text
stringlengths 2
1.05M
| repo_name
stringlengths 5
101
| path
stringlengths 4
991
| language
stringclasses 3
values | license
stringclasses 5
values | size
int64 2
1.05M
|
|---|---|---|---|---|---|
In the campaign, you play as Sergeant Daniel Recker of Tombstone Squad, a small unit of Marines assigned to the USS Valkyrie. During a routine intel mission, all hell breaks loose, and a chain of events are set into motion that could start World War III. The action is palpable, almost never slows, and set-piece-driven levels create spectacles that you have never seen before in a shooter. Although the campaign is short and sweet, it is easily the best Battlefield campaign so far, in both scope and quality.
Even on current-generation consoles, this game looks great. The sheer amount of on-screen action is astounding for this aging hardware to be capable of producing. Character models are easily the sharpest that they have ever been; the weapons look accurate and clean, and character animations flow through the environment without looking stiff or forced. DICE’s new Frostbite 3 engine shows its quality and diversity even on current-generation technology. Although, I will say I did encounter an occasional framerate drop and a character glitch from time to time. Once, I even saw an enemy fly through the air, and continue to do so, until he was out of sight, and all I could see was the orange marker I placed over his head. But overall, these issues are so few and far between that they don’t detract from the experience as a whole.
The audio of Battlefield 4 brings as much to the table as the visuals. Soldiers screaming or shouting orders, bullets whizzing by your head and snapping behind you, explosions, crumbling buildings, vehicles rolling or flying by, and other ambient noise put together a soundscape that will simply blow your mind. Score only plays a minor role in the multiplayer, but the single-player campaign uses it to an advantage, and the voice acting is surprisingly well done.
Thankfully, the control scheme hasn’t really changed, something any Battlefield veteran will be able to appreciate. Moving, shooting, driving, and flying all feel tight and well rounded, and fumbling over controls is kept to a minimum. I did have a little bit of trouble figuring out the weapon loadouts, but after a little trial and error, and several trips to the new Test Range (where you can test out new weapons, attachments, and vehicles), I figured it out without too much hassle.
In short, Battlefield 4 is an experience that any shooter fan is going to want to have. The developers at DICE have crafted their own brand of mayhem and destruction out of the series that simply defines their gameplay style. So if you like explosions, intense combat, accurate weapons, and the freedom of choice to play how you want to play, then do yourself a favor and go buy this game. I’ll see you online.
ByJoshua Bruce
Video Director
Date: October 29, 2013
RATING OUT OF 5
RATING DESCRIPTION
4.5
GraphicsThe Frostbite 3 engine shows its worth.
4.3
ControlResponsive and adaptive--hallmarks of the Battlefield series.
4.7
Music / Sound FX / Voice ActingVoice acting is excellent in single-player, but nothing beats the sounds of the battlefield coming to life around you as you play a multiplayer match.
4.8
Play ValueThe single-player campaign is a short but solid experience, but multiplayer is endlessly playable.
4.7
Overall Rating - Must BuyNot an average. See Rating legend below for a final score breakdown.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Conference Documents
Working papers
This paper reviews the theoretical and empirical literature on the role of blockholders (large shareholders) in corporate governance. We start with the underlying property rights of public corporations; we discuss how blockholders are critical in...Read more
Working papers
Outside directors and audit committees are widely considered to be central elements of good corporate governance. We use a 1999 Korean law as an exogenous shock to assess how board structure affects firm market value. The law mandates 50% outside...Read more
We report strong OLS and instrumental variable evidence that an overall corporate governance index is an important and likely causal factor in explaining the market value of Korean public companies. We construct a corporate governance...Read more
We study the resolution of financial distress in shipping, where the ex-territorial nature of assets has distanced the industry from on-shore bankruptcy legislation. We demonstrate how contracts and private institutions have adapted to the...Read more
Corporate governance is concerned with the resolution of collective action problems among dispersed investors and the reconciliation of conflicts of interest between various corporate claimholders. In this survey we review the theoretical and...Read more
Outside directors constitute a key component of most prescriptions for good governance of public companies. Given that outside directors are important corporate governance players, one is led to wonder what will motivate the individuals serving...Read more
The paper analyzes 362 European activist interventions by hedge funds, focus funds and other activist investors from 2000 to 2008. The sample includes both public and private interventions. The private interventions are based upon proprietary...Read more
This Report was prepared, with support by the World Bank, for the Russian Center for Capital Market Development and the Russian Federal Service on the Securities Market (FSFM). We discuss the liability under company law of members of the board of...Read more
Coffee
Session 2
Public Pension Funds and Corporate Political Activism
Speakers:
Discussant:
Public Pension Funds and Corporate Political Activism
Time:
11:45h
- 12:35h
This paper analyzes agency con icts between U.S. public pension funds and other shareholders. It studies the landmark decision by the U.S. Supreme Court on Citizens United v. FEC, which opens new doors for political activism by business. At the ruling, politically connected rms held by public pension funds have lower announcement returns. After the ruling, these rms remain engaged in political connections and experience a relative increase in ownership by public pension funds. Our evidence is consistent with public pension funds having a preference for more traditional forms of political activism, a preference not shared by other investors.
Most listed firms are freestanding in the U.S, while listed firms in other countries often belong to business groups: lasting structures in which listed firms control other listed firms. Hand-collected historical data illuminate how the present...Read more
A central challenge in the regulation of controlled firms is curbing controller tunneling. As independent directors and fiduciary duties are widely seen as not up to the task, a number of jurisdictions have given minority shareholders veto rights...Read more
This paper analyzes the effect that the U.S. Supreme Court’s landmark decision on Citizens United vs. FEC had on corporate political activism. The decision opened the door for corporate treasuries to engage in independent political...Read more
We investigate whether cultural differences between professional decision-makers affect financial contracts in a large dataset of international syndicated bank loans. We find that more culturally distant lead banks offer borrowers smaller loans...Read more
Lunch
Session 3
A Collaborative Model of the Corporation
Speakers:
Discussant:
A Collaborative Model of the Corporation
Time:
13:45h
- 14:35h
Two models of the corporation dominate legal discourse. The first is the management-power model, which is premised on vesting corporate insiders -- officers and directors -- with primary decision-making power. The second is the shareholder-power model which contemplates increased shareholder power to reduce managerial agency costs and self-dealing. Both models assume that insiders and shareholders engage in a competitive struggle for corporate power and address, descriptively and normatively, the appropriate allocation of that power.
Corporate law and practice have moved beyond existing theories of the corporation framed in terms of a competitive power struggle between insiders and shareholders, however. Increasingly, the insider- shareholder dynamic in the modern corporation is collaborative, not competitive. This Article responds to this development, defending a collaborative model of the corporation on both descriptive and normative grounds. In particular, the Article uses game theory to demonstrate how insider-shareholder collaborations are likely to produce complimentary information that increases firm value.
The collaborative model offers several insights for corporate governance. First, it suggests that, to enhance collaboration, core governance provisions should be the product of bilateral action involving both insiders and shareholders. Second, board insulation mechanisms should require shareholder input. Finally, doctrines constraining director use of corporate information should facilitate rather than frustrating information sharing between activist directors and their principals. In turn, implementation of these principles requires rethinking and adapting several existing principles of corporate law.
Working papers
Event studies have become increasingly important in securities fraud litigation after the Supreme Court?s decision in Halliburton II. Litigants have used event study methodology, which empirically analyzes the relationship between the disclosure...Read more
Two models dominate the debate on the theory of the firm. Under the management-power model, decision-making power exclusively belongs to corporate insiders (officers and directors). The competing shareholder-power model contemplates increasing...Read more
Passive investors — ETFs and index funds — are the most important development in modern day capital markets, dictating trillions of dollars in capital flows and increasingly owning much of corporate America. Neither the business model of passive...Read more
In 2015, Delaware made several important changes to its laws concerning merger litigation. These changes, which were made in response to a perception that levels of merger litigation were too high and that a substantial proportion of merger cases...Read more
There is mounting evidence that retail investors make predictable, costly investment mistakes, including underinvestment, naïve diversification, and payment of excessive fund fees. Over the past thirty-five years, however, participant-directed...Read more
Directors have traditionally been elected by a plurality of the votes cast. This means that in uncontested elections, a candidate who receives even a single vote is elected. Proponents of “shareholder democracy” have advocated a shift to a...Read more
Institutional Investors' Impact on the Outcome of Freezeout Tender Offers
Speakers:
Discussant:
Miriam Schwartz Ziv
Back to full programme
Institutional Investors' Impact on the Outcome of Freezeout Tender Offers
Time:
14:35h
- 15:25h
We study institutional investors' impact on going private tender offers by controlling shareholders ("freezeout" offers) because these are occasions where engagement-restraining considerations such as keeping the long term relations with the firm are less relevant. Further, we examine data from Israel, where regulation over freezeout offers is loose and where (consequently?) about half of the offers are rejected. We find that in accepted offers, the offer premium increases with institutional investor holdings. Institutional ownership also increases the likelihood that the offer is rejected. However, in rejected offers, institutional investors do not appear to add to public value. This complex evidence is consistent with institutional investors acting as strategic bargaining agents.
We examine the effects of a law amendment in Israel in 2011 that imposes a set of minimum corporate governance standards on privately held firms that issue publicly traded bonds. Two main results emerge. First, consistent with US evidence, the...Read more
We examine an extensive matched sample of U.S. dual and single class firms in 1980-2015 from the time of their IPO, and document that the valuation difference between dual and single class firms varies over their life cycle. On average, around...Read more
We study institutional investors' impact on going private tender offers by controlling shareholders ("freeze-out" offers) in Israel, where regulation over such offers is loose and where (consequently?) about half of the offers are rejected. In 35...Read more
Coffee
Session 4
Soft Shareholder Activism
Speakers:
Discussant:
Sivan Frenkel
Back to full programme
Soft Shareholder Activism
Time:
15:45h
- 16:35h
This paper studies communications between investors and firms as a form of corporate governance. The main premise is that activist investors cannot force their ideas on companies; they must persuade the board or other shareholders that implementing these ideas is in the best interest of the firm. In this framework, I show that voice (launching a public campaign) and exit (selling shares) enhance the ability of activists to govern through communication. The analysis identifies the factors that contribute to successful dialogues between investors and firms. It also shows that public communications are likely to be ine§ective, justifying the prevalence of behind-the-scenes communications.
Discussants
Conference Documents
Working papers
Conventional wisdom is that diversification weakens governance by spreading an investor too thinly. We show that, when an investor owns multiple firms ("common ownership"), governance through both voice and exit can strengthen -- even if the...Read more
We developed a model under which the allocation of control rights between shareholders and managers (“governance structure”) is irrelevant to firm value. In our model, governance structures affect managers’ incentive to invest, as strong...Read more
We derive a measure that captures the extent to which common ownership shifts managers’ incentives to internalize externalities. A key feature of the measure is that it allows for the possibility that not all investors are attentive to whether a...Read more
Working papers
This article tells how a shareholder class action against Teva Pharmaceutical Industries, the largest generic drug maker in the world, ended the practice of hiding individual executive pay figures by companies crosslisted in Israel and the United...Read more
We empirically examine whether and how the doctrine of enhanced judicial scrutiny that emerged from Revlon and its progeny actually affects M&A transactions. Combining hand-coding and machine-learning techniques, we assemble data...Read more
A central challenge in the regulation of controlled firms is curbing controller tunneling. As independent directors and fiduciary duties are widely seen as not up to the task, a number of jurisdictions have given minority shareholders veto rights...Read more
Activism, Strategic Trading, and Liquidity
Speakers:
Discussant:
Zvi Wiener
Back to full programme
Activism, Strategic Trading, and Liquidity
Time:
09:50h
- 10:40h
We analyze dynamic trading by an activist investor who can expend costly e↵ort to a↵ect firm value. We obtain the equilibrium in closed form for a general activism technology, including both binary and continuous outcomes. Variation in parameters can produce either positive or negative relations between market liquidity and economic e ciency, depending on the activism technology and model parameters. Two results that contrast with the previous literature are that (a) the relation between market liquidity and economic e ciency is independent of the activist’s initial stake for a broad set of activism technologies and (b) an increase in noise trading can reduce market liquidity, because it increases uncertainty about the activist’s trades (the activist trades in the opposite direction of noise traders) and thereby increases information asymmetry about the activist’s intentions.
Working papers
Short selling campaigns by hedge funds have become increasingly common in the last decade. Using a hand-collected sample of 252 campaigns, we document abnormal returns for targets of approximately -7% around the announcement date. Firm...Read more
We develop a model in which an activist shareholder can discipline management through intervention and through the threat of intervention. A weaker disciplinary role played by the intervention mechanism leads to lower firm value and more frequent...Read more
We analyze dynamic trading by an activist investor who can expend costly effort to affect firm value. We obtain the equilibrium in closed form for a general activism technology, including both binary and continuous outcomes. Variation in...Read more
Working papers
An important milestone often reached in the life of an activist engagement is entering into a “settlement” agreement between the activist and the target’s board. Using a comprehensive hand-collected data set, we analyze the drivers, nature, and...Read more
In choosing transparency, firms must trade off the benefits from better access to finance against the cost of a greater tax burden. We study this trade-off in a model with distortionary taxes and endogenous rationing of external finance. The...Read more
Blockholder monitoring is central to corporate governance, but blockholders large enough to exercise significant unilateral influence are rare. Mechanisms that enable small block-holders to exert collective influence are therefore important. We...Read more
This paper studies mutual fund voting in proxy contests using a comprehensive sample of voting records over the period 2008 - 2015, taking into account selective targeting by activists. We find that firm, fund, and event characteristics generate...Read more
During episodes of market turmoil, institutional investors with short trading horizons are inclined or forced to sell their holdings to a larger extent than investors with longer trading horizons. This may amplify the effects of market-wide...Read more
If unemployment insurance is more generous, workers should demand less implicit insurance from their employers: firm- and government-provided insurance should be substitutes. Using a firm-level international panel dataset, we investigate this...Read more
Hedge fund activism is a new form of arbitrage. Using a large hand-collected data set from 2001 to 2006 we find that activist hedge funds in the U.S. propose strategic, operational, and financial remedies and attain success or partial success in...Read more
We establish that the labor market helps discipline asset managers via the impact of fund liquidations on their careers. Using hand-collected data on 1,948 professionals, we find that top managers working for funds liquidated after persistently...Read more
Working papers
Using a comprehensive survey, we show that investors with a larger capital allocation to private equity are more specialized − measured by the degree to which the investor focuses on private equity rather than other classes of investments − and...Read more
Cross-border venture capital (VC) investments play an important role in the scaling up of high-growth companies. However, policymakers worry that foreign VC investments transfer the majority of economic activity to the investor country. On the...Read more
Most listed firms are freestanding in the U.S, while listed firms in other countries often belong to business groups: lasting structures in which listed firms control other listed firms. Hand-collected historical data illuminate how the present...Read more
Financial intermediaries can choose the extent to which they want to be active investors, providing valuable services like advice, support and corporate governance. We examine the determinants of the decision to become an active financial...Read more
We develop a theory and empirical test of how the legal system affects the relationship between venture capitalists and entrepreneurs. The theory uses a double moral hazard framework to show how optimal contracts and investor actions depend on...Read more
This paper examines the effect of investor power in a model of staged equity financing. It shows how the usual effect where market power reduces valuations can be reversed in later rounds. Once they become insiders, powerful investors may use...Read more
Lunch
Session 3
Standing on the Shoulders of Giants: The Effects of Passive Investors on Activism
Speakers:
Discussant:
Standing on the Shoulders of Giants: The Effects of Passive Investors on Activism
Time:
14:00h
- 14:50h
We analyze whether the growing importance of passive investors has influenced the campaigns, tactics, and successes of activists. We find activists are more likely to pursue changes to corporate control or influence when a larger share of the target company’s stock is held by passively managed mutual funds. Furthermore, higher passive ownership is associated with increased use of proxy fights and a higher likelihood the activist obtains board representation or the sale of the targeted company. Our findings suggest that the large ownership stakes of passive institutional investors mitigate free-rider problems and ultimately increase the likelihood of success by activists.
Working papers
This paper provides evidence on the incidence, characteristics, and performance of activist engagements across countries. We find that the incidence of activism is greatest with high institutional ownership, particularly for U.S. institutions. We...Read more
We study how deregulation of corporate law affects the decision of entrepreneurs of where to incorporate. Recent rulings by the European Court of Justice (ECJ) have enabled entrepreneurs to select their country of incorporation independently of...Read more
Adapting to Radical Change: The Benefits of Short-Horizon Investors
Speakers:
Discussant:
Adapting to Radical Change: The Benefits of Short-Horizon Investors
Time:
14:50h
- 15:40h
We show that following large permanent negative shocks, firms with more short-term institutional investors suffer smaller drops in sales, investment and employment and have better long-term performance than similar firms affected by the shocks. To do so, these firms increase advertising, differentiate their products from those of the competitors, conduct more diversifying acquisitions, and have higher executive turnover in the aftermath of the shocks. Our findings suggest that firms with more short-term investors put stronger effort in adapting their business to the new competitive environment. Endogeneity of institutional ownership and other selection problems do not appear to drive our findings.
Working papers
We study the impact of directors with foreign experience on firm performance in emerging markets. We use a unique dataset from China and exploit that at different times, Chinese provinces introduced policies to attract highly talented emigrants....Read more
Using a sample that provides unprecedented detail on foreign listings for 29 exchanges in 24 countries starting from the early 1980s, we show that although firms list in countries with better investor protection, they are less likely to list in...Read more
We study whether the individual decision to become an entrepreneur, entrepreneurial profits and investment are affected by the decisions of other individuals belonging to the same social group. To overcome identification problems, we include...Read more
We exploit the domestic portfolios of US mutual funds to provide microeconomic evidence that investors are more likely to liquidate geographically remote investments at times of high aggregate market volatility. This has important implications...Read more
We proxy for board members’ differences in opinions and values using directors’ ancestral origins and show that diversity has costs and benefits, which lead to high performance volatility. Consistent with the idea that diverse groups experiment...Read more
While the positive growth effects of financial integration are extensively documented, little is known of its impact on small and young firms. This paper aims to fill this void relying on a panel of 60,000 firm-year observations on listed and...Read more
Using a data set that provides unprecedented detail on investors' stockholdings, we analyze whether investors take the quality of corporate governance into account when selecting stocks. We find that all categories of investors who generally...Read more
Session 4
Do Institutional Investors Monitor their Large vs. Small Investments Differently? Evidence from the Say-On-Pay Vote
Speakers:
Discussant:
Do Institutional Investors Monitor their Large vs. Small Investments Differently? Evidence from the Say-On-Pay Vote
Time:
16:00h
- 16:50h
We consider institutional voting on Say-On-Pay as a function of the size of an institution's position. Smaller positions, measured either as percent of a firm held or portfolio weight invested in a firm, lead to lower support of management in SOP voting, consistent with small-scale investors having limited incentives and opportunity to participate in governance through alternative venues. This result is largest when the firm has significant blockholder presence, and holds independent of ISS recommendations. We also find that the size of investment at the institutional advisor level, rather than the fund level, better predicts voting. Hence, in companies with a dispersed shareholder structure, the SOP vote is particularly likely to be used to oppose management. To summarize, we find that, when a low-cost monitoring opportunity is made available, small institutional positions, which aggregate to a large level of ownership across institutions, can play a meaningful role in corporate governance.
Working papers
The relationship between changes in GDP and unemployment during the 2008 financial crisis differed significantly from previous experiences and across countries. We study firm-level decisions in France, Germany, Japan, the UK, and the US. We find...Read more
Are courts effective monitors of corporate decisions? In a controversial landmark case,
the Delaware Supreme Court held directors personally liable for breaching their fiduciary
duties, signalling a sharp increase in Delaware?s...Read more
Relative performance evaluation (RPE) in CEO compensation can be used as a commitment device to pay CEOs for their revealed relative talent. We find evidence consistent with the talent-retention hypothesis, using two different approaches. First,...Read more
Conference Documents
Working papers
This paper reviews the theoretical and empirical literature on the role of blockholders (large shareholders) in corporate governance. We start with the underlying property rights of public corporations; we discuss how blockholders are critical in...Read more
Corporate governance is concerned with the resolution of collective action problems among dispersed investors and the reconciliation of conflicts of interest between various corporate claimholders. In this survey we review the theoretical and...Read more
A central problem in conducting an event study of the valuation effects of corporate governance reforms is that most reforms affect all firms in a country. Share price changes may reflect the reforms, but could also reflect other information. We...Read more
We discuss empirical challenges in multicountry studies of the effects of firm-level corporate governance on firm value, focusing on emerging markets. We assess the severe data, “construct validity,” and endogeneity issues in these studies,...Read more
This article reports a unique analysis of private engagements by an activist fund. It is based on data made available to us by Hermes, the fund manager owned by the British Telecom Pension Scheme, on engagements with management in companies...Read more
We report strong OLS and instrumental variable evidence that an overall corporate governance index is an important and likely causal factor in explaining the market value of Korean public companies. We construct a corporate governance...Read more
Outside directors and audit committees are widely considered to be central elements of good corporate governance. We use a 1999 Korean law as an exogenous shock to assess how board structure affects firm market value. The law mandates 50% outside...Read more
Public Pension Funds and Corporate Political Activism
Public Pension Funds and Corporate Political Activism
Time:
11:45h
- 12:35h
This paper analyzes agency con icts between U.S. public pension funds and other shareholders. It studies the landmark decision by the U.S. Supreme Court on Citizens United v. FEC, which opens new doors for political activism by business. At the ruling, politically connected rms held by public pension funds have lower announcement returns. After the ruling, these rms remain engaged in political connections and experience a relative increase in ownership by public pension funds. Our evidence is consistent with public pension funds having a preference for more traditional forms of political activism, a preference not shared by other investors.
Conference Documents
Working papers
We investigate whether cultural differences between professional decision-makers affect financial contracts in a large dataset of international syndicated bank loans. We find that more culturally distant lead banks offer borrowers smaller loans...Read more
This paper analyzes the effect that the U.S. Supreme Court’s landmark decision on Citizens United vs. FEC had on corporate political activism. The decision opened the door for corporate treasuries to engage in independent political...Read more
Most listed firms are freestanding in the U.S, while listed firms in other countries often belong to business groups: lasting structures in which listed firms control other listed firms. Hand-collected historical data illuminate how the present...Read more
A central challenge in the regulation of controlled firms is curbing controller tunneling. As independent directors and fiduciary duties are widely seen as not up to the task, a number of jurisdictions have given minority shareholders veto rights...Read more
A Collaborative Model of the Corporation
A Collaborative Model of the Corporation
Time:
13:45h
- 14:35h
Two models of the corporation dominate legal discourse. The first is the management-power model, which is premised on vesting corporate insiders -- officers and directors -- with primary decision-making power. The second is the shareholder-power model which contemplates increased shareholder power to reduce managerial agency costs and self-dealing. Both models assume that insiders and shareholders engage in a competitive struggle for corporate power and address, descriptively and normatively, the appropriate allocation of that power.
Corporate law and practice have moved beyond existing theories of the corporation framed in terms of a competitive power struggle between insiders and shareholders, however. Increasingly, the insider- shareholder dynamic in the modern corporation is collaborative, not competitive. This Article responds to this development, defending a collaborative model of the corporation on both descriptive and normative grounds. In particular, the Article uses game theory to demonstrate how insider-shareholder collaborations are likely to produce complimentary information that increases firm value.
The collaborative model offers several insights for corporate governance. First, it suggests that, to enhance collaboration, core governance provisions should be the product of bilateral action involving both insiders and shareholders. Second, board insulation mechanisms should require shareholder input. Finally, doctrines constraining director use of corporate information should facilitate rather than frustrating information sharing between activist directors and their principals. In turn, implementation of these principles requires rethinking and adapting several existing principles of corporate law.
Working papers
We examine the Centros decision through the lens of SB 826 – the California statute mandating a minimum number of women on boards. SB 826, like the Centros decision, raises questions about the scope of the internal affairs doctrine...Read more
Despite the increasing importance of shareholder voting, regulators have paid little attention to the rights of retail investors who own approximately 30% of publicly traded companies but who vote less than 30% of their shares. A substantial...Read more
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How to integrate akka streams kafka (reactive-kafka) into akka http application?
I have a basic scala akka http CRUD application. See below for the relevant classes.
I'd simply like to write an entity id and some data (as json) to a Kafka topic whenever, for example, an entity is created/updated.
I'm looking at http://doc.akka.io/docs/akka-stream-kafka/current/producer.html, but am new to scala and akka, and unsure of how to integrate it into my application?
For example, from the docs above, this is the example of a producer writing to kafka, so I think I need to something similar, but whereabouts in my application should this go? Can I just add another map call in the create method in my service after I have created the user?
Many thanks!
val done = Source(1 to 100)
.map(_.toString)
.map { elem =>
new ProducerRecord[Array[Byte], String]("topic1", elem)
}
.runWith(Producer.plainSink(producerSettings))
Or do I need to do something like the example here https://github.com/hseeberger/accessus in the bindAndHandle() method in my Server.scala?
WebServer.scala
object System {
implicit val system = ActorSystem()
implicit val dispatcher = system.dispatcher
implicit val actorMaterializer = ActorMaterializer()
}
object WebServer extends App {
import System._
val config = new ApplicationConfig() with ConfigLoader
ConfigurationFactory.setConfigurationFactory(new LoggingConfFileConfigurationFactory(config.loggingConfig))
val injector = Guice.createInjector(new MyAppModule(config))
val routes = injector.getInstance(classOf[Router]).routes
Http().bindAndHandle(routes, config.httpConfig.interface, config.httpConfig.port)
}
Router.scala
def routes(): Route = {
post {
entity(as[User]) { user =>
val createUser = userService.create(user)
onSuccess(createUser) {
case Invalid(y: NonEmptyList[Err]) => {
throw new ValidationException(y)
}
case Valid(u: User) => {
complete(ToResponseMarshallable((StatusCodes.Created, u)))
}
}
}
} ~
// More routes here, left out for example
}
Service.scala
def create(user: User): Future[MaybeValid[User]] = {
for {
validating <- userValidation.validateCreate(user)
result <- validating match {
case Valid(x: User) =>
userRepo.create(x)
.map(dbUser => Valid(UserConverters.fromUserRow(x)))
case y: DefInvalid =>
Future{y}
}
} yield result
}
Repo.scala
def create(user: User): Future[User] = {
mutateDbProvider.db.run(
userTable returning userTable.map(_.userId)
into ((user, id) => user.copy(userId = id)) +=
user.copy(createdDate = Some(Timestamp.valueOf(LocalDateTime.now())))
)
}
A:
Since you have written your Route to unmarshall just 1 User from the Entity I don't think you need Producer.plainSink. Rather, I think Producer.send will work just as well. Also, as a side note, throwing exceptions is not "idiomatic" scala. So I changed the logic for invalid user:
val producer : KafkaProducer = new KafkaProducer(producerSettings)
val routes : Route =
post {
entity(as[User]) { user =>
val createUser = userService.create(user)
onSuccess(createUser) {
case Invalid(y: NonEmptyList[Err]) =>
complete(BadRequest -> "invalid user")
case Valid(u: User) => {
val producerRecord =
new ProducerRecord[Array[Byte], String]("topic1",s"""{"userId" : ${u.userId}, "entity" : "User"}""")
onComplete(producer send producerRecord) { _ =>
complete(ToResponseMarshallable((StatusCodes.Created, u)))
}
}
}
}
}
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Hot Alphas (Wounded Warriors #3) - Lora Leigh
The night had finally wound down, the last customer urged out the door and the Broken Bar was closed up for the night.
Standing next to the counter, Erin Masters surveyed the pristine area critically, ensuring everything was ready for the next night.
The head bartender and club manager, Jake Manning, had left her in charge of cleaning and restocking the various bottles of drinks kept on hand. The large crowds known to descend on the nightclub on any given night left no time to replace bottles. And he was damned picky about making certain everything, down to the last speck of dust, was cleaned away and the serving area ready to go the next evening.
Glancing to the mirrored wall behind the wide counter she found the neon BROKEN BAR sign. Her gaze moved to the camera eye in the center of it, then gave it her customary wink. She knew the girl that worked the security recordings. The wink was a nightly salute. Gabby would roll her eyes, Erin knew, and remember the night they’d had one drink too many, and revealed how each of them had become fixated on one of the Broken Bar’s security agents.
For Gabby, it was Iron.
For Erin, it was the hard, tough Turk Rogan.
Folding the damp bar towel she’d used to clean the wood bar, Erin pushed it into the small plastic bag of towels used that night and tied the bag closed. Picking it up she pushed through the swinging doors to the kitchen, finally relaxing at the thought of going home for the night.
Leaving the bag at the back door for morning pickup she made her way back to the front to check everything one last time. Jake could become highly critical if anything in the bartending section wasn’t just right. She sure as hell didn’t want him tearing her ass as he’d torn the last assistant’s. That one he’d sent running from the club in tears as she quit on the spot.
Flipping the kitchen light out, she stepped through the swinging doors once again and almost ran face-first into one of the nicest stretches of chests she’d ever beheld.
Powerful, not too wide, but rippling beneath the black T-shirt he wore. Her fingers itched to smooth across the expanse of powerful muscles.
He made other parts just ache.
“Turk.” She stepped back, looking up into the rough-hewn, hardened features of the security agent working cleanup with her.
Dark, chocolate-brown eyes were set into a brooding expression that gave him a hard, savage look. A sexy rough-hewn toughness that just took a girl’s breath away.
His gaze lowered to her lips. That look made her mouth go dry. It made her sex wet.
“Erin.” Deep, whispering of sensual delights and wicked knowledge, that voice sent shivers working down her spine as his gaze lifted to hers once again. “Have you finished up here?”
He stepped back, slowly, allowing her to ease from the doorway to the dimly lit bar area as she looked around one last time.
“Let’s hope I am.” She grinned back, smoothing her hands down the side of the short, black skirt she wore.
Turk’s gaze flickered down her body before coming back to hers, the shadow of something hungry in his eyes caused her heartbeat to pick up, racing in excitement as she swallowed nervously.
“Everything looks great.” He nodded, finally glancing around himself, his eyes narrowing. “Jake shouldn’t be able to bitch—no matter how much he loves doing it.”
Amusement gleamed in his eyes as they met hers once again.
“Good.” She glanced over the area again though. “Perhaps I’ll survive my first night closing.”
“You’ll survive,” he promised as though he’d already decided that on his own. “If you’re ready I’ll walk you out to your car. The rest of the waitresses have left and I’m ready to head out myself.”
“I just need to stop in the lounge and collect my purse.” She was already turning for the exit from the tending area, all too aware of the fact that he was walking behind her.
And he walked silently, too. There wasn’t so much as a whisper of his footsteps. Quiet, intense, his scarred face was normally implacable, his voice deep. He was the epitome of the type of agent her stepfather preferred as security personnel for the nightclubs that worked beneath the Covert Information Network.
The Broken Bar was one of those establishments, while five of the ten security personnel were longtime agents of the network. Ex-military, Rangers in this case, most of them wounded in some way that had ended their
| null |
minipile
|
NaturalLanguage
|
mit
| null |
MPP, chief hail riding amendment
The wheels of change in government rarely turn quickly, so it’s not surprising Nickel Belt at MPP France Gelinas was walking on air Monday night.
The New Democrat was celebrating a vote by members of Ontario’s general government committee to pass an amendment she introduced.
She wanted Bill 45, the Election Statute Law Amendment Act, changed to include members of Wahnapitae First Nation in her riding. She took the opportunity to have it included in the bill when it was being discussed at committee.
Gelinas had introduced at least two private member’s bills seeking the addition of the First Nation to her riding, the most recent Nov. 23.
“This is fabulous news for the members of Wahnapitae First Nation,” said Gelinas. “I am thrilled the committee agreed with my amendment to make this important change happen.”
A similar attempt by Gelinas was voted down by the Liberal government last year, she said. In fact, Gelinas and members of the First Nation “have been waiting 10 years for the proivincial government to correct a past mistake in riding boundaries,” she said in a telephone interview from Toronto on Monday night.
Gelinas said she “did the rounds” at Queen’s Park, canvassing the Liberals and Progressive Conservatives to support the amendment because it could only be passed with unanimous consent of all parties.
“And it passed, yeah,” said a jubilant Gelinas.
Wahnapitae First Nation Chief Ted Roque said he was very happy the committee passed Gelinas’ amendment.
He commended Gelinas for the work she has done to bring his community into her riding.
Roque and Gelinas held a news conference at Queen’s Park last month to pressure the Liberal government of Premier Kathleen Wynne to “do the right thing” and include the first nation in Nickel Belt riding.
Under the current riding boundaries, members of Wahnapitae First Nation, about 50 kilometres north of Sudbury, have to travel three hours to see Timiskaming-Cochrane NDP MPP John Vanthof for help with provincial issues.
Like any Ontarian, First Nations members often seek the assistance of their MPP to get a birth certificate, obtain information about the electricity rebate and for help with education and health care matters.
The provision to include Wahnapitae First Nation in the riding of Nickel Belt will go into effect for the 2018 provincial election.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Fossil skulls are among the best evidence that living things have never changed over the course of history, have never developed into other life forms, and that every living species has been created together with its own unique attributes. These proofs emphasize the dilemmas facing and illogicality of Darwinian thinking. The theory of evolution, which maintains that human beings are descended from apes, needs to explain why it is that no process similar to the imaginary transition from ape to human was ever undergone by any other form of life. Evolutionists have no answer to the question of why, for example, a jungle cat did not one day decide to walk upright on two legs, or why a fox did not improve its intelligence level and turn into a professor, or why a panda is unable to produce admirable works of art. Darwinism, depicted as a scientific theory, is in fact an unbelievable ideology.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Samuel Kissinger is a character in the Gay Julian Franchise, also a member of the Gay Gang. He is best friends with Sebastian Gatewell because of their similarity and having interest in many of the same things. Samuel also has a passion for all things cool, such as participating in Skateboard Sunday, where him and thirty others go on skateboards around the city.
He was executed from the Gay Gang for breaking the Gay Rules.
Gallery
Samuel Kissinger and Michael Clifford hung out which obviously means that they shagged. This is the picture they took shortly after they shagged, signifying that they wanted more shags.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Growers must know herbicides: Resistance now a concern in peanuts
Glyphosate and ALS herbicide resistance continues to be a major concern for Georgia growers, making it more important now than ever that they know the mode of action of the products they use, says Eric Protsko, University of Georgia Extension weed scientist.
“If you farm in Georgia, you know we're dealing with glyphosate and ALS resistance. When we talk about resistance, you need to know how your herbicides kill weeds — that will help you to manage your resistance problems,” said Protsko, speaking at the recent Georgia Peanut Farm Show in Albany.
Several counties in Georgia already have been or are being tested for pigweed resistance to glyphosate, he says. “It started in 2005 in three counties in middle Georgia. Over the years, we have found it more and more. Glyphostate resistance is real, it is a concern, and we have to do a better job of handling our glyphosate applications. Somewhere down the line, it'll be hard for us to get that product to work on some of these weeds that are resistant,” says Protsko.
This doesn't mean, he adds, that if a county has reported resistance, every field in that county has glyphosate-resistant pigweed.
Chances are good
“But if you've been using glyphosate in multiple crops and in multiple applications every year, that's when you're mostly likely to have it,” he says.
The other resistance concern is with the ALS herbicides, notes Protsko. “When I say ALS herbicides in peanuts, I'm talking about Cadre, Pursuit, Strongarm and Classic. They all have the same mode of action, and we do have resistance to those as well. If you're a cotton grower, and you're using Staple and Envoke, those are also ALS herbicides. And if you're a corn grower, Accent is an ALS herbicide.
“It's not only what you do with peanuts, but it's what you do in your other crops that affects how much resistance develops. As we go into the future, it's important for you to know your modes of action,” he says.
There are a lot of scientific names describing how herbicides kill plants, but it's not necessary for growers to know those, says Protsko. The updated version of the University of Georgia Pest Control Handbook will list “MOA” with a number next to it, he says. If the MOA numbers on two products match, then they have the same mode of action.
Turning to new products for peanut weed control, Protsko says there aren't many developments at the current time. “Late last year, we did get a new label for Aim in peanuts. This probably won't be used on a wide scale, but it'll help us in certain situations. The label is for using it as a harvest aide just before digging.
“I see this as useful in those occasional situations where you may have a bad morningglory problem. You know it can be a nightmare if you have ever tried to dig peanuts with morningglories. Aim will not remove the morningglories, but it will make them brittle, and it'll be easier to get that digger through the field so you don't have to get off every two minutes. It also might give you some activity on pigweed and tropical spiderwort,” he says.
Major concern
Palmer amaranth pigweed also is a major concern for Georgia peanut producers, says Protsko. A prolific seed producer, it can produce up to one million seeds under the right conditions.
“If you see one in the field, but you ignore it, a female plant can easily produce 500,000 seed. With such a buildup of seed, you can be back to ground zero very quickly. It also grows very rapidly, from 2 to 3 inches per day. If you go for a week without implementing a control strategy, that control strategy probably won't do you any good.”
Palmer amaranth is a very competitive plant, and only a few of the weeds can cause a lot of yield loss, says Protsko.
“The only way to control Palmer amaranth is to use a residual herbicide,” he says. “For peanuts, we have Valor, Dual Magnum, Outlook and the generic products. Strongarm will work on pigweed as well, but if they're ALS resistant, Strongarm won't work.”
Growers need to be more timely with their postemergence applications, says Protsko. “We can't allow those weeds to get 5 to 20 inches tall because we won't be able to control them effectively. If you're a cotton grower, you're being forced down a path where you'll have to use certain herbicides to manage pigweed. In cotton, you'll probably use Reflex in a lot of cases, and you'll use Valor in peanuts. Reflex and Valor are different herbicides, but they have the same modes of action. If we start over-using one of those two products, it's not inconceivable that we'll develop a resistance problem with them, and then we'll be in trouble because we'll lose some good tools.”
In comparing the residual products for controlling Palmer amaranth, Protsko says there isn't much difference in control for the first 20 to 30 days. “It's later when we see differences. In growers' fields with glyphosate-resistant pigweed, Valor still looked pretty good after 38 days. Dual Magnum gave good control for 30 days, but after that, it began to run out.”
If a grower is using a residual herbicide, there's not a guarantee it'll work unless it's activated by either rain or irrigation, he says. “If you have irrigation, you'll likely have more success. Dryland growers will have to rely on rainfall. We can incorporate products like Dual Magnum, Outlook and the generics, but we do not want to incorporate Valor mechanically.”
This past year was the first year that Provost fungicide was introduced into the market, says Protsko, and it is used in much the same manner as Folicur in a four-block program. “It's a good fungicide, but we had problems last year when we mixed it with something else — typically 2, 4-DB or 2, 4-D and some kind of fertilizer or surfactant. We were seeing leafspot and leaf shed, and a lot of this occurred when there were multiple tank-mixes in that situation Provost by itself didn't really cause a lot of problems. As a result of the experiences this past year, there will probably be some specific recommendations this year on what you can't mix with Provost.”
Tank-mix options
Many growers want to know, he says, what they can tank-mix with Provost. “It's a bad thing to mix three things in a tank, because we just don't know what'll happen. There are so many combinations out there, we could never test them under all environments to guarantee that you'll have crop safety, especially when it's 100 degrees F. and 99-percent humidity.”
Growers still have questions, says Protsko, about the relationship between Classic herbicide and tomato spotted wilt virus. Ten to 20 percent of Georgia peanuts are still treated with Classic for controlling Florida beggarweed, he says.
“There was some thought you might see an increase in tomato spotted wilt virus when we used Classic, so we did trials to see how much it affected the virus and how much it influenced yields. Over the past seven years, we've looked at six peanut varieties in 15 locations. One variety didn't respond any differently than another from the use of Classic. On the average, tomato spotted wilt increased by about 8 percent when we sprayed Classic. But we've never proven that Classic is causing yield loss. So if you think you have a bad enough problem with Florida beggarweed, spray Classic and don't worry about losing yield to tomato spotted wilt virus.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
GWEN STEFANI'S LEATHER PANTS
"I want leather pants, but I don't want to have a Ross from Friends moment with a tight pair. I'm thinking Gwen has the answer?" – Callie Leather joggers (like her Paige Denim "Jadyn" pair) will definitely help you avoid that "It made a paste!" moment with tight pants. We can't do anything about the $799 price tag making you sweat, though.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Emergency shock wave lithotripsy for ureteric stones.
Extracorporeal shock wave lithotripsy has been used for over 2 decades, but its application in the acute setting remains under review. With continuing refinements to the technology, it is timely to review its efficacy in the emergency setting. The procedure has an overall low morbidity and is generally well tolerated. Success rates of 70-80% are reported in a number of studies, with relatively low complication rates. Although much attention has been given to the improvements in the outcome of ureteroscopic stone clearance, the benefits of a noninvasive procedure which does not require general anaesthesia may be appealing and indeed preferable for many patients. This should remain a valid alternative treatment option offered to patients, and its provision may be restricted by resource availability rather than clinical evidence. Centres should be identified that can offer an emergency extracorporeal shock wave lithotripsy service and patients informed of outcome data from such centres.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Acoustical analysis of maternal sounds during the second stage of labor.
Experienced obstetric nurse and midwives indicate they can differentiate among sounds indicating that a woman is (a) beginning to manifest the effort to bear down, (b) experiencing pain, or (c) frightened. This study examined the acoustical properties of work/effort, childlike, and out-of-control utterances to determine whether their acoustical properties differed. Out-of-control utterances are more tense but contain similar levels of shimmer and pitch as childlike utterances. Work/effort utterances are higher pitched and more tense than childlike utterances. Work/effort utterances contain more shimmer but have similar levels of pitch and tenseness as out-of-control utterances.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The metabolic anatomy of paraneoplastic cerebellar degeneration.
Eleven patients with acquired cerebellar degeneration (10 of whom had paraneoplastic cerebellar degeneration [PCD]) were evaluated using neuropsychological tests and 18F-fluorodeoxyglucose/positron emission tomography to (1) quantify motor, cognitive, and metabolic abnormalities; (2) determine if characteristic alterations in the regional cerebral metabolic rate for glucose (rCMRGlc) are associated with PCD; and (3) correlate behavioral and metabolic measures of disease severity. Eighteen volunteer subjects served as normal controls. Although some PCD neuropsychological test scores were abnormal, these results could not, in general, be dissociated from the effects of dysarthria and ataxia. rCMRGlc was reduced in patients with PCD (versus normal control subjects) in all regions except the brainstem. Analysis of patient and control rCMRGlc data using a mathematical model of regional metabolic interactions revealed two metabolic pattern descriptors, SSF1 and SSF2, which distinguished patients with PCD from normal control subjects; SSF2, which described a metabolic coupling between cerebellum, cuneus, and posterior temporal, lateral frontal, and paracentral cortex, correlated with quantitative indices of cerebellar dysfunction. Our inability to document substantial intellectual impairment in 7 of 10 patients with PCD contrasts with the 50% incidence of dementia in PCD reported by previous investigators. Widespread reductions in PCD rCMRGlc may result from the loss of cerebellar efferents to thalamus and forebrain structures, a "reverse cerebellar diaschisis."
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Doctor insights on:
Why Do People Most Commonly Have Rectal Bleeding
1
Anatomy & physiology:
Lower part of rectum had communication between portal systems of GI tract that drains though liver & systemic system by normal venous return goes directly to heart , any increase of pressure in portal sys backs up , as in cirrhosis hemorriods etc and bleeds other reason to bleed, with each defecation due to streaching any ulcer like fissure, haemorroids , tumors, polyps infections all bleed.
...Read more
Rectal bleeding is a symptom in which a person has blood coming out of his anus, either during bowel movements (when he poops) and/or at other times. The bleeding can be from hemorrhoids, cancer, ulcers, etc.
...Read more
2
Rectal bleeding:
Rectal bleeding is often due to hemorrhoids. However, there are other causes that are very serious including cancer. In general, rectal bleeding should be discussed with your doctor and perhaps be consulted for a colonoscopy, especially if you are near the age of 50. http://www.laendo.net/english/gastrointestinal-bleeding.
...Read more
3
Depends:
If you are having persistent bleeding from your rectum, you need to get it checked. While hemorrhoids are a common cause of rectal bleeding, your physician may decide to pursue other diagnoses. Getting a full history and physical exam will guide the decision. Are you having symptoms like dizziness or passing out? Is the blood bright red or dark? These are questions that need to be answered.
...Read more
8
See your doctor.:
The most common cause of rectal bleeding in an 18 yo would be hemorrhoids but there can be other causes such as anal fissures or anal fistula. There are even rarer causes and sometimes the bleeding may be coming from other areas such as the colon or stomach. You should be evaluated by a surgeon.
...Read more
9
Not likely:
A particular food does not cause rectal bleeding. Hemorrhoids are the most common cause. Other causes are infections, inflammatory bowel diseases, ulcer or cancers. Rectal bleeding should not be ignored. It is important to see a physician and have it evaluated.
...Read more
Bleeding is a term describing the loss of blood. It can occur inside the body due to damage to blood vessels or organs or outside the body during menstruation or when there is a break in the skin.
...Read more
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Rick and Morty co-creator Justin Roiland and ex-Epic Games executive producer Tanya Watson have launched Squanchtendo Games, a new development studio dedicated to virtual reality.
<em>Image via <a href="http://squanchtendo.com/" target="_blank">Squanchtendo</a></em>
Loading
Announced via a comic strip press release starring the studio's mascot, Little Splzooshly, Squanchtendo plans on creating "funny, imaginative, story driven VR game experiences of all sizes across all VR platforms."While the studio has yet to formally reveal any projects, it teased there will be "a ton of announcements" in the near future.In addition to co-creating the Adult Swim series, Roiland also voices the titular characters, Rick and Morty. Watson, meanwhile, worked on the Gears series, Bulletstorm, and Fortnite during her time at Epic.Rick and Morty's other co-creator Dan Harmon, meanwhile, is reportedly writing new scenes for additional photography on Marvel's Doctor Strange.For much more VR, be sure to check out IGN VR, our virtual reality YouTube channel. And for more on Rick and Morty, which was renewed for season 3 last year, check out IGN's review of season 2
Jordan is a freelance writer for IGN. You can follow him on Twitter @jdsirani
| null |
minipile
|
NaturalLanguage
|
mit
| null |
With Labour Day (or Labor Day for my American friends/listeners… *smile*) how behind us, it’s time to “Hit The Books” and get back into our post-summer routines. A recent e-mail from a listener prompted this edition – the e-mail said “Enjoying the podcast, you talk about the being the author of the international best-seller “Rich is a State of Mind” – but you’ve never told us what the book is about”. Point taken. In this episode I answer the listener’s question, including a live clip from a recent event with a group of financial professionals as well as my favourite review of the book. I hope you enjoy it – feel free to share with your clients (and your peers!). Thank you for listening (questions and podcast ideas always welcome!)
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Maritime Force Protection Unit
A Maritime Force Protection Unit (MFPU) is a U.S. Coast Guard unit type tasked with the protection of U.S. Navy ballistic missile submarines (SSBN) while surfaced and transiting U.S. territorial waters to and from their patrol stations.
Maritime Force Protection Units have approximately 150 personnel and are "single-mission" units, meaning they have no other responsibilities other than the defense of SSBNs.
As of 2017, there were two Maritime Force Protection units, both of which were activated in 2007. The first, Maritime Force Protection Unit Kings Bay, is based at Naval Submarine Base Kings Bay; a second, Maritime Force Protection Unit Bangor, is based at Naval Submarine Base Bangor.
References
Category:United States Coast Guard
| null |
minipile
|
NaturalLanguage
|
mit
| null |
In most meat packing operations, not only are the primal cuts of slaughter animals of commercial value, but substantially all animal tissue has some commercial value. For example, the brain tissue and glands in hog heads are of importance as a source of hormones and other pharmaceutical compounds. The skull or head must be split in order to provide access to this important tissue. Although certain equipment is used in meat packing plants to split hog heads and the like, such equipment is not capable of accurate high production performance.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
defaults: &defaults
fog_provider: 'AWS'
aws_access_key_id: <%= ENV['AWS_ACCESS_KEY_ID'] %>
aws_secret_access_key: <%= ENV['AWS_SECRET_ACCESS_KEY'] %>
fog_directory: <%= ENV['AWS_S3_BUCKET'] %>
# You may need to specify what region your storage bucket is in
# fog_region: "eu-west-1"
existing_remote_files: keep
# To delete existing remote files.
# existing_remote_files: delete
# Automatically replace files with their equivalent gzip compressed version
gzip_compression: true
# Fail silently. Useful for environments such as Heroku
# fail_silently = true
development:
<<: *defaults
enabled: false
test:
<<: *defaults
enabled: false
staging:
<<: *defaults
fog_directory: "chronline-staging-assets"
production:
<<: *defaults
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Welcome! Sign in.
What God Says and Does
In the study of Acts 19:8-20, Alistair Begg leads us through Paul’s return visit to Ephesus, where he boldly proclaimed the Gospel and argued persuasively regarding the Kingdom of God. From Paul’s example, we learn the importance of being God-centered and God-glorifying when witnessing to others regarding the Good News of salvation and the power of the cross of Christ.
8And he entered the synagogue and for three months spoke boldly, reasoning and persuading them about the kingdom of God.9But when some became stubborn and continued in unbelief, speaking evil of the Way before the congregation, he withdrew from them and took the disciples with him, reasoning daily in the hall of Tyrannus.310This continued for two years, so that all the residents of Asia heard the word of the Lord, both Jews and Greeks.
The Sons of Sceva
11And God was doing extraordinary miracles by the hands of Paul,12so that even handkerchiefs or aprons that had touched his skin were carried away to the sick, and their diseases left them and the evil spirits came out of them.13Then some of the itinerant Jewish exorcists undertook to invoke the name of the Lord Jesus over those who had evil spirits, saying, “I adjure you by the Jesus whom Paul proclaims.”14Seven sons of a Jewish high priest named Sceva were doing this.15But the evil spirit answered them, “Jesus I know, and Paul I recognize, but who are you?”16And the man in whom was the evil spirit leaped on them, mastered all4 of them and overpowered them, so that they fled out of that house naked and wounded.17And this became known to all the residents of Ephesus, both Jews and Greeks. And fear fell upon them all, and the name of the Lord Jesus was extolled.18Also many of those who were now believers came, confessing and divulging their practices.19And a number of those who had practiced magic arts brought their books together and burned them in the sight of all. And they counted the value of them and found it came to fifty thousand pieces of silver.20So the word of the Lord continued to increase and prevail mightily.
Series: For the Sake of the Gospel, Volume 1
Other messages in: For the Sake of the Gospel, Volume 1
Are you passionate about sharing the Gospel? How willing are you to sacrifice and take risks so that unbelievers may become followers of Jesus, and believers may become better equipped to share the Good News of salvation?
In Volume 1 of this series of messages from Alistair Begg, we follow the Apostle Paul from Corinth to Caesarea on his final missionary trek. For the sake of the Gospel, Paul endured trials of every kind, boldly proclaiming the Good News and glorifying God even to those who doggedly persecuted him. Throughout his journey, we see evidence of God’s grace, providential protection, and provision. God’s guidance and care underpinned Paul’s confidence and enabled him to live out the faith he proclaimed.
It’s easy to believe God’s promises in the days of calm, but trusting Him in the midst of life’s storms is difficult, and our response to trials may either advance or impede the spread of the Gospel.
Other messages in: For the Sake of the Gospel, Volume 2
Are you passionate about sharing the Gospel? How willing are you to sacrifice and take risks so that unbelievers may become followers of Jesus, and believers may become better equipped to share the Good News of salvation?
In Volume 2 of For the Sake of the Gospel, it quickly becomes evident that nothing would silence the Apostle Paul from “preaching the kingdom of God and teaching about the Lord Jesus Christ”— not a trial before royalty, a hurricane-force storm at sea, a shipwreck, a poisonous snake bite, chains, or prolonged wrongful imprisonment. Paul was zealous to make all his days and all his deeds count for the Gospel. Alistair Begg uses Paul’s dramatic journey from Caesarea to Rome to illustrate God’s faithfulness and to encourage us to see our circumstances as opportunities to proclaim the Good News.
Our Resources
Donate
Insights Delivered to Your Inbox
First Name
Last Name
Email Address
Daily
Devotional, Morning and Evening
Weekly
Program Recap from TFL
MonthlyTruthLines letter from Alistair Begg
Truth For Life is the teaching ministry of Alistair Begg committed to teaching the Bible with clarity and relevance so that unbelievers will be converted, believers will be established, and local churches will be strengthened.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Well, just ask Capt. Chesley Sullenberger and the 155 people he saved in 2009 with his famous water landing.
Sullenberger lost power in both engines when the US Airways flight leaving LaGuardia Airport hit a flock of birds. He made the decision to ditch the flight in the Hudson River, and as the Wall Street Journal reported six years ago, he was able to do so thanks to the backup hydraulic system that was still working during the gliding descent and was able to power the aircraft’s flight-control system.
According to fearofflyinghelp.com, “aircraft have separate and redundant hydraulic systems to power flight controls, flaps, gear, thrust reversers, brakes, spoilers, etc. Each engine has a hydraulic pump and there is also an electric powered hydraulic pump. Some airplanes utilize a wind driven backup hydraulic pump.”
However, if there is a loss of power, AND the backup hydraulic system is down, there are myriad problems.
A Southwest spokeswoman issued a statement saying that the airline had informed the Federal Aviation Administration of the issue at 5 p.m. on Tuesday.
“Southwest Airlines discovered an overdue maintenance check required to be performed on the standby hydraulic system, which serves as a back-up to the primary hydraulic systems. As a result of this discovery, 128 -700 aircraft were identified as having overflown a required check,” she said. “Once identified, Southwest immediately and voluntarily removed the affected aircraft from service, initiated maintenance checks, disclosed the matter to the FAA, and developed an action plan to complete all overdue checks. The FAA approved a proposal that would allow Southwest to continue operating the aircraft for a maximum of five days as the checks are completed. Approximately 80 cancellations occurred (Tuesday) as a result of the events and the airline is anticipating a very minimal impact to their operations (today). The safety of our customers and employees remains our highest priority, and we are working quickly to resolve the situation.”
Comments
You may use your Facebook account to add a comment, subject to Facebook's Terms of Service and Privacy Policy. Your Facebook information, including your name, photo & any other personal data you make public on Facebook will appear with your comment, and may be used on TravelPulse.com. Click here to learn more.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
If you didn’t know it before, Port80 Software does dabble in client-side tools. One such little project of ours called w3compiler brings up lots of questions about JavaScript compression and obfuscation.
The basic premise of w3compiler is to prepare HTML, JavaScript, CSS and other source files for optimal Web site/application delivery. In order to optimize core Web site files for fast download, a variety of techniques can be employed, depending on the file type. For example, in (X)HTML files, you can remove most white space, comments, and unused tags such as extratags. CSS is fairly similar. JavaScript, however, presents a totally different set of possibilities and challenges. Of course, you can remove white space and some dead code statements here like you can in HTML and CSS. You can also shorthand statements (for example, x=x+1 would become x++, with a whopping 2 byte savings – hey, every 1 and 0 counts on the wire, right?). It may not seem like much, but it adds up, particularly with more complex AJAX-style applications.
A challenge we sometimes face here at Port80 is explaining exactly what we are doing with JavaScript in the w3compiler. Well, first off, w3compiler does safely remove white space, which indeed can make code look a little harder to decipher and make it much smaller. Yet, the software does a number of other things, namely variable renaming and object remapping.
In the case of variable renaming, you might have a variable like usersFirstName, and the tool might remap that variable everywhere across the entire Web site/app to uF or something similar. Variables include function names and such, so there could be quite a bit to rename across an entire site…
Object remapping is a bit different. For example, you might have repetition of:
The remapping of objects is done intelligently so as to not to increase code size or break the site — so the w3compiler has to understand usage of the code, much like a Web browser would parse the file. One downside: you do pay a slight browser memory penalty and potentially performance penalty at run time as the object is copied into the local browser’s memory space — but it is negligible and offset in most cases by the reduction in code size from optimization.
Delving deeper into the balance between JS speed optimization and obfuscation, let’s review a more complex example. Given JavaScript like:
Now, you might look at this code and exclaim, “Great, now it’s real difficult for people to steal my hard work in JavaScript!” Well, that’s somewhat true. The reality is that if you really wanted to make things harder, you might have variables not l and l1, but l1l1ll0l0l and l11l1ll0101 — which are, as they say, a bit difficult to just eyeball and then unroll the code. You might go further and run some simple obfuscation against the code like escaping the code:
Combo the two or do some other types of encodings, and you make it harder and harder to figure out what is going on with your JavaScript. This is the idea of obfuscation — making it so much of a pain for the potential thief so they move on to easier targets. Of course, with those digital assets that people want (like free video games, serial numbers, etc.), programmers can really add amazing obfuscation and copy protection — and folks will still spend quite a lot of time cracking away at this stuff. This is not to say that you shouldn’t attempt to obfuscate with a tool like w3compiler, but let’s be realistic about the protection JavaScript obfuscation provides…
In the case of w3compiling, we balance the need for speed with the need for protection — so far, we favor speed.
– J.A. @ Port80
P.S. The new version of w3compiler 2.0 is in internal BETA. If you want to be on the public beta team, just send an e-mail to [email protected].
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Menu
Migration scholars, journalists, & orgs on Twitter
A few weeks ago I tweeted a list of migration historians who are on Twitter. Based on the feedback I received I thought it would be a good idea to publish an expanded set of lists. Below are lists of
migration historians
other migration scholars/researchers/lawyers/policy analysts
activists, allies, and advocacy groups/organizations
migration journalists/writers/photographers/publications
academic groups/centers/institutes and policy/research organizations whose work focuses on migration
migration blogs/bloggers
I am sure I have unintentionally forgotten many people, groups, and organizations, but I plan on updating the list periodically, so please tweet at me or email me if you would like to be added, or know someone who would. (Also, let me know if, for whatever reason, you would like to be removed.) You can follow these lists on Twitter or check this page for the most up-to-date information.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Antimutagenic effect of essential oil of sage (Salvia officinalis L.) and its monoterpenes against UV-induced mutations in Escherichia coli and Saccharomyces cerevisiae.
Mutagenic and antimutagenic potential of essential oil (EO) of cultivated sage (S. officinalis L.) and its monoterpenes: thujone, 1,8-cineole, camphor and limonene against UVC-induced mutations was studied with Salmonella/microsome, E. coli WP2, E. coli K12 [Simić, D., Vuković-Gacić, B., Knezević-Vukcević, J., 1998. Detection of natural bioantimutagens and their mechanisms of action with bacterial assay-system. Mutat. Res. 402, 51-57] and S. cerevisiae D7 reversion assays. The toxicity of EO differed, depending on the strain used. The most sensitive were permeable strains TA100, TA102, E. coli K12 IB112 and non-permeable WP2. Mutagenic potential of EO and monoterpenes was not detected, with or without S9. EO reduced the number of UV-induced revertants in a concentration-dependent manner, reaching 50-70% of inhibition at the maximum non-toxic concentrations: 3 microl/plate (TA102), 5 microl/plate (WP2), 7.5 microl/plate (IB112), 30 microl/plate (E. coli K12 SY252) and 60 microl/plate (D7). The metabolic activation had no effect on antimutagenic potential of EO. Similar toxicity of monoterpenes was observed in TA100, E. coli SY252 and D7, with the exception of limonene (less toxic to D7). Reduction of UV-induced revertants by non-toxic concentrations of monoterpenes, tested with SY252 and D7, reached 40-50% at 15-20 microl/plate of thujone, 10 microl/plate of cineole and 1-10 microg/plate of camphor. Limonene showed antimutagenic effect only in D7. Our data recommend sage monoterpenes for further chemoprevention studies.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Physicochemical properties of the matrix proteins of three main culture vehicles.
The protein components of three industrial recombinant expression systems: Escherichia coli, Saccharomyces cerevisiae, and a mammalian cell culture supernatant of CHO cells were characterized in terms of their molecular weight, isoelectric point, and relative surface hydrophobicity. Identification of individual proteins was done by reference to their position in protein band profiles by polyacrylamide gel electrophoresis (PAGE) of the crude material. This permitted a rapid and facile assignment of quantitative values for these three parameters to all the major protein components in these materials. Because it is the indigenous proteins in expression systems that will form the bulk of any impurities in the product, once the values of these parameters are known for any target recombinant protein, the data obtained will enable appropriate expression systems to be chosen for minimizing amounts of potential contaminants and reducing downstream processing requirements and costs. The data will also indicate which fractionation steps (i.e., charge, size or hydrophobicity-based) are likely to be best for distinguishing between target and contaminant proteins, thus aiding and early removal of the maximum quantities of undesired protein to bring subsequent bioseparation steps down in scale and cost and up in terms of efficiency.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
In This Section
Davis, White lead Virtue, Moir by fair margin
Posted 2/16/14 by Lynn Rutherford, special to icenetwork
Meryl Davis and Charlie White just keep pushing their world-record score higher and higher, posting a 78.89 for their 'My Fair Lady' short dance. More important than that, though, is the 2.56-point lead they opened up over Canadians Tessa Virtue and Scott Moir. -Getty Images
They could have ice danced all night Sunday at the 2014 Olympic Winter Games, and the Iceberg Skating Palace crowd of more than 10,000 would have begged for more.
From elegant foxtrots to sparkling quicksteps and quirky Charlestons, the cream of international ice dance glided, whirled and twizzled their way into the audience's hearts and judges' leaderboard. As expected, two short dances stood apart: that of U.S. world champions Meryl Davis and Charlie White and Canadian Olympic gold medalists Tessa Virtue and Scott Moir.
When the last level had been decided and the final grade of execution entered, Davis and White led by 2.56 points. Both teams scored appreciatively higher than in the team short dance just days ago, and the Americans set a new record short dance score of 78.89 points.
"We were in the moment enjoying it," White, 26, said. "I don't think either one of us was thinking about pushing it. We were enjoying our company; it was really special for us."
"Excellent is a word to describe it," Davis, 27, said. "I felt like I was in a dream. Everything is coming together."
Both teams are coached by Marina Zoueva in Canton, Mich., and, as always, she selected material tailor-made to their different strengths. Davis and White are master storytellers on a grand scale, and Virtue and Moir are intimate performers with a deep connection to each other on the ice.
Davis and White's short dance to selections from My Fair Lady was classical musical theatre, charming and light, presenting a joyous scene of newfound love. Virtue and Moir's jazzy Louis Armstrong-Ella Fitzgerald medley gave off vibes of a speakeasy and a couple grabbing a few drinks and a dance.
The nod went to the Americans, who are now a free dance away from winning the first-ever U.S. ice dance Olympic gold. Nine judges graded them slightly higher in both execution and program components; the technical panel assigned Level 4's for all of their elements, including both sections of their Finnstep pattern dance.
"This program is so hard, and Marina has done such a great job preparing us, physically, mentally and emotionally," White said. "We can really focus on the performance and letting the skating go for itself."
Zoueva thinks Sunday's routine was the best Davis and White ever performed.
"They just fly," she said. "You can see they are strong, but you can also see they are so light, flowing. You didn't see any moment where it was forced."
Virtue and Moir's short dance looked as liquid and easy as Ella Fitzgerald's voice sounded in "Dream a Little Dream." They happily awaited their scores in the kiss and cry, and when 76.33 points appeared, looked disappointed. Moir shrugged.
"Our mindset was right; we just tried to do our job and stay in the moment," Moir said. "As we sat in the kiss and cry and waited for the marks, we looked at each other and said it really didn't matter. That was the feeling we wanted."
The Canadians received a Level 3 for the first section of the Finnstep, which cost them a point.
"We have to look at the tapes," Moir said. "I was surprised. I thought our levels were better than in the team competition, so I have to really see it."
The Finnstep, a pattern dance based on Finnish champions Susanna Rahkamo and Pettri Kokko's original set pattern dance of the 1994-95 season, includes two sections where all the couples must execute the same steps and holds. The technical panel determines levels using six key points: Level 4 is the most valuable.
"Finnstep is where you make it or break it," Moir said. "It's worth a lot of points. I think that was the strongest we've skated it, for sure."
Zoueva agreed, adding that she did not know why the Canadians did not gain a Level 4.
"They did it the best they've ever done; it was truly dance, with expression and joy," Zoueva said. "I didn't see any moment where I was uncomfortable. Callers and technical specialists, they have different views; they can zoom in [with replay]. In my view, Tessa and Scott's short dance was perfect from beginning to end."
Moir acknowledged it will be difficult to overtake Davis and White, whose free dance to Scheherazade is considered one of their finest ever.
"We feel like we can make it up, because there are a lot more elements in the free program," he said. "It's doable, but we know they will bring a great skate tomorrow. We train with them every day. We think we're up to it and we just can't wait to get out there."
This season, a popular guessing game is "Who will win bronze in Sochi?" There was no clear leader heading into these Games, although many thought competing on Russian soil would give 2013 European champions Ekaterina Bobrova and Dmitri Soloviev an edge.
A Russian team does sit in third -- not Bobrova and Soloviev but their younger teammates, Elena Ilinykh and Nikita Katsalapov, who skated a sophisticated Charleston and slow foxtrot to a medley including "Bei Mir Bist du Schoen."
The European silver medalists' program was clean and fast, closing with a challenging three-part twizzle sequence and exceptionally fast rotational lift. It earned 73.04 points, by far their personal best.
The crowd roared for the Russians. Reporters asked Ilinykh and Katsalapov if the support was distracting.
"Thank God we had very good training and another performance in the team event," Katsalapov said. "We tried out our free dance and noticed the audience was giving good support to Russians. When we started to skate, the audience calmed down."
Two-time French European champions Nathalie Péchalat and Fabian Bourzat strutted their stuff in Bob Fosse-inspired style to tunes from Chicago. Their sexy style and mature assurance earned 72.78, a new personal best and just 0.26 out of medal position.
Bobrova and Soloviev, who defeated the French by a point in the team short dance, are fifth with 69.97 points. Their quickstep and slow foxtrot routine to "Diamonds are a Girl's Best Friend" was speedy and entertaining, but they did not have the polish of the other top teams. Bobrova, in particular, wobbled a bit on the twizzles.
European champions Anna Cappellini and Luca Lanotte, and Canadian silver medalists Kaitlyn Weaver and Andrew Poje both skated to music from 42nd Street and placed sixth and seventh, respectively.
Madison Chock and Evan Bates brought a touch of old-time Hollywood glamour to their short dance to "No Business Like Show Business," which featured close holds and ended with a sensational rotational lift. The U.S. silver medalists sit eighth with 65.46.
"It felt amazing to perform that dance," Bates said. "We were just so in the moment, and we worked so hard to get to this point."
"It is so exciting, it is almost a magical moment," Chock said. "It felt solid, but we need to see the levels."
Skating to a Michael Bublé medley, U.S. bronze medalists Maia Shibutani and Alex Shibutani showed clean elegance and the finest three-part twizzles of the evening. They scored 64.47 points for ninth place.
"I think we believe we're a top team, and we've shown that in the practices," Alex said. "It's been a long journey [with] ups and downs.
"We're so lucky to be here," he added. "Now, we're just enjoying the entire experience."
| null |
minipile
|
NaturalLanguage
|
mit
| null |
is next in 2283, 9103, 20465, 36369, 56815?
81803
What is the next term in 80, 361, 844, 1529, 2416, 3505?
4796
What is next in -3560, -3565, -3570, -3575, -3580?
-3585
What is next in 139, 414, 1163, 2626, 5043?
8654
What is next in -738, -2992, -6754, -12030, -18826, -27148?
-37002
What comes next: 1602, 1485, 1368, 1251, 1134?
1017
What comes next: 1915, 1905, 1889, 1867, 1839, 1805?
1765
What is next in -471, -471, -475, -483, -495, -511?
-531
What is next in -2366052, -2366051, -2366050?
-2366049
What comes next: -15902, -15884, -15854, -15812, -15758, -15692?
-15614
What is the next term in 86, 147, 178, 167, 102, -29, -238?
-537
What comes next: 3700, 3691, 3682, 3673, 3664?
3655
What is next in -1100, -1114, -1146, -1202, -1288, -1410, -1574?
-1786
What is next in -3337, -3546, -3895, -4384?
-5013
What is next in 30, -419, -1168, -2217?
-3566
What is next in 6192, 24568, 55196, 98076, 153208, 220592, 300228?
392116
What is the next term in 142, 168, 206, 262, 342, 452, 598, 786?
1022
What comes next: -6776, -13552, -20326, -27098?
-33868
What is next in 201, 895, 2055, 3687, 5797, 8391, 11475, 15055?
19137
What comes next: -2028, -4070, -6112, -8154, -10196?
-12238
What is next in -392989, -785982, -1178975, -1571968, -1964961, -2357954?
-2750947
What comes next: 826, 1027, 1228?
1429
What comes next: -1019, -4101, -9241, -16439, -25695, -37009?
-50381
What is next in 378, 1210, 2582, 4482, 6898?
9818
What is next in 26, 563, 2034, 4907, 9650, 16731?
26618
What is the next term in 1267, 2525, 3771, 4999, 6203, 7377, 8515?
9611
What is next in 258, 1285, 3012, 5451, 8614, 12513, 17160?
22567
What is next in 4005, 32093, 108329, 256785, 501533, 866645, 1376193?
2054249
What is the next term in -784, -837, -892, -949?
-1008
What is next in 265, 154, 49, -50, -143?
-230
What is next in 141, -85, -301, -501, -679?
-829
What comes next: 25, 117, 389, 937, 1857?
3245
What is next in -95, -227, -425, -689, -1019, -1415?
-1877
What comes next: 11733, 46685, 104937, 186489, 291341?
419493
What comes next: -537488, -537492, -537498, -537506, -537516, -537528, -537542?
-537558
What is the next term in -88826, -177651, -266474, -355295, -444114?
-532931
What is the next term in -182856, -365715, -548596, -731511, -914472, -1097491, -1280580, -1463751?
-1647016
What comes next: 116, 122, 140, 176, 236, 326, 452?
620
What is next in 924, 950, 998, 1074, 1184, 1334?
1530
What is the next term in 3755, 4174, 4879, 5876, 7171, 8770, 10679, 12904?
15451
What is the next term in 26, 25, 18, 5, -14, -39, -70?
-107
What comes next: 1550, 1562, 1578, 1598, 1622?
1650
What is the next term in 188, 383, 580, 785, 1004, 1243, 1508, 1805?
2140
What comes next: -560, 23, 606, 1189, 1772, 2355?
2938
What is next in -434, -425, -410, -389, -362?
-329
What is next in 249, 569, 1021, 1671, 2585?
3829
What is next in 1464, 5837, 13126, 23331, 36452, 52489, 71442?
93311
What is next in 404, 627, 850, 1073, 1296?
1519
What comes next: 552, 1833, 3842, 6579, 10044, 14237?
19158
What is the next term in -955888, -955892, -955896?
-955900
What is the next term in 42, 56, 62, 60, 50, 32?
6
What comes next: -486, -361, -212, -39, 158?
379
What is next in -1196, -2372, -3554, -4742, -5936, -7136, -8342?
-9554
What comes next: -2361, -2350, -2323, -2274, -2197, -2086?
-1935
What is the next term in 4120, 8402, 12684, 16966, 21248?
25530
What is the next term in 100580, 100579, 100576, 100571, 100564?
100555
What is the next term in 24846, 49630, 74412, 99192?
123970
What comes next: 39088, 39085, 39082, 39079?
39076
What comes next: -54170, -216655, -487462, -866591, -1354042?
-1949815
What comes next: 10895, 10891, 10887, 10883, 10879, 10875?
10871
What comes next: 154, -79, -472, -1025, -1738, -2611?
-3644
What comes next: -439, -1711, -3823, -6769, -10543, -15139, -20551?
-26773
What is next in 610, 612, 624, 646, 678, 720, 772?
834
What is the next term in -832, -1144, -1664, -2392, -3328, -4472?
-5824
What comes next: 4544, 4061, 3578, 3095?
2612
What is the next term in 68569, 137141, 205715, 274291, 342869, 411449, 480031?
548615
What comes next: 52278, 104548, 156818, 209088?
261358
What is next in 116, 473, 1074, 1919, 3008, 4341?
5918
What is the next term in -3862, -3788, -3716, -3646?
-3578
What comes next: -172, -441, -714, -991?
-1272
What is the next term in -30348, -60652, -90958, -121266, -151576?
-181888
What is the next term in 82229, 82230, 82233, 82238, 82245?
82254
What comes next: -426, -1358, -2290?
-3222
What is the next term in 9110, 9108, 9122, 9158, 9222, 9320?
9458
What comes next: -3062, -6192, -9322, -12452, -15582, -18712?
-21842
What is next in 38, 32, 30, 32, 38?
48
What comes next: -6950, -7070, -7190, -7310, -7430, -7550?
-7670
What is next in -1757, -3535, -5341, -7187, -9085?
-11047
What is the next term in 3131, 3125, 3117, 3107?
3095
What is the next term in -5089, -5541, -5993?
-6445
What is next in 99, 127, 213, 393, 703, 1179, 1857, 2773?
3963
What is next in -519902, -519905, -519908, -519911, -519914?
-519917
What is the next term in 5561, 5525, 5501, 5495, 5513, 5561, 5645?
5771
What comes next: -7649, -30677, -69051, -122765, -191813, -276189, -375887?
-490901
What is next in 165, 56, -127, -384?
-715
What is the next term in -211, -419, -645, -883, -1127, -1371?
-1609
What is the next term in -1806535, -1806534, -1806533, -1806532, -1806531?
-1806530
What is next in -184, -370, -552, -730, -904?
-1074
What is next in -1718, -6853, -15408, -27383, -42778, -61593, -83828?
-109483
What comes next: 7659, 15500, 23341?
31182
What comes next: -59953, -119908, -179867, -239830, -299797?
-359768
What is next in 6504, 12996, 19488?
25980
What comes next: -9608, -9612, -9614, -9614, -9612, -9608, -9602?
-9594
What is the next term in 8080683, 8080684, 8080685, 8080686?
8080687
What comes next: 648, 2541, 5674, 10047?
15660
What is next in 612, 775, 956, 1149, 1348, 1547, 1740, 1921?
2084
What is the next term in 92911, 92925, 92939, 92953, 92967?
92981
What is the next term in -333, -326, -315, -300?
-281
What is the next term in -13487, -13485, -13477, -13463, -13443, -13417?
-13385
What is next in -12306, -12287, -12266, -12243, -12218, -12191?
-12162
What is the next term in -177, -226, -263, -282, -277, -242, -171, -58?
103
What is next in -1450, -5643, -12640, -22447, -35070?
-50515
What is the next term in 54, 43, 32, 21?
10
What is next in 262, 1329, 3108, 5599, 8802, 12717?
17344
What comes next: 1067302, 2134605, 3201908, 4269211, 5336514?
6403817
What is the next term in -14655, -29302, -43947, -58590?
-73231
What is the next term in 228, 358, 690, 1320, 2344?
3858
What is the next term in -4578, -4564, -4550, -4536?
-4522
What is next in -58790, -235186, -529182, -940778, -1469974, -2116770, -2881166?
-3763162
What is the next term in 37, 244, 641, 1270, 2173, 3392, 4969, 6946?
9365
What comes next: 326, 1531, 3540, 6353, 9970, 14391?
19616
What comes next: 1527, 1206, 885, 564, 243?
-78
What is the next term in -815, -1623, -2431?
-3239
What comes next: -22341, -22309, -22265, -22203, -22117, -22001?
-21849
What is the next term in 34977, 35156, 35335, 35514?
35693
What is next in -728, -1488, -2272, -3080?
-3912
What is next in -1623, -12837, -43263, -102507, -200175, -345873, -549207?
-819783
What is next in 99996, 99994, 99992, 99990?
99988
What is the next term in -148670, -148671, -148672, -148673, -148674, -148675?
-148676
What is next in 20476, 40950, 61424?
81898
What is next in -295, -700, -1213, -1828, -2539, -3340?
-4225
What comes next: -137, -245, -533, -1091, -2009?
-3377
What is next in 328986, 328988, 328990?
328992
What comes next: -4835, -9691, -14573, -19493, -24463, -29495, -34601?
-39793
What comes next: 783, 854, 971, 1134, 1343, 1598, 1899?
2246
What is the next term in 1154, 2439, 3714, 4973, 6210?
7419
What is the next term in 916, 1937, 3176, 4741, 6740, 9281?
12472
What comes next: 2843902, 5687803, 8531704, 11375605?
14219506
What comes next: 394399, 394402, 394405, 394408?
394411
What is next in -1652, -3317, -4982, -6647, -8312?
-9977
What is the next term in 173378, 346762, 520146, 693530, 866914?
1040298
What comes next: 363, 2863, 9635, 22809, 44515, 76883, 122043, 182125?
259259
What is t
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Spectiv
Spectiv is a community-driven virtual reality streaming platform supported by a unique ERC20 token. Signal Tokens (Sigs) will be sold for $0.50 each through a crowdsale with early engagement bonus opportunities. Learn more about what Spectiv is by reading this article:
https://medium.com/spectiv-vr/spectiv-vr-streaming-attention-token-88fcc6fb5ad9.
Update 1: Sutton Stone Partnership
We have officially partnered with US-based ICO consulting firm, Sutton Stone. Check them out here: www.suttonstone.com. Sutton Stone is a team of experienced legal/business developers focused on ICO structuring, fund governance, and community outreach. We will be working with Sutton Stone to ensure that our crowdsale is vetted, managed, and executed at the highest standard. Equally as important, Sutton Stone will assist us in company legal structure and business development advisory. This will include the formation of Spectiv as a business entity in Mauritius, a leading innovator in the crypto space that is setting up legislation to standardize and acknowledge ICOs as a legal process. James Duchenne, partner at Sutton Stone, is spearheading this effort through direct work with the government and central banks of Mauritius. Learn more about the Mauritius vision here.
Partnership Objectives
In the time leading up to the crowdsale, Sutton Stone will be helping us with the following objectives, as agreed upon in our partnership:
Venture assessment Legal regulations: KYC, AML, securities, regulatory arbitrage, corporate setup, prospectives/disclaimers, outside legal counsel Incentives: token model, token utility, implications Security: governance Operations: organizational model, non-profit structure, crowdsale processes
Schedule:
1 week for assessment
1 week for planning
2 weeks to address and adjust Token Sale model
1 month to execute the process
1 week for concluding work
Update 2: Developer Hiring
Ever since we announced the Spectiv project, we have had several developers reach out to us about joining the team. While we already have most bases covered, we did open up discussions with developers experienced in the VR and streaming spaces. With that said, we are happy to announce that we have brought on a new developer who will help us accelerate our alpha development. We expect to release a basic demo for Spectiv VR streaming within the next 30 days. This demo will allow users to interact with the Spectiv interface and watch a selection of VR video from our current VR production partners. We’re excited to share this with the community and we look forward to your feedback.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
If the future is to bring an endless variety of cryptocurrencies and tokens, the world will need a wallet that can hold them all.
Now, two of the most prominent startups in the sector are teaming up to entice developers to build just that. Announced Wednesday, decentralized internet startup Blockstack (through its venture capital fund, the Blockstack Signature Fund) and exchange platform ShapeShift are jointly offering a $50,000 bounty to the team or developer that makes the best open-source “universal” crypto wallet.
Contestants need to use Blockstack’s authentication, storage and encryption technology combined with ShapeShift’s API for token exchange. The goal is to build a wallet that supports almost any native token, even tokens that haven’t been created yet, before the deadline on June 29.
Xan Ditkoff, a growth partner at Blockstack and producer at Blockstack’s Signature Fund, explained:
“We’re super early in this space. There are undoubtedly winners that have yet to even appear yet. It’s important that a wallet can support digital assets that have yet to be created.”
Most cryptocurrency wallets only support at most a handful of tokens, forcing enthusiasts to juggle multiple wallets and sometimes keep their tokens on custodial platforms like exchanges.
The Jaxx wallet added ShapeShift support in 2016, although that wallet provider is known to have some security vulnerabilities. Plus, it can’t support all tokens the way this upcoming wallet aims to.
Hedging bets
Notably, the partnership says much about the changing demands of crypto consumers, as it grew out of Blockstack’s concern that not supporting certain coins could cost developer interest.
“You shouldn’t be deterred from building on Blockstack just because your community’s atomic unit of use, or wealth, or whatever, your token, isn’t represented on our platform,” Ditkoff told CoinDesk.
“As soon as we came up with that idea, ShapeShift was an obvious partner. They’ve probably done the most of any project … for users to hold, exchange and add new tokens,” he continue.
The partnership also is good for ShapeShift’s bottom line, since the platform will earn revenue whenever wallet users convert their tokens through the API.
“Much like you don’t have a website that serves all of the needs of an individual, you won’t have a single wallet or decentralized application that serves all of the needs of an individual as well,” a ShapeShift spokesperson said.
More broadly, in Ditkoff’s view, sometimes cryptocurrency tribalism can create familiar silos centered around specific tokens. But cooperation between teams often produces more innovative results than niche experiments, he said.
Submissions won’t only be judged based on the quality of the code. Judges will also consider how easy the wallet’s code is to audit and use.
“We’d love to see other developers use this going forward,” Ditkoff said, concluding:
“This space, in general, is going to succeed, or it’s not. It’s not going to be a winner take-all-type thing.”
Crypto wallet image via Shutterstock
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The present invention relates to the field of medical and dental instrument cleaning, and more particularly, to a hydro impact medical and dental instruments and other armamentarium washer.
In the conventional technique of cleaning medical and dental instruments, the instruments are first hand scrubbed using brushes with detergent and water. Subsequently, the instruments are placed in an ultrasonic cleaner designed to clean instruments using an ultrasonic solution and action. After the instruments are removed from the ultrasonic cleaner, they are placed in an autoclave or other sterilizing device. After these three steps, the instruments are considered sterile and reusable on other patients.
The problem with the conventional process, however, is that it is inefficient, labor intensive., hazardous, and expensive. The ultrasonic cleaner is designed to clean medical and dental instruments without preliminary hand scrubbing. However, this device has been ineffective in cleaning medical and dental instruments so that 100% of the residual material (human tissue, chemicals, medications, etc.) is removed. As a result, it has been necessary to hand scrub the instruments prior to placing them in the ultrasonic cleaner.
There are several disadvantages to hand scrubbing the instruments. The burden on office staff is increased because of the additional labor time required to scrub the instruments. Also, certain instruments are extremely sharp and may contain fine points conducive to puncture or cutting of the skin thereby making scrubbing of the instruments very dangerous. Office personnel are reluctant to hand scrub medical and dental instruments partly because there is an increase in awareness of the possibility of diseases transmitted from patients through contaminated equipment. Furthermore, hand scrubbing of the contaminated instruments may produce a splattering of contaminants with the splashing of water which causes office personnel to be concerned about disease transmission. Finally, hand scrubbing increases office expenses because it is extremely time consuming and inefficient. To properly remove 100% of the residual contaminants left on medical and dental instruments, a person must spend an extensive amount of time hand scrubbing. Accordingly, it is highly desirable to eliminate all hand scrubbing of contaminated medical and dental instruments.
Another disadvantage with the present system is that the ultrasonic cleaners use expensive hazardous ultrasonic solutions which generate hazardous wastes. Elimination of the use of these ultrasonic solutions would eliminate the handling and disposal of hazardous waste and decrease costs associated with the purchase of these expensive solutions. After ultrasonic cleaning, the instruments should be 100% clean of all contaminants for proper sterilization of the instruments. However, since instruments are often not completely clean when they are removed from the ultrasonic cleaner, residue material and other contaminants remain on the instruments even after they are removed from the autoclave or other sterilization device. Because of the inefficiency of the ultrasonic cleaners, tissue residue and other contaminants often remain on the medical and dental instruments prior to their insertion into the sterilizer. High heat within the autoclave sterilizer literally bakes the unremoved contaminants onto the medical and dental instruments which may cause the instruments to be non-usable.
It is therefore an object of the invention to provide a hydro impact medical and dental instruments and other armamentarium washer which eliminates the need for hand scrubbing of dental and medical instruments.
It is also an object of the present invention to provide a medical and dental instruments washer which uses non-hazardous and relatively inexpensive cleaning solutions thereby eliminating the need for expensive hazardous cleaning solutions and their disposal.
It is also an object of the present invention to minimize or possibly eliminate the handling of contaminated medical and dental instruments so that the instruments need not be touched by personnel after use until they are completely cleaned and sterilized.
Another object of the present invention is to decrease the risk of instrument puncture wounds to those who handle medical and dental instruments for the purpose of cleaning and sterilizing this equipment.
It is another object of the present invention to decrease office overhead by minimizing the expenses currently associated with specialized ultrasonic cleaners and solutions, including their disposal.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
LEGAL NOTICE AND DISCLAIMER FOR WEIGHT LOSS
Information provided on this website is based on analysis of historical research studies, and results from other former weight loss patients. Further it is also important to note that The Fit 4 Life Diet Plan is not the same as the program outlined by Dr. A.T.W. Simeons in his manuscript “Pounds and Inches” and we do not promote, recommend or support a 500 calorie diet.
*THESE STATEMENTS HAVE NOT BEEN EVALUATED BY THE FOOD AND DRUG ADMINISTRATION. THIS PRODUCT IS NOT INTENDED TO DIAGNOSE, TREAT, CURE OR PREVENT ANY DISEASE. NO PRESCRIPTION WILL BE PROVIDED UNLESS A CLINICAL NEED EXIST BASED ON REQUIRED LAB WORK, PHYSICIAN CONSULTATION AND CURRENT MEDICAL HISTORY EITHER THROUGH PATIENT'S PERSONAL PHYSICIAN OR FIT 4 LIFE MEDICAL CENTER PHYSICIAN. PLEASE NOTE; AGREEING TO LAB WORK DOES NOT AUTOMATICALLY QUALIFY PATIENT TO CLINICAL NECESSITY AND A PRESCRIPTION.
No claim or opinion on the Fit 4 Life Medical Center website or any advertisement is intended to be, or should be construed to be, medical advice and is intended for reference use only.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Were you holding out hope that, despite the end of all the other X-Men team books to make room for a weekly Uncanny X-Men, your beloved X-Men Red would continue? Sorry about your damn luck: X-Men Red is dead as a doornail, just as Bleeding Cool told you it would be (pip pip), and unlike its lead character, it won't be getting resurreXted. And it probably should have been no surprise, considering writer Tom Taylor lobbied for and received a gig writing Spider-Man. But still, we're all a little sad to see X-Men Red go.
There's no issue of X-Men Red in Marvel's January solicitations, confirming the book is done, at least as much as Marvel ever confirms a book is canceled, which is by not soliciting it and hoping nobody will notice. This means the last issue of X-Men Red will be December's X-Men Red #11, which did feature a pretty final-sounding solicit as well.
X-MEN RED #11
TOM TAYLOR (W) • ROGE ANTONIO (A)
Cover by JENNY FRISON
The X-Men have battled valiantly against their powerful psychic foe, Cassandra Nova, since the moment she framed Jean Grey for murder on the world stage. They have been hunted. They have been hated. And now…they can fight no more.
32 PGS./Rated T+ …$3.99
But never fear, X-fans. Marvel's already got a big X-over planned for 2019, and who knows what new X-books they'll launch out of that?
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Golden Dawn
Guardians of the Ancient Mysteries of Light
Originally founded in 1888 by the late, S.L. MacGregor Mathers. The modern day Golden Dawn continues to awaken ancient Magic within it's 1000s of members all over the world.
AWAKEN THE MAGIC WITHIN YOU
Golden Dawn Ancient Mystery School
Bend Reality To Your Will
This is seriously advanced spiritual training. You will learn ancient wisdom that has been handed down from generation to generation. With deep roots in Ancient Egyptian Ritual Magic, the Qabalah and teachings on personal empowerment through the Law of Attraction.
BECOME A MASTER MANIFESTOR
Hermetic Qabalah
The Tree Of Life
The Tree of life is based around ten Sephiroth, or spheres. These spheres progress upwards from Malkuth (the material world), to Kether (the world of pure creation). You will Learn the ancient mysteries of the Hermetic Qabalah. You will be empowered with practical techniques that will expand your mind and open your heart. You will learn manifesting that is beyond belief.
RELEASE THE MAGIC IN YOU
The Law Of Attraction
Thoughts Become Things
A key part of the Law of Attraction is understanding that where you place your focus has an intense impact on what happens to you. By focusing on positive or negative thoughts a person brings positive or negative experiences into their life. You will learn how to maximize the power of the Law of Attraction in your life. You will attract happiness, success, wealth and an abundance.
LIVE THE LIFE YOU DESIRE
Magical Tradition
If you seek the light of hidden wisdom. If you are sincere and want to learn the advanced, traditional teachings of the Golden Dawn. The Golden Dawn Ancient Mystery School is prepared to serve your desires to grow in Light, wisdom, magic and as far as your aspirations will take you.
Golden Dawn Mysteries
We can provide astral initiations and advancements for those who seek the light of the Golden Dawn; hunger for knowledge and spiritual, magical transformation but do not live by a temple. We remain the only Order that continues to provide long distance initiations where no Golden Dawn temple is nearby.
Worldwide Fraternity
Our Order of the Esoteric Golden Dawn, remains true to the classical tradition. Our Order provides the sincere seeker the opportunity to become part of a worldwide fraternity with Golden Dawn temples, sanctuaries and study groups throughout the US, Canada and Europe.
Over the last 100 years several books have been written on the history and workings of the Golden Dawn. While much of the corpus of information is of interest to the historian or casual magician, much of it lacks the ancient inner secrets and hidden subtleties that cause ironclad magic to work effectively and almost instantly. Ultimately the goal of any magician is to “cause reality to conform to will.” If you have been directed to this site, there is likely a cosmic reason you are here. However, only the chosen few accept their cosmic destiny and take action to become a member of our ancient mystery school of magic and light.
As a Member of the Golden Dawn Ancient Mystery School You will uncover:
How to make all of your magic intentions and rituals work every time.
Powerful magical methods that can give you the possibility of unlimited wealth and financial freedom! (Use this power to help yourself and others as well.)
Rebuild and learn health techniques that will give you abundant energy and personal power.
Develop the sensational skill to leave your body and travel the astral planes, using ancient methods taught by S.L. MacGregor Mathers the founder of the Order of the Golden Dawn.
How to gain full on, laser like magical mental focus to understand the past and influence the future through ancient tarot, traveling in the spirit vision and other well guarded methods.
Some Fraternities and so called magical experts Have Tried To Have Secrets Like This Banned! These same people have attacked our Order for offering true and legitimate astral initiation to members around the world in over 60 different countries.
The Golden Dawn Ancient Mystery School (Esoteric Order of the Golden Dawn) is fully committed to helping those who are serious about living a remarkable life of magic. When you become a member of Our Order, your initiation, either physically or astrally will drastically shift your energy. You will instantly begin living an amazing life of pure magic and light. Unlike many fraternities who keep you in the dark for years, our mission and goal is to quickly and yet safely awaken your latent powers.
Are You are tired of reading book after book, and spending hours on Facebook forums, and still your magic does not work? Read on…. prepare to take action.
If you are sick and tired of all the wasted time going through piles of useless information, paying tons of money for offer and offer on the internet, and you sincerely seek the light of true magic and hidden wisdom and power, then you are at the right place. You will learn all the classical Golden Dawn teaching and so much more when you join our Order. Magic knowledge did not end in the 1900’s with S.L. MacGregor Mathers. All the secret contacts of the past and new contacts of the present and future have vastly expanded our exclusive techniques of magic. The presence of the Invisible Chiefs remain as sacred teachers and guardians of our Order. The ancient teachings of light come alive in our expanded school of modern day magic. Plus, you will become part of a worldwide fraternity of serious students of magic and hidden wisdom. Only the serious need apply. In our Order you have no limits and no boundaries.
You can become as powerful as your aspirations will take you.
STOP! spending all your money on books and all your time on the Internet looking for the secrets that only exist in the Golden Dawn Ancient Mystery School. (Esoteric Order of the Golden Dawn)
When you become a member of the Golden Dawn Ancient Mystery School (Esoteric Order of the Golden Dawn) You will be on the road to becoming a master of ancient Hermetic teachings, Qabalah, The Magic of Light and much more..
The following is a summary of what you can expect to learn and master when your become a member:
Powerful universal laws designed to guarantee your magic works fast and effectively
Access to Source Light and cosmic empowerment you can use for unlimited magic. (Live the life you desire.)
Traveling in the Spirit Vision methods that will allow you to explore dimensions with remarkable clarity and precision.
Learn how to magically divine any situation accurately like reading your future or what is your best move to make in the near future.
Give yourself accurate psychic tarot readings. Never be a victim of psychics again.
Awaken your physical body to unlimited health and vitality thorough an empowered energy field that begins to grow and expand shortly after initiation into our Order.
Learn how to apply your magical powers to attract the right love partners into your life for dating, romance, sex and true love!
Defend yourself easily against black magic, curses, and negative thoughts that are coming against you.
Learn how to master the building blocks of physical reality to get what you want from life!
How to attract the right love partners into your life for dating, romance, sex and true love!
Learn the ancient Rosicrucian secrets of mind control. Learn how to see and know what others through bi-location.
Learn the master-key secrets to creating and healing through the ancient knowledge of Alchemy as taught by Master Alchemist.
Easily awaken your mind to having lucid dreams faster, using simple and effective method of the Magic of Light.
Discover some powerful secrets about man's ancient origins and where we truly come from!
Learn the un-written secrets to invoking the planets, and stars to awaken within you untold skills and powers.
Learn ancient secrets of the Holy Qabalah and Enochian Angels. Enjoy remarkable communication with Angels and Spiritual Beings that will aid you with every aspect of your life.
Our order works with a limited number of new students at any given time and therefore opportunity can be revoked at any given time without notice.
The key to invoking the magic of Light is to invest in you and take action now.
As an initiate of the Golden Dawn Ancient Mystery School (Esoteric Order of the Golden Dawn) you can expect to learn:
The complete Golden Dawn system of the Magic of Light (not some so-called reformed teachings).
The Western Mystery Tradition
Hermetics and hermeticism
The Holy Qabalah / healing qualities of the Tree of Life
Ancient Egypt and Greek mysteries
Angelic Invocation, Magic, and Guidance
Tarot meditation, magic and divination
Astrology / Gematria / Geomancy
Spiritual and Physical Alchemy
Astral travel / astral projection
Golden Dawn protection rites / banishings
Skrying / clairvoyance / traveling in the spirit vision
Ceremonial magic / alchemy
Enochian / angelic magic and techniques
Personal empowerment / complete grade initiations
Power of the elementals (air, fire, water, earth)
Talismans / amulets
Rosicrucian Magic of Light!
This only scratches the surface. Prepare to move your life from where you’re at to where you want to be. Our Order only works with a limited number of students at any given time. This opportunity may be withdrawn without notice.
“Magic should never interfere in your life, magic is secret knowledge of how to apply universal energy to awaken your latent powers and thus make your life more enjoyable.”
Dear Seeker of the light,
As Imperator General of the Order of the Esoteric of the Golden Dawn, I would like to personally welcome you.
Just by being here you are taking the first step into the light. I know that you are seeking to empower yourself through the ancient mystery's of Magic. I promise you that, by joining the Golden Dawn Ancient Mystery School you will lean how to use Magic to not only improve your own life but also for those around you. There is no limitations to what you can learn and what you will be able to achieve. With the right training, focus and intention YOU will bend reality to your own will.
"Thus will you obtain the glory of the whole universe. All obscurity will be clear to you. This is the greatest force of all power because it overcomes every suitable thing and penetrates every solid thing."
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Abstract METH, a potent addictive psychostimulant, is one of the most commonly abused drugs in the United States. METH abuse is highly prevalent in HIV-infected individuals, which presents unique challenges for HIV prevention and treatment. Given the overlap impact of METH use and HIV on neuronal damage in the CNS, it becomes urgent to understand the role of interplays between METH and HIV in the pathogenesis of HIV- associated neurocognitive disorders (HAND). However, studies of HAND have been hampered by difficulties in collecting primary microglial and neuronal cells from autopsy or biopsy of HIV patients. Recent success in generating microglia and neurons from human induced pluripotent stem cell lines (iPSCs) now offers a great opportunity to study the direct interactions between HIV-infected microglia and neurons. The proposed studies will use iPSC-derived microglia (iPSC-MG) and neuron (iPSC-N) to examine our overall hypothesis that METH and/or HIV inhibit the intracellular HIV restriction factors and induce the inflammasomes and neurotoxic miRNAs in iPSC-MG, which facilitate HIV infection/replication in iPSC-MG and promote the death of iPSC-N. We propose two specific aims to address this hypothesis: Aim 1 To determine whether METH enhances HIV infection/replication in iPSC-MG. Mechanistically, we will examine whether METH and/or HIV inhibit the intracellular HIV restriction factors in iPSC-MG; Aim 2 To determine whether METH and/or HIV infection induce expression of the inflammasomes and neurotoxic miRNAs in iPSC-MG and promote the death of IPSC-N. This project fits well to the NIDA?s recent interests in studying the impact of drug abuse and/or HIV on human iPSC-derived CNS cells. The information resulting from the proposed studies using the iPSC-MG and iPSC-N will provide important insights on how the interplays of two major pathologic factors (HIV and METH) in the CNS compromise the intracellular anti-HIV immunity of microglia and induce neuronal death, which are the key mechanisms for HIV infection/persistence in the brain and development of HAND.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Comparison of land- and aquatic-based plyometric training on vertical jump performance.
Plyometric training is a popular method by which athletes may increase power and explosiveness. However, plyometric training is considered a highly intense and potentially damaging activity particularly if practiced by the novice individual or if overdone. The purpose of this study was to compare vertical jump performance after land- and aquatic-based plyometric training. A convenience sample of 21 active, college-age (24 +/- 2.5 years) men were randomly assigned to 1 of 3 groups: group I, aquatic; group II, land; and group III, control. Training for the AQ and LN groups consisted of a 10-minute warm-up followed by 3 sets of 15 squat jumps, side hops, and knee-tuck jumps separated by 1-minute rests. The aquatic group performed the exercises in knee-level water adjusted to parallel the axis of the knee joint (+1 in.). The land group performed identical plyometric exercises on land. The control group engaged in no training. Participants trained twice a week for 6 weeks, and all training sessions were monitored. Pre- and post-test data were collected on maximum vertical jump height. A 2x3 analysis of variance with repeated measures was used to compare vertical jump height among the 3 groups. Results suggested that the aquatic- and land-based groups significantly (p < 0.05) outperformed the control group in the vertical jump. No significant difference was found in vertical jump performance between the aquatic- and land-based groups. It was concluded that aquatic training resulted in similar training effects as land-based training, with a possible reduction in stress due to the reduction of impact afforded by the buoyancy and resistance of the water upon landing.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
But more insidious and objectionable is the creeping misinformation that the nuclear industry has fed into the public sphere over the years. There seems to be a never-ending cabal of paid industry scientific ”consultants” who are more than willing to state the fringe view that low doses of ionising radiation do not cause cancer and, indeed, that low doses are actually good for you and lessen the incidence of cancer. Canadian Dr Doug Boreham has been on numerous sponsored tours of Australia by Toro Energy, a junior uranium explorer, expounding the view that “low-dose radiation is like getting a suntan”. Toro must have liked what it heard because it made him a safety consultant for the company in 2009.
Ionising radiation is a known carcinogen. This is based on almost 100 years of cumulative research including 60 years of follow-up of the Japanese atom bomb survivors. The International Agency for Research in Cancer (IARC, linked to the World Health Organisation) classifies it as a Class 1 carcinogen, the highest classification indicative of certainty of its carcinogenic effects.
In 2006, the US National Academy of Sciences released its Biological Effects of Ionising Radiation (VII) report, which focused on the health effects of radiation doses at below 100 millisieverts. This was a consensus review that assessed the world’s scientific literature on the subject at that time. It concluded: “. . . there is a linear dose-response relationship between exposure to ionising radiation and the development of solid cancers in humans. It is unlikely that there is a threshold below which cancers are not induced.”
The most comprehensive study of nuclear workers by the IARC, involving 600,000 workers exposed to an average cumulative dose of 19mSv, showed a cancer risk consistent with that of the A-bomb survivors.
April 26 marks the 25th anniversary of the Chernobyl disaster. The pro-nuclearists have gone into full-spin-ahead mode, misrepresenting the latest UNSCEAR (United Nations Scientific Committee on the Effects of Atomic Radiation) report on Chernobyl.
Two days ago on this page, George Monbiot (”How the anti-nuclear lobby misled us all with dodgy claims”), citing the report, wrongly plays down he death toll. He correctly states that the report found 6848 cases of thyroid cancer in children, although he fails to acknowledge it was due to the effects of radioactive iodine in the nuclear fallout. The number of cases will continue to increase, according to the US National Cancer Institute, for a further 10 to 20 years.
Thyroid cancer is easy to detect because it is normally a rare cancer. Most other cancers caused by radiation are not that easy to detect above the high background natural rates of cancer. It is the proverbial needle in a haystack scenario – but in this case the needles (radiation-induced cancer) look the same as the hay (other cancers). What the report therefore said was that statistical limitations and large uncertainties precluded being able to single out any radiation-induced cancers. It did not say there have been no cancers, as Monbiot and others claim, or that none will develop, only that it is not possible at this stage to detect them.
IARC states that ”by 2065, predictions based on these models indicate that about 16,000 cases of thyroid cancer and 25,000 cases of other cancers may be expected due to radiation from the accident and that about 16,000 deaths from these cancers may occur”. Whether we will be able to detect them when there will also be more than 1 million other cases of cancer over this period is debatable. But every one of these excess cancers is a tragedy for each victim and their family, and is no less so simply because cancer is a common disease.
George Monbiot should read properly the BEIR VII report that Helen Caldicott gave him – all 423 pages.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
All relevant data are within the paper.
Introduction {#sec004}
============
In the early 2000s the introduction of hybrid imaging techniques combining positron emission tomography (PET) or single photon emission computed tomography (SPECT) with X-ray computed tomography (CT) for diagnostic imaging represented a significant improvement over stand-alone applications of individual imaging modalities \[[@pone.0138658.ref001],[@pone.0138658.ref002]\]. As an intrinsic part of the hybrid imaging device, the CT permits accurate anatomic localization of tracer uptake and can be used for CT-based attenuation correction (CTAC) of emission data \[[@pone.0138658.ref003],[@pone.0138658.ref004]\].
As the two examinations are performed within a close time frame, imaging artifacts induced by patient movements or due to different filled organs (e.g. stomach, bladder) can be reduced or even avoided. Over the period of development of hybrid imaging, there have also been great improvements in diagnostic CT applications \[[@pone.0138658.ref005]\].
However, the introduction of new CT protocols (e.g. cardiac imaging) and the trend towards replacement of conventional X-ray imaging by CT examinations \[[@pone.0138658.ref006]\] have markedly increased medical radiation exposure and the risk of radiation-induced neoplasia in the population \[[@pone.0138658.ref005]\]. Worldwide, CT imaging in medical applications is responsible for more than 40% of the accumulated effective dose \[[@pone.0138658.ref007]\]. Studies suggest that, up to the age of 75, 0.6--3.2% of the cumulative risk of cancer can be attributed to radiation exposure caused by diagnostic imaging in developed countries \[[@pone.0138658.ref008],[@pone.0138658.ref009]\]. Therefore, medical CT imaging needs to be optimized.
In hybrid SPECT-CT imaging, the CT component can be used for (a) diagnostic CT applications (if the CT component has the appropriate imaging capabilities), (b) localization diagnostics by low-dose CT (LD-CT), or (c) exclusively for CTAC of emission data \[[@pone.0138658.ref010]\]. However, even with currently used CT protocols, a significant exposure is accumulated. Effective CT exposures of 7.0 ± 3.3 mSv (range = 3.7--11.1 mSv) were reported for consecutive SPECT-CT examinations with ^111^In-octreotide in tumor diagnostics \[[@pone.0138658.ref011]\]. The same authors reported a CT exposure of 3.8 ± 3.9 mSv (range = 0.2--12.4 mSv) for LD-CT imaging of bone metabolism with ^99m^Tc-methylene diphosphonate \[[@pone.0138658.ref011]\]. Both radiation risk and protection of patients in clinical SPECT-CT are currently controversial issues \[[@pone.0138658.ref012]\]. To minimize radiation exposure in diagnostic CT technical innovations (e.g. angular modulation of the tube current) and new reconstruction technologies (e.g. iterative CT reconstructions) were established \[[@pone.0138658.ref006],[@pone.0138658.ref013],[@pone.0138658.ref014]\].
However, such innovative techniques have to be optimized for LD-CT applications. Such an optimization is usually a multifactorial process of adjustment of X-ray tube current, X-ray tube voltage, pitch and image reconstruction (e.g. processing filters) to the clinical need and the condition of the patient. In general, the optimization process is a trade-off between image quality and radiation exposure. Other workers have reported their experience gathered with LD-CT applications in contrast-enhanced CT angiography (CCTA) \[[@pone.0138658.ref015],[@pone.0138658.ref016]\], but this imaging is performed under considerably different conditions and objectives. Furthermore, there are several studies presenting results of the long-term process of examining the influence of (LD-CT or) CT in PET imaging \[[@pone.0138658.ref017]--[@pone.0138658.ref019]\]. However, the impact of iterative reconstruction algorithms in LD-CT hybrid imaging and the effect of dose reduction on the CTAC of SPECT emission data have not yet been fully evaluated.
It was the purpose of this study to investigate the influence of iterative CT image reconstruction algorithms on CT image quality (e.g. image noise, contrast-to-noise ratio) and on CTAC SPECT-images using LD-CT protocols. The examinations were performed with a focus on phantom geometries representing different adult patients.
Materials and Methods {#sec005}
=====================
SPECT-CT {#sec006}
--------
All examinations were performed with a dedicated hybrid SPECT-CT (Discovery NM/CT 670, GE Healthcare, Milwaukee, USA). The integrated CT component is identical in construction to a 16-slice-CT used in diagnostic CT imaging (model: Bright Speed 16, GE Healthcare, Milwaukee, USA). The standard CT reconstruction was performed by filtered back projection (FBP). Additionally, the system includes an iterative CT reconstruction algorithm (ASIR, Adaptive Statistical Iterative Reconstruction, GE Healthcare, Milwaukee, USA) established in diagnostic CT imaging \[[@pone.0138658.ref014],[@pone.0138658.ref020]--[@pone.0138658.ref022]\]. ASIR uses the images reconstructed by FBP as starting information. The parameter ASIR-level (from 0% to 100% selectable in increments of 10%) defined the merging of the iterative reconstruction and the FBP reconstruction. The imaging protocol was chosen in accordance with the basic scan protocol for LD-CT in SPECT-CT imaging in routine clinical practice. Imaging and reconstruction protocols are defined below.
Low-dose CT Imaging and CT Phantom {#sec007}
----------------------------------
LD-CT phantom measurements were performed with a standardized phantom set (Catphan 500^®^, The Phantom Laboratory, Salem, NY, USA). Scattering and attenuation of the phantom corresponded to the head of an adult patient or to the abdominal region of a lean patient (outside-diameter = 210 mm; e.g. children), henceforth referred to as head geometry. To increase attenuation and scattering, comparable to the body/abdominal region of an adult, the phantom was extended by an additional annulus with a water equivalent attenuation (outside diameter = 350 mm; model: CTP540, The Phantom Laboratory, Salem, NY, USA), henceforth referred to as body geometry. Both geometries represented standardized set-ups for performance tests in diagnostic CT.
CT scans of the phantom were performed in an axial field-of-view (FOV) with a diameter of 50 cm by helical scans with a gantry rotation time t~rot~ = 0.8 s, a table pitch p = 1.375 and a primary collimation of 16 x 1.25 mm. The LD-CT scans were performed without an angular variation of the X-ray tube current. The X-ray tube voltage was set to a fixed value (U = 120 kVp) in accordance with the manufacturer's setting for CTAC. Scans were performed with different tube currents I = 10, 20, 30, 40, 50, 60, 80, 100, 120 mA to estimate the low-dose performance of the system for different CT dose exposures. The CT dose exposures for both phantom geometries were estimated for all X-ray tube currents by a calibrated dose meter (electrometer, DIADOS^®^ with CT adapter and ionization chamber, PTW Freiburg, Freiburg, Germany).
Image reconstruction was performed in accordance with the requirements of a clinically applied LD-CT protocol defined for SPECT-LD-CT imaging by the manufacturer. CT images were reconstructed in slices 3.75 mm thick (512 x 512 matrix, 0.977 x 0.977 mm) with FBP (with convolution kernel = 'standard'; particularly used for routine examinations like abdomen and pelvis scan in diagnostic CT; recommended by the manufacturer for LD-CT) and additionally with the ASIR algorithm. The ASIR-levels selected to estimate the basic potential of the iterative reconstruction algorithm were ASIR = 0% (equivalent to FBP reconstruction), ASIR = 50% (ASIR50%) and ASIR = 100% (ASIR100%).
Performance parameters were determined by regions of interest (ROIs) analysis. Image noise was estimated from ROIs in the uniformity module (section model: CTP486) of the Catphan^®^ phantom. These ROIs (n = 5) were always positioned in the same axial slice as presented in [Fig 1A](#pone.0138658.g001){ref-type="fig"}. Image noise was defined by the standard deviation of the pixel values. The mean reconstructed HU value (mean~high~) was estimated from ROI analysis of the high contrast module of the Catphan^®^ phantom (section model: CTP401, [Fig 1B](#pone.0138658.g001){ref-type="fig"}). The measurements were performed for 4 sensitometry samples made of Acrylic, Teflon, low-density-polyethylene (LDPE) and air. The contrast-to-noise ratio (CNR) for each module was calculated in relation to the background region by $$CNR = \frac{mean_{high} - mean_{BKG}}{SD_{BKG}}$$ where mean~BKG~ corresponded to the mean HU value in the background-ROI and SD~BKG~ corresponded to the standard deviation of the background-ROI. The background region was defined by 4 ROIs in the outer ring of the high contrast module ([Fig 1B](#pone.0138658.g001){ref-type="fig"}).
{#pone.0138658.g001}
SPECT-CT Imaging and SPECT-CT Phantom {#sec008}
-------------------------------------
The influence of the LD-CT image quality on SPECT imaging was examined by measurements using a standard elliptical SPECT phantom (Lung-Spine SPECT Phantom without modules, Biodex Medical Systems, Shirley, NY, USA). SPECT data were obtained for both: (1) the elliptical phantom (semi-axes: 310 x 230 mm, height: 190 mm; [Fig 1C](#pone.0138658.g001){ref-type="fig"}) and (2) the same elliptical phantom surrounded by 13 plastic bottles (diameter = 87 mm each) filled with purified water ([Fig 1D](#pone.0138658.g001){ref-type="fig"}) to increase attenuation and scattering.
The elliptical phantom was homogeneously filled with 550 MBq ^99m^Tc-pertechnetate diluted in water. SPECT imaging was performed over 360° (140 keV ± 10%, 60 projections at steps of 6°and 30 sec/projection) for a single bed position. A separate scatter window was measured at 120 keV ± 5%. The phantom-to-detector distance was minimized by the real-time automatic body contouring of the gamma camera. Several LD-CT scans were executed for CTAC of the SPECT data. The CT scan protocol, the variation of the X-ray tube currents and the image reconstruction of the CT images were performed as previously described for CT examinations with the Catphan^®^ phantom. The LD-CT images, which were used for attenuation correction, were reconstructed by FBP (filter: standard), ASIR50% and ASIR100%. Data processing was carried out on a dedicated workstation (Xeleris 3^®^, GE Healthcare, Milwaukee, USA). The attenuation map (μ map) was calculated by a system-specific algorithm \[[@pone.0138658.ref023]\]. The SPECT image reconstruction was performed by an iterative algorithm (3D-OSEM: 3D-Ordered Subset Expectation Maximization) including resolution recovery, scatter correction and attenuation correction by μ maps estimated from LD-CT (Evolution^®^ Package, GE Medical, Milwaukee, USA).
The LD-CT, the μ map and the CTAC SPECT images were analyzed for all voxels of the ROIs (square 5 x 5 cm), which were positioned in the center of the elliptical phantom. The mean attenuation coefficient μ within the μ maps and the mean reconstructed counts within the SPECT images were determined for both SPECT phantom geometries.
Radiation Dose {#sec009}
--------------
For the estimation of radiation exposure of LD-CT the CT dose index (CTDI~vol~) was determined for four different X-ray tube currents (I = 10, 40, 80, and 120 mA). The CTDI~vol~ values were automatically documented in a dose report by the SPECT-CT. The documented values were validated by measurements with the standardized CTDI~vol~ phantom and a calibrated dose meter. Furthermore, the effective dose resulting from these scan protocols was calculated with the software package CT-Expo™ \[[@pone.0138658.ref024]\] for abdominal examinations of normal adult patients (male/female). The calculation was performed in accordance with the ICRP publication 103 \[[@pone.0138658.ref025]\]. The length of the CT scan (l = 40 cm) covered the full field of view of a SPECT examination (CT-Expo^TM^, z-coordinates = 0--40).
Statistical analysis {#sec010}
--------------------
Data analyses were carried out using the software package R 2.15.3 (Foundation for Statistical Computing, Vienna, Austria, 2012, <http://www.R-project.org>). Descriptive parameters are given as mean and standard deviation as well as median and interquartile range (IQR; 25th-75th percentiles). HU values, Noise, CNR and reconstructed SPECT values were tested for normality by the Shapiro-Wilk test for every X-ray tube current. The dependencies between the X-ray tube current, image noise and CNR were analyzed by regression analyses. The level of agreement was estimated by Bland-Altman analysis \[[@pone.0138658.ref026]\]. Differences in image noise and CNR between reconstruction algorithms were analyzed using the Friedman test for paired data and t-test. All tests were performed two-sided and a p-value of \< 0.05 was considered as statistically significant. The influence of different X-ray tube currents and ASIR-levels on the SPECT reconstructions was evaluated by a general linear model (GLM).
Results {#sec011}
=======
CT Imaging {#sec012}
----------
### Noise {#sec013}
For equal scan conditions visual assessment revealed that the reconstructed images are less noisy with increasing ASIR-level than images reconstructed by FBP ([Fig 2](#pone.0138658.g002){ref-type="fig"}). In general, image noise increased with decreasing X-ray tube current for both FBP and ASIR. The ROI analysis of the image noise in the uniformity module of the Catphan^®^ phantom showed a 1/√I dependency for the head geometry (R^2^ = 0.95, p \< 0.0001, [Fig 3A](#pone.0138658.g003){ref-type="fig"}) and for the body geometry (R^2^ = 0.97, p \< 0.0001, [Fig 3B](#pone.0138658.g003){ref-type="fig"}). The noise in the images reconstructed with ASIR100% was significantly reduced compared to reconstructions with ASIR50% for both phantom geometries (p \< 0.0001, [Fig 3A and 3B](#pone.0138658.g003){ref-type="fig"}). Compared to images reconstructed by FBP and for equal X-ray tube currents, the noise of ASIR50% images was reduced by a factor of 1.5 for the head geometry (1.4 for body geometry, [Fig 3C](#pone.0138658.g003){ref-type="fig"}) and for ASIR100% by a factor of 2.5 for the head geometry (2.0 for body geometry, [Fig 3D](#pone.0138658.g003){ref-type="fig"}). Images scanned with an X-ray tube current of I = 20 mA and reconstructed by ASIR50% showed an image noise, which was not significantly different from images scanned with I~Head~ = 40 mA---50 mA (I~Body~ = 80 mA) and reconstructed by FBP (p~Head~ ≥ 0.33, p~Body~ = 0.06, [Fig 3A and 3B](#pone.0138658.g003){ref-type="fig"}). For both geometries the noise level of images scanned with I = 20 mA and reconstructed by ASIR100% was significantly below the noise levels of images reconstructed by FBP and an X-ray tube current of I = 120 mA (both p = 0.04, [Fig 3A--3D](#pone.0138658.g003){ref-type="fig"}).
{#pone.0138658.g002}
{#pone.0138658.g003}
Image noise was normally distributed in both phantom geometries for all X-ray tube currents and reconstruction algorithms examined (p~Head~ \> 0.43, p~Body~ \> 0.4).
### Hounsfield Unit (HU) Values, CT Bias {#sec014}
Regression analyses revealed high correlations of the mean HU values inside the ROIs in FBP and ASIR50% / ASIR100% reconstructed images for both phantom geometries ([Table 1](#pone.0138658.t001){ref-type="table"}). The mean difference within the HU values and the level of agreement estimated by Bland-Altman analysis revealed a small deviation of the HU values reconstructed by FBP and ASIR50% or ASIR100% ([Table 1](#pone.0138658.t001){ref-type="table"}). [Fig 4](#pone.0138658.g004){ref-type="fig"} shows the dependence of the HU values on X-ray tube current for Teflon, water and air for both geometries. There was a systematic bias of HU values for the body geometry at low X-ray tube currents. The change in the HU values appeared for X-ray tube currents of I ≤ 60 mA (p ≤ 0.04) compared to the HU values estimated by CT scans with I = 120 mA. In contrast, a bias effect in HU values was not observed for the head geometry. The ASIR algorithm did not affect the HU values or the occurrence of a bias effect in HU values for decreased X-ray tube currents in LD-CT ([Fig 4](#pone.0138658.g004){ref-type="fig"}).
10.1371/journal.pone.0138658.t001
###### Influence of the iterative reconstruction algorithm on the HU values. Comparison of ASIR 50% and ASIR 100% with FBP.
{#pone.0138658.t001g}
Material ASIR- R^2^ Mean difference in HU (FBP-ASIR) Mean HU~FBP~ (I = 120 mA)
---------- --------------- --------------- ---------------------------------- --------------------------- -----------------
Acrylic 50 0.999 / 0.999 0.31 ± 0.32 0.28 ± 1.08 118.9 / 128.7
100 0.999 / 0.993 0.63 ± 0.58 0.16 ± 10.02
H~2~O 50 0.999 / 0.999 0.01 ± 0.27 0.00 ± 1.30 2.6 / 10.3
100 0.988 / 0.881 0.02 ± 2.73 -0.09 ± 22.68
LDPE 50 0.996 / 0.999 -1.30 ± 2.10 -2.01 ± 1.58 -86.8 / -73.6
100 0.981 / 0.974 -2.59 ± 4.23 -4.17 ± 9.52
Teflon 50 0.994 / 0.999 -6.01 ± 3.26 7.24 ± 4.08 912.8 / 873.4
100 0.997 / 0.998 -12.00 ± 6.47 13.72 ± 15.32
Uniform 50 0.999 / 1.000 0.01 ± 0.20 0.014 ± 0.57 10.1 / 14.2
100 0.999 / 0.994 -0.01 ± 0.68 0.35 ± 7.42
Air 50 0.878 / 0.999 7.25 ± 3.75 -8.09 ± 6.12 -945.3 / -934.9
100 0.890 / 0.996 14.41 ± 7.64 -18.45 ± 16.94
Correlation between the mean HU from LD-CT images reconstructed by ASIR compared to the standard algorithm (FBP). Results are presented for the linear correlation analysis (R^2^), the mean difference between the HU values in FBP and ASIR reconstructed images and the levels of agreement (± 2 standard deviation) from Bland-Altman analysis. The mean HU values of the images reconstructed by FBP for I = 120 mA are shown for reference.
{#pone.0138658.g004}
### CNR {#sec015}
The CNR of the head and the body geometry showed different dependencies in relation to the X-ray tube current. The head geometry showed a dependency of \|CNR\| proportional to √I (R^2^ \> 0.94, p \< 0.0001, [Fig 5A--5D](#pone.0138658.g005){ref-type="fig"}). The CNR of the body geometry showed inflection points for X-ray tube currents in the range of I = 40--60 mA. Therefore, the CNR remained nearly constant for these currents ([Fig 5E--5H](#pone.0138658.g005){ref-type="fig"}).
{#pone.0138658.g005}
The CNR of the different sensitometry samples in images reconstructed by ASIR50% and ASIR100% were linearly correlated to the CNR of images reconstructed by FBP for both geometries (R~Head~ ^2^ ≥ 0.97 and R~Body~ ^2^ ≥ 0.94, both p \< 0.0001). The CNRs of the sensitometry samples in the head geometry were higher than the CNRs in the body geometry for equal tube currents and reconstruction parameters (p \< 0.0001). For equal X-ray tube currents (equal CT exposures) ASIR50% increased the CNR in the head geometry for the different sensitometry samples by a factor of 1.43 (range: 1.42--1.45) and ASIR100% by a factor of 2.19 (range: 2.15--2.32) compared to images reconstructed by FBP. For the body geometry the CNR was increased by a factor of 1.48 (range: 1.46--1.49) for ASIR50% and 2.54 (range: 2.51--2.57) for ASIR100%.
For the head geometry the CNR of images scanned with I = 30 mA and reconstructed by ASIR50% were not significantly different from the CNR of images scanned with I = 60--80 mA and reconstructed by FBP (p ≥ 0.37). Images scanned with I = 30 mA and reconstructed by ASIR100% showed a significantly better CNR (p \< 0.001) than did images reconstructed by FBP with I = 120 mA ([Fig 5A--5C](#pone.0138658.g005){ref-type="fig"}). For the body geometry the CNR of images scanned with I = 30 mA and reconstructed by ASIR50% or ASIR100% were not significantly different (p ≥ 0.29) from the CNR of images reconstructed by FBP with I = 80 mA ([Fig 5D--5F](#pone.0138658.g005){ref-type="fig"}).
SPECT Imaging {#sec016}
-------------
### HU Bias, μ Map Bias {#sec017}
CT scans of the SPECT phantom (with and without extension) were performed for different X-ray tube currents. Subsequently, the effect of a possible HU bias was examined for the μ maps and for the reconstructed counts of the SPECT images.
In the case of no extension (standard geometry, [Fig 6](#pone.0138658.g006){ref-type="fig"}), the X-ray tube current had a significant effect on the HU values and the μ maps for images reconstructed by FBP (both p \< 0.0001, [Fig 6A and 6B](#pone.0138658.g006){ref-type="fig"}). The mean of the HU values changed significantly from -0.88 ± 6.63 at I = 120 mA to 9.51 ± 25.51 at I = 10 mA (ΔHU = 10.39 ± 26.71, p \< 0.0001). The corresponding μ value changed slightly by 0.73% (Δμ = 0.0011 ± 0.0002 cm^-1^, p \< 0.0001). The different ASIR levels had no significant influence on the mean HU value (p \> 0.804) or the mean μ (p \> 0.768). However, the different x-ray tube currents did not influence the CTAC reconstructed count density inside the standard SPECT phantom (p = 0.37, [Fig 6C](#pone.0138658.g006){ref-type="fig"}). Furthermore, the CTAC reconstructed SPECT counts were not influenced by substituting CT data reconstructed by ASIR for the standard CT data reconstructed by FBP (ASIR50%: p = 0.933; ASIR100%; p = 0.738).
{#pone.0138658.g006}
The extended SPECT phantom showed a significant influence of the X-ray tube current on the mean HU values, the mean μ and the mean reconstructed SPECT counts (all p \< 0.0001, [Fig 6A--6C](#pone.0138658.g006){ref-type="fig"}). The estimated μ values were significantly decreased for X-ray tube currents of I ≤ 50 mA compared to I = 120 mA (p \< 0.0002). Additionally, the bias in μ values was propagated to the CTAC reconstructed SPECT counts. SPECT counts reconstructed with μ maps calculated from CT scans measured with I ≤ 20 mA differed significantly from SPECT data reconstructed with a μ map measured with I = 120 mA (p ≤ 0.001, [Fig 6C](#pone.0138658.g006){ref-type="fig"}). There was a decrease of 11.6 ± 1.8% (p \< 0.0001) in the mean counts when the X-ray tube current changed from I = 120 mA to I = 10 mA. For the extended SPECT phantom, the mean HU values of the ASIR50% and the ASIR100% data did not differ significantly from the FBP data (p \> 0.864).
Additionally, there was an offset in the reconstructed counts between both phantom geometries (data not shown). The SPECT counts reconstructed with μ maps from CT scans with I = 120 mA were significantly increased by 10.7% in the extended geometry compared to the standard geometry (p \< 0.0001).
Radiation Dose {#sec018}
--------------
There was a correlation between the measured CTDI~vol~ and the dose report for both CTDI~vol~-geometries. The scan protocols examined yielded CTDI~vol~-values ranging from 3.70--42.00 mGy (head geometry) and 1.87--20.77 mGy (body geometry). The correlations of the automatically documented and measured values for the CTDI~vol~ head and for the CTDI~vol~ body geometry were CTDI~vol,\ measured~ = -0.184 + 1.013 × CTDI~vol,\ documented~ (R^2^ = 1, p \<0.0001) and CTDI~vol,\ measured~ = -0.115 + 1.034 × CTDI~vol,\ documented~ (R^2^ = 0.99, p \< 0.0001), respectively. The results were documented for the different X-ray tube currents and for both CT phantom geometries ([Table 2](#pone.0138658.t002){ref-type="table"}). The calculated effective dose from the CT scan of a hybrid SPECT-CT application was documented for normal male and female patients ([Table 2](#pone.0138658.t002){ref-type="table"}).
10.1371/journal.pone.0138658.t002
###### CT exposure for the observed imaging protocol.
{#pone.0138658.t002g}
CTDI-Head Geometry CTDI-Body Geometry Dose Exposure
----- -------------------- -------------------- --------------- -------- -----------
10 3.70 (3.53) \+ 4.6 1.87 (1.78) \+ 4.6 0.4 / 0.4
40 14.07 (14.12) \- 0.4 6.93 (7.12) \- 2.7 1.5 / 1.7
80 28.03 (28.25) \- 0.8 13.93 (14.24) \- 2.2 3.0 / 3.5
120 42.00 (42.37) \- 0.9 20.77 (21.36) \- 2.7 4.5 / 5.2
Measured CT exposure (CTDI~vol,\ measured~), CT exposure automatically documented by the CT scanner (CTDI~vol,\ CT~) and the percentage deviation between CTDI~vol,\ CT~ and CTDI~vol,\ measured~ for the observed LD-CT protocol. Values were documented for the head and body geometry. The effective CT dose for a single abdominal bed position was calculated by the CT-Expo software.
Discussion {#sec019}
==========
In this paper we analyzed combinations of dose-reduced CT imaging protocols and image reconstruction algorithms with iterative noise suppression to obtain improved LD-CT images for anatomical localization and attenuation correction in hybrid SPECT-CT. We also examined the influence of decreased X-ray tube current on the reconstructed HU values. In diagnostic CT imaging a CT bias in HU values is not considered. However, for LD-CT imaging it is very important to describe effects of a potential bias in HU values concerning μ maps and attenuation correction of emission data.
Using the iterative reconstruction algorithm ASIR for LD-CT imaging, the images were less noisy compared to FBP reconstructions with identical X-ray tube currents. ASIR reduced image noise significantly and provided a noise level that was comparable to FBP reconstructions performed with higher X-ray tube currents. The magnitude of image noise reduction depended on the phantom geometry (attenuation, scatter, etc.) and the parameterization of the iterative reconstruction algorithm. The most distinct improvement with respect to image noise was achieved with ASIR100%. Through noise reduction, ASIR affected the estimated CNR too. The Catphan^®^ phantom (with and without annulus) showed the expected dependency \|CNR\| \~ √I for all the algorithms. Decreasing X-ray tube current in combination with ASIR reduced the CT-related radiation exposure, preserved or even reduced the noise level, and increased the CNR.
The images reconstructed by ASIR and by FBP showed no differences with respect to the HU values for the Catphan^®^ phantom (with and without annulus) for identical X-ray tube currents and the different material modules were well correlated for both types of reconstruction. However, there was a significant deviation in HU values (HU bias) for low X-ray tube currents (I ≤ 60 mA) for the Catphan^®^ phantom extended by the additional annulus, representing the abdominal region of a standard patient, compared to scans performed with higher X-ray tube currents. The HU bias observed for low X-ray tube currents and the artificial influence of the CTAC on the emission data was simulated by Xia et al. \[[@pone.0138658.ref010]\] for a PET-CT system. In our experimental examinations the HU bias already occurred at higher X-ray tube currents than those simulated by Xia et al. (I = 5--10 mA, U = 120 kVp, (11)). This deviation might be attributable to differences in the examined/simulated phantom geometry and the theoretical model used for the scanner vs. the CT employed (e.g. CT detector, electronic circuits, etc.). Finally, electronic noise and correction for the mean dark current of the system were discussed as possible causes of the HU bias \[[@pone.0138658.ref027]--[@pone.0138658.ref029]\].
The pure CT bias of a hybrid PET-CT system was observed by different authors \[[@pone.0138658.ref019]\]. More recently, the HU bias has been reproduced by phantom examinations for a PET-CT by Abella et al. \[[@pone.0138658.ref030]\]. Furthermore, the HU bias effect was not observed in general \[[@pone.0138658.ref018]\]. In addition, experience gathered with LD-CT imaging apart from hybrid applications (e.g. CCTA) have been reported \[[@pone.0138658.ref015],[@pone.0138658.ref016]\]. But in this field of application imaging conditions are significantly different, so that visualization of the structures of interest (e.g. arteries) are improved by the use of an additional contrast medium. Furthermore, the influence of image degrading effects (e.g. attenuation) are significantly reduced in the thoracic region compared to the abdominal region. Our set-up (abdominal region) was performed under considerably different imaging conditions, with a different focus of optimization.
The influence of the HU bias on hybrid SPECT imaging was examined with an elliptical SPECT phantom that represents a standard geometry in nuclear medicine. It is noteworthy that we did not receive functional data (SPECT data) from the CT phantom (Catphan^®^ phantom). Investigations with the sole elliptical SPECT phantom (standard patient geometry) revealed a slight HU bias and therefore only a small bias within the μ map. The reconstructed SPECT counts were not affected. This would also hold true for other regions of a standard patient with decreased attenuation (e.g. thorax, head). However, investigations with an extended version of the SPECT phantom (extended geometry), surrounded with 13 water-filled plastic bottles, which is somewhat closer to abdomen of an obese patient with increased attenuation, showed a significant bias in the HU values with decreasing X-ray tube current. The induced biases within the μ map and the reconstructed SPECT images were detected for I ≤ 50 mA (μ values) and for I ≤ 20 mA (reconstructed SPECT counts). Here, the reduction of CT exposure was limited by the bias effect in the HU values and its influence on the reconstructed SPECT information propagated by CTAC. Due to the fact that HU bias depends on the phantom geometry, the characteristic of the imaging system and the implementation of calculating μ maps from HU values, no general effect can be postulated. As a result, the HU bias should be considered as a property of the imaging system (e.g. hardware, reconstruction algorithm). Several authors have proposed new data processing technologies to overcome the influence of HU bias in LD-CT for hybrid imaging \[[@pone.0138658.ref027],[@pone.0138658.ref031]\]. A first implementation has recently become available for current hybrid PET-CT and SPECT-CT devices (Q.AC, GE Healthcare, Milwaukee, USA).
However, our study also underlines the need for complementary CT and SPECT phantoms. The standard phantoms for CT and SPECT imaging do not match perfectly (e.g. different dimensions, different composition of materials) and this hampers the optimization process for hybrid imaging systems. In our experiments the standard SPECT phantom (cross-section about 517 cm^2^) did not show a HU bias effect whereas the Catphan^®^ phantom with additional annulus (cross-section 952 cm^2^) showed the HU bias effect discussed!
Finally, the decrease in X-ray tube current was only one parameter for dose optimization. Decreasing the CT tube current reduces the number of X-ray photons, which leads to a linear decrease in radiation dose for a given acquisition time within a given scan protocol. An alternative for the optimization of radiation dose is the X-ray tube voltage. Decreasing the X-ray tube voltage lowers the hardness of the X-ray spectra and that leads to a decrease in photon penetration capacity applicable to small patients (i.e. children). The scan protocol, especially the tube voltage settings, was chosen following the strategies in diagnostic imaging. Besides, acquisitions with lower tube voltages (80 kVp, 100 kVp) were performed outside the study. But those results were not analyzed in the context of hybrid imaging with LD-CT of adult patients because of the highly reduced image quality. This effect is known from diagnostic CT imaging \[[@pone.0138658.ref032]\].
In future studies, the influence of the different ASIR-levels should be analyzed in more detail in phantom and patient set-ups to get an optimal dose reduction with respect to image quality for LD-CT applications (e.g. localization diagnostics, attenuation correction) in hybrid imaging. The iterative reconstruction algorithm examined (ASIR) was the first implementation of advanced CT reconstruction algorithms available in hybrid SPECT-CT imaging. Currently, novel implementations are coming up with a comprehensive modeling of image geometry (e.g. the physical dimension of the focal spot) and detector elements \[[@pone.0138658.ref033]\]. Studies of diagnostic CT imaging have reported a decrease in CT exposure (up to -75%) for the application of this refined algorithm \[[@pone.0138658.ref034]\], so that the use of that iterative reconstruction algorithm can further improve LD-CT in hybrid imaging devices.
Conclusion {#sec020}
==========
We have presented a systematic study for the use of an iterative image reconstruction algorithm (ASIR) for LD-CT that is widely used in diagnostic CT imaging. The algorithm was tested with regard to image quality and radiation dose management in LD-CT hybrid imaging by phantom examinations. The advantages of ASIR in LD-CT imaging were the reduction of image noise and the increase in the CNR compared to FBP reconstructions of the same CT scan. For that reason, the application of ASIR provides an opportunity to reduce CT radiation exposure without a significant impairment of image quality. However, there is a systematic limitation for CT dose reduction in hybrid SPECT-CT imaging for both reconstruction algorithms. A HU bias was observed in examinations of the extended phantom geometries (obese patients) for very low X-ray tube currents (I ≤ 20mA). The HU bias was propagated to the reconstructed SPECT counts by CTAC.
Additionally, we have underlined the need for complementary CT and SPECT phantoms.
[^1]: **Competing Interests:**The authors have read the journal\'s policy and the authors of this manuscript have the following competing interests: Oliver S. Grosser and Holger Amthauer have received research grants by GE Healthcare. There are no patents, products in development or marketed products to declare. This does not alter the authors\' adherence to all the PLOS ONE policies on sharing data and materials.
[^2]: Conceived and designed the experiments: OSG J. Ruf DC HA. Performed the experiments: OSG DK DC MT DL. Analyzed the data: OSG DK IGS. Wrote the paper: OSG DK J. Ruf CF J. Ricke HA.
[^3]: Current address: Department of Nuclear Medicine, University Hospital Freiburg, Freiburg, Germany
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Ormond Aebi
Ormond R. Aebi (February 10, 1916 – July 19, 2004) was an American beekeeper who was reported to have set the world's record for honey obtained from a single hive in one year, 1974, when 404 pounds of honey were harvested, breaking an unofficial 80-year-old record of 303 pounds held by A. I. Root. Together with his father Harry, the Aebi's wrote two books on beekeeping: The Art and Adventure of Beekeeping (1975) and Mastering the Art of Beekeeping (1979) (both currently out-of-print).
World record in honey production
Aebi held a Guinness World Record in quantity of honey produced from a hive of bees, but many others have surpassed that record. Single colonies of bees occasionally produce some spectacular crops. This is sometimes a combination a multiple queens in a hive (see two-queen beekeeping management), excellent weather conditions, or extraordinary good luck.
In 1979, Earl Emde of Big River, Saskatchewan, had several colonies produce over six hundred pounds each, though Guinness was never employed to substantiate the production. Many other beekeepers in Canada, Australia, North Dakota, Florida, and the mid-west have seen similar results on rare occasions. However, a Mr. Rob Smith of Australia surely holds the world’s most astounding result for an apiary. According to Bill Winner, Beekeeper Services Manager, Capilano Honey Company, “We can confirm the average production of 346 kilograms (762 lbs) per hive from 460 hives. (This is almost twice the Aebi claim to fame, and it is an average from hundreds of colonies, not just one hive's unique production.) The beekeeper’s name was Bob Smith from Manjimup, Western Australia. The honey was Karri. The year was 1954.” Mr. Winner adds: “This figure is confirmed by R. Manning with a reference to a journal highlighting a box titled World Record in Honey in 1954."
In comb honey production, during 1959, Karl Killion was reported to have produced 344 sections, an equivalent of approximately 600 pounds of extracted honey production.
Personal life
Ormond wrote a book on his own That Sheep Big Minnie (2003) reminiscing about his time watching his family flock in the '60s. Ormond Aebi, whose last name meant 'bee' in some language, was a third generation beekeeper. An Oregon native, Ormond was a devout Christian and served in the U.S. Army during World War II. In 1950 the Aebis moved to Santa Cruz, California and lived in the Live Oak neighborhood, where they raised bees, sold honey from their front yard and built wooden beehives from the local redwood.
He was known to have enjoyed beekeeping all his life. In 1981, Mr. Aebi told the Santa Cruz Sentinel he knew his bees so well that, when out driving, his father would say, " "Ormond, isn’t that one of our bees?," and I’ll say, "No, I don’t think so," or "Yep, sure is."
Ormond told me a curious story that day though, which I'll retell just as he told it to me. Ormond was a character with very strong beliefs, beliefs that I don't happen to share, but he was earnest and sincere and his beliefs do make for a good story. So here it is.
He said that Jesus came to him in a dream one night and told him that if he wanted to increase the productivity of his hives that he should attach a wire to the queen excluders of his hives. Jesus was very specific about the length of the wire and Ormond carefully complied with Jesus' instructions.
For those who don't know, the queen excluder is a series of parallel wires placed closely together in a bee hive. It sits between the lower brood boxes and the upper supers, the boxes where the honey is stored. It functions to keep the queen from laying eggs in the boxes that contain the honey in them. She's too big to fit between the wires, but the worker bees can still come and go unimpeded.
So Ormond attaches the precisely measured wires to the queen excluders and waits. Sure enough, just as Jesus promised in the dream, the productivity of the hives increases significantly.
Ormond is a religious man, and so he doesn't think it is too surprising that Jesus' advice worked. He mentions his experience to his beekeeping friends, and word eventually reaches the biology department of Stanford University.
Stanford University finds it surprising, very surprising.
They come to his home in Santa Cruz to investigate.
What the scientists eventually conclude is that somehow the wires that Ormond attached to his hives were acting as antennae, turning the hives into natural radios and piping in the local classical music radio station to the hives. The bees loved it. (KSCO AM 1080, if you're curious, it is now a right-wing talk radio station. I wonder what effect Rush Limbaugh would have on honey production.)
In his later years he was diagnosed with Diabetes, which did not seem to affect his health, but did contribute to his decision not to continue beekeeping when his swarms were destroyed by varroa mites. He worked as a part-time handyman at a daycare next door to his home for the last several years of his life, and continued to write to friends he made worldwide due to his books.
Addendum by someone who met Harry and Ormond Aebi in 1978 in Santa Cruz CA (Thomas Nathan Tully)
I moved to Santa Cruz CA from Maine in 1978. I rented the Aebi's earlier residence located at 1475 Eldorado Avenue in Santa Cruz CA. The house was in an area that allowed livestock and under a grandfather clause anyone who moved into that area could also have some farm animals as long as the previous home owners or renters had farm animals. If the property was ever without farm animals then the grandfathered clause would be terminated for that specific property. So I got 6 goats, a dozen hens, 4 rabbits and 3 ducks to add to the 3 bee hives that were onsight when I signed the rental agreement. These 3 hives were previously owned by the Aebis.
One day Ormond and dad Harry showed up and introduced themselves as previous owners and wanted to look in the barn for some specific beekeeping equipment they may have left behind when they moved. Ormond told me that he had moved to another location in the Live Oak community within a mile and did so by many treks with a wheel barrow. He also told me that the Lord Jesus had prompted him to move because he had his heart set on breaking the Guinness World Record for the most honey produced from one hive in one season. That feat was accomplished with 404 pounds of honey the following year after relocating. Ormond also told me that his ancestors were from Australia and his surname Aebi meant "Honey Bee".
I remembered seeing Ormond on TV as a child when broadcasts were only in black and white mode. He was demonstrating how to tend a bee hive. It was fascinating to me that I was actually talking to the same man who had a high pitched voice and still spoke caringly about his bees. It was about 15 years later and 3,000 miles from home for me.
Ormond told me that he would count the bees in each hive by placing about 5 narrow sticks on the landing board and counting the bees as they returned to the hive. He told me that their wings were smaller than what they should be because of the weight of pollen and nectar they would carry in flight. He said they would work until their wings got torn from the burden of weight they carried. He was saddened to see some bees on the ground below the landing board being consumed by ants.
Ormond had told me about his 1st book published in 1975, "The art and adventure of beekeeping". He also told me that he was writing a 2nd book in early 1979 which he would title "Honey is Money". However I see that the actual title became "Mastering the art of beekeeping" published later in 1979. Ormond was a good Christian man devoted to God first and devoted to his bees also. I am grateful to God for allowing me the opportunity to meet Harry and Ormond Aebi the extraordinary beekeepers!
In 2012 while I was away from home in Duluth MN working in Modesto CA I decided to revisit the 1-1/4 acre homestead of the Aebi beekeepers on Eldorado Ave in Santa Cruz where I once lived. Everything had changed to keep pace with the times! The house, barn and out building were gone and there were 3 homes evenly placed on the lot. That 1-1/4 acre lot must have sold to a property developer for an awesome amount of money.
The massive eucalyptus trees at the rear of the property provided a fragrance and was a gathering site for the Monarch Butterflies that would sojourn south for the winter were removed. I recall seeing the butterflies hanging on each other in clusters that resembled grapes in formation. The French Plum trees, the large Walnut Trees, the Blackberry Bushes which were all sources of nectar for the resident bees were also gone. These are memories that I want to keep alive and pass on to the willing readers of the story of the Aebi Beekeepers. I was blessed to have met Harry and his son Ormond and to have lived on their property where they cultivated their love of bees and honey.
References
Category:American beekeepers
Category:1916 births
Category:2004 deaths
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Police are still investigating this morning for an East Meadow doctor's car, as well as the man they say stole it.According to surveillance video, the
EAST MEADOW - Police are still investigating this morning for an East Meadow doctor's car, as well as the man they say stole it.
According to surveillance video, the suspect made his way into Doctor John Zaso's pediatrician's office on Merrick Avenue, sneaking into the waiting room behind a patient. The thief then made his way into Zaso's private office, snatching his set of keys, which included keys to his office, home and car.
Zaso's car is a black Jeep, which is a registered emergency vehicle, equipped with flashing red lights, sirens and a police radio.
Before leaving the building, the thief also walked out with a woman's purse. Nassau police say that the suspect is a black male, 5 foot 10 inches, in his late 30s to early 40s and was wearing a leather jacket, gray-hooded shirt and blue jeans.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
2 Delningar
Camille Paglia är en italiensk-amerikansk kultur- och konsthistoriker, i gränslandet mellan hednisk och feministisk världsbild. Hon är på samma gång lesbisk och en försvarare av män mot former av feminism hon upplever spårat ur. I hennes rika produktion finner vi bland annat Sexual Personae, där hon beskriver hur hedniska arketyper överlevt i populärkulturen. Den är även ett bra exempel på hennes intresse för mänsklig psykologi och myter (och väl värd att läsa parallellt med Bachofen och Evola). Hon spelade en central roll i de såkallade feministiska ”sexkrigen”under 1970- och 80-talen, det är i viss mån hennes förtjänst att man idag både kan kalla sig feminist och använda läppstift.
Paglia är kort sagt en mycket intressant och givande bekantskap, och min personliga favoritfeminist. Det är därför positivt, och kanske ett tecken i tiden, att Salon just nu publicerar en längre intervju med henne. Paglia ger där flera värdefulla insikter i fenomenet politisk korrekthet
Bristen på respekt
Paglia beskriver de politiskt korrekta som okunniga och hycklande. Så tar hon upp hur de kan förena krav på förståelse för islam med en nedlåtande inställning till sydstatares kristendom. Hon är själv ateist, men medveten om det djup som finns i de olika religiösa traditionerna. En liknande respekt saknas hos en Dawkins och en Hitchens. Resultatet är en hyper-politiserad miljö, Paglia skriver:
We have a whole generation of young people who are clinging to politics and to politicized visions of sexuality for their belief system. They see nothing but politics, but politics is tiny.
En effekt av detta är att kulturen blir tråkig och ointressant. Paglia tar särskilt upp politiskt korrekt humor, som hon beskriver som nedlåtande och trist. Hon jämför den med den risktagande och konfrontativa humor hon själv uppskattade under 1960-talet, och nämner Donald Trump som en bättre komiker i den skolan än en John Stewart. Trump är trots allt ”anti-PC”, och inte rädd för att vara ”elak och oförskämd”. Vi bör vara medvetna om att vi lever i en konsensuskultur, där oförskämdheter framstår som djupt problematiska så snart de inte kommer från en officiellt godkänd offergrupp (i synnerhet om de riktas mot en sådan). Detta sakernas tillstånd bör problematiseras, i varje fall om vi uppskattar ett fritt samhälle. Den insikt vi bör ta med oss är följande: ”det är ingen katastrof om någon är oförskämd mot Adam Tensta”. Debatten hittills har mer varit en pseudo-debatt, där det mer handlat om ifall någon var oförskämd mot honom, och i så fall hur mycket, och om det var medvetet. Men nog om det, åter till Camille Paglia.
Bristen på psykologi
We’re in a period right now where nobody asks any questions about psychology. No one has any feeling for human motivation. No one talks about sexuality in terms of emotional needs and symbolism and the legacy of childhood… and thus in this period of psychological blindness or inerteness, our art has become dull.
– Paglia
Bristen på respekt hänger nära samman med bristen på psykologi. Paglia har i sina böcker visat ett djupgående intresse för det mänskliga psyket, även dess mörkare sidor. Hon är exempelvis medveten om skillnaderna mellan män och kvinnor, skillnader som gör det till en grov förenkling att enbart tala om ”patriarkatet”. De flesta män lever i ett matriarkat när de börjar forma sin identitet, och den förkrossande majoritet som varken är våldtäktsmän eller bisexuella är beroende av kvinnligt samtycke för att ha ett sexliv. Paglia tar upp denna aspekt när hon beskriver Bill Clinton och Bill Cosby, två män som utsatt mängder av kvinnor för övergrepp. En bidragande orsak till detta, förutom att de båda uppenbarligen är kräk, finner Paglia i en rädsla hos båda männen. Hon skriver:
Young feminists need to understand that this abusive behavior by powerful men signifies their sense that female power is much bigger than they are! These two people, Clinton and Cosby, are emotionally infantile – they are engaged in a war with female power!
Men politisk korrekthet saknar nästan helt intresse för psykologi. En effekt av detta är att många feminister saknar förståelse och empati för de svårigheter som kan drabba män, och skillnaderna mellan män och kvinnor. Här tycks Paglia även kritisera fenomenet ”slut walks”, hon konstaterar att med den sexuella frigörelsen kom också ett ansvar för vilka situationer man försatte sig i. Hon tar också upp den utbredda kvinnliga besvikelsen över att deras manliga partners inte fungerar mer som kvinnor, en besvikelse som hade kunnat mildras om psykologiska insikter varit mer utbredda.
Bristen på allmänbildning
Paglias centrala kritik av politisk korrekthet är den brist på allmänbildning den hänger samman med. Hon har tidigare avbrutit intervjuer när frågorna blivit för ointelligenta, vilket i vår allt dummare tid får ses som en befriande attityd. Vi har idag bästsäljande ”ateister” som vet ytterst lite om religiösa traditioner och deras djup, vilket bland annat beror på att Sofokles med flera inte längre är en central del av utbildningen.
Vi har samtidigt en akademisk värld som förvandlats till det Paglia kallar ”caretaking nursery schools”. Problemet är inte bara hur lite människor vet, utan att de inte ens är medvetna om hur lite de vet. Detta är en central förutsättning för politisk korrekthet. Paglia skriver:
Now we have people emerging with Ivy League degrees who have no idea how little they know about literature or history. Their minds are shockingly untrained. They’ve been treated as fragile emotional beings throughout their schooling. The situation is worsening year by year, as teachers have to watch what they say and give trigger warnings…
Denna okunskap är en förutsättning för politisk korrekthet, känner man inte till sådant som den arabiska slavhandeln med både afrikaner och européer, eller importen av ”indentured servants” från Nordeuropa till Nordamerika, är det lätt att man inte inser hur komplext exempelvis slaveriet var. Då kan man lätt få sin bild av företeelsen från Hollywoodfilmer, och blir ett lätt offer för en binär världsbild. Detsamma gäller om man saknar kunskaper om mäns och kvinnors psykologi.
Sammantaget är Pagliaintervjun alltså väl värd att läsas, hon ger en god diagnos av vårt samhälle och visar inte minst att feminism kan vara många olika saker.
Intervjun:
Salons intervju – del två
Del ett
Mer Paglia
Camille Paglia
Camille Paglia revisited
2 Delningar
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Why is build.number an "abuse" of semantic versioning?
I was explaining a proposed build system (Gradle/Artifactory/Jenkins/Chef) to one of our senior architects, and he made a comment to me that I sort of disagree with, but am not experienced enough to really weigh-in on.
This project builds a Java library (JAR) as an artifact to be reused by other teams. For versioning, I'd like to use the semantic approach of:
<major>.<minor>.<patch>
Where patch indicates bug/emergency fixes, minor indicates backwards-compatible releases, and major indicates either massive refactorings of the API and/or backwards-incompatible changes.
As far as delivery goes here is what I want: a developer commits some code; this triggers a build to a QA/TEST environment. Some tests are ran (some automated, some manual). If all tests pass, then a production build publishes the JAR to our in-house repo. By this point the JAR should be versioned properly, and my thinking was to use the build.number that is automatically generated and provided by our CI tool to act as the patch number.
Thus, the versioning would actually be:
<major>.<minor>.<build.number>
Again, where build.number is provided by the CI tool.
The architect dismissed this, saying that using the CI build number was an "abuse" of semantic versioning.
My question is: is this correct, and if so, why? And if not, why not?
A:
Your build number won't be reset to 0, when minor and major versions increase, this violates sections 7 and 8 of the specs:
Minor version Y (x.Y.z | x > 0) MUST be incremented if new, backwards compatible functionality is introduced to the public API. It MUST be incremented if any public API functionality is marked as deprecated. It MAY be incremented if substantial new functionality or improvements are introduced within the private code. It MAY include patch level changes. Patch version MUST be reset to 0 when minor version is incremented.
Major version X (X.y.z | X > 0) MUST be incremented if any backwards incompatible changes are introduced to the public API. It MAY include minor and patch level changes. Patch and minor version MUST be reset to 0 when major version is incremented.
So, version numbers (major, minor, patch) must be provided manually, as these are used to tell your users about changes in one place without them having to look at your changelog or some other document.
If you want to include your build number, then you may append them after a + (section 10):
Build metadata MAY be denoted by appending a plus sign and a series of dot separated identifiers immediately following the patch or pre-release version. Identifiers MUST comprise only ASCII alphanumerics and hyphen [0-9A-Za-z-]. Identifiers MUST NOT be empty. Build metadata SHOULD be ignored when determining version precedence. Thus two versions that differ only in the build metadata, have the same precedence. Examples: 1.0.0-alpha+001, 1.0.0+20130313144700, 1.0.0-beta+exp.sha.5114f85.
A:
One reason is that the patch may require several builds, so if you have version 5.7, and you want to patch it to 5.7.1, but your first 2 bugfixes fail to build when they are submitted to the CI system, then you will be at 5.7.3 before you've released your first patch!
The answer is to simply use 4 digits (as Microsoft systems tend to have). The 4th is a build number and is used "for information only". Generally people put the repository version number in there (if they use SVN or TFS or similar) which is really nice as you can verify which exact commit was used to build the binaries. If you don't have such a thing, then the CI build number is a reasonable approximation (as you'd hope your CI system can remember the build numbers and tie it to the repo history, but you're not reliant on the CI system remembering them - you can never delete old builds).
One thing to note, The Microsoft schema for versioning uses the 3rd position for build numbers. Chrome uses just 1 number. Ubuntu uses the date. There is no "standard" to use, except that all numbers must increment.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
There are a lot of more of these than I was expecting, it's a great concept since so many secondary types are underused or non existent altogether (there's never been a psychic type Bulbasaur line for example), the lack of new artwork is a bit disappointing but now I'm wondering about how they'll be released in our sets. The May set will have a lot of orphaned cards with these. Unless they make an alternate type box or just save them for blister promos.
Click to expand...
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Redirect on login using macros doesn't work
Hi,
I try to use the new future of Ultimate Facebook to redirect members to own profile...and on the setting I get: members/USER_LOGIN
but when I login I'm redirect only in members
directory....why ???? Thanks
How do you rate me?
Thank you for rating your experience!
We’re thrilled to hear you had a great experience with . Would you like to leave a comment about your experience?
Thanks for voting on your experience with , we’d love to get some feedback please.
Ohh no! We’re really sorry to hear you didn’t have a pleasant experience with , we’re always looking at how we can improve and would appreciate you provide some further feedback here please.
Type your feedback here
it's great that you had a positive one. Based on your experience in this ticket would you please be kind enough to rate us externally on:
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Tag Archives: German Beer
This week’s featured beer is Spaten Oktoberfest, brewed by the Spaten-Franziskaner-Bräu located in Munich, Bavaria, which has a long history without which the history of German beer would be incomplete. Oktoberfest beer is a malty, moderately hopped, gold to copper German lager. Although Spaten’s products bear the label Seit 1397 (Since 1397), that date refers […]
Although last week’s beer was also a wheat beer, this week’s comes from a brewery that played a vital role in the history of the modern weissbier (weizenbier). By the latter half of the 19th century, the style had fallen out of popularity in Germany and was at risk of vanishing completely, but it was […]
A couple months ago, we featured a collaboration between BrewDog and Weihenstephaner. That beer, India Pale Weizen, seemed more representative of BrewDog’s style than that of Weihenstephaner, so it seems only fair that we should feature a beer from the latter. While the brewery is best known for its Hefeweissbier, I would like to introduce […]
This week’s feature is another monastic beer, one which was chosen the best of its style three times in the World Beer Cup. Brewed in the oldest monastery in Bavaria, this week’s beer is Weltenburger Kloster Barock Dunkel, a Munich dark lager with 4.7% abv. Located in Weltenburg on the Danube in Bavaria, Germany, Weltenburger […]
Our beer this week is Aecht Schlenkerla Eiche from the Heller-Bräu Trum brewery, brewed in the Franconian town of Bamberg, Germany. Schlenkerla Eiche is a doppelbock made with rauchmalz, or “smoke malt,” which is kilned during the malting process over an oak wood fire. Schlenkerla Eiche is sold only during Christmastime and is exported in relatively […]
Like this:
As our little group walked down the rather dreary central shopping arcade we could hear strains of vaguely German sounding music coming from up ahead. There in a small corner park was the stage, covered in musicians playing Studio Ghibli tunes to a beer swilling, sausage munching crowd. The Oktoberfest had come to Maebashi. I […]
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Since the clinical use of nitrogen mustard as an anticancer agent in the 1940s for the first time in the world, numerous anticancer drugs have ever been developed. Actually, for example, antimetabolites such as 5-fluorouracil, antitumor antibiotics such as adriamycin, platinum complex such as cisplatin, and plant-derived carcinostatics such as vindesine have been subjected to clinical use.
However, most of these carcinostatics have significant side effects such as digestive disorders, myelosuppression and alopecia since they are cytotoxic also to normal cells. Due to the side effects, their range of application is limited. In addition, the therapeutic effects themselves are partial and short, in most cases.
Developments of new carcinostatics in place of these has been made; however, satisfactory results have not yet been obtained. Patent Documents 1, 2, 3 and 4 disclose that certain kinds of compounds have fibrosing inhibitory actions, antitumor actions and STAT3/5 activation inhibitory actions, respectively. However, it is not known whether the specific compounds of the present invention have an antitumor effect.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Comorbidity profiles among adult patients with juvenile idiopathic arthritis: results of a biologic register.
This study aims to assess the prevalence of comorbidities in adult JIA and the impact of comorbidity on patients' perceived health state. Self-reported comorbidity was studied in 344 adult JIA patients who have been included in the biologic register JuMBO. The comorbidity prevalence among the patients was compared to an age- and sex-matched reference group from the population. The correlation of comorbidity with clinical and demographic parameters was analysed by linear or logistic regression models. Sixty two percent of the JIA patients reported at least one comorbidity. Uveitis was the most common comorbid condition (17.7%), followed by allergic rhinitis (14.5%), migraine (8.7%), and atopic dermatitis (8.7%). The prevalence of cardiovascular disorders was 9.9%, which was not higher than that in the population. However, patients with a systemic onset of JIA (soJIA) had a substantially higher rate of cardiovascular diseases of 40.6% (p=0.033). Patients with soJIA also had the highest prevalence (80.0%) and the highest mean number (1.8) of comorbidities. Patients with at least one comorbid condition suffered more often from fatigue and pain, had a lower functional capacity (p<0.001, each), and a lower physical and mental health-related quality of life than those without comorbidities (p<0.001 and p=0.017, respectively). The presence of any comorbidity and the level of disease activity were independent predictors of a lower SF-36 score. Our results indicate that comorbid conditions have a significant impact on the perceived health state in adult JIA. Among all JIA patients, those with systemic onset carry the highest risk for comorbidities, in particular for cardiovascular disorders.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Contact Principal Investigator / Project Leader: Yang, Mary Organization: University of Arkansas Little Rock Title: DEVELOP NOVEL DEEP LEARNING AND COMBINATORIAL OPTIMIZATION METHODS TO IDENTIFY KEY DISEASE REGULATORY ELEMENTS FOR SINGLE-CELL DATA Abstract Text: Description: Traditional bulk sequencing measures the average of cell population constituents, inevitably masking the intrinsic cell-to-cell heterogeneity. Single-cell technologies, on the other hand, enable a high-resolution measurement for each individual cell, providing new opportunities to capture cell population diversity and dissect the heterogeneity of complex diseases. Meanwhile, the high-sparsity and the relatively small number of sequencing reads pose new data analytic challenges. In this proposed project, we will develop innovative computational methods for single-cell RNA sequencing (scRNA-seq) data analysis and integration to identify key regulatory elements that underlie disease heterogeneity and drive disease development. The scRNA-seq data contains substantial proportion of zero expression counts due to low capture efficiency and stochastic gene expression. We will develop a novel data-driven deep learning model to recover the missing values. Our model utilizes a deep learning algorithm to capture complex and latent distributions of missing values without assuming an underlying distribution, thus, ensuring effective performance across various scRNA-seq generated by different protocols. scRNA-seq profiles enable characterization of unique transcriptome for each cell type. We hypothesize that disrupted expression patterns accompanying the disease development in different cell types are controlled by sequential alterations of the activity and connectivity in the regulatory networks. Hence, using scRNA-seq data, we will first infer cell lineage trajectories. Then, we will develop a novel deep neural network method to reconstruct cellular regulatory networks according to pseudo-time ordering of the cell types. With a new network alignment model, we will exploit the dynamic changes of regulations in the disease process, revealing key regulators and providing cell type-specific drug targets. The fulfillment of the proposed project will facilitate single-cell genomic and biomedical research efforts allowing for a much broader, cross-disciplinary understanding of the underlying mechanisms of complex diseases. The proposed project will be devised into capstone projects and will be primarily completed by undergraduate students under the PI's supervision with the assistance of a graduate student. The project will serve as a vehicle to equip undergraduate students with essential research skills and interdisciplinary knowledge, and to stimulate the students' ambition to pursue careers in the biomedical science. This project will create a multidisciplinary platform in a comprehensive university setting that encourages undergraduate students to engage in biomedical research.!
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Clean Energy Climate Bill Gives Coal a Competitive Future
America's future climate law began working its way through Congress this week, rewritten with new details and changes that were negotiated to give the coal industry generous incentives and the regulatory certainty to compete for a place in the nation's energy future.
Here's how Rep. Rick Boucher of Virginia, a lead negotiator for coal state Democrats on the House Energy and Commerce Committee, described the deal they worked out:
I've been working extensively to fashion a controlled program that Congress can adopt which will preserve coal jobs, create the opportunity for increasing coal production and keep electricity rates in regions like Southwest Virginia affordable. The compromise that I have reached with Chairman Waxman achieves those goals.
Boucher and fellow coal state Democrats cut those deals with the bill's authors, Reps. Henry Waxman and Ed Markey, with President Obama – a "clean coal" supporter – giving them a free hand to arrive at the formula that would secure the votes needed for passage.
Although the president called for a polluter-pays 100% auction of carbon allowances when he asked Congress for a climate law, the now 932-page American Clean Energy and Security Act of 2009 does the precise opposite: It contains a formula that gives most of the allowances to polluters for free – with about a third of them going to the coal-dominated power industry at no cost.
The free allocations were one major reason that Greenpeace withdrew support for the bill within hours of its introduction, but most of those in the climate community who have weighed in so far have been willing to swallow compromises that would have been unthinkable in January. Al Gore's support for the bill remains undiminished. Paul Krugman at The New York Timessummed up the prevailing attitude best:
The legislation now on the table isn't the bill we'd ideally want, but it's the bill we can get — and it's vastly better than no bill at all.
As climate actors start wading further into the details of the bill's provisions, however, they may find themselves hard pressed to justify passive acquiescence while enduring the certain further weakening of the bill on the Senate floor.
Ground zero of the contention centers around coal, an embattled industry which emerged from the negotiations with a surprisingly good deal. The bill contains performance standards for new coal plants that are weaker than those in the original Waxman-Markey discussion draft, funnels billions in funds and incentives to the development of "clean coal," and strips EPA of authority to proceed with development of regulations for smokestack CO2 produced by the industry.
Further, although the bill imposes a gradual economy-wide emissions cap, the penalty for non-compliance or failure to achieve target reductions would amount to no more than a slap on the wrist, given the low price permits are expected to fetch on the market for some time.
Mainstream environmental groups, however, are focused on what they would get in exchange — the holy grail of their climate campaign — the establishment of an economy-wide cap-and-trade system whose efficacy they believe can be increased over time. The bill also legislates valuable and groundbreaking support for clean energy, energy efficiency and green jobs, using federal law to erect economic pillars vital for eventually transitioning to a clean energy economy.
They seem satisfied even though the new bill also reduced the proposed national standard on renewable energy from 25% to 20%, compared to the first draft, diminishing its potential competitive pressure on coal.
All sides are now wading through the details of the massive bill, spinning messages and planning strategies for the political battle that is likely to continue for the duration of the year. It is unlikely that the parameters of coal's good deal will substantially change during this week's committee mark-up, but in the coming months, the future of coal will be a major topic of concern.
The continued growth and survival of coal brings three strikes against the bill in every climate campaigners handbook: It's the source of the lion's share of global CO2 emissions, it creates a weak negotiating position when across the table from China, and it fails to show the kind of leadership the world will want to see from the U.S. in Copenhagen.
Weakened Standards and Large Bonuses
The discussion draft of the Waxman-Markey bill contained performance standards for new coal plants that had some real bite. For starters, the draft stipulated that after January 1, 2015, no coal plants thatemitted more than 1,100 pounds of CO2 per megawatt-hour would be permitted for construction. That's a natural gas standard of performance, something that no coal plant can currently do, so it looked as if after 2015, no coal plants could be built unless they could capture and store their emissions. But the current bill has relaxed the standard in both definition and start date (see page 91).
Utilities may build coal plants permitted between now and 2020, as long as by 2025, these plants "achieve an emission limit that is a 50 percent reduction in emissions of the carbon dioxide produced by the unit." The language stipulating specific rate of emissions per megawatt-hour has been removed.
At the heart of the standard is the assumption that carbon capture and sequestration technology will be available for commercial deployment so that industry can comply. The bill is silent on what happens if CCS technology is not ready or proves unworkable.
It is possible that these new coal plants would be permitted to continue operations through a relaxation of the legal standard, since EPA even now cannot enforce a technology standard that cannot be met. Companies in the UK are already negotiating for an opt-out clause there if CCS is not ready in time.
Utilities in violation in any case would not be shut down, but would face penalties — set by the bill at two times the "fair market value of emissions allowances" (see page 427). The EPA estimates that a permit for a ton of CO2 would sell for only about $15 in 2020. That makes it possible for industry to plan to pay for non-compliance as the penalties would be relatively cheap, especially when compared to penalties under the acid rain cap and trade program, which are $2,000 per ton of pollutant in excess of allowance.
If the coal plants succeed in capturing and sequestering CO2 on the other hand, the owners stand to reap huge profits. First, the bill reserves 2% to 5% of allocations to pay for the development of CCS, which would amount to tens of billions of dollars of federal support for industry out of the gate, supplemented by an additional $1 billion annually made available through a small ratepayer levy.
The bill also provides enormous bonus allowances for the first movers of CCs technology potentially worth tens of billions of dollars. For every ton of CO2 that it sequestered, a utility would receive a bonus allowance many times more generous than the open carbon market would provide, from a minimum of $50 a ton to a maximum of $90 a ton for every ton of carbon sequestered.
EPA to Lose Primary Authority over CO2
In March 2008, Lisa Heinzerling of Georgetown Law School testified before Congress to explain the implications of Massachusetts v. EPA, the landmark case decided by the U.S. Supreme Court. In no uncertain terms, Heinzerling, an expert on the Clean Air Act who now works as an advisor to EPA Administrator Lisa Jackson, testified that the agency must regulate CO2 from power plants as a result of the decision.
It was a prospect that sent shivers through the fossil fuel industry, fearful of an uncertain and protracted regulatory process. The Waxman-Markey bill, through amendments to the Clean Air Act, imposes limitations on the authority of EPA to proceed. The bill devotes an entire title, Title VII, to the amendments (see page 590), which prohibits any greenhouse gas, including CO2, from being listed as a "criteria pollutant" or a "hazardous air pollutant" on the basis of their effect on climate change.
The bill also does not permit greenhouse gases to trigger New Source Review, nor affect the granting of a permit to operate under Title V of the Clean Air Act.
In short, the legislation rewrites the law so that the impact of Massachusetts v. EPA is narrowed in scope and Congress takes the lead on GHG regulation. With coal state lawmakers controlling the swing votes, however, some groups like Greenpeace would rather see EPA in charge of setting the rules on climate protection.
Kansas and New Hampshire
In recent years, the utility industry has had an almost impossible time proceeding with construction of new coal plants. Sierra Club's Beyond Coal campaign has halted close to 100 projects, forcing industry to look to extending the life of its aging fleet of existing plants, which on average are close to 40 years old.
A look at circumstances in two cases — one in Kansas and one New Hampshire — shows how a proposed new plant and the upgrading of an aging plant, respectively, would proceed even if Waxman-Markey is signed into law. The long time horizon before the law begins to bite in 2025 — when allowance auctions begin and performance deadlines hit — means the regulations have little chance to impact the behavior of corporations, which can barely contemplate a decade of strategic planning.
Evidence of this comes recently from Kansas, where the new governor recently signed a surprise deal with Sunflower Electric to allow construction of a new coal plant that would send 75% of its electricity to customers out of state. The deal signaled a reversal of two years of effort championed by former Gov. Kathleen Sebelius, now Obama's Health Secretary.
The utility said it planned to break ground on construction within 10 months, fully aware of pending federal legislation that would impose a price on carbon and emissions standards on new plants eventually. There are no plans to make the plant ready for a CCS retrofit.
Similarly in New Hampshire, PSNH's Merrimack Station, the largest single source polluter in the state, is moving ahead with a massive upgrade despite the opposition from leading local businesses, including Stonyfield Farms and Timberland.
The nearly half-billion dollars worth of upgrades won't do anything to reduce the plant's carbon emissions, but will allow the utility to reap an extra $20 million to $25 million a year from ratepayers. The state legislature, under the influence of the utility lobby, is turning a blind eye to the survival strategy of a dinosaur responsible for close to half of the CO2 emissions in the state.
Waxman-Markey is silent on the regulation of aging plants like these, presuming the carbon cap embedded in the bill will force needed changes through market mechanisms. PSNH, undeterred by the pending federal legislation, is already proceeding with construction on the half billion dollar upgrade.
There is some optimism within the climate community that market forces unleashed by the cap-and-trade program will put sufficient pressure on coal to force plants to close or diminish new construction in the coming decade. But the satisfaction within industry at the currently negotiated outcome is causing concern among others that the cap is far too weak to have an effect for decades.
It calls for a 4% reduction in U.S. emissions below 1990 levels by 2020, which is far below the EU target of a 20% reduction. The market signal may be barely audible. Indeed, one industrial Fortune 100 company with a carbon-intensive product line has been advised by three separate teams of consultants about the impact of a carbon price upon its business. Independently, the consultants reported that the impact in 2020 would be negligible, according to a company executive not authorized to speak publicly.
And even after 2020, one watchdog group was skeptical of success in ever making polluters pay. In a statement released today, Public Citizen had this to say:
We should not assume that a future Congress will hold fast to today's pledge to hold polluters accountable in 20 years. In fact, using history as a guide, these polluters will simply ramp up their lobbying and influence-peddling in an effort to again stall the day of reckoning when their greenhouse gas emissions carry a price.
Climate advocates still have time to reassess where this legislation is headed. For now, official statements are supportive, though laced with carefully wrought caveats about the need for strengthening its climate protection mechanisms. The 932 pages have been publicly available for only a few days, and the first order of business is getting the bill out of committee and onto the House floor.
It remains to be seen how hard lawmakers will allow themselves to be pressed to dial back the generous cards being handed to coal-fired power generation in particular, and the massive bet they are making on a future in which greenhouse gases will kept out of the atmosphere and instead buried underground.
No one can dispute that politics has trumped science in the design of this law — at least considering the gradual pace of emissions reductions contemplated for the next decade or two. And there is great concern that this climate bill in Copenhagen will look like too little too late from an administration that has promised global leadership on climate change.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Throughout the entire Zelda series there are characters that are essential to the game’s story and others that aren’t quite as important. Some characters are memorable because they deliver comic relief to an otherwise dramatic story. Other characters are molded into our memory forever due to extreme annoyances. These are the characters to make my top five minor character list.
5 — Navi
To me, Navi, while important to the story’s progression, makes this list because of her constant “Hey! Listen!” You guys know exactly what I’m talking about. Every time you get to something for the first time, you have to listen to what she has to say. When you walk up to a door with vertical bars, she proceeds to tell you that the door cannot be opened normally and you must find a way to open it. If you discover a door with a lock and chain on it, she tells you the door is locked and you have to get a key in order to open it. C’mon, Navi. It’s obvious that you need a key to unlock the door. She stops you ever so often to hint at what you should be doing or where you should go next.
4 – Castle Guards
I don’t know about you, but I love the Hyrule Castle guards. They look all tough in their armor with those silver helmets and jousting sticks. One of my favorite parts of this game is sneaking past all the guards. Not because it’s difficult, but because it’s fun. It makes me feel mischievous and there’s just something super cool about running around similar to a spy, having to avoid being caught and thrown out of the castle just to start the process all over again that’s so intriguing.
3 – Mido
Mido? Who does he think he is, the leader of the Kokiri Forest? He’s so smug. He’s only jealous because the Great Deku Tree has called upon Link. I will give him this, he has spunk. No matter what happened or how popular Link was to become, Mido never changed. He was true to himself. Personally, I think it’d have been cool to see Mido playing a much bigger role than just trying to stop you from seeing The Great Deku Tree and going into The Lost Woods later in the game.
2 – Kaepora Gaebora
Say what you will about Kaepora Gaebora’s ability to trick you into listening to his advice multiple times, but he is important. You first run into Kaepora Gaebora as you’re leaving Kokiri Forest and he gives you some advice. He basically emphasizes your need to meet Princess Zelda right away. He pops up in a few random places here and there. You see him at the top of Death Mountain and he compliments you on your progress thus far and offers you a quick lift all the way to the bottom of the mountain. Some say that he is a distraction that only makes it take a bit longer to complete the game due to having to hear his advice every time you bump into him. Kind of similar to Navi, although she is much more annoying than him.
1 – Malon
Number one on this list, and my personal favorite minor character is Malon. First off, she’s so adorable with her red hair and her little outfit. She’s such a sweet, innocent little girl who teaches you the song to call upon your noble steed, Epona. Once you learn this song, no matter where you are in Hyrule Field, you can play Epona’s song and she’ll come running to your side. Another reason I picked Malon is because without Epona, you’re left walking, rolling and jumping across Hyrule’s incredibly vast kingdom which often times takes much longer than riding Epona. To me, having an innocent child only teach you one thing that is immensely helpful throughout around eighty percent of the game, shows how much one person—be it a small child or an adult—can have such an effect on an entire adventure. Not to mention Malon made it much easier to progress through the quest to rid the Hylian kingdom of Ganondorf. Thank you, Malon, for making transportation faster.
The Legend of Zelda has always had a multitude of characters to know and love. Of course, some characters are chosen for major roles while others are cast as very minor roles. For example, Link’s companion in each game is a vital part of the storyline and is a major player. Others such as Malon, who teaches you a song to call a character that essentially has nothing to do with plot development, aren’t quite as important to the main quest. Ocarina of Time isn’t the only great game in the series, but it is one of the most important to me as it was the very first Zelda title I ever played. So that’s my top five minor character list from OoT. Which characters made your list?
By: Brandon Brock
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Vav proteins are a family of evolutionarily conserved molecules that contain a series of protein--protein interaction domains, including SH2 and SH3 domains, and a Dbl homology domain that acts as a Rho GTPase family guanine nucleotide exchange factor (GEF). The first identified Vav protein, Vav1, is highly expressed in the immune system, whereas Vav2 and Vav3 are ubiquitous and are highly expressed in the nervous system[@b1][@b2][@b3][@b4]. While the function of Vav in the immune system has been well studied, the understanding of Vav proteins in the nervous system is limited. Nevertheless, Vav proteins have been implicated in axonal growth and guidance, cerebellar development and plasticity[@b3][@b4][@b5][@b6]. Furthermore, Vav2 and Vav3 single-knockout mice exhibit evidence of sympathetic neuron hyperactivity, including elevated release of noradrenaline, adrenaline and dopamine[@b7][@b8], suggesting Vav proteins have a neuromodulatory role in the nervous system.
To explore the molecular mechanisms underlying the regulation of behaviour, we are studying locomotion in the model system *Caenorhabditis elegans*. *C. elegans* locomotion is governed by a small network of command interneurons that are postsynaptic to glutamatergic sensory neurons and presynaptic to the motor neurons that drive locomotion ([Fig. 1a](#f1){ref-type="fig"})[@b9][@b10][@b11][@b12]. Excitatory signalling from the sensory neurons to the command interneurons promotes locomotion[@b13][@b14]. This simple locomotory control circuit and the fact that the *C. elegans* genome encodes only one Vav family member, *vav-1* (ref. [@b15]) make *C. elegans* a valuable experimental system to help dissect the role of Vav proteins in the nervous system. Previously, *vav-1* was shown to regulate several rhythmic behaviours[@b15][@b16][@b17]. Here, we show that loss of *vav-1* function disrupts normal motor circuit activity. While *vav-1* mutants exhibit normal sinusoidal locomotion and nervous system development, they display increased locomotory velocity and elevated motor circuit activity. Moreover, by restoring VAV-1 expression in a single interneuron (ALA), the elevated motor circuit activity of *vav-1* mutants can be returned to a wild-type (WT) level. Finally, we have found evidence that VAV-1-dependent signalling in ALA opposes the activity of the command interneurons that directly promote motor circuit activity and animal locomotion ([Fig. 1a](#f1){ref-type="fig"}). Together, our results suggest that VAV-1 has a crucial role in regulating a neural circuit required for controlling motor neuron activity, which controls the rhythm of sinusoidal locomotion.
Results
=======
*vav-1* mutants have an elevated rate of locomotion
---------------------------------------------------
In *C. elegans*, loss-of-function mutations in *vav-1* result in severely defective pharyngeal pumping, which leads to larval lethality, since animals cannot feed. Selective expression of *vav-1* in pharyngeal tissue completely restores pharyngeal activity and animals develop into sexually mature adults[@b15]. However, in rescued *vav-1* mutant animals, referred to as *vav-1* mutants from this point forward, defects in other tissues are observed, including abnormal ovulation, fertilization and defecation cycle timing[@b15]. While documenting these adult phenotypes, we observed that *vav-1* mutants are more active than WT worms. To quantify the locomotory behaviour of *vav-1* mutants, we measured the crawling speed of animals moving on an agar surface seeded with bacteria. Consistent with our observations, *vav-1* mutants show an increase in crawling velocity compared with WT animals ([Fig. 1b](#f1){ref-type="fig"}). To determine whether this elevated locomotion was the result of disrupted VAV-1 function, we introduced a WT *vav-1* genomic construct into *vav-1* mutants and found that this rescues the elevated locomotion phenotype ([Fig. 1b](#f1){ref-type="fig"}). Importantly, although *vav-1* mutants travel faster than WT worms, they maintain a normal sinusoidal mode of locomotion and normal posture ([Fig. 1c](#f1){ref-type="fig"}), indicating coordinated motor output.
*vav-1* mutants have elevated motor circuit activity
----------------------------------------------------
Since Vav proteins are expressed in the nervous system, we hypothesized that VAV-1 acts in the nervous system to regulate motor activity. To investigate the role VAV-1 may have in the nervous system, we employed a pharmacological assay using the small-molecule aldicarb. Aldicarb is an acetylcholine (ACh) esterase inhibitor, which prevents the breakdown of the excitatory neurotransmitter ACh at synapses of neuromuscular junctions (NMJs)[@b18]. In *C. elegans*, exposure to aldicarb leads to progressive paralysis over time[@b18]. Moreover, mutations that increase synaptic transmission cause hypersensitivity to aldicarb, and those that decrease synaptic transmission cause resistance to the drug[@b18]. Strikingly, we found that *vav-1* mutants are hypersensitive to aldicarb and become paralysed more rapidly than WT animals, indicating excessive synaptic transmission ([Fig. 2a](#f2){ref-type="fig"}). Similar to the hyperactive locomotion detected in *vav-1* mutants, the increased sensitivity to aldicarb can be rescued by expression of a WT *vav-1* genomic fragment in *vav-1* mutant animals ([Fig. 2a](#f2){ref-type="fig"}). Importantly, aldicarb hypersensitivity is consistent with the increased rate of locomotion observed in *vav-1* mutants, suggesting that VAV-1 negatively regulates motor circuit activity. Thus, to test whether *vav-1* activity is required in the nervous system, we selectively expressed the *vav-1* complementary DNA in the nervous system of *vav-1* mutants using a pan-neuronal promoter from the *aex-3* gene[@b19]. Accordingly, we found that neuronal expression of *vav-1* can rescue the aldicarb hypersensitivity caused by loss of *vav-1* ([Fig. 2b](#f2){ref-type="fig"}). Similarly, we found that knocking down VAV-1 expression by neuronal-specific RNA interference (RNAi) causes aldicarb hypersensitivity similar to that of *vav-1* mutant worms ([Fig. 2c](#f2){ref-type="fig"}). These data suggest that *vav-1* activity is required in the nervous system to inhibit motor circuit activity.
To further explore the neuronal function of VAV-1, we utilized transgenic animals that express channelrhodopsin-2 (ChR2) specifically in cholinergic (excitatory) and GABAergic (inhibitory) motor neurons. ChR2s are light-gated ion channels that nonspecifically allow the flow of cations into a cell, leading to electrical excitation[@b20]. Thus, activation of ChR2 in cholinergic neurons results in a visible and measurable body wall muscle contraction as quantified by the percent change in overall length of the animal ([Fig. 2d](#f2){ref-type="fig"})[@b20][@b21]. In contrast, activation of ChR2 in the GABAergic neurons results in a visible and measurable body wall muscle relaxation ([Fig. 2e](#f2){ref-type="fig"})[@b21]. Activation of cholinergic ChR2 in the *vav-1* mutant background results in enhanced muscle contraction compared with WT animals ([Fig. 2d](#f2){ref-type="fig"}). In addition, we found that activation of GABAergic ChR2 results in enhanced relaxation in the *vav-1* mutant background compared with the WT background ([Fig. 2e](#f2){ref-type="fig"}). These findings suggest that *vav-1* mutants have hyperexcitable motor neurons, and further indicate that VAV-1 may play an inhibitory role in regulating motor circuit activity.
However, it is possible that the *vav-1* mutant aldicarb hypersensitivity and excessive response to ChR2 activation are caused by muscle cell defects. For instance, heightened muscle cell response to neurotransmitters could explain these phenotypes. Therefore, we tested the sensitivity of *vav-1* mutants to levamisole, an ACh receptor agonist. Similar to aldicarb, levamisole causes paralysis over time. Levamisole activates postsynaptic muscle cells, so paralysis occurs independently of presynaptic (neuronal) defects[@b18]. Analysis of levamisole-treated animals revealed that *vav-1* mutants responded like WT animals ([Fig. 2f](#f2){ref-type="fig"}), indicating normal activity of muscle in *vav-1* mutants. Taken together, our data indicate that VAV-1 acts in the nervous system to regulate motor circuit activity.
Since internal metabolic signals resulting from being well-fed or starved can influence the rate of locomotion of *C. elegans*[@b22], and mutations in genes affecting feeding can lead to aldicarb hypersensitivity[@b23], it is possible that *vav-1* mutants do not feed as well as WT animals, resulting in enhanced locomotion and aldicarb sensitivity. However, this is unlikely because mutant *vav-1* animals develop at a similar rate as WT animals; we regularly obtain synchronized populations of adult WT and *vav-1* animals for use in assays described here. Furthermore, we investigated fat accumulation in adult *vav-1* mutants by Oil-Red-O staining[@b24] and found that *vav-1* mutants were indistinguishable from WT animals ([Supplementary Fig. 1](#S1){ref-type="supplementary-material"}). These data indicate that *vav-1* mutants develop at a similar rate and have similar metabolic activity as WT animals.
*vav-1* is expressed in different classes of neurons
----------------------------------------------------
To determine which neurons may require VAV-1 function for normal locomotion and motor circuit activity, we used a standard reporter gene fusion approach[@b25] to express fluorescent proteins (green fluorescent protein (GFP) and mCherry) under control of the *vav-1* promoter[@b15]. For this analysis, we used the same genomic sequence for the *vav-1* promoter that rescued the elevated crawling speed and aldicarb hypersensitivity of *vav-1* mutants when driving expression of WT *vav-1* ([Figs 1b](#f1){ref-type="fig"} and [2a](#f2){ref-type="fig"}). The fluorescent proteins were targeted to the nucleus by a nuclear localization signal to aid in cell identification. We observed fluorescence in expected tissues, such as the pharynx and intestine[@b15], as well as in a small set of neurons. In five independent reporter lines generated, fluorescence was regularly observed in the ALA interneuron. To confirm the identity of this cell, we crossed a *vav-1* mCherry reporter line into animals carrying an ALA neuron marker, IDA-1::GFP, and observed co-localization ([Fig. 3a](#f3){ref-type="fig"}). Interestingly, the ALA interneuron has been implicated in regulating sleep-like behaviour[@b26]. In addition, we observed variable reporter expression in cholinergic motor neurons in the ventral nerve cord ([Fig. 3b](#f3){ref-type="fig"}), which are required for locomotion, but did not observe expression in GABA motor neurons of the ventral nerve cord. Rather, the *vav-1* reporter was expressed in two GABA motor neurons in the head, known as RME dorsal and RME ventral, which regulate head oscillations ([Fig. 3c](#f3){ref-type="fig"}). Several cell types were found to be negative for *vav-1* reporter expression. We found that our *vav-1* reporters did not show co-expression with markers of dopaminergic neurons (*Pdat-1::GFP*)[@b27], command interneurons of the locomotory circuit, which directly activate motor neurons (*Pglr-1::RFP*)[@b28] or with a marker of a small set of sensory neurons (AWC and ASE neurons, marked by *Pceh-36::RFP*)[@b29] ([Supplementary Fig. 2](#S1){ref-type="supplementary-material"}). In sum, fluorescent *vav-1* reporters are expressed in a small subset of neurons that comprise multiple cell types, including an interneuron, cholinergic motor neurons and a small subset of GABAergic motor neurons.
VAV-1 is not required for neuronal development
----------------------------------------------
Previous studies have indicated that Vav proteins in *Drosophila* and in mice are important for neuronal development[@b3][@b4][@b5]. Specifically, these studies have shown that Vav proteins are required for axonal guidance and cell migration events in the developing nervous system. Since defects in production or release of the inhibitory neurotransmitter GABA can cause aldicarb hypersensitivity due to increased excitability at the NMJ[@b30][@b31], we reasoned that improper development (for example, differentiation, axon guidance or cell migration) of GABAergic neurons or impaired GABA release could explain the aldicarb hypersensitivity phenotype of *vav-1* mutants ([Fig. 2a](#f2){ref-type="fig"}). Although we did not observe *vav-1* reporter expression in ventral nerve cord GABAergic motor neurons in adult animals, we cannot rule out embryonic expression or non-cell autonomous roles in GABAergic neuronal development. Thus, to examine GABAergic motor neuron development and synapse formation, we utilized existing transgenic strains carrying either a soluble GFP or a GFP synapse marker (GFP-tagged synaptobrevin, GFP::SNB-1), each driven by a GABAergic neuron-specific promoter[@b32]. These transgenes were introduced into the *vav-1* mutant background. Analysis of the soluble GFP marker in *vav-1* mutants indicated that all 26 GABAergic neurons differentiated and were present in their proper locations, and circumferential axon projections (commissures) were present and did not display defects in connectivity ([Fig. 4a,b](#f4){ref-type="fig"}). Furthermore, using the GFP::SNB-1 marker[@b32], we could identify and characterize presynaptic regions between motor neurons and adjacent muscle cells in the dorsal nerve cord (DNC) (at the NMJ), which appear as fluorescent puncta ([Fig. 4c](#f4){ref-type="fig"}). Comparing the distribution and fluorescence intensity of mutant and WT synaptic puncta can reveal defects in synaptic vesicle organization and kinetics[@b33]. As indicators of synaptic development and function, we used four parameters to analyse the synapses of *vav-1* mutants: the number of synaptic puncta per 20 μm of the DNC (density), the area of puncta, the fluorescence intensity of puncta and the interpunctal fluorescence intensity (intensity of the axon between synaptic puncta). From these analyses, we found *vav-1* mutant animals have a normal number of GABAergic synaptic puncta per length of the DNC ([Fig. 4d](#f4){ref-type="fig"}, left *y* axis), and the puncta were of normal size ([Fig. 4d](#f4){ref-type="fig"}, right *y* axis), which indicates normal development. Moreover, fluorescence intensity of puncta ([Fig. 4e](#f4){ref-type="fig"}, left *y* axis) and fluorescence intensity of the DNC between puncta (interpunctal intensity) ([Fig. 4e](#f4){ref-type="fig"}, right *y* axis) in *vav-1* mutants are indistinguishable from WT animals, suggesting normal synaptic activity.
To further investigate GABA motor neuron function, we utilized a pharmacologic approach. Pentylenetetrazole (PTZ), a GABA~A~ receptor antagonist, induces seizure-like behaviours in mutants with defects in GABA signalling[@b34]. We exposed *vav-1* mutants to PTZ and found that, unlike mutants with defects in GABA production, *vav-1* mutants did not display seizure-like behaviour ([Table 1](#t1){ref-type="table"}). These data indicate that GABA motor neuron activity is not impaired in *vav-1* mutants. This conclusion is further supported by the response of *vav-1* mutants to levamisole. Indeed, mutations that disrupt GABAergic motor neuron function cause levamisole hypersensitivity due to faulty inhibitory neurotransmission to the body wall muscle[@b30][@b31], whereas we observed a normal response to levamisole in *vav-1* mutants ([Fig. 2f](#f2){ref-type="fig"}). Together, these data indicate that GABAergic neurons in *vav-1* mutant animals develop normally and form proper synapses.
Since *vav-1* reporter expression was observed in the cholinergic motor neurons, we next investigated the organization of these neurons and their synapses in *vav-1* mutants. First, we analysed the development of the cholinergic nervous system using a cholinergic-specific soluble mCherry (*Punc-17::mCherry*)[@b35] in the *vav-1* mutant background. From this analysis, consistent with their normal sinusoidal locomotion, we found that cholinergic motor neurons of *vav-1* mutants have normal cell positions, axon development and morphology, and were indistinguishable from WT animals ([Supplementary Fig. 3](#S1){ref-type="supplementary-material"}). To further examine cholinergic neuron development, we investigated cholinergic synapse formation using a transgenic strain that expresses the same GFP-tagged synaptobrevin as in [Fig. 4c](#f4){ref-type="fig"}, but specifically in cholinergic motor neurons (*Punc-129::GFP::SNB-1*)[@b33]. We found that, similar to GABA motor neuron synapses, synapses at cholinergic NMJs are present and appear to be organized normally in *vav-1* mutants ([Fig. 4f](#f4){ref-type="fig"}). Examination of puncta number ([Fig. 4g](#f4){ref-type="fig"}, left *y* axis), the size of individual synaptic puncta ([Fig. 4g](#f4){ref-type="fig"}, right *y* axis), as well as the fluorescence intensity of puncta ([Fig. 4h](#f4){ref-type="fig"}, left *y* axis) and interpunctal intensity ([Fig. 4h](#f4){ref-type="fig"}, right *y* axis) in *vav-1* mutants revealed no differences from WT animals, indicating that VAV-1 does not have a role in cholinergic motor neuron synaptic development.
As *vav-1* reporters are expressed in the ALA interneuron, we also investigated the development of this neuron in *vav-1* mutants. Using a fluorescent ALA reporter, IDA-1::GFP, we found that the ALA cell body is visible in the dorsal ganglion adjacent to the nerve ring of WT and *vav-1* animals ([Fig. 4i](#f4){ref-type="fig"}, left two panels). In addition, axonal projections that extend laterally on both sides of the animal to the posterior end are also present in WT and *vav-1* animals ([Fig. 4i](#f4){ref-type="fig"}, right two panels). Therefore, collectively, these data indicate that VAV-1 is not required for normal neuronal development, but may instead play a role in neuronal function.
VAV-1 is required in ALA and requires GEF function
--------------------------------------------------
To determine which neuronal cells require VAV-1 for proper modulation of motor circuit activity, we expressed VAV-1 in different neuronal cell types using specific promoters. Since we observed strong expression with our *vav-1* reporter in ALA and variable but consistent expression in the ventral cord cholinergic motor neurons, which directly coordinate locomotion, we used the following promoters to drive *vav-1* expression in these neurons: the *ver-3* promoter to drive expression in the ALA neuron[@b26] and the *unc-17* promoter to drive expression in cholinergic motor neurons[@b36]. To test for rescue, these neuronal transgenic strains were then crossed into the *vav-1* mutant background. For simplicity, the two genotypes are thus referred to as *vav-1; ALA rescue* and *vav-1; cholinergic rescue*. These animals were assayed for aldicarb sensitivity in comparison with WT and *vav-1* mutants. Interestingly, expression of VAV-1 in cholinergic neurons caused heightened aldicarb sensitivity in the *vav-1* mutant ([Fig. 5a](#f5){ref-type="fig"}). Surprisingly, expression of VAV-1 in a single interneuron, ALA, returns the aldicarb sensitivity of *vav-1* mutants to a WT level ([Fig. 5b](#f5){ref-type="fig"}). Thus, these data indicate that VAV-1 function in the ALA interneuron is sufficient for normal motor circuit activity. Since VAV-1 is a conserved GEF for the Rho GTPase family[@b1][@b15], we examined whether VAV-1 requires an active GEF domain to regulate motor circuit activity. To accomplish this, a mutant *vav-1* construct that lacks GEF function[@b15] was introduced into the *vav-1* mutant background. We then tested the ability of GEF-dead VAV-1 to rescue the *vav-1* mutant aldicarb hypersensitivity, and found that unlike the WT construct ([Fig. 2a](#f2){ref-type="fig"}), the mutant GEF construct could not restore a normal aldicarb response ([Fig. 5c](#f5){ref-type="fig"}). Therefore, these data suggest that VAV-1 activates a Rho/Rac GTPase to mediate its neuromodulatory function. Furthermore, since we observed an elevated locomotion rate in *vav-1* mutants, we measured the rate of locomotion of *vav-1; ALA rescue* animals and found that expression of VAV-1 in the ALA neuron restores normal locomotory speed to *vav-1* mutants ([Fig. 5d](#f5){ref-type="fig"}). We also confirmed that VAV-1 lacking GEF activity cannot rescue the elevated crawling speed of *vav-1* mutants ([Fig. 5d](#f5){ref-type="fig"}). These data indicate that VAV-1 in a GEF-dependent manner is required in ALA for normal motor circuit activity.
ALA inhibits motor circuit activity
-----------------------------------
While we have found that VAV-1, via its Rho/Rac GTPase exchange activity, regulates motor circuit activity from the ALA neuron, the role(s) of VAV-1 in ALA, and of ALA in regulation of motor circuit activity, are not clear. ALA has been shown to electrically couple to the interneuron RID in the nerve ring and form chemical synapses with the command interneurons AVA, AVE (in the nerve ring) and possibly PVC (in the posterior ganglion)[@b37]. Thus, ALA has few synaptic partners and does not directly synapse onto motor neurons. In addition, it is not clear what neurotransmitter(s) ALA releases. However, it has been proposed that the ALA neuron is peptidergic[@b38]; ALA expresses proteins involved in dense-core vesicle-mediated signalling[@b39]. To gain insight into the function of VAV-1 in ALA, we examined the subcellular localization of a functional VAV-1::GFP expressed under its own promoter in ALA. We found that VAV-1::GFP is localized to the cell body of ALA, but not in the nucleus. Also, we did not observe VAV-1::GFP localization in the axons along the length of the animal ([Fig. 6a](#f6){ref-type="fig"}). These data indicate that VAV-1 does not associate with synaptic or dense-core vesicles or their release sites within ALA, and suggest that VAV-1 may not have a direct role in regulating vesicle release from the ALA neuron. However, these observations do not address a potential distal role of VAV-1 in neuropeptide or neurotransmitter release from ALA.
To address whether vesicle release from ALA is involved in its modulation of motor circuit activity, we drove ALA-specific expression of tetanus toxin light chain, which blocks release of vesicles containing neurotransmitters and neuropeptides by cleaving the vesicle protein synaptobrevin[@b40][@b41][@b42][@b43]. To accomplish this, we exploited a cell-specific, inverted Cre-Lox expression system[@b44][@b45]. This approach involves one promoter driving expression of a floxed inverted tetanus toxin (TeTx) and GFP construct, and a second promoter driving Cre. Thus, by promoter overlap the expression of TeTx occurs in only one cell ([Fig. 6b](#f6){ref-type="fig"}). We confirmed by fluorescence microscopy that GFP, and hence TeTx, is expressed solely in the ALA neuron ([Supplementary Fig. 4a](#S1){ref-type="supplementary-material"}). Utilizing this strain, we found that blocking vesicle release by TeTx in ALA induces aldicarb hypersensitivity in otherwise WT animals ([Fig. 6c](#f6){ref-type="fig"}) similar to *vav-1* mutants. These data suggest that ALA releases vesicles, perhaps containing neuropeptides or another neurotransmitter, to inhibit motor circuit activity.
Then, we performed a complimentary experiment, where we photoactivated the ALA neuron using ChR2. We used the same promoter-intersectional, inverted Cre-Lox strategy to drive expression of a slowly inactivating variant of ChR2\*(C128S)[@b46][@b47] specifically in ALA ([Fig. 6b](#f6){ref-type="fig"}; [Supplementary Fig. 4b](#S1){ref-type="supplementary-material"}). Owing to the length of time needed to complete an aldicarb assay, we chose this particular ChR2\*(C128S) variant so that ALA activation could be prolonged beyond the duration of the blue-light stimulus, allowing us to investigate the aldicarb sensitivity of ALA-activated animals over the course of hours. Animals were exposed to a 1-min pulse of low-intensity blue light before, and every 40 min during, the aldicarb assay. Strikingly, we found that ALA-photoactivated animals are aldicarb resistant, indicating that, consistent with the ALA::TeTx results, the ALA neuron provides an inhibitory input to the motor circuit ([Fig. 6d](#f6){ref-type="fig"}). To determine whether VAV-1 may play a role in regulating the activation state of ALA, we tested whether the aldicarb hypersensitivity of *vav*-*1* mutants could be rescued by photoactivating ALA. We found that, indeed, the *vav*-*1* mutant aldicarb response is returned to a WT sensitivity, albeit not to the level of aldicarb resistance observed in ALA::ChR2\*(C128S) animals ([Fig. 6e](#f6){ref-type="fig"}). Nevertheless, our results suggest that the role of VAV-1 in ALA is to regulate the activity of this neuron, and the effect of *vav*-*1* loss can be bypassed by photoactivating ALA.
VAV-1 abrogates command interneurons signalling
-----------------------------------------------
To further investigate the role of VAV-1-dependent signalling from ALA in mediating motor circuit activity, we investigated the potential role of the command interneurons in regulating motor neuron activity. The command interneurons AVA, AVE and PVC are postsynaptic to ALA[@b37] and promote forward and backward locomotion by directly regulating motor neurons[@b9]. AVA, AVE and PVC have been shown to express glutamate receptors *glr-1* and *nmr-1* (ref. [@b48]). Since these neurons promote locomotion, we hypothesized that VAV-1-dependent signalling in ALA inhibits the activity of the AVA, AVE and PVC command interneurons, thus inhibiting motor neuron activity and locomotion. In support of this hypothesis, activated mutations in *glr-1* result in aldicarb hypersensitivity[@b49]. Therefore, we reasoned that if the command interneurons are a link between ALA and regulation of motor neuron activity, ablating these neurons should block the effect of *vav*-*1* loss on aldicarb sensitivity ([Fig. 7a](#f7){ref-type="fig"}). Similarly, if we remove or reduce glutamatergic (excitatory) signalling in the command interneurons, we should decrease motor circuit activity in vav-1 mutants ([Fig. 7a](#f7){ref-type="fig"}). Conversely, we hypothesized that if glutamate receptor signalling in the command interneurons is downstream of VAV-1 in ALA, activating glutamate receptor signalling should produce aldicarb hypersensitivity that is not synergistic with *vav-1* mutant hypersensitivity ([Fig. 7a](#f7){ref-type="fig"}).
To test these hypotheses, we first killed the command interneurons using an existing transgenic strain carrying cell-specific miniSOG (mini singlet oxygen generator), allowing for light-inducible cell ablation[@b50]. We found that ablating the command interneurons (including AVA, AVD, AVE and PVC) alone does not alter aldicarb sensitivity, but returned the aldicarb response of *vav*-*1* mutants to WT sensitivity, indicating that these neurons are downstream of *vav*-*1* in the ALA neuron in regulating motor circuit activity ([Fig. 7b](#f7){ref-type="fig"}).
Then, we generated a *glr-1; nmr-1* double loss-of-function mutant and a *glr-1; nmr-1; vav-1* triple loss-of-function mutant and tested aldicarb sensitivity. The *glr-1; nmr-1* mutant show a normal response to aldicarb ([Fig. 7c](#f7){ref-type="fig"}). However, we found that introduction of the *glr-1* and *nmr-1* mutations into the *vav-1* mutant background completely restores a normal aldicarb response in *vav-1* animals ([Fig. 7c](#f7){ref-type="fig"}). These data suggest that VAV-1-dependent signalling in ALA is required to abrogate excitatory glutamatergic signalling in the command interneurons and, thus, inhibit the motor circuit. Finally, we examined the aldicarb sensitivity of an activated *glr-1* mutant reported to be aldicarb hypersensitive, *glr-1(nd38)*[@b49], as well as a second activated *glr-1* mutant that is equivalent to the δ2 glutamate receptor subunit mutation found in the Lurcher mouse[@b51]. Importantly, this second activated glutamate receptor is under control of the *nmr-1* promoter, so is expressed in fewer cells than *glr-1*, specifically including the command interneurons and two others neurons (AVG and RIM). We found that, indeed, both of these activated glutamate receptor mutants are aldicarb hypersensitive to a similar extent as *vav-1* mutants, and the *glr-1(nd38)*; *vav-1* double mutant is not significantly more aldicarb hypersensitive than either single mutant alone ([Fig. 7d](#f7){ref-type="fig"}). In support of our hypotheses, these data indicate that glutamate receptor excitatory signalling in the command interneurons is likely downstream of the inhibitory effect of VAV-1 activity in ALA on the motor circuit.
Discussion
==========
Previously, VAV-1 was shown to be a critical regulator of several rhythmic activities in *C. elegans* (for example, pharyngeal pumping, ovulation and the defecation motor program)[@b15][@b16][@b17]. Here, we show that the rhythmic behaviour of locomotion is also abnormal in *vav-1* mutants; these animals show hyperactive locomotion due to loss of *vav-1* in the nervous system. Accordingly, *vav-1* mutants are hypersensitive to aldicarb, an ACh esterase inhibitor, which suggests heightened ACh release from the motor neurons. Furthermore, photoactivation of the cholinergic motor neurons or GABAergic motor neurons in *vav-1* mutants results in excessive muscle contraction or excessive muscle relaxation, respectively. Intriguingly, we found that expression of *vav-1* in a single interneuron ALA could rescue the locomotory and aldicarb hypersensitivity phenotypes of *vav-1* mutants. These data indicate that the ALA interneuron, in a VAV-1-dependent manner, negatively regulates motor activity. Subsequently, we found evidence that ALA is an excitable neuron that when photoactivated can repress locomotory circuit activity. In addition, photoactivation of ALA was found to bypass the loss of VAV-1 function suggesting that VAV-1 is required for ALA signalling. Moreover, we found that vesicular release from ALA is crucial for repression of motor circuit activity.
ALA is a single interneuron that is positioned slightly posterior of the nerve ring in the head. It has two processes that extend to the posterior that run along the lateral nerve cords until they reach the tail. In addition, ALA sends a short process into the DNC. Although it is believed to be peptidergic[@b38], no peptides or neurotransmitters have yet been shown to have a role in ALA. In addition, ALA has few synaptic partners; ALA exhibits electrical coupling to the RID interneuron and chemical synapses with the command interneurons AVA, AVE and PVC[@b37][@b52]. Thus, ALA does not have a direct connection with any motor neurons. How does VAV-1 in ALA regulate motor neuron activity? Interestingly, the command interneurons are integral components of the locomotory control circuit[@b9][@b10][@b37], which directly promotes the activity of the motor neurons[@b13][@b14] ([Fig. 1a](#f1){ref-type="fig"}). The motor neurons themselves are thought to be the central pattern generator that produces rhythmic sinusoidal crawling[@b53] and the command interneurons promote their activity[@b13][@b14]. Thus, the command interneurons provide an ideal neural circuit in which ALA could participate to negatively regulate motor neuron activity and locomotion. In support of this notion, we have found that the aldicarb hypersensitivity phenotype of *vav-1* mutants can be rescued by ablation of the command interneurons or removal of excitatory glutamate receptors from the command interneurons. In addition, constitutive activation of excitatory glutamate signalling in the command interneurons leads to aldicarb hypersensitivity similar to *vav-1* mutants, and introduction of the *vav-1* mutation into the activated glutamate signalling background does not enhance the aldicarb hypersensitivity of the single mutants, suggesting they act in a common pathway. Together, the neural connectivity of ALA with the command interneurons and our genetic and pharmacological data support a model where ALA in a VAV-1-dependent manner acts to abrogate command interneuron function in promoting motor neuron activity. Previously, ALA has been found to have a role in behavioural quiescence (suppression of pharyngeal pumping and locomotion during lethargus) and it is required to suppress egg-laying activity after strong mechanical stimulation[@b26][@b54]. However, it is unclear how ALA suppresses these motor activities. Further studies will be required to investigate whether the motor circuit described here is involved in these other ALA-mediated behaviours.
In addition, we found that the GEF activity of VAV-1 is required for regulating motor circuit activity. Vav proteins, in addition to the Dbl homology domain, which contains the GEF activity, contain several protein--protein interaction domains, and some studies have revealed GEF-independent activity for Vav proteins, suggesting that Vav proteins can act as molecular adaptor proteins[@b1][@b55][@b56][@b57]. Nevertheless, our findings indicate that the role of VAV-1 in the regulation of motor circuit activity requires Rho/Rac GTPase function. The *C. elegans* Rho-family GTPases are widely expressed in most, if not all, neurons[@b58][@b59] and VAV-1, *in vitro*, can promote the exchange of GDP for GTP and activate all the Rho GTPase family members in *C. elegans*[@b15]. Thus, one or multiple Rho-family GTPases could mediate the effects of VAV-1 in ALA.
Mammalian Vav proteins have been reported to be highly expressed in the nervous system; however, their role in neurons is not well understood. Nevertheless, analysis of Vav2 and Vav3 knockout mice has revealed a remarkable parallel with the *C. elegans vav-1* mutant (for example, nervous system hyperactivity) suggesting a conserved mechanism. Indeed, both Vav2 and Vav3 knockout mice display sympathetic nervous system hyperactivity, which results in cardiovascular and renal dysfunction[@b7][@b8]. However, unlike *C. elegans vav-1* mutants, which do not show any detectable nervous system developmental defects, Vav3 is required for proper GABAergic axon guidance events in the ventrolateral medulla, which is a brainstem region that regulates sympathetic nervous system activity[@b4]. Thus, the function of Vav3 in the mammalian nervous system has diverged or has an expanded role compared with VAV-1 in *C. elegans* in the regulation of nervous system activity. Nevertheless, the mechanism underlying the elevation in sympathetic neuronal activity in Vav2 knockout mice is not known[@b4]. Moreover, human Vav3 was recently identified as one of the top candidate genes in a Japanese genome-wide association study of schizophrenia[@b60][@b61], indicating the importance of understanding the role of Vav proteins in the nervous system. In conclusion, our studies on VAV-1 in the *C. elegans* nervous system have demonstrated a novel role of VAV-1 in the regulation of a locomotory control circuit and indicate that *C. elegans* provides a powerful system to further explore the neuromodulatory role of Vav function in a developmentally intact nervous system.
Methods
=======
*C. elegans* strains and maintenance
------------------------------------
Animals were grown at \~20 °C on nematode growth media (NGM) plates seeded with OP50 *Escherichia coli*. Experiments were performed at \~24 °C. Strain maintenance was performed as described[@b62]. N2 Bristol was the WT strain. All analyses were carried out on young adult hermaphrodite worms. Strains were synchronized using hypochlorite treatment[@b62] and allowed to grow (\~2.5 days at 20 °C) to the young adult stage. The mutant and transgenic strains used in this study were: *glr-1 (ky176), nmr-1 (ak4), unc-25 (e156), glr-1 (nd38)*, *akEx52* \[*Pnmr-1::glr-1 (A/T)*\], *vav-1(ak41); akEx162* \[*Ppha-4::vav-1::GFP*\]*, vav-1(ak41) takIs5* \[*Ppha-4::vav-1::GFP*\]*, vav-1(ak41); akEx405* \[*Pvav-1::vav-1::GFP, Psur-5::GFP*\]*, vav-1(ak41); akIs76* \[*Paex-3::vav-1::GFP*\], *vav-1; akEx87* \[*Pvav-1::vav-1::GFP*\], *vav-1 (ak41); takEx81* \[*Pvav-1::vav-1 L288Q::GFP, Pttx-3::GFP*\], *takEx5* \[*Pvav-1::2xNLS GFP*\], *takEx6* \[*Pvav-1::2xNLS mCherry*\], *takEx65* \[*Punc-17::vav-1::GFP, Pttx-3::GFP*\], *takEx67* \[*Pver-3::vav-1::GFP, Pttx-3::GFP*\]*, takEx136* \[*Prab-3::Inverse TeTx-SL2-GFP, Pver-3::Cre, Pttx-3::GFP*\], *takEx132* \[*Prab-3::Inverse ChR2 (C128S)::GFP, Pver-3::Cre, Pttx-3::GFP*\]*, inIs181; inIs182* \[*Pida-1::ida-1::GFP*\]*, vtIs1* \[*Pdat-1::GFP*\], *otIs151* \[*Pceh-36::RFP*\]*, odIs6* \[*Pglr-1::RFP*\]*, juIs1* \[*Punc-25::GFP::snb-1*\]*, nuIs152* \[*Punc-129::GFP::snb-1, Pttx-3::RFP*\], *oxEx1088* \[*Punc-17::halorhodopsin::GFP*\], *oxIs12* \[*Punc-47::GFP*\], *nuIs321* \[*Punc-17::RFP*\]*, sid-1(pk3321) him-5(e1490) V; lin-15B(n744) X; uIs72*\[*Pmyo-2::mCherry*, *Punc-119::sid-1*, *Pmec-18::mec-18::GFP*\]*, zxIs3* \[*Punc-47::ChR2(H134R)::YFP*\], *zxIs6* \[*Punc-17::ChR2(H134R)::YFP*\], *juEx3771* \[*Pnmr-1-tomm-20N::miniSOG; Pnmr-1-mCherry*\].
Transgenic strains and constructs
---------------------------------
We used a standard PCR fusion-based technique[@b25] to generate fluorescent *vav-1* reporters containing the full *vav-1* promoter (\~8.4 kb upstream sequence), amplified from pRF35 (*vav-1* genomic clone)[@b15], followed by a 2 × SV40-NLS (second-generation nuclear localization signal) and either a \~1.2-kb fragment encoding GFP \[S65C\], amplified from pPD135.83 (L4796), or a \~1-kb fragment encoding mCherry, amplified from pDM1284 (ref. [@b63]), followed by the *let-858* 3′ untranslated region.
All plasmids generated to drive *vav-1* cDNA expression in specific neuronal subsets are derivatives of pRF84 \[*Ppha-4::vav-1::GFP*\]. The *unc-17* (\~3.5 kb) promoter and the *ver-3* (\~3 kb) promoter were amplified by PCR, using published primers[@b26][@b36]. Promoters were amplified from either genomic worm DNA or corresponding fosmids. Primers were used to flank each promoter with an SphI and an NheI restriction site, making them compatible to replace *Ppha-4* in pRF84.
To generate ALA-specific expression of tetanus toxin light chain (TeTx) and ChR2\*(C128S), we used floxed/inverted vector strategy previously described[@b44][@b45]. Briefly, the following constructs were custom-synthesized by Genscript: *Pver-3::nCre*, *Prab-3::lox2272loxP::inverse-TeTx::SL2::GFP::inverse-lox2272loxP* and *Prab-3::lox2272loxP::inverse-ChR2\*(C128S)::GFP::inverse-lox2272loxP* ([Fig. 6b](#f6){ref-type="fig"}). The *ver-3* promoter (3 kb promoter[@b26]) drives expression in ALA, the pharyngeal saucer muscle cell and the anal sphincter muscle[@b26][@b64]. The *rab-3* promoter (1.2 kb promoter[@b36]) displays pan-neuronal expression[@b65]. Lox sequences[@b45] and nCre sequence[@b43] were obtained from published sources. The temporal and spatial overlap of these promoter elements is only in ALA.
Transgenic strains were generated by microinjection following standard protocols[@b66]. The injected strain for fluorescent *vav-1* reporters was *lin-15(n765ts)*. The host strain for all other transgenes was WT (N2). Listed are the injection concentrations of expression constructs of interest and coinjected DNAs: *takEx6* \[*Pvav-1::2xNLS mCherry* at 100 ng μl^−1^, pJM23 at 20 ng μl^−1^, DNA ladder at 5 ng μl^−1^\], *takEx65* \[*Punc-17::vav-1::GFP* at 5 ng μl^−1^*, Pttx-3::GFP* at 85 ng μl^−1^, DNA ladder at 10 ng μl^−1^\], *takEx67* \[*Pver-3::vav-1::GFP* at 5 ng μl^−1^*, Pttx-3::GFP* at 85 ng μl^−1^, DNA ladder at 10 ng μl^−1^\], *takEx75* \[*Punc-25::vav-1::GFP* at 5 ng μl^−1^*, Pttx-3::GFP* at 85 ng μl^−1^, DNA ladder at 10 ng μl^−1^\], *takEx81* \[*Pvav-1::vav-1 L228Q::GFP* at 5 ng μl^−1^, *Pttx-3::GFP* at 80 ng μl^−1^, DNA ladder at 15 ng μl^−1^\], *takEx132* \[*Prab-3::inverse ChR2\*C128S-SL2-GFP* at 25 ng μl^−1^, *Pver-3::Cre* at 25 ng μl^−1^, *Pttx-3::GFP* at 50 ng μl^−1^, DNA ladder at 25 ng μl^−1^\], *takEx136* \[*Prab-3::inverse TeTx-SL2-GFP* at 5 ng μl^−1^, *Pver-3::Cre* at 25 ng μl^−1^, *Pttx-3::GFP* at 62.5 ng μl^−1^, DNA ladder at 25 ng μl^−1^\].
Briefly, integration of the *Ppha-4::vav-1* extrachromosomal array was carried out by treating *vav-1(ak41); akEx162 \[Ppha-4::vav-1, Punc-122::GFP\]*[@b15] with 3,800 Rads (gamma irradiation). F2 animals were screened for 100% transmission of the *Punc-122::GFP* marker. Two integrants were isolated using this method, *takIs3* and *takIs5*, and were subsequently outcrossed 10 × using the N2 WT background.
RNA interference
----------------
RNAi by feeding was carried out essentially as previously described[@b67]. In brief, L4 animals that are specifically sensitive to RNAi in the nervous system (*sid-1(pk3321) him-5(e1490) V; lin-15B(n744) X; uIs72*)[@b68] were raised on bacteria expressing double-stranded RNA specific for *vav-1* and empty vector. F1 adult progeny were subjected to aldicarb assays.
Locomotion assays
-----------------
Crawling assays were conducted on NGM plates seeded with OP50. Animals were analysed as synchronized young adults on their growth plates, or young adults selected from mixed-age populations, and moved to fresh-seeded NGM plates. Each plate was placed on an Olympus dissecting microscope equipped with a Sony CCD (charge-coupled device) camera for 2--5 min before starting a video recording of locomotion. For Fig. 1b, \~5 animals were included in each 5-min recording, and 7--11 replicate plates per strain were analysed. For [Fig. 5d](#f5){ref-type="fig"}, an estimated 20--50 animals per plate were included in each 1-min recording, and 5 replicate plates per strain were analysed. Wormlab software (MBF Bioscience) was used to calculate the average crawling speed.
Pharmacological assays
----------------------
Aldicarb and levamisole assays were performed with the experimenter blind to the strains. NGM plates containing either 1 or 0.5 mM (for differentiation between more hypersensitive strains) aldicarb were used in this study. Aldicarb assays were conducted as previously described[@b18]. Briefly, worms were gently prodded (with a platinum wire pick) three times between the vulva and tail, and if after any prod the worm responded by crawling, it was counted as not paralysed. Worms that crawled off the plate or exhibited vulval prolapse were removed from the assay. The ratio of worms still moving to total worms per plate was plotted for every 20- or 30-min time point. As previously observed[@b31], we noted day-to-day variation in the aldicarb assays. Nevertheless, all aldicarb assay paralysis curves are the summary of at least five assays, with \~15--20 worms per genotype per plate.
Levamisole plates were made with NGM containing 100 μM drug. Worms were deemed paralysed if they failed to respond by crawling when the agar plate was dropped (from a height of a few cm) while viewing under the dissecting microscope. Plates were dropped three times, with a short pause of \~5 s in between drops. The ratio of worms paralysed to total worms per plate was plotted for every 30-min time point. Levamisole paralysis curves are the summary of at least four assays, with \~15 worms per genotype per plate.
PTZ convulsion assays were performed as previously described[@b34]. Worms were exposed to 6 mM PTZ on NGM plates and assayed for seizure-like behaviour at 30 and 60 min. 10-25 animals per genotype were tested, divided into three assays.
Imaging and analysis
--------------------
Animals were immobilized using 300 μM sodium azide on 2% agarose pads. Soluble fluorophore imaging to investigate neuronal structure (GABAergic GFP, cholinergic mCherry, ALA neuron GFP or functional VAV-1 GFP) was performed with a Zeiss LSM510 META-NLO confocal microscope. All other imaging was conducted with an inverted Zeiss AxioObserver microscope equipped with a Zeiss AxioCam MRm (for imaging GABA GFP::SNB-1) or Andor Clara CCD camera (for imaging cholinergic GFP::SNB-1). When comparing WT with *vav-1* mutants, 10--25 animals were analysed per genotype.
For gross morphological analysis of GABAergic neurons (*oxIs12 \[Punc-47::GFP\]*), cholinergic neurons (*nuIs321 \[Punc-17::mCherry\]*), and the ALA neuron (*inIs181; inIs182 \[Pida-1::ida-1::GFP\]*), z-stacks of entire worms were collected using a × 10 objective. For quantitative analysis, z-stacks of overlapping fields of view were collected, using a × 40 objective and 3-μm-thick optical slices. Image J software was used to compress *z*-stacks into maximum intensity projection images. Using these images and z-stacks, the total number of neuronal cell bodies, commissures and axonal projections were counted and analysed. The data are plotted as the mean numbers of cell bodies or commissures ±s.e.m.
For neuron identification, we investigated co-localization of known neuron reporter fluorescence with *vav-1* reporter fluorescence. Adobe Photoshop was used to overlay the fluorescent images of a *vav-1* reporter and specific neuron reporter co-expressed in one animal.
All fluorescent synaptic vesicle marker imaging was conducted with a × 63 oil objective. Images were taken of the DNC in animals with the DNC oriented towards the objective. A 20-μm-long region of interest (ROI), located 20--40 μm posterior from the vulva, was selected from each image. All intensity measurement values are in arbitrary fluorescence units, and are corrected for mean background fluorescence within the worm (background was measured for each image, near the DNC). Image J software was used to analyse GFP GABAergic synaptic vesicle distribution (*juIs1 \[Punc-25::GFP::snb-1\]*). Synaptic fluorescent puncta above a set intensity threshold were automatically detected using Image J, and puncta size is displayed in pixels. Metamorph software was used to analyse GFP cholinergic synaptic puncta (*nuIs152 \[Punc-129::GFP::snb-1\]*). Selection of ROIs and analysis of fluorescence was performed with experimenter blind to the strains. A Wacom Bamboo tablet and stylus were used to draw freehand selections around apparent puncta, interpunctal regions of the DNC and around a background ROI for each image. Metamorph software was used for fluorescence intensity and area measurements.
Optogenetics
------------
Optogenetic experiments were performed essentially as described[@b21]. All-trans retinal (ATR) plates were NGM plates seeded with 100 μl of an *E. coli* (OP50) solution containing 0.67 mM ATR and allowed to grow overnight. Control plates were seeded with 100 μl OP50 solution lacking ATR. Worms carrying cholinergic \[*zxIs6 (Punc-17::ChR2)*\] or GABAergic channelrhodopsin \[*zxIs3 (Punc-25::ChR2)*\] were grown for 96 h, or synchronized and grown from the L1 larval stage for 54 h, on ±ATR plates at 20 °C, and resulting young adult worms were picked individually to fresh, seeded NGM plates for analysis. For each worm, a 10-s video was recorded using a fluorescence dissecting microscope and Sony CCD camera. The recording was started while the worm was mid-crawl, the blue light turned on within 3 s, and left on for the duration of the video (light intensity was \~80 mW cm^−2^ from an X-Cite 120 excitation light source). From each video, one frame was selected before blue-light exposure; post light exposure, the most contracted (for *zxIs6*) or most relaxed (for *zxIs3*) frame was selected. Using Image J and a Wacom Bamboo tablet and stylus, a freehand line was traced down the centre of each worm, from nose tip to the posterior-most point of the intestine. The length of each worm before and after exposure to blue light was measured. The difference between these lengths was taken, and then divided by the starting worm length. The resulting values were either percent contraction or percent relaxation, for *zxIs6* or *zxIs3*, respectively. Worm length measurements were performed blind except for --ATR control experiments, in which worms did not visibly contract or relax.
Optogenetic stimulation of ALA neuron for the aldicarb assay
------------------------------------------------------------
Prolonged photoactivation of the ALA neuron was achieved by a promoter-intersectional strategy (described above) used to drive ALA-specific expression of a slowly inactivating ChR2\*(C128S)[@b47]. Transgenic ALA::ChR2\*(C128S) animals were raised from synchronized L1 larva to young adults on NGM plates seeded with OP50 bacterial solution supplemented with 0.67 mM ATR. Before beginning the aldicarb assay, each strain (including WT, *vav-1* mutant and non-ATR-treated control animals) was exposed to blue light (at \~1 mW cm^−2^) for 60 s. Immediately, animals were transferred to aldicarb plates and the experimenter assessed paralysis every 20 min, blind to the strains. After each 40-min interval, each aldicarb plate (bearing 15--20 animals) was again exposed to blue light (\~1 mW cm^−2^) for 60 s to ensure prolonged activation of the channelrhodopsin. This light intensity was chosen based on previous studies using this channelrhodopsin variant (C128S) in muscle cells or neurons[@b45][@b47], and the timing of blue-light exposures was chosen in an effort to maintain activation of the channelrhodopsin while minimizing a potential decrease in function due to repeated blue-light stimuli, which has been observed in muscle[@b47]. In addition, 60 s of blue-light stimulus per plate was about the maximum duration possible due to the time restraints imposed by the aldicarb assay (that is, at every 20 min time point,\~10 min was required to test all strains for paralysis).
Command interneuron ablation with miniSOG
-----------------------------------------
Animals expressing miniSOG expressed in the command interneurons (*juEx3771* \[*Pnmr-1-tomm-20N::miniSOG; Pnmr-1-mCherry*\])[@b50] were exposed to blue light for 30 min (\~50 mW cm^−2^) as synchronized L1 larva in clear PCR tubes without caps, holding an estimated 150 animals in M9 buffer in each of four wells. Command interneuron-ablated worms were then plated onto NGM seeded with OP50 and grown to the young adult stage, along with synchronized WT and *vav-1* mutant animals, for subsequent aldicarb assays. Ablation was confirmed by loss of fluorescence in the command interneurons.
Oil-Red-O staining
------------------
Synchronized WT and *vav-1* mutant adult animals were stained using 60% Oil-Red-O to analyse fat content, as previously described[@b24]. To permeabilize the cuticle, worms were resuspended and gently rocked in 120 μl of PBS and 120 μl of 2 × Modified Ruvkun Witches Brew (MRWB) buffer containing 2% paraformaldehyde for 1 h at room temperature. MRWB buffer (2 × ): 160 mM KCl, 40 mM NaCl, 14 mM Na~2~EGTA, 1 mM spermidine-HCl, 0.4 mM spermine, 30 mM Na-PIPES pH 7.4, 0.2% β-mercaptoethanol. Samples were resuspended in 60% isopropanol for 15 min to dehydrate. Animals were then stained by rocking overnight at 20 °C in 1 ml of freshly diluted and filtered (0.2 μm filter) 60% Oil-Red-O in water. Animals were washed with 200 μl 1 × PBS with 0.01% Triton X-100 to remove dye and mounted on 2% agarose pads for imaging. Whole-slide imaging at × 40 resolution was conducted using a Hamamatsu NanoZoomer and NDP.scan software (Version 2.3).
Statistics
----------
Any comparison made between two groups (for example, WT versus *vav-1*) was performed using a two-tailed Student's *t*-test. For comparisons between three or more groups, we used one-way analysis of variance followed by Bonferroni post-tests. For pharmacological assay statistical analysis, we performed two-way analysis of variance followed by Bonferroni post-tests to determine differences between paralysis curves over time. The following relevant statistical comparisons were made:
In [Fig. 1c](#f1){ref-type="fig"}, *vav-1* is significantly different than WT at 60 (*P*\<0.05), 90 (*P*\<0.01) and 120 min (*P*\<0.05). *vav-1* is different than *vav-1; vav-1 rescue* at 90 (*P*\<0.001), 120 (*P*\<0.01) and 150 min (*P*\<0.05). WT is not significantly different than *vav-1; vav-1 rescue*. In [Fig. 1d](#f1){ref-type="fig"}, *vav-1* is different than WT at 60 (*P*\<0.01), 90 (*P*\<0.001) and 120 min (*P*\<0.01). *vav-1* is different than *vav-1; neuronal rescue* at 60 (*P*\<0.01) and 90 min (*P*\<0.05). *vav-1; neuronal rescue* is different than WT only at 120 min (*P*\<0.05). In [Fig. 1e](#f1){ref-type="fig"}, empty vector RNAi is different than *gar-2* RNAi, positive hypersensitive control, at 90 (*P*\<0.001), 120 (*P*\<0.001) and 150 min (*P*\<0.001). Empty vector RNAi is different than *vav-1* RNAi at 90 (*P*\<0.001), 120 (*P*\<0.001) and 150 min (*P*\<0.001). In [Fig. 1h](#f1){ref-type="fig"}, WT, *vav-1* and *vav-1; vav-1 rescue* are not significantly different from each other.
In [Fig. 5a](#f5){ref-type="fig"}, WT and *vav-1* are different at 60 (*P*\<0.01), 90--120 (*P*\<0.001) and 150 min (*P*\<0.05). WT and *vav-1; cholinergic rescue* are different at 60--120 (*P*\<0.001) and 150 min (*P*\<0.01). *vav-1* and *vav-1; cholinergic rescue* are different at 90 (*P*\<0.01) and 120 min (*P*\<0.05). In [Fig. 4b,c](#f4){ref-type="fig"}, WT and *vav-1* are different at 120 (*P*\<0.01) and 150 min (*P*\<0.001). In [Fig. 5b](#f5){ref-type="fig"}, WT is not significantly different from *vav-1; ALA neuron rescue*. Paralysis of *vav-1* versus *vav-1; ALA neuron rescue* is different at 150 (*P*\<0.01) and 180 min (*P*\<0.05). In [Fig. 5c](#f5){ref-type="fig"}, WT and *vav-1* are different at 60 (*P*\<0.05), 90 (*P*\<0.001) and 120 min (*P*\<0.01). WT and *vav-1; GEF-dead rescue* are different at 90 (*P*\<0.05), 120 (*P*\<0.01) and 150 min (*P*\<0.05). *vav-1* and *vav-1; GEF-dead rescue* are not significantly different from each other.
In [Fig. 6c](#f6){ref-type="fig"}, WT and *vav-1* are different at 120 (*P*\<0.01), 140 (*P*\<0.01), 160 (*P*\<0.05) and 180 min (*P*\<0.05). WT and ALA::TeTx are different at 100 (*P*\<0.05), 120 (*P*\<0.05), 140 (*P*\<0.001) and 160 min (*P*\<0.05). *vav-1* and ALA::TeTx are not statistically different. In [Fig. 6d](#f6){ref-type="fig"}, WT and ALA::ChR2 +ATR are different at 100 (*P*\<0.05), 120 (*P*\<0.0001), 140 (*P*\<0.001) and 160 min (*P*\<0.05). ALA::ChR2 --ATR and ALA::ChR2 +ATR are different at 120 (*P*\<0.001), 140 (*P*\<0.05) and 160 min (*P*\<0.05). WT and ALA::ChR2 --ATR are not statistically different. In [Fig. 6e](#f6){ref-type="fig"}, WT and *vav-1* are different at 80 (*P*\<0.05), 100 (*P*\<0.01) and 120 min (*P*\<0.05). WT and *vav-1*; ALA::ChR2 are different at 80 (*P*\<0.0001), 100 (*P*\<0.0001) and 120 min (*P*\<0.01). *vav-1* and *vav-1*; ALA::ChR2 +ATR are different at 120 (*P*\<0.01) and 140 min (*P*\<0.05). The following paralysis curves were not statistically different: WT and *vav-1*; ALA::ChR2 +ATR, as well as *vav-1* and *vav-1*; ALA::ChR2 --ATR.
In [Fig. 7b](#f7){ref-type="fig"}, WT and *vav-1* are different at 80--220 (*P*\<0.001) and 240 min (*P*\<0.05). The following paralysis curves are not different at any time point: WT and miniSOG, and WT and *vav-1*; miniSOG. In [Fig. 7c](#f7){ref-type="fig"}, WT and *vav-1* are different at 80 (*P*\<0.05), 100--180 (*P*\<0.001) and 200 min (*P*\<0.05). WT and *nmr-1; glr-1; vav-1* are different only at 220 min (*P*\<0.05), and WT and *nmr-1; glr-1* are not significantly different. *nmr-1; glr-1* and *nmr-1; glr-1; vav-1* mutants are not significantly different at any point. In [Fig. 7d](#f7){ref-type="fig"}, WT and *glr-1 (nd38)* are different at 80--200 (*P*\<0.001) and 220 min (*P*\<0.01). WT and *Pnmr-1::Lurcher* are different at 80 (*P*\<0.05), 100--200 (*P*\<0.001) and 220 min (*P*\<0.01). WT and *vav-1* are different at 80--200 (*P*\<0.001) and 220 min (*P*\<0.05). WT and *glr-1 (nd38); vav-1* are different at 60--200 (*P*\<0.001) and 220 min (*P*\<0.01). *glr-1 (nd38)* and *Pnmr-1::Lurcher* are different at 80 and 120 min (*P*\<0.05). *Pnmr-1::Lurcher* and *glr-1 (nd38); vav-1* are different at 60 (*P*\<0.01), 80 (*P*\<0.001), 100 (*P*\<0.01), 120 (*P*\<0.001) and 140 min (*P*\<0.05). The following paralysis curves are not statistically different at any time point: *glr-1 (nd38)* and *vav-1*, *glr-1 (nd38)* and *glr-1 (nd38); vav-1*, *vav-1* and *glr-1 (nd38); vav-1*, *Pnmr-1::Lurcher* and *vav-1*.
Author contributions
====================
A.L.F. and K.R.N. designed and performed experiments and wrote paper. J.T.L. performed experiments.
Additional information
======================
**How to cite this article:** Fry, A. L. *et al.* VAV-1 acts in a single interneuron to inhibit motor circuit activity in *Caenorhabditis elegans*. *Nat. Commun.* 5:5579 doi: 10.1038/ncomms6579 (2014).
Supplementary Material {#S1}
======================
###### Supplementary Figures
Supplementary Figures 1-4
This work was supported by funds from the American Heart Association and National Institutes of Health (GM088213) to K.R.N. We thank A. Gottschalk, I. Greenwald, O. Hobert, Y. Jin, J. Kaplan, A. Maricq, D. Sieburth and M. Zhen for kindly providing nematode strains and reagents, and Cara Davis, Shaarika Sarasija and Jennifer Bonner for comments on the manuscript. Some nematode strains were also provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
{#f1}
{#f2}
{#f3}
![Loss of VAV-1 does not lead to defects in neuronal development or synapse formation.\
(**a**) Representative confocal micrographs of WT (top panel) and *vav-1* mutant (bottom panel) animals expressing GFP in all GABAergic neurons (*oxIs12 \[Punc-47::GFP\]*). In WT (top panel), arrows and lines point to GABA neuron representative cell bodies and circumferential axons (commissures), respectively. In *vav-1* mutants (bottom panel), these features are also present. Dashed arrows indicate fluorescent coelomocytes, a marker of the *vav-1* mutant strain that should be ignored. Asterisk marks non-specific posterior intestinal GFP. Anterior is to the left, and scale bars, 100 μm. (**b**) Quantification of the number of GABA neuron cell bodies and commissures indicates that *vav-1* mutants show grossly normal GABA neuron development. *n*=13 (WT) and 19 (*vav-1*). (**c**) Representative images of GABAergic neuron synapses and (**f**) cholinergic synapses in the dorsal nerve cord of WT (left) and *vav-1* mutant (right); fluorescent puncta are synaptobrevin tagged with GFP at the neuromuscular junction (NMJ). GABAergic animals are *juIs1 \[Punc-25::GFP::snb-1\]*, and cholinergic are *nuIs152 \[Punc-129::GFP::snb-1\]*. (**d**,**g**) Quantification of density of fluorescent puncta (left *y* axis) and the mean area of puncta (right *y* axis). For **d**, *n*=10 (WT) and 11 (*vav-1*). For **g**, *n*=11 (WT) and 16 (*vav-1*). (**e**,**h**) Quantification of fluorescence intensity of puncta (left *y* axis), and of nerve cord between puncta (right *y* axis). For **e**, *n*=10 (WT) and 11 (*vav-1*). For **h**, *n*=28 (WT) and 36 (*vav-1*). (**i**) The structure of the ALA neuron in WT and *vav-1* mutants is shown using a fluorescent ALA reporter analysed by confocal microscopy (*Pida-1::ida-1::GFP*). In the left panels, solid arrows point to the ALA neuron cell body and a dashed arrow points to one ALA axonal projection. The right panels show the same axons projecting to the tails of these animals. Asterisks mark GFP associated with coelomocytes and rectal epithelial cells, and can be ignored. *n*=3(WT) and 11 (*vav-1*). Quantified data are displayed as mean ±s.e.m. and were analysed by two-tailed Student's *T*-tests (no significant differences were found). NS, not significant.](ncomms6579-f4){#f4}
{#f5}
{#f6}
{#f7}
###### Response of *vav-1* mutants to 6 mM PTZ.
**Genotype** **% Animals displaying anterior seizure (30 min)** **% Animals displaying anterior seizure (60 min)**
------------------------------------------------- ---------------------------------------------------- ----------------------------------------------------
WT 0 0
*unc-25 (e156)*/GAD[\*](#t1-fn2){ref-type="fn"} 70 87
*vav-1 (ak41)* 0 0
PTZ, pentylenetetrazole; WT, wild type.
^\*^*unc-25* encodes a glutamic acid decarboxylase.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
June 12, 2015
Here's a very interesting article in the Jewish Telegraphic Agency archive about calls for Sephardic Jews to granted the right of return to the Spain of their ancestors. Note that the article, pasted here in full, is from 1933:
Ayala Urges Spain Right Wrong of 1492; Asks Citizenship for Sons of the Expelled
October 15, 1933
A movement for the return of the descendants of those Jews who were exiled from Spain in 1492 has been started by the famous Spanish author and statesman, Franzesco Ayala. His plan, which has a very large measure of support behind it, provides not only for the repatriation of Sephardic Jews, but also for the granting of Spanish citizenship to such of them as care to accept it, wherever they may be living.
Spain has long begun to realize the enormous loss it suffered by the banishment of the Jews, for by this means it lost some of its most intelligent, wealthy and enterprising citizens. The desire to make good this wrong and to receive back at least part of the descendants of these exiled Jews, is not entirely new. But the abolition of the monarchy and the setting up of the republic, and the abrogation of the supremacy of the Catholic Church that soon followed, strengthened this sentiment, and the Nazi persecution of the Jews gave it a new impetus. Franzesco Ayala’s plan has now given it practical shape, and it is all the more important since it has the full backing and support of the Spanish Government.
FAITHFUL TO SPANISH TRADITION
According to Ayala, there are anywhere from 800,000 to 1,000,000 Sephardic Jews scattered all over the world, but chiefly in the Balkan countries and in Holland. For more than 400 years, down to the present day, they have continued to speak a beautiful old Spanish dialect, they have stuck to their old Spanish traditions and customs, and have kept up their old Spanish culture. No better proof could be required of their loyalty and devotion to their old fatherland, in spite of its cruel treatment of their ancestors. It would therefore be no more than an elementary duty, Alaya says, to thank them and to extend a hearty welcome to them to return to their old home.
Ayala tries to show that the old Spanish anti-Semitism was a very different thing from the present German brand. In Spain in the fifteenth century, anti-Semitism was not political, but purely religious, and it was in accord with the views of the time, and with the laws of the land, for the Catholic Church was at that time the only recognized religion in Spain. Nazi anti-Semitism, however, had no such excuse, for it is based exclusively on political and racial grounds which it is impossible to justify, and it is a breach of the laws of Germany, for the Jews had lived there for generations and had been granted full civil rights.
ALL RELIGIONS NOW EQUAL
The new Spanish Republic had abolished the absolutism of the Catholic Church, and the new Constitution provides for absolute liberty of thought and freedom of worship. All religions are now equal in the eyes of the law, and there is now no reason why the Jews should not return to Spain in large numbers.
Ayala realizes the enormous political, cultural and economic benefits Spain would derive from a large Jewish population, and therefore wishes to incorporate the million descendants of those Jews who were banished over 400 years ago in the Spanish people. Since it would be impossible, however, to get them all to come back, he at least wants to make them “Sons of Spain” again, by granting them Spanish citizenship, whether they come back or not.
Ayala’s movement has a great body of support, and is growing form day to day. The Government supports it whole-heartedly. But there are many technical and legal difficulties in the way of its realization.
MORAL SIGNIFICANCE
At the same time its moral significance cannot be overestimated. At the very moment when Germany has turned back the clock of history, and is depriving its Jews of their citizenship and driving them into exile, Spain, which did the same 400 years ago, is doing her utmost to retrieve her error, is welcoming her Jews back, and offering them all the rights of Spanish citizenship.
In Spain, the last act of a great tragedy is being played, the first act of which took place in the Middle Ages. In Germany, it is the first act that is being played now. But there too the last act will come sooner or later.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
TOLEDO, Ohio (AP) -- The mother of three children killed this week in what Ohio police believe was a murder-suicide says her mother and brother weren't in their "right minds" when the deaths occurred. Police say notes found at a Toledo house indicate the children's grandmother and uncle planned to kill themselves and the children by funneling fumes from a pickup truck into a car where their five bodies were found. The children's mother, Mandy Hayes, tells WTOL-TV in Toledo her mom was her best friend and she was close to her brother. Investigators and family friends say the murder-suicide appears to stem from a family disagreement over where the children should live. The children had been living with Hayes' mother the past three years. Hayes had decided recently to take the children back home.
WILX.com is happy to provide a forum for commenting and discussion. Please respect and abide by the house rules:
Keep it clean, keep it civil, keep it truthful, stay on topic, be responsible, share your knowledge, and please suggest removal of comments that violate these standards. Comments may take up to 24 hours or longer to appear on the site.
Online Public Information File
Viewers with disabilities can get assistance accessing this station's FCC Public Inspection File by contacting the station with the information listed below. Questions or concerns relating to the accessibility of the FCC's online public file system should be directed to the FCC at 888-225-5322, 888-835-5322 (TTY), or [email protected].
| null |
minipile
|
NaturalLanguage
|
mit
| null |
After an 18 month process, Royal FloraHolland is about to reshape its co-operative principles. On December 7th, members will decide on major changes in regards to membership and a co-operative tariff structure. Next summer decisions will be instituted on co-operative leadership. These changes were prepared by co-operative members, not by the co-operative staff.
In early 2016, Royal FloraHolland formed a Leading Team of thirteen members/growers who had to come up with proposals on two subjects: future leadership and tariffs and forms of membership. Richard Kneppers, co-owner of Maridadi Flowers in Naivasha, Kenya, Bianca van Eijk, a Dutch grower of Agapanthus and Royal FloraHolland’s Stakeholder Manager, Leo Keijzer, told us about the process and its outcome.
“We started by defining what a co-operative is and should be. Then we started the process of members speaking with fellow members. During the past twelve months, 1,116 unique members attended the member sessions. Some of them came to several sessions, which meant that, in total, the Leading Team welcomed almost 2,300 members to the sessions. Normally the co-operative and its staff would organize such a process, but this time there was only staff to guide the process. We were taught how to lead these types of discussions but were at liberty to debate as we pleased. The real advantage of this approach was that honest discussions occurred. People learned to listen to the others’ points of view. We went back to our co-operative roots. And surprisingly, the differences of opinion weren’t as big as we thought they would be. There were meetings in the Netherlands, Africa, Israel and elsewhere. We held discussions with growers of both large and small nurseries. Nearly everyone agreed that there is a need for co-operatives because people see the benefits of cooperating, just as they did one hundred years ago. If people were critical, it was about the co-operative’s communication style: sending too much information and too little discussion.
“The Leading Team provided another approach. The members could speak candidly and they did. Co-operative staff weren’t even allowed to visit Leading Team sessions, which led to this openness. We were determined to give every member the opportunity to speak his mind. Even members who never speak at meetings had their say. Because it was a Leading Team of members/growers, the proposals about co-operative tariffs were far more numerous than they would have been had the co-operative staff made the proposals. Another result of this process was that we have now started testing a Member’s Council that may replace the General Member’s Meeting.
“A decision on the new tariff structure will be made in December. In the new structure, unlike the current one, costs will be paid by members who benefit directly from them. This may lead to advantages for growers with higher turnovers. Of course this means that growers with smaller nurseries may have to pay additional costs but in the process we have been able to convince them of the practicality of the new structure. In a way, it is what they suggested themselves when we asked for their opinions, from which we created a proposal which was then discussed with them again.
“Basically our starting principle was simple. Royal FloraHolland has 4,200 members. We knew that these 4,200 members would be smarter than a single co-operative. We used the intelligence of our members to strengthen the co-operative. Now we can adapt the co-operative Royal FloraHolland to the 21st century with the support of our members.”
FCI shares knowledge, offers inspiration, and reinforces the special and necessary cooperation in the floriculture sector by connecting people, markets, continents and cultures. FCI is more than just a magazine; it has become a platform linking people’s business in the horticultural world.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Converting IPAddress array to HTML
$NetConf = Get-CimInstance -ClassName win32_networkadapterconfiguration | where {$_.IPAddress -ne $null} | select IPAddress| ConvertTo-Html -As Table -Property IPAddress -Fragment -PreContent "<h2>IP config</h2>"
How to convert this output
172.17.7.97, fe80::4da6:ae96:zzzz:zzzz
10.0.75.1, fe80::1063:f3b7:52:zzzz
192.168.0.107, fe80::7d9f:d8d:zzzz:zzz
to table like:
MacAddress IPAddress Description
xx.xx.xx.xx 10.0.75.1 asdasdasdasd
Thanks a lot.
A:
Unless I'm missing something you shouldn't even be getting that original output you're showing us. Not with how you select your property.
However, I believe the following does what you are asking.
Or are you asking on how to exclude IPv6 in your output as well?
Edited to add a few different variants.
# Both IPv4 & IPv6, combined.
$NetConf1 = Get-CimInstance -ClassName Win32_NetworkAdapterConfiguration |
where { $_.IPAddress -ne $null } |
select MacAddress, @{N="IPAddress";E={$_.IPAddress -join "," }}, Description |
ConvertTo-Html -As Table -Property MacAddress, IPAddress, Description -Fragment -PreContent "<h2>IP config</h2>"
# Both IPv4 & IPv6, separated.
$NetConf2 = Get-CimInstance -ClassName Win32_NetworkAdapterConfiguration | where { $_.IPAddress -ne $null } |
select MacAddress,
@{N="IPv4Address";E={ $_.IPAddress | where { ([ipaddress]($_)).AddressFamily -eq 'InterNetwork' }}},
@{N="IPv6Address";E={ $_.IPAddress | where { ([ipaddress]($_)).AddressFamily -eq 'InterNetworkV6'}}},
Description | ConvertTo-Html -As Table -Property MacAddress, IPv4Address, IPv6Address, Description -Fragment -PreContent "<h2>IP config</h2>"
# IPv4 only
$NetConf3 = Get-CimInstance -ClassName Win32_NetworkAdapterConfiguration | where { $_.IPAddress -ne $null } |
select MacAddress,
@{N="IPAddress";E={ $_.IPAddress | where { ([ipaddress]($_)).AddressFamily -eq 'InterNetwork' }}},
Description | ConvertTo-Html -As Table -Property MacAddress, IPAddress, Description -Fragment -PreContent "<h2>IP config</h2>"
| null |
minipile
|
NaturalLanguage
|
mit
| null |
A treatment of stomatitis and treatment in cats.
A three-year old spayed female Domestic Shorthair was diagnosed with chronic plasmacytic stomatitis involving the mandibular gingiva caudal to the canine teeth. The cat presented with excessive drooling and bleeding from the gums. The definitive diagnosis was made on oral tissue samples obtained by biopsy and submitted for histopathology. The management included bilateral extraction of the mandibular and maxillary premolars and molars with closure of the defects utilizing a single mucosal flap in each quadrant. Preoperative laboratory evaluation and negative feline leukemia virus and/or feline immunodeficiency virus testing were performed. Following surgical removal of the teeth, the inflammation improved for eight months before returning. The cat now maintains comfort with parenteral injections of corticosteroid approximately every three to five months. Compounding pharmacists play a vital role in the treatment of felines due to their small size concerns with toxicity and sensitivity to certain medications and their reluctance to be dosed. Even in medical cases where a surgical procedure is the final resolution to an issue, compounded preparations are often required prior to surgery, during surgery, and post surgery for the purpose of eliminating pain and discomfort in the feline patient.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
533 So.2d 290 (1988)
Leo Alexander JONES, Petitioner,
v.
Richard L. DUGGER, Etc., Respondent.
No. 73281.
Supreme Court of Florida.
November 10, 1988.
*291 Larry Helm Spalding, Capital Collateral Representative, and Billy H. Nolas, Staff Atty., Office of the Capital Collateral Representative, Tallahassee, for petitioner.
Robert A. Butterworth, Atty. Gen., and Mark C. Menser, Asst. Atty. Gen., Tallahassee, for respondent.
PER CURIAM.
Leo Alexander Jones, a state prisoner under a death warrant, petitions this Court for a stay of execution and a writ of habeas corpus. We have jurisdiction. Art. V, §§ 3(b)(1), 3(b)(5), Fla. Const.
Jones was convicted of first-degree murder in the sniper shooting of Thomas J. Szafranski, a Jacksonville police officer. The trial judge followed the jury recommendation and sentenced Jones to death. The conviction and sentence were affirmed. Jones v. State, 440 So.2d 570 (Fla. 1983). Jones later petitioned this Court for a writ of habeas corpus, which was denied. Jones v. Wainwright, 473 So.2d 1244 (Fla. 1985). He then made a motion for postconviction relief under rule 3.850, Florida Rules of Criminal Procedure. The trial court denied the motion, and this Court affirmed. Jones v. State, 528 So.2d 1171 (Fla. 1988). In order to address Jones' current petition, we have stayed his execution until noon, November 14, 1988.
Jones' primary argument is based on the recent decision of Booth v. Maryland, 482 U.S. 496, 107 S.Ct. 2529, 96 L.Ed.2d 440 (1987). In that case, the United States Supreme Court held that introduction of victim impact evidence to a capital punishment sentencing jury violated the eighth amendment to the United States Constitution.
Jones argues that victim impact evidence was improperly introduced into his case in two ways. First, during the penalty phase proceeding, the state presented testimony from the Duval County sheriff to the effect that the sheriff's office was "like a family" and that an officer's death affects a department's operations. Jones also points out that the presentence investigation report contained biographical information about the slain police officer which was necessarily considered by the trial judge because the sentencing order concludes with a eulogy containing this information entitled, "Lest We Forget Thomas J. Szafranski."
The state argues that the sheriff's testimony was not victim impact evidence but was rather directed to the aggravating circumstance of "interference with a governmental function." Further, the state says that the eulogy was no more than a tribute to the slain officer and did not play a part in the judge's determination to sentence Jones to death.
In Grossman v. State, 525 So.2d 833 (Fla. 1988), petition for cert. filed (July 25, 1988), the defendant relied upon Booth for the argument that the presentation of victim impact evidence to the sentencing judge tainted his sentence of death. We *292 pointed out that Booth was decided in light of the Maryland practice in which a jury is the sentencing authority, whereas in Florida the jury makes only an advisory recommendation to the judge who passes the ultimate sentence. Nevertheless, in view of Booth, we held that henceforth victim impact evidence should not be considered by the judge or the jury in death penalty sentencing.
In Grossman we then considered whether a defendant's failure to object to the introduction of the victim impact evidence was a procedural bar to raising the issue on appeal. We held:
Victim impact is not one of the aggravating factors enumerated in section 921.141. We have previously held that "[t]he aggravating circumstances, specified in the statute are exclusive, and no others may be used for that purpose." Miller [v. State], 373 So.2d 882 at 885 [(Fla. 1979)]. Thus, appellant was entitled to object to the introduction of the evidence. The state correctly points out that appellant made no objection, whereas in Booth there was an objection to such evidence. There is nothing in the Booth opinion which suggests that it should be retroactively applied to the cases in which victim impact evidence has been received without objection. Except for fundamental error, an appellate court will not consider an issue unless it was presented to the lower court. Steinhorst v. State, 412 So.2d 332 (Fla. 1982). Therefore, we hold that by his failure to make a timely objection, appellant is procedurally barred from claiming relief under Booth.
525 So.2d at 842.
Like Grossman, Jones failed to object to either the sheriff's testimony or the biographical information contained in the presentence investigation report. Therefore, if Grossman was procedurally barred on direct appeal, there can be no question that Jones is barred from raising this point for the first time in his second petition for habeas corpus. Jones' reliance on Scull v. State, 533 So.2d 1137 (Fla. 1988), is misplaced. There, in the course of remanding a capital felony case for resentencing, we simply reminded the trial judge that pursuant to Grossman, victim impact evidence may no longer be considered in capital sentencing proceedings.
Jones also raises a number of other issues which merit only brief mention:
1. A renewed attack on the aggravating circumstance of a prior conviction of a felony involving the use or threat of violence to a person. The validity of this circumstance was raised on direct appeal and any argument on this issue should have been made at that time.
2. A contention that there were improper references to pretrial psychiatric reports which were not introduced into evidence. This is a matter which should have been raised on direct appeal.
3. An assertion based on Caldwell v. Mississippi, 472 U.S. 320, 105 S.Ct. 2633, 86 L.Ed.2d 231 (1985), that the jury's responsibility in making its sentencing recommendation was impermissibly diminished. This argument is procedurally barred because there was no objection to the statements which are said to have offended the principles of Caldwell. Moreover, this argument should have been made on direct appeal because Caldwell did not represent a change in the law upon which to justify a collateral attack. Foster v. State, 518 So.2d 901 (Fla. 1987), cert. denied, ___ U.S. ___, 108 S.Ct. 2914, 101 L.Ed.2d 945 (1988).
4. A new assertion concerning the validity of the aggravating circumstance that the murder was committed to disrupt or hinder the lawful exercise of any governmental function or the enforcement of laws. This circumstance was attacked on direct appeal, and any additional argument on the subject should have been made at that time.
5. An argument grounded on Maynard v. Cartwright, ___ U.S. ___, 108 S.Ct. 1853, 100 L.Ed.2d 372 (1988), that the jury instruction with respect to whether the murder was committed in a cold, calculated, and premeditated manner was overbroad. *293 Maynard dealt with the validity of a jury instruction involving the definition of heinous, atrocious, and cruel. Because Jones' killing was not found to be heinous, atrocious, and cruel, Maynard is inapplicable to this case.
6. A contention that the language of the jury instructions improperly shifted to Jones the burden of proving that the mitigating circumstances outweighed the aggravating circumstances. This argument is procedurally barred because it should have been raised on direct appeal. Clark v. State, 533 So.2d 1144 (Fla. 1988).
The petition for habeas corpus is denied. We decline to extend the stay of execution beyond noon, November 14, 1988. No motion for rehearing may be filed.
It is so ordered.
EHRLICH, C.J., and OVERTON, McDONALD, SHAW, GRIMES and KOGAN, JJ., concur.
BARKETT, J., dissents with an opinion.
BARKETT, Justice, dissenting.
I would reach the substance of the Booth issue, grant a stay and request further briefing from the parties. The sentencing order of the trial judge reflects extensive, emotional reliance on the character and worth of the victim as well as the impact of his death upon his family and his work. I cannot say with certainty that application of the death sentence here has the necessary indicia of reliability required by law. E.g., Eddings v. Oklahoma, 455 U.S. 104, 111, 102 S.Ct. 869, 874, 71 L.Ed.2d 1 (1982). I thus believe we should reach the Booth issue notwithstanding the procedural bar upon which the majority opinion relies.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
How to convert a json payload to a custom object?
We have a json payload:
{
"aps": {
"alert": {
"title": "Payload",
"body": "Lets map this thing"
},
},
"type": "alert",
"message": "This is a message",
}
The custom object has been created:
class PushNotificationDetail {
var title: String //operation
var body: String //message
var type: detailType
var message: String?
init(title: String, body: String, type: detailType, message: string?){
self.title = title
self.body = body
self.type = type
self.message = message
}
}
The problem is mapping it correctly to the created object, what would be the best way to achieve this?
A:
You should use Swift4 Codable protocol to initialise your object from the json returned by the api. You will need to restructure your structure to match the data returned by the api:
struct PushNotificationDetail: Codable, CustomStringConvertible {
let aps: Aps
let type: String
let message: String?
var description: String { return aps.description + " - Type: " + type + " - Message: " + (message ?? "") }
}
struct Aps: Codable, CustomStringConvertible {
let alert: Alert
var description: String { return alert.description }
}
struct Alert: Codable, CustomStringConvertible {
let title: String
let body: String
var description: String { return "Tile: " + title + " - " + "Body: " + body }
}
extension Data {
var string: String { return String(data: self, encoding: .utf8) ?? "" }
}
Playground Testing
let json = """
{"aps":{"alert":{"title":"Payload","body":"Lets map this thing"}},"type":"alert","message":"This is a message"}
"""
if let pnd = try? JSONDecoder().decode(PushNotificationDetail.self, from: Data(json.utf8)) {
print(pnd) // "Tile: Payload - Body: Lets map this thing - Type: alert - Message: This is a message\n"
// lets encode it
if let data = try? JSONEncoder().encode(pnd) {
print(data.string) // "{"aps":{"alert":{"title":"Payload","body":"Lets map this thing"}},"type":"alert","message":"This is a message"}\n"
print(data == Data(json.utf8)) // true
}
}
| null |
minipile
|
NaturalLanguage
|
mit
| null |
"It Came From Kuchar" is a film about the legendary, underground filmmaking twins, George and Mike Kuchar. As kids in the 1950s, George and Mike began making no-budget 8mm epics in their Bronx neighborhood, starring friends and family. In the 1960s the Kuchars became part of Warhol's New York, underground film scene. The Kuchar brother's films have inspired many prominent filmmakers, including John Waters, Buck Henry, Atom Egoyan, Guy Maddin and Wayne Wang.
Rated No Rating .
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The use of video information in obtaining consent for female sterilisation: a randomised study.
Providing additional information by video in addition to the standard consultation in women requesting sterilisation increases patients' knowledge about the procedure with no change in anxiety levels. Randomised control trial in 6 weeks. Women requesting sterilisation (n = 31). Gynaecology clinics in two teaching hospitals. Comparison of providing additional information by video in addition to the standard consultation with the standard consultation. Patients' knowledge of sterilisation, anxiety levels and acceptance of the video approach. Women receiving video information as well as the standard consultation had significantly higher knowledge scores compared with women only receiving the conventional consultation. Women undergoing a conventional consultation (no video) in a nurse-led dedicated sterilisation clinic had significantly higher knowledge scores than women having their consultation in a general gynaecological clinic. There were no differences in anxiety levels between the groups. Information giving by video was acceptable to the majority of women. Videos are a reliable and consistent method of delivering information to women requesting female sterilisation.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Ludwig Boltzmann: The Master of Disorder
The principle in physics called entropy has a convoluted history. The genesis of the idea started in the 1800s with the industrial revolution and the advent of steam engines. Although steam power was producing an incredible amount of energy and transforming societies, the fundamental physical laws behind the process was largely unknown. The full story behind solving this question concludes with Austrian physicist, Ludwig Boltzmann, and his view of entropy. His insights into the physical reality behind heat and energy were later applied to a much larger scheme, including the whole universe.
The Universe in a Coffee Cup
Why does a hot cup of coffee left on a table get colder over time? The answer to this simple questionis at the heart of Boltzmann’s idea. The explanation is due to the behavior of atoms. Today, the existence of atoms is taken for granted, but back in the late 1800s many prominent scientists did not believe in atoms (including Ernst Mach, one of Boltzmann’s adversaries). No one had observed an atom, and it was thought that no one ever would. Nevertheless, Boltzmann peered deeper into the physical world than any of his contemporaries.
Let’s get back to the hot cup of coffee. The heat from the coffee will disperse to the cup, the table and the surrounding air, until the temperature of the coffee is roughly equal to its environment. The same amount of energy still exists, but now covers a wider area. The flow of energy, left alone, will always flow from a hot source to a cold source. This natural flow of energy was the secret behind the steam engine, as the heat energy was converted to physical work. Boltzmann realized that this phenomenon of heat transferring and dispersing could be explained within the framework of atoms.
In the hot coffee, the atoms are tightly arranged and jostling about. The vibrations of the atoms are responsible for the heat. But as they move they contact the atoms of the cup, and transfer some of their energy. This continual process of bumping eventually distributes the heat energy to a much larger number of atoms. In the hot coffee the atoms are arranged in a unique way, but there are may possible arrangements in which the atoms can spread out. In the language of entropy, the system has moved from low entropy (an ordered state) to high entropy (a disordered state). The natural tendency for systems to move from order to disorder is now understood as a fundamental principle that underpins the entire universe. Loosely speaking, this describes the second law of thermodynamics.
What is Order and Disorder?
Classical physics, the method of scientific reasoning that held sway since Issac Newton, demanded that precise calculations were made. Physics was about discovering exactly how things moved and interacted. If atoms really existed, the sheer amount of them imposed an almost insurmountable problem. How could they ever be studied? Boltzmann took a different approach. Perhaps his greatest insight was that the motion of atoms could be described mathematically by using statistical probabilities. In addition to studying atoms, probabilities could be used to determine the amount of entropy in any system. This idea leads us to a definition of order and disorder:
Order means that there are very few configurations, if changed, which would go unnoticed.
Disorder means that there are many configurations, if changed, which would go unnoticed.
For example, take the analogy of a deck of playing cards. Dealt at random, there are few arrangements of cards that will line up in numerical order. Conversely, there are many arrangements of cards that will be mixed up. The reason is obvious. The probability is much higher for a disordered configuration than for an ordered configuration. Order is a special and unique condition, while disorder can come about in numerous ways. Therefore, we can conclude that high entropy (disorder) is a more natural state. We can still create order, but we need to intervene in some way. Still, any system left alone will move from order to disorder (or entropy will increase).
Statistical Reasoning
The entropy in a cup of coffee will tend to increase. Someone has to create the order by heating up the water and making the coffee. What would be the likelihood that the heat would naturally occur in the coffee? Of course we know that doesn’t make any sense. Thus by statistical reasoning, it makes perfect sense that disorder is more likely than order. Entropy, and in turn the second law of thermodynamics, is based on the probability of how any physical system will evolve. Eventually, everything dissolves, crumbles, decays, degrades and collapses.
We don’t need to look any further than our own homes, as it is a constant effort to maintain order (the special condition where items are neatly arranged). Disorder happens much more naturally, because there are many more ways in which the home can be disordered. Left unchecked, dirty dishes will accumulate, laundry will build up, and things will get scattered. The condition of the home’s structure will also degrade over time. This is all due to the principle of entropy.
A Story of Triumph and Tragedy
Boltzmann’s theories were highly controversial in his time; many prominent physicists rejected his ideas. And to make matters worse, he suffered from severe bouts of depression (probably due to undiagnosed bipolar disorder). On the positive side, he also went through periods of intense creativity. Aside from describing what entropy actually was, Boltzmann was able to put numbers to his theory. He devised a mathematical formula that could calculate the amount of disorder in a system.
His use of probabilities went against years of certainty behind the theories of classical physics. In the early 20th century, scientists would soon find his method useful in probing the atom. Probabilities would become a fundamental feature of quantum mechanics. The sad part to the story is that Boltzmann’s achievements would only be recognized after his death. In 1906, he committed suicide during one of his episodes of depression. Whether the final blow was delivered by his mental illness or the lack of recognition for his work is unclear. Nevertheless, his lasting legacy is engraved on his tombstone in Vienna: his equation for quantifying entropy, S = K log W.
References: Order and Disorder the ENERGY – HD Documentary, Published on June 24, 2014.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
There is some evidence that magnesium helps prevent the uterus from contracting too soon, though this is still inconclusive. Magnesium certainly helps prevent cramps, though.
Magnesium citrate, on the other hand, is something that the FDA recommends taking only when the benefits outweigh the risks.
In BJOG: An International Journal of Obstetrics and Gynaecology in August 2007, two studies are cited. The first study concluded:
“Additional magnesium appeared to benefit the fetus during labour. Significantly fewer showed fetal heart rate irregularities, meconium-stained liquor and partogram abnormalities. The supplemented group also had fewer late stillbirths either before or during labour.”
“It must be stressed that these secondary findings, although of interest, need to be substantiated by further work. Until then, supplementation cannot be recommended but poorly nourished women should be encouraged to eat a diet that contains adequate magnesium, in particular brown – rather than white – bread.”
The second study had the following comments:
“In our commentary, we recommend further research to find out whether improving calcium intake from before pregnancy might reduce not only blood pressure, but associated problems such as protein in the urine as well. We suggest that fortification of staple foods might make the benefits of adequate calcium intake available to all pregnant women, not only those with access to antenatal care.”
“While these studies show that the consumption of certain minerals during pregnancy results in favourable outcomes for mother or baby, it must be stressed that in these studies, the intake of supplements are carefully measured.”
“Women should attend their antenatal clinics so that tests identifying problems can be carried out. If they are interested to know more about supplementation, they should speak to their GPs and midwives for further advice.”
“We should note that women who do not have a deficiency in magnesium or calcium need to be careful about taking extra supplements if they don’t need it.”
So, while magnesium looked like a plus, these were undernourished women in the study. Assuming you have a healthy diet, you may want to think twice about using magnesium supplements.
There are several other studies, and while most suggest that magnesium is beneficial for the fetus, almost all balance that by saying that the results for well-nourished women may be different.
So What to Do?
In light of the research, try eating better. An extra serving of spinach, nuts or halibut each day may do wonders. If you really feel the need to take supplements, at least try to make sure the dosage is not much over the RDA of 350mg.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
There is no change in the lives of nearly 1,850 sex workers of Garstin Bastion (GB) Road – renamed as Swami Shraddhanand Marg – part of Chandni Chowk Lok Sabha constituency, one of the seven constituencies of Delhi.
In a season when the voter is the king and political leaders of all hues go door-to-door asking for votes — with many undertaking this exercise only at this time — the electorate of Delhi’s infamous red light area, GB Road, is all but forgotten.
None of the three main candidates contesting from the Chandni Chowk Lok Sabha constituency of Delhi, of which the GB Road is a part, has paid the sex workers a visit. These candidates are – BJP’s sitting MP and Union minister, Harsh Vardhan, Congress’ old-guard JP Agarwal and AAP’s backroom strategist and IT professional, Pankaj Gupta. Polling will be held here on 12 May.
There is no change in the lives of nearly 1,850 sex workers of Garstin Bastion (GB) Road – renamed as Swami Shraddhanand Marg – part of Chandni Chowk Lok Sabha constituency, one of the seven constituencies of Delhi.
The women of these brothels haven’t even received voter’s slip, so they might not be able to cast their vote.
The inmates of brothels living in cramped rooms in the claustrophobic kothas that can aptly be described as pigeon holes see no ray of hope in elections. It’s like the kothas they stay, where no sunlight ever enters.
Narrow corridors flanked by ‘pan’-stained walls after a flight of dark, dingy and steep stairs lead one to these kothas on the first and second floors of old buildings constructed during the British Raj on one side of a kilometre long stretch of the congested GB Road.
Though aware of BJP, AAP and Congress, and about their leaders like Prime Minister Narendra Modi or Delhi chief minister Arvind Kejriwal, most of the sex workers are ignorant about the candidates contesting the Lok Sabha election this time.
Of the 10 Assembly segments in this constituency, the red light area on GB Road is a part of Matia Mahal and Ballimaran seats. The over-crowded Shradhhanand Marg that has the largest wholesale market for tools and equipment, is a witness to anarchy due to unruly traffic, lawlessness, hooliganism in broad daylight, overflowing drains, open gutters and lack of parking facility. A passerby can anytime be intimidated by pimps, pickpockets and hooligans, though there are two police posts, including a Mahila Thana at the two ends of the road.
“Nothing has improved in this area in the last several years. There have been multi-fold times rise in goondagardi (hooliganism) and all sorts of criminal activities in this area, which has made GB Road area very unsafe. There are cases of looting and stabbing in broad daylight. Resultantly, the business in these brothels has drastically declined. We’ve been suffering year after year due to poor civic amenities, but no government has helped in redressing these issues,” said Nazreen, a brothel owner, who now voluntarily works for BPUS for the welfare of sex workers of the area.
The last political leader to have visited the area was former Union minister and Congress candidate Kapil Sibal, who ranked third in the 2014 Lok Sabha election, while Harsh Vardhan defeated AAP’s journalist-turned-politician Ashutosh by over one lakh votes.
“It was during 2014 elections that Kapil Sibal had visited this area and interacted with us including many sex workers. But after that, no one visited, not even Kejriwal, who had made tall promises before elections. In the past, a few politicians used to visit like Congress leader and minister in Sheila Dikshit’s government, Haroon Yusuf. Nothing will change for sex workers, no matter who comes to power,” Iqbal Ahmed, secretary (Delhi unit) of Bhartiya Patita Uddhar Sabha (BPUS) told Firstpost.
BPUS is an NGO founded by activist-president Khairati Lal Bhola (91) that works for the welfare of sex workers. One of the major works done by the organisation was to get voting right for sex workers. Bhola has been demanding legalisation of prostitution or sex trade for years, so that it would free sex workers from the exploitation by brothel owners and pimps, extortion by the police and from the clutches of moneylenders. But, it hasn’t materialised yet.
Till 1947, sex workers were given license to operate, and after 1956, renewal of licenses was discontinued. The sex workers, who are mostly below poverty line, don’t have ration cards.
“Despite trying hard for years, we failed to get ration cards for these sex workers. However, in the face of severe resistance from brothel owners and pimps, we managed to get voter IDs for 1,500 odd sex workers. Though these women cast votes, they don’t get basic facilities like other citizens. AAP government publicised so much about Mohalla Clinics, but there is none here. One has to visit government hospitals or private clinics,” said Ahmed (61), who have been residing in this area almost for four decades and joined BPUS after coming in contact with Bhola.
Issues plaguing GB Road red light area
Lack of basic medical facilities. No Mohalla Clinic in the area.
No free distribution of condoms. There are no condom dispensation machines. Under the Central government’s AIDS prevention programme, the National AIDS Control Organisation (NACO) distributes free condoms.
Most of the time, street lights are dysfunctional, which has made GB Road a safe haven for criminals. From snatching, robbing, drug peddling to intimidation by touts and pimps, and murder – every form of crime takes place even in broad daylight.
Lack of parking facility, traffic congestion and overflowing drains.
According to residents, the municipal corporation doesn’t bother to take preventive measures during monsoons against vector-borne diseases by spraying DDT and other insecticides.
Any address mentioning GB Road on any document itself is a problem for the children of sex workers during school admission.
The hooliganism and the unsafe atmosphere in the area have badly affected the business of tools and equipment. The General Machinery and Merchant Association has given several memoranda to the government and district administration for safety and security, but to no effect.
“Sahab humey rajneeti samaj nahi aati (Sir, we don’t understand politics). But every time an election takes place and a new government is formed, we pray that they would do something for the unfortunates like us. Instead, we have faced harassment by Mahila Aayog (Delhi Commission for Women) on the pretext of raids,” lamented Rani (name changed) a sex worker who has been a resident of GB Road for the last 18 years.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Direct medical costs and medication compliance among fibromyalgia patients: duloxetine initiators vs. pregabalin initiators.
To assess and compare direct medical costs and medication compliance between patients with fibromyalgia who initiated duloxetine and patients with fibromyalgia who initiated pregabalin in 2008. A retrospective cohort study design was used based on a large US national commercial claims database (2006 to 2009). Patients with fibromyalgia aged 18 to 64 who initiated duloxetine or pregabalin in 2008 and who had continuous health insurance 1 year preceding and 1 year following the initiation were selected into duloxetine cohort or pregabalin cohort based on their initiated agent. Medication compliance was measured by total supply days, medication possession ratio (MPR), and proportion of patients with MPR ≥ 0.8. Direct medical costs were measured by annual costs per patient and compared between the cohorts in the year following the initiation. Propensity score stratification and bootstrapping methods were used to adjust for distribution bias, as well as cross-cohort differences in demographic, clinical and economic characteristics, and medication history prior to the initiation. Both the duloxetine (n = 3,033) and pregabalin (n = 4,838) cohorts had a mean initiation age around 49 years, 89% were women. During the postindex year, compared to the pregabalin cohort, the duloxetine cohort had higher totally annual supply days (273.5 vs. 176.6, P < 0.05), higher MPR (0.7 vs. 0.5, P < 0.05), and more patients with MPR ≥ 0.8 (45.1% vs. 29.4%, P < 0.05). Further, relative to pregabalin cohort, duloxetine cohort had lower inpatient costs ($2,994.9 vs. $4,949.6, P < 0.05), lower outpatient costs ($8,259.6 vs. $10,312.2, P < 0.05), similar medication costs ($5,214.6 vs. $5,290.8, P > 0.05), and lower total medical costs ($16,469.1 vs. $20,552.6, P < 0.05) in the postinitiation year. In a real-world setting, patients with fibromyalgia who initiated duloxetine in 2008 had better medication compliance and consumed less inpatient, outpatient, and total medical costs than those who initiated pregabalin.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Alloy valve extender that screws onto the existing valve stem. Simple to use, no valve core removal & reinstallation. Needed. The valve can not be mechanically closed after the extender is installed, air pressure in the tire keeps it from opening.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Judith Benitez had gone most of her adult life without knowing how to drive.
The 35-year-old woman from Mexico who is in the U.S. illegally would ask family members for rides to pick up her children from school. Trips to the grocery store or the doctor’s office were complicated.
That changed last year when Assembly Bill 60 was implemented, granting people in the country illegally the right to obtain driver’s licenses in California. Benitez, who lives in Lemon Grove, learned to drive and was among those in line at the Department of Motor Vehicles the day the law took effect.
“Truthfully, it was an extremely emotional time because having a [driver’s] license isn’t just any little thing,” she said. “We feel a little more protected.”
An estimated 605,000 licenses were issued under the law last year, accounting for nearly half of all new licenses, according to the California DMV. Nearly 400,000 of the licenses were issued during the first six months.
“We believe that this new law increases safety on California roads by putting licensed drivers behind the steering wheel,” spokesman Artemio Armenta said.
Gov. Jerry Brown signed the measure into law in 2013, further establishing California as a national leader on immigrant rights. The legislation was authored by Assemblyman Luis Alejo (D-Salinas), the son of farmworkers.
Brown in August signed a trio of immigration-related measures, which included elimination of the word “alien” within California’s labor code to describe immigrants in the country illegally. The new laws also included allowing noncitizen high school students to serve as election poll workers and protecting immigrant minors in civil lawsuits.
Licenses granted under the law have “federal limits apply” printed on them, which means that unlike California law enforcement, law enforcement officers in other states and federal officials aren’t obligated to accept the licenses as a valid form of identification.
State leaders and law enforcement officials have said the law will improve road safety because more drivers will be licensed and be more likely to be insured.
Join the conversation on Facebook >>
Officer Josh Nelson, spokesman for the California Highway Patrol Border Division, said it’s difficult to determine whether improved traffic safety is correlated with the implementation of the law, but said it’s likely.
“Knowing that these drivers are being properly trained in order to get their licenses, it would only make sense that the roads would be safer,” he said.
California is among 12 states that now allow immigrants in the country illegally to obtain driver’s licenses, areas covering an estimated 37% of that population, according to an August report by the Pew Charitable Trusts.
California, at 22%, has the nation’s largest percentage of immigrants in the country illegally who are eligible for driver’s licenses, according to Pew.
Critics say immigrants in the country illegally shouldn’t be given the privilege of obtaining licenses because they broke the law by entering the country. States such as California are only facilitating illegal immigration, they argue.
Other states such as Florida, New Jersey and Georgia have considered whether immigrants in the country illegally are entitled to driver’s licenses, a rite of passage deeply rooted in American culture.
In the year before the California law was implemented , the DMV hired 1,000 temporary employees and opened four additional processing centers. It also extended hours of operation to include Saturdays.
“The demand at the beginning of the year was very high because we had literally done more than 200 outreach events across the state. We were all hands on deck,” Armenta said.
The DMV has since resumed regular office hours and only 200 temporary employees will remain by the 2016-2017 fiscal year.
Erika Paz emigrated from Mexico in 1987, but her visa expired soon after. Though she obtained her driver’s license seven years ago as a permanent resident and is now a U.S. citizen, Paz created a public Facebook group to help community members exchange tips about the driver’s license law.
The group, Preparándonos para las Licencias, or Preparing Ourselves for Licenses, has garnered about 18,000 followers since its creation in 2014.
“Community members have become very helpful toward each other, to the point where the person who gets their license is willing to help another person by either lending them their car or driving them to the DMV to take their test,” Paz said.
Maribel Solache joined the thousands of other immigrants in the country illegally who lined up at the DMV early Jan. 2, 2015, the first day licenses became available. She recalls a chaotic scene with long lines, limited staff and a downed computer system.
“There was a big resistance and fear but upon getting to the DMV and seeing the diversity of people there, I felt like I wasn’t the only one in that situation,” she said in Spanish.
The San Marcos resident passed her written exam on the first attempt and her driving exam 10 days later. Within a week, she had her license. Today Solache, a former attorney from Mexico City, leads small study groups in which she helps others navigate the license application process.
[email protected]
Sanchez is a staff writer for the San Diego Union-Tribune.
Interested in the stories shaping California? Sign up for the free Essential California newsletter >>
ALSO
Suffering bobcats, coyotes, owls spur Thousand Oaks neighborhood to rethink war on rats
Arrests in 1989 El Salvador priest massacre elicit shock, happiness — and a hope for justice
6th Street Bridge before and after
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Success
Success
Black Velvet Booth Seating - Corner
This black velvet corner booth seat is part of our extensive modular booth seating range. This range provides a really flexible seating solution for event organizers as the various sections can be arranged in pretty much any configuration to ensure you've got the perfect seating for your event.
Our modular booth seating comes in 4 different sections, choose from middle, end, back and corner sections, and together you can create seating to suit any space or seating requirements. Create stylish booth seating, bench style seating or even creative curved seating arrangements
Our booth seating is available leather or velvet and comes in a vast array of different colours. Our modular booth seating provides a truly versatile choice really will make the most of your space whilst creating a cosy seating area for your guests and clients. Boasting Chesterfield style button detail, deep seats and high backrests the range is built for comfort and style.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Noel Sheppard
Noel Sheppard was an American conservative commentator, editor, and small business owner from Northern California. He had contributed to the Washington Examiner, National Review, The American Spectator, and the websites the American Thinker and Real Clear Politics. Sheppard had been a guest commentator on Fox News, Headline News, and CNN. He was also the owner of Secure Legacy Estate Planning, a legal and financial estate planning firm based out of Danville, California
In 2005, Sheppard became a founding contributor and associate editor to the Media Research Center's NewsBusters website. He died March 28, 2014, two months after receiving a diagnosis of lung and lymph node cancer.
References
External links
Category:2014 deaths
Category:American alternative journalists
Category:American bloggers
Category:American political writers
Category:American male non-fiction writers
Category:American conservative people
Category:Deaths from lung cancer
Category:Deaths from lymphoma
Category:National Review people
Category:Online journalists
Category:The American Spectator people
Category:Year of birth missing
Category:21st-century American non-fiction writers
Category:American male bloggers
| null |
minipile
|
NaturalLanguage
|
mit
| null |
List of terrorist incidents in Punjab (India)
This is a partial list of victims of violence in Punjab (India) during the 1980s and 1990s.
During the Punjab insurgency
After end of Punjab insurgency
On 31 August 1995, Chief minister Beant Singh was killed by a suicide bomber. The pro-Khalistan group Babbar Khalsa claimed responsibility for the assassination, but "security authorities" were reported to be doubtful of the truth of that claim. A 2006 press release by the Embassy of the United States in New Delhi indicated that the responsible organization was the Khalistan Commando Force.
The Indian Express reported in its online edition on 19 June 2006 that the Khalistan Zindabad Force(KZF) was behind bomb blasts in Jalandhar, India, at the Inter-State Bus Terminus that left three people killed and injured 12. A police spokesman said the attack was planned by a pair of KZF leaders, one based in Pakistan and one in Canada, and executed by a "local criminal".
On 22 May 2005, Consecutive bomb blasts took place in the Liberty cinema and Satyam cinema in New Delhi during the screeing of the movie Jo Jo Bole So Nihaal (film) in which 3 people died and dozens were injured. The movie was being opposed by a section of intellectual Sikhs.
On 14 October 2007, Six people were killed and 32 injured in a bomb blast at Shingaar cinema hall,Ludhiana.
On 24 September 2009, the Punjab Police arrested two Babbar Khalsa militants involved in the assassination of Rulda Singh, president of the Punjab Rashtriya Sikh Sangat who was shot at and seriously injured by two unidentified persons at his residence near New Grain market on 29 July.
On 27 July 2015, Insurgent Gunmen from Pakistan in Army fatigues attacked a Police Station in Gurdaspur. 7 people died including Gurdaspur SP and 3 terrorist also gunned down by Punjab Police SWAT Team.
On 2 January 2016, some terrorists who crossed the border from Pakistan illegally armed with weapons attacked the Indian Air Force base in Pathankot. Six terrorist and 7 soldiers were killed in it.
See also
Punjab insurgency
Operation Blue Star
Operation Woodrose
1991 Punjab killings
1987 Punjab killings
References
Bibliography
Knights of Falsehood, KPS Gill, 1997
Global security watch, Satyapal Dang, 2008
Sikhs Slay 13 Hindus In Punjab, United Press International, 29 March 1986
Sikh Extremists Open Fire On Top Punjab Police Official, 4 October 1986 The New York Times
External links
Bombs exploded today at a crowded vegetable wholesale market
Bomb Blast Kills 24, Injures 45 in India; Sikh Militants Blamed
Category:Terrorism in Punjab, India
Terrorism
Punjab India
Category:History of Punjab, India (1947–present)
Category:Sikh terrorism
Category:Lists of disasters in India
Terrorist incidents in Punjab
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The role of infarction-associated pericarditis on the occurrence of atrial fibrillation.
Transient atrial fibrillation is a relatively common arrhythmia in the early phase of acute Q-wave myocardial infarction. However, the role of infarction-associated pericarditis on the genesis of atrial fibrillation is controversial. This study was designed to examine the relative importance of infarction-associated pericarditis among other clinical variables on the genesis of transient atrial fibrillation in patients with acute myocardial infarction. Three hundred and ninety-eight patients with acute Q-wave myocardial infarction were examined carefully by means of auscultation, ECG, two-dimensional echocardiography and haemodynamic measurements. The diagnosis of pericarditis was made on the basis of pericardial rub detected during the first 3 days after admission. At least 0.5 mm of PQ-segment depression from a TP segment lasting more than 24 h in both limb and precordial leads was considered diagnostic of PQ-segment depression. Atrial fibrillation was present in 76 patients (19%). Sixteen (42%) of 38 patients with PQ-segment depression had atrial fibrillation, whereas 23 (30%) of 77 patients with pericardial rub had atrial fibrillation. Based on ten clinical variables, multivariate analysis was performed to determine the important variables related to the occurrence of atrial fibrillation. PQ-segment depression (chi-square = 4.10, P < 0.05) was selected with age (chi-square = 10.52, P < 0.005), the number of left ventricular segments with advanced asynergy (chi-square = 7.73, P < 0.01) and pericardial effusion (chi-square = 7.95, P < 0.005) as important factors related to atrial fibrillation. Patients with PQ-segment depression had a significantly higher pulmonary capillary wedge pressure than those without it. Among patients with infarction-associated pericarditis, those with PQ-segment depression represent atrial involvement associated with extensive myocardial damage and hence, PQ-segment depression is one of the clinical signs related to the occurrence of atrial fibrillation in acute Q-wave myocardial infarction.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[Quantitative study on copy numbers of porcine endogenous retroviruses in genome of Banna miniature swine inbred line].
To investigate the copy numbers of porcine endogenous retroviruses in genome of Banna miniature swines for screening of donors in xenotransplantation with porcine transplants. The genomic DNA of peripheral blood mononuclear cells(PBMCs) of 50 Banna miniature swines in 4 inbred sublines and 5 European Large White Pigs was extracted for the detection to pol, envA, envB, envC and envA/C recombinant in PERVs with real-time quantitative/semi-quantitative PCR and normal PCR. PCR products of pol, envA and envB of PERV could be obtained from all the Banna samples, and the mean amount of these products was 24.2+/-9.4,13.1+/-8.4,16.4+/-9.8 respectively and was significantly different among the inbred herds (P<0.01). The envC and envA/C were not amplified. The copy numbers of pol, envA and envB genes of PERV in porcine genome were significantly different among the inbred herds of Banna miniature swines, and envC and envA/C were absent in genome of Banna Miniature Swines.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
INTRODUCTION {#sec1-1}
============
The primary reason for an endodontic failure is the persistence or regrowth of bacteria within the root canal system (RCS); such cases require retreatment.\[[@ref1]\] When retreatment is indicated, efficient and thorough removal of all the root canal filling material is required, allowing effective disinfection and a favorable outcome.\[[@ref2]\] However, many studies have reported that complete removal of the root canal filling is difficult.\[[@ref3][@ref4][@ref5]\]
Various instrumentation techniques are available for effective removal of root fillings. These include endodontic hand files, engine-driven rotary files, ultrasonic tips and files, and heat-carrying instruments. The use of rotary files successfully facilitates an effective removal of the bulk of gutta-percha--based fillings from the RCS.\[[@ref6][@ref7][@ref8]\]
The use of gutta-percha solvents in conjunction with endodontic instrumentation results in easier removal of gutta-percha from the root canals.\[[@ref9][@ref10]\] Chloroform is the most commonly used gutta-percha solvent because it acts very rapidly, but was proposed to be a potential carcinogen.\[[@ref11][@ref12]\] Other solvents include xylene, Endosolv R (Septodont, Paris, France), refined orange oil, eucalyptol, and tetrachloroethylene.\[[@ref9][@ref10]\]
Fruchi *et al*. reported that WaveOne (25/0.08, Dentsply Tulsa Dental Specialties, Tulsa, OK) reciprocating files, when used alone to remove the root fillings, leave some residue within the RCS.\[[@ref13]\] It is a published fact that ProTaper retreatment files (Dentsply Maillefer) alone leave around 10-35% of the root fillings after their use.\[[@ref14][@ref15]\] Hence, use of supplementary files is recommended. Recently, Abramovitz *et al*. reported that the use of Self-Adjusting File (SAF; ReDent, Ra'anana, Israel) as a supplementary tool after the use of D1-D3 ProTaper retreatment files resulted in much cleaner canals during retreatment.\[[@ref15]\] Solomonov *et al*. also concluded that a combination of ProFile (Maillefer Instruments, Ballaigues, Switzerland) for removal of the bulk of root filling and SAF to remove the remaining root filling residue was more effective than ProTaper retreatment files followed by ProTaper F1 and F2. The ProFile + SAF group was also reported to consume less time than the ProTaper group.\[[@ref16]\] Nevertheless, the design of this study did not allow isolation of the effect of the SAF *per se* on either the cleaning efficacy or the time required to accomplish the procedure.
As root filling residue is present after using retreatment files and the use of supplementary file is indicated,\[[@ref14][@ref15][@ref16]\] the present *ex vivo* study was designed to compare the efficacy of removing root fillings from oval canals using ProTaper retreatment files followed by either WaveOne reciprocating file or the SAF using high-resolution cone-beam computed tomography (CBCT).
MATERIALS AND METHODS {#sec1-2}
=====================
Selection of teeth {#sec2-1}
------------------
Forty maxillary canines with single root canal with no previous endodontic treatment and completely developed apices were selected from a collection of recently extracted teeth. The teeth were cleaned ultrasonically (UDS-P, Woodpecker, Guangxi, China) of any calculus and plaque accumulation. The teeth were sectioned at/below the cementoenamel junction (CEJ) to obtain a root length of 18 mm for all the samples. A \#15 K-file was placed in the root canal to the apical foramen and the working length was established by reducing 1 mm. The teeth were instrumented with WaveOne primary files (25/0.08), using X Smart Plus endomotor (Dentsply Maillefer). The shaping procedure was continued till the file reached the working length. Irrigation was done with 3% sodium hypochlorite (NaOCl) and ethylenediaminetetraacetic acid (EDTA) Gel (RC Help, Prime Dental Products, Mumbai, India) as used as lubricant. After instrumentation, the canals were irrigated with 17% aqueous EDTA solution, followed by flushing the canal with distilled water and drying the canal with paper points.
Obturation was done using standard WaveOne master cones (Dentsply Tulsa Dental Specialties) and AH-Plus sealer (Dentsply DeTrey, Konstanz, Germany) followed by warm lateral compaction using accessory gutta-percha cones. The excess gutta-percha was removed using a heated hand plugger. The teeth were then kept for 30 days at 37°C and 100% humidity to allow complete setting of the sealer. The samples were mounted on wax-blocks, and preoperative CBCT scan was performed.
The teeth were then randomly divided into two groups (*N* = 20) for the retreatment procedure.
Retreatment procedures {#sec2-2}
----------------------
### Group 1: ProTaper retreatment files followed by WaveOne file {#sec3-1}
ProTaper retreatment files D1-D3 were used to remove the bulk of the root canal filling material, following manufacturer\'s instructions. These files were used till no gutta-percha was visible on the file when it was withdrawn from the root canal. Endosolv R was used as a gutta-percha softener. The canals were irrigated with 3% NaOCl between each file and a final rinse was performed with 2 mL of 3% NaOCl.
After the procedure detailed above, a WaveOne primary file was used with Endosolv R. A drop of the solvent was placed in the canal and the WaveOne file was used for removal of residual root filling material. Whenever the file met resistance the file was withdrawn, the canal was irrigated with NaOCl, the canal was dried, Endosolv R was placed again, and the procedure was continued. The instrumentation was continued till the file reached the working length and till no debris was visible on the file. After instrumentation the canal was irrigated with 2 mL of 3% NaOCl.
The teeth were then dried and a postoperative CBCT was performed.
### Group 2: ProTaper retreatment files followed by SAF {#sec3-2}
The initial stage of the procedure for removing the bulk of root filling was carried out in a similar manner as in Group 1.
After removing the bulk of root filling material, a SAF file (2.0 mm diameter) was used to remove the remaining root filling residue. It was operated with an RDT3-NX handpiece-head (ReDent-Nova, Ra'anana, Israel) attached to an X-Smart Plus endomotor, at 5000 vibrations/min. Irrigation, as indicated below, was provided using a VATEA peristaltic pump (ReDent-Nova).
First, the SAF was operated in the canal for 1 min under continuous NaOCl irrigation to remove coarse root filling debris.\[[@ref17]\] Next, the VATEA pump was turned off and the canal was dried. The canal was then filled with a drop of Endosolv R, following by SAF operation in the canal again for 1 min. Subsequently, the Endosolve R was removed by irrigating the root canal with 1 mL of 3% NaOCl, the canal was dried, the canal was filled again with Endosolv R, and the SAF was operated again for 1 min. Next, the VATEA pump was turned on, and the SAF operated with 3% NaOCl irrigation for an additional 30 s. The teeth were then dried and a postoperative CBCT performed.
CBCT scans {#sec2-3}
----------
The CBCT scans were obtained using ProMax 3D Mid (Planmeca OY, Helsinki, Finland). The samples were exposed to 90 kV and 8 mA with a FOV of 4.5 × 4.5 cm^2^ and an isotropic resolution of 0.1 mm, with 12.28 s exposure time. The artifacts created by the radiopaque root fillings were decreased/eliminated using inbuilt software (Romexis v3.20, Planmeca OY, Helsinki, Finland).
Statistical analysis {#sec2-4}
--------------------
Mean \[±standard deviation (SD)\] were calculated for each parameter for each group and the groups compared to each other using Student\'s *t*-test (SPSS Inc. software v20 Inc., Chicago, IL, USA).
RESULTS {#sec1-3}
=======
Volume of the root fillings {#sec2-5}
---------------------------
The mean preoperative volume of the root canal fillings was 36.3 (±1.8) mm^3^ in Group 1 and 36.6 (±1.3) mm^3^ in Group 2. Statistical analysis revealed that the two groups did not differ from each other.
Volume of root filling residue {#sec2-6}
------------------------------
The mean postoperative volume of the root filling residue was 9.4 (±0.5) mm^3^ in Group 1 and 2.6 (±0.4) mm^3^ in Group 2. These residue volumes represented 26% and 7% of the original root filling volumes in Group 1 and Group 2, respectively. \[Figure [1a](#F1){ref-type="fig"}--[d](#F1){ref-type="fig"}\] The amount of residue left in the canal after the ProTaper retreatment files + WaveOne procedure was 3.6× larger than that which was left after the ProTaper retreatment files + SAF procedure. The difference was statistically significant (Student\'s *t*-test, *P* \< 0.001) \[[Figure 2](#F2){ref-type="fig"}\]. The mean time required for the completion of the retreatment procedure was 8.6 (±0.56) min and 8.41 (±0.36) min for Group 1 and Group 2 respectively (*P* \> 0.05; Student\'s *t*-test).
{#F1}
{#F2}
DISCUSSION {#sec1-4}
==========
Retreatment is considered a valid alternative for extraction in case of failure in endodontic treatment. The complete removal of root filling material is difficult, but it is one of the main goals of nonsurgical endodontic retreatment procedures.\[[@ref3][@ref4][@ref5]\]
A warm lateral compaction obturation technique was chosen in the present study because it produces a better gutta-percha adaptation to the root canal walls than the lateral compaction technique.\[[@ref18]\] This was especially important as the canals of the canines that were used in the present study had oval cross sections. Wilcox *et al*.\[[@ref3]\] and Friedman *et al*.\[[@ref19]\] have shown that epoxy-resin--based sealers adhere to the dentine and are more difficult to remove. Therefore, in order to test the retreatment protocols in challenging conditions, AH-Plus sealer, an epoxy-resin sealer was used in the present study.
Both of retreatment protocols that were compared in the present study consisted of a two-stage procedure. The first stage was standardized by the use of ProTaper retreatment files (D1-D3) to remove the bulk of root filling material. The second stage aimed to remove the remaining root filling residue.
Previous studies have reported that retreatment with ProTaper retreatment files (D1-D3) alone failed to render the canals completely free of root filling residue.\[[@ref15][@ref20]\] Therefore, an additional file has been used in an attempt to effectively remove the root filling residue. The inability of the D1-D3 files to remove the root filling residue in the apical part of the canal is not surprising and could be expected, as the apical size of the D3 file is 20 and in many clinical cases the initial preparation of the apical part of the canal was greater than 20. In the present study, too, the initial preparation of the canal was done with WaveOne primary file (apical size of 25).
In the present study, an additional procedure was performed after the D3 file, using either WaveOne primary files in Group 1 or the SAF in group 2. The WaveOne file was tested here as it was the file used to initially prepare these canals and was likely to remove the root filling residue without excessive altering of the shape of the canal. The use of larger files, such as the WaveOne "large" file with an apical size of 40, was avoided as they might alter the shape of the canal, increasing the risk of canal transportation.\[[@ref16]\]
The SAF was used in Group 2. This file adapts to the cross section of the canal and has a scrubbing effect on the walls.\[[@ref21][@ref22][@ref23]\] The ability of the SAF to adapt to an oval cross section of the canal may explain its better cleaning ability, which was found in the present study. While the WaveOne reciprocating file was likely to reach all the canal walls that were initially instrumented with the same size and type of file, it most probably could not reach root filling material that was present in the buccal and/or lingual recesses.
Solomonov *et al*. found that a retreatment procedure consisting of ProFile followed by the SAF was more effective than ProTaper retreatment files followed by ProTaper F2 file. They had used two different files for removal of the bulk of root filling material. In one group this was done using three files (D1-D3) and in the other just one ProFile (\#25 with 0.6 taper) file, which could be the possible reason for the time required being less when ProFile and SAF were used.\[[@ref16]\] In order to isolate the second part of the procedure as a single variable, the removal of bulk of root filing material in each group of the present study was standardized.
It was recently reported that the use of two-dimensional (2D) radiographs failed to represent the real cleanliness of the canal and thus the effectiveness of retreatment procedures.\[[@ref24]\] In the present study, three-dimensional (3D) CBCT, which is readily available to more researchers than micro-CT, was used to compare the efficiency of two retreatment protocols.
CONCLUSIONS {#sec1-5}
===========
This *ex vivo* study has shown that root filling material could not be removed completely from the root canals by either of the retreatment protocols tested. However, a retreatment procedure consisting of ProTaper retreatment files followed by SAF resulted in cleaner root canal space when compared to ProTaper retreatment files followed by WaveOne. CBCT with its built-in software may also be a valid tool for such *ex vivo* studies.
Financial support and sponsorship {#sec2-7}
---------------------------------
Nil.
Conflicts of interest {#sec2-8}
---------------------
There are no conflicts of interest.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Patagonia micropuff hoody, Men's medium.
This one is used with minor thread pulls
in chest at logo (photo) and small pink
stain on arm (photo). It ...
238
Good
65.00
Thu December 18, 2014 1:15am
Patagonia Guide Hoody
posted by D.B.AndersonPatagonia Guide hoody size men's small.
Few years old but great shape other than small
nick on elbow (see pic). Zipper works fine but has
one missing tooth. Never has been a ...
| null |
minipile
|
NaturalLanguage
|
mit
| null |
This article is part of an ongoing “No Blue Wave” series which analyzes the upcoming midterms. Read other parts in The Renegade Deplorable — Max’s exclusive column for Halsey News.
The fabled “Blue Wave” has yet to appear in North Carolina early voting.
In fact, NC early voting casts huge doubt of any ‘blue wave’ in November whatsoever.
Democrats are down -5% from 2014 — a year Ds lost Congressional and Senate races — while Republicans are matching their 2016 levels at 30%.
Digging deeper, turnout seems to be highest among those 60+ with a drop of -5% among African-Americans.
Meanwhile, white voter turnout shows a marginal increase of +3% from 2016.
Overall, early voting is down from the 2014 midterm elections — largely because of the Democrat drop off.
It should be noted Democrats outnumber Republicans in registration.
However, as in West Virginia, significant numbers of Southern Dems vote Republican. Bear in mind, Republicans typically win the election day vote. Therefore, Democrats need a disproportionately heavy turnout of their base in the early vote in order to win on election day.
Collectively, the data suggests the GOP is in for a good night, despite agenda polls being utilized by the MSM to depress Republican turnout.
Regardless, make sure you drag your Republican friends with you to the polls on November 6th!
Subscribe to The Max Radio Broadcast here.
Follow Max on Twitter @Maximus_4EVR & @Maximus_Legacy.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Background: American Indians (hereafter: Indigenous) have higher rates of diabetes and diabetes-related complications than the general population. It is important for individuals with diabetes to engage in diabetes self-management behaviors (DSMB) to prevent complications and enhance outcomes, and many different social and individual determinants impact the likelihood of performing these behaviors. Despite the breadth of literature investigating factors influencing DSMB, little information describes these behaviors among Indigenous individuals with type 2 diabetes (T2D), and no data were found regarding culturally specific factors impacting them. Aims: The purpose of this study is to determine factors influencing DSMB of Indigenous individuals who are recently diagnosed with T2D. Methods: This cross-sectional study will utilize an adapted form of Andersen's Behavioral Model to examine the predisposing and enabling characteristics impacting DSMB in five upper Midwest Indigenous tribal communities. Participants will be randomly selected from clinic records if they identify as American Indian, are over the age of 18, and have been diagnosed within the past two years with T2D. A total of 256 individuals will be invited to participate. Participants will complete computer-assisted personal interviews (CAPI). Data analysis will include descriptive statistics, bivariate correlations, regression models, and structural equation modeling. Expected Outcomes: This research will enhance the knowledge of rates of engagement in DSMB, and elucidate the factors influencing these behaviors. Results will facilitate future planning of both provider- and community-based interventions to address barriers and facilitators of DSMB. Understanding the complex relationship between individual and community level factors will provide impetus for socio-ecological interventions aimed at multiple levels of determinants.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Please confirm: NSTimer is to repeatedly make an event occur at intervals
I'm trying to make an iOS app. As part of the app, I want a UIScrollView to scroll every X seconds. I believe that I need to use NSTimer. Is this correct?
A:
Yes. You can use NSTimer for this:
float interval = 2.5f; //whatever interval you want
NSTimer *timer = [NSTimer scheduledTimerWithTimeInterval:interval target:someTarget selector:@selector(someSelector:) userInfo:nil repeats:YES];
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
Java-Read Text Files And Store Them As Arrays
I have the following piece of code. I do not understand why its not working.
I'd really appreciate help on this.
import java.util.Scanner;
import java.io.*;
class ReadFiles {
String [] codes = new String[99];
int i = 0;
private Scanner readCodes;
public void openCodesFile() {
try {
readCodes = new Scanner(new File("C:/Users/Carlo/Desktop/Files/codes.txt"));
} catch (Exception e) {
System.out.println("Could not locate the data file!");
}
}
public void readCodesFile() {
while(readCodes.hasNext()) {
codes[i] = readCodes.nextLine();
i++;
System.out.println(codes[i]);
}
}
public void closeCodesFile() {
readCodes.close();
}
}
class NewHardware {
public static void main(String[] args) {
ReadFiles codesRead = new ReadFiles();
codesRead.openCodesFile();
codesRead.readCodesFile();
codesRead.closeCodesFile();
}
}
The output prints out "null" a bunch of times.
Also, I want to be able to not only print out the codes but use the codes array in the class NewHardware and manipulate it (print it out, truncate it, etc).
I was thinking of doing the following with readCodesFile():
public String readCodesFile() {
while(readCodes.hasNext()) {
codes[i] = readCodes.nextLine();
i++;
System.out.println(codes[i]);
}
return (codes[i]);
}
Or something but it hasn't worked just yet. Am I on the right track?
Oh, just wanted to add that the text contains the following:
G22
K13
S21
I30
H15
N23
L33
E19
U49
EDIT:
Thanks to Tony and Churk below to help me with my idiocy. I am accepting Tony's answer basically because he challenged me to think but Churk's answer is just as valuable.
For the second part of my question (where I asked about being able to use it in class NewHardware), I did the following:
class NewHardware {
public static void main(String[] args) {
ReadFiles codesRead = new ReadFiles();
codesRead.openCodesFile();
codesRead.readCodesFile();
for (int i = 0; i < 9; i++) {
System.out.println("\n\n" + codesRead.codes[i]);
}
codesRead.closeCodesFile();
}
}
This is of course not the final program code but this has helped me get the basic idea. Hope this helps others too.
A:
Look carefully at your readCodesFile() method. Look at every line. What is it doing? Can you explain it to us?
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The Trump administration decided on Saturday, July 7, to suspend risk adjustment payments that were designed under the Affordable Care Act to provide stability to individual health insurance markets across the nation. The payments encouraged health insurers to enroll more consumers in plans and offered some financial help to cover the costs of individuals with higher medical care. Insurance Commissioner Kreidler offered the following statement.
”The Trump administration’s suspension of risk adjustment payments is just the latest attempt to undermine health care for millions of consumers across the country, including about 270,000 people enrolled in Washington state’s individual market. Without this program, insurers might have taken on less risk in the market, especially in rural counties.
“The timing of this suspension is a clear signal the administration intends to further increase instability. President Trump is imposing another uncertainty tax on consumers looking for health care.
“I fear this latest decision, if it stands, will lead to fewer choices for consumers and higher premiums they would pay for health plans in 2019. Insurers proposed rates in May. With suspension of the risk adjustment payments, insurers must now contend with another disruption to the market by the time they finalize rates early this fall. This is another act of sabotage by the administration.
“It’s also taking legal action to abandon the protection for people with pre-existing conditions. All of these acts take direct aim at the heart of the Affordable Care Act and the viability of individual health insurance markets everywhere.
“The administration has failed miserably to live up to its promise of better health care, so now it’s taking a million cuts to undermine the market and harm consumers in the end.”
| null |
minipile
|
NaturalLanguage
|
mit
| null |
DID I mention that I’ve signed a pledge — just like those Republican congressmen who have signed written promises to different political enforcers not to raise taxes or permit same-sex marriage? My pledge is to never vote for anyone stupid enough to sign a pledge — thereby abdicating their governing responsibilities in a period of incredibly rapid change and financial stress. Sorry, I’ve signed it. Nothing more I can do.
If this kind of idiocy by elected officials sends you into a hair-pulling rage and leaves you wishing that we had more options today than our two-party system is putting forward — for instance, a party that would have offered a grand bargain on the deficit two years ago, not on the eve of a Treasury default — not only are you not alone, but help may be on the way.
Thanks to a quiet political start-up that is now ready to show its hand, a viable, centrist, third presidential ticket, elected by an Internet convention, is going to emerge in 2012. I know it sounds gimmicky — an Internet convention — but an impressive group of frustrated Democrats, Republicans and independents, called Americans Elect, is really serious, and they have thought out this process well. In a few days, Americans Elect will formally submit the 1.6 million signatures it has gathered to get on the presidential ballot in California as part of its unfolding national effort to get on the ballots of all 50 states for 2012.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Lionel Messi has been a soccer star since he was a teenager, so few can understand what it’s like to grow up in the public eye.
Luckily, Sergio Aguero, was available to set Messi at ease and conduct a recent interview with the FC Barcelona and Argentina goal machine.
As Messi prepared for yet another interview (where he would probably answer the same bland questions in his usual understated manner), the surprise guest interviewer emerged, thanks to Argentine production company Mundo Leo.
Aguero, 25, and Messi, 26, have been friends and occasional teammates since they were teenagers, so Messi was comfortable answering some unusual questions. The duo riffs on topics such as Messi’s messiest roomate, toughest video-game soccer opponent, and which of their sons will wear the iconic No. 10 jersey for Argentina in the future.
Messi beams with delight throughout the interview, which shows soccer fans that he can have a sunny disposition off the field, after all.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Visitors can enjoy a pint - or two - at the Guinness Storehouse in Dublin, Ireland. The company recently announced it will no longer be using fish bladders in the brewing process to make the beer more attractive to vegetarians and vegans. Photo by POM POM/Shutterstock
DUBLIN, Ireland, Nov. 4 (UPI) -- The Guinness Brewing company announced fish bladders are being eliminated from the brewing process to allow vegans and vegetarians to enjoy the company's beer.
The brewery's 256-year-old recipe for its famous dark stout calls for fish bladders known as isinglass to be used as part of the filtration process to help yeast settle and clarify the liquid, but the company said the process is being changed to make the brew more vegan-friendly.
"Isinglass has been used widely within the brewing industry as a means of filtration for decades," Guinness said in a statement provided to ABC News. "However, because of its use we could not label Guinness as suitable for vegetarians and have been looking for an alternative solution for some time. We are now pleased to have identified a new process through investment in a state-of-the-art filtration system."
A Guinness spokesman told The Times of London the company expects "to stop using [isinglass] as the new filtration asset is introduced."
The new filtration process is scheduled to be implemented next year.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
J-S49020-19
NON-PRECEDENTIAL DECISION - SEE SUPERIOR COURT I.O.P. 65.37
COMMONWEALTH OF PENNSYLVANIA IN THE SUPERIOR COURT
OF PENNSYLVANIA
Appellee
v.
MICHAEL CHRISTIAN
Appellant No. 2 EDA 2019
Appeal from the Judgment of Sentence Entered November 20, 2018
In the Court of Common Pleas of Delaware County
Criminal Division at No.: CP-XX-XXXXXXX-2017
BEFORE: BENDER, P.J.E., STABILE, J., and STEVENS, P.J.E.*
MEMORANDUM BY STABILE, J.: FILED NOVEMBER 14, 2019
Appellant Michael Christian appeals from the November 20, 2018
judgment of sentence entered in the Court of Common Pleas of Delaware
County (“trial court”), following his jury convictions for burglary and criminal
trespass.1 Upon review, we affirm.
The facts and procedural history this case are undisputed. On
September 27, 2017, Springfield Township Police Department charged
Appellant with, inter alia, the above-mentioned crimes.2 The affidavit of
probable cause accompanying the complaint provided in relevant part:
____________________________________________
* Former Justice specially assigned to the Superior Court.
1 18 Pa.C.S.A. §§ 3502(a)(1)(i), and 3503(a)(1)(i).
2Appellant also was charged with disorderly conduct under Section 5503(a)(4)
of the Crimes Code, 18 Pa.C.S.A. § 5503(a)(4). That charge, however, was
withdrawn.
J-S49020-19
On Wednesday, September 27, 2017, at 7:06 p.m., the
Springfield Township Police Department received a report of a
burglary interrupted at 233 Swarthmore Ave., Springfield
Township. Officers Rick Christy and Scott Francis responded and
spoke to Marie and Joseph Gousie, parents of the homeowners
who were babysitting for their five and two year old grandchildren.
Mrs. Gousie stated that she was upstairs in a bedroom when she
noticed a man walk into her grandson’s bedroom. When she
confronted the male, he turned around and headed down the
staircase. She then yelled to her husband and he confronted the
male at the bottom of the stairs. When Mr. Gousie asked the
subject what he wanted, the response was “a glass of water.” The
male was told to leave and he replied, “Yes sir.” The subject left
through the open garage and fled the area on his bicycle. . . . A
subject, later identified as [Appellant], was stopped by officers at
Swarthmore and Yale Avenues, and positively identified by Mr.
Gousie.
Affidavit of Probable Cause, 9/8/17 (sic). Appellant was held for court on all
charges. The case ultimately proceeded to a jury trial, at which the
Commonwealth offered the testimony of Mr. Gousie, Fernando Gonzalez and
Sergeant Patrick Fisher, Nether Providence Police Department. The trial court
summarized the witness testimonies as follows, beginning with Mr. Gousie’s:
On September 27, 2017, Mr. Gousie and his wife, Marie, were
babysitting their grandchildren at 233 South Swarthmore Avenue
in Springfield, Pennsylvania.
Mr. Gousie was watching television in the living room with the
children, ages five and two, when he heard his wife yell to
someone upstairs, “What are you doing here?” When he entered
the hall to investigate, Mr. Gousie saw Appellant coming down
from upstairs. Mr. Gousie asked Appellant what he was doing
there. To which, Appellant responded that he wanted a drink of
water. Mr. Gousie told Appellant to leave and asked his wife to
call the police. He then watched Appellant leave through the
garage door, get on a bicycle, and start riding away. Before
getting far, Appellant was stopped by police and arrested.
Mr. Gousie explained that if Appellant had come in the house
through the garage, he would have been in direct view of the
kitchen, but instead Appellant went upstairs where Mrs. Gousie
found him exiting one of the bedrooms. Appellant did not tell the
Gousies that people were trying to kill him nor did he ask them to
call 911 for him. Mr. Gousie admitted that nothing was taken from
the house and no one was harmed. Appellant presumably entered
the house through the garage which was unlocked.
-2-
J-S49020-19
The Commonwealth also presented the testimony of [Mr.]
Gonzalez, the homeowner of 233 South Swarthmore Avenue [and
Mr. Gousie’s son-in-law]. Mr. Gonzalez testified that he did not
give Appellant permission to enter the home. Additionally, Mr.
Gonzalez explained that, when he appeared for a hearing in
November of 2017, Appellant approached him and apologized
explaining that people were trying to kill him so he entered the
house to hide.
Finally, Sergeant [] Fisher of the Nether Providence Police
Department testified on behalf of the Commonwealth. Sergeant
Fisher was called to assist the Springfield Township Police with a
robbery in progress at 233 South Swarthmore Avenue. Within a
second or two prior to arriving at the residence, Sergeant Fisher
observed a male, matching the description given by radio, riding
a bike towards him. Appellant was waving his hands as if he was
trying to flag the officer down. Sergeant Fisher stopped his vehicle
and placed Appellant on the ground while another officer placed
him under arrest. Appellant did not tell Sergeant Fisher that he
was in fear of his life.
Trial Court Opinion, 1/22/19 at 1-3 (unnumbered) (internal record citations
omitted). Appellant did not testify in his own defense. On October 24, 2018,
at the conclusion of trial, the jury found Appellant guilty of burglary and
criminal trespass. On November 20, 2018, the trial court sentenced Appellant
to 54 to 108 months’ imprisonment for the burglary conviction.3 Appellant
timely appealed. Both the trial court and Appellant complied with Pa.R.A.P.
1925.
On appeal, Appellant raises a single issue for our review. “Whether the
evidence was sufficient to sustain the conviction for burglary where the
Commonwealth failed to prove beyond a reasonable doubt that [Appellant]
____________________________________________
3 For purposes of sentencing, the conviction for criminal trespass merged with
burglary. As a result, the trial court imposed no additional penalty for criminal
trespass.
-3-
J-S49020-19
entered the building with the intent to commit a crime therein?” Appellant’s
Brief at 5.
“A claim challenging the sufficiency of the evidence is a question of law.”
Commonwealth v. Widmer, 744 A.2d 745, 751 (Pa. 2000).
The standard we apply in reviewing the sufficiency of the evidence
is whether viewing all the evidence admitted at trial in the light
most favorable to the verdict winner, there is sufficient evidence
to enable the fact-finder to find every element of the crime beyond
a reasonable doubt. In applying the above test, we may not weigh
the evidence and substitute our judgment for the fact-finder. In
addition, we note that the facts and circumstances established by
the Commonwealth need not preclude every possibility of
innocence. Any doubts regarding a defendant’s guilt may be
resolved by the fact-finder unless the evidence is so weak and
inconclusive that as a matter of law no probability of fact may be
drawn from the combined circumstances. The Commonwealth
may sustain its burden of proving every element of the crime
beyond a reasonable doubt by means of wholly circumstantial
evidence. Moreover, in applying the above test, the entire record
must be evaluated and all evidence actually received must be
considered. Finally, the finder of fact while passing upon the
credibility of witnesses and the weight of the evidence produced,
is free to believe all, part or none of the evidence.
Commonwealth v. Antidormi, 84 A.3d 736, 756 (Pa. Super. 2014), appeal
denied, 95 A.3d 275 (Pa. 2014).
“A person is guilty of burglary if he or she enters a building or occupied
structure with the intent to commit a crime therein, unless he or she is licensed
or privileged to enter. 18 Pa.C.S.A. § 3502(a).” Commonwealth v.
Lambert, 795 A.2d 1010, 1015 (Pa. Super. 2002) (en banc), appeal denied,
805 A.2d 521 (Pa. 2002). In Lambert, we explained the jury may find the
mens rea for burglary solely through circumstantial evidence.
The intent to commit a crime after entry may be inferred from
the circumstances surrounding the incident. While this intent may
be inferred from actions as well as words, the actions must bear
a reasonable relation to the commission of a crime. Once one has
-4-
J-S49020-19
entered a private residence by criminal means, we can infer that
the person intended a criminal purpose based upon the totality of
the circumstances. The Commonwealth is not required to
allege or prove what particular crime a defendant intended to
commit after his forcible entry into the private residence.
Id. at 1022 (citations omitted) (emphasis added).
Instantly, based upon the evidence presented at trial, viewed in a light
most favorable to the Commonwealth, we agree with the trial court’s
conclusion that the Commonwealth proved beyond a reasonable doubt
Appellant committed burglary. As the trial court explained:
In the case sub judice, the testimony of the three
Commonwealth witnesses, when taken as a whole and viewed in
the light most favorable to the Commonwealth, was sufficient for
the jury to find that Appellant had the intent to commit a crime in
the residence. Appellant entered the home surreptitiously, as
evidenced by the fact that neither Mr. Gousie nor his wife noticed
him enter. Once inside, Appellant bypassed the kitchen directly
in front of him, where he could have obtained a drink of water,
and went upstairs. In doing so, Appellant presumably slipped
right past Mr. Gousie and the minor children. Appellant was first
seen by Mrs. Gousie when she observed him exiting one of the
upstairs bedrooms. Appellant could not have obtained a glass of
water in a bedroom, as was his explanation to Mr. Gousie
regarding why he was in the house. Interestingly enough,
Appellant then contradicted his own explanation for why he was
in the residence when he told Mr. Gonzalez that he was being
chased and entered the house to hide. These conflicting
statements certainly affected Appellant’s credibility and supported
the inference that Appellant entered the residence with the intent
to commit a crime. All these circumstances, taken as a whole,
were sufficient for the jury to infer that Appellant entered the
residence with the intent to commit a crime.
Trial Court Opinion, 1/22/19 at 4-5 (unnumbered). Accordingly, Appellant is
not entitled to relief.4
____________________________________________
4 To the extent Appellant relies on Commonwealth v. Wilamowski, 633
A.2d 141 (Pa. 1993) for the proposition that he did not have an intent to
commit a crime once he entered the Gousies’ residence, such reliance is
-5-
J-S49020-19
Judgment of sentence affirmed.
Judgment Entered.
Joseph D. Seletyn, Esq.
Prothonotary
Date: 11/14/19
____________________________________________
misplaced. In Wilamowski, the defendant kicked in a person’s garage door
and fled from the scene. Our Supreme Court reasoned that “there was no
additional evidence to establish that he possessed an intent to commit a crime
inside. He broke the door and apparently walked away from it without any
showing that he entered the structure or attempted to enter.” Id. at 144.
The Court further noted that the defendant’s “path into the structure was now
unobstructed, but he chose to walk away and go to the neighbor’s house to
ask for directions.” Id. Here, Appellant not only entered the Gousies’
residence, but he surreptitiously wandered all the way up to a second-floor
bedroom past Mr. Gousie who was watching TV with his two grandchildren
when Mrs. Gousie discovered him. As noted above, Appellant’s explanation
for being in the house changed from wanting a glass of water to hiding out in
the house because people allegedly were trying to kill him.
-6-
| null |
minipile
|
NaturalLanguage
|
mit
| null |
[Descriptive epidemiology of Ewing's tumor--analysis of German patients from (EI)CESS 1980-1997].
Due to low absolute morbidity rates a reliable descriptive epidemiology of the Ewing family of tumors (EFT) has been mainly provided by large population-based cancer registry reports. To date, only few reports on this topic have been published. The present report is based on data of 945 German patients who were enrolled into the (EI)CESS therapy studies between 1980 and 1997. It is assumed that under the age of 15 years an almost complete registration of all German patients with Ewing's sarcoma has been achieved. Diagnoses in all patients were ascertained by biopsies. In this analysis we looked at the associations between year of first diagnosis, age at first diagnosis, gender, the histological subtypes and the primary skeletal localisation of the tumours. The majority of patients with EFT was male (60%). More than half of the patients developed the disease between age 10 and 19 (57%) while about 20% were younger and almost a quarter was diagnosed after age 20 years. The percentage of patients older than 15 years was higher in men (55%) than in women (45%). The age-standardized annual incidence before age 15 years was estimated as 3 per million, and the cumulative incidence up to that age as about 46 per million. Long bones of the lower extremities (32%, femur alone 16%) and the pelvis were the most common sites of primary localisation. While 70 to 80% of all tumours in the long bones of the extremities were composed of Ewing's sarcomas, about one third in the central skeleton and over 20% in the pelvic bones were Primitive neuroectodermal tumours (PNET). Atypical Ewing's sarcoma accounted for about 10% of tumours in all sites. The large (EI)CESS database enables the meaningful and reliable description of epidemiological characteristics of the rare occurrence of the Ewing family of tumours. Further analyses of this database seem to hold great promise.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Deconstructed Beef Wellington with Bleu Cheese Sauce
Well, maybe it is cold outside wherever YOU might be but around here we can just pretend it’s cold outside and snuggle up after this perfect “date night” meal – my Deconstructed Beef Wellington.
Sometimes in the “hustle and bustle” of the holidays, it’s hard to schedule some much needed down time. On the night BEFORE Christmas Eve, The Husband and I always try to have a quiet night together after the kids go to bed. We know it will be crazy for the next few days so a little unwind time is always good.
We love Beef Wellington and I thought it would be fun to put a new twist on a classic. It still takes a little effort but it’s definitely a lot easier than the traditional recipe. I love having little “short cuts” in my refrigerator and freezer at the holidays and every day and they make recipes like this {not to mention holiday baking!} so much easier.
Our favorite things about beef wellington are obviously the delicious beef tenderloin, the layer of duxelles {mushrooms minced with shallots and herbs and then sauteed in butter} and the puff pastry so we have all of that goodness included here, don’t worry.
I love working with puff pastry and I always make sure to have it on hand in my freezer for both sweet and savory recipes. I would definitely say it’s one of my favorite “go to” frozen staples. If you haven’t ventured out and tried it yet, I have to tell you it’s not scary at all and can be used in so many creative ways. I love that I can use what I need and keep the rest frozen until the next recipe.
Making the Duxelles is a piece of cake too. The food processor does the work and prep is only about 5 minutes. Love that. More time to light candles! 😉
You can see what the mixture looks like before the quick sauté. Super easy and aren’t you fancy having just made Duxelles?? 🙂
A quick little spread onto the puff pastry before the tenderloin and bleu cheese sauce…
So aside from a little prep, this recipe is really easy. If you look at the recipe below, you will see there are several things you are able to do at the same time!
This bleu cheese sauce is incredible. If you just don’t like bleu cheese you could use gorgonzola. Either are easy to find in the refrigerated section of your grocery store. I have yet to meet a cheese I don’t like so I love “cheesy” options! 😉
I hope you enjoy this recipe as much as we did. You can print it below and for more information on how refrigerated and frozen items can provide awesome shortcuts you can take a look at the Easy Home Meals Website or Pinterest board for more great inspiration.
Do you have any relaxing holiday traditions or a holiday entertaining plan in place to make sure that the holidays aren’t overwhelming? As always, I’d love to hear all about it in the comments!
Pinned. Son had a day off and decided to try his hand at making beef wellington. It was good, but holy cow lots of work. So ever since that time, younger bro wants me to make it and I say HECK NO! This I can make, and we are all bleu cheese fans.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
"word # of string" idiom (part of extended string functions)
I'm trying to label variables in a forvalues loop on Stata version 11.2.
However, I can't get the extended string function word # of string idiom to work:
local names `""Growth" "Mature" "All""'
forvalues i = 0/2 {
local name : word `i' of `names'
display "`name'"
}
This follows a Statalist solution, but I keep getting invalid syntax errors.
I also tried local names Growth Mature All, but that doesn't work either.
Is there a way to do this algorithmically?
A:
word 0 won't work. Stata starts counting at 1. Change your loop to 1/3 and it will work.
Also, consider tokenize:
. tokenize `""Growth" "Mature" "All""'
. forval i = 1/3 {
2. di "``i''"
3. }
Growth
Mature
All
tokenize splits a string into tokens, meaning words separated by spaces unless quotation marks bind words together. The tokens have names 1, 2, 3. As you go round the loop, i is first 1, so the request is to display the first macro, etc.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Pericardial effusion in women with breast cancer.
Ninety patients with a history of breast cancer and pericardial effusion detected on echocardiography were identified and divided on a clinical basis into three groups. Group 1 consisted of 20 patients who had progressive metastatic breast cancer and echocardiography performed on a routine basis as a part of a clinical trial involving 38 patients. All 20 had small unexpected effusions, and only one patient developed symptomatic malignant pericardial disease late in her clinical course. Group 2 consisted of 32 patients who were without evidence of metastatic disease at the time of positive echocardiography and the etiology was considered benign in all patients. Six patients required pericardiectomy, five for severe radiation induced pericarditis and one for amyloid. No patient developed proven or suspected malignant pericardial disease. Group 3 comprised 38 patients who had known metastatic disease outside the pericardium at the time of positive echocardiography. Nineteen patients in Group 3 had histologically proven malignant involvement during life or at autopsy, and five more had suspected malignant pericardial disease. Ten patients initially were treated with pericardiectomy and 28 patients were managed with systemic therapy alone (24 patients) or with pericardiocentesis (four patients). Among the 12 patients with malignant effusion treated without surgery, proven local progression of pericardial disease occurred in six, with sudden death in two of those patients. No patient treated initially with surgery suffered progression of her pericardial disease. It was concluded that: small, clinically unsuspected pericardial effusions appear to be relatively common in women with metastatic breast cancer; no patient with clinical pericardial disease confirmed on echocardiography and no evidence of metastatic breast cancer developed malignant pericardial involvement; 50% of patients with known metastatic disease and a clinically apparent pericardial effusion had malignant pericardial disease; and nonsurgical therapy in patients with histologically proven or clinically suspected malignant pericardial effusion was associated with a high incidence of progressive pericardial disease.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Aromatic Lateral Substituents Influence the Excitation Energies of Hexaaza Lanthanide Macrocyclic Complexes: A Wave Function Theory and Density Functional Study.
The high interest in lanthanide chemistry, and particularly in their luminescence, has been encouraged by the need of understanding the lanthanide chemical coordination and how the design of new luminescent materials can be affected by this. This work is focused on the understanding of the electronic structure, bonding nature, and optical properties of a set of lanthanide hexaaza macrocyclic complexes, which can lead to potential optical applications. Here we found that the DFT ground state of the open-shell complexes are mainly characterized by the manifold of low lying f states, having small HOMO-LUMO energy gaps. The results obtained from the wave function theory calculations (SO-RASSI) put on evidence the multiconfigurational character of their ground state and it is observed that the large spin-orbit coupling and the weak crystal field produce a strong mix of the ground and the excited states. The electron localization function (ELF) and the energy decomposition analysis (EDA) support the idea of a dative interaction between the macrocyclic ligand and the lanthanide center for all the studied systems; noting that, this interaction has a covalent character, where the d-orbital participation is evidenced from NBO analysis, leaving the f shell completely noninteracting in the chemical bonding. From the optical part we observed in all cases the characteristic intraligand (IL) (π-π*) and ligand to metal charge-transfer (LMCT) bands that are present in the ultraviolet and visible regions, and for the open-shell complexes we found the inherent f-f electronic transitions on the visible and near-infrared region.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
AIE YEP Sydney - Hydrogen Energy Panel Discussion
Join the Australian Institute of Energy and the Young Energy Professionals for a discussion of renewable hydrogen in the energy economy of the future.
Hydrogen is emerging as a key player in the energy sector as a means for production, storage and transport of renewable energy. There are several projects in the pipeline around Australia, and many more overseas, that are demonstrating the utility and versatility of the essential element.
Join panellists from Siemens, BOC, Energy Estate, H2U and UNSW Sydney to discuss hydrogen’s place in the energy value chain. You’ll hear more about enabling technology, applications, finance and research in the field.
An opportunity for networking will provided after the Q&A with drinks and refreshments.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
update json replacing variable input from form in php
Greeting, I'm new to PHP, and currently looking for a way to edit json.
I have a form to input the key that wants to edit. I echo the input from form and successfully got the output showing but it didn't pass to json file to update. The code is as below.
function testfun()
{
// read file
$data = file_get_contents('Book2.json');
// decode json to array
$json_arr = json_decode($data, true);
foreach ($json_arr as $key => $value) {
if ($value['CELL_NAME'] == $_POST['in_cell']) {
$json_arr[$key]['@25'] = $_POST['in_remark'];
}
}
// encode array to json and save to file
file_put_contents('Book2.json', json_encode($json_arr));
}
//you this post contain test?
//test is the the button when i submit the form
if (array_key_exists('test',$_POST))
{
testfun();
}
Am I missing something?
A:
As you mention in the comments, the content of the $json_arr is:
{"CELL_NAME":"1234A","@25":"remark value"}
So when you trying to access in:
foreach ($json_arr as $key => $value) {
if ($value['CELL_NAME'] == $_POST['in_cell']) {
$json_arr[$key]['@25'] = $_POST['in_remark'];
}
}
it has no key for $value at CELL_NAME key.
I guess your $data from the file should be like that (an array of JSONs):
$data = '[{"CELL_NAME":"1234A","@25":"remark value"}, {"CELL_NAME":"1234B","@25":"remark value"}]';
Now you can do this and it will work:
$arr = json_decode($data, true);
foreach ($arr as $key => $value) {
if ($value['CELL_NAME'] == "1234A") // you can change with $_POST['in_cell']
$arr[$key]['@25'] = "test"; // you can change with $_POST['in_remark']
}
| null |
minipile
|
NaturalLanguage
|
mit
| null |
ONE MORE BULLET WON'T KILL YOU | ACTION FILM BLOG
In the past, I have denounced films on this blog for not having an engaging enough narrative to back up their action sequences or having action sequences that had too much shaky cam, both of which removed my ability to engage in the action as it was shown. However, I’m about to praise the film Retaliation from 1968 for having both these issues. How is that fair? Does anything separate it from any number of Luc Besson produced wannabes?
Let’s bounce back for a minute. Retaliation is a Japanese film from the Nikkatsu in the 1960s. The crime films made by the studio were generally b-films that directors such as Yasuharu Hasebe or Seijun Suzuki could churn out quickly. Suzuki himself would casually quickly spew out four or so a year, but what made his so special was a matter of peppering the simple plots with all the energy, pace and strangeness you could desire on a tight budget. Suzuki’s Branded to Kill features men who become turned on by the smell of rice and feature women with dead birds hanging from their rear-view mirrors.They borrowed from James Bond films: gangsters, machoness and noir cool to create a delerious cocktail that made them unique creations. Suzuki has already earned his cult status with fans like John Woo,Jim Jarmusch and John Zorn. Seeing Suzuki’s films makes you wonder what the other films are like from Nikkatsu. Are they useless derivative junk with Suzuki being their only real diamond in the rough?
Outside Suzuki, Nikkatsu’s action films have been more written about about then watched. Retaliation is directed by Yasuharu Hasebe in 1968 and has recently been released on blu-ray and DVD by Arrow Video. It’s been screened on rare occasions at some Asian film festivals, but has only received an English-subbed home video release in 2015. The film, as of writing, this has less than 50 votes on IMDb. I hope this changes, as this film, when approached with the knowledge of Nikkatsu’s history, is quite a firecracker.
Film poster for Retaliation
Retaliation was made quickly, with scripts written as the film was in the middle of shooting. This could lead to some messy narrative confusion, but actually allows the filmmakers freedom to go as far as they want when it comes to camera angles and pure cinematic staging. This film is about a gangster named Jiro Sagae (Akira Kobayashi), who is released from prison and finds himself lent out to another Yakuza clan, who are interested in purchasing land to increase their own grasp of the area. This makes the film’s original title I Own Your Turf! more apt. He meets with Jo Shisido’s character, Hino, who is forced to work with him – an act he cannot really sink his teeth into as Jiro had killed his relatives several years in the past. Shootouts between gang members and double-crosses ensue!
The film’s plot is a bit crude, with perhaps one too many characters. The fact that Jo Shishido’s character is more interesting than Kobayashi’s is an issue, as he has a motive for revenge while Kobayashi’s role is limited to his relationship with Meiko Kaji’s character and his old gangster leader who returns to the story towards the end. What shapes this film into something more interesting is how it’s shot. There is lots of hand-held camera work and the crew is quite playful when trying to illustrate the action. Take the opening scene, where we have a quick duel between Jo and Akira.
Normally, I’d leap at the chance at the point out scenes so obviously constructed to hide what’s going on, but peeking through the bushes and spying between train carts gave me this “you are there” feeling that I feel like shaky-cam developers like Paul Greengrass are trying to pull off in his Bourne series. It works here, I believe, because I can still see follow the action by seeing who’s attacking who and what they are attempting to do, but am given this in a new perspective of the “not having the best seat in the house” type camera. This type of camera trickery isn’t set strictly to the action scenes either and is often deployed in bizarre fashion such as a dinner meeting between gangsters where an argument erupts from a bird’s eye point of view. I’m not going to spoil any other scenes, but let’s say they involve spot light lit battles and one surprisingly brutal bathroom brawl.
If there’s sour parts, it’s the obligatory scenes of nudity and rape that began coming up in the 1970s. These scenes feel tossed in and only suggest that those bad guys we saw earlier are, guess what, bad! I know this is coming from a man who later directed films with titles as explicit as Raping!. What could that one be about. . .
I’m getting far off topic, but I’d suggest that if you like your films with the cool vibe of the John Woo and Johnnie To and just want to be swept into unique and kinetic camerawork and violent action scenes, please seek out Retaliation. For those requiring a new narrative or political importance in your crime sagas, I’m sure there are some Jean-Pierre Melville films you haven’t seen yet.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Surveillance of tuberculosis treatment prescription in Italy. The Varese TB Study Group.
In industrialized countries, data on antituberculosis treatment are scanty. The aim of this study was to describe the tuberculosis (TB) treatment programme from diagnosis to drug intake in a model area of northern Italy, evaluating: 1) antiTB regimens prescribed and their adequacy; 2) dosage of drugs; 3) side-effects; and 4) drug resistance. Individual data on new TB cases from all the existing health facilities of the area were collected by means or a prospective surveillance system based on the systematic review of original clinical forms. Regimens were classified as adequate, potentially adequate and inadequate, based on published recommendations. Data on drug dosage, side effects and drug resistance were analysed. Out of 109 TB cases with regimen recorded on clinical records, 20.2% included more than four major drugs, 63.3% three drugs and 16.5% two drugs. The regimens were classified as 1.8% adequate, 85% potentially inadequate and 12.8% inadequate. The dosages prescribed (mean +/- SD in mg.kg body weight-1.day-1) were: isoniazid: 6.8 +/- 2.7: rifampicin: 10.2 +/- 2.5; ethambutol: 21.3 +/- 4.5; streptomycin: 17.4 +/- 4.0: and pyrazinamide: 15.2. Twelve per cent of cases required treatment modification due to side-effects. Resistance to one single drug was found in 9% of cases, but no case with multidrug-resistant TB. The description of the treatment programme revealed that: 1) the majority of regimens are potentially adequate; 2) they are at a proper dosage; 3) the side-effects are in agreement with the literature; and 4) drug-resistance rates are low.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
America First, Last and Always!
Happy Thanksgiving Day 2017! I am thankful that the White House is occupied by President Donald J. Trump! As soon as he took office, America′s slide into Socialism came to a screeching halt. President Trump is precisely the sort of person we need in the Oval Office. A strong leader. A REAL man who is bold, brash and a fighter. President Trump is fighting for us, not for globalists or some political crime syndicate. He is living up to his campaign promise to Make America Great Again!
America certainly is getting better. The nation′s over all attitude is more optimistic. Consumer Confidence is higher than it has been for nearly 2 decades. The various equity markets are all at record levels. Our Gross National Product, GDP, is increasing at rates we have not seen in about a decade or more. More citizens are working. More companies are higher. The trade imbalances are poised to decline significantly. Our allies internationally are being reassured. Our enemies tremble in fear.
On top of everything else, President Donald Trump is fun! He has an awesome sense of humor. Whats more, he is driving the Far Left absolutely CRAZY! President Trump is out doing Ronald Reagan. I won′t even bother mentioning the two, low-energy Bush guys. Thanks to President Trump, we didn′t get stuck with a third Bush. Nor a second Clinton! For that we should all Thank God in giving us President Donald J. Trump.
I don′t even want to think about what this country would be like had Hillary Clinton won. There are too many signs as it is. Like Dartmouth College holding an event next year about ″What′s Up With White People?″ Or like the Girl Scouts warning parents not to force their children to hug family members visiting for the holidays. Speaking of holidays, thanks to President Trump, we can now say ″Merry Christmas″ again! There is no doubt that Hillary Clinton would have continued the godless policies of Barack Obama in removing Christ from our national culture.
So on this Thanksgiving Day 2017, while you boycott NFL games on TV, let us all stand for our Flag, our National Anthem, and for President Donald J. Trump. Thank the Good Lord, Our Heavenly Father, that He has blessed our country with a man, a REAL MAN, to lead us back to prosperity and peace. And yes, make sure your Liberal relatives know that you are happy and proud that President Trump is in the White House! Let them steam and squirm. Our side won! Victory is to be rejoiced! Spoils enjoyed! Amen!
For more REAL NEWS and views, follow Andrew Zarowny on Facebook and on Twitter @mrcapitalist.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Top Value Cabernets
Review from original list creator:"Smooth chocolatey nose with the kind of wood aromas that I like in a wine, not overdone at all. The mouth has a dry, kind of funky earth attack, with some chalkiness and apple fruit acidity in the middle, and a smooth finish that shows a hint of white pepper."by
33093Chris Carpita
| null |
minipile
|
NaturalLanguage
|
mit
| null |
INTRODUCTION {#s1}
============
Ovarian cancer is the most lethal and the second most commonly diagnosed disease among all gynecological malignancies worldwide \[[@R1]--[@R3]\]. The high mortality rate of ovarian cancer is due to its poor prognosis and majority of the cases are diagnosed with advanced stage disease \[[@R4]\]. Ovarian cancer is a heterogeneous tumor with a wide range of clinical presentations, cytological features and genetic alterations \[[@R5], [@R6]\]. Ovarian high-grade cancers are characterized by high-grade nuclei, poor differentiation, a high mitotic index, less responsive to chemotherapy, more aggressiveness as well as low survival rate \[[@R6]--[@R8]\]. The relatively worse pathogenesis and clinicopathologic features of high-grade ovarian cancers cause poor clinical management of this type of disease. Therefore, understanding the underlying molecular mechanisms may assist in developing better curative therapy in aggressive ovarian cancers.
Forkhead box M1 (FoxM1) is a member of the evolutionary conserved Forkhead box transcription factor family, with a conserved winged-helix DNA-binding domain \[[@R9]\]. Emerging evidence has shown that aberrant upregulation of FoxM1 is seen frequently in various human cancers \[[@R10]--[@R13]\]. FoxM1 has been shown to play a role in tumor invasion, migration, and angiogenesis \[[@R14]--[@R16]\]. Given that FoxM1 acts as a critical master regulator of tumorigenesis and metastasis in human cancers, it is imperative to understand the molecular mechanism of FoxM1 involved in the transcriptional regulation of the diverse signaling pathways in each step of tumorigenesis. The identification of downstream regulators of FoxM1 might provide potentially reliable molecular therapeutic target for ovarian cancer.
The WNT/β-catenin Pathway has shown to contribute to ovarian cancer initiation, metastasis, chemo-resistance and recurrence \[[@R17]--[@R19]\]. The oncogenic potential of FoxM1 is mainly based on its ability to transcriptionally activate genes that are involved in different facets of cancer development \[[@R20]\]. Activation of TCF4/LEF-1 by binding to β-catenin induces the transcription of various target genes, including c-Myc, cyclin D1, VEGF, MMP2 and MMP9 \[[@R21]--[@R25]\]. Therefore, it is important to elucidate how aberration in components of the Wnt signaling pathway causes the activation of β-catenin/TCF4-mediated transcription in tumors, including EOC.
It has been reported that FoxM1 directly binds to β-catenin and increases β-catenin nuclear localization and transcriptional activation of WNT target genes and glioma tumorigenesis \[[@R24]\]. In addition to glioma, several other tumors have shown the upregulation of both FoxM1 and WNT/β-catenin including medulloblastoma, colon cancer and hepatocellular carcinoma \[[@R26]--[@R28]\]. In this study, we show using a large cohort of Middle Eastern ovarian cancer that co-expression of FoxM1 and β-catenin were significantly correlated with advanced stage. We also describe the regulatory mechanism of FoxM1/β-catenin and the inhibition of these signaling using the FoxM1 inhibitor, thiostrepton and β-catenin inhibitor, FH535 could synergistically abrogate the ovarian cancer growth, migration/invasion as well as *in vitro* and *in vivo* tumor growth. Our results emphasize the importance of FoxM1/β-catenin interaction in ovarian tumorigenesis and argue the importance of this pathway as a promising therapeutic target in high-grade ovarian cancer.
RESULTS {#s2}
=======
Evaluation of FoxM1 over-expression by IHC in EOC TMA {#s2_1}
-----------------------------------------------------
Immunohistochemical analysis of FoxM1 expression was interpretable in 261 EOC spots and the incidence of FoxM1 over-expression was found to be 60.5% (158/261). FoxM1 expression was seen predominantly in the nuclear compartment. FoxM1 over-expression was associated with adverse clinico-pathological parameters such as high grade serous carcinomas (*p* = 0.0221), poorly differentiated tumors (*p* = 0.0024) and high proliferative index (Ki-67, *p* = 0.0007) (Table [1](#T1){ref-type="table"}). Of particular interest was the significant association between FoxM1 over-expression and elevated nuclear β-catenin expression (*p* = 0.0139). This concomitant increase of FoxM1 and β-catenin was associated with advanced stage (Stage III and IV, *p* = 0.0389) EOCs, thus providing a clue to the possible role of interplay between these two markers in promoting aggressiveness of EOCs ([Supplementary Table 1](#SD1){ref-type="supplementary-material"}). Significant association of FoxM1 over-expression was also noted with transcriptional factor TCF4 (*p* = 0.0066); markers of invasion and migration, MMP-9 (*p* = 0.0455) and u-PAR (0.0071), and cell cycle regulator, Cyclin D1 (*p* = 0.0094) (Figure [1](#F1){ref-type="fig"}, Table [1](#T1){ref-type="table"}).
###### Association of clinico-pathological characteristics with FoxM1 over-expression in patients with epithelial ovarian cancer
Total High Fox-M1 Low Fox-M1 *p* value
---------------------------- ------- ------------- ------------ ----------- ----- ------ --------
Total Number of Cases 261 158 60.5 103 39.5
Age
≤ 50 years 117 44.8 67 57.3 50 42.7 0.3300
\>50 years 144 55.2 91 63.2 53 36.8
Histopathology
High grade Serous 138 52.9 97 70.3 41 29.7 0.0221
Low grade Serous 55 21.1 26 47.3 29 52.7
Mucinous 27 10.3 12 44.4 15 55.6
Endometriod 27 10.3 16 59.3 11 40.7
Clear cell 6 2.3 3 50.0 3 50.0
Undifferentiated 8 3.1 4 50.0 4 50.0
FIGO Grade
Well differentiated 50 19.2 23 46.0 27 54.0 0.0024
Moderately Differentiated 114 43.7 64 56.1 50 43.9
Poorly Differentiated 97 37.1 71 73.2 26 26.8
Tumour Stage
Stage I 34 13.6 20 58.8 14 41.2 0.2397
Stage II 13 5.2 10 76.9 3 23.1
Stage III 159 63.4 92 57.9 67 42.1
Stage IV 45 17.9 32 71.1 13 28.9
Ki-67
Above 50 135 53.1 96 71.1 39 28.9 0.0007
Below = 50 119 46.9 60 50.4 59 49.6
β-catenin
Above 0 41 16.3 32 78.0 9 22.0 0.0139
Below = 0 211 83.7 123 58.3 88 41.7
TCF4
Above 90 216 84.0 139 64.4 77 35.6 0.0066
Below = 90 41 16.0 17 41.5 24 58.5
VEGF
Above 140 47 18.4 31 66.0 16 34.0 0.5056
Below = 140 209 81.6 127 60.8 82 39.2
MMP-2
Above 80 204 80.9 129 63.2 75 36.8 0.0531
Below = 80 48 19.1 23 47.9 25 52.1
MMP-9
Above 80 190 81.2 122 64.2 68 36.8 0.0455
Below = 80 44 18.8 21 47.7 23 52.3
Cyclin D1
Above 15 51 19.7 39 76.5 12 23.5 0.0094
Below = 15 208 80.3 119 57.2 89 42.8
u-PAR
Above 50 189 75.3 125 66.1 64 33.9 0.0071
Below = 50 62 24.7 29 46.8 33 53.2
PFS--Median (months) 20.3 18.4 0.3869
Contingency table analysis and χ2 tests were used to study the relationship between clinico-pathological variables and protein expression. Survival curves were generated using the Kaplan-Meier method, with significance evaluated using the Mantel-Cox log-rank test. The limit of significance for all analyses was defined as a *p*-value of 0.05.
{#F1}
We further analyzed the expression of FoxM1 in high grade serous carcinoma and low grade serous carcinoma. Our results showed that incidence of FoxM1 overexpression is higher in the high grade serous tumors than low grade serous tumors -- 70.3% (97/138) vs 47.3% (26/55). We also observed that FoxM1 overexpression is associated with high proliferative index (Ki67, *p* = 0.0072) in high grade serous carcinoma. Interestingly, only in high grade serous carcinoma FoxM1 overexpression showed significant association with elevated nuclear β-catenin expression (*p* = 0.0089) ([Supplementary Tables 2 and 3](#SD1){ref-type="supplementary-material"}).
FoxM1 interact with β-catenin *in vitro* and *in vivo* in EOC {#s2_2}
-------------------------------------------------------------
Our clinical data showed that FoxM1 was significantly associated with elevated nuclear β-catenin. To study the FoxM1 and β-catenin interaction *in vitro*, we first detected the basal expression of FoxM1 and β-catenin in a panel of six cell lines by immuno-blotting. As shown in Figure [2A](#F2){ref-type="fig"}, we identified concomitant expression of FoxM1 and β-catenin in five EOC cell lines (MDAH2774, SKOV3, OVCAR3, OVISE and OVSAHO), whereas cells with low or negligible expression of FoxM1 (OVTOKO) showed low expression of β-catenin. Next, we inhibited FoxM1 using a specific FoxM1 inhibitor, thiostrepton and analyzed the expression of β-catenin and TCF4 in EOC cells. Figure [2B](#F2){ref-type="fig"} shows that inhibition of FoxM1 markedly down-regulated the expression of active-β-catenin and TCF4 in EOC cells in a dose-dependent manner. In order to determine the localization of FoxM1 and β-catenin, immunofluorescence staining in the EOC cells was employed (Figure [2C](#F2){ref-type="fig"}). The results show that untreated EOC cells exhibited a high expression of FoxM1 and β-catenin in nuclear region, while treatment of thiostrepton markedly decreased FoxM1 and β-catenin expression in the same region (Figure [2C](#F2){ref-type="fig"}). TCF4 expression was also abundant in the nucleus of FoxM1 expressing EOC cells, while inhibition of FoxM1 using thiostrepton down-regulates TCF4 expression ([Supplementary Figure 1A](#SD1){ref-type="supplementary-material"}). Next, physical interaction of FoxM1 with β-catenin was examined by immunoprecipitation (IP) analysis. The result shows that FoxM1 binds to β-catenin and TCF4 and was dramatically reduced after thiostrepton treatment in EOC cells (Figure [2D](#F2){ref-type="fig"}). To determine whether FoxM1 transcriptionally activates β-catenin in our model, we performed ChIP analysis. Nucleotide sequence analysis of the 2-kb β-catenin promoter revealed the presence of two FoxM1 consensus sequences in the forward strand (Figure [2E](#F2){ref-type="fig"}). ChIP analysis demonstrated that FoxM1 binds to β-catenin promoters at both sites, F1 (-1261-1255) and F2 (-1609-1604) in OVCAR3 cells. Interestingly, the degree of FoxM1 binding to β-catenin promoter at both sites was decreased after thiostrepton treatment in a dose dependent manner (Figure [2E](#F2){ref-type="fig"}).
{#F2}
It has been reported that uPAR, c-Myc, cyclinD1, VEGF and MMPs are the target genes of β-catenin/TCF4 dependent transcription \[[@R29]--[@R31]\]; and these genes have been implicated in different cellular processes including proliferation, survival, migration, invasion and angiogenesis \[[@R32]\]. As shown in Figure [2F](#F2){ref-type="fig"}, thiostrepton treatment decreased the CyclinD1, c-Myc, uPAR, VEGF, MMP-9 and MMP-2 expressions in EOC cells in a dose-dependent manner. Reports indicated that TCF4 binds to uPAR and cMYC promoters \[[@R29], [@R33]\]. To confirm this in our model system, we performed ChIP analysis using a TCF4 antibody and primers that specifically amplify the β-catenin/TCF4 binding site on the promoters of uPAR (−308 to −302) and c-Myc (−452 to −446). As shown in [Supplementary Figure 1B-1C](#SD1){ref-type="supplementary-material"}, TCF4 binds to the uPAR and c-Myc promoters in OVCAR3 cells and the degree of binding was decreased after thiostrepton treatment in a dose dependent manner.
To confirm these above findings, we silenced FoxM1 with specific siRNA and assessed the protein expression of FoxM1 and their downstream targets in EOC cells. As shown in Figure [3A](#F3){ref-type="fig"}, silencing of FoxM1 exhibited similar results of inhibiting FoxM1 with thiostrepton. Silencing of FoxM1 decreased active-β-catenin and TCF4 expression with an accompanying downregulation of CyclinD1, cMYC, uPAR, VEGF, MMP-9 and MMP-2 in EOC cells. These results were further confirmed by immunofluorescence analysis (Figure [3B](#F3){ref-type="fig"}). In addition, silencing of FoxM1 markedly reduced tumorigenesis in nude mice (Figure [3C--3E](#F3){ref-type="fig"}). Furthermore, tumors developed from FoxM1 knockdown cells showed decreased expressions of active-β-catenin and TCF4 compared to those tumors developed from non-transfected or scramble control cells (Figure [3F](#F3){ref-type="fig"}). Conversely, forced expression of FoxM1 in OVTOKO cells (FoxM1 low expressing cells) increased the accumulation of nuclear β-catenin (Figure [3G--3H](#F3){ref-type="fig"}) expression with an accompanied increase of TCF4, CyclinD1, cMYC, uPAR, VEGF, MMP-9 and MMP-2 expressions (Figure [3H](#F3){ref-type="fig"}). Next, we inhibited FoxM1 using thiostrepton and analyzed the expression of β-catenin and TCF4 in FoxM1 overexpressing OVTOKO clones. As shown in [Supplementary Figure 2](#SD1){ref-type="supplementary-material"}, treatment of thiostrepton dramatically down-regulated the expression of FoxM1, active-β-catenin and TCF4 in FoxM1 overexpressing clones.
{#F3}
Down-regulation of FoxM1 using thiostrepton inhibited cell viability and induced apoptosis in EOC cells {#s2_3}
-------------------------------------------------------------------------------------------------------
We sought to determine whether down regulation of FoxM1 with thiostrepton, leads to inhibition of cell proliferation in EOC cells. EOC cell lines, OVCAR3 and SKOV3 were treated with different doses of thiostrepton for 48 hours and cell viability was assayed using MTT assay. Figure [4A](#F4){ref-type="fig"} shows a dose dependent and significant (*p* \< 0.05) inhibition of cell viability in both cell lines. Similarly, thiostrepton treatment also significantly (*p* \< 0.05) decreased the proliferation of EOC cells as confirmed by clonogenic assay (Figure [4B--4C](#F4){ref-type="fig"}). Next, to determine whether thiostrepton induced inhibition of cell viability was due to apoptosis, we treated EOC cells with increasing doses of thiostrepton for 48 hours and analyzed the cells for apoptosis after dual staining with annexin V/PI by flow cytometry. There was a dose dependent and significant induction of apoptosis in both EOC cell lines tested (Figure [4D--4E](#F4){ref-type="fig"}). As shown in Figure [4F](#F4){ref-type="fig"}, thiostrepton treatment induced activation and cleavage of caspase-3 and PARP in both cell lines. Furthermore, thiostrepton treatment also caused down-regulation of anti-apoptotic proteins, Bcl-2, Bcl-xL and survivin that play an important role in inhibition of apoptosis (Figure [4F](#F4){ref-type="fig"}). We found evidence that Bax protein underwent conformational changes at 16 hours in EOC cell lines after thiostrepton treatment at different time course ([Supplementary Figure 3A](#SD1){ref-type="supplementary-material"}). We then tested the effect of thiostrepton on the mitochondrial membrane potential and release of cytochrome c in these cells. As shown in [Supplementary Figure 3B](#SD1){ref-type="supplementary-material"}, treatment of cells with thiostrepton resulted in loss of mitochondrial membrane potential in EOC cells as measured by JC1 stained green fluorescence depicting apoptotic cells. We next studied the release of cytochrome c from mitochondria into cytosol. As shown in [Supplementary Figure 3C](#SD1){ref-type="supplementary-material"}, higher level of cytochrome c was measured in cytosolic and lower levels in mitochondrial fraction in both cell lines after thiostrepton treatment. Furthermore, we also pre-treated EOC cells with a universal caspase-inhibitor, zVAD-fmk for three hours followed by treatment with thiostrepton for 48 hours. The pre-treatment of zVAD-fmk significantly (*p* \< 0.05) inhibited apoptosis induced by thiostrepton ([Supplementary Figure 3D--3E](#SD1){ref-type="supplementary-material"}). This data confirmed that thiostrepton-induced apoptosis is caspase dependent.
{#F4}
Down-regulation of FoxM1 using thiostrepton inhibited invasion, migration and angiogenesis {#s2_4}
------------------------------------------------------------------------------------------
FoxM1 has been shown to play a role in cell invasion, migration and angiogenesis via modulation of VEGF, uPAR, MMP-2 and MMP-9 \[[@R14]\], therefore, we next sought to investigate the effect of thiostrepton on cell invasion, migration and angiogenesis in EOC cells. As shown in Figure [2F](#F2){ref-type="fig"}, treatment of thiostrepton markedly decreased VEGF, uPAR, MMP-2 and MMP-9 expressions in EOC cells. To investigate whether down regulation of FoxM1 plays a role in inhibiting invasion and migration, EOC cell lines were treated with different doses of thiostrepton in the presence of universal caspase inhibitor (zVAD-fmk). Interestingly, inhibition of FoxM1 by thiostrepton significantly decreased invasion (Figure [4G--4H](#F4){ref-type="fig"}) and migration (Figure [4I--4J](#F4){ref-type="fig"}) of EOC cells. Treatment of zVAD-fmk confirms that inhibition of invasion and migration by thiostrepton was not through inducing apoptosis. We also studied the effect of FoxM1 inhibition in EOC cells on angiogenesis by tube formation assay. Tube formation of endothelial cells is one of the key steps of angiogenesis \[[@R34]\]. Incubation of HUVECs on matrigel with conditioned media (source of VEGF) of EOC cells resulted in the formation of elongated and tube like structures which were effectively reduced by conditioned media from thiostrepton treated EOC cells (Figure [4K](#F4){ref-type="fig"}). To further confirm these observations, we determined the secreted levels of VEGF by ELISA experiment in thiostrepton treated EOC cells. Decreased levels of VEGF was observed in a dose dependent manner in thiostrepton treated EOC cells (Figure [4L](#F4){ref-type="fig"}). Together, these findings suggest that thiostrepton can significantly repress FoxM1 expression and reduce EOC cell invasion, migration and angiogenesis by down-regulating FoxM1 target gene expression such as VEGF, uPAR, MMP-2 and MMP-9.
Thiostrepton and FH535 synergistically inhibited EOC cell growth *in vitro* and *in vivo* {#s2_5}
-----------------------------------------------------------------------------------------
Our clinical and *in vitro* data showed a strong association between FoxM1 and β-catenin protein expression in EOC, we assumed that targeting of FoxM1 and β-catenin expression together can lead to efficient cytotoxic effects in EOC cells. Therefore, we wanted to investigate whether co-treatment of thiostrepton and FH535 at sub-toxic doses, can potentiate anticancer effects in EOC cells. We have determined sub-optimal doses of thiostrepton and FH535 that can be used in combination to inhibit cell viability, clonogenicity and induce apoptosis. First we have treated sub-optimal doses of thiostrepton and FH535, either alone or in combination to EOC cells and analyzed the colony number. Combination of thiostrepton and FH535 significantly (*p* \< 0.05) inhibited the clonogenicity of EOC cells as compared to treatment alone (Figure [5A--5B](#F5){ref-type="fig"}). As shown in Figure [5C](#F5){ref-type="fig"}, co-treatment of thiostrepton and FH535 also significantly (*p* \< 0.05) potentiated apoptosis in EOC cells. Next we investigated whether co-treatment with sub-optimal doses of thiostrepton and FH535 could inhibit expression of FoxM1, β-catenin and their downstream targets by immuno-blotting. As shown in Figure [5D](#F5){ref-type="fig"}, combination treatment of thiostrepton and FH535 successfully down-regulated expression of FoxM1, active-β-catenin, β-catenin, TCF4, CyclinD1, cMYC, uPAR, VEGF, MMP-9 and MMP-2 in EOC cell lines. Similar results were observed by immunofluorescence where thiostrepton and FH535 synergistically inhibited the expression of FoxM1 and β-catenin in EOC cells (Figure [5E](#F5){ref-type="fig"}). These data clearly indicate that co-treatment with thiostrepton and FH535 synergistically inhibits cell viability and potentiate apoptosis in EOC cells.
{#F5}
The synergistic inhibition of FoxM1 and β-catenin significantly suppressed EOC cell growth *in vitro.* We further determined whether co-treatment of thiostrepton with FH535 suppress EOC cell line generated xenograft tumor growth in nude mice. For xenograft study, OVCAR3 cells were injected (5 × 10^6^ cells per mouse) into the flanks of 6-week-old female nude mice. After the tumors had developed (about 100 mm^3^), the mice were injected (i.p) with thiostrepton (20 mg/kg) and FH535 (10 mg/kg) either alone or in combination, twice a week for 30 days. DMSO (0.1%, i.p) was served as vehicle control. We found that co-treatment of thiostrepton and FH535 significantly suppressed tumor volume (Figure [6A](#F6){ref-type="fig"}) and tumor weight (Figure [6B](#F6){ref-type="fig"}) but had no effect on the body weight of mice (data not shown). Images of tumor showed that co-treatment of thiostrepton and FH535 caused shrinkage of tumor size (Figure [6C](#F6){ref-type="fig"}). Further, we analyzed the expression of FoxM1 and β-catenin in xenograft tumors by immunofluorescence and immuno-blotting. We observed both FoxM1 and β-catenin proteins accumulated in the nucleus of vehicle treated tumors (Figure [6D](#F6){ref-type="fig"}). Interestingly, co-treatment with thiostrepton and FH535 markedly suppressed the expression of FoxM1 and β-catenin (Figure [6D--6E](#F6){ref-type="fig"}) and their downstream target proteins in tumors (Figure [6E](#F6){ref-type="fig"}). Our data clearly indicates that co-treatment with thiostrepton and FH535 augmented antitumor effects in OVCAR3 cell xenografts in nude mice.
{#F6}
DISCUSSION {#s3}
==========
In this study, we present that FoxM1 over-expression is a common alteration in Saudi EOC. FoxM1 is significantly associated with high proliferation and high grade EOC. Interestingly, FoxM1 is significantly associated with high expression of β-catenin. Importantly the concomitant increase of FoxM1 and β-catenin is associated with late stage (stage III and IV) EOC. In order to gain insight into biological plausibility of FoxM1/β-catenin overexpression in the pathogenesis of EOC, which would be suggested by our findings above, we first set out to test the potential role of FoxM1 in relevant EOC cell lines. To determine the role of FoxM1 expression *in vitro*, we assessed expression of FoxM1 in a panel of six EOC cell lines. On the basis of FoxM1 expression, we identified two EOC cell lines (OVCAR3 and SKOV3) that had over expression of FoxM1 as well as OVTOKO that had negligible expression. We functionally investigated the consequence of FoxM1 down-regulation in cell proliferation, apoptosis and angiogenesis as well as on invasion and migration. In our study, we found down-regulation of FoxM1 by thiostrepton elicited dramatic effect on cell viability and colony formation as confirmed by clonogenic assay. Down-regulation of FoxM1 by thiostrepton also induced apoptosis in OVCAR3 and SKOV3 cell line as confirmed by flow cytometry. We also tested the effect of the down regulation of FoxM1 by thiostrepton on the migration and invasion of EOC cells and tube formation (angiogenesis) of HUVECs. We found that the down-regulation of FoxM1 inhibited migration and invasion of EOC and reduced the tube formation of HUVECs.
Our clinical data showed FoxM1 expression and nuclear β-catenin are concomitantly increased in EOC samples and their upregulated expression are significantly associated with advance stage tumor, prompted us to study the biological relevance of this interaction. There are reports showing the biological interaction between FoxM1 and β-catenin in glioma \[[@R24]\], medulloblastoma \[[@R26], [@R35], [@R36]\] and colon cancer \[[@R37]\]. To determine this interaction, we first screened six EOC cell lines for the expression of FoxM1 and β-catenin by western blot. Interestingly, cell lines that displayed high level of FoxM1 showed activation of β-catenin whereas cell lines (OVTOKO) that had negligible expression of FoxM1 showed no activation of β-catenin. This concomitant expression of FoxM1 and β-catenin is similar to our findings in the clinical samples. Furthermore, we showed that down-regulation of FoxM1 by siRNA and thiostrepton resulted in decreased β-catenin transcriptional activity of Wnt target gene expression both *in vitro* and *in vivo*. We also confirmed the interaction between β-catenin and FoxM1 proteins in the nucleus by immunoprecipitation. This interaction was inhibited by down regulation of FoxM1 by thiostrepton in a dose dependent manner.
Importantly, we showed that FoxM1 binds to β-catenin promoter in the nucleus of EOC using ChIP analysis and this binding was inhibited with thiostrepton. Given this interaction of FoxM1-β-catenin signaling, we hypothesize that co-targeting both FoxM1 and β-catenin will be a novel therapeutic approach for late stage EOC. For this purpose, we used thiostrepton, FoxM1 inhibitor and FH535, a classic inhibitor of β-catenin pathway either alone or in combination, and our results showed the effectiveness of this therapeutic approach in inhibiting proliferation, inducing apoptosis and repressing EOC cancer cell growth and metastasis both *in vitro* and in EOC xenografts. Combination therapy was significantly better than monotherapy inhibition of EOC tumor growth. Combination with thiostrepton and FH535 was found to be synergistic not only in inhibition of cell growth but also in inhibition of metastatic and angiogenesis markers like MMP2, MMP9 and VEGF.
Altogether, our study showed the role of FoxM1 alteration in Middle Eastern EOC. Our data highlights the interaction between FoxM1 and β-catenin signaling pathways and suggest that co-targeting both FoxM1 and β-catenin might be a novel therapeutic approach in treatment of patient with aggressive late stage EOC.
MATERIALS AND METHODS {#s4}
=====================
Clinical samples and TMA construction {#s4_1}
-------------------------------------
Two hundred and seventy-six patients with EOC diagnosed between 1989 and 2015 were selected from King Faisal Specialist Hospital and Research Center. All samples were analyzed in a tissue microarray format. Tissue microarray construction was performed as described earlier \[[@R38]\]. Briefly, tissue cylinders with a diameter of 0.6 mm were punched from representative tumor regions of each donor tissue block and brought into recipient paraffin block using a modified semiautomatic robotic precision instrument (Beecher Instruments, Woodland, WI). Two 0.6-mm cores of EOC were arrayed from each case. Clinical and histological data were available for all these patients and are summarized in [Supplementary Table 4](#SD1){ref-type="supplementary-material"}. The patients were diagnosed histologically and received follow-up care in the Departments of Obstetrics and Gynecology and Oncology at King Faisal Specialist Hospital and Research Centre. Department of Obstetrics and Gynecology, King Faisal Specialist Hospital and Research Centre provided long-term follow-up data for these patients. The median follow-up time was 11.0 months (range, 2--199 months). Progression-free survival was computed from date of surgery for patients who underwent primary cytoreduction and from date of diagnosis by biopsy or cytology in those who underwent primary neoadjuvant chemotherapy. The institutional review board of the King Faisal Specialist Hospital and Research Centre approved the study.
Immunohistochemistry (IHC) {#s4_2}
--------------------------
Tissue microarray slides were processed and stained manually. The immunohistochemistry (IHC) protocol was followed as mentioned before \[[@R39]\] and described in Supplementary Materials and Methods .
FoxM1 immunohistiochemical expression was seen predominantly in the nuclear compartment and nuclear expression was quantified by H score as described previously \[[@R40]\]. Briefly, each TMA spot was assigned an intensity score from 0--3 (I~0~, I~1--3~) and proportion of the tumor staining for that intensity was recorded as 5% increments from a range of 0--100 (P~0~, P~1--3~). A final H score (range 0--300) was obtained by adding the sum of scores obtained for each intensity (I) and proportion (P) of area stained (H score = I~1~XP~1~ + I~2~XP~2~ + I~3~XP~3~) as described previously \[[@R41]\]. EOCs were categorized into 2 groups using X-tile bioinformatics software: low FoxM1 expression (H score ≤75) and high FoxM1 expression (H score\>75). X-tile plots were constructed for assessment of biomarker and optimization of cut off points based on outcome as has been described earlier \[[@R42], [@R43]\]. Similarly, X-tile was used to determine an optimal cut off for other antibodies.
Statistical analysis {#s4_3}
--------------------
Contingency table analysis and χ^2^ tests were used to study the relationship between clinico-pathological variables and protein expression. Survival curves were generated using the Kaplan-Meier method, with significance evaluated using the Mantel-Cox log-rank test. The limit of significance for all analyses was defined as a *p*-value of 0.05; two-sided tests were used in all calculations. The JMP10.0 (SAS Institute, Inc., Cary, NC) software package was used for data analyses.
Cell culture {#s4_4}
------------
EOC cell lines MDAH2774, SKOV3, OVCAR3, OVSAHO, OVTOKO and OVISE cells were purchased from ATCC (Manassas, VA). Following tests of these cell lines for immunological markers and cytogenetics, they were also fingerprinted and species was confirmed by IEF of AST, MDH and NP. The cell lines were cultured in RPMI 1640 supplemented with 10% (v/v) fetal bovine serum (ATCC), 100 units/mL penicillin, and 100 units/mL streptomycin (SIGMA) at 37°C in humidified atmosphere containing 5% CO~2~. All experiments were performed in RPMI 1640 (ATCC) containing 5% serum.
Reagents and antibodies {#s4_5}
-----------------------
FoxM1 inhibitor, thiostrepton was purchased from Tocris Cookson Inc (Ellisville, MO). β-Catenin inhibitor, FH535 was purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against β-catenin (CST-9562), cMYC (CST-5605), MMP-9 (CST-2270), MMP-2 (CST-4022), caspase-3 (CST-9665), Bcl-2 (CST-2876) and Bcl-xL (CST-2762), β-actin (CST-3700) were purchased from Cell Signaling Technology (Beverly MA). Anti--active-β-catenin (clone 8E7\#05-665) antibody was purchased from EMD Millipore (Billerica, MA). FoxM1 (sc-502), TCF4 (sc-166699), CyclinD1 (sc-753), uPAR (sc-10815), VEGF (sc-57496), Survivin (sc-374616), PARP (sc-7150) and GAPDH (sc-25778) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Annexin V was purchased from Molecular Probes (Eugene, OR).
Gene silencing using siRNA {#s4_6}
--------------------------
FoxM1 siRNA, and scrambled control siRNA were purchased from Qiagen (Valencia, CA, USA). Cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) for 6 hours following which the lipid and siRNA complex was removed and fresh growth medium containing 20% fetal bovine serum was added. After 48 hours of transfection cells were harvested and used for various experiments such as immunofluorescence analysis, immuno-blotting and xenograft assays.
Plasmid and transfection {#s4_7}
------------------------
Plasmid DNA encoding human FoxM1 was purchased from Origene (Rockville, MD). Transfection was performed using Lipofectamine™2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Briefly, EOC cells were seeded in 6-well culture plates; when approximately 50% confluent, cells were transfected with 4 μg plasmid. After 48 hours of transfection, cells were used for immunofluorescence analysis and immuno-blotting.
Immunofluorescence analysis {#s4_8}
---------------------------
EOC cells grown on coverslips in 6-well plates were fixed with ice-cold 100% methanol followed by permeabilization with 0.2% Triton X-100, blocked with 5% horse serum in PBS solution, and incubated with antibodies to FoxM1 (1:100), β-catenin (1:200), or TCF4 (1:100) in buffer A (1% BSA, 0.1% Triton X-100, 10% horse serum in PBS solution) for 1 h at 37 °C. Cells were then incubated with Alexa Fluor 488 goat anti-rabbit or Alexa Fluor 594 goat anti-mouse antibody and mounted using DAPI. The cells were visualized using Olympus BX63 fluorescence microscope.
Chromatin immunoprecipitation (ChIP) assay {#s4_9}
------------------------------------------
ChIP analysis was performed using a Pierce agarose ChIP Kit (Thermo Scientific, Rockford, IL). OVCAR3 cells were treated with and without indicated doses of thiostrepton. After 48 hours of treatment, cells were fixed with formaldehyde and cross-linked. The chromatin was sheared and immunoprecipitated with 2 μg of anti-FoxM1or control IgG antibody. DNA protein complexes were eluted from protein A/G agarose beads using a spin column and were reverse cross-linked by incubating with NaCl at 65°C. The intensity of FoxM1 binding to the β-catenin promoter was analyzed by thermal cycler using following primer sequences, FoxM1 binding to the β-catenin promoter sites, F1(-1261-1255): (F) TGCTGCATTAGAATGGGAAA and (R) TGTGGGGATTTTTCTTTGGA; F2(-1609-1604): (F) AATTGGAGGCTGCTTAATCG and(R) TTGTGGGGATTTTTCTTTGG.
Animals and xenografts study {#s4_10}
----------------------------
Six-week-old nude mice were obtained from Jackson Laboratories (Bar Harbor, ME) and maintained in a pathogen-free animal facility at least 1 week before use. All animal studies were done in accordance with institutional guidelines. For xenograft study, mice were inoculated subcutaneously into the flanks with 5 × 10^6^ OVCAR3 cells in 100 µl PBS. After tumors grew to about 100 mm^3^, mice were treated intraperitoneally with thiostrepton (20 mg/kg) and FH535 (10 mg/kg) either alone or in combination, twice a week for 30 days. The body weight and tumor volume of each mouse was monitored weekly. After 5 weeks treatment, mice were sacrificed and individual tumors were weighed, then snap-frozen in liquid nitrogen for storage.
SUPPLEMENTARY MATERIALS FIGURES AND TABLES {#s5}
==========================================
**Author contributions**
PP, SPD and AKS: Designed, executed and write the manuscript, NMA: Executed the experiments, IAA, AT and FAD: Collected and analyzed all the clinical samples, SKP: Prepared the TMA and conducted all the immunohistochemistry experiments and scoring of IHC spots, KSA: Made substantial contributions to conception and design and acquisition of data along with analysis and interpretation of data; Prepared and wrote the manuscript. KSA gave the final approval for the submission of the manuscript.
We would like to thank Dr. Maqbool Ahmed, Saravanan Thangavel, Roxanne Melosantos and Rafia Begum for their technical assistance and Zeeshan Qadri for statistical analysis. This study was supported by King Abdul Aziz Centre for Science and Technology (KACST) under Project No. NSTIP 10-BIO963-20 (RAC 2140-033).
**CONFLICTS OF INTEREST**
There are no conflicts of interest to report.
[^1]: These authors contributed equally to this work
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Businesses seldom raise wages due to a sense of corporate benevolence. Rather, wages rise when the demand for workers increases. This forces businesses to increase wages out of self-interest, to keep their employees from being hired away by competitors.
That may seem counterintuitive. Most people think a corporate tax cut just means bigger profits for businesses — profits that are used to line the pockets of the rich: the owners, corporate executives, and shareholders. But what actually happens is way more complicated, and it’s very good news for workers.
First, let’s look at the big picture, the U.S. corporate income tax rate is one of the highest in the world. On top of the 35 percent federal tax rate there are state taxes, bringing the average top corporate rate to nearly 40 percent of taxable income. Other provisions of the tax code — such as not allowing firms to fully deduct their capital expenses — help make the U.S. business tax environment one of the most burdensome in the world.
That’s something that investors, both foreign and domestic, weigh heavily when deciding where to build their new factory or back a new business venture. Put another way, our current business tax environment discourages investment in America. Foreign and domestic investment dollars still flow, but they flow elsewhere, as investors choose to set up shop in other countries.
Today, business investment in the United States is unusually low. Investment per worker is 8 percent below the historic norm, according to a 2015 report by the Chicago Federal Reserve Bank. And subpar investment creates huge problems.
Businesses make investments, in things like machinery and new technology, so that their employees can become more productive. As employees produce more, profits go up, enabling the business to hire more workers and make even higher profits. But the hiring spree benefits workers as well as businesses: the increased demand for workers leads to higher wages for all.
Recent research by economist Salim Furth concludes that making up the “lost” 8 percent of investment per worker “would increase wages between 13 percent and 20 percent” for all Americans. That could be as much as a $10,000 raise for the typical American family (median annual wage approximately $50,000 a year), that would mean a raise of $6,500-$10,000.
Comprehensive corporate tax reform — a package that includes both a lower tax rate and the immediate write-off of capital expenses — could increase American wages by even more than 20 percent, according to some estimates.
Ridding the tax code of its current bias against investment would unleash a torrent of new investment in American businesses and American workers — and it’s the workers who pocket most of the profits.
Anemic economic growth since the great recession, the sluggish rate of business start-ups, and reduced entrepreneurship — all are partially the result of historically low rates of U.S. investment. Tax reform can remake America into a top global destination for business investment, and a far more rewarding workplace for American workers.
Adam N. Michel is an analyst specializing in tax and budget issues at the Heritage Foundation’s Roe Institute for Economic Policy Studies.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Veganism and vegetarianism in heavy metal has become a significant trend. This always interested me, partially because I credit my own interest in punk and heavy metal with my gradual conversion to vegetarianism (and hopefully one day soon, veganism) Of course – this made me wonder, why? Why is it that heavy metal seems to be so strongly affiliated, statistically speaking, with what is, objectively speaking, a fairly minor, and, in today's society, kind of weird lifestyle choice? That is not to say that metal is dominated by vegetarianism, but rather that bands like GWAR who released a memorable video for PETA have helped to codify its role in the scene. As with anything else tied into old school underground metal, it can be hard to find any sort of accurate documentation, especially since most of this stuff got started before the days of online webzines codifying everything and making it painfully clear who did what first. So I put on my investigators cap to try and figure out why this lifestyle is so important to me, and so many of our favorite extreme music musicians.
Advertisement. Scroll to continue reading.
Of course, metal icons who identify with vegetarianism were present even in the earliest days of the genre. One need look no further than the gods themselves, Black Sabbath to find out that Geezer Butler is a longtime committed veggie. Butler though never made a big deal about his eating habits and shouldn't be credited with too much of an influence on the eating choices of future metalheads. Perhaps the true root of the growth of vegetarian comes from groups like Napalm Death and Carcass who took the whole thing to a very political place – and that's where it started to matter, in metal at least. Meanwhile in hardcore we certainly can find political vegetarians making moves early on. Minor Threat's Ian MacKaye is perhaps the most famous example in that particular scene, and he definitely had some influence on the guys in both Napalm Death and Carcass. Considering the early material from both of those bands was considered to be a crossover between punk and metal it makes sense that they would be the ones to bring it to the metal world. In a more modern context we see bands like Between The Buried And Me coming out in strong support for PETA, and Cattle Decapitation using their lyrics as a way to communicate a pro-veg message.
I don't want to write an entire article about Carcass's influence on the food politics of metal though, even if the cover of Reek Of Putrefaction did change everything for me, and countless others. Looking at that album art when I was 12 was the first time that I realized that humans are meat, just as much as pigs or cows. What's interesting to consider is that there's been a handful of other influential bands who had ideologies to match that never got nearly as far, and I'm not just talking about the radical right wing groups who dominate the European scene.
What drove me forward was the question, 'Why is it that vegetarianism should reign as an ideology in metal over say, Buddhism?' With that example there certainly have been a wide range of influential bands who supported Buddhist ideologies, like Cynic, and yet they never seemed to end up deeply embedded into the world of heavy metal the way that vegetarianism is.
Advertisement. Scroll to continue reading.
I feel part of why vegetarianism has really taken off in the metal community is that vegetarianism is a rather extreme ideology. It's one that, like metal, admits that the world is an inherently fucked up place and that we need to work together to carry forward. Furthermore, just like metal's general ideology, vegetarianism is something that requires a fair bit of dedication to really pull off. The one prepares you for the other. If you're already used to having to dig to find the sickest black metal bands, (Or perhaps just the quasi-legendary Vegan Black Metal Chef) the weird inconveniences that sustainable eating choices can force upon you are not going to seem to be as much of a struggle. It is a lot easier to qualify it as just another part of a metalheads life, and an individuals responsibility to mankind.
Don't get me wrong though, I'm not trying to come off as preachy, even if I do genuinely believe that a balanced vegetarian lifestyle is a better option for nearly everyone. Despite how I may make it sound, vegetarianism still isn't especially dominant in the metal scene. It just so happens to be more prevalent than in most other music communities I have observed. If you want to eat meat that's totally your own choice, and vegetarianism is not something that should be undertaken lightly, I fucked it up my first few months as a vegetarian and that almost caused some serious damage. That might be part of why veg lifestyles are still in the minority, Converge only have so much power after all. While it is a good and important life choice to make, I don't want people to dive in unready. Of course, the sooner you dive in, the sooner you will get to realize that a ton of your metal friends have probably already made similar choices and are going to be willing to help you move forward with the lifestyle, creating a better more sustainable future for all of us.
As Morbid Angel famously put it, this is extreme music for extreme people. Metal as a whole implies a level of extremity and dedication that has been wrought by a long history of dedicated and passionate individuals who are working on a largely volunteer basis to create what they genuinely believe will be a better tomorrow. Veganism has its long history in heavy metal because it is coming into a world that embraces that exact kind of thing. Metal, like vegetarianism is about ultimately about a minority fighting against the world. If it's not your cup of tea so be it, but for those of us who seek to make a difference then let your freak flag fly, and let your eating habits reflect that. Metal needs veganism because it gives us another great thing to rally around and prove that we are here to help change the world, and beyond that, it makes you a better Devin Townsend fan, and who doesn't want that? So even if you are an avowed meat eater, I encourage you to consider these ties and see if maybe metal has been priming you for veganism all along.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Q:
XenServer not detecting whole RAM (Dom0 and DomU 32-bit issue)
Well, somewhere I has read that my machine has a problem reading all the RAM because of the 32-bit limitation:
http://xenserver.org/blog/entry/the-reality-of-a-64-bit-dom0.html
I don't underestand anything, can somebody explain what this means?
http://discussions.citrix.com/topic/265801-xenserver-detected-just-3319mb-ram-howto-set-more/
My problem here is that I have also an Asrock MB and I don't know if the problem is here, or is with my instalation:
Somewhere, outside my home, I have also installed XenServer with the same ISO and 4GB and everything is working fine.
But here not, I don't know exactly if I have to patch something... Because in the first image the Xen Project Hypervision redirects me to: http://xenproject.org/developers/teams/hypervisor.html
That means that If I install this packet I will fix this?
Can somebody explain all this to me?
Please, don't downvote me, I don't know if the things I'm asking is in the correct way, I didn't talk of any of this things by myself because I don't understand anything, so any help is welcome.
EDIT:
There are some posts I have also readed that I didn't understand:
https://wiki.xen.org/wiki/Xen_Project_Software_Overview
https://wiki.xen.org/wiki/Dom0_Kernels_for_Xen
Can somebody tell clearly what I need to do, or to know to solver this issue?
By the moment I understand that XenServers runs on 64-bit (I don't have any 32-bit option, but I can't prove that this is really 64-bit), but that part that controls the hardware is in 32-bits, how this is possible? Can I fix this? Why in my other machine using the same ISO I don't have problems? That means that I have a problem with my hardware, is there any compatibility issue?
EDIT2:
Intel (R) virtualization is enabled... So, the only thing, that you have to do is tell me to check things by the moment.
But there is something that was unexpected:
When the BIOS is loading, it tell me that it has 3319MB, that I think is RAM, and XenServer only can use 3318MB... So, can I imagine that the BIOS detect the two modules, but, It only uses 3318MB, actually the problem is not in XenServer, the real problem is with the hardware???
Thanks!
A:
I solved myself the problem.
It was problem of the BIOS, because I bought two modules of 2GB of DDR2 and I had to activate the Memory Remap option.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
The British Inter-University China Centre 英国跨大学中国研究中心
Who are we?
The British Inter-University China Centre (BICC) is the hub of a joint enterprise of three partner institutions, the universities of Bristol, Manchester and Oxford, and a premier teaching and research facility on China in the UK. The current phase of the project (phase 3), is hosted from February 2014- February 2016 at Manchester University in the Faculty of Arts and Cultures, under the Manchester directorship of Yangwen Zheng.
The Past
In its initial phase, BICC was funded by the Economic & Social Research Council, the Scottish Funding Council, and the Higher Education Funding Council for England, as well as the AHRC. In 2006-2012 the centre oversaw the training of a cadre of new postgraduate and postdoctoral researchers, as part of a programme of national capacity enhancement in the field of Chinese studies. Chinese language capability lay at the heart of the training programme, and the centre ran teaching programmes and provided opportunities for retooling in Chinese for students without the language. The aim was also to produce a body of original research, developed by all members of the BICC, which would then be disseminated both within the academic and wider communities through events, network building, and knowledge exchange initiatives.
The Future
BICC’s mission in its current phase extends the previous work already done in the China Field, through increasing educational links at academic and institutional level, between research bodies, colleges, schools and universities. Knowledge Exchange is a key objective in this phase of the project, both within and external to the academic community. BICC wants to reach outside of academia and to engage with the public and cultural sector as well as maintaining its partnerships and links within the Chinese Studies field. As its community of researchers continues to expand, and as its former students have moved into lectureships at universities across the United Kingdom and internationally, BICC wishes to maintain its teaching and research excellence on all China related matters, with a unique strength in History, Language and Culture, Politics and International Relations, all underpinned by language study. BICC wishes to bring its knowledge outside of a University setting in order to bring its understanding to all corners of society, and to promote interest in China to all sections of the community.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Introduction
============
Asthma is one of the most common chronic illnesses in the United States. In 2009, the overall prevalence of asthma was 8.2 percent affecting approximately 24.6 million people (17.5 million adults and 7.1 million children ages 0--17 years).[@b1-egems1032] When managed appropriately, asthma is a controllable disease, such that many hospitalizations, missed school/work days, and deaths are preventable.[@b2-egems1032] Nevertheless, in 2009, an estimated 12.7 million people (8.7 million adults and 4.0 million children) experienced asthma exacerbations, 1.75 million had asthma-related emergency department (ED) visits and 456,000 had asthma-related hospitalizations.[@b1-egems1032] The evidence for medical management strategies to improve asthma control have been synthesized in national asthma guidelines[@b3-egems1032] and subsequent reviews[@b4-egems1032]--[@b6-egems1032]; the four key components of care central to asthma control are assessment and monitoring; asthma care education; control of environmental factors and comorbid conditions; and pharmacologic therapy.
The Patient-Centered Medical Home (PCMH) model, endorsed by many primary care professional organizations,[@b7-egems1032] may be an advantageous health care delivery system for asthma management. The medical home model is the focus of multiple reform efforts related to health care delivery, reimbursement, and primary care.[@b8-egems1032]--[@b10-egems1032] The PCMH model facilitates chronic care by coordinating clinical staff and workflows to optimize patient management, monitoring and education and is associated with improved quality of care including for asthma management.[@b11-egems1032]--[@b14-egems1032] However, there are remaining questions about the effects of efforts to implement PCMH on asthma outcomes.[@b15-egems1032]--[@b17-egems1032]
The Institute of Medicine designates as high priority comparative effectiveness research (CER) on health care delivery system characteristics such as the PCMH.[@b18-egems1032] Methods for such investigations are not well established, and randomized trials are infeasible given that it is unlikely that practices will agree to be randomized to the adoption of PCMH infrastructures and processes. However, widespread but varied implementation of the medical home model offers the opportunity to conduct observational research (as a "natural experiment"). In this paper, we present a prospective, observational cohort-study protocol designed to investigate the relationship between a practice's medical home characteristics and asthma control in adults and children, among patients receiving care in federally qualified health centers and other safety net primary-care practices. The two central innovative aspects of this protocol are the development of an approach for CER on delivery system characteristics, and the creation of a data infrastructure that facilitates the participation of a large number of safety net practices in research. Following published design and reporting guidelines, the current paper therefore represents an a priori specification of the objectives and research design for this study.[@b19-egems1032],[@b20-egems1032]
Hypotheses
==========
The purpose of the prospective, observational cohort study described in this protocol is to estimate the effects of medical home characteristics on asthma control in adults and children. We hypothesize that greater practice-level medical home characteristics are associated with better asthma control, in terms of both patient-reported asthma control and asthma exacerbations.
Methods
=======
Study Design
------------
This is a prospective, longitudinal cohort study, utilizing survey methodologies and secondary analysis of existing structured clinical-, administrative-, and claims data (henceforth "electronic health data"). Practice-level medical home characteristics will be correlated with patient-level asthma outcomes, controlling for potential confounding variables, using a clustered design. Linear and nonlinear mixed models will be used for analysis. The study's inception date was July 1, 2012. Institutional Review Board (IRB) approvals, including waivers for informed consent and Health Insurance Portability and Accountability Act (HIPAA) authorization, and data use agreements (DUAs) were obtained for this study.
Setting
-------
The setting for this research is the Scalable Architecture for Federated Translational Inquiries Network (SAFTINet), an Agency for Healthcare Research and Quality (AHRQ)-funded safety net-oriented practice-based research network. Most participating practices are federally qualified health centers, and several are school-based health centers; all have either electronic health record (EHR) or other digital systems to store clinical data. There are approximately 50 participating practices from four health care organizations in Colorado and Tennessee; the practices care for approximately 200,000 patients, of whom an estimated 20,000 have asthma and about 40 percent are eligible for Medicaid. SAFTINet developed an information technology infrastructure designed to securely share electronic health data to support quality improvement and CER. The SAFTINet databases include existing administrative-, clinical-, Medicaid claims- and enrollment data, and patient-reported outcomes (PROs) data collected during routine clinical care; data are standardized to the Observational Medical Outcomes Partnership (OMOP) common data model (Version 4).[@b21-egems1032] The data are HIPAA-limited datasets, de-identified with the exception of service dates, birth dates for those \<90, and ZIP codes. Data sharing partners maintain their own separate databases, which are connected via secure networks and can be queried via a secure web-based portal.
Data Sources
------------
Electronic health data from the SAFTINet databases will be used to select patients for inclusion in the cohorts, to operationalize patient-level outcomes, covariates and descriptors, and to assign patients to practices. Data collected during routine clinical care between July 2010 and December 2013 will be included. Medical home characteristics were assessed using self-report, practice-level surveys completed by practice personnel.
Study Population
----------------
The study includes a cohort of children and adolescents with asthma and a cohort of adults with asthma. Asthma is a chronic condition punctuated with acute exacerbations; therefore, we elected to use a prevalent-diagnosis design, rather than an incident-diagnosis design. Using the data sources available, which do not include narrative documentation, an incident-diagnosis design would likely not be accurate, as fastidious clinical documentation is required to distinguish newly diagnosed asthma from prevalent asthma in new patients.
Patients eligible for inclusion in the cohorts will be identified based on demographic- and encounter data (dates and places of service and associated ICD-9 diagnosis codes). An asthma diagnosis will be defined as the presence of at least two unique encounters with diagnosis codes for asthma (ICD-9 = 493) occurring within an 18-month period but separated by at least 28 days. This requirement for two visits is to eliminate the single visit to the office or ED with a final diagnosis of "rule out asthma diagnosis," which would be coded as 493 since there are no "rule out" coding modifiers.
To be included in the child cohort, patients must be between 2 and 17 years old at study inception. To be included in the adult cohort, patients must be men between the ages of 18 and 55 years or women between the ages of 18 and 60 years at study inception. Our age criteria were selected to increase the likelihood of an accurate asthma diagnosis, as asthma is often confused with chronic obstructive pulmonary disease in older adults[@b22-egems1032] and with serial respiratory viral infections in younger children.[@b23-egems1032] To be included in the analysis for a given outcome, patients must have had at least one encounter at a participating practice during the corresponding exposure period ([Figure 1](#f1-egems1032){ref-type="fig"}). To be included in analyses involving patient-reported asthma control, patients must have at least one recorded Asthma Control Test (ACT) value.
Exclusion criteria for both cohorts include diagnosis codes for other chronic lung diseases, including cystic fibrosis (277.0), chronic lung disease of prematurity (770.7, 765.21--765.26, chronic obstructive pulmonary disease (496), emphysema (492), chronic bronchitis (491), pulmonary fibrosis (503, 508.1, 515), or active tuberculosis (010, 011, 012, 018).
Variables and Measurement
=========================
The periods for measurement of study variables are depicted in [Figure 1](#f1-egems1032){ref-type="fig"}. We will assess patient-level asthma outcomes in two ways: patient-reported asthma control (ACT Value) and a measure of asthma exacerbations based on electronic health data. Both patient-reported asthma control and asthma exacerbations will be assessed repeatedly over time within patients during an 18-month outcome period (July 1, 2012--December 31, 2013). For each month during the outcome period, we will determine for each eligible patient whether or not an exacerbation occurred during that month. We will establish an index date for each outcome measurement: the index date for each ACT score will be the date on which the ACT was administered; the index date for each asthma exacerbation will be the last day of the calendar month in which that exacerbation occurred. For the ACT outcome analysis, we will measure exposure to medical home characteristics and covariate measures in the 24 months preceding the date of the ACT. For the asthma exacerbation outcome analysis, we will assess each patient-month for the presence or absence of an exacerbation. The exposure period assigned to each patient-month will be the 24-month period ending at the end of the patient-month during which exacerbations are assessed.
Medical home characteristics were measured via self-report survey at study inception. For each individual outcome measurement, the medical home exposure period is the 24 months preceding, and inclusive of, the index date. There is no single index date or exposure period. Patient exposure to a practice's medical home characteristics will be assigned based on a patient's health care utilization at a practice during a 24-month exposure period. We have chosen 24 months as the exposure period, as patients may seek care less often than once a year. As patients may visit more than one practice, for analytic purposes we will assign patients to the practice accessed most frequently during each exposure period, or, when treated an equal number of times at two or more practices, to the most recent practice. So that we may capture patients who access care only during an exacerbation, we include patients for whom exacerbation encounters are their only encounters within the exposure period. The anticipated time course to improved control after exposure to a medical home is likely to be short---a few weeks to a few months; therefore, we have not specified a time gap between the exposure and outcome measurement.
Data from the exposure period will also be used to assess several potential confounding variables. Prior asthma control and exacerbation rates are known predictors of the study's outcome measures.[@b24-egems1032] Definitions, measures and data sources are summarized in [Table 1](#t1-egems1032){ref-type="table"}.
Outcomes
--------
### Patient-Reported Asthma Control
The most recent asthma guidelines recommend the assessment of patient-reported asthma control as an indicator of both current symptom burden and risk of future exacerbations.[@b4-egems1032]--[@b6-egems1032] Patient-reported asthma symptom control will be measured using the ACT[@b25-egems1032] and the Childhood ACT (C-ACT)[@b26-egems1032]. The ACT is a copyrighted instrument of QualityMetric Incorporated; the C-ACT is a copyrighted instrument of GlaxoSmithKline. GlaxoSmithKline can grant access to both instruments. We received permission from GlaxoSmithKline to use the ACT and C-ACT for this study. The ACT and C-ACT (hereafter referred to together as the "ACT") are widely used, valid and reliable tools for measuring patient-reported asthma symptoms control.[@b27-egems1032] The ACT has five items measured on a five-point scale, which are then summed to represent total control. ACT total scores range from 5 to 25; higher scores indicate better control. ACT scores can also be categorized as follows: In control (total score \> 19), poorly controlled (total score 16--19), very poorly controlled (total score \< 15). We will exclude from analyses ACT assessments that occur within 21 days of an asthma exacerbation.
Given the choice of several existing, validated patient-reported asthma measures, the SAFTINet clinical partners selected the ACT to assess asthma control because the ACT is available in relevant languages, is relatively brief and easy to administer, and is indicated in the asthma guidelines as an appropriate tool for identifying patients in need of intensified treatment. The clinical partners were allowed broad latitude for workflow implementation and data collection; the minimal criteria were that the ACT should be administered to all patients with asthma at least once a year and the ACT score should be documented in a structured data field so as to be included in the SAFTINet databases. The varied implementation plans included both point of care and telephone-based modes of ACT administration.
### Asthma Exacerbations
An additional outcome is the presence of an asthma exacerbation for a given patient during each month of the outcome period. Evidence of asthma exacerbations will be inferred from utilization patterns and use of symptom control medications using encounter and prescription data from the SAFTINet database. For all patients, we will define asthma exacerbations based on the presence of any of the following criteria, using clinical data originating in the EHR or surrogate EHR system: A prescription for oral (systemic) steroids prescribed within two days of the date of a practice visit that includes a diagnostic code for asthma, orAt least three outpatient visits occurring on separate days within a 14-day period that include a diagnostic code for asthma, orAdministration (not merely a prescription) of an inhaled beta-agonist medication (nebulizer or metered dose inhaler) at (on the same date as) an outpatient visit.
For the subset of patients (about 40 percent of the sample) covered by Medicaid, we will include an additional criterion for an asthma exacerbation, based on claims: 4. An asthma-related emergency department visit or hospitalization with asthma listed as the primary or secondary diagnosis.
Only one of the above criteria must be met to establish an exacerbation. We will count asthma exacerbations as separate events when at least 21 days elapse between the end of one event (or the date of an event occurring on one particular day) and the beginning of the next exacerbation-defining event. For each month in the 18-month outcome period, we will indicate whether or not an exacerbation occurred during that month. For exacerbations spanning two or more months (multiple criteria met over time, with less than 21 days between each criterion date), the exacerbation will only be counted in the first month.
Exposure Variables
------------------
### Medical Home Characteristics
We assessed practice medical home characteristics via self-report surveys. To select a survey instrument suitable for measuring medical home characteristics in this study, we conducted a literature review, examined existing surveys, and sought recommendations from SAFTINet clinical partners and experts in the field. None of the existing options fully met the needs of the SAFTINet project, lacking both critical face validity and applicability to practices that were not in the process of seeking formal medical home recognition; therefore, a medical home characteristics survey was adapted for this study based on concepts and items from several sources.[@b28-egems1032]--[@b31-egems1032] The resulting self-administered instrument, the SAFTINet Delivery of Coordinated Care Survey (DoCCS), was informed by our review of the literature, consultation with experts, and published surveys designed to assess progress toward becoming a medical home.[@b28-egems1032],[@b31-egems1032]
The DoCCS includes nine sections organized by medical home domain, as shown in [Table 2](#t2-egems1032){ref-type="table"}. The DoCCS assesses respondents' perceptions of the extent to which their practice has adopted characteristics of these nine medical home domains. Each domain includes between 5 to 17 questions, with responses measured on a 1--5 scale, from "No/Almost Never" to "Almost Always." For each practice, we will compute a mean score for each domain (continuous measure with a range of 1--5) and an overall score, a total of the mean scores for all nine domains (continuous measure with a range of 9--45).[@b30-egems1032] We plan to analyze the DoCCS score as a continuous measure, as well as to compare practices by DoCCS score quartile.
Each participating practice was asked to identify three practice members (a lead clinician, such as a medical director; a practice manager; and a lead member of the nursing staff) to complete the survey on behalf of the practice. The initial DoCCS measurement was made in July--September 2012. Respondents had the option of completing the DoCCS on paper or through an online survey via RedCap, a secure, web-based application designed exclusively to support data capture for research studies.[@b32-egems1032] We plan to use only one set of responses per practice for the primary analyses. We will primarily use lead clinician responses, as this role is likely to have the most informed perception of how a practice operates. If no lead clinician was available to complete the survey, we will use practice manager, and then lead nurse, responses. A second DoCCS measurement was made, February--April, 2013, and will be used to assess the assumption of practice-level stability in DoCCS values during the study period.
Patient-Level Covariates
------------------------
The patient-level covariates to be included in this analysis are patient demographics (age, race/ethnicity, income, urban versus rural residence) and other factors related to risk for poor asthma control (asthma severity, previous exacerbations, and certain comorbidities). For the child cohort comorbidities of interest, we selected allergic rhinitis (ICD-9 = 477), sinusitis (ICD-9 = 461, 473), and gastroesophageal reflux disease (ICD-9 = 530.81). For the adult cohort, we selected allergic rhinitis and sinusitis. For prior exacerbations, we will apply the same criteria used to define an asthma exacerbation outcome. Using prescription data in the SAFTINet database accrued during the exposure period, we will classify asthma severity as follows[@b33-egems1032]: Intermittent/exercise-induced asthma = only on short-acting beta-agonist (rescue medicines)Mild persistent asthma = low-dose inhaled corticosteroid (ICS) such as fluticasone, or leukotriene receptor antagonist such as monteleukastModerate persistent asthma = moderate-dose ICS, or low-dose combination therapy such as fluticasone/salmeterolSevere persistent asthma = high-dose ICS or medium- to high-dose combination therapy or omalizumab.
Practice-Level Covariates
-------------------------
Practice-level characteristics are collected through an online survey adapted from the Baseline Practice Survey[@b34-egems1032] and through community-level data from the Area Resource File[@b35-egems1032] and Index of Medical Underservice[@b36-egems1032] linked to the practice by the practice's address. The practice-level characteristics survey was administered twice, concurrently with the two administrations of the DoCCS. The survey incorporates measures of the following domains: (1) patient demographics, including race/ethnicity, language, and payer; (2) organizational slack (size), including the number and type of providers and patients; and (3) pressure from payers, including membership in an accountable care organization (ACO), the presence of pay-for-performance pressures, and financial incentives to adopt medical home characteristics. The geographically linked variables assessed will include the proportion in the community with managed care insurance and with public insurance, the urban/rural designation, and the degree of medical underservice.[@b35-egems1032],[@b36-egems1032] We will assess practice level variables for their role as potential confounders, as described below. We will also consider changes in practice measures, such as changes in provider full-time equivalents and other resources, and the role of time-varying practice-level measures on the model.
Study Design Issues: Bias and Confounding
=========================================
As with any nonexperimental study, several types of bias are possible, including selection bias, confounding, and misclassification bias. In this section, we discuss sources of bias that may influence internal validity and the ability to make causal inferences. We seek to address potential biases through analysis using multivariate models, sensitivity analysis, or through reasoning.
Selection bias
--------------
Selection bias pertains to nonrandom selection into the study population,[@b37-egems1032] and could be introduced by our selection criterion requiring 18 months between asthma diagnostic codes, as this likely selects a more severe asthma sample than if we also included patients with less frequent asthma-related encounters. We can use the data to test for this effect---to determine whether patients with more severe disease are likely to be included in the study, and include this assessment of selection bias in reporting our findings. Also, practices lower in medical home characteristics may lack mechanisms for routine data collection, and may disproportionately administer the ACT to patients who present for acute asthma problems. In this case, results would be biased in favor of practices with greater medical home characteristics. We have partially addressed this problem by excluding ACT assessments that occur within 21 days of an asthma exacerbation.
Confounding
-----------
Confounding is a problem of common causes, such that variables that influence asthma control also influence how patients get "selected" for exposure to a practice's medical home characteristics. The factors that influence allocation of subjects into practices that have more robust medical-home characteristics may also be the factors related to patients' greater medical complexity, and thus to their risk for poor outcomes (indication bias). Selection of covariates to control for confounding is described below. We also plan to use the data to determine baseline factors predictive of allocation to different exposure levels and address this statistically through inverse probability of exposure weights.
Misclassification bias
----------------------
Misclassification of exposure to medical home characteristics may be due to measurement error. For example, a patient in poor asthma control at the time of an encounter at their exposure practice may have unsuccessfully attempted to access asthma care at a second practice; because the unsuccessful attempts were not recorded in the dataset, the first practice is misclassified as the patient's exposure practice. Similarly, patients who switch practices during the study period may be misclassified by our protocol to assign them to the exposure characteristics of the practice at which they had more visits. Switching may have occurred for reasons related to either the practice's medical home characteristics or the patient's underlying disease severity, and thus may bias the time-varying treatment analysis. We plan to address this through a sensitivity analysis involving varying the protocol for exposure-assignment for the subgroup of patients who switch practices.
Misclassification of asthma outcomes may be due to limitations of the data sources. For patients lacking claims data, it is possible we will underidentify exacerbation events based on ED encounters.
Selection of Variables to Control Confounding
---------------------------------------------
We approached the selection of variables to control confounding from a theoretical rather than an empirical (e.g., methods used in machine learning or in high-dimensional propensity score analysis) perspective. Consistent with causal graph theory,[@b38-egems1032] we developed a hypothesized causal structure for the relationship between medical home characteristics and asthma outcomes ([Figure 2](#f2-egems1032){ref-type="fig"}). First, we identified intermediate variables (see [Figure 2](#f2-egems1032){ref-type="fig"})---those that may lie in the causal pathway between medical home characteristics and asthma outcomes---as adjusting for these variables would inappropriately attenuate an observed effect of exposure on outcomes. Second, we identified patient- and practice-level factors (see [Figure 2](#f2-egems1032){ref-type="fig"}) that may influence asthma control and level of medical home model concordance of the patient's practice.
Patient-level predictors of exposure to a practice with medical home characteristics include demographics,[@b39-egems1032]--[@b47-egems1032] health status including prior utilization[@b39-egems1032],[@b45-egems1032],[@b48-egems1032], neighborhood characteristics[@b39-egems1032],[@b40-egems1032] and comorbidity.[@b45-egems1032],[@b47-egems1032],[@b49-egems1032] Although there is limited evidence on how underserved patients select primary care providers, patients may self-select into a particular practice based on factors such as proximity, affordability, insurance coverage, provider reputation, and appointment availability during convenient hours.[@b50-egems1032]--[@b52-egems1032] Where people choose to live, and thus which practices are in close proximity, may be related to certain demographic or health status factors.[@b53-egems1032]
Patient-level characteristics are also known predictors of asthma control. Asthma control is related to patient demographics such as age, race, ethnicity, language, income and insurance status[@b16-egems1032],[@b54-egems1032]--[@b57-egems1032], as well as intrinsic factors such as comorbidity, asthma severity and a history of poor control.[@b58-egems1032] After considering several diagnosis-based risk adjustment scores to adjust for overall comorbidity, based on expert opinion, we chose to adjust for specific comorbid conditions.[@b45-egems1032],[@b49-egems1032],[@b59-egems1032]--[@b61-egems1032]
Practice-level characteristics may also be predictive of medical home characteristics; for example, larger practices may have more resources for pursuing changes consistent with achieving greater concordance with the medical home model.[@b62-egems1032]--[@b67-egems1032] Similarly, practice-level characteristics of the population the practice serves---such as community-level medical underservice[@b68-egems1032]---may be associated with the practice's medical home characteristics. We did not find studies indicating that practice-level characteristics (other than medical home characteristics) are predictive of asthma control (see dotted line in [Figure 2](#f2-egems1032){ref-type="fig"}), but will test potential practice-level factors for confounding prior to inclusion in multivariate models.
We narrowed the list to factors that are likely to be common causes of both medical home exposure and asthma control. We eliminated confounders that are medical home characteristics themselves (access and appointment availability), factors likely to have little variability in a safety net population (e.g., insurance coverage), and any unmeasured variables. As shown in [Figure 1](#f1-egems1032){ref-type="fig"}, we will consider patient demographics and factors related to risk for poor asthma control as potential confounders. We will empirically test that these factors are related to both medical home characteristics and asthma outcomes prior to inclusion in multivariate models.
Sample Size and Power Estimation
================================
We used standard software for power- and sample-size estimation. We followed Murray for computing the variance inflation factor.[@b69-egems1032] In this clustered design, there are up to 55 practices that will be providing practice-level data, with at least 100 patients per practice. As intraclass correlations (ICC) for this study are unknown, we estimated detectable effect sizes based on a lower (ICC = .05) and a higher (ICC = .10) bound for ICC. For ICC = .05, the effective sample size would be 455. This would provide sufficient power to detect an effect size of Cohen's d = .19. For ICC = .10, the effective sample size would be 248, allowing us to detect an effect size of d = .26. Both estimated effect sizes are in the "small" range, suggesting that this study is adequately powered to detect even small effects.
Statistical Methods
===================
We will test our hypotheses separately for adults and children. Our analytic models must accommodate clustering both at the patient level (longitudinal), as asthma control will be measured repeatedly over time within patient, and at the practice level (patients clustered within practices); therefore, we will use mixed effects modeling.[@b70-egems1032] For the exacerbation outcome analysis, we will specify a nonlinear mixed effects model (logistic or ordinal regression). For the ACT outcome analysis, we will use a linear mixed effects model. The large number of patients (∼20,000) will likely ensure that parameter estimates and residuals will be normally distributed, and thus allow us to use linear models. This assumption will be confirmed prior to analysis.
The predictor variables are the total and domain medical home scores from the DoCCS. They will be included in the model as continuous variables. We will check the linearity of the relationship using a simple linear spline with a single knot at the mean of the medical home score. Prior to testing the primary hypotheses, we will test whether any of the suspected confounders are associated with (1) receiving care in practices that are higher versus lower in medical home characteristics or (2) asthma control. Only those factors associated with both medical home exposure and asthma control are likely to be confounders.
The models will be fit in four steps: (1) DoCCS score as the sole explanatory variable; (2) addition of variables identified as potential confounders (e.g., are correlated with both the DoCCS score and the outcome, and not in a proposed mediating pathway), (3) addition of select patient demographics as covariates; and (4) addition of select patient-level risk factors for poor asthma control as covariates. At each step, the parameter estimating the association of the outcome with DoCCS scores will be examined; if there is a large change in its value (e.g., parameter is sensitive to the addition of the covariates), we will attempt to identify the covariate driving the change. If more than 10 percent of the covariates values are missing, they will not be included in the models unless they have been identified as a confounder, in which case the missing values will be multiply imputed using a fully conditional specification (FCS). We will use Predictive Mean Matching for continuous variations and Logistic models for dichotomous variables. Models will include all variables measuring asthma control and medical home characteristics as variables that predict missingness of the confounder and have less than 10% missing values.[@b71-egems1032] If less than 10 percent of the values are missing, a simple imputation scheme will be developed, either using the most common value or the value that represents \>50 percent of the units or a random selection (e.g., one imputation from a multiple imputation procedure). We take this strategy because small amounts of missing data are unlikely to affect results but will make sensitivity analysis difficult. Further details on the models are provided in the [appendix](#app1){ref-type="app"}.
Sensitivity Analyses
--------------------
Where claims data are available, we will compare results when asthma exacerbations are defined both with and without the utilization data available from claims data: i.e., hospitalizations and emergency department visits. This would allow us to test whether the association between medical home characteristics and the number of asthma exacerbations varies based on the type of data available for exacerbation detection. For example, patients at a clinic with poor medical home characteristics may seek care for asthma exacerbations at emergency departments rather than at the clinic, and the availability of emergency department utilization data could reverse the direction of the association between medical home characteristics and the number of asthma exacerbations. We will also conduct sensitivity analyses using different exposure periods, such as varying the length of the exposure period (e.g., 24 months versus 18 months prior to the index date) as well as varying the inclusion or exclusion of encounters occurring on or within 30 days of the index date.
Expected Results
================
We anticipate finding variation among practices in the DoCCS total score, with greater variation for some domains over others. We hypothesize that greater practice-level medical-home total and domain scores are associated with better asthma control, in terms of both patient-reported asthma control and rates of asthma exacerbations.
Discussion
==========
This study is one of the first to use existing electronic health data, augmented by patient-reported outcome (PRO) measures, to conduct comparative effectiveness research on health care delivery system characteristics. The most innovative aspect of this research protocol is the development of an approach to performing comparative effectiveness research (CER) on a practice-level, multifaceted, nonbinary health care delivery system variable: concordance with the medical home model. Developing this approach required new approaches to operationalizing the measure of medical home characteristics and to defining what it meant to be exposed to these characteristics in the context of the typical temporal treatment-response relationship for patients with asthma. A second innovative aspect is the setting for the research: real-world safety net practices and populations. Although prior asthma research has been conducted in underserved populations, the focus on a practice-level exposure variable required that we include a large number of practices. The innovative Scalable Architecture for Federated Translational Inquiries Network (SAFTINet) information technology infrastructure is key to involving safety net practices on this scale; without such infrastructure, few practices would have the resources to contribute data that could be utilized for CER.
Methodological and practical challenges addressed during the development and implementation of this protocol include the following: (1) identifying and implementing a measure of medical home characteristics pertinent to the study setting and research design that operationalizes exposure to multifaceted, health care delivery-system characteristics; (2) implementing PRO data collection in diverse health care organizations and clinical settings; (3) data collection and data quality assessment in a large network of geographically and technologically diverse health care organizations; (4) contingency planning for the heterogeneity of available and complete study data from multiple real-world primary and secondary sources; and (5) addressing multiple sources of confounding and bias.
Existing measures of medical home characteristics did not meet the needs of the current study, as they did not adequately define or operationalize the Patient-Centered Medical Home (PCMH) model for use as a CER tool, and most were designed as preparatory assessment to plan for PCMH recognition or assumed that the respondent was already engaged in a formal PCMH implementation initiative. Drawing on local research expertise in the PCMH model, SAFTINet researchers and clinical partners collaborated to adapt several existing instruments to create an instrument---the Delivery of Coordinated Care Survey (DoCCS)---better suited for both the clinical setting and the challenges of comparative effectiveness research modeling. Engaging both research expertise and clinical and organizational stakeholders was key to successful primary data collection for this measure.
SAFTINet researchers and clinical partners collaborated to select and implement a PRO measure for asthma control: the Asthma Control Test (ACT). To mitigate the variation in ACT data collection methods across practices and associated bias, the research team and clinical partners agreed on a set of minimum requirements for ACT data collection, beyond which collection methods were permitted to vary across practices. This engagement of clinical and research stakeholders---beginning early in the process and with regular opportunities for input---was key to partner buy-in for collecting valid PRO measure data. However, despite this close collaboration, there are inconsistencies in the timing and mode of ACT administration, as the participating organizations developed their own implementation plans that they felt would work within their own environments.
There are also limitations related to the secondary use of electronic health data. The SAFTINet research network encompasses many practices that are geographically and technologically diverse, resulting in varied approaches to data collection and use of electronic health records (EHRs); also, claims data are only available for patients during periods of active enrollment in Medicaid. We expect these facts will lead thereby to varied data availability, completeness, homogeneity and quality. To mitigate the issue of heterogeneity of data availability, this study protocol contains permutations for definition of inclusion criteria and outcomes based on type of data available, and planned sensitivity analyses to evaluate the impact of this heterogeneity. Although contingency planning for varied data availability added complexity to the analytic plan, having specified these approaches a priori enhances the methodological rigor of this study. Although beyond the scope of this paper, the SAFTINet research and technical technical teams have specified protocols for data quality assessment to both assess and mitigate variations in quality inherent in real-world data collection across diverse settings.
Finally, there are methodological challenges to be addressed in the conduct of rigorous observational CER. Regarding the multiple potential sources of bias and confounding, we addressed these challenges a priori during the development of the research protocol, by specifying a theoretical causal structure to facilitate identification of sources of bias, drawing on prior literature and experts in both asthma care delivery and the medical home model. As specified, we will adjust for those common cause variables available in the data-set. However, patients attending a safety net primary-care practice are unlikely to have multiple nearby options for obtaining primary health care services. Therefore, selecting a practice based on its medical home characteristics or status is unlikely, and therefore does not represent a major source of selection bias.
Conclusions and Next Steps
==========================
Practices vary in how they deliver care to patients, yet little is known about how these variations in health care delivery impact chronic disease control. A key strength of the SAFTINet infrastructure is that it is designed to measure these variations in delivery system characteristics. In the present study, we measure cross-sectional variation among SAFTINet clinics, but SAFTINet can also measure longitudinal changes related to internal change, such as quality improvement initiatives and research trials, and external change, such as that brought on by the changes in health care funding and policy.
The design of rigorous observational CER on health care delivery system characteristics in a real-world setting requires extensive stakeholder engagement starting early in the planning phase to allow sufficient time for consensus building and buy in. It also requires a team with diverse research and technological experience, able to access and quality-test data from diverse settings and adjust for real-world variation via advanced analytic techniques.
This protocol represents one of several designed by the SAFTINet CER team to explore the effects of health care delivery system characteristics, such as those concordant with the medical home model, on disease control for several primary care cohorts, including children and adults with asthma. The team's initial work is observational in nature; with increased network participation and successful demonstration of preliminary findings, we expect to conduct more rigorous pragmatic trials and randomized controlled trials.
The authors wish to acknowledge the following groups and individuals for their contributions to this work: David R. West, Wilson D. Pace, Mika K. Green, Claire Zelie, Robert Valuck, and Anne Libby of the University of Colorado, and Gurvaneet Randhawa of the Agency for Healthcare Research and Quality. We also wish to thank all of our partners for contributing their time, expertise and resources for their participation in this project. Funding was provided by AHRQ 1R01HS019908 (Scalable Architecture for Federated Translational Inquiries Network; PI: Lisa M. Schilling).
**Disciplines**
Health Information Technology \| Health Services Research \| Primary Care \| Respiratory Tract Diseases
For the patient-level variables, given the i^th^ patient in the j^th^ practice at the t^th^ occasion $$g\left\{ {E\left( Y_{ijt} \right)} \right\} = \beta_{0j} + \beta_{1j}\,\, X_{1ij} + \cdots + \beta_{nj}\,\, X_{nij}$$where X~nij~ are patient-level covariates and Y~ijt~ are patient-level outcomes (ACT scores or asthma exacerbations).
For the practice-level models, in the j^th^ practice $$\beta_{0j} = \gamma_{00} + \gamma_{01}\,\, Z_{1j} + \cdots + \gamma_{0n}\,\, Z_{mj} + \delta_{0j}$$ $$\beta_{1j} = \gamma_{10} + \gamma_{11}\,\, Z_{1j} + \cdots + \gamma_{1n}\,\, Z_{mj} + \delta_{1j}$$where Z~mj~ are DoCCS total and domain scores.
The linear mixed model for ACT may be obtained through *g*{*E*(*Y~ijt~*)} = *E*(*Y~ijt~*), and the logistic mixed model for the presence of exacerbations may be obtained through $g\left\{ {E\left( Y_{ijt} \right)} \right\} = \text{log}\left( \frac{P\left( {Y_{ijt} = 1} \right)}{1 - P\left( {Y_{ijt} = 1} \right)} \right)$. Also note that for the ACT outcome, *t* represents the occasion on which the ACT was measured, which does not necessarily have to match for all individuals; however, for the exacerbation outcome, *t* corresponds to the month recorded for presence of an exacerbation. For the exacerbation outcome measure, we will model whether or not there was an exacerbation at the patient level in a given month.
{#f1-egems1032}
{#f2-egems1032}
######
Variables, Data Sources and Measurement
**Variable(s)** **Measure(s)** **Data source**
------------------------------------------------- ----------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------
Medical Home Characteristics Total score and domain scores Practice Survey
Asthma Control Asthma Control Test (ACT) score Scalable Architecture for Federated Translational Inquiries Network (SAFTINet) database (patient-reported outcome---PRO)
Exacerbation measure during the out-come period SAFTINet database (clinical and claims)
Patient Demographics Age, race/ethnicity, socioeconomic status (income level), urban/rural SAFTINet database (administrative)
Prior exacerbations Number of exacerbations during the exposure period SAFTINet database (clinical and claims)
Asthma severity Medication regimen indicative of intermittent or persistent (mild, moderate or severe) asthma SAFTINet database (clinical)
Comorbidities Presence of comorbid conditions known to exacerbate asthma symptoms (diagnosis codes) SAFTINet database (clinical)
Prior ACT scores ACT scores during exposure period SAFTINet database (patient reported outcome---PRO)
######
Medical Home Domains and Example Goals
---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
**Medical Home Domain** **Example Goal**
----------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------
1\. Personal Clinician and Sustained Partnership Clearly link patients to a clinician and/or care team so both the patient and provider/care team recognize each other as partners in care.
2\. Personal Clinician-Led, Team-Based Care Team-based care led by clinician.
3\. Coordinated and Integrated Care Link patients with community resources to facilitate referrals and respond to social service needs.\
Provide coordinated care with specialists and other providers.
4\. Patient/Family-Centered Care/Support Shared Decision-Making Assess and respect patient and family values and expressed needs.
5\. Quality Improvement and Safety Establish and monitor metrics to evaluate improvement efforts and outcomes and to provide feedback.
6\. Organized Care and Evidence-based Medicine Use point of care reminders and other evidence-based protocols to provide optimal care.
7\. Access Provide scheduling options that are patient- and family-centered and accessible to all patients.
8\. Engaged Leadership Provide visible and sustained leadership, overall culture change, and specific strategies to improve quality and sustain and spread change.
9\. Registries Use patient tracking registries to monitor and inform clinical interventions for persons with specific health care needs.
---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
| null |
minipile
|
NaturalLanguage
|
mit
| null |
South Bend Worm Gear Fishing Rod and Spinning Reel Combo
This is one awesome outfit for the price, you get a spinning rod, reel and it’s already pre-spooled.
The ball bearing drive reel features a sturdy graphite body and comes with its graphite spool pre-spooled to get you on the water quickly. The 65-inch, 2-piece rod features strong and lightweight fiberglass blank construction and is equipped with 4 ceramic guides + tips for a smooth performance, a lightweight yet sturdy graphite reel seat with aluminum hoods, and a comfortable EVA Grip.
Rod Specifications:
Length: 64 inches
Blank: fiberglass
Handle: EVA
Guides: ceramic
Guides plus tips: 4
Reel seat: graphite with aluminum hood
Reel Specifications:
Ball bearing drive
Graphite spool
Graphite body
Pre-spooled
Losing a 10lb Trout is bad luck but you can play fish with a bit of care and adjusting the drag accordingly. It does take quite some time to do this and isn’t that easy but I find the rewards of catching a fish heavier than your line strength is well worth it.
Just make sure you do not leave your landing net at home.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Albert Stewart Meek
Albert Stewart Meek (26 October 1871 – 1 October 1943) was an English bird collector and naturalist.
Biography
Meek was born on 26 October 1871 in Bow, London, the son of a merchant in natural history. In 1893 he travelled to Australia and spent some time at George Barnard’s cattle station at Coomooboolaroo, the only place in Australia where the now-extinct paradise parrot had occurred. It is not known if Meek ever saw this species.
In 1894 he began collecting bird and insect specimens for Lionel Walter Rothschild; first in England, then in Australia. Later, in the Pacific region (in particular the Solomon Islands, New Guinea and Bougainville, he was the first naturalist who observed the birdlife).
Meek also collected reptiles for the Natural History Museum in London, including the holotype and paratype of the venomous Woodlark Island snake (Toxicocalamus longissimus) from Woodlark Island, off the east coast of British New Guinea, and described by George Albert Boulenger in 1896, as the type-species of the genus Toxicocalamus. A third specimen collected by Meek, reported to have come from Fergusson Island in the d'Entrecasteaux Islands also off the east coast of British New Guinea, is also believed to have originated from Woodlark Island. Today this rare snake is still only known from twelve specimens in four museums.
Meek became a dealer in feathers and insects. In 1904 he travelled to Choiseul, where he collected the last specimens of the Choiseul crested pigeon. But, due to the horrible reputation of the islanders as cannibals, he was protected by an armed escort to bring the skins to his vessel. On an expedition in New Guinea in 1906 he discovered and shot the first specimen of the Queen Alexandra's birdwing (Ornithoptera alexandrae), the largest butterfly in the world. While on a visit to New Guinea he estimated that the headdress of a chief needed the feathers of more than 23 killed birds (e.g., birds of paradise), just to create the middle part.
His collection of bird skins and insects is held by the Natural History Museum in London. Specimens from Meek's collections can also be seen in the American Museum of Natural History.
Species named after Meek include eight full bird species: Choiseul crested pigeon (Migrogoura meeki), Meek's lorikeet (Charmosyna meeki), Meek's pygmy parrot (Micropsitta meeki), Bougainville crow (Corvus meeki), white-throated white-eye (Zosterops meeki), yellowish-streaked honeyeater (Ptiloprora meekiana), North Solomons dwarf kingfisher (Ceyx meeki) and the Manus hawk owl (Ninox meeki). Also several butterfly and moth species were named after Meek, including Graphium meeki, Gnathothlibus meeki, Delias meeki, Angonyx meeki, Macroglossum meeki, Oxycanus meeki, Bindahara meeki, Acupicta meeki, and Udara meeki. In 1896, Oldfield Thomas described Emballonura beccarii meeki, a subspecies of the Beccari's sheath-tailed bat of which Meek had collected the type series on Kiriwina, Trobriand Islands. Despite the considerable collections of reptiles made by Meek, including the holotype and paratype of the rare elapid snake Toxicocalamus longissimus, only one reptile was named in his honour, a treesnake Dendrophis meeki, by G.A.Boulenger in 1895, this species now being a synonym of Dendrelaphis gastrostictus.
Meek died on 1 October 1943 at his home in Bondi, Sydney. He had two sons and two daughters: Wilfred, Victor, Gladys and Marie.
Literature by and about Meek
Rothschild, M. 1983. Dear Lord Rothschild: Birds, butterflies and history. Balaban, Philadelphia. xx + 398 pp. Mentions Walter Rothschild's collectors in New Guinea, including William Doherty, Albert S. Meek, Ernst Mayr, etc.
Rothschild, W., and E. Hartert. 1913. List of the collections of birds made by Albert S. Meek in the lower ranges of the Snow Mountains, on the Eilanden River, and on Mount Goliath during the years 1910 and 1911.Novitates Zoologicae 20:473–527. Notes on Lepidoptera collected by Albert S. Meek in Irian Jaya during 1910 and 1911, including descriptions of localities
Barbara and Richard Mearns, The Bird Collectors, Academic Press, 1998,
Albert S. Meek, A Naturalist in Cannibal Land, 1913, Fischer Unwin, London
References
External links
Category:1871 births
Category:1943 deaths
Category:English naturalists
Category:English entomologists
| null |
minipile
|
NaturalLanguage
|
mit
| null |
News & Media
Fireweed Announces Positive Metallurgical Test Results
May 15, 2018
Vancouver, British Columbia: FIREWEED ZINC LTD. (“Fireweed” or the “Company”) (TSXV: FWZ) is pleased to announce positive results from metallurgical tests conducted as part of the Preliminary Economic Assessment (“PEA”) work underway for the Macmillan Pass Zinc Project, Yukon. Base Metallurgical Laboratories of Kamloops, BC, performed the test work under supervision by Fireweed’s PEA contractor, JDS Energy and Mining, Inc. (“JDS”).
Highlights
Excellent metallurgical results based on the most extensive and representative work to date.
For the first phase of testing, the eight core were combined into five composite samples: two from the Tom West zone, one from Tom East and two from Jason Main. This phase included mineralogy, comminution and flotation tests.
A second set of three composites was then prepared from the five phase one composites. These three composites represent both the major deposits, Tom (combined West and East), Jason Main, and a “global” sample made up of a 65% Tom and 35% Jason blend, representative of the total projected project production across both deposits. This second set of composite samples underwent locked cycle testing to determine recovery and concentrate grades close to what would be expected in an operating plant. Analyses for other elements in the concentrates, and tailing filtration tests, were also completed.
Mineralogy
Tests revealed acceptable liberation of sphalerite and galena at a primary grind of P80 50 µm (80% passing through a 50 micron mesh).
Comminution
Comminution test work determined the grinding energy required to liberate lead and zinc minerals prior to flotation, and abrasion testing to determine mill and grinding media wear characteristics:
LCT simulates a continuous, stable, processing plant flotation circuit. The LCT employed a conventional flotation flowsheet at a target primary grind size of P80 50 µm. Regrinding was included in both the lead and zinc circuits, with grind sizes of 15 µm and 25 µm respectively. The LCT45 results for the global blend sample had an average lead concentrate grade of 61% Pb at 75% Pb recovery, and an average zinc concentrate grade of 58% Zn at 89% Zn recovery.
Other Elements
The iron levels are low, at about 1.5%, a feature desired by zinc smelters. Deleterious element levels were generally low, except for mercury at 155 ppm and silica at 4% in the global zinc concentrate. Either or both may incur modest smelter penalties. See Appendix for values of other elements in concentrates.
Conclusions
The Tom and Jason deposits reacted well to conventional flotation concentration processing. The global material, simulating blending of feed from Tom and Jason zones, also reacted well, revealing no material issues with blending Tom and Jason mineralization. This ability to blend material will allow flexibility in planning mining and processing scenarios. Concentrate recoveries and grades were all excellent. Details of these metallurgical tests will be presented in the pending PEA report.
Future Metallurgical Plans
Additional metallurgical work is planned for 2018 to build and improve on these results. Objectives of future work will include:
Build up of a full geometallurgical block model to better predict recoveries, concentrate grades and general optimization and coordination of mining and processing operations.
Better understand variability in lead and silver metallurgical performance. Additional test work will be performed to optimize and improve lead performance.
Further optimize the concentrates to improve their specifications.
Technical information directly related to the metallurgical work in this news release has been reviewed and approved by Kelly McLeod, P.Eng., Senior Process Engineer for JDS Energy & Mining Inc. and a ‘Qualified Person’ as defined under Canadian National Instrument 43?101. Other technical information (not directly related to the metallurgical work) has been reviewed and approved by Brandon Macdonald, P.Geo, a ‘Qualified Person’ as defined under Canadian National Instrument 43?101.
Definitive Option Agreements Signed
Further to the Company’s news release dated March 27, 2018 announcing the signing of letter option agreements with Constantine Metal Resources Ltd./Carlin Gold Corporation and Golden Ridge Resources Ltd. for large neighbouring claimblocks, Fireweed is pleased to announce that definitive option agreements have been signed and TSX Venture Exchange approval received for both options.
About Fireweed Zinc Ltd.: Fireweed Zinc is a public mineral exploration company focused on zinc and managed by a veteran team of mining industry professionals. The Company is advancing its large 470 km2 Macmillan Pass Project in Yukon, Canada, which is host to the 100% owned Tom and Jason zinc-lead-silver deposits with recently announced new Mineral Resources (see Fireweed news release dated January 10, 2018 for details) and a pending PEA economic study. The project also includes option agreements on large blocks of adjacent claims (MAC, MC, MP, Jerry, BR and NS) which cover projected extensions of mineralization from the Jason area and areas where previous exploration identified zinc, lead and silver geochemical anomalies in critical host geology.
Additional information about Fireweed Zinc and its Macmillan Pass Project, can be found on the Company’s website at www.FireweedZinc.com and on SEDAR at www.sedar.com .
ON BEHALF OF FIREWEED ZINC LTD.
“Brandon Macdonald”
CEO & Director
Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release.
Forward-Looking Statements
This news release contains “forward-looking” statements and information relating to the Company and the Macmillan Pass Project that are based on the beliefs of Company management, as well as assumptions made by and information currently available to Company management. Such statements reflect the current risks, uncertainties and assumptions related to certain factors including but not limited to, without limitations, exploration and development risks, expenditure and financing requirements, general economic conditions, changes in financial markets, the ability to properly and efficiently staff the Company’s operations, the sufficiency of working capital and funding for continued operations, title matters, First Nations relations, operating hazards, political and economic factors, competitive factors, metal prices, relationships with vendors and strategic partners, governmental regulations and oversight, permitting, seasonality and weather, technological change, industry practices, and one-time events. Additional risks are set out in the Company’s prospectus dated May 9, 2017 and filed under the Company’s profile on SEDAR at www.sedar.com. Should any one or more risks or uncertainties materialize or change, or should any underlying assumptions prove incorrect, actual results and forward-looking statements may vary materially from those described herein. The Company does not undertake to update forward?looking statements or forward?looking information, except as required by law.
| null |
minipile
|
NaturalLanguage
|
mit
| null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.