller pair. In general, one roller of the pair of rollers is provided with a rigid, grooved surface, which makes contact with a resilient, rubbery surface and/or covering on the other roller. During the filter strand production, these rubber-covered rollers are subjected to a gradual, hardly noticeable wear of the covering. However, the roller covering wear clearly affects the filter quality after a specified production interval because the filter tow can no longer be transported and gathered to the required and desired degree.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Right ventricular wall-motion changes after infant open heart surgery--a tissue Doppler study.
Right ventricular (RV) dysfunction is a well-recognized complication of cardiopulmonary bypass surgery (CPB) in adults. Infants and neonates may also be at high risk for this due to immature myocardium. Conventional assessment of RV function is just qualitative, but novel tissue Doppler echocardiographic (TDI) markers including peak systolic strain rate (SR) and isovolumic contraction acceleration (IVA) permit noninvasive quantitation of RV function. This study assessed myocardial velocities, IVA and SR in infants and neonates undergoing open heart surgery using TDI to study regional myocardial function perioperatively. Transthoracic TDI data were obtained in the OR before and 24 hours post-CPB on 53 consecutive infants (age 0.39 ± 0.23 years). They were followed with TDI through hospital discharge. Mean CPB time was 87 ± 49 min (cross-clamp 52 ± 26 min). Peak systolic (STDI ) and diastolic myocardial velocities (ETDI , ATDI ), IVA, and peak SR were recorded in RV and LV from standard views for offline analysis. Postoperatively, LV systolic function and diastolic longitudinal function were unchanged or improved from baseline. LV radial velocities were increased postoperatively indicating adequate support. In contrast, RV longitudinal systolic and diastolic function was significantly diminished after CPB. RV changes persisted through hospital discharge. In infants and neonates, perioperative measurements of systolic and diastolic tissue Doppler parameters are feasible and revealed significant RV systolic and diastolic dysfunction post-CPB with preserved LV function. As such, TDI provides a sensitive tool to monitor the infant heart after CPB and may potentially be useful to assess different myocardial protection strategies.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
I just looked down onto the mouse pad I've been using for the past four years
(literally) and I notice that it advertises the "Transwestern Pipeline
Company - An ENRON Company".
Insidious; it has influenced my every click over these past years...Oh, how
the Taht Moh turns!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A veterinarian for whom I once worked used to frequently repeat: “Communication is a difficult thing.” There are no truer words. I have often observed two people who thought they were communicating well with each other, only to see that they did not understand each other at all. It’s a fascinating circumstance to watch.
If communicating with other humans is difficult, how do we imagine that we can communicate effectively with another species, especially one that is not even a mammal?
The effectiveness and quality of our communication with our own parrots is a subject worthy of ongoing exploration. Evidence of this is the often heard statement, “He bit me with NO warning!”
If you scroll through any parrot-related Facebook feed, you would be led to believe that behavior problems like screaming and biting are just a normal part of living with parrots. This is not true.
Behavior Problems = Communication Problems
The majority of behavior problems in parrots are, in reality, communication problems. This is especially true for screaming, biting and fear-based behaviors.
We cannot have good relationships with people or parrots without effective communication. Historically, we have primarily communicated with our birds through the provision of physical affection, talking conversationally, and attempts to punish undesirable behavior. These efforts at relationship building miss the mark completely.
Why? Physical affection communicates to parrots the wrong message – that we offer the possibility to them of a pair bond. This in itself leads to several different behavior problems. It also teaches dependence, rather than independence.
Talking to them doesn’t result in any particular adverse consequences, but what does it really accomplish? How valuable is it to a parrot when we talk? It might be mildly entertaining to have us yakking away at them, but are we really getting any important message across?
Lastly, “punishment” is ineffective in the manner in which it is most often used. For example, covering a screaming bird’s cage is typically something they don’t mind at all. We might intend for it to communicate to the bird that its noise is an undesirable behavior, but the message doesn’t get across. Further, effective punishment will create distrust and fear. That’s not where we want to be in our relationships with our bird.
How Do We Listen to a Parrot?
Good communication with any species requires both talking and listening. But, how do we listen to a parrot?
The answer? We must read body language. Body language is the only way that parrots have to communicate their feelings to us.
The next important question is, “How do we talk to another species so that understanding is ensured? The answer to that is “We use positive reinforcement!” We need to be clear communicators when interacting with our parrots so that they understand which behaviors will help them to be successful in our homes – which behaviors will earn them what they really want.
Thus, success with our parrots depends upon two things: (1) listening to what they have to tell us by reading body language, and (2) communicating to them through the use of positive reinforcement.
Reading Body Language
When it comes to reading body language, it helps to understand the differences that may be present depending upon the part of the world in which the parrot originated. For many years, parrots have been informally relegated to two different groups – New World parrots and Old World parrots.
Old World parrots derived from Africa, Asia and Europe. Examples of these species would be cockatoos, African Greys, cockatiels, ring-necked parakeets, Eclectus, Poicephalus, and lovebirds. The body language of these species often tends to be more subtle in nature.
Conversely, New World parrots that come from the Americas, tend to have more overt or dramatic body language. Examples include Amazon parrots, conures, caiques, parrotlets, Pionus parrots, monk parakeets and macaws. Both parrots in the photos are indicating interest, but it is more obvious in the macaw.
Keep in mind that is only a generalization. The body language that any individual displays will depend more upon his previous learning history (his socialization) than upon his species. However, this information can be helpful.
It teaches us, for example, that we must anticipate that an Amazon is not going to communicate in the same way that an African grey communicates. An Amazon who intends aggression will typically let you know in a more pronounced manner with pinning eyes, flared tail and raised feathers on the back of his head. The African grey who feels the same may only raise the feathers on his shoulders slightly and look at you with a bit more intensity.
This information also suggests that living without problems with our parrots will hinge upon building our own skills of observation, since each species with whom we interact will likely have a different style of communication. Therefore, we learn to take nothing for granted. Each new individual will need the same careful “get-to-know-you” observations that we used with the last.
Parrots and Emotions
The presence of emotions in animals and birds has long been the subject of much discussion. (I have listed a few reliable references below.) And, as often happens in a new area of exploration for truth, the pendulum of opinion has swung from one extreme to the other.
For some years now, the attribution of emotions to animals was often met with the accusation that the speaker was being anthropomorphic, assigning human characteristics to the animals under discussion. However, researchers are now taking this subject more seriously. Frans De Waal has given us the books Are We Smart Enough to Know How Smart Animals Are? and Mama’s Last Hug, for example. Both discuss the emotions of animals in a very convincing manner.
Finally, “hard science”has met “soft science” and now many are admitting that animals have emotions, possibly the same emotions that we experience as humans. Anyone who has lived with parrots knows this from experience. They are by nature incredibly social, sentient, and expressive.
The list of emotions now attributed to animals is surprisingly long. I found a more distilled list that includes: happiness, anger, disgust, fear, sadness, and surprise. However, labels often fail us and these are labels. What does happiness look like in a parrot? What does sadness look like?
I think it makes sense instead to begin our exploration of how parrots express their emotions by first observing their body language in a variety of contexts and then doing our best to gather enough anecdotal evidence that we can correctly evaluate it and interpret it, thereby achieving some general agreement and creating a reference.
When I did this myself, I came to the conclusion that the parrots I have known had communicated to me, by using body language, the following: well-being or happiness, interest, disinterest, alarm or surprise, fear or aversion, heightened arousal, anger or “go away,” and sexual interest or romantic love.
Obviously, there are likely to be other emotional states that I have not listed. However, parrots have few facial muscles for exhibiting expressions, unlike our mammal friends. Therefore, reading their messages may be a bit more challenging. They use primarily three forms of body language to communicate. When we make observations, we have three main areas to examine: their eyes, feather position, and body position.
Interpreting the Eyes
Parrots will communicate in very subtle ways with their eyes and it can take experience to learn to read them. The most obvious change in a parrot’s eyes is called “pinning.” When a parrot pins his eyes, he alternately contacts and expands his pupils. This may last for just a brief few seconds, or can go on for a full minute or two.
Almond-shaped eye = relaxed Rounded eye = alarm or concern
Eye shape is a much more subtle change. A parrot’s eyes may appear round at some times and more almond-shaped at others. In my experience, there can also be a change in the expression behind the eyes, which can range from a very soft and relaxed appearance to a hard stare.
Interpreting Feather Position
Loose feathers = more relaxed
Observing feather position contributes to the information base we accumulate when we read body language. A parrot may hold his contour feathers over his body in a tight, slicked-down manner or in a more relaxed, inflated way with a little air trapped behind them.
Heightened Arousal
Movement of specific feather groups often tells a more obvious story. Some parrots will fan their tail feathers outward, raise their crests, or raise certain areas of feathers over their bodies.
Interpreting Body Position
Body position gives us even more overt details. Parrots may lean toward or away from us, stand up tall, hide, or stand with one foot held upward against the body. All of these changes tell a story.
Raised feathers, low crouch, hard eyes = Stay away!
Thus, when we read avian body language, we must look at each of these three areas, ask ourselves what we are seeing, and then assimilate this information so that we can interpret what that parrot may be trying to tell us.
Signs of Well-being or Happiness
Signs that a parrot is experiencing a state of happiness or well-being might include the following:
Stretching Shoulder raise (both wings being raised in unison and then lowered) Unilateral (the parrot stretches out both wing and leg on the same side at the same time.)
Tail wags
Feathers relaxed
Eyes soft and almond-shaped
Beak grinding
Rough out (whole body shake out)
Head bobbing
Preening (not excessive)
Cheek feathers covering beak (cockatoos)
Expressions of Interest
Leaning or moving toward us or an item without signs of “anger” – see below
Eager look to the face and eyes
Contour feathers relaxed
Crest up (cockatoos or cockatiels)
Signs of Disinterest
Turning or physically moving away
Flying away
Preening as you attempt to engage socially
Eating treats very slowly when trying to train
Signs of Surprise or Alarm
Raised crest
Rounded eyes
Raised wings
Looking skyward
Standing up very tall
Feathers slicked down
Sharp calls
Signs of Fear or Aversion
Round eyes
Beak slightly open
Standing up very straight
Contour feathers held tightly against the body
Growling
Creating distance rapidly Leaning away Moving away
Signs of Heightened Arousal
Eye pinning
Raised crest
Whole body bobbing
Foot tapping against a perch (cockatoos)
Tail fanning
Facial blushing
Signs of Anger (“Go Away!”)
Eye pinning
“Hard” eyes
Tail fanning
Hissing (cockatoos)
Growling (greys)
Lunging / biting
Swaying from side to side
Raised feathers on certain areas
Crouching with beak open
Signs of Sexual Interest or Romantic Love
Beak clacking (cockatoos)
Tongue wagging (cockatoos)
Regurgitation
Masturbation
Wing drooping
Head bobbing
Soliciting allopreening
Seeks close physical contact
Putting It All Together
As stated previously, we won’t be successful in accurately reading avian body language unless we take all signs into consideration. Once we do, however, we can then take our cues from the parrot and respond appropriately.
If an Amazon parrot is fanning his tail, pinning his eyes, has his feathers raised on the back of his head and is leaning toward us with beak open, we are going to walk away and figure out another way to approach him that will not result in the aggression that is so obviously intended.
If we observe that our macaw is blushing, pinning his rounded eyes, swaying from side to side and slightly fanning his tail, we are going to conclude that this moment might not be the best time to ask him to step up. He is obviously in a heightened state of arousal and could bite just out of excitement.
If the Senegal we just adopted looks at us with rounded eyes, and stands up tall with feathers held tightly down, rapidly trying to scramble away from our approach, we are going to stop in our tracks realizing that perhaps this bird has more of a history of fear than we were lead to believe.
And, if our cockatoo clacks her beak at us as we remove her from the cage, begins to regurgitate, and then tries her best to scramble to a shoulder for a cuddle session, we are going to also stop in our tracks and realize that she has the wrong idea. We are not sexual partners. She belongs on a perch near you, but not on you.
Our Own Body Language
We must also exercise control over our own body language and use this to mirror that which the parrot offers. Since parrots communicate through body language, they are especially sensitive to ours.
Barbara Heidenreich said once, “If an animal is aware of us, we must be aware of the animal.” That is the cardinal rule, or should be, whenever you are in any animal’s presence. Many accidents and injuries could be avoided by following this simple advice. In general, the following rules will help to ensure your success when meeting new birds and in a variety of other situations:
Move slowly.
Keep gestures to a minimum.
Use a low voice.
Mirror the bird’s behavior – respond appropriately.
Practice awareness.
Communicating with Parrots
All living creatures are hard-wired to behave upon the environment in such a way that they can gain access to the things that they want. When we live with a parrot, one of the most valuable pieces of information we can have is to know what things he values most and to then use them to reward the behaviors that we would like him to perform more often: talking rather than screaming, stepping up rather than moving away, going back into the cage rather than biting.
The mistake that most caregivers make is to assume that the parrot wants approval. They typically reward behavior by talking, with an enthusiastic “Good bird!” Frankly, I have seen no evidence that parrots care what we think. They don’t care if we approve of the behavior they just offered.
What they want is currency – hard cash. What is hard cash to a parrot? Usually, it is going to be some high-value food – typically high-fat nuts or seeds. It could be head scratches. It could be a bottle cap. It is up to each of us to investigate and discover what constitutes hard cash for each of our parrots. This is likely to be different for each one.
One we know what a parrot wants, success is just around the corner if we follow the following rules:
Living as a Trainer
Realize that every social interaction is a learning moment for the parrot.
Use positive reinforcement for all cued behaviors so that the parrot has control – he understands what he can do to acquire the things that he wants.
Get into the habit of asking yourself, “What am I reinforcing right now?”
Remember:
Every interaction with a parrot must be a dialogue. When training When handling When offering a treat.
Practice respect. Allow them control. Give them a choice.
I would like to see a new era dawn, when it comes to relationships between companion parrots and their caregivers. In order for those relationships to be problem-free and full of joy we need to understand each other. This means that we have to listen to them and behave in a trust-building manner by altering our own behavior based upon the messages that they communicate.
We then must offer them choices about how to behave and ensure that the behavior we want gets rewarded with a rate of exchange that ensures that this will continue to be offered in the future.
References
Bekoff, M. (2000) Animal Emotions: Exploring Passionate Natures: Current interdisciplinary research provides compelling evidence that many animals experience such emotions as joy, fear, love, despair, and grief—we are not alone. BioScience, Volume 50, Issue 10, October 2000, Pages 861–870, https://doi.org/10.1641/0006-3568(2000)050[0861:AEEPN]2.0.CO;2
Safina, C. (2015.) Beyond Words: What Animals Think and Feel. Henry Holt & Company, LLC. New York, NY.
Paul,E. and Mendl, M. 2018. Animal emotion: Descriptive and prescriptive definitions and their implications for a comparative perspective.Applied Animal Behaviour Science,Volume 205,Pages 202-209,ISSN 0168-1591, https://doi.org/10.1016/j.applanim.2018.01.008.
Weary, D., Droege, P., and Braithwaite, V. 2017. Chapter Two – Behavioral Evidence of Felt Emotions: Approaches, Inferences, and Refinements. Editor(s): Marc Naguib, Jeffrey Podos, Leigh W. Simmons, Louise Barrett, Susan D. Healy, Marlene Zuk. Advances in the Study of Behavior, Academic Press,Volume 49,Pages 27-48,ISSN 0065-3454,ISBN 9780128121214,https://doi.org/10.1016/bs.asb.2017.02.002.
Thank you for reading my blog. I am Pamela Clark, an IAABC Certified Parrot Behavior Consultant. My passion is helping people with parrots by offering behavior consultations and publishing information you can trust. To access free resources, schedule a consultation, or subscribe to my newsletter (which is a different publication from this blog), please visit me at http://www.pamelaclarkonline.com. Until next time!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
INTRODUCTION {#sec1-1}
============
The term of preterm birth used to define the premature neonates considering pregnancies age of less than 34 weeks and corticosteroids are commonly prescribed to promote embryos' lung maturity.\[[@ref1]\] The amniotic fluid index (AFI) has been an integral component of fetal assessment during antepartum ultrasound examination for \>20 years. Decreased amniotic fluid or oligohydramnios, is typically defined as an AFI below 5-cm, which represents the value below the first percentile. In term and near-term gestations, this 5-cm threshold has been associated with increased rates of complications, including small for gestational age neonate, nonreassuring fetal heart rate (FHR), stillbirth, and neonatal death. The amniotic fluid volume is most abundant in the early third trimester, subsequently decreasing until term. Before 34 weeks, the value of 8-cm is below the fifth percentile for gestational age.\[[@ref2][@ref3]\] AFI values between 5- and 8-cm have been termed "borderline." Potential risks associated with borderline amniotic fluid in the preterm period are not fully understood.\[[@ref2][@ref3]\] Dexamethasone and betamethasone cause to produce surfactant in fetus lung and thereby it reduces the resistant between layers of airways and sacs to simply slide on each other and eventually easily breathing of neonate after birth preventing respiratory distress syndrome in neonate. Therefore, corticosteroids can be recommended in fetus at risk of preterm labor. The preferred gestational age for administration of dexamethasone and betamethasone is usually 28-34 weeks.\[[@ref4]\] The usage dose of betamethasone is 0.17 mg/kg daily for 2 doses to reduce the risk of intraventricular hemorrhage, chronic lung diseases, necrotizing enterocolitis, and retinopathy of prematurity, sepsis, and Neonatal Intensive Care Unit administration. Considering the side effects of each drug, some studies have been done to evaluate the side effects of dexamethasone and betamethasone. Normal range of AFI in fetus is \>8-23 cm and its average is 12.8-cm in Jackson study that measured the effect of corticosteroids on AFI which in about 72% of cases the AFI was decreased.\[[@ref4][@ref5]\]
Biophysical profile parameters (BPP) consists of five parameters including:
Fetal tone,Fetal gross movement,Fetal breathe,AFI,Nonstress test (NST) changes, each of these parameters is assigned number 0-2.
The normal score of BPP is 8-10 and 6-8 is unclear and below 6 considers as abnormal. BPP for the most of the fetus (95.95%) is normal.\[[@ref6][@ref7]\] In the Jackson study that measured BPP after administration of corticosteroids, fetal gross movement and AFI score were decreased in 44% and 87% of cases, respectively.\[[@ref8]\]
To evaluate the effect of corticosteroids on NST, the parameters that change in NST are a short and long beat to beat which are decreased generally, and it can be neglect the corticosteroids effect on acceleration.\[[@ref9]\] The difference between dexamethasone and betamethasone on NST, AFI, and BPP, dexamethasone has no clear effect on NST, AFI, and BPP but betamethasone usually decreases AFI in 63% of cases, short beat to beat in NST in all cases and fetal movement in 80% cases but other parameters have no changes.\[[@ref9][@ref10]\] Thus because of the importance of NST, AFI, and BPP on decision for the fetus, the changes after administration of dexamethasone and betamethasone on BPP, NST, and AFI and differences between their effects on the BPP, AFI, NST are important for us. Knowing of these changes prevents rash decision for patients.\[[@ref9]\] In this study, we compared the effect of betamethasone versus dexamethasone on the AFI in the women at risk of preterm labor to the best decision may be made for each patient.
MATERIALS AND METHODS {#sec1-2}
=====================
This study is a double-blind clinical trial study registered in [www.irct.ir](www.irct.ir) with code of IRCT201212307513N2 and conducted on 70 patients for 28-34 weeks. Women having at least once preterm labor in their previous pregnancy have been submitted in Al Zahra Hospital and Shahid Beheshti clinic of obstetrics and gynecology in 2012-2013. In this study, neither the person who collected the data nor the mothers who received the drugs were aware of the prescribed medications. Inclusion criteria in our study were pregnancy, having at least once preterm labor or being at risk of preterm labor, no consumption of any drugs only ferrous sulfate or folic acid, having no background illness. The women with intrauterine growth retardation fetus, vaginal leak, gestational diabete mellitus, preeclampsia, consumption of any drugs, vaginal bleeding or if the neonate had anomaly after birth were excluded from the study. In our study, all cases with decrement of AFI, BPP fewer than 8 and nonreactive NST were hospitalized. Sample size was calculated with confidence level of (*Z* = 1− = 1/96) and the power of (2 = 1−B = 0.84).
These pregnant women were randomly allocated into two 35 populated groups. Seventy women were randomly allocated in two groups. The first group were received 8 mg each 12 h for 4 doses dexamethasone when the patient at risk of preterm labor admitted in clinic or hospitalized and the second group were received 12 mg betamethasone each 24 h similarly.
Nonstress test was measured in the before and 3 days after intervention. Accordingly only one sonographer measures the AFI of all 70 cases in this study.\[[@ref8]\] Nevertheless, the measurement bias of that sonographer in different time of measurement could be about 5-cm. In order to avoid such bias, in this study, only more than 5-cm decrement in AFI and AFI under 8-cm is considered as a meaningful decrease. AFI sonography performed and repeated 3 days after administration of corticosteroids in each group and data were collected. NST has three parameters of variability in FHR:
Long beat to beat.Short beat to beat.Acceleration.
One observer performs NST after and before of administration of corticosteroids in each group and short beat to beat and a long beat to beat, and acceleration were evaluated. By the observer, each parameters of NST based on existence or absence were analyzed. One sonographer done sonography BPP before and after corticosteroids (3 days after taking corticosteroids) and AFI lower than 8-cm or any decrement more than 5-cm was registered. The BPP that consists of five components that each of them has a score 0 or 2. BPP score was NL (8-10), (6-8) BPP would be repeated, and (4-8) were hospitalized. BPP data combine two sources 1-ultrasound imaging and NST which has been previously explained above. If the NST is reactive, its score is 2 otherwise its score is 0. AFI which has been explained above is 0 if AFI \<5 cm or a largest vertical pocket of amniotic fluid \<2 cm otherwise is 2. The other parameter is fetal breathing movement score is 2 if ≥1 episode of rhythmic fetal breathing movement of ≥30 s within 30 min and otherwise is 0. Fetal movement is the other score and if ≥3 discrete body or limb movement within 30 min is 2 and otherwise is 0. Finally, fetal tones score, ≥1 episodes of a fetal extremity with return to flexion or opening or closing of a hand is 2 and otherwise is 0. All of the sonographic parts of BPP have been done by just one sonographist before administration of corticosteroids and 3 days after that and data collected.
Finally, the data entered to the computer and analyzed by IBM SPSS version 22 software. The Chi-square and Fisher\'s exact tests (for comparison of qualitative data between the two groups), Student\'s *t*-test (for comparison of quantitative data between the two groups) and repeated measures ANOVA test (for comparison of AFI changes in the before and after intervention between the two groups).
All mothers with nonreactive NST and AFI lower than 7 (AFI \<7) and BPP lower than or equal to 8 (BPP ≤8) were admitted and observed until all these parameters became normal. All mothers included in our study sample size were closely observed until their delivery as well as all newborn in regards to their birth weight and their Apgar score within minute 1 and 5.
RESULTS {#sec1-3}
=======
In our study, 70 women were chosen based on our inclusion criteria and were randomly divided into two groups. Betamethasone has been prescribed for the first group and dexamethasone for the second group. The average range of studied women age was 26.5 ± 6.2, and the mean of pregnancy age was 32 ± 1.9 other general information about each group population was shown in [Table 1](#T1){ref-type="table"}. Two groups were matched in gestational age, mother age, number of previous pregnancy; fetus expired after 20 weeks, number of living present children, and the number of abortion. Based on the Student\'s *t*-test, Chi-square and Fisher\'s tests, the distributions of variables between the two groups were not statistically significant between the two groups (*P* \> 0.05). The average of AFI before and after giving the medication has been presented in [Table 2](#T2){ref-type="table"}. According to Student\'s *t*-test, no statistically difference between the two groups was seen in the before and after intervention (*P* \> 0.05). Nevertheless, about 20% of cases had AFI decrement after betamethasone administration. There was no significant difference in AFI between these two groups before and after administration of corticosteroids but according to repeated measures ANOVA, time had statistical effect on AFI (*P* = 0.034) \[[Figure 1](#F1){ref-type="fig"}\]. Furthermore, no statistically difference between NST acceleration tests was detected before and after corticosteroids administration in both groups.
######
Distribution of basic and general variables
######
Distributions of NST and BPP variables
{#F1}
The only statistically significant difference was found between the results of long beat to beat and short beat to beat test between the two groups. The results of BPP sonography have revealed no significant difference in fetal thoracic movement and fetal tone between the two groups but remarkably a great variance in fetal movement.
In the group who has received dexamethasone and in betamethasone receiver group there was normal fetal movement in 90% and 60% of the cases, respectively (*P* = 0.001). Furthermore, the average of BPP index between betamethasone and dexamethasone recipients was associated with a meaningful difference.
DISCUSSION {#sec1-4}
==========
This study was performed to check, analyze, and compare the effect of betamethasone and dexamethasone on fetal index including AFI, BPP, NST in pregnant women with the pregnancy age of 28-34 weeks experiencing prematurity (premature delivery). Mothers were divided into two groups having no significant difference in their demographic information or history of past pregnancy. Thus, the changes in the results (alternance) could be due to the difference of the corticosteroids they were given at the last week of their pregnancy. According to our study results, although in some cases AFI was decreased, no significant influence on AFI was observed owning to corticosteroids injection, such that regarding to AFI, no remarkable variance was found between the two groups. Only it was observed that 3 days after corticosteroids injection, there was a 2.11 ± 0.1 cm decrease in AFI of betamethasone group and 0.9-cm in the dexamethasone group but as mentioned before there was no great variance. However, some other studies in contrary to ours have been related the AFI changes to corticosteroids injection. In Jackson study, the AFI has been decreased exactly after corticosteroids injection in about 72% of their sample size.\[[@ref8]\] In Kazardoost *et al*. study which has been done in Yasooj Medical School in 2010, betamethasone injection was also considered as a reason for AFI decrease.\[[@ref11]\]
The NST results showed no great variance in acceleration index between the recipients of dexamethasone and betamethasone with a significant difference between short beat to beat and a long beat to beat index in the mentioned groups. Short beat to beat index was normal in 98% of women in the dexamethasone group and 66% of betamethasone group. Long beat to beat in all of the dexamethasone group and 80% of betamethasone recipients was normal. Moreover, the results of BPP sonography have introduced a noticeable difference in fetal movement and thereby a biophysical profile showed difference between these two groups.
Furthermore, 90% of dexamethasone recipients and 60% of betamethasone ones had normal fetal movement. The same results were reported with BPP indicating that the dexamethasone group had greatly higher BPP. In Kazardoost *et al*. study, which was mentioned previously, all fetal movement had decreased after injection of betamethasone.\[[@ref11]\] According to Mulder *et al*. study, only short and long beat to beat index were decreased due to corticosteroids injection, with no effect on acceleration.\[[@ref12]\] Doyle *et al*. in a study concluded that the benefits of late dexamethasone may not outweigh actual or potential adverse effects but considering the evidence of both benefits and harms of treatment, and the limitations of the evidence at present, it appears prudent to reserve the use of late dexamethasone to infants who cannot be weaned from mechanical ventilation, and to minimize the dose and duration of any course of treatment.\[[@ref4]\]
All studies taking into account corticosteroids influence on fetal indexes including AFI, BPP, and NST, reported no great changes in these indexes due to corticosteroids injection.\[[@ref4]\] In Rotmensch *et al*. study on two groups of women exposed to (experiencing) preterm delivery prescribed with dexamethasone and betamethasone and the results were observed 48 h after injection. Fetal thoracic movement in 83% of betamethasone group and 90% of the dexamethasone group had been decreased. Fetal movement in 53.2% of dexamethasone recipients has been decreased. There was also a 48.6% decrease in fetal movement for betamethasone group, and there was a meaningful variance between these two groups.\[[@ref13]\] In another study, the BPP status was assessed after corticosteroids injection. According to the study, for 44% of samples, gross fetal movement was decreased, and AFI and BPP index decrement has been reported for 87% of samples.\[[@ref8]\] In our study, there were no differences in fetal tone and fetal thoracic movement between the two groups before and after of corticosteroids administration. Based on the results of this study and other similar works in this area, it can be concluded that dexamethasone has lower effect on AFI, BPP, and NST indexes respect to betamethasone and for this reason it is more preferred rather than betamethasone.
CONCLUSION {#sec1-5}
==========
According to this study, AFI has no significant change before and after corticosteroids administration.
AUTHOR\'S CONTRIBUTION {#sec1-6}
======================
ZK and HGT have collected data and conducted the statistical analysis and prepared the first draft of manuscript. BK is the corresponding author of the manuscript and has participated in manuscript preparation. All authors have read and approved the content of the manuscript.
We are appreciate to Dr. Sam Mirfendereski and Dr. Ali Foroutanfar for their help in sonographic data. Also we thanks Mr. Mehrabian for his help in data analysis.
**Source of Support:** Nil
**Conflict of Interest:** None declared.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Capsule:
We discuss how therapeutic decisions should be shared with women who have deep endometriosis after a comprehensive evaluation; an in depth and realistic review of the benefits and risks should be made clearly available.
Deep endometriosis is a demanding condition that is associated with infertility. However, evidence supporting a direct link between deep endometriosis and infertility is weak. In fact, infertility in affected patients is more likely to be explained by the strong association between deep endometriosis and adhesions, superficial endometriotic implants, ovarian endometriomas, and adenomyosis. The purported beneficial effects of surgery on infertility are mainly based on the 40%–42% pregnancy rate (PR) after surgery observed in published case series. However, this level of evidence is questionable and overestimates the benefits of the intervention. Even if comparative studies are lacking, IVF may be a valid alternative. The procedure may be less effective in affected women compared with other indications and it is not without additional deep endometriosis-related risks. Some case reports suggest that lesions might progress during IVF causing ureteral or intestinal complications or can decidualize during pregnancy causing intestinal perforation, pneumothorax, and pelvic vessels rupture. Finally, in the decision-making process, physicians should also consider that women with a history of deep endometriosis may face an increased risk of pregnancy complications. In conclusion, clear recommendation for the management of infertile women with deep endometriosis cannot be extrapolated from the literature. The therapeutic decision should be based on a comprehensive evaluation that includes clinical history, instrumental findings, pain symptoms, risks of pregnancy complications, and the woman’s wishes.
We read with great interest the extremely good article of Somigliana
and Garcia-Velasco (1) focusing on the relationship between infertility and deep
endometriosis, and the therapeutic strategies that could be considered. They
thoroughly discuss whether or not young patients with deep endometriosis actually
need surgery, however less extensively their need of IVF to conceive.
We agree that pregnancy rates (PR) in the series of patients managed by surgery cannot entirely be attributed to the surgical procedure, and several patients would have probably been pregnant even if the surgery had not been performed (1). Moreover, authors reporting the benefit of surgery on fertility should justify the existence of preoperative infertility, even though those patients were managed for stage 4 endometriosis, in which negative impact on spontaneous conception should no longer be demonstrated. Conversely, infertility in the series of patients managed
by primary IVF does not need to be proven, because “case series of IVF are more
informative than those of surgery », as « all observed pregnancies could
be attributed to the procedure itself. »(1)
In our opinion, the questions should be
asked differently: What is the likelihood of pregnancy for a young patient with
deep endometriosis and pregnancy desire by primary IVF or surgery? (2) Does a
woman have more chances to be pregnant after a single or several IVF procedures
than after surgery followed or not by IVF? (2,3) Does a patient take a higher
risk by undergoing surgery or, conversely, in delaying the intervention for months
or years? (2,4) Is it less expensive to manage patients by several primary IVF
procedures or by a surgical intervention followed by spontaneous conception in
up to two-thirds of cases? (4) Is surgery definitively avoided in patients
undergoing primary IVF, or is it only postponed?
If a comparative “intention to treat” randomized trial is performed in this topic in the future, it will specifically answer each of the questions listed above.
In this way, it is interesting to review the comparative study of Bianchi et al (5)
by obtaining the lacked data about patients who conceived spontaneously. Accordingly
to the study’s design, women who spontaneously conceived were excluded from the
study, as were those who declined postoperative IVF. Thus, the results of the
study were reasonably different from those that would have been provided by an
“intention to treat” study where all pregnancies should have been taken into
account. To calculate the total PR, the number of patients who spontaneously
conceived in each arm of the trial should be considered. Data was obtained upon
request, and there were therefore 10 out of 115 patients with spontaneous
conception in the primary IVF arm, giving a spontaneous PR of 8.7%. In the
surgical arm, 18 out of 84 conceived spontaneously, resulting in a spontaneous
PR 2.5 times higher (21.4%). Thus, the overall PR is 29.6% in the primary IVF
arm vs. 51.2% in the surgical arm (P=0.003). By choosing surgery, patients from
Sao Paolo increased their chances to conceive by 66% during the study follow
up.
Recent guidelines state that « The effectiveness of surgical excision of
deep nodular lesions before treatment with assisted reproductive technologies
in women with endometriosis-associated infertility is not well established in
regard to reproductive outcomes (C) » (6). This means that surgery is not
required once IVF decision has been made, if the sole goal of treatment is to
increase PR following IVF. In daily practice, this statement is frequently
misunderstood, leading to the systematic practice of primary IVF in women with
deep endometriosis, because surgery is supposed to be of no effect in improving
the PR. In numerous young patients, severe complaints occur rapidly after interrupting
the contraceptive pill, and the diagnosis of deep endometriosis is affirmed.
Consequently, they usually seek care after a couple of months of pregnancy
attempts, and do not meet “infertility” criteria. When referred to medical
teams who recommend primary IVF, they are automatically recorded as “infertile”
and undergo IVF. On the other hand, when referred to teams where surgery is
recommended to treat both pain and manage pregnancy intention, they undergo primary surgery with or without postoperative IVF (3). Ultimately, the major clinical
outcome in all those young patients is the overall PR. To date, available data
suggest that PR would be comparable and if not higher in patients referred to medical
centers recommending surgery (2). In addition, in this latter case, deep endometriosis
is treated. The rate of severe postoperative complications is low when patients
are managed by experienced teams (in 405 patients managed for colorectal
endometriosis from 2010 to 2015 in our center there were prospectively recorded:
2.5% of rectovaginal fistulas, 0.25% leakages, 0.75% severe bladder dysfunction
over 3 months postoperatively, and only 1 patient with Clavien 4 complication).
Moreover, the rate of complications also concerns women who underwent primary
IVF in whom surgery is merely postponed for years.
As we recently exchanged at the last World Congress of Endometriosis in Sao Paolo, this exciting debate could only be closed by a large randomized trial in intention to treat
comparing primary IVF to primary surgery in women with deep endometriosis and
pregnancy wish (2).
We fully agree with the comments from Dr Roman and Dr Darwish – there is today a lack of strong data to support clearly any direction. Thus, young asymptomatic women may choose surgery -considering the low incidence of complications in experienced hands, but sometimes severe, that may requiere additional surgery- whereas symptomatic women and “not-so-young” women will be directly managed with IVF as time is their most precious asset that cannot be wasted while waiting for a spontaneous pregnancy.
New Discussion Features!
NEW! Open access free discussion forums on EVERY article in Fertility and Sterility! Just go to the issue and click on article title. You will be able to submit comments questions or share your thoughts on the paper-- Speak your mind!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Time To Make It Happen Is NOW If You Want To One Day Hear Your Creator Happily Say “Job Well Done!”
How else could I have said it? Many of you who read my blog on a regular basis know that I love the circus like effect of long blog titles but this time I kept it short and sweet because the message can’t be described any other way.
The time is now!
What do I mean by this?
Well this was the word that was put on my heart to share and immediately upon arising I walked a straight line to my keyboard just to put it down with the sense of urgency of a man who the night before drank a gallon of milk mixed with heavy sweet chocolate syrup to wash down an entire box of chocolate chip cookies before polishing off three Hershey’s chocolate candy bars!
I had to do this NOW!
But in actuality that is how we should go after most goals in life but we have been rendered ineffective. The spirit of procrastination has most of us locked arm in arm and is escorting us through life while smiling like a father giving away his daughter to the groom at her wedding! Except that spirit never gives us away! It kindly walks us all throughout our life keeping us at a safe distance from our goals just enough to feel as though we can achieve them but far enough to keep us from ever realizing them.
It keeps us sleepwalking through life.
We have become “zombified!” We talk the right words yet the results of our diatribe never pan out into any tangible accomplishment. We play and pretend. Yet we feel the frustration of never going after what it is that our God has placed the seeds of greatness in us for.
What do most sane minded individuals do when they repetitiously execute a movement that bring absolutely no results? They change it right? If you see that every time you attempt to drive down a particular road in your vehicle you get into a major automobile collision, you begin to understand that this is just not the road for you. But we as the stubborn human beings that we are we will continue to go down the same beaten path an then expect a vastly different result! Isn’t this the textbook definition of madness?
So now we go to these jobs where we have been slaving for years and then we expect to get rich one day while we toil on in iniquity thinking that our supervisors and bosses are going to give us something that they are now pocketing for themselves. If you think that the job that you are on and its supervisors are going to have an epiphany about how great a person you are and reward you with “great wealth” either you are just as delusional as the rest of your coworkers or you just love being taken advantage of!
When are you going to get the guts to stand up and start something of your own that will eventually “take you there” into the life that God has planned for you? Is it your job that woke you up this morning and continues to give you the breath of life? Show your God that you trust and fear Him even more than you trust and fear your boss! Because in actuality we give our bosses more honor and respect than we do our Heavenly Father and this is why our lives are as jacked up as they are!!!!
Make your move! Not next year! Not next week! Not tomorrow!
The time is NOW!
You have that gym membership or exercise equipment sitting up at home collecting dust, either way no matter which one it is for you, you haven’t even THOUGHT of utilizing it like you swore you would at that New Years Party that you attended where you proclaimed either publicly or to yourself that this was the year that you were going to drastically improve yourself physically. Now here we are in April with one third of the year gone forever and you are sitting up here looking the same way, hanging out with the same non-motivated people who will have you eating the same old junk and looking worse than ever before!
Same effort and movement, same result. It’s as simple as that! And if the truth be told when this year rolls around to an end, most of us will be even bigger, fatter, more obese with a slimy life sapping beauty robbing oily assed pork chop taking constant residence in our mouths talking that same junk that we do when the New Years celebrations approach us!
Until you see that time waits on no one you will NEVER have the mentality to be a true achiever and conqueror in this gift of a life that God has given you! I look at people and even myself included because I am not perfect, and I say to myself do we want God to do it ALL for us? Shouldn’t there be a few things that WE should be responsible for? Dear LORD! He gave us these wonderful bodies to navigate the face of this vast earth in, he gave us an entire planet from which we have absolutely EVERYTHING to sustain this wonderful life but WE chop it short through our foolish health practices. All of the medicine that we can ever need is there for us in abundance growing up in the form of plants, leaves and roots. He has given us a life giving sun to sustain us in ways that we are only NOW beginning to understand and comprehend. He has given us so much but we refuse to do the little thing that He asked of us in the form of obedience to His law!
We are disobedient and have be one severely disoriented in our awareness because of it. We posture and pose as the great children of God that we were made to be but can never show how much power we have because we are not “hooked up” to the source of that power!
This is no time to be wasting ANY time because I don’t know about you but I don’t know what time my Father is going to call my name so I make the best use of the time that I have because of it.
I have no time to waste just merely looking like the real thing when I am out here trying to BE the real thing!
Some of us claim that there is power in the word of God and quite frankly to be raw with you……there IS! But judging by what I see around me in all of the communities that I have lived in before, most who claim an obedient life to the divine commandments are no better than that scarecrow that sits out on the fields to scare the crows away from the crops! They may look like spiritual firebrands when they are performing their weekly “in the spirit” display of a fraudulent connection to the Creator but leave the service and not have a clue as to how to balance their own damn checkbook! They leave out and tell themselves that they carry the spirit of God within them but are envious of the supposed brother and sister because they have a sexy and highly desirable spouse and they DON’T! What kind of child of God are you?
You got more rime to be up in someones personal business but you can never find the time to improve YOUR life! People always tell me that I am always too busy doing something and that I never have the time for myself.
Well this is what I tell them……
I tell them that there is no such thing as having time for myself because this time that has been given to me is a very serious thing that is not to be piddled away on carnal foolishness. This is borrowed time. I didn’t create it nor can I destroy it. It is God’s and it was given to me for a time to make positive use of it to validate my existence here and please Him! So this is why even in my sleep I am planning my strategy and visualizing. Because when I awaken it is like hearing that starting shot at the beginning of a foot race! How can I know where I am going when I have no plan? How can I be a winner when I do not know how to run the race or play the game?
If you want to come out on top in this life instead of complaining about how time moves so fast get up on the waves of time and ride it like a surfer at the beach who rides the waves that are fast coming into shore! When you really look at that surfer he is not really putting out much effort now is he? But he has learned how to harness the power of that wave which weighs so much more than him and carries an uncontrollable amount of deadly brute force that could wipe him out immediately!
But it almost a thing of beauty to watch him or her merely maintain the proper balance with a slight tilt here and a slight lean there.
How do they say it in the streets? He was CHILLIN’! Lol!
This is what we need to learn to do in mastering this powerful thing called time. It is not our enemy, it is our friend, we just merely have to know how to harness its powerful potential in our lives so that we will not merely be spectators in the stadium of life but the high priced well paid performers that the masses pay for dearly to watch us shine effortlessly!
That wonderful reality starts right here right now deep within your mind and every fiber of your being. It’s a visualization that is so powerful that you can see it, you will taste it and you will just KNOW that it is not merely a possibility but a definite FACT that it is a reality that will soon transpire right in front of our very eyes.
In other words, the time to move forward into that wonderful life is NOW!
No my friend, it “ain’t” happening like that! Maybe for a time you can fool yourself into thinking you can get over but there comes a time when we ALL have to pay the piper! The time is now to walk the straight and narrow. The rime is now to learn how to improve your health. The time is now to stop doing that thing that you are secretly doing that is sabotaging your greatness from manifesting and the time is now to change a life trajectory aimed at a definite failure into one that with the guaranteed promise of God is one that is destined for success!
You have no more excuses anymore my friend because you now know that the time is NOW!
Ice Cube tried to warn ya’ll. Don’t mess with Yo-Yo. The rap legend claims that someone affiliated with R. Kelly dropped his digits to her daughter when she brought her daughter to his recording studio. Yo-Yo was in Atlanta Saturday night for the Trumpet Awards at The Cobb Energy Performing Arts Center when she was asked her thoughts on […]
Prince’s estate is said to have reached a deal to settle the matter over Prince.com, which should allow them to finally take ownership of the website. On January 11, court documents were filed by the estate informing the court they had reached an agreement in the battle over the Web domain. The estate says the […]
Miles Brockman Richie, son of music icon Lionel Richie, was cautioned and detained by police at London’s Heathrow Airport after he became irate when he learned he could not get on a flight and claimed he had a bomb in his bag and allegedly got into an altercation with officials. According to TMZ, Richie allegedly became enraged when he […]
Charleston police have arrested a 35-year-old pastor after he allegedly strangled a pregnant woman causing her to fall and hit her head at a downtown church. Rashan Lamar Wilson was charged with domestic violence of a high and aggravated nature. He was given a $20,000 surety bond, issued a no-contact order for the victim and […]
Da Brat let it be known that she still supports her friend, R. Kelly, and won’t be muting him anytime soon. She also questioned where the alleged victims’ parents were at and the role they played, and according to TMZ, she said she wanted to ask them one simple question: “do ya keep track of your kids?” TMZ interviewed Brat […]
If they made it to five years, Waka Flocka and Tammy Rivera had promised they would renew their vows and have an extravagant beach wedding ceremony. Well, they did, and they did. On Saturday, the pair renewed their vows in Mexico, five years after they legally married without a ceremony in 2014, according to PEOPLE magazine. “Today my dream has […]
Civil rights activist, Dr. Martin Luther King, has moved many with his words. From his ‘I have a Dream’ speech in 1963 to his final speech, ‘ I’ve been to the Mountaintop’ in 1968, Dr. King always used his voice to speak on the injustice in the Black community and the importance of equality for […]
Ja Rule is fighting back against claims that he is at least complicit in the disastrous Fyre Festival, in which attendees expected to sleep in luxurious villas on a secluded island in the Bahamas, dine on scrumptious food and enjoy concerts put on by major music artists. Instead, they were reportedly stranded, given cheese sandwiches to eat […]
Senator Kamala Harris (D-Calif) announced her candidacy for president this morning on ABC’s Good Morning America, saying she chose the day that America honors the life of the Rev. Dr. Martin Luther King, Jr., to announce because of all that the Civil Rights leader has meant to her family and our nation. “I love my […]
Executive producer of the new doc “When Harlem Saved a King,” talks about why the world needs to know this story about the woman who plotted MLK's first assassination attempt in Harlem. The post New documentary sheds light on the Harlem community that saved the life of Dr. Martin Luther King appeared first on theGrio.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The first Blu-ray Disc volume of the Puella Magi Madoka Magica television anime series sold 53,000 units (rounded to the nearest thousand) to become the #1 television anime release in first-week Blu-ray sales to date. The first Madoka Magica volume supplants the former record-holder, the sixth and final Blu-ray volume of Bakemonogatari (51,000 units). Not incidentally, Akiyuki Shinbo directed both projects.
The first Madoka Magica volume accomplished this feat despite a recall that Aniplex announced on its second official day of sales. It sold 22,000 units on its first day of sales alone, April 27. It also sold 9,097 DVDs during the April 25-May 1 week.
Source: Mainichi Shimbun's Mantan Web
| null |
minipile
|
NaturalLanguage
|
mit
| null |
397 F.3d 964
In re: GRAND JURY SUBPOENA, JUDITH MILLER
No. 04-3138.
No. 04-3139.
No. 04-3140.
United States Court of Appeals, District of Columbia Circuit.
Argued December 8, 2004.
Decided February 15, 2005.
Appeals from the United States District Court for the District of Columbia (No. 04mc00407) (No. 04mc00460) (No. 04mc00461).
Floyd Abrams argued the cause for appellants. With him on the briefs was Joel Kurtzberg. Donald J. Mulvihill entered an appearance.
Reid Alan Cox was on the brief for amicus curiae Center for Individual Freedom in support of appellants.
Theodore J. Boutrous, Jr. and Thomas H. Dupree, Jr. were on the brief for amici curiae Magazine Publishers of America, Inc., et al. in support of appellants.
James P. Fleissner, Assistant U.S. Attorney, argued the cause and filed the brief for appellee.
Before: SENTELLE, HENDERSON and TATEL, Circuit Judges.
1
Opinion for the Court filed by Circuit Judge SENTELLE.
2
Concurring opinion filed by Circuit Judge SENTELLE.
3
Concurring opinion filed by Circuit Judge HENDERSON.
4
Opinion concurring in the judgment filed by Circuit Judge TATEL.
5
SENTELLE, Circuit Judge.
6
An investigative reporter for the New York Times; the White House correspondent for the weekly news magazine Time; and Time, Inc., the publisher of Time, appeal from orders of the District Court for the District of Columbia finding all three appellants in civil contempt for refusing to give evidence in response to grand jury subpoenas served by Special Counsel Patrick J. Fitzgerald. Appellants assert that the information concealed by them, specifically the identity of confidential sources, is protected by a reporter's privilege arising from the First Amendment, or failing that, by federal common law privilege. The District Court held that neither the First Amendment nor the federal common law provides protection for journalists' confidential sources in the context of a grand jury investigation. For the reasons set forth below, we agree with the District Court that there is no First Amendment privilege protecting the evidence sought. We further conclude that if any such common law privilege exists, it is not absolute, and in this case has been overcome by the filings of the Special Counsel with the District Court. We further conclude that other assignments of error raised by appellants are without merit. We therefore affirm the decision of the District Court.
I. Background
7
According to the briefs and record before us, the controversy giving rise to this litigation began with a political and news media controversy over a sixteen-word sentence in the State of the Union Address of President George W. Bush on January 28, 2003. In that address, President Bush stated: "The British government has learned that Saddam Hussein recently sought significant quantities of uranium from Africa." The ensuing public controversy focused not on the British source of the alleged information, but rather on the accuracy of the proposition that Saddam Hussein had sought uranium, a key ingredient in the development of nuclear weaponry, from Africa. Many publications on the subject followed. On July 6, 2003, the New York Times published an op-ed piece by former Ambassador Joseph Wilson, in which he claimed to have been sent to Niger in 2002 by the Central Intelligence Agency ("CIA") in response to inquiries from Vice President Cheney to investigate whether Iraq had been seeking to purchase uranium from Niger. Wilson claimed that he had conducted the requested investigation and reported on his return that there was no credible evidence that any such effort had been made.
8
On July 14, 2003, columnist Robert Novak published a column in the Chicago Sun-Times in which he asserted that the decision to send Wilson to Niger had been made "routinely without Director George Tenet's knowledge," and, most significant to the present litigation, that "two senior administration officials" told him that Wilson's selection was at the suggestion of Wilson's wife, Valerie Plame, whom Novak described as a CIA "operative on weapons of mass destruction." Robert Novak, The Mission to Niger, CHI. SUN-TIMES, July 14, 2003, at 31. After Novak's column was published, various media accounts reported that other reporters had been told by government officials that Wilson's wife worked at the CIA monitoring weapons of mass destruction, and that she was involved in her husband's selection for the mission to Niger. One such article, published by Time.com on July 17, 2003, was authored in part by appellant Matthew Cooper. That article stated that:
9
Some government officials have noted to Time in interviews... that Wilson's wife, Valerie Plame, is a CIA official who monitors the proliferation of weapons of mass destruction... [and] have suggested that she was involved in the husband's being dispatched to Niger to investigate reports that Saddam Hussein's government had sought to purchase large quantities of uranium ore....
10
Matthew Cooper et al., A War on Wilson?, TIME.COM, at http:// www.time.com/time/nation/article/0.8599.465270.00.html (Dec. 13, 2004). Other media accounts reported that "two top White House officials called at least six Washington journalists and disclosed the identity and occupation of Wilson's wife." Mike Allen & Dana Priest, Bush Administration is Focus of Inquiry; CIA Agent's Identity was Leaked to Media, WASH. POST, Sept. 28, 2003, at Al. The Department of Justice undertook an investigation into whether government employees had violated federal law by the unauthorized disclosure of the identity of a CIA agent. See, e.g., 50 U.S.C. § 421 (criminalizing, inter alia, disclosure of the identity of a covert agent by anyone having had authorized access to classified information). As the investigation proceeded, in December of 2003, the Attorney General recused himself from participation and delegated his full authority in the investigation to the Deputy Attorney General as Acting Attorney General. The Deputy, in turn, appointed Patrick J. Fitzgerald, United States Attorney for the Northern District of Illinois, as Special Counsel and delegated full authority concerning the investigation to him. As part of the ongoing investigation, a grand jury investigation began in January of 2004.
11
In cooperation with Special Counsel Fitzgerald, the grand jury conducted an extensive investigation. On May 21, 2004, a grand jury subpoena was issued to appellant Matthew Cooper, seeking testimony and documents related to two specific articles dated July 17, 2003, and July 21, 2003, to which Cooper had contributed. Cooper refused to comply with the subpoena, even after the Special Counsel offered to narrow its scope to cover only conversations between Cooper and a specific individual identified by the Special Counsel. Instead, Cooper moved to quash the subpoena on June 3, 2004. On July 6, 2004, the Chief Judge of the United States District Court for the District of Columbia denied Cooper's motion in open court, and confirmed the denial with reasoning set forth in a written order issued on July 20, 2004.
12
A further grand jury subpoena was issued to Time, Inc., seeking the same documents requested in the subpoena to Cooper. Time also moved to quash its subpoena. On August 6, 2004, the District Court denied Time's motion. Both Cooper and Time refused to comply with the subpoenas despite the District Court's denial of their motions to quash. The District Court thereafter found that Cooper and Time had refused to comply with the subpoenas without just cause and held them in civil contempt of court. After both Cooper and Time had filed appeals, and further negotiations between Special Counsel and the two had proceeded, Cooper agreed to provide testimony and documents relevant to a specific source who had stated that he had no objection to their release. Cooper and Time fulfilled their obligations under the agreement, the Special Counsel moved to vacate the District Court's contempt order, and the notices of appeal were voluntarily dismissed.
13
On September 13, 2004, the grand jury issued a further subpoena to Cooper seeking "[a]ny and all documents ... [relating to] conversations between Matthew Cooper and official source(s) prior to July 14, 2003, concerning in any way: former Ambassador Joseph Wilson; the 2002 trip by former Ambassador Wilson to Niger; Valerie Wilson Plame, a/k/a Valerie Wilson, a/k/a Valerie Plame (the wife of former Ambassador Wilson); and/or any affiliation between Valerie Wilson Plame and the CIA." An August 2, 2004 subpoena to Time requested "[a]ll notes, tape recordings, e-mails, or other documents of Matthew Cooper relating to the July 17, 2003 Time.com article entitled `A War on Wilson?' and the July 21, 2003 Time Magazine article entitled, `A Question of Trust.'" Cooper and Time again moved to quash the subpoenas, and on October 7, 2004, the District Court denied the motion. The two refused to comply with the subpoenas, and on October 13, 2004, the District Court held that their refusal was without just cause and held both in contempt.
14
In the meantime, on August 12 and August 14, grand jury subpoenas were issued to Judith Miller, seeking documents and testimony related to conversations between her and a specified government official "occurring from on or about July 6, 2003, to on or about July 13, 2003, ... concerning Valerie Plame Wilson (whether referred to by name or by description as the wife of Ambassador Wilson) or concerning Iraqi efforts to obtain uranium." Miller refused to comply with the subpoenas and moved to quash them. The District Court denied Miller's motion to quash. Thereafter, the court found that Miller had refused to comply without just cause and held her in civil contempt of court also. She also has appealed.
15
The appellants have proceeded with common counsel and common briefing in a consolidated proceeding before this court. They assert four theories for reversal. Their first claim is that the First Amendment affords journalists a constitutional right to conceal their confidential sources even against the subpoenas of grand juries. Secondly, they claim that reporters enjoy an evidentiary privilege under the common law to conceal confidential sources. Adjunct to this claim, while denying that the privilege is less than absolute, they argue that if the privilege is in fact qualified, the United States has not overcome the privilege. Thirdly, appellants argue that their due process rights were violated by the Special Counsel's ex parte and in camera submission of evidence to the court to establish that the United States had overcome any qualified privilege. Finally, they argue that the Special Counsel failed to comply with Department of Justice guidelines for the issuance of subpoenas to journalists, and that the failure to comply is an independent ground for reversal of their contempt conviction. Finding no grounds for relief under the First Amendment, due process clause, or Department of Justice guidelines, and persuaded that any common law privilege that exists would be overcome in this case, we affirm the judgment of the District Court for the reasons set out more fully below.
II. Analysis
A. The First Amendment Claim
16
In his opinion below, the Chief District Judge held that "a reporter called to testify before a grand jury regarding confidential information enjoys no First Amendment protection." In Re Special Counsel Investigation, 332 F.Supp.2d 26, 31 (D.D.C.2004). Appellants argue that "this proposition of law is flatly contrary to the great weight of authority in this and other circuits." Appellants are wrong. The governing authority in this case, as the District Court correctly held, comes not from this or any other circuit, but the Supreme Court of the United States. In Branzburg v. Hayes, 408 U.S. 665, 92 S.Ct. 2646, 33 L.Ed.2d 626 (1972), the Highest Court considered and rejected the same claim of First Amendment privilege on facts materially indistinguishable from those at bar.
17
Like the present case, Branzburg was a consolidated proceeding involving multiple contempt proceedings against news media defendants. The named petitioner, Branzburg, had been held in contempt in two related proceedings, arising from one extended task of investigative journalism. The first arose from an article published by his employer, a daily newspaper, describing his observation of two Kentucky residents synthesizing hashish from marijuana as part of a profitable illegal drug operation. The article included a photograph "of hands working above a laboratory table on ... a substance identified ... as hashish." 408 U.S. at 667, 92 S.Ct. 2646. A Kentucky grand jury subpoenaed the journalist who "refused to identify the individuals he had seen possessing marihuana or the persons he had seen making hashish from marihuana." Id. at 668, 92 S.Ct. 2646. Branzburg claimed privilege both under the First Amendment of the United States Constitution and various state statutory and constitutional provisions. He was held in contempt and the proceeding eventually made its way to the Supreme Court.
18
The second case involving petitioner Branzburg arose out of a later article published by the same newspaper describing the use of drugs in Frankfort, Kentucky. According to the article, this publication was the product of two weeks spent interviewing drug users in the area. The article further reported that its author had seen some of his sources smoking marijuana. The article related numerous conversations with and observations of unnamed drug users. Branzburg was again subpoenaed to appear before a Kentucky grand jury "to testify in the matter of violation of statutes concerning use and sale of drugs," id. at 669, 92 S.Ct. 2646 (internal quotation marks omitted). Branzburg moved to quash the subpoena. The motion was denied. The journalist sought the protection of the Kentucky Court of Appeals by way of mandamus and prohibition, claiming "that if he were forced to go before the grand jury or to answer questions regarding the identity of informants or disclose information given him in confidence, his effectiveness as a reporter would be greatly damaged." Id. at 670, 92 S.Ct. 2646. The Kentucky courts rejected Branzburg's claim of a First Amendment privilege. Again, he petitioned for certiorari in the Supreme Court.
19
The consolidated petitions in Branzburg also included In re Pappas. Petitioner Pappas was a television newsman-photographer for a Massachusetts television station. On July 30, 1970, during a time of civil unrest in New Bedford, Massachusetts, he gained entrance to the headquarters of the Black Panther Party, upon his agreement not to disclose anything he saw or heard inside the headquarters. Subsequently, he was subpoenaed to appear before a Massachusetts grand jury. Although he appeared and answered other questions, he refused to answer any questions about what had taken place inside the Black Panther headquarters, "claiming that the First Amendment afforded him a privilege to protect confidential informants and their information." Id. at 673, 92 S.Ct. 2646. The Massachusetts trial court denied his motion to quash made on First Amendment and other grounds and ruled that the journalist "had no constitutional privilege to refuse to divulge to the grand jury what he had seen and heard, including the identity of persons he had observed." Id. Like Branzburg, Pappas petitioned for certiorari to the United States Supreme Court.
20
In the final petition consolidated in the Branzburg proceedings, the Court considered the petition for certiorari of the United States from a decision of the Ninth Circuit Court of Appeals, Caldwell v. United States, 434 F.2d 1081 (9th Cir.1970), in which the circuit had recognized a qualified testimonial privilege for newsmen arising from the First Amendment and allowing a reporter claiming protection under the privilege to refuse to testify before a grand jury investigating allegations of violations of numerous criminal statutes by the Black Panther Party in California. The reporter in Caldwell had engaged in investigative journalism directed toward the Black Panthers at a time when they were suspected of such crimes as making threats against the President of the United States and a possible conspiracy to assassinate the President, as well as interstate travel to incite rioting and the commission of mail frauds and swindles. He claimed to have obtained information from confidential informants.
21
As can be seen from the account of the underlying facts in Branzburg, there is no material factual distinction between the petitions before the Supreme Court in Branzburg and the appeals before us today. Each of the reporters in Branzburg claimed to have received communications from sources in confidence, just as the journalists before us claimed to have done. At least one of the petitioners in Branzburg had witnessed the commission of crimes. On the record before us, there is at least sufficient allegation to warrant grand jury inquiry that one or both journalists received information concerning the identity of a covert operative of the United States from government employees acting in violation of the law by making the disclosure. Each petitioner in Branzburg and each journalist before us claimed or claims the protection of a First Amendment reporter's privilege. The Supreme Court in no uncertain terms rejected the existence of such a privilege. As we said at the outset of this discussion, the Supreme Court has already decided the First Amendment issue before us today.
22
In rejecting the claim of privilege, the Supreme Court made its reasoning transparent and forceful. The High Court recognized that "the grand jury's authority to subpoena witnesses is not only historic ... but essential to its task." 408 U.S. at 688, 92 S.Ct. 2646 (citation omitted). The grand juries and the courts operate under the "longstanding principle that `the public has a right to every man's evidence,' except for those persons protected by constitutional, common law, or statutory privilege." Id. (citations and internal punctuation omitted). The Court then noted that "the only testimonial privilege for unofficial witnesses that is rooted in the Federal Constitution is the Fifth Amendment privilege against compelled self-incrimination." Id. at 689-90, 92 S.Ct. 2646. The Court then expressly declined "to create another by interpreting the First Amendment to grant newsmen a testimonial privilege that other citizens do not enjoy." Id. at 690, 92 S.Ct. 2646. In language as relevant to the alleged illegal disclosure of the identity of covert agents as it was to the alleged illegal processing of hashish, the Court stated that it could not "seriously entertain the notion that the First Amendment protects a newsman's agreement to conceal the criminal conduct of his source, or evidence thereof, on the theory that it is better to write about a crime than to do something about it." Id. at 692, 92 S.Ct. 2646.
23
Lest there be any mistake as to the breadth of the rejection of the claimed First Amendment privilege, the High Court went on to recognize that "there remain those situations where a source is not engaged in criminal conduct but has information suggesting illegal conduct by others." Id. at 693, 92 S.Ct. 2646. As to this category of informants, the Court was equally adamant in rejecting the claim of First Amendment privilege:
24
[W]e cannot accept the argument that the public interest in possible future news about crime from undisclosed, unverified sources must take precedence over the public interest in pursuing and prosecuting those crimes reported to the press by informants and in thus deterring the commission of such crimes in the future.
25
Id. at 695, 92 S.Ct. 2646.
26
The Branzburg Court further supported the rejection of this claimed privilege by the commonsense observation that "it is obvious that agreements to conceal information relevant to the commission of crime have very little to recommend them from the standpoint of public policy." Id. at 696, 92 S.Ct. 2646. While the Court recognized the right of the press to abide by its agreements not to publish information that it has, the Court stated unequivocally that "the right to withhold news is not equivalent to a First Amendment exemption from an ordinary duty of all other citizens to furnish relevant information to a grand jury performing an important public function." Id. at 697, 92 S.Ct. 2646.
27
We have pressed appellants for some distinction between the facts before the Supreme Court in Branzburg and those before us today. They have offered none, nor have we independently found any. Unquestionably, the Supreme Court decided in Branzburg that there is no First Amendment privilege protecting journalists from appearing before a grand jury or from testifying before a grand jury or otherwise providing evidence to a grand jury regardless of any confidence promised by the reporter to any source. The Highest Court has spoken and never revisited the question. Without doubt, that is the end of the matter.
28
Despite the absolute and unreversed answer to the question of constitutional privilege by the Supreme Court in Branzburg, appellants nonetheless persist in arguing that the District Court erred in concluding that journalists subpoenaed to reveal their confidential sources before federal grand juries enjoy no First Amendment protection. They base this argument on the concurring opinion of Justice Powell in Branzburg and a case from this circuit, Zerilli v. Smith, 656 F.2d 705, 711 (D.C.Cir.1981). These authorities, either separately or together, provide no support for the existence of such a privilege protecting reporters subpoenaed to a grand jury. Appellants' argument concerning Justice Powell's concurrence begins with the fact that the decision of the Supreme Court was reached by a 5-4 divided Court. Thus, each of the justices joining in the result was essential to the result. Therefore, appellants argue, it is the opinion of the least encompassing justice which determines the precedent set by the decision rather than the decision which appellants style a "plurality" opinion authored by Justice White. In support of this proposition, they advance an argument that first admits that when the opinion of an individual justice is not needed for a majority his separate opinion is not a gloss giving authoritative definition to the majority opinion in which he did not join, but rather is no more than his separate thoughts, and "the meaning of a majority opinion is to be found within the opinion itself." McKoy v. North Carolina, 494 U.S. 433, 462 n. 3, 110 S.Ct. 1227, 108 L.Ed.2d 369 (1990) (Blackmun, J., concurring). But, appellants argue, when the individual justice is needed to constitute the majority, "the opinion is not a majority except to the extent that it agrees with his views. What he writes is not a `gloss' but the least common denominator." That is to say, the separate opinion "cannot add to what the majority opinion holds, binding the other four justices to say what they have not said; but it can assuredly narrow what the majority opinion holds, by explaining the more limited interpretation adopted by a necessary member of that majority...." Id. at 462 n. 3 (Scalia, J., joined by Rehnquist, C.J., and O'Connor, J., dissenting).
29
Without attempting to resolve any dispute or difference that may exist between Justice Blackmun and the three dissenting justices in McKoy, even if we accept Justice Scalia's analysis at full value, it does not help appellants in this case. Justice Powell's concurring opinion was not the opinion of a justice who refused to join the majority. He joined the majority by its terms, rejecting none of Justice White's reasoning on behalf of the majority. He wrote separately "to emphasize" what seemed to him "to be the limited nature of the Court's holding." 408 U.S. at 709, 92 S.Ct. 2646 (Powell, J., concurring). Justice White's opinion is not a plurality opinion of four justices joined by a separate Justice Powell to create a majority, it is the opinion of the majority of the Court. As such it is authoritative precedent. It says what it says. It rejects the privilege asserted by appellants.
30
Nonetheless, appellants urge that Justice Powell must have been contemplating the creation or recognition of some further sort of First Amendment privilege for reporters asserting confidential sources, else why would he have bothered writing? To that, the United States replies that by its terms Justice Powell's opinion recognizes only that
31
if the newsman is called upon to give information bearing only on a remote and tenuous relationship to the subject investigation, of if he has some other reason to believe that his testimony implicates confidential source relationships without a legitimate need of law enforcement, he will have access to the court on a motion to quash and an appropriate protective order may be entered.
32
Id. at 710, 92 S.Ct. 2646 (emphasis added).
33
Therefore, the United States contends, Justice Powell, who expressed no disagreement with the majority about the existence of a constitutional privilege, only emphasized that there would be First Amendment protection in cases of bad faith investigations. Appellants counter that Justice Powell could not have meant what the United States argues, as this would have given reporters no more protection than other citizens. However, they never make it clear why they are convinced that Justice Powell must have intended to give reporters more protection than other citizens. The Constitution protects all citizens, and there is no reason to believe that Justice Powell intended to elevate the journalistic class above the rest. Cf. Branzburg at 690, 92 S.Ct. 2646 ("the only testimonial privilege for unofficial witnesses that is rooted in the Federal Constitution is the Fifth Amendment privilege against compelled self-incrimination.").
34
In any event, whatever Justice Powell specifically intended, he joined the majority. Not only did he join the majority in name, but because of his joinder with the rest of a majority, the Court reached a result that rejected First Amendment privilege not to testify before the grand jury for reporters situated precisely like those in the present case. As we noted above, there is no factual difference between Branzburg and the present case. If Justice Powell in any way meant to afford more protection than was afforded by the rest of the majority, that protection cannot possibly extend to appellants as Branzburg is directly on point and reached a result in which Justice Powell joined, rejecting the applicability of constitutional privilege.
35
Zerilli cannot possibly help appellants, although they assert that Zerilli, citing Justice Powell's "deciding vote" in Branzburg, recognized, at least in dicta, a reporter's privilege in civil cases and held that Branzburg was not controlling as to that issue. Indeed, the Zerilli Court expressly distinguished its case from Branzburg. "Although Branzburg may limit the scope of a reporter's First Amendment privilege in criminal proceedings, this circuit has previously held that in civil cases, where the public interest in effective law enforcement is absent, that case is not controlling." 656 F.2d at 705. Zerilli has no force in the present case. Even if Zerilli states the law applicable to civil cases, this is not a civil case. Zerilli could not subtract from the Supreme Court's holding in Branzburg. Zerilli, along with several other lower court decisions cited by appellants, may recognize or at least suggest the possibility of privileges under various circumstances. None of them can change the law applicable to grand juries as set forth in Branzburg. As the Supreme Court has told us:
36
If a precedent of this Court has direct application in a case, yet appears to rest on reasons rejected in some other line of decisions, the court of appeals should follow the case which directly controls, leaving to this Court the prerogative of overruling its own decisions.
37
Rodriguez de Quijas v. Shearson/American Express, 490 U.S. 477, 484, 109 S.Ct. 1917, 104 L.Ed.2d 526 (1989). The Supreme Court has not overruled Branzburg.
B. The Common Law Privilege
38
Appellants argue that even if there is no First Amendment privilege protecting their confidential source information, we should recognize a privilege under federal common law, arguing that regardless of whether a federal common law privilege protecting reporters existed in 1972 when Branzburg was decided, in the intervening years much has changed. While appellants argue for an absolute privilege under the common law, they wisely recognize the possibility that a court not recognizing such an absolute privilege might nonetheless find a qualified privilege. They therefore also argue that if there is a qualified privilege, then the government has not overcome that qualified privilege. The Court is not of one mind on the existence of a common law privilege. Judge Sentelle would hold that there is no such common law privilege for reasons set forth in a separate opinion. Judge Tatel would hold that there is such a common law privilege. Judge Henderson believes that we need not, and therefore should not, reach that question. However, all believe that if there is any such privilege, it is not absolute and may be overcome by an appropriate showing. All further believe, for the reasons set forth in the separate opinion of Judge Tatel, that if such a privilege applies here, it has been overcome. Therefore, the common law privilege, even if one exists, does not warrant reversal.
C. The Due Process Argument
39
While appellants insist that their privilege is absolute, they assert a secondary line of argument that if their privilege is conditional, then their due process rights have been violated by the refusal of the Special Counsel and the District Court to provide them access to the Special Counsel's secret evidentiary submissions in support of the enforcement of the subpoenas. This argument is without merit. As appellants themselves admit in their brief, this circuit has recognized that "a district court can ensure that [grand jury] secrecy is protected by provisions for sealed, or when necessary ex parte, filings." In re Grand Jury, 121 F.3d 729, 757 (D.C.Cir.1997). Indeed, the rule of grand jury secrecy is so well established that we have noted that "[t]here is a plethora of authority recognizing that the grand jury context presents an unusual setting where privacy and secrecy are the norm." In re Sealed Case, 199 F.3d 522, 526 (D.C.Cir.2000) (collecting authorities).
40
As the Supreme Court has reminded us on occasion, "the grand jury is an institution separate from the courts." United States v. Williams, 504 U.S. 36, 47, 112 S.Ct. 1735, 118 L.Ed.2d 352 (1992). The function of that separate institution is to "serv[e] as a kind of buffer or referee between the government and the people." Id. The function of the grand jury "depends on `maintaining the secrecy of the grand jury proceedings in the federal courts.'" In re Sealed Case, 199 F.3d at 526 (quoting United States v. Procter & Gamble Co., 356 U.S. 677, 681, 78 S.Ct. 983, 2 L.Ed.2d 1077 (1958)). The authorities collected in In re Sealed Case recite the broad variety of circumstances in which the courts have upheld this grand jury secrecy, a secrecy that has been the persistent rule for grand jury proceedings for at least four hundred years. See Douglas Oil v. Petrol Stops Northwest, 441 U.S. 211, 218 n. 9, 99 S.Ct. 1667, 60 L.Ed.2d 156 (1979) ("Since the 17th century, grand jury proceedings have been closed to the public, and records of such proceedings have been kept from the public eye.").
41
In the Douglas Oil decision, the Supreme Court catalogs multiple reasons for preserving the ancient secrecy of the grand jury:
42
(1) disclosure of pre-indictment proceedings would make many prospective witnesses "hesitant to come forward voluntarily, knowing that those against whom they testify would be aware of that testimony"; (2) witnesses who did appear "would be less likely to testify fully and frankly as they would be open to retribution as well as inducements"; and (3) there "would be the risk that those about to be indicted would flee or would try to influence individual grand jurors to vote against indictment."
43
In re North (Omnibus Order), 16 F.3d 1234, 1242 (D.C.Cir., Spec.Div., 1994) (quoting Douglas Oil Co., 441 U.S. at 218-19, 99 S.Ct. 1667).
44
Appellants have offered nothing to take the present grand jury investigation outside the general rule, let alone elevate their objections to constitutional due process status. Indeed, appellants' argument is principally built around a case from another circuit never authoritative here, no longer authoritative in the circuit of its origin, and distinguishable on its facts from the beginning. In United States v. Dinsio, 468 F.2d 1392 (9th Cir.1972), the court ruled that a defendant who had been held in contempt for refusing to furnish finger and palm print exemplars to a federal grand jury was deprived of her due process rights when the district court refused to let her inspect an ex parte government affidavit upon which the court had determined that the grand jury's request was reasonable. The Ninth Circuit itself has since declared that "to the extent that our decision in United States v. Dinsio... may be considered to support the witness in his refusal to cooperate, it has been superseded by United States v. Mara [410 U.S. 19, 93 S.Ct. 774, 35 L.Ed.2d 99 (1973)], and United States v. Dionisio, 410 U.S. 1, 93 S.Ct. 764, 35 L.Ed.2d 67 (1973)." In re Braughton, 520 F.2d 765, 767 (9th Cir.1975). The Ninth Circuit went on to say "nothing in the law of this circuit now requires a court to interrupt a grand jury while a recalcitrant witness produces a series of mini trials challenging the reasonableness of the government's efforts to obtain fingerprint, voice, or handwriting exemplars or the relevance of such exemplars to the government's case." Id.
45
Similarly, Dinsio was never the law of this circuit, just as it is no longer the law of the Ninth Circuit, and nothing in the law of the District of Columbia Circuit requires or has ever required a district court to interrupt the grand jury while a recalcitrant witness enjoys a series of mini trials over his access to materials cloaked by grand jury secrecy.
46
Assuming for the sake of this case that the general rule of grand jury secrecy is not sufficient to justify the District Court's use of in camera and ex parte proceedings, we further note that we have approved the use of such a procedure in other cases raising privilege claims. In In re Sealed Case No. 98-3077, 151 F.3d 1059 (D.C.Cir.1998), a case, like this one, involving the use of in camera and ex parte proceedings in the context of a Rule 6(e) motion by the government, we upheld their use, and in so doing, relied, at least in part, on precedent established in privilege analysis. We observed there that "courts often use in camera, ex parte proceedings to determine the propriety of a crime fraud exception to the attorney-client privilege when such proceedings are necessary to ensure the secrecy of ongoing grand jury proceedings." Id. at 1075 (citing In re Grand Jury, 103 F.3d 1140, 1145 (3d Cir.), cert. denied sub nom. Roe v. United States, 520 U.S. 1253, 117 S.Ct. 2412, 138 L.Ed.2d 177 (1997)). Having previously noted the propriety of the procedures to protect the well-established attorney-client privilege, we are persuaded that a similar protection of grand jury secrecy is appropriate to protect whatever privilege, if any, may exist between a reporter and a confidential source.
47
We affirm the District Court's ruling on the maintenance of the seal of grand jury secrecy.
D. Department of Justice Guidelines
48
In their final argument for reversal of the District Court's contempt finding, appellants contend that the Special Counsel did not comply with the Department of Justice guidelines for issuing subpoenas to news media and that such failure provides an independent basis for reversal. The District Court expressed its doubt that the DOJ guidelines were enforceable, but found that even if they were, Special Counsel had fully complied with the guidelines. Because we conclude that the guidelines create no enforceable right, we need not reach the question of the Special Counsel's compliance.
49
The guidelines in question are set forth in 28 C.F.R. § 50.10 and the United States Attorney's Manual, § 9-2.161. Those guidelines provide that subpoenas for testimony by news media must be approved by the Attorney General, a requirement not pertinent in the present case as the Special Counsel had received delegation of all the Attorney General's authority, and should meet the following standards:
50
(a) "In criminal cases, there should be reasonable grounds to believe, based on information obtained from nonmedia sources, that a crime has occurred, and that the information sought is essential to a successful investigation-particularly with reference to establishing guilt or innocence. The subpoena should not be used to obtain peripheral, nonessential, or speculative information." 28 C.F.R. § 50.10(f)(1).
51
(b) Before issuing a subpoena to a member of the news media, all reasonable efforts should be made to obtain the desired information from alternative sources. Id. at §§ 50.10(b), 50.10(f)(3);
52
(c) Wherever possible, subpoenas should be directed at information regarding a limited subject matter and a reasonably limited period of time. Subpoenas should avoid requiring production of a large volume of unpublished materials and provide reasonable notice of the demand for documents. Id. at § 50.10(f)(6);
53
(d) "The use of subpoenas to members of the news media should, except under exigent circumstances, be limited to the verification of published information and to such surrounding circumstances as relate to the accuracy of the published information." Id. at § 50.10(f)(4); and
54
(e) When issuance of a subpoena to a member of the media is contemplated, the government shall pursue negotiations with the relevant media organization. The negotiations should seek accommodation of the interests of the grand jury and the media. Where the nature of the investigation permits, the government should make clear what its needs are in a particular case as well as its willingness to respond to particular problems of the media. Id. at § 50.10(c).
55
However, as the District Court correctly observed, the guidelines expressly state that they do "not create or recognize any legally enforceable right in any person." Id. at § 50.10(n). This reservation has been upheld by several federal appellate and district courts. See In re Special Proceedings, 373 F.3d 37, 44 n. 3 (1st Cir.2004) (noting that DOJ guidelines state that they do not create legally enforceable rights); In re Grand Jury Subpoena American Broadcasting Companies, Inc., 947 F.Supp. 1314, 1322 (D.Ark.1996) (declining to quash subpoena based on failure to comply with DOJ regulations, on ground that regulations, by their own terms, confer no rights on media witnesses). See also In re Grand Jury Proceedings No. 92-4, 42 F.3d 876, 880 (4th Cir.1994) (holding that special prosecutor's failure to comply with guidelines regarding issuance of subpoenas to attorney, even if applicable, were not enforceable by witness through motion to quash). The guidelines, not required by any constitutional or statutory provision, see In re Special Proceedings, 373 F.3d at 44 n. 3, exist to guide the Department's exercise of its discretion in determining whether and when to seek the issuance of subpoenas to reporters, not to confer substantive or procedural benefits upon individual media personnel. See In re Shain, 978 F.2d 850, 853 (4th Cir.1992) (holding reporters have no right to seek enforcement of DOJ guidelines before being compelled to testify) (citing United States v. Caceres, 440 U.S. 741, 99 S.Ct. 1465, 59 L.Ed.2d 733 (1979) (exclusionary rule not applicable to evidence obtained in violation of internal IRS regulations governing electronic surveillance)); In re Grand Jury Proceedings No. 92-4, 42 F.3d at 880 (following In re Shain, 978 F.2d at 854).
56
Appellants rely on Morton v. Ruiz, 415 U.S. 199, 94 S.Ct. 1055, 39 L.Ed.2d 270 (1974). In that case, the Supreme Court stated that "where the rights of individuals are affected, it is incumbent upon agencies to follow their own procedures. This is so even where the internal procedures are possibly more rigorous than otherwise would be required." Id. at 235, 94 S.Ct. 1055.
57
Ruiz, however, is distinguishable. Regulations considered by the Court in that case required the publication of directives that "inform the public of privileges and benefits available and of eligibility requirements." Id. (quotation marks omitted). The Supreme Court found that the publication requirement was intended to benefit potential beneficiaries and therefore invalidated a Bureau of Indian Affairs attempt to limit general assistance benefits to otherwise eligible beneficiaries based on an unpublished eligibility requirement. This reasoning has no applicability to the guidelines before us.
58
It is well established that the exercise of prosecutorial discretion is at the very core of the executive function. Courts consistently hesitate to attempt a review of the executive's exercise of that function. See, e.g., United States v. Armstrong, 517 U.S. 456, 464-65, 116 S.Ct. 1480, 134 L.Ed.2d 687 (1996). Federal prosecutors have "broad discretion to enforce the Nation's criminal laws." Id. at 464, 116 S.Ct. 1480 (internal punctuation and citations omitted). The prosecutor's discretion arises from their designation "as the President's delegates to help him discharge his constitutional responsibility to `take care that the laws be faithfully executed.'" Id. (quoting U.S. CONST. art. II, § 3). Given the nature of the guidelines themselves, and the function they govern, we conclude that the guidelines provide no enforceable rights to any individuals, but merely guide the discretion of the prosecutors. We therefore need not reach the question of the Special Counsel's compliance with the guidelines, and again we affirm the decision of the District Court.
III. Conclusion
59
For the reasons set forth above, the judgment of the District Court is affirmed.
60
SENTELLE, Circuit Judge, concurring.
61
As noted in the opinion of the court, I write separately to express my differing basis for affirming the District Court on the common law privilege issue. I would hold that reporters refusing to testify before grand juries as to their "confidential sources" enjoy no common law privilege beyond the protection against harassing grand juries conducting groundless investigations that is available to all other citizens. While I understand, and do not actually disagree with, the conclusion of my colleagues that any such privilege enjoyed by the reporters has been overcome by the showing of the United States, and that we therefore need not determine whether such privilege exists, I find this ordering of issues a bit disturbing. To me, the question of the existence of such privilege vel non is logically anterior to the quantum of proof necessary to overcome it. While I understand Judge Henderson's theory that she cannot support a privilege afforded by the common law which would not be overcome by the quantum of proof offered by the government, I think it more logical to not reach the quantum question in the absence of a determination as to the existence of the privilege than to proceed the other way around.1 That said, I fully join the conclusion that we should affirm the District Court's decision to hold the appellants in contempt, unswayed by their claim of protection of common law privilege. I write separately only to explain my reasons for rejecting the theory that such a privilege is known to the common law.
62
I base my rejection of the common law privilege theory on foundations of precedent, policy, and separation of powers. As to precedent, I find Branzburg v. Hayes, 408 U.S. 665, 92 S.Ct. 2646, 33 L.Ed.2d 626 (1972), to be as dispositive of the question of common law privilege as it is of a First Amendment privilege. While Branzburg generally is cited for its constitutional implications, the Branzburg Court repeatedly discussed the privilege question in common law terms as well as constitutional. Indeed, the majority opinion by Justice White includes the phrase "common law" no fewer than eight times. More significant than the fact that the Court frequently spoke of the common law is what the Court had to say about it: "at common law, courts consistently refuse to recognize the existence of any privilege authorizing a newsman to refuse to reveal confidential information to a grand jury." Id. at 685, 92 S.Ct. 2646 (collecting cases).
63
At page 688, 92 S.Ct. 2646, the Court continued, "although the powers of the grand jury are not unlimited and are subject to the supervision of a judge, the longstanding principle that `the public ... has a right to every man's evidence,' except for those persons protected by a constitutional, common law, or statutory privilege ... is particularly applicable to grand jury proceedings." (emphasis added) (citations omitted). Significantly, the Court made this statement in the course of holding the journalists litigating before it unprotected by privilege against contempt citations. Granted, the Court expressly held that it was not about to create a new "constitutional" privilege. But in the same paragraph with that rejection it expressly discusses the possible protection of common law and in the end reaches a result that leaves the reporters unprotected. I think it therefore indisputable that the High Court rejected a common law privilege in the same breath as its rejection of such a privilege based on the First Amendment. Especially is this so when we consider that it makes little sense to assume that the Court first reached out to take a constitutional question it would not have needed to answer had there been such a common law privilege, and then proceeded to answer that question in such a fashion as to reach a result upholding contempt citations and reversing vacation of such citations.2
64
Because the Supreme Court rejected the common law privilege, I think it would be at least presumptuous if not overreaching for us to now adopt the privilege. As the opinion of the court notes, "the Supreme Court has told us:
65
If a precedent of this Court has direct application in a case, yet appears to rest on reasons rejected in some other line of decisions, the court of appeals should follow the case which directly controls, leaving to this Court the prerogative of overruling its own decisions."
66
Maj. Op. at 972 (quoting Rodriguez de Quijas v. Shearson/American Express, 490 U.S. 477, 484, 109 S.Ct. 1917, 104 L.Ed.2d 526 (1989)).
67
The Supreme Court has rejected a common law privilege for reporters subpoenaed to give evidence to grand juries. In my view that rejection stands unless and until the Supreme Court itself overrules that part of Branzburg. Although the appellants argue that other changes in the law since Branzburg should lead to an opposite result, I think that argument should appropriately be made to the Supreme Court, not the lower courts.3
68
Even if appellants are correct that we would have the power to adopt such a privilege in the face of the Branzburg precedent, I nonetheless would not accept that invitation. Appellants' argument for our authority to adopt the new privilege begins with the Federal Rules of Evidence. Rule 501, enacted by Congress in the Federal Rules of Evidence in 1975, three years after Branzburg, rejected an enumeration of specific federal privileges and provided that privileges in federal criminal cases "shall be governed by the principles of the common law as they may be interpreted by the courts of the United States in the light of reason and experience." Although the rules became effective after Branzburg, Rule 501 does not effect any change in the authority of federal courts to adopt evidentiary privileges. Before the enactment of the Federal Rules of Evidence, the authority of the federal courts to adopt common law privileges was governed by case law. The relevant case law provided for precisely the same authority as Congress enacted in the rules. Indeed, the language of the rule is drawn directly from case law governing at the time of Branzburg. The Supreme Court expressly held in Wolfle v. United States, 291 U.S. 7, 54 S.Ct. 279, 78 L.Ed. 617 (1934), that
69
the rules governing the competence of witnesses in criminal trials in the federal courts are not necessarily restricted to those local rules enforced at the time of the admission into the union of the particular state where the trial takes place, but are governed by common law principles as interpreted and applied by the federal courts in the light of reason and experience.
70
291 U.S. 7, 12, 54 S.Ct. 279, 78 L.Ed. 617 (1934) (citing Funk v. United States, 290 U.S. 371, 54 S.Ct. 212, 78 L.Ed. 369 (1933)) (emphasis added). Given the venerable origins of the language used in Rule 501, it cannot be said that the courts have more power to adopt privileges today than at the time of Branzburg. The power is precisely the same. Thus, the enactment of Rule 501 cannot by itself work any change in the law which should empower us to depart from the Supreme Court's clear precedent in Branzburg.
71
Appellants persist, however, that the state of the common law has changed sufficiently to warrant a new approach. By appellants' count, at the time of the Branzburg decision, only seventeen states had enacted what appellants refer to as "shield laws" to protect journalists from forced disclosure of confidential sources or newsgathering materials, while today, thirty-one states (plus the District of Columbia) have such statutes.4 Nonetheless, I think it remains the prerogative of the Supreme Court rather than inferior federal tribunals to determine whether these changes are sufficient to warrant an overruling of the Court's rejection of such a common law privilege in Branzburg.
72
Furthermore, even if we are authorized to make that decision, reasons of policy and separation of powers counsel against our exercising that authority. While I concede that the adoption of the "shield" by legislation rather than judicial fiat does not prevent the change being considered by the courts in assessing the common law, I find the adoption of the privilege by the legislatures of the states instructive as to how the federal government should proceed, if at all, to adopt the privilege. The statutes differ greatly as to the scope of the privilege, and as to the identity of persons entitled to the protection of the privilege. We have alluded in the majority opinion to the differing decisions of courts as to civil, criminal, and grand jury proceedings. There is also a more fundamental policy question involved in the crafting of such a privilege.
73
The Supreme Court itself in Branzburg noted the difficult and vexing nature of this question, observing that applying such privilege would make it
74
necessary to define those categories of newsmen who qualify for the privilege, a questionable procedure in light of the traditional doctrine that liberty of the press is the right of the lonely pamphleteer who uses carbon paper or a mimeograph just as much as of the large metropolitan publisher who utilizes the latest photocomposition methods.
75
408 U.S. at 704, 92 S.Ct. 2646. The Supreme Court went on to observe that "freedom of the press is a `fundamental personal right ... not confined to newspapers and periodicals. It necessarily embraces pamphlets and leaflets.... The press in its historic connotation comprehends every sort of publication which affords a vehicle of information and opinion.'" Id. (quoting Lovell v. Griffin, 303 U.S. 444, 450, 452, 58 S.Ct. 666, 82 L.Ed. 949 (1938)). Are we then to create a privilege that protects only those reporters employed by Time Magazine, the New York Times, and other media giants, or do we extend that protection as well to the owner of a desktop printer producing a weekly newsletter to inform his neighbors, lodge brothers, co-religionists, or co-conspirators? Perhaps more to the point today, does the privilege also protect the proprietor of a web log: the stereotypical "blogger" sitting in his pajamas at his personal computer posting on the World Wide Web his best product to inform whoever happens to browse his way? If not, why not? How could one draw a distinction consistent with the court's vision of a broadly granted personal right? If so, then would it not be possible for a government official wishing to engage in the sort of unlawful leaking under investigation in the present controversy to call a trusted friend or a political ally, advise him to set up a web log (which I understand takes about three minutes) and then leak to him under a promise of confidentiality the information which the law forbids the official to disclose?
76
The state legislatures have dealt with this vexing question of entitlement to the privilege in a variety of ways. Some are quite restrictive. Alabama limits its protection to "person[s] engaged in, connected with, or employed on any newspaper, radio broadcasting station or television station, while engaged in a newsgathering capacity." ALA. CODE § 12-21-142. Alaska's statutes protect only the "reporter," a category limited to "person[s] regularly engaged in the business of collecting or writing news for publication or presentation to the public, through a news organization." ALASKA STAT. § 09.25.300. The statutory privilege in Arizona protects "a person engaged in newspaper, radio, television or reportorial work, or connected with or employed by a newspaper or radio or television station...." Ariz. Rev. Stat. § 12-2237. Arkansas's legislature has declared the privilege applicable to "any editor, reporter, or other writer for any newspaper, periodical, or radio station, or publisher of any newspaper or periodical, or manager or owner of any radio station...." Ark. Code Ann. § 16-85-510. Delaware is perhaps the most specific, protecting a "reporter," which
77
means any journalist, scholar, educator, polemicist, or other individual who either: (a) At the time he or she obtained the information that is sought was earning his or her principal livelihood by, or in each of the preceding 3 weeks or 4 of the preceding 8 weeks had spent at least 20 hours engaged in the practice of, obtaining or preparing information for dissemination with the aid of facilities for the mass reproduction of words, sounds, or images in a form available to the general public; or (b) Obtained the information that is sought while serving in the capacity of an agent, assistant, employee, or supervisor of an individual who qualifies as a reporter under subparagraph a.
78
DEL. CODE ANN. tit. 10 § 4320. Presumably, states such as these would provide the privilege only to the "established" press.
79
Others are quite inclusive. The Nebraska legislature, for example, has declared:
80
(1) That the policy of the State of Nebraska is to insure the free flow of news and other information to the public, and that those who gather, write, or edit information for the public or disseminate information to the public may perform these vital functions only in a free and unfettered atmosphere; (2) That such persons shall not be inhibited, directly or indirectly, by governmental restraint or sanction imposed by governmental process, but rather that they shall be encouraged to gather, write, edit, or disseminate news or other information vigorously so that the public may be fully informed.
81
NEB. REV. STAT. § 20-144. To that end, it protects any "medium of communication" which term "shall include, but not be limited to, any newspaper, magazine, other periodical, book, pamphlet, news service, wire service, news or feature syndicate, broadcast station or network, or cable television system." Id. at § 20-145(2) (emphasis added).
82
In defining the persons protected by that privilege, Nebraska tells us that "Person shall mean any individual, partnership, limited liability company, corporation, association, or other legal entity existing under or authorized by the law of the United States, any state or possession of the United States, the District of Columbia, the Commonwealth of Puerto Rico, or any foreign country." Id. at 20-145(7). Presumably, then, Nebraska, perhaps more in keeping with the spirit of the recent revolutionaries who gave us the First Amendment, protects the pamphleteer at the rented printer, and the blogger at the PC, as well as the giant corporation with its New York publishing house.
83
The variety of legislative choices among the states only serves to heighten the concern expressed by the majority in Branzburg. See 408 U.S. at 704, 92 S.Ct. 2646. This concern is reinforced by examination of the Jaffee decision, upon which appellants rely. In Jaffee, the Supreme Court extended a federal privilege "to confidential communications made to licensed social workers in the course of psychotherapy." 518 U.S. at 15, 116 S.Ct. 1923. There is little definitional problem with the application of this privilege. The court need only ask: Does this "social worker" have a license? If the answer is "yes," then the privilege applies; if it's "no," the privilege does not. If the courts extend the privilege only to a defined group of reporters, are we in danger of creating a "licensed" or "established" press? If we do so, have we run afoul of the breadth of the freedom of the press, that "fundamental personal right" for which the Court in Branzburg expressed its concern? 408 U.S. at 704, 92 S.Ct. 2646. Conversely, if we extend that privilege to the easily created blog, or the ill-defined pamphleteer, have we defeated legitimate investigative ends of grand juries in cases like the leak of intelligence involved in the present investigation?
84
Nor does the identity of the protected persons constitute the only difficult policy decision. Branzburg enumerates several concerns. For example, does "the public interest and possible future news about crime from undisclosed, unverified sources ... take precedence over the public interest in pursuing and prosecuting those crimes reported to the press by informants and in thus deterring the commission of such crimes in the future"? Id. at 695, 92 S.Ct. 2646. Do "agreements to conceal information relevant to the commission of crime avail little to recommend them from the standpoint of public policy"? Id. at 696, 92 S.Ct. 2646. What are we to do with the historic common law recognition of "a duty to raise the `hue and cry' and report felonies to the authorities"? Id. (see also authorities collected in id. at 696 n. 34, 92 S.Ct. 2646). Should we be creating immunity from prosecution for "misprision" of a felony-that is, the concealment of a felony? Id. at 696, 92 S.Ct. 2646.
85
Should the privilege be absolute or limited? If limited, how limited? Without attempting to catalog, I note that the state statutes provide a variety of answers to that policy question. Therefore, if such a decision requires the resolution of so many difficult policy questions, many of them beyond the normal compass of a single case or controversy such as those with which the courts regularly deal, doesn't that decision smack of legislation more than adjudication? Here, I think the experience of the states is most instructive. The creation of a reporter's privilege, if it is to be done at all, looks more like a legislative than an adjudicative decision. I suggest that the media as a whole, or at least those elements of the media concerned about this privilege, would better address those concerns to the Article I legislative branch for presentment to the Article II executive than to the Article III courts.
86
For all the reasons set forth above, I would hold that there is no common law privilege protecting reporters or any other news media personnel, no matter how defined, from the reach of grand jury subpoenas on claim of confidentiality.
Notes:
1
See Opinion of Judge Tatel at pp. 988-91
2
By way of comparison, under the constitutional avoidance doctrine, the Supreme Court counsels courts "to adopt constructions of statutes to `avoid decision of constitutional questions,' not to deliberately create constitutional questions."See, e.g., McConnell v. Federal Election Commission, 540 U.S. 93, 180, 124 S.Ct. 619, 157 L.Ed.2d 491 (2003); United States v. 37 Photographs, 402 U.S. 363, 373, 91 S.Ct. 1400, 28 L.Ed.2d 822 (1971), United States ex rel. Attorney General v. Delaware and Hudson Co., 213 U.S. 366, 407, 29 S.Ct. 527, 53 L.Ed. 836 (1909); Ashwander v. Tennessee Valley Authority, 297 U.S. 288, 341, 56 S.Ct. 466, 80 L.Ed. 688 (1936) (Brandeis, J., concurring).
3
I wish to make it plain that I do not fault the appellants for making the argument, understanding that they must if they wish to preserve it for Supreme Court review. Nonetheless, I think it is only the High Court and not this one that may act upon that argument
4
The fact that the adoption has been by legislation rather than court decision does not deprive the change in law of common law force. As the Supreme Court has noted, "the policy decisions of the states bear on the question whether federal courts should recognize a new privilege or amend the coverage of an existing one[,]" and further has told us that "it is of no consequence that recognition of the privilege in the vast majority of the states is the product of legislative action rather than judicial decision."Jaffee v. Redmond, 518 U.S. 1, 12-13, 116 S.Ct. 1923, 135 L.Ed.2d 337 (1996).
87
KAREN LECRAFT HENDERSON, Circuit Judge, concurring.
88
I write separately to emphasize that adherence to the principle of judicial restraint — patience in judicial decision-making —would produce a better result in II.B of the majority opinion. Because my colleagues and I agree that any federal common-law reporter's privilege that may exist is not absolute and that the Special Counsel's evidence defeats whatever privilege we may fashion, we need not, and therefore should not, decide anything more today than that the Special Counsel's evidentiary proffer overcomes any hurdle, however high, a federal common-law reporter's privilege may erect.
89
In our circuit it is a venerable practice, and one frequently observed, to assume arguendo the answer to one question — e.g., whether to recognize a federal common-law reporter's privilege — in order to resolve a given case by answering another and equally dispositive one — e.g., whether any privilege would protect these reporters.1 Although both of my colleagues question the logic of this approach here, it is a mode of decision-making they themselves have often used.2 In this case, however, they employ two divergent forms of "wide-angle adjudication." See Harry T. Edwards, The Role of the Judge in Modern Society: Some Reflections on Current Practices in Federal Appellate Adjudication, 32 CLEV. ST. L. REV. 385, 414 (1983-84). Judge Sentelle would hold that a reporter enjoys no federal common-law privilege to refuse to provide a bona fide grand jury with relevant documents and testimony while Judge Tatel would fix the contours of a qualified reporter's privilege by using a novel multi-factor balancing test only to conclude that it helps these reporters not at all.3
90
While I am convinced that we need not, and therefore should not, go further than to conclude, as did the district court, see Appendix 35-36, 275, that the Special Counsel's showing decides the case, I feel compelled to comment briefly on my colleagues' opposing conclusions if only to make clear why I think it unwise to advance either of them. I cannot agree with Judge Sentelle's conclusion that the United States Supreme Court has answered the question we now avoid. Branzburg v. Hayes addressed only "whether requiring newsmen to appear and testify before state or federal grand juries abridges the freedom of speech and press guaranteed by the First Amendment" and "h[e]ld that it does not." 408 U.S. 665, 667, 92 S.Ct. 2646, 33 L.Ed.2d 626 (1972) (emphases added). The boundaries of constitutional law and common law do not necessarily coincide, however, and while we are unquestionably bound by Branzburg's rejection of a reporter's privilege rooted in the First Amendment, we are not bound by Branzburg's commentary on the state of the common law in 1972. Federal Rule of Evidence 501, which came into being nearly three years after Branzburg, authorizes federal courts to develop testimonial privileges "in the light of reason and experience," allowing for the often evolving state of the commonlaw. See FED. R. EVID. 501; Trammel v. United States, 445 U.S. 40, 47, 100 S.Ct. 906, 63 L.Ed.2d 186 (1980) ("In rejecting the proposed Rules and enacting Rule 501, Congress manifested an affirmative intention not to freeze the law of privilege."); see id. ("The Federal Rules of Evidence acknowledge the authority of the federal courts to continue the evolutionary development of testimonial privileges."). Judge Sentelle's view also discounts the fact that, even as they rejected a reporter's First Amendment right to withhold testimony from a bona fide grand jury, both the Branzburg majority opinion as well as Justice Powell's separate concurrence hint ambiguously at the existence of some special protection for reporters stemming from their significant role in sustaining our republican form of government.4
91
At the same time, I am far less eager a federal common-law pioneer than Judge Tatel as I find less comfort than he in riding Jaffee v. Redmond, 518 U.S. 1, 116 S.Ct. 1923, 135 L.Ed.2d 337 (1996), into the testimonial privilege frontier. Just as Rule 501 imposes no "freeze" on the development of the common law, see Univ. of Penn. v. EEOC, 493 U.S. 182, 189, 110 S.Ct. 577, 107 L.Ed.2d 571 (1990); Trammel, 445 U.S. at 47, 100 S.Ct. 906, it likewise does not authorize federal courts to mint testimonial privileges for any group — including the "journalistic class," as Judge Sentelle dubs it, Maj. Op. at 972 — that demands one. The Supreme Court has warned that testimonial privileges "are not lightly created nor expansively construed, for they are in derogation of the search for truth." United States v. Nixon, 418 U.S. 683, 710, 94 S.Ct. 3090, 41 L.Ed.2d 1039 (1974); see Branzburg, 408 U.S. at 690, 92 S.Ct. 2646; see also Jaffee, 518 U.S. at 21, 116 S.Ct. 1923 (Scalia, J., dissenting). Accordingly, we should proceed as cautiously as possible "when erecting barriers between us and the truth," id., recognizing that the Legislature remains the more appropriate institution to reconcile the competing interests — prosecuting criminal acts versus constricting the flow of information to the public — that inform any reporter's privilege to withhold relevant information from a bona fide grand jury. See Univ. of Penn., 493 U.S. at 189, 110 S.Ct. 577.
92
Because Jaffee sits rather awkwardly within a jurisprudence marked by a fairly uniform disinclination to announce new privileges5 or even expand existing ones,6 and even though it enjoyed the support of an overwhelming majority, I am hesitant to apply its methodology to a case that does not require us to do so. While it would not be the first of its kind, see Lemon v. Kurtzman, 403 U.S. 602, 91 S.Ct. 2105, 29 L.Ed.2d 745 (1971) ("Lemon test"); cf. Elk Grove Unified Sch. Dist. v. Newdow, ___ U.S. ___, 124 S.Ct. 2301, 2327 n. 1, 159 L.Ed.2d 98 (2004) ("We have selectively invoked particular tests, such as the `Lemon test,' with predictable outcomes." (internal citation omitted)) (Thomas, J., concurring in judgment), the type of multi-factor balancing test Judge Tatel proposes seems, at least to me, to lack analytical rigor because its application to this case is foreordained. Indeed, I am not convinced that a balancing test that requires more than an evaluation of the essentiality of the information to the prosecution and the exhaustion of available alternative sources thereof is either useful or appropriate. While Judge Tatel makes the centerpiece of his test the balancing of "the public interest in compelling disclosure, measured by the harm the leak caused, against the public interest in newsgathering, measured by the leaked information's value," see Tatel Op. at 998, this court (in the civil context),7 the United States Department of Justice8 and the lone district court that has recognized a federal common-law reporter's privilege in the grand jury context9 have declined to consider either of these factors in deciding whether to recognize a reporter's exemption from compulsory process.10 There is a good reason for this: I suspect that balancing "harm" against "news value" may prove unproductive because in most of the projected scenarios — leaks of information involving, for example, military operations, national security, policy choices or political adversaries — the two interests overlap. Furthermore, Branzburg warns of the risk inherent in the judicial assessment of the importance of prosecuting particular crimes. See 408 U.S. at 706, 92 S.Ct. 2646 ("By requiring testimony from a reporter in investigations involving some crimes but not in others, [the courts] would be making a value judgment that a legislature had declined to make, since in each case the criminal law involved would represent a considered legislative judgment, not constitutionally suspect, of what conduct is liable to criminal prosecution. The task of judges, like other officials outside the legislative branch, is not to make the law but to uphold it in accordance with their oaths."). And any evaluation of the importance of newsgathering keyed to its perceived "benefit" to the public, Tatel Op. at 997; see id. at 1001 ("beneficial newsgathering"), seems antithetical to our nation's abiding commitment to the uninhibited trade in ideas. See, e.g., Riley v. Nat'l Fed'n of Blind, Inc., 487 U.S. 781, 790-91, 108 S.Ct. 2667, 101 L.Ed.2d 669 (1988) ("The First Amendment mandates that we presume that speakers, not the government, know best both what they want to say and how to say it."); Cohen v. California, 403 U.S. 15, 24, 91 S.Ct. 1780, 29 L.Ed.2d 284 (1971) ("The constitutional right of free expression is ... designed and intended to remove governmental restraints from the arena of public discussion, putting the decision as to what views shall be voiced largely into the hands of each of us."); McConnell v. FEC, 251 F.Supp.2d 176, 360 (D.D.C.2003) ("[T]he First Amendment delegates to the populace at large the responsibility of conducting an `uninhibited, robust, and wide-open' debate." (quoting New York Times Co. v. Sullivan, 376 U.S. 254, 270, 84 S.Ct. 710, 11 L.Ed.2d 686 (1964))); cf. Gertz v. Welch, Inc., 418 U.S. 323, 346, 94 S.Ct. 2997, 41 L.Ed.2d 789 (1974). Moreover, to attempt to establish the contours of a reporter's privilege here would tend, unnecessarily, to leave a future panel less maneuverability in a case that might require just that to achieve justice. On this score, Judge Tatel levels the identical charge against my approach, see Tatel Op. at 990, but I fail to see how declining to decide whether a reporter's privilege exists or to define its contours could confine a future panel.
93
For the foregoing reasons, I am convinced that the court would chart the best course by charting the narrowest one and, accordingly, concur only in the judgment with respect to II.B of the majority opinion. In all other respects, I fully concur.
Notes:
1
See, e.g., Dir., Office of Thrift Supervision v. Vinson & Elkins, LLP, 124 F.3d 1304, 1308 (D.C.Cir.1997) (because appellant failed to show sufficient need for attorney interview notes, court "save[d] for another day" "difficult matters" of determining "degree of selection necessary to transform facts into opinions and the standard of review we should employ of a district court determination" regarding discovery of attorney work product); Littlewolf v. Lujan, 877 F.2d 1058, 1065 (D.C.Cir.1989) ("find[ing] it unnecessary to address the difficult questions raised by appellants regarding the Due Process adequacy of the period provided by the Act" because "[e]ven if we assume arguendo that the six-month limitations period is unreasonably short and that, as a consequence, the Act effectively `takes' the Band members' property rights, we conclude that the statute provides the Indians with just compensation"); cf. Michel v. INS, 206 F.3d 253, 260 n. 4 (2d Cir.2000) ("Where ... no harm results from our failing to answer a question, we believe that the `doctrine of judicial restraint provides a fully adequate justification for deciding [the] case on the best and narrowest ground available.'" (quoting Air Courier Conference of Am. v. Am. Postal Workers Union, 498 U.S. 517, 531, 111 S.Ct. 913, 112 L.Ed.2d 1125 (1991) (Stevens, J., concurring in judgment))).
2
See, e.g., Tradesmen Int'l, Inc. v. NLRB, 275 F.3d 1137, 1142 (D.C.Cir.2002) (Sentelle, J.) (assuming union organizer's activity constituted "concerted activity" under 29 U.S.C. § 157 but holding it was not protected under statute); Jackson v. Dist. of Columbia, 254 F.3d 262, 265 (D.C.Cir.2001) (Tatel, J.) ("continu[ing]" assumption that Religious Freedom Restoration Act applies to federal government and holding prisoners failed to exhaust administrative remedies); Carney v. Am. Univ., 151 F.3d 1090, 1094-95 (D.C.Cir.1998) (Tatel, J.) (assuming without deciding retaliation violates 42 U.S.C. § 1981 and remanding claim for trial); Massachusetts. v. United States Dep't of Transp., 93 F.3d 890, 892 (D.C.Cir.1996) (Sentelle, J.) ("We need not determine whether an agency's interpretation of a statute on the preemption question is subject to Chevron analysis in order to decide this case, as the agency's determination here cannot be upheld with or without deference.").
Judge Tatel distinguishes these cases by concluding that their analysis cannot be used to avoid the "dispositive" issue in this case. Tatel Op. at 990. There are, however, only three ways of answering the question whether these reporters' confidential source information is protected by a federal common-law privilege: (1) there is no privilege, (2) there is an absolute privilege and (3) there is a qualified privilege. None of us, including the reporters in their brief, would choose door number two, see Tatel Op. at 996; Appellants' Br. at 42, and only one of us heads for door number one, see Sentelle Op. at 976-77. That leaves door number three. But in choosing this route, the critical question is not definitional, as Judge Tatel sees it, see Tatel Op. at 990, but quantitative: Is the Special Counsel's evidentiary proffer sufficient to overcome any qualified privilege that may exist? Because we agree that the answer is "yes," there is no need for us to go any further. Granted, the circumstances of the cited cases differ but they use the same analysis. Moreover, its application here is consistent with the tried and true principle that "[w]here ... no harm results from our failing to answer a question, ... the `doctrine of judicial restraint provides a fully adequate justification for deciding [the] case on the best and narrowest ground available.'" Michel, 206 F.3d at 260 n. 4 (quoting Air Courier Conference of Am., 498 U.S. at 531, 111 S.Ct. 913 (Stevens, J. concurring in judgment)); see supra note 2.
3
Judge Tatel maintains that "[f]or the sake of reporters and sources," we must establish the contours of a privilege in order to "clarify the rules governing their relationship." Tatel Op. at 991. But the press's collection of information, including from confidential sources, seems to me near impervious to regulation: "[E]xperience teaches us more than sufficiently that men have nothing less in their power than their tongue...." BENEDICT DE SPINOZA, ETHICS 168 (G.H.R. Parkinson ed. & trans., Oxford Univ. Press 2000);cf. STANLEY WALKER, CITY EDITOR 44 (Johns Hopkins Univ. Press 1999) (1934) ("Women, wampum, and wrongdoing are always news."). As the Branzburg Court recognized, "the relationship of many informants to the press is a symbiotic one which is unlikely to be greatly inhibited by the threat of subpoena." 408 U.S. 665, 694, 92 S.Ct. 2646, 33 L.Ed.2d 626 (1972).
4
See Branzburg, 408 U.S. at 708, 92 S.Ct. 2646 ("[N]ews gathering is not without its First Amendment protections, and grand jury investigations if instituted or conducted other than in good faith, would pose wholly different issues for resolution under the First Amendment."); id. at 710, 92 S.Ct. 2646 ("The asserted claim to privilege should be judged on its facts by the striking of a proper balance between freedom of the press and the obligation of all citizens to give relevant testimony with respect to criminal conduct.") (Powell, J., concurring); see also In re Grand Jury, 955 F.2d 229, 234 (4th Cir.1992) (noting Branzburg's observation that First Amendment protects reporter in grand jury proceedings initiated or conducted in bad faith presents a "paradox" because "district courts can control prosecutorial abuse in any setting, not just in cases involving the First Amendment").
5
See Univ. of Penn., 493 U.S. 182, 110 S.Ct. 577, 107 L.Ed.2d 571 (rejecting privilege protecting academic peer-review materials); United States v. Gillock, 445 U.S. 360, 100 S.Ct. 1185, 63 L.Ed.2d 454 (1980) (rejecting privilege protecting "legislative acts"); see also Jaffee, 518 U.S. at 18-36, 116 S.Ct. 1923 (Scalia, J., dissenting).
6
See United States v. Zolin, 491 U.S. 554, 109 S.Ct. 2619, 105 L.Ed.2d 469 (1989) (permitting in camera review of materials to establish applicability of crime-fraud exception to attorney-client privilege); Trammel v. United States, 445 U.S. 40, 100 S.Ct. 906, 63 L.Ed.2d 186 (1980) (witness spouse's voluntary testimony not covered by spousal privilege); see also Jaffee, 518 U.S. at 18-36, 116 S.Ct. 1923 (Scalia, J., dissenting).
7
Zerilli v. Smith, 656 F.2d 705, 713-714 (D.C.Cir.1981); Carey v. Hume, 492 F.2d 631, 636-38 (D.C.Cir.1974); cf. United States v. Ahn, 231 F.3d 26, 37 (D.C.Cir.2000) (affirming district court's conclusion that reporter's privilege was not overcome because his testimony was not "`essential or crucial'" to defendant's case or relevant to determination of guilt or innocence).
8
See 28 C.F.R. § 50.10. As Judge Tatel points out, see Tatel Op. at 997, the Justice Department regulations aim to "strike the proper balance between the public's interest in the free dissemination of ideas and information and the public's interest in effective law enforcement and the fair administration of justice," see id. § 50.10(a), but the regulations do not balance the two interests. They establish instead that, in requesting authorization to subpoena a member of the press, the government should: reasonably believe that, in a criminal case, the information sought is essential "to a successful investigation — particularly with reference to directly establishing guilt or innocence," see id. § 50.10(f)(1); attempt unsuccessfully to obtain the information from "alternative nonmedia sources," see id. § 50.10(f)(3); seek only to verify, "except under exigent circumstances," published information and "such surrounding circumstances as relate to the accuracy of the published information," see id. § 50.10(f)(4); treat "[e]ven" requests for publicly disclosed information "with care to avoid claims of harassment," see id. § 50.10(f)(5); and, "wherever possible," seek material information on a limited subject matter and for a limited time period, avoid requiring the production of large quantities of unpublished material and "give reasonable and timely notice of the demand for documents," see id. § 50.10(f)(6).
9
See In re Williams, 766 F.Supp. 358, 368-70 (W.D.Pa.1991), aff'd by equally divided court, 963 F.2d 567 (3d Cir.1992) (en banc) (order without treatment of merits).
10
Judge Tatel insists that his test is not "novel ..., considering its basis inZerilli and Carey and the Justice Department's own guidelines." See Tatel Op. at 998. But the central factors of his test — the balancing of "the public interest in compelling disclosure, measured by the harm the leak caused, against the public interest in newsgathering, measured by the leaked information's value," Tatel Op. at 997-98 — find no support that I can detect in those cases. See 28 C.F.R. § 50.10; Zerilli, 656 F.2d at 713-714; Carey, 492 F.2d at 636-38.
94
TATEL, Circuit Judge, concurring in the judgment.
95
This case involves a clash between two truth-seeking institutions: the grand jury and the press. On the one hand, the grand jury, a body "deeply rooted in Anglo-American history" and guaranteed by the Fifth Amendment, see United States v. Calandra, 414 U.S. 338, 342-43, 94 S.Ct. 613, 38 L.Ed.2d 561 (1974), holds "broad powers" to collect evidence through judicially enforceable subpoenas. See United States v. Sells Eng'g, Inc., 463 U.S. 418, 423-24, 103 S.Ct. 3133, 77 L.Ed.2d 743 (1983). "Without thorough and effective investigation, the grand jury would be unable either to ferret out crimes deserving of prosecution, or to screen out charges not warranting prosecution." Id. at 424, 103 S.Ct. 3133. On the other hand, the press, shielded by the First Amendment, "has been a mighty catalyst in awakening public interest in governmental affairs, exposing corruption among public officers and employees and generally informing the citizenry of public events and occurrences." Estes v. Texas, 381 U.S. 532, 539, 85 S.Ct. 1628, 14 L.Ed.2d 543 (1965). Using language we have quoted with approval, see Carey v. Hume, 492 F.2d 631, 634-35 (D.C.Cir.1974), the Second Circuit aptly described this conflict between press freedom and the rule of law: "Freedom of the press, hard-won over the centuries by men of courage, is basic to a free society. But basic too are courts of justice, armed with the power to discover truth. The concept that it is the duty of a witness to testify in a court of law has roots fully as deep in our history as does the guarantee of a free press." Garland v. Torre, 259 F.2d 545, 548 (2d Cir.1958).
96
Because I agree that the balance in this case, which involves the alleged exposure of a covert agent, favors compelling the reporters' testimony, I join the judgment of the court. I write separately, however, because I find Branzburg v. Hayes, 408 U.S. 665, 92 S.Ct. 2646, 33 L.Ed.2d 626 (1972), more ambiguous than do my colleagues and because I believe that the consensus of forty-nine states plus the District of Columbia — and even the Department of Justice — would require us to protect reporters' sources as a matter of federal common law were the leak at issue either less harmful or more newsworthy.
I.
97
Although I join the court's rejection of appellants' First Amendment argument, I am uncertain that Branzburg offers "no support" for a constitutional reporter privilege in the grand jury context. See majority op. at 970-71. To be sure, Branzburg upheld the enforcement of subpoenas seeking confidential source information, including notes and testimony about interviews and observations at a militant group's headquarters. See 408 U.S. at 672-77, 92 S.Ct. 2646. Yet even the Branzburg majority declared that "news gathering is not without its First Amendment protections," id. at 707, 92 S.Ct. 2646, a phrase we have interpreted (albeit in dictum) to "indicate[ ] that a qualified privilege would be available in some circumstances even where a reporter is called before a grand jury to testify," Zerilli v. Smith, 656 F.2d 705, 711 (D.C.Cir.1981). Branzburg's caveat, placed in a discussion of "[o]fficial harassment of the press" and "grand jury investigations ... instituted or conducted other than in good faith," Branzburg, 408 U.S. at 707-08, 92 S.Ct. 2646, seems to refer only to journalists' power to quash "unreasonable or oppressive" subpoenas, see Fed.R.Crim.P. 17(c)(2). But given that any witness — journalist or otherwise — may challenge such a subpoena, the majority must have meant, at the very least, that the First Amendment demands a broader notion of "harassment" for journalists than for other witnesses. Reinforcing that view, the majority added, "We do not expect courts will forget that grand juries must operate within the limits of the First Amendment as well as the Fifth." Branzburg, 408 U.S. at 708, 92 S.Ct. 2646. That prediction, too, would appear meaningless if no First Amendment safeguards existed for subpoenaed reporters.
98
Then there is Justice Powell's "enigmatic concurring opinion." Id. at 725, 92 S.Ct. 2686 (Stewart, J., dissenting). Though providing the majority's essential fifth vote, he wrote separately to outline a "case-by-case" approach, see id. at 710, 92 S.Ct. 2686 (Powell, J., concurring), that fits uncomfortably, to say the least, with the majority's categorical rejection of the reporters' claims. Emphasizing "the limited nature of the Court's holding," id. at 709, 92 S.Ct. 2686, he wrote:
99
The asserted claim to privilege should be judged on its facts by the striking of a proper balance between freedom of the press and the obligation of all citizens to give relevant testimony with respect to criminal conduct. The balance of these vital constitutional and societal interests on a case-by-case basis accords with the tried and traditional way of adjudicating such questions.
100
Id. at 710, 92 S.Ct. 2686. "In short," Justice Powell concluded, "the courts will be available to newsmen under circumstances where legitimate First Amendment interests require protection." Id. Even more than the majority opinion, this language places limits on grand jury authority to demand information about source identities — though, again, the precise extent of those limits seems unclear.
101
Given Branzburg's internal confusion and the "obvious First Amendment problems" involved in "[c]ompelling a reporter to disclose the identity of a confidential source," Zerilli, 656 F.2d at 710, it is hardly surprising that lower courts have, as Chief Judge Hogan put it, "chipped away at the holding of Branzburg," finding constitutional protections for reporters in "various factual scenarios different than those presented in Branzburg." In re Special Counsel Investigation, 332 F.Supp.2d 26, 31 (D.D.C.2004). We ourselves have affirmed the denial of a criminal defense subpoena on grounds that the defendant "failed to carry his burden" of "demonstrat[ing] that the reporters' qualified privilege should be overcome." United States v. Ahn, 231 F.3d 26, 37 (D.C.Cir.2000). In civil litigation, moreover, we have held that the First Amendment requires courts to "look to the facts on a case-by-case basis in the course of weighing the need for the testimony in question against the claims of the newsman that the public's right to know is impaired." Carey, 492 F.2d at 636; see also Zerilli, 656 F.2d at 707 (affirming the denial of a motion to compel discovery because "in this case the First Amendment interest in protecting a news reporter's sources outweighs the interest in compelled disclosure"). Other circuits have reached similar conclusions. See, e.g., United States v. LaRouche Campaign, 841 F.2d 1176, 1180-81 (1st Cir.1988) (acknowledging First Amendment limits on criminal defense subpoenas directed at news organizations); United States v. Burke, 700 F.2d 70, 76-77 (2d Cir.1983) (extending a First Amendment reporter privilege developed in civil cases to a criminal defense subpoena); Bruno & Stillman, Inc. v. Globe Newspaper Co., 633 F.2d 583, 593-99 (1st Cir.1980) (describing First Amendment limits on discovery of reporters' sources in civil litigation); Silkwood v. Kerr-McGee Corp., 563 F.2d 433, 436-37 (10th Cir.1977) (indicating that a qualified newsgathering privilege "is no longer in doubt"); but see In re Grand Jury Proceedings, 810 F.2d 580, 584-85 (6th Cir.1987) (rejecting claims of First Amendment privilege in grand jury proceedings).
102
In this case, however, our hands are tied for two independent reasons. First, although this circuit has limited Branzburg in other contexts, see Zerilli, 656 F.2d at 707; Carey, 492 F.2d at 636; Ahn, 231 F.3d at 37, with respect to criminal investigations we have twice construed that decision broadly. In Reporters Committee for Freedom of the Press v. AT & T, 593 F.2d 1030 (D.C.Cir.1978), which addressed a First Amendment challenge regarding access to journalists' phone records and describing Branzburg as foreclosing "case-by-case consideration," we declared, "Good faith investigation interests always override a journalist's interest in protecting his source." Id. at 1049 (emphasis added). Echoing this broad view, we have also described Branzburg as "squarely reject[ing]" a claim to "general immunity, qualified or otherwise, from grand jury questioning." See In re Possible Violations of 18 U.S.C. 371, 641, 1503, 564 F.2d 567, 571 (D.C.Cir.1977). In this circuit, then, absent any indication of bad faith, I see no grounds for a First Amendment challenge to the subpoenas at issue here.
103
Second, although Branzburg involved militants and drug dealers rather than government leakers, the factual parallels between that case and this one preclude us from quashing the subpoenas on constitutional grounds. See majority op. at 969. If, as Branzburg concludes, the First Amendment permits compulsion of reporters' testimony about individuals manufacturing drugs or plotting against the government, see 408 U.S. at 667-69, 675-77, 92 S.Ct. 2646, all information the government could have obtained from an undercover investigation of its own, the case for a constitutional privilege appears weak indeed with respect to leaks, which in all likelihood will be extremely difficult to prove without the reporter's aid. Thus, if Branzburg is to be limited or distinguished in the circumstances of this case, we must leave that task to the Supreme Court.
II.
104
But Branzburg is not the end of the story. In 1975 — three years after Branzburg —Congress enacted Rule 501 of the Federal Rules of Evidence, authorizing federal courts to develop evidentiary privileges in federal question cases according to "the principles of the common law as they may be interpreted ... in the light of reason and experience." Fed.R.Evid. 501; see also Pub.L. No. 93-595, 88 Stat. 1926 (1975). Given Branzburg's instruction that "Congress has freedom to determine whether a statutory newsman's privilege is necessary and desirable and to fashion standards and rules as narrow or broad as deemed necessary to deal with the evil discerned," 408 U.S. at 706, 92 S.Ct. 2646, Rule 501's delegation of congressional authority requires that we look anew at the "necess[ity] and desirab[ility]" of the reporter privilege — though from a common law perspective.
105
Under Rule 501, that common lawmaking obligation exists whether or not, absent the rule's delegation, Congress would be "the more appropriate institution to reconcile the competing interests... that inform any reporter's privilege to withhold relevant information from a bona fide grand jury." Sep. op. at 983-84 (Henderson, J., concurring) (citing Univ. of Pa. v. EEOC, 493 U.S. 182, 189, 110 S.Ct. 577, 107 L.Ed.2d 571 (1990)); but see sep. op. at 978-79 (Sentelle, J., concurring) (observing that even before Rule 501, case law provided federal courts with "precisely the same authority" to recognize common law privileges) (citing Wolfle v. United States, 291 U.S. 7, 12, 54 S.Ct. 279, 78 L.Ed. 617 (1934)); Univ. of Pa., 493 U.S. at 189, 110 S.Ct. 577 (declining to recognize a privilege "where it appears that Congress has considered the relevant competing concerns but has not provided the privilege itself"). As the Supreme Court has explained, "Rule 501 was adopted precisely because Congress wished to leave privilege questions to the courts rather than attempt to codify them." United States v. Weber Aircraft Corp., 465 U.S. 792, 803 n. 25, 104 S.Ct. 1488, 79 L.Ed.2d 814 (1984). Thus, subject of course to congressional override, we must assess the arguments for and against the claimed privilege, just as the Supreme Court has done in cases recognizing common law privileges since 1975. See, e.g., Jaffee v. Redmond, 518 U.S. 1, 15, 116 S.Ct. 1923, 135 L.Ed.2d 337 (1996) (psychotherapist-patient); Upjohn Co. v. United States, 449 U.S. 383, 389, 101 S.Ct. 677, 66 L.Ed.2d 584 (1981) (attorney-client); Trammel v. United States, 445 U.S. 40, 51, 100 S.Ct. 906, 63 L.Ed.2d 186 (1980) (confidential marital communications).
106
In this case, just as Jaffee v. Redmond recognized a common law psychotherapist privilege based on "the uniform judgment of the States," 518 U.S. at 14, 116 S.Ct. 1923, I believe that "reason and experience" dictate a privilege for reporters' confidential sources — albeit a qualified one. Guided by Jaffee's reasoning, I reach this conclusion by considering first whether "reason and experience" justify recognizing a privilege at all, and if so whether the privilege should be qualified or absolute and whether it should cover the communications at issue in this case.
107
Before undertaking that analysis, I think it helpful to explain why, in my view, we should not, as would Judge Henderson, short-circuit Jaffee's framework and decide whether the special counsel may overcome the reporter privilege without ever reaching the issue of whether the privilege in fact exists. See sep. op. at 982 (Henderson, J., concurring). Unless we conclude, as does Judge Sentelle, see sep. op. at 977 (Sentelle, J., concurring), and as did the district court, see In re Special Counsel Investigation, 338 F.Supp.2d 16, 18-19 (D.D.C.2004), that no privilege exists, we cannot resolve this case without adopting some standard. Judge Henderson criticizes my approach, but she never indicates what standard she would apply, except to state that "the Special Counsel's evidentiary proffer overcomes any hurdle, however high, a federal common-law reporter's privilege may erect." See sep. op. at 982 (Henderson, J., concurring). To reach even that conclusion, however, one must explain why federal common law cannot support any higher "hurdle," such as an absolute privilege for source identities, which exists in the District of Columbia and several states, see, e.g., D.C.Code Ann. §§ 16-4702, 16-4703(b); 42 Pa. Cons.Stat. § 5942; Ala.Code § 12-21-142, or a privilege that applies unless non-disclosure "will cause a miscarriage of justice," N.D. Cent.Code § 31-01-06.2; see also Minn.Stat. § 595.024; N.M. Stat. Ann. § 38-6-7. Without ruling out all such plausible alternatives that would allow the reporters to prevail, how could one know that they cannot prevail here? And without selecting some other test based on Jaffee and Rule 501, how could one know that no such alternatives are plausible?
108
Because the Jaffee analysis is thus essential to resolving this case (assuming a privilege exists), our frequent practice of avoiding non-essential issues is inapplicable. To be sure, declining to resolve waived issues, see, e.g., Carney v. Am. Univ., 151 F.3d 1090, 1094-95 (D.C.Cir.1998), disposing of procedurally defective claims without reaching the merits, see, e.g., Jackson v. District of Columbia, 254 F.3d 262, 264, 270-71 (D.C.Cir.2001); cf. Massachusetts v. U.S. Dep't of Transp., 93 F.3d 890, 891 (D.C.Cir.1996) (assuming deferential review because even under that standard agency action was unreasonable), and expressing no view on one element of a claim because another element is clearly defective, see, e.g., Tradesmen Int'l, Inc. v. NLRB, 275 F.3d 1137, 1142 (D.C.Cir.2002); Dir., Office of Thrift Supervision v. Vinson & Elkins, LLP, 124 F.3d 1304, 1308 (D.C.Cir.1997); Littlewolf v. Lujan, 877 F.2d 1058, 1060 (D.C.Cir.1989), may well represent "patience in judicial decision-making," sep. op. at 982 (Henderson, J., concurring). Patience, however, cannot justify "declining ... to define [the disputed privilege's] contours," see id. at 986, for that is the dispositive issue in this case.
109
Accordingly, given that we must apply some test to the government's showing, if we simply assume the privilege exists but our assumption is wrong, then we will have reached out to establish a framework for a non-existent claim — an undertaking hardly consistent with principles of judicial restraint. Indeed, our decision would establish a precedent, potentially binding on future panels, regarding the scope of the assumed privilege, even though resolving that question was entirely unnecessary. Therefore, I think it imperative to decide as a threshold matter whether the privilege exists, turning only afterwards to the privilege's specific contours.
110
In this case, moreover, the issue of the privilege's existence is fully briefed, and resolving it definitively will provide critical guidance in similar situations in the future. This is not the only case to raise reporter privilege issues in D.C. federal courts in recent years. See Lee v. U.S. Dep't of Justice, 327 F.Supp.2d 26 (D.D.C.2004); Lee v. U.S. Dep't of Justice, 287 F.Supp.2d 15 (D.D.C.2003). And given the many leaks that no doubt occur in this city every day, it would be naive to suppose that it will be the last. For the sake of reporters and sources whom such litigation may ensnare, we should take this opportunity to clarify the rules governing their relationship.
111
Thus, I agree with Judge Sentelle that "the question of the existence of such privilege vel non is logically anterior to the quantum of proof necessary to overcome it." Sep. op. at 977 (Sentelle, J., concurring). Without resolving the first question, we cannot and should not decide the second.
Existence of the Privilege
112
Under Jaffee, the common law analysis starts with the interests that call for recognizing a privilege. See 518 U.S. at 11, 116 S.Ct. 1923. If, as the Supreme Court held there, "[t]he mental health of our citizenry is a public good of transcendent importance," id. — one that trumps the "fundamental maxim that the public has a right to every man's evidence," id. at 9, 116 S.Ct. 1923 (internal quotation marks and ellipsis omitted) — then surely press freedom is no less important, given journalism's vital role in our democracy. Indeed, while the Jaffee dissenters questioned psychotherapy's "indispensable role in the maintenance of the citizenry's mental health," see id. at 22, 116 S.Ct. 1923 (Scalia, J., dissenting), the First Amendment's express protection for "freedom ... of the press" forecloses any debate about that institution's "important role in the discussion of public affairs," Mills v. Alabama, 384 U.S. 214, 219, 86 S.Ct. 1434, 16 L.Ed.2d 484 (1966). "Whatever differences may exist about interpretations of the First Amendment, there is practically universal agreement that a major purpose of that Amendment was to protect the free discussion of governmental affairs." Brown v. Hartlage, 456 U.S. 45, 52, 102 S.Ct. 1523, 71 L.Ed.2d 732 (1982) (quoting Mills, 384 U.S. at 218-19, 86 S.Ct. 1434).
113
Like psychotherapists, as well as attorneys and spouses, all of whom enjoy privileges under Rule 501, see, e.g., Jaffee, 518 U.S. at 18, 116 S.Ct. 1923 (psychotherapists); Upjohn Co., 449 U.S. at 389, 101 S.Ct. 677 (attorneys); SEC v. Lavin, 111 F.3d 921, 925 (D.C.Cir.1997) (spouses), reporters "depend[ ] upon an atmosphere of confidence and trust," Jaffee, 518 U.S. at 10, 116 S.Ct. 1923. If litigants and investigators could easily discover journalists' sources, the press's truth-seeking function would be severely impaired. Reporters could reprint government statements, but not ferret out underlying disagreements among officials; they could cover public governmental actions, but would have great difficulty getting potential whistleblowers to talk about government misdeeds; they could report arrest statistics, but not garner first-hand information about the criminal underworld. Such valuable endeavors would be all but impossible, for just as mental patients who fear "embarrassment or disgrace," id., will "surely be chilled" in seeking therapy, id. at 12, 116 S.Ct. 1923, so will sources who fear identification avoid revealing information that could get them in trouble.
114
Because of these chilling effects, "[w]ithout a privilege, much of the desirable evidence to which litigants ... seek access ... is unlikely to come into being." Id. Consequently, as with other privileges, "the likely evidentiary benefit that would result from the denial of the privilege is modest." Id. At the same time, although suppression of some leaks is surely desirable (a point to which I shall return), the public harm that would flow from undermining all source relationships would be immense. For example, appellant Judith Miller tells us that her Pulitzer Prize-winning articles on Osama bin Laden's terrorist network relied on "information received from confidential sources at the highest levels of our government." (Miller Aff. ¶ 10, Appellant's App. at 169.) Likewise, appellant Matthew Cooper maintains that his reports for "Time's four million-plus readers about White House policy in Iraq, the chances of passage of major legislation such as Budget and Energy Bills, and the Clinton White House" would have been impossible without confidentiality. (Cooper Aff. ¶ 21, Appellant's App. at 286.) Insofar as such stories exemplify the press's role "as a constitutionally chosen means for keeping officials elected by the people responsible to all the people whom they were elected to serve," Mills, 384 U.S. at 219, 86 S.Ct. 1434, "reason and experience" support protecting newsgathering methods crucial to their genesis. Acknowledging as much in Zerilli, we emphasized that "[c]ompelling a reporter to disclose the identity of a source may significantly interfere with this news gathering ability" and weaken "a vital source of information," leaving citizens "far less able to make informed political, social, and economic choices." 656 F.2d at 711.
115
It is true, as the special counsel observes, that apart from affidavits and citations to two articles in their reply brief, the reporters present no empirical evidence that denial of the privilege "will have a significant impact on the free flow of information protected by the First Amendment." Appellee's Br. at 47. But the Supreme Court has never required proponents of a privilege to adduce scientific studies demonstrating the privilege's benefits. Rather, as the Jaffee dissenters pointed out, the empirical question — "[h]ow likely is it that a person will be deterred from seeking psychological counseling, or from being completely truthful in the course of such counseling, because of fear of later disclosure in litigation?" — was one "[t]he Court [did] not attempt to answer." 518 U.S. at 22-23, 116 S.Ct. 1923 (Scalia, J., dissenting). Instead, following the wise precept that common sense need not be "the mere handmaiden of social science data or expert testimonials," Amatel v. Reno, 156 F.3d 192, 199 (D.C.Cir.1998), Jaffee relied on the traditional common law process: it examined the logical prerequisites of the confidential relationship, taking into account the policy and experience of parallel jurisdictions. See Jaffee, 518 U.S. at 10, 116 S.Ct. 1923 (reasoning that given the need for "frank and complete disclosure of facts, emotions, memories, and fears" in psychotherapy, "the mere possibility of disclosure may impede development of the confidential relationship necessary for successful treatment").
116
Likewise, in Trammel v. United States, while justifying the privilege against adverse spousal testimony in terms of "marital harmony," 445 U.S. at 44-45, 53, 100 S.Ct. 906, the Court allowed waiver by the testifying spouse based not on divorce statistics or psychological studies, but rather on the commonsense supposition that "[w]hen one spouse is willing to testify against the other in a criminal proceeding — whatever the motivation — their relationship is almost certainly in disrepair," id. at 52, 100 S.Ct. 906. And in Swidler & Berlin v. United States, 524 U.S. 399, 118 S.Ct. 2081, 141 L.Ed.2d 379 (1998), though finding the "empirical information... scant and inconclusive," id. at 410, 118 S.Ct. 2081, the Court held that the attorney-client privilege survives the client's death because "[k]nowing that communications will remain confidential even after death encourages the client to communicate fully and frankly with counsel," id. at 407, 118 S.Ct. 2081 — a proposition the Court supported with neither evidence nor even citation. Given these decisions, the equally commonsense proposition that reporters' sources will be more candid when promised confidentiality requires no empirical support.
117
In any event, the special counsel's confidence that exposing sources will have no effect on newsgathering is unjustified. Citing the "`symbiotic' relationships between journalists and public officials," the special counsel presumes that leaks will go on with or without the privilege. Appellee's Br. at 47 (quoting Branzburg, 408 U.S. at 694, 92 S.Ct. 2646); see also sep. op. at 983 n. 3 (Henderson, J., concurring). Not only does this contradict the Justice Department's own guidelines, which expressly recognize that revealing confidential sources can "impair the news gathering function," 28 C.F.R. § 50.10, but the available evidence suggests the special counsel is wrong. As anyone with even a passing interest in news knows, reporters routinely rely on sources speaking on condition of anonymity — a strong indication that leakers demand such protection. Besides, for all the reasons that lead me to conclude that a privilege exists, reporters and their editors, attorneys, and sources probably believe the same, making it speculative indeed for the special counsel to suppose that dashing that expectation of confidentiality would have no effect on newsgathering.
118
Turning next, as did Jaffee, to the consensus among states, I find support for the privilege at least as strong for journalists as for psychotherapists. Just as in Jaffee, where "the fact that all 50 states and the District of Columbia have enacted into law some form of psychotherapist privilege" favored an exercise of federal common lawmaking, see 518 U.S. at 12, 116 S.Ct. 1923, so here undisputed evidence that forty-nine states plus the District of Columbia offer at least qualified protection to reporters' sources confirms that "`reason and experience' support recognition of the privilege," id. at 13, 116 S.Ct. 1923. Indeed, given these state laws, "[d]enial of the federal privilege ... would frustrate the purposes of the state legislation" by exposing confidences protected under state law to discovery in federal courts. See id.
119
Making the case for a privilege here even stronger than in Jaffee, federal authorities also favor recognizing a privilege for reporters' confidential sources. As noted earlier, we ourselves have limited discovery of reporters' sources in both civil and criminal litigation, see Zerilli, 656 F.2d at 707; Carey, 492 F.2d at 636; Ahn, 231 F.3d at 37, as have other federal courts, see, e.g., Bruno & Stillman, 633 F.2d at 593-99; Burke, 700 F.2d at 76-77; Silkwood, 563 F.2d at 436-37, including some acting on the basis of Rule 501, see, e.g., Riley v. City of Chester, 612 F.2d 708, 715 (3d Cir.1979) (recognizing a qualified common law privilege in civil litigation); but see In re Grand Jury Proceedings, 5 F.3d 397, 398 (9th Cir.1993) (holding that no "scholar's privilege" exists under the First Amendment or common law). In addition, the Justice Department guidelines (though privately unenforceable, for reasons the court explains, see majority op. at 974-76) establish a federal policy of protecting "news media from forms of compulsory process, whether civil or criminal, which might impair the news gathering function." 28 C.F.R. § 50.10. Denial of the privilege, then, would not only buck the clear policy of virtually all states, but would also contradict regulations binding on the federal government's own lawyers.
120
Resisting this consensus, the special counsel asserts that Branzburg already performed the analysis required by Rule 501, thus "resolv[ing] the common law argument." Appellee's Br. at 35; see also sep. op. at 977-78 (Sentelle, J., concurring). Branzburg did no such thing. As the Branzburg majority's very first sentence makes plain, the "issue" in that case was "whether requiring newsmen to appear and testify before state or federal grand juries abridges the freedom of speech and press guaranteed by the First Amendment," 408 U.S. at 667, 92 S.Ct. 2646 (emphasis added), not whether it abridged the common law. Later emphasizing the same point, the majority stated, "Petitioners Branzburg and Pappas and respondent Caldwell press First Amendment claims." Id. at 679, 92 S.Ct. 2646 (emphasis added); see also sep. op. at 978 (Henderson, J., concurring). Indeed, having examined the briefs and lower court opinions, I see no evidence that the parties ever even argued for a separate common law privilege. To be sure, the majority declared that "the great weight of authority is that newsmen are not exempt from the normal duty of appearing before a grand jury and answering questions relevant to a criminal investigation," id. at 685, 92 S.Ct. 2646, but that point served only to reinforce the majority's constitutional holding.
121
Nor does Branzburg support the concurrence's constitutional avoidance theory. See sep. op. at 977 (Sentelle, J., concurring). Although the Branzburg majority could have avoided the First Amendment claim by recognizing a common law privilege, given that the majority opinion neither did so nor even raised that possibility, Branzburg's holding hardly forecloses the common law argument presented here. Quite the contrary, Branzburg acknowledged that "Congress has freedom to determine whether a statutory newsman's privilege is necessary and desirable and to fashion standards and rules as narrow or broad as deemed necessary to deal with the evil discerned," 408 U.S. at 706, 92 S.Ct. 2646, a power Congress delegated to the federal courts through Rule 501. Thus, if anything, the view that Branzburg disposed of the common law privilege gets it backwards. Insofar as Branzburg relied on the "great weight of authority" to discern the First Amendment's meaning, see id. at 686, 92 S.Ct. 2646, the shift in favor of the privilege since that time — from seventeen states with statutory privileges then to thirty-one plus D.C. today, with another eighteen providing common law protection — could provide a basis for rethinking Branzburg. Cf. Atkins v. Virginia, 536 U.S. 304, 306-07, 122 S.Ct. 2242, 153 L.Ed.2d 335 (2002) (overturning prior understanding of Eighth Amendment "cruel and unusual punishment" based on a "consensus" among "the American public, legislators, scholars, and judges" regarding execution of the mentally retarded). Although that is something only the Supreme Court can do, this point underscores the error in seeing Branzburg as dispositive.
122
Given that the common law issue thus remains open, this court must assess the reporters' claim in light of "reason and experience" today. As Branzburg itself observes in describing Congress's powers, privilege rules may require "refashion[ing]... as experience from time to time may dictate." 408 U.S. at 706, 92 S.Ct. 2646. Bestowing that refashioning power on the federal courts, Rule 501 evidences an "affirmative intention not to freeze the law of privilege," but rather "to leave the door open to change." Trammel, 445 U.S. at 47, 100 S.Ct. 906. Consistent with that intent, the Court in Trammel modified the privilege against adverse spousal testimony recognized just twenty-two years earlier in Hawkins v. United States, 358 U.S. 74, 79 S.Ct. 136, 3 L.Ed.2d 125 (1958), allowing the testifying spouse to waive the privilege, see Trammel, 445 U.S. at 53, 100 S.Ct. 906, even though Hawkins had held just the opposite, see Hawkins, 358 U.S. at 77-78, 79 S.Ct. 136. Had the Supreme Court addressed a common law claim in Branzburg, lower courts might lack authority to reconsider that case's result notwithstanding the subsequent growth in support for the privilege. But cf. Trammel, 445 U.S. at 43, 100 S.Ct. 906 (affirming court of appeals decision limiting Hawkins). Absent such a definitive ruling, however, and despite Branzburg's observation about the "great weight of authority" thirty-three years ago, see 408 U.S. at 686, 92 S.Ct. 2646, we must approach the issue with the same open-mindedness demonstrated by Trammel.
123
For much the same reason, the omission of a reporter privilege from the Judicial Conference Advisory Committee's draft rules submitted to Congress in 1972 (and ultimately replaced by Rule 501) need not dictate the outcome here. True, as the special counsel points out, the Supreme Court in United States v. Gillock, 445 U.S. 360, 367-68, 100 S.Ct. 1185, 63 L.Ed.2d 454 (1980), declined to recognize a privilege not appearing in the Advisory Committee draft. As that decision acknowledges, however, the draft rules merely reflected what was "thought to be ... indelibly ensconced in our common law" at the time. See id. Accordingly, when the Jaffee Court considered whether the psychotherapist privilege extended to social workers, it relied not on the 1972 draft, which covered only licensed psychotherapists, but rather on the reasons for the privilege and the state laws in effect when Jaffee was decided. See Jaffee, 518 U.S. at 15-17 & n. 16, 116 S.Ct. 1923. Likewise, here, the dramatic growth in support for the reporter privilege supercedes the Advisory Committee's decades-old choice to omit the privilege from its draft.
124
Equally inconsequential is the adoption of the reporter privilege in thirty-one states through legislation, rather than judicial action. See sep. op. at 978-79 (Sentelle, J., concurring). As the Jaffee dissent pointed out, a far greater proportion of states — indeed, every state — established the psychotherapist privilege by statute, see Jaffee, 518 U.S. at 25-26, 116 S.Ct. 1923 (Scalia, J., dissenting), yet the majority considered that fact "of no consequence," id. at 13-14, 116 S.Ct. 1923. Nor does it matter that unconventional forms of journalism — freelance writers and internet "bloggers," for example — may raise definitional conundrums down the road. See sep. op. at 978-81 (Sentelle, J., concurring); but see Eugene Volokh, Opinion, You Can Blog, But You Can't Hide, N.Y. Times, Dec. 2, 2004, at A39 ("[T]he rules should be the same for old media and new, professional and amateur. Any journalist's privilege should extend to every journalist."). As Jaffee makes clear, "[a] rule," such as Rule 501, "that authorizes the recognition of new privileges on a case-by-case basis makes it appropriate to define the details of new privileges in a like manner." 518 U.S. at 18, 116 S.Ct. 1923. After all, "flexibility and capacity for growth and adaptation is the peculiar boast and excellence of the common law." Hurtado v. California, 110 U.S. 516, 530, 4 S.Ct. 111, 28 L.Ed. 232 (1884). Here, whereas any meaningful reporter privilege must undoubtedly encompass appellants Cooper and Miller, full-time journalists for Time magazine and the New York Times, respectively, future opinions can elaborate more refined contours of the privilege — a task shown to be manageable by the experience of the fifty jurisdictions with statutory or common law protections.
125
In sum, "reason and experience," as evidenced by the laws of forty-nine states and the District of Columbia, as well as federal courts and the federal government, support recognition of a privilege for reporters' confidential sources. To disregard this modern consensus in favor of decades-old views, as the special counsel urges, would not only imperil vital newsgathering, but also shirk the common law function assigned by Rule 501 and "freeze the law of privilege" contrary to Congress's wishes, see Trammel, 445 U.S. at 47, 100 S.Ct. 906.
Scope of the Privilege
126
The next step, according to Jaffee, is to determine what principles govern the privilege's application in this case. See Jaffee, 518 U.S. at 15-16, 116 S.Ct. 1923 (deciding first that a psychotherapist privilege exists and only then addressing whether the privilege applies to social workers). Pointing out that many jurisdictions recognize only qualified protection for reporters, the special counsel argues that the uniform judgment of states must support application of the privilege in the precise context at issue — defiance of grand jury subpoenas — before federal courts may recognize it. That view, however, belonged to the Jaffee dissent, not the seven-justice majority. Although the dissenters noted an "enormous degree of disagreement among the States as to the scope of the privilege," 518 U.S. at 33, 116 S.Ct. 1923 (Scalia, J., dissenting), particularly as to which professions it covered, see id. at 27, 116 S.Ct. 1923 (Scalia, J., dissenting), the Court extended the privilege to licensed social workers because "[t]he reasons for recognizing a privilege for treatment by psychiatrists and psychologists apply with equal force to treatment by a clinical social worker," id. at 16-17, 116 S.Ct. 1923. Likewise, Jaffee rejected a proposed balancing test not because other jurisdictions had done so, but because "[m]aking the promise of confidentiality contingent upon a trial judge's later evaluation of the relative importance of the patient's interest in privacy and the evidentiary need for disclosure would eviscerate the effectiveness of the privilege." See id. at 17-18, 116 S.Ct. 1923.
127
Here, even assuming that some jurisdictions categorically exclude grand jury subpoenas — a proposition for which the special counsel cites no authority — the interests protected by the privilege militate against such a limited approach. Although the public interest in law enforcement may well be at its apex when the government is investigating crime, news stories of paramount First Amendment importance, such as reports about government corruption or wrongdoing, may involve sources who "would surely be chilled," Jaffee, 518 U.S. at 12, 116 S.Ct. 1923, if they thought grand juries could discover their identities from reporters in whom they confide. Furthermore, the special counsel's proposal is quite anomalous, considering that neither the attorney-client, nor the spousal, nor even the psychotherapist privilege gives way to the grand jury's truth-seeking function. See, e.g., Swidler & Berlin, 524 U.S. at 403, 118 S.Ct. 2081 (attorney-client); Blau v. United States, 340 U.S. 332, 333, 71 S.Ct. 301, 95 L.Ed. 306 (1951) (spousal); In re Grand Jury Proceedings (Gregory P. Violette), 183 F.3d 71, 72 (1st Cir.1999) (allowing grand jury testimony not because no psychotherapist privilege exists in that context, but rather because a "crime-fraud exception" applies to the privilege).
128
As to the scope of the privilege, however, I agree with the special counsel that protection for source identities cannot be absolute. Leaks similar to the crime suspected here (exposure of a covert agent) apparently caused the deaths of several CIA operatives in the late 1970s and early 1980s, including the agency's Athens station chief. See Haig v. Agee, 453 U.S. 280, 284-85 & n. 7, 101 S.Ct. 2766, 69 L.Ed.2d 640 (1981). Other leaks — the design for a top secret nuclear weapon, for example, or plans for an imminent military strike — could be even more damaging, causing harm far in excess of their news value. In such cases, the reporter privilege must give way. Just as attorney-client communications "made for the purpose of getting advice for the commission of a fraud or crime" serve no public interest and receive no privilege, see United States v. Zolin, 491 U.S. 554, 563, 109 S.Ct. 2619, 105 L.Ed.2d 469 (1989) (internal quotation marks omitted), neither should courts protect sources whose leaks harm national security while providing minimal benefit to public debate.
129
Of course, in some cases a leak's value may far exceed its harm, thus calling into question the law enforcement rationale for disrupting reporter-source relationships. For example, assuming Miller's prize-winning Osama bin Laden series caused no significant harm, I find it difficult to see how one could justify compelling her to disclose her sources, given the obvious benefit of alerting the public to then-underappreciated threats from al Qaeda. News reports about a recent budget controversy regarding a super-secret satellite program inspire another example (though I know nothing about the dispute's details and express no view as to its merits). See, e.g., Dan Eggen & Walter Pincus, Justice Reviews Request for Probe of Satellite Reports, Wash. Post, Dec. 16, 2004, at A3; Douglas Jehl, New Spy Plan Said to Involve Satellite System, N.Y. Times, Dec. 12, 2004, at A1. Despite the necessary secrecy of intelligence-gathering methods, it seems hard to imagine how the harm in leaking generic descriptions of such a program could outweigh the benefit of informing the public about billions of dollars wasted on technology considered duplicative and unnecessary by leading Senators from both parties. In contrast to the nuclear weapon and military strike examples mentioned above, cases like these appear to involve a balance of harm and news value that strongly favors protecting newsgathering methods.
130
Given these contrasting examples, much as our civil cases balance "the public interest in protecting the reporter's sources against the private interest in compelling disclosure," Zerilli, 656 F.2d at 712; see also Carey, 492 F.2d at 634-36, so must the reporter privilege account for the varying interests at stake in different source relationships. In other words, to quote the Justice Department subpoena guidelines, "the approach in every case must be to strike the proper balance between the public's interest in the free dissemination of ideas and information and the public's interest in effective law enforcement and the fair administration of justice." 28 C.F.R. § 50.10(a).
131
Citing our reporter privilege cases — Zerilli, Carey, and Ahn — the special counsel urges us to rely on two factors deemed "central" in those decisions and emphasized in the Justice Department guidelines: first, the requesting party's need for the evidence, and second, that party's exhaustion of alternative sources. See Zerilli, 656 F.2d at 712-14; Ahn, 231 F.3d at 37; Carey, 492 F.2d at 636-37, 638; 28 C.F.R. § 50.10(b), (f)(1). While both these considerations are obviously essential to minimizing the burden on newsgathering, they can serve as exclusive measures in the privilege analysis only where there exist means of proof other than compelling the reporter's testimony. When prosecuting crimes other than leaks (murder or embezzlement, say) the government, at least theoretically, can learn what reporters know by replicating their investigative efforts, e.g., speaking to the same witnesses and examining the same documents. Accordingly, if a truly exhaustive investigation has failed to prove a crime that the government reasonably believes has occurred, compelled disclosure of a reporter's source may be justified notwithstanding the attendant burdens on newsgathering. As the special counsel acknowledged at oral argument, however, when the government seeks to punish a leak, a test focused on need and exhaustion will almost always be satisfied, leaving the reporter's source unprotected regardless of the information's importance to the public. The reason for this is obvious: Insofar as the confidential exchange of information leaves neither paper trail nor smoking gun, the great majority of leaks will likely be unprovable without evidence from either leaker or leakee. Of course, in some cases, circumstantial evidence such as telephone records may point towards the source, but for the party with the burden of proof, particularly the government in a criminal case, such evidence will often be inadequate.
132
In leak cases, then, courts applying the privilege must consider not only the government's need for the information and exhaustion of alternative sources, but also the two competing public interests lying at the heart of the balancing test. Specifically, the court must weigh the public interest in compelling disclosure, measured by the harm the leak caused, against the public interest in newsgathering, measured by the leaked information's value. That framework allows authorities seeking to punish a leak to access key evidence when the leaked information does more harm than good, such as in the nuclear weapon and military strike examples, while preventing discovery when no public interest supports it, as would appear to be the case with Miller's Osama bin Laden articles. Though flexible, these standards (contrary to the special counsel's claim) are hardly unmanageable. Indeed, the Supreme Court employs a similar requirement of "legitimate news interest," meaning "value and concern to the public at the time of publication," in assessing restrictions on government employee speech. See City of San Diego v. Roe, ___ U.S. ___, 125 S.Ct. 521, 526, 160 L.Ed.2d410 (2004) (per curiam). Nor is this analysis "novel," see sep. op. at 983 (Henderson, J., concurring), considering its basis in Zerilli and Carey and the Justice Department's own guidelines.
133
Though recognizing that leaks with "national security implications" raise different concerns from "information in the nature of `whistleblowing,'" Appellee's Br. at 44, 48, the special counsel insists that the prosecutor, not the court, should assess factors other than need and exhaustion. Under this theory, balancing the two remaining concerns, the harmfulness of the leaked information and the damage to newsgathering that might flow from enforcing the disputed subpoenas, would be a matter of prosecutorial discretion. In my view, the special counsel's position distorts the roles of judge and prosecutor in evidentiary disputes.
134
Although courts certainly defer to executive judgments about which crimes merit prosecution — a judgment that is, after all, a "core executive constitutional function," United States v. Armstrong, 517 U.S. 456, 465, 116 S.Ct. 1480, 134 L.Ed.2d 687 (1996) — nonetheless the executive branch possesses no special expertise that would justify judicial deference to prosecutors' judgments about the relative magnitude of First Amendment interests. Assessing those interests traditionally falls within the competence of courts. Cf. Landmark Communications, Inc. v. Virginia, 435 U.S. 829, 843, 98 S.Ct. 1535, 56 L.Ed.2d 1 (1978) ("Deference to a legislative finding cannot limit judicial inquiry when First Amendment rights are at stake."). Indeed, while the criminality of a leak and the government's decision to press charges might well indicate the leak's harmfulness — a central concern of the balancing test — once prosecutors commit to pursuing a case they naturally seek all useful evidence. Consistent with that adversarial role, the Federal Rules of Evidence assign to courts the function of neutral arbiter: "Preliminary questions concerning the qualification of a person to be a witness, the existence of a privilege, or the admissibility of evidence shall be determined by the court." Fed.R.Evid. 104(a) (emphasis added). Accordingly, just as courts determine the admissibility of hearsay or the balance between probative value and unfair prejudice under Rule 403, so with respect to this issue must courts weigh factors bearing on the privilege.
135
Moreover, in addition to these principles applicable to the judicial role in any evidentiary dispute, the dynamics of leak inquiries afford a particularly compelling reason for judicial scrutiny of prosecutorial judgments regarding a leak's harm and news value. Because leak cases typically require the government to investigate itself, if leaks reveal mistakes that high-level officials would have preferred to keep secret, the administration may pursue the source with excessive zeal, regardless of the leaked information's public value. Of course, in this case a special counsel was appointed to exercise independent judgment. Yet independent prosecutors, too, may skew their assessments of the public interests implicated when a reporter is subpoenaed. After all, special prosecutors, immune to political control and lacking a docket of other cases, face pressure to justify their appointments by bagging their prey. Cf. Morrison v. Olson, 487 U.S. 654, 727-28, 108 S.Ct. 2597, 101 L.Ed.2d 569 (1988) (Scalia, J., dissenting) (noting "the vast power and the immense discretion that are placed in the hands of a prosecutor with respect to the objects of his investigation" and observing that "the primary check against prosecutorial abuse is a political one"). To be clear: I do not impugn the motives of this special counsel. Indeed, as I conclude below, his pursuit of the reporters' testimony appears reasonable. Nevertheless, these considerations — the special counsel's political independence, his lack of a docket, and the concomitant risk of overzealousness — weigh against his claim to deference in balancing harm against news value.
136
Paralleling the special counsel's argument about executive discretion, my concurring colleague suggests that my approach pays insufficient deference to Congress. See sep. op. at 986 (Henderson, J., concurring). "Branzburg," she writes, "warns of the risk inherent in the judicial assessment of the importance of prosecuting particular crimes." See id. Although it is true that Branzburg cautioned against second-guessing the "legislative judgment ... of what conduct is liable to criminal prosecution," 408 U.S. at 706, 92 S.Ct. 2646, it did so in a passage rejecting a test of governmental need that apparently "distinguish[ed] between the value of enforcing different criminal laws," deeming some statutes "compelling" and others unimportant. See id. at 702, 705-06, 92 S.Ct. 2646. The approach I propose entails no such judgment about the value of the statute under which the government is proceeding. Rather, my approach focuses on whether evidence the government believes it needs, i.e., a reporter's testimony about a particular source, is privileged. To be sure, insofar as the reporter's testimony is critical in a particular case, privileging the evidence may render that case unprovable. But that risk accompanies any privilege or indeed any rule of evidentiary exclusion. Had Congress believed that judicial decisions excluding evidence interfered with its "legislative judgment" regarding underlying crimes, it would hardly have authorized recognition of common law privileges by enacting Rule 501.
137
Furthermore, and perhaps even more important, Branzburg addressed only a First Amendment privilege claim. See supra at 993-94. In that case, therefore, because Congress cannot overturn constitutionally based decisions, recognizing the asserted privilege would have permanently foreclosed punishment of any crimes dependent on proof subject to the privilege. The qualified privilege I would recognize, however, rests on Rule 501, not the Constitution. If Congress believes that this approach overrides its judgment about what conduct should be criminal, it may simply overturn the privilege and authorize use of the evidence.
138
Next, the special counsel argues that waivers signed by suspected sources represent an "additional factor" favoring compulsion of the reporters' testimony. Appellee's Br. at 46. As the reporters point out, however, numerous cases (including persuasive district court decisions from this circuit) indicate that only reporters, not sources, may waive the privilege. See, e.g., United States v. Cuthbertson, 630 F.2d 139, 147 (3d Cir.1980); Palandjian v. Pahlavi, 103 F.R.D. 410, 413 (D.D.C.1984); Anderson v. Nixon, 444 F.Supp. 1195, 1198-99 (D.D.C.1978). For the contrary proposition, the special counsel cites McKevitt v. Pallasch, 339 F.3d 530 (7th Cir.2003), but that case involved a criminal defendant's effort to obtain non-confidential records from the biographers of a government witness, not waiver of confidentiality by a previously unidentified source. See id. at 531, 533-34. Nor does Hutira v. Islamic Republic of Iran, 211 F.Supp.2d 115 (D.D.C.2002), help the special counsel. While that decision indicated that "`the absence of confidentiality may be considered in the balance of competing interests as a factor that diminishes the journalist's, and the public's, interest in non-disclosure,'" id. at 120 (quoting Shoen v. Shoen, 5 F.3d 1289, 1295 (9th Cir.1993)), it quashed the subpoena at issue, reasoning that "the privilege for journalists shields both confidential and nonconfidential information from compelled disclosure," id.
139
As this case law recognizes, a source's waiver is irrelevant to the reasons for the privilege. Because the government could demand waivers — perhaps even before any leak occurs — as a condition of employment, a privilege subject to waiver may, again, amount to no privilege at all, even in those leak cases where protecting the confidential source is most compelling. Moreover, although the attorney-client and psychotherapist privileges are waivable by clients and patients, respectively, see, e.g., In re Sealed Case, 877 F.2d 976, 980 (D.C.Cir.1989) (attorney-client); Jaffee, 518 U.S. at 15 n. 14, 116 S.Ct. 1923 (psychotherapist), that is because those privileges exist to prevent disclosure of sensitive matters related to legal and psychological counseling, see, e.g., Swidler & Berlin, 524 U.S. at 407-08, 118 S.Ct. 2081; Jaffee, 518 U.S. at 10-11, 116 S.Ct. 1923, a rationale that vanishes when the source authorizes disclosure. In contrast, the reporter privilege safeguards public dissemination of information — the reporter's enterprise, not the source's.
140
Consistent with that purpose, the privilege belongs to the reporter. Not only are journalists best able to judge the imperatives of newsgathering, but while the source's interest is limited to the particular case, the reporter's interest aligns with the public, for journalists must cultivate relationships with other sources who might keep mum if waiving confidentiality at the government's behest could lead to their exposure. Indeed, as compared to counseling-related privileges, the privilege against spousal testimony represents a better analogy. Just as under Trammel's waiver theory testifying spouses, regardless of the other spouse's wishes, may judge for themselves whether their testimony will undermine "marital harmony," see Trammel, 445 U.S. at 44-45, 52-53, 100 S.Ct. 906, so should journalists — the experts in newsgathering — base the decision to testify on their own assessment of the consequences, unconstrained by their source's waiver (provided other requirements of the privilege are met).
141
For their part, appellants insist that a qualified privilege fails to provide the certainty their work requires because sources are unlikely to disclose information without an advance guarantee of secrecy. In particular, they argue that journalists cannot balance a leak's harm against its news value until they know what information the source will reveal, by which time it is too late to prevent disclosure. True enough, but journalists are not the ones who must perform the balancing; sources are. Indeed, the point of the qualified privilege is to create disincentives for the source — disincentives that not only promote the public interest, but may also protect journalists from exploitation by government officials seeking publication of damaging secrets for partisan advantage. Like other recipients of potentially privileged communications — say, attorneys or psychotherapists — the reporter can at most alert the source to the limits of confidentiality, leaving the judgment of what to say to the source. While the resulting deterrent effect may cost the press some leads, little harm will result, for if the disincentives work as they should, the information sources refrain from revealing will lack significant news value in the first place.
142
In any event, although Jaffee said that "[m]aking the promise of confidentiality contingent upon a trial judge's later evaluation ... [will] eviscerate the effectiveness of the privilege," 518 U.S. at 17, 116 S.Ct. 1923, the clash of fundamental interests at stake when the government seeks discovery of a reporter's sources precludes a categorical approach. See Zerilli, 656 F.2d at 712 n. 46 (rejecting arguments for greater "specificity" as to the scope of the First Amendment privilege in civil litigation). And as we explained in Zerilli, the "deterrence effect" on beneficial newsgathering will be small if courts make clear that the privilege is "overridden only in rare circumstances." See id. at 712 & n. 46.
143
In short, the question in this case is whether Miller's and Cooper's sources released information more harmful than newsworthy. If so, then the public interest in punishing the wrongdoers — and deterring future leaks — outweighs any burden on newsgathering, and no privilege covers the communication (provided, of course, that the special counsel demonstrates necessity and exhaustion of alternative evidentiary sources).
III.
144
Applying this standard to the facts of this case, and considering first only the public record, I have no doubt that the leak at issue was a serious matter. Authorized "to investigate and prosecute violations of any federal criminal laws related to the underlying alleged unauthorized disclosure, as well as federal crimes committed in the course of, and with intent to interfere with, [his] investigation, such as perjury, obstruction of justice, destruction of evidence, and intimidation of witnesses," see Letter from James B. Comey, Acting Attorney General, to Patrick J. Fitzgerald, United States Attorney, Northern District of Illinois (Feb. 6, 2004), the special counsel is attempting to discover the origins of press reports describing Valerie Plame as a CIA operative monitoring weapons of mass destruction. See majority op. at 966-67. These reports appeared after Plame's husband, former Ambassador Joseph Wilson, wrote in a New York Times op-ed column that his findings on an official mission to Niger in 2002 cast doubt on President Bush's assertion in his January 2003 State of the Union address that Iraq "recently sought significant quantities of uranium from Africa." See id. at 966.
145
An alleged covert agent, Plame evidently traveled overseas on clandestine missions beginning nearly two decades ago. See, e.g., Richard Leiby & Dana Priest, The Spy Next Door; Valerie Wilson, Ideal Mom, Was Also the Ideal Cover, Wash. Post, Oct. 8, 2003, at A1. Her exposure, therefore, not only may have jeopardized any covert activities of her own, but also may have endangered friends and associates from whom she might have gathered information in the past. Acting to criminalize such exposure of secret agents, see 50 U.S.C. § 421, Congress has identified that behavior's "intolerable" consequences: "[t]he loss of vital human intelligence which our policymakers need, the great cost to the American taxpayer of replacing intelligence resources lost due to such disclosures, and the greatly increased risk of harm which continuing disclosures force intelligence officers and sources to endure." S.Rep. No. 97-201, at 10-11 (1981), reprinted in 1982 U.S.C.C.A.N. 145, 154-55.
146
The leak of Plame's apparent employment, moreover, had marginal news value. To be sure, insofar as Plame's CIA relationship may have helped explain her husband's selection for the Niger trip, that information could bear on her husband's credibility and thus contribute to public debate over the president's "sixteen words." Compared to the damage of undermining covert intelligence-gathering, however, this slight news value cannot, in my view, justify privileging the leaker's identity.
147
Turning now to the classified material, I agree with the special counsel that ex parte review presents no due process difficulty. To be sure, grand jury secrecy is not absolute. As Rule 6(e) itself provides, courts may "authorize disclosure ... of a grand jury matter ... preliminarily to or in connection with a judicial proceeding." Fed.R.Crim.P. 6(e)(3)(E). In addition, as the reporters point out, even apart from United States v. Dinsio, 468 F.2d 1392 (9th Cir.1972), now superceded by United States v. Mara, 410 U.S. 19, 93 S.Ct. 774, 35 L.Ed.2d 99 (1973), see majority op. at 974 (citing In re Braughton, 520 F.2d 765, 767 (9th Cir.1975)), the Second and Ninth Circuits have held that due process requires an "uninhibited adversary hearing" in civil contempt proceedings, see United States v. Alter, 482 F.2d 1016, 1024 (9th Cir.1973) (internal quotation marks omitted); In the Matter of Kitchen, 706 F.2d 1266, 1272 (2d Cir.1983) (internal quotation marks omitted), including "the right to confront all the government's evidence, both documentary and testimonial, unless particular and compelling reasons peculiar to the grand jury function require some curtailment of [that] right," Kitchen, 706 F.2d at 1272.
148
In this circuit, however, we have approved the use of "in camera, ex parte proceedings to determine the propriety of a grand jury subpoena or the existence of a crime-fraud exception to the attorney-client privilege when such proceedings are necessary to ensure the secrecy of ongoing grand jury proceedings." In re Sealed Case No. 98-3077, 151 F.3d 1059, 1075 (D.C.Cir.1998) (per curiam). Just as due process poses no barrier to forcing an attorney to testify based on the court's examination of evidence, unseen by the lawyer, that the client sought legal advice in pursuit of a crime, neither does it preclude compulsion of a reporter's testimony based on a comparable review of evidence, likewise unseen by the reporter, that a source engaged in a harmful leak. In fact, appellants' protests notwithstanding, ex parte review protects their interests, as it allows the government to present — and the court to demand — a far more extensive showing than would otherwise be possible given the need for grand jury secrecy discussed in the court's opinion, see majority op. at 973-74.
149
That said, without benefit of the adversarial process, we must take care to ensure that the special counsel has met his burden of demonstrating that the information is both critical and unobtainable from any other source. Having carefully scrutinized his voluminous classified filings, I believe that he has.
150
With respect to Miller, * * * * * [REDACTED] * * * * *
151
Regarding Cooper, * * * * * [REDACTED] * * * * *
152
In sum, based on an exhaustive investigation, the special counsel has established the need for Miller's and Cooper's testimony. Thus, considering the gravity of the suspected crime and the low value of the leaked information, no privilege bars the subpoenas.
153
One last point. In concluding that no privilege applies in this case, I have assigned no importance to the fact that neither Cooper nor Miller, perhaps recognizing the irresponsible (and quite possibly illegal) nature of the leaks at issue, revealed Plame's employment, though Cooper wrote about it after Novak's column appeared. Contrary to the reporters' view, this apparent self-restraint spares Miller and Cooper no obligation to testify. Narrowly drawn limitations on the public's right to evidence, testimonial privileges apply "only where necessary to achieve [their] purpose," Fisher v. United States, 425 U.S. 391, 403, 96 S.Ct. 1569, 48 L.Ed.2d 39 (1976), and in this case the privilege's purpose is to promote dissemination of useful information. It thus makes no difference how these reporters responded to the information they received, any more than it matters whether an attorney drops a client who seeks criminal advice (communication subject to the crime-fraud exception) or a psychotherapist seeks to dissuade homicidal plans revealed during counseling (information Jaffee suggested would not be privileged, see 518 U.S. at 18 n. 19, 116 S.Ct. 1923). In all such cases, because the communication is unworthy of protection, recipients' reactions are irrelevant to whether their testimony may be compelled in an investigation of the source.
154
Indeed, Cooper's own Time.com article illustrates this point. True, his story revealed a suspicious confluence of leaks, contributing to the outcry that led to this investigation. Yet the article had that effect precisely because the leaked information — Plame's covert status — lacked significant news value. In essence, seeking protection for sources whose nefariousness he himself exposed, Cooper asks us to protect criminal leaks so that he can write about the crime. The greater public interest lies in preventing the leak to begin with. Had Cooper based his report on leaks about the leaks — say, from a whistleblower who revealed the plot against Wilson — the situation would be different. Because in that case the source would not have revealed the name of a covert agent, but instead revealed the fact that others had done so, the balance of news value and harm would shift in favor of protecting the whistleblower. Yet it appears Cooper relied on the Plame leaks themselves, drawing the inference of sinister motive on his own. Accordingly, his story itself makes the case for punishing the leakers. While requiring Cooper to testify may discourage future leaks, discouraging leaks of this kind is precisely what the public interest requires.
IV.
155
I conclude, as I began, with the tensions at work in this case. Here, two reporters and a news magazine, informants to the public, seek to keep a grand jury uninformed. Representing two equally fundamental principles — rule of law and free speech — the special counsel and the reporters both aim to facilitate fully informed and accurate decision-making by those they serve: the grand jury and the electorate. To this court falls the task of balancing the two sides' concerns.
156
As James Madison explained, "[A] people who mean to be their own Governors must arm themselves with the power which knowledge gives." See In re Lindsey, 148 F.3d 1100, 1109 (D.C.Cir.1998) (quoting Letter from James Madison to W.T. Barry (Aug. 4, 1822), in 9 The Writings of James Madison 103 (Gaillard Hunt ed., 1910)). Consistent with that maxim, "[a] free press is indispensable to the workings of our democratic society," Associated Press v. United States, 326 U.S. 1, 28, 65 S.Ct. 1416, 89 L.Ed. 2013 (1945) (Frankfurter, J., concurring), and because confidential sources are essential to the workings of the press — a practical reality that virtually all states and the federal government now acknowledge — I believe that "reason and experience" compel recognition of a privilege for reporters' sources. That said, because "[l]iberty can only be exercised in a system of law which safeguards order," Cox v. Louisiana, 379 U.S. 559, 574, 85 S.Ct. 476, 13 L.Ed.2d 487 (1965), the privilege must give way to imperatives of law enforcement in exceptional cases.
157
Were the leak at issue in this case less harmful to national security or more vital to public debate, or had the special counsel failed to demonstrate the grand jury's need for the reporters' evidence, I might have supported the motion to quash. Because identifying appellants' sources instead appears essential to remedying a serious breach of public trust, I join in affirming the district court's orders compelling their testimony.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Xcode - compiling .tcc files
We are taking over a legacy project and I cannot get it to compile, the .TCC files from a taglib toolkit are throwing all kinds of exceptions. I am using C++98 and libstdc as that fixed a bunch of issues on other projects they gave us. I've set the file to be a C++ source file in xcode, it had it as plain text in the properties so I changed it. I'm guessing the file type is somehow throwing off Xcode or there are some changes I need to make but do not know what, any ideas?
some errors include:
/src/ofxSoundTagReader/libs/taglib/toolkit/tlist.tcc:78:9: Delete called on 'const TagLib::FileRef::FileTypeResolver' that is abstract but has non-virtual destructor
/src/ofxSoundTagReader/libs/taglib/toolkit/tlist.tcc:41:32: Expected class name
/src/ofxSoundTagReader/libs/taglib/toolkit/tlist.tcc:51:27: Explicit specialization of non-template class 'List'
/src/ofxSoundTagReader/libs/taglib/toolkit/tlist.tcc:51:36: Definition or redeclaration of 'ListPrivate' cannot name the global scope
/src/ofxSoundTagReader/libs/taglib/toolkit/tlist.tcc:50:1: Extraneous template parameter list in template specialization or out-of-line template definition
/src/ofxSoundTagReader/libs/taglib/toolkit/tlist.tcc:51:36: Variable 'ListPrivate' declared as a template
A:
"tlist.tcc" contains the implementation of the template class defined in "tlist.h", and you're not supposed to compile it separately.
It's #included at the end of "tlist.h", which only contains the class definition.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Mutual funds and exchange-traded funds benchmarked to the Bloomberg Barclays Aggregate U.S. Bond Index lost about $17.7 billion in value last week, according to a MarketWatch analysis of data provided by Morningstar.
As of a week ago Friday, the roughly 1,700 exchange-traded and mutual funds benchmarked to the index collectively managed about $1.2 trillion. By the close of trading on Thursday, the Bloomberg index registered a total return of minus 1.487 percentage points. Funds benchmarked to an index are supposed to reflect its holdings as accurately as possible, but occasionally there are slight discrepancies.
Because many mutual funds report their holdings only once a month, the total AUM figure used as the basis for these calculations doesn’t reflect changes in valuation due to market movements between Oct. 31 and Nov. 4. It also doesn’t reflect changes due to investor withdrawals between Oct. 31 and Thursday.
The index, which is weighted by market capitalization, comprises a broad range of U.S. dollar-denominated bonds, including Treasurys, asset-backed securities and corporate debt. Only fully taxable bond issues are eligible, which excludes most municipal bonds and inflation-linked government bonds.
Republican President-elect Donald Trump’s unexpected victory over Democrat Hillary Clinton in Tuesday’s election triggered an explosive bond-market selloff—the biggest since the “taper tantrum,” which occurred in the summer of 2013.
Former Federal Reserve Chairman Ben Bernanke unwittingly sparked the taper tantrum when he told Congress that the Fed would “gradually reduce the flow of [bond] purchases” as the U.S. economic outlook improves. The comment led to a prolonged selloff that saw the 10-year yield rise from about 1.6% to nearly 3% between late May and early September 2013.
Many, including a team of macro strategists at Bank of America Merrill Lynch led by David Woo, expect bonds to continue falling as Trump and the Republican-controlled Congress cut taxes and fund infrastructure projects. That will increase the budget deficit and increase the supply of Treasurys as government borrowing rises.
Treasury yields have risen steadily in recent months, after plunging to historic lows following the U.K.’s late-June vote to leave the European Union. Treasurys represent a plurality of the index’s holdings.
Intraday Data provided by SIX Financial Information and subject to terms of use.
Historical and current end-of-day data provided by SIX Financial Information. Intraday data
delayed per exchange requirements. S&P/Dow Jones Indices (SM) from Dow Jones & Company, Inc.
All quotes are in local exchange time. Real time last sale data provided by NASDAQ. More
information on NASDAQ traded symbols and their current financial status. Intraday
data delayed 15 minutes for Nasdaq, and 20 minutes for other exchanges. S&P/Dow Jones Indices (SM)
from Dow Jones & Company, Inc. SEHK intraday data is provided by SIX Financial Information and is
at least 60-minutes delayed. All quotes are in local exchange time.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
About Me
I am a historian specializing in the political culture of late 18th century America, so I actually DO know what this country was founded upon, as opposed to the AM radio hosts and halfwit politicians who routinely make this claim. I don't get enough sleep, non-lethal food or exercise, and this is entirely my fault. I live in a house full of women - even the cats are girls. If you see me lost on the street, just point me to the nearest bookstore and call my wife to come pick me up. Thanks.
Disclaimer
All views expressed on this blog are mine, do you hear, mine MINE MINE! All mine! Mwahahahaha! Any resemblance to the views of my family members, friends and acquaintances is always greatly appreciated but probably more than I could hope for.
You may find these views offensive. This is not my problem.
Followers
Contact Me!
I now have a dedicated email account, which I think will actually work. I know! Give it a try. Money back if not totally delighted.
david4q10d [squiggly "at" thingie] charter [dot] net
Tuesday, July 19, 2016
Stray Thoughts on the Current Debacle in Cleveland
I just can’t bring myself to watch the Republican National Convention. I just can’t.
Oh, I read about it. Somehow it all seems less insulting to me as an American, less aggressively psychotic, less like the death knell of a once-proud political party if you can skim lightly over the articles the next day rather than see it unfold live in all its unmedicated glory. There’s a little distance there that you need to have just to keep the screaming heebie-jeebies away, the deep fear that comes from knowing that this is representative of a far too large portion of the population of the most powerful nation on earth.
Face it – this is one of the Only Two Major Parties we have in this country, and they just officially nominated as their candidate for the highest office in the land a man whose utter lack of principles is perhaps his best quality. It is better than his inability to comprehend anything that doesn’t directly concern his own ego. It ranks higher than his eagerness to pander to the worst elements of a society on the verge of self-inflicted breakdown. It’s far more endearing than the sad realization that behind the bluster and the ego there is essentially nothing – as one of the people who knows him best recently put it, there is no inner Trump: he’s a hollow blowhard all the way through. And it certainly bodes fairer for the future than the fact that he seems incapable of telling the truth even when it would benefit him to do so. According to the people who rank such things, he is being truthful less than 10% of the time – a modern record. Hilary, Bernie, Jeb, Kasich, and most major political figures from either party tend to be truthful around half the time, which may sound bad (it's not anything you'd put up with from a colleague or roommate, for example) but is still 500% better than the guy the GOP thinks should be president.
I’ve seen the chaos that erupted on the floor on the first day. I note with grim foreboding the fact that you now have one faction of the GOP calling another faction of the GOP fascists to the national media. As an academic I am deeply puzzled at why Trump’s wife thought she could give Michelle Obama’s speech (with a dash of Rick Astley) and not think people would catch that. One of the hardest lessons my students learn is that plagiarism is astonishingly easy to spot these days, and the whole function of modern social media is to create pile-ons of astonishing ferocity and pitiless mocking. You can survive looking bad in the modern political and cultural arena, but you cannot long survive looking ridiculous and incompetent.
If they can bungle what should have been a well-oiled publicity machine that they had months to plan, can any sentient being on the planet think they’re going to do better if entrusted with the messy and demanding prospect of making real-world decisions in actual time? This is the guy people want with his finger on the nuclear button? This should have been a completely artificial manufactured PR event, and it has turned into an embarrassment for both the GOP and the nation as a whole.
Yes indeed, this has been exactly the clusterfuck that Democrats had been hoping for and Republican professional operatives had been dreading. Anyone who tells you otherwise is trying to sell you something.
And yet there he is.
There are times when you think to yourself that perhaps the entire world has indeed lost its mind. That perhaps humanity really is a weed species that has overstayed its welcome on this green and fertile planet, and if we destroyed ourselves it would not be that bad a thing for everything else. The trees would thank us, if nothing else. Maybe the songbirds too.
As a historian, someone who has studied the past, has studied the blood and work and sacrifices that have built human civilization out of the grey mists of the past, this is a saddening thought.
Yet there is nothing inevitable about the continued existence of the United States of America. There is nothing inevitable about the continued existence of humanity as a whole. We have it in our power to make short work of the achievements of past generations.
4 comments:
I have watched most of the convention. It amazes me that they spend an enormous amount of time excoriating Hillary for being dishonest, and trying to scare the living out of the acolytes, and so little time talking about what they think should be done (I.e., the party platform). Maybe when Trump finally speaks this will happen, but I am not counting on it. It frightens me that so many of the electorate are swallowing Trump's drivel and begging for more.
Honestly, I'm not surprised by that at all. For one thing, their candidate has no positions or policies to talk about. Trump led the GOP nomination process nearly wire to wire without ever once articulating a coherent idea or plausible policy, which says volumes about the GOP base voters. All he has is spectacle, bluster, and grift, and that seems to be sufficient. For another, it's not like the GOP has had much interest in actual policymaking for the last decade or so. I'm still waiting for their replacement for the ACA, for example. Any day now. And for a third, have you seen their platform? A more incoherent collection of right-wing extremist fantasies and punitively stupid hallucinations you will never find emitted from a major party.
What else can they talk about but Hillary? They certainly can't afford to focus the discussion on themselves.
Excellent points, and thanks for the welcome; I have been reading your blog for a couple of years, first time I've felt compelled to comment. I'm reminded of the line from Men in Black; "A person is smart - people are stupid". Let's hope there are more smart persons than stupid people in the whole of the electorate!
I've always loved that line. "... Imagine what you'll know tomorrow." As a historian, it speaks to me.
On the other hand, there's also HL Mencken's line - "Nobody has ever gone broke underestimating the intelligence of the American public, but a great many people have been elected to office thereby," or something like that.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
<?xml version="1.0" encoding="utf-8"?>
<!-- Contains only the modules that ship with TSK -->
<PIPELINE_CONFIG>
<PIPELINE type="FileAnalysis">
<MODULE order="1" type="plugin" location="tskHashCalcModule"/>
<!--<MODULE order="2" type="plugin" location="tskHashLookupModule" arguments="TODO: See README for how to create NSRL index file"/>-->
<MODULE order="3" type="plugin" location="tskFileTypeSigModule"/>
<MODULE order="4" type="plugin" location="tskEntropyModule"/>
<MODULE order="5" type="plugin" location="tskZipExtractionModule"/>
<MODULE order="6" type="plugin" location="tskLibExifModule"/>
</PIPELINE>
<PIPELINE type="PostProcessing">
<!--This pipeline configuration assumes that the RegRipper executable is named rip.exe and is present in the program directory-->
<!--<MODULE order="1" type="plugin" location="tskRegRipperModule" arguments="-e #PROG_DIR#/RegRipper/rip.exe; -o #MODULE_OUT_DIR#/RegRipper/"/>-->
<MODULE order="2" type="plugin" location="tskInterestingFilesModule"/>
<MODULE order="3" type="plugin" location="tskSaveInterestingFilesModule"/>
<MODULE order="4" type="plugin" location="tskSummaryReportModule"/>
</PIPELINE>
</PIPELINE_CONFIG>
| null |
minipile
|
NaturalLanguage
|
mit
| null |
WASHINGTON (AP) - The latest on relations between the United States and Venezuela (all times local):
4:45 p.m.
Venezuela’s U.N. ambassador is accusing the Trump administration of “sabotaging” talks between President Nicolas Maduro’s government and opposition, saying Washington is trying to start a war.
Ambassador Samuel Moncada said at a news conference at U.N. headquarters Tuesday that U.S. National Security Adviser John Bolton made this clear earlier when he said: “We don’t believe in dialogue. We believe in action. Maduro has to go.”
Moncada says the U.S. is “sabotaging the conversations among Venezuelans.”
He called the Trump’s administration the most racist in the history of the Western Hemisphere and accused it of “trying to fabricate a war on Venezuela.”
___
4:15 p.m.
Venezuela is asking the U.N. Security Council to urgently investigate what it says are “dangerous” actions by the United States that threaten war and “stop the impending catastrophe of a world power that behaves like an outlaw state.”
In a letter to council members Tuesday, President Nicolas Maduro’s government accused the Trump administration of violating the U.N. Charter by considering a blockade of Venezuela.
The letter also cites what it says were “hostile and illegal incursions” by U.S. military aircraft in Venezuela’s airspace and a U.S. military ship into the country’s territorial waters. Venezuela says such actions “precipitate tensions between the two countries in order to justify a large-scale military intervention against our nation” and are “planned provocations that threaten peace and demand a response” from the Security Council.
___
1:35 p.m.
The United Nations says it will continue to cooperate with Venezuelan authorities and other national and international actors to address the needs of the Venezuelan people.
U.N. spokesman Stephane Dujarric said Tuesday the U.N. took note of the Trump administration’s decision to freeze all Venezuelan government assets, and stressed the importance of allowing humanitarian aid into the country.
Dujarric said, “It is very, very important to keep the humanitarian needs of the Venezuelan people first and foremost.” And he added that “there are some very clear humanitarian principles at the international level which means that humanitarian aid needs to be allowed to get in to those who need it the most.”
He said the U.N. in Venezuela is working according to international principles to make sure that aid, including to children and to ensure maternal health, is delivered properly.
___
11:55 a.m.
Venezuela’s vice president says the latest U.S. sanctions freezing the assets of Nicolas Maduro’s government are an attack on private property and a threat to world order.
Foreign companies that continue to do business with the Maduro government can face retaliation in the U.S. under the asset freeze announced Monday night.
Delcy Rodriguez says “The U.S. has to understand once and for all that they aren’t the owners of the world.” The vice president made the statement Tuesday flanked by top officials, including Venezuela’s defense minister.
She said “every country that has investments in the U.S. should be very worried because this sets a dangerous precedent against private property.”
She also said the U.S. measures are likely to bring additional hardships on the Venezuelan people, who are already suffering from the effects of hyperinflation and a deep recession.
___
11 a.m.
Cuba’s foreign minister is denouncing new U.S. sanctions on a Havana ally, Venezuela.
Bruno Rodríguez says via Twitter that the sanctions amount to “another action to damage and rob that nation.”
Rodríguez expresses solidarity with Venezuelan President Nicolás Maduro and urges an end to “the attempt at imperialist domination.”
Venezuela is not only an ideological friend of Cuba but a crucial commercial partner. Cuba has sent thousands of doctors to treat the poor in the South American nation, while Venezuela has provided oil shipments on preferential terms in a boost for Cuba’s limping economy.
The new sanctions on Venezuela are similar to those long ago imposed against Cuba.
___
10:35 a.m.
Venezuela’s government says tougher new U.S. sanctions blocking dealings with it are a “grave aggression” aimed at “the failure of political dialogue.”
Tuesday’s statement from the socialist government comes a day after the Trump administration froze all Venezuelan government assets, placing Nicolás Maduro’s administration alongside a short list of adversaries from Cuba, North Korea, Syria and Iran that have been targeted by similar actions.
The executive order blocks American companies and individuals from doing business with Maduro’s government and its top supporters. It came Monday night as an executive order from President Donald Trump and takes effect immediately.
Venezuela said the measure is meant “to formalize the criminal economic, financial and commercial blockade” of the country and “strangle” the population.
It called the measure “the most grotesque and shameless looting.”
___
10:20 a.m.
National Security Adviser John Bolton says the U.S. will target anybody - at home or abroad - who supports the government of Venezuelan President Nicolás Maduro with stiff financial sanctions.
Bolton spoke Tuesday in Peru’s capital a day after the Trump administration announced a new round of sweeping measures aimed at pressuring Maduro from office.
The tough measures are similar to those used on adversaries Cuba, North Korea, Syria and Iran.
The U.S. is among more than 50 nations that back opposition leader Juan Guaido’s bid to oust Maduro.
Bolton calls Maduro a “brutal dictator,” accusing him of using death squads and a corrupt food scheme to control Venezuelans.
Bolton warns key Maduro backers Russia and China not to double down on a bad bet by continuing to support the socialist president.
___
9:10 a.m.
A senior Venezuelan official is accusing the Trump administrations of “gangsterism” and “international banditry” following a fresh round of harsh financial sanctions against the socialist government.
Vice Minister of International Communication William Castillo on Tuesday blasted the White House’s announcement freezing Venezuelan government assets.
U.S. officials say they’re increasing pressure on President Nicolás Maduro to force his government from power.
Castillo is among the highest ranking Venezuelan officials to comment on the measures announced late Monday. Maduro has so far remained silent.
The actions also blocks Venezuelan officials identified as being close to Maduro from entering the U.S.
___
5:35 a.m.
A senior Russian lawmaker has denounced the U.S. freeze of all Venezuelan government assets as a crude interference in the country’s internal affairs.
Konstantin Kosachev is the head of the Russian upper house’s international affairs committee and said Tuesday the Trump administration’s action amounts to “international banditry.” He added in remarks carried by the state RIA Novosti news agency that Washington’s move represents an “open meddling into Venezuela’s internal affairs.”
The U.S. ban blocks American companies and individuals from doing business with President Nicolás Maduro’s (nee-koh-LAHS’ mah-DOO’-rohz) government and its top supporters. It’s the first of its kind in the western hemisphere in more than three decades.
Russia has staunchly backed Maduro, while the U.S. and dozens of other nations have cast their support behind opposition leader Juan Guaidó (gwy-DOH’) and recognized him as Venezuela’s interim president.
The Maduro government has yet to respond.
___
1:05 a.m.
The Trump administration has frozen all Venezuelan government assets in a dramatic escalation of tensions with Nicolás Maduro.
The ban places Maduro’s socialist administration alongside a short list of adversaries from Cuba, North Korea, Syria and Iran that have been targeted by such aggressive U.S. actions.
The ban blocks American companies and individuals from doing business with Maduro’s government and its top supporters. It came Monday night as an executive order from President Donald Trump and takes effect immediately.
Trump’s order spares Venezuela’s still sizable private sector. Yet it represents the most sweeping U.S. action to remove Maduro since the Trump administration recognized opposition leader Juan Guaidó as Venezuela’s rightful leader in January.
The order also exposes foreign entities doing business with the Maduro government to U.S. retaliation.
The Maduro government has yet to respond.
Sign up for Daily Newsletters Manage Newsletters
Copyright © 2020 The Washington Times, LLC.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Introduction {#S1}
============
CD4^+^ T helper (T~H~) cells are a critical component of the adaptive immune system that can differentiate into distinct regulatory and effector lineages thus influencing autoimmune diseases, inflammatory disorders, infectious diseases, and cancer.^[@R1]--[@R3]^ Regulatory T~H~ cells expressing Foxp3 (T~reg~) can develop intrathymically or in the periphery and are potently immunosuppressive and help to maintain immunological homeostasis.^[@R2]^ Effector T~H~ cells (T~eff~), on the other hand, can be grouped into several general categories (T~H~1, T~H~2, T~H~9, T~H~17, T~H~22, and T~FH~) based on dominant signature cytokines produced and associated master transcription factors expressed.^[@R4]^ Interestingly, specific cytokines and factors are involved in dictating differentiation of naive T~H~ cells into either T~reg~ or T~eff~ lineages.^[@R5]^ For example, in the presence of IL-2 and TGFβ naive T~H~ cells differentiate into induced T~reg~ cells (iT~reg~) while the combination of IL-6 plus TGFβ promotes T~H~17 and inhibits iT~reg~ differentiation. ^[@R6]--[@R8]^ Alternatively, IL-4 can promote the differentiation of T~H~2 cells while the addition of TGFβ can induce reprograming into T~H~9 cells.^[@R9]--[@R11]^ Thus, the local cytokine milieu present during T~H~ cell priming dramatically influences specific lineage commitment.
The interleukin-1 (IL-1) family of cytokines have recently emerged as critical regulators of adaptive immune cell function and plasticity, particularly at mucosal surfaces.^[@R12],\ [@R13]^ IL-1 signaling was recently shown to be involved in overriding retinoic acid-mediated Foxp3 induction while inducing protective T~H~17 responses during *Citrobacter rodentium* infection.^[@R14]^ Another IL-1 family member, IL-33, acts as an alarmin that is released during tissue damage and can bind to the IL-33 receptor ST2 on T~reg~ cells to induce their stability and immunosuppressive function in the intestine.^[@R15]^ Thus, IL-1 family members can be released in the local environment following tissue damage, or in response to infection, and potently dictate T~H~ cell differentiation and function that ultimately aids in resolution of inflammation and host protection. However, the role of "novel" IL-1 family members, such as IL-36, in regulating CD4^+^ T~H~ cell differentiation into specific lineages remains incompletely defined.^[@R16]^ In the present report, we investigated the role of the IL-36γ/IL-36R axis in controlling the balance of T~reg~ and T~eff~ lineages, with particular focus on how this pathway regulates T~H~ cell dependent intestinal inflammation. Our results demonstrate that signaling through IL-36R employs MyD88 and NFκBp50 in CD4^+^ T cells to potently inhibit iT~reg~ development, while concomitantly promoting T~H~9 differentiation via a IL-2-STAT5 and IL-4-STAT6 dependent pathway. Additionally, mice deficient in IL-36γ-IL-36R signaling were protected from T~H~ cell-dependent intestinal inflammation and exhibited increased colonic iT~regs~ and diminished T~H~9 cells. Collectively, these data highlight IL-36R signaling as a regulator of the iT~reg~-T~H~9 balance *in vitro* and *in vivo* with functional implications in the regulation of intestinal inflammation.
Results {#S2}
=======
IL-36γ abrogates iT~reg~ induction via IL-36R-mediated signaling in CD4^+^ T cells {#S3}
----------------------------------------------------------------------------------
To investigate the contribution of the IL-36/IL-36R axis in CD4^+^ T~H~ cell differentiation, we first explored whether IL-36 ligands could modulate Foxp3 induction in responding T cells using a naive CD4^+^ T cell--DC *in vitro* co-culture system in the presence of αCD3ε, TGFβ and IL-2 (iT~reg~ condition).^[@R17]^ Intriguingly, compared to other IL-1 family members tested, IL-36 ligands -- IL-36α, IL-36β and IL-36γ -- all potently abrogated the induction of Foxp3-expressing iT~reg~ cells in a dose dependent fashion ([Fig. 1a--c](#F1){ref-type="fig"}; [Supplementary Fig. 1a](#SD1){ref-type="supplementary-material"}). Given that all three IL-36 ligands were behaving similarly, combined with the preferential expression of IL-36γ in the mouse intestine during colitis,^[@R18]^ we focused specifically on IL-36γ and asked whether it was acting on CD4^+^ T cells or DCs to inhibit iT~reg~ differentiation. To do so, we employed a co-culture system whereby CD4^+^ T cells or DCs were isolated from WT or IL-36R-deficient mice. Interestingly, the expression of IL-36R by CD4^+^ T cells, but not DCs, was essential for the iT~reg~-inhibiting ability of IL-36γ in this assay ([Fig. 1d,e](#F1){ref-type="fig"}). We next investigated whether IL-36γ was acting to inhibit iT~reg~ differentiation via the induction of autocrine/paracrine signaling, including IL-6 which is known to potently block *de novo* Foxp3 expression and promote T~H~17 differentiation.^[@R6],\ [@R8]^ Notably, inhibition of iT~reg~ cells mediated by IL-36γ was not reversible by antibody-mediated neutralization of IL-1β, IL-6, IL-12/23p40 ([Fig. 2a,b](#F2){ref-type="fig"}), or IL-4, IL-5, IL-9, IL-13, IL-22 and IFNγ ([Supplementary Fig. 2a,b](#SD1){ref-type="supplementary-material"}), although we cannot formally confirm complete neutralization in our specific culture conditions. Since recent studies have implicated the glucocorticoid-induced tissue necrosis factor receptor related protein (GITR)/GITR ligand axis is suppressing Foxp3^+^ iT~reg~ differentiation,^[@R19],\ [@R20]^ we also examined whether this pathway could be involved in the inhibition of iT~reg~ differentiation mediated by IL-36γ. Notably, antibody-mediated blockade of GITR ligand was also unable to reverse the effects of IL-36γ on suppressing iT~reg~ differentiation ([Supplementary Fig. 3a,b](#SD1){ref-type="supplementary-material"}). Of note, the effect of IL-36γ on iT~reg~ inhibition was not affected by the irradiation of DCs ([Supplementary Fig. 4](#SD1){ref-type="supplementary-material"}). We also confirmed the ability of IL-36γ to suppress iT~reg~ cell induction in the absence of DCs by using purified naive CD4^+^ T cells which were isolated from WT mice or OT-II mice ([Supplementary Fig. 5a and b](#SD1){ref-type="supplementary-material"}).
Overall, these findings demonstrate that IL-36γ inhibits Foxp3^+^ iT~reg~ differentiation via IL-36R-mediated signaling in CD4^+^ cells independent of well-defined inflammatory cytokines or GITR/GITR ligand induction.
IL-36γ-mediated suppression of iT~reg~ cells is MyD88- and NFκBp50-dependent {#S4}
----------------------------------------------------------------------------
Given that MyD88 is a key adaptor molecule employed for signaling downstream of several IL-1 family member cytokines receptors including IL-1R, IL-18R, IL-33R and IL-36R,^[@R12]^ we performed T/DC co-cultures whereby CD4~+~ T cells were isolated from MyD88-sufficient (WT) or deficient (*Myd88^−/−^*) mice in order to assess whether deletion of MyD88 specifically in CD4^+^ T cells restored iT~reg~ differentiation in the presence of IL-36γ. Notably, MyD88 expression in CD4^+^ T cells was involved in the suppression of iT~reg~ cell development mediated by IL-36γ ([Fig. 2c,d](#F2){ref-type="fig"}). Since signaling through IL-36R can lead to NFκB activation,^[@R21]^ we next explored whether NFκBp50 was involved in IL-36γ-mediated suppression of iT~reg~ differentiation. To address this question we employed a co-culture system whereby CD4^+^ T cells were isolated from p50-sufficient (WT) or deficient (*p50^−/−^*) mice. Remarkably, deficiency of NFκBp50 specifically in CD4^+^ T cells fully restored iT~reg~ induction in the presence of IL-36γ ([Fig. 2e,f](#F2){ref-type="fig"}). Altogether, our data indicate that IL-36γ suppresses iT~reg~ differentiation via MyD88- and NFκBp50-dependent signaling in CD4^+^ T cells.
IL-36γ alters NFκB signaling and acetylation of the Foxp3 locus during iT~reg~ cell differentiation {#S5}
---------------------------------------------------------------------------------------------------
We next investigated whether IL-36γ may be mediating its effects on inhibiting iT~reg~ cells by interfering with signaling downstream of TGFβ receptor, specifically SMAD3, since it is known to bind the conserved noncoding sequence 1 (CNS1) in the Foxp3 locus and positively regulate Foxp3 expression.^[@R22]^ Flow cytometric analyses revealed that IL-36γ did not inhibit TGFβ-induced phosphorylation of SMAD2/3 ([Fig. 3a](#F3){ref-type="fig"}) or nuclear translocation of SMAD3 ([Fig. 3b](#F3){ref-type="fig"}). Since deficiency of NFκBp50 in CD4^+^ T cells fully restored iT~reg~ induction in the presence of IL-36γ, we next examined how IL-36γ modulates the nuclear translocation of specific NFκB family members. As shown in [Fig. 3b](#F3){ref-type="fig"}, upon CD4^+^ T cell activation under neutral conditions, IL-36γ promoted nuclear translocation of NFκB p65 and p50, but not p105. Under iT~reg~ conditions, p65 nuclear translocation was also observed, however, this nuclear translocation was similar +/− IL-36γ. Interestingly, NFκBp50 nuclear translocation was observed under iT~reg~ conditions and the addition of IL-36γ further augmented nuclear translocation. Together, these results suggest that IL-36γ-enhanced NFκBp50 nuclear translocation may alter the overall ratio of nuclear p50 to p65 resulting in impaired iT~reg~ cell differentiation. Since the IL-36γ - MyD88 - p50 axis could epigenetically alter the chromatin status in CD4^+^ T cells under iT~reg~ conditions,^[@R19]^ we next examined whether IL-36γ modulates histone acetylation at the Foxp3 locus, which includes the promoter, CNS1, and CNS2 regions. Indeed, we observed significant decreases in histone H3 acetylation (H3Ac) status at the Foxp3 promoter, CNS1 and CNS2 regions under iT~reg~ conditions in the presence of IL-36γ ([Fig. 3c](#F3){ref-type="fig"}). Collectively, these data suggest that IL-36γ activates NFκBp50 in CD4^+^ T cells and modulate histone acetylation status at the Foxp3 locus during iT~reg~ cell differentiation *in vitro*.
IL-36γ promotes T~H~9 differentiation in a MyD88- and NFκBp50-dependent manner {#S6}
------------------------------------------------------------------------------
Having defined the ability of IL-36γ to inhibit iT~reg~ cell differentiation, we next explored which T~H~ cell lineages IL-36γ may be favoring. To do so, we performed gene expression profiling of CD4^+^ T~H~ cells stimulated with αCD3ε in the presence or absence of IL-36γ by using the T/DC co-culture system. Notably, under iT~reg~ conditions, IL-9 was identified as one of the top genes induced by IL-36γ among the analyzed gene set ([Fig. 4a,b](#F4){ref-type="fig"}; [Supplementary Fig. 6](#SD1){ref-type="supplementary-material"}). We also performed parallel experiments but under neutral conditions (no addition of either TGFβ1 or IL-2). Similar to results observed using iT~reg~ culture conditions, IL-9 was the top gene induced by IL-36γ under neutral conditions ([Fig. 4a,c](#F4){ref-type="fig"}; [Supplementary Fig. 6](#SD1){ref-type="supplementary-material"}). The ability of IL-36γ to potently induce IL-9 expression in a dose dependent manner was additionally confirmed by qPCR and ELISA ([Fig. 4d,e](#F4){ref-type="fig"}; [Supplementary Fig. 1b](#SD1){ref-type="supplementary-material"}). Interestingly, the induction of IL-9 mediated by IL-36γ was more than 5-fold greater than that of IL-1β, which has been reported to induce IL-9,^[@R23]^ and IL-18 and IL-33 in both iT~reg~ and neutral conditions ([Fig. 4e](#F4){ref-type="fig"}). We also tested whether IL-9 production by CD4^+^ T cells was controlled via IL-36R expression on T cells or DCs by performing the co-culture experiments as in [Fig. 1d](#F1){ref-type="fig"}. Similar to the requirement for IL-36R expression on CD4^+^ T cells in mediating iT~reg~ inhibition, the expression of IL-36R by CD4^+^ T cells, but not DCs, was involved in the IL-9-inducing ability of IL-36γ ([Fig. 4f](#F4){ref-type="fig"}). Additionally, we also confirmed that the irradiation of DCs does not affect the ability of IL-36γ to induce IL-9 production in this setting ([Supplementary Fig. 4](#SD1){ref-type="supplementary-material"}). Next we investigated the mechanism via which IL-36γ induced IL-9 production from CD4^+^ T cells. Since IL-36γ abrogated iT~reg~ differentiation via a MyD88 and NF-κBp50 dependent signaling pathway, we asked whether IL-36γ-induced IL-9 production was also dependent upon MyD88 and NFκBp50. Indeed, using CD4^+^ T cells isolated from *Myd88^−/−^* or *p50^−/−^* mice, a near complete abrogation of IL-36γ-induced IL-9 production was observed in neutral conditions as well as in iT~reg~ conditions ([Fig. 4g](#F4){ref-type="fig"}). We further examined whether the addition of IL-36γ could modulate the expression of transcription factors known to be required for T~H~9 differentiation, specifically PU.1^[@R24]^ and IRF4.^[@R25]^ Indeed, both PU.1 and IRF4 were significantly induced in CD4^+^ T cells in the presence of IL-36γ as compared with the cells cultured in the absence of IL-36γ ([Supplementary Fig. 7a,b](#SD1){ref-type="supplementary-material"}). Thus, IL-36γ robustly induces IL-9 producing CD4^+^ T cells via T cell-intrinsic MyD88- and NFκBp50-dependent signaling.
Next, we further investigated the ability of IL-36γ to induce IL-9 in the absence of DCs by using purified CD4^+^ T cell cultures and various standard T~H~ cell polarizing conditions. Consistent with our data from T/DC co-cultures, IL-36γ significantly induced the differentiation of IL-9 producing cells under T~H~0 conditions ([Supplementary Fig. 8a,b](#SD1){ref-type="supplementary-material"}). Remarkably, IL-36γ also significantly augmented T~H~9 cell differentiation under T~H~9 conditions ([Supplementary Fig. 8a,c](#SD1){ref-type="supplementary-material"}). Intriguingly, the ability of IL-36γ to potently induce IL-9 producing T cells was also observed under other T~H~ cell polarizing conditions including T~H~2 and iT~reg~ conditions, but to a far lesser extent under T~H~1 and T~H~17 conditions ([Supplementary Fig. 8a](#SD1){ref-type="supplementary-material"}). Thus, these findings demonstrate that IL-36γ is a potent inducer of IL-9 production and augments T~H~9 differentiation, even in the absence of DCs.
IL-36γ induces IL-9 expression via IL-2-STAT5 and IL-4-STAT6 signaling {#S7}
----------------------------------------------------------------------
Several factors have been reported to promote IL-9 production by CD4^+^ T cells, including IL-1β, IL-2, IL-4, IL-21, IL-25 and TGFβ.^[@R26]^ To investigate the potential involvement of these cytokines in IL-36γ-induced IL-9 production, we performed T/DC co-cultures in the presence of cytokine specific neutralizing Abs targeting IL-2, IL-4, TGFβ, IL-5, IL-13, IL-1β, IL-6, IL-12/23p40, IL-21 and IL-25. Among these known IL-9 inducing cytokines tested, only neutralization of IL-2 and IL-4 significantly reduced the production of IL-9 induced by IL-36γ ([Fig. 5a](#F5){ref-type="fig"}). Although neutralization of TGFβ and IL-5 modestly reduced the induction of IL-9, the reduction was not statistically significant. These data indicate that IL-9 induction mediated by IL-36γ was largely IL-2 and IL-4 dependent, and are consistent with the ability of IL-36γ to induce both IL-2 and IL-4 production from responding CD4^+^ T cells ([Fig. 3a--c](#F3){ref-type="fig"}).
Since IL-2 signaling activates STAT5, which is involved in the development of T~H~9 cells, ^[@R26]^ we next examined the phosphorylation of STAT5 (pSTAT5) in T/DC co-cultures in response to IL-2 (as a positive control) or IL-36γ. As shown in [Fig. 5b,c](#F5){ref-type="fig"}, IL-36γ induced pSTAT5 by day 1 to the same level as IL-2. At day 3, IL-2 continued to increase pSTAT5^+^ cells as did IL-36γ, albeit to a far lesser extent. We further examined whether IL-36γ-induced STAT5 activation was mediated via enhanced IL-2 production by performing T/DC co-cultures in the presence or absence of anti-IL-2 neutralizing Abs. Indeed, the phosphorylation of STAT5 mediated by IL-36γ was completely abrogated in the presence of anti-IL-2 neutralizing Abs ([Fig. 5d](#F5){ref-type="fig"}). Moreover, we performed T/DC co-cultures in the presence of the STAT5 selective inhibitor (STAT5i), CAS 285986-31-4. Pharmacological inhibition of STAT5 also significantly abrogated IL-9 production in a dose-dependent manner, suggesting that STAT5 is indeed required for IL-36γ-induced IL-9 production ([Fig. 5e](#F5){ref-type="fig"}).
Next we examined the phosphorylation of STAT6 (pSTAT6), which is required for mediating responses to IL-4 and also involved in T~H~9 cell development.^[@R26]^ As shown in [Fig. 5f,g](#F5){ref-type="fig"}, IL-4 (positive control) significantly induced pSTAT6 within 45 minutes as compared to IL-36γ, however, IL-36γ induced pSTAT6 gradually by day 1 and more so at day 3, which is in contrast to the rapid pSTAT5 activation in the presence of IL-36γ ([Fig. 5b,c](#F5){ref-type="fig"}). To further assess the requirement for STAT6 in IL-36γ-induced IL-9 expression, we performed T/DC co-cultures in the presence of the STAT6 selective inhibitor (STAT6i), AS1517499. Pharmacological inhibition of STAT6 significantly reduced IL-9 production in a dose-dependent fashion, demonstrating that STAT6 is also involved in IL-36γ-induced IL-9 production ([Fig. 5h](#F5){ref-type="fig"}). Similarly, STAT6 inhibition abrogated IL-36γ-induced IL-4 production ([Fig. 5h](#F5){ref-type="fig"}). To further confirm the requirements for IL-4 and STAT6 in regulating IL-36γ-induced IL-9 production, we isolated CD4^+^ T cells and DCs from either IL-4-deficient (*Il4^−/−^*) or STAT6-deficient (*Stat6^−/−^*) mice and performed T/DC co-cultures. Deficiency of either IL-4 or STAT6 significantly impaired IL-9 production induced by IL-36γ ([Fig. 5i](#F5){ref-type="fig"}). Consistent with these data, IL-36γ-induced pSTAT6 was also significantly reduced in *Il4^−/−^* and *Stat6^−/−^* CD4^+^ T cells ([Fig. 5j](#F5){ref-type="fig"}). Taken together, these data suggest that IL-36γ induces IL-2-STAT5 signaling followed by IL-4-STAT6 signaling to drive IL-9 expression in CD4^+^ T cells.
Deficiency of IL-36γ or IL-36R *in vivo* ameliorates T~H~ cell-driven colitis {#S8}
-----------------------------------------------------------------------------
As our findings demonstrated that IL-36R signaling strongly induced T~H~9 cell differentiation *in vitro*, we explored the role of the IL-36/IL-36R axis in a T~H~2/9 cell-dependent model of colitis induced by the hapten oxazolone. Oxazolone-induced colitis is a T~H~2 model of colitis resembling ulcerative colitis (UC) in humans^[@R27]^ and more recently, T~H~9 cells have been shown to play a central role in disease pathogenesis in this colitis model^[@R28]^ as well as in UC.^[@R29]^ We first used mice deficient in IL-36R *(Il1rl2^−/−^*) to examine the contribution of IL-36R signaling in driving colonic inflammation in this model. In response to oxazolone treatment, *Il1rl2^−/−^* mice exhibited significantly reduced weight loss and colonic inflammation when compared to WT control mice ([Fig. 6a,b](#F6){ref-type="fig"}), although we did not observe differences in survival rate ([Supplementary Fig. 9a](#SD1){ref-type="supplementary-material"}). Since IL-36γ mRNA expression was significantly higher than that of IL-36α and IL-36β in total colonic tissue of oxazolone-treated mice ([Supplementary Fig. 10](#SD1){ref-type="supplementary-material"}), we next examined mice deficient in IL-36γ (*Il1f9^−/−^*) to confirm the contribution of this specific cytokine in regulating colonic inflammation. Similar to *Il1rl2^−/−^* mice, *Il1f9^−/−^* mice exhibited significantly reduced weight loss and colonic inflammation when compared to WT control mice, ([Fig. 6c,d](#F6){ref-type="fig"}) but with no differences in survival rate as well ([Supplementary Fig. 9b](#SD1){ref-type="supplementary-material"}). Of note, we also tested the contribution of IL-36R receptor signaling in the CD4^+^CD45RB^hi^ T cell transfer model of colitis. Using this model, *Rag1*^−/−^ mice transferred with IL-36R-deficient CD45RB^hi^ cells exhibited modestly, but significantly reduced weight loss and colonic inflammation when compared to *Rag1*^−/−^ mice transferred with IL-36R-sufficient CD45RB^hi^ cells ([Supplementary Fig. 11a,b](#SD1){ref-type="supplementary-material"}). Thus, these results indicate that the IL-36γ/IL-36R axis plays a key role in driving T~H~ cell-dependent colonic inflammation, particularly in the T~H~2/9 oxazolone model.
IL-36γ controls the T~reg~-T~H~9 cell balance *in vivo* {#S9}
-------------------------------------------------------
Next, we further investigated IL-36γ-mediated regulation of T~H~ differentiation *in vivo* during colitis. Following treatment with oxazolone, *Il1f9^−/−^* mice displayed significantly reduced IL-9 production by colonic lamina propria lymphocytes (LPL) ([Fig. 7a](#F7){ref-type="fig"}), as well as reduced IL-9 producing CD4^+^ T cell frequency and absolute cell number ([Fig. 7b,c](#F7){ref-type="fig"}), when compared to WT mice. In addition, the frequency and absolute number of Foxp3^+^CD4^+^ T cells was significantly increased in *Il1f9^−/−^* colonic tissue ([Fig. 7d,e](#F7){ref-type="fig"}). Further both the frequency and absolute number of Helios^−^Foxp3^+^CD4^+^ T cells were significantly increased in *Il1f9^−/−^* colonic tissue ([Fig. 7f,g](#F7){ref-type="fig"}). We also confirmed that *Il1rl2^−/−^* mice exhibit reduced IL-9 production as well as increased Helios^−^ Foxp3^+^CD4^+^ T cells in this model ([Supplementary Fig. 12a,b](#SD1){ref-type="supplementary-material"}). Although the frequency of Helios^−^Foxp3^+^CD4^+^ T cell was modestly higher in *Il1f9^−/−^* colonic tissue at steady state when compared to WT colonic tissue, it was not statistically significant ([Supplementary Fig. 13a,b](#SD1){ref-type="supplementary-material"}). Thus, diminished T~H~9 cells and enhanced Helios^−^Foxp3^+^ T~reg~ cells observed in *Il1f9^−/−^* mice and *Il1rl2^−/−^* mice in the oxazolone model of colitis were consistent with the ability of IL-36γ and IL-36R to control the iT~reg~-T~H~9 balance *in vitro*. Since many cell types have been shown to express IL-36R and respond to IL-36 ligands, it is possible that non-T cells expressing IL-36R may also mediate effects in the oxazolone model of colitis, and future studies employing cell-lineage specific deletion of IL-36R are warranted to address the relative contribution of various cell types *in vivo*. Lastly, we investigated the correlation of human IL-9 and IL-36 cytokines in datasets generated from UC and Crohn's disease (CD) patient samples. Within two different datasets, there were significant correlations between human IL-9 and IL-36α or IL-36β in UC, and a positive correlation was also observed between IL-9 and IL-36γ, although it did not reach statistical significance. Notably, these correlations between human IL-9 and IL-36 cytokines were not observed in CD ([Supplementary Fig. 14](#SD1){ref-type="supplementary-material"}). Altogether, the IL-36/IL-36R pathway appears to play a major role in regulating the T~H~ cell balance *in vivo* during T~H~9-mediated intestinal inflammation in mice and correlates with IL-9 expression in human UC.
Discussion {#S10}
==========
In the present study, we provide evidence that signaling through IL-36R dramatically inhibited iT~reg~ differentiation while redirecting towards IL-9 producing T~eff~ cells via a pathway involving MyD88 and NFκBp50 in CD4^+^ T cells. IL-36R signaling potently induced STAT5 phosphorylation via IL-2 signaling and STAT6 phosphorylation via IL-4 signaling and both pathways were required for maximal IL-36γ-induced T~H~9 differentiation. Importantly, the role of IL-36R signaling in controlling the iT~reg~-T~H~9 balance was further confirmed *in vivo* using the oxazolone model of colitis. In this model, mice deficient in IL-36γ-IL-36R signaling exhibited increased iT~reg~ and diminished T~H~9 cells and significantly ameliorated colonic inflammation. Overall, these data highlight a fundamental contribution of the IL-36/IL-36R axis in the regulation of T~H~ cell differentiation and intestinal inflammation in mice.
The contribution of the IL-36/IL-36R axis to regulating regulatory and effector T cells extends beyond the intestine to other mucosal surfaces. The IL-36/IL-36R axis has been shown to play a pro-inflammatory role at barrier surfaces including the skin and lungs. Pioneering studies linked missense mutations in *IL36RN*, a gene encoding IL-36 receptor antagonist (IL-36RA), to a rare and life-threatening form of skin inflammation in humans termed generalized pustular psoriasis.^[@R30]^ These findings were further supported by evidence for increased expression of IL-36α and IL-36γ in skin psoriatic lesions in mice and humans and the fact that transgenic mice overexpressing IL-36α in keratinocytes develop skin inflammation.^[@R31]^ IL-36 cytokines can also be expressed by bronchial epithelial cells in response pro-inflammatory cytokines such as TNF, IL-1β, and IL-17, as well as in response to microbial challenge.^[@R32]^ Additionally, direct administration of IL-36α or IL-36γ in the lungs of mice was sufficient to induce neutrophil recruitment, inflammatory cell influx, enhanced mucus production and lung resistance.^[@R32]^ In the intestine, IL-36 ligands were induced following DSS-induced intestinal damage in response to stimulation by the microbiota and IL-36R plays a fundamental role in the repair of tissue damage in this T-cell independent model of colitis.^[@R18],\ [@R33]^ Consistent with these findings, IL-36α as well as IL-36γ, have been shown to be increased in human IBD, particularly, ulcerative colitis (UC), however the function of IL-36 ligands and IL-36R during human IBD remains obscure.^[@R34],\ [@R35]^ It is important to note that beyond expression, IL-36 ligands must further undergo proteolytic cleavage at the N-terminus to acquired optimal biological activity.^[@R36],\ [@R37]^ Recent evidence suggests that the neutrophil-granule derived proteases cathepsin G, elastase, and proteinase-3, are responsible for cleavage of IL-36 ligands, which results in a dramatic increase in biological activity.^[@R38]^ Following cleavage and activation, IL-36 ligands then mediate their biological effects by binding to IL-36R which, like IL-36 ligands, is expressed by numerous cell types including dendritic cells, T cells, keratinocytes and epithelial cells.^[@R18],\ [@R31],\ [@R32]^
Interestingly, we found that expression of IL-36R on CD4^+^ T cells was involved in the effects of IL-36 ligands in regulating iT~reg~ and T~H~9 cell differentiation. Another recent report defined an important contribution of IL-1R signaling directly in CD4^+^ T cells in the control of the T~H~17-iT~reg~ cell balance in the presence of retinoic acid.^[@R14]^ This study is consistent with previous reports indicating that T cell-specific IL-1-MyD88 signaling is required for the induction for T~H~17 cell differentiation.^[@R39],\ [@R40]^ Further, the IL-1 family member, IL-33, can directly augment colonic T~reg~ function by binding to the IL-33 receptor, ST2.^[@R15]^ Overall, these data highlight IL-1 family members as central mediators in the control of adaptive immune responses via direct action on T~H~ cells, and underscores the unique and non-redundant functions of IL-1, IL-33, and IL-36 ligands in this process.
In the presence of TGFβ, it is known that cytokines such as IL-6 and IL-4 can direct naive T~H~ cells to T~H~17 and T~H~9 lineages, respectively, by blocking the generation of iT~reg~ cells.^[@R6],\ [@R7],\ [@R10],\ [@R11]^ Therefore, it is intriguing that IL-36-mediated inhibition of iT~reg~ differentiation occurred independent of these cytokines. Additionally, we did not observe any inhibition of the TGFβ-signaling pathway by IL-36γ. These data suggest that signaling through IL-36R may be capable of directly inhibiting the Foxp3 transcription machinery. Although the mechanism of how NFκB signaling controls the accessibility to Foxp3 locus during iT~reg~ cell development remains unclear,^[@R41]^ it is notable that a recent report provided evidence that the GITR costimulatory molecule was a potent inhibitor of iT~reg~ differentiation and an inducer of T~H~9 cells through NFκBp50 activation, leading to recruitment of histone deacetylases at the Foxp3 locus and a 'closed' chromatin structure.^[@R19]^ In the present study, we demonstrated that NFκBp50, but not the GITR/GITR ligand axis, is instrumental in contributing to diminished iT~reg~ cell development and enhanced T~H~9 differentiation mediated by IL-36γ, indicating that signaling through IL-36R and GITR may regulate iT~reg~ **--** T~H~9 cell balance via unique, albeit partially overlapping mechanisms. Of note, in addition to inhibiting iT~reg~ differentiation, it remains to be elucidated whether IL-36 receptor signaling also alters the function of thymically derived nT~reg~ cells or not.
Although the contribution of IL-2, IL-4, and TGFβ to T~H~9 differentiation is well established.^[@R9]--[@R11]^, the endogenous inducers of T~H~9 cells have not been fully elucidated.^[@R26]^ Previous reports have demonstrated that IL-36 cytokines can induce T~H~1 responses and further augment IL-9 expression by polarized T~H~9 cells, as well as suppress T~H~17 responses.^[@R16],\ [@R35]^ However, the effect of IL-36 cytokines on naive CD4^+^ T cells to modulate *de novo* differentiation into the iT~reg~ or T~H~9 cell lineages has not been previously reported. By employing *ex vivo* cell culture system using FACS-sorted CD4^+^ T cells and DCs, here we identified a link between IL-36R signaling, activation of IL-2-STAT5 and IL-4-STAT6 pathways, and IL-9 production. We showed that IL-36γ induces endogenous IL-2 and IL-4 in the T/DC co-culture and that STAT5 and STAT6 phosphorylation is dependent upon each cytokine production respectively, although we cannot exclude that the effects of blocking IL-2-STAT5 may be due to downstream events. Notably, IL-36γ-induced IL-9 production appears to be due to neither IL-25 nor IL-1β, which has been shown to drive IL-2-IL-4-independent T~H~9 responses.^[@R23],\ [@R42]^ Additionally, by using various T cell polarizing conditions, we demonstrated that IL-36γ significantly induced IL-9 under T~H~0, T~H~2, T~H~9 and iT~reg~ conditions, whereas it did not under T~H~1 and T~H~17 conditions. This is consistent with previous reports showing that IFNγ inhibits IL-9 production by neutralizing the effect of IL-4,^[@R9]^ and IL-6 inhibits IL-9 production by regulating STAT5 activation via STAT3.^[@R43]^ Overall, these data support the notion that the IL-36/IL-36R axis induces T~H~9 cells via both IL-2-STAT5 and IL-4-STAT6 dependent pathways.
Accumulating evidence suggests the importance of T~H~9 cells in diseases including atopic dermatitis^[@R44],\ [@R45]^, asthma^[@R46],\ [@R47]^, cancer,^[@R23],\ [@R48]^ and IBD.^[@R28],\ [@R29]^ While the term IBD comprises CD and UC, both of which the etiology remain unknown, distinct immunological dysregulation are associated with each disease.^[@R49]^ Particularly, IL-9 and IL-9R were shown to be up-regulated in patients with UC.^[@R28],\ [@R29]^ During colitis, IL-9 can inhibit epithelial cell proliferation and increase intestinal permeability via IL-9R expressed in epithelial cells, suggesting that IL-9 signaling may regulate barrier function in UC.^[@R28]^ Our data reported here propose a link between IL-36 and IL-9 during T~H~ cell-driven intestinal inflammation resembling UC and suggest that the IL-36/IL-36R may be contributing to disease pathology in T~H~9-mediated inflammatory disorders. Indeed, data from human IBD samples indicated a link between IL-36α, IL-36β and IL-9 specifically in UC. Collectively, these findings define a novel role for the IL-36 pathway in controlling the T~reg~ --T~H~9 cell balance during intestinal inflammation and provide the foundation for exploring whether manipulating this pathway may be beneficial in the treatment of IBD and other inflammatory conditions.
Materials and Methods {#S11}
=====================
Mice {#S12}
----
C57BL/6 (WT), *Myd88*^−/−^, *p50*^−/−^, *Il4*^−/−^, *Stat6*^−/−^, B6.Cg-Tg(TcraTcrb)425Cbn/J (OT-II) and *Rag1*^−/−^ mice were obtained from the Jackson Laboratories and housed in SPF conditions. IL-36R^−/−^ mice (*Il1rl2*^−/−^) mice were provided by Amgen. Sperm of IL-36γ^−/−^ (*Il1f9*^−/−^) mice was obtained from the KOMP repository (UC Davis) and heterozygous *Il1f9*^+/−^ founder mice were generated by the Mouse Transgenic and Gene Targeting Core facility at Emory University. *Il1f9*^+/−^ mice were subsequently bred to generate *Il1f9*^−/−^ mice. Unless otherwise stated, mice were used at 6--12 weeks of age. Experiments were carried out using age and gender matched groups. Animal protocols were approved by the Institutional Animal Care and Use Committee of Georgia State University.
Flow cytometry {#S13}
--------------
Fluorescence dye labeled antibodies (Abs) specific for CD3 (145-2C11), CD4 (L3T4), CD25 (PC61.5), CD45 (30F11), CD45RB (C363.16A), CD11c (N418), TCRβ (H57-597), MHC-II (M5/114.15.2), Helios (22F6), FoxP3 (NRRF-30), IL-9 (RM9A4), pSMAD2/3 (O72-670), pSTAT5 (SRBCZX), pSTAT6 (18/P-Stat6), PU.1 (9G7), and IRF4 (3E4) were purchased from Becton Dickinson (BD), eBioscience, Biolegend and Cell Signaling Technology. Fc block (2.4G2) was purchased from BD. Dead cells were identified using the fixable Aqua dead cell staining kit (Invitrogen). Intracellular staining for Helios, IRF4 and Foxp3 was performed using a Foxp3 staining buffer set (eBioscience). Intracellular staining of IL-9 was performed after restimulation of cells with phorbol-12-myristate 13-acetate (Sigma), ionomycin (Sigma) and brefeldin A (eBioscience) for 4 hours. Stimulated cells were fixed and permeabilized, and then stained with Abs specific for IL-9. Detection of pSMAD2/3 was performed according to the BD Phosflow protocol. For intracellular detection of pSTAT5, pSTAT6 and PU.1, cells were fixed by 1.6% paraformaldehyde and incubated for 10 min at room temperature. Cells were then permeabilized by ice-cold methanol and stored at −80 °C before staining. Multi-parameter analysis was performed on a Fortessa (BD) and analyzed with FlowJo software (Tree Star). Cell sorting was performed using a SH800Z cell sorter (SONY).
T cell and dendritic cell (T/DC) co-culture {#S14}
-------------------------------------------
Naive CD4^+^ T cells (CD4^+^CD25^−^) were purified from spleens by magnetic selection (Miltenyi Biotec) and subsequently sorted by fluorescence activated cell sorting (FACS) and cultured for 4 days in the presence of FACS-sorted CD45^+^MHCII^+^CD11c^+^ DCs at a 10:1 T/DC cell ratio (DCs were not irradiated unless specified). All cultures contained purified anti-CD3ε (2μg/ml; 145-2C11; eBioscience). For iT~reg~ cell induction, the cultures contained human TGFβ (5ng/ml) (Peprotech) and human IL-2 (20ng/ml) (Peprotech). The following cytokines were used in indicated experiments (100ng/ml): murine IL-1β (Peprotech), murine IL-18 (R&D), murine IL-33 (Peprotech), murine IL-36α, murine IL-36β and murine IL-36γ (R&D). Neutralizing Abs specific for IL-1β (B122), IL-2 (JES6-1A12), IL-4 (11B11), IL-5 (TRFK5), IL-6 (MP5-20F3), IL-9 (D9302C12), IL-12/23p40 (C17.8), IL-13 (ebio1316H), IL-21 (FFA21), IL-22 (IL22JOP), IL-25 (35B), TGFβ-1,2,3 (1D11) and IFNγ (XMG1.2) purchased from eBioscience, Biolegend and R&D were used (10μg/ml). In indicated experiments the STAT5 inhibitor (CAS 285986-31-4; EMD Millipore) and STAT6 inhibitor (AS 1517499; Axon Medchem) was used.
CD4^+^ T cell differentiation {#S15}
-----------------------------
FACS-sorted CD4^+^CD25^−^ T cells purified from spleen were activated with plate-bound anti-CD3ε (1μg/ml) and anti-CD28 (10μg/ml; 37.51; BD) and cultured for 3 days under T~H~9 conditions (murine IL-4: 100 ng/ml; human TGFβ: 5ng/ml; and anti--IFNγ: 10 μg/ml), T~H~2 conditions (murine IL-4; and anti--IFNγ), T~H~1 conditions (murine IL-12: 1 ng/ml), T~H~17 conditions (human TGFβ: 1 ng/ml; murine IL-6: 50 ng/ml; anti--IFNγ; and anti--IL-4: 10 μg/ml), and iT~reg~ conditions (human TGFβ: 5ng/ml). Recombinant proteins were purchased from Peprotech and R&D. In some experiments Ovalbumin 323--339 (OVA; Sigma) was used.
Gene expression analysis by RT^2^ profiler PCR array system {#S16}
-----------------------------------------------------------
RT^2^ profler PCR array system (Qiagen) was used to assess gene expressions of T~H~ cell immune responses induced by IL-36γ. Briefly, FACS-sorted naive CD4^+^CD25^−^ T cells were co-cultured in the presence of FACS-sorted CD45^+^MHCII^+^CD11c^+^ DCs for 24hr at a 10:1 T/DC cell ratio. RNA was obtained from the cultured cells by using the RNeasy mini kit (Qiagen) and then cDNA was generated using the RT2 First Strand Kit (Qiagen) followed by genomic DNA elimination. cDNA was applied for Mouse T~H~17 response RT2 Profiler PCR Array (PAMM-073ZA; Qiagen) and then PCR amplification was performed with RT^2^ SYBR Green qPCR Mastermix. Gene expression analysis was performed using **ΔΔ** C~T~ method by Profiler PCR Array Analysis Software (Qiagen; version 3.5). Non-detected genes (C~T~ value \> 35) were excluded and gene expression was normalized to the mean of five housekeeping gene sets according to Qiagen's recommendations.
Enzyme-linked immunosorbent assay (ELISA) {#S17}
-----------------------------------------
Cytokine protein secretion was measured in cell free supernatants using ELISA kits for mouse IL-4 and IL-9 (eBioscience) according to the manufacturer's protocol.
RNA isolation and quantitative real-time polymerase chain reaction (qPCR) {#S18}
-------------------------------------------------------------------------
Total RNA was isolated from murine cells and tissues using the Qiagen RNeasy Mini Kit and QIAcube with on-column DNase digestion. cDNA was generated using the Superscript First-Strand Synthesis System for RT-PCR and random hexamer primers (Invitrogen). qPCR was performed with SYBR Green on an StepOnePlus real-time PCR system (Applied Biosystems) and gene expression was normalized to *Gapdh*. Primers used were:
1. m*Il1f9* (F, TTGACTTGGACCAGCAGGTGTG;
2. R, GGGTACTTGCATGGGAGGATAG)
3. m*Il1f6* (F, TAGTGGGTGTAGTTCTGTAGTGTGC;
4. R, GTTCGTCTCAAGAGTGTCCAGATAT)
5. m*Il1f8* (F, ACAAAAAGCCTTTCTGTTCTATCAT;
6. R, CCATGTTGGATTTACTTCTCAGACT)
7. m*Il9* (F, CATCAGTGTCTCTCCGTCCCAACTGATG;
8. R, GATTTCTGTGTGGCATTGGTCAG)
9. m*Gapdh* (F, TGGCAAAGTGGAGATTGTTGCC;
10. R, AAGATGGTGATGGGCTTCCCG)
Western blot analysis {#S19}
---------------------
Following cytokine stimulations, proteins were extracted from CD4^+^ T cells and separated into cytosol and nuclear fractions using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific) according to the manufacturer's instruction. The samples were separated on 8 or 10 % SDS-PAGE gel, transferred to polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with blocking buffer (TBS containing 0.1% Tween 20 (TBS-T) and 5% nonfat dry milk). After 3 washes with TBS-T, the membrane was incubated overnight with primary antibodies at 1: 1,000--1: 4,000 dilutions in blocking buffer at 4 °C. After 3 washes with TBS-T, the membrane was incubated with corresponding secondary antibody at 1: 4,000 dilution in blocking buffer for 1 h. After 3 washes with TBS-T, the proteins were visualized using Amersham ECL Prime Detection Reagent (GE Healthcare). The primary antibodies used were: α-Tubulin (sc-69969, Santa Cruz); NF-κB p65 (sc-8008, Santa Cruz); NF-κB p105/p50 (ab32360, Abcam); SMAD3 (ab28379, Abcam); TFIIB (sc-225, Santa Cruz). The secondary antibodies used were: anti-mouse IgG (\#7076, Cell Signaling Technology); anti-rabbit IgG (\#7074, Cell Signaling Technology).
Chromatin Immunoprecipitation (ChIP) assay {#S20}
------------------------------------------
FACS-sorted naive CD4^+^CD25^−^ T cells were co-cultured in the presence of FACS-sorted CD45^+^MHCII^+^CD11c^+^ DCs for 4days at a 10:1 T/DC cell ratio under iT~reg~ conditions in the presence or absence of IL-36γ. ChIP assays were performed with EZ-ChIP kit (17--371, EMD Millipore) as previously described.^[@R50]^ Briefly, chromatin DNA was obtained from the cultured cells after fixation with formaldehyde and fragmented by sonication to a mean length of 500 bp, and was immunoprecipitated with control or anti-acetyl-histone H3 antibody (06--599, EMD Millipore). The precipitated DNA was subjected to qPCR using specific primers for Foxp3 locus.^[@R19]^
Oxazolone colitis {#S21}
-----------------
Oxazolone colitis was induced as previously described.^[@R27]^ Briefly, in order to presensitize mice, a 2 × 2 cm field of the abdominal skin was shaved, and 100 μl of a 3% solution of oxazolone (4-ethoxymethylene-2-phenyl-2-oxazoline-5-one; Sigma) in 100% ethanol was applied. Five days after presensitization, mice were challenged intrarectally with 100μl of 1% oxazolone in 50% ethanol under general anesthesia with isoflurane.
CD4^+^CD45RB^hi^-induced colitis {#S22}
--------------------------------
FACS-sorted CD4^+^CD25^−^CD45RB^hi^ naive T cells from WT mice or IL-36R^−/−^ mice (5x10^5^) were injected i.p. into *Rag1^−/−^* recipients. Colons were dissected from recipient mice 6 weeks post-transfer when clinical signs of chronic colitis were evident.
Histology {#S23}
---------
Colons were gently flushed clean and fixed in 10% formalin. Paraffin embedding, sectioning, hematoxylin/eosin staining, slide scanning and assessment of histology were performed at the University of Michigan Pathology Core. The degree of inflammation (infiltration of immune cells) and epithelial damage (epithelial injury and ulceration) of was graded in a blinded fashion from 0 to 4 or 0 to 3 respectively.
Microarray analysis {#S24}
-------------------
Two microarray datasets were downloaded from the Gene Expression Omnibus database (<http://www.ncbi.nlm.nih.gov/geo/>), including GSE36807 (Montero 2013) and GSE16879 (Arijs 2009). Expression data from GSE36807 included colonic specimens from 15 ulcerative colitis patients and 13 Crohn's disease patients. Microarray data from GSE16879 included samples from 24 ulcerative colitis patients and 37 Crohn's disease patients prior to infliximab treatment. These datasets contained gene expression data derived from the Affymetrix U133_plus2 platform. For microarray analysis, expression and raw expression data (CEL files) were summarized and normalized using the Robust Multi-array Average algorithm from the Bioconductor library for the R statistical programming system.
Statistical analysis {#S25}
--------------------
All Statistical analyses except for human microarray analysis were performed with GraphPad Prism software, version 6.0b (Graphpad Software). Student's *t* test or One-way ANOVA and Tukey's Multiple Comparison Test was used to determine significance. \**P* \< 0.05, \*\**P* \< 0.01, \*\*\**P* \< 0.001; ns, not significant. For human microarray data, Spearman's rank correlation coefficient analysis was performed with IBM SPSS Statistics 19 software.
Supplementary Material {#S29}
======================
We thank Richard Blumberg for critical discussion regarding oxazolone model of colitis; Ifor Williams and Gisen Kim for critical discussion regarding the manuscript; Hirokazu Tanaka and Wooseok Seo for technical advice regarding ChIP assay. This work was supported by National Institutes of Health Grants DK097256 (to T.L.D.), and DK055679 and DK059888 (to A.N.), as well as by a Crohn's and Colitis Foundation of America Research Fellowship Award (to A.H.).
**Conflict of Interest:** The authors declared no conflict of interest.
**Author Contributions**: A.H. and T.L.D. conceived the idea for this project and designed the experiments. A.H. performed most of the experiments and analyzed the data. K.M. and S.O. performed the western blot analysis and the microarray analysis, respectively. H.A, V.L.N. and S.W.Y. provided technical support. A.N. supervised pathological analysis. J.E.K., J.D.L and A.T.G. provided reagents, mice and critical discussion. H.A, A.N. and A.T.G. critically read the manuscript. A.H. and T.L.D. wrote the manuscript.
{#F1}
{#F2}
{#F3}
{#F4}
{#F5}
{#F6}
{#F7}
| null |
minipile
|
NaturalLanguage
|
mit
| null |
"Trading is statistics and time series analysis." This blog details my progress in developing a systematic trading system for use on the futures and forex markets, with discussion of the various indicators and other inputs used in the creation of the system. Also discussed are some of the issues/problems encountered during this development process. Within the blog posts there are links to other web pages that are/have been useful to me.
Pages
Tuesday, 23 August 2011
It has taken some time, but I have finally been able to incorporate the Trend Vigor indicator into my Naive Bayesian classifier, but with a slight twist. Instead of being purely Bayesian, the classifier has evolved to become a hybrid Bayesian/clustering classifier. The reason for this is that the Trend Vigor indicator has no varying distribution of values but tends to return values that are so close to each other that they can be considered a single value, as mentioned in an earlier post of mine. This can be clearly seen in the short 3D visualisation animation below. The x, y and z axis each represent an input to the classifier, and about 7 seconds into the video you can see the Trend Vigor axis in the foreground with almost straight vertical lines for its "distributions" for each market type. However, it can also be seen that there are spaces in 3D where only combined values for one specific market type appear, particularly evident in the "tails" of the no retracement markets ( the outermost blue and magenta distributions in the video. )
The revised version of the classifier takes advantage of this fact. Through a series conditional statements each 3D datum point is checked to see if it falls in any of these mutually exclusive spaces and if it does, it is classified as belonging to the market type that has "ownership" of the space in which it lies. If the point cannot be classified via this simple form of clustering then it is assigned a market type through Bayesian analysis.
This Bayesian analysis has also been revised to take into account the value of the Trend Vigor indicator. Since these values have no distribution to speak of a simple linear model is used. If a point is equidistant between two Trend Vigor classifications it is assigned a 0.5 probability of belong to each, this probability rising in linear fashion to 1.0 if it falls exactly on one of the vertical lines mentioned above, with a corresponding decrease in probability assigned to the other market type classification. There is also a boundary condition applied where the probability is set to 0.0 for belonging to a particular market type.
The proof of the pudding is in the eating, and this next chart shows the classification error rate when the classifier is applied to my usual "ideal" time series.
The y axis is the percentage of ideal time series runs in which market type was mis-classified, and the x axis is the period of the cyclic component of the time series being tested. In this test I am only concerned with the results for periods greater than 10 as in real data I have never seen extracted periods less than this. As can be seen the sideways market and both the up and down with no retracement markets have zero mis-classification rates, apart from a small blip at period 12, which is within the 5% mis-classification error rate I had set as my target earlier.
Of more concern was the apparent large mis-classification error rate of the retracement markets ( the green and black lines in the chart. ) However, further investigation of these errors revealed them not to be "errors" as such but more a quirk of the classifier, which lends itself to exploitation. Almost all of the "errors" occur consecutively at the same phase of the cyclic component, at all periods, and the "error" appears in the same direction. By this I mean that if the true market type is up with retracement, the "error" indicates an up with no retracement market; if the true market type is down with retracement, the "error" indicates a down with no retracement market. The two charts below show this visually for both the up and down with retracement markets and are typical representations of the "error" being discussed.
The first pane in each chart shows one complete cycle in which the whole cycle, including the most recent datum point, are correctly classified as being an up with retracement market ( upper chart ) and a down with retracement market ( lower chart. ) The second pane shows a snapshot of the cycle after it has progressed in time through its phase with the last point being the last point that is mis-classified. The "difference" between each chart's respective two panes at the right hand edge shows the portion of the time series that is mis-classified.
It can be seen that the mis-classification occurs at the end of the retracement, immediately prior to the actual turn. This behaviour could easily be exploited via a trading rule. For example, assume that the market has been classified as an up with retracement market and a retracement short trade has been taken. As the retracement proceeds our trade moves into profit but then the market classification changes to up with no retracement. Remember that the classifier (never?) mis-classifies such no retracement markets. What would one want to do in such a situation? Obviously one would want to exit the current short trade and go long, and in so doing would be exiting the short and initiating the possible long at precisely the right time; just before the market turn upwards! This mis-classification "error" could, on real data, turn out to be very serendipitous.
All in all, I think this revised, Mark 2 version of my market classifier is a marked improvement on its predecessor.
Tuesday, 16 August 2011
Some time ago (the file was last edited in July 2010) I wrote an Octave .oct function to create synthetic data for testing and optimisation purposes. I was inspired to do so by the December 2005 issue of The Breakout Bulletin and it has recently come to mind again due to a posting on the StackExchange Quantitative Finance Forum here. I have posted the code for my .oct function in the code box below.
In writing this function I wanted to extend the ideas presented in the Breakout Bulletin and make them more applicable for the purposes I had/have in mind. By randomly scrambling the data any bar to bar dependency is destroyed (by design of course), but what if you want to preserve some bar to bar dependencies? This .oct function is my solution to preserving this dependency and a brief discussion of the theory behind it follows.
Firstly there is an assumption that any single bar and the market forces that caused the bar to be formed the way it did (up bar, down bar, doji etc.) are dependent on the immediately preceding market activity and the "current mode" of the market. Implicit in this assumption is that certain "types" of bars are more likely to be seen depending on market "mode," i.e. the types of bar in an up trend are likely to be distinctly different from those in a down trending or sideways trending market, so what is needed is some way to bin the bars which reflects this.
My solution is to apply a 21 bar moving median of the close and median absolute deviations from this median as bands above and below it, similar to Bollinger Bands. There are 3 levels; 1 x MAD, 2 x MAD and 3 x MAD above, and 3 below; to give a total of 8 "zones" as they are called in the code. Furthermore, a 21 bar moving median of the True Range and a 4 bar WMA of the True Range are also calculated. The first part of the code ("Code Block A Loop"), after all the required declarations, loops over the input time series data calculating all the above and assigning each bar to a specific bin based upon the "zone" in which the previous bar resides, and further assignation depends on whether the previous bar is a high or low volatility bar decided by the True Range 4 bar WMA being above or below the True Range 21 bar moving median. This gives a total of 16 different bins to which a bar can be assigned. On assignation to a bin, the open, high, low and close are recorded in that bin by their relation to the previous close thus: log10(close/previous_close), log10(open/previous_open)... etc.
The next part of the code ("Code Block B Loop") actually creates the synthetic data by randomly drawing a bar's relationships to its previous close from the "relevant bin" and calculating a "new" bar based upon these relationships. This "relevant bin" is determined by the "zone" position and volatility of the most recently calculated synthetic "new" bar. After a new, "new bar" has been created, the median, MADs and True Range calculations are updated to include this new, "new bar," which becomes the previous bar on the next iteration of the loop for Code Block B Loop.
Finally, a small part of the code adjusts the input data in the case of negative values due to the possible use of continuous back-adjusted futures contracts as the input data. This is necessary to avoid errors in trying to calculate the log10 of a negative number.
The above method of binning the input data and subsequent randomisation is my attempt to ensure that dependencies/characteristics of the original data are preserved - for example - assume a bar is above the upper 3 x MAD level and is determined to be a high volatility bar, then the next synthetically created bar will be drawn only from the binned distribution of bars that in the real data also follow a bar above the upper 3 x MAD level and is determined to be a high volatility bar.
This code is offered as is and comes with no warranty whatsoever. However, if you like it and use it I would be interested to hear from you. In particular, if you have any suggestions for the code's improvement, extension, optimisation etc. or see any errors in the code, I would really appreciate your feedback.
A final thought: although not implemented in the above code it would be possible to apply some form of "quality control" to the output. Statistical measures of the input time series could be taken and thresholds established and only those synthetic outputs that fall within these threshold conditions could be accepted as a valid synthetic time series output.
Below is a screenshot of a time series and synthetic data generated from it using the above function code. For the moment I won't say which is the original and which is the synthetic data - perhaps readers would like to post their guesses as comments?
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Government to Draft New Cyber-Safety Legislation
The province is working on new legislation to protect Nova Scotians of all ages from the harmful effects of cyberbullying.
“We all know that sharing hurtful and malicious posts online can have long lasting and devastating impacts on an individual – no matter their age. In our new digital world, bullying has gone well beyond the playground,” said Justice Minister and Attorney General Diana Whalen. “We must continue our efforts to protect victims of cyberbullying.”
In December, 2015, the Supreme Court of Nova Scotia struck down the existing CyberSafety Act. The Department of Justice accepts the court’s ruling that the definition of cyberbullying in the former act was overly broad and will not appeal the court’s decision. Instead, a new act will be drafted that addresses the court’s concerns and ensures Nova Scotians have a high level of protection when faced with cyberbullies.
“We have work to do over the next several months to gather the legal expertise and input needed to make sure the new act is strong, protects the public and addresses the concerns raised in the court decision,” said Ms. Whalen. “We want to get this right and that means finding a balance between the important right to freedom of speech and the protection of victims of cyberbullying.”
Targeted consultations will be conducted over the next several months. The earliest the new legislation will be introduced is in the fall.
The CyberSCAN unit will continue to educate students on cyberbullying while new legislation is drafted. CyberSCAN has helped hundreds of Nova Scotians since its introduction in 2013 and conducted over 800 presentations in schools across the province.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
WORSHIP is an act of religious devotion, often performed before a diety, but generally directed towards a “Higher Power”. It may be practised privately or in a congregation lead by a spiritual leader in a building – be it a church, a mosque, a synagogue, a temple or a gurdwara, formally consecrated for religious use.
CLASSIC HINDU TEMPLE IN SOUTH INDIA WITH SACRED POND AND SOARING TOWERS
HINDUS WORSHIP A MULTITUDE OF DEITIES. ACTS OF PUJA OFFERINGS ARE MADE TO THE OBJECT OF DEVOTION BOTH IN THE HOME AND IN THE TEMPLE, ESPECIALLY DURING COMMUNAL FESTIVALS. HERE A PRIEST OFFERS ARTI BEFORE LORD KRISHNA AND HIS CONSORT, THE POPULAR GODDESS RADHA.
THE ART-NOUVEAU STYLE SYNAGOGUE IN SUBOTICA, SERBIA WAS BUILT IN 1902
DURING THE TIME OF THE TEMPLE IN JUDAISM, THE ASSOCIATED RITES WERE CONSIDERED AN IMPORTANT ACT OF VENERATION, BUT THE MOST COMMON FORM OF WORSHIP REMAINS THAT OF PRAYER. HERE A MAN COMMUNES WITH GOD AT THE WESTERN WALL, ALL THAT REMAINS OF THE TEMPLE IN JERUSALEM.
THE YELE PAGODA IN MYANMAR, BUILT IN 3 BCE, IS SAID TO CONTAIN RELICS OF THE BUDDHA
BUDDHISTS OF THE THERAVADA SCHOOL FOLLOWED BY 94% OF THE POPULATION IN THAILAND MAKE OFFERINGS OF FLOWERS AND INCENSE AT A POPULAR SHRINE IN BANGKOK.
THE HUGE HASSAN II MOSQUE IN CASABLANCA HOLDS 25,000 WORSHIPPERS
IN ISLAM, WORSHIP REFERS TO RITUALISTIC DEVOTION AS WELL AS ACTIONS OUTLINED IN THE HOLY QUR’AN. PRAYER OR SALAAT SHOULD BE PRACTISED FIVE TIMES DAILY. iT MAY BE PERFORMED IN PRIVATE OR IN COMMUNAL WORSHIP, LEAD BY THE IMAM OF THE MOSQUE.
THE GURDWARA IS THE PLACE OF DEVOTIONALS IN SIKHISM
SIKH WORSHIP OF GOD, THE CREATOR, INVOLVE COMMUNAL RITUALS IN THE GURDWARA. HERE PEOPLE PAY THEIR RESPECTS TO THE GURU GRANTH SAHIB, THE SACRED TEXTS VENERATED AS A “LIVING GURU”- WAHEGURU- THE WONDERFUL GURU.
CELEBRATING THE HOLY EUCHARIST IS A COMMON FORM OF COMMUNAL WORSHIP IN THE ANGLICAN CHURCH. PRIVATE PRAYERS ARE ALSO SAID TO PROMOTE SPIRITUAL GROWTH AND COMMUNION WITH GOD. VENERATION OF THE VIRGIN IS WIDESPREAD AMONG CATHOLIC DENOMINATIONS.
Trump’s decision to move the US embassy from Tel Aviv to Jerusalem is distressing for Palestinians not only for political reasons since East Jerusalem was seen as capital of a future Palestinian state, but because al Haram esh-Sharif (the Noble Sanctuary) in the heart of the old city contains places of worship associated with the Prophet Muhammad of equal importance to Mecca and Medina.
VIEW OF THE NOBLE SANCTUARY IN EAST JERUSALEM. IT IS DOMINATED BY THE DOME OF THE ROCK BUILT BY THE UMAYYAD CALIPHS RULING FROM DAMASCUS IN 692 CE. AL-AQSA MOSQUE IS LOCATED AT THE SOUTHERN END OF THE PLATFORM FACING MECCA.
THE DOME OF THE ROCK, QUBBAT AS-SAKRAH, IS AN EARLY EXAMPLE OF MUSLIM ARTISTIC GENIUS. IT IS BUILT OVER THE SACRED ROCK ASSOCIATED WITH THE MIRACULOUS MI’RAJ, OR ‘NIGHT JOURNEY’, MADE BY THE PROPHET MUHAMMAD FROM MECCA TO JERUSALEM.
PALESTINIAN SCHOOLCHILDREN VISIT THE DOME OF THE ROCK IN EAST JERUSALEM, A SACRED MUSLIM SHRINE, IT IS BUILT OVER THE ROCK FROM WHERE, AFTER OFFERING A PRAYER, THE PROPHET MUHAMMAD ASCENDED INTO HEAVEN IN THE PRESENCE OF GOD.
EVERY INCH OF BUILDING IS COVERED IN GLEAMING TILES EMBELLISHED WITH GEOMETRIC PATTERNS, TYPICAL OF ISLAMIC ART, AND STYLISED CALLIGRAPHY RECOUNTING SIGNIFICANT EVENTS AND VERSES FROM THE HOLY QUR’AN.
THE SACRED SHRINE IS CONSTRUCTED OVER THE ROCK FROM WHERE THE PROPHET ASCENDED INTO HEAVEN. THE FIFTH CALIPH, ABD AL-MALIK, EMPLOYED FIFTY-THREE CLEANERS TO DAILY PURIFY IT WITH A BLEND OF MUSK, AMBERGRIS AND ROSEWATER.
A LAMP IN THE BELLY OF THE SACRED ROCK. IN UMAYYAD TIMES, 5000 LAMPS BURNING OIL OF JASMINE ESSENCE AND TAMARISK WERE USED TO PERFUME THE BUILDING.
STEPS BENEATH THE ROCK LEAD DOWN TO THE ‘WELL OF SOULS’, SO-CALLED BECAUSE MUSLIMS BELIEVE THE SOULS OF THE DECEASED LINGER HERE, BEFORE THEIR OWN DEPARTURE. THE GROTTO CONTAINS ISLAM’S OLDEST PRAYER NICHE.
THE AL-AQSA MOSQUE BUILT IN THE EARLY 8TH CENTURY IMMORTALISES THE MI’RAJ RECORDED IN SURAH XV11 OF THE QUR’AN: Glory be to him who has made his servant go by night from the Sacred Temple to the farthest temple whose surroundings we have blessed.
Ramadan, a month of sacrifice and endurance in the Muslim world is an occasion for visitors to share in the rewards of abstinence. After sunset.
However Islam is not unique in advocating disciplines at significant times of the year. Devout Christians do not consume red meat during the solemn period of Lent. Hindus eat but once a day during Shravan, a month dedicated to Lord Shiva. On Yom Kippur —the Day of Atonement—Jews, among other taboos, abstain from eating, drinking, washing or performing any sort of work for twenty-five hours.
This said, the sawm (fast) is especially difficult for Muslims since not a crumb of food, nor a drop of water can pass their lips between dawn and dusk during the entire ninth month of the Hijiri Islamic lunar calendar. Intercourse during daytime is further considered a grave sin.
SCENE IN THE EMIRATE OF AJMAN DURING THE FAST MONTH OF RAMADAN
Fasting is hard enough —try it yourself —but when Ramadan falls in summer, the extreme temperatures in Middle Eastern countries push people to the limits of endurance. Then in northern Europe, where the sun may not set until 10pm, Muslims must abstain for a punishing 15-16 hours, especially difficult for the thousands of Muslim waiters when all around are indulging in food and drink.
SHI’ITE FAMILIES IN IRAQ FAST IN THE COURTYARD OF THE IMAM ALI SHRINE IN KARBALA
Muslims fast not merely for atonement, but in an endeavour to come closer to God through scrupulous self discipline. Fasting teaches devotion, patience and fortitude: a dry mouth and a painful stomach reminding how the poor suffer at all times of the year. The experience is spiritual as well as physical. Devout Muslims will perform an extra twenty rakkas (bendings) when offering prayers. Others may spend the daylight hours reading the Qur’an.
MANY SPEND THE DAYLIGHT HOURS OF RAMADAN READING THE QUR’AN
While highly personal, Ramadan is equally a social occasion bringing people together in the knowledge that irrespective of class, or wealth, all are enduring pain. A feeling of goodwill prevails. People give more generously at this time and cook large meals for the less well off.
PAKISTANI WORKERS ENJOY AN IFTAR MEAL DONATED BY A WEALTHY ARAB IN DUBAI
in Muslim countries, a typical Ramadan day begins when the family rises to eat a nourishing meal before dawn. Shops close after the noon prayer, but during the morning food is sold in souqs and supermarkets for women to prepare dishes to be eaten when the fast is broken.
Men pass the long daylight hours sleeping and listening to Quranic recitals on the television, but as sunset approaches people emerge to pass the final hours outdoors.
A CANNON IS FIRED TO SIGNAL THE END OF THE DAYTIME FAST IN DOHA, QATAR
Waterfront corniches in the Arab states are thronged with crowds as the sun sinks into the Gulf. At the same time, Muslims throughout the world are walking out the last minutes to dusk. Then suddenly streets empty as all head home for iftar – literally break-fast.
THIRSTY AFTER THE LONG FAST PEOPLE TAKE WATER AND FRUIT
Starting with water, fruit juices and dates, little is eaten at first. Soup follows, then a main meal of meat or poultry, salads and rice.Family members and invited guests commonly sit around dishes laid out on a tablecloth on the floor. Everyone enjoys their food much more for having gone so long without. Festivities last until late, Ramadan lamps twinkle on street corners and foodstalls do a brisk trade in snacks and softdrinks.
A STREET STALL IN BANGLADESH DOES A BRISK TRADE IN RAMADAN SNACKS
Entering into the spirit of things, children run from house to house singing traditional ditties for a reward of sweets. Parks and carousels are crowded and young men race up and down in cars, playing music and sounding horns, but shortly after midnight before next day’s fast begins, you can hear a pin drop…….
Persons real or imagined are central to worship in most mainstream religions. Christians venerate Jesus Christ with the Virgin Mary having special significance for Catholics. Buddhists revere Sidi Gautama who became the Buddha and whose effigy is found in the sacred places wherever Buddha is known to have preached. Sikhs follow the teachings of Guru Nanak, the original guru who founded Sikhism in 1469. Then there are the Hindus —at last count exceeding 1 billion —who believe in one Supreme God manifested in hundreds of male and female forms and avatars. This Supreme Being is depicted in the Hindu trimurti/trinity in which the cyclical functions of creation, preservation and destruction are symbolised by three powerful deities: Brahma, Vishnu and Shiva. With other gods and goddesses mentioned in the Vedas, and in the epic poem the Ramayana, they are worshiped in temples all over India as well as in mandirs or shrines in family homes.
Brahma, the Creator
Ancient religious texts known as the puranas ascribe the creation of the Universe to Lord Brahma, the first god in the Hindu triumvirate. While an integral part of the Supreme God, he is no longer widely worshiped since it is considered his creative work has been done. Brahma’s consort is Saraswati, the Goddess of Music andLearning.
Vishnu, the Preserver
Vishnu is the second member of the trimurti. He maintains moral order and harmony in the Universe which is periodically destroyed by Shiva in order to prepare for the next cycle of creation. Hindu scriptures speak of Vishnu appearing as ten avatars which include a fish (here) a tortoise and a boar.
Shiva, the Destroyer
Shiva, the third member of the trimurti is tasked with destroying the Universe in order to prepare for its renewal at the end of each cycle. Shiva’s destructive power is regenerative, a necessary attribute to making renewal possible. Symbolising strength and virility he has many devotees known as Shaivites.
Krishna, the Compassionate
Hindus identify Lord Krishna as the teacher of the sacred Bhagavad Gita. From Kṛṣṇa, the Sanskrit word for the colour blue, Krishna is often depicted as a cow-herder cavorting in lush pastures. His promise that he will manifest himself whenever moral order declines has sustained Hindu belief for thousands of years.
Kali, the Durga Mother Goddess
Kali, or Durga Devi, is the powerful Mother Goddess who fights the buffalo demon Mahishasura in order to restore dharma. While terrifying to her adversaries, she is equally filled with love for her devotees. Durga Puja, a festival marking the battle, is held all over India, especially in her home city of Kolkata
Lakshmi, Goddess of Wealth
Lakshmi, Goddess of Wealth and good fortune, is prominent among Hindu female deities. The consort of Lord Vishnu, she has many followers especially among business people who lay their accounts before her image in hope of enjoying a prosperous year. A Lakshmi puja is held on the third day of Divali
Ganesh, Remover of Obstacles
Lord Ganesha, the jolly god with an elephant head, occupies a special place in the hearts of Hindus. Most families have a picture, or statue of him, in the home and he is worshiped at small street shrines as well as in Hindu temples. The annual festival of Ganesh Chaturthi celebrates his birthday.
Saraswati, Goddess of Wisdom
Mentioned in the Rigveda, Saraswati the goddess of learning, wisdom, and music. Students offer prayers to her during the school term and especially before their examinations. She is often dressed in white symbolizing light, knowledge and truth. Her four hands hold a book, a mālā rosary, a water pot and a musical instrument.
Hanuman, the Monkey God
Hanuman is widely worshiped in Hinduism. Starring in the epic poem, the Ramayana, he is celebrated for his strength, devotion, and courage while helping Rama (an avatar of Lord Vishnu) battle the demon king Ravana. His value lies in inspiring his followers to conquer obstructions in their own lives.
Surya, the Sun God
Surya, the golden Sun God is usually depicted arriving on a chariot pulled by seven horses. Once ranked in importance with Vishnu and Shiva, he has many temples dedicated to him and is invoked in the Gayatri mantra, uttered daily at dawn by millions of Hindus.
Images in this post are strictly copyright and may not be used in anyway without permission
St John’s Anglican Church was among the first public buildings erected by the East India Company when Calcutta became the official capital of British India in 1772. Its foundation stone was laid by the first Governor General of India, Warren Hastings, on 6th April 1784 and the church opened for worship in 1787. Built of stone from the ruins of the ancient Bengali town of Gaur, St John’s bears a passing resemblance to the 13th century church of St Martins-in-the-Fields in London. Its neo-classic style architecture is topped by a similar spire inset with a giant clock said to have been wound every day since its construction. Whether you are a Christian or not, a reason to visit St John’s is that its compound houses a monument in memory of the soldiers who suffocated in a small room in Fort William following the British surrender of Calcutta to the Nawab of Bengal, Siraj ud-Daulah, in April 1756. Of the 146 prisoners crammed in overnight, only 43 were still alive when the cell was unlocked next morning ——the dead, with no room to fall, remained on their feet. The lexicon “black hole of Calcutta” has entered the English language to mean anywhere small, dark and claustrophobic. The room concerned is said to have measured only 14x18feet.
An obelisk commemorating the lives lost on that terrible night was removed in 1821. The new Viceroy of India, Lord Curzon, built a new memorial in 1901, but due to the sensitivities of the Indian independence movement, it was taken to its present site in the shady compound of St John’s Church. Located on Netaji Subhash (NS) Road, St John’s is a quiet oasis in the maelstrom of modern-day Kolkata. Your transport can drive in and park outside the entrance of the church (leave a tip for the gate keeper on your way out).
Animal sacrifice is mentioned hundreds of times in the Old Testament, but over the centuries, both Judaism and Christianity have gradually consigned the practice to the past.
A fundamental difference within the disturbed world of Islam is that the majority of peaceful Muslims are unwilling to acknowledge, much less abjure, the warrant for violence and intolerance embedded in the Qur’an. The Qur’an is believed to be the direct words of God, revealed via the Angel Gabriel to the Prophet Muhammad,more than 1400 years ago. It is therefore considered sacrilegious to affect any changes in the text.
THE HEAD OF THE HOUSEHOLD CUTS THE THROAT OF A SACRIFICIAL ANIMAL IN LAHORE
Whereas Salafists take the Qur’an at its most literal, pious Muslims quietly adhere to its teachings on diet and dress without trying to impose Islamic lore on unbelievers. The problem is that many of their religious beliefs sit uncomfortably in the economic, cultural and political structure of democratic societies playing host to millions of Muslim migrants and refugees,
Islam espouses many customs that aggravate western sensibilities. Perhaps none is more sensitive than the edicts concerning women. Sura 4:34 …”Allah permits the hitting of women”…being one of the most noxious.
Ramadan, the month long fast when Muslims may not eat or drink between the hours of dawn and dusk may have been all very well for a herdsman resting under a date palm in 9thcentury Arabia, but the practice is unsuited in an inter-connected world.
A WRETCHED BULL FOR SACRIFICE IN INDONESIA WHICH HAS AN ABOMINABLE ANIMAL RIGHTS RECORD
Among other Muslim observances, Eid ul-Adha — the feast of sacrifice — is considered repugnant in societies with a concern for animal welfare. Dating from a time when Arabs offered blood sacrifices to pagan idols, it requires every Muslim family slaughter an animal at the end of the hajj pilgrimage (a symbolic act commemorating the willingness of the Prophet Ibrahim to sacrifice his son to God, and believed to bring good karma).
HOW TO EDUCATE CHILDREN ON KINDNESS TO ANIMALS WHEN SACRIFICE IS SEEN AS ENTERTAINMENT
On the first day of Eid ul-Adha an estimated 400 million animals worldwide have their throats cut — bull, buffalo, cow, sheep, camel, goat — whatever the head of the household can afford, with the meat then distributed, as an act of charity, to the poor.
DISTRIBUTION OF MEAT OF SACRIFICIAL ANIMALS IN BANDA ACEH
How much more compassionate it would be to gift the animal to a poor family for milk. Or to build up a small rural herd. It is also economically more sensible.
” Give a man a fish and he’ll eat for a day: give him a fishing rod and he’ll eat for a lifetime. ”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Lion’s Gateway Focus – Lisa Transcendence Brown
Lion’s Gateway Focus: Old Program Matrix Collapses Individually & Collectively for Convergence on a Higher Plane of Existence – Transcending Your Dis-Empowered State of Mind
8/5/2017
Your Consciousness Creates. It created, believed and supported the Old Earth Matrix, through your fears and your beliefs. You believed it all, because it WAS PHYSICALLY REAL at the time, yet it is no longer, unless you keep trying to make it so. Your fears keep you deeply embedded, your dis-empowered states. Your beliefs that you carry around with you, the stories that you tell yourself that keep you in this place. Your human is unaware that these realities are no longer true and that the STRUCTURES that held them in place (your unconsciousness) comes to a close, a conclusion, as your amnesia lifts and the dis-illusion becomes visible both within and outside of you. Read more
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Big Mac attack
Patrick McGuigan made the most out of his opportunities after the University of San Francisco gave him the chance to pitch
Patrick McGuigan has been successful in every role asked of him the past four seasons by San Francisco Dons baseball coach Nino Giarratano.
The right-hander worked nine games out of the bullpen as a freshman and became a fixture there the next two seasons before finally getting a start as a junior.
This year, injuries to the pitching staff gave McGuigan the opportunity to start, and he has responded with a 9-2 record. He was so impressive during March that he was named the West Coast Conference pitcher of the month.
Despite being the Star-Bulletin's All-State Pitcher of the Year in 2002, McGuigan was not recruited. He also teamed with catcher and current Hawaii Rainbow Matt Inouye, the Star-Bulletin All-State Offensive Player of the Year, to lead the Mid-Pacific Owls to the state championship.
"The Dons weren't going to recruit me, but said I was welcome to come and try out. They said the program was going in a good direction and it would be a good place to play," said McGuigan, whose sister, Nanea, was working in the USF athletic department at the time.
Giarratano, who never saw McGuigan play a high school game, received a telephone call from MPI baseball coach Dunn Muramaru.
"He said nothing but great things about Patrick. He told me what a great competitor Patrick was. Dunn saw the potential," said Giarratano. "We wanted to give Patrick an opportunity. We're sure glad we did."
McGuigan enjoys the reliever role. He is USF's all-time saves leader with 17 and the career leader in appearances (86).
"There is pressure as a reliever, but fortunately I had a lot of opportunities and chances to get better. The team relies on you a lot and I have been fortunate to keep that position (as a reliever)," McGuigan said.
Although he made 12 starts this year, McGuigan still has seen action out of the 'pen. When he is there and it's late in the game with the score tight, he begins getting ready.
As the 2006 season evolved and the Dons battled for one of the two playoff berths in the WCC championship series, McGuigan has been in the 'pen Friday and Saturday. If he wasn't needed or just faced a couple of batters to close a game, he would start Sunday.
"Patrick did wonderful as a starter, but is so valuable late in the season coming out of the 'pen. Winning games is such a high commodity," Giarratano said.
"It is kind of a dual role for Patrick. He has pitched a lot of innings, so now I want more quality than quantity.
"He throws three pitches -- fastball, slider and changeup -- for strikes. He has movement on his fastball. His slider to right-handed hitters, at times, is unhittable.
"It is about the same velocity as his fastball and looks like a fastball until the last 5 feet. And, when batters start going outside for the slider, they can't handle the inside fastball."
McGuigan pitched two shutout innings last Friday to get the win as USF beat Loyola Marymount 5-4 in 11 innings, then started and got the victory Sunday as the Dons swept the series to win their first-ever WCC title.
Not an overpowering pitcher, McGuigan relies on getting opponents to make contact, not solid contact, then letting his teammates do the rest.
"We have a solid defensive team this year. They make plays for you, and that is comforting," said McGuigan, who had no plans to be a starter this year. "When Coach gave me the opportunity, I had some success."
McGuigan acknowledges the slider is his dominant pitch and he uses it often. He takes pride in hitting his spots and getting opponents to hit ground balls.
"No matter what I have asked, starter or closer, Patrick does the best he can and that is why he is so successful. His command of his pitches is his greatest strength," Giarratano said. "We don't have a team captain, but emotionally, he has great leadership qualities."
Being named player of the month -- when he was 4-0 with a 1.59 ERA and held opponents to a .139 batting average -- was unexpected.
"I don't pay attention to things like that. You don't shoot for those things. It just happened," McGuigan said.
"It obviously was a team effort. There are guys out there who score runs and make me look good."
The highlight of McGuigan's USF career came earlier this year when he defeated then-No. 22 Pepperdine in the deciding meeting of a three-game series.
"It was the first time in a long time we won a series there. It was big for our program," he said.
McGuigan ranks second on the Dons' career list for wins (21), is sixth in strikeouts (170) and eighth in ERA (2.84).
He graduates with a degree in marketing today and would like to stay in San Francisco if he doesn't get a chance to play pro ball.
"There has been a little interest. The scouts are not swarming, but you never know what will happen with the draft, McGuigan said.
"It has been a great four years. I've had a lot of fun. The teams I've been a part of are more than you can ask for. The coaches help you learn and make you work hard. San Francisco has all kinds of people and it is a great place to learn outside of the world of baseball."
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Photo credit: @alabamapublicradio | Twitter
A German court in the town of Traunstein sentenced a 30-year-old rejected Muslim refugee to life imprisonment on Friday after he murdered a 38-year old woman in front of a supermarket last year.
The Afghan man had stabbed the woman to death in the Bavarian town of Prien am Chiemsee in April 2017.
The horrible act was furthermore committed before the eyes of two of the woman's sons, aged 5 and 11 at the time, who are now traumatized for life.
The mother of two had converted to Christianity while still in Afghanistan and had lived in the German town since 2011. She was an active member of the community and was involved in helping the Protestant church.
<blockquote class="twitter-tweet" data-lang="en"><p lang="de" dir="ltr"><a href="https://twitter.com/hashtag/Prien?src=hash&ref_src=twsrc%5Etfw">#Prien</a> am Chiemsee:<br>Afghane ermordet Mädchen, weil sie Christin war.<a href="https://t.co/F3Irh6jzPL">https://t.co/F3Irh6jzPL</a></p>— erwilldochnurspielen (@willnurschreibn) <a href="https://twitter.com/willnurschreibn/status/962079419098714112?ref_src=twsrc%5Etfw">February 9, 2018</a></blockquote>
<script async src="https://platform.twitter.com/widgets.js" charset="utf-8"></script>
The man's defense attorney, Mr Harald Baumgärtl, tried to appeal for leniency with the court, stating that his client had been confronted "from his earliest childhood with violence, blood and death."
The illiterate refugee explained to the court that he couldn’t bear the fact that the woman had converted to Christianity and said that she had spoken to him multiple times about her new found happiness in the religion and therefore had tried to convert him as well.
Islam not only forbids its followers to convert to other religions or renounce their faith, if a follower does convert to another religion and relinquishes Islam that is punishable by death in some countries.
<blockquote class="twitter-tweet" data-lang="en"><p lang="de" dir="ltr">Urteil <a href="https://twitter.com/hashtag/Prien?src=hash&ref_src=twsrc%5Etfw">#Prien</a>: Der Afghane wird wg. dem <a href="https://twitter.com/hashtag/Mord?src=hash&ref_src=twsrc%5Etfw">#Mord</a> an seiner zum Christentum konvertierten Landsfrau zu lebenslanger Haft verurteilt - es wird zudem eine besondere Schwere der Schuld festgestellt - Haftentlassung nach 15 Jahren somit so gut wie ausgeschlossen<a href="https://t.co/GprIYqW3bv">https://t.co/GprIYqW3bv</a></p>— Einzelfallinfos (@Einzelfallinfos) <a href="https://twitter.com/Einzelfallinfos/status/962023045752799234?ref_src=twsrc%5Etfw">February 9, 2018</a></blockquote>
<script async src="https://platform.twitter.com/widgets.js" charset="utf-8"></script>
The woman’s oldest son stated that he hoped the accused would "receive the punishment he deserved" and above all not be sent back to Afghanistan as the boy believed he would be "celebrated for what he had done" over there.
Source:
https://www.wochenblatt.de/boulevard/chiemgau-bgl/artikel/226083/lebenslaenglich-mit-besonderer-schwere-der-schuld
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Edgar Morais
Edgar Morais (born June 25, 1989) is an actor, writer and director. Morais started his acting career on stage in several productions including the Portuguese Golden Globe winning adaptation of Shakespeare's Julius Caesar directed by Luis Miguel Cintra. He made his feature film debut as an actor in Catarina Ruivo's drama From Now On.
Personal life
Morais was born in Portugal, to an antique restorer mother and a contractor father. He was raised in Lisbon and attended EPTC, one of Portugal's oldest and most prestigious acting schools. Morais speaks fluent English, Portuguese, French, and Spanish.
Edgar Morais currently lives in New York City.
Theater career
Morais made his stage debut in William Shakespeare's Macbeth at the Mirita Casimiro Theater in Lisbon in 2006. He has appeared in many theater productions since including Moliere's A Rehearsal at Versailles, Brian Friel's Lovers, Jean Genet's Deathwatch and Arnold Wesker's The Kitchen.
Morais is also known for his role as Lucius in the Portuguese Golden Globe winning adaptation of The Tragedy of Julius Caesar, written by William Shakespeare and directed by Luís Miguel Cintra, at the São Luiz Municipal Theater in Lisbon.
Film career
In 2007, while still in theater school, Morais made his acting film debut in From Now On, directed by Catarina Ruivo (winner of the Audience Award at Rio de Janeiro Film Festival).
While living in Los Angeles, Morais was cast in the Lucas Elliot Eberl-directed drama, Fault Line (2009) alongside Michael Welch, Chris Marquette, Leah Pipes and Angela Sarafyan, in the hit NBC TV show CTRL, directed by Robert Kirbyson starring Steve Howey and Tony Hale, and in Q'orianka Kilcher's (Terrence Malick's The New World) directional debut film, Saudade. Morais also appeared in Chasing Eagle Rock directed by Erick Avari, with Beth Behrs and Michael Welch, in The Monogamy Experiment directed by Amy Rider alongside Shailene Woodley and Renee Olstead and in Oh Gallow Lay directed by Julian Wayser which premiered at the Venice Film Festival in 2015.
Morais can also be seen in the 2018 film Marfa Girl 2 directed by Larry Clark, and in the forthcoming Chalk directed by Victoria Mahoney alongside Shiloh Fernandez and Mirrah Folks.
Heatstroke starring Leah Pipes, Michael Welch and Paul James Jordan marks Morais' narrative directorial debut. The short film had its world premiere in the official selection at IndieLisboa International Film Festival on May 4th 2019, where it competed for the Short Film Grand Prize. Heatstroke was also an official selection at FEST New Directors New Films Festival in June 2019, where it competed for the National Grand Prix.
In 2019, Edgar was as one of only 10 actors selected to take part in "Passaporte", an initiative created by the Portuguese Academy of Cinema (Academia Portuguesa de Cinema) to present and promote Portuguese cinema talents to some of the most influential casting directors in the world.
Edgar Morais is currently in production on his feature film directorial debut, You Above All, which he also wrote, co-directing with Lucas Elliot Eberl, starring himself alongside Olivia Thirlby, Steven Weber, Richard Riehle, Rita Blanco and John Robinson.
Filmography
References
External links
Category:1989 births
Category:Living people
Category:Portuguese male film actors
Category:Portuguese male television actors
Category:Portuguese male stage actors
Category:People from Coimbra
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Multilingual website using OWIN and asynchronous methods
Background
I'm creating a simple, multilingual website using ASP.NET 4.6, C#, OWIN pipeline on IIS (Microsoft.Owin.Host.SystemWeb), lots of asynchronous method calls and standard, global resource files (*.resx in App_GlobalResources). The website uses MVC5, WebAPI2 and Autofac as dependency resolver.
Problem
I can't correctly change the locale/culture of generated pages, because asynchronous methods use multiple threads per request and I can't find a way to set Thread.Current[UI]Culture for every thread associated with given request as those properties aren't synchronized. I would also like to stay with clean code without "async/await culture configuration" messing with useful code.
Code
Startup.cs
public void Configuration(IAppBuilder app)
{
...
app.UseAutofacMiddleware(container);
app.UseAutofacMvc();
app.UseAutofacWebApi(httpConfiguration);
app.UseWebApi(httpConfiguration);
...
app.Use(async (ctx, next) =>
{
/* in production, detect based on current URL and/or cookie */
var culture = new CultureInfo("pl_PL");
CultureInfo.CurrentCulture = CultureInfo.CurrentUICulture = culture;
await next.Invoke();
});
}
SampleController.cs
public async Task<ActionResult> SayHello()
{
// returns pl_PL message
var msgA = Resources.Messages.HelloWorld;
await someService.doSthAsync();
// returns system default (en_US) message
var msgB = Resources.Messages.HelloWorld;
return Content(msgA + " - " + msgB);
}
Should I create a custom [AspNet]SynchronizationContext as suggested in this SO answer? If that is the case how should I do that?
Should I give up on global resouorces as source of translations and use some other approach? If so, what (library?) could I use?
A:
What about using the Owing Globalization Library, it seems like it was created just for this purpose.
You can still use your resx to localize your resources, and it has great customization capabilities:
public void Configuration(IAppBuilder app)
{
...
app.UseGlobalization(new OwinGlobalizationOptions("en-US",true)
.DisablePaths("Content", "bundles")
.Add("fr-FR", true).AddCustomSeeker(new CultureFromPreferences()));
}
I have tested the use of async/await and the culture is preserved:
public async Task<ActionResult> About()
{
var msgA = Resources.Resources.About;
await Task.Delay(1000);
var msgB = Resources.Resources.About;
ViewBag.Message = msgA + " - " + msgB;
return View();
}
Note: I'm not the author of the library, I happen to have used it before.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The RhoA-ROCK-PTEN pathway as a molecular switch for anchorage dependent cell behavior.
The proliferation of anchorage-dependent cells of mesenchymal origin requires the attachment of the cells to substrates. Thus, cells that are poorly attached to substrates exhibit retarded cell cycle progression or apoptotic death. A major disadvantage of most polymers used in tissue engineering is their hydrophobicity; hydrophobic surfaces do not allow cells to attach firmly and, therefore, do not allow normal proliferation rates. In this study, we investigated the molecular mechanism underlying the reduced proliferation rate of cells that are poorly attached to substrates. There was an inverse relationship between the activity of the small GTPase RhoA (RhoA) and the cell proliferation rate. RhoA activity correlated inversely with the strength of cell adhesion to the substrates. The high RhoA activity in the cells poorly attached to substrates caused an increase in the activity of Rho-associated kinase (ROCK), a well-known effector of RhoA that upregulated the activity of phosphatase and tensin homolog (PTEN). The resulting activated PTEN downregulated Akt activity, which is essential for cell proliferation. Thus, the cells that were poorly attached to substrates showed low levels of cell proliferation because the RhoA-ROCK-PTEN pathway was hyperactive. In addition, RhoA activity seemed to be related to focal adhesion kinase (FAK) activity. Weak FAK activity in these poorly attached cells failed to downregulate the high RhoA activity that restrained cell proliferation. Interestingly, reducing the expression of any component of the RhoA-ROCK-PTEN pathway rescued the proliferation rate without physico-chemical surface modifications. Based on these results, we suggest that the RhoA-ROCK-PTEN pathway acts as a molecular switch to control cell proliferation and determine anchorage dependence. In cells that are poorly attached to substrates, its inhibition is sufficient to restore cell proliferation without the need for physico-chemical modification of the material surface.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
But since the predominant organizational headgear for the Detroit Pistons the past five years resembled that of a court jester, there's understandably some excitement at The Palace of Auburn Hills that their search for a new president of basketball operations and head coach ended with a single hire.
Stan Van Gundy can coach. But Tom Gores is gambling a reported $35 million over the next five years that Van Gundy can capably juggle the daunting responsibilities of coaching a team that chews coaches up and spits them out with regular ease, while also overseeing a vast organizational cultural change.
Good luck.
Van Gundy's a recycled coach liberated from the NBA scrapheap, cleaned, polished and passed off as a fresh new vision for what would be his third team.
Nobody disputes that he knows his basketball. But if this was the best chief executive that the headhunting firm Gores commissioned to engage in a far-reaching personnel search could come up with, it's yet another example of the Pistons being more interested to engage in what's expeditious rather than what's the correct path for a franchise desperately seeking a complete rebuild.
The best candidate's often the guy you never heard of, somebody unearthed through exhaustive diligence. There was an assistant general manager out there with a wealth of knowledge from successful organizations such as the San Antonio Spurs and Oklahoma City Thunder that have consistently won through sound drafting.
But instead the Pistons opted for an attention grab, combining both positions to entice interest amid other more high-wattage head coaching openings with the Golden State Warriors, New York Knicks and Los Angeles Lakers.
GALLERY: NBA offseason coaching carousel
Byron Scott was hired by the Lakers after being fired a year ago by the Cavaliers. Scott, a great player for the Lakers in the 1980s and 1990s, has a 416-521 career record with three teams (Cleveland, New Orleans and New Jersey). Brett Davis, USA TODAY Sports
The Cavaliers hired David Blatt, a veteran European coach with no NBA experience. Blatt last coached Maccabi Tel Aviv but also has coached the Russian national team and other teams in Israel, Russia, Greece, Italy and Turkey. Guiseppe Cacace, AFP/Getty Images
Flip Saunders already was the Timberwolves' president of basketball operations, but after not landing the head coach he wanted, he'll take that job, too. Saunders has a 638-526 career record. Richard Sennott, AP
Steve Kerr will get his first coaching experience with the Warriors, who hired him to replace Mark Jackson. Kerr was general manager of the Suns from 2007 through 2010. Robert Hanashiro, USA TODAY Sport
John Loyer may still have a job with the Pistons, but the interim head coach tag is no longer his. Loyer went 8-24 after taking over for Maurice Cheeks but will be replaced by Stan Van Gundy. Tim Fuller, USA TODAY Sports
Like this topic? You may also like these photo galleries:
The Spurs' Gregg Popovich became head coach after already holding the general manager title, and his team has a trusted player evaluation system in place. Doc Rivers got the added title from the Los Angeles Clippers as a means for prying him loose from the remaining years of his coaching contract with the Boston Celtics last year.
But it won't work with the Pistons.
It's not about maintaining a blueprint but rather creating it. There's too much attention to detail as the director of basketball operations, especially for a franchise seeking an escape from the competitive abyss.
There really isn't any down period in a basketball presidency. It doesn't matter how many basketball eyes Van Gundy trusts as his subordinates out there in collegiate outposts on wintry nights attempting to find that raw diamond in the next draft. Van Gundy himself must be directly involved.
But he'll be coaching in Milwaukee and Minnesota, trying to squeeze the maximum out of the talent he inherited.
Both the coaching and franchise supervision could suffer under those conditions.
This was another public relations move for Gores. Another attempt at convincing an increasingly disinterested public that NBA basketball is still relevant in the Detroit area.
I'm sure he's pleased that he snatched Van Gundy away from the Warriors with the promise of organizational control. But it was an unnecessary risk putting absolute trust in somebody with absolutely no prior basketball administrative experience.
Van Gundy lost previous battles with management in regards to his occasionally combative coaching style. He butted heads with Dwight Howard as the Orlando Magic's head coach, ultimately leading to his dismissal two years ago.
But this time, he would have the backing of the front office because he would be the head of the front office.
Perhaps that ensures that Van Gundy the Pistons president will keep Van Gundy the Pistons head coach longer than 50 games next season.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Phaser3 Scenes transitions
I'm new to Phaser3 and before starting a crazy project, I want to know how I should start, switch between scenes. I saw that there are several functions, start, launch, switch, run, resume, pause, etc...
Example, lets say I want to have 2 scenes, a Menu and a Game. I boot on the Menu and I want to go to the Game scene and if I click on a button then come back to the Menu scene. I've achieved this by calling the start function, but I noticed that the all, init, preload and create functions are called everytime and therefore I'm loading all the images, setting all the listener over and over again.
This seems wrong, should I be using the launch or switch functions and pausing and resuming? But how do I hide the previous scene?
Thanks in advance.
A:
This question might be a little too broad, but with Phaser 3 in mind, it still depends upon what purpose your menu serves.
I think most games have a main menu that will generally be called when the game first starts, and then won't be called again.
If this is an in-game menu, where settings can be changed or part of the game can be reset/restarted, then it might not make sense to redirect to a completely different scene.
With Phaser 3's support of multiple scenes - with Dev Log #119 and Dev Log #121 probably being the best current sources of information - another option would be to start a new scene within the current scene to handle this.
However, if this is really just UI, there's nothing to stop you from creating an overlay, instead of spawning an entire scene.
If you're concerned about performance I might think about whether the entire menu needs to be called, or if a simplified menu would work. Also, make sure that you're preloading assets before you're in the menu and main game.
I personally use Boot > Preloader > Splash Screen > Main Menu > Main Game scenes, where the Preloader loads the majority of the assets I'll need. This has the downside of a longer initial load, but the upside of minimal loading after this point.
Scene Transitions
How I handle these in my starter templates is to add the scenes to the Scene Manager when creating the scene. Then I transition by start to the first scene.
this.scene.add(Boot.Name, Boot);
this.scene.add(Preloader.Name, Preloader);
this.scene.add(SplashScreen.Name, SplashScreen);
this.scene.add(MainMenu.Name, MainMenu);
this.scene.start(Boot.Name);
Then I simply keep starting the next scenes as needed.
this.scene.start(Preloader.Name);
For another game that uses multiple scenes I ended up creating the following function (TypeScript) to handle this:
private sleepPreviousParallelScene(sceneToStart: string): Phaser.Scene {
if (this.uiSceneRunning !== sceneToStart) {
// Make sure that we properly handle the initial state, when no scene is set as running yet.
if (this.uiSceneRunning !== "") {
this.scene.get(this.uiSceneRunning).scene.sleep();
}
const newScene = this.scene.get(sceneToStart);
newScene.scene.start();
this.scene.bringToTop(sceneToStart);
this.uiSceneRunning = sceneToStart;
return newScene;
} else {
return this.scene.get(this.uiSceneRunning);
}
}
In the game I was using this for, I was trying to replicate a standard tab interface (like what's see in the Dev Logs above with the file folder-like interface).
| null |
minipile
|
NaturalLanguage
|
mit
| null |
6 life lessons that Kuch Kuch Hota Hai taught us
Karan Johar’s Kuch Kuch Hota Hai released on this day 20 years ago… time does fly past doesn’t it? For an entire generation, Kuch Kuch Hota Hai was much more than just a film as it taught us the true meaning of friendship and the true meaning of love. Not only this film went on to be a blockbuster, but even today it is regarded as one of Bollywood’s most iconic films. It is hard to put a finger on one thing that you like the most in the film simply because there is so much to love about it. For starters, It had one of Bollywood’s favourite on screen pair of Shah Rukh Khan and Kajol and if this wasn’t enough star power, it also featured Salman Khan and Rani Mukerji in supporting roles. The film had a story that accurately depicted the value of relations in one’s life and to top it all there were some thumping numbers that topped the charts for quite a while after the release. But, beneath all that ‘naachna gaana’, we learnt a few lessons about relationships that are applicable to our lives even today. Have a look!
Never suppress your feelings
Remember the dialogue about ‘dil ki baat’ from the Rifat Bi (Himani Shivpuri)? She always used to tell Anjali that, “Dil ki baat dil mein nahi rehni chahiye.”. What she obviously means by this is that matters of the heart must not be suppressed. Suppressing your feelings gives you nothing but pain and regret.
Later on in the film, when Rahul (Shah Rukh Khan) is playing a game with his daughter in which he has to say the first word that comes to his mind on hearing something he ends up saying Anjali Sharma (Kajol). Coincidence? We think not. In fact, this scene showed that even though Rahul might not have admitted it but in his heart he still loved Anjali.
Love is friendship
The most popular dialogue from the film - “Pyaar dost hai”. Kuch Kuch Hota Hai also taught us that friendship is the first step towards love. At a time when love stories were all about just falling in love, the film showed us that there is more to love than meets the eye.
The most important thing in a relationship is that you must be completely open and comfortable with your special one like you are with your best friends. Anjali and Rahul always looked at each other as good friends however the two of them did no realise how and when that friendship turned into something more.
You can find love again
Yes, we remember the dialogue from the film which says, “Hum ek baar jeete hain, ek baar marte hain. Shaadi ek baar karte hai, aur pyaar bhi ek hi baar karte hai.” However, the film itself proves that you can find love again. After Tina’s (Rani Mukerji) death, Rahul had accepted a life without ‘love’. He was in the belief that there is only one girl out there for every man and he lost his and now has to live with the fact. So, whatever the situation you might yourself in, always believe in love and don’t lose hope just because of one bad experience. Maybe you have an Anjali somewhere out there for you as well.
You’re pretty great just the way you are
The great Oscar Wilde once stated: “Be yourself; everyone else is already taken.” Well, Kuch Kuch Hota Hai proved that what he said was just right. It is only human nature to feel that the grass is greener on the other side. So, we try to ‘become’ like other people hoping that we feel more accepted and more important in the society. However, you must realise that nobody, we repeat nobody is perfect and that changing yourself will never be the answer to your problems.
In the film, when Anjali notices that Rahul is attracted to Tina, she tries to become more like her by putting on a short skirt and some lipstick. However, her assumption that Rahul will magically fall in love with her because of her makeover doesn’t come to fruition. Instead, she is mocked by Rahul and the rest of the college. So, trying to be like someone else won’t help you in anyway. Instead, you’ll be better off with someone who loves you for the way you are.
Always keep your promise
Do you recall what were you doing at the age of 8? Probably playing a video game or hanging out with some friends in school. Rahul’s daughter Anjali (Sana Saed) meanwhile was trying get her father reunited with his closest friend just to fulfil the promise she made to her deceased mother. She eventually goes on to complete her mother’s last wish which teaches us that regardless of age, if we make a promise, we must act upon it.
Love happens when you least expect it
When Rifat Bi tells Anjali that she will not know when friendship turns into love, Anjali shrugs off the idea. However, Anjali does fall for the snobbish, self centred and stubborn Rahul in the process doing something she never thought was possible. Which is why the film proves that there is no place or time to fall in love. It just… happens.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Previous Events
Rutgers Selects the Albira Preclinical Imaging System from Carestream Molecular Imaging for its New Molecular Imaging Center
Product News: Rutgers Selects the Albira Preclinical Imaging System from Carestream Molecular Imaging for its New Molecular Imaging Center
21 Aug 2012
Rutgers University has added an Albira PET/CT system from Carestream Molecular Imaging to its new Molecular Imaging Center in Piscataway, N.J.
Located in a specially renovated facility near Rutgers’ Livingston campus, the Molecular Imaging Center now houses the Albira PET/CT, a Carestream In-Vivo MS FX PRO optical imaging system, an MRI system, 3-D displays and other technologies, plus a federally registered holding facility for small animals. The center will support research in basic sciences, cardiovascular and neurodegenerative diseases, cancer, and many other fields.
The Albira purchased by Rutgers is a single system with two imaging modalities: PET (positron emission tomography) and CT (computerized tomography). It is also upgradable to add a third modality: SPECT (single-photon emission computed tomography). The Albira system features a unique modular architecture that introduces an exclusive, patented single-crystal detector technology and associated electronics for rapid acquisition and reconstruction of highly resolved quantitative PET and SPECT images. This approach contrasts with the pixelated crystal technology used in most current PET and SPECT systems today. Albira offers unprecedented sensitivity and resolution allowing scientists to visualize metabolic processes and structures in small living animals.
Rutgers and Carestream have also signed a two-year collaborative agreement. The deal provides Rutgers with the Albira unit plus additional hardware, computer systems, and software. The agreement calls for Rutgers to collaborate with Carestream on product awareness, scientific knowledge exchange and new product innovation. The university’s lab also will become a user demonstration site.
“Scientific knowledge exchange is the most significant aspect of this agreement,” said Patrick J. Sinko, Ph.D., R.Ph., Associate Vice President for Research and Parke-Davis Chair Professor of Pharmaceutics, who developed the center. “This is a major asset for life-sciences research at Rutgers and we’re pleased to provide this service to our faculty.
“We’re also excited about opening our doors to scientists with New Jersey companies and other universities and colleges,” Sinko said. “There are no other imaging facilities in the area that offer the breadth of imaging technologies and faculty expertise in novel imaging approaches and analysis. This strategic partnership means more than just state-of-the-art resources – it’s going to lead the way into the future of research imaging.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[A new possibility of "non-parenteral" (local) vaccination: immunization per wound (author's transl)].
Hitherto the term "non-parenteral" (local) vaccination meant all those modes of vaccination where the vaccine is applied on the skin or the mucous membranes. The most common types of local immunization are oral and nasal vaccination. Using model studies with the mouse immunization per wound was investigated as an alternative mode of vaccination. Immunization was done with tetanus-toxoid, efficiency was tested by challenge with 10 LD50 tetanus toxin. For immunization per wound only slightly higher antigen doses are necessary compared with subcutaneous immunization. A single subcutaneous vaccination with 2 Lf tetanus-toxoid and a single application per wound of 10 Lf resulted in the same efficiency index of 100. Immunization per wound has to be carried out immediately after injury. It seems to be optimal within the first 3 to 5 hours. At a later time the same efficiency index can only be achieved by use of a higher antigen doses. Immunization per wound is possible with all kinds of wound, even with burns. Size of wound and wound-supply do not influence the efficacy of wound-immunization. Immunization per wound does not disturb wound healing. The experiments reported here showed, for the first time, that immunization per wound is as effective as parenteral immunization. The most important advantage of wound-immunization is the speed and ease with which it can be administered, a fact which predestines it for vaccination in emergency cases. In practice it will be useful to combine wound-vaccination with wound-sprays.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
We were just served notice that UBC is appealing the court case we've been fighting them on for the past three years. Again.
After UBC originally refused The Ubyssey's Freedom of Information request for their grading rubrics for broad-based admissions, the BC Office of Information and Privacy (OIPC) demanded they release them. So they sued the OIPC in the BC Supreme Court, and we won there too.
After the latest decision, the university had a choice — they could hand over the rubrics the OIPC and the BC Supreme Court demanded they release, or they could try again in the BC Court of Appeal. They chose the latter.
UBC has now been ordered multiple times by multiple officials to release the documents, but they're determined to waste tens of thousands of dollars on a case they're destined to lose, fighting against their own students in the interest of opacity. We've sent a freedom of information request to find out exactly how much money the university has wasted fighting us in court and we'll let you know as soon as we find out.
For a university wracked with transparency issues that can't seem to stop hiking tuition and housing fees, it's interesting to say the least that they continue to treat non-transparency as a key fiscal priority.
See you in court, UBC.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Jump up ^ Braden, Donna R.; Village, Henry Ford Museum and Greenfield (1988). Leisure and entertainment in America. Henry Ford Museum & Greenfield Village. ISBN 9780933728325. Archived from the original on 15 July 2014. Retrieved 2 June 2014. Halloween, a holiday with religious origins but increasingly secularized as celebrated in America, came to assume major proportions as a children's festivity.
In Marvel Zombies Return Spider-Man is teleported to a new world, where he consumes and infects the Sinister Six (except for Sandman). As his cosmic abilities did not come with him, and his webshooters have dried up, the zombified superhero is forced to make do with his own veins and arteries. Following the death of the Spider-Man of this universe (killed by Sandman in revenge for the deaths of the Sinister Six)[16] the zombie Spider-Man works on developing a cure for the plague with the aid of the Kitty Pryde of this universe, using nanites and the blood of this world's Wolverine.[17] With the zombie Giant-Man having followed Spider-Man to this new reality, Spider-Man resolves to stop Giant-Man.[18] Spider-Man releases the Sandman, now infused with nanites, and wipes out every zombie hero and villain. Zombie Spider-Man dies from being exposed to his own weapon.[volume & issue needed]
Spider-Man is an unlockable character in the Facebook game Marvel: Avengers Alliance. As an Infiltrator, he gains the Combat Awareness buff after attacking Tacticians. He has tremendous agility and an appropriate repertoire of powers, including: web-based attacks and his Spider Sense. He starts with his traditional red & blue costume, but players can purchase the black costume to fight as an ebony Infiltrator or a nefarious Bruiser. By unlocking Spider-Man players also gain access to the bonus missions in Chapter 3 of the single-player campaign.
During The Gauntlet storyline, a new Captain Universe makes himself known when he arrives on Earth with plans to kill Juggernaut.[17] Spider-Man learns that Captain Universe is a man named William Nguyen who wants revenge on Juggernaut for ruining his life during one of his rampages.[18] When he insists on trying to kill Juggernaut instead of fixing the tectonic plates beneath New York City, the Uni-Power leaves Nguyen and enters the Juggernaut. The Juggernaut, as Captain Universe, repairs the damage to the tectonic plates that was caused by him during the same rampage that ruined Nguyen's life. After the 'healing' of the tectonic plates, the Uni-Power subsequently leaves the Juggernaut and is not further seen.[19]
Spider-Man first appears in the episode Along Came A spider where he helps Captain America fight the serpent society He next appears in New Avengers where he leads the New lineup of Avengers against Kang...after the victory and return of the Original Avengers he officially becomes a member (although a reserve one). The last time he appeared was Avengers Assemble amongst the rest of Earth's heroes fighting The Heralds of Galactus.
In Scotland, Midnight and Glaive ambush Scarlet Witch and the Vision in an attempt to forcibly remove the Mind Stone located in the Vision's head. Since removing the stone would also kill the Vision, the two heroes attempt to resist, but are overwhelmed by Thanos' children. When it looks like that they will succeeded in taking the Mind Stone; Steve, Black Widow and Falcon swoop in and resuce their comrades from Midnight and Glaive before regrouping with War Machine and Bruce at the New Avengers Facility in upstate New York. Realizing that their assailants won't rest till they have the stone and not wanting to see any of his friends or loved ones get hurt trying to stop them, the Vision offers to sacrifice himself by having Scarlet Witch destroy the Mind Stone to keep it out of the hands of Thanos' children. Rather then sacrifice his friend, Steve suggests that they go to Black Panther for help citing that Wakandan science might have a way to remove the stone without killing the Vision.
After escaping through the Bifröst, the Hulk crash-lands into the Sanctum Sanctorum before reverting to his alter ego Bruce Banner. After being discovered by the Sanctorum's guardian Doctor Strange and his assistant Wong, he warns them that Thanos and his forces are coming to Earth to find the remaining Infinity Stones as part of plan to use the stone's combined power in conjunction with the Infinity Gauntlet to kill half of all life in the universe. In response to Bruce's warning, Doctor Strange calls Bruce's former teammate Iron Man the Sanctorum in order to get his assistance in thwarting Thanos' plan. Shortly after Iron Man arrives, Thanos' children Maw and Obsidian arrive to retrieve the Time Stone located inside amulet around Doctor Strange's neck. The ensuing battle draws the attention of Iron Man's protégé Spider-Man who assists his mentor and Doctor Strange in fighting off the alien invaders. After subduing their target, Maw and Obsidian retreat with back to their ship where Maw attempts to remove the stone from the Eye of Agamotto, but an enchantment placed on the amulet prevents Maw from removing the Time Stone. Iron Man and Spider-Man decide to pursue Maw's spaceship to rescue their comrade while Wong stays behind to guard the Sanctorum and Bruce leaves to contact Steve Rogers for help.
In an unidentified alternate universe, Peter and Ben Parker live together in a Latin & Spanish neighborhood and Ben is married to a Spanish Aunt May. When Ben got shot by a mugger, he had a blood transfusion with Peter and got his nephew's Spider-powers. When Ben became Spider-Man, he was a ruthless hero where he once severely beat up Kraven the Hunter. He along side Peter battled crime until Peter and May died from unknown reason.[81]
The Batsuit is the costume Batman wears to conceal his identity and to frighten criminals. Unable to create it by himself, Bruce Wayne needed Lucius Fox to provide him some sort of armor. Fox presented him a prototype armor suit that was rejected by the army due to cost. After receiving the suit, Bruce sprays it with black rubber and adds a bat symbol.
Spider-Man Noir appears in Ultimate Spider-Man, voiced by Milo Ventimiglia. In the episode "The Spider-Verse: Part 2", after Green Goblin appears on the Noir reality to collect the DNA of that universe Spider-Man, he is confronted by both the "Noir" and the "Ultimate" Spider-Man, who had followed the Goblin to this universe. However, after rejecting an alliance proposed by his counterpart, Noir is forced to work together with him after the Green Goblin hijacks an airship to draw out Spider-Man Noir, taking a group of civilians present hostage, including Mary Jane. While the Ultimate Spider-Man is saving the hostages, Spider-Man Noir fights the Goblin on his own, but the Goblin manage to take the DNA of a distracted Spider-Man Noir and then departs. Spider-Man Noir admits to both Ultimate Spider-Man and Mary Jane that he should drop the "lone wolf" act, and as his counterpart follows the Goblin to another dimension, the two Spider-Men depart as friends. Spider-Man Noir later returns In "The Spider-Verse: Part 4", summoned by "Ultimate" Spider-Man along with other Spider-Man counterparts to form a team known as the Web-Warriors in order to combat the Green Goblin and Electro. After the villains are defeated, the Web-Warriors return to their respective dimensions. Spider-Man Noir makes a cameo in the fourth season episode "Miles from Home".
Other Protestant Christians also celebrate All Hallows' Eve as Reformation Day, a day to remember the Protestant Reformation, alongside All Hallow's Eve or independently from it.[210][211] This is because Martin Luther is said to have nailed his Ninety-Five Theses to All Saints' Church in Wittenberg on All Hallows' Eve.[212] Often, "Harvest Festivals" or "Reformation Festivals" are held on All Hallows' Eve, in which children dress up as Bible characters or Reformers.[213] In addition to distributing candy to children who are trick-or-treating on Hallowe'en, many Christians also provide gospel tracts to them. One organization, the American Tract Society, stated that around 3 million gospel tracts are ordered from them alone for Hallowe'en celebrations.[214] Others order Halloween-themed Scripture Candy to pass out to children on this day.[215][216]
Superhuman Durability: Under normal circumstances, Spidercide's body is somewhat harder and more resistant to certain types of physical injury than the body of a normal human. He can withstand powerful impact forces, such as falling from a height of several stories or being struck by a superhumanly strong opponent such as Spider-Man, that would severely injure or kill a normal human with little to no injury.
To make your own superhero costume, choose a form-fitting Spandex outfit with full-length leggings and long sleeves, which is perfect for disguising yourself while allowing you the freedom of movement to take down villains. Make your own mask to hide your true identity, and drape fabric over your shoulders if you want a cape. Wear brightly colored boots, and attach a letter or your own symbol to the center of your chest or cape. If you use any accessories for crime-fighting, like a sword or a shield, include that in your costume as well.
Jump up ^ Mader, Isabel (30 September 2014). "Halloween Colcannon". Simmer Magazine. Archived from the original on 5 October 2014. Retrieved 3 October 2014. All Hallow's Eve was a Western (Anglo) Christian holiday that revolved around commemorating the dead using humor to intimidate death itself. Like all holidays, All Hallow's Eve involved traditional treats. The church encouraged an abstinence from meat, which created many vegetarian dishes.
With the release of the Spider-Man films, the Spider-Man video games followed suit. Spider-Man: The Game was released in unison with the film in 2002. It was released on the PlayStation 2, the Nintendo GameCube, the Gameboy Advance, the Xbox and the PC. The game broke many sales records at the time. When Spider-Man 2 was released in June 2004, Spider-Man 2: The Game was released the day before. The game saw release on the same consoles as Spider-Man: The Game did, in addition to the Nintendo DS and Sony PSP. 2005 saw a comic related Spider-Man game hit the market; Ultimate Spider-Man followed many of the comic story arcs, and allowed the player to switch between Spider-Man and Venom. Spider-Man, voiced by Quinton Flynn, appears as one of the main characters in Marvel: Ultimate Alliance and he has special conversations with Mysterio, Lizard and Scorpion, and Dark Spider-Man. His simulator disk has him saving Dum Dum Dugan from the Scorpion and A.I.M in the Omega Base. His costumes are his classic, symbiote, Scarlet Spider and Stark Armor costumes. Spider-Man's latest film, Spider-Man 3 also saw the same video game treatment as its prequels. Spider-Man 3 was released on more consoles than any game before it. The game was available for the Xbox 360, PlayStation 2 and 3, Nintendo Wii , Gameboy Advance, Nintendo DS, the Sony PSP and PC. Spider-Man: Friend or Foe was released in October 2007 for Xbox 360, Wii, Playstation 2 , PC, PSP and Nintendo DS. This Spider-Man game features the villains from the Spider-Man films, but with a humorous twist.
The Memory cloth is a piece of equipment that Bruce is shown by Lucius Fox at Applied Sciences. The item itself is normally soft and light, but when an electric current is passed through it the cape takes a rigid shape. Bruce took it, and the gloves then customized the skeleton and cut into bat wing shape scalloped cape and somehow made it a functional paraglider contraption.
Spider-Man is zombified by Captain America. Unlike many of his zombie compatriots, Spider-Man is consumed with guilt over his need to eat flesh, though he is unable to prevent himself from satiating his hunger. He later eats Galactus, and becomes one of The Galactus, a number of heroes who obtain Galactus' powers due to consuming him. When his hunger begins to fade he turns on his fellow zombies, and later travels to Earth Z, where he kills the Sinister Six. He makes attempts to find a cure and succeeds, filling Sandman with nanobites and using him to wipe out all zombies, including himself.
Take a regular football uniform, then add fake blood and face paint and your child becomes a zombie quarterback. That is just one example from thousands of possibilities. Visit our website’s blog to find more ideas. We show you how to do it yourself as well as provide detailed steps to make it look great. Make a Halloween costume for boys with your own special touch by creating your own!
Although supposedly designed for maximum flexibility and movement, the Nomex armor does restrict Batman's movement somewhat, slowing him down in combat. The design of the mask and cape also restricted his neck movement, making it impossible for him to turn his head, and forcing him to rely on peripheral vision. For these reasons, Bruce asked Lucius to design a new suit with faster, freer movement in mind.
In 2008, Art Asylum/Diamond Select Toys released their 24th set of Marvel Minimates figures which included Captain Universe/Cosmic Spider-Man. The figure came bundled in a two-pack with a Venom figure. It featured a removable mask and the face of a very determined-looking and angry Peter Parker with a non-removable reused hairpiece from Set 18's "Black Unmasked Spidey" figure.
The ideas of second-wave feminism, which spread through the 1960s into the 1970s, greatly influenced the way comic book companies would depict as well as market their female characters: Wonder Woman was for a time revamped as a mod-dressing martial artist directly inspired by the Emma Peel character from the British television series The Avengers (no relation to the superhero team of the same name),[29] but later reverted to Marston's original concept after the editors of Ms. magazine publicly disapproved of the character being depowered and without her traditional costume;[30] Supergirl was moved from being a secondary feature on Action Comics to headline Adventure Comics in 1969; the Lady Liberators appeared in an issue of The Avengers as a group of mind-controlled superheroines led by Valkyrie (actually a disguised supervillainess) and were meant to be a caricatured parody of feminist activists;[31] and Jean Grey became the embodiment of a cosmic being known as the Phoenix Force with seemingly unlimited power in the late 1970s, a stark contrast from her depiction as the weakest member of her team a decade ago.
George Stacy (deceased): Gwen Stacy's father, Police Captain. Introduced in The Amazing Spider-Man (vol. 1) #56 (1968). He approves of Peter and Gwen's relationship as boyfriend and girlfriend. During a fight between Spider-Man and Doctor Octopus, he is crushed by falling debris while saving a child. As he dies, he reveals to Peter that he had known his identity for some time (something Peter had suspected anyway), and asks Peter to take care of Gwen.
^ Jump up to: a b c Manning, Matthew K.; Gilbert, Laura, ed. (2012). "1970s". Spider-Man Chronicle Celebrating 50 Years of Web-Slinging. Dorling Kindersley. p. 59. ISBN 978-0756692360. In the first issue of The Amazing Spider-Man to be written by someone other than Stan Lee...Thomas also managed to introduce a major new player to Spidey's life - the scientifically created vampire known as Morbius.
Is anyone looking for the easiest superheroes to dress up as? It is not too late to make yourself a superhero costume that will amaze the crowd. You see, there are too many of the DIY projects on Pinterest. And we don’t want you to go over the painful “research” of the easiest last-minute costumes to make. So, we decided to save you a lot of time and present you with our choices. We will be giving away tips on what materials you can use in designing and creating your own Halloween piece. But we have one request, though. Be yourself, bring out the superhero in you, and together, let’s save you time, money, and effort in making you the best superhero costume. What do you say?
Peter Parker's re-emerged consciousness begins to explore his Mindscape, discovering the world is now a large empty space, with only the very few key memories left. Recalling that he's more than Peter Parker, he is Spider-Man, he declares that Otto had made a big mistake in leaving the memories that define him and promises to find a way to regain the control of his body. Continuing to explore the Mindscape for clues into reclaiming his body from Doctor Octopus, he makes a note that only 31 pieces of his memories are left and wonders what he can do with them. Just then, he stumbles upon the memory of his fight with the Green Goblin at the Brooklyn Bridge, wonders why Doctor Octopus is probing into this. Deciding to delve into Doctor Octopus's memories for a way out, he is overwhelmed by the amount of memories and struggles to hold on. He sees a bright light and witnesses the moment of Otto Octavius's birth. Peter Parker's consciousness struggles to fight against the deluge of Doctor Octopus' memories, but it proves too much and he convinces himself that he is Doctor Octopus merging with Otto's memories.
Captain Marvel a.k.a. Carol Danvers: Carol Danvers, the superhero Ms. Marvel, has worked with Spider-Man on occasion and even agreed to go on a date with him in accordance with his helping her on a mission, despite how angry he can make her. She later fulfills her promise.[3] Spider-Man had admitted to himself he finds her attractive in her outfit. At the end of the near disastrous date, the two bonded together over a love of junk food. After she was possessed by the symbiote for a time, Venom hints to Spider-Man that his feelings for Ms. Marvel are mutual. The two have remained good friends.
The Toei Company had made a television series based on Marvel's famous hero as a tokusatsu in Japan. Even though the powers and costume are the same; the man behind the mask was a young motorcycle rider named Takuya Yamashiro who instead of getting bitten by a radioactive spider follows his archaeologist father and discovers a UFO called "Marveller" from the planet "Spider". When his father was killed exploring the ship, Takuya meets the lone survivor from Spider. It gives him a bracelet that not only grants him the same costume and the same powers as the American version but it also allows him to summon a giant robot (which looks an awful lot like a Power Ranger zord) to fight the evil of Professor Monster and his monstrous minions. The series lasted 41 episodes and is available in streaming video on Marvel's website.
On All Hallows' Eve, Christians in some parts of the world visit cemeteries to pray and place flowers and candles on the graves of their loved ones.[81] The top photograph shows Bangladeshi Christians lighting candles on the headstone of a relative, while the bottom photograph shows Lutheran Christians praying and lighting candles in front of the central crucifix of a graveyard.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Passivation Using Molecular Halides Increases Quantum Dot Solar Cell Performance.
A solution-based passivation scheme is developed featuring the use of molecular iodine and PbS colloidal quantum dots (CQDs). The improved passivation translates into a longer carrier diffusion length in the solid film. This allows thicker solar-cell devices to be built while preserving efficient charge collection, leading to a certified power conversion efficiency of 9.9%, which is a new record in CQD solar cells.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
It looks like it has been cut that way deliberately, but this huge iceberg is simply a wonderful display of nature’s awesomeness and beauty.
The rectangular mile-wide block of ice was seen off the east coast of the Antarctic Peninsula near to the Larsen C ice shelf.
Nasa scientists took the picture and shared it on Twitter saying that the shape of it suggests that it only calved from the ice shelf quite recently.
A perfectly formed iceberg pictured soon after it broke away from the Larsen C ice shelf (Picture: Nasa)
The pizza berg in the Weddell Sea with grease ice forming (Picture: Nasa)
Scientists are currently taking part in an airborne survey of Earth’s ice as part of what is known as Operation IceBridge.
The operation will give a 3D view of the ice at either end of the planet so that they can monitor how much it changes over time.
Amazon reveals new Echo and Ring devices including a personal home security drone
The space agency said: ‘A tabular iceberg can be seen on the right, floating among sea ice just off the Larsen C ice shelf.
‘The iceberg’s sharp angles and flat surface indicate that it probably recently calved from the ice shelf.’
Last month one of the largest icebergs ever recorded, a trillion-ton monster four times the size of London started moving and spinning as it breaks free of the ice.
A fracture in the sea ice that is partially refrozen and continuing to re-freeze, known as a lead (Picture: NASA)
Shackleton Range next to Recovery Glacier, East Antarctica (Picture: Nasa)
Last year, the iceberg A-68 broke off Antarctica’s Larsen C ice shelf after years of cracks spreading across the ice – but it’s remained ‘stuck’ near the ice shelf.
But it’s now on the move, according to Professor Mark Brandon of the Open University – who says the iceberg ‘will not be stopped easily’.
The Lust List: New tech we want this week
Brandon wrote on his blog that in July, ‘the weather conditions and ocean currents conspire to swing the trillion tonnes of the giant iceberg A68 in an anticlockwise direction.
‘Sentinel-1 SAR satellite imagery from 29 August 2018 shows that to the north of the iceberg the wind is pushing the sea ice northwards faster than the iceberg is rotating.
‘My guess is that A68a will continue rotating as it is now around that western point, until what is currently the northern edge collides with the Larsen C ice front.
‘It has a spectacular amount of momentum and it’s not going to stopped easily. I should think we will see some interesting collisions with the ice shelf in the next few months.’
The iceberg broke off last year (NASA)
The iceberg drifted in August (Getty)
A huge crack has been spreading across the Antarctic Lasen C ice shelf for many years, but it began accelerating late last year.
The ice shelf is about 1,100ft thick and floats on the edge of West Antarctica.
On July 12 an iceberg has ‘fully detached’ from the Larsen C ice shelf (Picture: EPA/NASA/USGS)
The false-colour view shows the relative warmth or coolness across the region (Picture: EPA/NASA)
Scientists from Project MIDAS – a British Antarctic Survey project involving researchers from several British universities – said last year that they feared the entire ice shelf could become unstable.
The researchers wrote,‘Computer modeling suggests that the remaining ice could become unstable, and that Larsen C may follow the example of its neighbour Larsen B, which disintegrated in 2002 following a similar rift-induced calving event.’
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The present invention relates generally to holding mechanisms and more particularly to a spacecraft having a mechanical holding mechanism which is substantially free of microdynamic noise.
Movable structures such as solar arrays, antennas, masts, sensors, and the like, are frequently used in spacecraft applications where large structures are required when the spacecraft is in orbit but a compact structure is required when launching the spacecraft. The movable structures are typically stowed during launch and are subsequently deployed at a preselected time after the spacecraft decouples from the launch vehicle. After deployment, the movable structures are each positioned to a preselected location by a positioning mechanism such as an actuator or a spring.
A separate mechanical latching mechanism, such as a mechanical clamp, is typically used to hold the movable structures in the preselected locations. Mechanical latching mechanisms typically have at least two mechanical surfaces which are in physical contact with each other, examples of which are the pin and jaws of a mechanical clamp. When these two mechanical surfaces move with respect to each other, microdynamic noise is generated, which in turn generates low levels of vibration in the movable structure. This microdynamic noise is generally at a micro-G level and is therefore not a concern for most spacecraft applications. However, for spacecraft applications which require an ultra-quiet dynamic environment, such as a spacecraft having a spaced-based interferometer, microdynamic noise can interfere with the mission of the spacecraft and can perturbate the data gathered by the spacecraft.
Methods have been suggested to combat microdynamic noise. One such method consists of isolating and highly damping the source of the microdynamic noise. However, this is difficult to accomplish in practice. Another method consists of removing moving parts, such as hinges, from the load path once the movable structure is positioned to the preselected location. This is also difficult to accomplish in practice. Yet another method applies large amounts of preload to the holding mechanism, such as latches, in attempts to prevent slippage which generates microdynamic noise. However, evidence exists that sufficient preloads cannot be applied to bearings or latches to remove all microdynamic noises. Lastly, a technique of maintaining the structures at a constant temperature within a narrow band of temperatures has been suggested so that the structures do not expand and contract and generate microdynamic noise. This is very difficult to accomplish in practice and requires precision heating or cooling of the structure which is expensive, requires additional equipment on the spacecraft and extracts a large weight penalty.
What is needed therefore is a method to reduce the microdynamic noise in a high precision spacecraft which has a movable structure in which the method is relatively simple to accomplish in practice and does not exact a large weight penalty.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A US secret service agent who suffered a stroke during Donald Trump’s visit to his Turnberry golf resort has died.
Nole Edward Remagen was serving as part of the US president's security detail for his UK trip when he suffered the stroke on Sunday.
He had been receiving treatment at a hospital in Scotland but died from the on Tuesday surrounded by his family, the White House said.
Mr Remagen was a veteran agent with 19 years' experience and was a "dedicated professional of the highest order", the US secret service said in a statement.
It added: “The secret service thanks the medical personnel in Scotland, in addition to the members of the White House Medical Unit and Police Scotland who provided exceptional care and support for a member of our family.”
The White House described Mr Remagen as an "elite hero" who served in the agency's select presidential protection division.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Typically, the communication facility connecting telephone equipment to a public switched telephone network (PSTN) comprises a twisted pair of copper wires, and is referred to as a "customer line." The customer line provides a two-way communication path between the telephone equipment and a central office serving as a gateway to the PSTN.
To realize customer lines, a feeder cable extends from the central office to a feeder distribution interface, from which a distribution cable runs. The feeder cable and distribution cable are each composed of many plastic-insulated copper wires twisted together into pairs. The number of wire pairs in either cable is typically on the order of 1,000. The wire pairs in the feeder cable, known as "feeder pairs," each of which corresponds to a telephone number, are terminated on one side of the feeder distribution interface. The wire pairs in the distribution cable, known as "distribution pairs," each of which corresponds to a customer line, extend from the other side of the interface. The assignment of a telephone number to a particular customer line is accomplished by connecting, at the feeder distribution interface, the feeder pair corresponding to the telephone number with the distribution pair corresponding to the particular customer line.
To deliver customer lines to customer premises, e.g., a cluster of homes, the distribution cable containing the distribution pairs may be aerially suspended by and strung through telephone poles, or buried underground. Aerial terminals are used to terminate the distribution pairs from above ground while pedestal terminals which are the ground versions of the aerial terminals are used to terminate the distribution pairs from underground. These aerial terminals or pedestal terminals are placed close to the cluster of homes.
In prior art, each aerial or pedestal terminal is used to terminate a predetermined number of distribution pairs, which includes a splice chamber, and a terminal block having the predetermined number of pairs of metal posts thereon, where the predetermined number is typically 12. Accordingly, the splice chamber in the terminal is used to splice 12 distribution pairs from the distribution cable. Each resulting pair of splice connections corresponding to a distribution pair is terminated at first ends of a respective pair of metal posts on the terminal block. Drop wires may be extended from the other ends of the metal post pair to one of the homes for connection with telephone equipment. Thus, currently, each aerial or pedestal terminal typically provides 12 customer lines which are shared by four homes, i.e., three lines per home.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Melissa Rycroft of Good Morning America interviewed Tristan and Val. Melissa asks Tristan on his career and personal life and Val talks of his family and all the sacrifices they’ve made for he and Maks to dance. Great interviews. But, be sure to read the link above for even more.
I'm a fashion and music fan....and I have always loved dancing too of any kind. Dancing With The Stars seems to have this way of bringing all of those things together. One of my favorite dancing quotes at the moment: "No matter what, nobody can take away the dance you've already had...." ~Gleb Savchenko . For fun music and dance mixes, visit WilUnleashed Soundcloud. To view my photography site, see Lisa Kay Photography.
Tristan is adorable!!! Without the ‘ego’ of the C-brothers..even though Maks is still my favorite. The ego stuff works for him but not so much for his brother. I hope Nancy can take Tristan far because he is just too cute to lose this early. Producers, are you listening? He is a keeper.
Thank Goodness, Melissa Rycroft didn’t get the DWTS hostess gig. She grates on my last nerve. Now onto the dancers….
Tristan is so humble and so sweet. Yes, Producers he is a keeper!!
In my opinion, there is only room for one Chmerkovskiy and only ONE “Sex on the Stick”. Maks is Maks and I love him. And Val is trying too hard to be like Maks, I’m not impressed with Val at all, and frankly I could care less if Val was eliminated this week. Sorry.
Tristan is the perfect warm, wonderful, handsome boy next door. Utterly adorable. The only disappointment: “I’m not takin’ me top off” LOL (but I can respect that.) 😉
Val is charming and I like his dry sense of humor. I think he’s got the toughest gig on the show *because* he’s Maks’s little bro. Comparisons are inevitable and a lot of folks will only see him as a coyp of his brother. Hope he figures out how to present himself (and gets the chance to do it).
And Maks, well, it’s already been said…Maks is Maks. There’s nobody quite like him. Normally, I don’t go for the supremely confident, in your face types, but there’s just something about Maks…
@Sandy, I agree with you wholeheartedly about Melissa… she just annoys me! And I realize I’m in the minority, but oh well. 🙂
I love how humble Tristan is, and I really believe that goes back to how he was raised. He was clearly taught to value every experience and not take anything for granted, and look at the man he’s become because of that… humble, appreciative and “real.” I dig it. I think in time he will come to realize that showboating just a little will benefit he and his partner, but I do respect him a great deal for being a “purist.” I like that he’s a bit shy and modest.
That being said, Val is quickly becoming my favorite C-brother. He seems less about the ego than Maks, and he’s just so captivating when he dances. I hope they’ll both stick around for a few seasons!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Method with @Transactional called on target not on proxy instance
I'm currently migrating one of my projects form "self configured spring" to spring boot. while most of the stuff is already working I have a problem with a @Transactional method where when it is called the context is not present as set before due to a call to the "target" instance instead of the "proxy" instance (I'll try to elaborate below).
First a stripped down view of my class hierarchy:
@Entity
public class Config {
// fields and stuff
}
public interface Exporter {
int startExport() throws ExporterException;
void setConfig(Config config);
}
public abstract class ExporterImpl implements Exporter {
protected Config config;
@Override
public final void setConfig(Config config) {
this.config = config;
// this.config is a valid config instance here
}
@Override
@Transactional(readOnly = true)
public int startExport() throws ExporterException {
// this.config is NULL here
}
// other methods including abstract one for subclass
}
@Scope("prototype")
@Service("cars2Exporter")
public class Cars2ExporterImpl extends ExporterImpl {
// override abstract methods and some other
// not touching startExport()
}
// there are other implementations of ExporterImpl too
// in all implementations the problem occurs
the calling code is like this:
@Inject
private Provider<Exporter> cars2Exporter;
public void scheduleExport(Config config) {
Exporter exporter = cars2Exporter.get();
exporter.setConfig(config);
exporter.startExport();
// actually I'm wrapping it here in a class implementing runnable
// and put it in the queue of a `TaskExecutor` but the issue happens
// on direct call too. :(
}
What exactly is the issue?
In the call to startExport() the field config of ExporterImpl is null although it has been set right before.
What I found so far:
With a breakpoint at exporter.startExport(); I checked the id of the exporter instance shown by eclipse debugger. In the debbug round while writing this post it is 16585. Continuing execution into the call/first line of startExport() where i checked the id again (of this this time) expecting it to be the same but realizing that it is not. It is 16606 here... so the call to startExport() is done on another instance of the class... in a previous debug round i checked to wich instance/id the call to setConfig() is going... to the first on (16585 in this case). This explains why the config field is null in the 16606 instance.
To understand what happens between the line where i call exporter.startExport(); and the actuall first line of startExport() i clicked into the steps between those both lines in eclipse debugger.
There i came to line 655 in CglibAopProxy that looks like this:
retVal = new CglibMethodInvocation(proxy, target, method, args, targetClass, chain, methodProxy).proceed();
checking the arguments here i found that proxy is the instance with id 16585 and target the one with 16606.
unfortunately I'm not that deep into springs aop stuff to know if that is how it should be...
I just wonder why there are two instances that get called on diffrent methods. the call to setConfig() goes to the proxy instance and the call do startExport() reaches the target instance and thus does not have access to the config previously set...
As mentioned the project has been migrated to spring boot but we where before already using the Athens-RELEASE version of spring platform bom. From what i can tell there where no special AOP configurations before the migration and no explicitly set values after the migration.
To get this problem fixed (or at least somehow working) i already tried multiple things:
remove @Scope from the sub class
move @Transactional from method level to class
override startExport() in subclass and put @Transactional here
add @EnableAspectJAutoProxy to application class (i wasn't even able to log in - no error message)
set spring.aop.proxy-target-class to true
the above in diffrent combinations...
Currently I'm out of clues on how to get this back working...
Thanks in advance
*hopes someone can help*
A:
Spring Boot tries to create a cglib proxy, which is a class based proxy, before you probably had an interface based (JDK Dynamic Proxy).
Due to this a subclass of your Cars2ExporterImpl is created and all methods are overridden and the advices will be applied. However as your setConfig method is final that cannot be overridden and as a result that method will be actually called on the proxy instead on the proxied instance.
So either remove the final keyword so that CgLib proxy can be created or explicitly disable class based proxies for transactions. Add @EnableTransationManagement(proxy-target-class=false) should also do the trick. Unless there is something else triggering class based proxies that is.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Omani jet order provides boost
We look forward to working with Oman’s Ministry of Defence and the Royal Air Force of Oman
Guy Griffiths of BAE Systems
PM David Cameron, who visited the Middle Eastern state yesterday, said the contract for 12 Typhoon and eight Hawk jet aircraft “will safeguard thousands of jobs across the UK”.
Work will begin in 2014 at Warton and Samlesbury in Lancashire and Brough in East Yorks.
The sites employ 6,000 high technology and engineering staff. Delivery of the planes is expected by 2017.
The Omani Ministry of Defence becomes the seventh operator of Eurofighter Typhoon and the third export customer, after Saudi Arabia and Austria.
Guy Griffiths, group managing director for BAE Systems’ international business, said: “We believe that Oman has now added the most advanced fighter jet and proven training aircraft available in the world to its military portfolio.
“We look forward to working with Oman’s Ministry of Defence and the Royal Air Force of Oman to ensure this is a highly successful programme.” Before his arrival in the capital Muscat, the Prime Minister dismissed concerns about selling arms in the region.
He said: “Boosting exports is vital for economic growth and that’s why I’m doing all I can to promote British business in the fastest-growing markets.
“Every country in the world has a right to self-defence and I’m determined to put Britain’s first-class defence industry at the forefront of this market, supporting 300,000 jobs across the country.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Hypoxia-inducible factor-1-dependent overexpression of myeloid cell factor-1 protects hypoxic cells against tert-butyl hydroperoxide-induced apoptosis.
Increased levels of Mcl-1 (myeloid cell factor-1) have been reported in several cancers, suggesting an important role played by Mcl-1 in cancer cell survival. Mcl-1 is an anti-apoptotic protein shown to delay or block apoptosis. In this work, using semiquantitative immunofluorescence, real-time PCR, and RNase protection assay, an increase in Mcl-1 expression was detected in hepatoma HepG2 cells incubated under hypoxia or in the presence of cobalt chloride. Through analysis of the Mcl-1 promoter sequence, a putative HIF-1 (hypoxiainducible factor-1) binding site was identified. A Mcl-1 promoter fragment containing this hypoxia-responsive element was able to bind HIF-1 in vitro. It also induced hypoxia-dependent transcription of a luciferase reporter gene, which was suppressed by anti-HIF-1alpha short interfering RNA. Finally, overexpression of Mcl-1 protected HepG2 cells against apoptosis induced by tert-butyl hydroperoxide as shown by inhibition of caspase-3 activation and DNA fragmentation. All these data suggest a potential anti-apoptotic role of HIF-1 that could protect cells against apoptosis under hypoxia by overexpression of the Mcl-1 protein.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
President Trump might want to take his crusade against “fake news” to his own golf clubs.
According to an investigation by The Washington Post, several Trump-owned golf clubs in the U.S., Ireland and Scotland had been displaying fake Time magazine covers featuring Trump’s photo.
Since the story broke on Tuesday, a reporter with NJ.com also claims to have spotted one at the Trump National Golf Club in Bedminster, N.J.
TRUMP ORGANIZATION TO LAUNCH BUDGET-FRIENDLY HOTEL BRAND WITH PATRIOTIC THEME
Time has since asked the Trump Organization to remove the framed magazine covers from his properties, reports the Post.
The fake covers were first discovered by a reporter during a visit to one of Trump’s private clubs. The eagle-eyed visitor noticed several discrepancies between a traditional Time cover and the fake, namely: the lack of a thin white border inside the red border; the exclamation points after two of the cover lines; and the headlines aligned on the right of the page, rather than the top.
The article was also dated March 1, 2009, and a subsequent investigation determined that Time didn’t publish an issue on March 1, 2009. Time did publish an issue on March 2, 2009, but it featured a photo of Kate Winslet on the cover.
Whomever made the fake cover appears to have lifted two of the issue’s headlines — “Obama’s Next Move: Can He Curb Health Care Costs?” and “How Stressed Is Your Bank? A Checkup” — directly from the Winslet cover. He/she also added three new headlines, two of which tout Trump’s stint as the host of “The Apprentice” in exclamatory statements including “Trump Is Hitting on All Fronts … Even TV!” and “The ‘Apprentice’ Is a Television Smash!”
The third of the new headlines read, “Global Warming: A New Age of Extinction.”
SUPREME COURT TRAVEL BAN: FLOOD OF LAWSUITS EXPECTED FROM RULING
It’s still unclear who created the covers or how long they have been hanging. Representatives for the Trump White House or his Mar-a-Lago resort in Palm Beach— where one of the covers hung near the entrance — did not return requests for comment.
However, Principal Deputy White House Press Secretary Sarah Huckabee Sanders responded to an enquiry from the Washington Post via email, writing, “We couldn’t comment on the décor at Trump Golf clubs one way or another.”
Twitter, on the other hand, was all too happy to comment. Social media users turned Trump’s Time cover into something of a meme, offering up jokes, criticisms, and even putting themselves in place of Trump on the cover:
FOLLOW US ON FACEBOOK FOR MORE FOX LIFESTYLE NEWS
According to a tally currently being updated by Washington Post reported David Fahrenthold, the fake Time cover has been found at seven of Trump’s properties, though two have since been taken down.
Ironically, though, Donald Trump has appeared on 14 bona fide Time magazine covers since 1989.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
This randomized controlled comparison of the safety and efficacy of RS-79070, an oral pro-drug of ganciclovir with IV ganciclovir as induction therapy for the treatment of newly diagnosed peripheral CMV retinitis. Further objectives are to assess the effects of both induction and maintenance therapy with RS-79070 on CMV viral load, and to assess the pharmacokinetics of ganciclovir following administration of RS-79070. Patients will be randomly assigned to receive either IV ganciclovir at 5 mg/kg IV bid for 3 weeks, then IV ganciclovir 5mg/kg qd for one week. The other group will receive the investigational therapy of 900 mg of RS-79070 po bid for 3 weeks, followed by 900 mg of RS-79070 qd for one week. Following this phase of the trial, all patients will be offered entry into a long-term follow-up phase of the study where they can receive 900 mg of RS-79070 po qd.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[A case of metastasis to the stomach from primary adenocarcinoma of the lung cancer].
We report a case of gastric metastasis of lung cancer performed gastrectomy for the primary foci. A 70s woman was diagnosed as having right lung cancer and underwent right lower lobectomy and lymph node dissection. The histological diagnosis was adenocarcinoma (pT4, N2, M0). Four years later, positron emission tomography (PET)-CT revealed a tumor in the stomach and para-aortic lymph nodes swelling. The submucosal tumor was showed in the cardia by endoscopic examination. Biopsy showed a papillary adenocarcinoma. With the diagnosis of gastric metastasis from lung cancer, she was operated on. A proximal gastrectomy was carried out. The histopathological examination demonstrated papillary adenocarcinoma similar to that of the lung cancer with lymph node metastasis. No postoperative complications occurred and she was discharged from the hospital. Since then, she was treated with adjuvant chemotherapy as an outpatient.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
e
Is 2169 a factor of 2574091?
False
Does 50 divide 283850?
True
Is 2 a factor of 165985?
False
Is 80 a factor of 2816821?
False
Is 8349921 a multiple of 195?
False
Is 2644464 a multiple of 444?
True
Is 327 a factor of 172002?
True
Does 32 divide 72861?
False
Is 1016910 a multiple of 45?
True
Is 3338266 a multiple of 27?
False
Is 20 a factor of 2192780?
True
Does 219 divide 556479?
True
Does 76 divide 259985?
False
Is 6 a factor of 3147222?
True
Is 82 a factor of 31980?
True
Does 27 divide 56511?
True
Does 36 divide 492876?
True
Does 27 divide 97146?
True
Is 18 a factor of 590346?
True
Is 63238 a multiple of 161?
False
Does 202 divide 96526?
False
Does 5 divide 258732?
False
Is 8 a factor of 3124454?
False
Is 4 a factor of 79449?
False
Is 6432 a multiple of 12?
True
Is 8690920 a multiple of 35?
True
Is 488647 a multiple of 28?
False
Does 774 divide 1884690?
True
Is 24 a factor of 996288?
True
Is 57 a factor of 155838?
True
Is 192 a factor of 224039?
False
Is 95 a factor of 663195?
True
Does 72 divide 726552?
True
Is 68544 a multiple of 56?
True
Does 190 divide 144780?
True
Is 237 a factor of 446725?
False
Is 87170 a multiple of 50?
False
Does 61 divide 429104?
False
Does 43 divide 5533666?
False
Is 79 a factor of 58223?
True
Is 28 a factor of 6868895?
False
Does 12 divide 841139?
False
Is 90 a factor of 342900?
True
Is 6 a factor of 578567?
False
Is 40 a factor of 929830?
False
Is 979470 a multiple of 18?
True
Is 204863 a multiple of 408?
False
Is 332 a factor of 225096?
True
Does 603 divide 586116?
True
Does 226 divide 483141?
False
Is 250502 a multiple of 406?
True
Does 166 divide 1699?
False
Is 157 a factor of 2153962?
False
Does 970 divide 9241190?
True
Does 89 divide 1979838?
False
Does 13 divide 5867038?
False
Is 3 a factor of 56745?
True
Is 187 a factor of 3180683?
True
Does 183 divide 5673?
True
Is 53970 a multiple of 21?
True
Is 389711 a multiple of 12?
False
Is 98 a factor of 1065492?
False
Is 630 a factor of 4106597?
False
Is 136 a factor of 6347023?
False
Is 11 a factor of 2193587?
True
Does 37 divide 711880?
True
Does 132 divide 74910?
False
Does 22 divide 1712373?
False
Is 165 a factor of 4570720?
False
Does 129 divide 61564?
False
Is 191 a factor of 1232332?
True
Is 89 a factor of 374792?
False
Is 1034820 a multiple of 45?
True
Is 1934303 a multiple of 486?
False
Does 16 divide 509360?
True
Does 112 divide 34413568?
True
Is 21 a factor of 1037204?
False
Does 26 divide 174911?
False
Does 4 divide 95836?
True
Is 328401 a multiple of 7?
False
Is 23 a factor of 1082702?
True
Does 4 divide 612695?
False
Is 131062 a multiple of 7?
False
Does 27 divide 3228606?
True
Is 2 a factor of 142068?
True
Is 14 a factor of 1934374?
False
Is 9 a factor of 4653598?
False
Is 20 a factor of 4660?
True
Is 8 a factor of 229909?
False
Is 943830 a multiple of 120?
False
Does 2 divide 50013?
False
Does 995 divide 7466480?
True
Is 237 a factor of 4848601?
False
Is 489983 a multiple of 38?
False
Does 22 divide 25027861?
False
Is 218942 a multiple of 210?
False
Does 31 divide 93124?
True
Does 74 divide 1424823?
False
Is 114312 a multiple of 24?
True
Does 318 divide 234055?
False
Is 4170942 a multiple of 20?
False
Is 10 a factor of 451571?
False
Is 313817 a multiple of 353?
True
Does 9 divide 29757?
False
Is 14 a factor of 2240490?
True
Is 49715 a multiple of 7?
False
Is 6419546 a multiple of 137?
True
Is 33 a factor of 33365?
False
Is 805486 a multiple of 902?
True
Does 12 divide 118716?
True
Does 1452 divide 5880092?
False
Is 166866 a multiple of 6?
True
Is 4 a factor of 416240?
True
Does 40 divide 332720?
True
Is 219050 a multiple of 130?
True
Is 46 a factor of 395830?
True
Does 165 divide 412821?
False
Is 9829 a multiple of 2?
False
Does 173 divide 618553?
False
Does 227 divide 1550053?
False
Is 703 a factor of 10746170?
False
Is 103863 a multiple of 23?
False
Is 6327465 a multiple of 76?
False
Does 75 divide 1220925?
True
Is 26 a factor of 1075438?
True
Does 12 divide 3755016?
True
Is 692839 a multiple of 11?
False
Does 172 divide 144308?
True
Is 714 a factor of 1208088?
True
Is 1330890 a multiple of 37?
True
Does 100 divide 468472?
False
Is 11 a factor of 732556?
True
Does 121 divide 264748?
True
Is 1124100 a multiple of 173?
False
Is 13 a factor of 405314?
True
Is 6476328 a multiple of 17?
False
Does 543 divide 72660?
False
Does 12 divide 6171660?
True
Is 42 a factor of 2532042?
False
Is 128736 a multiple of 216?
True
Does 489 divide 461616?
True
Is 360400 a multiple of 68?
True
Is 129 a factor of 1184091?
True
Does 30 divide 1233990?
True
Does 137 divide 9904440?
False
Is 10 a factor of 12610?
True
Is 107 a factor of 4451842?
True
Does 15 divide 651015?
True
Is 868608 a multiple of 26?
True
Is 1280000 a multiple of 200?
True
Does 20 divide 587897?
False
Does 2 divide 400?
True
Does 1098 divide 940333?
False
Is 64714 a multiple of 19?
True
Does 219 divide 1296042?
True
Is 1351794 a multiple of 263?
False
Is 262299 a multiple of 17?
False
Does 97 divide 266008?
False
Is 150 a factor of 415971?
False
Is 167110 a multiple of 10?
True
Is 261 a factor of 727146?
True
Is 30 a factor of 90134?
False
Is 1269053 a multiple of 23?
False
Is 32 a factor of 39456?
True
Is 4759736 a multiple of 999?
False
Is 40352 a multiple of 104?
True
Does 6 divide 22650?
True
Is 2068380 a multiple of 60?
True
Is 27 a factor of 362151?
True
Does 13 divide 37568?
False
Is 1364121 a multiple of 81?
True
Is 240004 a multiple of 326?
False
Is 26199 a multiple of 41?
True
Is 5 a factor of 62718?
False
Does 488 divide 6311792?
True
Is 96466 even?
True
Is 8 a factor of 44984?
True
Is 1878761 a multiple of 517?
False
Is 686 a factor of 1552117?
False
Is 93660 a multiple of 28?
True
Does 206 divide 158744?
False
Is 446975 a multiple of 20?
False
Is 51 a factor of 808656?
True
Is 739588 a multiple of 164?
False
Is 237048 a multiple of 102?
True
Does 132 divide 1625945?
False
Is 70 a factor of 200439?
False
Is 16248210 a multiple of 1749?
True
Is 132 a factor of 252780?
True
Is 469638 a multiple of 33?
False
Is 3790674 a multiple of 10?
False
Does 8 divide 1544920?
True
Is 7469730 a multiple of 150?
False
Is 5080242 a multiple of 6?
True
Does 115 divide 1560895?
True
Is 103 a factor of 53560?
True
Does 36 divide 1266774?
False
Is 1925503 a multiple of 347?
True
Is 44 a factor of 805588?
False
Is 159 a factor of 535353?
True
Does 25 divide 5313307?
False
Is 691360 a multiple of 32?
True
Is 39 a factor of 297013?
False
Does 88 divide 35288?
True
Is 198 a factor of 12806838?
True
Is 80128 a multiple of 14?
False
Is 2021 a multiple of 12?
False
Does 309 divide 1366089?
True
Is 3464188 a multiple of 1228?
True
Does 431 divide 1655040?
True
Does 40 divide 14776817?
False
Does 91 divide 189185?
False
Does 23 divide 11028997?
False
Is 216700 a multiple of 25?
True
Does 44 divide 312796?
True
Does 251 divide 2660539?
False
Is 9 a factor of 6307142?
False
Is 179 a factor of 180808?
False
Is 306 a factor of 677284?
False
Is 729145 a multiple of 18?
False
Is 185204 a multiple of 99?
False
Is 30464 a multiple of 7?
True
Is 19404 a multiple of 28?
True
Is 1447938 a multiple of 626?
True
Is 45053 a multiple of 27?
False
Does 6 divide 144672?
True
Does 120 divide 9048120?
True
Is 2598622 a multiple of 13?
True
Does 44 divide 25603?
False
Is 8 a factor of 4966?
False
Is 108240 a multiple of 12?
True
Does 13 divide 620711?
True
Does 9 divide 343082?
False
Does 7 divide 228634?
True
Is 176547 a multiple of 21?
True
Does 14 divide 96128?
False
Is 13410135 a multiple of 299?
False
Is 250 a factor of 277750?
True
Is 207088 a multiple of 163?
False
Is 133 a factor of 387296?
True
Is 586185 a multiple of 15?
True
Is 258055 a multiple of 101?
True
Is 104360 a multiple of 2?
True
Is 17 a factor of 10232640?
True
Is 44629 a multiple of 7?
False
Is 77771 a multiple of 7?
False
Does 13 divide 27209?
True
Is 42 a factor of 443385?
False
Does 20 divide 13971433?
False
Does 951 divide 344262?
True
Does 29 divide 276033?
False
Does 40 divide 1701200?
True
Is 305 a factor of 177693?
False
Does 140 divide 2174480?
True
Is 569541 a multiple of 41?
False
Does 45 divide 3065670?
True
Does 57 divide 263853?
True
Is 61550 a multiple of 50?
True
Is 607904 a multiple of 1140?
False
Is 81 a factor of 5228010?
False
Does 8 divi
| null |
minipile
|
NaturalLanguage
|
mit
| null |
450 N.W.2d 783 (1990)
John W. MORGAN and Diane C. Morgan, Plaintiffs and Appellants,
v.
Gerald M. BALDWIN, Defendant and Appellee.
No. 16561.
Supreme Court of South Dakota.
Argued November 27, 1989.
Decided January 24, 1990.
Rehearing Denied March 2, 1990.
Rick Johnson of Johnson, Eklund & Davis, Gregory, for plaintiffs and appellants.
Ed Carpenter, Rapid City, for defendant and appellee.
HERTZ, Circuit Judge.
The trial court found that appellants' John W. Morgan and Diane C. Morgan (Morgans) claim against appellee, Gerald M. Baldwin (Baldwin) was essentially a claim for attorney malpractice rather than a contract claim. The trial court applied the three year statute of limitations, SDCL 15-2-14.2, rather than the six year limitation prescribed for contract actions, SDCL 15-2-13(1), and granted Baldwin summary *784 judgment. Morgans appeal. We reverse and remand for trial.
We do not reach the merits of this case since the summary judgment involves only the question of what statute of limitations is applicable. We set out only those facts which are necessary to the appropriate resolution of this appeal.
Morgans owned and operated a KOA campground west of Custer, South Dakota, as well as a gun shop in the city of Custer. Since 1975 they employed Baldwin as their attorney.
Morgans decided to start a second KOA campground north of Custer (North Campground). It is not clear whether Baldwin or Morgans initiated a partnership discussion. In any case, on May 11, 1979, Morgans and Baldwin executed a partnership agreement which Baldwin prepared.
The partnership agreement called for the incorporation of the business. Baldwin was to pay Morgans an amount equal to one-half of Morgans' present cash investment in the purchase of the Northern Campground's real property and $10,000 for the KOA franchise. All cash contributions toward the construction of the North Campground were to be made on a 50/50 basis. Any overpayment by one party would be repaid to that party as funds became available. In addition, Morgans were to have management control and Baldwin was to contribute legal and business management services without expense to the venture.
On July 8, 1981, Morgans and Baldwin restructured their relationship with respect to the North Campground and entered into a limited partnership agreement prepared by Baldwin. Under this agreement, Morgans became solely responsible for the management of the partnership business. Baldwin no longer had anything to do with the management or conduct or control of the business, and was not to be held personally liable for the expenses, liabilities, or obligations of the partnership. The profits of the business were to continue to be divided on a 50/50 basis. Morgans were to be paid $4,000 per month after the payment of all current obligations. The agreement also called for John Morgan to assign his interest in the proceeds from the sale of the West Campground contract to the Custer County Bank to pay off partnership indebtedness.
On July 9, 1981, John Morgan signed an agreement prepared by Baldwin to purchase Baldwin's share of the North Campground for $50,000.
In August of 1983, Baldwin prepared and presented an agreement to Morgans purporting to dissolve their Northern Campground partnership. The sale proceeds from the West Campground contract were not sufficient to satisfy all partnership obligations, so Baldwin and Morgans agreed that portions of the indebtedness due the Custer County Bank would be shared equally.
After the execution of the dissolution of the limited partnership in August 1983, Morgans began consulting with attorneys about their contracts with Baldwin. On September 16, 1987, Morgans instituted the present litigation.
Baldwin contends that all of Morgans' claims arise out of Baldwin's employment as Morgans' attorney and the legal advice Baldwin gave them with respect to their partnership. Thus Baldwin urged the trial court to apply the three year attorney malpractice statute, SDCL 15-2-14.2. Morgans claim that their complaint is basically one founded on breach of contract, and therefore the statute of limitations governing contracts was applicable, SDCL 15-2-13(1). The trial court concluded that the nature of the action Morgans pleaded was essentially one alleging attorney malpractice and accordingly applied the three year statute of limitations, resulting in an order dismissing Morgans' complaint.
The issues raised by this appeal are:
I. Whether the allegations in the complaint are in the nature of a contract cause of action subject to the six year statute of limitations, or one in attorney malpractice subject to the three year statute of limitations?
II. Whether there was sufficient evidence of fraudulent concealment of a *785 cause of action presenting a jury issue rather than a law question for the court?
An initial review of pertinent summary judgment principles is appropriate. The party moving for summary judgment has the burden to show that there is no genuine issue as to any material fact and that he is entitled to judgment as a matter of law. SDCL 15-6-56(c). The evidence, including all pleadings, affidavits and deposition testimony, must be viewed in the light most favorable to the non-moving party, and reasonable doubts should be resolved against the moving party. All reasonable inferences that may be drawn from the facts must be accepted in favor of the non-moving party. Groseth International, Inc. v. Tenneco, Inc., 410 N.W.2d 159 (S.D.1987); Wilson v. Great Northern Railway Co., 157 N.W.2d 19 (S.D.1968). Summary judgment is a drastic remedy, and should not be granted unless the moving party has established the right to a judgment with such clarity as to leave no room for controversy. Jewson v. Mayo Clinic, 691 F.2d 405 (8th Cir.1982).
Issue 1
WHETHER THE ALLEGATIONS IN THE COMPLAINT ARE IN THE NATURE OF A CONTRACT CAUSE OF ACTION SUBJECT TO THE SIX YEAR STATUTE OF LIMITATIONS, OR ONE IN LEGAL MALPRACTICE SUBJECT TO THE THREE YEAR STATUTE OF LIMITATIONS.
It is generally held that the nature of the cause of action or the right sued upon (and not the form of the action) is the test to determine what statute of limitation applies and whether the action is barred by the running of the limitation period. 54 C.J.S. Limitations of Actions § 32; 51 Am. Jur.2d, Limitations of Actions § 62.
As a matter of policy, where there is a substantial question as to which of two or more statutes of limitation within the jurisdiction should be applied, the statute containing the longest limitation should be applied. Williams v. Lee Way Motor Freight, 688 P.2d 1294 (Okla.1984). In other words, if a substantial doubt exists about which statute of limitations applies, the longer rather than the shorter period of limitation is preferred. 51 Am.Jur.2d, Limitations of Actions § 63; 54 C.J.S. Limitations of Actions § 39.
Where the same transaction gives rise to two causes of action having different statutes of limitations, one may be timely while the other is barred. Triangle Underwriters, Inc. v. Honeywell, Inc., 604 F.2d 737 (1979). In determining the applicable statute of limitations, it is the gravamen of the claim which governs and not the form in which it is pleaded. Edwards v. State, 95 Misc.2d 516, 407 N.Y.S.2d 804 (1978); Giffin v. United Transp. Union, 190 Cal.App.3d 1359, 236 Cal.Rptr. 6 (1987).
Under certain circumstances potential liability in tort may co-exist with liability in contract. When facts warrant either form of action, an injured party has the right to elect which form of action he will pursue. The general rule applied to situations falling within the twilight zone of contract and tort law is that doubt must be resolved in favor of an action on contract. The choice of which statute of limitations should apply ultimately rests on a characterization of the essence of the claim. Weible v. Ronan State Bank, 776 P.2d 837 (Mont.1989); Thiel v. Taurus Drilling Ltd. 1980-II, 710 P.2d 33 (Mont.1985).
Baldwin, however, urges that the general rule that the statute containing the longest limitation should be applied is contrary to the holding expressed in Deitz v. Bowman, 403 F.Supp. 1111 (D.S.D.1975). In Deitz, Judge Bogue stated that if the rule favoring a longer limitations period is part of the policy against statutes of limitations generally, it is not applicable, in light of Chipperfield v. Woessner, 84 S.D. 13, 166 N.W.2d 727 (S.D.1969). Baldwin thus claims that where there is a substantial doubt about which statute of limitations should apply, a trial court is at liberty to disregard such doubt and apply the shorter limitation period.
In examining the Chipperfield case, relied upon in Deitz, supra, it is clear that the holding only concerned the fact that in *786 South Dakota a statute of limitations defense is a meritorious defense which should not be regarded with disfavor and which should be treated like any other defense. Chipperfield did not involve the issue in Deitz, nor the issue in this case. As a matter of fact, the only pertinent holding in Deitz is that there was no substantial question (doubt) as to the applicability of the shorter statute of limitations. Thus we hold that Deitz is not controlling here.
We have held that the nature of the allegations must be determined from the allegations of the pleadings involved. Baker v. Jewell, 77 S.D. 573, 96 N.W.2d 299 (S.D.1959). This rule is applicable to statutes of limitations. Chipperfield v. Woessner, supra. Accordingly, we hold that in South Dakota, when one of two statutes of limitations may be applicable, such application should always be tested by the nature of the allegations in the complaint, and if there is any doubt as to which statute applies, such doubt be resolved in favor of the longer limitation period.
It is now necessary to apply the nature of the allegations test to Morgans' complaint in this case. Without setting out separate and distinct causes of action, the complaint alleges both contract claims as well as attorney malpractice claims.
Specifically, Morgans claim certain damages based on Baldwin's failure to perform agreements contained in the partnership agreement. These include Baldwin's failure to pay Morgans $10,000 for the KOA campground franchise and his half of construction expenses at the North Campground. Morgans also claim $66,000 for wages under the limited partnership agreement. Morgans concede a $10,000 credit is due Baldwin for personal items Morgans used while operating the North Campground.
Morgans claim they were required to absorb a $100,000 loss from the sale of the West Campground because of Baldwin's failure to properly advise them concerning other options available to them which might have preserved additional equity from the sale. Further, Diane Morgan claims a loss of $21,811.61, representing her interest in the sale of the West Campground. She attributes the loss to Baldwin's failure to properly advise her and protect her interest in the property.
Baldwin claims that because Morgans in their depositions characterized their claims in the nature of attorney malpractice, such testimony is conclusive of the nature of the cause of action. The Morgans, of course, are lay people, and as such have little, if any, concept of the niceties of pleading causes of action. We conclude that the test to be applied is the nature of the allegations in the complaint and not Morgans' characterization of their relationship with Baldwin. Although complaints of attorney malpractice are interwoven with breach of contract obligations, the gravamen of Morgan's cause of action is an obligation founded on contract.
This court, generally, has, almost without exception, viewed with disfavor any overly technical construction of our statutes, rules and pleadings, that would make effective use of our court system needlessly complex rather than simple, or unreasonably inaccessible rather than available to all who seek redress of wrongs.
All pleadings shall be so construed as to do substantial justice. SDCL 15-6-8(f). By this statutory mandate we are required to construe pleadings liberally for the purpose of determining its effect with a view of doing substantial justice between the parties. Burmeister v. Youngstrom, 81 S.D. 578, 139 N.W.2d 226 (1965). We believe our decision here is consistent with this goal.
What was said in Williams v. Lee Way Motor Freight, 688 P.2d 1294 (Okla.1984) is pertinent here:
Generally if there is a substantial question of which of two or more statutes of limitations should be applied, the doubt should be resolved in favor of the application of the statute which contains the longest limitation. This serves the legislative intent of protecting defendants from stale claims, yet provides an approach of liberality which affords a plaintiff party-litigant maximum free access *787 to our court system. Although statutes of limitations are primarily designed to assure fairness to defendants because they prevent claims from being brought when the relevant evidence is so old that it is unreliable, the policy of repose is outweighed where the interest of justice requires otherwise.
For all the reasons stated, we find the applicable statute of limitations to be the one applied to contracts.
This court must emphasize that the determination to apply the contract limitation period is not based on the length of that limitation period; rather it is based solely upon the dominant or pervading cause of action (contract) which is inextricably intertwined with the attorney malpractice claim.
Having so decided, one of the immediate concerns of the trial court upon our remand is the effect of our ruling on the attorney malpractice claim. The trial court is entitled to some direction from this court. Are the Morgans restricted to damages only arising out of the contract claim, or should both claims be litigated as one claim? We have not had occasion to address this precise question. Little has been written concerning this question, but what has been written supports the conclusion that a single statute of limitation should be applied to the entire action.
Where a single injury results from a wrongful act, the court will assume, for the purpose of determining which of two or more statutes of limitations is applicable, that the complaint states only a single wrong, for which there can be only one recovery, although the allegations in the complaint purport to state several "separate and distinct" causes of action arising from negligence, breach of contract or statute and misrepresentation. 51 Am.Jur.2dLimitations of Actions § 63, citing Schmidt v. Merchants Despatch Transportation Co., 270 N.Y. 287, 200 N.E. 824 (1936).
Under some authority, only one statute of limitations may be applied to the entire action, as where the causes of action are inextricably intertwined. In this case all the claims flowing from defendant's conduct may be subsumed under a single limitation period. 54 C.J.S., Limitation of Actions §39, citing Walden III, Inc. v. State of Rhode Island, 442 F.Supp. 1168 (D.C.R.1.1977); Thiel v. Taurus Drilling, supra; Carpenter v. Dizio, 506 F.Supp. 1117, (D.C.Pa.1981).
It is, of course, possible to allege several, individual causes of action based upon the same injury. A court may be obligated to segregate plaintiff's various claims and apply separate statutes of limitations to each. Multiple periods of limitations could apply to the same case. Construing this theory of election of remedies with reference to statutes of limitations, the United States Supreme Court has stated:
If the choice of the statute of limitations were to depend upon the particular facts or the precise legal theory of each claim, counsel could almost always argue, with considerable force, that two or more periods of limitations should apply to each § 1983 claim. Moreover, under such an approach, different statutes of limitations would be applied to various 1983 claims arising in the same state, and multiple periods of limitations would often apply to the same case. There is no reason to believe that congress would have sanctioned this interpretation of its statute.
Wilson v. Garcia, 471 U.S. 261, 105 S.Ct. 1938, 85 L.Ed.2d 254 (1985).
While we now have in South Dakota a statute which limits 1983 actions to three years after the alleged constitutional deprivation occurred (SDCL 15-2-15.2), we are persuaded by the logic and reasoning of this analysis, and see no reason why it should not be followed in this case. Accordingly, we hold that different periods of limitation should not be applied to different aspects of the two claims set out in the complaint. Thiel v. Taurus Drilling, supra.
Having thus decided, we find the applicable statute of limitation to be the one applied to contracts, which is six years (SDCL 15-2-13). Further, we conclude that because the allegations here are inextricably *788 intertwined with the contract claims, the attorney malpractice claims are subsumed in the contract claim. Accordingly, we reverse and remand this matter for trial.
By reason of our decision here, we perceive no need to discuss Issue II of this appeal.
WUEST, C.J., MORGAN and HENDERSON, JJ., and FOSHEIM, Retired Justice, concur.
HERTZ, Circuit Judge, for SABERS, J., disqualified.
FOSHEIM, Retired Justice, for MILLER, J., disqualified.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Free Panel to Make 16-bit Luminosity Masks
Lately I’ve been experimenting with several features that could make Photoshop extension panels easier to install and use. To test some of these new elements, I’ve created a mini-panel (image below) focused on just making 16-bit luminosity masks, like the downloadable actions that were available in the previous blog posts. With the new custom panel these same actions can now be run with a click of a button instead of having to play them from Photoshop’s regular Actions panel. The new panel can be downloaded free at this website.
It’s a very simple panel overall and provides the easiest way yet to quickly generate the Lights, Darks, and Midtones series of luminosity masks using the new 16-bit process. The luminosity masks generated are placed on the Channels panel, so check there for the results after clicking one of the buttons. Luminosity masks can do many things, and it’s up to the user to determine which mask they want to use and how to use it for their image. Techniques for using luminosity masks are described in the tutorials section of my website.
The CC and CS6 versions look slightly different, but do the same thing. They also have slightly different installation procedures. The complete Instructions PDF describes how to install the panel, how to use it, and also has some trouble-shooting tips. Please take a few minutes to read it before installing the panel to help insure that the process goes smoothly.
Once installation is complete on any compatible version of Photoshop, open Photoshop and click through the menu commands Window > Extensions > TK. The panel should appear. Once available, it can be opened, closed, and docked to a panels bar just like over Photoshop panels. An image needs to be open for most of the buttons to work.
This is my first experience with the new features and distribution method. If there are problems, please let me know. We can try and work them out together.
Thanks Tony, for your continuing development of your actions. Like someone before me said, everyone is jumping on the bandwagon but few are crediting you with your work. They installed flawlesly. Will there be a 16 bit Triple Play down the road?
Hi Tony,Thank you so much for the new ‘TK-mini Panel’ !! Installed flawlessly, and while I’ve just barely got my feet wet with it, I like it’s compactness.The idea of being able to add/subtract each group separately leaves a less cluttered working area. Thanks again, Tony, stay well, Emerson E Liley Jr
Hello Tony, I hope all is well with you. Thank you for the mini-panel. I hope it is a portent of another great iteration of the full version, which I still use on every processed image. The panel installed exactly as it was supposed to install. I added it to cc 2014 and CS6. Really looking forward to easy 16 bit renditions. My best always, Guy
| null |
minipile
|
NaturalLanguage
|
mit
| null |
<?xml version="1.0" standalone="no" ?>
<!DOCTYPE pov SYSTEM "/usr/share/cgc-docs/replay.dtd">
<pov>
<cbid>CROMU_00033</cbid>
<replay>
<write echo="ascii"><data>SEND\x06/92htc\x5a\x00H6ZLULTnH0bBqTP0hx3EtzdEX09R8BbCvWUZtimvnCBZIjxgCMXVlAPsuEww9I2M0ajFP3f6trY3cOIuMBuNhGlmh0</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /92htc\n</data></match></read>
<write echo="ascii"><data>SEND\x0a/Nugyy7ZSh\x16\x00osquJ4faRwiPvfuYdrhLoq</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /Nugyy7ZSh\n</data></match></read>
<write echo="ascii"><data>SEND\x06/dzyQk\x5f\x00OC0rP3KirSg6JP9BbJh3dGreMPJkstRnU8SLaOs6yqEh70APSaeI5PkBkkrfVMILypNTzc8f7QBoO6sQqCPUIcGD0FHF504</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /dzyQk\n</data></match></read>
<write echo="ascii"><data>SEND\x09/rJgzBayz\x1f\x00Db9ktaY90YC4s4Un3wEyNeh3F7bOYzC</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /rJgzBayz\n</data></match></read>
<write echo="ascii"><data>NDIR\x0a/jWbAtH4N3</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x09/wsS7PfgT</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x12/wsS7PfgT/mGdBUVq4\x22\x00n04UECpXlUsNdHuTjZxwWDghmH2z4ZnChX</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /wsS7PfgT/mGdBUVq4\n</data></match></read>
<write echo="ascii"><data>SEND\x0f/jWbAtH4N3/HbA4\x56\x00AaHAQNqGu7kBVBOPbzDtroB8eM5HFn1pOXbA0JATjXeFTQIHizoqmOm3wAB3EqsyAV1KVtDC2C7bKW9Lakw5t1</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/HbA4\n</data></match></read>
<write echo="ascii"><data>NDIR\x06/AnGXp</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>RECV\x0a/Nugyy7ZSh</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] osquJ4faRwiPvfuYdrhLoq\n</data></match></read>
<write echo="ascii"><data>RECV\x09/rJgzBayz</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] Db9ktaY90YC4s4Un3wEyNeh3F7bOYzC\n</data></match></read>
<write echo="ascii"><data>NDIR\x0b/AnGXp/7Gqh</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x0a/SkMIZFNF9</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x12/SkMIZFNF9/petzVR0</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>RECV\x0a/Nugyy7ZSh</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] osquJ4faRwiPvfuYdrhLoq\n</data></match></read>
<write echo="ascii"><data>SEND\x13/SkMIZFNF9/l3ujkQKM\x23\x00DmgpNJyDmp1R0wumcLiPCUs5lockQRiiQXr</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/l3ujkQKM\n</data></match></read>
<write echo="ascii"><data>NDIR\x12/SkMIZFNF9/PQj77B2</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x0b/AnGXp/tCSZ\x31\x00Sq6ZxxFPgHcvsFVrLDV6RrIlIiGYcfXdXjNbjgKnrbQ1eUPiy</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /AnGXp/tCSZ\n</data></match></read>
<write echo="ascii"><data>SEND\x05/jfkp\x2d\x00npABroEZdf361LKRRdAFCRUZZNyQHB9BPuHgNIuMrF1kk</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jfkp\n</data></match></read>
<write echo="ascii"><data>NDIR\x1d/SkMIZFNF9/petzVR0/wpWmFUphqo</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x15/jWbAtH4N3/eDq6S1lAMq</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x13/jWbAtH4N3/Fum6ywP9</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x1e/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x13/jWbAtH4N3/7F9KSvuD</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x0f/jWbAtH4N3/wQ3a</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x13/jWbAtH4N3/oHM2fxPs\x3a\x00FPJF49wK0qaf0VuXciXfmwGwtSi97Tu9SxCIxem4bveTMGUkK9ZDqt54Lp</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/oHM2fxPs\n</data></match></read>
<write echo="ascii"><data>SEND\x25/SkMIZFNF9/petzVR0/wpWmFUphqo/qDJWRqs\x20\x00GW3JT9C42imtSi4DVZ2u61q8evLKyxSt</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/petzVR0/wpWmFUphqo/qDJWRqs\n</data></match></read>
<write echo="ascii"><data>SEND\x1a/jWbAtH4N3/7F9KSvuD/ZLaQUK\x46\x00ivArmv5IaDFR1mjvcpkv9ZDUWrs1XKbx02qdH3oci10JVmWyt8tmhyqzKT20t3CMsl5Qh6</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/7F9KSvuD/ZLaQUK\n</data></match></read>
<write echo="ascii"><data>RECV\x0a/Nugyy7ZSh</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] osquJ4faRwiPvfuYdrhLoq\n</data></match></read>
<write echo="ascii"><data>NDIR\x1d/SkMIZFNF9/petzVR0/7uK53b2AxN</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x0e/wsS7PfgT/w9tf</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x11/jWbAtH4N3/Munboh\x2b\x004yAyYWwbZeC5h4s23IQYjPNovt7Fi2fwhIhuKYpFHbw</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/Munboh\n</data></match></read>
<write echo="ascii"><data>RECV\x0a/Nugyy7ZSh</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] osquJ4faRwiPvfuYdrhLoq\n</data></match></read>
<write echo="ascii"><data>SEND\x17/wsS7PfgT/w9tf/AYNilmoW\x1b\x000pQ4MNF7kPXhOjD2flaTfey3wxq</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /wsS7PfgT/w9tf/AYNilmoW\n</data></match></read>
<write echo="ascii"><data>NDIR\x1c/jWbAtH4N3/eDq6S1lAMq/wTPgJ0</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x1b/SkMIZFNF9/PQj77B2/qAmZAomU\x29\x00EzeVj0LeK26fs13vuDzWIijk3DnPbHMAP0IxmDygr</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/PQj77B2/qAmZAomU\n</data></match></read>
<write echo="ascii"><data>SEND\x18/wsS7PfgT/w9tf/8BfVgy2Nh\x43\x00GrTsTmYHhzdKfObuqxpcxbI87dhat6uyopSIxw8Td8NhhlofjgSxbPbQmlCjg3EWpZM</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /wsS7PfgT/w9tf/8BfVgy2Nh\n</data></match></read>
<write echo="ascii"><data>SEND\x1a/jWbAtH4N3/wQ3a/0hxjgj2Yjh\x3a\x00b460fSagH5l3PJe3ivVqyJ1yyMHxaJePpiT7tIIIvs8OcbFRW6zNsjdCI7</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/0hxjgj2Yjh\n</data></match></read>
<write echo="ascii"><data>SEND\x24/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/Gc24H\x4f\x00mijLpe3RAkRbar80lAIbUJAu3SXE4ztoGI8ktr7UTWvRgiLeSfhZ8wOD7MyipXOakzMmgNqogDhE0Fd</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/Gc24H\n</data></match></read>
<write echo="ascii"><data>SEND\x19/SkMIZFNF9/petzVR0/Vyx1sT\x52\x00N3vsRZRQUWhmiORYT4qFGPY37etQa4Q20IzchZXoZY8IUawQrnVKajW5g6IQeK2eMRsT94QAbQy3PA5M6F</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/petzVR0/Vyx1sT\n</data></match></read>
<write echo="ascii"><data>SEND\x24/jWbAtH4N3/eDq6S1lAMq/wTPgJ0/HwDaMKP\x48\x00AJoob0fDXe5IhTV5UwK809UyS9g5RMVWknJy5zJb7cVwi34OMUW2iwLxRtngC5aa9fAkVmCp</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/eDq6S1lAMq/wTPgJ0/HwDaMKP\n</data></match></read>
<write echo="ascii"><data>NDIR\x1e/jWbAtH4N3/7F9KSvuD/5Wnh0DZiRV</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x10/AnGXp/7Gqh/2PEK\x18\x00xSx7oC1d6pGka9O9I7NKAYxz</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /AnGXp/7Gqh/2PEK\n</data></match></read>
<write echo="ascii"><data>NDIR\x29/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/7vq6PuYvsq</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x24/jWbAtH4N3/eDq6S1lAMq/wTPgJ0/gvuqGum\x2b\x00hD5IjO3mZTCE6xMFqpzwo7IkdrHbhNvNdKL9E5YJyXA</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/eDq6S1lAMq/wTPgJ0/gvuqGum\n</data></match></read>
<write echo="ascii"><data>NDIR\x25/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/IEldgA</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x20/jWbAtH4N3/eDq6S1lAMq/kpIDmXlEoC\x48\x00qPQJ3z3LNIo7NcyD3HlelMI9ci0UW2nj4TK8JQZEtvM0QrGkBEiV1QXgpSwA4b4SN6ABkpKo</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/eDq6S1lAMq/kpIDmXlEoC\n</data></match></read>
<write echo="ascii"><data>SEND\x0f/jWbAtH4N3/9VpV\x57\x003BlLHsBvTvttFgpx4TNMMfUORxP5q61FDESR5Bd2uVSTq8Kcf0voYHMZzjz9DHJqJnuDxymjXU9d0hl3qNw2TK3</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/9VpV\n</data></match></read>
<write echo="ascii"><data>NDIR\x17/jWbAtH4N3/wQ3a/B3Az0mI</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x23/jWbAtH4N3/eDq6S1lAMq/wTPgJ0/TZmX7j</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x1b/SkMIZFNF9/PQj77B2/EEGT16Qm</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x1a/jWbAtH4N3/wQ3a/5uL3jokJq3</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x24/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x1b/SkMIZFNF9/PQj77B2/vMMFeima</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x32/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/7vq6PuYvsq/mZeepVZp</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x2c/jWbAtH4N3/eDq6S1lAMq/wTPgJ0/TZmX7j/pVYEEFJc\x5f\x00Y8p8tvW4Q4tDz7ZytDX3tyPJ2cus1rl5cpZnqQMCahGBwbVy3m6iylLJG3yaiiNv4Fp6ktrNSmFEjc3r0tkp0irexZqmMPY</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/eDq6S1lAMq/wTPgJ0/TZmX7j/pVYEEFJc\n</data></match></read>
<write echo="ascii"><data>SEND\x26/SkMIZFNF9/PQj77B2/EEGT16Qm/DXy6jsdi1E\x24\x00Sc57Xu3d2vh7Rcit3UPmks63MWo1jMQKDxYo</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/PQj77B2/EEGT16Qm/DXy6jsdi1E\n</data></match></read>
<write echo="ascii"><data>SEND\x18/SkMIZFNF9/petzVR0/sA7N8\x28\x00LXT0xcIepJ2cx3TlZBWrmAGBH7UipK6HnS3ocor7</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/petzVR0/sA7N8\n</data></match></read>
<write echo="ascii"><data>NDIR\x21/jWbAtH4N3/wQ3a/B3Az0mI/ahyRKY70G</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x31/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/7vq6PuYvsq/jKqoXNp</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x1b/jWbAtH4N3/eDq6S1lAMq/hlgb0\x15\x00Pg2WOSNTjD8ftF5sRl4S3</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/eDq6S1lAMq/hlgb0\n</data></match></read>
<write echo="ascii"><data>SEND\x1f/jWbAtH4N3/wQ3a/5uL3jokJq3/xotT\x4f\x00YxNXabe6R54Ct8YIXoH2ljPGVPlyGS9p6mcCWyeQwkYcRusC03hKqLyEHs0FfOjZT8WJQuhXlZfq1b2</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/5uL3jokJq3/xotT\n</data></match></read>
<write echo="ascii"><data>SEND\x21/jWbAtH4N3/wQ3a/5uL3jokJq3/hjKRLT\x59\x00GYpsw1X1Gv1QGQSlTPWwlXjYB7734oQD8RzmGa5rBShvKBOmQFdVFfRD6bMZBH87XjrmC0y808xDiIXhAt4OlYgdO</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/5uL3jokJq3/hjKRLT\n</data></match></read>
<write echo="ascii"><data>NDIR\x13/wsS7PfgT/OdmBtxO5l</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x2c/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/8vX2mql</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x2a/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/IEldgA/O5QX\x39\x00NfHkGuXGpiA5B8ddYBx8Yz2PTn55jVLx3V0WR7rMb5SCD6ymlyQzTEsKM</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/IEldgA/O5QX\n</data></match></read>
<write echo="ascii"><data>SEND\x29/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/xzRm\x4c\x00LMKFL8ltaYCDslv70UkB1xdzNUc0V1HCOr7PbcVZyQhdhV2MIK6ZewTmAg0lKCgr0AcMEpFjURfs</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/xzRm\n</data></match></read>
<write echo="ascii"><data>RECV\x21/jWbAtH4N3/wQ3a/5uL3jokJq3/hjKRLT</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] GYpsw1X1Gv1QGQSlTPWwlXjYB7734oQD8RzmGa5rBShvKBOmQFdVFfRD6bMZBH87XjrmC0y808xDiIXhAt4OlYgdO\n</data></match></read>
<write echo="ascii"><data>NDIR\x3b/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/7vq6PuYvsq/mZeepVZp/hxvKfqBl</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x26/jWbAtH4N3/7F9KSvuD/5Wnh0DZiRV/HHlGyvk</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x15/AnGXp/7Gqh/BTkYpewjP\x35\x00qzd8jK2MBA0nH6qEejCJjNGthFcWM5dJ1tzw37TSSwIppS8p88WqW</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /AnGXp/7Gqh/BTkYpewjP\n</data></match></read>
<write echo="ascii"><data>SEND\x19/jWbAtH4N3/wQ3a/XVzuW7Gh5\x2a\x00q45nugj5nbKxP0DFFq2zqJwDABE8tbNGEHuS7xLZr3</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/XVzuW7Gh5\n</data></match></read>
<write echo="ascii"><data>NDIR\x18/jWbAtH4N3/Fum6ywP9/dPlX</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x28/jWbAtH4N3/wQ3a/B3Az0mI/ahyRKY70G/GbYxzY</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x1e/jWbAtH4N3/Fum6ywP9/dPlX/APCGP\x47\x00AMfBYS64VqIcjcQJjkphnw6TG2mOMddUeCYwBsagu34NN3KhPbp2VNvmYNEuZH2xYTr4CWo</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/Fum6ywP9/dPlX/APCGP\n</data></match></read>
<write echo="ascii"><data>REPO\x24/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/Gc24H</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Gc24H removed\n</data></match></read>
<write echo="ascii"><data>REPO\x12/wsS7PfgT/mGdBUVq4</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] mGdBUVq4 removed\n</data></match></read>
<write echo="ascii"><data>REPO\x1b/SkMIZFNF9/PQj77B2/qAmZAomU</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] qAmZAomU removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x1d/SkMIZFNF9/petzVR0/rxJK6EGdmq</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x27/SkMIZFNF9/petzVR0/7uK53b2AxN/XBLydFoh2</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>REPO\x26/SkMIZFNF9/PQj77B2/EEGT16Qm/DXy6jsdi1E</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] DXy6jsdi1E removed\n</data></match></read>
<write echo="ascii"><data>REPO\x19/SkMIZFNF9/petzVR0/Vyx1sT</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Vyx1sT removed\n</data></match></read>
<write echo="ascii"><data>SEND\x20/jWbAtH4N3/wQ3a/5uL3jokJq3/RjrVv\x15\x00niciPIbyOhd5iXfnszYHr</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/5uL3jokJq3/RjrVv\n</data></match></read>
<write echo="ascii"><data>SEND\x29/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/05sa\x4c\x00x6yYkU0jZlcpomMekfPu5KeQGvx3H7aaZAokRduRCxul5I3Db3S6Zxm9QFgG2uBvJkMbvCGqPo2z</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/05sa\n</data></match></read>
<write echo="ascii"><data>SEND\x1a/jWbAtH4N3/wQ3a/nj223OANIR\x5b\x00P4nJifTSuB9SDkHbkgud3I8665iUVg65aYQO55ZnDdA4C27tQaAtIqGkXiWB0L0DestS7xFBSn5GEkZ4yXwFDGHNPOt</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/nj223OANIR\n</data></match></read>
<write echo="ascii"><data>REPO\x1b/jWbAtH4N3/eDq6S1lAMq/hlgb0</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] hlgb0 removed\n</data></match></read>
<write echo="ascii"><data>SEND\x25/SkMIZFNF9/petzVR0/7uK53b2AxN/kkKlfMZ\x3f\x007VmIEoNUH1lPzIQtl2tt2HLrzlydGruidDMptBTAP8voxoYa49WEztbJ3ePNsgg</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/petzVR0/7uK53b2AxN/kkKlfMZ\n</data></match></read>
<write echo="ascii"><data>REPO\x0b/AnGXp/tCSZ</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] tCSZ removed\n</data></match></read>
<write echo="ascii"><data>REPO\x1e/jWbAtH4N3/Fum6ywP9/dPlX/APCGP</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] APCGP removed\n</data></match></read>
<write echo="ascii"><data>REPO\x13/jWbAtH4N3/oHM2fxPs</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] oHM2fxPs removed\n</data></match></read>
<write echo="ascii"><data>SEND\x22/jWbAtH4N3/wQ3a/5uL3jokJq3/Hy5izrp\x5c\x00GCQxIPBzI1wolKm0aj1EvjqVka9C57Tc12VBOrZ7zMP3Az76QLB3mRPDhtgjLgPt5GEz7uqs5zvp35QK21bwQACyp4KU</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/5uL3jokJq3/Hy5izrp\n</data></match></read>
<write echo="ascii"><data>REPO\x19/jWbAtH4N3/wQ3a/XVzuW7Gh5</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] XVzuW7Gh5 removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x25/jWbAtH4N3/eDq6S1lAMq/wTPgJ0/AQkZ7jbE</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>REPO\x2c/jWbAtH4N3/eDq6S1lAMq/wTPgJ0/TZmX7j/pVYEEFJc</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] pVYEEFJc removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x24/jWbAtH4N3/wQ3a/5uL3jokJq3/NXVNDq5LO</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x1a/jWbAtH4N3/eDq6S1lAMq/zIpK\x5e\x00cH8WipHboRkerZyzx9zKWvYINuv8JrXfdU5dCi2X3KCBDC2CYOhbIuWt3AE3R47VGfwNAQvcTTqFL53RQyFskknx6FHzor</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/eDq6S1lAMq/zIpK\n</data></match></read>
<write echo="ascii"><data>NDIR\x2c/jWbAtH4N3/wQ3a/5uL3jokJq3/NXVNDq5LO/T9FKVSC</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>REPO\x25/SkMIZFNF9/petzVR0/7uK53b2AxN/kkKlfMZ</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] kkKlfMZ removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x08/T4XMo5y</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x0a/DtZITpdp1</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>RECV\x0f/jWbAtH4N3/HbA4</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] AaHAQNqGu7kBVBOPbzDtroB8eM5HFn1pOXbA0JATjXeFTQIHizoqmOm3wAB3EqsyAV1KVtDC2C7bKW9Lakw5t1\n</data></match></read>
<write echo="ascii"><data>NDIR\x2b/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/tNudN1</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x1c/jWbAtH4N3/eDq6S1lAMq/QiPuq0</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>REPO\x1a/jWbAtH4N3/wQ3a/nj223OANIR</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] nj223OANIR removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x2e/jWbAtH4N3/7F9KSvuD/5Wnh0DZiRV/HHlGyvk/bW7Z9oP</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>RECV\x0f/jWbAtH4N3/HbA4</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] AaHAQNqGu7kBVBOPbzDtroB8eM5HFn1pOXbA0JATjXeFTQIHizoqmOm3wAB3EqsyAV1KVtDC2C7bKW9Lakw5t1\n</data></match></read>
<write echo="ascii"><data>NDIR\x2e/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/mHyTdn9mT</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x14/jWbAtH4N3/wQ3a/F3sp\x40\x000y06e9bmK6QrpS6MphLY1zkGXedjvyOlD1osyTbOHfgemH0yZLaH7lexOJ4ihhTz</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/F3sp\n</data></match></read>
<write echo="ascii"><data>RECV\x17/wsS7PfgT/w9tf/AYNilmoW</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] 0pQ4MNF7kPXhOjD2flaTfey3wxq\n</data></match></read>
<write echo="ascii"><data>SEND\x32/jWbAtH4N3/wQ3a/5uL3jokJq3/NXVNDq5LO/T9FKVSC/JRLEH\x29\x00KZqH8SBKo7ooFgS6p7hSKlQ4Fo3NIzI7vQkSqQs6T</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/5uL3jokJq3/NXVNDq5LO/T9FKVSC/JRLEH\n</data></match></read>
<write echo="ascii"><data>SEND\x21/jWbAtH4N3/wQ3a/B3Az0mI/g4BxZXk4x\x36\x000rjRr4zenM4y6rNq7rPJnwKvZbylUq6LZsE4koZRhiZkjXaYltO4ow</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/B3Az0mI/g4BxZXk4x\n</data></match></read>
<write echo="ascii"><data>SEND\x23/SkMIZFNF9/petzVR0/wpWmFUphqo/rzGXl\x25\x00rcm9NB6g4egtGvdVj3NB18TBZmPm3xicPNlyV</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/petzVR0/wpWmFUphqo/rzGXl\n</data></match></read>
<write echo="ascii"><data>REPO\x0f/jWbAtH4N3/9VpV</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] 9VpV removed\n</data></match></read>
<write echo="ascii"><data>RECV\x24/jWbAtH4N3/eDq6S1lAMq/wTPgJ0/gvuqGum</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[DATA] hD5IjO3mZTCE6xMFqpzwo7IkdrHbhNvNdKL9E5YJyXA\n</data></match></read>
<write echo="ascii"><data>NDIR\x33/jWbAtH4N3/Fum6ywP9/V1Kys1Rg2t/7vq6PuYvsq/jfSF1h3bX</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>REPO\x21/jWbAtH4N3/wQ3a/B3Az0mI/g4BxZXk4x</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] g4BxZXk4x removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x2a/jWbAtH4N3/wQ3a/B3Az0mI/ahyRKY70G/b0q7CcRP</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>NDIR\x17/jWbAtH4N3/wQ3a/pxlCocu</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x2a/jWbAtH4N3/wQ3a/5uL3jokJq3/NXVNDq5LO/48N3E\x22\x00pndmS2woiZ7rdIKgLx83uSpXzGyYzuv9Pq</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/wQ3a/5uL3jokJq3/NXVNDq5LO/48N3E\n</data></match></read>
<write echo="ascii"><data>NDIR\x35/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/tNudN1/dkz2bzC6z</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x14/wsS7PfgT/w9tf/2S8vh\x41\x00YfOOaHcIsBNoQUZFW8JsPZnC2Fm6sqbg2IvokhZJ0mzPoBxnV6J68RfKPUa8cMSS6</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /wsS7PfgT/w9tf/2S8vh\n</data></match></read>
<write echo="ascii"><data>REPO\x32/jWbAtH4N3/wQ3a/5uL3jokJq3/NXVNDq5LO/T9FKVSC/JRLEH</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] JRLEH removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x2c/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/qtI0nVT</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>REPO\x10/AnGXp/7Gqh/2PEK</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] 2PEK removed\n</data></match></read>
<write echo="ascii"><data>SEND\x2c/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/NLct9xQ\x14\x009DIPDhBpus171G11XC5D</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/NLct9xQ\n</data></match></read>
<write echo="ascii"><data>SEND\x15/wsS7PfgT/w9tf/zjTZ6p\x3c\x00bjBVZywYnINl0oDd8rX9VsavCeldEIV2GazewBihQCVOJCrzFyhCy1hDBtxi</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /wsS7PfgT/w9tf/zjTZ6p\n</data></match></read>
<write echo="ascii"><data>REPO\x17/wsS7PfgT/w9tf/AYNilmoW</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] AYNilmoW removed\n</data></match></read>
<write echo="ascii"><data>REPO\x15/wsS7PfgT/w9tf/zjTZ6p</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] zjTZ6p removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x2d/SkMIZFNF9/PQj77B2/EEGT16Qm/ucZQrBP0/JfvgPYqw</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x32/SkMIZFNF9/petzVR0/7uK53b2AxN/XBLydFoh2/28hJjaF4hM\x2b\x00AqOuQTLuXEpZCcgZRHmNHKWui0SeIpnivetLWerWTGh</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/petzVR0/7uK53b2AxN/XBLydFoh2/28hJjaF4hM\n</data></match></read>
<write echo="ascii"><data>REPO\x2a/jWbAtH4N3/wQ3a/5uL3jokJq3/NXVNDq5LO/48N3E</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] 48N3E removed\n</data></match></read>
<write echo="ascii"><data>SEND\x23/jWbAtH4N3/7F9KSvuD/5Wnh0DZiRV/0lv2\x28\x00gD9PJzWuEmr2g1gLqPeaS5yrnqSmBm1pCNZHEDL5</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /jWbAtH4N3/7F9KSvuD/5Wnh0DZiRV/0lv2\n</data></match></read>
<write echo="ascii"><data>REPO\x15/AnGXp/7Gqh/BTkYpewjP</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] BTkYpewjP removed\n</data></match></read>
<write echo="ascii"><data>REPO\x32/SkMIZFNF9/petzVR0/7uK53b2AxN/XBLydFoh2/28hJjaF4hM</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] 28hJjaF4hM removed\n</data></match></read>
<write echo="ascii"><data>NDIR\x1a/jWbAtH4N3/eDq6S1lAMq/WDej</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Added new directory\n</data></match></read>
<write echo="ascii"><data>SEND\x10/SkMIZFNF9/EG3c0\x28\x00UWfqXpdGOGMrAMB2AN14QvZ8RNMIaCsLpY3Ogm9O</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] File received: /SkMIZFNF9/EG3c0\n</data></match></read>
<write echo="ascii"><data>REPO\x1a/jWbAtH4N3/eDq6S1lAMq/zIpK</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] zIpK removed\n</data></match></read>
<write echo="ascii"><data>STOP</data></write>
<read echo="ascii"><delim>\n</delim><match><data>[INFO] Terminating\n</data></match></read>
</replay>
</pov>
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Can I use netcat as a lightweight web-server that will save post data as a file?
I know that netcat can be used as a lightweight web-server to host a file, but I want to also have any post data saved to a separate file. Is this possible with netcat? What's the lightest way I can do something like this, preferably in os x.
Thanks
A:
Well, you can get all the html headers:-
while true
do
cat some_file_to_server | nc -l 3333| head --bytes 2000 >> log_file
date >> log_file
done
This will save the first 2000 bytes of the headers and the time stamp to a log_file, then restart the server.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
7th Indiana Infantry Regiment
The 7th Regiment Indiana Volunteer Infantry was an infantry regiment from the State of Indiana that served in the Union Army during the American Civil War.
Service
The 7th Indiana Volunteer Infantry was organized at Indianapolis, Indiana, between April 21 and April 27, 1861. The Regiment was sent to Grafton, Virginia (now West Virginia) on May 30, 1861, and participated in the Battle of Philippi, one of the first land battles of the Civil War, on June 3, 1861.
As part of Brigadier General Thomas A. Morris' Indiana Brigade (of Major General George B. McClellan's Army of West Virginia), the 7th Indiana participated in the Rich Mountain Campaign from July 6 to 17. The regiment saw action at Laurel Hill (July 7), Belington (July 8), the Battle of Corrick's Ford (July 12–14), and in the pursuit of Brig. Gen. Robert S. Garnett's forces (July 15–17). The regiment was mustered out of service on August 2, 1861.
A new 7th Indiana was organized from the three-month regiment at Indianapolis, Indiana, on September 13, 1861. The regiment mustered out of service on September 20, 1864. Men who re-enlisted, and those still with unexpired service, were transferred to the 19th Indiana Volunteer Infantry Regiment.
Total strength and casualties
The three-month regiment suffered one enlisted man killed in battle and two enlisted men who died of disease, for a total of three fatalities.
The re-mustered regiment suffered 8 officers and 108 enlisted men killed in action or died of wounds and 2 officers and 111 enlisted men who died of disease, for a total of 229 fatalities.
Commanders
Colonel Ebenezer Dumont
Colonel Ira Glanton Grover
See also
List of Indiana Civil War regiments
Indiana in the Civil War
Notes
References
Union Regimental Histories - Indiana, The Civil War Archive website, after Dyer, Frederick Henry. A Compendium of the War of the Rebellion. 3 vols. New York: Thomas Yoseloff, 1959.
Civil War - Indiana
Category:Military units and formations established in 1861
Category:Military units and formations disestablished in 1861
Category:Military units and formations disestablished in 1864
Category:1864 disestablishments in the United States
Category:Indiana Civil War regiments
Category:1861 establishments in Indiana
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Speeding up a Git monorepo - illuminated
https://dropbox.tech/application/speeding-up-a-git-monorepo-at-dropbox-with--200-lines-of-code
======
benreesman
Monorepo/multirepo (and monolith/microservice which often tags along) seems
like a false dichotomy.
There are costs to having big repositories (e.g. TFA and needing to do scaling
work), and there are costs to having lots of repositories involved in
producing a unified working result (dependency resolution is NP-complete in
many of its useful formulations). Big players have the muscle to optimize
Mercurial and Git, so they get to do super slick trunk-only monorepo
development at engineer-commit scale, but still often have auxiliary
repositories that take e.g. machine generated commits. Smaller players
probably aren’t hitting scaling limits on these tools. But every situation is
different and if one approaches it as an engineering problem you can usually
do something very workable.
Likewise with monolith/microservice: there is a happy medium where you
introduce a network boundary for an engineering reason (maybe one part of my
computation needs a lot of CPU but a different part needs a lot of RAM, so
they run on different SKUs/instance types). My big giant web app that dates to
the founding of the company? Probably don’t want to rewrite that so let’s spin
services out of it incrementally when I need to write something in C++ or use
a shitload of RAM or whatever. That’s bread and butter systems engineering.
But this “pick a side” mentality where it’s like one giant ball of PHP in one
giant Subversion repository or every team has their own little service in
their own little repo and I burn 40% of my cycles parsing JSON isn’t a set
cover: you’re allowed to choose a happy medium.
Just do things for valid technical reasons and don’t have Conway’s law go
apeshit on your architecture by shattering it into a zillion pieces. The human
factor stuff can be addressed with engineering rigor and consensus. “This is
too slow to be in Python now” is a good reason to make a service. “The iOS
team shares no code with the web team and bisects will be faster/easier” is a
good reason to make a repo.
“I want to have my own coding style and/or use some language no one else knows
and/or learn k8s and/or not deal with that team I don’t like” are not
engineering reasons to type ‘git init’ or make a network call.
~~~
afarrell
> The human factor stuff can be addressed with engineering rigor and
> consensus.
How do you add engineering rigor and consensus? Let's say as an Individual
Contributor.
~~~
cjfd
By working at a place where people listen to you and are not (too) crazy.
~~~
Cthulhu_
Just you? If it's a team effort, places like Dropbox have hundreds, if not
thousands of engineers, all with an Opinion.
~~~
cjfd
Sometimes I get they feeling that they should indeed just listen to me. When
one needs an argument to convince a colleague that one really should not be
using == to compare two floats because of rounding errors or when working in a
place currently suffering from blatently ignoring
[https://www.joelonsoftware.com/2000/04/06/things-you-
should-...](https://www.joelonsoftware.com/2000/04/06/things-you-should-never-
do-part-i/) and experiencing the predictable consequences afterwards I indeed
quite often get the feeling that in many places where I could work I actually
am the only adult in the room.
To be a bit more practical, though, yes one should listen to others as well
because in some cases they might actually have ideas that are good. Also,
morally, it kind of is the golden rule that if one expects to be listened to
one needs to listen oneself as well. In cases of large places with lots of
people I would say that there should be some form of code ownership and hence
people and/or smallish teams can decide what to do with the code that they
own. One of the most important things that contributes to code quality is not
too many changes of code stewardship.
------
klodolph
I’m still hoping some standard toolset emerges for dealing with large
monorepos sometime in the near future. At the moment it’s clear that a number
of companies are rolling their own solutions, which follow one of two
patterns:
\- Persistent process which watches workspace changes, or
\- Workspace in virtual filesystem.
The other common factor seems to be trunk-based development with all commits
rebased into a linear history. I’m not super hopeful that we’ll see an open-
source solution in this space for a while, though—any company with a code base
large enough to really need these solutions is also large enough to throw a
few engineers at VCS, especially given that they’d already have engineers
supporting VCS from the operations side of things.
~~~
ublaze
Author of the post here.
I think Git upstream is trying to simplify configuration. They have a config
option called `features.manyFiles` which enables most of the features we
enabled for our developers ([https://git-scm.com/docs/git-
config#Documentation/git-config...](https://git-scm.com/docs/git-
config#Documentation/git-config.txt-featuremanyFiles)).
We wanted to use this instead of deploying a wrapper, but it turns out that
some of Git's features like fsmonitor do not interact well with repositories
with submodules (there were Git crashes). And we have some developers that
work on repositories with submodules. So we needed something more flexible,
like enabling these features only on particular repositories.
~~~
dundarious
I’m quite confused as to what you actually shipped to your developers to
increase performance. This config option is a great place to start, but it
would be great if that were clearer, so that others could follow suit.
~~~
ublaze
We shipped a wrapper that tweaks git configs and logs metrics, and a custom
fsmonitor hook that was _slightly_ faster than the stock one. We also ensured
watchman was installed on developers laptops.
And we made a few changes to Git to fix bugs (for example, `git stash` wasn't
using fsmonitor data, so it was slow).
~~~
dundarious
It would be great to have a listing of those config tweaks, even if with
caveats attached, such as “causes issues with submodule”.
I don’t want to seem demanding, but it’s such a tantalizing article without
this info :)
~~~
ublaze
Sure.
core.fsmonitor is set to our custom fsmonitor (this causes issues with
submodules, at least on 2.24)
core.untrackedCache true
We use index version 4
And a slight hack: our wrapper sets GIT_FORCE_UNTRACKED_CACHE = 1. This forces
`git status` to write the untracked cache if it notices a difference. I was
too lazy to add a patch to configure that.
~~~
dundarious
Wonderful, thank you!
------
shoo
I reckon the discussion of the history that lead dropbox to switch to a
monorepo is more interesting than the git speedups.
The last couple of places I've worked at are large non-tech companies, both
orgs were internally using on-prem gitlab/github/bitbucket . These tools make
it much easier for teams (or individuals) to create as many new repos as they
want without coordinating with anyone else -- for better or worse.
I suspect what happens quite often these days is that people create many repos
without consciously thinking about if that's a good idea or not -- because it
is familiar and because there are relatively high quality tools/products to
let you make more repos.
The small part of the org I currently work in probably has O(200) employees
and O(200) git repos.
The last system I worked on in previous company had a single git repo
containing all parts of a line of business application (db, API server,
frontend, backend servers for batch jobs) but then there were about 40 other
git repos containing deployment scripts etc used to deploy just this one
system. It made it bloody hard to figure out exactly what version of what
script or library was actually used to deploy ( to be fair, a lot of this was
a consequence of using ansible modules which expects each module to be in its
own git repo, and having a couple of people hack together a lot of ansible
modules in a short amount of time without review)
------
jgavris
Great post!
I wrote a (fast?) fsmonitor hook in Rust...benchmarked against the reference
Perl implementation it's quite a bit faster. On a repo of 130k files, my
monitor is able to `git status` in 18 millseconds.
[https://github.com/jgavris/rs-git-fsmonitor](https://github.com/jgavris/rs-
git-fsmonitor)
~~~
ublaze
Which operating system are you using? That's impressive. More importantly, our
hook doesn't support the new query version so we might want to switch.
~~~
jgavris
I use macOS, but some folks have contributed a linux package / installer. And
yeah, I added the v2 of the hook recently which is even faster!
------
thinxer
For anyone interested in why monorepo works, I'd recommend the book Software
Engineering at Google: Lessons Learned from Programming Over Time. It has
detailed the reasons for the One Version Rule and Version Control over
Dependency Management.
~~~
secondcoming
Doesn't Google use Perforce though, which (last time I used it) forces a
monorepo approach? git doesn't have equivalents to branchspecs and
clientspecs.
~~~
thinxer
It is because Google wants a monorepo, then Google choose to use Perforce (and
later Piper). It is not that Google uses Perforce and thus are limited to a
monorepo.
The core value behind monorepo (and monorepo-like approaches) explained in the
book is that dependency management is harder than version control.
------
nickcw
It is interesting that the speed of lstat on macOS is the driver behind this
problem. According to the article it is 10x slower than Linux.
I wonder if anyone has tried attacking that end of the problem? Faster lstat
on macOS would benefit all applications not just git.
~~~
ublaze
[https://gregoryszorc.com/blog/2018/10/29/global-kernel-
locks...](https://gregoryszorc.com/blog/2018/10/29/global-kernel-locks-in-
apfs/) is an interesting write up about the problem.
------
silverlake
The fact that so many are using monorepos points to a weakness in revision
control and dependency management tools. This is a big gap where someone will
invent Git’s replacement. What features will it need to replace Git?
~~~
j88439h84
> The fact that so many are using monorepos points to a weakness in revision
> control and dependency management tools.
People seem to like monorepos, what problem do you have in mind?
~~~
danenania
Access control is a big one.
------
swiley
Is there a reason people prefer a monorepo to submodules?
I worked at one place that kept everything in a mercurial mono repo and it was
a real pain keeping branches in sync.
~~~
saxonww
I introduced a submodule at my last job to hold common build code used across
multiple repositories. I knew going in that some of our developers didn't
really understand git, and were not interested in rectifying that. I won't say
the submodule was a disaster, but I definitely paid for it with time spent
sitting with people and helping them fix messes. I would do it again but only
if I knew I could count on the team to make more than a token effort to
understand what a submodule was and how it worked. I would not even consider
adding multiple submodules unless I felt like everyone knew exactly how to use
them.
Another potential source of issues: the submodule remote URI is checked in as
part of the .gitmodules file. If your CI system uses a different URI than your
developers, you have to work around that. If you change where your source is
hosted and you want to check out an old version, you have to figure that out
too.
That said, I think the most common reason is the same reason some people
prefer monorepos in the first place: they perceive the monorepo as simpler,
and adding submodules is not simpler. They want to know about and manage 1
repository clone. They want to commit, push, review, and build out of 1
repository. They want to search for stuff in 1 directory tree. They'd also
like to do that with 1 tool, ideally 'git'. Nothing really offers that except
monorepos.
~~~
mkesper
You can use relative paths for submodule urls.
------
duncans
Title should be "Speeding up a Git monorepo at Dropbox with <200 lines of
code" \- looks like some sanitisation regex got over-zealous here.
~~~
illuminated
Yes, I have posted that exact title but haven't noticed the cut until now. I
hope the mods will be able to fix this.
~~~
fastball
Honestly the HN obsession with modifying titles is excessive. I understand not
wanting to have incendiary titles which encourage flamewars, but the rest of
the policies around title editing / sanitizing don't seem that useful and
actual hinder coherence in many cases (like this one)
------
kccqzy
It's a shame that Dropbox abandoned Mercurial for Git. With both Facebook and
Google contributing to better support for monorepos in Mercurial, Mercurial
seems like a better choice for big monorepos.
~~~
mehrdada
Huh? I don’t know about Facebook but Google for sure does not use Mercurial as
monorepo backend (nor does it use Git). There are Git and Mercurial-alike
clients to interface with the in-house backend which is a Perforce like thing.
Neither Git nor Mercurial would be fun to use at Google scale. Dropbox has a
much smaller monorepo hence they can clone the whole Git thing on developer
machines. I assume doing the same with Mercurial is impractical as no one has
patience for something that slow.
~~~
kccqzy
I should clarify my comment by saying monorepo-related Mercurial improvements
benefit not just those monorepos backed by Mercurial, but also where Mercurial
is "just" a front end to a different system. I mean just think about it, what
does a front end in this case really mean? When you run a command like `hg
log` how much of the original Mercurial code are you running? Do you design an
entirely different system that happens to share the same command-line syntax
as the original Mercurial, or do you emulate the .hg folder format and run the
original Mercurial code, or somewhere in between? Thinking about this problem
would shed more light on why Google's work on Mercurial benefits everyone else
with a big monorepo even though Google is "just" using Mercurial as a front
end.
And both Facebook and Google have contributed to Mercurial on this front,
though admittedly Facebook did more work than Google did. I know the tree
manifest feature ([https://www.mercurial-
scm.org/wiki/TreeManifestPlan](https://www.mercurial-
scm.org/wiki/TreeManifestPlan)) is done by Google and upstreamed, and it
benefits every repo with millions of files. (Just clone the hg repository and
search for commits with a google.com author email and see what kind of commits
they are.)
~~~
mehrdada
Sure, but still in Google/Facebook case there’s a centralized backend that
does the day to day operations that you invoke from your laptop. In Dropbox
case, it is just a local git repo that you push to server only when you want
to land a change; just like whatever one does with GitHub, but quite a big
one, so the use case is quite different from F/G, which is what I was getting
at. In principle maybe you could do it, that’d require quite a big investment
in effectively rebuilding mercurial though.
------
cryptonector
Did Microsoft's enhancements to Git, particularly the Bloom filter
optimizations to git log/blame make it into the mainline?
~~~
WorldMaker
It sounds like a lot of them have, but most still need to be configured. The
commit-graph [1] is the biggest internal part of those optimizations and I
believe core.commitGraph is still defaulted to off (and probably is more
overhead than necessary for small to medium repositories).
[1] [https://git-scm.com/docs/commit-graph](https://git-scm.com/docs/commit-
graph)
~~~
stolee
Thanks for the link to the documentation. That is updated with every major Git
version, and can be used to track what features are present. Also, the release
notes can be helpful.
In particular, the recent Git v2.27.0 release does include an implementation
of Bloom filters with speedups for `git log` and `git blame`. You need to
manually run the command to make it work. The version I prefer is this:
> git commit-graph write --changed-paths --reachable
After that first write (which writes filters for every reachable commit) you
can do a smaller write by adding `--split` to write incrementally [2]
[2] [https://devblogs.microsoft.com/devops/updates-to-the-git-
com...](https://devblogs.microsoft.com/devops/updates-to-the-git-commit-graph-
feature/)
By writing these filters, you will speed up most `git log` and `git blame`
calls. There is an improvement coming in the next version that includes
speedups for `git log -L`.
__Caveat: __The biggest reason these improvements have not been widely
advertised is that the user experience has not been completely smoothed out.
In particular, you can only write the changed-path Bloom filters using the
command(s) above. If a commit-graph is written during GC (due to
`gc.writeCommitGraph` config setting) then the filters will disappear. Similar
for `fetch.writeCommitGraph`. We plan to have these resolved in time for
v2.28.0, along with more performance improvements.
(Full disclosure: I am a contributor to Git, Scalar, and VFS for Git, which
are referenced by the article.)
~~~
ublaze
Thanks for your work and your team's work on Git!
------
alkonaut
For huge repos building on build servers also becomes a problem. A build
machine can usually do a shallow clone, but it would be better to filter to
smaller pieces.
Even more importantly, when you have multiple builds using the same repo, CI
systems usually work by setting up a local copy of the repository per build,
so if you have a compile+unit test build, and another for slower integration
tests running the same code, then the machine might end up having two git
/objects directories somewhere, containing the same data. If you have a 100Gb
repository and maybe 100 different builds against it, this quickly becomes
unmanageable.
What I'd want is the ability to use a common objects directory for a machine,
where common objects would be deduplicated. I don't know if this is achievable
with GVFS or even by linking the directories?
------
matt-attack
Can someone explain how git can be slow for these folks while the Linux kernel
continues to use git? Do these performance issues plague Linus as well? Or is
the Linux kernel smaller than the code in TFA?
~~~
alkonaut
Kernel is tiny. Whole repo is like 1.5GB. That's nothing. We are just 20 devs,
not a massive company and I'm on 100k commit, 50Gb history repo.
~~~
saagarjha
That’s a massive repository…I’ve worked in code with many hundreds of
thousands of commits from many, many people and they’re a couple gigabytes at
most. Are you storing assets in your tree?
~~~
alkonaut
Yes a lot of it is non-text content (By file count not so much, but by size
probably 80% or more). Nothing unnecesary, but resourcees required to build
and test each revision (Not e.g. documentation). It's a document based and
graphical app (CAD) so it is not practical to store separate non-text assets
from the source tree. Each branch has different versions of various test
inputs/outputs, drawings, image resources etc. We use git LFS obviously,
otherwise this whole setup would be impossible. In all, it's actually a decent
experience. We couldn't migrate off Subversion until LFS was stable, but now
that it is, Git is actually a quite good VCS for the "Subversion use case"
(Large, central, heavy in binaries).
------
perryizgr8
Those times look too long for the number of files. Here's my time:
$ time git status
On branch master
Your branch and 'origin/master' have diverged,
and have 1 and 115 different commits each, respectively.
(use "git pull" to merge the remote branch into yours)
real 0m0.517s
user 0m0.240s
sys 0m0.472s
$ git ls-files | wc -l
130685
This is on Ubuntu Linux, no special additions done to git. I wonder why the
author's experience is so different.
------
saxonww
I started using this a few months ago to solve the very important problem of
my git-status-decorated bash prompt taking too long to display on macOS. I'm
very happy with the result, but there are a couple of situations where it
seems to get stuck and I have to go kill processes: after I've created a lot
of untracked files and then deleted them; and if I've moved back and forth
between revisions with thousands of combined file changes.
Still highly recommended for large (or just old) repos.
~~~
saagarjha
I learned very quickly to run my bash prompt in a timeout wrapper after
cloning WebKit once and having an absolutely miserable time doing anything
while inside the repository.
------
the8472
They mention stat syscalls as limiting factor in large repos. I wonder whether
the ceiling of "too large" could be raised by batching/streaming stat calls
via io-uring. It wouldn't help mac users, but at least on linux it could
improve the out of the box experience for large repos.
------
monocul4r
There is currently no efficient way in git to just clone a single
subdirectory. This is very inconvenient when dealing with very large monorepos
- even with depth 1 - you still have to grab the entire tree.
~~~
the8472
[https://github.blog/2020-01-13-highlights-from-
git-2-25/#par...](https://github.blog/2020-01-13-highlights-from-
git-2-25/#partial-clones-and-git-sparse-checkout)
------
revskill
I couldn't use monorepo if i have a service to deploy to Heroku though. Or do
you know if i can deploy a monorepo to Heroku ?
------
mkesper
Easy fix: Disallow use of MacOS. I really don't get why developers use an OS
where no upstream package management of developer tools exists and that offers
no way of running performant VMs.
~~~
Hackbraten
I do like macOS’s UX and the fact that OS updates have been literally painless
for the 16 years I’ve been using macOS as my daily driver. At the same time,
it being a Unix under the hood, it gives me POSIX compatibility all over the
place. Regarding developer tools, Homebrew has done a good enough job so far.
YMMV.
I see why people dislike macOS but banning it at the workplace would be over
the top.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
-----BEGIN OPENSSH PRIVATE KEY-----
b3BlbnNzaC1rZXktdjEAAAAAFmFlczEyOC1nY21Ab3BlbnNzaC5jb20AAAAGYmNyeXB0AA
AAGAAAABAHURyWtYwqVbjholNpL6opAAAAEAAAAAEAAABoAAAAE2VjZHNhLXNoYTItbmlz
dHAyNTYAAAAIbmlzdHAyNTYAAABBBM+ppawNxvkdHbOaB3ygsRueTdIKiT+OQkAH/5LpDx
XcD6i5AR8T/vrCsZ9/y+8GxU8gmvg4Uszr6LDfaQBZnsUAAADAFqKM/ylVkJ/ZA40ZROrW
LNgrttf2+lpVkADwXWzhuESFPPzERKlbHVsVtbiiYmPkLnY1s5VM4zXIj7xyO9YNA9KcM5
GHOKUL2/NmDaTyGgc9s3BGu/ibpjSeOd1rtGAB4cw1s9ifbXBQd3qDbqzaEmovs3MGaGHD
c3VagdxhsppjrPjZ+B40Pzs9QkSGutsSJDpH9wVIu4OLr89TquTU3PVACDRU03lPPENVbt
rh2IMJeEQyNINQHtfVwordj8LMOEsBjyQ1aqHNva/iKyTBiw==
-----END OPENSSH PRIVATE KEY-----
| null |
minipile
|
NaturalLanguage
|
mit
| null |
June 24, 2013
The Perfect Show-Trial for the Putin Era
The trial of Moscow's May 6 protesters begins today. There's little doubt about how it will end.
May 6, 2012 in Moscow was warm and sunny, one of the first days of spring that you could walk around without a jacket. Katya Minsharapova was wearing a light summer dress, the kind that got a few extra seconds of attention from strangers on the hour-long subway ride from the suburb of Altushyevo to the center of Moscow. Katya, who is 24 years old, and has a warm, pretty face, had arrived in the center of town with her 22-year-old boyfriend, Andrei Barabanov, for an antigovernment protest scheduled for later that day.
Minsharapova and Barabanov’s politics were more curious than fully articulated. They knew they were dissatisfied with the current order of things, with venal officials and the poor state of education and unsatisfying job prospects. She was trained in airbrushing; he helped with designs and braided friends’ hair into dreadlocks for spare cash. The couple was political in the way that many young people in Moscow were a year ago: energized for the first time about the prospect of changing how they were governed, and perhaps a little naïve about the ease of doing so.
A round of protests earlier that winter, following fraudulent parliamentary elections, had been marked by a certain buoyancy, a sense, however short-lived, that wit and logic might just be the thing that could undo the cynicism of the Putin system. Minsharapova later recalled “the positive atmosphere,” at the earlier protests. “Everyone was smiling, happy. There was no hatred, no ill-will.” That idealism about change now seemed misplaced. The gathering on May 6, after all, had been called to protest the next day’s re-inauguration of Vladimir Putin, who was treating his return to power as a virtuous and redeeming triumph.
With Moscow largely empty thanks to Russia’s annual May holidays, the demonstration offered the opposition and its supporters a chance to act out their frustrations that they didn’t achieve more—at least not yet—and to hold a defiant Irish wake for the winter protest movement. Estimates of the crowd on May 6 would later vary, but it seemed possible that around 40,000 people had shown up—less than the 100,000 that came to rallies that winter, but far more than had ever attended a political demonstration at any other time in the Putin era. Those who joined represented a mix of Russia’s political ideologies and social classes: older liberals, far-left socialists, young professionals, nationalists, and anarchists.
Associated Press
MAY 6
As many as 40,000 opposition protestors gather in downtown Moscow to protest Vladimir Putin's re-inauguration as president.
Mikhail Kosenko, who is 38 years old and has a long mustache and droopy eyes, came by himself. Once a sharp-witted high school student, he had suffered a brain injury in the army service in the late 1980s after being beaten by fellow cadets. Doctors pronounced him medically disabled; for years after, he mainly stayed inside the Moscow apartment he shared with his sister and her adult son, listening to the radio and reading books on communist history.
Artem Savelov also came alone. Savelov is 33 years old, with a boyish face and a wide smile that curves upward somewhat mischeviously; if not for the silver streaks in his hair, he could pass for a teenage skateboarder in California. He has strong stutter that came on as a young boy.
Denis Lutskevitch, a handsome, solidly built 21-year-old university student who had served in an elite marine infantry unit, came with some classmates. He had marched through Red Square for the annual May 9 military parade the year before, and his mother, Stella, told me that afterward, “He came home with such pride. He had such a smile.” Lutskevitch was thinking of joining one of the Russian security agencies, perhaps the Federal Guard Service, which protects Putin and other officials, and had already been called for an interview. He didn’t have pronounced political views; he came to the protest mainly because his friends seemed intrigued. Maybe he could watch over them if things got messy.
Stepan Zimin, who is 21 years old, showed up with some fellow anarchist friends. As is the fashion among anarchist street activists, they all wore surgical masks over their faces. Zimin had diverse interests: He was studying Arabic at the Russian State Humanities University in Moscow and liked to spend weekends dressing up for medieval historical reenactments.
The march was meant to snake its way from the Lenin statue at October Square to Bolotnaya Square, just across the river from the Kremlin and the site of a large protest earlier that winter. They never made it. After marching down the wide thoroughfare of Yakimanka Street, passing the headquarters of the Ministry of Internal Affairs and the French Embassy, they reached a bridge that leads to the Kremlin walls. There, a cordon of riot police in shoulder pads and plastic visors—their imposing yet awkward getup has given them the nickname “cosmonauts”—was blocking the flow of marchers toward the stage set up on the square.
Some people toward the front, unable to move any further because of the police, sat down. Others shouted to keep marching but couldn’t agree on a direction: to the right, straight into the police, back toward the start of the march. Negotiations, to the extent there even were any, went nowhere. So marchers sat on the hot asphalt, yelling at police and singing protest songs, but mainly not knowing what was going on.
A clip from state-owned TV station Russia Today shows police clashes with protestors in Bolotnaya Square.
About an hour later, a handful of protesters broke through the police line. Officers swung their batons wildly. Chunks of asphalt went flying. As slowly as events had unfolded an hour earlier, they were now moving quickly. Activists wearing scarves over their faces tossed flares that soared in a flash of yellow sparks toward the police. Every few minutes, riot troops would form into lines and push into the crowd, knocking down some people and grabbing others for arrest. Tufts of dark gray smoke, set off from grenades launched by demonstrators or provocateurs—or both—masked an ugly scene of metal and plastic and flesh.
Lutskevich was separated from his friends from the university. He would later tell his mother that he saw a young woman being grabbed by the police; he lunged to try and free her. Officers went after him, managing only to rip off his shirt. He stood on the square, naked from the waist up, looking for others who might need help. A few minutes later, he was surrounded by as many ten officers in riot gear, who kicked him and beat him with rubber truncheons. He was arrested and carried away.
Minsharapova, who is just under five feet tall, couldn’t see much of anything. A knot of police swept through the tightly packed crowd, lifting her up into a crush of people and separating her from Barabanov. “I understood right away that I wouldn’t be able to find him,” she recalled. “He’s gone. And I start to panic. I had his mobile phone in my bag, so I can’t call him. I can’t see him. Where we were just standing, there now isn’t anybody.” Twenty or so minutes later she got a call from an unknown number: it was Barabanov on a borrowed phone, telling her he’d been beaten and detained by the police and was now sitting in an avtozak, an armored police van. Zimin and Savelov were detained, too.
In total, more than 450 people were arrested that day. All were held just a few hours, or at most overnight, and given administrative summonses and small fines. The next morning, a judge gave Barabanov the token sentence of the night he spent in jail and released him. Police took Lutskevich, his face and back covered in bulbous welts, to a hospital, where doctors had a look at him and let him go. Kosenko was also caught up in the clashes and was arrested. He came home and told his sister, Kseniya, he would have to pay 500 Rubles, or about $16. That’s not so bad, she thought. “My son and I even laughed,” she said, “at how he got off so cheaply.”
Today, the events of May 6, 2012—and more important, how the Russian state has chosen to respond to those events—are regarded as an inflection point in the Putin era. Before that day, it was relatively safe to be a regular, anonymous supporter of the opposition; afterwards, that was no longer the case. For more than a decade, Putin and those around him had managed to secure their rule with clever games of cooptation and manipulation. Now they would now rely on blunter tools. The good times of the 2000s, fueled by rising oil prices and Putin’s general popularity, allowed for a delicate touch in maintaining control. May 6 is when things began to get a lot rougher. One year on, the events of one chaotic afternoon have morphed into large-scale prosecutions that are shaping up to be the defining piece of political theater in the new age of Putinism.
The immediate days after the protest were strange ones. On his way to the Kremlin for his inauguration ceremony on May 7, Putin and his motorcade glided through the streets of the capital that had been cleared of nearly all its citizens. On television, the spectral ceremony created the impression of an aloof emperor fearful of his subjects, or at least wholly detached from them. Still, the protest mood lingered, now manifested in momentary gatherings of a few dozen people in public squares or along the city’s boulevard ring. They would be chased away by police, only to pop up across town an hour later.
Associated Press
MAY 6
Denis Lutskevich, a former naval cadet, is detained by police in Bolotnaya Square.
A few days after the inauguration, Moscow’s mayor, Sergei Sobyanin, made a show of visiting injured officers in the hospital, promising them apartments in Moscow as thanks for “preventing an act of provocation.” Putin’s spokesman, Dmitry Peskov, was less subtle. Police should “smear their livers on the asphalt,” he said of street protesters. The Investigative Committee, a powerful body equivalent to the FBI, announced that it was opening a criminal case relating to calls for mass riots on May 6. Two hundred investigators were put on the case. Most of the investigation centered on watching the hours of footage taken on the square and combing the records of those detained the day of the protest.
The arrests began on May 27 with a 19-year-old student at Moscow State University. Around 10 p.m. the next night, Barabanov was at home with Minsharapova and his 55-year-old mother when the lights went out. His mother walked out to check the fuse box and found a group of men in black masks carrying machine guns. The men burst into the apartment, throwing Barabanov to the floor. Once the men had taken him away, one came back to show his mother an arrest warrant.
Police came for Zimin on the morning of June 7. A friend of his girlfriend, Sasha Kunko, wrote her around lunchtime to ask, “Are you aware of what’s going with Stepan?” She didn’t believe it—until she checked the news on the website of the Investigative Committee. At 9 p.m. that same evening, the buzzer rang at the apartment Kosenko shared with his sister and her son. A “whole crowd” of men walked in and announced that they had a search warrant. Four of them grabbed Mikhail. He was taken to Petrovka 38, the headquarters of the Moscow police force.
Two days later, Lutskevich was arrested; police showed up at his mother’s apartment at four in the morning. Savelov was arrested the next day, while his father was away at their dacha. When the father returned, the apartment was a mess; things had been thrown all over the place. Moscow police called in the middle of the night to say his son was being held.
In the immediate hours and days after the arrests, according to the defendants and their lawyers, investigators were most concerned with pressuring those detained—all rank-and-file activists, or merely “accidental passengers,” in the words of one lawyer—to finger known opposition leaders as having orchestrated the events of May 6. Lutskevich’s lawyer told me that in the first days of his detention, interrogators pushed Lutskevich to sign a statement saying he had been directed by a group of known anti-Putin leaders including Alexei Navalny, the anticorruption blogger who is the closest thing the Russian opposition has to a star, and who currently faces his own politically motivated trial.
Courtesy of Victor Savelov
ARTEM SAVELOV
The defendant waves a flag and watches a column of police march past at the May 6 protests.
“I don’t even know what they look like,” Lutskevich told the police, according to his lawyer. The response: “Well if you don’t want to cooperate, that means you’ll sit in prison.”
When Kosenko was examined by medical staff in jail, his lawyers say, doctors spent more time asking him about his political affiliations than about his medical background. He was not given the medication he had taken regularly for ten years, an antipsychotic called thioridazine. After a small outcry in the Russian press—his lawyers got word to independent journalists—he got his medication, though not always regularly, according to his sister and his lawyers.
After Savelov’s first court hearing, an investigator told his father that the 33-year-old was facing eight to ten years in prison, but if he would “cooperate” with the investigation—name opposition leaders as the organizers of the May 6 clashes—then he could get just two to three years. “And so loudly, right there, I ask him, ‘Are you ready to sit in prison for two or three years for nothing at all?,’” his father recalls. “He stammered, and then walked away. I said, ‘You see! You don’t want to spend that time in prison, but someone else should, just like that.’”
One day recently, I went to see Natalia Taubina, the head of the Public Verdict Foundation, a Russian legal-aid group representing a handful of the May 6 defendants. As we sat in her office, she tried to explain the process of criminal investigations in Russia, especially in politically sensitive cases. First, she said, the state settles on a version of an event—in the case of May 6, mass riots organized by opposition leaders. Then, she said, various judicial and law-enforcement bodies do not engage in “an investigation of an event in order to understand what actually happened, but in the reconstruction of an event so as to match a certain version.” In the end, she said, the Russian criminal-justice system decides cases according to an equation made up of bureaucratic momentum, a reverence for clean statistics, and the interpretation of signals passed “intuitively and harmoniously” from politically powerful offices and individuals—Putin, to be sure, but not only him.
Over the months of reporting this story, I tried to speak with Moscow police, responsible for security on Bolotnaya Square last May 6, and the Investigative Committee, in charge of the criminal investigation and arrests that have followed over the past year. They refused to meet with me or provide comment, citing the ongoing case and pending trial. I did, however, manage to pass some questions to an investigator working on the May 6 case through Svetlana Reiter, a Russian journalist who has done an extraordinary job covering the evolution of the case over the last year. The investigator said that “operatives have spent a whole year watching videos taken on the square by law enforcement agencies and journalists,” and are continuing to hunt for new suspects. “This work is ongoing and will continue until they find everyone they can.” The investigator denied the case has any political resonance, saying it is “a routine matter that has nothing to do with politics; it has received close attention due to the fact that police officers received trauma and bodily injury.”
There are now 28 people charged as part of the May 6 investigation. Most face the same two charges: using force against a representative of the authorities and participating in mass riots. If convicted, the defendants face up to 13 years in prison. On the first allegation, in many cases the only evidence is the testimony of those the state has identified as victims and witnesses: the police officers present that day. This approach has produced some irregularities, with police changing their statements or remembering key details long after the day itself. The two police witnesses against Alexei Gaskarov, a 27-year-old activist, only appeared nearly a year after the events of May 6. They were suddenly were able to pick out Gaskarov as having struck another officer and as being the leader of a group of young people “dressed in sportswear.”
Similarly, Vassily Kushner, a lawyer who has represented Zimin, told me that the police officer who is the official victim in the case against his client said nothing about his injuries or Zimin when first interviewed in the days after the May 6 protest. Then, early last June, he told investigators about a broken finger he suffered on May 6—and that it was caused by Zimin throwing a stone toward police lines. Later, a different officer from the same unit as the alleged victim contradicted that story, telling an investigator that he saw Zimin throw stones on May 6 but not in the direction of either officer. At this, according to Kushner, the investigator leaped up and yelled, “You better speak the truth or we’ll open a case against you for misleading investigators!” (Kushner also said that the investigator made a point to describe photos that Kushner had posted online from his family vacation in Spain. “We keep track of everything,” he was told.)
The state’s sealed indictment against the May 6 defendants, which comprises more than 60 volumes, abounds with questionable facts, according to the parts of the document that are publicly available and to several defense lawyers and others who’ve been able to review it (the entire document is not publicly available). For instance, it alleges that Savelov, with his near crippling stutter, led the crowd in rounds of antigovernment chants. It says that the police officer allegedly struck by Kosenko suffered a concussion, even as the witness to the alleged assault, another police officer, says only that he saw Kosenko beat the officer in the arm and body—not the head.
In comparison with the first set of charges, the second—participating in mass riots—is more theoretical. When does a protest become a riot? One of Kosenko’s lawyers, Valery Shukhardin, explains that Russian jurisprudence defines mass riots as a kind of coordinated pogrom involving “arson, destruction of property, use of force toward fellow citizens.” A spontaneous outburst of accidental violence would not seem to qualify—a point that is likely to form one of the defense’s key strategies.
This line of argument gained some momentum in February, when the Kremlin’s human rights council released a statement that said police, not protestors, were largely to blame for the violence, and that the classification of mass riot “does not reflect the reality of what happened.” The council is technically powerless and frequently ignored, but in this case even some within the security services apparently agree: An internal police investigation leaked to The New Times, a liberal weekly, states that officers were able to maintain public order on May 6 and that “an emergency situation was prevented.”
Ultimately, what the bosses want, the bosses will receive. At his annual press conference last December, Putin said that going to a protest in and of itself should not send a person to prison—but assault against a law enforcement officer must be punished. Again, the signal was clear enough. The next day, investigators delivered some news to Alexei Polikhovich, a 22-year-old university student who, unlike most defendants, had only faced the mass riot count. Now he would face the other charge as well: A policeman had just remembered that Polikhovich beat him on the arm.
As they await trial, the majority of the May 6 defendants are being held at one of Moscow’s five pretrial detention facilities. Although Russian judicial guidelines call for those facing the particular charges entered against the May 6 defendants to be granted bail or home arrest, judges at successive rounds of hearings extended the suspects’ detention many times over.
Unlike in the old days, they are not entirely cut off, or even entirely without access to friends. Yes, the state-run television channels shown in jail will occasionally air a report on the May 6 case: a new suspect has been arrested, the Investigative Committee has opened a new charge against an opposition leader. But the prisoners can also subscribe to independent newspapers; the fiery and liberal Novaya Gazeta is a favorite. Anna Karetnikova, a member of a commission that moitors Russian prisons, told me about visiting a left-wing detainee whose message for the outside world was, “Tell my comrades that we must categorically condemn the repression of the working class in South Africa.” As Karetnikova remembered, “I’m standing there thinking, I didn’t even know of anything that happened in South Africa.”
Zimin for a while found himself in an even more unlikely circumstance. He shared a cell with a rich guy awaiting trial for fraud; the cellmate paid for a host of welcome luxuries for the enclosure: a refrigerator, a fan, a plasma TV.
One night not long ago I sat at a café near Tretyakov Gallery with Sasha Kunko, Zimin’s girlfriend, who is 25 years old and works at a Moscow publishing house. She and Zimin had been dating for just two months before he was arrested. The two met as swing dance partners—last year, they reached the finals of the Russian championship in boogie-woogie—and have now spent far more time as couple with Zimin in jail than when he was free. Theirs is a courtship of jailhouse letters and conversations through thick glass, giving their relationship an intensity both tragic and intoxicating.
Kunko told me about his letters to her, in which he fantasized about taking her for a stroll through Moscow in the rain. She was going the next morning to jail for another visit. “Everyone there is sad, mournful,” she said. “Our meetings are happy. We try to joke. ... We have to not take it so seriously, even though it’s absurd and nightmarish.” Every now and then, as we were talking, Kunko would pause to cry “Of course we’re afraid,” she said. “We understand where we are seeing each other and why.”
Courtesy of author.
'GREETINGS, JOSHUA!'
Mikhail Kosenko: “Just as the incoming surf breaks against the rocks, the experience of a person in prison breaks against the lack of freedom.”
Adding to the impression of procedural correctness, the Russian prison service also has an efficient Internet portal for sending letters to those behind bars—the May 6 defendants have gotten dozens, if not hundreds, of letters—but replies may be censored. I wrote letters to half a dozen; I received only one back, from Mikhail Kosenko. I asked him about his life in prison and how he relates to the social resonance of his case.
“Greetings, Joshua!” it began. He wrote that he does not feel the center of any of kind of attention, and that information gets to him only in “vague echoes.” He asked me how the May 6 case is discussed in the West. As the one-page letter went on, it became more scattered and free form—though that gave it a loose, almost koan-like quality. “People write me letters in their thoughts, I know this,” Kosenko wrote, apropos of nothing. In between sentences describing the New Year’s cards he received in jail and the help he has gotten from his sister, he wrote: “Just as the incoming surf breaks against the rocks, the experience of a person in prison breaks against the lack of freedom.”
Since his arrest, psychiatrists from the state-run Serbsky Institute have declared Kosenko insane, writing that he “poses a threat to himself and to the people around him, and needs to be committed to a medical institution.” His case is now being heard separately; if found guilty, he will be sent to a psychiatric hospital.
As for the rest, the Investigative Committee has now passed the cases of the first 12 defendants on to court—including Barabanov, Savelov, and Zimin. The trial itself begins June 24. The remaining defendants will be tried in batches throughout the coming months, all part of the same overarching May 6 case. “It’s impossible for it not to be a show,” one lawyer told me; he said the process could last more than a year and involve as many as 400 witnesses on each side.
No one is especially optimistic. The one May 6 defendant who pled guilty, Maxim Luzyanin, a 36-year-old gym owner, was sentenced to four-and-a-half years in prison—more than nearly anyone expected for someone who had ostensibly cooperated with the investigation. “He didn’t go for the kind of compromise that was actually wanted or expected of him,” says Sergei Davidis, who heads the program on political prisoners at the human rights group Memorial.
I asked Davidis how he thought the trial would end. “Will the court give them a year? Or five? That will be an indication of what the state is thinking,” he said. “But they won’t be acquitted and freed, that’s for sure.” That’s partially a recognition of the political nature of the trial, but beyond that, in just about any case, the Russian criminal justice system moves in one direction only; switching into reverse is something approaching a mechanical impossibility.
The number of those soon to appear in the “aquarium”—the nickname for the glass-walled cage where defendants sit in Russian courtrooms—could have been even larger if not for those who fled the country ahead of possible prosecution. Around 50 people have left in total, according to activists and journalists. One May 6 suspect who left, a 36 year-old rocket engineer named Alexander Dolmatov, committed suicide at a deportation center in Rotterdam in January. His application for political asylum in The Netherlands had been rejected. His Dutch lawyer, Marq Wijngaarden, told me that his client’s behavior “radically changed” and that he had been convinced he was “contacted and possibly threatened” by Russian security services.
Over the past year, the May 6 defendants, even those at the same jail, have been kept in separate cells and have not had much chance to meet one another, though many have come to feel bound together by fate and circumstance. Some have remained apolitical; others have started to carry themselves as oppositionists. As Zoya Svetova, a noted journalist for The New Times who covers the prisons, and has visited many of the accused, told me, “They have been confronted with the lawlessness of the state, they see they are being held in jail for nothing. They see they are victims of a political decision. They read about themselves in Novaya Gazeta. They deny their guilt, and in so doing, begin to feel like heroes.”
No matter how the trial unfolds, the state has already achieved part of its goal: The sweeping investigation into the violence and the random, or at least unpredictable, pattern of arrests is meant to frighten and splinter the opposition and those who might support it. The crowds at protests have certainly been smaller in the past year; part of that is surely a result of deterrent effect of the May 6 prosecution and the overall sense of gloom that has descended over much of the opposition movement.
NTV
"ANATOMY OF A PROTEST"
In a screenshot from a documentary purporting to show Sergei Udaltsov meeting with a Georgian politician to dicuss carrying out the protests of May 6.
Beyond that, the authorities appear intent on using the case to create a master narrative of the protests, in which opposition leaders gathered money from murky sources abroad to organize mass riots carried out by their foot-soldiers in the streets. This act in the country’s ongoing political theater became clearer in January, when the Investigative Committee announced it was combining the May 6 case with another ongoing criminal investigation: the probe into claims made in a television documentary, “Anatomy of a Protest-2,” aired last October.
That gloomy and conspiratorial purported documentary alleged that far-left activist Sergei Udaltsov, among others from the Russian opposition, met with a Georgian politician to discuss carrying out a campaign of political terror in Russia—including the “mass riots” of May 6. An offscreen voice ominously suggests, “An action plan has already been mapped out, and its masterminds are outside Russia,”1 In linking the charges against Udaltsov and others with those against the May 6 defendants, the Investigative Committee said in a statement that is has “grounds to believe that the crimes in question were all committed by the same people.” Uldatsov is now under house arrest.
Another defendant, a leftist activist and Udaltsov associate named Konstantin Lebedev, shocked his onetime allies by announcing in April that he was pleading guilty and cooperating with investigators. He was sentenced to two and a half years. In an interview with Kommersant, he said he did not consider himself a “traitor” and only “admitted the obvious.” (Among other far-fetched plots, Lebedev said the gang considered or smearing valerian root—a kind of catnip—all over Moscow’s FSB headquarters, so that the building would be swarmed by hundreds of cats.)
A map issued by the Moscow police showed that marchers would be able to enter Bolotnaya Square from all sides, including the bridge that was later closed.
Moscow political circles are now caught up in guessing whether Lebedev was a sleeper agent planted long ago by the Kremlin or simply lost his will to fight. Perhaps it doesn’t matter—the Russian state can be quite skilled in finding in nearly everyone the magic, yet varying, point between cooptation and coercion. Sergei Zheleznyak, deputy speaker of parliament from the pro-Kremlin United Russia party, nicely summed up the official line last month, saying that the events of May 6 were “financed from abroad, so as to motivate those people who were headed to a provocation.” With the two cases now combined, the dramatis personae are set: The May 6 defendants will be cast as the foot soldiers of a would-be putsch, with Udaltsov, in his scheming with foreigners, playing a role loosely modeled on Trotsky’s.
Before the trial has a chance to display the martyrs of May 6, word of yet another possible twist is circulating in protester circles: Perhaps the very clashes with police at the heart of the indictment were manufactured, or at least egged on, by the state.
A self-appointed “independent public commission” made up of figures close the opposition released a 150-page report this spring that calls the violence of May 6 “a preplanned large-scale provocation.” In essence, the authors argue that rather than engaging in prosecutorial irregularities after the fact, the Putin state, just a day shy of restoring the leader to the presidency, arranged the whole affair.
Some pieces of the official story from May are indeed curious. For one, the Moscow police changed the approved route of the march at the last minute, and to this day the website of the Moscow police department shows a much different, and more expansive, map for the protest: marchers would be allowed to enter the park at Bolotnaya Square from all sides, including from the bridge that ended up being blocked by columns of riot police. That is the last information organizers had as they headed to the starting point of the demonstration. A police memorandum obtained by Reiter and posted by Russian Esquire, acknowledges that officials changed the location of barricades and police forces without informing organizers or the public
NTV
THE ACCUSED
The May 6 video footage, which aired on state-run NTV, appears to show Barabanov (above, in black t-shirt) shove and kick a police officer.
As it happened, metal barricades and rows of riot police blocked the bridge and one side of the park, pushing marchers into a tight stack on the bridge and funneling them toward the narrow embankment where clashes would later break out. And once the violence did kick off, the police may have been content to let it continue: Ilya Ponomoryev, one of the few Duma deputies to take part in opposition protests, told me that he tried unsuccessfully to talk with any police commanders that day about calming tensions between the two sides. When he found a vice mayor of Moscow off to the side, Ponomoryev said he was shooed off; the official told him, “What you wanted to create, this chaos, you got it.”
But chaos indeed seems the correct word to describe the events of May 6: Neither police officials or opposition leaders seemed fully in control. Moreover, even if the authorities increased tensions—perhaps on purpose—some people from the crowd did indeed attack police. Video taken on May 6 and leaked from law-enforcement sources to the state-run channel NTV depicts several defendants, including Barabanov, grabbing and punching several officers.2 (NTV is often an untrustworthy outlet of state propaganda, but the footage itself seems legit.) I watched the clips one night with Reiter. “They answered force with force,” she said of the protestors on May 6. “Police started to beat them, they started to answer, it’s that simple.” To deny that fact, she said, is an “affront,” even to those accused. In April, investigators released a page of Zimin’s diary, written on May 2, in which he describes his plans to meet with fellow anarchists a few days later at the May 6 protest for a “decisive moment.” He writes, “Burning fuel flying, smoke, and a blow to the face—this will be the last I remember before falling on the asphalt.” (Zimin's lawyers say this was a piece of creative writing.)
For the government, there's a benefit to associating anti-Putin activism with a rosters of who can easily be portrayed as oddballs—someone who's been declared insane, someone who stutters, someone who braids dreadlocks: just the kind of people you could tar as misfits who fight with cops without justification. (Other defandants, who include college students and office workers, might be harder to smear in this particular way.) But in any event, raising reasonable questions about the actions of at least some of the May 6 accused is not a way of answering questions about what measures investigators used to pursue the charges, or what sentences are justified. Prosecutors have never looked into the many charges of excessive force on the part of the police; Gaskarov, who was beaten in the face by police on May 6 and then arrested in April, was one of those who lodged a complaint that went nowhere.3 Same goes for 68 year-old pensioner who suffered a concussion after being struck in the head by police batons.
It doesn’t matter. Once the state put forward the narrative of “mass riots,” police were instantly exculpated of any wrongdoing. In other words, only the Kremlin can explain why it is trying to position chaotic street clashes with police one afternoon in May more than a year ago as a premeditated attempt at a coup’detat.
Not long ago, I went to see Viktor, Savelov’s father, at their three-room apartment in the northern outskirts of Moscow. He showed me childhood photos of his son and told me of their trips to the Russian Far East, where they would walk along the river gathering stones. In the corner of Savelov’s bedroom, beyond the Pam Anderson poster and the Warcraft CDs, was a large, empty aquarium. “I gave all the fish away,” his father said. He opened the closet door to show me a messy stack of papers he scooped up from the floor after the police came. “He’ll come home one day and figure it all out,” Viktor said.
1
The full 40-minute documentary can be seen in Russian here; the footage of Udaltsov is shown between 10–13 minutes.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Automatically refresh SQLDataSource cache after expired
I have added SQLDataSource control on page with EnableCaching and Cache Duration is 3 hours(10800 Seconds).
I am Showing data from SQLDataSource On Page Load event. I just want to know that, After 3 hours the SQLDataSource refresh automatically or do we need to open page in browser after every 3 hours?
A:
It cached for 3 hours, if you hit the page again after 3 hours you will get latest. However, its not an AJAX mechanism, if you're expecting to see updated results without hitting the page_load event again then you'll need to add the asynchronous postback stuff yourself.
The SqlDataSource control supports data caching. While data is cached, the Select method retrieves data from the cache rather than from the underlying database. When the cache expires, the Select method retrieves data from the underlying database, and then caches the data again.
Ref: https://msdn.microsoft.com/en-us/library/system.web.ui.webcontrols.sqldatasource.enablecaching(v=vs.110).aspx
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Wednesday, 30 April 2014
Way overdue but anyway, on our monthly night outs, we chanced upon this restaurant in VivoCity. Dim lights & diners huddled together for cosy conversations, we felt very much at ease in this comfortable setting.
3 of us shared -
(1) Caesar Salad
(2) Seafood Platter (my favourite dish, the prawns & salmon were fresh & cooked to perfection, I especially liked how the freshness of the seafood was not overpowered by the marinate)
(3) Pork Burger (everyone around us were having burgers, since after finishing the seafood platter we still had stomach space for food, we added on this order)
After dinner we proceeded to OutPost Bar & Bistro to chill out with the live band playing. The first band that played was not worth mentioning because I felt their arrangement is very messy or rather, they play on a very impromptu basis so the drummer will go along with his senses to add on suitable beats to the song. The vocalist was not impressive as well. The next band however WAS impressive & the vocalist was none other than Ruth Kueo 魏妙如. Tiny girl with huge vocals, I love her performance ALOT! That night I heard her sing Mandarin, English as well as one Cantonese song, brilliant live act!
Beer, sausages, live music, fun-loving colleagues. This is how I spent my public holiday eve :)
Sunday, 20 April 2014
Shopping -
(1) Phuket town weekend night market
This is a large scale local market, you can find everything ranging from food, clothes, souvenirs, accessories, DVDs, temporary tattoo services. First & foremost food, on day 2 we only had breakfast in the hotel before embarking on our city tour at 11am, as your can imagine when we got to the weekend market round 5pm we were famished. But much to our delight there were just SOOOO many stalls in the weekend market selling food.
The shopping was also quite unbeatable, shorts going at THB100 ~S$4, tops also going at THB100 ~S$4. The weekend night market is pretty huge, you could easily spend 4-5hrs there, shopping & filling your tummy at the same time. Day 3 after checking out the walking street in Phuket town, we made our way back to the weekend night market because we really couldn't get enough of mainly the food & partly the shopping!
(2) Phuket town Sunday walking street
Sunday after checking out, our first destination was to the Sunday walking street. As the name implies, this shopping street only operates on Sundays. This is reason why tourists intending to visit Phuket should go on weekends as this is when the weekend market & also Sunday walking street opens for business. Personally I felt this walking street was not a must-go unless you have plenty of time to spare on your itinerary because the stretch of street was not long & hence only a handful of shops available.
Saturday, 19 April 2014
Airport Transfer
After some research online, I am glad I went with Phuket Connect Transfers. Single trip from airport to resort costs us THB800 (other sites have given higher quotes) & the duration fmo airport to resort took round 1 hour.
Day 1 of our trip - Our flight landed at 10.10am local time but the immigration queue took aeons to clear, we only exited the terminal at 11am. Fortunately the driver did not forsake us. I certainly heaved a huge sigh of relief when I still saw him waiting patiently outside the airport holding up my name on a cardboard. Best part about booking with Phuket Connect Transfers is you only pay the driver after he has sent you to your destination. I believe there are other sites which require pre-payment with credit card. I certainly do not want to risk paying only to have the driver do a no-show.
On our last day, we again hired the same company for a half day service. 4 hours for THB1,700 (~ S$68) & the final drop-off at Phuket airport. It is critical to mention in your request for quotations that you require drop-off at the airport because the location of the airport is pretty far off & requires considerable travelling time. This is an important factor for planning your itineraries, definitely wouldn't want to miss your flight!
Phuket Sightseeing & City Tour
Day 2 of our trip - Why not just kick back relax & engage a tour guide & driver to bring us round the city? Besides its the first time my other half is in Phuket. Private tour for 2 THB2,000 (~$80) & extra charge for the remote location of our resort THB200 (~$8). Well, like what the guide says, Avista Faraway.
Of course the cashew nut & gem factory were not places we wanted to visit but it was part of the tour as part of the local tourism board's effort to promote their local industries. Don't worry, there is no hardselling, just take a walk around & you are free to go. We did buy a few cans of cashew nut as they are pretty tasty! Each can for THB199 (~ S$8). Comes in various flavours, we bought Tom Yum, BBQ & Wasabi.
Much of the time was spent on the bus, driving round scenic routes. We requested for drop-off at the weekend night market at the end of the tour but as you would have guessed it, the tour guide persuaded us to do a Thai massage at this shady massage place . Don't be mistaken, the place is not some "lup sup" or inappropriate business, it is a legitimate massage parlour just that it would be equivalent to the foot reflexology joints we find here in Singapore. 1hr Thai massage for 2 pax, THB800 (~S$32). Before the driver & guide left, we were negotiating on price for transportation on our 3rd day. THB2,000 for 4hrs (tour guide & driver) & final drop-off at airport, in the end we didn't engage her as prices were too steep!
As we were short of Thai Baht, we made a stopover (or rather WALKED) at Central Mall which was a 15mins walk away (& also along the way to our final destination the weekend market), we exchanged our monies at Thai Military Bank (TMB) on the 2nd floor of the mall. Rates were comparable to Singapore money changers. Central Mall also offers free WiFi for tourists, just register at the Information Counter with your passport.
The tour guide convinced us that the weekend night market was well within walking distance from the massage parlour, boy oh boy, we walked for a great distance under the sweltering sun before arriving at our destination! More details on the night market in next post!
Friday, 18 April 2014
Pum Restaurant & Cooking School
This would come across as pretty odd to you but as much as I love beach vacations, I am never a fan of the sun nor sea (non-swimmer here). So I never participate in sea sports when on beach vacations. On our 3D2N Phuket trip, I decided to include something out of the norm & perhaps also to prepare for wedded life. There are quite a few cooking schools available in Phuket, depending on your schedule, budget as well as preferred dishes, you will have no problem booking a class to cater to your needs.
After reading reviews I settled with Pum Restaurant & Cooking School. They have a variety of classes available depending on what you want to learn & how much time you are willing to spare. 2 of us enrolled in Pum's Little Shoes (2 pax THB3,000 ~S$120) where each of us picked 3 dishes which we wanted to learn, it was a full hands-on class. At the end of 3 hours, you get to taste the fruits of your labour!Day 1 of our trip - After some rest, we took the resort shuttle to Jungceylon for lunch before our cooking class at 4pm. There was 6 students in a class & our teacher is called Irene. At Pum's, they advocate cooking using natural ingredients which should be easily found in wet markets (or hopefully Golden Mile Complex here). All ingredients are prepared beforehand so we just follow Irene's instructions to cook the dishes. Quite an experience I'd say. I was certainly surprised at how simple the dishes could be prepared & for those health conscious, you will be happy to know that at Pum's, they cook without using MSG.
Flight
JetStar sale tickets $448 for 2, departs on Fri 18 Apr 8.20am & returning on 20 Apr 10pm. Flight landed puncutally but immigration at Phuket airport took an hour to clear (can you believe it??). We did not encounter any delays for our departing flight on 20 Apr :)
Resort
Location - Booked a 2N stay (THB12,000 ~S$500) in Club Vista room at the luxurious Avista Hideaway Resort & Spa, located up the hill (exact location is Tri Trang Beach) from Patong Beach. Location of this resort is not most convenient, the tour guide which brought us round the city on Day 2 joked that this is Avista Faraway. Also, when looking for transport back to resort from the weekend market, taxi quoted us THB700 (~ S$28) again because of location. Transportation back to Patong Beach would probably at best only cost round THB500 (~ S$20).
I picked this resort as I wanted peace & tranquility considering we were visiting during the Easter long weekend, I would expect Patong Beach to be packed with tourists & parties late into the night. And this resort only opened its doors in 2012, everything is new which is something I really like. Pardon the cleanliness freak in me but I would hate to imagine head lice crawling on used pillows and bedsheets!
Day 1 of our trip - When we arrived at the resort on Day 1, it was approximately 12pm local time. Once you step into the main reception area, you can't help but be blown away by the lovely scenery. Being immersed in such lush greenery all around the resort, the unblocked view is simply breathtaking. Official check-in was at 2pm but fortunately the staff was accommodating enough to allow us to check-in ahead of 2pm, we waited approximately 20mins for the staff to prepare our room. We eagerly explored the resort & snapped many pictures while sipping on the welcome drinks.
The walk from reception desk to our room requires a fair bit of navigation but nothing too mind boggling :) I was pretty disappointed to find out that none of the rooms have a sea-view because of the orientation of the resort. To my dismay, our room 902 faces barren lands, probably pending construction works to be done. Looking down from the balcony you would see the Club Vista pool :) The room is spacious & the lightings create a warm & cosy ambience, perfect for relaxation!
Right after we checked into our room, we crashed & took a nap & only got up in the afternoon to catch the hotel shuttle to Jungceylon. Our hungry tummies settled upon Urban Food for lunch, food was nothing to shout about & prices were comparable to Singapore X_x.
After lunch we strolled around Patong area before our cooking class at 4pm.
Breakfast - Our room reservations included buffet breakfast served at Vista - The Restaurant every morning, food variety is not too shabby! I certainly enjoyed my sumptuous breakfast for the 2 consecutive mornings, in particular the high ceilings & surrounding greenery makes you feel very refreshed & recharged each morning.
Swimming Pools - The Avista Hideaway has 3 pools - (1) the main pool which is right in front of Vista. (2) The Club Vista is a private pool located right beneath my block of rooms. This is an adult-only pool so for those who want to escape from the screaming kids, this is the pool to go to. (3) The riverside pool, right beneath the main reception area.
Day 3 of our trip - Got up for breakfast before heading to the pool, frolicking in the water & sipping our drinks (Mango ice-blended & Mojito for THB320) by the pool is quite an indulgence! Our return flight was at 10pm & the hotel has kindly extended late check-out at 4pm. We arranged for transport to pick us up at 4pm. Based on my interactions & experiences with local Singapore hotels, none of which has ever offered such late check-out timings. Maybe partly because I am a local doing a staycation, not a tourist waiting to catch a flight.
To sum it up, I am very glad to have booked my stay with Avista. The resort was simply amazing!
Saturday, 5 April 2014
Yet another place serving whole-day breakfast but the food was nothing to shout about. Managed to get seats without queue, a plus point if you are looking for a place to settle your whole-day breakfast craving.
Celebrated the bff's birthday, their chocolate cake is so thick & tasty but even the 2 of us didn't manage to finish it.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
All items to be sold at online auction only. All items are sold "as is, where is" & ALL sales are FINAL! There are NO warranties or guarantees expressed or implied on any of the merchandise. Bidders are given ample time to preview items, but in the event that they cannot preview, they acknowledge by bidding that they accept the auctioneers description when they bid on a particular item. Wham will not be responsible for any errors or omissions in the description of the merchandise. A 15% buyer's premium will be added to all purchased lots and all items will be paid for immediately following the close of the auction by a credit/debit card on file. Items to be shipped will be subject to shipper's instructions per our information page.
By clicking the Confirm Bid button, you are agreeing to the terms of sale.
By clicking "Confirm Buy" you are agreeing to the terms of the sale.
Instant Purchase items may have additional fees such as an Internet Premium, Sales Tax, Shipping or other fees
not included in the Instant Purchase price. Please see Auction Information for full details.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The present invention relates to a new and distinct cultivar of Sanvitalia plant, botanically known as Sanvitalia procumbens, and hereinafter referred to by the name ‘Duesantogo’.
The new Sanvitalia plant is a product of a planned breeding program conducted by the Inventor in Rheinberg, Germany. The objective of the breeding program is to create new compact and mounding Sanvitalia plants with numerous inflorescences.
The new Sanvitalia plant originated from a cross-pollination conducted by the Inventor in Rheinberg, Germany in July, 2009 of a proprietary selection of Sanvitalia procumbens identified as code number L08-0603-002, not patented, as the female, or seed, parent with a proprietary selection of Sanvitalia procumbens identified as code number F-20-025, not patented, as the male, or pollen, parent. The new Sanvitalia plant was discovered and selected by the Inventor as a single flowering plant from within the progeny of the stated cross-pollination in a controlled greenhouse environment in Rheinberg, Germany in May, 2011.
Asexual reproduction of the new Sanvitalia plant by vegetative cuttings in a controlled environment in Rheinberg, Germany since July, 2011 has shown that the unique features of this new Sanvitalia plant are stable and reproduced true to type in successive generations.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Alpha-amylase is found primarily in the pancreas and salivary glands. When released in the digestive tract, the enzyme hydrolyses starch. Alpha-amylase determinations are useful in the diagnosis of diseases of the pancreas and parotids. Elevated serum levels are associated with acute pancreatitis and other pancreatic disorders, as well as mumps and bacterial parotitis. Decreased serum values may be found with liver diseases, such as hepatitis and obstructive jaundice, and liver tumors or abscesses.
Historically, methods for determining alpha-amylase in serum have included viscosimetric, turbidimetric, iodometric, and reductometric technology. With these methodologies, reaction times are long, endogenous glucose tends to interfere, reaction colors are unstable, and reproducibility is poor. Recently, assay systems for the determination of alpha-amylase have been developed.
Such assay systems for alpha-amylase typically include a reagent comprising a polysaccharide or oligosaccharide substrate with a label, e.g., a chromogen unit, attached. The substrate is hydrolyzed by alpha-amylase to form one or two smaller oligosaccharides. The reagent further comprise one or more enzymes which further hydrolyze the smaller oligosaccharides to free the label unit which can then be detected spectrophotometrically.
Such assay reagents enable rapid and accurate determinations of alpha-amylase compared to historical methodologies. However, the stability of such reagents is poor. Consequently, assay reagents are generally stored in a lyophilized state and must be reconstituted prior to use. Once reconstituted, the shelf life is generally one to fourteen days. Moreover, such reagents tend to give variable and often undesirably high background levels which adversely affect the consistency and accuracy of this system.
The above-identified patent applications disclose a stable, single-liquid alpha-amylase assay reagent for the rapid determination of the alpha-amylase in biological fluids. The assay reagent comprises an aqueous solution substantially free of alpha-amylase and/or alpha-amylase activity containing at least one substrate which is cleavable directly or indirectly by alpha-amylase to produce a detectable change in the reaction mixture. The detectable change may be the production or elimination of a detectable component. Such components may be detected by any suitable means including optical, electrochemical and thermochemical means.
In a preferred embodiment of the invention, the reagent comprises a polysaccharide or long-chain oligosaccharide substrate having a label attached at the reducing end. The substrate is hydrolyzable by alpha-amylase to form short-chain oligosaccharides, at least one of which comprises the label. The reagent further comprises at least one exo-enzyme, and preferably a pair of exo-enzymes, current maltase and alpha- or beta-glucosidase, which further hydrolyses the oligosaccharides to free the label which is then detectable spectrophotometrically. The rate at which the free label is formed provides a direct indication of the concentration of alpha-amylase in the biological fluid.
The alpha-amylase reagent is made substantially free of alpha-amylase by utilizing sterile water and purified reagents, and by passing the exo-enzymes and substrate, either individually or in combination, through a filter having a pore size of not more than about 0.2 micron to remove alpha-amylase-producing bacteria. Elimination of alpha-amylase from the reagent eliminates the consumption of the substrate during storage and hence stabilizes the reagent.
The alpha-amylase assay reagent is further stabilized by the inclusion of a polyol which retards the degradation of the exo-enzymes.
In commercial reagent we have employed as the exo-enzymes a mixture of a fairly high concentration of about 10 U/ml alpha-glucosidase (maltase) derived from yeast and 10 U/ml glucoamylase.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Los Angeles Dodgers are back in the postseason for the sixth year in a row, kicking off the National League Division Series at home in Chavez Ravine tonight. And as tradition now dictates for the Levy Restaurant Group’s culinary team that operates the baseball park, the one-off food creations for this series are ludicrous.
This postseason the team is offering more than half-a-dozen new menu items at various bars and levels, including some that are inspired by the opposing team Atlanta Braves and their home state of Georgia. That’s certainly the case with the so-called Rib Bundle, which is basically just a big paper cup filled with fries, macaroni salad, and bone-on ribs with just a hint of peach. Yes, it’s all just kinda sitting in one bowl, and can be found at the King’s Hawaiian on the Reserve level.
In in a similar vein, the stadium crew is also offering smoked bbq wings done in a peach sauce, and served at the Jim Beam bar. Other fine options include a carne asada nacho bowl served in a plastic helmet and available at several stands along the Reserve level; a hot link with barbecue sauce and slaw from King’s Hawaiian Grill; and a meat-lovers pizza with meatballs, pepperoni, and sausage found at Lasorda’s, and at Loge and Reserve level.
The coup de grace is the below mac and cheese hot link burrito, an otherworldly concoction that puts actual macaroni and cheese inside a tortilla alongside as full hot link, a bunch of pulled pork, and a grip of baked beans. If anything it looks awfully similar to the popular burrito available at Ray’s BBQ in Huntington Park, though it’s unclear if that’s where Dodger chef Ryan Evans got the idea. Again, this one’s available from the King’s Hawaiian Grill.
All of these monstrous new food items are available starting tonight and for game two of the series on Friday at home. Should there be a need for a game five in the series, that will mean a return for these menu items on October 10. Go Dodgers.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
In a semiconductor manufacturing business, such as a semiconductor foundry, information technology (IT) services provide cohesion to internal and external customers, as well as to technologies employed in making semiconductor devices. A semiconductor foundry may utilize processing equipment coupled to a network of computing devices, robotics, customers, and manufacturing equipment. The business operations of the semiconductor foundry may rely on electronic information exchanged among many different entities using the network. This information may be used to control manufacturing equipment, conduct product analysis, and for other business and engineering applications.
The amount of information and the relatively large number of tools and other pieces of equipment used to perform the manufacturing process in the semiconductor foundry may be difficult to maintain. For example, if a tool or piece of equipment is designed to permit the entry of control functions, diagnostic commands, or other data, it may be necessary for a user to attach a laptop computer or other relatively bulky device to the tool in order for such interaction to be achieved. Some tools enable a user to control tool functions through a remote hand held electronic device. However, such hand held devices are generally associated with a single tool, and may not permit the user to easily interact with various other tools using the same device.
Accordingly, what is needed is a system and method thereof that addresses the above discussed issues.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
John Higgins (poet)
John Higgins (c. 1544 – by 1620) was an English cleric, poet and linguist. He is now best known as a contributor to the Mirror for Magistrates series of poetry collections.
Life
Higgins was said by Thomas Hearne to have been a student of Christ Church, Oxford, but his name does not appear in the university register. He taught grammar between 1568 and 1570. By 1574 he was vicar of Winsham in Somerset, where his successor was in post by 1620.
Works
Higgins's major work is The First Parte of the "Mirour for Magistrates" (1574). This expansion of The Mirrour for Magistrates (1559) by William Baldwin added the beginning of traditional British history in Geoffrey of Monmouth, where Baldwin's collection started English history from the reign of Richard II. Sixteen legends, dealing with Albanact, Locrinus, Bladud, Ferrex, Porrex, Nennius, and others, are told in verse "complaints".
Higgins reissued his First Parte in 1575, enlarging his metrical address at the conclusion, and adding a new poem, Irenglass. In 1587 Thomas Newton prepared a collective edition of the original Mirrour and its supplementary volumes. For this edition Higgins prepared 23 further poems: the new series treats of Brennus, Cæsar, Nero, Caracalla, and others. In a later section appears another new poem by him, How the Valiant Knight, Sir Nicholas Burdet, Chiefe Butler of Normandy, was slayne at Pontoise, Anno 1441. Richard Niccols reissued all Higgins's contributions in another collective edition of the Mirrour, published in 1610, and reissued as The Falles of Vnfortvnate Princes in 1619. In 1815 Joseph Haslewood reprinted the whole work.
Other works were:
A revised edition of the Dictionarie of Richard Huloet, London, 1572 (by Thomas Marshe), dedication to Sir George Peckham.
Flowers, or Eloquent Phrases of the Latine Speach, gathered out of the sixe Comœdies of Terence, whereof those of the first three were selected by Nicholas Vdall, and those of the latter three nowe to them annexed by John Higgins (1575, new edition 1581, by Thomas Marshe). *The Nomenclator or Remembrancer of Adrianus Junius, Physician, divided into two Tomes, conteining proper names and apt termes for all things vnder their conuenient titles, London (for Ralph Newberie and Henrie Denham),' 1585, dedication to Valentine Dale.,
An Answer to Master William Perkins concerning Christ's Descension into Hell (Oxford, 1602).
Notes
External links
Attribution
Category:English Anglican priests
Category:English poets
Category:English translators
Category:16th-century people
Category:1540s births
Category:17th-century deaths
Category:Year of birth uncertain
Category:Year of death missing
| null |
minipile
|
NaturalLanguage
|
mit
| null |
An elderly man and a teenage boy were injured Thursday morning in a series of dog attacks, the Pasco County Sheriff's Office said.Deputies initially responded around 6:53 a.m. Thursday to a report of five dogs – three adult bulldogs and two puppies – attacking a 15-year-old boy and an elderly man at two different places in Shady Hills. The man has serious injuries, the sheriff’s office said.One of the dogs bit the boy on the leg either while he walked to school or was waiting for the bus, the sheriff’s office said. The boy’s injuries are considered minor.A Pasco County deputy shot one of the dogs after it tried to attack him, the sheriff's office said. Authorities euthanized the dog that was shot at the request of the owner, but the deputy was not injured.Two of the other dogs involved in the attack are in custody of Pasco County Animal Services. The two puppies at the scene were not involved in the attack, according to the sheriff's office. The two puppies were returned to their owner.Animal Control is on the scene to take control of the dogs. All five dogs belonged to the same owners.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Twenty-five years after McDonald’s, working with the Environmental Defense Fund, agreed to get rid of foam clamshells for its burger–in what is now called the first corporate environmental partnership–the problem of wasteful, polluting, throwaway packaging is, if not worse than ever, no better.
With industry leaders like McDonald’s, Starbucks, PepsiCo and Coca-Cola have invested in more sustainable packaging, others have failed to follow. This is the conclusion of a thorough packaging study released last week by As You Sow and the Natural Resources Defense Council that I covered for the Guardian.
Here’s how my story begins:
Big brands, including Burger King, Dunkin Donuts, KFC, Kraft Foods and MillerCoors, are wasting billions of dollars worth of valuable materials because they sell food and drinks in subpar packaging, according to a comprehensive new report on packaging and recycling by the fast food, beverage, consumer goods and grocery industries.
The 62-page rank-‘em-and-spank-‘em study, Waste and Opportunity 2015, was published Thursday by advocacy nonprofits As You Sow and the Natural Resources Defense Council. They found that few companies have robust sustainable packaging policies or system-wide programs to recycle packages. Indeed, no company was awarded their highest rating of “best practices.”
The environmental groups did identify a number of leaders, albeit flawed ones. In the beverage industry, New Belgium Brewing, Coca-Cola, Nestlé Waters and PepsiCo won praise. Starbucks and McDonald’s are said to be a cut above their competitors in fast food and quick-serve restaurants. As for consumer goods companies and grocery stores, the report offers qualified praise for Walmart, Procter & Gamble, Colgate-Palmolive and Unilever.
Broadly, though, this study paints a discouraging picture. What progress has been made is incremental and spotty, not comprehensive. As often than not, single-use packages of food and drinks are made from virgin materials and then tossed in the trash.
As the report notes, with an overall recycling rate of 34.5% and an estimated packaging recycling rate of 51%, the United States lags behind many other developed countries. Less than 14% of plastic packaging — the fastest-growing form of packaging — is recycled. Recyclable post-consumer packaging with an estimated market value of $11.4bn is wasted annually.
The interesting question is, what have we learned from NGO and government efforts to curb packaging waste and pollution? I’m not quite ready to give up on voluntary corporate efforts–not yet, anyway. Walmart reduced packaging across its global supply chain by 5 percent between 2006 and 2013; that’s a big deal. It’s now pushing suppliers to use more recycled content.
An alternative approach is increased government regulations–deposit bills on bottles and, more recently, plastic bag bans and taxes. (New York City has just banned polystyrene packaging, joining 100 other jurisdictions, reports Mark Bittman.) But these are also halfway measures.
Bolder would be an economy-wide effort to impose Extended Producer Responsibility (EPR) rules, which are in place in much of the EU. I don’t know enough about how these work and what they cost to have an informed opinion.
I did buy a set of headphones for my iPhone the other day and had the hardest time getting them out of the ridiculous plastic package. Surely a company that’s as good at design as Apple can do better. But what’s the incentive for them to do so? Saving a few pennies from a $29.95 (!) set of headphones clearly isn’t enough.
So I like McDonald’s. Really, I do. The fries. The coffee. Even the (850 calorie for a large!) strawberry McCafe Shake. The clean bathrooms, too. It’s my default place to stop when driving more than a few hours.
I also like the people I know who work at McDonald’s. Bob Langert, the company’s sustainability chief, is a great guy. Their PR folk are unfailingly gracious. And I’m told by a friend of the CEO, Don Thompson, that he’s a terrific person, too.
But–and you knew there was a “but,” didn’t you?–McDonald’s has a big problem. Actually, a couple.
The company wants to sell the world as many hamburgers as it possibly can. Beef, when produced at an industrial scale, is a terribly inefficient way to deliver protein to people. The production of beef requires more water and more land, and generates more greenhouse gas emissions, than the production of chicken or pork or, goodness knows, vegetable protein. Maybe the easiest way for any of us to do our part to deal with the climate crisis is to eat less beef. So long as McDonald’s is pushing burgers, it is, in effect, pushing climate change and deforestation, not to mention obesity and heart disease, at least for those consumers who do want the company wants them to do and eat more burgers. McDonald’s response to this is to join in the Global Coalition for Sustainable Beef–a laudable idea, and one that could reduce the environmental impacts of beef. But I’m skeptical about how far and how fast coalitions like this will take us. (See my 2012 story for YaleEnvironment360, Should Environmentalists Just Say No To Eating Beef?) The evidence, when you look at similar efforts to produce “sustainable” palm oil or fish, is decidedly mixed.
Then there’s the inequality problem, which is all over the news lately, and for good reason. CEO Thompson made $13 million or so in 2012. The front-line McDonald’s worker makes less than $20,000 a year. Many rely on government assistance to get by. I don’t begrudge Thompson his paycheck, but something’s amiss when the people who work for him need help from the government to feed their families.
What should McDonald’s do? I tried to address that question in a story today for Guardian Sustainable Business.
Alas, the price of a burger does not reflect its full cost. The environmental impact of beef is staggering: on average, 6.5 kilograms of grain, 36 kilograms of roughage and 15,500 cubic meters of water are required to produce one kilogram of beef, according to the new Meat Atlas from the Heinrich Boll Foundation, an environmental non-profit. What’s more, beef generates more greenhouse gas emissions than cheese, pork, turkey, chicken, eggs or vegetable protein.
Then there are the costs of supporting those who cook and serve burgers: More than half (52%) of the families of front-line fast-foodworkers are enrolled in at least one government-funded safety net program, according to a 2013 UC Berkeley Labor Center study titled“Fast Food, Poverty Wages”. The research estimates the industry-wide cost to these programs, very roughly, at about $7bn. Median pay for front-line fast-food workers is about $8.69 per hour, which comes to a bit more than $18,000 per year. And we won’t even consider the costs of treating the health problems that are caused by consuming too much processed food.
All of which raises a question: how can a company that depends on cheap meat and cheap labor become sustainable, responsible and even admirable?
You’ll have to read the rest of the story to see the full answer, but, in essence, I argue that McDonald’s should do three things.
(1) Nudge its customers to eat less beef.
(2) Raise the wages of its workers, publicly and proudly.
(3) Become an advocate for a price on carbon.
Will this happen? Probably not. Could it happen? I’m curious to know what you think.
It’s a business cliche–the customer is always right–but unlike most cliches, this one is untrue.
I realized that years ago when I was talking with a top executive at Southwest Airlines. Southwest chooses its employees carefully. They are recruited, in large part, for their good character and values, as well as their friendly personalities and desire to serve. So when an airline passenger tangles with a Southwest gate agent or flight attendant, the assumption at headquarters is that the customer is probably wrong. Those customers who are particularly unpleasant or argumentative when dealing with Southwest are politely told that they will never be permitted to fly on the airline again.
I raise this because on the subject of genetically-engineered potatoes, McDonald’s, in all likelihood, will soon find itself caught in an awkward place–between the worries of some of its customers about GMOs and the desires of an important supplier to improve the health of the potato and reduce food waste. That is the topic of today’s column for Guardian Sustainable Business.
Here’s how it begins:
“Do you want fries with that?” Not if they’re made from genetically engineered potatoes, say activists who oppose GMOs.
The advocacy group Food & Water Watch is asking McDonald’s, the world’s biggest buyer of potatoes, not to source a genetically engineered spud that was developed by its biggest supplier, the J.R. Simplot Co.
“This potato is anything but healthy,” writes Wenonah Hauter, the executive director of Food and Water Watch, in a letter (PDF) to Don Thompson, McDonald’s CEO. Altering the plant’s genes, she writes, could unintentionally affect other characteristics of the potato, “with potentially unforeseen consequences for human health”. The letter has been signed by 102,000 people.
This is a problem for McDonald’s – and for anyone who believes that genetic engineering has the potential to increase crop yields, help solve environmental problems or deliver healthier foods.
The interesting thing about the new potato varieties developed by the J.R. Simplot Co., an Idaho-based potato processing giant, is that they are engineered to deliver consumer and environmental benefits, as my story goes on to explain. They are designed to lower levels of acrylamide, a potential carcinogen. And they reduce black spots from bruising, which means fewer potatoes have to be thrown away. Unlike some other GMO crops, which primarily benefitted farmers (not that there’s anything wrong with that), these will benefit people who choose to eat the fries at Mickey D’s.
The GMO debate is complicated, although rarely is it presented that way. See, for example, this page on the Organic Consumer Assn. website, blasting Monsanto with ridiculous headlines like “Monsanto’s GE Seeds Pushing US Agriculture into Bankruptcy.” That will come as a surprise to USDA, which says that the US agriculture sector will enjoy record high income of $120 billion this year. But I digress. Few people truly understand the science of biotechnology. I certainly don’t. So if we take sides, we do so based mostly based on the opinions of others who we trust. As my story says, the debate
gets emotional very quickly and often comes down to questions of trust. Here the anti-GMO forces have an advantage. They can position themselves as consumer advocates – public interest groups, if you will. By comparison, the companies that favor GMOs are seen as self-interested and lacking credibility. Government regulators also, generally, don’t inspire trust.
No wonder anti-GMO sentiments seem be growing. It’s easy for NGOs to stir up fear, and the record of government regulators–whether we’re talking about USDA, the FDA or the SEC–doesn’t inspire confidence. We should approach new GMO crops with humility and caution, particularly when considering their environmental impact. Like any technology, genetic engineering comes with risks as well as benefits.
But let’s not forget that Americans eat genetically engineered food every day, with no adverse health effects that can be attributed to GMO foods. There’s a broad consensus among mainstream scientists that the GMO crops now on the market are safe to eat.
Here’s a question. Which trio of companies has done more for the environment…
Patagonia, Starbucks and Chipotle?
Or Walmart, Coca-Cola and McDonald’s?
I don’t have an answer. Patagonia, Starbucks and Chipotle have been path-breaking companies when it comes to sustainability, but Walmart, Coca-Cola and McDonald’s are so much bigger that, despite their glaring flaws, and the fundamental problems with their business models, they will have a greater impact as they get serious about curbing their environmental footprint, and that of their suppliers.
Small and mid-sized companies create sustainability solutions, as a rule, but the impact comes when big global corporations embrace them. Size matters.
All that is by way of introduction to my latest story for Guardian Sustainable Business, about McDonald’s coffee-buying practices and the role of the consumer in driving them to scale.
Here’s how it begins:
Across the US, McDonald’s last week introduced pumpkin spice lattes made with Rainforest Alliance-certified espresso. No such assurance comes with McDonald’s drip coffee. Why? Because consumers haven’t yet shown Mickey D’s that they care.
That’s gradually changing, says Bob Langert, the vice president of sustainability for McDonald’s, and not a moment too soon. As the world’s biggest fast-food chain, which has 34,000 restaurants in 118 countries, seeks to make its supply chain more environmentally friendly, McDonald’s is trying to enlist its customers as allies.
That’s why the pumpkin lattes marketing features the little green frog seal of approval from the Rainforest Alliance. That’s also why McDonald’s fish sandwiches, for the first time, feature a blue ecolabel from the Marine Stewardship Council certifying that the pollock inside comes from better-managed fisheries.
By talking to consumers about its sustainability efforts, McDonald’s hopes to build brand trust and loyalty. Until recently, people had to dig into the company’s website to learn about its environmental performance.
“We’ve had sustainable fish for many years, but we didn’t tell people about it,” Langert told me during lunch in Washington DC. (He ordered fish.) “We feel there’s a tipping point coming. We see the consumer starting to care. Consumer expectations are rising.”
What McDonald’s is doing with its coffee isn’t innovative. Starbucks paved the way. But if McDonald’s, Dunkin’ Donuts, 7-Eleven, Walmart, Costco, Target and others follow, the world’s coffee farmers will be a lot better off.
Meantime, McDonald’s is leading the way as it encourages potato farmers to use fewer pesticides and less fertilizer, as the story goes on to say. And it could potentially have a huge impact as it tackles its most important supply chain–beef.
Elitists will scoff at everything McDonald’s does, of course, and some of their criticisms have merit. A Big Mac, it’s safe to assume, has a big carbon footprint. Eating too much food from Mickey D’s (or anywhere else) makes people fat. I’d like to see fast-food chains pay their workers better, even if that means customers will have to pay more for breakfast or lunch. But on the environment, McDonald’s is moving in the right direction. Just as important, the company is trying to move its customers along, too.
One of the great virtues of market capitalism is that power is widely dispersed–among consumers, corporate executives, investors and regulators. Lots of people get lots of votes that collectively shape business, and that’s good. But decentralization creates a daunting problem for anyone who cares about corporate sustainability: It’s hard to get things done.
In conversations today at the GreenBiz Forum in New York, people who could be described as powerful—executives with big titles (vice chairman, vice president, CEO) at big institutions (NASDAQ, McDonald’s and Ingram Barge, America’s biggest barge company)–all lamented the limits on their influence over what their companies do, let along how industries can change.
This is why sustainability has to be a team sport. Very few people–or companies–can do much on their own.
Take Bob Langert, vice president for corporate responsibility at McDonald’s, who is one of the most respected sustainability executives in the US. He’s got credibility inside the company and with NGO partners. But to get anything done, he’s got to win over thousands of owner-operators of McDonald’s stores, as well as a a diverse set of suppliers and, in some instances, the tens of millions of people who eat at Mickey D’s every day.
“We are the world’s largest small business,” Langert said. The overwhelming majority of McDonald’s outlets are “owned and operated by independent business people. They have a lot of power in our system. That means we can’t dictate from on high. I challenge people to show me a company that’s more democratic than McDonald’s.” [click to continue…]
On a biking trip last week through Piedmont, a mostly unspoiled agricultural region in northwest Italy, I came across many things: charming hilltop towns, sleepy sidewalk cafes, vineyards that stretch for acres, fields of corn or cows, lush backyard vegetable gardens and fruit trees bearing plums, peaches, apples and lemons. Even the smaller towns have their own pasticceria (bakery), macelleria (butcher shop) and alimentari (grocery selling fresh fruits and vegetables).
Noticeably absent were fast food restaurants or supermarkets. Piedmont is known for its wine, cheese, meats and truffles and the region has created its share of global brands, among them Barolo, Moscato and Nutella. But even in Turin, the region’s commercial hub, you have to look hard to find a McDonald’s or Walmart. (Carrefour Express has outlets in Turin, but they stock more fresh foods than packaged goods.)
This is no accident. Piedmont is home to the Slow Food Movement, which was launched in 1989 after its founder, an Italian journalist named Carlo Petrini, led a campaign that stopped McDonald’s from opening a restaurant near Rome’s Spanish steps. Since then, Slow Food has grown into a global NGO with about 100,000 members in 153 countries (Slow Food USA is based in Brooklyn), a thriving publishing arm and its own small college, the University of Gastronomic Sciences, which is near Bra, Petrini’s home town. [click to continue…]
Today’s guest post comes from Cindy Hoots of Cone Communications, the company founded by Carol Cone that does excellent work around cause marketing and corporate responsibility. Cindy, whose clients include Johnson & Johnson and Green Mountain Coffee Roasters (but not McDonald’s), previously spent 10 years at Starbucks, working on stakeholder engagement, communications and social media. She also edited The Inspired Economist blog. You can find her on Twitter at @ethicalbiz.
When it comes to multinational corporations, we want to “see the man behind the curtain.” Better yet… we want to question him about his business practices. So what happens when we don’t get the opportunity to ask the burning questions? Well, we begin to spread rumors, create urban myths and make stuff up. McDonald’s Canada has decided to lift “the curtain” (at least a little) and directly answer customer questions through the brilliant use of social media.
Over the summer, the fast food giant launched an initiative called “Our Food. Your Questions” which allows customers to ask questions through Facebook and Twitter and then receive personalized responses from the McDonald’s Canada team. The team has promised to answer every question and has already confronted a number of hot button CSR issues including genetically modified organisms (GM0s), Fair Trade, and animal cruelty. [click to continue…]
Helene York is a vegetarian, but as director of strategic sourcing and research at Bon Appetit Management Co., a big food-service company, she needs to think about meat. This week, Bamco made a serious commitment to change the way it buys pork, beef, poultry and eggs.
stop serving all pork produced using the cruel and inhumane practice of gestation crates and all eggs, including “liquid” ones (those removed from their shells), from hens confined to battery cages by 2015.
This won’t be easy. About 90 percent of female pigs are raised in metal cages so small that a pregnant sow cannot even turn around. This commitment aims to eliminate one of the worst practices in the meat industry.
Bon Appetit said it will also aim to drive best practices by promising that, by 2015,
at least 25 percent of all our meat, poultry, and eggs will meet the highest animal welfare standards, as verified by the independent third parties Animal Welfare Approved, Food Alliance, or Global Animal Partnership. These four groups don’t just ban gestation crates and battery cages, they prohibit routine antibiotics and all hormones, and reward producers for allowing animals to engage in their natural behaviors.
Happy New Year! And good riddance to 2011, a year during which we made little or no progress on some of the issues that I care most about: climate change, the long-term federal debt, social mobility (aka the American dream), and our dysfunctional Congress. Yet I remain an optimist.
Texas drought 2011
I could write many words about our woes. Instead, I’ll try to be succinct. On the climate issue,global emissions of carbon dioxide from fossil-fuel burning jumped by the largest amount on record in 2010, we learned recently, and 2011 surely brought further increases. Concentrations of CO2 are 39% above where they were at the start of the industrial era and approaching the point when some scientists say it will be nearly impossible to contain global warming, the Guardian reports. Neither the US nor the UN moved closer to regulating CO2. In a discouraging development, Republicans Mitt Romney and Newt Gingrich backed away from their once-sensible support of greenhouse gas regulation, in what can only be seen as shameless pandering to the know-nothing wing of the Republican Party. Discouraging, too, was the Fukushima nuclear disaster, which will slow down the growth of carbon-free nuclear power. So will the failure of Solyndra. Meanwhile, the U.S. suffered massive flooding of the Mississippi and Missouri Rivers, a terrible drought in Texas, record wildfires and at least 2,941 monthly weather records that were broken by extreme events, according to the NRDC.. Coincidence? Uh, no.
Like the atmospheric concentrations of CO2, the federal budget deficit has been growing.That’s no coincidence either. We’re living beyond our means, whether by burning fossil fuels or taxpayer dollars, and sticking future generations with the cleanup bill. Just last week, the White House asked for a $1.2 trillion increase in the federal debt limit, raising it to about $16.4 trillion. According to Marketplace Radio, that amounts to about $52,000 for every American. For a typical family of four, that’s bigger than the mortgage. [click to continue…]
Smithfield is a pork giant. It has 49 factories, 500 or so hog farms, 48,000 employees and about $11 billion in revenues in FY2010. It slaughtered about 27 million animals last year in the U.S. “We’re the largest pork producer in the world, by a long shot,” says Dennis Treacy, the company’s chief sustainability officer.
Yes, Smithfield has a chief sustainability officer–and that may surprise you if you remember reading horror stories about Smithfield’s confined animal feeding operations (CAFO’s), its problems managing pig manure, its labor conflicts or animal welfare issues in places like The New York Times and Rolling Stone. The company was featured–not in a flattering way–in the movie Food Inc. and sued by Robert F. Kennedy Jr. and the Waterkeeper Alliance.
Dennis Treacy
Treacy had problems with Smithfield, too, before joining the company. In fact, Treacy, who was the director of the Department of Environmental Quality (DEQ) for the state of Virginia from 1998 to 2002 under Republican Gov. Jim Gilmore, once sued Smithfield for polluting the state’s waters. (You could look it up.) In 1997, Smithfield was fined $12 million, one of the largest fines at the time, for violations of the federal Clean Water Act.
Now, though, Treacy says Smithfield has cleaned up not just the water but its own act. He’s been with the company for nine years, and says he was hired to make the company more sustainable and improve its reputation. “We have slowly but surely built a sustainability program,” he says. “It’s the right thing to do, and everybody wants to work for a company that is respected.”
I met Dennis earlier this week in Washington. He seems like a good guy, and he’s spent his career on environmental issues–he studied fisheries and wildlife at Virginia Tech, got a law degree from Lewis and Clark in Oregon, which is a top environmental law school, and he lives on a small farm near Richmond where he and his wife raise chickens and rabbits. [click to continue…]
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Using previous random string in python
#Variables
enemy=['Dummy','Ghost','Warrior','Zombie','Skeleton']
#Functions
#Meeting an enemy - Attack / Defend Option
def encounter(enemy):
print(name,"encountered a",enemy,".","What do you do?")
print("Attack? or Defend?")
#def defend(dvalue):
def battle():
encounter(random.choice(enemy))
#Attack Or Defend?
choice=input("What do you do?")
if choice!="Attack": #If the choice isn't attack then ask again
print("Do you attack or defend?")
choice=input("What do you do?")
if choice!="Defend": #If the choice isn't defend then ask again
print("Do you attack or defend?")
choice=input("What do you do?")
#Say correct sentence depending on what you do.
dmg=randint(0,50) #Dmg randomizer
if choice=="Attack": #If the choice was attack then do a random number of dmg to it
print(name,choice,"s",enemy,".","You deal",dmg,"damage","to it.")
if choice=="Defend": #If ... to it
print(name,choice,"s.")
I am making a text based RPG game. All is going well but I have one problem which I don't know how to solve and haven't found any solutions for. Basically when you encounter an enemy it chooses a random one from the list. 'Bob has encounter a skeleton.' That's fine but then when it does the damaged part it prints the entire list and I don't know how to make it so that is prints the previous enemy selected, in this case a skeleton.
Any solution would be appreciated. Thanks.
A:
You could save the choice of enemy to a variable:
current_enemy = random.choice(enemy)
encounter(current_enemy)
# ...
if choice=="Attack":
print(name,choice,"s",current_enemy,".","You deal",dmg,"damage","to it.")
# etc...
Hope that helps!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
It is a story in which the children of a wealthy businessman who has just died undertake a crazy dispute to control the football team owned by the family.
A comedy of 13 episodes that Netflix just released and has a fantastic cast including; Spanish actor Carlos Bardem and with names like Luis Gerardo Mendes, Andrés Montiel, Sofia Sisniega and Stephanie Cayo. It is a fun comedy, dramatic and beautifully written series.
Movies – Peliculas
September 4th. – Steve Jobs
His passion and ingenuity have been the driving force behind the digital age. However, his drive to revolutionize technology was sacrificial. Ultimately it affected his family life and possibly his health. In this revealing film, we explore the trials and triumphs of a modern day genius, the late CEO of Apple Inc. Steven Paul Jobs.
Septiembre 11th. – The Visit – La Visita
The terrifying story of a brother and sister who are sent to their grandparents’ remote Pennsylvania farm for a weeklong trip. Once the children discover that the elderly couple is involved in something deeply disturbing, they see their chances of getting back home are growing smaller every day
Septiembre 25 – SICARIO
After rising through the ranks of her male-dominated profession, idealistic FBI agent Kate Macer receives a top assignment. Recruited by mysterious government official Matt Graver, Kate joins a task force for the escalating war against drugs. Led by the intense and shadowy Alejandro, the team travels back-and-forth across the U.S.-Mexican border, using one cartel boss to flush out a bigger one.
For Heaven’s sake – at 710 theatre- Buffalo- September 17-oct 4th.
A witty drama about family, faith, and the ties that bind, FOR HEAVEN’S SAKE! played to packed houses Off-Broadway last fall. The play is set in 1974 Buffalo and follows the Kilgannons, a typical Irish-American family, during a time when the world outside was changing fast, the generation gap was widening even faster, and the future was momentarily up for grabs.
In Rochester – Bill Maher – september 27th.
For more than twenty years, Bill Maher has set the boundaries of where funny, political talk can go on American television. First on “Politically Incorrect” (Comedy Central, ABC, 1993-2002), and for the last thirteen years on HBO’s “Real Time,” Maher’s combination of unflinching honesty and big laughs have garnered him 34 Emmy nominations. Maher won his first Emmy in 2014 as executive producer for HBO series, “VICE.” In October of 2008, this same combination was on display in Maher’s uproarious and unprecedented swipe at organized religion, “Religulous,” directed by Larry Charles (“Borat”). The documentary has gone on to become the 8th Highest Grossing Documentary ever.
Panorama Hispano is the regional news and information newspaper for Hispanic and other diverse communities.
US Hispanics are now the largest ethnic minority in the United States numbering 54.2 million as of July 2014. Serving: Buffalo, Rochester, Fredonia, Niagara Falls, NY and Erie, PA. Outside our Market area: Visit our affiliate at: http://www.impremedia.com/
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Effects of dietary sodium chloride intake on renal function and blood pressure in cats with normal and reduced renal function.
To determine effects of variations in dietary intake of sodium chloride (NaCl) on systemic arterial blood pressure (ABP) in cats with normal and reduced renal function. 21 adult cats (7 with intact kidneys [control cats; group C], 7 with unilateral renal infarction with contralateral nephrectomy [remnant-kidney model; group RK], and 7 with unilateral renal infarction and contralateral renal wrapping and concurrent oral administration of amlodipine [remnant-wrap model; group WA]). All cats were sequentially fed 3 diets that differed only in NaCl content (50, 100, or 200 mg of Na/kg); each diet was fed for 7 days. The ABP was recorded continuously by radiotelemetry, and renal function (glomerular filtration rate [GFR]) was determined on the sixth day of each feeding period. Dietary supplementation with NaCl did not affect ABP, but it increased GFR in groups C and WA. The renin-angiotensin-aldosterone axis was activated in groups RK and WA at the lowest NaCl intake, but supplementation with NaCl suppressed this activation in group WA. The lowest NaCl intake was associated with hypokalemia and a high fractional excretion of potassium that decreased in response to supplementation with NaCl. Arterial baroreceptor resetting was evident after chronic hypertension but was not modified by dietary supplementation with NaCl. Low NaCl intake was associated with inappropriate kaliuresis, reduced GFR, and activation of the renin-angiotensin-aldosterone axis without evidence of a beneficial effect on ABP. Therefore, this common dietary maneuver could contribute to hypokalemic nephropathy and progressive renal injury in cats.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Introduction {#sec1}
============
Five-membered heterocycles are widely prevalent in the pharmaceutical industry.^[@ref1]^ For example, a number of top-selling drugs, including raltegravier (Isentress),^[@ref2]^ sitagliptin (Januvia),^[@ref3]^ atorvastatin (Lipitor),^[@ref4]^ and resperidone (Risperdal),^[@ref5]^ contain at least one five-membered heterocycle ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}, highlighted in blue). The commonality of five-membered heterocycles is due, in part, to their enormous structural diversity and interesting biological and electronic properties.^[@ref1]^ Similarly, (hetero)aryl fluorides are frequently employed in medicinal chemistry due to their enhanced metabolic stability and membrane permeability in comparison to nonfluorinated analogues ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}, highlighted in red).^[@ref6]^ Indeed, all of the drugs shown in [Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"} contain *both* a five-membered heterocyclic core and an aryl fluoride.
{#fig1}
Considering the independent importance of five-membered heterocycles and aryl fluorides in the pharmaceutical industry, there is a surprising lack of five-membered heteroaryl fluorides that have been prepared and studied for potential biological activity.^[@ref7]^ This is likely due to the limited methods available for the fluorination of five-membered heteroarenes,^[@ref8]^ which include thermal^[@cit9a]^ or photochemical^[@cit9b]^ Balz--Schiemann reactions, Halex reactions,^[@ref10]^ electrophilic fluorinations of metalated heteroarenes,^[@ref11]^ and direct fluorinations with F~2~.^[@ref12]^ All of these methods suffer from severe drawbacks in terms of safety, functional group tolerance, generality, and/or formation of complex mixtures of products, which limit their utility. To date, most of the recently developed transition-metal-mediated methods for aryl fluorination^[@ref13]^ have seen limited application to five-membered heteroaryl systems.^[@ref14]^ Thus, there remains a strong need for the development of new methods for the fluorination of five-membered heteroarenes.
We^[@ref15]^ and others^[@ref16]^ have explored the Pd-catalyzed cross-coupling of (hetero)aryl halides with a metal fluoride salt ([Figure [2](#fig2){ref-type="fig"}](#fig2){ref-type="fig"}A) as a simple and general method for the synthesis of (hetero)aryl fluorides. Advances in ligand (**L1**--**L3**) and precatalyst (**P1**--**P3**, [Figure [2](#fig2){ref-type="fig"}](#fig2){ref-type="fig"}B) design have allowed us to convert a variety of nitrogen-containing six-membered heteroaryl triflates^[@cit15a],[@cit15d]^ and bromides^[@cit15a],[@cit15c]^ into the corresponding heteroaryl fluorides. Thus, we wondered if this methodology could be extended to the preparation of five-membered heteroaryl fluorides. However, previous stoichiometric and catalytic investigations of cross-coupling reactions involving five-membered heteroaryl halides suggest that reductive elimination is significantly more challenging in these reactions in comparison to that with six-membered aryl halides, likely due to the smaller size and increased electron richness of five-membered heteroaryl groups.^[@ref17]^ Considering the already high kinetic barrier for C--F reductive elimination from Pd(II),^[@cit16b],[@cit16c]^ prior to this work it remained unclear if the reductive elimination of five-membered heteroaryl fluorides was feasible under synthetically relevant conditions. As a second challenge, nitrogen-containing heterocycles can inhibit Pd-catalyzed reactions by coordinating to the Pd center.^[@cit15d],[@ref18]^ Herein, we describe catalytic, stoichiometric, and computational studies aimed toward determining if the Pd-catalyzed fluorination of five-membered heteroaryl bromides is a viable transformation with current catalyst systems.
{#fig2}
Results and Discussion {#sec2}
======================
We began our investigation by attempting the Pd-catalyzed fluorination of an array of five-membered heteroaryl bromides (**4**--**13**) under the standard reaction conditions used for the fluorination of six-membered heteroaryl bromides^[@cit15a],[@cit15c]^ using **P1**--**P3** as precatalysts ([Table [1](#tbl1){ref-type="other"}](#tbl1){ref-type="other"}). Unfortunately, the desired product was not observed in any of these reactions (see [Table S1](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf) in the Supporting Information for additional examples). In most cases, the starting material was recovered along with trace amounts of the corresponding reduction (Ar--H) product, as judged by GC/MS analysis of the crude reaction mixtures. Increasing the catalyst loading, reaction temperature, or number of equivalents of AgF/KF did not change the outcome of these reactions. For bromoazoles containing sp^2^-hybridized nitrogen centers (**8**--**12**), catalyst inhibition could account for this observation.^[@ref18]^ Indeed, we have found that the addition of various thiazoles and N-substituted (benz)imidazoles to the otherwise high-yielding Pd-catalyzed fluorination of 4-(*n*Bu)PhBr inhibits the desired reaction (see [Table S2](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf) in the Supporting Information). However, 1-methyl-1*H*-pyrazole did not significantly inhibit this reaction, indicating that the unsuccessful fluorinations of **10** and **11** are not necessarily due to catalyst inhibition. Thus, for simple five-membered heteroaryl bromides lacking sp^2^-hybridized nitrogen centers (e.g., **4**--**7**), as well as bromopyrazoles (**10** and **11**), at least one of the elementary steps of the catalytic cycle shown in [Figure [2](#fig2){ref-type="fig"}](#fig2){ref-type="fig"} must not be operative under the standard reaction conditions.
###### Selected Examples of Unsuccessful Pd-Catalyzed Fluorinations of Five-Membered Heteroaryl Bromides[a](#t1fn1){ref-type="table-fn"}
{#fx1}
{#fx2}
Reaction conditions: ArBr (0.10 mmol), AgF (0.20 mmol), KF (0.05 mmol), **P1--P3** (2%), solvent (1.0 mL), 130 °C, 14 h. TBME = *tert*-butyl methyl ether.
Significant decomposition observed by ^19^F NMR and GC/MS.
PhSO~2~F observed by ^19^F NMR and GC/MS.
On the basis of previous work,^[@ref15]−[@ref17]^ we hypothesized that C--F reductive elimination from Pd(II) was the most challenging step in these reactions. We carried out an in-depth study of this transformation in order to improve its efficiency. To this end, we prepared **L1**-ligated oxidative addition complexes of 2-bromothiophene (**13**) and 5-acetyl-2-bromothiophene (**14**) to study their solid-state structures ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}A).^[@ref19]^ Although **13** and **14** proved to be unstable in solution for extended periods of time, single crystals suitable for X-ray diffraction of both complexes could be obtained ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}B).^[@ref20]^ Notably, these complexes are among the first biaryl monophosphine-ligated oxidative addition complexes of five-membered heteroaryl halides that have been synthesized and characterized.^[@ref21]^ The solid-state structures of **13** and **14** were compared with that of the previously reported complex **L1**·Pd(4-(CN)Ph)Br (**15**)^[@cit17b]^ to analyze the differences that arise upon replacing a six-membered aryl group with a smaller five-membered heteroaryl group ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}C). Consistent with our previous computational studies,^[@cit17b]^ the Ar--Pd--Br angle is significantly wider in five-membered heteroaryl complexes **13** and **14** (**13**, 81.48(4)°; **14**, 81.2(1)°) than in six-membered aryl complex **15** (79.03(8)°) ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}C). The smaller angle in **15** in comparison to those in **13** and **14** reflects the greater proclivity of this complex to undergo reductive elimination.^[@cit17b]^ Notably, only small differences were observed in the Pd--Ar and Pd--ipso bond lengths among these complexes ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}C).
{#fig3}
Unfortunately, to date, all attempts to prepare **L**·Pd(Ar)F complexes bearing five-membered heteroaryl groups have been unsuccessful.^[@ref22]^ Thus, we carried out density functional theory (DFT) calculations to better understand the structure and reactivity of these species (**17**--**19**) in comparison to that of the analogous complex bearing a phenyl group (**16**); the results of these studies are summarized in [Table [2](#tbl2){ref-type="other"}](#tbl2){ref-type="other"} (see the [Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf) for optimized ground- and transition-state geometries). Consistent with our initial hypothesis, the barrier to C--F reductive elimination was calculated to be 7.0 kcal/mol higher in energy for the 2-thienyl-substituted complex **17** (27.7 kcal/mol) in comparison to phenyl-substituted complex **16** (20.7 kcal/mol), suggesting that reductive elimination is on the order of 100000 times slower in the former case. Additionally, the ground-state Ar--Pd--F angle was wider in **17** (82.3°) than in **16** (80.7°), which corroborates the X-ray crystallographic findings in [Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}C. Notably, the calculated Pd--F bond lengths are in line with those that have been observed experimentally for other **L*n***·Pd(Ar)F complexes.^[@cit16d]^ The barrier to reductive elimination for the corresponding 3-thienyl complex **18** was 1.8 kcal/mol lower than for **17**, which is also consistent with previous experimental and theoretical findings.^[@cit17c],[@cit17d]^ Taken together, these crystallographic ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}) and computational ([Table [2](#tbl2){ref-type="other"}](#tbl2){ref-type="other"}) studies confirm that C--F reductive elimination of five-membered heteroaryl fluorides is an extremely challenging process and is therefore most likely the rate-limiting step of the Pd-catalyzed fluorinations presented in [Table [1](#tbl1){ref-type="other"}](#tbl1){ref-type="other"}.
###### Computationally Determined Parameters for **L3**·Pd(Ar)F Complexes **16**--**19**[a](#t2fn1){ref-type="table-fn"}
{#fx3}
{#fx4}
Energies were calculated at the M06/6-311+G(d,p)-SDD/SMD(toluene) level of theory with geometries optimized at the B3LYP/6-31G(d) level. Δ*G*^⧧^ values were determined at 25 °C.
Ground-state values.
On the basis of this analysis, we hypothesized that ortho-substituted heteroaryl bromides might be effective substrates for this reaction, due to the known accelerating effect of ortho substituents on reductive elimination.^[@ref23]^ Indeed, DFT calculations confirm that the addition of an phenyl group adjacent to the Pd center (**19**) decreases the barrier of C--F reductive elimination substantially (21.8 kcal/mol) in comparison to **18** (25.9 kcal/mol). Therefore, we investigated the reactivity of 2-substituted-3-bromothiophenes ([Table [3](#tbl3){ref-type="other"}](#tbl3){ref-type="other"}), because bromothiophenes tend to be well-behaved in Pd-catalyzed cross-coupling reactions.^[@ref24]^ Unfortunately, the desired product was not observed with a methyl group in the 2-position (**20a**, entry 1). The addition of an additional electron-withdrawing group to further promote reductive elimination (**20b**, entry 2) was still ineffective.^[@ref25]^ However, the corresponding substrate substituted with a bulky phenyl group in the ortho position furnished the desired product **20c**, albeit in modest yield (entry 3). This finding represents one of the first transition-metal-catalyzed fluorinations of a five-membered heteroarene. An examination of the solvent and precatalyst employed revealed that *tert*-butyl methyl ether (TBME) is generally superior to other ethereal (2-MeTHF, cyclopentyl methyl ether, Bu~2~O) and hydrocarbon (toluene, cyclohexane) solvents and that **P3** is consistently superior to **P1** and **P2**([@cit15a]) for carrying out this transformation. The incorporation of various electron-withdrawing groups at the 5-position of the heteroaryl bromide further improved the yield of the desired product to synthetically useful levels (entries 4--8).^[@ref25]^ Indeed, the presence of an ester (**20d**), nonenolizable ketone (**20e**), sulfonamide (**20f**), or amide (**20g**) was advantageous at this position, although substrates bearing formyl, acetyl, cyano, and nitro groups underwent significant decomposition during the reaction (see [Table S1](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf) in the Supporting Information). It should be noted that isolated products were contaminated with less than 1% of the corresponding reduction product, as judged by GC analysis (see the [Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf) for details). However, small amounts (\<5%) of a second fluorothiophene product, which is likely the regioisomeric product with the fluorine adjacent to the electron-withdrawing group, were detected in the crude reaction mixtures.^[@ref26]^ Consistent with this hypothesis, this side product was not observed during the synthesis of **20h** (entry 9), wherein the proposed regioisomer and the desired product are identical compounds. Additionally the use of AlPhos (**L3**) generally affords better selectivity for the desired product in comparison to HGPhos (**L2**) (as shown for **20d**, entries 4 and 5), which is also the case with six-membered-ring substrates.^[@cit15a]^ In all cases except for **20f**, the undesired regioisomer could be chromatographically separated from the desired product.
###### Pd-Catalyzed Fluorination of 2-Substituted 3-Bromothiophenes[a](#t3fn1){ref-type="table-fn"}
{#fx5}
entry product R~1~ R~2~ R~3~ conversn, %[b](#t3fn2){ref-type="table-fn"} yield, % (α:β)[c](#t3fn3){ref-type="table-fn"}
----------------------------------- --------- ------------ ------ ------------- --------------------------------------------- ------------------------------------------------
1 **20a** Me H H n/d n/o
2 **20b** Me H CO~2~Me n/d n/o
3 **20c** Ph H H 45 22 (\>50:1)
4 **20d** Ph H CO~2~Me 95 80 (\>50:1)
5[d](#t3fn4){ref-type="table-fn"} **20d** Ph H CO~2~Me 95 91 (10:1)
6 **20e** Ph H C(O)Ph 98 91 (26:1)
7[e](#t3fn5){ref-type="table-fn"} **20f** Ph H SO~2~NEt~2~ 100 93 (30:1)[f](#t3fn6){ref-type="table-fn"}
8 **20g** Ph H C(O)NEt~2~ 100 94 (\>50:1)[f](#t3fn6){ref-type="table-fn"}
9 **20h** Ph H Ph 95 80
10 **20i** Ph Me Ph n/d 20
11 **20j** Ph Ph Ph n/d n/o
12 **20k** 1-naphthyl H H n/d n/o
Reaction conditions unless specified otherwise: ArBr (0.10 mmol), AgF (0.20 mmol), KF (0.05 mmol), **P3** (2%), TBME (1.0 mL), 130 °C, 14 h. n/d = not determined. n/o = not observed.
Determined by GC.
Yield determined by ^19^F NMR comparison to an authentic sample unless otherwise noted.
**P2** was used in place of **P3**.
Toluene as reaction solvent.
Isolated yield, 0.50 mmol scale.
We also investigated whether additional ortho substitution could further promote C--F reductive elimination (entries 10--12). Bromothiophenes bearing additional methyl (**20i**, entry 10) or phenyl (**20j**, entry 11) groups adjacent to the bromine atom produced diminished yields in comparison to the corresponding substrate lacking substitution at the 4-position (**20h**, entry 9). Likewise, the presence of a bulky 1-naphthyl group in the ortho position impeded the formation of **20k** (entry 12). The sluggish reactivity of these extremely hindered substrates is likely due to slow oxidative addition of the aryl bromide to the active **L3**·Pd(0) species. Overall, these studies revealed that only 3-bromothiophenes bearing both phenyl groups in the ortho position and electron-withdrawing groups on the thiophene ring provide synthetically useful yields, which is consistent with our hypothesis that C--F reductive elimination is the challenging process in this transformation.
We next attempted to extend these findings to other five-membered heteroaryl bromides bearing ortho phenyl substituents ([Table [4](#tbl4){ref-type="other"}](#tbl4){ref-type="other"}). Consistent with the results highlighted in [Table [3](#tbl3){ref-type="other"}](#tbl3){ref-type="other"}, only 2-bromothiophenes bearing an electron-withdrawing group in the 5-position afforded a high yield of the desired product (**21a**), while those substituted with an electron-neutral phenyl group (**21b**) or lacking substitution at this position (**21c**) were less reactive ([Table [4](#tbl4){ref-type="other"}](#tbl4){ref-type="other"}). The overall lower yields obtained for these substrates in comparison to those in [Table [3](#tbl3){ref-type="other"}](#tbl3){ref-type="other"} (compare **21b** to **20h** and **21c** to **20c**) are consistent with the DFT calculations in [Table [2](#tbl2){ref-type="other"}](#tbl2){ref-type="other"}, which show that reductive elimination of 3-thienyl groups is easier than that of 2-thienyl groups, as well as with literature precedent.^[@cit17c],[@cit17d]^ Notably, in the case of **21a**, 4% of the corresponding reduction product was isolated along with the desired aryl fluoride.
###### Additional Pd-Catalyzed Fluorinations of Ortho-Substituted Five-Membered Heteroaryl Bromides[a](#t4fn1){ref-type="table-fn"}
{#fx6}
{#fx7}
Reaction conditions unless specified otherwise: ArBr (0.10 mmol), AgF (0.20 mmol), KF (0.05 mmol), **P3** (2%), TBME (1.0 mL), 130 °C, 14 h. n/o = not observed.
Isolated yield, 0.50 mmol scale.
Contaminated with 4% of the corresponding reduction product.
Yield determined by ^19^F NMR comparison to an authentic sample.
Toluene as reaction solvent.
Determined by GC.
The fluorinations of ortho-substituted benzofused heteroaryl bromides (**22** and **23**) afforded similar results. Although 3-bromo-2-phenylbenzo\[*b*\]thiophene underwent fluorination only sluggishly, furnishing an inseparable mixture of starting material and **22a**, the corresponding benzo\[*b*\]furan underwent clean fluorination to give **22b** in high yield. The higher reactivity of benzofurans (**22b**) in comparison to benzothiophenes (**22a**) likely reflects the stronger inductive electron-withdrawing effect of the O atom in the benzofuran ring.^[@cit17c],[@cit17d],[@ref27]^ Unfortunately, the corresponding 3-bromo-*N*-sulfonylindole did not undergo fluorination to provide **22c**. Consistent with our studies concerning non-benzo-fused bromothiophenes ([Tables [3](#tbl3){ref-type="other"}](#tbl3){ref-type="other"} and [4](#tbl4){ref-type="other"}), the corresponding 2-bromobenzo\[*b*\]thiophene bearing an ortho phenyl group provided only a low yield of **23** under the reaction conditions.
We also examined the Pd-catalyzed fluorination of bromoazoles with phenyl groups in the ortho position (**24**--**26**, [Table [4](#tbl4){ref-type="other"}](#tbl4){ref-type="other"}). Low yields of the desired product were observed with both ortho-substituted 4- (**24a**,**b**) and 5-bromothiazoles (**25**). Thiazoles inhibit the desired reaction, which likely explains the observed decrease in reactivity in comparison to thiophenes (see [Table S2](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf) in the Supporting Information). As in previous cases, increasing the catalyst loading did not significantly improve the yield of these reactions. Additionally, none of the desired product was observed with more electron rich 4-bromo-1*H*-pyrazoles substituted with a phenyl group in the ortho position (**26a**,**b**), regardless of the nitrogen protecting group (for additional examples, see [Table S1](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf) in the Supporting Information).
To overcome the generally poor reactivity of bromoazoles, we also attempted the fluorination of electron-deficient 2-bromo-1,3-azoles ([Table [5](#tbl5){ref-type="other"}](#tbl5){ref-type="other"}). In these cases, significant formation of side products occurred using TBME as the reaction solvent, and so these reactions were carried out in toluene. Although 2-bromothiazole did not provide the desired product (**27a**) under the reaction conditions, the addition of a phenyl group adjacent to the nitrogen center led to a low yield of **27b**. As shown with bromothiophenes (**20d**--**g**, [Table [3](#tbl3){ref-type="other"}](#tbl3){ref-type="other"}; **21a**, [Table [4](#tbl4){ref-type="other"}](#tbl4){ref-type="other"}), the presence of an electron-withdrawing group on the thiazole ring was crucial for the isolation of **27c** in synthetically useful yield. Notably, less than 5% of **27b**,**c** was observed in the absence of **P3**, ruling out the possibility of a background Halex process. Although simple N-substituted 2-bromo-1*H*-imidazoles underwent decomposition (**28a**) or no reaction (**28b**) under these conditions, we found that the more activated 8-bromocaffeine could be efficiently converted to **29** in high yield; again, only trace amounts of **29** were observed in the absence of catalyst. Additionally, none of the corresponding reduction product was detected in the purified samples of **27c** and **29** (see the [Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf) for details). It should be noted that benzo-fused 2-bromoazoles, such as 2-bromobenzothiazole and 2-bromo-1-methyl-1*H*-benzimidazole, underwent significant fluorination in the absence of catalyst, reflecting their proclivity toward Halex processes (not shown). Nevertheless, this methodology may be attractive for the synthesis of 2-fluoroazoles bearing electron-withdrawing groups.
###### Pd-Catalyzed Fluorinations of 2-Bromo-1,3-azoles[a](#t5fn1){ref-type="table-fn"}
{#fx8}
{#fx9}
Reaction conditions unless specified otherwise: ArBr (0.10 mmol), AgF (0.20 mmol), KF (0.05 mmol), **P3** (2%), toluene (1.0 mL), 130 °C, 14 h. n/o = not observed.
Yield determined by ^19^F NMR comparison to an authentic sample.
\<5% yield observed in the absence of **P3**.
Isolated yield, 0.50 mmol scale.
Significant decomposition observed by ^19^F NMR and GC/MS.
Conclusion {#sec3}
==========
By systematically studying substituent effects on the fluorination of five-membered heteroaryl bromides, we were able to identify a number of five-membered heteroaryl fluorides that could be prepared in synthetically useful yields with a catalyst system based on **L3**. In particular, electron-deficient and ortho-substituted benzo\[*b*\]thiophenes, ortho-substituted benzo\[*b*\]furans, and highly activated 2-bromo-1,3-azoles are viable substrates for this reaction.^[@ref28]^ Despite these advances, the scope of this reaction remains limited, especially with respect to bromoazoles. Although our previous work in this area^[@cit15d],[@cit17a],[@cit17b]^ suggests that increasing the steric bulk of the ligand could potentially help overcome these problems, it is probable that a more fundamental change to the reaction, such as a change in mechanism, transition-metal catalyst, or ligand architecture may be needed to access a broader scope of five-membered heteroaryl fluorides. Given the potential importance of five-membered heteroaryl fluorides in medicinal chemistry, this transformation remains an active area of research in our group.
Experimental Section {#sec4}
====================
General Procedure for Pd-Catalyzed Fluorination Reactions {#sec4.1}
---------------------------------------------------------
In a nitrogen-filled glovebox, an oven-dried screw-cap reaction tube equipped with a stir bar was charged (in this order) with silver fluoride (26 mg, 0.20 mmol, 2.00 equiv), additive (0.05 mmol, 0.50 equiv), **P1**--**P3** (4.0 mg, 2%), aryl bromide (0.10 mmol, 1.00 equiv), and solvent (1.0 mL). The tube was capped, removed from the glovebox, and placed in an oil bath that had been preheated to 130 °C, and the mixture was vigorously stirred for 14 h. (*Caution*! Perform behind a barrier such as a blast shield!) At this time, the tube was cooled to room temperature, and 1-fluoronaphthalene (20 μL, 1.55 equiv) was added. The reaction mixture was analyzed directly by ^19^F NMR. Afterward, the reaction mixture was filtered through a silica gel plug, eluted with EtOAc, and analyzed by GC (or GC/MS).
The Supporting Information is available free of charge on the [ACS Publications website](http://pubs.acs.org) at DOI: [10.1021/acs.organomet.5b00631](http://pubs.acs.org/doi/abs/10.1021/acs.organomet.5b00631).Full procedural and spectroscopic data ([PDF](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_001.pdf))Solid-state structure of **13** ([CIF](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_002.cif))Solid-state structure of **14** ([CIF](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_003.cif))Cartesian coordinates for the ground-state structures of **16**--**19** and the corresponding C--F reductive elimination transition-state geometries ([XYZ](http://pubs.acs.org/doi/suppl/10.1021/acs.organomet.5b00631/suppl_file/om5b00631_si_004.xyz))
Supplementary Material
======================
######
om5b00631_si_001.pdf
######
om5b00631_si_002.cif
######
om5b00631_si_003.cif
######
om5b00631_si_004.xyz
The authors declare the following competing financial interest(s): MIT has patents on some of the ligands and precatalysts used in this work, from which S.L.B. and former coworkers receive royalty payments.
Research reported in this publication was supported by the National Institutes of Health under award number GM46059. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. P.J.M. thanks the National Science Foundation for a predoctoral fellowship (2010094243). P.J.M. also thanks Amgen for an educational donation, for which we are grateful. One of the X-ray diffractometers used in this work was purchased with the help of funding from the National Science Foundation (Grant CHE 0946721). Dr. Peter Mueller (MIT) is acknowledged for solving the X-ray structures of **13** and **14**. Dr. Aaron Sather (MIT) is acknowledged for helpful discussions, assistance with this manuscript, and the generous donation of **P3**. We thank Prof. Peng Liu (University of Pittsburgh) for help with computational studies. Calculations were performed at the Center for Simulation and Modeling at the University of Pittsburgh.
Dedicated to the memory of Professor Gregory L. Hillhouse: brilliant chemist, great person and friend.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
At its core, the NFL combine is a fantastic opportunity for teams to test everything about draft prospects except their on-field performance.
They see how fast and strong the players are, how they check out medically and how well they respond in an interview, even if some questions are borderline illegal.
For draft analysts, the combine is an opportunity to stick irrelevant labels on players such as "high ceiling" and "freak athlete," sexy terms often given to players whose draft stock relies heavily on factors other than on-field performance. Those players have flown up post-combine draft boards this week while players with impressive college careers have started to fall.
After a 4-12 season, the Lions aren't in the market for sexy. That's why they should pass on BYU defensive end Ezekial Ansah. He may be the next Jason Pierre-Paul, but he'll enter the league as a project.
Instead, they should use the No. 5 pick on a polished pass rusher, with the top targets being LSU's Barkevious Mingo, Georgia's Jarvis Jones and Florida State's Bjoern Werner.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
wx file error when using Haskell
I am trying to learn to use the wx packages to make GUI programs in Haskell with the following code:
module Main where
import Graphics.UI.WX
gui :: IO ()
gui = do
f <- frame [text :="Hello World!"]
staticText f [text :="Some static text"]
return ()
main :: IO()
main = start gui
But when I try to compile this I get the following error:
C:\Haskell>ghc -O2 --make gui.hs
[1 of 1] Compiling Main ( gui.hs, gui.o )
gui.hs:2:0:
Bad interface file: C:\temp\wxhaskell-0.11.1.2\lib\imports\Graphics
mismatched interface file versions (wanted "6103", got "6104")
This is after I installed wx from a binary file that is the latest version.
What do I do to make this compile or get wx to work in general?
EDIT: On further inspection it turns out I am using using:
C:\Haskell>ghc --version
The Glorious Glasgow Haskell Compilation System, version 6.10.3
A:
You have GHC version 6.10.3 and it seems you've wxHaskell pre-compiled with GHC version 6.10.4. That's the mismatch.
Possibilities:
-downgrade wxHaskell
-upgrade to GHC version 6.10.4
It seems many pre-build packages are in transition from being build in version 6.10.3 to 6.10.4. This is annoying. I think time will resolve these kind of issues?
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Intrathecal infusional therapies for intractable pain: patient management guidelines.
This article focuses on appropriate patient selection for and management of patients selected for continuous spinal infusional opioid therapy. Patients with cancer-related pain who have undergone sequential strong opioid drug trials, who have intractable, unmanageable side effects, and who have undergone a successful spinal opioid efficacy trial are candidates for implantable spinal infusional therapy. Patients with noncancer-related chronic pain, who have failed all conventional syndrome-specific therapies before neuroablative surgical procedures, including sequential strong opioid drug trials, who have intractable, unmanageable side effects, and who have undergone successful spinal opioid efficacy trial are deemed candidates for implantable spinal infusional therapy. Patients with chronic noncancer-related pain and patient with cancer-related pain who have life expectancies greater than 3 mo all have implanted programmable infusion pumps. Patients with cancer-related pain who have life expectancies less than 3 mo have implanted permanent epidural catheters connected to external pump systems. Management guidelines for complications of therapy broadly categorized as surgical, mechanical, and pharmacologic are presented.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
In recent years, the rapidly accelerating cost of funeral services has become the object of mounting public concern. Although modern techniques could probably do much to reduce these costs, funerals have resisted the application of technology largely because of the solemnity and traditional conservativeness of the funeral ceremony. Thus, coffins, caskets, head stones, and the like are prepared by means of conventional techniques which require the expenditure of extensive hand workmanship and traditional materials.
In the above-referenced patern application entitled Multi-element Casket, which is hereby incorporated by reference, I disclosed a very economical apparatus for the display and cremation of the deceased. The casket disclosed there comprises a number of elements and is particularly suited for services involving cremation of the deceased. The casket comprises a container bottom configured and dimensioned to contain suitable bedding which is disposed within the container bottom. A platform supports the container bottom as well as an outer casket shell having sidewalls and an openable top element. In accordance with the apparatus there disclosed the outer casket shell is configured and dimensioned to extend around and be positioned over the container bottom while they both rest on the platform.
One of the advantages of the apparatus disclosed in my earlier application is the ease with which the casket may be transported and stored. Specifically, the actual cremation receptacle comprises a container bottom and support elements which are made in such a manner that they may be folded into compact form. The container further comprises a top which may be folded into a box for containing both the container bottom and the support member. This particular structure is extremely advantageous inasmuch as the outer casket shell is conventional in appearance and is reused, and the disposable part of the casket, namely, the container bottom and, typically, bedding and liner, are relatively inexpensive.
While this arrangement works well in the United States, in some foreign countries furneral services and customs vary quite markedly from those in this country. For example, in Japan the appearance of the casket is not as critical as it is in the United States. Another difference is the fact that the top of the casket, instead of containing a half-door which opens, has a glass window which is provided with a pair of shutters. This is part of a problem caused by a radical difference in undertaking procedures between those of the Far East and those of the West. Specifically, in Japan and a number of other Far Eastern countries the body of the deceased is not embalmed. Hence, decay of the body proceeds at an accelaerated rate. Such decay results in the generation of liquids and vapors. The liquids tend to destroy even conventional wooden caskets. In accordance with the present invention, an inexpensive and novel casket assembly, particularly useful in such circumstances, is described.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
So, do you just ignore how you make people feel on occasion to be a bitch, or did you lie about your results to become more of one? Because the INFPs I know - myself included - would be ashamed to call your possessive, stank attitude one of their own.
While certain personality types (especially those belonging to the SJ subgroup) would discard such notions as irresponsible and reckless, ISFPs actually do great in areas that require an artistic, independent approach. ISFP personalities also tend to be very charming, mostly because they find it really easy to pick the best compliment for a particular person – ISFPs’ sensitivity (F) and great control of all five senses (S) mean that they are very much in tune with the physical, sensual world. Consequently, ISFPs rarely have difficulties connecting with other people, despite the fact that they are introverts (I). Even when the ISFP is being truly unpredictable or even reckless, their charm easily disarms those around them.
That being said, ISFPs also need time to withdraw from social interaction and let their mind rest. This personality trait can often surprise other people who may have believed that ISFPs’ spontaneity and enthusiasm meant that they would always desire to be “in the open”. However, at the end of the day, ISFPs are still introverts and their inner batteries need some time to recharge. This contributes to the air of unpredictability and mystery that usually surrounds ISFPs – if someone with this personality type has a very strong I trait, even their closest friends may have difficulties anticipating ISFP’s thoughts and reactions.
ISFP personalities also tend to be very sensitive to other people’s feelings – they are inclined to seek harmony in all situations and have no difficulties sensing a change in someone’s emotional state. On the other hand, ISFPs can also be incredibly competitive and react very badly to any form of criticism. That competitive nature often pushes ISFPs towards risky activities such as gambling or extreme sports – and they also tend to do quite well in those fields, mostly because they are so in touch with the physical environment.
Sensitive and observant. ISFP personalities find it easy to relate to other people and recognize their emotional states.They seek harmony and strongly dislike conflicts.
Charming and open-minded. ISFPs are relaxed, warm individuals who rarely have difficulties making friends or fitting in. They also tend to be very tolerant and flexible.
Artistic. People with this personality type tend to have a very good sense of aesthetics and beauty. This is also their primary way of expressing themselves – ISFPs’ artistic skills are truly enviable.
Imaginative. ISFPs possess a creative mind and are often seen as trend setters, coming up with bold and unusual ideas all the time. Their vivid imagination and artistic skills form a powerful combination, often helping the ISFP in an unexpected way.
Curious. ISFPs tend to be very inquisitive and willing to try out new things. They would rather take risks than miss an exciting opportunity.Passionate and enthusiastic.ISFP personalities may often be quiet and reserved, but they can also become incredibly passionate if they are working on something that excites and interests them. People with the ISFP type tend to have very intense feelings, but their passion and enthusiasm are usually hidden from the outside world.
ISFP weaknesses
May have low self-esteem. ISFPs often have problems with self-confidence, especially earlier on in life. Most of their positive traits revolve around sensitivity and artistic expression, and such things are often seen by many as secondary to, for instance, academic performance.
Difficulties in the academic environment. People with the ISFP personality type usually find scientific subjects and research quite difficult, and may fall behind their peers in highly technical fields.
Get stressed easily. ISFPs are intensely emotional individuals – consequently, they may have difficulties coping with conflicts or stress. This can also lower their self-esteem and stifle their creativity.
Very competitive. Despite being quite reserved or even shy, ISFP personalities can become very competitive in certain situations. This trait is very common among SP types.Unpredictable. ISFPs dislike long-term commitments and plans, often living completely in the present and consciously trying to avoid thinking about the future. This can lead to a lot of tension and misunderstanding in their romantic relationships.
Fiercely independent. ISFPs value their freedom very highly and do not really worry about traditions, rules or guidelines, believing that they only hinder artistic expression and free thinking. Not surprisingly, ISFP personalities are likely to clash with more traditional types, especially in the workplace.
I put in bold the parts I agree with. I took this test awhile back and I got the same result.
Generally, ENTJs pay a lot of attention to their friendships. It is not always easy to be an ENTJ’s friend as people with this personality type tend to have a very strong willpower and are also likely to be very smart, argumentative and critical. Not everyone can withstand an argument with them – and this is exactly why ENTJs respect and value friends who are able to hold their ground. That being said, ENTJ personalities do not understand nor respect emotional arguments and appeals. They are very rational individuals and can only accept a different opinion if it is supported by logic and reason.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Nordreisa Church
Nordreisa Church () is a parish church of the Church of Norway in Nordreisa Municipality in Troms og Finnmark county, Norway. It is located in the village of Storslett. It is the church for the Nordreisa parish which is part of the Nord-Troms prosti (deanery) in the Diocese of Nord-Hålogaland. The white, wooden church was built in a long church style in 1856 by the architect Christian Heinrich Grosch. The church seats about 350 people. The building was consecrated on 8 October 1856 by the Bishop Knud Gislesen.
During the last winter of World War II (1944–1945), the church was used as a residence for German soldiers, and the service building nearby was used as a horse stable. The church was spared during the burning of Finnmark and Northern Troms by the retreating German Army in 1945. Much of the church inventory disappeared during this period, but a few years after the war a baptismal bowl from 1856 was found in a pile of horse manure.
Media gallery
See also
List of churches in Troms
References
Category:Churches in Troms
Category:Nordreisa
Category:Wooden churches in Norway
Category:19th-century Church of Norway church buildings
Category:Churches completed in 1856
Category:1856 establishments in Norway
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.