text
stringlengths 2
1.05M
| repo_name
stringlengths 5
101
| path
stringlengths 4
991
| language
stringclasses 3
values | license
stringclasses 5
values | size
int64 2
1.05M
|
|---|---|---|---|---|---|
Earlier in the day, Obama will stop in Connecticut to push for an increase in the federal minimum wage, an issue he has made a centerpiece of his domestic agenda.
About 25 donors have shelled out as much as $32,400 to attend a small “round-table discussion” with Obama in Cambridge and another 70 donors have given $5,000 to $20,000 to attend a fund-raising dinner later in the evening at Artists for Humanity in South Boston.
President Obama is swooping into Boston to raise money for the Democratic National Committee on Wednesday, less than a week after Governor Chris Christie of New Jersey and former governor Mitt Romney held a major fund-raiser for the Republican Party in Boston.
Governor Deval Patrick, who has sought an increase in the minimum wage in Massachusetts, is planning to join the president at that event at Central Connecticut State University in New Britain and attend the fund-raisers in Cambridge and Boston.
Obama’s fund-raising swing comes as he faces a crisis in Ukraine, as well as problems closer to home.
Massachusetts, which pioneered universal health insurance when Romney was governor, is among the states struggling to adapt to the more complex requirements of the Affordable Care Act, the federal version of that law signed by Obama. The state is facing a backlog of thousands of applications for subsidized coverage, and the website for its health exchange has been plagued with error messages since it was revamped in October.
But Obama’s loyal backers say that, despite the troubles, they are eager to support him.
“I’m always interested in seeing the president of the United States,” said Alan D. Solomont, a former ambassador to Spain and Andorra under Obama who is planning to attend at least one of Wednesday’s fund-raisers.
Woody Kaplan, a major benefactor of the Democratic Party, who lives in the Back Bay, said heavily Democratic Boston is always friendly territory for the president.
“Boston has been incredibly supportive of Obama in both elections, and I think he feels at home with us,” said Kaplan, who said he cannot attend Wednesday’s events because he has already given the party the maximum amount allowable under federal law.
Obama does not plan to hold any public events while in town, and his fund-raiser in Cambridge will be closed to the press. But his dinner in South Boston will be open to select media, meaning his remarks there will be made public.
Philip W. Johnston, a former chairman of the state Democratic Party, said Obama is using his local stops solely to help his party retain control of the US Senate and avoid losing seats in the US House in the mid-term elections in the fall.
Most of the pivotal races are in other states, but both national parties are closely invested in what is expected to be a competitive fight for the Sixth Congressional District seat currently held by US Representative John F. Tierney, a Salem Democrat. Tierney is facing a challenge in the Democratic primary from a political newcomer, Seth Moulton, and a potential rematch against Republican Richard Tisei, a former state senator who narrowly lost to Tierney in 2012.
Michael Levenson can be reached at [email protected]. Follow him on Twitter @mlevenson.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
In The Media
Justin Trudeau May Soon Drop a Bomb on the F-35
Fresh off his ascent in the Canadian elections, Prime Minister-designate Justin Trudeau is grounding planes. The day after defeating Stephen Harper, Trudeau informed President Obama that Canada will withdraw its six fighter jets from the coalition bombing the self-proclaimed Islamic State (IS) in Iraq and Syria. "He understands the commitment I've made around ending the combat mission," Trudeau told reporters, invoking a campaign pledge to shift Canadian involvement from air strikes to training anti-IS forces and delivering humanitarian aid.
Trudeau didn't offer a timeline, but he may soon redial the White House for yet another pullout. The Liberal leader has vowed to abandon the troubled multi-billion dollar purchase of 65 F-35A stealth fighters from Lockheed Martin. The F-35 has been developed under a nine-nation, Pentagon-run initiative sharing the jet's $1.5 trillion USD cost (counting everything from development through the 55 year projected life of the planes in the fleet), making it the most expensive military acquisition in history.
Canada's exit would end an involvement plagued from the start. Without holding an open competition, the cabinet of outgoing prime minister Stephen Harper signed on to the F-35 program in 2010 to replace an aging fleet of 1980s-era CF-18s. After investing hundreds of millions of taxpayer dollars, the government was forced to freeze the project in 2012 when an audit found officials had mismanaged the project and hid its true costs.
While the public was told the F-35 purchase would amount to around $9 billion, estimates say the actual price tag could reach as high as $49 billion over the deal's four decades. The controversy has piled on as experts issued scathing assessments of the plane's functionality.
"The F-35 is double-inferior," an analysis by the RAND Corporation (a US think tank with strong military ties) concluded, "[It] can't turn, can't climb, can't run." Pierre Sprey, revered designer of the F-16 fighter jet, was even more blunt. "It's not good at anything — it's a turkey," Sprey told the CBC in 2012. The F-35's "real mission," he explained, was "for the US Congress to send money to Lockheed." A mock airfight earlier this year saw the 1970s-era F-16 come out on top, leading one test pilot to complain that the F-35 suffered from "a distinct energy disadvantage for every engagement." Lockheed has pushed back on the staged air battle, saying its plane wasn't fully equipped.
Against this backdrop, canceling the F-35 deal became a cornerstone of the Liberals' campaign. Calling the jet purchase a "nightmare," Trudeau promised voters he'd scrap it and pick a cheaper alternative. "It's a stealth fighter that will cost tens of billions more than what Harper promised, a stealth fighter jet that can't defend our Arctic, a stealth fighter that's not actually stealth," Trudeau declared. "A new Liberal government won't buy the overpriced F-35."
With the Liberal leader now set to take office, that position, more than extricating Canada from the fight against IS, is causing the most waves.
"That's to their detriment because it's the most important fighter plane ever built," fumed Republican Senator Orrin Hatch of Utah. "They have the right to do whatever they want to, but it's stupid."
"Trudeau hasn't left himself any outs," a US industry source warned Reuters. "His statements were very categorical."
Despite its detractors, the US and Lockheed are sticking by their project, calling it the most effective and agile fighter jet in history. "The F-35 is comparable or better in every [metric], sometimes by a significant margin," Lockheed says. A US Government Accountability Office review found "considerable progress" in the F-35's development, which it said is "now moving in the right direction." Defenders also say the F-35's projected costs have been overblown, and that alternatives like the Boeing F/A-18E Super Hornet won't be much cheaper, if at all.
While Canada will lose the development money it's spent on the F-35, it apparently won't incur additional penalties for pulling out. But there could be other consequences. Lockheed could lose up to $6 billion, and the firm has suggested potential repercussions for Canadian contractors.
"If the Canadian government were to decide not to select the F-35, we will certainly honor the contracts that we have here with the Canadian industry," a Lockheed exec said in 2013. "But our approach in the future would be to try to do business with the industries that are in the countries that are buying the airplane." Harper echoed that warning during the campaign, claiming that Trudeau's pledge would mean "cratering our aerospace industry." Canadian firms have estimated they stand to lose up to $8 billion over the deal's lifespan.
Others involved in the program have played down those concerns. "I don't see any reason why [Canadian suppliers] would not continue to be part of the team whether Canada [purchases aircraft] or not," Frank Kendall, the Pentagon's top weapons buyer, said last month. Alan Williams, the military official who presided over Canada's entry into the F-35 deal, has also said Canadian firms will emerge unscathed.
For the remaining nations partnering to buy the F-35, Canada's exit means one less party to split the bill. On Wednesday, the Pentagon said Trudeau's move will raise the United States' per-plane cost by $1 million, or more than $1.7 billion overall. That's a fair sum on its own, but a relative drop in the docket compared to the $400 billion Washington has already spent.
If he follows through, Trudeau will make Canada the first nation to ground both the anti-IS bombing mission and the F-35 procurement program. Taken together, experts say the moves portend a new foreign policy direction for a post-Harper Canada.
In ditching the F-35, Canada will not only forfeit any stealth capability for the foreseeable future, but it "may also be dumping any hope of operating over battlefields protected by sophisticated surface-to-air missiles and long-range radars," the military industry news site Defense One notes. The Liberal Party platform affirms that, saying: "The primary mission of our fighter aircraft should remain the defense of North America, not stealth first-strike capability."
"It reflects a shift from war fighting (and participation in 'coalitions of the willing') to sovereignty protection," McGill political scientist Rex Brynen told VICE News. "It is early days yet, and political realities have a way of modifying electoral campaign positions. However, there is no doubt that the Liberals will adopt a far less bellicose public posture."
Others say the shift will only go so far. Yves Engler, author of several books on Ottawa's foreign relations, says Trudeau won't end Canadian militarism abroad, just scale it back. "Washington presumably won't like Canada's withdrawal [from the anti-IS coalition], but the question becomes whether they make some kind of side deal for enhanced Canadian participation," Engler says. "Special Forces operations — which Trudeau is not calling for the removal of — could increase as part of a backdoor deal. The Liberals have a tendency to not participate in the high-profile politically controversial missions, but then provide other forms of military support."
David Perry, a Senior Analyst with the Canadian Global Affairs Institute, points out that Trudeau will increase Canada's small training mission in Iraq. "Depending on the nature of the training mission enhancement, that could be a very significant, leadership role [for Canada]," Perry says. Instead of withdrawing the current force of around 600 Canadian soldiers, there "could simply be a shift in emphasis."
"Canada is, has been, and will continue to be, deeply connected with its allies in the security realm," says Jeremy Littlewood of Carleton University's Norman Paterson School of International Affairs. "This represents a change in Canada's contribution, not a seismic shift in Canada's commitment to work with allies in countering terrorism."
For Trinity College professor and Middle East scholar Vijay Prashad, Canada's exit from the anti-IS bombing highlights the precarious state of the US-backed coalition.
"The alliance has been ineffective strategically in its war on IS," Prashad says. "Canada's withdrawal will not impact the bombing as such, because it did not play a major role. But Canada did provide the sense of an alliance. Will this be taken as evidence of a weak coalition? It was already weak — it merely proves the obvious."
On today's Global Exchange Podcast, CGAI Vice President Colin Robertson sits down with CGAI Fellow Sarah Goldfeder and CGAI Advisory Council Member Laura Dawson to discuss last week's midterm election in the United States. Join Colin, Laura, and Sarah as they debate the implications of the 2018 U.S. midterm on the agenda of Donald Trump, the effect a Democratic House of Representatives will have on Canada, as well as what the election means for bilateral relations moving forward.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
You are at:
Iran's Rouhani sworn in for second term as tensions simmer over nuclear deal
Iran's Rouhani sworn in for second term as tensions simmer over nuclear deal
Before the ceremony, Rouhani met with EU foreign policy chief Federica Mogherini and called for greater efforts to safeguard the 2015 nuclear deal between Tehran and world powers in the face of new US sanctions.
Iran's President Hassan Rouhani has inaugurated for a second term. Rouhani warned the US against tearing up the nuclear deal. He is also facing challenges closer to home amid accusations he is rolling over to conservatives.
Before the ceremony, Rouhani met with EU foreign policy chief Federica Mogherini and called for greater efforts to safeguard the 2015 nuclear deal between Tehran and world powers in the face of new US sanctions.
"Iran will not be the first to violate the nuclear deal... but nor will it stay silent when the US fails to respect its commitments," he told the packed parliament hall."Iran has proved that it will respond to respect with respect, and to sanctions and threats with an appropriate response and with resistance," he added.
Zimbabwean President Robert Mugabe also attended the ceremony which came two days after Rouhani was officially sworn in by supreme leader Ayatollah Ali Khamenei.The emir of Qatar, which has fallen out with its Gulf allies in part over ties to Iran, was notably absent, despite attending Rouhani's last inauguration in 2013.
But among Iranians, the real attention was on who would be named to Rouhani's new cabinet.He has already been barraged with criticism over indications that women would again be entirely absent and that this reformist allies would barely be represented.
Rouhani's last government had three women among a large cohort of vice-presidents, but they lacked ministerial rolesthat would require approval by parliament.
"It was the reformists that allowed him to win the elections in 2013 and 2017... he must listen to those who supported him," Rassoul Montajabnia of the reformist National Confidence party told the Arman newspaper.Rouhani won a convincing victory over hardline cleric Ebrahim Raisi in the May presidential election, vowing to continue rebuilding ties with the West and easing social restrictions at home.That helped win over the reformists -- whose candidates dropped out of the last two elections to ensure his victory.
"Rouhani created a lot of expectation and now there is a sense that he is retreating from his promises," said AliShakourirad, head of the reformist People's Unity Party.The absence of women was down to pressure from religious conservatives behind the scenes, Shakourirad said."Rouhani didn't want to make his task any more complicated than it already is," he told AFP.
The final line-up is due to be announced in coming days, and must then be approved by parliament.Despite the furore, the reshuffle is not expected to touch big names such as Foreign Minister Mohammad Javad Zarif and Oil Minister Bijan Namdar Zanganeh."The main ministers are very likely to stay in place," said Henry Smith, Iran analyst with consultancy Control Risks.
"Rouhani will have a fairly smooth time getting parliament to approve his appointees. He's been doing back and forth consultations with the necessary power centres -- the parliament speaker, supreme leader, the Revolutionary Guards-- and I don't think you'll see a significant change in economic or indeed the social policy," he added.
Despite his efforts to build backroom consensus, hardliners have given Rouhani a rough ride since his election, perhaps worried at the growing strength of the reformists.The arrest of his brother on corruption charges was interpreted by some as a shot across the bow by the hardline judiciary.
Rouhani also triggered a war of words with the Revolutionary Guards after criticising their outsized role in the economy, although analysts say this is part of a cautious realignment of Iran's policies to balance its security priorities with the need to attract investment.
"Rouhani has no interest in pushing the Revolutionary Guards totally out of the economy. It's about creating enough space so Iran can get the foreign investment and technology it needs," said Smith.Investment has belatedly started to arrive in the wake of the 2015 nuclear deal that eased sanctions in exchange for curbs on Iran's nuclear programme, notably through last month's billion-dollar gas deal with France's Total and China's CNPC.Billions more are needed to jump-start the stagnant economy and tackle a jobless rate of 12.7 per cent.
But with Washington imposing yet more sanctions this week, Iran's re-engagement with the world remains largely stalled."The problem is Iran feels the need to react to these moves by the US, which just gives the US fuel," said Smith.Mogherini held a meeting ahead of the inauguration with Zarif, who criticised European governments for their support of US calls for UN action in response to an Iranian satellite launch on July 27."This is the wrong path," Zarif said.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Under the terms of the Higher Education Act and other Federal legislation providing funding assistance to postsecondary education, an institution or program is eligible to apply for participation in certain Federal programs if, in addition to meeting other statutory requirements, it is accredited by a nationally recognized accrediting agency or if it is an institution or program with respect to which the U.S. Secretary
of Education has determined that there is satisfactory assurance the institution or program will meet the accreditation standards of such an agency or association within a reasonable time. An institution of program may establish satisfactory assurance of accreditation by acquiring preaccreditation status with a nationally recognized agency that has been recognized by the U.S. Secretary of Education for the award of such status. According to the Criteria for Nationally Recognized Accrediting Agencies, if an accrediting agency has developed a preaccreditation status, it must demonstrate that it applies criteria and follows procedures that are appropriately related to those used to award accreditation status. The criteria for recognition also require an agency's standards for preaccreditation to permit an institution or program to hold preaccreditation no more than five years.
The following is a list of accrediting agencies recognized for their preaccreditation categories and the categories that are recognized:
Regional Institutional Accrediting Agencies
MIDDLE STATES COMMISSION ON HIGHER EDUCATION: Candidate for Accreditation
NEW ENGLAND ASSOCIATION OF SCHOOLS AND COLLEGES: Commission on Institution of Higher Education : Candidate for Accreditation
NORTH CENTRAL ASSOCIATION OF COLLEGES AND SCHOOLS-- The Higher Commission: Candidate for Accreditation
NORTHWEST COMMISSION ON COLLEGES AND UNIVERSITIES: Candidate for Accreditation
SOUTHERN ASSOCIATION OF COLLEGES AND SCHOOLS-- Commission on Colleges: Candidate for Accreditation
WESTERN ASSOCIATION OF SCHOOLS AND COLLEGES-- Accrediting Commission for Community and Junior Colleges: Candidate for Accreditation Accrediting Commission for Senior Colleges and Universities: Candidate for Accreditation
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How do I get the "old value" from a ReactiveCocoa signal?
If I'm using RACable like this:
[RACAbleWithStart(self.myProp) subscribeNext:^(id x) {
// Do stuff
}];
How can can I access the old value of myProp (before the change the caused the signal to fire)? So I can access it like this:
[RACAbleWithStart(self.myProp) subscribeNext:^(id x) {
// Do stuff
id newValue = x;
id oldValue = RAC_oldValue;
}];
A:
I have used this snippet with success:
[[object rac_valuesAndChangesForKeyPath:@"property" options:NSKeyValueObservingOptionOld observer:self] subscribeNext:^(RACTuple *tuple) {
id newObject = tuple.first;
NSDictionary *change = tuple.second;
id oldObject = change[NSKeyValueChangeOldKey];
}];
Source: ReactiveCocoa documentation
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Thermoelectric Detection of Multi-Subband Density of States in Semiconducting and Metallic Single-Walled Carbon Nanotubes.
Thermoelectric detection of a multi-subband density of states in semiconducting and metallic single-walled carbon nanotubes is demonstrated by scanning the Fermi energy from electron-doped to hole-doped regions. The Fermi energy is systematically controlled by utilizing the strong electric field induced in electric-double-layer transistor configurations, resulting in the optimization of the thermoelectric power factor.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Diffuse optical imaging techniques are known in medical and biological applications. Overviews of diffuse optical imaging techniques can be found in “Recent Advances in Diffusion Optical Imaging” by Gibson, et al, Phys. Med. Biology, vol. 50 (2005), R1-R43and in “Near-infrared Diffuse Optical Tomography,” by Hielscher, et al, Disease Markers, Vol. 18 (2002), 313-337. Briefly, diffuse optical imaging involves the use of near-infrared light incident upon a sample of interest. An example in the medical and biological field is optical mammography where near infrared light is used to illuminate breast tissue. A detector is placed on the opposite side of the breast from the incident light some distance away and collects scattered light from the breast tissue. The scattered light of interest that is detected may be directly scattered incident light or scattered fluorescence light caused by the excitation of an injected fluorescing material that fluoresces when exposed to the incident light. By measuring the amplitude of the light of interest at the detector and the distribution of photon arrival times at the detector for various source and detector positions, a reconstruction of the underlying tissue optical properties can be made. An overview of image reconstruction techniques can be found in the citations given in the aforementioned review articles.
Measurements of the photon flight-time distributions are typically carried out using either the time-domain or the frequency-domain technique. In the time-domain technique, the sample is excited with a pulse of light from a pulsed laser and the scattered light is measured using a detector with single-photon sensitivity. The detector measures the time delay between the excitation pulse and the first detected photon. The flight-time distribution is determined by using many repeated pulses and building up a histogram of the measured time delays. Unfortunately, the pulsed laser sources and single-photon detectors are relatively expensive. Because detection is typically done at the single-photon level, it can require a significant amount of time to build-up enough data to approximate the flight-time distribution. One disadvantage of the frequency-domain approach is that it is not a direct measurement of the photon flight time. Rather, it provides an estimate of the mean flight time based on the phase shift between a detected signal and the excitation signal. In some cases, more accurate image reconstructions can be obtained using more complete measurements of the flight-time distributions. This data is not readily obtained with frequency-domain instrumentation. A further disadvantage of the frequency-domain approach is the need for accurate high-frequency analog electronics. An overview of both the time-domain and frequency-domain techniques can be found in the above-referenced article by Hielscher, et al.
U.S. Pat. No. 5,565,982 discloses a time-resolved spectroscopy system using digital processing techniques and two low power, continuous wave light sources. The disclosed system requires two light transmitters of different wavelengths modulated with separate codes for interrogating a sample of interest. Properties of the sample are inferred by differential comparison of the return signals from each of the two light sources. It is undesirable to have two distinct light sources due to the cost and complexity involved. Furthermore, the noise level associated with a measurement made with two separate light sources will be higher than with a single source even if the codes used to drive the two sources are orthogonal.
A system and method capable of addressing these disadvantages while providing acceptable temporal information for whatever application the photon measurement is being used is needed.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Colicinogenic mutant of ColE1 plasmid that fails to confer immunity to colicin E1.
Insertion of the ampicillin transposon (Tn3) into ColE1 DNAs causes various mutations in the plasmids. Escherichia coli K-12 cells carrying one of these mutants showed novel properties; they were sensitive to colicin E1 and were able to produce active colicin E1. The site and the orientation of Tn3 insertion in this mutant ColE1 DNA were determined by heteroduplex analysis and by enzymatic digestion with restriction endonucleases. The potential usefulness of this mutant ColE1 DNA as a cloning vehicle is discussed.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Monday, 20 April 2009
Just another depressing post
One of my friends said recently that she was embarked on a course of self-destruction. We didn't discuss it at the time, but I can empathise with that.
For me, it's a relationship thing. I really can't handle them.
I'm either incredibly immature (almost certainly) and/or just incapable of handling a nice relationship (equally almost certainly).
I can never believe that something will last - if it feels nice it must be too good to be true - and I'm always waiting for the bitter and inevitable end. And maybe that's why I feel like rushing it along, hastening the end, to get past the bad bit and move on.
Or I'm not sure whether I feel exposed when I share part of myself with people, and want to rush back into my shell, just venturing out on the odd occasional foray. Or whether I am like a stray dog, wanting to take the scraps offered but frightened that the hand that feeds me will hurt - so I bite it instead.
Maybe I can't handle all-round perfect nice people. They seem to bring out the worst in me. I like people to have faults. And be real.
Or perhaps I don't trust people. They usually let you down in the end.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
George Clooney visits volatile Sudan region
Actor and human rights activist George Clooney made a quiet visit to a
volatile border region between Sudan and South Sudan last week ahead of a
testimony he will be giving before a US Senate committee on Wednesday.
George Clooney addresses the Council on Foreign Relations regarding to the situation in Southern Sudan in New YorkPhoto: DON EMMERT/AFP/Getty Images
Clooney made the dangerous crossing from South Sudan into Sudan's Nuba Mountains region, Jonathan Hutson, a spokesman for the anti-genocide group the Enough Project, said Tuesday.
Clooney saw burned-out villages and met with residents forced to seek shelter in caves because of aerial attacks by Sudan's military.
Violence has flared along the Sudan-South Sudan border since South Sudan seceded last year, and some experts worry the conflict could grow. South Sudan shut down its oil industry this year after accusing Sudan of stealing its oil.
Wednesday's hearing before the Senate Foreign Relations Committee will examine the oil dispute and the limited access aid groups are being given to Sudan's southern regions. Aid experts say people who live in Sudan's Nuba Mountains will soon face a hunger crisis because they haven't been able to plant crops amid fear of attacks from Sudan.
Clooney travelled to what is now known as South Sudan in January 2011 as the region cast votes to secede from Sudan. The vote was the culmination of a peace deal that ended more than two decades of civil war.
After that visit, Clooney helped found the Satellite Sentinel Project, which uses satellite imagery to track military movements and attacks in the hopes of bringing attention to and potentially heading off hostilities.
On his most recent visit Clooney, met South Sudan President Salva Kiir and the country's defense minister.
John Prendergast, the co-founder of the advocacy group the Enough Project, also travelled to South Sudan last week. Prendergast and Princeton Lyman, the US envoy to Sudan and South Sudan, are also scheduled to speak at Wednesday's Senate hearing.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Strachan must concentrate on Scotland team as whole says Willie Miller
Former Scotland defender Willie Miller insists Gordon Strachan should concentrate on trying to extract the best from his squad as a whole, instead of yearning for a superstar who could help end the country’s long wait to reach a major finals.
During the recent friendlies, lost to Italy and France respectively, Strachan lamented not having a player such as Sweden talisman Zlatan Ibrahimovic or Wales’ Gareth Bale, saying: “It’s not about teams, we have to produce individual players.”
However, Miller, who represented Scotland at the 1982 and 1986 World Cup finals, believes his former Aberdeen and national team colleague needs to focus all his energy on what he has got at his disposal.
“He’s not going to get one, is he?” said Miller, in reference to Strachan’s comments. “I’m sure Gordon, in his own way, would say he’s not going to get one. I can’t see any on the horizon. So, unless Gordon knows better than I do, he’s not going to get that. So he’s a manager who needs a complete team performance – and a team performing at a high level in every game. I think that’s what he’s got to concentrate on, rather than wishing he could have a Gareth Bale, a Thomas Muller or Robert Lewandowski.”
Asked if Scotland, who finished fourth in their Euro 2016 qualifying section, can progress from a World Cup qualifying group which includes England, Slovakia, Slovenia, Lithuania and Malta to reach Russia, Miller said: “I think it’s a tough group.
“Are we going to top that group? The likelihood is no. Are we good enough to finish second? We’ve got a chance. But we’re going to have to put the best team together and they’ll have to play at their best.
“They’re going to have to play the way they did in the first half of the Euro qualifying campaign.
“Not the second half, when we didn’t match those performances – and that’s why we didn’t qualify, ultimately, though it was the Georgia result [a 1-0 defeat in Tbilisi] that really set us back.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The peptidoglycan biosynthesis genes MurA and MraY are related to chloroplast division in the moss Physcomitrella patens.
In the moss Physcomitrella patens, 10 Mur genes involved in peptidoglycan biosynthesis were found, and the MurE and Pbp genes are related to plastid division. Although the MraY and MurG genes were missing in our previous expressed sequence tag screening, they were discovered in the P. patens genome in this study, indicating that P. patens has a full set of genes capable of synthesizing peptidoglycan. In addition, a second MurA gene (PpMurA2) was found. Whereas Northern analyses indicated that PpMurA1, PpMurG and PpMraY were expressed, transcripts of PpMurA2 were detected only when RT-PCR was employed. Whereas GFP fusion proteins with either PpMurA1 or PpMraY were detected in chloroplasts, the PpMurA2 fusion proteins were located in the cytoplasm. Protonema cells in the wild-type plants had an average of 46 chloroplasts. PpMurA1 gene-disrupted lines had <10 chloroplasts, whereas approximately 30 chloroplasts existed in the PpMurA2 knockout lines. The PpMurA1/A2 double-knockout lines had only a few macrochloroplasts, suggesting a redundant function for these two genes. Disruption of the PpMraY gene in P. patens resulted in the appearance of macrochloroplasts. Anabaena MraY fused to the N-terminal region of PpMraY and A. thaliana MraY could complement the macrochloroplast phenotype in the PpMraY knockout line. Electron microscopic observations showed no obvious differences in the shape or stacking of thylakoid membranes between all knockout transformants and wild-type plants, suggesting that these Mur genes are related only to plastid division in moss.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Flights were delayed and even cancelled at Billy Bishop Toronto City Airport on Sunday due to a flight planning system interruption.
“Everything is operating normally as of now,” said Porter Airlines spokesperson Brad Cicero.
Cicero confirmed there were some delays and cancellations and that it is “best for passengers to check our website about information related to specific flights.
One traveller said her flight was supposed to leave at 8 a.m. for Newark, New Jersey but she has been waiting for over two hours at the airport.
@CityAlanna @CityNews was supposed to leave at 8am for Newark, NJ – so I've been here in the lounge waiting for about 2.5 hours — Jenn (@JennAndTheCity) November 6, 2016
You can visit the website here.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Is Big Data the Next Billion-Dollar Technology Industry? - SuperChihuahua
http://www.financialsense.com/contributors/doug-hornig/is-big-data-the-next-billion-dollar-technology-industry
======
edhallen
This article gets a few things right, but I find it largely to be another
example of playing up the hype without talking about the real meat of big
data's potential.
Some of the more useful points: 1.) Big data's promise has led to massive
advances in technology, and companies are spending billions on this new
technology 2.) The limiting factor with Big Data is analytical in nature, not
necessarily in storage, processor speed, etc.
What this article fails to address is why big data is so valuable. While it
gave one example of a real use case (identifying influencers in social
networks), if anything this served to highlight the problem with Big Data. Are
companies completely shifting their marketing budgets to target influencers?
Is this driving major financial impact for Facebook?
I have no doubt that companies are actively identifying incredibly powerful
new uses of big data, but for big data to be truly revolutionary, we need to
develop the analytic methodologies and decision-making processes to benefit.
Reading the McKinsey report cited in the article is illuminating. There's a
ton of value cited, but it isn't particularly clear how companies changed
their decisions based on big data in a way that drove the value.
(I posted more thoughts on this broken link between big data articles and
actual decision-making here: [http://www.klaviyo.com/blog/2012/07/16/the-
curse-analytics-b...](http://www.klaviyo.com/blog/2012/07/16/the-curse-
analytics-big-data-hype/))
------
Animus7
buzzword buzzword unqualified huge number superlative google microsoft! big
data! $X billion buzzword buzzword random powerpoint diagram.
And on top of that, the entire article ends up being a plug for a conference.
I have no idea who's upvoting this or why.
------
hastur
If I hear the "big data" buzzword one more time, I'm going to throw up.
~~~
rhizome
Wherever you see it, just mentally replace it with "data warehouse." ;)
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Coen brothers' 2000 film O Brother, Where Art Thou? presents an intriguing and unusual case for the question of whether historical accuracy is important in films that use classical antiquity as a direct setting or indirect reference point. With key elements of the film based on Homer's Odyssey, O Brother is set in the American south during the Great Depression. Those familiar with the often whimsical style of the Coen brothers probably did not know what, if any, connection this effort would have to either historical period. However, lovers of Homer have noted many clever allusions to the adventures of Odysseus in the O Brother, while those interested in the myth of a charming Old South appeared pleased at how the film nostalgically presented 1930s southern culture.
Classical Allusions
Homer's Odysseus becomes Ulysses Everett McGiIl (George Clooney) in the Coens' reimagining of the epic Greek story. Though he is also a man who prizes his intellect as a mechanism for making his way back home, Everett soon discloses a shallow obtuseness beneath his clever and fast-talking rhetoric. Still, like Odysseus, Everett longs to get back to his beloved wife Penelope, a.k.a. Penny (Holly Hunter), who is being courted by a suitor. Unlike her ancient counterpart, Penny is not exactly the faithful wife; she divorces Everett in his absence to pursue a more profitable match. And even when the couple is reunited at the end, the last scene depicts Penny nagging her ever-apologizing husband, who is followed by seven daughters rather than one son.
Homer's blind prophet Tiresias is central in the Coens' version, too, though now he appears as an old black man (Lee Weaver) who says he works for "no man" and has "no name" (echoing Odysseus' famous lines). In riddles, this blind seer warns Everett and his companions (Pete played by John Turturro and Delmar played by Tim Blake Nelson) of the perils of the journey but predicts a successful homecoming. In O Brother, the Cyclops takes the guise of John Goodman's conniving, one-eyed bible salesman, who examples an on-going religious subtext (again similar but quite different from Homer). The Sirens now appear as seductive songstresses in wet dresses (played by Mia Tate, Musetta Vander, and Christy Taylor), also filling Circe's role as beautiful witch by supposedly turning Pete into a toad (and they even recall the role of Nausicaa and her maids with their clothes-washing). But Ulysses Everett McGiIl, unlike the ancient Odysseus, has no defense against any of their feminine wiles. Along with his companions, Everett gets "liquored up" and intends "to fornicate" because he does not have the good sense to see that the Sirens plan to tum the men over to the law for the reward money.
More subtle references to Homer's story include: the hero's journey to the underworld, which has become the fire and brimstone meeting of the KKK; the conversion of the Lotus Eaters into the glassy-eyed crowd waiting to be dunked in the river for baptism; the saving of Odysseus from the watery deep, mirrored in Everett emerging from the floods of the Tennessee Valley Authority; the transformation of Poseidon into Sheriff Cooley (Daniel Von Bargen), who also represents an unrelenting and blind revenge (note the sunglasses). And just as Poseidon ignores Zeus' decree that Odysseus shall return home, the trooper also does not care about anyone else's authority - in this case the indifference concerns the governor's pardon at the end. The modern Ulysses also returns home in disguise, through a fake beard and blackface in the film, making Everett appear to be a down-and-out, old hillbilly like the beggar Odysseus. Once again there is a showdown among opposing forces at a banquet. The ancestral home is threatened but still intact, at least long enough to yield an object that gives legitimacy to Ulysses' relationship with his wife (the tree-bed in Homer vs. the ring in the film).
The hero is saved in both cases by a deus ex machina; fate plays a prominent role in both stories -all is "foreordained," as Everett claims. …
The rest of this article is only available to active members of Questia
Print this page
While we understand printed pages are helpful to our users, this limitation is necessary
to help protect our publishers' copyrighted material and prevent its unlawful distribution.
We are sorry for any inconvenience.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Filed 12/19/13 P. v. Virden CA2/4
NOT TO BE PUBLISHED IN THE OFFICIAL REPORTS
California Rules of Court, rule 8.1115(a), prohibits courts and parties from citing or relying on opinions not certified for
publication or ordered published, except as specified by rule 8.1115(b). This opinion has not been certified for publication
or ordered published for purposes of rule 8.1115.
IN THE COURT OF APPEAL OF THE STATE OF CALIFORNIA
SECOND APPELLATE DISTRICT
DIVISION FOUR
THE PEOPLE, B245435
Plaintiff and Respondent, (Los Angeles County
Super. Ct. No. KA096392)
v.
BRIAN VIRDEN,
Defendant and Appellant.
APPEAL from a judgment of the Superior Court of Los Angeles County,
Bruce F. Marrs, Judge. Affirmed.
Bernstein Law Office, Inc., Nathaniel Clark and Bob Bernstein for
Defendant and Appellant.
Kamala D. Harris, Attorney General, Dane R. Gillette, Chief Assistant
Attorney General, Lance E. Winters, Assistant Attorney General, Victoria B.
Wilson and Jonathan J. Kline, Deputy Attorneys General, for Plaintiff and
Respondent.
Defendant Brian Virden was charged with various sex offenses against three
cousins, Ryan D., Julian D., and Amanda D. The alleged victims were adults at the
time of trial, and the crimes occurred years earlier when they were children. The
jury acquitted defendant of all charges concerning Amanda D.1 It convicted him of
committing sexual battery upon Julian (§ 243.4, subd. (a)) and of committing a
forcible lewd act upon Ryan (§ 288, subd. (b)(1).) The trial court later vacated the
sexual battery conviction on the ground that it violated the statute of limitations,
leaving only the conviction of committing a forcible lewd act on Ryan. On that
count, the court sentenced defendant to six years in state prison and ordered that he
register as a sex offender. He appeals from the judgment of conviction. We
affirm.
BACKGROUND
Because this appeal concerns only the conviction of committing a forcible
lewd act on Ryan, we summarize only the evidence relevant to that count, and
reserve for our discussion of defendant’s contentions any mention of other
evidence that might be relevant.
Prosecution Evidence
Ryan was 20 years old at the time of trial. Defendant is Ryan’s cousin and
was 30 years old at the time of trial.2 3
1
All undesignated section references are to the Penal Code. The Amanda D.
charges of which defendant was acquitted were: forcible lewd act upon a child (§ 288,
subd. (b)(1)), two counts of oral copulation of a person under 14 (§ 288a, subd. (c)), two
counts of sexual penetration by a foreign object upon a child (§ 289, subd. (j)),
kidnapping to commit oral copulation or lewd act (§ 209, subd. (b)(1)), and two counts of
lewd act upon a child (§ 288, subd. (a)).
2
Defendant was born in January 1982. The trial was in August 2012.
2
According to Ryan, when he was approximately three to five years old, he
was in the living room of his house watching television with defendant. Both of
them were lying on the floor. Defendant “kind of like grabbed [Ryan’s] hand and
guided it into [defendant’s] pants until [Ryan] felt his penis.” Defendant’s pants
were up; he was not exposed. Ryan could not remember if defendant “spoke or if
he was like instructing . . . nonverbally, but he indicated that he wanted [Ryan] to
masturbate him or like he kind of pantomimed it.” Defendant “made [Ryan] like
stroke up and down or . . . just kind of indicating [he] should do that so [Ryan]
followed his direction.” Ryan felt a kind of throb, and then defendant guided
Ryan’s hand back out of his pants. Ryan and defendant never talked about the
incident afterward.
Perhaps that same day, defendant asked Ryan how big his penis was. Ryan
was confused by the question. Later, in Ryan’s room, defendant pulled his penis
out and played with it like a puppet.
Although he was always aware that the masturbation incident had happened,
Ryan never told anyone. Not until he was 17 did he come to admit that defendant
had abused him. For months thereafter he had flashbacks. In a paper he wrote in
high school for a religious retreat in 2010, he mentioned the incident. He meant to
keep it from his parents, but his mother found the paper and read it. Nonetheless,
respecting his wishes, his parents did not call the police.
Defense Evidence
3
Ryan testified that defendant was approximately 11 years older than he. However,
given that Ryan was 20 at the time of trial, and that defendant was 30, it appears that
defendant was 10 years older.
3
Defendant denied that he ever touched Ryan inappropriately.4 Defendant
called Lee Coleman, a pediatrician and psychiatrist who has studied the subject of
false accusations of child sexual abuse. As here relevant, Dr. Coleman testified
that in the paper Ryan wrote in high school for a religious retreat in 2010, he
seemed to be discovering “new memories.” The paper contained “a lot of red
flags” suggesting that the memories were not of actual events. Ryan’s description
of his realization process was consistent with so-called “recovered memory,” a
discredited theory. It was extremely unlikely that an 18 year old would have much
memory of events that occurred at the age of three or four years old.
DISCUSSION
I. Sufficiency of the Evidence and Alleged Misconduct Regarding the Use of
Force
Defendant contends that the evidence is insufficient to prove that he used
“force” within the meaning of section 288, subdivision (b)(1), in the incident in
which he made Ryan masturbate him. For purposes of section 288, subdivision
(b)(1), “force” means physical force that is “‘substantially different from or
substantially greater than that necessary to accomplish the lewd act itself.’”
(People v. Soto (2011) 51 Cal.4th 229, 242; accord, People v. Griffin (2004) 33
Cal.4th 1015, 1027.) It has been held that a defendant’s holding the victim’s hands
on his genitals to manually stimulate himself is sufficient to show a use of force.
(People v. Babcock (1993) 14 Cal.App.4th 383, 386-388 (Babcock) [defendant
grabbed victims’ hands and forced them to touch his genitals, overcoming attempt
to pull away]; People v. Pitmon (1985) 170 Cal.App.3d 38, 48 (Pitmon) [defendant
4
He also denied the other charges against him.
4
grabbed victim’s hand, placed it on his genitals, and rubbed himself with the
victim’s hand].) As stated in People v. Alvarez (2009) 178 Cal.App.4th 999,
1005, “[T]he force requirement will be deemed satisfied when the defendant uses
any force that is ‘different from and in excess of the type of force which is used in
accomplishing similar lewd acts with a victim’s consent.’ [Citation.] [¶]
According to the majority of courts, this includes acts of grabbing, holding and
restraining that occur in conjunction with the lewd acts themselves.”
Here, viewing the evidence in the light most favorable to the judgment
(People v. Ochoa (1993) 6 Cal.4th 1199, 1206), the evidence shows that defendant,
in Ryan’s words, “kind of like grabbed [Ryan’s] hand and guided it into
[defendant’s] pants until [Ryan] felt his penis.” Ryan could not remember if
defendant “spoke or if he was like instructing . . . nonverbally, but he indicated that
he wanted [Ryan] to masturbate him or like he kind of pantomimed it.” Defendant
“made [Ryan] like stroke up and down or . . . just kind of indicat[ed] [he] should
do that so [Ryan] followed his direction.” Ryan felt a kind of throb, and then
defendant guided Ryan’s hand back out of his pants. Ryan was only three to five
years old at the time.
As in Babcock and Pitmon, supra, this evidence was sufficient to prove the
use of force substantially different from or greater than that necessary to commit a
similar lewd act on a consenting victim. Defendant “kind of like grabbed” Ryan’s
hand, inserted it under defendant’s pants, and led it to his erect penis. He then, by
instruction or pantomime, made Ryan stroke his penis. When finished, he guided
Ryan’s hand out of his pants. The act of willfully causing Ryan to touch
defendant’s penis with the intent to arouse defendant’s sexual passions, if
committed on a consenting victim, does not require the grabbing of the hand,
forcing it to touch the penis, convincing by word or example to perform
5
masturbation, and then, following climax, forcing the hand out of the pants. Such
conduct, viewed in the light most favorable to the judgment, thus constitutes force
substantially different from or greater than the force necessary to commit the lewd
act.
Defendant contends that the prosecutor committed misconduct in explaining
the requirement of force. The contention is forfeited by defendant’s failure to
object at trial. (People v. Morales (2001) 25 Cal.4th 34, 43-44.) In any event,
there was no misconduct. The prosecutor argued: “Force doesn’t mean that he has
to grab them, that he has to hit them or strike them. It’s just an application of force
beyond what’s necessary. So for Ryan and Amanda [the alleged victim in the
counts of which defendant was acquitted], it’s when he takes their hand and puts it
on his on his own penis. For Amanda, it’s sticking his penis in her mouth and
holding her head and her neck and moving it. It’s lying her down, picking her up.
That’s the force. It’s holding their hand on his penis and moving it up and down.”
This passage is a correct statement of the law, and an appropriate argument on
whether the evidence proved the element of force.
Defendant contends that Ryan’s testimony was too vague to constitute
substantial evidence. We disagree. As discussed, the evidence was sufficient to
support the conviction.
II. Misconduct in Argument Regarding Dr. Coleman’s Testimony
Defendant contends that the prosecutor committed misconduct in closing
argument by stating that portions of Dr. Coleman’s testimony supported the notion
that it is common for sexually abused children not to show symptoms and not to
tell what has happened for fear of getting someone they love in trouble. Defendant
forfeited the claim by failing to object at trial. (People v. Brady (2010) 50 Cal.4th
6
547, 583.) In any event, the prosecutor’s argument was within the broad latitude
counsel is granted in argument to urge inferences and conclusions from the
evidence. (People v. Valdez (2004) 32 Cal.4th 73, 133-134.)
As relevant to defendant’s contention, Dr. Coleman testified as follows: that
“the vast majority” of victims in his cases did not claim abuse until years later; that
although he did not “know how common” it was for children not to report abuse
immediately, “what we can say is don’t be surprised, don’t let it in any way take
away the possible belief that it happened just because some time has gone by”; that
“[w]e really don’t know” how common it is for children not to tell anyone of abuse
because “[n]obody has statistics,” but “it can happen and one shouldn’t in any way
let that influence one’s judgment about the accuracy of an allegation just because
nothing was said”; that using the term “frequently” to describe how often victims
of abuse love the abusers, or how often they do not show signs of abuse, implies a
“certain likelihood,” and “it’s better to say we don’t know how common. It’s not
rare or unusual, and therefore, the real issues are what is the truth of a particular
case. That factor shouldn’t cause your judgment to be influenced one way or the
other because it’s common enough that it shouldn’t diminish your belief or
possible belief. You should let other things influence you.”
In that portion of her argument discussing Dr. Coleman’s testimony, the
prosecutor stated: “He [Dr. Coleman] finally admitted we can’t have any
expectations about how a child will behave toward their abuser. He didn’t like to
use the word ‘common,’ but essentially it’s common for children not to show any
signs and symptoms. It’s common for children not to tell. It’s common for
children not to want to get somebody that they love in trouble. It’s common for
children not to understand what just happened. [¶] Ryan and Amanda told you
7
they didn’t even know what sex was. They did not understand why the defendant
was violating them in that way.”
The prosecutor’s argument was a legitimate comment on Dr. Coleman’s
testimony. The prosecutor’s characterization of Dr. Coleman’s testimony as
conceding in substance that it was common for victims of child sexual abuse not to
show symptoms and to be reluctant to get a loved one in trouble was a fair
interpretation of the testimony that “[i]t’s not rare or unusual” for the victim to
love the abuser or not to show signs of abuse, and that such things are “common
enough that it shouldn’t diminish your belief or possible belief.” Similarly, the
prosecutor’s argument that Dr. Coleman conceded that child victims commonly do
not report abuse was fair comment on his testimony that one should not be
“surprised” when a victim of child sexual abuse does not report it, and that it “can
happen.” Finally, it requires no expert testimony to assert that it is common for
child victims, such as Ryan at age 3 to 5, not to understand they have been sexually
abused.
Finally, even if the prosecutor’s argument was improper, it was harmless as
to the sole conviction at issue on appeal. (People v. Watson (1956) 46 Cal.2d 818,
836.) The jury acquitted defendant of all the counts concerning Amanda, and thus
it is not reasonably probable that the supposed misconduct had any effect on the
jury’s evaluation of Dr. Coleman’s testimony or its application to the charge of
committing a forcible lewd act on Ryan.
III. Misconduct in Eliciting Character Evidence
Defendant contends that the prosecutor committed misconduct by
intentionally eliciting testimony that defendant sold drugs to high school girls. We
disagree.
8
In its rebuttal case, the prosecution called one of defendant’s cousins, Jessica
C., to rebut defendant’s testimony that suggested he had no sexual interest in
underage girls after he reached adulthood. Jessica testified to particular incidents
that defendant denied had occurred.5
As here relevant, defendant denied that when he was married and living in
San Diego next door to a high school, he would invite high school girls to his
house and would also comment to others about those girls. In seeking to rebut this
testimony, the prosecutor asked Jessica whether, when defendant was living in San
Diego, defendant made comments about girls at the nearby high school. After
Jessica said that he did, the prosecutor asked, “What would he say?” Jessica
responded, “That the high school girls would come to his house and they would
purchase illegal drugs.” Defense counsel objected. The trial court ruled: “As to
what was going on and the why’s, sustained, stricken. [The] [j]ury is directed to
disregard. As to the girls coming and going, that will stay in.”
At sidebar, defense counsel moved for a mistrial on the ground that the
prosecutor had intentionally elicited testimony that defendant sold drugs. He noted
that in a report of an interview of Jessica that the prosecutor had provided, it stated
that Jessica had said that defendant would sell marijuana to high school girls.
Defense counsel had asked the prosecutor whether she intended to elicit that fact,
and she had said she did not.
The prosecutor explained that before Jessica testified, the prosecutor talked
to her “just about high school girls . . . coming over, him making comments about
high school girls.” She told Jessica she was going to ask about defendant’s
5
For instance, rebutting specific denials of events defendant gave in his testimony,
Jessica testified that she witnessed defendant French kissing a 13-year-old girl he met at
Disneyland, and that in a video from 2006, when defendant was 22, he said that a girl
“kissed like she was 15, 16 maybe.”
9
“contact with high school girls and . . . comments about the high school girls.” As
the prosecutor noted, defendant had made other comments to Jessica suggesting his
interest in underage girls. (See fn. 5, ante.) Thus, she expected similar testimony.
She did not expect Jessica to respond to her question by referring to defendant
selling drugs.
The trial court ruled that the prosecutor had not intentionally elicited the
objectionable part of Jessica’s answer. Rather, Jessica had volunteered the
information. As the trial court stated, the prosecutor “didn’t go into it [the
reference to selling drugs]. The answer went long on the part of the witness.” The
court denied the motion for a mistrial, noting that it had struck the reference to
defendant selling drugs and had directed the jury not to consider it.
A trial court’s ruling denying a mistrial is reviewed for an abuse of
discretion. (People v. Ayala (2000) 23 Cal.4th 225, 283.) Although it is
misconduct for a prosecutor intentionally to elicit inadmissible testimony (People
v. Bonin (1988) 46 Cal.3d 659, 689), the trial court concluded that the prosecutor
did not intentionally elicit Jessica’s response referring to defendant selling drugs.
Rather, the testimony was inadvertent. Substantial evidence supports that finding,
and we will not substitute our judgment for that of the trial court. Therefore, the
record fails to demonstrate any prosecutorial misconduct. Further, the trial court
struck the objectionable answer and directed the jury to disregard it. We find no
abuse of discretion in the trial court’s denial of the mistrial motion.
Moreover, even if there were misconduct, it was not prejudicial. Defendant
was charged with 10 counts of sexual offenses committed against three of his
cousins when they were children. The jury heard extensive testimony about those
alleged acts. The lone, brief reference to defendant selling drugs to high school
girls pales in comparison to that evidence. Moreover, the jury acquitted defendant
10
of all charges against his female cousin Amanda, and convicted him of only two
counts: committing sexual battery on Julian, a male cousin (the trial court later
vacated this conviction), and committing a forcible lewd act on Ryan, the
conviction at issue in this appeal. In these circumstances, it is not reasonably
probable that absent the objectionable testimony that defendant sold drugs to high
school girls, the jury would have reached a different result with respect to
defendant’s committing a forcible lewd act on his three-to-five-year-old male
cousin, Ryan. (People v. Watson, supra, 46 Cal.2d at p. 836.)
IV. Withholding Evidence
Defendant contends that the prosecutor committed misconduct by failing to
disclose exculpatory evidence. He is mistaken,
In a mid-trial offer of proof, defense counsel sought to introduce evidence
concerning family conflicts between, inter alia, Julian’s and Amanda’s mother,
Lisa C., and defendant’s mother, Jennifer L., in an attempt to show that Julian and
Amanda had a motive to lie. The trial court excluded the evidence under Evidence
Code section 352.
However, in light of the defense offer of proof, the prosecutor, at a break in
the cross-examination of Julian D., the alleged victim of the sexual battery
conviction that the trial court later vacated, turned over to defense counsel
information from her investigating officer concerning certain text messages
between Lisa and Jennifer that she believed would rebut portions of the proffered
defense evidence. In one of the of the text messages, dated April 2, 2010, Lisa
wrote that Julian denied the allegations. The prosecutor explained that until the
defense offer of proof, she had not thought the text exchanges were relevant.
11
Defense counsel complained that he was receiving this information in the
middle of trial, and the court questioned whether it was potentially exculpatory
evidence under Brady v. Maryland (1963) 373 U.S. 83 (Brady). The prosecutor
replied that there was no dispute in the case that Julian had initially denied that
defendant had abused him, and thus she had not believed that the evidence was
material. The court directed the parties to review the text messages overnight, and
at defense counsel’s request the prosecutor agreed to make Julian available for any
additional examination. The subject was not addressed again during the trial.
We find no merit in defendant’s claim that the prosecutor violated her duty
under Brady to disclose evidence that is both favorable to the defense and material
to guilt or punishment. (See Brady, supra, 373 U.S. at p. 87.) For Brady purposes,
evidence is “material” only if there is a reasonable probability that, had it been
disclosed, the result of the trial would have been different. (People v. Morrison
(2004) 34 Cal.4th 698, 714.) Here, as the prosecutor noted, there was no dispute
that Julian had initially denied being abused by defendant. Indeed, before the
disclosure of the texts, Julian had testified on both direct and cross examination
that when his mother first asked him whether defendant had abused him, he denied
it. The defense obviously knew that fact, and the disclosure of the text message
from Julian’s mother reiterating that fact cannot be considered material – that is,
there is no reasonable probability that had the text message been disclosed earlier,
the result of the trial would have been different. The fact was already known to the
defense and presented to the jury.
Moreover, even if there were a Brady violation, any error was harmless
beyond a reasonable doubt. (Chapman v. California (1967) 386 U.S. 18, 36.)
Although defendant was convicted of sexual battery on Julian, the trial court set
that verdict aside on the ground it that violated the statute of limitations. The fact
12
that Julian initially denied being abused had no tendency in reason to impeach
Ryan’s testimony that defendant abused him, and thus it could not possibly have
had any impact on the jury’s view of his credibility. Therefore, as to the sole
conviction at issue in this appeal, any supposed Brady violation was harmless.
V. Defendant’s Sentence
Defendant contends that his sentence of six years in state prison and the
requirement that he register as a sex offender constitutes cruel and unusual
punishment under the Eighth Amendment of the United States Constitution. He
appears to argue that his sentence was unconstitutional because he committed the
forcible lewd act against Ryan when he was approximately 13, and he was
“deprived of the right to juvenile proceedings” by the counts against Amanda (of
which he was acquitted), which rendered him ineligible for juvenile treatment
under Welfare and Institutions Code section 707, subdivision (d)(2).
Defendant forfeited this claim by failing to raise it in the trial court. (People
v. Norman (2003) 109 Cal.App.4th 221, 229.) Additionally, he has forfeited the
argument on appeal because: (1) he fails to cite to any legal authority on cruel and
unusual punishment other than the Eighth Amendment itself, and (2) fails to make
any reasoned argument applying principles of Eighth Amendment jurisprudence.
Because he has failed to cite relevant case authority and present reasoned argument
supported by relevant legal principles, he has forfeited the issue on appeal.
(People v. Stanley (1995) 10 Cal.4th 764, 793.)
Finally, even if the claim were properly presented under appropriate Eighth
Amendment principles, we would reject it. (See People v. Perez (2013) 214
Cal.App.4th 49, 60 [30-years-to-life sentence for a 16 year old who was convicted
of one count of sexual penetration with a foreign object of nine year old and one
13
count of committing a forcible lewd act on an eight year old during single event
did not violate cruel and unusual punishment principles].)
DISPOSITION
The judgment is affirmed.
NOT TO BE PUBLISHED IN THE OFFICIAL REPORTS
WILLHITE, J.
We concur:
EPSTEIN, P. J.
MANELLA, J.
14
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Development of mitochondrial permeability transition inhibitory agents: a novel drug target.
Apoptosis is a genetically conserved mechanism that eliminates unnecessary or surplus cells and is also involved in the pathomechanism of a wide variety of diseases. The intrinsic pathway of apoptosis includes the mitochondria where numerous pro-apoptotic proteins are sequestered and their release marks the point-of-no-return, indicating the ultimate commitment to cell death. The mitochondrial permeability transition (mPT) is a mechanism enabling the release of Cytochrome-c (Cyt-c), AIF and other pro-apoptotic proteins, and is characterized by an alteration in the permeability of the organelle's membrane. This is due to reactive oxygen species or Ca(2+) triggered dynamic assemble of a trans bi-membrane channel from various protein components including the voltage dependent anion channel, the adenine nucleotide translocase, the cyclophyllin D that enables solutes up to 1.5 kDa to pass through. The resultant influx of water into the mitochondrial matrix leads to mitochondrial swelling and the rupture of the membranes. Numerous agents can inhibit mPT including amiodarone, a widely used antiarrhythmic agent. Modification of this benzofuran derivate with nitroxides or their secondary amine derivates that exhibits antioxidant properties leads to the enhancement of mPT inhibitory effect of the original compound. Furthermore this hybrid compound is also capable of influencing the necrotic cell death pathway. This strategy may prove to be beneficial to increase the effectiveness of other mPT inhibitory agents. However, further studies are necessary to identify the components and structure of the permeability transition pore in order to design more effective mPT inhibitory compounds to fully exploit the therapeutic potential of this novel drug target.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Memory management with `addrinfo` structures
I've just started to work with UDP sockets in C and I have a question relating to memory management. Often examples show something of the following
struct addrinfo *result; //to store results
struct addrinfo hints; //to indicate information we want
:
:
:
if( (s = getaddrinfo(hostname, NULL, &hints, &result)) != 0){
fprintf(stderr, "getaddrinfo: %s\n",gai_strerror(s));
exit(1);
}
:
:
:
//free the addrinfo struct
freeaddrinfo(result);
I've also seen the introduction of an additonal local addrinfo structure used in a for loop to cycle through the result for the sake of extracting a particular entry...something like this
struct addrinfo *entry; //to store a result from linked list
:
:
:
for (entry = result; entry != NULL; entry = entry->ai_next)
{
:
:
:
}
My question is why is result the only structure that gets passed to freeaddrinfo and not hints or entry? In other words, I've never seen anyone call freeaddrinfo(hints).
One other thing, should I be preallocating memory for or initializing structures of the form addrinfo? If so, how do I do that?
A:
Just skimmed through...it's because getaddrinfo dynamically allocates the memory?
Yes. More specifically, it allocates memory for the linkedlist pointed to by result pointer. Since the library is allocating memory on your behalf, library implementors have also providing you with an API to free the memory.
If that's the case, should I be pre-allocating memory / initializing entry in the example above? Why doesn't that get passed to freeaddrinfo
No. entry is just a variable used to iterate through the list. It is very much similar to
`for (i = 0; i < n; i++)`
loop you will find anywhere else. i is just an iterator.
You don't have to use entry variable at all if you don't want to. You can iterate through the linkedlist with just a while loop
while (result != NULL) {
//Do what you have to do here
result = result->ai_next;
}
If you observe closely, you will see that you are moving the result variable itself to the end of the list. If you iterate this way, there is no way for you to free the memory since you have lost the starting address which was returned to you by getaddrinfo(). To get around this, you can save the starting address in a temp variable and then use the while loop. Just add this line before the while loop.
struct addrinfo *entry = result; //save the starting address
while (...) {
}
You can call free on entry pointer now, instead of result. The effect would be the same.
freeaddrinfo(entry);
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Esoteric Transport and DAC Upgrades
Esoteric has upgraded the wiring and parts inside the flagship P-01 and D-01 SACD/CD transport and DAC and has renamed them the P01-VU and D01-VU respectively. Each DAC is a single channel and retails for $16k and the transport will run you $32k. These are superbly built and incredible sounding digital products. Even if you can't afford them, just be glad they exist in our world.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A balanced anesthesia with dexmedetomidine decreases postoperative nausea and vomiting after laparoscopic surgery.
To evaluate the effect of adding dexmedetomidine to a balanced anesthetic technique on postoperative nausea and vomiting after laparoscopic gynecological surgeries. A prospective double-blind randomized study was designed at Jordan University Hospital, Amman, Jordan between December 2008 and February 2009. Eighty-one female patients in their child-bearing age (17-48 years); American Society of Anesthesiologists (ASA) clinical status I, who were scheduled for elective diagnostic laparoscopic surgeries under general anesthesia were divided into 2 groups. Group D (n=42) received dexmedetomidine infusion, while group P (n=39) received 0.9% sodium chloride infusion along with the balanced anesthesia. The incidence of early (up to 24 hours) postoperative nausea, vomiting, nausea and vomiting, and the need for postoperative rescue anti-emetic medications were recorded. The total incidence of postoperative nausea and vomiting decreased significantly in group D; 13 out of 42 patients (31%), compared to group P; 23 out of 39 patients (59%), vomiting alone did not significantly change, the incidence of postoperative nausea, and the use of rescue anti-emetic medications were significantly different. A significant drop in overall consumption of fentanyl and sevoflurane was also noted in group D. Combining dexmedetomidine to other anesthetic agents, results in more balanced anesthesia and a significant drop in the incidence of postoperative nausea and vomiting after laparoscopic gynecological surgeries.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1
Simplify sqrt(15)/(sqrt(3) + sqrt(147)*-2 - sqrt(3)) + (0 + sqrt(125) + sqrt(125))*-4.
-561*sqrt(5)/14
Simplify ((-3 + sqrt(153)*-1 + 0)*-4)**2*3.
864*sqrt(17) + 7776
Simplify -2 + ((sqrt(1100) + (sqrt(1100) - sqrt(1100)*-1 - sqrt(1100)) + -1 - sqrt(1100))**2 - (-1*sqrt(1100) + 2 + sqrt(1100))) + 0.
-20*sqrt(11) + 1097
Simplify (-5*(sqrt(133)*-2*2 + sqrt(133)))/((-1*sqrt(21))/sqrt(3)*-3).
5*sqrt(19)
Simplify -2 + -4*(-2*sqrt(1700)*1 + -2)**2.
-27218 - 320*sqrt(17)
Simplify (sqrt(60) + sqrt(60) + (sqrt(60) - sqrt(960)*6) - (-2*sqrt(660))/sqrt(11))/((sqrt(108)*-1 - sqrt(108))*-5).
-19*sqrt(5)/30
Simplify -6*(1*-1*sqrt(153) + sqrt(153))/(sqrt(9) + sqrt(27)/sqrt(3)*-3)*2*1.
0
Simplify (-1*(sqrt(350)*-2)/sqrt(7))/(sqrt(640) + sqrt(640) + (sqrt(640) + 1*sqrt(640))*2).
sqrt(5)/24
Simplify -6*(0 + 0 + sqrt(34)/sqrt(2) - (sqrt(1700) + 0)*-2).
-126*sqrt(17)
Simplify (0 + 2*sqrt(72)*-2*5*1 + -5)**2.
1200*sqrt(2) + 28825
Simplify 1*6*(sqrt(416) + (sqrt(416) - (sqrt(416) + (sqrt(416) - 3*(sqrt(416) - (-2*sqrt(416) - sqrt(416)))) + sqrt(416))) + sqrt(416))/sqrt(8).
144*sqrt(13)
Simplify ((-2*sqrt(10) - sqrt(10))*-4 + -1*sqrt(1000))/(sqrt(30)/(sqrt(18)/sqrt(3)) - (sqrt(5)*-1*-4 - sqrt(5))).
-sqrt(2)
Simplify 5 + ((sqrt(90) + -1*sqrt(90))*-3)/(-2*sqrt(500) + sqrt(5)).
5
Simplify (-2*((sqrt(1331) - (6*(2 + sqrt(1331)) - sqrt(1331))) + (sqrt(1331) - (sqrt(1331) + sqrt(1331) + sqrt(1331) + 2 + sqrt(1331) + -3))))**2.
6776*sqrt(11) + 261360
Simplify -4*(sqrt(252) - ((-2 + sqrt(252))*-5 + sqrt(252)))*-3.
-120 + 360*sqrt(7)
Simplify -5 + (4 + 0 + sqrt(112))**2 + sqrt(112)*-3 + 5.
20*sqrt(7) + 128
Simplify (-4 + 1 + -1*sqrt(833) + -3 + -1*sqrt(833))**2.
168*sqrt(17) + 3368
Simplify 1 + ((sqrt(304) + 0 + 1 - (-2*sqrt(304) + 5)) + (sqrt(304) - sqrt(304)*2)*4 + (sqrt(304) - (1 + sqrt(304) + -3)) + sqrt(304))**2.
5
Simplify -4*((sqrt(320) + sqrt(320) + -1 + sqrt(320) + -2)**2 + sqrt(320)*-1 + -2).
-11548 + 608*sqrt(5)
Simplify (sqrt(2600)*-1*-6 + sqrt(2600))/(sqrt(450)/sqrt(9)*-5).
-14*sqrt(13)/5
Simplify ((sqrt(792) + -1*(sqrt(792)*-1 + sqrt(792)) + sqrt(792))/(sqrt(2)*1*5 - (sqrt(24)/sqrt(3) + sqrt(8))))**2.
1584
Simplify ((sqrt(35) + (sqrt(35) + (-4*sqrt(35)*2 - sqrt(35)) - sqrt(35)))*-3)/((sqrt(112) - (sqrt(112)*-2 + sqrt(112))) + sqrt(7) + sqrt(42)/sqrt(54)).
18*sqrt(5)/7
Simplify sqrt(272)*5*4 + (2*(3 + sqrt(272)))**2.
176*sqrt(17) + 1124
Simplify (6*(4*sqrt(84)/(sqrt(2) + sqrt(8)))/((sqrt(96)/sqrt(32))/sqrt(2)))**2.
1792
Simplify -5 + -2*((-2 + -1*sqrt(637) + (sqrt(637) - (sqrt(637) + (sqrt(637) - (sqrt(637) - 3*(sqrt(637) + 2) - sqrt(637))))))*5)**2.
-799455 - 28000*sqrt(13)
Simplify 2 + (sqrt(95) + 2*3*sqrt(95) + sqrt(95) - sqrt(95))/(sqrt(500)*2).
7*sqrt(19)/20 + 2
Simplify (sqrt(105)/sqrt(28) - (sqrt(2160) + (sqrt(2160) - sqrt(2160)*-1) + sqrt(2160) + sqrt(2160)))/(sqrt(3) + sqrt(12)/sqrt(4)*1 - sqrt(48)) + 1.
1 + 119*sqrt(5)/4
Simplify -5 + ((-1*(1 + sqrt(700)) + -5*-3*sqrt(700))*-5)**2.
-7000*sqrt(7) + 3430020
Simplify -1*(-1*sqrt(130)/(1*sqrt(10)) - (sqrt(13) - (-1 + sqrt(13)))**2*-5*-1).
sqrt(13) + 5
Simplify -3 + (sqrt(65)*4*6)/((sqrt(30)*-3)/sqrt(6)).
-8*sqrt(13) - 3
Simplify (-6*(sqrt(63) - (-1*sqrt(756) - sqrt(756))/sqrt(12)))/((-1*sqrt(9)*2 + sqrt(9))*4).
9*sqrt(7)/2
Simplify 1*-1*sqrt(171)/(sqrt(72)/(sqrt(8) + (4*sqrt(8) - sqrt(8)))).
-4*sqrt(19)
Simplify (((sqrt(175)*-3 - sqrt(175))*5)/sqrt(5))/((sqrt(45)/sqrt(144) - sqrt(5))*3).
80*sqrt(7)/9
Simplify (sqrt(187) - (sqrt(187) - 3*(3*sqrt(187) - sqrt(187))) - sqrt(187))/(sqrt(11) - sqrt(264)/sqrt(6)) + 5.
-5*sqrt(17) + 5
Simplify (sqrt(91)*1*-1)/((sqrt(441)/sqrt(7))/sqrt(9)).
-sqrt(13)
Simplify -1*(sqrt(25)/(4*sqrt(5)*-1) + -4 + 2)**2.
-69/16 - sqrt(5)
Simplify sqrt(126)/sqrt(112) - -3*sqrt(20)/(sqrt(10) + sqrt(60)/sqrt(6) + sqrt(10)).
7*sqrt(2)/4
Simplify (((1*sqrt(150) + sqrt(150))*-2)/sqrt(5))/(sqrt(60)/(sqrt(24)/sqrt(4)) - sqrt(10) - sqrt(50)/sqrt(80)).
16*sqrt(3)
Simplify -4*-2*((sqrt(75) - (sqrt(75) + sqrt(75) + ((sqrt(75) - (sqrt(75) - (0 + sqrt(75)) - sqrt(75))) + sqrt(75) + sqrt(75))*-2 + sqrt(75)))*-5)**2.
540000
Simplify (2*sqrt(231)/sqrt(7))/(3*sqrt(11)*4).
sqrt(3)/6
Simplify ((sqrt(117) + -2*sqrt(117))*-1 - sqrt(117)*-1*-2)/(sqrt(900) + 4*sqrt(900)*-1).
sqrt(13)/30
Simplify (sqrt(108) + 3 - sqrt(27))**2*6 + (sqrt(3) + sqrt(12)/(sqrt(12)/sqrt(3)))**2*-2*1.
108*sqrt(3) + 192
Simplify ((0 + -2 + sqrt(2057) + sqrt(2057) + 2)**2 + -4)*4.
32896
Simplify ((sqrt(66) + (2*sqrt(66) - sqrt(66) - sqrt(66)) + sqrt(66))*-4*-1)/(-2*sqrt(24)*1).
-2*sqrt(11)
Simplify 3 + (4*(1*sqrt(147))**2 - (3 + 1 + sqrt(6)/sqrt(2))).
-sqrt(3) + 587
Simplify 5*(5*sqrt(176)*-2)/(sqrt(484) - (sqrt(484) + sqrt(484)*2*-3)).
-50*sqrt(11)/33
Simplify (sqrt(126)/sqrt(2))/sqrt(9) + (-3 + sqrt(7))*-5 + sqrt(7) + 5.
-3*sqrt(7) + 20
Simplify (5 + (sqrt(192) + sqrt(192) + 0 + -1)*-1)**2*3.
-576*sqrt(3) + 2412
Simplify (4*(sqrt(450) - sqrt(50))*-4)/(sqrt(160) + (sqrt(160) - ((sqrt(160) + -1*sqrt(160))*-1 - sqrt(160)))).
-8*sqrt(5)/3
Simplify (-4*(-1 + sqrt(200)))**2 - (sqrt(2450)*4)**2.
-35984 - 320*sqrt(2)
Simplify (sqrt(2835) - sqrt(2835)*4 - sqrt(2835))/(sqrt(40)/(sqrt(8)*-3)).
108*sqrt(7)
Simplify ((sqrt(363) - (3*(sqrt(363) + sqrt(363) + -1 + sqrt(363)) + sqrt(363))) + (sqrt(363) - -4*(sqrt(363) + 1 - sqrt(363))) - (5 + -1*sqrt(363)*4))**2.
-176*sqrt(3) + 5812
Simplify -2 + (sqrt(11) - (1*sqrt(132))/sqrt(12))**2 - (-3 + (sqrt(110) - (sqrt(110) - 2*sqrt(110) - sqrt(110)) - sqrt(110))/sqrt(10)).
-2*sqrt(11) + 1
Simplify sqrt(10)/(sqrt(200)*-2) - ((sqrt(40) + -1*sqrt(40))/sqrt(8) + -4).
-sqrt(5)/20 + 4
Simplify -5*(sqrt(32)*-4 - sqrt(2) - sqrt(2) - (sqrt(72) + (sqrt(72) + (2*sqrt(72) - sqrt(72)) - sqrt(72))) - (sqrt(882) - 3*sqrt(882)))**2.
-1440
Simplify (-3*sqrt(192)/sqrt(4) + sqrt(48) - (5 + sqrt(1200) - sqrt(1200)))**2.
80*sqrt(3) + 217
Simplify (4 + sqrt(304)*-3 + -3*(sqrt(304) + (sqrt(304)*-1)**2))*-4.
96*sqrt(19) + 3632
Simplify (5 + (-6*(sqrt(5) + 5))**2 + 3)*-2.
-2176 - 720*sqrt(5)
Simplify (2*(sqrt(42) - (sqrt(42) + sqrt(378))))/sqrt(6) - (1*(sqrt(28)*-1)/sqrt(4))**2.
-6*sqrt(7) - 7
Simplify -1*(sqrt(5) + -1) + 3 - ((sqrt(20)*-3*3)/sqrt(4))**2.
-401 - sqrt(5)
Simplify (sqrt(10) - ((sqrt(810) - (sqrt(810) - (-2*sqrt(810) + sqrt(810))) - sqrt(810)) + sqrt(810)) - sqrt(10))/(sqrt(45)/(sqrt(9)*1)).
9*sqrt(2)
Simplify 4*((1*(sqrt(1539) + (sqrt(1539)*-1 + sqrt(1539) - sqrt(1539)) + sqrt(1539)) - sqrt(1539))**2 + -3 + 2 + sqrt(1539))*1.
-4 + 36*sqrt(19)
Simplify (sqrt(187) + sqrt(187) + 2*sqrt(187)*-1 + sqrt(187) - -3*sqrt(187)*2)/((sqrt(99) - 3*((sqrt(99) - sqrt(99)*-2) + sqrt(99)) - sqrt(99))/sqrt(9)) + -4.
-4 - 7*sqrt(17)/12
Simplify (sqrt(768)/sqrt(8))/(4*sqrt(27))*-2 + 4.
-2*sqrt(2)/3 + 4
Simplify (4*(sqrt(117) - (sqrt(117) - (sqrt(117) + sqrt(117)*-1 - sqrt(117)))))/(sqrt(441) - (sqrt(441)*4 + sqrt(441))) + 2.
sqrt(13)/7 + 2
Simplify 2 + (-4 + (sqrt(125) - (2*sqrt(125))**2))*-1 + 5.
-5*sqrt(5) + 511
Simplify (5*sqrt(33)*-4)/(sqrt(3) + (sqrt(3) + sqrt(9)/sqrt(3))*4).
-20*sqrt(11)/9
Simplify -4 + ((sqrt(39) - sqrt(39)*-1)*6 + sqrt(39) + sqrt(39))/(sqrt(9)/sqrt(27)).
-4 + 42*sqrt(13)
Simplify (-5*(sqrt(35) + sqrt(35)*-2))/(-6*sqrt(7)*-2) + -5.
-5 + 5*sqrt(5)/12
Simplify (sqrt(399)/((sqrt(42)/sqrt(96) - sqrt(7)) + sqrt(7)))/((2*sqrt(300) - sqrt(300))*1).
2*sqrt(19)/5
Simplify 3 + -2 + -1 + (sqrt(2736) + (sqrt(2736) + -1 - sqrt(2736)))*1 + 0.
-1 + 12*sqrt(19)
Simplify -1 + ((sqrt(7) - (sqrt(7)*2)**2) + -3 - (sqrt(14)/(sqrt(18)/sqrt(9)) - sqrt(7)))*-3.
-3*sqrt(7) + 92
Simplify (-1*sqrt(91)*-3 - (4*(sqrt(91) - (sqrt(91) + (sqrt(91) - 1*sqrt(91)))) - sqrt(91) - sqrt(91)))/(sqrt(56)/(sqrt(200)*-2))*3.
-150*sqrt(13)
Simplify -4*(-3 + sqrt(18)/(sqrt(6) - -4*sqrt(6))) + -3.
-4*sqrt(3)/5 + 9
Simplify ((1*sqrt(150) - sqrt(150)) + (sqrt(60)/(sqrt(30)/sqrt(3) + sqrt(10)) - sqrt(6)) + sqrt(6))/(sqrt(6)/(-2*sqrt(9)/sqrt(3))).
-sqrt(3)
Simplify 2*((sqrt(72)*-1)**2 + 1) - 3*2*sqrt(72)*-2.
72*sqrt(2) + 146
Simplify (sqrt(468)*-2)**2 + -3*sqrt(52)/sqrt(4) - (1 + (-2 + -2*sqrt(13) - sqrt(13)) + sqrt(117)/(2*sqrt(9))).
-sqrt(13)/2 + 1873
Simplify 1 + ((sqrt(462)/sqrt(176))/(sqrt(6) - (sqrt(54) + sqrt(216)/sqrt(4) + sqrt(54))))**2 + 5.
6151/1024
Simplify (-4 + 1*sqrt(272) - (sqrt(816)/sqrt(3) + sqrt(1088)*-1)**2) + 0.
-276 + 4*sqrt(17)
Si
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Arya Permana
Arya Permana (born 2006) is the world's heaviest living child, weighing at as of 2016. He is considered morbidly obese.
Medical concerns
Permana was born in Indonesia at a normal weight; he began rapidly gaining weight in 2014. By early 2016, weight increase and associated medical issues had prevented him from attending school. As a result of medical concerns, Permana was placed on a rapid diet plan in order to lower his weight by mid-2016. While this diet reduced his weight and allowed him to return to school, continued hunger and further medical concerns prompted a sleeve gastrectomy surgery. This has successfully reduced his weight by .
References
Category:Living people
Category:2006 births
Category:Indonesia
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Return results with unique identifiers across multiple columns
Trying to return all results that have the following values
Data:
Column1|Column2|Column3|ID
1 | 2 |1 |67
1 | 1 |1 |67
2 | 2 |2 |67
4 | 4 |1 |67
Return:
Column1|Column2|Column3|ID
1 | 1 |1 |67
2 | 2 |2 |67
Paramaters:
Return any data that has:
1 in column1 AND 1 in column2 AND 1 in column3
2 in column1 AND 2 in column2 AND 2 in column3
3 in column1 AND 3 in column2 AND 3 in column3
Thanks! Right now I' just making multiple queries and compiling the data together.
HAVING (((dbo_INVOICE.INV_TOTAL)>0) AND ((dbo_ITEMSORD.INVOICE_ID)="002") AND
((dbo_PACKAGE.INVOICE_ID)="002") AND ((dbo_INVOICE.INVOICE_ID)="002"));
A:
First looking at your code you are not comparing aggregations in your HAVING clause so it is likely you actually want these conditions in a WHERE clause. Then parenthesis and AND/OR are your friend here so you can establish precedence in your constraints. so for the case you described you could write:
WHERE
(Column1 = 1 AND Column2 = 1 AND Column3 = 1)
OR (Column1 = 2 AND Column2 = 2 AND Column3 = 2)
OR (Column1 = 3 AND Column2 = 3 AND Column3 = 3)
And if you actually want to simplify you can test that A = B AND B = C and A is 1,2, or 3. Because that would mean that A = B = C and they are between 1 AND 3. which can be done like this:
WHERE
Column1 = Column2 AND Column2 = Column3
AND Column1 IN (1,2,3)
And looking at your specific sql statement something like this would likely work for you:
WHERE
dbo_INVOICE.INV_TOTAL > 0
AND dbo_ITEMSORD.INVOICE_ID = dbo_PACKAGE.INVOICE_ID
AND dbo_PACKAGE.INVOICE_ID = dbo_INVOICE.INVOICE_ID
AND dbo_ITEMSORD.INVOICE_ID IN ("001","002","003")
Note if you just want all of the columns to be equal and don't care what the values are just take out the IN condition.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
rdma back-end has scatter/gather array ibv_sge[MAX_SGE=4] set
to have 4 elements. A guest could send a 'PvrdmaSqWqe' ring element
with 'num_sge' set to > MAX_SGE, which may lead to OOB access issue.
Add check to avoid it.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Subjects
Tuesday, December 4, 2012
Cash Balance Plans
"The real reason that we
can't have the Ten Commandments in a courthouse: You cannot post 'Thou shalt
not steal,' 'Thou shalt not commit adultery,' and 'Thou shalt not lie' in a
building full of lawyers, judges, and politicians. It creates a hostile work
environment." – George Carlin
"A cash balance plan splits the difference in that it provides a guaranteed minimum benefit for every employee but has predictable and manageable cost and is not susceptible to abuse." - According to Rep. Dan Biss of Skokie, whose fingerprints are all over the proposed change.
Cash Balance Plan (…like a pension only really different)
Noun: A Cash Balance Plan is just one of the many proposed moving parts put forth by Rep. Elaine Nekritz of Northbrook and Rep. Dan Biss of Skokie in another immoral attempt to stop Illinois' fiscal bleeding by bleeding the minority the General Assembly and the various Governors cheated to begin with. Don't be fooled by the saccharine description that will by provided by legislators like Biss. While they will promise you that a cash balance plan is a better compromise between the mismanagement of pensions and the risky self-management of 401(k)'s, it was never intended to provide for a stable retirement.
A Cash Balance Plan
is another variation on retirement savings plans developed in the 1980’s that
is both deceptively simple yet devilishly complicated. In its design, a Cash
Balance Plan falls into the federally recognized arena of defined
benefits (like a pension) as opposed to defined contributions (like a
401K). There is no simple definition, so
you’ll need to read on.
In essence, the employer
credits a worker, like a teacher, each working year a percentage (usually 4 –
5%) of her salary, which becomes a “hypothetical” account balance that grows
over the years. For example, let’s say
that Jane the reading teacher earns $30,000 in a year one of her work at the
school. Her “hypothetical” account would
be 4% of $30,000. That would equal
$1,200. Next year, Jane earns
$32,000. Add another 4% ($1,280), and
Jane’s “hypothetical” account has now grown to $2,480. Are you with me so far?
Now let’s add another aspect
to Jane’s “hypothetical” account. The employer will also provide an annual
percentage rate as if the money accumulating in Jane’s hypothetical account
were invested in something like an index or long-term Treasury bond. Right now, T-Bonds are a little under 3%, but
the employer will have to maintain that number and accept the risk throughout
Jane’s tenure at the school. In year
one, Jane has no interest as her “hypothetical” account starts. But in year two, she can figure an additional
$34.80 in interest added to her “hypothetical” account.
By the way, hypothetical
means just that. There is no real money
in any account, but the employer is responsible for actuarially maintaining
that record for later dispersing of funds “hypothetically” earned.
This alternative defined benefit plan has
become the darling of Representative Biss’ approach to solving the “pension
crisis.” In fact, Representative Biss (Skokie), whose proposal for a cash
balance plan in HB1673 was deleted only after Speaker Madigan handed the dying
bill to Rep. Cross last spring, still strongly considers this concept a positive
alternative for both Tiers of public employees.
The plan in HB1673 was a replica of his initial proposal in his own HB6149. Now we see its re-appearance in a proposed new bill HB6258 - being launched in the Veto Session. According to the legislator Biss, in the spring he wanted to make improvements to "the inadequate benefit offered Tier II employees and preserve the
existing defined benefit… for Tier I employees" (Representative Biss in a May 2012 email communication). Last spring Biss offered choices for cash balance plans. His new proposal, on the oher hand, will place all new hires since 2011 in a Cash Balance Plan. And, because of Representative Biss' connections to the pension
committee, which will once again hammer out the details of the next proposals
sure to come at us in November through January, we should all be aware of his
involvement and strong advocacy for this kind of retirement plan.
Second, let me try and make this simple. The main
differences between reading teacher Jane’s defined benefit pension and a Cash Balance Plan(CBP) are these (to name a few):
A CBP is a slowly building “hypothetical account” which
takes into account all of your years of service, and it is not
calculated at all like our current pensions. Many years from now, instead of calculating
Jane’s retirement by averaging the last four years of her earnings and a
percentage based upon the number of years of service, it will include all the early
years for which Jane made very little compensation. This is especially impactful for teachers who
have received pay increases over the years as well as later increased
compensation for educational advancements and degrees.
A CBP
is a completely portable account; consequently, it is very alluring to those
who move from one job to another (unlike most educators) and likewise serviceable
to employers. After two years of
service, the State of Illinois (or local school district – but that’s
another earlier vocab) can cut a check for Jane for $2,480 and send her on
her way. Oops, she’ll also get that
nearly 3% per year in hypothetical interest too. Or $34.80.
Let’s talk about that
interest, too. What if returns on
investments increase? What if the Great
Recession ends in the next ten or thirty years? What if the market returns on
investments become much more than just under 3%. Does Jane get that too? Sorry, no.
The employer reaps any extras off of Jane’s hypothetical accounts. Of course, the employer will argue that it
took on the risk to begin with.
Starting to see how this works?Cash Balance Plans were first developed in the 1980’s
by Kwasha-Lipton, a New Jersey investment firm, as a means to capture surplus dollars from
employee pension plans without running afoul of the IRS for not paying the
federal taxes on money taken out of employee pension plans (Schulz, Ellen. Retirement Heist). Regular pensions
produce rapid growth in value at the end of a career, but by creating an
instrument that grows slowly at a flat rate, money can be saved (or diverted)
from pension responsibilities. Multiple
those by a hundred thousand or more, and you’ve made some seriously big
money. According to Schulz,
Kwasha-Lipton partners determined savings of 25 – 40% in pension costs by
converting to this “new, complicated” product.
To see just how smugly they celebrated their manipulation of middle
class pension savings, take a look at some of their end-of-year parties. One of the
first companies to employ this new concept in order to re-direct funds destined
for workers pensions was Bank of America.
I’m shocked?
It gets
worse. When companies or the State of Illinois
convert to a Cash Balance Plan, they freeze the
old pension, ending its growth. On
occasion, the “old” pension is converted to a lump sum which becomes the new
“hypothetical account balance.” The
balance now grows by a flat rate of 4%, killing any leveraged growth. The older a worker, or the more time vested
in the regular pension plan, the greater the suffering. For example, a teacher like Kenneth, who has
over 30 years in the system, my have an opening account balance of nearly
$200,000 to start. But remember that at
9.4% per year, Kenneth has already contributed well over that amount – more
like $300,000. It will take Ken many
more years to build back that contribution amount. When Cash Balance Plans emerged in the
business world, age discrimination suits became a new growth industry. Later legal federal adjustments were made to
provide some protections for the elderly and vested employee. On the other hand, these instruments and
their half-sister, the 401 (k), were developed to provide portability to a more
mobile work force and savings for employers who faced promises of pensions to
an aging work force.
Finally, Cash Balance Plans are required by law to fulfill at
least one aspect of a defined benefit: they must provide an annuity payment for
the balance of a retiree’s life (or offer a lump sum pay out). Most workers wanting to manage their own end
of life savings/retirement choose the latter, but others will accept the annual
guaranteed pension benefit. How much per
month? Unlike a pension, you’d better
look at it from an annual perspective. According
to a recent CBS analysis of Cash Balance Plans vs. Insurance Annuities (2012),
the average annual pay out for those who desire the CBP
annuity for life is about $8,000 per
year for every $100,000 saved in their eventual "hypothetical account." See cash balance retirement plans: annuity options.
At those rates, young Jane
better have well over a million in her hypothetical account when its time to
leave. At those rates, the State of
Illinois will be able to begin having public employees pay down the debt
created by years of underfunding. Indeed, the unfunded liability is expected to be completely taken care of in a mere thirty years if Rep. Nekritz and Rep. Biss can get HB6258 or another yet unnumbered bill passed. Stop the bleeding? Remember, my fellow public employee, the target has always been you and
me.
About Me
I am a retiree, political activist, social advocate and community volunteer. I taught at Lyons Township High School in LaGrange for 34 years in the Language Arts classroom and worked as an administrator for several years. My current avocations include various community outreach and assistance programs. Having benefitted from employment in a collegial, reflective teaching environment that encouraged dedication and professionalism, I continue to seek the promotion of education at all levels as a long-term effort combining talent, perseverance, commitment, and constant professional growth - not a blind adherence to a business model of measured production.
Copyrights & Fair Use
This blog contains copyrighted material the use of which has not always been specifically authorized by the copyright owner. I am making such material available in my efforts to advance understanding of issues vital to a democracy. I believe this constitutes a “fair use” of any such copyrighted material as provided for in section 107 of the U.S. Copyright Law.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Plant regeneration from protoplasts of mango (Mangifera indica L.) through somatic embryogenesis.
This report describes a protocol for the regeneration of plants from protoplasts isolated from proembryogenic masses (PEMs) in a suspension culture derived from the nucellar callus of mango (Mangifera indica L. cv 'Amrapali'). The maximum yield (24.6±1.1×106), with 81.04±4.1% viable protoplasts per gram PEMs, was obtained with an enzyme mixture containing 1.2% cellulase, 1.0% hemicellulase and 0.6% pectinase. An optimum density of 5×104 cultured protoplasts per milliliter culture medium was required for the highest frequency (88.89±5.40%) of division. Dividing protoplasts developed into microcalli that proliferated on medium supplemented with growth regulators (auxins or kinetin alone, or auxins with kinetin) and produced somatic embryos after transfer to a growth regulator-free medium. The protocallus on 2,4-D-containing medium produced the maximum number (102.50±6.93) of somatic embryos. Maturation of somatic embryos depended upon the presence, and the nature and combination of growth regulators in the medium during proliferation of the callus. The mature somatic embryos germinated and developed into plants that were transferred to soil.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
North Carolina health officials say a fourth person has died from Legionnaires' disease. The N.C. Department of Health and Human Resources said in a statement that its Division of Public Health has confirmed 141 cases involving residents from counties and multiple states. In addition to the deaths, 94 people were hospitalized.
Information gathered by local health officials showed that most patients attended the NC Mountain State Fair, which ran from Sept. 6-15 at the Western North Carolina Agricultural Center in Fletcher. Officials have said those who were diagnosed with the disease may have walked by the hot tub displays.
On Thursday, DHHS reported a case of Legionnaires' in a person who didn't attend the fair, but instead went to the Agricultural Center for a quilt show.
Get Breaking News Delivered to Your Inbox
Legionnaires' disease is a severe form of pneumonia. People get sick inhaling microscopic water droplets containing the legionella bacteria. It is not contagious. According to the Centers for Disease Control and Prevention, one in 10 Legionnaire's victims will die.
Officials have not identified any of the people who have died from the disease, but CBS affiliate WSPA reported earlier this months that a woman's obituary said she died from Legionnaires' disease, and her family said she attended the N.C. Mountain State Fair prior to being admitted to the hospital.
This is at least the second major Legionnaires' outbreak in the past two months. In August, a widespread outbreak of the disease killed one person and sickened possibly dozens of others who were all guests at the Sheraton Atlanta Hotel.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Last year, I looked at the gender ratios across college majors and discovered an interesting-yet-spurious correlation: College majors with higher male:female ratios (i.e., with more men than women) tend to have students with higher estimated IQs. After much debate, the correlation seemed to be explained by the fact that male-dominated majors tend to be more quantitative in nature, and the IQ estimation procedure relied heavily on students’ quantitative SAT score. Thus, we were only observing a gender preference for quantitative vs. non-quantitative majors.
Recently, I ran across an interesting FiveThirtyEight article that analyzed the estimated median earnings for recent college graduates broken down by major. The data that they used from the American Community Survey was publicly available on their GitHub, so I decided to take a closer look at the correlation between estimated median earnings and the gender ratio for each majora.
Below, each square is a college majorb scaled by the number of recent college graduatesc. The squares are colored by the general category of each major, and I annotated a handful of the most popular majors. If you’d like to look up specific majors, use FiveThirtyEight’s lookup tables.
The trend that’s immediately apparent from this chart is that female-dominated majors make less on average than male-dominated majors. Some interesting exceptions to the trend are Nursing (90% women; $48k median earnings) and Transportation Science (12% women; $35k median earnings), where Nursing especially stands out as a relatively lucrative major despite being primarily women.
Despite the outliers, we’re still left to wonder: Is it really true that women earn less than men — even for college graduates? I decided to investigate this issue a little further. Of course, the first step is to make sure that our eyes aren’t fooling us, so I fit a linear regression onto the data and weighted the majors by their number of recent graduates.
Sure enough, there’s a clear and significant negative correlation between a college major’s median year earnings and gender ratio. Let’s try to find out why.
Why do female-dominated majors earn less?
If you look through the list of female-dominated majors, you’ll notice that many of them can be quite difficult to find a job with because they’re so competitive: There are far more graduates than jobs in many of the fields. Could female-dominated majors be earning less because they couldn’t find a job after college? The unemployment rate for each major was included in the data set, so let’s take a look at that correlation below.
For the most part, this idea seems to be busted: There is no significant correlation between the gender ratios and unemployment rates of college majors, and most majors are sitting around the national unemployment rate of 5.5%.
What about underemployment? In his FiveThirtyEight article, Ben Casselman wrote that drama majors (which tend to be female more often than male) are more likely to end up waiting tables than using their degree. Underemployment rate was also available for each major, so let’s take a look.
Yet again, our idea has been busted: There is only a weak correlation between the gender ratios and underemployment rates of college majors, so the typical narrative of useless college degrees doesn’t seem to explain why male-dominated majors earn more than female-dominated ones.
I was a bit lost at this point until I remembered my controversial post from last year.
Back to an old study…
If you read my blog last year (or read the introduction to this post!), you may remember the correlation between quantitative SAT scores (and IQs) and gender ratios of college majors. What if we matched up the quantitative SAT scores — which can be used as a proxy for how quantitatively-focused a major is — with the median earnings for each majord?
(Again, the majors are scaled by the number of recent graduates to provide a sense of relative popularity.)
(For the stats nerds: R^2 = 0.624)
Perhaps this all makes sense now: It seems possible that male-dominated majors — such as Engineering, Physics, and Computer Science — earn more than female-dominated majors because male-dominated majors are often more quantitative in nature. These quantitative majors are often employed by large companies to design products, perform data analysis, manage the company, etc., and their salaries are higher to match the responsibilities of the job.
It’s another question of whether businesses and governments should value the services provided by quantitative majors more than, say, Education majors, but I’ll leave that discussion for another day.
Disclaimer
Of course, correlation != causation, and I’m not trying to make any causative inferences here. We would need to perform controlled experiments if we wanted to establish a causal relationship. I’m simply building a plausible narrative around these correlations in case anyone wanted to explore these correlations in more depth in the future.
Summary
Female-dominated majors tend to earn less than male-dominated majors
This correlation isn’t explained by the employability of the majors
It seems plausible that male-dominated majors are usually paid more because they are more quantitative in nature, which large companies tend to value highly
Alternative explanations
So, what do you think? Do you think this explanation holds, or do you think there’s another explanation at work here? I’ll do my best to describe plausible alternative explanations in this section.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
the remainder when r is divided by t.
17
Suppose 2336*y + 74 = 2337*y. What is the remainder when y is divided by 11?
8
Let h = -48 - -65. Suppose -15*i + h*i - 192 = 0. Suppose 2*m - 2 = 20. What is the remainder when i is divided by m?
8
Suppose 2*z + 5*t - 2872 = 327, 2*z - 5*t = 3149. What is the remainder when z is divided by 106?
103
Suppose 0 = -7*m + 2*m + 1500. Let t(n) = -n**2 + 32*n + 43. What is the remainder when m is divided by t(32)?
42
Let l = 313 + -189. Let q be (-353)/(-3) + (-7)/(-21). Suppose 0 = 2*j - 2*r - 76, r + q = 3*j - r. What is the remainder when l is divided by j?
40
Let d be 2 - ((-5)/1 - -4). Suppose 47 = -d*q + 56. Suppose -3 = q*j - 4*y - 35, -j = 3*y + 11. What is the remainder when 13 is divided by j?
1
Let c(n) = -3*n**3 - 5*n**2 + 3*n - 4. Let d = 13754 - 13696. Calculate the remainder when c(-5) is divided by d.
57
Let p(m) = 14*m**2 + 38*m - 228. Calculate the remainder when p(6) is divided by 57.
48
What is the remainder when 375 is divided by 5 + 1 - ((-197 - -3) + -32)?
143
Suppose 0*j + 43 = 5*j + 4*o, -5*j + 41 = 3*o. Let b = -5 + j. Let m(f) = 3*f**3 + 4*f. Calculate the remainder when m(b) is divided by 13.
6
Suppose 5*q = -3*z + 3*q + 31, -15 = -3*q. Suppose 2*v + 7*w - 170 = 12*w, -3*w = -v + 83. What is the remainder when v is divided by z?
4
Suppose -72*d = -66*d - 30. Suppose -31 = -d*m + 2*o, -17*o + 19*o = -4*m + 32. Calculate the remainder when 258 is divided by m.
6
Let w(q) = 45*q**2 + 3780*q + 57. What is the remainder when 1121 is divided by w(-84)?
38
Suppose -2*p + f + 364 = -0*f, 0 = -3*f. Suppose 13*a - 15*a + p = 0. Calculate the remainder when (-14)/a + 82/26 is divided by 3.
0
Let k(h) = -11*h - 62. Let q = 26 + -37. Let o be k(q). Suppose -32*p - o = -33*p. Calculate the remainder when p is divided by 10.
9
Suppose a + 9180 = -14*a. Let y = -532 - a. Calculate the remainder when y is divided by 46.
34
Suppose 30 = 5*n - 65. Let a(d) = -d**2 + 19*d + 10. Calculate the remainder when 38 is divided by a(n).
8
Suppose 2*l = 4*s - 14, 3*l - 22 = -2*s + 7*l. Calculate the remainder when 17 is divided by 32/(-24)*(-9)/s.
5
Suppose -4*j - 7*y + 1112 = -8*y, -4*j + 1112 = 3*y. What is the remainder when j is divided by 61?
34
Let o = 10199 - 9958. Calculate the remainder when o is divided by 50.
41
Suppose 213*q = -200*q + 10325. Let j = 4 - 10. Let c(o) = -o**2 - 9*o - 8. Calculate the remainder when q is divided by c(j).
5
Suppose -m = 2*h - 3*m + 130, -5*h = 3*m + 293. What is the remainder when (1 + 0 - 2)*(-30 + h) is divided by 31?
29
Suppose -5*k = -3*c + 132, 5*k = c - 4*c + 102. What is the remainder when 1517 is divided by c?
35
Let d(h) = 2*h + 4. Let s = 83 - -2. Let w = -40 + s. What is the remainder when w is divided by d(4)?
9
Suppose -100 = -x + 2*n, 67*n - 66*n = 5*x - 482. Calculate the remainder when 282 is divided by x.
90
Suppose -3*s - 5676 = -2*k, 0 = 4*s - 0*s - 4*k + 7564. What is the remainder when 4/26 + (s/(-26) - -3) is divided by 13?
11
Let g = -3381 - -3733. Calculate the remainder when g is divided by 179.
173
Let s = 1889 + -1355. Calculate the remainder when s is divided by 173.
15
Let f = -13 - -67. Suppose -99 = -8*v + 5*h + 1220, -3*v + 492 = -h. Calculate the remainder when v is divided by f.
1
Suppose -6*t + 146 = f - 9*t, -4*t = -4*f + 592. Calculate the remainder when 662 is divided by f.
66
Suppose -2*f - 106 = -558. Suppose -l = -5*u - 35 + 7, -4*u + 24 = 0. What is the remainder when f is divided by l?
52
Let p be ((-1)/(4/(-374)))/((-44)/88). Let j = 196 + p. What is the remainder when 32 is divided by j?
5
Suppose -7*k - 6 + 27 = 0. Suppose k*c - 123 = d, 11*d - 13*d - 6 = 0. What is the remainder when 277 is divided by c?
37
Suppose -24*z + 20*z = 0. Suppose z = 4*u - 59 - 45. Let c = 3 + u. Calculate the remainder when c is divided by 8.
5
Let p(q) = 5*q + 61. Let m be p(-11). Suppose -73 = -3*z + 2*y, 0 = -z + m*y - y + 7. Calculate the remainder when 44 is divided by z.
17
Let j(b) = -20*b + 24. Let n = -90 - -115. What is the remainder when j(-3) is divided by n?
9
Let q(f) = -f + 14. Let h(v) = -v**3 + 5*v**2 - v - 3. Let d be h(3). Let x be q(d). Suppose 2 = -x*p + 156. Calculate the remainder when p is divided by 13.
12
Suppose -99*s + 95*s = -1760. Suppose 15*l - s = -25*l. What is the remainder when 109 is divided by l?
10
Suppose -5*l = 5*h - 1700, -4*h + l + 778 = -557. What is the remainder when h is divided by 30?
5
Suppose 2*i - 8 = 0, -4*i = -y + 4*y - 382. Suppose 25*q - 4*b = 28*q - 105, -2*q + 75 = b. What is the remainder when y is divided by q?
5
Let a(m) = -5*m**3 + 8*m**2 + 5*m - 9. Let w(b) = b**3 + 2*b**2 - b. Let i(f) = a(f) + 4*w(f). Calculate the remainder when i(16) is divided by 2.
1
What is the remainder when (-309)/(-3) - (3/2)/(180/(-240)) is divided by 30?
15
Suppose 0 = -c - 1 - 1, 64 = -5*a - 2*c. Let q(r) = 23*r**3 + 12 + 12*r - 12*r**3 - 10*r**3 + 13*r**2. What is the remainder when q(a) is divided by 7?
5
Let t = 177 - 174. Suppose n + 2*a - 19 = -4*n, t*n - 6 = -3*a. Calculate the remainder when 103 is divided by n.
3
Let s = -6370 - -6795. What is the remainder when 2982 is divided by s?
7
Let f(l) = -3*l**2 - 32*l + 36. Let o(z) = z**2 + 11*z - 12. Let y(a) = 3*f(a) + 8*o(a). What is the remainder when 99 is divided by y(-3)?
18
Let t(k) = -174*k - 513. Calculate the remainder when 267 is divided by t(-3).
6
Calculate the remainder when 352 is divided by 4/((-180)/25)*-90.
2
Suppose -3*f - 115 = 127*q - 132*q, 2*f - 62 = -2*q. What is the remainder when 44977 is divided by q?
23
Suppose 0*k = 2*k - 10. Suppose -k*h + 309 = -q, 5*h - 6*h + 81 = -5*q. Suppose 1033*r = 542*r + 515*r - 408. Calculate the remainder when h is divided by r.
10
Let n(l) = 25*l + 8. Suppose -j - u + 21 = 0, -53 = -4*j + 5*u + 49. Calculate the remainder when n(3) is divided by j.
14
Let l = 31638 + -31618. What is the remainder when 7178 is divided by l?
18
Let c(z) = -11*z + 4. Let a be c(-5). Suppose -3*t = l - 148, -4*t - 4*l = -65 - 119. Let u = a - t. Calculate the remainder when 14 is divided by u.
6
Let x(m) = -m**2 + 6*m + 4. Let u = -46036 + 46069. Calculate the remainder when u is divided by x(5).
6
Let t = 36 - 22. Let y = t - 10. Calculate the remainder when ((-23)/(-161))/(3/273) is divided by y.
1
Suppose -5*u - 4*a = a - 40, 4*a - 7 = u. Let q(v) = 5*v - 7. Calculate the remainder when 119*-21*(-4)/140*(-50)/(-35) is divided by q(u).
12
Suppose 0 = -22*r - 34*r + 448. What is the remainder when 70 is divided by r?
6
Calculate the remainder when (-12)/34 + (-813072)/(-663) is divided by 56.
50
Let t = 2134 - 1099. Suppose -2*s - 16 = 2*z - 706, -3*z + s = -t. What is the remainder when z is divided by 35?
30
Let m(h) = -2*h**2 - 39*h - 12. Let d be m(-19). Suppose -306 = d*k - 13*k. What is the remainder when k is divided by 9?
6
What is the remainder when 1342 is divided by ((-320)/(-16) + -104)*2/(-3)?
54
Suppose 0 = -485*n - 264282 + 1021637 + 69570. What is the remainder when n is divided by 565?
10
Let i(w) = -w + 9. Let m be i(8). Let r(k) = 50*k**2 - 4*k + 2. What is the remainder when r(2) is divided by m/(1/(-13)*(-9 - -8))?
12
Let g be 87/(-145) + (-18)/(-5). Let j = 107 - g. Calculate the remainder when j is divided by 26.
0
Let r(h) = -h**3 - 6*h**2 + 12*h + 22. Let a(v) = 6*v + 2. What is the remainder when r(-8) is divided by a(2)?
12
Let l = 1746 + -1082. What is the remainder when l is divided by 19?
18
Suppose -5*m - u = -127, m + 2*u = -2*u + 14. Suppose -32*i + 66 = -m*i. Suppose -h - 180 = -7*h. Calculate the remainder when h is divided by i.
8
Let u(s) = -848*s - 1894. Calculate the remainder when u(-4) is divided by 15.
13
What is the remainder when (-4 - -3)/((-2)/10 + (-8896)/(-44680)) is divided by 32?
29
Let d be (6 - 1)*1/((-5)/2). Let m = 7 + d. Suppose -6*l + 8 = -m*l. What is the remainder when l is divided by 5?
3
Suppose -c = 5*f - 1453, 22*c - 1459 = 21*c - 4*f. Calculate the remainder when c is divided by 494.
1
Let d(l) = -l**3 - 3*l**2 + 7*l - 2. Calculate the remainder when (-13*3/(-234)*-9)/(3/(-200)) is divided by d(-5).
9
Let k = -7499 - -7724. Calculate the remainder when k is divided by 113.
112
Let a be (24/(-8) + 146)/(-1 - 0). Let r = a + 196. Calculate the rema
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The fine structure of human embryonic stem cells.
The fine structure of human embryonic stem (ES) cell colonies was analysed by transmission electron microscopy (TEM) after 35 passages of in-vitro culture. Most cells formed compact, saucer-shaped colonies with epithelioid cells on the periphery and polygonal cells within the colony. Three morphological types of cells were identified based on their fine structure: undifferentiated cells resembling inner cell mass (ICM) cells of blastocysts; protein-synthesizing cells at the onset of cellular differentiation; and compact masses of secretory cells resembling unicellular goblet cells of the intestine. The predominant cell type was the undifferentiated ES cells resembling ICM cells of blastocysts. These cells had large nuclei containing reticulated nucleoli, well-developed rough endoplasmic reticulum (RER), Golgi complexes, elongated tubular mitochondria, lysosomes and typical centrosomes with centrioles associated with microtubules and microfilaments, organizing the cytoskeleton. Some ES cells have very large nuclei and scanty cytoplasms with fewer organelles. The isolated or attached protein-synthesizing cells at the onset of differentiation had extensive RER and large Golgi complexes. The morphologically differentiated cells formed compact colonies and resembled goblet-like cells in microstructure. They had RER and large Golgi complexes associated with secretory vesicles. The epithelioid cells at the periphery were columnar and largely polarized by centrosomes associated with Golgi complexes. Epithelioid cells in all three categories had specialized cell junctions (desmosomes), anchored by tonofilaments, and surface blebs. Isolated cells were seen on the surface, towards the centre of the colony, and their free surfaces had microvilli and larger blebs. Approximately 3-5% of all cells were mitotic, with typical bipolar spindles organized by centrosomes, pivotally located at the poles, and appeared to resemble typical somatic cells.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Vascular injuries in pelvic cancer surgery.
Although pelvic cancer surgery is attended by many difficulties, vascular injuries are actually rare. New techniques of isotopic and ultrasound monitoring allow objective assessment of such patients with vascular injury. In venous problems, absolutely precise diagnosis is now possible and in both arterial and venous injury, extra-anatomic reconstructions can be done which return the vascular status of the patient to near normal.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Football
The village of Burwell is well served with football teams from junior level through to adult and veterans teams, and they use the facilities at Burwell Sports Centre to train. Details of all the clubs are listed below.
Burwell Tigers run girls, boys and mixed teams between U8s and U16s and can be contacted via Jack Smith on 07825 999542
Burwell Tigers adult team please contact Jack Smith on 07825 999542.
Burwell Swallows run boys and mixed teams between U8s and U16s and can be contacted via Shaune Bridgeman on 07789 502283.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Specific request for Youtube API from shell
Using bash, I try to retrieve information from my YouTube channel.
curl -G https://www.googleapis.com/youtube/v3/search -d part="snippet" -d q="THISISMYCHANNELID" -d key="THISISMYKEY"
This works quite well, but it doesn't give me the 2 information I need:
-The number of subscribers of the channel
-The number of uploaded videos of the channel
I went trough the official documentation ( https://developers.google.com/apis-explorer/#p/youtube/v3/ ) but I didn't find any relevant query, though I am sure there is a solution for that.
A:
You just need to call Channel List API and use snippet=statistics. From channel model it will give :
"statistics": {
"viewCount": unsigned long,
"commentCount": unsigned long,
"subscriberCount": unsigned long,
"hiddenSubscriberCount": boolean,
"videoCount": unsigned long
}
Using curl & jq, you can use :
curl -G -s https://www.googleapis.com/youtube/v3/channels \
-d part="statistics" \
-d id="UC_x5XG1OV2P6uZZ5FSM9Ttw" \
-d key="your_key" | \
jq -r '.items[].statistics | (.subscriberCount, .videoCount)'
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The housing market is looking robust, and you have your heart set on a bigger home, just up the road. The challenge is selling your house first. It is possible, with the right advice and expertise, to dress a house for sale. Home staging tips will help you showcase...
Your spouse talked you into it, and now you have two pallets of laminate flooring to lay. If you are researching the best tools for doing your job easier, you might stop right now and check out our list of professionals. A professional flooring installer can make...
Do you want to save money on energy bills but don’t know where to start? A good first step is to conduct a do-it-yourself (DIY) energy assessment, also called an energy audit. An audit can identify many of your home’s energy deficiencies, helping you make simple...
Whether you are a novice DIY woodworker or a pro, everyone wants their projects to look professional. If you like woodworking, a brad nailer will be an essential tool for you. With a little experience and know-how, you can make trim work, cabinets and other furniture...
You probably hear about this almost daily in the news – thieves stealing packages from door steps or breaking into homes or garages. Home security is essential for keeping your family and property safe, and protecting your valuables from potential break-ins from...
Categories
Meta
Find The Home Pros role in sharing information to and from the public and private entities is solely as a courtesy and does not constitute an endorsement of either party or promise response or results. Project details provided are those of the requester and no other information is available from Find The Home Pros. It is the requester’s responsibility to conduct due diligence in checking references, company background, and proof of current insurance before hiring a contractor.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Late last Thursday night, two guys rang reader Sean’s doorbell and asked if he’d like to get anything out of his 2007 Jeep Compass before they repossessed it. Since then, Sean has tried to get current on his payments, but Chrysler’s web site snafus have kept him from getting the cash to Chrysler, which won’t let him get his car back unless he forks over hundreds of dollars in fees. Oy. Sean’s story, inside..
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
jQuery tokeninput search across multiple fields
I installed the JQuery token-input plugin. https://github.com/loopj/jquery-tokeninput
Autocomplete is working, but I have a situation where I am search across multiple model attributes. For example, I have a drug Model and the model attributes include name and active ingredient
I am using the meta_where gem to search across multiple fields, and it is working correctly; checking the json output shows that my Drug.where() method is returning the correct result rows. However, on the front-end side, jQuery is populating the autocomplete box with only the name of the drug. How do I get jQuery to display multiple model attributes in the autocomplete box? Ideally, I would like to display something like "model.name (model.active_ingredient)" in the autocomplete dropdown. Right now, jQuery tokeninput is fetching the correct rows, but displaying only the name. How do I get the other attributes of the model to show up?
Thanks
A:
you could combine the name and active_ingredient for the json,
because, all you can use is the name: "Aspirin (Mentol)"
when you return it from the controller, and seperate it, like you need it.
(in your Drug model)
def fullname
"#{name} (#{active_ingrdient})"
end
all you need is to set the name: parameter in the json fill with your fullname attribute
format.json do
render :json => @drugs.map { |drug| drug.as_json(:only => :id, :methods => :name) }
end
to set it manually:
format.json do
render :json => @drugs.map { |drug| {:id => drug.id, :name => drug.fullname} }
end
hope that helps you further
| null |
minipile
|
NaturalLanguage
|
mit
| null |
THE lights will go off in the Brisbane CBD today in a power shutdown of a magnitude not seen since the 1974 floods.
The city's massive power grid will be shut down from 7am, sending 100,000 homes and businesses into darkness.
The drastic measure means virtually every CBD business or home will be powerless.
Power provider Energex has decided to play it safe and before a rising Brisbane River peaks again this afternoon.
It fears a serious health risk would follow if its underground substations, many near the river, are inundated.
About 12 high-power substations that normally each surge with 110,000 volts will be turned off.
Energex crews intend to inspect the sub-stations after the afternoon’s peak high tide to assess the amount of damage and to determine the re-energisation timetable.
Ipswich CBD and inner-city suburbs will also be shut down from 11pm last night.
There are currently 22,000 southeast Queensland properties without power.
There are also thousands more in flooded areas just outside the southeast, including Toowoomba.
Energex spokesman Mike Swanston said safety was the key issue and thanked residents for their patience while repair crews toiled in trying conditions.
"No one should never underestimate the old adage that power and water don't mix, and as water continues to rise Energex will be taking a safety first approach under these extreme weather conditions," Mr Swanston said.
"Similarly, as the weather worsens overnight, power interruptions caused by winds blowing tree branches onto powerlines and other extreme conditions are expected to continue.
"But we ask customers to remain patient as our crews work around the clock in the in heavy rains and high winds."
Mr Swanston urged people with medical conditions that rely on electrical-powered equipment, as well as refrigerated medications, to keep in close contact with their medical practitioner and seek advice.
Mr Swanston added that people who see damaged or threatened power infrastructure should stay well clear and call Energex's priority line on 13 19 62.
He also urged the public to keep out of flood waters near any electrical equipment and stay away from fallen powerlines.
Originally published as Brisbane switches power off
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Friday, November 26, 2010
Now this pie is pure fat and sugar. So if you are watching your figure...your blood sugar..or anything this is definitely not for you...but boy oh boy it was yummy! And once a year...why not splurge!!!!! Now I would suggest if you are going to make this, to get two people to do it. I would have had a heck of a time trying to do this by myself so I enlisted Dave's help! It was definitely needed!!!
Heat 1/4 cup heavy cream for the crust in a small saucepan over medium until it bubbles around edges of pan. Place cocoa powder in a bowl, stir in cream; set aside. Beat cubed butter and 10 tbsp powdered sugar in bowl of a stand mixer with a paddle attachment until smooth. Beat in cocoa mixture, half the flour, and 1 egg yolk until smooth. Beat in remaining flour just until combined. Shape dough into a disk, wrap in plastic wrap, and refrigerate at least 1 hour or overnight. Roll chilled dough on a lightly floured surface to 1/4 inch thick; transfer to a 9 - inch pie plate. trim overhang to 1 inch and roll edge under itself. Cover crust with plastic wrap and freeze 15 minutes. Preheat oven to 375 degrees. Place a piece of parchment paper or aluminum foil inside pie shell and fill with pie weights. Bake pie shell 25 - 30 minutes. Remove parchment and weights and bake the crust until crisp and dry, 5 - 10 minutes more; set aside. Sprinkle walnuts on bottom of crust.
Whisk together milk, cornstarch, and salt for slurry in a bowl; set aside. Brown 10 tbsp butter for the filling in a saute pan over medium heat, about 15 minutes. Add brown sugar and golden syrup; bring to a boil. Boil 3 minutes; whisk in boiling water until smooth, boil 1 minute more. Whisk slurry into sugar mixture and increase heat to medium-high. Cook, whisking constantly, until mixture comes to a boil, about 5 minutes; cook 1 minute more and remove from heat.
Beat heavy cream for the topping in a bowl with a hand mixer on medium to soft peaks. Add 1/4 cup powdered sugar and 2 tsp whiskey, beating until combined. Top pie with whipped cream and garnish with the Heath crunchies.
Now some of you may say "Ewww" to my next dish, but they were sooooo yummy!! I found this recipe in the Cuisine Magazine, but changed it up a bit. As soon as I said Brussel Sprouts, Dave said "Bacon?". Well the recipe didn't call for bacon so I added it. It also said to roast in the oven and since I had dressing, green bean casserole and rolls in the oven, PLUS the turkey, I had to improvise and actually fake roast them in cast iron pot on the stove, but they turned out so yummy I wanted to share them with you:
2 lbs brussel sprouts, trimmed and halved
1 tbsp, olive oil, salt and pepper
5 slices of maple bacon, chopped
1/4 cup minced shallots
8 oz mushrooms, sliced (if you have them)
½ cup of chicken stock or white wine
1 cup heavy cream
In a Dutch oven pot, cook the chopped bacon until crisp.
Remove the bacon. Using the grease from the bacon (adding a bit of olive oil if
you don’t have enough grease) add the shallots and garlic. Sauté till tender. Add
the mushrooms and sauté till tender. Deglaze the pan with the chicken stock or
the white wine. Add the Brussels sprouts and cook over medium heat until they
are tender and start to become a golden brown. Mine were kinda large, so this
took about 30 minutes. Add the heavy
cream bring to a boil. Salt and pepper to taste. It was heavenly! The sauce browned a bit..Yum!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Epidemiology of ovarian cancer.
What factors influence a woman's chances of developing or avoiding ovarian cancer? Because early diagnosis is so difficult and this disease is usually diagnosed only in the late stages where treatment usually fails, physicians and women are becoming increasingly interested in answering this question. As a result of two studies conducted over the last fifteen years, certain risk factors have been identified, showing that a woman has a greater chance of developing ovarian cancer if she is white, married, has a family history of the disease, has no children or has a history of difficulty in conceiving, and has menopausal hot flashes. Chances of developing the disease are also greater in women who have a primary breast or colon tumor. Clinical conditions were utilization of these risk factors may contribute to the reduction of morbidity and mortality of ovarian cancer are suggested.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Change SASS or LESS variable value at runtime
I am actually trying to make a web app using ASP MVC to support some dynamic color setting. For example, admin can set theme colors for specific user groups. When admin saves the new color codes, those new color codes need to be saved in CSS. So users login they will see different colors based on their group.
For this, I am thinking of using SASS or LESS. It would be easier if I can easily set variables in SASS or LESS to new color codes in Save action.
So my questions is...
How can I retrieve variables from SASS or LESS file and set new value to the variables? Is there a library for this? I have checked BundleTransformer and dotless. But I still don't know if these library support handling variables.
If I can update variables in SASS or LESS, will it be compiled on any change?
And what can I do for the cached CSS on client side?
I would really appreciate it if you guys can give me any better or other approaches.
Thanks,
A:
If you're targeting only users with modern browsers, CSS has experimental variable support (see Can I use.. data). Here's an example of from MDN:
:root {
--main-bg-color: pink;
}
body {
background-color: var(--main-bg-color);
}
If you took this approach, you would only have to insert the colour variable into a simple stylesheet, and CSS would do the rest:
<style>
:root {
--group-colour: {{ groupColour }}
}
</style>
<link rel="stylesheet" href="/path/to/stylesheet/with/variables.css">
For more information on CSS variables, see MDN's CSS var() documentation.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
GEOS managed to offer nearly all the functionality of the original Mac in a 1 MHz computer with 64 Kilobytes of RAM. It wasn't an OS written to run on a generic x86 chip on a moving hardware platform. It was written using immense knowledge of the hardware and the tricks one could use to maximise speed. Note:After a small break, here is another one of the articles for the Alternative OS contest.
It had a postscript-like imaging model, complete with outline font technology and separate rotation, translation & scaling matrices for both the application and the UI. (a leaf from Mac OS X's book; 10 years before)
Here it sounds like GEOS did this 10 years before anybody else, which is a bit far fetched. Mac OSX is really NeXTstep version 5. NeXTstep had real display postscript right from the start, and had its first release in 1988. I think this makes for a closer race than the article indicates.
I don't know the history of GEOS, but I gather that it was originally released in 1986. Did it incorporate the "postscript-like imaging model" at this point? Did it even have it before NeXT? (And postscript-like doesn't mean actual Postscript(tm), right?)
I can't say I know a lot about NeXT systems, so indeed, you may be true. There are two main strains of GEOS, the 6502 version, and the x86 version. Both are entirely different operating systems. PC/GEOS which included the object orientated UI model, was started around 1989.
PC/GEOS's UI model had a few extra tricks up its sleeve though. PC/GEOS's UI was entirely object orientated. When Brian describes being able to change one thing into another, he isn't talking about fancy skins. The UI elements in an app were described in data, and the UI would represent that data according to the UI being used.
For example, a menu in a program could be realised as a menu, or a bullet list, or a folding tree structure, or, anything you could imagine with that dataset. This goes far beyond simple skinning in KDE, or even Cocca on OS X.
Thanks for elaborating, this sounds really interesting. The UI is data in Cocoa as well though. It sounds like GEOS and NeXT has alot in common here.
My comment on the "10 years before" business is strengthened by your reply. Mac OS X is a direct descendent of a system which had display postscript before GEOS picked up a similar idea. Apple reimplemented it as display PDF, but that was only done because the license fees involved with Postscript made the system too expensive for the home user market.
To continue on with the UI concepts. The UI had about a dozen basic classes you could pick from. You would create the object you wanted, and specify hints that told the OS what the object was for. The OS would figure out how to visually represent the object.
It really made UI programming so much simpiler than in other GUIs, where you have a seperate class with a different API for each variation of widget.
Also, by default, the UI of a GEOS app ran on a seperate thread from the processing. That made sure the UI always ran smoothly.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A desaceleração econômica que ocorreu devido ao coronavírus e o potencial de uma guerra de petróleo pode se transformar em uma recessão que derrubará o Bitcoin e os mercados tradicionais.
De acordo com Joachim Fels, conselheiro econômico global da Pacific Investment Management Co., a desaceleração rapidamente se transformará em recessão . [Bloomberg]
O estrategista e consultor haviam declarado anteriormente que a chance de recessão era de apenas 35%. No entanto, com o surto do coronavirus , e o subseqüente resultado econômico impactos, o futuro é muito mais sombrio do que antes.
Problemas no Paraíso de Crédito
Enquanto Fels acredita que a recessão provavelmente seria breve devido à rápida expansão e contração do impacto viral – ela poderia continuar. Em particular, Fels deixou claro que a situação de crédito nos EUA era preocupante, afirmando: “Estamos preocupados com possíveis fissuras no ciclo de crédito dos EUA em um ambiente de fluxos de caixa corporativos cada vez menores, o que poderia levar a um forte aperto nas condições financeiras que retornar à economia real “.
O impacto do aperto no crédito, associado à redução no fluxo de caixa, pode ser dramático. Como a liquidez no mercado continua a diminuir, uma contração da economia seria a única resposta às reduções de gastos corporativos.
Resposta do Bitcoin
Embora a economia possa entrar em uma recessão substancial, alguns esperam que o Bitcoin permaneça estável. Na semana passada, parecia mostrar que o Bitcoin tinha poder de permanência, pois se separou do mercado de ações.
No entanto, o fim de semana revelou que a criptomoeda estava seguindo os passos do Dow com perdas maciças. Somente no domingo, um declínio de mais de 10% deixou os comerciantes fieis de Bitcoin cambaleando .
Em meio a ameaças de sair completamente do mercado, muitos comerciantes se viram segurando sacolas. Vários comerciantes tinham entrado em janeiro , esperando retornos no pré halving.
No entanto, como forças econômicas externas desligam o crescimento, o ativo digital sofreu perdas dramáticas. Até o momento, o preço do Bitcoin era de US $ 7.900.
Para manter-se informado, tendo a sua disposição conteúdo constante e de qualidade, não deixe de acompanhar nosso site. Aproveite e faça parte da nossa página de criptomoedas no Twitter.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A small business devoted to the creation of custom sewing and knitting creations.Specializing in medieval, renaissance, and fantasy garb. Also handles weddings and graduations. We're based in Winnipeg, Manitoba, Canada, but we ship worldwide. Just ask!
Items posted on the main page are available for purchase unless otherwise indicated. If you'd like to purchase an item shown, send me a message indicating which country you live in and I'll quote you a shipping price. All payments are processed through Paypal only. If you're looking for a custom item, let me know the specifics and I'll quote you a total price. Custom items typically take 6 weeks to produce after payment is received. Keep this in mind when asking for custom orders.
Friday, December 26, 2014
Well, winter has set in around here. It's not going to let us go until at least March (though May has become more common in recent years), so it's coats for everyone. That includes our four-legged friends. In our house, that means the dogs and cats.We have poodles, toy poodles to be exact, so it's important that the little guys (and girls) and warm enough. Since it routinely gets to forty below in the winter, "warm enough" is a relative term. Still, we have to try, so this time every year I break out the fleece and get to work.
If you want to make a dog sweater (or a cat sweater) yourself, it's actually not all that hard. You don't even need a pattern, though patterns for pet sweaters can be found at most fabric stores. At home, however, I don't bother with a pattern. I simply get out the fabric I'm looking for and have the dog (or cat) in question lie still on the flat fabric. I can then trace the pet, making sure to leave enough ease so the sweater fits when I'm finished. I even add a hood, though since the animals hate hoods, this step is only for my own entertainment.
Once I have two pieces cut (because all pets have two sides, let's remember), The rest is easy. Sew it all together, making sure to leave enough room in the belly to get the sweater on the dog (I don't do Velcro or elastic for pet sweaters because the cat eats both).
I really wish I had a picture of one of the cats in a sweater, but they seem camera shy. Or maybe they're embarrassed. I did use pink bunny fleece for both of them...and they're boys.
Friday, September 12, 2014
Birds make excellent pets, but they do have a tendency to make a racket in the early morning. The rising sun gets them up, and they seem to have an innate need to greet the day the very second the sun sneaks above the horizon. This can be annoying, but fortunately it's a very simple thing to fix.
If you can convince your bird that it's actually still dark out, he will remain quiet until a decent hour. This is where bird cage covers come in. Sometimes you'll get lucky and have a cover come with the cage you bought. Unfortunately, most cages don't actually come with a cover. This is why I make them for avid bird lovers.
I can make them in just about any color. The first picture is for a parrot cage with a play apparatus on top. These types of cages take a little more measuring and have to be made with a little more care. The fabric is a navy cotton striped with red (though you can't really see the red in the picture). Perfect measurements are the key to this cage.
The second cage, made out of a purple cotton, is more standard. This budgie cage is just square with a handle for hanging or carrying on the top. These cage covers are easier, though accurate measuring is still essential. The cage has to leave room for the hanger, of course, so this is always taken into account when making covers of this nature.
Both styles close easily with Velcro. You can make them yourself, if you're so inclined, with some dense fabric (of a type that won't smother the bird, of course) and heavy-duty Velcro. If you're really concerned about your bird getting all noisy in the morning, line your bird cage cover with either the same fabric or a lining fabric to block out the most light.
Friday, June 27, 2014
The stitch and pink seam finish is quick and easy, but it's really only useful for fabrics that are tightly woven. Fabrics that fray are not a good match for this seam, and knitted fabrics absolutely should not be finished this way (unless you want your project to unravel). With the appropriate fabric, however, this seam finish will work well enough.
The term 'pink' refers to a set of pinking shears, so you'll need a sharp set for this seam finish. But before breaking out the pinking shears, stitch ¼" from the raw edge of the seam allowance. You can use either a simple straight stitch or a zigzag. Now use the pinking shears to trim the excess fabric away. Don't get too close to your line of stitching or you risk cutting your stitching. If you can avoid this particular problem, your stitch and pink seam will hold as well as any other.
Friday, June 13, 2014
There are few seams in the world easier than a simple pink seam, especially because the pink seam doesn't require any actual sewing. This method is fast and efficient, but it's really only designed for tightly woven fabrics that won't fray even when worn several times. If you have a fabric that frays, pick a different seam.
Still, a pinked seam is useful, especially when you're in the middle of a project. To complete this seam, simply press the seam into its open position, then find a pair of good pinking shears. They must be sharp. If they're not, you'll only damage your fabric. Use the pinking shears to trim the seam allowance raw edge, but don't get too close. You don't want to cut anywhere near the actual seam.
Saturday, April 26, 2014
This corset-style gown spent most of its time in the back room, occasionally being used as a display model(floor model) around Halloween for a few years. It was never worn, but did spent some time on a mannequin. We've changed our Halloween display, and that means selling off the old display items. Also, we no longer have these fabrics available, so there won't be any more of these gowns (in these particular colors) once this last one is gone.
This gown is constructed out of a heavy black cotton blend. The accents are a tangerine damask cotton with an embossed rose print. The roses are hard to see in the photo unless you look closely, but they are there. This gown is corset-style, but bear in mind that it doesn't give any real support. Appropriate undergarments will still be required as the ribbons are for decorative purposes only. The ribbons can be pulled to make the gown slightly smaller than the indicated measurements.
The orange belt in the picture is attached to the gown and cannot be removed. It can, however, be tied either in front of the gown or behind it. Tying the belt in a bow behind the body is a more classic look, but I pulled the belt to the front so it could be easily seen. The belt can help to make the gown fit you more exactly. This gown is designed for Halloween wear, as evidenced by the colors, but you could wear it for other events throughout the year as well.
There is decorative black stitching along the neck and around the sleeves that cannot be seen in the picture. The sleeves are tight until the flounce. The flounce is vibrant and fun and will cover the hand on most wearers.
The gown's approximate measurements are as follows:
Bust: 36"
Waist: 28"
Hips: 38"
Since this is a floor model, there might be some minor markings, but I can't see any. I would consider this gown to be in near-perfect condition These gowns retail for $99.99, but since it's a floor model bidding starts at well under half that price.
Friday, April 25, 2014
This turquoise cloak spent 18 months as a display cloak (floor model). It was never worn, but did spent most of that time on a mannequin. A change in the colors in the shop means this cloak is now for sale. Also, we no longer have these fabrics available, so there won't be any more of these cloaks (in these particular colors) once this last one is gone.
The shell of this medieval cloak is a turquoise damask cotton with an embossed rose print (which is almost impossible to see in the photo). The lining is thick white cotton with an embossed dandelion print. Again, this is hard to see in the photo. Both fabrics are fairly heavy, making this a wonderfully warm cloak. It closes with a pewter clasp and has a lovely drape due to the weight of the fabrics used in its construction.
The cloak itself is large enough to fit most people. I would call it a large cloak, but it can be worn by most adults who wear size large or smaller. It will brush the floor on anyone under 5'6"tall. If you're shorter than that, it will drag on the floor. This gothic cloak is definitely considered full-length. The hood is large and deep (though thrown back in the picture).
Since this is a floor model, there might be some minor markings, especially on the lining. The markings on the lining are not noticeable when the cloak is worn. The shell is in near-perfect condition with no marks that I can see. These cloaks retail for $59.99, but since it's a floor model bidding starts at less than half that price.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Sorry, this property has been leased. To view more rental properties click here
City Tower 33rd floor, 183 City Rd: The Lifestyle You Will Adore!
221
Do not miss the opportunity to rent this modern and spacious two bedroom apartment on the 33rd floor of 'City Tower' with spectacular views towards the bay, Albert Park lake & Docklands. Only a short walk away from Crown Entertainment Complex, South Melbourne Market, convenience stores and public transport, this truly is the perfect location!
**** IMPORTANT! REGISTER TO INSPECT PROPERTIES ****
By registering your details you will be INSTANTLY informed of
any updates, changes or cancellations for your property appointment.
If no one registers for an inspection time then that inspection may not proceed.
DON'T MISS OUT
Book for an inspection time today by sending us a message!
****
Accommodation: Comprising spacious open plan living and dining area with air conditioning leading out to your own private balcony. Modern kitchen with dishwasher, granite benchtops & glass spashbacks. Very good sized bedrooms mirrored built in wardrobes, master with ensuite and walk in robes. Sparkling central bathroom with concealed laundry facilities including dryer.
Features: Floor to ceiling windows throughout the apartment, security tag entry, 7 day concierge service and one secure under cover car space. Enjoy use of resort style facilities including 25m indoor swimming pool, tennis court & large fully fitted gymnasium.
Please call us on 03 9697 8800 or email [email protected] to arrange for an inspection!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
AppEngine: Memcache without any instance
My problem is my memcache resets every night. What could the be problem?
I have a very simple low-traffic web site on Google App Engine in Java. I do not have any instances left at night because of lack of traffic. If there is no instance, does it mean that memcache clears all its data?
A:
Memcache is not persistent and can be evicted by memory pressure. Share memcache is shared with other apps. You can buy dedicated memcache for reserved amount. What you described does not seem to be a problem at all.
One important question is, what is the timeout that you set?
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Chylous ascites after liver transplantation with mesentero-portal jump graft.
Chylous effusions and lymphatic leaks occur after trauma, malignant disease, primary lymphatic disorders, and parasitosis, and rarely after abdominal surgery. Chylous ascites after orthotopic liver transplantation is a rare complication. We report a case of chylous ascites occurring after hepatic transplantation with a mesentero-portal venous jump graft, successfully treated with conservative management.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Not registered yet? !! History Commons Alert, Exciting News
Global Search General search criterion Search for: Events
Entities
Essays
Topics
Timelines
Projects
Search for:
Titles / Names
Descriptions
Period: Added: Last changed: Criterion specific to events Project: -- none -- US Solar Industry Global Financial and Economic Crisis 2007-Present Complete 911 Timeline US Electoral Politics US Civil Liberties US Health Care System US Domestic Terrorism Climate Change and Global Warming Football Business and Politics War in Afghanistan Iraq Under US Occupation Events Leading Up to the 2003 Invasion of Iraq Prisoner Abuse in Iraq, Afghanistan and Elsewhere Domestic Propaganda and the News Media US International Relations Neoconservative Influences on US Policies US Confrontation with Iran 2001 Anthrax Attacks Iran-Contra and Arms-for-Hostages Scandals Alleged Use of False Flag Attacks by Intelligence Agencies Nixon, Ford, and Watergate Genetic Engineering and the Privatization of Seeds The Struggle for Kosovar Albanian Self-Determination US Environmental Issues Environmental Impact of the 9/11 Attacks Neoliberalism and Globalization Hurricane Katrina Water Privatization History of US Interventions A. Q. Khan's Nuclear Network 2004 Ousting of Jean-Bertrand Aristide US Military Bush administration's treatment of US troops Threats to Food Safety Mental Health Care in the United States Peak Oil 9/11 Timeline Miscellaneous Entries 2008 Mumbai Attacks Topic: -- none -- Regions Africa Asia Caribbean Central America Europe Middle East North America Oceania other South America Southeast Asia Topics Economy Education Governance Health International Affairs Media Military Affairs Nature Society Timeline: -- none -- 1993 Branch Davidian Crisis 2000 Elections 2001 Anthrax Attacks 2004 Elections 2008 Elections 2008 Mumbai Attacks 2010 Elections 2012 Elections 9/11 Timeline A. Q. Khan's Nuclear Network Alleged Use of False Flag Attacks Civil Liberties Complete 911 Timeline Domestic Propaganda Elections Before 2000 Environmental Impact of 9/11 Events Leading to Iraq Invasion Food Safety Football Business and Politics Global Economic Crises Global Warming Haiti Coup Hurricane Katrina Inslaw and PROMIS Iran-Contra Affair Iraq under US Occupation Kosovar Albanian Struggle Neoconservative Influence Neoliberalism and Globalization Niger Uranium and Plame Outing Nixon and Watergate Other Health Care Systems Seeds Torture of US Captives Treatment of US troops US confrontation with Iran US Domestic Terrorism US Environmental Record US Health Care US International Relations US Mental Health Care System US Military US Solar Industry US-Bolivia (1951-2000) US-Brazil (1961-2003) US-Britain-Diego Garcia (1770-2004) US-Britain-Guyana (1953-1992) US-Cambodia (1955-1993) US-Chile (1964-2005) US-Congo (1959-1997) US-Cuba (1959-2005) US-Dominican Republic (1959-2005) US-El Salvador (1980-2002) US-Ghana (1952-1966) US-Guatemala (1901-2002) US-Haiti (1804-2005) US-Indonesia-East Timor (1965-2002) US-Iran (1952-1953) US-Iraq 1980s US-Laos (1958-1973) US-Nicaragua (1979-) US-Panama US-Venezuela (1948-2005) US-Vietnam (1947-2001) War in Afghanistan Water Category: -- none -- 'War on Terrorism' Outside Iraq - Counterterrorism Action After 9/11 'War on Terrorism' Outside Iraq - Counterterrorism Policy/Politics 'War on Terrorism' Outside Iraq - Destruction of CIA Tapes 'War on Terrorism' Outside Iraq - Escape From Afghanistan 'War on Terrorism' Outside Iraq - High Value Detainees 'War on Terrorism' Outside Iraq - Internal US Security After 9/11 'War on Terrorism' Outside Iraq - Afghanistan 'War on Terrorism' Outside Iraq - Terror Alerts 'War on Terrorism' Outside Iraq - Drone Use in Pakistan / Afghanistan 2004 Electoral Politics - Campaign Financing 2004 Electoral Politics - Election Fraud / Media Malfeasance 2004 Electoral Politics - Media Coverage of Electoral Events 2004 Electoral Politics - Other 2004 Electoral Politics - The Politics of Terror 2004 Electoral Politics - Voter ID/Outreach 2004 Electoral Politics - Washington Gubernatorial Race A. Q. Khan's Proliferation Network - Britain A. Q. Khan's Proliferation Network - Iran A. Q. Khan's Proliferation Network - Libya A. Q. Khan's Proliferation Network - Netherlands A. Q. Khan's Proliferation Network - North Korea A. Q. Khan's Proliferation Network - Other Countries A. Q. Khan's Proliferation Network - Turkey / Sibel Edmonds Allegations A. Q. Khan's Proliferation Network - United Arab Emirates A. Q. Khan's Proliferation Network - USA Abortion - Abortion controversy & violence Actual Anthrax Attacks - Fraudulent Anthrax Attacks Actual Anthrax Attacks - Real Anthrax Attacks Aiding the Contras - Aid for Nicaraguan Contras Aiding the Contras - Arms Sales Profits to Contras Aiding the Contras - Third-Party Funding Al-Qaeda by Region - "Lackawanna Six" Al-Qaeda by Region - Al-Qaeda in Southeast Asia Al-Qaeda by Region - Al-Qaeda in Germany Al-Qaeda by Region - Al-Qaeda in Italy Al-Qaeda by Region - Al-Qaeda in Spain Al-Qaeda by Region - Al-Qaeda in Balkans Al-Qaeda by Region - Islamist Militancy in Chechnya Albania's struggle for independence - Independent Albania Albania's struggle for independence - National Awakening Albania's struggle for independence - The Cold War Albania's struggle for independence - World War II and After Albanians in Macedonia - National Liberation Army Albanians in Macedonia - Albanians in Yugoslav Macedonia Alhazmi and Almihdhar: Specific Cases - Bayoumi and Basnan Saudi Connection Alhazmi and Almihdhar: Specific Cases - Bayoumi and Basnan Saudi Connection Alhazmi and Almihdhar: Specific Cases - CIA Hiding Alhazmi & Almihdhar Alhazmi and Almihdhar: Specific Cases - CIA Hiding Alhazmi & Almihdhar Alhazmi and Almihdhar: Specific Cases - Search for Alhazmi/ Almihdhar in US Alhazmi and Almihdhar: Specific Cases - Search for Alhazmi/ Almihdhar in US Alleged False Flag Operations - Algeria Alleged False Flag Operations - Indonesia Alleged False Flag Operations - Israel / the Mossad Alleged False Flag Operations - Other / Unknown Alleged False Flag Operations - Russia Alleged False Flag Operations - The Balkans Alleged False Flag Operations - The Philippines Alleged US False Flag Operations - Alleged US False Flag Attacks Alleged US False Flag Operations - Anabasis Operation in Iraq Alleged US False Flag Operations - Related US Policy Before 9/11 - 1993 WTC Bombing Before 9/11 - Alleged Israeli Spy Ring Before 9/11 - Counterterrorism Action Before 9/11 Before 9/11 - Counterterrorism Policy/Politics Before 9/11 - Insider Trading/ Foreknowledge Before 9/11 - Insider Trading/ Foreknowledge Before 9/11 - Military Exercises Before 9/11 - Military Exercises Before 9/11 - Other Pre-9/11 Events Before 9/11 - Other Pre-9/11 Events Before 9/11 - Pipeline Politics Before 9/11 - Pakistani ISI Links to 9/11 Before 9/11 - Soviet-Afghan War Before 9/11 - Warning Signs Before 9/11 - US Air Security Before 9/11 - Warning Signs Case studies - drugs - Ketek Case studies - drugs - Paxil Case studies - drugs - Vioxx Case studies - drugs - Zoloft Cases studies-GM Crops - Afghanistan Cases studies-GM Crops - Argentina Cases studies-GM Crops - Brazil Cases studies-GM Crops - India Cases studies-GM Crops - Indonesia Cases studies-GM Crops - Mexico Cases studies-GM Crops - Zambia Cases studies-Other - Iraq Cases studies-Other - Seed Sector Review Cases studies-Other - Terminator seeds Cold War - US Policy Towards Soviet Union Companies - Bechtel Companies - Blackwater USA Companies - Custer Battles Companies - Delta & Pine Land Companies - Halliburton Companies - Monsanto Companies - Syngenta Conflicts of interest - Clinical drug studies Conflicts of interest - FDA advisory panels Conflicts of interest - Political appointments Conflicts of interest - Published studies Corporate Interests - Agribusiness Corporate Interests - Automobile industry Corporate Interests - Cattle Industry Corporate Interests - Coal Industry Corporate Interests - Energy industry Corporate Interests - Factory farms Corporate Interests - Mining industry Corporate Interests - Oil and gas industry Corporate Interests - Snowmobile Industry Corporate Interests - Timber industry Counterproliferation Officials Working against A. Q. Khan Network - Atif Amin Counterproliferation Officials Working against A. Q. Khan Network - Richard Barlow Counterproliferation Officials Working against A. Q. Khan Network - Valerie Plame Wilson Counterterrorism before 9/11 - Counterterrorism Action Before 9/11 Counterterrorism before 9/11 - Counterterrorism Policy/Politics Counterterrorism before 9/11 - Hunt for Bin Laden Countries and Regions - Chile Countries and Regions - Haiti Countries and Regions - Mexico Countries and Regions - US Criticism and Retaliation - Exposure of Plame Wilson Criticism and Retaliation - Joseph Wilson's Criticism Criticism and Retaliation - Novak Outing of Plame Wilson Criticism and Retaliation - Gov't Attempts to Discredit Wilson Criticism and Retaliation - Gov't Cover-Up of Leak Criticism and Retaliation - Gov't Involvement in Leak Criticism and Retaliation - White House Leak of Classified Info Criticism and Retaliation - Gov't Propaganda, Pressure Criticism and Retaliation - Wilsons' Lawsuit v. Cheney, Libby Crops - Canola Crops - Corn Crops - Cotton Crops - Potatoes Crops - Rice Crops - Soybeans Crops - Wheat Cuban health care system - General history Cuban health care system - Women's health Day of 9/11 - All Day of 9/11 Events Day of 9/11 - All Day of 9/11 Events Day of 9/11 - Alleged Passenger Phone Calls Day of 9/11 - Flight AA 11 Day of 9/11 - Flight AA 77 Day of 9/11 - George Bush Day of 9/11 - Dick Cheney Day of 9/11 - Dick Cheney Day of 9/11 - Donald Rumsfeld Day of 9/11 - Donald Rumsfeld Day of 9/11 - Flight AA 11 Day of 9/11 - Flight AA 77 Day of 9/11 - Flight UA 175 Day of 9/11 - Flight UA 93 Day of 9/11 - George Bush Day of 9/11 - Passenger Phone Calls Day of 9/11 - Pentagon Day of 9/11 - Pentagon Day of 9/11 - Richard Clarke Day of 9/11 - Richard Clarke Day of 9/11 - Shanksville, Pennsylvania Day of 9/11 - Shanksville, Pennsylvania Day of 9/11 - Training Exercises Day of 9/11 - Training Exercises Day of 9/11 - Flight UA 175 Day of 9/11 - Flight UA 93 Day of 9/11 - World Trade Center Day of 9/11 - World Trade Center Development of Pakistani Nuclear Program - A. Q. Khan's Career Development of Pakistani Nuclear Program - Pakistani ISI Links Development of Pakistani Nuclear Program - Progress with Pakistani Nukes Disaster Management Legislation Relevant to Katrina - Legislation Documents - Internal Memos/Reports Documents - Presidential Directives Drug Economy - Drug Economy Drug Economy - US Counter-Narcotics Operations Drug industry - Intellectual property Drug industry - Disregard for Public Safety Drug industry - Fraud Drug industry - Manipulation of data Drug industry - Marketing Election Propaganda - Obama 'Birther' Controversy Election Propaganda - Propaganda from Candidates, Parties Election Propaganda - Propaganda from Media Election Results - Election Results Election Results - Voting Issues Election themes - Absentee votes Election themes - Diebold Election themes - Electronic voting Election themes - Exit polls Election themes - Florida Legislation intervention Election themes - Irregularities Election themes - Legal action Election themes - Long lines Election themes - Resource allocation Election themes - Optically scanned votes Election themes - Other Election themes - Political strategies Election themes - Punch-card voting machines Election themes - Recounts Election themes - US Supreme Court intervention Election themes - Voter intimidation and harassment Election themes - Voter registration issues Emergency Preparedness/Response Plans - Evacuation Emergency Preparedness/Response Plans - Recovery Emergency Preparedness/Response Plans - Response Emergency Preparedness/Response Plans - Shelter Entries by Country or Region - Czech Republic Entries by Country or Region - England Entries by Country or Region - Italy Entries by Country or Region - Spain Espionage - Classified Information to Israel Events in Economic History - 1980s Savings and Loan Crisis Events in Economic History - 2011 US Credit Default Events in Economic History - Oil and OPEC Events in Economic History - Other Events in Economic History Events in Economic History - US Financial Deregulation Events in Economic History - US Monetary Policy Execution of Emergency Plans - Other States' Assistance Execution of Emergency Plans - Emergency Response Execution of Emergency Plans - Evacuation Execution of Emergency Plans - Sheltering Failing Companies: Specific Cases - Northern Rock Failing Companies: Specific Cases - AIG Finance - Private Finance Finance - Public Finance Foreign Relations - Iran-Afghan Relations Foreign Relations - Pakistan-Afghan Relations Foreign Relations - US-Taliban Relations Freedoms and Responsibilities - Airport and Immigration Security Freedoms and Responsibilities - Citizenship Rights Freedoms and Responsibilities - Freedom of Speech / Religion Freedoms and Responsibilities - Impositions on Rights and Freedoms Freedoms and Responsibilities - Gun Rights Freedoms and Responsibilities - Media Freedoms Freedoms and Responsibilities - Privacy Freedoms and Responsibilities - Taxation General - Abortion-Based Rhetoric and Actions General - Allegations of War Crimes General - Anti-Communist Rhetoric and Actions General - Anti-Government Rhetoric and Action General - Anti-Health Care Reform General - Anti-Semitic Rhetoric and Actions General - Anti-Tax Rhetoric and Actions General - Biological Weapons Programs General - Chemical Weapons Programs General - Diplomacy and Geopolitics General - Environmental Activism General - Environmental Treaties General - Faith-Based Rhetoric and Actions General - Gender-Based Rhetoric and Actions General - Global Media General - International Criminal Court General - Israel/Palestine Conflict General - NATO General - Neoconservatives in Foreign Policy General - Nuclear Nonproliferation Efforts General - Nuclear Weapons Treaties General - Other General - Other Weapons Programs General - Race and Ethnic-Based Rhetoric General - United Nations General - US and International Terrorism General - US Foreign Policy General - US Interventions General - US Nuclear Weapons Programs General - US Policy towards Torture General - World Court General Events - 'Dodgy Dossier' General Events - 'Mission Accomplished' General Events - 'Tea Party' Movement General Events - 1949 Peekskill Riots General Events - 2000 Elections General Events - 2001 Clinton 'Vandal Scandal' General Events - 2004 Elections General Events - 2008 Elections General Events - 2010 Elections General Events - 2012 Elections General Events - Abortion Controversy & Violence General Events - After Effects General Events - Anti-Government Rhetoric General Events - Arms-for-Hostages Scandal General Events - British Disinformation Campaigns General Events - CIA Disinformation Campaigns General Events - Conservative Opposition to Obama General Events - CDMT State Dept General Events - Lynch Disinfomation General Events - Domestic Violence & Terrorism General Events - Faith-Based Rhetoric General Events - Fairness Doctrine General Events - Gender-Based Rhetoric General Events - Geopolitics and Diplomacy General Events - Gun/Second Amendment Rhetoric General Events - Health Care Reform Controversy General Events - Immigration Controversy & Violence General Events - Iran-Contra Affair General Events - Iraqi Defectors and the INC General Events - Marketing and Public Relations General Events - Sotomayor Nomination to USSC General Events - Obama 'Birther' Controversy General Events - Other General Events - Plame-Niger Controversy General Events - Political Front Groups General Events - Presidential Pardons General Events - Race-Based Rhetoric General Events - Labor/Union Rhetoric & Actions General Events - States' Rights / Nullification General Events - Violation of US Law General Events - White House Involvement General Events - White House Iraq Group General Events - WikiLeaks Controversy General Topic Areas - Weapons Inspections General Topic Areas - Abu Ghraib Scandal Aftermath General Topic Areas - Air pollution General Topic Areas - Alleged Al-Qaeda Ties General Topic Areas - Priorities General Topic Areas - Economic policy, foreign interference General Topic Areas - Arms Proliferation General Topic Areas - Coverup General Topic Areas - Calls for Overthrow General Topic Areas - Club Ownership General Topic Areas - Combat Actions and Events General Topic Areas - Corporate welfare General Topic Areas - Covert/Clandestine Operations General Topic Areas - Covert Operations General Topic Areas - Criticisms of US General Topic Areas - Debt/Losses General Topic Areas - Detainee Treatment Act General Topic Areas - Detainments General Topic Areas - Diplomacy General Topic Areas - Disciplinary Actions General Topic Areas - Diversion of Resources to Iraq General Topic Areas - Documented cases WTC-related illness General Topic Areas - Endangered species General Topic Areas - Environmental enforcement General Topic Areas - EPA's reponse General Topic Areas - Expert opinions/Independent studies General Topic Areas - Foreign involvement General Topic Areas - Forest policy General Topic Areas - Geopolitics General Topic Areas - Global warming General Topic Areas - Appointments and resignations General Topic Areas - Corruption General Topic Areas - Reports/Investigations General Topic Areas - Government statements General Topic Areas - US Policy Papers General Topic Areas - Hezbollah General Topic Areas - High-level Decisions and Actions General Topic Areas - Human Rights Groups General Topic Areas - Impunity General Topic Areas - Pentagon's Power General Topic Areas - Indefinite Detention General Topic Areas - Independent Investigations General Topic Areas - Indications of Abuse General Topic Areas - Indoor remediation General topic areas - Industry General Topic Areas - Internal Opposition General Topic Areas - Financial General Topic Areas - Nuclear Program General Topic Areas - Opposition Groups General Topic Areas - Alleged WMDs General Topic Areas - Israel General Topic Areas - Legal Proceedings General Topic Areas - Match Fixing General Topic Areas - Media Coverage General Topic Areas - Media General Topic Areas - Military Commissions / Tribunals General Topic Areas - Military Propaganda General Topic Areas - Miscellaneous General Topic Areas - Deception General Topic Areas - Mistreatment of troops General Topic Areas - Misuse of EPA standards General Topic Areas - Motives General Topic Areas - National Parks General Topic Areas - Neoconservative Hawks General Topic Areas - Oil and Gas General Topic Areas - Other General Topic Areas - Other Events General Topic Areas - Other events General Topic Areas - Other Events General Topic Areas - Other events General Topic Areas - Outsourcing and privatization General Topic Areas - Pay and benefits General Topic Areas - Personal stories General topic areas - Politicization General Topic Areas - Politicization and deception General Topic Areas - Politicization of Intelligence General Topic Areas - Pre-9/11 Plans for War General Topic Areas - Pre-war Planning General Topic Areas - Predictions General Topic Areas - Predictions General Topic Areas - Preparation General topic areas - Presentation of science General Topic Areas - Prisoner Deaths General Topic Areas - Private Contractors General Topic Areas - Public health General Topic Areas - Public land use General Topic Areas - Public Opinion on Iraqi Threat General Topic Areas - Public Statements General Topic Areas - Putting troops in danger General Topic Areas - Recruiting General Topic Areas - Rescue/recovery workers General Topic Areas - Government tests General Topic Areas - Shorelines and oceans General Topic Areas - Deaths due to Pentagon's negligence General Topic Areas - Statements/Writings about Torture General Topic Areas - Superfund sites and clean-up General Topic Areas - Supreme Court Decisions General Topic Areas - The 'Generals' Revolt' General Topic Areas - The Decision to Invade General Topic Areas - The opposition/post-Artistide gov't General Topic Areas - The overthrow of Aristide General Topic Areas - Think Tank Activities General Topic Areas - Toxic waste General Topic Areas - Transfers of Young Players General Topic Areas - Legal Justification General topic areas - Policies General Topic Areas - US Intel on Iran General Topic Areas - US Military Dominance General Topic Areas - Pre-war Attacks against Iraq General Topic Areas - Propaganda General Topic Areas - Planning General Topic Areas - Water pollution General Topic Areas - Weaponization of Space General Topic Areas - Western Business Interests General Topic Areas - Wetlands General topic areas - Whistleblowers General Topic Areas - Wildlife protection General Topics - Al-Zarqawi / Al-Qaeda in Iraq General Topics - Economic Reconstruction General Topics - Military Operations General Topics - Other General Topics - Plans for Withdrawal of Forces General Topics - Political Administration General Topics - Poor Treatment of US Troops General Topics - Post-Invasion Looting General Topics - Public Opinion General Topics - Search for WMDs General Topics - Security General Topics - The 'Generals' Revolt' Genetically Modified Crops - GM Contamination Genetically Modified Crops - Experimental GM Crops Genetically Modified Crops - International trade of GM food Genetically Modified Crops - National policies toward GM food Geopolitics and Islamic Militancy - Londonistan - UK Counterterrorism Geopolitics and Islamic Militancy - Alleged Iraq-Al-Qaeda Links Geopolitics and Islamic Militancy - Iraq War Impact on Counterterrorism Geopolitics and Islamic Militancy - Israel Geopolitics and Islamic Militancy - Algerian Militant Collusion Geopolitics and Islamic Militancy - Indonesian Militant Collusion Geopolitics and Islamic Militancy - Philippine Militant Collusion Geopolitics and Islamic Militancy - Yemeni Militant Collusion Geopolitics and Islamic Militancy - Other Government-Militant Collusion Geopolitics and Islamic Militancy - Pakistan and the ISI Geopolitics and Islamic Militancy - Saudi Arabia Geopolitics and Islamic Militancy - Terrorism Financing Geopolitics and Islamic Militancy - US Dominance Geopolitics and Islamic Militancy - US Intel Links to Islamic Militancy Global Economic Crisis - Bailouts and Other Government Aid Global Economic Crisis - Commentaries on Economic Issues Global Economic Crisis - Failing Companies Global Economic Crisis - Other Global Economic Crisis - Western Purchases by Asians Global Economic Crisis - US Labor Issues Global Economic Crisis by Country - Britain Global Economic Crisis by Country - Greece Global Economic Crisis by Country - Iceland Global Economic Crisis by Country - Other Nations Global Economic Crisis by Country - USA Governing Bodies - FIFA Governing Bodies - UEFA Government oversight of drug industry - Defense of corporate interests Government oversight of drug industry - Dismissal of data Government oversight of drug industry - Suppression of data Greek minority in Albania - Albanian-Greek Relations Health Care Insurance Industry - US Health Insurers Health Care Scandals - HCA - Inflated Costs High Ranking Detainees - Abd al-Rahim al-Nashiri High Ranking Detainees - Abu Zubaida High Ranking Detainees - Ahmed Khalfan Ghailani High Ranking Detainees - Ali Saleh Kahlah al-Marri High Ranking Detainees - Hambali High Ranking Detainees - Ibn al-Shaykh al-Libi High Ranking Detainees - Khalid Shaikh Mohammed High Ranking Detainees - Majid Khan High Ranking Detainees - Other High Ranking Detainees High Ranking Detainees - Ramzi bin al-Shibh History - History of Pre-Modern Solar Dev/Use HIV/AIDS Epidemic - HIV/AIDS Epidemic Hostage Crisis and Iranian Arms Sales - 'October Surprise' Hostage Crisis and Iranian Arms Sales - US Hostages Hostage Crisis and Iranian Arms Sales - Hezbollah and Iran Hostage Crisis and Iranian Arms Sales - Iran-Iraq War Hostage Crisis and Iranian Arms Sales - Israeli Involvement Independent Kosova - Actions of the Republic of Kosova Indicators of global warming - Melting glaciers Industry - Commercial Involvement Industry - Environmental Impact Industry - Solar Industry Industry - Utilities and the Solar Industry International Treaties and Organizations - IMF International Treaties and Organizations - NAFTA International Treaties and Organizations - World Bank International Treaties and Organizations - WTO Interventions - Court Actions and Lawsuits Interventions - Federal Government Actions Interventions - Law Enforcement Actions Investigating the Plame Wilson Leak - Fitzgerald Investigation Investigating the Plame Wilson Leak - International Investigations Investigating the Plame Wilson Leak - DOJ/FBI Investigation Investigating the Plame Wilson Leak - Trial of Lewis Libby Investigations - Internal Investigation Investigations - House-Senate Committee Investigations - Special Prosecutor Investigations - Tower Commission Investigations: Specific Cases - 9/11 Commission Investigations: Specific Cases - 9/11 Commission Investigations: Specific Cases - 9/11 Congressional Inquiry Investigations: Specific Cases - 9/11 Congressional Inquiry Investigations: Specific Cases - CIA OIG 9/11 Report Investigations: Specific Cases - CIA OIG 9/11 Report Investigations: Specific Cases - FBI 9/11 Investigation Investigations: Specific Cases - FBI 9/11 Investigation Investigations: Specific Cases - Other 9/11 Investigations Investigations: Specific Cases - Role of Philip Zelikow Investigations: Specific Cases - Role of Philip Zelikow Investigations: Specific Cases - WTC Investigation Investigations: Specific Cases - WTC Investigation Iraq in the 1980s and 1990s - Desert Shield/Desert Storm Iraq in the 1980s and 1990s - Iraq Invasion of Kuwait Iraq in the 1980s and 1990s - US Hostages During Desert Shield Iraq in the 1980s and 1990s - US-Iraq Collaboration Iraq in the 1980s and 1990s - Weapons of Mass Destruction Iraq, Niger, and Uranium - British Support of Uranium Claims Iraq, Niger, and Uranium - Forged Iraq-Niger Documents Iraq, Niger, and Uranium - Iraqi Uranium and Nuclear Devices Iraq, Niger, and Uranium - Iraq's Connections to Niger Iraq, Niger, and Uranium - Joseph Wilson's Trip to Niger Iraq, Niger, and Uranium - US Attempts to Verify Connection Islamist Militarism - Taliban Actions, Rhetoric Islamist Militarism - John Walker Lindh Islamist Militarism - Osama Bin Laden and Al-Qaeda Islamist Militarism - Other Islamist Radical Groups Islamist terrorism and radicalism in the Balkans - The West and Islamist Terrorists Key Events - Key Day of 9/11 Events Key Events - Key Day of 9/11 Events Key Events - Key Events Key Events - Key Events Related to DSM Key Events - Key Hijacker Events Key Events - Key Hijacker Events Key Events - Key Warnings Key Events - Key Warnings Key Figures - Alan Fiers Key Figures - Caspar Weinberger Key Figures - Dick Cheney Key Figures - Donald Gregg Key Figures - Edwin Meese Key Figures - Elliott Abrams Key Figures - Eugene Hasenfus Key Figures - Felix Rodriguez Key Figures - George H. W. Bush Key Figures - George Shultz Key Figures - John Poindexter Key Figures - Lawrence Walsh Key Figures - Oliver North Key Figures - Richard Secord Key Figures - Robert McFarlane Key Figures - Ronald Reagan Key Figures - Salem bin Laden Key Figures - William Casey Knowledge - Environmental Risk Knowledge - Evacuation Problem Knowledge - Flood Risk Knowledge - Increased Chance of Hurricane Knowledge - Advisories Knowledge - Levee Breach/Flooding Knowledge - Organization Capacity Knowledge - Public Safety Risk Knowledge - Response Level Knowledge - Sheltering Laboratories - Battelle Memorial Institute Laboratories - Dugway Proving Ground Laboratories - USAMRIID Lawsuits and Court Actions - Lawsuits, Attempts to Decertify Legal actions - Monsanto v. Schmeiser Legal actions - Other Legal actions - Sample v. Monsanto Legal Changes - Court Procedures and Verdicts Legal Changes - Expansion of Presidential Power Legal Changes - Sotomayor Nomination Legal Changes - Other Legal Changes Legal Changes - Patriot Act Legal Changes - Signing Statements Legal Changes - State Secrets Legal Changes - 'Tenther' Initiative Legal Repercussions - 'Executive Privilege' Legal Repercussions - Congressional Investigations Legal Repercussions - Ford Appointment to White House Legal Repercussions - Senate Watergate Investigation Legal Repercussions - Watergate Prosecutions Legal Repercussions - Watergate Resignations and Firings Legal Repercussions - Watergate Special Prosecutor Media - Academic Media Media - Popular Media Media Coverage - Media Coverage Media Coverage and Responses - Media Coverage and Responses Media Involvement - Media Responses and Participation Media Involvement and Responses - Media Involvement and Responses Media Response - 'Deep Throat' Media Response - 'Silent Coup' Media Response - Frost/Nixon Interviews Media Response - Nixon, Ford Relations with Media Media Response - Woodward, Bernstein & Post Media-Generated Propaganda - 'Friedman Unit' Media-Generated Propaganda - 'Jeff Gannon' Controversy Media-Generated Propaganda - Conservative Media Pundits Media-Generated Propaganda - Dartmouth Review Media-Generated Propaganda - Fox News Media-Generated Propaganda - Liberal Media Pundits Media-Generated Propaganda - Media Complicity Media-Generated Propaganda - Media Coverage of Iraq War Media-Generated Propaganda - Media Opposition Military Analysts - Military Analysts in the Media Military Analysts - Pentagon Propaganda Campaigns Miscellaneous - Czech Politics Miscellaneous - General Miscellaneous Entries Miscellaneous - Human Trafficking Miscellaneous - Miscellaneous Entries about the CIA Miscellaneous - Solar Energy Miscellaneous - Wikileaks Miscellaneous Al-Qaeda Issues - Alleged Al-Qaeda Linked Attacks Miscellaneous Al-Qaeda Issues - Alleged Al-Qaeda Media Statements Miscellaneous Al-Qaeda Issues - Key Captures and Deaths Neoconservative Think Tanks - American Enterprise Institute Neoconservative Think Tanks - Other Think Tanks Neoconservative Think Tanks - PNAC Nixon Resignation and Pardon - Nixon Impeachment Nixon Resignation and Pardon - Nixon Pardon Nixon Resignation and Pardon - Nixon Resignation Nixon Resignation and Pardon - Nixon's Final Days Nixon Resignation and Pardon - Nixon, Ford, and Vietnam Oil Industry - Metering Oil Industry - Production Sharing Agreements Organization - Academia/Professional Organization - Alabama: State Organization - Federal Organization - Federal: FEMA Organization - Florida: State Organization - General Public Organization - Louisiana: NOLA Organization - Louisiana: SELA Organization - Louisiana: State Organization - Media Organization - Mississippi: Biloxi Organization - Mississippi: Gulfport Organization - Mississippi: Other Local Organization - Mississippi: State Organization - NGOs Organization - Private Sector Organization - States: Other States Organizations - Animal Liberation Front Organizations - Army of God Organizations - Aryan Nations Organizations - Christian Identity Organizations - Earth Liberation Front Organizations - Elohim City Organizations - Ku Klux Klan Organizations - Michigan Militia Organizations - Montana Freemen Organizations - Montana Militia Organizations - National Alliance Organizations - Oath Keepers Organizations - Operation Rescue Organizations - Other Anti-Abortion Groups Organizations - Other Environmental Activists Organizations - Other Militias, Separatists Organizations - Posse Comitatus Organizations - PLAL Organizations - SHAC Organizations - Stormfront Organizations - The Order Organizations - Westboro Baptist Church Organizations - WCOTC Other - 'Team B' Other - Bush/Nixon Connections Other - Ford/Nixon Connections Other - Gamesmanship with the USSR Other - Israeli Attitude to Pakistan Nukes Other - ITT and Dita Beard Other - Nixon Election Victories Other - Nixon's Racial and Ethnic Slurs Other - Other Other - Other Other - Other Other - Other Other - Other Related Events Other - Pakistani Nukes & Islamic Militancy Other - Rumsfeld, Cheney, and Ford Neocons Other - Vice President Spiro Agnew Other Al-Qaeda-Linked Figures - Abu Zubaida Other Al-Qaeda-Linked Figures - Al-Qaeda's Hamburg Cell Other Al-Qaeda-Linked Figures - Anwar Al-Awlaki Other Al-Qaeda-Linked Figures - Anwar Al-Awlaki Other Al-Qaeda-Linked Figures - Ayman Al-Zawahiri Other Al-Qaeda-Linked Figures - Hambali Other Al-Qaeda-Linked Figures - Khalid Shaikh Mohammed Other Al-Qaeda-Linked Figures - Khalid Shaikh Mohammed Other Al-Qaeda-Linked Figures - Mohammed Haydar Zammar Other Al-Qaeda-Linked Figures - Mohammed Haydar Zammar Other Al-Qaeda-Linked Figures - Mohammed Jamal Khalifa Other Al-Qaeda-Linked Figures - Nabil Al-Marabh Other Al-Qaeda-Linked Figures - Osama Bin Laden Other Al-Qaeda-Linked Figures - Osama bin Laden Other Al-Qaeda-Linked Figures - Ramzi Bin Al-Shibh Other Al-Qaeda-Linked Figures - Ramzi Bin Al-Shibh Other Al-Qaeda-Linked Figures - Ramzi Yousef Other Al-Qaeda-Linked Figures - Sheikh Omar Abdul-Rahman Other Al-Qaeda-Linked Figures - Victor Bout Other Al-Qaeda-Linked Figures - Wadih El-Hage Other Al-Qaeda-Linked Figures - Zacarias Moussaoui Other Al-Qaeda-Linked Figures - Zacarias Moussaoui Other Detainees - Abed Hamed Mowhoush Other Detainees - Asif Iqbal Other Detainees - Binyam Mohamed Other Detainees - Bisher al-Rawi Other Detainees - Hassan Mustafa Osama Nasr Other Detainees - Huda al-Azzawi Other Detainees - Jamal Udeen Other Detainees - Jamil al-Banna Other Detainees - John Walker Lindh Other Detainees - Jose Padilla Other Detainees - Khalid el-Masri Other Detainees - Maher Arar Other Detainees - Moazzam Begg Other Detainees - Mohamed al-Khatani Other Detainees - Mohammed Jawad Other Detainees - Other Detainees Other Detainees - Rhuhel Ahmed Other Detainees - Saddam Salah al-Rawi Other Detainees - Salim Ahmed Hamdan Other Detainees - Shafiq Rasul Other Detainees - Tarek Dergoul Other Detainees - Yaser Esam Hamdi Other Topics - Anthrax Letters & Hoax Letters Other Topics - Cipro / Bayer Other Topics - FBI Investigation Other Topics - Other Entries Other Topics - Patriot Act Other Topics - US Military Bioweapons Pakistan / ISI: Specific Cases - 2008 Kabul Indian Embassy Bombing Pakistan / ISI: Specific Cases - Pakistani Nukes & Islamic Militancy Pakistan / ISI: Specific Cases - Haven in Pakistan Tribal Region Pakistan / ISI: Specific Cases - Hunt for Bin Laden in Pakistan Pakistan / ISI: Specific Cases - Mahmood Ahmed Pakistan / ISI: Specific Cases - Pakistani ISI Links to 9/11 Pakistan / ISI: Specific Cases - Saeed Sheikh Pentagon Papers - 'Pentagon Papers' Leak Pentagon Papers - Ellsberg Break-in Period - During Katrina Period - Pre-Impact Katrina Period - Before Katrina Period - After Katrina Period - Immediate Katrina Aftermath Policies - Court decisions Policies - International agreements Policies - National legislation/policy Policies that Affected Intensity of Katrina Impact - Canvassing Policies that Affected Intensity of Katrina Impact - Land Development Policies that Affected Intensity of Katrina Impact - Disaster Mitigation Policies that Affected Intensity of Katrina Impact - Disaster Preparedness Policies that Affected Intensity of Katrina Impact - Environmental Policies/Programs Policies that Affected Intensity of Katrina Impact - FEMA Restructuring Policies that Affected Intensity of Katrina Impact - Flood Control Programs Policies that Affected Intensity of Katrina Impact - Outsourcing Policies that Affected Intensity of Katrina Impact - Political Patronage Policies that Affected Intensity of Katrina Impact - Resource Allocation Politicization-Detailed - Communications with Congress Politicization-Detailed - Government reports Politicization-Detailed - Media contact with scientists Politicization-Detailed - Political pressure on staff Politicization-Detailed - Press releases Politicization-Detailed - Public outreach Possible Al-Qaeda-Linked Moles or Informants - Abu Hamza Al-Masri Possible Al-Qaeda-Linked Moles or Informants - Abu Qatada Possible Al-Qaeda-Linked Moles or Informants - Ali Mohamed Possible Al-Qaeda-Linked Moles or Informants - Haroon Rashid Aswat Possible Al-Qaeda-Linked Moles or Informants - Khalil Deek Possible Al-Qaeda-Linked Moles or Informants - Luai Sakra Possible Al-Qaeda-Linked Moles or Informants - Mamoun Darkazanli Possible Al-Qaeda-Linked Moles or Informants - Nabil Al-Marabh Possible Al-Qaeda-Linked Moles or Informants - Omar Bakri & Al-Muhajiroun Possible Al-Qaeda-Linked Moles or Informants - Other Possible Moles or Informants Possible Al-Qaeda-Linked Moles or Informants - Reda Hassaine Prisoner Rights - Detainee Treatment Act Prisoner Rights - Detainments in US Prisoner Rights - Detainments Outside US Prisoner Rights - Gov't Violations of Prisoner Rights Privatization - Argentina Progress and Impact Hurricane Katrina - Alabama: State Progress and Impact Hurricane Katrina - Florida Progress and Impact Hurricane Katrina - Louisiana: NOLA Progress and Impact Hurricane Katrina - Louisiana: SELA Progress and Impact Hurricane Katrina - Louisiana: State Progress and Impact Hurricane Katrina - Mississippi: Biloxi Progress and Impact Hurricane Katrina - Mississippi: Gulfport Progress and Impact Hurricane Katrina - Mississippi: Local Progress and Impact Hurricane Katrina - Mississippi: Other Local Progress and Impact Hurricane Katrina - Mississippi: State Projects and Programs - Able Danger Projects and Programs - Al-Qaeda Malaysia Summit Projects and Programs - Remote Surveillance Projects and Programs - Yemen Hub Projects and Programs - Al-Qaeda Malaysia Summit Projects and Programs - Phoenix Memo Projects and Programs - Randy Glass/ Diamondback Projects and Programs - Robert Wright and Vulgar Betrayal Projects and Programs - Sibel Edmonds Projects and Programs - Able Danger Projects and Programs - Phoenix Memo Projects and Programs - Yemen Hub Prominent Neoconservatives - Albert Wohlstetter Prominent Neoconservatives - David Wurmser Prominent Neoconservatives - Douglas Feith Prominent Neoconservatives - Irving Kristol Prominent Neoconservatives - James Woolsey Prominent Neoconservatives - John Bolton Prominent Neoconservatives - Laurie Mylroie Prominent Neoconservatives - Michael Ledeen Prominent Neoconservatives - Norman Podhoretz Prominent Neoconservatives - Paul Wolfowitz Prominent Neoconservatives - Richard Perle Prominent Neoconservatives - William Kristol Prominent Neoconservatives - Zalmay Khalilzad Propaganda and Media Coverage - Military Analysts Propaganda and Media Coverage - Other Propaganda / Psyops Public Policy - Other Nations' Policies Public Policy - US Policies Quotes from Senior US officials - Decision to Invade Quotes Quotes from Senior US officials - Chemical & Bio Weapons Allegations Quotes from Senior US officials - Imminent Threat Allegations Quotes from Senior US officials - Iraq Ties to Terrorists Allegations Quotes from Senior US officials - WMD Allegations Quotes from Senior US officials - Nuclear Weapons Allegations Quotes from Senior US officials - Democracy Rhetoric Recovery from Katrina - citizenship Recovery from Katrina - Governmental Services (water, electricity, etc) Recovery from Katrina - Industry (oil industry, etc.) Recovery from Katrina - Infrastructure (bridges; roads) Renditions - Extraordinary Rendition Renditions - Rendition after 9/11 Renditions - Rendition before 9/11 Response in Wake of Katrina Disaster - Investigations Response in Wake of Katrina Disaster - Response to Emergency Response Response in Wake of Katrina Disaster - Response to Evacuation Execution Scientific issues - Causal factors Scientific issues - Hurricane intensity Secrecy - 2006 US Attorney Firings Secrecy - Continuity of Government Secrecy - Government Acting in Secret Secrecy - Government Classification Seed Industry - Biotech patents Seed Industry - Biotech/seed industry Seed Industry - Coercive tactics Seed Industry - Seed/biotech industry consolidation Seed Industry - Perception management Seed Industry - Public-private collaboration Serb minority in the Republic of Kosova - Kosovar Serbs in Yugoslav Kosovo Social impacts - Biodiversity Social impacts - Environment Social impacts - Farmers' rights Social impacts - Food security Social impacts - Indigenous peoples Social impacts - Public Health Social impacts - Resistance Soviet Occupation of Afghanistan - CIA Operations Soviet Occupation of Afghanistan - Soviet Occupation of Afghanistan Soviet Occupation of Afghanistan - US Aid to Islamist Mujaheddin Specific Allegations - Biological Weapons Trailers Specific Allegations - 2001 Anthrax Attacks Specific Allegations - Africa-Uranium Allegation Specific Allegations - Al Zarqawi Allegation Specific Allegations - Aluminum Tubes Allegation Specific Allegations - Drones Specific Allegations - Poisons and Gases Specific Allegations - Atta in Prague Connection Specific Alleged Al-Qaeda Linked Attacks or Plots - 1993 WTC Bombing Specific Alleged Al-Qaeda Linked Attacks or Plots - 1993 Somalia Fighting Specific Alleged Al-Qaeda Linked Attacks or Plots - 1998 US Embassy Bombings Specific Alleged Al-Qaeda Linked Attacks or Plots - 2000 USS Cole Bombing Specific Alleged Al-Qaeda Linked Attacks or Plots - 2001 Attempted Shoe Bombing Specific Alleged Al-Qaeda Linked Attacks or Plots - 2002 Bali Bombings Specific Alleged Al-Qaeda Linked Attacks or Plots - 2004 Madrid Train Bombings Specific Alleged Al-Qaeda Linked Attacks or Plots - 2005 7/7 London Bombings Specific Alleged Al-Qaeda Linked Attacks or Plots - Millennium Bomb Plots Specific Alleged Al-Qaeda Linked Attacks or Plots - 1995 Bojinka Plot Specific Cases and Issues - 2007 NIE on Iran Specific Cases and Issues - Chalabi and the INC Specific Cases and Issues - Anabasis Specific Cases and Issues - Arms for Hostages Specific Cases and Issues - Powell's Speech to UN Specific Cases and Issues - Curveball Fabrications Specific Cases and Issues - Iran-India pipeline Specific Cases and Issues - Iran/Contra Affair Specific Cases and Issues - Coastal Wetlands Specific Cases and Issues - Military Analysts Propaganda Specific Cases and Issues - Office of Special Plans Specific Cases and Issues - Outing of Jose Bustani Specific cases and issues - War Net Specific cases and issues - Spy Plane Crash in China Specific Cases and Issues - Spying on the UN Specific Cases and Issues - US MEK policy Specific cases and issues - USS Greeneville Collision Specific Events - 'Unabomber' Attacks Specific Events - 1949 Peekskill Riots Specific Events - 1992 Ruby Ridge Standoff Specific Events - 1993 Branch Davidian Siege Specific Events - 1995 Oklahoma City Bombing Specific Events - 2001 Anthrax Attacks Specific Events - 2009 Health Care Protests Specific Events - 2009 Holocaust Museum Shooting Specific Events - Death of Robert Jay Mathews Specific Events - Eric Rudolph Bombings Specific Events - FACE Law Specific Events - Killing Spree by John Salvi Specific Events - Shepard/Byrd Hate Crimes Act Specific Events - Freemen/FBI Standoff Specific Events - Murder of Alan Berg Specific Events - Murder of Dr. Barnard Slepian Specific Events - Murder of Dr. David Gunn Specific Events - Murder of Dr. George Tiller Specific Events - Murder of Dr. John Britton Specific Events or Operations - Destruction of CIA Tapes Specific Events or Operations - Qala-i-Janghi Massacre Specific Events or Operations - Operation Copper Green Specific Issues - 'Stop-Loss' Program Specific Issues - Hussein's Capture Specific Issues - CIA in Iraq Specific Issues - Deloitte Money League Specific Issues - FC Sion Affair Specific Issues - Human Rights Violations Specific Issues - Iraq and Iran Specific Issues - Military Privatization Specific Issues - Neoliberal Reforms Specific Issues - Oversight and Transparency Specific Issues - The Oil Law Specific Issues - US Use of Chemical Weapons Specific Issues and Cases - Cheney Energy Task Force Specific Issues and Cases - Clear Skies Specific Issues and Cases - Asbestos removal in Libby, Montana Specific Issues and Cases - EPA library closures Specific Issues and Cases - Formaldehyde Rule Specific Issues and Cases - Klamath Basin Fish Kill Specific Issues and Cases - Mining in the Cabinet Mountains Specific Issues and Cases - Mountaintop Mining Specific Issues and Cases - New Source Review Specific Issues and Cases - Outsourcing CAT Specific Issues and Cases - Pentagon cuts to IDP and FSA Specific Issues and Cases - Roadless Rule Specific Issues and Cases - Round Up power plant Specific Issues and Cases - Concentrated Animal Feeding Operations Specific Issues and Cases - Snowmobile regulation Specific Issues and Cases - Stop Loss Specific Issues and Cases - The Transfer of the EPA Ombudsman Specific Issues and Cases - Body armor Specific Issues and Cases - USGS assessment Specific Issues and Cases - lightly armored vehicles Specific Pollutants - Atrazine Specific Pollutants - Formaldehyde Specific Pollutants - Lead Specific Pollutants - Methyl Bromide Specific Pollutants - Mercury Specific Pollutants - MTBE State - Florida State - Georgia State - Indiana State - Nebraska State - Nevada State - New Hampshire State - New Mexico State - North Carolina State - Ohio State - Oregon State - Other Statements - Execution of Emergency Plans Statements - Katrina Statements - Mitigation Statements - Plans Statements - Policies Statements - Recovery Statements - Response Statements - Warnings Statistics - Health Care Cost Studies - Studies-academic Studies - Studies-Academic Studies - Studies-academic Studies - Studies-civil society Studies - Studies-government Studies - Studies-government Studies - Studies-other Studies - Studies-private sector Surveillance - Database Programs Surveillance - National Security Letters Surveillance - NSA Wiretapping / Stellar Wind Surveillance - Other Surveillance Suspects - Al-Qaeda Suspects - Author of Ayaad Assaad Letter Suspects - Bruce Ivins Suspects - Iraq Suspects - Other Suspects Suspects - Steven Hatfill Technology - Non-Silicon Technology Technology - Silicon Technology Terrorism Financing: Specific Cases - Drugs Terrorism Financing: Specific Cases - Al-Kifah/MAK Terrorism Financing: Specific Cases - BCCI Terrorism Financing: Specific Cases - BIF Terrorism Financing: Specific Cases - Bin Laden Family Terrorism Financing: Specific Cases - BMI and Ptech Terrorism Financing: Specific Cases - Al Taqwa Bank The Alleged 9/11 Hijackers - Other 9/11 Hijackers The Alleged 9/11 Hijackers - Alleged Hijackers' Flight Training The Alleged 9/11 Hijackers - Alleged Hijackers' Flight Training The Alleged 9/11 Hijackers - Hani Hanjour The Alleged 9/11 Hijackers - Hani Hanjour The Alleged 9/11 Hijackers - Hijacker Contact w Government in US The Alleged 9/11 Hijackers - Hijacker Contact w Government in US The Alleged 9/11 Hijackers - Hijacker Visas and Immigration The Alleged 9/11 Hijackers - HIjacker Visas and Immigration The Alleged 9/11 Hijackers - Marwan Alshehhi The Alleged 9/11 Hijackers - Marwan Alshehhi The Alleged 9/11 Hijackers - Mohamed Atta The Alleged 9/11 Hijackers - Mohamed Atta The Alleged 9/11 Hijackers - Alhazmi and Almihdhar The Alleged 9/11 Hijackers - Alhazmi and Almihdhar The Alleged 9/11 Hijackers - Other 9/11 Hijackers The Alleged 9/11 Hijackers - Possible Hijacker Associates in US The Alleged 9/11 Hijackers - Possible Hijacker Associates in US The Alleged 9/11 Hijackers - Possible 9/11 Hijacker Funding The Alleged 9/11 Hijackers - Possible 9/11 Hijacker Funding The Alleged 9/11 Hijackers - Ziad Jarrah The Alleged 9/11 Hijackers - Ziad Jarrah The Inslaw Dispute and PROMIS - Internal DoJ Investigations The Inslaw Dispute and PROMIS - Legal Proceedings The Inslaw Dispute and PROMIS - Origin of Dispute The Inslaw Dispute and PROMIS - Other Events The Inslaw Dispute and PROMIS - Oversight by Congress The Inslaw Dispute and PROMIS - Use Outside Justice Department The NATO-Yugoslav war - UCPMB The Post-9/11 World - 9/11 Denials The Post-9/11 World - 9/11 Investigations The Post-9/11 World - 9/11 Investigations The Post-9/11 World - 9/11 Related Criminal Proceedings The Post-9/11 World - 9/11 Related Criminal Proceedings The Post-9/11 World - 9/11 Related Lawsuits The Post-9/11 World - 9/11 Related Lawsuits The Post-9/11 World - US Government and 9/11 Criticism The Post-9/11 World - US Government and 9/11 Criticism The Post-9/11 World - 9/11 Denials The Post-9/11 World - Media The Post-9/11 World - Media The Post-9/11 World - Other Post-9/11 Events The Post-9/11 World - Other Events The struggle over Kosova - People's Front for Kosovo The struggle over Kosova - Kosovo Liberation Army The struggle over Kosova - Yugoslav policies in Kosova Topics - Uprisings Topics - Origins Topics - Statistics Treatment of US Troops - Equipment Treatment of US Troops - Other Treatment of US Troops - Pay and Benefits Treatment of US Troops - Stop-Loss Program Treatment of US Troops - Veterans Affairs Types of Abuses Performed by US - Abrogation of Rights Types of Abuses Performed by US - Sexual Temptation Types of Abuses Performed by US - Dangerous Conditions Types of Abuses Performed by US - Deception Types of Abuses Performed by US - Medical Services Denied Types of Abuses Performed by US - Electrodes Types of Abuses Performed by US - Exposure to Insects Types of Abuses Performed by US - Extreme Temperatures Types of Abuses Performed by US - Forced Confessions Types of Abuses Performed by US - Ghost Detainees Types of Abuses Performed by US - Insufficient Food Types of Abuses Performed by US - Intimidation/Threats Types of Abuses Performed by US - Involuntary Drugs Types of Abuses Performed by US - Isolation Types of Abuses Performed by US - Mental Abuse Types of Abuses Performed by US - Physical Assault Types of Abuses Performed by US - Poor Conditions Types of Abuses Performed by US - Sexual Humiliation Types of Abuses Performed by US - Sleep Deprivation Types of Abuses Performed by US - Stress Positions Types of Abuses Performed by US - Suppression of Religious Expression Types of Abuses Performed by US - SERE Techniques Types of Abuses Performed by US - Use of Dogs Types of Abuses Performed by US - Waterboarding Types of Violence - Arson Types of Violence - Beatings/Mobs Types of Violence - Bioweapon Attacks Types of Violence - Bombs and Explosives Types of Violence - Harassment and Threats Types of Violence - Kidnapping Types of Violence - Other Violence Types of Violence - Rhetorical Violence Types of Violence - Robberies, Larcenies, Fraud, Etc. Types of Violence - Shooting/Guns Types of Violence - Vandalism Types of Violence - Rhetoric from National Figures US Bases and Interrogation Centers - Salt Pit (Afghanistan) US Bases and Interrogation Centers - Abu Ghraib Prison (Iraq) US Bases and Interrogation Centers - Al Jafr Prison (Jordan) US Bases and Interrogation Centers - Al Qaim (Iraq) US Bases and Interrogation Centers - Bagram (Afghanistan) US Bases and Interrogation Centers - Camp Bucca (Iraq) US Bases and Interrogation Centers - Camp Cropper (Iraq) US Bases and Interrogation Centers - Diego Garcia US Bases and Interrogation Centers - Gardez (Afghanistan) US Bases and Interrogation Centers - Guantanamo (US Base in Cuba) US Bases and Interrogation Centers - Kandahar (Afghanistan) US Bases and Interrogation Centers - Other US Bases and Centers US Bases and Interrogation Centers - Stare Kiejkuty (Poland) US Bases and Interrogation Centers - US Base (Thailand) US Bases and Interrogation Centers - USS Peleliu US Detention Facilities and Detainee Treatment - US Detainees US Economic Policies and Events - Bush Policies and Actions US Economic Policies and Events - Commentaries and Criticisms US Economic Policies and Events - Obama Policies and Actions US Economic Policies and Events - Pre-2001 Policies and Actions US Elections, Voting, and Campaign Finance - Campaign Finance US Elections, Voting, and Campaign Finance - Election, Voting Laws and Issues US Elections, Voting, and Campaign Finance - Voter Fraud/Disenfranchisement US Elections, Voting, and Campaign Finance - Voting Rights US Foreign Relations - Post-Soviet Relations US Foreign Relations - US-African Relations US Foreign Relations - US-China Relations US Foreign Relations - US-European Relations US Foreign Relations - US-Israeli Relations US Foreign Relations - US-Korean Relations US Foreign Relations - US-Latin American Relations US Foreign Relations - US-Middle East Relations US Foreign Relations - US-South Asian Relations US Foreign Relations - US-Soviet Relations US Health Care Funding Reform - Clinton Health Care Reform US Health Care Funding Reform - US Health Care Problems US Health Care Funding Reform - Other health care systems US Health Care Funding Reform - History of US Health Care System US Health Care Funding Reform - Obama Health Care Reform US Health Care Funding Reform - US Health Care Costs US Health Care Funding Reform - US Health Care Polls US Health Care Funding Reform - Medicaid US Health Care Funding Reform - Medicare US Invasion, Occupation of Afghanistan - Battle of Tora Bora and Aftermath US Invasion, Occupation of Afghanistan - Calls for US Military Action US Invasion, Occupation of Afghanistan - CIA Intel, Military Operations US Invasion, Occupation of Afghanistan - Civilian Casualties US Invasion, Occupation of Afghanistan - Critics of US Military Action US Invasion, Occupation of Afghanistan - Death of Pat Tillman US Invasion, Occupation of Afghanistan - Economic Reconstruction US Invasion, Occupation of Afghanistan - Oil Pipelines and Interests US Invasion, Occupation of Afghanistan - Other US Allies US Invasion, Occupation of Afghanistan - Pakistan Involvement US Invasion, Occupation of Afghanistan - Political Reconstruction US Invasion, Occupation of Afghanistan - Prison Revolt at Qala-i-Janghi US Invasion, Occupation of Afghanistan - US Invasion, Occupation US Invasion, Occupation of Afghanistan - US Military Strategies and Tactics US Invasion, Occupation of Afghanistan - US Redirection of Forces to Iraq US Military Involvement - US Peacekeeping Forces US Policies in the Balkans - US Policy on Yugoslavia US Policy Areas - Afghanistan and South Asia US Policy Areas - Balkans US Policy Areas - General Middle East Policy US Policy Areas - Iran US Policy Areas - Iraq US Policy Areas - Israel US Policy Areas - Overall US Foreign Policy US Policy Areas - Russia and Central Asia US Policy Areas - Saudi Arabia US Policy Areas - Syria US Policy Areas - Terrorism and Al-Qaeda US Policy Areas - Turkey US Policy Areas - US Intelligence US Relations to Pakistani Nuclear Program - Assistance to Khan Network in US US Relations to Pakistani Nuclear Program - Cover-up of US Intelligence US Relations to Pakistani Nuclear Program - Other US Politics US Relations to Pakistani Nuclear Program - Soviet-Afghan War Connections US Relations to Pakistani Nuclear Program - US Congressional Oversight US Relations to Pakistani Nuclear Program - US Sanctions US Relations to Pakistani Nuclear Program - US Weapons Sales to Pakistan US Relations to Pakistani Nuclear Program - Western Intel on Pakistani Nukes Valerie Plame Wilson, CIA Agent - Plame Wilson's CIA Career Valerie Plame Wilson, CIA Agent - Covert Activities Voter Fraud Allegations and Media Malfeasance - Voter Fraud / Media Malfeasance Warning Signs: Specific Cases - Bush's Aug. 6, 2001 PDB Warning Signs: Specific Cases - Bush's Aug. 6, 2001 PDB Warning Signs: Specific Cases - Foreign Intelligence Warnings Warning Signs: Specific Cases - Foreign Intelligence Warnings Warning Signs: Specific Cases - Presidential Level Warnings Warning Signs: Specific Cases - Presidential Level Warnings Watergate Campaign Conspiracy - 'Plumbers' Watergate Campaign Conspiracy - 'Townhouse Operation' Watergate Campaign Conspiracy - Allegations of White House Cover-up Watergate Campaign Conspiracy - Slush Funds & Illegal Contributions Watergate Campaign Conspiracy - Illegal Wiretapping & Surveillance Watergate Campaign Conspiracy - Nixon Campaign 'Dirty Tricks' Watergate Campaign Conspiracy - Payoffs and Blackmail Watergate Campaign Conspiracy - Political Subordination of FBI, CIA Watergate Campaign Conspiracy - Political Subordination of IRS Watergate Campaign Conspiracy - Watergate Burglary Watergate Campaign Conspiracy - Watergate Tapes and Documents Weapons of Mass Destruction - Biological Weapons Weapons of Mass Destruction - Chemical Weapons Weapons of Mass Destruction - Incendiary Weapons Weapons of Mass Destruction - Nuclear Weapons Weapons of Mass Destruction - Other WMDs Yugoslavia - Destruction of Yugoslavia Time period: Criterion specific to entities Entity type: -- none -- People Groups Businesses Organizations Governmental Organizations Political Parties Schools Cultural Groups Parks Structures Websites Infrastructures Legislation Projects Political Organizations Multi-Lateral Organizations Currently unknown/unspecific Entities Printer-Friendly View
Printer-Friendly View Email to Friend
Email to Friend Increase Text Size
Decrease Text Size
Ordering Date ascending Date descending Time period
Email Updates Receive weekly email updates summarizing what contributors have added to the History Commons database Donate Developing and maintaining this site is very labor intensive. If you find it useful, please give us a hand and donate what you can.
Donate Now Volunteer If you would like to help us with this effort, please contact us. We need help with programming (Java, JDO, mysql, and xml), design, networking, and publicity. If you want to contribute information to this site, click the register link at the top of the page, and start contributing.
Contact Us
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Mapping the Demand for Serious Games in Postgraduate Medical Education Using the Entrustable Professional Activities Framework.
Serious games are potentially powerful tools for residency training and increasingly attract attention from medical educators. At present, serious games have little evidence-based relations with competency-based medical education, which may impede their incorporation into residency training programs. The aim of this study was to identify highly valued entrustable professional activities (EPAs) to support designers in the development of new, serious games built on a valid needs-assessment. All 149 licensed medical specialists from seven specialties in one academic hospital participated in seven different Delphi expert panels. They filled out a two-round Delphi survey, aimed at identifying the most valuable EPAs in their respective curricula. Specialists were asked to name the most highly valued EPA in their area in the first Delphi round. In the second round, the generated responses were presented and ranked according to priority by the medical specialists. Sixty-two EPAs were identified as valuable training subjects throughout five specialties. Eleven EPAs--"management of trauma patient," "chest tube placement," "laparoscopic cholecystectomy," "assessment of vital signs," "airway management," "induction of general anesthesia," "assessment of suicidal patient," "psychiatric assessment," "gastroscopy," "colonoscopy," and "resuscitation of emergency patients"--were consistently given a high score. The future medical specialist is an active learner, comfortable with digital techniques and learning strategies such as serious gaming. In order to maximize the impact and acceptance of new serious games, it is vital to select the most relevant training subjects. Although some serious games have already targeted top-priority EPAs, plenty of opportunities remain.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Background {#Sec1}
==========
Stroke is a leading cause of morbidity and mortality worldwide resulting in an estimated 4.4 million deaths each year \[[@CR1]\]. Large vessel intracranial atherosclerotic disease (ICAD) is believed to have a higher frequency among the South Asians \[[@CR2]--[@CR7]\] with one study \[[@CR8]\] reporting it to be responsible for at least 30--50% strokes among the Asian population.
The pathophysiology of ischemic stroke revolves around atherosclerotic plaque formation over a number of years in the arteries of the Circle of Willis before the final cerebrovascular event. This event is presumably caused by a rupture of that plaque or progressive hemodynamic stenosis leading to decompensated low flow state with failure of the collaterals \[[@CR9], [@CR10]\].
Regardless of the mechanism of stroke, prevention is the key to reduce mortality \[[@CR11]\]. Studies such as WASID study \[[@CR12]\] have identified medications that are beneficial in high risk patients. However, to identify intracranial stenosis there need to be screening tools that are not only effective but also widely available at an affordable cost to make them relevant to low income countries where this condition is prevalent.
The gold standard to detect large artery intracranial stenosis is conventional cerebral angiography \[[@CR13]\] but the cost, unavailability and risk of stroke \[[@CR14]--[@CR17]\] make it impractical for screening purposes. Similarly magnetic resonance angiography (MRA) is not considered a viable option due to its high cost and availability issues \[[@CR18]\]. Due to its wide availability, significantly less cost and non-invasiveness, the transcranial Doppler sonography (TCD) is considered a potentially valuable screening tool \[[@CR19]\]. Previous studies that have looked at this diagnostic modality have shown encouraging results by reporting negative predictive values and sensitivities comparable to that of the MRA \[[@CR20]\].
However, the majority of these studies have been performed on the Western population. Hence, this study aims to explore the viability of the TCD in this region as a screening tool to detect intracranial atherosclerotic disease in a real life low middle income country clinical setting.
Methods {#Sec2}
=======
Study setting {#Sec3}
-------------
This study was conducted in a tertiary care hospital in Karachi, a metropolitan city located in the south of Pakistan with a multiethnic population of more than 13 million persons \[[@CR21]\]. The hospital has its own stroke team and is equipped with MRA and TCD facilities along with on call radiologists round the clock.
Selection of participants {#Sec4}
-------------------------
All patients admitted to this center after being diagnosed with stroke between January 2012 and January 2013 were eligible for this study. Participants were men and women aged \>18 years who presented to the Emergency Department and were subsequently diagnosed with stroke due to atherosclerotic disease via CT scan or MRI. Participants had to consent to TCD in addition to routine MRA which is done as part of standard of care of every patient admitted with stroke at this center.
Patients were excluded from participation if they had concomitant acute coronary syndrome or any extracranial vascular disease. Any patient who refused consent was also excluded.
Data collection instruments {#Sec5}
---------------------------
Relevant demographic data including, age and gender was extracted from the medical records available.
The subtype of stroke was determined using the causative classification system for ischemic stroke (CCS) \[[@CR22]\].
The MRA was interpreted on digital images and the degree of stenosis was calculated using the following equation \[[@CR13]\]:$$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ \% {\text{ stenosis}} = \left[ { 1- \left( {{\text{D}}_{\text{stenosis}} /{\text{D}}_{\text{normal}} } \right)} \right] \times 100 $$\end{document}$$
Using the degree of stenosis, the artery was then classified as normal or with mild atherosclerotic changes, moderately stenosed and severely stenosed or occluded. A normal artery had \<30% stenosis, a moderately stenosed artery had 30--50% stenosis and a severely stenosed artery was defined as an artery with \>50% stenosis. The severely stenosed artery was used as the outcome of interest since the WASID study \[[@CR12]\] had defined this as the critical value beyond which there is proven benefit of antiplatelet therapy. The MRA was used as the gold standard since catheter angiography was considered too invasive for the purpose of this study.
All the TCDs were performed and reported by the same sonographer who had received training in this field. He was blinded to the MRA findings and was required to report the peak velocity (PV) and the time averaged mean of the maximum velocity (MV) for the following arteries: the right middle cerebral artery (RMCA), the left middle cerebral artery (LMCA), the right anterior cerebral artery (RACA), the left anterior cerebral artery (LACA), the right posterior cerebral artery (RPCA) and the left posterior cerebral artery (LPCA). The vertebral and the basilar arteries were excluded.
Using the TCD, intracranial stenosis was categorized as \>50 or \<50%. There were two criteria that were used for this purpose. The first criterion used the mean velocity (MV) while the second criterion used the peak velocity (PV). Both criteria were used independently and results using each criterion are reported.
Using the MV, any artery with a time averaged mean of the maximum velocity of \>100 m/s was considered to have \>50% stenosis. This value was chosen taking into consideration the findings of the SONIA trial \[[@CR20]\].
Using the peak velocity to determine the degree of stenosis, the criterion verified by Baumgartner et al. \[[@CR23]\] was used which was slightly more complex. The cut offs for the peak velocity for \>50% stenosis were as follows: for the MCAs \>220 cm/s; for the PCAs \>145 cm/s; For the ACAs \>155 cm/s.
As in the SONIA trial \[[@CR20]\], the standards set by the Intersocietal Commission for the Accreditation of Vascular Laboratories (ICAVL) \[[@CR24]\] were followed for the TCD. Details of these standards are given in Additional file [1](#MOESM1){ref-type="media"}: Appendix 1.
Statistical considerations {#Sec6}
--------------------------
The findings of the MRA were compared to those from the TCD to calculate the sensitivity, the positive predictive value and the negative predictive value of the TCD.
Sensitivity = true positive/(true positive + false negative) \[[@CR25]\].
Negative predictive value = true negative/(true negative + false negative) \[[@CR25]\].
All data was entered and analyzed via SPSS v19. Statistical analysis were reviewed by a biostatistician.
Ethical considerations {#Sec7}
----------------------
Prior to obtaining data, the study protocol was approved by the Ethical Review Committee of the Aga Khan University Hospital. No financial incentives were provided to any study participant. Written informed consent and verbal assent was given by all participants or their legal surrogate respondents prior to the investigation.
Results {#Sec8}
=======
There were a total of 86 patients who were enrolled in the study. 45 (52%) were male while 41 (48%) were female. The mean age for male patients was 57 (SD: 16) while the mean age for female patients was 60 (SD: 14). 97.7% patients (n = 84) had suffered from an ischemic stroke while only 2.3% (n = 2) had a hemorrhagic stroke.
Among the 86 patients enrolled in the study, all 6 arteries (LACA, RACA, LMCA, RMCA, LPCA, RPCA) were found normal in 55 (63.9%) of the patients as detected by the MRA while the remaining 31 patients had at least one diseased artery.
In all, 516 arteries (86 patients with 6 arteries each) were looked at and the MRA reported 407 (78.9%) of the arteries to be either normal or with mild atherosclerotic irregularity, 66 (12.8%) had moderate stenosis and 43 (8.3%) were severely stenosed or completely occluded. The highest proportion of severely stenosed arteries was in the RMCA (17.4%, n = 15) followed by the LMCA (9.3%). Detailed findings of the MRA are given in Table [1](#Tab1){ref-type="table"}.Table 1Magnetic resonance angiography findingsNormal/mild atherosclerotic changes (\<30% stenosis)Moderately stenosed (30--50% stenosis)Severely stenosed (\>50% stenosis)Right middle cerebral artery60 (69.8%)11 (12.8%)15 (17.4%)Left middle cerebral artery67 (77.9%)11 (12.8%)8 (9.3%)Right anterior cerebral artery71 (82.6%)10 (11.6%)5 (5.8%)Left anterior cerebral artery70 (81.4%)11 (12.8%)5 (5.8%)Right posterior cerebral artery70 (81.4%)12 (14.0%)4 (4.7%)Left posterior cerebral artery69 (80.2%)11 (12.8%)6 (7.0%)Overall407 (78.9%)66 (12.8%)43 (8.3%)
Of the 86 patients, 38 (44.2%) had complete examinations where all 6 arteries of interest (LACA, RACA, LMCA, RMCA, LPCA, RPCA) were seen, 45 had incomplete assessments where at least one but not all arteries were visualized and there were 3 patients, all women, in whom not a single artery was visualized. Overall, there was an attempt to visualize a total of 516 arteries in 86 patients (6 arteries in each patient) through the TCD but they were successful in insonating only 375 (72.7%) arteries. The insonation failure in men was 19.6% (n = 53) while it was 35.7% (n = 88) in women. The arteries most successfully insonated were the MCAs (91.7% RMCAs and 89.5% LMCAs) followed by the ACAs (65.1% LACAs and 68.6% RACAs) while the PCAs were insonated least successfully (61.6% in right 60.5% in left). Insonation success rate for each artery is given in Table [2](#Tab2){ref-type="table"}.Table 2The proportion of successful and unsuccessful insonations in each arterySuccessfulUnsuccessfulRight middle cerebral artery78 (91.7%)8 (9.3%)Left middle cerebral artery77 (89.5%)9 (10.5%)Right anterior cerebral artery59 (68.6%)27 (31.4%)Left anterior cerebral artery56 (65.1%)30 (34.9%)Right posterior cerebral artery53 (61.6%)33 (38.4%)Left posterior cerebral artery52 (60.5%)34 (39.5%)Total375 (73.7%)141 (27.3)
The findings of the sonography were categorized both via the peak velocity as well as the mean velocity to categorize the degree of stenosis as assessed by the TCD. Regardless of the criteria used, no artery was labeled as having \>50% stenosis by the TCD. This essentially gives us sensitivity and positive predictive values of 0% for all arteries using either criterion. Similarly both criteria also had an identical negative predictive value (93.3%). A brief comparison on MRA and TCD findings is given in Table [3](#Tab3){ref-type="table"}.Table 3Comparison of transcranial Doppler and magnetic resonance angiography findingsTCDMRA\>50% stenosis\<50% stenosis\>50% stenosed00\<50% stenosed25350Failed to insonate18123Total43473
The proportion of stenosed vessels among arteries that were not successfully insonated was 12.7% which is higher than the proportion of stenosed or occluded vessels (8.3%) among the visualized arteries.
Discussion {#Sec9}
==========
With the abundant data available on the prevalence and the magnitude of ICAD \[[@CR6], [@CR26]--[@CR29]\] it is important to look at screening and diagnostic modalities that can be effective in reducing morbidity and mortality. This is one of the earlier studies to explore the use of intracranial Doppler among the South Asian population. Previous studies \[[@CR20], [@CR30]--[@CR33]\] in other parts of the world regarding the TCD have had promising results. Although the sensitivity has been reported to be as low as 65% in some cases \[[@CR20]\], a negative predictive value of over 90% would suggest that the Doppler can be used to screen out patients who would benefit from aggressive risk management \[[@CR34]\]. Unfortunately, this study suggests the Doppler ultrasound is an ineffective tool for this purpose in the South Asian setting when done in a pragmatic fashion in real life patients admitted for stroke.
Since only 38 of the 86 patients had complete examinations, TCD appears to be an unreliable screening tool since most patients will then have to undergo further evaluation based on inconclusive results. Although previous studies \[[@CR35], [@CR36]\] have reported insonation failures, these failures are estimated to be between 10 and 30%. Hashimoto et al. \[[@CR37]\] reported a failure to visualize temporal windows in 29% of the subjects when he studied the Japanese population while another study, also in Japan, by Itoh \[[@CR38]\] had a failure rate of around 22.8%. Similarly, when Seidel used the color coded doppler in the German population, he failed to visualize the intracranial arteries in 20% of cases \[[@CR39]\]. One study in 2011 \[[@CR40]\] in the United States reported an insonation failure of around 22.2% in 99 patients Interestingly, the study mentioned above quoted higher insonation failure rates for African Americans (47%) compared to whites (15%) when it used multivariate analysis. This would support the belief that difficulties that have been documented \[[@CR19]\] using TCD, such as difficulty in visualizing temporal windows and fixating probe positions, are more applicable to certain populations compared to others and more specifically Asians and African Americans as compared to Caucasians.
What is also of note however, is that most studies \[[@CR20], [@CR33], [@CR41]--[@CR44]\] that have studied the TCD have primarily looked at the MCAs while only some have studied the vertebrobasilar arteries \[[@CR32]\], the PCAs \[[@CR32], [@CR45], [@CR46]\] or all the arteries that were included in this study \[[@CR35], [@CR47]\]. When we look at the failure rate of MCAs in our study (\<10%), it does become comparable to the other studies mentioned earlier. And so perhaps the only artery that had any results was the MCA but even this does not seem feasible.
The rate of insonation failures was higher in women as compared to men. Although this finding has not been encountered commonly, there has been at least one previous study \[[@CR40]\] that reported a higher insonation failure rate in women compared to men. On the other hand, Hashimoto et al. \[[@CR37]\] reported a much higher (84 vs. 52%) rate of successful insonations in men compared to women.
The most significant result pertaining to the outcome of the ultrasound was the inability of the TCD to correctly detect any vessel as stenosed or occluded. This would rule out the TCD as a screening tool since it fails to identify high risk patients that need to be managed. The two criteria that were used to classify stenosis TCD findings, the PV and MV, both reported negative predictive values of 93.3%. This would seem to be in line with previous studies \[[@CR20]\] but it is in fact a reflection of the proportion of normal vessels and their of correct classification Hence, this does not have any importance in relation to identifying diseased vessels. This study therefore cannot be used to establish the superiority of one criterion over another nor does this have any importance when assessing the TCD as a screening tool.
This study is one of the first to look at the TCD in the South Asian population. However, it is a limited observation in a single center with a trained operator who had standardized training and audit. The strokes were classified with rigor and the images reviewed with MRA and radiology. Under these settings and clinical conditions it appears that the TCD is not a useful tool at all. Whether broad based population studies on community based patients would be different is an area of further investigation and these finding are limited to an inpatient type setting.
Conclusions {#Sec10}
===========
With the rapidly growing morbidity and mortality rates of stroke in this region, screening tools need to be devised that can identify high risk patients so that strokes may be prevented. This study evaluated the TCD as a potential screening tool for this purpose in a hospital setting.
Additional file {#Sec11}
===============
Additional file 1:**Appendix 1.** Reference standards for TCD performance.
ICAD
: large artery intracranial atherosclerosis
TCD
: transcranial Doppler
MRA
: magnetic resonance angiography
WASID
: warfarin aspirin symptomatic intracranial disease
SONIA
: the stroke outcomes and neuroimaging of intracranial atherosclerosis
CCS
: causative classification system for ischemic stroke
PV
: peak velocity
MV
: time averaged mean of the maximum velocity
PCA
: posterior cerebral artery
MCA
: middle cerebral artery
ACA
: anterior cerebral artery
LPCA
: left posterior cerebral artery
LMCA
: left middle cerebral artery
LACA
: left anterior cerebral artery
RPCA
: right posterior cerebral artery
RMCA
: right middle cerebral artery
RACA
: right anterior cerebral artery
ICAVL
: Intersocietal Commission for the Accreditation of Vascular Laboratories
AKK conceptualized the study and organized it, reviewed this manuscript and wrote the first outline; HR, wrote the second draft, edited the paper and helped analyze the results; NM reviewed the paper and performed ultrasound evaluations; BA provided statistical support; MJ reviewed the paper and the data entry procedures; FW, SK classified the strokes for this study and reviewed this manuscript prior to publication. All authors read and approved the final manuscript.
Acknowledgements {#d30e1002}
================
This work was facilitated by the following: The Karachi Intracranial Stenosis Study was funded by a grant awarded to Ayeesha Kamran Kamal and Philippe M Frossard (formerly Dept. of Biologic and Biomedical Sciences, Aga Khan University) by the Higher Education Commission, Government of Pakistan, and No. 20-941/R&D/07. Ayeesha Kamran Kamal was also the recipient of a seed money Grant from the University Research Council, Aga Khan University Hospital to initiate exploratory work that led to the elaborated study. Dr. Faisal Wadiwalla trained as neurovascular research fellow whose training was currently funded by Award Number D43TW008660 from the Fogarty International Center and the National Institute of Neurologic Disorders and Stroke.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The content is solely the responsibility of the authors and does not necessarily represent the official views of the Fogarty International Center, National Institute of Neurologic Disorders and Stroke or the National Institute of Health or the Higher Education Commission, Government of Pakistan.
The authors would like to acknowledge the patience, kindness, time and cooperation of all patients and their families who contributed to this study. We would also like to take this opportunity to acknowledge, Hina Tejani for their excellent secretarial support. In addition the stroke team would like to acknowledge the support of the Section of Neurology at AKUH who always facilitate logistically all research endeavors.
Compliance with ethical guidelines {#d30e1011}
==================================
**Competing interests** The authors declare that they have no competing interests.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A large number of different types of fixtures are designed for displaying merchandise in stores. Stores often have pegboard walls, slot walls, and/or wire grid walls for supporting and displaying merchandise in addition to various floor fixtures on which merchandise may be placed or hung for display. Various types of brackets are designed for engaging different types of walls and display fixtures for holding the merchandise. Slot walls are provided with vertically spaced horizontal slots. In section, the slots have a "T" shape. Different types of displays are typically secured to the slots using brackets having an offset or "Z" shaped upper edge. The upper edge of the bracket fits into the slot and the bracket is held in place by the edge engaging the slot. Such a bracket is not capable of engaging a wire grid wall or a horizontal hang bar. One type of wire grid wall consists of a grid wires welded together into a grid forming 3 inch squares. The wires typically are up to gauge O, or 0.3065 inch diameter. However, other wire sizes and grid spacings also are used. A common hang bar is a steel bar of about 0.12 inch thick by about 0.5 inch high. The hang bar is horizontally mounted on a wall or on a floor or counter display fixture. Displays which are supported on wire grid walls and hang bars typically include one or more inverted "U" shaped brackets. The brackets generally have a gap sized to closely engage the wire or hang bar. Two different size brackets are used for typical hang bars and wire grid walls. If the bracket is too loose on the wire or on the bar, the display can move and may lack stability. The brackets used for wire grid walls and hang bars have not been suitable for use on slot walls.
One type of retail store display fixture has pairs of spaced horizontal wires. The display fixture may sit on a counter for holding jewelry, for example. The wires may be 11 gauge or smaller, or up to 0.120 inch diameter and may have a spacing in each pair of about 0.5 inch. A greater spacing is provided between the pairs of wires. Jewelry or other small merchandise may be hung on the wires. Or, many brackets designed for engaging a hang bar also may be supported on a wire pair.
In the past, a bracket designed for engaging one type of wall system or display fixture generally was not suitable for use with other types of wall systems, display fixture or hang bars. If a store has displays including, for example, slot walls and either wire grid walls or hang bars, separate sets of brackets were required for use with each. Ira single bracket could be designed for use with multiple types of fixture and wall constructions, the required inventory of brackets would be reduced and the display cost for a store would be reduced.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Maurice Dunlea Hinchey (October 27, 1938 – November 22, 2017) was a U.S. Representative from New York. He was a member of the Democratic Party. He retired at the end of his term in January 2013 after twenty years in Congress.
A New York City native who moved to the Hudson Valley where he attended high school and college, Hinchey had previously represented part of the area in the New York State Assembly since 1975. As chair of that body's Environmental Conservation Committee, he took the lead in bringing environmental issues to the fore, particularly when he held hearings on the problems created by toxic waste disposal in the Love Canal neighborhood of Niagara Falls. In his later years in Congress he vehemently opposed hydraulic fracturing to exploit the natural gas resources of the Marcellus Shale. Throughout his career he was considered a political progressive for his liberal stands on other issues.
He was particularly noted for his work on protecting the natural environment. For fourteen years he chaired the Committee on Environmental Conservation. Hinchey also served on the Ways and Means, Rules, Banks, Health, Higher Education, Labor, Energy and Agriculture committees.[citation needed]
During his chairmanship of the Committee on Environmental Conservation, the committee conducted a successful investigation into the causes of "Love Canal," the nation's first major toxic dump site. During his tenure, he also played a crucial role in the passage of the country's first law concerning regulation of acid rain. His committee also gained public attention for its investigation of the infiltration of the waste removal industry by organized crime.[citation needed]
In 1992, 28th District Congressman Matthew F. McHugh retired after 18 years in the House. Hinchey won the Democratic nomination for the district, which had been renumbered the 26th after New York lost three districts as a result of the 1990 census. He defeated Republican Robert Moppert, a county legislator in Broome County (which includes Binghamton) in the November general election by a 50% – 47% margin. In 1994, Hinchey faced Moppert again; in that year's Republican Revolution wave election, Hinchey won by only 1,200 votes.[citation needed]
Hinchey ran in historically Republican areas throughout his career (his Assembly district was held by Republicans from 1915 until McHugh won it for the Democrats in 1975). He is best categorized as having been a progressivepopulist. For example, he was one of the first and most outspoken opponents of the 2003 war in Iraq, and one of only 11 co-sponsors of the Kucinich Resolution to impeach President Bush.[6] He bridged the ideological gap with a reputation for supporting many measures to improve integrity in government,[7][8][9][10] by popular (in New York) advocacy of strong environmental protection,[11][12] and by diligent constituent services. He sat on the powerful Appropriations Committee, a post which helped him to deliver federal support on programs important to his district.[citation needed]
In 2010, Hinchey was elected to his tenth and final term, with a 52% to 48% margin over Republican George Phillips of Binghamton.[13]
On June 18, 2008, he stated: "Should the people of the United States own refineries? Maybe so. Frankly, I think that's a good idea," but conceded that it was unlikely the government would do so, and suggested putting national pressure on the oil companies.[17]
Hinchey, a Navy Veteran, scored highly on a 2010 report released by the Iraq and Afghanistan Veterans of America. Hinchey, a strong supporter of pro-veteran policies, helped vote numerous pieces of legislation into law; and during the time he did the American Legion called 2010 "a banner year on veterans legislation".[18] The Veterans' Benefits Act of 2010, addresses issues of veterans' housing and employment and as well it enhances insurance programs for surviving and disabled veterans.[19] In 2009, Hinchey was a member of the House of Appropriations Committee, and was a part of the largest funding for the Department of Veterans' affairs in the past 30 years. Hinchey wrote the Carmelo Rodriguez Military Medical Accountability Act, which would provide the opportunity for veterans to hold the military accountable for insufficient healthcare.[20]
Hinchey was an original co-sponsor in the Small Business Clean Energy Financing Act. The act contributed about $630 million in loans to environmentally friendly energy companies in the years between 2006 and 2009.[21] Hinchey was a solar energy supporter; he helped organize the non-profit organization called The Solar Energy Consortium (TSEC). TSEC supports the growth of a solar energy industry in New York, creating green jobs in the Hudson Valley area. Hinchey supported the Home Star Energy Retrofit Act. The bill supports green energy by offering rebates to homeowners who improve their homes to conserve more energy.[22]
In 2010 midterm elections, Hinchey clashed with his opponent over shale gas drilling and hydraulic fracturing in upstate New York. Hinchey was against gas drilling in this area.[23] However, this was not the only time he clashed over gas drilling. Obama's administration ignored a request by Hinchey to slow drilling in New York and Pennsylvania.[24] Along with Rep. Diana DeGette (D-Colo.) and Sen. Bob Casey (D-Pa.), Hinchey introduced legislation called the "FRAC Act" which proposes lifting fracturing exemptions and forcing public disclosure.[24]
Hinchey supported the Clean Air Act, and did not approve of the Bush Administration's decision to roll back the New Source Review (NSR) component of the Act, fearing it would result in increased acid rain and more pollution of the lakes of the area.[25] Hinchey was disappointed with General Electric's delays and the U.S. Environmental Protection Agency's failure to properly enforce a decision to clean up the Hudson River and make GE pay for the removal of PCB pollution.[18]
Hinchey introduced the Hinchey–Rohrabacher amendment in 2001, to prohibit the Justice Department from taking actions to interfere with the implementation of state medical cannabis laws. The amendment failed 152–273 upon its initial vote in 2003, and was defeated several more times in subsequent years up until Hinchey's 2012 retirement. In 2014, however, the amendment passed the House as the Rohrabacher–Farr amendment and was signed into law, providing supporters of medical cannabis with a key victory at the federal level.[26]
In 2009, the U.S. House Committee on Appropriations approved adding a provision authored by Hinchey to the committee report on the fiscal 2010 Justice Department appropriations bill, requesting "clarification of the Department's policy regarding enforcement of federal laws and use of federal resources against individuals involved in medical marijuana activities."[27]
Hinchey was made an Officer of the Order of Orange-Nassau on September 4, 2009 by the Ambassador of the Netherlands in capacity of Queen Beatrix. He was awarded the Dutch royal order for his work to commemorate the quadricentennial anniversary of Henry Hudson's exploration and discovery of the river in New York that now bears his name and for his efforts to strengthen the U.S.-Netherlands relationship.[29]
Representative Hinchey voted yes on H.R. 2433 Veterans Opportunity to Work Act of 2011.[30] This law will amend title 38, United States Code, to make certain improvements in the laws relating to the employment and training of veterans, and for other purposes.[31]
Hinchey, in August 2010, voted yes on the "Offshore Drilling and Other Energy Laws Amendments."[32] This regulates or controls the use of oil and natural gas.[32] It also increases safety on blowout preventers on oil wells, as well as upping the penalty for leaking or spilling of oil or "other hazardous substances" into the Gulf of Mexico. He also voted to repeal Don't Ask, Don't Tell in March 2010. This makes it illegal to dismiss someone from the army for being homosexual, having engaged in or suspected of engaging in "homosexual acts."[citation needed]
Another bill that Hinchey voted yes on, the Aid to States for Medicaid, Teacher Employment and Other purposes, passed in the House in August 2010. This budgets $10 billion to the Education Jobs Fund to be given to the states for teacher hiring and training. It also increases Federal Medical Assistance Percentages (FMAP) to states in need, and lengthens the period for states to increase their FMAP.[32]
In November 2011, he voted to reaffirm "In God We Trust" as the national motto and "encourag[e] the public display of the national motto in all public buildings, public schools, and other government institutions."[33]
In a letter sent on November 10, 2010 to Jeffrey Zients, the Acting Director of the Office of Management and Budget, Hinchey promoted the support of Job Corps. This program helps high-school dropouts find careers and receive their high school diplomas or GED's. He asked Zients for increased federal funding for this recovery program in the 2012 budget.[32]
On October 18, 2010, Hinchey held a Medicare forum to reassure seniors about provisions in the health care bill which would or would not change parts of Social Security and Medicare. He stated that the health care reform bill would increase the efficiency of Medicare; the Act would not cut into Medicare or social security funding.[citation needed]
Hinchey wrote a letter to President Barack Obama in October 2010 regarding Social Security. In the letter, he described to Obama how he believes social security is important and urged the President to increase its budget in the upcoming year.[32]
In May 2010, Hinchey, along with two other Progressive democrats, Lois Capps and Jay Inslee, began a petition to ask Obama to delay Shell from beginning exploratory drilling near Alaska. They wanted to understand the causes of the Gulf oil spills before Shell went ahead with Offshore drilling. Hinchey and the others were worried about the environmental effects if an accident were to occur; in the Arctic waters, a spill would not be contained as in the Gulf spill. Another priority is assuring that native communities would not be harmed; since they often depend on fish and marine life to sustain them, their resources would be vastly depleted if a spill happened.[34]
After the New York Times first disclosed the existence of the Bush administration's warrantless surveillance program in late 2005, Hinchey was among the earliest members of Congress to criticize the program. Not long after, Hinchey—along with three other House Democrats—John Lewis of Georgia, Henry Waxman of California, and Lynn Woolsey of California—wrote the Justice Department, requesting an investigation to determine whether Bush administration violated any laws in authorizing and carrying out the program.[3] As a result, the Justice Department's Office of Professional Responsibility (OPR) commenced an investigation.[3][35] It was later disclosed that the OPR investigation was closed down when President Bush himself refused to allow the Justice Department attorneys who were to conduct the investigation to have the necessary security clearances to conduct the inquiry.[35] After a public outcry, President Bush capitulated and allowed the investigators to have their security clearances so that they could conduct the inquiry.[36]
In December 1994 Hinchey was issued a summons after X-ray machines at Washington National Airport found a loaded .32-caliber handgun in his carry-on luggage before he boarded a flight. He had carried the pistol since receiving a state permit to do so while investigating organized crime as an assemblyman in the 1980s, and forgotten it was there when he decided to fly back to his district rather than drive. Hinchey pleaded no contest and was fined.[37]
In January 2012, Hinchey held a news conference at Senate House in Kingston, where he had announced his first run for Congress two decades earlier, to announce his retirement. "It's time for someone else", he told assembled reporters and activists. His illness and age had been factors, and he realized he still had time and wanted to enjoy it.[38]
He denied his decision to step down had anything to do with the state's pending redistricting, but did say that he wanted to make his intentions clear before the process was completed. His departure was seen as making it easier for the state's Democratic Party to decide which member of its congressional delegation would have to give up their district, since New York had to eliminate two of its seats that year.[39] Hinchey's seat was one of two, the other being that of newly elected Republican Bob Turner, eliminated in redistricting.
On April 22, 2011, Hinchey's office announced that he was being treated for a curable form of colon cancer. A statement released by his office said that Hinchey would have surgery at the Albany Medical Center, receive treatment at the Ulster Radiation Oncology Center in Kingston, New York, and also undergo chemotherapy.[40][41][42] The statement said that he would continue to work during his treatment. [40] His doctors said that they expected a full recovery.[42][43]
Maurice Hinchey had three grown children. He and his wife, Ilene Marder Hinchey, resided together in Saugerties, New York.[4]
Shortly after being treated for the colon cancer, Hinchey began experiencing symptoms of frontotemporal dementia, a diagnosis that his family did not make public until 2017.[44] Hinchey died from the disease on November 22, 2017 in Saugerties at the age of 79.[45] In December 2017, the Chicago City Council passed a resolution honoring Hinchey.[46]
This page is based on a Wikipedia article written by contributors (read/edit). Text is available under the CC BY-SA 4.0 license; additional terms may apply. Images, videos and audio are available under their respective licenses.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
We just got an agreement this morning with Canada and Mexico to replace NAFTA, which has driven the markets higher.
I thought the Trump-induced trade war with China would have resolved by now as well. At the beginning of the summer I forecast that the president would talk big, beat on a couple of trade partners with some tariffs, then quickly reach a negotiated truce and claim victory.
It hasn’t turned out that way.
Striking a deal with our old NAFTA buddies is definitely a good thing, but it’s not the Holy Grail of trade.
Yes, Canada and Mexico are larger trade partners than China, but China is the biggest threat by far by coercing companies into sharing trade secrets and dumping products in our markets. But we’ve not reached a deal with the Middle Kingdom, not even close.
Trump made the equity markets wretch a couple of weeks ago when he announced that he has another $267 billion worth of tariffs ready to go, after the $200 billion that he’s been working on.
But this is still just the opening act.
President Trump isn’t a protectionist, he’s an equal opportunity guy.
As soon as he gets a concession from China he’ll eliminate the tariffs and claim victory. It’s just a question of when, and what happens next.
As soon as the tariffs with regard to China come off, the equity markets should shoot even higher, especially the industrials, which generate about half their revenue overseas as well as purchase raw materials internationally.
By weighing on the markets with tariffs, President Trump has created a coiled spring that’s ready to leap higher.
But he’d better hurry. His moment in the sun could quickly melt if the Chinese trade war lasts into November.
The Democrats are on the war path (just look at the theatrics of the Supreme Court nomination hearings), and they have one very uniquely styled scalp in mind.
The Senate is unlikely to change, but if history is any guide, Madam Pelosi will once again wield the speaker’s gavel in the House of Representatives. Mid-term elections are historically not friendly to the sitting president’s party.
There’s not much about Trump’s agenda that Pelosi will want to keep, and she certainly won’t help him push through any further reform of government agencies.
Beyond what can be accomplished by executive order, the Trump train will come to a dead stop on the tracks somewhere between stations.
Without more love from Washington, companies are likely to take a cautious view of the future. Times are good right now after extracting $1 trillion from taxpayers in the form of corporate tax cuts and getting some love from the administration on the Clean Power Plan, but we’re just two short years from the next president election.
With the Dems aiming for the president, and him providing them with plenty of ammunition, who knows what will happen?
An implosion or two seems quite possible.
So what’s an investor to do?
Do you bet on the upside, estimating that the trade war will end and you’ll enjoy a nice run? Or do you move to the sidelines and protect what you’ve earned and let the markets fall as they may?
Neither. Or rather, both, but in their own time.
The investment environment today is a great example of why we need to have a plan for every investment we make.
Before you buy a security, you should know what would make you sell it, such as a pre-determined stop-loss level. By taking care of that on the front end, you save yourself a bunch of second-guessing and worrying when things get dicey.
So make a plan, grab some popcorn, and sit back to watch the fireworks over the next couple of months. It should be entertaining, to say the least.
Note: This article was written by Rodney Johnson. It was originally published at Economy & Markets on October 2, 2018.
In Economy & Markets Daily, the Dent Research team, featuring editors Harry Dent and Rodney Johnson use the power of demographic trends and consumer spending patterns to accurately identify economic booms and busts well ahead of the mainstream. Harry & Rodney believe demography is destiny. It is the future that has already been written. You just need to know how to read it.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Some coupons & discounts are not applicable to certain brands or products. Additional discounts & coupons are also not applicable to items that are marked as:
Everyday Value
Top Deals
Extreme Deals
Black Friday Deals
Cyber Monday Deals
Terms & Conditions for eBags Coupons and Discounts
At eBags, Free Shipping, Percent Savings, Dollar Savings and Reward offers are all considered to be promotional offers. Free Shipping is not available to Alaska or Hawaii.
Coupons and discounts apply only to available inventory and your next purchase. We're sorry, but we do not offer rain checks. Coupons and discounts may not be combined with other coupons or discounts. Coupons and discounts may not be applied to the purchase of email gift certificates or to eBags corporate sales orders.
Free Shipping promotions are determined based on the total pre-tax value of the items in your shopping cart after any discounts have been applied.
eBags Rewards
Product Features
Features two zippered compartments, inner mesh pockets and strap that adjusts to 50in
Detailed Product Description
Keep your passport, credit cards, cash, and other valuables within easy reach inside this sporty waist bag from Lewis N. Clark. The Lewis N. Clark RFID Waist Stash is made from nylon and polyester fabric and features a compact shape and a lightweight design with RFID blocking technology that keeps your valuables safe from wireless identity thieves and hackers. This waist stash has a zip top main compartment and includes inner mesh pockets as well as a separate zip front pocket to hold cash and other small items. An adjustable strap makes this belt bag easy and comfortable to wear around the waist.
Show MoreShow Less
Product Specifications
Best of the Best
An item achieves "Best of the Best" distinction when eBags customers give it exceptionally high marks in their post-purchase reviews. In order for an item to be "Best of the Best," it must meet the following criteria:
The overall rating must be 4.5 out of 5 stars or better.
90% or more of customers must say they would recommend it.
Ratings Summary
Overall Rating: 4.5
89% recommended
Based on 87 Ratings
Appearance
4.5
Total Ratings
stars
Durability
4.4
Total Ratings
stars
Organization
4.6
Total Ratings
stars
Price/Value
4.5
Total Ratings
stars
Product Reviews
"Bought this to carry my passport and my ID when I travel. It works both under and over your clothes because the fabric on the back is soft and the strap is decently long. I like that it also provides RFID protection."
Show More
"As a flight attendant traveling to many foreign cities, I bought this to wear on layovers while shopping & site seeing. I prefer to wear it under my clothes for extra security. I like the lightweight hands-free feature, and it holds my basics: passport, cash, a credit card, comb,lipstick, hand sanitizer. But the most important feature is the RFID protection as we find ourselves in many crowds on subways, buses and tourist attractions. Pick pockets and RFID scanners will have to find another victim!"
Show More
"It has plenty of room for the items I need to take when sight-seeing when I don't want to carry even a small handbag, ie sunglasses,some cash, sunscreen etc., when I just want to "travel light.""
Show More
"This is my go to item for airline travel. I've had knee replacements so every time I go through security, I need a pat down check, unless they have the X-ray. This means my belongings are sitting at the end of the check line usually out of sight. This item makes me feel more secure having the really important stuff on my body instead of in my unattended carry on bag. I might have to take it off but that's ok, I still have it in my hand. I won't travel by air without it. When I arrive it immediately goes in the hotel room safe which is also convenient."
Show More
For what types of Journeys and Adventures do you think this product works best?
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Sunday, September 27, 2009
Attending Ginn's Wedding Luncheon......Royal China Restaurant at Jalan Ampang.Little wedding gift on the table - 2 love shapechocolates:Only me & Ee Lin from the college gang. None of the others that we knew, except her mum & grandma.Ginn & the bridegroom (Eric) were getting ready to walk into the wedding hall with a little girl pouring the red flowers:The luncheon was planned to start at 12pm but it started at 1pm:While slide showing of the pre-wedding photos, here came the first dishes of the wedding luncheon - salad prawn, scallop vege, fried fishball with otak-otak:No shark fin served but chicken soup was the replacement:Ginn & Eric's families on the stage:The wedding ended at 3pm. This was the last dessert dishes, tong shui & red beanrabbit bao: Me & Eelin went over to take a photo with Ginn before leaving.
Wednesday, September 16, 2009
We celebrated Liang Ying Huat's birthday at FiremanBBQ in The Curve. (Liang = OYL, Ying = LOHHY, Huat = CWH. Last year we celebrated it as Loh Yuen Huat in Station One Cafe).This time Pei Fen also joined in, also to share the cost =pThey use chicken skin on the BBQ pot as oil, so unhealthy.Because the table cannot be combined, so we have to split into 2 tables.Aren also came over to join the dinner:Me & HuiYing should have kept ordering the 凉粉dessert under the buffet list rather than paying extra for green tea or chestnut dessert.The choices of food were so limited and they sometimes just repeating the same food that we didn't order.BBQ on top, in the middle. Then, all the BBQ oil dropped into the lower side of hot water, ewww.... how to drink the soup? Some say the soup became so sweet:Group photo before going back:
Sunday, September 06, 2009
Zing's 2 guinea pigs:They are about 1 year old.Zing managed to book a court in Setapak's Ibu Kota dewan for 2 hours (RM8 per hour).We haven't gathered for badminton since high school i guess.Dinner at Red Island cafe. Golden sauce friedrice 金香炒饭:Fries & Pandan butter toast:
Friday, September 04, 2009
Rushed for dinner at Wongkok Char Chan Teng, 1U. My set of Shanghai Noodle with minced pork & sesame. 上海芝麻肉碎面，好久没有吃到浆料及口感那么好的面条了:)Booked 10 lanes for about 50 staff. RM9 for 2 games, RM2 for shoes (Started at 8:30pm - 10:30pm). For every stike, we were given 1 can of 100 Plus while stock last. Champion = RM100.My team - Crocodile (Jerry, Boon Siong, Me & Yee Shyuan), each member also managed to get at least 1 can of 100 Plus :)Group photo before going back:
| null |
minipile
|
NaturalLanguage
|
mit
| null |
For a while now, India’s aviation industry has been on a wing and a prayer.
Burdened by high fuel prices, rising cost of airport operations, and taxes, the sector will be high on hope as finance minister Nirmala Sitharaman presents her first union budget on July 5.
Policy initiatives have become imperative as the dire straits that airlines are in show. India’s oldest private carrier halted operations over two months ago and has now been referred by lenders to the debt tribunal for bankruptcy proceedings. State-run Air India, meanwhile, may not be able to pay salaries beyond October as it is burdened by debt repayments, reported the Economic Times newspaper, quoting senior officials.
This has had an impact on domestic passenger traffic, which, for the first time in five years, contracted by 4.5% year-on-year in April, data from sector regulator directorate general of civil aviation show.
“Given the strong contribution of the aviation sector to the economy, the union budget should address the challenges related to complex policies, a multi-tiered tax system and (poor) infrastructure,” Indiver Rastogi, president and group head of global business travel at Thomas Cook (India), told Quartz.
Here’s what experts want Sitharaman to focus on:
Regional connectivity
Budget carriers IndiGo and SpiceJet have started to reap the benefits of introducing flights to non-metro cities.
“There is a huge surge in demand from smaller cities for domestic travel. While RCS (regional connectivity scheme) has made notable progress, steps should be taken to encourage more airlines to fly to some of the tier 2 and tier 3 regional airports,” said Aloke Bajpai, CEO and co-founder of the Gurugram-based travel portal Ixigo.
In 2017, India launched the Ude Desh ka Aam Nagrik (UDAN), which aims to increase regional connectivity by capping airfares on these routes. Air India’s subsidiary Airline Allied Services, SpiceJet, IndiGo, Air Deccan, Air Odisha and Turbo Megha are the main flight operators under UDAN.
Experts say more airlines should be included and the scope of RCS initiatives should be expanded.
“Sustained delivery on key initiatives like UDAN, Heritage City Development and Augmentation Yojana (HRIDAY), and integrated development of pilgrimage destinations through Pilgrimage Rejuvenation and Spirituality Augmentation Drive (PRASAD) is the need of the hour,” said Mahesh Iyer, executive director and chief executive officer, Thomas Cook (India).
Lower taxes
Aviation Turbine Fuel (ATF) in India has not yet been brought under the goods and services tax (GST) regime. The central government currently charges an 11% excise duty on ATF and state-level taxes can go as high as 30%.
“There is a need for bringing air turbine fuel within the ambit of the goods and services tax, thereby effectively capping the tax rate at 28% and ensuring seamless flow of input tax credits,” Anuj Prasad, partner, Shardul Amarchand Mangaldas, a Delhi-based corporate law firm, told Quartz.
Airlines and travel portals say they are also burdened by tax collected at source (TCS) when they sell a services.
“As this sector is one of the most tax compliant in India, we hope the government will take necessary actions to remit or remove TCS entirely. This will alleviate the unnecessary financial burden on airlines and OTAs (Open Travel Alliance, a group of major airlines, hoteliers, and others in the travel industry),” said Indroneel Dutt, chief financial officer at Cleartrip, a Mumbai-based online travel firm.
Allied sectors
Analysts’ hopes for sectors tied to the aviation industry are also high. For instance, the Maintenance, Repair and Overhaul (MRO) industry, should get tax cuts, they say.
“The budget should try to address the tax issues faced by MRO industry by reducing the GST rate. Currently airlines prefer getting cheaper services from countries like Sri Lanka, Singapore, Malaysia and not from India. So a policy providing some relief in that aspect is expected,” said Vishal Kotecha, associate director at India Ratings & Research Private Limited, a New Delhi-based credit rating agency.
Focus on providing superior infrastructure is also in the budget wish list. “The government must incentivise infrastructure activities in the sector, such as development of new commercial airports in high customer density areas,” Prasad said.
Rajeev Kale, president and country head for holidays at Thomas Cook (India) advocated strengthening of overall infra ecosystem. “A focus on increasing allocation to development of new tourism circuits and attractions, along with improvement of roads, railways, airports, waterways and sanitation will catalyse growth.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Enmax Power Corporation 2016-17 Transmission Tariff
Enmax Power Corporation’s 2016-2017 transmission tariff application is in the last stages with final argument due later in August. To date, there have been relatively few issues raised in this written proceeding. Among the more substantive issues raised are the following.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Cannot login to local database using web service
I am trying to access my local database using a web service also running locally on the Default Website in IIS7. I previously always used Windows Authentication but I read that to use web services you have to use SQL Server authentication, I have no experience with this but tried it out. I created a new login, but when I try using those credentials in my connection string:
connectionString="Server=.\SQLExpress;Database='SponsorChild';Trusted_Connection=True;User Id=abc;Password=abcpass" name="SponsorChildDatabase"/>
and try using the web service, I get the error:
System.Data.SqlClient.SqlException: Cannot open database "SponsorChild" requested by the login. The login failed.
Login failed for user 'IIS APPPOOL\DefaultAppPool'.
So it seems not even the right user is being passed. Moreover, when I try logging in using SQL Management Studio, it also gives me a login error (error 18456 with state 38). I apologize if this is just some rookie mistake, but I'm just starting out with databases and website building and still have a lot to learn. Any help is greatly appreciated.
A:
Trusted_Connection=True uses the Windows credentials and not the provided username and password. The user you've setup in the database doesn't play a role. You either need to use SQL Server auth or authenticate the Windows account the service is running under.
This is a sample connectionstirng not using Windows credentials:
Server=myServerAddress;Database=myDataBase;User ID=myUsername;Password=myPassword;Trusted_Connection=False;
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Way We Were (2014 TV series)
The Way We Were () also known as 16 Summers is a 2014 Taiwanese romance drama produced by Ruby Lin and Lisa Tan (Lin's agent) and directed by Fu-Hsiang Hsu (許富翔). It stars Lin, Weber Yang, Ann Hsu, Melvin Sia and Jason Tsou (鄒承恩) as five friends who met in college in late-1990s Taipei. The series narrates a love and friendship story that spans 16 years, from the summer of 1998 to 2014. It is set against major events that occurred in Taiwan during the 16 summers, such as the 729 blackout, 921 earthquake, SARS and the Financial crisis of 2007–08.
According to online statistics collected by the website dailyview.tw, it was the most popular Taiwanese idol dramas in 2014. Another website 7headlines.com ranked it the second most popular Taiwanese drama of 2014, after In a Good Way (which began broadcasting in 2013 and was therefore not included in dailyview.tw's ranking). Google ranked it the second most-searched TV series in Taiwan in 2014, after the Korean drama Empress Ki.
At the 50th Golden Bell Awards, the series won three out of seven nominations, including Best Television Series, Best Director, and Best Supporting Actress for Ann Hsu.
Synopsis
While in college, Jia-Ni Tang (Ruby Lin) falls in love with her schoolmate and neighbour, Wei-De Fang (Weber Yang), after she agrees with Wei-De's idea of an eye for an eye, when she catches her boyfriend cheating with another girl. However, broader events intervene in their romance: during the historic 921 earthquake in Taiwan, Jia Ni's friend Jun-Jie Wang (Melvin Sia) becomes crippled in one leg. Out of obligation and compassion, Jia-Ni decides to marry Jun-Jie. When Jia Ni and Wei-De run into each other again in 2008, she is a married woman and he is about to walk down the aisle. They are still in love but part as friends. But when fate brings the two back together at another wedding in 2013, will they make the same decision?
Cast
Main cast
Ruby Lin as Jia-Ni Tang
Weber Yang as Wei-De Fang
Jason Tsou as Guo-Qing Ding
Ann Hsu as Rui-Rui Zheng
Melvin Sia as Jun-Jie Wang
Supporting cast
Queenie Tai as Ge Qing
Ke Shu Qin as Linda
Dylan Kuo as Jiang Da-wei (cameo)
Akio Chen as Wei-De's Father
Lu Hsueh-Feng as Jia-Ni's Mother
Lo Pei-An as Jia-Ni's Father
Pang Yong Zhi as Tang Jia-Xing (Jia-Ni's brother)
Albee Liu as Jia-Ni's sister-in-law
Tao Chuan-Cheng as Jun-Jie's Father
He Ai Yun as Jun-Jie's Mother
Chen Shi-Rong as Guo-Qing's Mother
Gao Ting Yu as Xiao Yao (Jia-Ni's co-worker)
Yu Jin as Ah Tai (Ding Guo-Qing's brother)
Kelly Mi as Wei-De's Mother
Lu Ying Rong as Xiao Mei
Hank Wu as Jian Zhong
Liu Sai Yang as Jiang Hua
Lai Li Hua as Chen Li
Yang Qing as Shu Ling
Zhang Xi En as Luo Xiao Jun
Shan Cheng-Ju as Jin Ge
Renzo Liu as Liang Ge
Yao Mi as Bao Bao
Eric Chou as pop singer
Pauline Lan & TOLAKU as themselves (cameo)
Soundtrack
The Way We Were Original Soundtrack (16個夏天 電視原聲帶) was released on September 24, 2014 by various artists under Sony Music Entertainment (Taiwan) Ltd. It contains 15 songs, in which of them are instrumental versions of some songs.
Eric Chou appears in ep.4, ep.10, ep.14 and ep.16 as a pop singer, performing his song live.
Pauline Lan and the band TOLAKU appear in ep.5 as themselves, performing their song on stage.
Production
TVBS launch of its own drama division in 2013, The Way We Were was announced to be the third drama being made by TVBS.
It began filming in Taipei, Taiwan, on 31 March 2014 and ended on 1 July 2014. It reported more than 2 million NTD were spent on 2 days of filming in Shanghai.
It first aired in Taiwan on the Public Television Service and TVBS on 19 July 2014. And at same time, it aired in China by online video platform site iQIYI.
Special appearances
As her production, Lin invited good friends of her as cameo role or mentioned them by characters. Dylan Kuo guest stars in the earlier episodes, as he said "(I) have to be in Ruby Lin’s drama." His character mentioned Peter Ho's name in ep.1 as an in-joke; Ho is a good friend of Kuo and Lin's in real life. In ep.3, Ruby Lin's character watched celebrity Alec Su on TV. It was another in-joke since Lin had been very good friends with Su since 1997, with the media over the years frequently asking them whether they were dating. Lin's own name as well as her claim-to-fame TV series My Fair Princess (1998-1999) are also mentioned in several episodes as in-jokes.
In addition, every episode begins with a short message from a celebrity friend of Lin's on the topic of "farewell", including Kevin Tsai (ep.1), Zhang Ziyi (ep.2), Mark Chao (ep.3), Peter Ho (ep.4), Vivian Hsu (ep.5), Jerry Yan (ep.6), Huang Xiaoming (ep.7), Tony Yang (ep.8), David Tao (ep.9), Patty Hou (ep.10), Huang Bo (ep.11), Shu Qi (ep.12), Cecilia Cheung (ep.13), Richie Jen (ep.14), Rainie Yang (ep.15), and Ethan Juan (ep.16).
DVD release
December 17, 2014: The Way We Were (DVD) (Taiwan Version) (16個夏天 (DVD)(台灣版)) - Public Television Service Foundation. (TW) - DVD Region 3 - 8 Dics (Ep.1-16)
Accolades
Lan Zu-wei, chairman of the 50th Golden Bell Awards jury and film critic, said “The Way We Were” is an outstanding production on the strength of its complete storyline and high artistic and commercial values.
The series was praised for using character modeling, transformation of Taiwan's landscape and changes in characters' personalities to show 16 years of changes in the Taiwanese society.
“The Way We Were” selected as top ten 2015 Chinese-language TV series by Yazhou Zhoukan (Asia Weekly).
Broadcast
On 12 August, Taiwan Ministry of Foreign Affairs (MOFA) said The Way We Were is to be broadcast on 13 TV channels in Honduras, Guatemala, Panama, Nicaragua, El Salvador, Paraguay and the Dominican Republic — seven of Taiwan's 22 diplomatic allies — and in Argentina, Colombia and Mexico. It was chosen by the ministry following a strict screening process and will be the second Taiwanese TV series to be aired in Latin America.
References
External links
PTS The Way We Were official site
Official Facebook
TVBS Official site
Official Weibo
Category:Taiwanese romance television series
Category:Taiwanese drama television series
Category:2014 Taiwanese television series debuts
Category:2014 Taiwanese television series endings
Category:TVBS shows
Category:Public Television Service shows
Category:Films with screenplays by Ryan Tu
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Python: Reading Data from Multiple CSV Files to Lists
I'm using Python 3.5 to move through directories and subdirectories to access csv files and fill arrays with data from those files. The first csv file the code encounters looks like this:
The code I have is below:
import matplotlib.pyplot as plt
import numpy as np
import os, csv, datetime, time, glob
gpheight = []
RH = []
dewpt = []
temp = []
windspd = []
winddir = []
dirpath, dirnames, filenames = next(os.walk('/strm1/serino/DATA'))
count2 = 0
for dirname in dirnames:
if len(dirname) >= 8:
try:
dt = datetime.datetime.strptime(dirname[:8], '%m%d%Y')
csv_folder = os.path.join(dirpath, dirname)
for csv_file2 in glob.glob(os.path.join(csv_folder, 'figs', '0*.csv')):
if os.stat(csv_file2).st_size == 0:
continue
#create new arrays for each case
gpheight.append([])
RH.append([])
temp.append([])
dewpt.append([])
windspd.append([])
winddir.append([])
with open(csv_file2, newline='') as f2_input:
csv_input2 = csv.reader(f2_input,delimiter=' ')
for j,row2 in enumerate(csv_input2):
if j == 0:
continue #skip header row
#fill arrays created above
windspd[count2].append(float(row2[5]))
winddir[count2].append(float(row2[6]))
gpheight[count2].append(float(row2[1]))
RH[count2].append(float(row2[4]))
temp[count2].append(float(row2[2]))
dewpt[count2].append(float(row2[3]))
count2 = count2 + 1
except ValueError as e:
pass
I have it set up to create a new array for each new csv file. However, when I print the third (temperature) column,
for n in range(0,len(temp)):
print(temp[0][n])
it only partially prints that column of data:
-70.949997
-68.149994
-60.449997
-63.649994
-57.449997
-51.049988
-45.349991
-40.249985
-35.549988
-31.249985
-27.149994
-24.549988
-22.149994
-19.449997
-16.349976
-13.25
-11.049988
-8.949982
-6.75
-4.449982
-2.25
-0.049988
In addition, I believe a related problem is that when I simply do,
print(temp)
it prints
with the highlighted section the section that belongs to this one csv file, and should therefore be in one array. There are also additional empty arrays at the end that should not be there.
I have (not shown) a section of code before this that does the same thing but with different csv files, and that works as expected, separating each file's data into a new array, with no empty arrays. I appreciate any help!
A:
The issue had been my use of try and pass. All the files that matched my criteria were met, but some of those files had issues with how their contents were read, which caused the errors I was receiving later in the code. For anyone looking to use try and pass, make sure that you are able to safely pass on any exceptions that block of code may encounter. Otherwise, it could cause problems later. You may still get an error if you don't pass on it, but that will force you to fix it appropriately instead of ignoring it.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The “Contact Sports” Exception For Physical Injuries Suffered While Playing A Sport
Iowa law recognizes that participants in certain types of activities or circumstances owe less of a duty of care to other participants. In other words, in certain situations it’s harder to sue someone than it’d normally be. Those instances normally involve situations in which someone has voluntarily exposed themselves to a greater risk of harm and thus can’t be heard to complain when harm occurs.
One such activity that has been identified as an exception is contact sports. Participants in contact sports are not governed by the general rules of negligence. Rather, participants in contact sports are merely required to refrain from reckless or intentional conduct. This standard recognizes that known risks associated with a contact sport are assumed by participants in the sport and that it is contrary to the competitiveness of contact sports to impose a duty on participants to protect co-participants from such known and accepted risks through the exercise. So participants in contact sports are not completely free from legal responsibility for their conduct that creates a risk of injury, but they do enjoy a substantially lower duty of care in protecting other participants. This applies not only to the conduct that occurs within the rules and objectives of the sport, but also by conduct from participants who fail to properly execute an activity contemplated by the sport or who violate the sport’s rules.
So what is a contact sport? This analysis does not focus on whether the participants were engaged in a formally organized or coached sport, but instead centers on whether the activity inherently involves the risk of injurious contact to participants. Not all sports inherently involve contact capable of injury. The purpose of deciding whether an activity is a contact sport is to determine if the risk of harm of injurious contact was known and understood as a part of the sport. If the risk of injury is a part of the sport, then the participants must only refrain from reckless or intentional conduct causing injury.
Once an activity has been identified as a “contact sport,” the injured party can only recover if the higher standard of recklessness is proved. In order to prove recklessness, a plaintiff must show that the participant has intentionally done an act of an unreasonable character in disregard of a known risk or a risk so obvious that the participant must be taken to have been aware of it and so great as to make it highly probable that harm would follow. An act performed by a participant in a sport that produces a radically different result from the normal and expected result of the act, even when performed negligently, gives rise to an inference that the result was purposeful.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
This proposal describes the development, implementation and maintenance of a data coordinating center (CoC) for the second phase of the SEARCH for Diabetes in Youth Study. The SEARCH study CoC is being proposed by a team of investigators from the Wake Forest University School of Medicine (WFUSM) in response to an RFA from the Centers for Disease Control and Prevention entitled, "Incidence, Natural History, and Quality of Life of Diabetes in Youth" (RFA-DP-05-069). WFUSM is well positioned to serve in this capacity, having served as the CoC for the first phase of the SEARCH study since 2001. This study was a six-center study examining the prevalence, incidence, and clinical presentation of diabetes among youth 0 - 19years by diabetes type, ethnicity, gender and age, since 2001. Data from over 10,000 youth, representing prevalent cases in 2001 and incident cases in 2002 - 2005 atthe six SEARCH centers (South Carolina, Cincinnati, Seattle, Southern California, Colorado, Hawaii), is currently being stored and analyzed by the WFUSM SEARCH CoC. The WFUSM will provide statistical and operational support to address the following study aims proposed by the original SEARCH clinic sites for the second phase of SEARCH: (1) to prospectively ascertain newly diagnosed (2006-2008) incident diabetes cases in children/youth <20 years of age and collect data that permits estimation of temporal trends in diabetes incidence by age-group, gender, race/ethnicity anddiabetes type for the period 2002 - 2008;(2)to conduct longitudinal follow-up of incident cases already recruited to SEARCH in 2003 - 2005 in order to document the evolution of newly diagnosed diabetes according to clinical and biochemical factors and characterize the evolution of key risk factors for diabetes complications, according to diabetes type and race/ethnicity;(3) to assess the impact of quality of diabetes care in youth on short- and long-term outcomes including quality of life by completing analytic work initiated in SEARCH as described in the Quality of Care Roadmap and expanding the scope of quality of care assessment initiated in SEARCH in order to explore the interrelationships of patient characteristics, important domains of health care with outcomes, including glycemic control, satisfaction with care, receipt of recommended services, complications, and quality of life;and (4) to develop and validate simple and low- cost case definitions and classifications of diabetes types in youth that can be used for public health surveillance. Additionally, the WFUSM CoC will develop a plan to secure a central laboratory for the SEARCH study for storage and analysis of blood and urine sample and storage of DNA for ancillary studies. This phase of the SEARCH study will build on the knowledge gained in the first phase of the study, and will provide valuable clinical and public health information to address the growing problem of childhood diabetes.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Tear it up and ruin it? Nope....but steel is indefinately harder on yourgun than brass would be. Also it is more succeptible to rust. Check these casings for anti-corrosive primers. Cheap ammo often has corrosive primers. This WILL ruin your BBL. So you can buy cheep but watch the corrosive primers. In addition to the primers watch the lacquer coated casings. These gum up your gun if you dont watch out. I was in the shop with a guy who was trying to send his gun back to bushmaster. It was so caked up with the stuff. I checked in with the shop later bushy cleaned it all out for the guy. Odd...
Yup, AR's like to be clean. When a buddy of mine bought his first AR- I gave him some pointers along the way with a heavy emphasis on keeping it clean. He made his way to Camp Perry with a dirty one where I guess the humidity played it's card. In short order, he said he was sitting there taking in awful looks and snide remarks from a USMC Line Armorer who preached a cleaning sermon to him. He's a great fella and a good friend... but still- I ain't a-gonna let him forget that.
Been shooting Wolf for years, never a problem. Just keep your firearm clean. Wolf now uses a polymer coating on their shells. Lacquer is a thing of the past unless you get old ammo that's been sitting around in a mom and pop gun shop.
Wolf now uses a polymer coating on their shells. Lacquer is a thing of the past unless you get old ammo that's been sitting around in a mom and pop gun shop.
From my experiences, neither the lacquer or the polymer coatings have anything to do with the problems caused by steel case ammo. I have seen both lacquer and polymer steel cases stick in AR15s. I've also heated lacquer cases to 500F plus and left it much longer than it would ever see that temperature in a rifle and no lacquer melted. I've even seen the Hornady training ammo fail to function in some AR15s and it is superlative ammo, although steel cased.
Clearly the straight walled 5.56x45 case and the chamber of an AR15 are not a great match for steel. My hypothesis is that the steel just doesn't expand the same as the brass and isn't as quick to shrink back. Certainly steel cases work in a lot of ARs with no problems; but just not as reliably as brass.
I think it was on ar15.com that someone mentioned a problem with brass cases sticking in his Colt AR. It boiled down to shoot quite a lot of steel cased ammo followed by brass cased ammo.
The steel cases don't expand and seal the chamber at tightly as brass. This can allow some fouling to enter the chamber. If enough fouling accretes in the chamber, brass cases used later can "stick" in the chamber due to the now uneven surfaces. In the example situations he gave, he had to use a rod to pound the empty case out of the chamber.
I shoot the stuff in my AC556 full-auto. I've examined the spent cases and the poly coating is still intact - indicating that the steel casing never even came into contact with the chamber. If you have a stuck cartridge, the steel casing POSSIBLY could be a little harder on your extractor.
The Wolf ammo got a bad reputation when they were lacquer coated. The lacquer would melt off and gum up the chambers and cause cartridges to stick in the chamber. Not so with the newer poly-coated ammo. My AC556 gets quite hot when I'm shooting it - but not hot enough to melt the poly-coating.
Nor is the worlf ammo really prone to rust - also because they are poly-coated. The only draw back to using the wolf ammo is that it is too dificult to reload. Also, after the cartridge is fired, the cases do become prone to rusting if left out in the elements.
I am buying wolf .223 and 9mm when I can find good deals on the stuff. The ammo dealers have a lot of this stuff on order. I am hoping that after Obama's inaguration, the run on ammo will "cool off" and I might be able to pick up some more cheap wolf ammo at that time.
And, are you talking about poly-coated wolf, or lacquer-coated wolf? Lacquer coated wolf screws up rifles. You can't even find lacquer coated wolf for .223 rifles any longer.
And, please tell me how those rifles were screwed up.
I know that I and other AC556 owners regularly run Wolf poly-coated .223 ammo through our guns at full-auto, with absolutley no ill effects. I can't imagine an AR15 not being able to eat poly-coated wolf ammo. Prior to wolf coming out with the poly-coated cases, no one would use the stuff in their AC556's because it would coat the chamber with hard lacquer resin.
I have witnessed a Bushmaster choke on the polymer casings just the same as the lacquer. After about 100 rounds, whenever it got hot it would have a stuck case that required serious effort to clear. The owner would then scrub the chamber spotless (with hardened carbon deposits so big I initially thought the bolt lugs or some other part had broken) and then it would run another 80-100 rounds. Same rifle ran fine with brass.
I don't think the case coating has anything to do with it because I've seen lacquered cases do just the same thing and nobody has ever shown me a case where the lacquer has melted off - not to mention I cannot do it in my own experiments. I'd also add that Hornady uses lacquered steel in their training ammo and seem to have no problems.
I have seen old Wolf gunk up chambers with a red goo; but that was clearly the neck sealant and not lacquer. I wonder if this is the source of the lacquer myth?
And, are you talking about poly-coated wolf, or lacquer-coated wolf? Lacquer coated wolf screws up rifles. You can't even find lacquer coated wolf for .223 rifles any longer.
And, please tell me how those rifles were screwed up.
I know that I and other AC556 owners regularly run Wolf poly-coated .223 ammo through our guns at full-auto, with absolutley no ill effects. I can't imagine an AR15 not being able to eat poly-coated wolf ammo. Prior to wolf coming out with the poly-coated cases, no one would use the stuff in their AC556's because it would coat the chamber with hard lacquer resin.
Please do a search. This topic has been rehashed over and over again. If you like the stuff from a cheapness perspective, more power to you. If I have sinned against the Wolfammowoobie by again expressing my disdain for the stuff sorry..
I shot a hundred rounds of Wolf Military Classic .223 a couple of weeks ago. The last of the Wolf that I had and out of the 100 rounds I had one failure to feed properly. That seems to be about the average for me personally when I use that stuff however I have zero problems when I shoot brass. I religiously clean and lube my rifle after every shooting session so I don't know why it happens. I decided to stick with brass exclusively when shooting my AR-15. I bought a huge load of Prvi Partizan .223 it's almost as cheap and its brass.
This email link is to reach site administrators for assistance, if you cannot access TFL via other means. If you are a TFL member and can access TFL, please do not use this link; instead, use the forums (like Questions, Suggestions, and Tech Support) or PM an appropriate mod or admin.
If you are experiencing difficulties posting in the Buy/Sell/Trade subforums of TFL, please read the "sticky" announcement threads at the top of the applicable subforum. If you still feel you are qualified to post in those subforums, please contact "Shane Tuttle" (the mod for that portion of TFL) via Private Message for assistance.
This email contact address is not an "Ask the Firearms Expert" service. Such emails will be ignored. If you have a firearm related question, please register and post it on the forums.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Chinese Spicy Chicken or Le Tze Gee to use the ethnic title, is a dish that will challenge your taste with subtle hints of spice rather than heavy doses of it. Some spicy dishes are too heavy in one spice or another and that overpowers all other tastes. Chinese are far more subtle in their use of spices and when this dish is prepared properly, your taste buds are invaded with a variety of subtle tastes that combine to make this one of the best Chinese chicken recipes.
Ingredients
1/2 cup vegetable Oil
2 Chicken breast fillets
1 Tbsp Sherry
1 Tbsp light soy sauce
1 Tbsp corn starch … [Read more...]
Find Your Favorite
Find Recipes by Category
Featured Posts
Greek Roast Lamb is a traditional dish prepared in a unique eastern Mediterranean manner. It is an ideal method of cooking to draw out the subtle flavors that are natural to this meat. Cooking Tip This recipe recommends one hour and fifteen minutes cooking time and you should be aware that this is accurate […]
Homemade Granola makes a great breakfast as well as a delicious and healthy snack after school. Make a batch of this nutritious granola that features coconut, sunflower seeds, almonds and pecans with tasty dried fruit and keep on hand for a quick morning meal when time is short. Ingredients 2 Cups of old-fashioned oats […]
Thai Chicken Soup is a unique type of chicken soup that brings the favor of the orient to your table. Easy to make, delicious to eat. This recipe is a big favorite with my family because the coconut milk adds a special taste. Ingredients 2 inches of galanga root 5 stalks (the bottom 6 inches) […]
Chicken and Herb Casserole advertises itself before it reaches the table thanks to the smell of herbs cooking. The great thing about it is that it only takes about half an hour to prepare and cook. Ingredients 6 boneless chicken breast halves salt and pepper 1/4 cup butter 1 can (10.5 ounces) condensed cream […]
Diet Breakfast Burrito combines bananas and peanut butter in a tortilla for a meal way beyond the idea of “diet food”. This is a base recipe that can be adapted to your own taste. I like brunch recipes like this because they can provide a dozen or more meals depending upon your imagination. Ingredients 1 […]
Banana Nut Bread has always been a favorite and with this slow cooker recipe you can cook it without fuss. It is just as tasty as the original and maybe a touch more moist. The secret of this type of crock pot cooking is to place a traditional bake pan inside the slow cooker. This […]
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Tuesday, February 26, 2008
No love for Elbie
In both the Democratic and Republican primaries for Governor there's one candidate who is not as well known as the others.
Dennis Nielsen is not likely to defeat Richard Moore or Bev Perdue, but he's actually been treated with a fair amount of respect. He was invited to participate in the NAACP forum last month, where he impressed some people. When he filed last week, NBC 17 did a story about it.
There has been no such respect for Republican Elbie Powers, who is vying with Fred Smith, Bill Graham, Bob Orr, and Pat McCrory for his party's nomination. In fact the morning that filing opened when the News&Observer did a 'by the numbers' look at this year's political races it said there were 4 GOP candidates for Governor, completely neglecting his candidacy!
Check out Mr. Powers' website. There's more substantive information there about his views on the issues than you can find on the sites of several of his opponents. I may not agree with all of it but I certainly appreciate his putting it out there. And I hope the news media in our state will treat Mr. Powers with at least as much respect as they are giving Mr. Nielsen.
1 comment:
Anonymous
said...
Do you know seal cegel? I like it. My brother often go to the internet bar to buy sealonline cegel and play it. After school, He likes playing games using these seal online cegel with his friends. I do not like to play it. Because I think that it not only costs much money but also spend much time. One day, he give me many cheap seal cegeland play the game with me. I came to the bar following him and found buy seal online cegelwas so cheap. After that, I also go to play game with him.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Ethical controversies involving President Trump Donald John TrumpBiden leads Trump by 36 points nationally among Latinos: poll Trump dismisses climate change role in fires, says Newsom needs to manage forest better Jimmy Kimmel hits Trump for rallies while hosting Emmy Awards MORE’s Cabinet officials are piling up and becoming a major headache for the White House.
Reports of administration officials taking lavish trips, traveling on private jets, accepting gifts and buying expensive furniture have raised deep concerns among outside groups, Democrats and even some Republicans about the way taxpayer money is being spent under the new administration.
Trump himself has drawn ire for refusing to divest his business interests and taking frequent weekend trips on Air Force One to his private resort in Palm Beach, Fla.
“Some of the problem is the result of President Trump’s pledge to do things differently in Washington,” said Scott Amey, general counsel for the Project on Government Oversight, a nonpartisan government watchdog group.
“He has brought people into public service that are new to government and what we’re seeing is some of the differences between public service and what might be acceptable in the business world. Unfortunately that can be a recipe for waste and abuse and the taxpayer ends up holding the bill.”
At least one Cabinet official has already been forced to resign over his use of taxpayer funds.
In September, former Georgia Rep. Tom Price Thomas (Tom) Edmunds PriceConspicuous by their absence from the Republican Convention Coronavirus Report: The Hill's Steve Clemons interviews Chris Christie Trump flails as audience dwindles and ratings plummet MORE (R) stepped down from his post as Trump’s Health and Human Services secretary after it was revealed he was using private jets for official business at taxpayers’ expense, at a cost of more than $1 million. Price reimbursed the government for a little over $51,000 for his seat on the planes.
The spotlight is now on Housing and Urban Development (HUD) Secretary Ben Carson Benjamin (Ben) Solomon CarsonBiden cannot keep letting Trump set the agenda The Hill's 12:30 Report: Trump heads to New Hampshire after renomination speech Five takeaways on GOP's norm-breaking convention MORE after it was reported he ordered a $31,000 dining room set for his office late last year.
Here’s a look at who’s in hot water.
Ben Carson
The HUD secretary said on Thursday he has directed his staff to cancel the order for the $31,000 dinning room set and that he was just “as surprised as anyone” to find out about the purchase.
A HUD spokesman told The New York Times Carson didn’t know the table had been purchased and wants to be “as fiscally prudent as possible with the taxpayers’ money.”
Helen Foster, a senior career official at HUD, said in media reports that she was replaced after refusing an order from the then-acting secretary to find a way around a $5,000 legal limit set for office redecorating.
ADVERTISEMENT
It isn’t the first controversy Carson has faced as secretary.
The Washington Post reported in January that Carson allowed his son to help organize and participate in an agency “listening tour,” despite department lawyers warning him that it could violate ethics rules.
Citing current and former HUD officials, the Post reported that Carson’s wife, son and daughter-in-law have all attended official HUD meetings. The department’s inspector general is reportedly investigating.
Carson said the media is smearing his family.
"This week, my family and I have been under attack by the media questioning our integrity and ethics. I have openly asked for an independent investigation to rest these unfounded biases," he said in a statement.
David Shulkin David Jonathon ShulkinVA inspector general says former top official steered M contract to friend Schumer demands answers in use of unproven coronavirus drug on veterans Former Trump VA secretary says staffer found plans to replace him in department copier MORE
The Veteran Affairs (VA) secretary has been struggling with the fallout over a July trip to Europe.
A VA inspector general investigation found he misused government resources by not only scheduling significant personal time to sightsee while abroad, but accepting tickets to the Wimbledon tennis championships for himself and his wife.
The report said Shulkin misled investigators into believing the tickets were from a friend and therefore qualified for the “personal friendship” exception to the rule prohibiting government officials from accepting gifts. The report also found that Shulkin’s chief of staff had changed an official email to get government approval for his wife’s airfare.
Shulkin last month told USA Today that he had reimbursed the government $4,312 for the cost of his wife’s flights and would reimburse the adviser to the Invictus Games for the Wimbledon tickets.
“I do recognize the optics of this are not good,” Shulkin said in testimony to Congress. “I do accept responsibility for that, but I do believe it’s important the United States continues its work with its allied countries.”
Rep. Mike Coffman Michael (Mike) Howard CoffmanColorado mayor says he called protesters 'domestic terrorists' out of 'frustration' Colorado governor directs officials to reexamine death of Elijah McClain in police custody Petition demanding justice for Elijah McClain surpasses 2 million signatures MORE (Colo.), a Republican who could face a tough reelection race next year, is calling for Shulkin’s resignation.
In a letter to Trump this week, Coffman said Shulkin “clearly lacks the moral authority to lead the VA” and the “integrity expected” of a Cabinet official.
“Inevitably, employees throughout the VA will consider the example set by Secretary Shulkin as a ‘green light’ to avoid accountability, to take opportunities for personal enrichment, or other violations of laws, regulations, and their duties,” he said.
Scott Pruitt Edward (Scott) Scott PruittJuan Williams: Swamp creature at the White House Science protections must be enforceable Conspicuous by their absence from the Republican Convention MORE
The Environment Protection Agency (EPA) administrator is being scrutinized over reports that he routinely flies first or business class at taxpayers’ expense.
House Oversight and Government Reform Committee Chairman Trey Gowdy Harold (Trey) Watson GowdySunday shows preview: Election integrity dominates as Nov. 3 nears Tim Scott invokes Breonna Taylor, George Floyd in Trump convention speech Sunday shows preview: Republicans gear up for national convention, USPS debate continues in Washington MORE (R-S.C.) asked Pruitt to submit a detailed account of his flights after The Washington Post reported dozens of first class trips, including one from Washington to New York that cost $1,641.53.
Pruitt has also been asked to hand over all documents showing agency authorization of the non-coach accommodations. Gowdy said “blanket” authorization to fly first class is prohibited unless the traveler has an up-to-date documented disability or special need.
Gowdy has given Pruitt until 5 p.m. on March 6 to respond to his request.
Pruitt has defended his flights, saying his accommodations were determined entirely by his security detail. On Thursday he told CBS News’s “The Takeout" podcast the quantity, quality and types of security threats he's faced is unprecedented.
Pruitt said he was flying coach until a threat assessment showed the best way to protect him was for him to sit in a place where he could quickly leave if a threat arose, but that he's told his security to find a different way to handle threats.
"I've instructed those same individuals to accommodate those security threats in alternate ways, up to and including flying coach going forward," he said. "There’s a change coming."
Pruitt said his next flight will be coach.
Ryan Zinke Ryan Keith ZinkeTrump extends Florida offshore drilling pause, expands it to Georgia, South Carolina Conspicuous by their absence from the Republican Convention Trump flails as audience dwindles and ratings plummet MORE
The Interior secretary is another Cabinet official who has been feeling the heat over his travel costs and arrangements.
Members of Congress have pressed Zinke about his use of charter planes — one trip cost $12,000 — as well his use of military and government aircrafts.
Citizens for Responsibility and Ethics in Washington shared documents it obtained with CNN that said Zinke's office was told in October that he was on pace to be $200,000 over budget for travel. Zinke’s office has denied that accusation, saying there is no firm budget specifically for travel.
Zinke is also being investigated by watchdogs for potentially violating the Hatch Act, which bans federal employees from using their positions for political purposes, after speaking to the Golden Knights, an NHL team.
The team’s owner, Fidelity National Financial Chairman Bill Foley, personally donated to Zinke’s reelection bid for a Montana House seat in 2013 and 2014.
And CNN reported this week that Zinke is now being questioned for meeting with wealthy Republican donors during a trip to Texas in September to speak at an annual gun retreat.
Interior has said that Zinke follows all agency procedures for his travel and has his trips approved by the department’s ethics office.
Steven Mnuchin Steven Terner MnuchinLawmakers fear voter backlash over failure to reach COVID-19 relief deal United Airlines, unions call for six-month extension of government aid House Democrats plan to unveil bill next week to avert shutdown MORE
The Treasury secretary and his wife, Louise Linton, created controversy when they took a government plane to Fort Knox in August on the day of the solar eclipse.
Linton was slammed by critics for posting a photo of herself exiting the jet on Instagram and naming in hashtags the luxury fashion designers she was wearing.
The post came amid backlash over reports that Mnuchin had requested to use the government plane for the couple’s honeymoon earlier that year.
Mnuchin said he only explored the idea to ensure he could perform his duties while abroad.
“Let me be clear. I’m very sensitive to the use of government funds. I’ve never asked the government to pay for my personal travel,” he said.
In a tweet, Mnuchin said he didn't use the government plane on his honeymoon, but if he had he would have paid for it himself.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Plum Brook Shale
The Plum Brook Shale is a geologic formation in Ohio. It preserves fossils dating back to the Devonian period.
See also
List of fossiliferous stratigraphic units in Ohio
References
Category:Devonian Ohio
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Wednesday, October 19, 2011
Lee McCulloch grabbed the only goal of the game as Rangers claimed victory over Liverpool in a friendly at Ibrox.
Both sides used the fixture to give game time to players who have not featured as regularly as others so far in their respective domestic campaigns.
Skipper David Weir made only his second appearance of the season for Rangers after spending the early part of the campaign sidelined through injury, while Matt McKay was handed his first start.
Danny Wilson was named in the starting line-up for Liverpool against his former club but another ex-Rangers player, Charlie Adam, started on the bench, while Steven Gerrard was not included in the squad.
Juan Manuel Ortiz tried his luck with a decent shot early on that Doni did well to smother, before the goalkeeper was called into action again to block from Steven Whittaker.
The breakthrough came from the resulting corner when Steven Davis delivered into the packed goalmouth and the ball broke for McCulloch who forced home with 20 minutes gone.
McKay should have doubled the advantage a few minutes later with a header from six yards but Doni produced a great save to deny the Australian.
Liverpool could have levelled through a deflected shot from Andy Carroll but Allan McGregor was able to block comfortably in the Rangers goal.
Davis ran onto a long ball from McCulloch in plenty of space and tried to lob the goalkeeper only for his effort to dip just over the crossbar.
Liverpool emerged for the second half unchanged, while Rangers made five changes at the break, including McGregor being replaced in goal by Neil Alexander.
The home side thought they had added to their lead 10 minutes after the restart when substitute Kyle Lafferty tested Doni at his right-hand post and the goalkeeper spilled the ball but referee Willie Collum ruled that the effort did not cross the line.
Doni injured himself while attempting to make the save and was replaced by Martin Hansen.
Both sides then made a number of changes with just over an hour gone and Adam's introduction to the action was met with one of the biggest cheers of the night from the Ibrox crowd.
Rangers continued to carve out the best of the chances and Lafferty saw his long-range shot graze the crossbar, with the woodwork denying the Northern Irishman on this occasion.
Liverpool almost levelled late on when Carroll teed up the shot for Jordan Henderson and his well-struck shot was deflected just past the upright.
Carroll then went to ground under pressure from Alexander but there was no penalty award as Rangers held on for the win.
Liverpool goalkeeper Pepe Reina is delighted to have club captain Steven Gerrard back from injury and has described him as 'a born winner'.
Gerrard started his first game for the Merseyside giants in seven months on Saturday against Manchester United at Anfield in the Premier League and also found the target, as the match finished in a 1-1 draw.
Reina is overjoyed that the England international midfielder has recovered from a groin injury and is hopeful of watching him in action regularly this season.
"Stevie is the badge of this football club, the soul of this team and we are more than happy to have him back in the team," said the Spaniard in the Liverpool Echo.
"Hopefully he will be back for a long, long time. Just by the fact that he is on the pitch it is an inspiration for us.
"He always leads by example and anything he does he does with passion and a lot of commitment. He is a born winner."
The draw with champions United has placed Liverpool in fifth spot on 14 points from eight matches, making Reina optimistic of further progress in the table as the season unfolds.
"It's a positive thing to be disappointed at having not beaten Manchester United," enthused the 29-year-old.
"It speaks well about the hunger of the team and the performance of the team that clearly we deserved three points. It was unlucky but we have to keep going.
"We have been consistent so far this season. We had just one poor game at Spurs (4-0 defeat in September).
"It shows without doubt the progress that has been made. We are all much happier than a year ago.
"It is not about belief. It is about the quality of the team and the squad and the strength we have as a group.
"We have to work on a daily basis to improve, keep going and compete more often with the people above us.
"We will find out at the end of the season and hopefully the distance won't be that big."
Liverpool is being touted with a move for PSV Eindhoven's Dutch starlet Georginio Wijnaldum.
The 20-year-old attacking midfielder, who has been likened to Real Madrid superstar Cristiano Ronaldo, is gaining the attention of a number of European clubs, after growing unsettled following his €5 million summer switch from Feyenoord.
Wijnaldum has been lauded for his attacking style and dribbling abilities, and is reportedly being lined up for a January move after only four months in Eindhoven.
While the player and his agent haven't mentioned any potential suitors as of yet, the Dutch international is believed to be keen on a move to Premier League giants Liverpool.
Wijnaldum is a huge fan of Dirk Kuyt, and following his success in the Premier League, has previously expressed a desire to follow in Kuyt's footsteps.
If Liverpool boss Kenny Dalglish were to give the go-ahead for the player's transfer, it is expected that PSV would want to recoup most of his initial fee.
Despite not featuring regularly for Eindhoven this season, Wijnaldum was granted his first international cap against San Marino in a Euro 2012 qualifying match. He marked his debut with a goal in an 11-0 thrashing.
When Rafael Benitez signed Brazilian midfielder Lucas Leiva back in 2007, much was expected of the youngster, who made his international debut the year before whilst with Gremio.
A £5 million price-tag added further to the pressure, and whilst much higher figures are now spent on young players (think £16 million for Jordan Henderson), the fee suggested big things were to come.
"I am looking forward to seeing him score goals for Liverpool in the future and [we] believe he has the mentality and the character you need to do well in England," uttered Benitez at the player's unveiling.
Few would have believed it after his first few seasons at Anfield, but Lucas continues to prove the Spaniard right, and after a stellar campaign last year, the 24-year-old is again impressing on Merseyside, leading the Barclays Premier League tackling stats by a distance.
Of the top five tacklers in the division, Lucas has made over ten more successful challenges, with a 73% success rate from his 48. Youssouf Mulumbu, next on the list, has a 59% success rate from 37 efforts.
Whilst stats can only tell you so much in October, it's indisputable that Lucas has enjoyed a resurrection at Liverpool in the last season and a quarter.
His first season with the Reds was seen more as a bedding in period, but big things were expected of the Brazilian in the 2008/09 campaign after returning to the club with an Olympic bronze medal.
However, Lucas struggled to take opportunities when presented, and failed to impress in the shadow of Javier Mascherano, Steven Gerrard and Xabi Alonso. Booed off the pitch in a Barclays Premier League match against Fulham, Benitez was passionate in his defence of the player.
"People just don't know how good Lucas is. He is a fantastic player, he was captain of his club side at 19 and has already won full caps with Brazil. Not just any country, but Brazil," said Benitez after further criticism of the player came the Spaniard's way at a Charity event.
"He can tackle, he can pass the ball and he can win in the air. He is still a very young player learning to live in a different country.
"It is not easy for him to get into the team, considering the quality of the opposition he has to face in that department at Anfield."
Ian Doyle, writing for the Liverpool Daily Post at the time, went as far as to suggest a Champions League clash against PSV Eindhoven, which followed the Fulham draw, could decide his future at the club.
If that was the case, then it was lucky Lucas shined in a 3-1 win.
Confidence clearly grew, and a commanding display in-place of Xabi Alonso in the 4-1 win at Old Trafford in March certainly helped convince the fans that perhaps they mis-judged the hard-working midfielder.
Liverpool legend John Aldridge believes that Jose Enrique was one of the best investments Kenny Dalglish made in the summer transfer window, with the manager finally finding a star to fill the left-back position in the Reds’ line up.
Enrique signed for Liverpool in early August, and has starred for the club since, as the Reds aim to steal a place in the top four and make the Champions League for the first time since 2010.
And Aldridge, who played for Liverpool in the 1980s glory days alongside Dalglish, believes that the side are a lot better off now they have Enrique on board.
“Every time I see Jose Enrique play he impresses me,” Aldridge told the Liverpool Echo.
“The Spanish left-back seems to grow in confidence with every game and he was great against Manchester United.
“He’s very solid defensively, physically strong and has got great quality going forward. In general we defended really well as a unit and it was just a pity we went to sleep from a corner and paid the price.”
Liverpool had their chances to steal a win from United at the weekend, but the game resulted in a 1-1 draw. Ferguson didn’t start his top forwards for the match, and Aldridge believes that this showed how much respect the legendary manager has for the Liverpool squad.
“Alex Ferguson paid Liverpool tremendous respect with the team he put out on Saturday,” he explained.
“He set his stall out to come to Anfield and nick a point. Thanks to some good fortune he got what he wanted.
“I’ve never seen United approach a game against Liverpool like that. By playing Phil Jones in a holding midfield role alongside Darren Fletcher, United were never going to pose much of a threat going forward. They simply set out to stop Liverpool playing.
“The bench they had was formidable with Rooney, Nani, Hernandez, Carrick and Valencia but Ferguson filled the team full of grinders. United had been bullied at Anfield in recent years. In March they were outplayed and outfought and Ferguson clearly feared a repeat.”
International midfielder Joe Cole has explained his reasons for leaving Anfield to join French champions Lille on loan, insisting he hopes to move permanently as Liverpool are now a 'settled' team under Kenny Dalglish without him.
Cole evidently feels that he is no longer a part of that 'settled' squad, though his ongoing loan spell at Lille has been a resounding success with the English midfielder currently impressing in Ligue 1.
The crafty playmaker has now insisted that the tactical approach at Liverpool didn't suit his style of play, suggesting that injuries hindered his progress under both Roy Hodgson and Kenny Dalglish.
"I just didn't play enough. I was suspended and then came back into a struggling side and, under Roy [Hodgson], the tactics didn't suit me.
"I'd never criticize him – he had a tough job at the time – but the team wasn’t playing well and, when that happens, the first players to be dropped are always the flair players and the youngsters. That's just the way it is."
Since arriving at Liverpool on a free transfer under Hodgson, Cole came under a lot of criticism for his inflated wages and persistent struggles with fitness. During his spell at Anfield, Cole cost Liverpool £157,000 per game played and £1.2 million per goal, but his form since joining Lille has shown he is still a player of immense talent.
The former England midfielder - who recently revealed he hopes to resurrect his international career - has claimed that he constantly felt the need to prove his worth under Kenny Dalglish, and is now looking forward to the prospect of permanently playing in France.
"Under Kenny [Dalglish] I'd had a few injuries and the side was settled. As a youngster, at West Ham and Chelsea, I'd been lucky enough to make an impact when I came on and earned the chance to stay involved. At Liverpool, I felt like a young player again.
"I always needed to do something special just to earn another chance. And it didn't happen for me. I'm not going to blame anyone else and I like the club and I'm sure they'll get where they need to go. But I had to come here and play again.
“I could join Lille permanently. If they are happy with me, and vice versa, I don’t see why not," Cole revealed to the People.
“Lille has quality players, and there’s an unbeatable mood in the dressing room. I benefit from it every day and I am enjoying myself. There is a superb team spirit at the club. I love playing here.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Enjoy a Two-Course Lunch Special at Sandbar
Sandbar
Sandbar serves a special two-course prix fixe lunch Monday through Friday from noon to 3 p.m. Cost is $18 per person, plus tax and gratuity. The special includes the soup du jour and choice of one sandwich or salad. The selection, subject to change, includes:
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
USB Debugging option not available
I am currently facing a problem with an Android Tablet, the tablet is working on 2.3.4 and it's a specific tablet (not a usual brand such as Samsung...).
Information on the tablet :
Filesystem : Release 4.6.4-r171
Kernel : 2.6.35.3-g56a157f
It's seems to be a MX 93 (freescale)
I want to connect it for debugging. The problem is there is no "Debugging USB" option to check in the Parameters => Application => Developpment.
Have you any ideas on how to do it ?
Thank you by advance.
A:
To enable ADB manually you need to configure USB interface and start adbd service on the device. First of all install a terminal emulator application. In the terminal run this command:
setprop sys.usb.config adb
If you are lucky and adbd service is properly pre-configured on your device it should start enumerating now.
If not - try looking for start adbd in the init*usb.rc files in the / folder. The lines before that command should give you an idea what else could be missing.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Monday, December 3, 2012
I am more and more convinced that we live in a world of make-believe, a world of make-believe created by the media we use.
Six years ago I started a personal inquiry into why every time I built an art program at a school it was either cut or I was bumped out within two or three years. This journey took me to spending five years as a technology integration specialist, study of school policy, and intense research into the history of public schooling, particularly the history of trends in instructional methods and pedagogy. What I found was something quite troubling. In the past ten years Minnesota has lost over 50% of its fine arts FTEs in schools across the state. How can this be? Could there be other data and statistics out there that would point to the source of this problem? I will come back to this point later.
Last summer it struck me. I have attended and presented at the ISTE Conference twice in the last three years and have followed it closely the years I could not attend. This is the world's largest education technology conference. Now, when I was growing up the computer was a major influence on my intellectual development. I spent hours learning how to program video games and write code. Through writing code I learned algebra, logic, mechanics, and physics in an intensely immersive project-based authentic way. For me the most important aspect of this machine as a learning tool was what it provided as a medium of expression, of creativity, and of engagement. It brought math to life. It also provided me a way to cope with my dysgraphia. But, of the 385 concurrent sessions offered at the 2012 ISTE Conference only four were about engaging students as computer programmers. FOUR! That is just 1% of the sessions at the world's largest education technology conference. What is going on here? For fun, and to illustrate a point, I created this infographic about last summers ISTE Conference:
1% of sessions at ISTE about programming and 50% of Minnesota's art teachers lost, could these statistics have a common root? I believe so. What I left out of this infographic is that when you search the ISTE conference site using the session keyword search engine the number of sessions with the word "create" appear far more than any of the examples I listed here. However, upon closer inspection of these sessions they are all examples of creation as a consumer of participatory media. When we create a web page using a WYSIWYG editor, when we build a Facebook page, when we upload photos to Flickr, when we make a podcast, when we click "like" on someone's status, when we click a link we are feeding the beast. All of these activities produce data.
In Marshal McLuhan's (1964) Understanding Media: The Extensions of Man McLuhan tells us that the "Medium is the Message," meaning that it matters less what content is contained in media than the effect a media has on us. In other words, the effect of the existence of television in our homes is greater than the effect of any content that may be delivered through it. A media has an effect of working us over, making us numb to its nature and leading us to shift our ways of thinking. McLuhan wrote this book at a time when Television was beginning to take over as the dominant media.
Twenty years later Neil Postman wrote Entertaining Ourselves to Death at a time when television had long since replaced newsprint and radio as the dominant media and McLuhan's observations were more apparent. Postman observed that when a society shifts its dominant media from one to another it also shifts what it values as sources of truth. Once it was that “feeling is believing” then “saying is believing” then
“seeing is believing” then “reading is believing” then “deducing is
believing” and now “counting is believing.” Postman argues that it is
the media driven culture that has reduced our concept of what is
believable data to that which can be counted, that which can be
objectified and abstracted. I would argue that it is not the mass media of television or radio that did this, these are analog media but rather the emergence of the computer and digital media.
If you look to rhetorical arguments, campaign propaganda, and advertisements from the 1950s you see a different appeal than you do today. Not a day goes by where we are not inundated with data and statistics as a source to base our beliefs, change our minds, or influence actions but just 60 years ago the use of data and statistics was far less a part of our lives. Instead, the analog electric media of the time produced a belief system that relied on analog sources. A politician was more likely to use a "plain folk" argument or a clever play on words to sway a voter and the advertisements for products focused more on how a product would make you feel.
But today it is data that we look to for our source of truth. The role of data and data visualization have changed and evolved over time. We have become a data-obsessed culture to the point where if we make decisions that are not data-driven or data-informed we are looked to be foolish. In a staff meeting just a couple of months ago a colleague said, "How can you justify a decision like that without collecting data to back it up?" A statement like this is telling on two fronts. First, it negates qualitative data and only focuses on that which can be quantified. Second, it implies that the decision has already been made and that the data we collect ought to back up our decision. This is not data-driven decision making, it is decision-driven data collection. But more times than not what is called data-driven decision making is really a rhetorical device used to justify decisions based on other factors.
The building blocks of digital media is data, it is digits, 1s and 0s and having moved to center stage in the past 10 years as the dominant media it has shifted publicly accepted sources of truth to that which can be quantified. If it can't be counted it is hard to justify it and it is hard for the meta-world created by the data we produce which overlays our real world to see it. Along with this new source of truth comes a charge and desire to "feed the beast;" to produce more and more data. Because, the more clearly the meta-data world represents aspects of our real world the easier it is to manipulate both. Hence the presence of so many sessions at ISTE asking teachers and students to "create" but so few asking them to "program." And, because there is no data-collection method used to evaluate the effectiveness of Minnesota's arts programs many of them get left out of the data-driven decision process. How can you make a decision to keep a program when the law of the land (NCLB) asks you to make decisions based upon data you have collected. Data that is easily quantifiable. But, make a standardized test to evaluate student achievement in the fine arts and you kill it.
I say we are living in a make-believe world. The data=truth pandemic is a grand illusion. This world overlays our real world and we tap into it all the time. Today with a smartphone and an augmented reality app you can scan your neighborhood and access data about physical places and soon you will be able to access data about people. QR codes give us access to the meta-data world associated with objects around us. There have even been calls to create a game layer over the real world. These tools all give us more information that are supposed to help us make decisions but what do they leave out? Are there things in our real world that cannot be digitized or datafied? Are there things that will not make it into the meta-world. And, when we rely on the meta-world for our source of truth what happens to those things that don't make it there?
The big problem is not that data cannot represent aspects of truth. It can. But it can never represent all aspects of truth. It is by nature an abstraction and massive amounts of data rely on visualization techniques to make sense of it. A data visualization is a further abstraction one step more removed from the truth. The more we work with abstraction the more we can manipulate the interpretation of truth. Truth in data becomes truth crafted by interpretation of data which becomes truth crafted by design. Nowhere is this more evident than in the emergence of infographics.
If I gave you a statistic that said homeowners increased their spending on entertainment 11% between 1986 and 2010 you probably wouldn't pay it much mind. But, if I accompanied that statistic with picture of an overweight guy in a stained tank top slumping on a couch watching television and eating potato chips you would interpret that data infusing it with negative associations. However, if I instead accompanied that data with an image representing ballet, the theater, or the symphony it takes on a new interpretation. Data can be manipulated without changing the data.
Marshal McLuhan was cautiously optimistic that if we understand the nature of media we can avoid many of the negative effects it brings. If we understand the nature of the beast we can keep it at bay. At the same time he observed that, "First we craft our tools then our tools craft us," leaving the possibility that it matters not how much we understand the nature of the media, it will likely have its effect anyway.
11 comments:
I agree with your argument, but I think that "creation as a consumer of participatory media" needs more explanation as an idea. If you could elaborate more in this area, then you would have better buy in from a larger group on the basic idea in this article.
Unfortunately, this is really one of the challenges of the digital age. How can we move from scripted creation in a highly restrictive environment to more free-range creation? How can we move from constructing IKEA furniture to carpentry?
I understand what you're saying, and I surely agree that more folks should know how to code. That said, it's only when the tools become available in easier form that the true flourishing of creativity becomes possible, because then average folks - not just specialized experts - can utilize them without steep learning curves.
HTML, blogs, and Facebook are a prime example of this. When we tried to advocate to people the power of having a site on the Web, few took us up on that proposition when it required learning HTML. More took us up on that when it became easier, in the form of blogs. And even more took us up on that when it became even easier, in the form of Facebook. We see similar parallels with other forms of digital creation.
Despite your concern about use of pre-designed tools, we are seeing an ever-increasing flourishing of user-generated content, conversation, and connections, all of which were less possible when the tools were more difficult.
Fair enough. But just because you had the interest to start digging into coding doesn't mean most people do. In fact, we know they don't. And yet they can be quite creative with tools others design and offer. For example, you're not using blogging software you created from scratch. Nor do you likely use word processing software, presentationware, electronic spreadsheets, email programs, and other tools that you made yourself. And yet you use those tools that were made by others in creative and powerful ways. Doesn't your daily practice disprove your own point?
So because I use tools someone else made to write and publish my blog it negates the startling statistic that less than 1% of the sessions at ISTE last year were about teaching students to program? Plus, my point is not that we should only use tools we make from scratch but only that computational thinking is important enough to develop in students that it should not be on the endangered species list. And, I do often make my own tools.
I'm curious to hear from either of you (Scott or Carl) on how Jonassen's Mindtools would fit into this discussion. There are obviously advantages to being able to create something on your own, it's just a balance between what you're asking others to do, and what they're willing to do (i.e. learn how to code).
There are also implications on design model thinking here. Can teachers (and students) be designers without knowing how the programs they're using internally work?
After some reflection on Scott's comment yesterday, I don't think I ever made the case that tools made by others limit creativity. They do place limits on expression, which is true of any media, digital or analog. What I was trying to point out was that with web 2.0 this limit of expression is different because it produces data that can be accessed by the tool maker and most web 2.0 tools integrate data collection and aggregation as a core feature. In many cases this has profound positive advantages but it still fuels the belief that data is the source of truth.
I am only slightly familiar with Johannson's Mindtools. My understanding is that basically he sees the use of technology in a learning environment as a cognitive extension. I think this theory is in perfect alignment with Marshal McLuahn's belief that all technology and all media are extensions of people. Tons of others support this viewpoint as well.
Also, I agree with Scott in that you certainly can design without knowing how all the nuts and bolts work. In fact, you could argue that the web designer who writes all his work in html didn't invent the language or the browser that is used to compile the code, nor did he invent the assembly language that the the browser code gets translated into or the machine on which it renders.
Thanks for providing such nice information to us. It provides such amazing information on care/as wellHealth/.The post is really helpful and very much thanks to you. The information can be really helpful on health, care as well as onexam/ tips. The post is really helpful. Thanks for providing such nice information to us. It provides such amazing information on Law Exams/
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Introduction {#S0001}
============
The hsp70s are a family of ubiquitously expressed heat shock proteins. Almost all living organisms possess proteins with structure similar to that of hsp70s. The hsp70s are an important part of the cell machinery for protein folding and they help to protect cells from stress (Tavaria *et al.,* [@CIT0036]; Morano, [@CIT0024]). Members of the hsp70 family are strongly up-regulated by heat stress and toxic chemicals, particularly heavy metals such as arsenic, cadmium, copper, mercury, etc. Hsp70 was originally discovered by F.M. Ritossa in the 1960s when a lab worker accidentally boosted the incubation temperature of *Drosophila* (fruit flies). While examining the chromosomes, Ritossa found a "puffing pattern" that indicated elevated gene transcription of an unknown protein (Ritossa, [@CIT0032]). This was later described as the "Heat Shock Response" and the proteins were termed as "Heat Shock Proteins" (hsps). The argument to use measurements of this stress response as a biomarker is based on the mode of induction of the *hsp70* gene(s) and the corresponding protein class, hsp70, which so far represents the best investigated family of stress proteins. The role of hsp70 in intracellular protein folding and the transmembrane protein passage is based on their capability to bind uncoiled polypeptide chain (Kohler *et al.,* [@CIT0019]). Genes encoding heat shock proteins are highly conserved and many of their products can be assigned to families on the basis of sequence homology and molecular weight. In an un-stressed cell, hsp acts in successful folding, assembly, intracellular localization, secretion, regulation and degradation of other proteins (Fonager *et al.,* [@CIT0010]). Under conditions in which protein folding is perturbed or proteins begin to unfold and denature, hsp assists in protein refolding, in protecting cellular systems against protein damage, in solubilizing aggregates to some extent, in sequestering overloaded and damaged protein to degradation machinery (Fonager *et al.,* [@CIT0010]). Under stressful conditions, all living organism respond by synthesizing heat shock proteins (HSPs) (Nover, [@CIT0030]; [@CIT0031]). HSPs function as molecular chaperons that prevent cellular damage (Bennett & Waters, [@CIT0004]). In the recent years, *hsp70* has been considered to be one of the candidate genes for predicting cytotoxicity against environmental chemicals (Bierkens, [@CIT0005]; Mukhopadhyay *et al.,* [@CIT0026]; Mukhopadhyay *et al.,* [@CIT0025]; Lis *et al.,* 1983; Siddique *et al.,* 2011[@CIT0033], [@CIT0034]).
Methyl methanesulfonate (MMS) is a quiet stable molecule, but the presence of oxidizing agents, acids, alkali and excess heat may lead to its instability. Exposure to MMS appears to be limited to laboratory research personnel (HSDB, [@CIT0015]). It is classified not only as a carcinogen but also as a mutagenic agent for bacteria and yeast (alkylating agent). It has also been reported to cause developmental toxicity (HSDB, [@CIT0015]). The American Conference of Governmental Industrial Hygienists (ACGIH 1997) has not proposed any occupational exposure limit for MMS in workplace air and no international guidelines for MMS in drinking-water have been established (WHO, [@CIT0037]). MMS methylates DNA on N^7^-deoxyguanine and N^3^-deoxyadenine. Originally, this action was believed to directly cause double-stranded DNA breaks, because homologous recombination-deficient cells are particularly vulnerable to the effects of MMS (Lundin *et al.,* [@CIT0022]). MMS is used experimentally as a mutagen, teratogen, and brain carcinogen, as a research chemical, and also as a catalyst in chemical synthesis (IARC, 1974; Merck,[@CIT0023]; HSDB, [@CIT0015]). Methanesulfonic acid monoesters may be used as insect and mammalian pest chemosterilants and also as a possible human male contraceptive (IARC [@CIT0017] & [@CIT0016]). Most of the chemotherapeutic agents target DNA (Cozzi *et al.,* [@CIT0008]). Therefore, the DNA repair status is of utmost importance for tumor sensitivity to drugs and at the same time for the protection of normal tissue. In humans the therapeutic application of MMS to cancer patients of total doses ranging from 2.8 to 800 mg/kg body weight over a period of up to 350 days led to significant gastrointestinal and hepatic toxic effects. MMS induced somatic and sex-linked mutations in *Drosophila* (Y*oda et al.,* [@CIT0038] *).* Nowadays the use of animals in toxicological research and testing has become an important issue for both science and ethics. As a result emphasis has been given to the use of alternatives to mammals in testing, research and education (Mukhopadhyay *et al.,* [@CIT0026]). The European Centre for the Validation of Alternative Methods (EVCAM) has recommended the use of *Drosophila* as an alternative model for scientific studies (Festing *et al.,* [@CIT0009]; Benford *et al.,* [@CIT0003]). The effect of various pesticides, such as hexa chlorocyclohexane (Chowdhuri *et al.*, [@CIT0007]), Chlorpyrifos (Nazir *et al.*, [@CIT0029]), organophosphate compounds (Gupta *et al.*, [@CIT0011]), fungicides such as captan (Nazir *et al.*, [@CIT0028]), argemone oil (Mukhopadyay *et al.*, [@CIT0027]), and industrial solid wastes (Siddique *et al.*, [@CIT0035]), has been studied for hsp70 expression in the third instar larvae of transgenic *Drosophila melanogaster (hsp70-lacZ)Bg* ^*9*^.
{#F0001}
In the present study, the toxicity of different doses and hours of exposure of MMS was evaluated by quantifying the *hsp70* expression and tissue damage in the third instar larvae of transgenic *Drosophila melanogaster* *(hsp70-lacZ) Bg* ^*9*^.
Methods {#S0002}
=======
Fly strain {#S20003}
----------
A transgenic *Drosophila melanogaster* line that expresses bacterial beta-galactosidase as a response to stress was used in the present study (Lis *et al.*, 1983). In the said strain of flies, the transformation vector is inserted with a P-element, the line contains wild type *hsp70* sequence up to the *lacZ* fusion point. The flies and larvae were cultured on standard *Drosophila* food containing agar, corn meal, sugar, and yeast at 24°C±1 (Nazir *et al.,* [@CIT0028]).
Experimental design {#S20004}
-------------------
MMS concentrations at 0.25, 0.50, 0.75 and 1.0 µl/ml of food were established. The third instar larvae were allowed to feed on them for different time intervals (2, 4, 24 and 48 hrs).
Soluble O-nitrophenyl-β-D-galactopyranoside (ONPG) assay {#S20005}
--------------------------------------------------------
The expression of *hsp70* gives the measure of cytotoxicity (Chowdhuri *et al.,* 1996Chowdhuri *et al.,* [@CIT0006]). We followed the method as described by Nazir *et al.* ([@CIT0028]). Briefly, after washing the larvae in phosphate buffer, they were put in a microcentrifuge tube (20 larvae / tube; 5 replicates/group), permeabilized for l0 min by acetone, and incubated overnight at 37°C in 600 µl of ONPG staining buffer. Following incubation, the reaction was stopped by adding 300 µl of Na~2~CO~3~. The extent of the reaction was quantified by measuring the absorbance at 420 nm using Systronics UV/VIS Spectrophotometer 118, India.
Trypan blue exclusion test {#S20006}
--------------------------
The extent of tissue damage in larvae caused by the exposure to different concentrations of MMS was assayed by a dye exclusion test (Krebs & Feder, [@CIT0020]; Nazir *et al.,* [@CIT0028]). Briefly, the internal tissues of larvae were explanted in a drop of phosphate buffer (PB), rotated in trypan blue stain for 30 min, washed thoroughly in PB, and scored immediately for dark blue staining. A total of 50 larvae per treatment (10 larvae per dose; 5 replicates per group) were scored for the trypan blue staining on an average composite index per larva: no color, 0; any blue, 1; darkly stained nuclei, 2; large patches of darkly stained cells, 3; or complete staining of most cells in the tissue, 4 (Krebs & Feder, [@CIT0020]).
Statistical analysis {#S20007}
--------------------
Statistical analysis was carried out by Student\'s *t* test using commercial software statistica Soft Inc, India (2007).
Results {#S0008}
=======
The results of the present study reveals that the exposure of the third instar larvae of transgenic *Drosophila melanogaster (hsp70-lacZ) Bg* ^*9*^ to different doses of MMS, *i.e.* 0.25, 0.50, 0.75 and 1.0 µl/ml for the duration of 2 hrs did not induce significant expression of *hsp70* as compared to untreated larvae ([Table 1](#T0001){ref-type="table"}; [Figure 2](#F0002){ref-type="fig"}). The doses of 0.25 and 0.50 µl/ml MMS showed the effect of exposure duration increase over 4, 24 and 48 hrs on the activity of *hsp70* expression ([Table 1](#T0001){ref-type="table"}; [Figure 2](#F0002){ref-type="fig"}). At further higher doses, *i.e.* 0.75 and 1.0 µl/ml, the expression of *hsp70* was significant for different durations of exposure as compared to the untreated larvae but the expression of *hsp70* was less as compared to the treatment of 0.50 µl/ml of MMS for 4, 24 and 48 hrs of exposure ([Table 1](#T0001){ref-type="table"}; [Figure 2](#F0002){ref-type="fig"}). Regression analysis was also performed to study the dose effect of third instar larvae of transgenic *Drosophila* *melanogaster (hsp70-lac Z)Bg* ^*9*^ for various durations of exposure ([Table 3](#T0003){ref-type="table"}; Figure [3](#F0003){ref-type="fig"}--[6](#F0006){ref-type="fig"}). The exposure to 0.25, 0.50, 0.75 and 1 µl /ml MMS for 4 and 24 hrs was associated with the β-coefficient of 0.327 (F = 0.321) and 0.433 (F = 0.462), respectively ([Table 2](#T0002){ref-type="table"}; [Figure 4](#F0004){ref-type="fig"} and [5](#F0005){ref-type="fig"}). However, for the exposure of 48 hrs, the β-coefficient was -- 0.240 (F = 0.124) ([Table 2](#T0002){ref-type="table"}; [Figure 6](#F0006){ref-type="fig"}). The reduction in the value of the β-coefficient demonstrates the reduction in β-galactosidase activity for the longest duration of exposure. The regression analysis was also performed to study the effect of exposure durations at various doses of MMS ([Table 3](#T0003){ref-type="table"}; Figure [7](#F0007){ref-type="fig"}--[10](#F0010){ref-type="fig"}). The exposure of third instar larvae of transgenic *Drosophila* *melanogaster (hsp70-lac Z) Bg* ^*9*^ to 0.25 µl/ml of MMS for 2, 4, 24 and 48 hrs of duration was associated with the β-coefficient of 0.981 (F = 50.37) ([Table 3](#T0003){ref-type="table"}; [Figure 7](#F0007){ref-type="fig"}). Similarly, the exposure of third instar larvae to 0.50 and 0.75 µl/ml MMS for 2, 4, 24 and 48 hrs was associated with the β-coefficient of 0.638 (F = 1.325) and 0.396 (F = 0.371), respectively ([Table 3](#T0003){ref-type="table"}; [Figure 8](#F0008){ref-type="fig"} and [9](#F0009){ref-type="fig"}). The exposure of third instar larvae to 1.0 µl/ml MMS resulted in the reduction of the β-coefficient, *i.e.* 0.261 (F = 0.878) ([Table 3](#T0003){ref-type="table"}; [Figure 10](#F0010){ref-type="fig"}). The reduction in the value of the β-coefficient demonstrates the reduction in β-galactosidase activity at the highest dose of exposure. Trypan blue staining was performed to study the tissue damage induced by MMS in the larval tissue exposed to different doses of MMS. About 90% of the untreated larvae were negative to trypan blue staining even after 48hrs of the treatment. In about 80% of the larvae light staining was observed only in the midgut of the larvae exposed to different doses of MMS for 2 hrs but the larvae exposed to higher doses of MMS, *i.e.* 0.75 and 1.0 µl/ml, showed damage in the midgut, salivary glands, malpighian tubules and the hindgut. [Figures 11](#F0011){ref-type="fig"}--[14](#F0014){ref-type="fig"}) showed trypan blue staining for the control larvae and those exposed to 0.50, 0.75 and 1.0 µl/ml MMS for 48 hrs.
{#F0002}
{#F0003}
{#F0004}
{#F0005}
{#F0006}
{#F0007}
{#F0008}
{#F0009}
{#F0010}
{#F0011}
{#F0012}
{#F0013}
{#F0014}
######
β-galactosidase activity measured in transgenic *Drosophila melanogaster (hsp70-lacZ) Bg* ^*9*^ third instar larvae exposed to different concentrations of methyl methanesulfonate for various time intervals.
TreatmentsMMS (µl/ml) After 2 hrsO.D (Mean±SE) After 4 hrsO.D (Mean±SE) After 24 hrsO.D (Mean±SE) After 48 hrsO.D (Mean±SE)
----------------------- -------------------------- ------------------------------------------------- ------------------------------------------------- -------------------------------------------------
0.25 0.2448±0.0193 0.2425±0.0039 0.2530±0.0520[\*](#TF0001){ref-type="table-fn"} 0.2740±0.0218[\*](#TF0001){ref-type="table-fn"}
0.50 0.2106±0.0097 0.3017±0.0114[\*](#TF0001){ref-type="table-fn"} 0.3100±0.0240[\*](#TF0001){ref-type="table-fn"} 0.3160±0.0236[\*](#TF0001){ref-type="table-fn"}
0.75 0.2196±0.0167 0.2865±0.0085[\*](#TF0001){ref-type="table-fn"} 0.2885±0.164[\*](#TF0001){ref-type="table-fn"} 0.2740±0.040[\*](#TF0001){ref-type="table-fn"}
1.0 0.2474±0.0088 0.2718±0.0117[\*](#TF0001){ref-type="table-fn"} 0.2865±0.0325[\*](#TF0001){ref-type="table-fn"} 0.2750±0.0382[\*](#TF0001){ref-type="table-fn"}
Untreated 0.2387±0.0152 0.2355±0.0154 0.2186±0.0125 0.2537±0.0208
Significant at *p*\<0.05 compared to Untreated.
MMS: Methyl methanesulfonate; O.D: Optical density; SE: Standard Error.
######
Regression analysis for β-galactosidase activity in the third instar larvae of transgenic *Drosophila melanogaster (hsp70-lacZ) Bg* ^*9*^ to study the dose effect of MMS (0.25, 0.50, 0.75 and 1µl/ml of MMS) for 2, 4, 24 and 48 hrs of exposure.
S.No. Duration (hrs) Regression Equation r-value -coefficient SE *p*-value F-value
------- ---------------- ------------------------ ---------- -------------- ------- ----------- ---------
1 2 Y = 0.22640 + 0.00672X 0.11851 0.119 0.027 0.0142 0.28
2 4 Y = 0.25745 + 0.02908X 0.37196 0.372 0.351 0.0181 0.321
3 24 Y = 0.26475 + 0.03160X 0.43324 0.433 0.318 0.0140 0.462
4 48 Y = 0.29540-0.0156X -0.24160 -0.240 0.030 0.010 0.124
MMS: Methyl methanesulfonate; SE: Standard error
######
Regression analysis for β-galactosidase activity in the third instar larvae of transgenic *Drosophila melanogaster (hsp70-lacZ) Bg* ^*9*^ to study the duration exposure effects at fixed concentration.
**S.No.** **Concentrations (µl/ml)** **Regression Equation** **r-value** **B-coefficient** **SE** ***p*****-value** **F-value**
----------- ---------------------------- ------------------------- ------------- ------------------- -------- ------------------- -------------
1 0.25 Y = 0.24078 + 0.00066X 0.98072 0.981 0.002 0.0001 50.37
2 0.50 Y = 0.25576 + 0.00148X 0.63836 0.638 0.033 0.0170 1.375
3 0.75 Y = 0.25551 + 0.00060X 0.39586 0.396 0.026 0.0105 0.371
4 1.00 Y = 0.26191 + 0.00042X 0.55252 0.261 0.121 0.0022 0.878
MMS: Methyl methanesulfonate; SE: Standard error
Discussion {#S0009}
==========
The results of the present study revealed that MMS induced significantly the expression of *hsp70* at 0.25, 0.50, 0.75 and 1.0 µl/ml at 4, 24 and 48 hrs of exposure as compared to the untreated larvae. hsp70 expression was not significant after 2 hrs of exposure. The reduction in the activity of *hsp70* at 0.75 and 1.0 µl/ml of MMS for different times of exposure may be due to a reduction in the number of viable cells after 24 and 48 hrs of exposure or to auto-repression of hsp70 once its upper limit has been achieved. The instability of the reporter gene may also be involved at the exposure to 0.75 and 1.0 µl/ml MMS for different durations that may lead to a decrease in the activity of *hsp70* expression. The tissue damage caused by the exposure to the higher doses of MMS was evident by the trypan blue exclusion assay in the larvae exposed for different durations. A dose-dependent increase in the activity of β galactosidase clearly demonstrated the dose-dependent toxic effect of MMS in transgenic *Drosophila melanogaster (hsp70-lacZ) Bg* ^*9*^ and underlined the usefulness of *hsp70* expression as bio-indicator of exposure to environmental chemicals.
MMS causes DNA damage by methylating N^7^-deoxyguanine and N^3^-deoxyadenine. Methylation causes double-strand DNA breaks and inhibition of replication fork movement. Apart from DNA adduct formation and methylation, MMS also leads to protein adduct formation. MMS methylates the N-terminus of valine and histidine residues in proteins and is thus classified as super clastogen (Zhang *et al.,* [@CIT0039]). Toxicological studies for MMS have been carried out in various experimental models like mice, rats, etc. According to the National Toxicological Programme guidelines, development and validation of alternative models is necessary to obtain reliable and sensitive results. For traditional toxicological studies a shift has taken place from the use of mammalian models to alternative models and in silico approaches. *Drosophila, Zebra fish, C. elegans* are now used as animal models in toxicological research (Avanesian *et al.*, 2009). *Drosophila* has many similarities with the human genome and is easy to handle, culture, and moreover ethical problems are less serious with this model (AMBR, [@CIT0001]). Genetically modified models provide reliable information about the mode of action for the test chemical. They provide exactness in toxicological research. The transgenic mouse is already in use for various carcinogenesis studies (Avanesian *et al.,* 2009). *Drosophila melanogaster* has been used in genetic, behavioral and molecular biology research. Recently, *Drosophila* has been used as a model for disease oriented molecular screening. *Drosophila* as a model in pharmaceutical research has been evaluated and validated for various medical problems like aggression, sleep, pain, seizures, psychoactive drug addiction, etc. The use of the alternative *Drosophila* model in pharmaceutical research is time and cost effective in comparison to rodents. In the future *Drosophila* will be used to detect adverse drug reactions. It will also be helpful in reducing time and cost in the field of drug development processes (Avanesian *et al.,* 2009). In the present study, transgenic *Drosophila melanogaster (hsp70-lacZ) Bg* ^*9*^ strain was used to study the effect of MMS on *hsp70* expression and tissue damage in the 3^rd^ instar larvae. Animal models remain important models ranging from worms to primates that can be used for the detection of adverse effects (Avanesia *et al.,* [@CIT0002]). Although mammalian systems may represent more accurate evaluation tools of short-term and long-term safety, they are frequently laborious and costly, particularly at early stages of drug discovery and development. Application of transgenic models in assaying environmental pollution has opened a new frontier in biomonitoring. Guven *et al.* ([@CIT0012]) and Guven and de Pomerai ([@CIT0013]) have successfully developed transgenic *Caenorhabditis elegans s*train *(hps70-lacZ)* and used it in soil ecotoxicological studies. Halloran *et al.* ([@CIT0014]) cloned zebra fish promoter for the inducible *hsp70* gene and made stable transgenic lines of zebra fish. They express the reporter green fluorescent protein gene under the control of *hsp70* promoter.
The tiny fruit fly or *Drosophila* is a well known model organism for developmental biologists and geneticists. In toxicological arena, however, few reports have successfully employed transgenic *Drosophila* as a model organism in the recent years (Mukhopadhyay *et al.,* [@CIT0026]). Jowett ([@CIT0018]) showed that the transgenic fruit fly could be used to study both drug metabolism and oxidative stress. The transgenic *Drosophila melanogaster* line that expresses bacterial β-galactosidase as a response to stress was used in the study of Lis *et al.* ( [@CIT0021]). In the said strain of flies the transformation vector is inserted with a P element; the line contains wild type hsp70 sequence up to the lacZ fusion point. Elevated levels of *hsp70* expression as a measure of cellular assault have been established in the present study. Hence it is concluded that the expression of *hsp70* on exposure to the effect of environmental chemicals is a potential indicator of non-target toxicity. The presented results are suggestive of the cytotoxic potential of methyl methanesulfonate to non target organisms like *Drosophila.* The study further supports the convenient and inexpensive use of *hsp70* expression as a bioindicator of exposure to environmental chemicals.
We express our sincere and gratitude to **Prof. Irfan Ahmad,** Chairman of the Department of Zoology, for providing laboratory facilities. We are also grateful to **Dr. D. Kar Chowdhuri**, Scientist F & Head Embryo Toxicology, IITR, Lucknow, UP, India for providing Bg^9^ *Drosophila* strain and **Dr. Mohammad Kamil Usmani**, **Associate Professor** and **Dr. Mohd Shamim** (Young Scientist), Department of Zoology for providing the facility of photography.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Igarapé Humaitá
The Igarapé Humaitá is a river of Acre state in western Brazil.
See also
List of rivers of Acre
References
Brazilian Ministry of Transport
Category:Rivers of Acre (state)
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Help Stop Bullfighting!Bullfighting is a traditional European and Latin American sport that involves bulls being publicly baited, taunted, lanced and eventually stabbed to death by bullfighters inside a ring.
Dog Fighting Is Not Entertainment!Dog fighting, in and of itself is a heinous crime. What may be surprising to find out, however, is that others are encouraging dog fighting by offering instructional videos about the activity!
Dogs Are Not A Delicacy!Dogs are stolen from loving families and off the streets and illegally transported by truck and by boat into other countries for meat!
Animal News: News and information at The Animal Rescue Site
Students to submit art for Endangered Species Day contest
May 6, 2011
May 20 is Endangered Species Day, hosted by the U.S. Fish and Wildlife Service (FWS), and students from grades 1 to 12 in Florida will be able to submit artwork depicting various endangered species, according to a recent report from TCPalm.com.
In Indian River, Martin and St. Lucie counties, students attending public and private schools, as well as those who are home schooled, can draw pictures and make artworks that show an animal on the federal endangered species list.
The winners of the contest will receive a $100 U.S. Savings Bond and will have their work printed in the 2012 Endangered Species Calendar.
"We want young people to become interested in conservation and educated about all the endangered species right here in our backyard," said a spokesman for the U.S. FWS, Ken Warren.
Some of the endangered species in the Treasure Coast region of Florida include manatees, leatherback turtles and wood storks.
Leatherback turtles are the largest type of turtles and can be found in Southeastern Florida, Puerto Rico, St. Croix and Culebra, according to Turtles.org.
Jun 26, 2012:
More than 200 people were arrested when INTERPOL seized almost two tons of contraband ivory and forty pounds of rhino horn in an operation that spanned three months and fourteen African countries.
Mar 30, 2012:
A group of scientists, animal activists, lawmakers and zoo officials are proposing what seems like a radical solution to the rapidly declining population of polar bears in the arctic - bring more into captivity, The Philadelphia Inquirer reports.
Mar 29, 2012:
A dog that was likely looked upon by Jesus, Moses and many other biblical characters is now the center of a land, religion and animal rights dispute in Israel, The Washington Post reports.
Mar 12, 2012:
The Obama administration recently unveiled a $33 million bid that would ask farmers and landowners to help save seven rare and endangered animals across the country, The Baltimore Sun reports.
Feb 28, 2012:
As other states in the mid and northwest United States de-list the gray wolf from their endangered species protection lists, one wolf in California draws attention and leaves many wondering what the Golden State will do with the wild canine, Reuters reports.
Feb 23, 2012:
U.S. wildlife investigators recently broke up an international rhinoceros smuggling ring that could save animals from being pawns in what has been an extremely lucrative trade, The Associated Press reports.
Jan 27, 2012:
California condors face a number of threats that have caused their population levels to dwindle to near-extinction, but a recent study found that lead poisoning is one of the biggest issues these birds face, Oregon Live reports.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
'Sound of Music Live!' a ratings hit for NBC, but critics not so kind
Right now Bob Greenblatt is adding "live TV musicals" to his list of favorite things (right after brown paper packages tied up with string).
"Sound of Music Live!", the first live musical on network television in more than 50 years and a pet project of the NBC Entertainment chairman,proved to be a worthwhile gamble on Thursday night. The three-hour event, based on the 1959 Rodgers & Hammerstein musical and starring Carrie Underwood and Stephen Moyer, reeled in a whopping 18.5 million viewers overall and delivered a 4.6 rating with viewers younger than 50. Translated from Nielsen-speak, that means more than 5.5 million people in the advertiser-coveted 18-to-49-year-old demographic tuned in. That was enough to tie CBS' top-rated "The Big Bang Theory" in the demo at 8 p.m.
The broadcast delivered the Peacock Network its best Thursday-night performance with younger viewers since the finale of "ER" in 2009. Audiences also mostly stayed put throughout the broadcast, which peaked at 8:30 p.m. with 19.7 million viewers and wrapped up with 17 million. The success of "The Sound of Music Live!" proves that in an era of time-delayed viewing, networks can still create DVR-proof programming (and probably should).
Conveniently, the live format also made the show immune to critics, who were unable to issue their verdicts until after "The Sound of Music Live!" had aired. That was probably a good thing for NBC, given that reviews were largely unfavorable, with many critics praising the network for taking a big gamble while singling out Underwood's performance as the production's most obvious liability.
Wrote Times critic Robert Lloyd, "As a stage actress, there was no way to regard her as anything but an amateur -- good enough, certainly, to convey the meaning of her lines, and sometimes better than that, but lacking weight and substance and the shadings she can bring to a song."
Reviews aside, it's probably a safe bet that NBC will try another ambitious live show in the near future. "The Sound of Music Live!" producers Neil Meron and Craig Zadan have said they would like to bring a live musical to television every year.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Outdoor Climbing Walls
Clear Playground Wall
EVerlast's clear playground climbing wall allows for climbing on both sides, making it perfect for playgrounds, schoolyards or backyards. It’s really fun for climbers to see each other through the climbing wall and makes supervising children easier! Each Clear Playground Wall™ includes yellow and green Groperz™ Hand Holds to offer a variety of options for climbers to use as they traverse. Try the extra challenge of climbing using only hand holds of the same color!
GRay CLimbing wall
Everlast's freestanding playground rock climbing wall allows for climbing on both sides, making it perfect for playgrounds, schoolyards or backyards. It’s really fun for climbers to reach the end and transfer to the opposite side of the climbing wall! Each Playground Wall™ includes yellow and green Groperz™ Hand Holds to offer a variety of options for climbers to use as they traverse. Try the extra challenge of climbing using only hand holds of the same color!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[BODY COMPOSITION AND CONSUMATORY BEHAVIOR OF STUDENTS].
The aim of the study was to determine indices of the anthropometric research, body composition and to evaluate the influence of consumatory behavior on the body composition of students of the medical Univercity. In the study there were used the Dutch eating behavior questionnaire (Dutch Eating Behavior Questionnaire or DEBQ), anthropometric, bioimpedancemetric indices obtained in the survey of 101 students in the Health Centres of the city of Omsk with the use of body composition analyzer "MEDES". The representativeness of the minimal sample was calculated according to the recommendations of Plokhinskiy N.A. Statistical treatment of the collected data allowed to determine the average values, median, 25 and 75 percentiles, standard deviations, coefficients of variation of anthropometric, bioimpedancemetric indices, data of testing offeeding behavior offemale and male students of the Medical University, to determine the statistically significant gender differences in indices. With the help of cluster analysis of K-means in the format adopted in Statistica 6.1 there was made optimal grouping in the entire set of objects, there were identified two clusters. With the help of elements of cluster analysis there were established students included in different clusters for the implementation of personalized recommendations on hygienic education of the students.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
An unexpected failure occurred while logging in (Underlying error code 1100)
I got this error when trying to run an app on the device.
The operation couldn’t be completed. Unable to log in with account '[email protected]'. An unexpected failure occurred while logging in (Underlying error code 1100).
A:
It turned out that Xcode has signed me out from my apple ID account.
So I went to
Xcode -> Preference -> Accounts
and re-logged into my account again.
and now the error is gone
A:
You can check if Apple's systems are currently under maintenance by visiting: https://developer.apple.com/system-status/
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[External canthopexy and blepharoplasty].
The obliquity of the palpebral cleft is one of the determinant elements of facial appearance. External canthopexy or transposition of the external palpebral tendon, performed in young subjects by release of the orbital septa, allows rejuvenation of the face and tightening of the skin without resection. In elderly subjects it is also a good insurance against postoperative lagophthalmia.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
December 9, 2011
Japan Suing Sea Shepherd For Disrupting Whaling Activity
Japanese whaling authorities said on Friday that they were suing the Sea Shepherd Conservation Society group to try and stop it from interfering in the annual whale hunt.
This is the first move by Japan to attempt legal action against anti-whaling campaigners, who have used extreme methods against ships involved in the hunt.
"Today, Kyodo Senpaku Kaisha and the Institute of Cetacean Research along with research vessels' masters filed a lawsuit against the Sea Shepherd Conservation Society (SSCS) and Paul Watson," they said in a statement.
"The Institute of Cetacean Research and Kyodo Senpaku are seeking a court order in the US District Court in Seattle, Washington that prevents SSCS and its founder Paul Watson from engaging in activities at sea that could cause injuries to the crews and damage to the vessels."
Sea Shepherd regularly sends vessels to harass the whalers, and in previous years they have thrown stink bombs onto the decks of the Japanese fleet.
According to the statement, the whaling program was "greatly contributing to the advancement of scientific knowledge of whale resources in the Antarctic."
Commercial whaling has been banned under a 1986 International Whaling Commission agreement, but "lethal research" is still allowed.
Japan said whale hunts are needed to substantiate its view that there is a robust whale population in the world. However, it is no secret that the country sells its whale meat for consumption.
"The activities perpetrated by SSCS and Paul Watson not only put at risk the safety of the research vessels at sea but are also affecting the scientific achievement" of the program," it said.
Japan cut its whale hunt for the 2010 to 2011 season short by a month after catching just a fifth of its planned catch, blaming Sea Shepherd's interference as the reason for why.
Japan also said that it planned to use some of the public funds it gained for earthquake and tsunami reconstruction to help boost security for its whalers.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The 'Red Queen' dilemma--running to stay in the same place: reflections on the evolutionary vector of HBV in humans.
Estimates for the evolutionary rate of HBV until now have been interpreted as showing that HBV is a relatively recent acquisition for mankind. The existence of defined HBV genotypes is thought to represent past founder effects. We have explored virus mutation in a group of 48 persistently infected blood donors sampled at two points in time and suggest otherwise. HBV-infected donors were detected by hepatitis B surface antigen (HBsAg) screening and staged by hepatitis B e markers. Serum DNA from those persistently infected with HBV was characterized by consensus sequencing and the amino acid sequences inferred. These were compared against consensus genotype sequences and divergence measured at two points in time. Rates of viral mutation were higher across both HBsAg and hepatitis B core antigen in the group of donors seropositive for hepatitis B e antibody (1.36×10⁻³ and 1.54×10⁻³ changes per residue per year, respectively) than in those seropositive for hepatitis B e antigen (4.59×10⁻⁴ and 6.62×10⁻⁴ changes per residue per year, respectively). Codon mutations reverting to the genotype consensus were commonly seen. Codon changes were clustered close to the C-terminal region of HBsAg and were accommodated in overlapping polymerase by synonymous substitutions. It is suggested that in vivo HBV behaves as a self-normalizing meme and mutational rates, although high, do not lead to significant change over time in a persistent infection. This would be compatible with co-evolution within its human host and introduction within humans being an ancient occurrence.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
-- English (US) -- Russian (RU)
All times are GMT. The time now is 02:17 PM . vBulletin Skin by ForumMonkeys. Powered by vBulletin®.
Copyright ©2000 - 2020, Jelsoft Enterprises Ltd.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Investigating the α-effect in gas-phase S(N)2 reactions of microsolvated anions.
The α-effect-enhanced reactivity of nucleophiles with a lone-pair adjacent to the attacking center-was recently demonstrated for gas-phase S(N)2 reactions of HOO(-), supporting an intrinsic component of the α-effect. In the present work we explore the gas-phase reactivity of microsolvated nucleophiles in order to investigate in detail how the α-effect is influenced by solvent. We compare the gas-phase reactivity of the microsolvated α-nucleophile HOO(-)(H2O) to that of microsolvated normal alkoxy nucleophiles, RO(-)(H2O), in reaction with CH3Cl using a flowing afterglow-selected ion flow tube instrument. The results reveal enhanced reactivity of HOO(-)(H2O) and clearly demonstrate the presence of an α-effect for the microsolvated α-nucleophile. The association of the nucleophile with a single water molecule results in a larger Brønsted βnuc value than is the case for the unsolvated nucleophiles. Accordingly, the reactions of the microsolvated nucleophiles proceed through later transition states in which bond formation has progressed further. Calculations show a significant difference in solvent interaction for HOO(-) relative to the normal nucleophiles at the transition states, indicating that differential solvation may well contribute to the α-effect. The reactions of the microsolvated anions with CH3Cl can lead to formation of either the bare Cl(-) anion or the Cl(-)(H2O) cluster. The product distributions show preferential formation of the Cl(-) anion even though the formation of Cl(-)(H2O) would be favored thermodynamically. Although the structure of the HOO(-)(H2O) cluster resembles HO(-)(HOOH), we demonstrate that HOO(-) is the active nucleophile when the cluster reacts.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Regardless of who wins the race to become leader of Alberta’s United Conservative Party (UCP) later this month, the Angus Reid Institute (ARI) says that man “will find himself on a relatively promising path to the premier’s office,” based on the latest results of a quarterly poll.
The ARI survey gathered opinions on the frontrunners in the UCP leadership race – Brian Jean and Jason Kenney – as well as thoughts on the party as a whole and on the governing New Democrats (NDP).
The poll, released Wednesday, found that 70 per cent of respondents “agree” they see Alberta Premier Rachel Notley’s “government is out of touch with what Albertans really want” and that both Kenney and Jean are viewed more favourably than Notley.
The results of a quarterly poll conducted by the Angus Reid Institute suggest Albertans think their NDP government “is out of touch with what Albertans really want.”. CREDIT: Angus Reid Institute
Forty-nine per cent of respondents approved of Jean and 38 per cent approved of Kenney, compared to 29 per cent approving of Notley.
Story continues below advertisement
“They match what you would think in your gut,” Duane Bratt, a political analyst at Mount Royal University, said of Wednesday’s polling numbers. “There is clear unhappiness and unease with the Notley government in how they have governed, particularly on financial issues and the issues around the debt and bringing in the carbon tax and the lack -so far – of pipelines being built.
“This leads naturally to support for the primary opponent, which would be the UCP.”
READ MORE: UCP leadership candidates promise health-care reform in Alberta
Watch below: On Aug. 1, 2017, Lisa MacGregor filed this report after a new poll suggested Alberta’s United Conservative Party would form a majority government if an election were held that day.
1:52 Poll suggests UCP would win majority if Alberta held election today Poll suggests UCP would win majority if Alberta held election today
The trajectory of Notley’s approval rating, based on quarterly polls conducted by the ARI, has generally been downward since June 2015.
Story continues below advertisement
The results of a quarterly poll conducted by the Angus Reid Institute indicate Premier Rachel Notley’s support from Albertans has been steadily decreasing since June 2015. CREDIT: Angus Reid Institute
“While hardly the worst approval rating among sitting premiers, Notley’s approval numbers – and their trajectory since she took office – are likely not encouraging to New Democratic Party strategists in the province,” the ARI said in a news release.
Alberta Premier Rachel Notley speaks about a new hospital that will be built in Edmonton Alta, on Tuesday, May 30, 2017. THE CANADIAN PRESS/Jason Franson
READ MORE: Alberta Premier Rachel Notley popular nationally, not so much at home: poll
When asked if they would prefer to see Jean or Kenney leading the UCP into the next provincial election, 33 per cent of respondents said Jean, 22 per cent said Kenney, 22 per cent said neither and 23 per cent said they didn’t have a preference.
Story continues below advertisement
The ARI poll also found support for Jean and Kenney increases the older voters are. Of respondents in the 18-34 age range, Jean enjoyed 39 per cent support and Kenney had 33 per cent support, in the 35-54 demographic, Jean saw 48 per cent support while Kenney saw 38 per cent support and among respondents 55 and older, support for Jean rose to 60 per cent while Kenney enjoyed 45 per cent support.
Alberta Wildrose leader Brian Jean and Alberta PC leader Jason Kenney shake hands after announcing a unity deal between the two in Edmonton on May 18, 2017. Jason Franson/Canadian Press
But while the ARI poll painted a rosy picture of how respondents perceive the UCP two years ahead of its first election campaign, the survey did highlight ongoing concerns about where the party stands on the political spectrum.
Forty-seven per cent of respondents expressed concern that the UCP will be too right-wing.
The Angus Reid Institute released the results of a quarterly poll on Oct. 11, 2017. CREDIT: Angus Reid Institute
“There’s also some unease that people have about the UCP about whether they may be too far right,” Bratt said. “This is a snapshot in time… if an election was held today, the UCP wins but the people still have their doubts about them.
Story continues below advertisement
READ MORE: Jason Kenney and Brian Jean response to anti-gay comments ‘cowardly’: Rachel Notley
“It’s interesting that when Brian Jean ran the Wildrose Party, he was dismissed as too far right,” Bratt added. “But in comparison to Jason Kenney, he looks pretty moderate. In fact, he has tried to play that in his leadership race and so I think there’s a lot more concern and unease around Jason Kenney than there is about Brian Jean.”
Sixty-three per cent of respondents said “the PC-Wildrose merger will be a good thing for Alberta, overall.” However, 57 per cent of respondents also agreed with the statement “Conservatives in Alberta think they’re entitled to govern.”
-With files from 630 CHED’s Scott Johnston.
You can view the complete survey results below:
Story continues below advertisement
Methodology: The Angus Reid Institute analyzed the results of an online survey conducted from Sept. 5 – 19, 2017, among a representative randomized sample of 606 Alberta residents who are members of the Angus Reid Forum. The survey data were donated by MARU/Matchbox. For comparison purposes only, a probability sample of this size would carry a margin of error of +/- 4 percentage points, 19 times out of 20. Discrepancies in or between totals are due to rounding. Detailed tables are found at the end of this release.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
We have entered one of the most tumultuous economic periods in our history due to the COVID-19 outbreak. Read about my plan to help workers and small businesses here.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
NullPointerException when creating SpecificDatumWriter
While learning Apache Avro by Tom White's book, Hadoop: The Definitive Guide, I got an error.
The example has 3 steps:
Create an Avro schema file (Pair.avsc)
{
"type":"record",
"name":"Pair",
"doc":"A pair of strings.",
"fields":[
{ "name":"left", "type":"string" },
{ "name":"right", "type":"string" }
]
}
Compile the schema file to create a Java class (Pair.java) using
$ java -jar $AVRO_HOME/avro-tools-1.6.2.jar compile schema src/main/resources/Pair.avsc src/main/java/
Use SpecificDatumWriter<Pair> and SpecificDatumReader<Pair> to serialize/deserialize data.
The original example method is testPairSpecific() in https://github.com/tomwhite/hadoop-book/blob/master/avro/src/main/java/AvroTest.java .
I rewrote the example code (createPairAndSerializeThenDeserialize() in https://github.com/philipjkim/avro-examples/blob/master/src/test/java/org/sooo/AvroTest.java), which is almost similar to the original one. The differneces are:
Avro version I used is 1.6.2, in original 1.3.2.
The contents of Pair.java created by avro-tools.jar differ (original: https://github.com/tomwhite/hadoop-book/blob/master/avro/src/main/java/Pair.java , mine: https://github.com/philipjkim/avro-examples/blob/master/src/main/java/org/sooo/Pair.java )
After running the test, I got an error:
java.lang.NullPointerException
at java.lang.String.replace(String.java:2228)
at org.apache.avro.specific.SpecificData.createSchema(SpecificData.java:195)
at org.apache.avro.specific.SpecificData.getSchema(SpecificData.java:140)
at org.apache.avro.specific.SpecificDatumWriter.<init>(SpecificDatumWriter.java:33)
at org.sooo.AvroTest.createPairAndSerializeThenDeserialize(AvroTest.java:86)
...
AvroTest.createPairAndSerializeThenDeserialize() is:
@Test
public void createPairAndSerializeThenDeserialize() throws IOException {
// given
Pair datum = new Pair();
datum.setLeft(new Utf8("L"));
datum.setRight(new Utf8("R"));
// serialize
ByteArrayOutputStream out = new ByteArrayOutputStream();
DatumWriter<Pair> writer = new SpecificDatumWriter<Pair>(Pair.class); /* Line 86 */
Encoder encoder = EncoderFactory.get().binaryEncoder(out, null);
writer.write(datum, encoder);
encoder.flush();
out.close();
// deserialize
DatumReader<Pair> reader = new SpecificDatumReader<Pair>(Pair.class);
Decoder decoder = DecoderFactory.get().binaryDecoder(out.toByteArray(),
null);
Pair result = reader.read(null, decoder);
// then
assertThat(result.getLeft().toString(), is("L"));
assertThat(result.getRight().toString(), is("R"));
}
I'd like to know what is wrong with this example. Thanks for any comments.
FYI, my example project repo is https://github.com/philipjkim/avro-examples .
A:
Your Pair.avsc file is missing a namespace field for your custom package name:
...
"namespace": "org.sooo",
...
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1 dutch; flemish x-vnd.Haiku-Media 582516163
Couldn't add volume control in Deskbar: %s\n Media views De volumebesturing kon niet aan Deskbar worden toegevoegd: %s\n
Restart media services Media views Mediaservices herstarten
Quit Media Window Afsluiten
<none> VideoInputMenu Used when no video input is available <geen>
Couldn't remove volume control in Deskbar: %s\n Media views De volumebesturing kon niet van de Deskbar verwijderd worden: %s\n
Video output: Media views Video-output:
Video input: Media views Video-invoer:
Audio output: Media views Audio-output:
Please select a SoundFont. Midi View Selecteer een SoundFont.
There are no SoundFonts installed. Midi View Er zijn geen SoundFonts geïnstalleerd.
Quitting Media now will stop the restarting of the media services. Flaky or unavailable media functionality is the likely result. Media Window Nu afsluiten van Media zal de herstart van de media-services stopppen. Dit leidt waarschijnlijk tot het onbetrouwbaar of niet functioneren van media-functionaliteit.
Could not connect to the media server.\nWould you like to start it ? Media Window Kon geen verbinding met mediaserver maken.\nWilt u hem starten?
Video settings Media Window Video-instellingen
Audio mixer Media Window Audiomixer
Show volume control on Deskbar Media views Toon volumebediening in Deskbar
Start media server Media Window Mediaserver starten
Audio settings Media Window Audio-instellingen
Quit anyway Media Window Toch afsluiten
Media System name Media
Warning! Media Window Waarschuwing!
MIDI Settings Media Window MIDI-instellingen
SoundFonts Midi View SoundFonts
Audio input: Media views Audio-input:
<none> Media views <geen>
Channel: Media views Kanaal:
This hardware has no controls. Media Window Deze hardware heeft geen bedieningselementen.
Defaults Media views Standaardwaarden
<none> VideoOutputMenu Used when no video output is available <geen>
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A portrait of President George W. Bush by artist Robert Anderson was unveiled Friday at the National Portrait Gallery (Photo by CNSNews.com/Penny Starr)
(CNSNews.com) – The Smithsonian’s National Portrait Gallery has agreed to change the wording on the plaque accompanying a portrait of President George W. Bush in response to a complaint by Sen. Bernard Sanders (I-Vt.).
Sanders objected to the sign's language because he believed it suggested a linkage between the terrorist attacks of Sept. 11, 2001 and the subsequent U.S. invasion of Iraq in 2003.
The plaque reads: “Expecting that the success of his presidency would hinge, as it had when he was governor, on his negotiating skills and ability to solve problems, Bush found his two terms in office were instead marked by a series of catastrophic events: the attacks on September 11, 2001, that led to wars in Afghanistan and Iraq; the devastation wrought by Hurricane Katrina; and a financial crisis during his last months in office.”
Plaque on portrait of President George W. Bush at the Smithsonian’s National Portrait Gallery (CNSNews.com/Penny Starr)
Sanders, a self-described “democratic socialist,” wrote a letter to National Portrait Gallery Director Martin Sullivan on Jan. 7 complaining about the phrase, “the attacks on September 11, 2001, that led to wars in Afghanistan and Iraq."
On Monday, Sullivan wrote back to Sanders, saying that the plaque would be changed.
The letter reads as follows:
Dear Senator Sanders,
Thank you for your letter of January 7, 2009, regarding the label which accompanies the National Portrait Gallery’s recently acquired portrait of George W. Bush.
Our label was not intended to imply that there was a causal connection between the attacks that occurred on 9/11 and the subsequent U.S. invasion of Iraq. Our intention was to remind viewers of the portrait that the listed events were defining episodes in the Bush presidency, within the limited space of an object label. I appreciate your concern, however, about the words “led to.” We will revise the label to delete the words “led to.” I would welcome the opportunity to escort you on a personal tour of the National Portrait Gallery, and will call your office in hopes that we can arrange that.
Thank you for your interest in the Smithsonian Institution.
Sincerely,
Martin E. Sullivan, director
Sanders indicated that he was grateful to Sullivan for moving so swiftly to change the Bush portrait plaque. “I very much appreciate the prompt response from the director and appreciate his willingness to make the change,” he said in a statement released Monday.
Bethany Bentley, spokeswoman for the National Portrait Gallery, told CNSNews.com that the gallery’s staff historians select the wording to be used on the plaques in the American Presidents exhibit and that no other presidential plaque has been challenged or changed.
Sanders ran for several statewide offices in Vermont in the 1970s as a candidate for the socialist Liberty Union Party. He was elected mayor of Burlington, Vt., in 1981 and served until 1989.
He was elected to Congress in 1990, becoming “only the third Socialist elected to the House,” according to the New York Times. He was elected to the Senate in 2006 as an Independent.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
1707 Brittlebush LnJohns Island,
SC29455
(Johns Island)
Property Details
for 1707 Brittlebush Ln
Description provided by Trulia
1707 Brittlebush Ln
This is a Townhome located at 1707 Brittlebush Lane, Johns Island SC. 1707 Brittlebush Ln has 3 beds, 3 ½ baths, and approximately 1,796 square feet. The property was built in 2007. 1707 Brittlebush Ln is in the Johns Island neighborhood in Johns Island, SC.
Public Records
for 1707 Brittlebush Ln
Official property, sales, and tax information from county (public) records as of 05/2012:
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Pages
Wednesday, 12 April 2017
Malabu Oil Deal: Goodluck Jonathan Debunks Allegation that he Received $200m from Shell and Eni
Goodluck Jonathan
In a report published by Buzzfeed concerning the ongoing international investigation over the controversial Malabu Oil Deal, former President Goodluck Jonathan was alleged to have probably received $200m of the $1.3bn paid by Shell and Eni for OPL 245 oil block considered to be one of the richest in Africa.
Shell, had on Monday, after leaked emails showed that it may have known that the $1.3bn it paid for the oil bloc was some form of bribery, confessed to knowing the money will be used to “pay off” some individuals.
Shell’s partners Eni, has said an internal investigation found no wrongdoing.
BBC, in a report on Tuesday, also said that emails showed that Jonathan allegedly received $466m which was shared among himself and members of his government.
BBC also reported that Shell and Eni negotiated with Etete one year before the $1.3bn payment was made in 2011.
Dan Etete, Nigeria’s Petroleum Minister in 1998 who is a convicted money launderer, had awarded the licence for OPL 245 oil block to Malabu Oil and Gas, a company he partly owned.
That contract was nullified by Olusegun Obasanjo when he assumed office as president in 1999.
Obasanjo assigned the oil block to Shell – without public bid. Ownership was suspiciously reverted to Malabu thereafter, leading to legal action by Shell who later resorted to negotiating directly with Etete after President Goodluck Jonathan assumed office in 2010.
Of the $1.3 billion paid by Shell and Eni for the block, only $210 million went into the federal government’s treasury as “signature bonus” while the rest went to Malabu Oil and Gas.
The oil block was handed over to the federal government following a Federal High Court order on January 26.
Shell filed a motion to reverse the order and on March 17, 2017, a Federal High Court sitting in Abuja ordered that the oil block be returned to Shell and Eni, an Italian oil company.
Shell’s confession came a day after a recording between its CEO Ben van Beurden, and his then chief financial officer, Simon Henry was leaked. The recording revealed that the company knew that a large percentage of the $1.3bn was going to Etete.
Ben van Beurden, in the phone call, expressed worries that the internal emails Shell’s investigators had uncovered could draw the attention of the United States Justice Department. In particular, he cited emails written by former members of the British spy agency known as MI6 that Shell had hired.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Background
==========
Malignant mesothelioma is an aggressive, treatment-resistant tumor, arising from transformed mesothelial cells lining the pleura, peritoneum and pericardium. Athough relatively a rare disease, its incidence rate is increasing throughout the world \[[@B1],[@B2]\]. Its major risk factor is asbestos exposure, besides it can also be caused by ionizing radiation, erionite exposure, chest injuries, and presumably SV40 virus \[[@B3]\]. Patients with malignant pleural mesothelioma (MPM) usually present with shortness of breath and chest pain with pleural effusions. Patients are diagnosed with cytopathology of mesothelioma effusions or fine-needle aspirations, and histopathology is often required to establish the diagnosis \[[@B4]\]. Despite the current regimen of surgical resection, chemotherapy, and radiation therapy for treating MPM, the prognosis remains dismal, with median survival being 9--12 months from diagnosis \[[@B3]\]. Therefore developing new molecular targeted therapies may pose promise for this devastating illness.
The pathogenic mechanisms underlying mesothelioma involve deregulation of multiple signaling pathways, including activation of multiple receptor tyrosine kinases such as the epidermal growth factor receptor (EGFR) family and MET, and subsequent deregulations of mitogen-activated protein kinase (MAPK) and phosphatidylinositol-3-kinase (PI3K)-AKT signaling cascades, the TNF-α / NF-κB survival pathway, Wnt signaling, and loss of tumor suppressors such as Neurofibromatosis type 2(NF2), p16^INK4A^, and p14^ARF^\[[@B5]\]--\[[@B7]\]. Understanding mechanisms of the dysregulated signaling pathways allows strategies for development of targeted new therapies against this devastating disease.
It has been recently reported that sonic hedgehog (Hh) signaling, another important pathway during development and tumorigenesis, is aberrantly activated in MPM, and inhibition of hedgehog signaling suppresses tumor growth \[[@B8]\]. Deregulated Hedgehog (Hh) pathway activation has been implicated in several human cancers including glioma, basal cell carcinoma, medulloblastoma, lung, breast, pancreatic and gastric cancers \[[@B9]\]--\[[@B14]\]. The Hh family of proteins controls multiple fundamental cellular functions, including cell proliferation and survival, body patterning and organ morphogenesis during embryonic development \[[@B9]\], \[[@B13]\]--\[[@B16]\]. Hh signaling is orchestrated by two trans-membrane receptors, Patched (Ptch1) and Smoothened (SMO). In the absence of the Hh ligand, PTCH1 inhibits SMO, causing cleavage of GLI1 to the N-terminal repressor form. Once Hh binds to PTCH1, the inhibitory effect on SMO is released, causing active full-length GLI1 to transport into the nucleus and activate transcription of the Hh target genes in a context- and cell-type specific manner, including GLI1, PTCH1, HHIP and C-MYC \[[@B13]\]--\[[@B16]\]. Targeted inhibition of aberrant Hh signaling leads to suppression of cancer stem cells awakened and propelled by inappropriate Hh signaling \[[@B10],[@B11],[@B16]\].
We propose that the Hh signaling pathway may play an essential role during pathogenesis of MPM. To test this hypothesis, we measured SMO and SHH expression levels in MPM tissue specimens, and studied the relation of those expression levels with regard to overall survival. We also examined multiple mesothelioma cell lines for SMO expression and their cell proliferation responses to a specific SMO inhibitor. We therefore aim to better elucidate the role of Hh signaling in the tumorigenesis of MPM, and such finding may lead to development of improved molecular targeted therapies against this fatal disease.
Methods
=======
Patients
--------
We identified patients who underwent surgical resection for malignant pleural mesothelioma at our institution from April 2000 to January 2010 and had a tissue specimen available in our tissue bank. Clinical and histological data were obtained by review of electronic medical records and entered prospectively into our tissue bank database. Vital status was obtained through the Social Security Death Master File. Overall survival was calculated from the date of surgery. Our institutional review board approved this study.
RNA extraction and real-time RT-PCR
-----------------------------------
Total RNA was isolated from MPM tissue samples using the RNeasy kit (Qiagen). Genomic DNA contamination was eliminated by DNase I treatment. 250 ng of RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad). The resulting cDNAs were analyzed with real-time RT-PCR using Gene Expression Assays in a 7900 Real-Time PCR System (Applied Biosystems) for 40 cycles (96°C for 15 seconds and 60°C for 1 minute). Gene expressions were normalized to 18S rRNA expression.
Immunohistochemistry (IHC)
--------------------------
Peroxidase-based immunohistochemistry using paraffin-sections was performed per standard protocol. Smo antibody (abcam, ab72130) and Shh antibody (abcam, ab19897) were employed following the manufacturer\'s instructions. These slides were then mounted in Citifluor.
Cell lines and cell culture
---------------------------
Mesothelioma cell lines NCI-H28, REN, and H290 were cultured in RPMI 1640 (Life Technology, Carlsbad, CA) supplemented with 10% FBS and penicillin (100 IU/ml) and streptomycin (100 ug/ml), at 37°C in a humid incubator with 5% CO2. Cells were seeded one day before treatment with cyclopamine (Selleckchem) at 10 uM and 20 uM or vehicle (DMSO) for 72 hours. Cells were subjected to proliferation assays at 0, 24, 48 and 72 hours after drug treatment.
Cell proliferation assay
------------------------
Cells will be treated with Cyclopamine at indicated doses in 96-well plates for 6--7 days. Cell proliferation was assayed by MTS assay (Promega) according to the manufacturer's protocol and as described previously \[[@B17]\]. The quantity of formazan product as measured by the absorbance at 490 nm is directly proportional to the number of living cells in culture. Data are representative of at least 3 independent experiments with similar results.
Western blotting
----------------
Whole cell lysates were resolved by SDS-PAGE and transferred to nitrocellulose membranes for immunoblotting with the indicated antibodies: α-human SMO mouse monoclonal antibody (Sigma), α-ß-actin mouse monoclonal antibody (Sigma) as described previously \[[@B18]\]. Data represent three independent experiments with consistent results.
Survival and statistical analyses
---------------------------------
Survival analysis was performed using univariate and multivariate Cox proportional hazards models, Kaplan-Meier survival curves, and the log-rank test. For the Cox proportional hazards models, age and sex were included in the multivariate model a priori. Race, histological type, stage, smoking status were included in the multivariate model only if the p-value was less than 0.10 in the univariate analysis. For all statistical tests, a two-sided alpha level less than 0.05 was considered statistically significant. Analyses were performed using Stata version 11.
Results and discussion
======================
Patients
--------
Forty-six patients underwent surgical resection for malignant pleural mesothelioma at our institution, had tissue specimens deposited at our tissue bank and available for use. Patient baseline characteristics were summarized as in Table [1](#T1){ref-type="table"}.
######
Patient baseline characteristics
**All patients (N = 46)**
------------------------------- ---------------------------
**Age, mean ± SD---yr.** **67.2 ± 10.7**
**Sex---no. (%)**
**Female** **11 (24)**
**Male** **35 (76)**
**Race---no. (%)**
**White** **36 (78)**
**Non-white** **10 (22)**
**Smoking status---no. (%)**
**Never** **13 (28)**
**Ever** **27 (59)**
**Missing** **6 (13)**
**Histologic type---no. (%)**
**Epithelioid** **39 (85)**
**Sarcomatous** **2 (4)**
**Other** **5 (11)**
**Stage---no. (%)**
**I** **5 (11)**
**II** **8 (17)**
**III** **11 (24)**
**IV** **3 (7)**
**Missing** **19 (41)**
SMO and SHH expression analysis
-------------------------------
SMO and SHH expression levels were evaluated at both mRNA and protein expression levels. Protein expression levels examined by Immunohistochemistry (IHC) correlated well with mRNA levels assessed by RT-PCR (examples are shown in Figure [1](#F1){ref-type="fig"}). SMO expression level was determined for all 46 patients, whereas SHH expression level was determined for 23 patients. Since SMO and SHH expression level encompassed such a wide range, we chose the median level from the tumor samples as a good initial threshold to investigate the importance of SMO and SHH. Separated apart by the median level, 23 (50%) samples above the median were named as the \"high\" category, while 23 (50%) samples below the median were named as the \"low\" category. The number of samples in each category is displayed in the risk table below each Kaplan-Meier survival curve.
{#F1}
Survival analysis
-----------------
Median follow-up time was 11.8 months (inter-quartile range, 6.3 to 27.0 months). Forty-five patients died, including 31 patients who died within two years of their operations. In the univariate Cox proportional hazards model, sex and histological type were significantly associated with overall survival, and these variables were included in the multivariate model (Table [2](#T2){ref-type="table"}). Age was not significantly associated with overall survival, however, this variable was included in the multivariate model a priori. Race, smoking status, and stage were not significantly associated with overall survival, and these variables were not included in the multivariate model. In the univariate model, higher SMO expression levels were associated with worse overall survival (p = 0.05). Kaplan-Meier survival estimates confirmed these results (Figures [2](#F2){ref-type="fig"} and [3](#F3){ref-type="fig"}A).
{#F2}
{#F3}
######
Univariate and multivariate Cox proportional hazards model
**Univariate analysis** **Multivariate analysis**
-------------------------- ------------------------- --------------------------- ---------- ---------- --------------- ----------
**Age (10 years)** **0.84** **0.61-1.16** **0.28** **0.82** **0.57-1.17** **0.28**
**Sex**
**Female** **1** **1**
**Male** **0.55** **0.27-1.12** **0.10** **0.75** **0.33-1.74** **0.50**
**Histologic type**
**Epithelioid** **1** **0.04** **1** **0.08**
**Sarcomatous** **7.76** **1.54-39.0** **0.01** **7.26** **1.25-42.1** **0.03**
**Other** **1.53** **0.58-4.00** **0.39** **1.38** **0.52-3.69** **0.52**
**SMO expression level** **1.05** **1.00-1.10** **0.05** **1.06** **1.00-1.12** **0.03**
In the multivariate Cox proportional hazards model, SMO expression level remained associated with worse survival (Table [2](#T2){ref-type="table"}). However, sex was no longer associated with overall survival (p = 0.50) and histological type was less strongly associated with overall survival (p = 0.08). After adjusting for age, sex, and histological type, the hazard ratio and significance of SMO expression level increased compared to the univariate model (p = 0.03).
SHH expression level was analyzed separately because data was only available for 26 patients. In the univariate model, SHH expression level was significantly associated with overall survival. Increase in SHH expression level strongly correlates with elevated risk of death (95% CI, 1-28%; p = 0.04; data not shown). When SHH expression level was dichotomized at the median, log-rank test was not significant (p = 0.45), although the Kaplan-Meier survival curve showed separation after 12 months (Figure [3](#F3){ref-type="fig"}B).
After including SHH expression level in the multivariate model above, SHH expression level remained significant and even increased the significance of SMO expression level. After adjusting for age, sex, and histological type, increase in SMO expression level strongly correlates with increase in risk of death (95% CI, 8-72%; p = 0.009; data not shown); and so does increase in SHH expression level (95% CI, 1-26%; p = 0.04; data not shown). Histological type was no longer associated with overall survival (p = 0.87).
SMO Inhibition suppresses mesothelioma cell proliferation
---------------------------------------------------------
To assess the role of Hh signaling in tumor growth of mesothelioma, we utilized a small molecule Hh signaling inhibitor cyclopamine which specifically antagonizes SMO receptor \[[@B11]\]. Three mesothelioma cell lines were treated with cyclopamine and examined for expression of several key effectors of the SHH pathway. Expression of all Gli downstream effector genes (including GLI1, GLI2, PTCH, PTCH2) was suppressed, suggesting the specificity of cyclopamine in inhibiting the SHH pathway (Figure [4](#F4){ref-type="fig"}).
{#F4}
We observed relatively high level of endogenous SMO expression in all three mesothelioma cell lines examined, including H28, H290 and REN (Figure [5](#F5){ref-type="fig"}A). Notably, Cyclopamine treatment significantly suppressed proliferation of these mesothelioma cells in a dose-dependent manner (Figure [5](#F5){ref-type="fig"}B-D). These results strongly support that Hh signaling plays essential role in mesothelioma cell proliferation.
{#F5}
Role of Hh activation in mesothelioma
-------------------------------------
Hh signaling plays pivotal roles in development and in cancer. It is implicated in tumorigenesis of multiple human cancers. However, whether Hh signaling plays essential roles in mesothelioma remains elusive. We have analyzed both mRNA and protein expression profiles of mesothelioma tumor samples from 46 patients, and showed that SHH and SMO expression was spreading over a wide range of expression levels (Figure [6](#F6){ref-type="fig"}). To assess whether Hh signaling activation may impact on the prognosis of mesothelioma patients, we carried out univariant and multivariant COX proportional hazard ratio analysis. Interestingly, we observed that higher SMO expression levels are strongly associated with worse overall survival in malignant pleural mesothelioma after adjusting for age, sex, and histological type (Figures [2](#F2){ref-type="fig"}, [3](#F3){ref-type="fig"}A). Consistently, higher SHH expression level correlates with worse survival in a smaller number of patients (Figure [3](#F3){ref-type="fig"}B). Although our results are limited by relatively small number of patients, due to the relatively low incidence of MPM, our data strongly support that Hh signaling plays indispensable roles in mesothelioma, and exerts significant impact on the prognosis of mesothelioma patients.
{#F6}
As deregulated Hh signaling pathway has been implicated in many different types of cancer, and inhibition of Hh signaling leads to suppression of tumor growth \[[@B10],[@B11]\], we addressed whether Hh signaling plays critical roles in proliferation of mesothelioma cells. Remarkably, we observed elevated endogenous SMO expression in 3 mesothelioma cell lines tested (Figure [5](#F5){ref-type="fig"}A). Furthermore, utilizing a specific Hh inhibitor cycloplamine, which significantly suppressed expression of Gli downstream targets (Figure [4](#F4){ref-type="fig"}), we observed significant inhibition of cell proliferation in all 3 mesothelioma cell lines examined (Figure [5](#F5){ref-type="fig"}B-D). These data indicate that aberrant Hh activation plays critical roles in tumor cell proliferation in mesothelioma, consistent with recent data by Shi Y et al. \[[@B8]\].
Conclusions
===========
Taken together, our results demonstrated a strong association between higher SMO and SHH expression levels with poorer overall survival. Furthermore, we showed inhibition of Hh signaling blocked cell proliferation in multiple mesothelioma cell lines, strongly supporting that aberrant Hh signaling is essential for tumor growth in mesothelioma. Therefore our findings revealed the hitherto unappreciated roles of Hh activation in MPM, and pinpointed Hh signaling antagonist as a potential new therapy against this devastating disease.
Competing interests
===================
All authors have no competing financial interests.
Authors' contributions
======================
YZ carried out the statistic analysis and drafting of the manuscript. JH carried out the cell cultures and cell proliferation assays, Western blotting and drafting of the manuscript. FZ carried out the RNA extractions and Real-time RT-PCR assays, drafting and revising the manuscript. HL participated in the statistic analysis. DMJ conceived of the study and supervised the projects. BH designed the experimental approaches and coordinated the project progression. NL participated in the cell proliferation assay and the Western Blot assay. All authors read and approved the final manuscript.
Acknowledgements
================
This work was supported by NIH/NCI grants R01CA125030 and R01CA132566, the Eileen D. Ludwig Endowed for Thoracic Oncology Research, the Kazan, McClain, Abrams, Fernandez, Lyons, Greenwood, Harley & Oberman Foundation, Paul and Michelle Zygielbaum, and the Jeffrey and Karen Peterson Family Foundation, and by a Zhejiang Provincial Natural Science Foundation grant to F. Zhang (Y2110030).
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Florida Republican Congressman Matt Gaetz demanded the top Democrat on the House Intelligence Committee be recused from future involvement in the Trump-Russia probe.
Gaetz said Rep. Adam Schiff (D-Calif.) invalidated his ability to properly investigate allegations against President Trump, which include those in an unverified dossier compiled by former MI6 officer Christopher Steele.
Schiff has said that Trump has worked with a foreign power (Russia) to affect an American presidential election.
Gaetz said recent revelations about Schiff show his "hypocrisy" on the matter, declaring the Burbank representative did effectively the same thing.
Gaetz pointed to audiotape of a phone call Schiff held with Russian pranksters purporting to be Ukrainian dignitaries with access to compromising photos of Trump with a Ukrainian model.
According to Tucker Carlson, Schiff sounded amicable to the news. Carlson cited a report that the congressman later had a staffer dial back the number to possibly set up a meeting with the "Ukrainians."
.@TuckerCarlson on use of Steele dossier in Russia probe: "In a moment like this, when leaks are the coin of the realm in Washington...it's hard to imagine we haven't heard of any other evidence. So maybe there isn't any." #Tucker https://t.co/NeF4OJIuL4 pic.twitter.com/bJV6TQd0Gv — Fox News (@FoxNews) February 8, 2018
"Adam Schiff should step aside as the lead Democrat on the Intel committee as a consequence of this scandal," Gaetz said.
"Schiff was off playing footsies with the Ukrainians, trying to get naked pictures of Donald Trump," Gaetz added. "[Schiff] has gone from having an oversight responsibility to an actual principal in this investigation for engaging with 'Ukrainians'."
He noted Attorney General Jeff Sessions recused himself from the executive branch's part in the investigation over what Gaetz considered a handshake in a greeting line.
Watch more above.
WATCH FULL EPISODES OF YOUR FAVORITE FOX NEWS SHOWS!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Introduction {#s0005}
============
Drought is a wide world problem constraining global crop production seriously [@b0005]. Common wheat possesses a very complex and huge genome with size of ∼16 × 10^9^ bp, which consists of about 90% repeated sequences [@b0010]. Under drought stress, H~2~O~2~ generated as a result of electron leakage from the photosynthetic and respiratory electron transport chains to oxygen or during photorespiration resulting from the oxygenase activity of Rubisco. Also, drought results in changes in antioxidant enzymes activity. High antioxidant activities could be interpreted as symptoms of oxidative stress or damage, the plant upregulates antioxidant enzymes because it produces more reactive oxygen species (ROS) [@b0015]. Conversely, high antioxidant activity could be interpreted as higher tolerance to oxidative stress.
Alteration of gene expression is always involved in preparing plants for an existence under stress. Under conditions of water deficit (dehydration), numerous processes are modified or impaired resulting in growth inhibition [@b0020] to cope with osmotic changes in their tissues. Modification of gene expression results in a strict control of the physiological and biochemical responses to stress. Identification and isolation of these genes are essential for developing tolerant crops. Expression profiling has become an important tool to investigate responses of an organism to environmental changes at the transcriptional level [@b0260]. One of these adaptations is to produce proteins called dehydrins. Dehydration responsive element binding proteins (DREBs) constitute a large family of TFs that induce the expression of a large number of functional genes and impart stress endurance to plants [@b0030]. The dehydration responsive element (DRE) as a cis-acting element was found in the promoter regions of many drought- and low-temperature-inducible genes [@b0035]. All *dreb* genes feature three conserved regions, an EREBP/AP2 DNA binding domain, an N-terminal nuclear localization signal, and conserved Ser/Thr rich region adjacent to the EREBP/AP2 domain. *dreb tfs* play key roles in plant stress signaling transduction pathway, they can specifically bind to DRE/CRT element (G/ACCGAC) and activate the expression of many stress inducible genes. In several cases, the overexpression of these *dreb*/*cbf* genes was associated with retardation of plant growth under non stressful conditions [@b0040]. It was suggested that the overexpression of these genes under stress-inducible promoter but not constitutive promoter may be a solution to avoid the change in plant growth [@b0045]. Dehydrins *dhn* are associated with crucial protective functions [@b0050]. *dhn* are part of the late embryogenesis abundant proteins (LEA) [@b0055]. They are produced in response to abscisic acid (ABA) [@b0050]. They are primarily distributed in cytosol, nucleus and plasma membranes [@b0060]. Dreb controls expression of cold-regulated (*cor*) gene. Wcor410 is a dehydrin that accumulates around the plasma membrane and is present in lesser amounts in the intercellular space [@b0065]. It is up regulated by low temperatures, dehydration, ABA, salt, wounding and polyethylene glycol. So, the present work is aimed at studying the expression of *wdhn*, *dreb* and *wcor410* in order to find their roles in drought tolerance of two wheat cultivars that differentially tolerate water stress.
Material and methods {#s0010}
====================
Plant material and growing conditions {#s0015}
-------------------------------------
Seeds of two bread wheat (*Triticum aestivum*) cultivars, (Sids 4, and Gmiza 10) were obtained from Wheat Research Department, Field Crops Research Institute, Agricultural Research Center, Giza, Egypt. The seeds were sown in a mixture of sand and clay culture (1:1) in plastic pots (25 cm diameter) under field conditions in greenhouse. Ten seeds of each cultivar were sown per pot. Seedlings, shortly after seedling emergence, were thinned to five per pot (11 days after sowing, 11 DAS) and watered by tap water twice in week. On the 17th DAS, the pots of each cultivar were divided into two groups: one was left as control and irrigated with tap water and the other was restricted to drought by withholding water up to the end of the experiment (33 DAS).
The experimental design was a complete block randomized design and repeated twice in triplicates so that the mean values ± SE values were of *n* = 6. The design consisted of 144 pots \[2 cultivars × 2 sets (2 treatments) × 3 pots per set (3 replications per treatment each pot contained 5 plants) × 2 experimental repetitions × 6 intervals\]. At each interval starting from the 17th DAS every 3 days up to the 33rd DAS, the full analysis of variance (ANOVA) was calculated at *p* = 0.05 for 24 samples \[2 cultivars × 2 treatments × 6 replications\]. At harvest, samples from different pots of each cultivar were collected and used for fresh and dry weight determinations while leaves from the remaining individuals were collected, frozen immediately in liquid nitrogen and stored at −80 °C for subsequent analyses.
Activity assay of antioxidant enzymes {#s0020}
-------------------------------------
Frozen leaf samples were ground in liquid nitrogen and homogenized in 50 mM sodium phosphate buffer (pH 7.0) containing 2 mM EDTA, 5 mM β-mercaptoethanol and 4% (w/v) polyvinylpyrrolidine-40 (PVP-40). The homogenate was centrifuged at 30,000×*g* for 30 min at 4 °C. The supernatant was used for assay of the antioxidant enzymes catalase (CAT), guaiacol peroxidase (GPX), ascorbate peroxidase (APX) and superoxide dismutase (SOD). CAT activity was assayed according to the method of Aebi [@b0070], GPX activity was assayed according to the method of Chance and Maehly [@b0075], APX activity was assayed according to the method of Nakano and Asada [@b0080] and SOD activity was measured according to Giannopolitis and Ries [@b0085].
Membrane stability index and H~2~O~2~ content {#s0025}
---------------------------------------------
The Membrane stability index (MSI) was determined indirectly by measuring the electrical conductivity according the protocol of Kocheva et al. [@b0090]. Leaf membrane stability was estimated using the equation, MSI = \[1−(*C*~1~/*C*~2~)\] × 100 [@b0095]. Relative Injury percentage was calculated as: RI(%) = 100−{\[1−(*T*~1~/*T*~2~)\]/\[1−(*C*~1~/*C*~2~)\] × 100}, where *C* and *T* refer to electrical conductivity of control and drought treated samples, and the subscript 1 and 2 refer to electric conductivity readings before and after autoclaving, respectively. H~2~O~2~ was measured according to Alexieva et al. [@b0100].
RNA isolation and cDNA preparation {#s0030}
----------------------------------
Total RNAs were extracted from 500 mg of shoot samples by using easy-BLUETM TRI-reagent (iNtrON Biotechnology) according to Chomczynski et al. [@b0105] DNA was removed from RNA samples by using RNase-free DNaseI (Thermo scientific) following the instruction protocol. Purity of total RNA was assessed at 260/280 nm. Quality of the RNA was assured with ethidium-bromide stain analysis by agarose gel electrophoresis. About 0.1--1 μg DNA-free RNA in distilled water (DEPC-treated) were added into Maxime RT PreMix tubes with Oligo dT primer to a total volume of 20 μl. The tubes were left for 2 min at room temperature and then the pellet was dissolved by pipetting. The cDNA synthesis reaction was performed using Thermal counter. The mixture was incubated at 45 °C for 60 min followed by 5 min at 95 °C. The reactant was diluted by adding 20--50 μl sterile water then stored at −20 °C for RT-PCR. To check if the cDNAs were properly synthesized, 18S rRNA of Arabidopsis (amplicon length is about 800 bp) was amplified by PCR conditions. These results were used as positive controls of cDNAs.
Primer design and DNA analysis {#s0035}
------------------------------
Specific primer pairs were designed to recognize a conserved regions which were predetermined using alignment of dehydrin genes sequences from wheat that are available at the GenBank. The alignment for these identified genes was performed by CLUSTALW. The primer pair for *dhn* and *wcor* genes was designed by PRIMER 3 program (<http://fokker.wi.mit.edu/primer3/input.htm>) and was checked by OligoAnalyzer 3.1, while the primer pair for *dreb* gene was designed according to the sequence of *Triticum aesitivum dreb* gene (*wdreb*) available in the NCBI database under the accession number AB193608 ([Table 1](#t0005){ref-type="table"}) [@b0110]. The PCR conditions were modified according to the primer properties, and the PCR products.
Semi-quantitative PCR {#s0040}
---------------------
Semi-quantitative PCR of the three genes (*dhn*, *wcor* and *dreb*) was performed in 50 μl reaction mixtures containing 16 μl RNase--DNase-free water, 25 μl Dream Taq Green PCR Master Mix (2×) (Thermo Scientific Cat. No. \#K1081) and 10 μl of each of the forward and reverse primers (10 mM each) as indicated in [Table 1](#t0005){ref-type="table"}, 1 μl cDNA template.
Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed as follows: initial denaturation at 95 °C for 5 min followed by (26--40) cycles of denaturation at 95 °C for 30 s, annealing at (43--58 °C) for (30--45 s) for different template cDNAs and genes specific primers were optimized, extension at 72 °C for 30 s, and final extension for 10 min at 72 °C. For semi-quantitative analysis, 10 μl of PCR products was collected after different cycles before reaching the plateau phase. The PCR cycles were adjusted to be in the linear range by viewing the RT-PCR product after each cycle on agarose gels. For ascertaining equal RNA loading in RT reaction, 18S rRNA was used as an internal control and the fold expression of the target genes was normalized accordingly. The resolved gel images were introduced into LabImage V 2.7.2 to measure the band volumes. Each experiment was repeated three times. Optical densities of bands that represent *Arabidopsis 18S* rRNA were obtained for normalization of data. Ratio of gene band intensity to 18S rRNA band intensity was calculated.
Isolation and identification of DNA sequence of dhn and wcor genes {#s0045}
------------------------------------------------------------------
PCR product for *dhn* was extracted from agarose gels while *wcor* was isolated from PCR mix by ISOLATE PCR and Gel Kit (Cat. No.: BIO-52029) following the instruction protocol. The extracted PCR products were sequenced in both directions by GATC Biotech. Ltd. <http://www.gatc-biotech.com/en/home.html>, ORF was found by Six-frame translation, <http://www.bioline.com/calculator/01_13>. A database analysis was done for each sequence in NCBI and BioEdit Sequence Alignment Editor Software, Version 7.04.1 using Megablast (nucleotides) search to test out the homology of the sequences. DNA alignment was done by multalin (<http://bioinfo.genotoul.fr/multalin/multalin.html>).
Statistical analysis {#s0050}
--------------------
The experimental design exhibited that water regimes were in main plots, and wheat genotypes in sub plots with three random replications of two experiments. For individual experiments, standard error of means of each ratio was calculated from *n* = 6 and analysis of variance (ANOVA) was carried out at every interval at 0.05 significance level [@b0115].
Results {#s0055}
=======
Growth parameters {#s0060}
-----------------
As Shown in [Table 2](#t0010){ref-type="table"}, both cultivars showed gradual increase in the fresh weight with time progress. Drought resulted in decreases in fresh weight of both cultivars, the magnitude of decrease was more pronounced in Gmiza than in Sids especially at the last harvest. Shoot dry weight also showed a gradual increase in both cultivars ([Table 2](#t0010){ref-type="table"}). At the end of the experiment there was a significant decrease in dry weight in Gmiza cultivar compared with control, otherwise drought caused insignificant decrease in dry weight in both cultivars. The results also show that there was a progressive increase in the leaf area in both cultivars under normal conditions ([Table 2](#t0010){ref-type="table"}). Sids had larger leaf area than Gmiza during the whole experiment. Drought decreased Sids leaf area comparing control value only after 26 and 30 DAS. Conversely, drought stress caused insignificant decrease in leaf area in Gmiza comparing control values. Surprisingly, the largest increase and the greatest decrease in leaf area were observed in watered and drought stressed Sids plants respectively.
Membrane stability index (MSI) and H~2~O~2~ content {#s0065}
---------------------------------------------------
In [Table 3](#t0015){ref-type="table"}, withholding water resulted in severe damage to membranes of Gmiza comparing with control while Sids did not encounter any damage in MSI along the experiment. On the other hand, after three days of withholding water, Sids and Gmiza cultivars had H~2~O~2~ content significantly higher than control, the magnitude of increase was most pronounced in Gmiza. Only on 30 and 33 DAS there was significant increases in the H~2~O~2~ content in accumulated in Gmiza due to drought comparing with control values. However, there was not any significant difference in the H~2~O~2~ content between watered and drought stressed Sids plants.
Antioxidant enzymes activity {#s0070}
----------------------------
Drought stress enhanced significantly CAT activity in Sids plants compared with its control all over the experiment ([Table 4](#t0020){ref-type="table"}). Conversely, drought stress inhibited CAT activity in Gmiza plants compared with its control; this inhibition was significant and most pronounced starting from the 26th DAS. Similarly, drought stress enhanced GPX activity in Sids plants compared with the control values all over the experiment ([Table 4](#t0020){ref-type="table"}). Contrarily, drought stress inhibited GPX activity in Gmiza plants compared with the control; but this inhibition was insignificant at all intervals. Generally, Sids has higher activity of SOD than Gmiza. Moreover, drought resulted in a significant increase in SOD activity comparing control until the end of the experiment ([Table 4](#t0020){ref-type="table"}). However Gmiza plants encountered nonsignificant decrease in SOD activity during withholding water throughout the experiment. In the same pattern, Sids generally has higher activity of APX than Gmiza. Nonetheless, APX activity was inhibited in both Sids and Gmiza cultivar due to drought, however this inhibition was significant only from 30 DAS onward comparing control values. The magnitude of inhibition in APX activity was greater in Gmiza than in Sids.
Responses of dhns, wcor and dreb to drought stress {#s0075}
--------------------------------------------------
Drought stress increased the transcript level of *dhn* in both cultivars after three days stress by about 2-folds ([Fig. 1](#f0005){ref-type="fig"}A). Nevertheless, after six days of stress, the mRNA level of *dhn* declined slightly in Gmiza but increased by 3-folds in Sids. Drought stress for 10 days resulted in an increase in the transcript level of *dhn* gene by 2-folds again in Gmiza however it reached the highest value in Sids as it went up by about more than 4-folds. On the other hand, after 2 days of rehydration, the transcript level of *dhn* declined to the minimum level in both cultivars. It is worth mentioning that the early expression of *dhn* gene after 26 cycles in the drought stressed Sids plants was after 6 days drought.
The transcript level of *wcor* gene was over regulated following drought stress for 3 days by 2-folds in Gmiza ([Fig. 1](#f0005){ref-type="fig"}B). However, there was an increase in about 30% in Sids as compared with control transcript levels. On the other hand, after 6 days drought the increase in the *wcor* transcript level was restricted to Sids cultivar as there was a decline in the mRNA level of *wcor* in Gmiza plants by about 40% as compared with control. Afterward, there was up-regulation in the mRNA level of *wcor* gene in both cultivars as a result of drought stress for 10 days in both cultivars but the increase in the expression level was highly significant in Sids plants. On other hand, rewatering both plants resulted in sharp reduction in the transcript level to reach minimum level during treatment period. It is noticed that there was a dense early expression for *wcor* gene after 37 cycles in the droughted Gmiza after 6 days drought.
Drought stress differentially regulated the expression level of *dreb* gene in both cultivars ([Fig. 1](#f0005){ref-type="fig"}C). After 3 days stress, the mRNA level in Gmiza went up 4.5 times of the control level but decreased slightly in Sids plants. However 6 days stress led to a sharp decrease in the *dreb* mRNA level in Gmiza and significant increase in case of Sids plants. The increase in the *dreb* transcript level continued up to the maximum value after 10 days stress while the transcript level of the droughted Gmiza plants was slightly higher than the transcript level of control plants. Afterward, the transcript level of *dreb* went down to lowest values in both cultivars after 2 days rehydration.
Characterization of tadhn and wcor {#s0080}
----------------------------------
The sequence analysis results showed that the fragment size of *tadhn* was 307 bp; (G + C) content was 58.63% ([Fig. 2](#f0020){ref-type="fig"}). The predicted molecular weight for this fragment was 93.888 kDa for single strand and 187.111 kDa for double strand. This fragment encoded a polypeptide of 102 amino acids (20.4% Gly). A comparison of the deduced protein sequence of *tadhn* with known *dhn*s sequences from wheat, *Hordeum vulgare* and *Prunus persica* showed the conserved Ser-repeat in the N-terminus, Y-segment and has one Lys-rich region at the C-terminus of the protein (K-segments). The predicted protein was found to have similarity with other dehydrin proteins by about 35--79%. The similarity was 35% with *P. persica* dehydrin, AAC49658; 79% with *T*. *aestivum* dehydrin, BAF30987; 68% with *T. aestivum* LEA D-11 dehydrin, BAC01112 and *H. vulgare* subsp. spontaneum dehydrin5, AAQ55342.
Results of BLAST search using Megablast (nucleotide) indicated that the *Tadhn* DNA sequence shared high nucleotide sequence homology with wheat and other plants at about 91--96% identity. The similarity percentages were 96% with *T. aestivum wcor726*, U73213; 95% with *T*. *aestivum wdhn* gene, FN393741; DHN14, AB272228; 93% with *Lophopyrum elongatum* dehydrin AF031250; 91% *T*. *aestivum* rab15B, X62476 and 91% with *T*. *turgidum* subsp. Durum *dhn5*, AM180933.
Similarly, the fragment size of *wcor* was 429 bp; (G + C) content was 55.94% ([Fig. 3](#f0025){ref-type="fig"}). The predicted molecular weight for this fragment was 130.722 kDa for single strand and 261.259 kDa for double strand. This fragment encoded a polypeptide of 144 amino acids (with 17.12% Glu and 15% Ser) and the predicted protein with molecular weight of 16.26 kDa. The deduced amino acid sequences corresponding to the partial genomic fragment which was similar to previously reported DHNs. The amino acid sequence of *wcor* contains Ser-repeat and has two Lys-rich regions (K-segments). The predicted deduced protein was found to 45 to 86% similarity with other dehydrins. 78% similarity with *H. vulgare* dehydrin8, AAD02259; 81% with *T*. *aesitivum wcor410*, AEJ88292; 62% with *Oryza sativa* SK3-type dehydrin, ABS44866 and 45% with DHN2-like protein in *Zea mays*.
Results from BLAST search using Megablast (nucleotide) indicated that the DNA sequence was highly identical to *dhn* sequence from wheat and other plants at about 80--92% identity. The similarity percentages were 89% with *T*. *aesitivum wcor410c*, U73211; 89% with *T*. *turgidum* subsp. Durum *dhn11*, AJ890140; 86% with *T*. *aesitivum wcor410b*, U73210; 85% with *T*. *aesitivum WZY1-2*, EU124658; 82% with *H. vulgare* dehydrin8, AF181458 and 77% with *Oryza sativa* SK3-type dehydrin, *EF444534*.
Discussion {#s0085}
==========
The present results revealed that the drought stress significantly declined the fresh weight in both cultivars but only Sids could tolerate the stress and retained its fresh weight at the end of the experiment. Sayar et al. [@b0120] reported that there was a decrease in the seedling fresh weight of both drought tolerant and sensitive durum wheat cultivars as osmotic potentials increased. Moreover, the dry weight of Sids was not significantly affected by drought by the end of the experiment although drought significantly decreased dry weight of Gmiza. Drought may limit the growth of the plant organs thereby reducing meristems and finally decreasing the capacity of vegetation [@b0125]. More increase in dry weight of Sids was detected after 16 days drought stress than the other cultivar. This means that Sids was the superior cultivar in its growth and this probably due to the vigor and strength of its genotype.
Specific leaf area is a marker for the regulation of plant leaf following abiotic stress factors including drought [@b0130]. The specific leaf area was larger in Sids, the more tolerant cultivar, than in Gmiza the less tolerant one. According to our results, drought did not change Sids leaf area at early stress but led to a significant decrease during the period from 26 to 30 DAS. Conversely, drought stress caused insignificant decrease in leaf area in Gmiza comparing control values. Sayar et al. [@b0120] found decrease in leaf area in both tolerant and sensitive cultivars of durum wheat linearly as osmotic potentials in PEG increased. Reduction of leaf area in the more tolerant cultivar, Sids may be a try to decrease the transpiring area as an adaptive response to water deficit for avoiding water loss.
Cell membranes are among the first targets of adverse stresses and the maintenance of membrane integrity and stability under abiotic stress conditions is a major component of environmental stress tolerance in plants [@b0135]. Our results showed a reduction in membrane stability index in both genotypes due to mild drought stress followed by severe reduction in sensitive genotype. The decrease in MSI progressively augmented with increasing drought severity. These results are in agreement with those of Filippou et al. [@b0140].
In addition, the present results revealed that mild drought induced H~2~O~2~ generation in Sids and Gmiza. H~2~O~2~ content sharply dropped in Sids at 23 DAS but its accumulation continued in Gmiza. These findings are in accordance with the results of Wang et al. [@b0145] who found that exposure of plants to moderate stress can induce tolerance to severe stress. Such treatment can improve tolerance to other stress as so-called cross-acclimation to stress usually functions to rescue plants from oxidative stress and lipid peroxidation [@b0150]. Severe drought stimulates H~2~O~2~ production in Gmiza plants suggesting a lack of an enhanced capacity for protection from oxidative damage caused by drought stress in this sensitive cultivar. Actually, H~2~O~2~ produced by photorespiration can act on the redox states of leaf antioxidant pools, implicating the possibility of photorespiratory H~2~O~2~ as a signal role under drought [@b0155].
The results of antioxidant enzymes showed variation and differentiation between tolerant and sensitive genotypes. CAT enzyme showed high significant activity in Sids genotype at all intervals and reached its maximum activity at moderate drought stress. Contrarily, there was no significant response to drought stress in the sensitive cultivar Gmiza except on 30 DAS. Accordingly, Rivero et al. [@b0160] found that CAT remained more active for a greater duration of drought stress. APX and POD might be responsible for the fine modulation of reactive oxygen species (ROS) for signaling, whereas CAT might be responsible for or the removal of excess ROS during stress [@b0165]. Moreover, GPX activity showed significant increase in Sids genotype nearly during all the experimental period. However, there was no significant response in Gmiza to drought. Various stressful conditions of the environment have been shown to induce the activity of GPX [@b0170]. POD, APX and glutathione reductase are involved in fine regulation of ROS and loss of their activities resulted in build up of ROS to high levels that resulted in CAT induction. It appears that there was an association between the higher antioxidant capacity and higher tolerance to drought stress in our tolerant wheat cultivar. The association between the levels/activities of antioxidant enzymes and plant drought tolerance has been previously observed [@b0175]. This strong antioxidant system under stress conditions plays a major role in stress tolerance of both leaves and roots of many species.
It has been reported that dehydrin accumulation is correlated with dehydration when dehydrin accumulation was compared in dried cereal seedlings [@b0180]. *dhn* data of the present results were in accordance with that observed by Lopez et al. [@b0185] in drought-tolerant wheat compared with drought-sensitive plants. Dehydrins were thought to be associated with crucial protective functions [@b0050]. Recently, antioxidative activity has been proposed to be an important function of dehydrins [@b0190], since *CuCOR19* was proposed to have antioxidative activity [@b0195] and *PvSR3* dehydrin was suggested to protect cells against oxidative damage caused by ROS and metal ions [@b0200]. In accordance, the present results exhibited a general relationship between enzymatic antioxidants and *dhn*. Indeed, the more tolerant cultivar, Sids showed greater stimulation of antioxidant enzymes and also a 3-fold increase in the mRNA of *dhn*.
Regarding the transcript level of *wco*r gene, drought stress resulted in over regulation in Sids cultivar more than Gmiza. On the other hand, rewatering both cultivars resulted in sharp reduction in the transcript level of *wcor* gene to reach its minimum level during treatment period. Moreover, there was a dense early expression for *wcor* gene after 37 cycles in the droughted Gmiza after 6 days drought. Similarly, findings of Kurahashi et al. [@b0205] on wild wheat *Aegilops tauschii* showed that KU-2829A, with high ABA sensitivity and drought tolerance, showed more rapid response in cold-responsive / late embryogenesis abundant (*cor*/*lea*) gene expression than the ABA-insensitive and drought-sensitive KU-2811. As indicated for *dhn*, there was a relationship between *wcor* and the efficiency of the antioxidant enzymes. The transcript level of *wcor* was increased more in the tolerant cultivar, Sids than in the sensitive one particularly under severe drought stress. The same pattern was also detected regarding the antioxidant enzymes supporting their relationship.
*dreb2* homologs contribute to increase multiple stress tolerance in several plant species [@b0210; @b0215; @b0220; @b0225] expression is induced by low temperature, drought, NaCl exposure, and exogenous ABA treatment [@b0230]. Drought stress differentially regulated the expression level of *dreb* gene in both cultivars. The increased *dreb* expression by drought was reported by Chen et al. [@b0235]. In this context, the level of mRNA of *dreb* was sharply decreased after 6 days of dehydration in the sensitive cultivar, Gmiza but increased in the more tolerant one, Sids. Such increase continued to become maximum value after 10 days of water stress. A similar trend was also detected in enzymatic antioxidants pointing out to the presence of a general relationship between antioxidants and *dreb*. Altering the expression level of a single *dreb*/*cbf* can increase or decrease levels of expression of other transcription factors, which in turn, can lead to activation of a larger number of target genes, some of which may be directly activated not by the initially over-expressed *dreb*/*cbf* but by downstream *drebs*/*cbfs*. Several research groups have shown that raising levels of *dreb*/*cbf* expression by plant transformation enhance expression of downstream target genes encoding late embryogenesis abundant (LEA) proteins, also known as dehydrins (DHNs), and cold-responsive (COR) proteins [@b0240].
Conclusions {#s1055}
===========
The present work is an attempt to clarify the direct relationship between *wdreb* and the two *cor* and *dhn* genes in development of drought stress tolerance in wheat using two cultivars with different drought tolerance. According to the present results, *dreb* seemed to activate the transcription process of *Tadhn* and *wcor*. Almost all genes examined in Sids and Gmiza appeared to be regulated by drought stress and subsequent rewatering in a variable manner. The most striking overall trend observed was the acute induction in expression of *dhn*, *wcor* and *dreb* in leaves tissue during severe water stress conditions in tolerant genotype Sids. Moreover, there was a general relationship of the enzymatic antioxidants with the genes *dhn*, *wcor* and *dreb*. A further study is needed to elucidate the transcription factors in relation to these antioxidant enzymes with the dreb genes. Some transcription factors that regulate the expression of several genes related to stress have been discovered [@b0030]. Transcriptome analysis has revealed that dozens of transcription factors are involved in the plant response to various stresses [@b0245; @b0250]. Transcription factors control the rates of transcription to regulate the amounts of gene products (RNA and protein) available to the cell. DREBs are important plant transcription factors that regulate the expression of many stress-inducible genes [@b0255]. So, the data presented here indicate a cross-talk between physiological and molecular tolerance mechanisms in response to drought stress.
Conflict of interest {#s0155}
====================
*The authors have declared no conflict of interest.*
Compliance with Ethics Requirements {#s0160}
===================================
*This article does not contain any studies with human or animal subjects.*
Peer review under responsibility of Cairo University.
{#f0005}
{#f0020}
{#f0025}
######
Primer pairs and numbers of cycles used for amplification of different genes.
Gene name Forward primer Reverse primer No. of cycles
----------- -------------------------- -------------------------- ---------------
dhn 5′ATGGAGCACCAGGGGC3′ 5′GCAGCTTGTCCTTGATCTTG3′ 33
wcor 5′ATGGAGGATGAGAGGAG3′ 5′GCTTGTCCTTGATCTTG3′ 40
dreb 5′AAGAAAACAGGCGACAAGAT′3 5′ACGAAGCACAAAAAACTAGC′3 27
18S RNA CCACCCATAGAATCAAGAAAGAG GCAAATTACCCAATCCTGAC 25
######
Changes in shoot fresh weight, dry weight and leaf area of two wheat cultivars (Sids, sd and Gmiza, gm) as a result of drought by withholding water. *n* = 6, Data are means ± SE, LSD was calculated at 0.05.
Days after sowing (DAS)
------------------------------ ------------------------- ------------------ ------------------ ------------------ ------------------ ------------------
*Fresh weight (g per plant)*
F wt
sd 0.262 ± 0.001 0.437 ± 0.085 0.573 ± 0.087 0.651 ± 0.094 0.683 ± 0.143 1.064 ± 0.033
sd^∗^ 0.262 ± 0.001 0.362 ± 0.039^s^ 0.373 ± 0.120^s^ 0.502 ± 0.018^s^ 0.558 ± 0.144^s^ 0.878 ± 0.070^s^
gm 0.172 ± 0.018 0.247 ± 0.050 0.323 ± 0.018 0.388 ± 0.014 0.395 ± 0.010 0.651 ± 0.058
gm^∗^ 0.172 ± 0.018 0.257 ± 0.044 0.265 ± 0.010 0.283 ± 0.069^s^ 0.272 ± 0.075^s^ 0.279 ± 0.077^s^
LSD 0.021 0.056 0.076 0.066 0.090 0.066
*Dry weight (g per plant)*
sd 0.043 ± 0.003 0.065 ± 0.011 0.111 ± 0.015 0.118 ± 0.012 0.134 ± 0.012 0.190 ± 0.016
sd^∗^ 0.043 ± 0.003 0.077 ± 0.004^s^ 0.069 ± 0.022^s^ 0.077 ± 0.002^s^ 0.102 ± 0.012^s^ 0.153 ± 0.016^s^
gm 0.039 ± 0.001 0.041 ± 0.008 0.049 ± 0.020 0.070 ± 0.006 0.076 ± 0.018 0.120 ± 0.007
gm^∗^ 0.039 ± 0.001 0.028 ± 0.006^s^ 0.035 ± 0.004^s^ 0.049 ± 0.014^s^ 0.070 ± 0.014 0.064 ± 0.003^s^
LSD 0.004 0.008 0.013 0.011 0.015 0.012
*Leaf area (cm^2^)*
sd 6.84 ± 0.37 7.09 ± 0.12 8.14 ± 0.22 9.05 ± 0.43 11.21 ± 0.41 10.65 ± 0.50
sd^∗^ 6.84 ± 0.37 7.06 ± 0.35 7.99 ± 0.19 7.18 ± 0.33^s^ 7.69 ± 1.05^s^ 8.81 ± 0.14^s^
gm 4.30 ± 0.11 6.57 ± 0.56 6.74 ± 0.73 7.73 ± 0.48 6.63 ± 0.21 7.19 ± 0.06
gm^∗^ 4.30 ± 0.11 5.23 ± 0.22^s^ 6.43 ± 0.06 6.79 ± 0.23 5.55 ± 0.14^s^ 5.40 ± 0.08
LSD 1.18 1.11 1.11 1.27 0.73 1.88
Values followed by an ^s^ are significantly different at 0.05 from their corresponding control.
An *^∗^* represents cultivars grown under drought.
######
Changes in membrane stability index and H~2~O~2~ content of two wheat cultivars (Sids, sd and Gmiza, gm) as a result of drought by withholding water. *n* = 6, Data are means ± SE, LSD was calculated at 0.05.
Days after sowing (DAS)
----------------------------------------------- ------------------------- ----------------- ----------------- ----------------- ----------------- -----------------
*Membrane stability index (MSI)*
MSI
sd 94.04 ± 0.51 93.04 ± 0.45 96.74 ± 0.38 84.52 ± 0.72 89.07 ± 0.54 90.99 ± 0.76
sd^∗^ 94.04 ± 0.51 91.03 ± 0.33^s^ 99.33 ± 0.67^s^ 80.33 ± 0.60^s^ 86.83 ± 0.73 86.05 ± 3.44
gm 95.68 ± 0.09 95.68 ± 0.09 97.76 ± 0.38 85.33 ± 2.32 83.18 ± 0.91 91.21 ± 0.61
gm^∗^ 95.68 ± 0.09 86.46 ± 0.11^s^ 74.52 ± 0.72^s^ 57.42 ± 0.42^s^ 48.19 ± 1.35^s^ 48.19 ± 0.53^s^
LSD 1.39 1.51 1.89 4.07 3.49 7.13
*H~2~O~2~ content (μmole g^−1^ fresh weight)*
sd 1.40 ± 0.09 0.78 ± 0.11 0.10 ± 0.01 1.92 ± 0.16 1.94 ± 0.16 2.38 ± 0.33
sd^∗^ 1.40 ± 0.09 1.76 ± 0.13^s^ 0.44 ± 0.08^s^ 2.74 ± 0.05 3.51 ± 0.47^s^ 2.85 ± 0.44
gm 1.62 ± 0.14 0.91 ± 0.07 0.37 ± 0.04 3.35 ± 0.13 3.11 ± 0.36 2.67 ± 0.36
gm^∗^ 1.62 ± 0.14 2.17 ± 0.08^s^ 1.02 ± 0.19^s^ 4.16 ± 0.92 6.64 ± 0.70^s^ 4.83 ± 0.44^s^
LSD 0.33 0.23 0.32 1.17 1.37 1.17
Values followed by an ^s^ are significantly different at 0.05 from their corresponding control.
An *^∗^* represents cultivars grown under drought.
######
Changes in CAT, GPX, SOD and APX activities of two wheat cultivars (Sids, sd and Gmiza, gm) as a result of drought by withholding water. *n* = 6, Data are means ± SE, LSD was calculated at 0.05.
Days after sowing (DAS)
--------------------------------------------------- ------------------------- ------------------ ------------------ ------------------ ------------------ ------------------
*CAT activity (μmole min^−1^ g^−1^ fresh weight)*
CAT
sd 0.303 ± 0.008 0.873 ± 0.037 2.155 ± 0.223 1.881 ± 0.011 3.003 ± 0.082 2.229 ± 0.551
sd^∗^ 0.303 ± 0.008 2.812 ± 0.100^s^ 6.477 ± 0.740^s^ 5.413 ± 0.117^s^ 5.126 ± 0.058^s^ 4.955 ± 0.073^s^
gm 0.242 ± 0.011 1.961 ± 0.084 1.537 ± 0.264 2.942 ± 0.139 3.457 ± 0.087 3.124 ± 0.398
gm^∗^ 0.242 ± 0.011 1.433 ± 0.233 1.333 ± 0.203 0.964 ± 0.122^s^ 1.671 ± 0.091^s^ 1.865 ± 0.034^s^
LSD 0.280 0.581 1.501 0.471 0.547 1.034
*GPX activity (nmole min^−1^ g^−1^ fresh weight)*
sd 13.92 ± 2.28 13.87 ± 0.91 47.58 ± 4.13 57.41 ± 0.49 94.62 ± 2.51 50.64 ± 1.46
sd^∗^ 13.92 ± 2.28 78.58 ± 1.42^s^ 124.73 ± 7.20^s^ 152.97 ± 2.62^s^ 141.23 ± 4.00^s^ 97.58 ± 10.18^s^
gm 8.85 ± 0.32 16.70 ± 1.51 55.56 ± 0.63 42.49 ± 1.76 82.45 ± 2.38 67.34 ± 1.77
gm^∗^ 8.85 ± 0.32 28.79 ± 0.67^s^ 56.58 ± 3.03 32.81 ± 1.47^s^ 70.20 ± 1.25^s^ 67.44 ± 0.91
LSD 5.43 4.38 13.44 5.50 10.44 41.18
*SOD activity (Unit g^−1^ fresh weight)*
sd 65.4 ± 0.6 127.8 ± 1.4 251.5 ± 4.2 282.2 ± 3.4 253.1 ± 4.0 269.1 ± 10.2
sd^∗^ 65.4 ± 0.6 352.9 ± 16.0^s^ 390.5 ± 4.5^s^ 371.9 ± 11.0^s^ 338.5 ± 4.0^s^ 396.9 ± 3.7^s^
gm 42.5 ± 1.7 91.6 ± 1.2 244.4 ± 37.6 251.3 ± 6.9 188.5 ± 9.4 210.8 ± 4.1
gm^∗^ 42.5 ± 1.5 84.3 ± 1.6 204.9 ± 3.8 169.7 ± 2.3^s^ 170.0 ± 7.4 210.2 ± 5.0
LSD 5.4 26.8 60.7 32.1 25.8 22.5
*APX activity (nmole min^−1^ g^−1^ fresh weight)*
sd 32.57 ± 0.67 39.30 ± 3.59 32.43 ± 1.20 26.66 ± 1.04 22.63 ± 1.19 24.69 ± 1.33
sd^∗^ 32.57 ± 0.67 33.62 ± 5.44 22.77 ± 4.76^s^ 25.28 ± 1.51 10.54 ± 1.99^s^ 10.54 ± 0.67^s^
gm 14.20 ± 0.33 30.69 ± 6.90 13.11 ± 3.81 15.89 ± 1.60 14.81 ± 3.60 19.20 ± 1.18
gm^∗^ 14.20 ± 0.33 22.43 ± 6.30 5.32 ± 1.68 6.01 ± 1.18^s^ 4.99 ± 0.33^s^ 2.39 ± 0.67^s^
LSD 10.03 11.01 9.07 7.64 5.51 3.56
Values followed by an ^s^ are significantly different at 0.05 from their corresponding control.
An *^∗^* represents cultivars grown under drought.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
ENTERTAINMENT
Kubbra Sait shared some important points to become successful in the entertainment industry but a user added one more point to her list and said, "You forgot one more important thing. Show off your t*ts."Sep 1, 2018
Bigg Boss Telugu 2 elimination live updates: Nani announced on Saturday that Kaushal is saved from eviction and Ganesh was eliminated from his show. He will send one of Samrat, Nutan Naidu, and Amit Tiwari out of the house on Sunday.Sep 1, 2018
The artist re-imagined various characters from Mahabharata and Ramayana, and brilliantly turned them into sketches. Aamir Khan can certainly take inspiration and finalise the cast of Mahabharata accordingly if he is making the movie.Sep 1, 2018
It is being said that Kangana Ranaut's constant bullying on Manikarnika's sets led Sonu Sood to walk out of the project. Apparently, Kangana even wanted to chop down Sonu's role when she started directing the film.Sep 1, 2018
Rumours suggest that Mahika Sharma and her "close friend" British porn star Danny D are not only confirmed to be part of Bigg Boss 12, but will also be seen dancing with host Salman Khan on the premiere night.Sep 1, 2018
Karan Johar further spoke about his dating life and said that he is not somebody who would go for "casual sex" as he believes he needs to interact with the other person to a certain extent to create a comfort zone.Sep 1, 2018
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Upper buccal sulcus approach to management of fractures of the zygomatic complex: a retrospective study of 50 cases.
A retrospective study was conducted of 50 consecutive cases of fractures of the zygomatic complex reduced by the upper buccal sulcus approach. All were treated successfully with simple elevation (n=38), elevation with intraoral plating at the zygomatic buttress (n=8), or extraoral placement of bone plates (n=4). In no case was the approach deemed unsuitable, or abandoned in favour of another technique. There was minimal morbidity (one case each of mild diplopia, trismus, and swelling, all of which settled spontaneously). The upper buccal sulcus approach is a safe, rapid and effective technique for the reduction of zygomatic body and arch fractures.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Sen. Dianne Feinstein Dianne Emiel FeinsteinFeinstein 'surprised and taken aback' by suggestion she's not up for Supreme Court fight Democrats shoot down talk of expanding Supreme Court Biden leads Trump by 12 points among Catholic voters: poll MORE (Calif.), the top Democrat on the Senate Judiciary Committee, wants the Senate to apply the "McConnell standard" and wait until after the midterm elections to vote on a Supreme Court justice who will replace Justice Anthony Kennedy.
“Leader McConnell set that standard in 2016 when he denied Judge [Merrick] Garland a hearing for nearly a year, and the Senate should follow the McConnell Standard," Feinstein said shortly after Kennedy announced his retirement.
Top Dem on Judiciary Cmte, @SenFeinstein wants to wait until after election to consider Kennedy’s replacement: “Leader McConnell set that standard in 2016 when he denied Judge Garland a hearing for nearly a year, and the Senate should follow the McConnell Standard.” pic.twitter.com/Aau3sCi7Tc — Frank Thorp V (@frankthorp) June 27, 2018
ADVERTISEMENT
McConnell quickly responded to the announcement that Kennedy was retiring by saying that the Senate would vote in the fall on President Trump’s second Supreme Court nominee.
“We’re now four months away from an election to determine the party that will control the Senate," Feinstein added. "There should be no consideration of a Supreme Court nominee until the American people have a chance to weigh in."
Feinstein's comments echoed what many Democratic lawmakers said. Senate Minority Leader Charles Schumer Chuck SchumerCruz blocks amended resolution honoring Ginsburg over language about her dying wish Senate Democrats introduce legislation to probe politicization of pandemic response Schumer interrupted during live briefing by heckler: 'Stop lying to the people' MORE (D-N.Y.) said it would be the "height of hypocrisy" for Republicans to vote on a nominee to replace Kennedy and urged McConnell to have the proceedings take place in 2019.
Sen. Dick Durbin Richard (Dick) Joseph DurbinFeinstein 'surprised and taken aback' by suggestion she's not up for Supreme Court fight Grand jury charges no officers in Breonna Taylor death Democrats shoot down talk of expanding Supreme Court MORE (D-Ill.) said in a statement that McConnell set the "new standard by giving the American people their say in the upcoming election before court vacancies are filled."
“The U.S. Senate must be consistent and consider the president’s nominee once the new Congress is seated in January," he added.
Merrick Garland Merrick Brian GarlandPoll: 59 percent think president elected in November should name next Supreme Court justice Mark Kelly: Arizona Senate race winner should be sworn in 'promptly' Chief justice honors Ginsburg: 'When she spoke, people listened' MORE, President Obama's nominee to replace the late Justice Antonin Scalia, had his nomination blocked in 2016 by McConnell. The GOP leader argued that voters should have the chance to weigh in on what they'd desire for the court in the 2016 presidential election.
The move allowed for Trump to nominate now-Justice Neil Gorsuch to the court shortly after taking office in 2017.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Symptoms & Treatments
The menopause can cause various symptoms such as hot flushes and changes to your vagina. Hormone replacement therapy (HRT) may ease symptoms. If you are considering taking HRT, Richard will be happy to discuss the risks and benefits with you. If you are taking HRT, you should have regular check ups to decide whether or…
Fibroids are non-cancerous growths in the womb. They can be quite small (size of a pea), or very large (size of a melon). They are common and usually cause no symptoms. However, they can sometimes cause heavy periods, abdominal swelling and urinary problems. Treatment is available if symptoms occur.
Acute pelvic pain is pain that starts over a short period of time anywhere from a few minutes to a few days. This type of pain is often a warning sign that something is wrong and should be evaluated promptly.
Some women experience very heavy bleeding during periods. This can involve flooding and/or clots. If your periods change or become heavier than previously it is a good idea to see a doctor to discuss this. Richard is able to offer investigation and a full range of treatments for this distressing problem.
The average menstrual cycle of a woman is 28 days although some women can have shorter cycles and some can have longer. The menstrual cycle is calculated from the first day of a woman’s period to the day before the next period. At some time you may experience abnormal or irregular bleeding and it is…
What is Vaginal Prolapse? Vaginal prolapse (also genitourinary prolapse) occurs when the ligaments and muscles that support the womb (uterus) and hold it in place, are weakened and are no longer effective. The causes of this condition include childbirth and previous surgery. Whilst many women do not have pronounced symptoms that accompany vaginal prolapse, weakened…
Many women each year in the UK will get an abnormal smear result. An abnormal or positive smear result does not mean you have cancer. It does mean that you have some changes in your cervical cells that could eventually develop into cancer and these will need to be investigated.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
In order to reduce costs and time to market, current integrated circuit (IC) designs often incorporate several functionalities into a single chip. This is particularly true as IC fabrication technologies move towards ultra-deep sub-micron geometries, such as, for example, 40 nanometer (nm) or 28 nm. Such a design approach is typically referred to as a system on a chip (SoC).
In order to conserve power in a SoC design, it is important that different functional blocks in the SoC be capable of being independently turned off (i.e., powered down) when they are inactive. However, with smaller feature sizes (e.g., gate oxide thickness, gate channel width and length, etc.) in current technologies, there is a significant amount of leakage current (e.g., sub-threshold leakage current) even when a functional block is powered off. In order to overcome this leakage problem, power islands are often created that supply power to individual blocks, and the power supplied to an inactive block can be selectively turned off without interfering with the overall SoC operation. This approach, however, increases layout routing congestion and design complexity, among other disadvantages.
Conventionally, when the core power supply is turned off, an input/output (I/O) buffer circuit (typically used in a SoC design for performing interfacing functions) can be forced into a limited subset of operational modes; typically, tri-state mode, weak pull-up mode, or weak pull-down mode. This can be achieved, for example, with a core power detection circuit in conjunction with a plurality of I/O level control signals. However, a full set of modes that an I/O buffer may offer during normal operation is not realizable when the core power supply to the buffer circuit is removed (i.e., turned off or otherwise disconnected).
In order to maintain proper operation of a SoC even when one or more functional blocks are powered off, it is important that I/O buffers in the powered-off blocks be able to provide a full set of functional modes as are available when power is supplied to the buffer during a normal operation thereof. One known approach to achieve this objective is to provide an I/O level signal for each core level signal. Given the number and complexity of current I/O buffers employed in a given SoC design, however, it is simply impractical to provide as many I/O level signals as there are core level signals. This approach also increases design complexity, layout routing congestion, and characterization, verification and functional model complexities, and is therefore undesirable.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
gun laws
Twenty-six seconds of silence were observed in honor of the victims killed at Sandy Hook Elementary School at a memorial organized to mark six months since the massacre. Margaret Warner reports on how lawmakers and activists are engaged in the debate about new forms of gun control. Continue reading →
Lawmakers in Congress and at the state level are grappling with how to approach and pass new gun legislation. For the latest from Capitol Hill and state capitals, Gwen Ifill talks with Ed O’Keefe of The Washington Post, Arkansas State Rep. Charles Collins and Vinny DeMarco, president of Marylanders to Prevent Gun Violence. Continue reading →
In other news Tuesday, 115 Roman Catholic Cardinals convened a conclave to begin the papal election process. Their first first vote was inconclusive, but they will resume voting Wednesday. Also, a Colorado judge entered a not guilty plea for James Holmes, the man accused of last July’s mass shooting in a movie theater. Continue reading →
A tough battle is being waged over gun laws and ways to address gun violence in Florida, a state known to have some of the least restrictive firearm laws in the country. Special correspondent Trimmel Gomes of Florida Public Radio looks at gun ownership in the Sunshine State. Continue reading →
Judy Woodruff talks to National Rifle Association president David Keene about his opposition to potential, additional gun control laws intended to curb gun violence nationwide. Keene has rejected White House recommendations on gun control and dismissed any ban on assault weapons or high-capacity magazines. Continue reading →
President Obama called on Republicans to "act responsibly" and raise the nation’s debt ceiling before March when the U.S. is expected to breech its borrowing limit and possibly default on its debt. Judy Woodruff talks to the Wall Street Journal’s Carol Lee and Politico’s Jake Sherman about Obama’s plans for the federal deficit. Continue reading →
A grand jury will not investigate the death of Trayvon Martin — the unarmed black teenager shot in a gated community in February, a special prosecutor said Monday. Gwen Ifill and Daniel Webster of Johns Hopkins’ Center for Gun Policy and Research discuss the case’s potential effects on other states’ “stand your ground” laws. Continue reading →
The U.S. Supreme Court set the stage for a major ruling on the Second Amendment Tuesday when it agreed to take a case weighing the constitutionality of a ban on handguns in Washington, D.C. Marcia Coyle of the National Law Journal details the significance of the case. Continue reading →
An investigation into the Virginia Tech shootings criticized the university for failing to respond to the behavior of Seung-Hui Cho and for communication problems. Panel member Tom Ridge discusses the findings. Continue reading →
Washington, D.C. residents and officials are lobbying the House of Represenatives to get a voting member. The NewsHour reports on the fight for voting rights in the nation’s capital. Continue reading →
| null |
minipile
|
NaturalLanguage
|
mit
| null |
"It was like putting a package of fireworks into a bonfire, like a rain of bullets."
That's how "Mario" described the bursts of gunfire that were used against him and his classmates as they returned to their school on the night of Friday, September 26, in Iguala, Mexico. The attack claimed six lives that night and left 43 students missing in a case that has shaken the country and led to international calls for a just investigation.
Mario, who asked that his real name not be used in this story, is a first-year student at the Raul Isidro Burgos Ayotzinapa Normal School, in the volatile southern state of Guerrero. It is the only all-male boarding school among nine rural teachers colleges in the state, the only one where the students say they run the place, not the professors.
All decisions at the 88-year-old campus are made democratically among the students, and activities are carried out through commissions. Those sort of activities led a group of normalistas, as they are called, to depart from their campus on September 26 to the city of Iguala — on two commercial buses they had taken without force from drivers.
In recent days, VICE News spoke to a dozen survivors who reconstructed what happened the night of the police attack in Iguala.
The families and supporters of the missing normal school students have protested in cities across Mexico. Above, a demonstration in Chilpancingo, Guerrero. (Photo by Lenin Ocampo.)
Student-Organized Bus Hijackings
Earlier in the day, the student commissions for "Struggle" and "Transport" scheduled "carteras," a term used to describe student activities outside the school. In "carteras," the students take over passenger buses and occupy toll stations on highways, asking for donations in exchange for letting automobiles pass.
That day, they planned to protest before a scheduled event for María de los Ángeles Pineda, the wife of Iguala's now fugitive mayor, Jose Luis Abarca.
Pineda, like many first ladies across the government ranks in Mexico, served as honorary local president of Mexico's family welfare agency, known as Desarrollo Integral de la Familia, or DIF, in Iguala. Her family's alleged links to the Beltran Leyva cartel were well known across the state, but authorities had done nothing about the serious accusations — including kidnapping and homicide — surrounding the mayor and his wife.
Instead, Pineda's name was already being floated as a mayoral candidate for Iguala in elections next year. The students decided to protest at one of her ceremonial DIF events in the community of Tixtla that day "because she wanted the power to stay in one family," Mario said.
They returned to the Ayotzinapa campus by 4pm. The teaching students had two private Estrella de Oro buses already under their control, but they needed more.
'When it started, one of us said, don't be afraid, friends, they are firing to the sky,' Mario went on. 'The buses stopped, and that's when I saw the bullets were coming toward us.'
The commissions then decided to head to Iguala to claim more buses — a soft hijacking so commonplace for the Ayotzinapa school that students paid the drivers off — so that they could travel to the October 2 memorial march in Mexico City the following week.
The Aytozinapa Normal School is usually the only option available for Mario and his classmates. They are mostly the sons of poor campesinos forgotten by Mexico's globalized agricultural economy, families where paying for a college degree is out of the question. The normal schools are free, but chronically underfunded and neglected.
One-hundred and twenty students, none older than 25 and most in their first year at Ayotzinapa, squeezed into the two buses, which had been sitting at their campus for three days. They would take four more from the Iguala central terminal and return to Ayotzinapa, survivors said.
"That Friday we left [the school] on two buses that we had already agreed on with the drivers. We got to the terminal [in Iguala] and we took the others without any problem," Mario said.
"In total, we were on six buses that left the station, two that we already had and four others that we had taken. Three took off in a caravan through downtown, and the other three took another route."
One of the injured normal school students, in a hospital in Iguala, the day after the police attack. (Photo by Pedro Pardo.)
It Sounded Like Fireworks
That night Mario wore only a white T-shirt, a red-and-blue cap he used to help cover his face, his red Ayotzinapa uniform jacket, and one of the only two pairs of black shoes he owns.
The buses arrived at the Iguala terminal just before 7pm, as the sun was setting. They showed up in a city where any stranger is seen with suspicion, where in the past year more than 50 bodies have been found, according to news accounts, in clandestine graves on the city's outskirts. The pervasive sense of fear is due to a fight between local drug gangs Guerreros Unidos and Los Rojos, both splinters of the Beltran Leyva cartel.
Mario rode on the third bus in the caravan, taking Juan Alvarez Street, into the horror.
At the intersection with Mina Street, in the very center of Iguala — Guerrero's third-largest city and a key smuggling point for narcotics controlled by the gangs — the attack began.
"When it started, one of us said, 'Don't be afraid, friends, they are firing to the sky'," Mario went on. "The buses stopped, and that's when I saw the bullets were coming toward us."
The young men began panicking. Mario and three other friends got off, each also wearing the red jacket of their Ayotzinapa uniforms. They saw that the gunfire was coming from men inside two municipal police cruisers. Trying to defend himself, Mario threw rocks in their direction.
As bullets kept hitting the buses, they ran to the first bus. "But then we saw that they were ten police cars, surrounding us. We had no where to run and no rocks to defend ourselves," Mario said.
"One of the bullets hit Aldo, who fell right next to me. I saw how a pool of blood formed. I yelled at them that they already hit one of us, and they began firing more," he went on. "If you moved, they fired, if you yelled or talked, they fired. They fired so much, from in front, and from behind, that us, the ones who got off, we hid in between the first and second bus."
A federal special operations police officer stands guard near an entrance to Iguala, Guerrero. (Photo by Hans-Maximo Musielik.)
In the midst of the gunfire, an ambulance took Aldo Gutiérrez Solano, one of the 25 injured by bullets that night, to a hospital. Lázaro Mazón, Guerrero state health secretary, told VICE News the student did not die of his wounds but remained in a coma.
As this occurred, the normalistas on the third bus, the same one that Mario exited seconds after the gunfire started, were being loaded into police cars. The students interviewed by VICE News counted at least 30 of their classmates who were taken away in vehicles marked by the numbers 017, 018, 020, 022, 028, and 302.
Mario returned to the bus and collected bullet casings he described as being from rifles and handguns. He watched as friends, all identified among themselves by nicknames, were taken away: "Comelón," "Amilcingo," "Chabelo," "El Chicharrón."
Then a second group of officers arrived, but these, Mario said, wore "helmets, bulletproof vests, body armor, black gloves, and anti-riot gear." These police officers surrounded the first two buses.
"They looked like state police, because of how they were equipped, and they told us, 'Sons of bitches, you're getting the fuck out of here! Get on your buses and get the hell out, you're not welcome in this city,' " as the municipal agents took off in vehicles, with normalistas in their control, their wrists bound, Mario said.
Federal helicopters fly over the location of a suspected mass grave outside Iguala. (Photo by Hans-Maximo Musielik.)
Escaping the Bullets to a Clinic
Mario saw everything. Javier only heard it.
With the first bullets that hit his window on the third bus, he hit the floor. Javier was in Seat 24, whispering pleas for help into his cell phone so that the police outside wouldn't hear. The driver of the second bus never opened his cabin's door.
They called for help to Ayotzinapa. As soon as he heard the message, the school's student secretary general mobilized a group of Ayotzinapa students and professors in two trucks. They made it to Iguala about an hour after the first attack, accompanied by three local journalists.
Hoping to receive them, Javier left the bus. The bullets had stopped and the police were nowhere to be seen for a few moments.
"As soon as I got off the bus, I went to a friend who was injured," Javier said. "He had his lip ripped open and was trying to get up when the second shooting started. I thought they were fireworks, but they were bullets again, hitting the floor, jumping."
He and three other students managed to carry Edgar Andrés Vargas, whom they called "El Oaxaco," to a clinic a block away.
"There were no doctors, and the watchman said he couldn't help us, but we went up to the third floor, where other patients saw us and ran away," Javier went on. "I think they thought we were in a cartel. We stayed there listening to the shooting."
Two of the victims remained where they fell in the hours after the Iguala bus attacks. (Photo by Lenin Ocampo.)
The second attack against the normalistas — when many were already wounded — came from a group of police trucks that sped toward them from the opposite direction on the street. That is when Julio Cesar Ramírez, 23, and Daniel Gallardo, 19, were killed, along with a woman riding in a taxi and a driver of one of the buses.
The gunmen in the police trucks were armed civilians, witnesses told VICE News. One of these gunmen hit another passenger bus carrying members of a local soccer team called "Los Avispones de Chilpancingo." That is where David Josué García, 15, was killed.
'I feel safe here, and if they're going to take away my life, let them take it as I defend myself and do something.'
As Javier and the wounded student "El Oaxaco" hid in the third floor of the clinic, Mario stayed on the floor of the third bus. He said the second attack from police and armed men lasted fifteen minutes. The rest of the young men ran off in any direction they could.
One of them, Martin, who also did not want to use his real name, darted through the gunfire that hit the buses. He and a fellow student named Julio Cesar Mondragón rushed out help their wounded classmates. They ran up into a hill, where the light of the street faded into darkness.
"We ran. We ran into an empty lot and we stayed there about 30 minutes. We saw two police trucks and heard people yell, 'Tírenles, tírenles!'"—or 'Shoot at them, shoot at them!'—Martin told VICE News. "El Chilango got scared and ran off. I didn't see him again, until he showed up in the newspapers."
Martin might be the last survivor of the Iguala attack that saw "El Chilango" alive. Julio Cesar Mondragón was found the next day with his eyes gouged out and the skin of his face sliced off, just a few streets away from where the police attack took place.
"I recognized him for his handkerchief," Mario told me. "It was the same one he used to cover his face. It was brown, a thick fabric."
Mario said Julio Cesar was a father of a small girl and, like him, listened to hip-hop.
Members of a Guerrero self-defense militia arrive in Iguala to aid the search for the missing. (Photo by Hans-Maximo Musielik.)
'You Took Them Alive, Alive We Want Them'
Mario, who is 23, forced out a smile as he recalled his friend "El Chilango." Tears welled in his eyes and trickled down his cheeks.
Mario doesn't have any contact with his parents. He is from Tlapa, another municipality in the mountains of Guerrero. His mother abandoned him and two younger siblings when Mario was 15. He fought with his father, a campesino who eventually formed a family with another woman.
For a few years, Mario and his little brothers lived with uncles. He worked at a laundry, an office supply store, and a nursery school. He didn't have contact with his mother until she heard he had enrolled in the normal school. She called him on the phone one day to congratulate him.
Mario said he has now lost his family, the family he found when enrolled in the Ayotzinapa Normal School.
"That's why I am going to stay here, until I find my compañeros," Mario said. "I feel safe here, and if they're going to take away my life, let them take it as I defend myself and do something."
The normal schools are free, but chronically underfunded and neglected.
The walls of the Ayotzinapa Normal School are decorated with the faces of historic communist leaders and famous phrases uttered by Ernesto "Che" Guevara. No longer just a school, it has a different atmosphere these days. Sometimes it feels like an aid center, sometimes like a funeral parlor, and in recent days, like a market for the various organizations that have arrived with promises of helping the Aytozinapa students and their families.
Every morning at 6am, federal police forces in Iguala gather for a ceremony for the Mexican flag. (Photo by Hans-Maximo Musielik.)
Lucio Cabañas and Genaro Vázquez, historic guerrilla leaders from Mexico's "Dirty War" period in the 1960s and 1970s in Guerrero, studied at the Ayotzinapa school. Their faces also adorn the walls, where banners now hang that read, "You Took Them Alive, Alive We Want Them," along with the faces of the 43 missing.
The discovery of nine mass graves around Iguala make no difference to the parents holding vigil here. They said they wouldn't believe a word spoken by the governor, Angel Aguirre. They call him a "murderer."
According to statements of two of the 34 suspects now under arrest in connection to the case, authorities in Guerrero say the missing students were most likely killed, burned, and buried in the mass graves later discovered in the forested hillsides outside Iguala.
The parents have deposited their trust in a team of forensics investigators from Argentina, who are collecting DNA samples from the relatives of the missing normalistas, to compare with data gathered from the bodies being pulled from the graves.
The parents also seem to care little about the arrival of Mexico's recently formed militarized police force, the gendarmerie, on the order of President Enrique Peña Nieto, or for the arrival of Guerrero self-defense militia groups who are aiding in the search for more bodies.
One of the mass graves cordoned off by police and being examined forensics investigators. (Photo by Hans-Maximo Musielik.)
Their hope is fueled by memories.
Cornelio Flores grows corn and bean with his wife in the municipality of Tixtla. His son, also Cornelio, is 20 years old and entered the Ayotzinapa Normal School a year ago. He likes tostadas, enchiladas, and the Chivas soccer team.
Cornelio called his father the night of September 26, that's why the man reaching his 60s said firmly that he is sure his son is alive, even if he might have been kidnapped by the police.
The older Cornelio got the call at 11:30pm that night. At the other end of the line, his son said he was escaping from police that were chasing him and had just killed one of his classmates.
Flores told his son to run and hide. He said he still hopes his son will arrive at Ayotzinapa the way he instructed him to do that night. Running.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Hill climb riding position
With the current stem and bars I have on my bike I have quite an upright position and get a falling back feeling while climbing. When I stand in the pedals to gain an extra bit of power in a climb I often end up spinning my back wheel and losing momentum. I'd like to have a more solid feeling when climbing so that I can exert more effort.
What can I do to improve my position so that my climbing improves?
The set up is standard on my Specialized Hardrock (I believe it is a 75mm stem with a 20 rise and a 680mm bar with 35mm rise and 8 backsweep). I tried some back of a fag packet trigonometry and guessing that my hand position (not taking into account the angle of the headtube) is currently about 23mm in front of the steerer and about 61mm above it.
A:
I assume you have worked out the problem is your center of gravity is too far back, so there is not enough weight on the front wheel. This is a common problem, and I have found my new bike is worse than any other I have ridden- I went for a smallish frame for tight technical single track. I am still playing around to see what I can do.
I assume you have tried leading forward and getting you weight further forward.... On the track, try to slide forward to the front of the seat. Change down to a lower gear and higher cadence, you generate a smoother action and have more control over the torque lifting the front wheel.
Ultimate solution is usually a larger frame - more precisely, a longer wheelbase. Assuming you are not able to change you bike there are a couple of things you can do at no or low cost.
Slide you seat forward on the rails - this moves your weight forward, but shortens the cockpit. Get a longer seat, which gives you options of riding positions. Forward for hill climb, back for a a bigger cockpit and better fit.
Try a longer stem - 75mm is quite short and you should be able to go out to about 120mm. What I suggest is try several sizes and see if you can find a fit that works - talk to your LBS, they may be prepared to let you try on and swap it if it does not work. It's such a trivial job I have seen it done on the trail. Remember to play with seats rails as well.
Handlebar height. If you have packers on the steerer, lower the height of the bars by putting the packers on the top or the stem, and see how that feels.
As said, all these things are aimed at moving weight forward. Some will change the way you sit and ride, and the best position will need to be a compromise between uphill climbs and other riding. Often, by the time it is steep enough to be a problem, you are quicker to get off the bike.
A:
If you aren't riding clipless pedals, invest in them and a pair of shoes. It will be the single biggest improvement you'll ever make in how ride if you're riding XC- not only in terms of climbing but in terms of your whole riding experience.
Now, if you've already got that covered, before you go changing everything on your bike and possibly the bike itself, you need to work on positioning and technique. Here's three key things to work on to improve your climbing:
Stay seated! Move your butt way forward so that you're basically sitting on the nose of the saddle. It's not at all comfortable but it moves your center of gravity forward which does two things- it helps keep your front wheel on the ground and helps your rear wheel keep traction.
Don't slam your saddle forward because you're having trouble climbing. You don't want to compromise your normal riding position so that you're always ready to climb- the rest of your riding will suffer. Of the reasons for adjusting saddle position for XC riding, center of gravity is not one of them.
Shift down a gear or two so that your cadence is higher than normal, but without being awkwardly high. Try to spin relatively smoothly up the hill. Once again, this aids in keeping traction with the rear wheel. Too high a gear and you'll stall, too low a gear and you'll find yourself losing your line.
Drop your forearms to be parallel with the ground and pull back and down through your power stroke. This keeps your center of gravity lower and further forward while helping the rear wheel hold traction at the point when it's most likely to spin out. Don't be too forceful with this motion or else you'll just knock yourself off course on your ascent. This was probably the most useful piece of advice I was ever given to improve my climbing.
Again, practice these techniques before you go and make your bike all squirrely. Technique beats equipment any day. If you're truly concerned about your fit and positioning on the bike, find an LBS with someone trained on bike fit to help you.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.