text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the present invention is directed to an explosive composition comprised of heavy anfo and a plant - derived , inert bulking and sensitizing additive . heavy anfo is comprised of an emulsion explosive in combination with anfo and / or ammonium nitrate . the emulsion explosive is comprised of : ( a ) a disperse phase with an aqueous solution of one or more oxidizer salts ; and ( b ) a continuous phase with an oil and an emulsifying additive . suitable oxidizer salts include ammonium nitrate , sodium nitrate , and calcium nitrate . other oxidizers known to those skilled art or set forth in the literature relating to explosives are also feasible , including but not limited to urea , iron oxide , lead dioxide , ammonium perchlorate , barium nitrate , barium peroxide , lead tetroxide , potassium chlorate , potassium chlorate , potassium perchlorate , sodium perchlorate , etc . generally , the oxidizer or oxidizers are concentrated in the aqueous solution and can be saturated in the aqueous solution . the oil is typically fuel oil or diesel oil or a combination thereof . however , other oils known to those skilled in the art or set forth in the literature relating to explosives are feasible , including but not limited to waste oil , bunker oil , and mineral oil . potential substitutes for oil are coal dust and rubber . any one of a number of emulsifying additives known to those skilled in the art and set forth in the literature relating to explosives are feasible . many suitable emulsifiers are characterized as esters or other derivatives of monhydric or polyhydric alcohols that are combined with long chain components or other lyophilic materials . a typical explosive emulsion used in heavy anfo is comprised of from about 40 % to about 80 % by weight ammonium nitrate ; from about 0 % to about 40 % by weight calcium nitrate ; from about 0 % to about 15 % sodium nitrate ; from about 10 % to about 25 % by weight water ; and from about 5 % to about 12 % by weight fuel oil . anfo is comprised of ammonium nitrate and fuel oil . typically , the ammonium nitrate is in the form of porous ammonium nitrate prills . however , other forms of ammonium nitrate can be utilized to produce anfo , including but not limited to agricultural grade ammonium nitrate prills , crystalline ammonium nitrate , and ground ammonium nitrate . however , these other forms of ammonium nitrate typically result in a lower quality anfo relative to anfo made with porous ammonium nitrate prills . if desired , some of the ammonium nitrate can be replace with one or more other oxidizers , such as those noted with respect to the emulsion explosive . fuel oil as used herein refers to any liquid petroleum product that is burned in a furnace for the generation of heat or used in an engine for the generation of power . in addition , the term fuel oil comprises : ( a ) suitable substitutes for such liquid petroleum products , such as mineral oils , and ( b ) combinations of such liquid petroleum products and suitable substitutes . the plant derived , inert bulking and sensitizing additive comprises hulls of a grain with a characteristic of the hulls being that they each have a plurality of voids , commonly referred to as micro - voids due to their small size . the micro - voids serve to create what are known as “ hot spots ” or void volumes that , all other factors remaining constant , increase the sensitivity of the explosive composition . the hulls also , all other factors remaining constant , decrease the density of the explosive composition . consequently , the hulls serve both to decrease density and increase sensitivity . in one embodiment , the additive comprises the hulls but is substantially devoid of any portion of the grain other than the hulls . in another embodiment , the explosive composition comprises the hulls but is substantially devoid of any portion of the grain other than the hulls , i . e ., no portion of the grain other than the hull serves another purpose within the explosive composition . in yet a further variation , the additive comprises the hulls from the grain and another component that serves to reduce the density and / or increase the sensitivity of the explosive that is approximately the same size as a hull . one type of hull that has a plurality of micro - voids and is capable of acting as an inert bulking agent to reduce the density of the explosive composition is a rice hull . the micro - void characteristic of rice hulls is discussed in chapter 19 of rice : chemistry and technology , written by bienvenido o . juliano , which is incorporated herein by reference . rice hulls also have a waxy coating that complements the water resistant characteristic of the heavy anfo . however , any other type of hull that exhibits micro - voids and is capable of acting as an inert bulking agent is also feasible . the ranges of the raw materials for an explosive composition comprised of heavy anfo and a plant - derived , inert bulking and sensitizing additive is set forth in table i . table i min . % max % raw materials by weight ammonium nitrate 50 99 calcium nitrate 1 20 * sodium nitrate 1 20 * fuel phase 1 10 water 1 . 5 12 inert bulking agent 1 25 ** it should be noted that the composition set forth in table ii assumes that an emulsion explosive is being utilized that comprises at least calcium nitrate and sodium nitrate . as previously noted emulsion explosives with other compositions are feasible . the ranges of the raw materials for an embodiment of an explosive composition comprised of heavy anfo and a plant - derived , inert bulking and sensitizing additive that has characteristics that approach those of anfo are set forth in table ii . table ii range ± 1 % raw materials by weight ammonium nitrate 75 calcium nitrate 12 * sodium nitrate 12 * fuel phase 6 . 6 water 6 . 6 inert bulking agent 15 ** the ranges of the raw materials for an embodiment of an explosive composition comprised of heavy anfo and a plant - derived , inert bulking and sensitizing additive that has characteristics that more closely approach those of anfo is set forth in table iii . table iii more preferred constituents range ± 1 % raw materials by weight ammonium nitrate 75 . 23 calcium nitrate 11 . 61 * sodium nitrate 11 . 61 * fuel phase 6 . 49 water 6 . 58 inert bulking agent 13 . 5 ** having described the explosive composition , a method for manufacturing the composition is now described . generally , the explosive composition of a heavy anfo and a plant derived , inert bulking and sensitizing additive is formed in a blender . it is desirable to produce the explosive composition such that little mechanical stress is imparted to the constituents of the composition during the manufacturing process , but a high degree of homogeneity is achieved because this reduces the variability in the performance characteristics of the explosive composition . a mixer that has been found to be capable of producing the explosive composition with a high degree of homogeneity and to do so while causing little mechanical stress on the constituents of the composition is an end - to - end level blender . an example of such a blender is set forth in u . s . pat . no . 4 , 506 , 990 , which is incorporated herein by reference . blenders that operate on similar principles to the blender set forth in the &# 39 ; 990 patent are also feasible , as well as any blenders that are capable of achieving a high degree of homogeneity in the composition while subjecting the constituents of the composition to little stress during the manufacturing process . it should be appreciated that the explosive composition can be made and function as an explosive without having a high degree of homogeneity or having been subjected to little mechanical stress during the manufacturing process . however , if there is not a high degree of homogeneity and / or the composition is subject to significant mechanical stress during the manufacturing process the performance characteristics of the resulting composition are subject to a greater degree of variability . the blender is implemented on a mobile platform to allow the explosive composition to be blended on the blast site and then transported between the various blast holes at the site . the blender is also equipped with directable chute , sleeve or auger that allows the explosive composition to be dispersed into the blast holes . it should be appreciated that the blender can be implemented on a stationary platform and then transferred to a mobile vehicle for transport to the blast holes . however , the transfer operation subjects the explosive to unnecessary mechanical stress that may adversely affect the performance of the composition . regardless of the type of blender that is utilized , the explosive composition is formed by blending heavy anfo and the plant derived , inert bulking and sensitizing additive comprised of hulls of grain with each of the hulls having a plurality of voids . more specifically , the inert bulking and sensitizing additive is added to heavy anfo that is present in the blender and blended with the heavy anfo . the blending is terminated when it appears that the hulls are substantially evenly distributed between the heavy anfo particles . the heavy anfo in the blender can be produced at a different location and then loaded into the blender . however , in many cases , it is desirable to produce the heavy anfo in the same blender that is used to blend the heavy anfo with the bulking and sensitizing additive . in this case , the production of the explosive composition commences with the loading of an emulsion explosive into the blender . the emulsion explosive has a bulk density from about 1 . 26 gm / cc to about 1 . 50 gm / cc , an oxygen balance from about 7 . 5 to about 1 . 0 . the emulsion explosive also has from about 10 % to about 25 % by weight water . the blender is typically not operative during the loading of the emulsion explosive . after the emulsion explosive has been loaded into the blender , anfo and / or ammonium nitrate is loaded into the blender . typically , the blender is not operative during the loading of the anfo and / or ammonium nitrate . at least in the case of an end - to - end level blender , the anfo and / or ammonium nitrate is loaded such that it is on top of the previously loaded emulsion explosive . this reduces the mechanical stress placed on the anfo and / or ammonium nitrate when the blender is activated because the rotors of the blender have been lubricated by the emulsion explosive . after the anfo and / or ammonium nitrate has been loaded into the blender , the blender is activated to blend the emulsion explosive with the anfo and / or ammonium nitrate and thereby manufacture heavy anfo . in the case of an end - to - end level blender , the blending takes approximately two minutes . the heavy anfo has a bulk density from about 1 . 0 gm / cc to about 1 . 45 gm / cc . heavy anfo with a bulk density in this range , and especially with respect to the upper end of the range , is generally consider to be too dense to reliably detonate in certain applications . after the heavy anfo has been produced , the inert bulking and sensitizing agent comprised of hulls that have voids is added to the heavy anfo in the blender and blended as described above . the blending of the additive with the heavy reduces the bulk density of the explosive composition . depending upon the amount of additive utilized , the resulting explosive composition has a bulk density from about 0 . 35 gm / cc to about 1 . 33 gm / cc . when an end - to - end level blender is used , blending of the heavy anfo followed by the blending of the heavy anfo with the inert bulking and sensitizing additive typically requires 4 to 12 minutes to complete . the explosive composition is used in mining operations by loading the composition one or more blast holes together with an appropriate detonating device . typically , the detonating device is loaded into a blast hole prior to the loading of the explosive composition into the blast hole . a blast engineer determines the amount of explosive that is to be loaded into each hole and a weighing system on the vehicle that transports the composition to the blast hole or holes is used to load the appropriate amount of the explosive composition in each hole . as previously , the explosive composition can be manufactured on the blast site . further , the explosive composition can be manufactured on site and on a mobile vehicle that can then be used to transport the composition to the blast hole or holes . | 2 |
according to the present invention , in the preferred embodiment , a liquid crystal display device is assembled using the following procedure : 1 . the substrates are a flexible polymer material with a low level of birefringence to improve the optical qualities of the final product and having a glass transition temperature greater than 150 degrees c . in order to facilitate the various drying and baking operations . a polymer that meets these requirements is poly ether sulphone ( pes ). a vapor barrier is coated onto the outside surface of the substrate to improve the reliability and product life of the display ; the vapor barrier is typically composed of a thin film laminate structure of silicon oxide and another polymer . 2 . the substrates are coated with a vacuum - deposited layer of typically indium tin oxide ( ito ), which is a transparent conductor . the ito is then patterned via chemical , electron beam , or laser etching . 3 . the prepolymer may be a commercially available photocured polymer such as norland product &# 39 ; s noa - 65 or it may be a custom formulation such as the following : % material 50 sartomer co . sr 9644 15 sartomer co . sr 306 18 . 5 sartomer co . sr256 1 . 25 stabilizer 3 aceto quantacure itx 5 . 5 tri ethanol amine ( tea ) 1 . 05 3m corp . fc - 430 1 . 6 dow coming dc - 57 1 . 6 wetting agent 2 . 5 fratelli lamberti escacure kip 4 . the prepolymer mixture is diluted in a solvent such as methanol at a ratio sufficient to achieve a viscosity of approximately 50 cps . 5 . a polyimide solution is coated onto the ito side of at least one of the substrates and baked at a temperature of 150 degrees c . for one hour . the polyimide surface ( s ) are then rubbed to develop an alignment layer for the liquid crystal . 6 . a liquid crystal such as merck e7 is coated in a thin layer onto the polyimide surface . the exact quantity of liquid crystal is not critical since the thickness of the cell is determined by the spacer elements . 5 . glass spacers of a diameter of 3 - 3 . 5 μm are surface - etched using a 1 . 25 % solution of hydrofluoric acid for 10 minutes while suspended in solution in an ultrasonic vibration tank . after washing , the etched spacers are then coated with a mixture of methacrylate silane and a photoinitiator by immersing the spacers into a solution containing the initiator and an adhesion promoter such as a silane and then spraying the spacers into the top of a vertical drying column onto the substrate ( s ). silanes improve the bonding between glass and polymers via chemical bonding at the silane / glass interface and a dispersion of the polymer into the silane at the silane / polymer interface . 6 . spacers are mixed into the prepolymer solution in a concentration of approximately 1 : 1 wt / wt . the spacers are then dispersed into the prepolymer solution using ultrasonic mixing . 7 . using an aerosol spray system , the prepolymer / spacer mixture is then sprayed onto the uncoated substrate for a sufficient time to achieve a surface density of at least about 30 spacers / mm2 when the display has been assembled . the spacers tend to be distributed generally randomly across the substrate surface . micro - filtered compressed nitrogen at approximately 10 - 30 psi is used as the propellant . the pressure , viscosity of the mixture , relative concentrations of spacers and prepolymer , as well as nozzle orifice shape are adjusted to achieve the prepolymer coating single spacers with some number of droplets containing prepolymer only . that substrate is then exposed to 120 degrees centigrade for 15 minutes to remove the solvents from the mixture . 8 . the substrate with the prepolymer / spacer mix will typically undergo a pre - cure step to provide a tack to the polymer prior to the lamination step . if the prepolymer is curable by both heat and light , then the solvent bake step can be used as the pre - cure step as well . 9 . the substrates are then laminated together while maintaining the proper alignment between the ito patterns on the upper and lower substrates . 8 . both sides of the cell are then exposed to uv light that causes scission of the photoinitiator and release of free radicals around the spacers . the polymerization reaction will then proceed with the initiation sites centered around each spacer that was deposited with the initiator . fig1 depicts a cross - sectional view of the display after step 8 . the resulting display is quite flexible . it can be flexed without permanent damage by at least the amount of flexing specified in the flexing tests described in u . s . pat . no . 6 , 019 , 284 , hereby incorporated by reference . it is not necessary that polymer form in the vicinity of each spacer , nor that the polymer extend fully from one substrate to another in all cases . some spacers , for example , may not have been coated with prepolymeric material , or they may have been imperfectly coated . polymer supports that do not extend fully from one substrate to the other may still be of benefit in creating isolated regions of liquid crystal , and thereby make possible improved bistability of certain ferroelectric liquid crystal materials , which may exhibit improved bistability if the liquid crystal layer is divided into discrete droplets along one substrate . in another embodiment , pses smaller than the predominant spacer element size that determines the substrate spacing can be added to the prepolymer / spacer mix . these pses are composed of a polymer formulated to typically achieve a transparency and an index of refraction that is the same as the polymer and liquid crystal to reduce dispersion . these polymer spacing elements can be produced by a number of methods and may even be formed at the time of their deposition onto the substrate via aerosol dispersion followed by heat and ultraviolet cure of the polymer microspheres generated . once the pses are deposited onto the substrate , the prepolymer / spacer mix is deposited as before . alternatively , the pses may be mixed with the prepolymer / spacer mix prior to its deposition onto the substrate . this embodiment allows for additional points of polymer contact between the substrates without any additional rigid spacer elements that can reduce the contrast of the display . this can be seen in fig2 . in a separate process step , additional pses may be deposited . in this case , the aerosol conditions are adjusted so that the droplet size results in the tops of pses being slightly higher than the desired spacing between the substrates . additionally , the pses are deposited onto the surface in a semi - cured state . upon lamination , the prepolymer covered spacers are pushed through the liquid crystal layer and pressed against the opposing substrate as in the previously described embodiments ; the semi - cured pses are also pushed through the liquid crystal layer and compressed by the opposing substrate . the pses may be composed of a polymer that , while having similar optical properties as the polymer coating the spacers , may have different mechanical properties , for instance , the pse material may be formulated to shrink upon curing as well as having a value for its elongation before break parameter . in this way , the plastic substrates can actually be drawn together by a controlled amount subsequent to a full cure of the laminated cell . this will significantly enhance the flexure performance of the display as well as its overall durability . in another embodiment , the spacers either individually or in small groups are encased in a collapsible shell that also contains a quantity of prepolymer . this can be achieved by a variety of well - known techniques classified generally as microencapsulation . microencapsulation processes fall into several general categories , all of which can be applied to the present invention : interfacial polymerization , in situ polymerization , physical processes such as coextrusion , and coacervation . when the substrates are laminated together with the liquid crystal material and the polymer - coated spacer elements taking the form of the just - described encapsulated elements , the microcapsules are crushed during the lamination process releasing the prepolymer . as in other embodiments the spacers are pressed against both substrates during lamination , while the released prepolymer remains surrounding the spacer elements and is being brought into contact with the two substrates . the display is then exposed to ultraviolet light as before and the prepolymer is polymerized , resulting in the cured polymer bonding the spacer to both substrates . while other microencapsulation techniques can be used to create microcapsules with the appropriate characteristics for this invention , two encapsulation techniques that are particularly well suited to the present invention are in - situ polymerization and interfacial polymerization . the technique of in situ polymerization utilizes an oil / water emulsion , which is formed by dispersing the spacer / prepolymer mix in an aqueous environment . prior to emulsifying the prepolymer in the aqueous phase , the spacers are mixed and fully dispersed into the prepolymer in a ratio of 1 : 2 wt / wt . the resulting prepolymer droplets due to emulsification will be 15 - 30 microns in diameter with less than 5 spacers contained within the droplet . a goal of the process is to create capsules with only one spacer per capsule . tighter control of process parameters can achieve less deviation on droplet size which will minimize capsules with more than one spacer . by using a spacer composed of a material of different density than the prepolymer , e . g . glass , the number of capsules not containing one spacer can be minimized by sorting the finished capsules via such density - sorting methods as flotation or centrifuge . the monomers are introduced into the aqueous phase , polymerize , and form a polymer with higher affinity for the internal phase than for the aqueous phase , thus condensing around the emulsified oily droplets . in one especially useful in situ polymerization processes , urea and formaldehyde condense in the presence of poly ( acrylic acid ) ( see , e . g ., u . s . pat . no . 4 , 001 , 140 ). the resulting capsule wall is a urea / formaldehyde copolymer , which encloses the spacer / prepolymer droplet . the capsule is clear and rigid . transparency is important since the capsule shell will remain in the display after lamination ; rigidity is an important feature of the capsule shell since an overly compliant shell material will result in the shell not crushing and properly releasing the prepolymer during lamination . melamine - based shell materials also have the required qualities transparency and rigidity . the electro - optic material used in the display can be any type of liquid crystal ; for instance , the invention provides benefits to nematic , twisted nematic , super - twisted nematic , ferrolectric , anti - ferroelectric , cholesteric liquid crystal displays , to name a few . the invention also provides benefits to non - lcd displays . for instance , the durability of electrophoretic and gyricon displays can be significantly enhanced by this method . in another preferred embodiment , a liquid crystal display device is assembled using the following procedure : 1 . the substrates are a flexible polymer material with a low level of birefringence to improve the optical qualities of the final product and having a glass transition temperature greater than 150 degrees c . in order to facilitate the various drying and baking operations . a polymer that meets these requirements is poly ether sulphone ( pes ). a vapor barrier is coated onto the outside surface of the substrate to improve the reliability and product life of the display ; the vapor barrier is typically composed of a thin film laminate structure of silicon oxide and another polymer . 2 . the substrates are coated with a vacuum - deposited layer of typically indium tin oxide ( ito ), which is a transparent conductor . the ito is then patterned via chemical , electron beam , or laser etching . 3 . the prepolymer may be a commercially available photocured polymer such as norland product &# 39 ; s noa - 65 or it may be a custom formulation such as the following : % material 50 sartomer co . sr 9644 15 sartomer co . sr 306 18 . 5 sartomer co . sr256 1 . 25 stabilizer 3 aceto quantacure itx 5 . 5 tri ethanol amine ( tea ) 1 . 05 3m corp . fc - 430 1 . 6 dow coming dc - 57 1 . 6 wetting agent 2 . 5 fratelli lamberti escacure kip 4 . the prepolymer mixture is diluted in a solvent such as methanol at a ratio of 1 : 25 parts by weight . 5 . a polyimide solution is coated onto the ito side of at least one of the substrates and baked at a temperature of 150 degrees c . for one hour . the polyimide surface ( s ) are then rubbed to develop an alignment layer for the liquid crystal . 6 . glass spacers of a diameter of 3 - 3 . 5 μm are used . the spacers are mixed into a liquid crystal such as merck e7 in large numbers ( with a density sufficient to produce a surface density of at least about 30 spacers / mm2 when the display has been assembled ). the spacers tend to be distributed generally randomly across the substrate surface . 7 . the liquid crystal / spacer mix is coated in a thin layer onto the polyimide surface . the exact quantity of liquid crystal is not critical since the thickness of the cell is determined by the spacer elements . 8 . the pses are deposited onto the uncoated substrate via aerosol dispersion . the viscosity of the prepolymer formulation is adjusted and the prepolymer is diluted , as necessary , in a solvent in addition to adjusting the aerosol parameters to achieve particle sizes of the pses that are approximately 30 % larger than the spacer diameter . that substrate is then exposed to 120 degrees centigrade for 15 minutes to remove the solvents from the mixture . 9 . the substrate with the pses will typically undergo a pre - cure step to provide a tack to the polymer prior to the lamination step . if the prepolymer is curable by both heat and light , then the solvent bake step can be used as the pre - cure step as well . 10 . the substrates are then laminated together while maintaining the proper alignment between the ito patterns on the upper and lower substrates . fig4 depicts the substrates just prior to lamination . 11 . both sides of the cell are then exposed to uv light that causes scission of the photoinitiator and release of free radicals around the spacers . the polymerization reaction will then proceed with the initiation sites centered around each pse . two or more photoinitiators with different spectral sensitivities may be used to control when polymerization is initiated at a particular site . since scission of the photoinitiator occurs when the photon energy of the light source exceeds a certain threshold , photoinitiators will typically be sensitive to light of wavelengths less than a specific value ; thus , a photoinitiator sensitive to visible light will usually also be sensitive to ultraviolet light . one embodiment using this feature would be to coat the spacer elements with a uv sensitive photoinitiator and to have the prepolymer of the pses contain a visible light sensitive photoinitiator . the assembly is first exposed to visible light , resulting in the curing of only the pses , which , due to the shrinkage of the pse polymer , draw the two substrates together . the assembly is then exposed to uv light , causing the polymer surrounding the spacers to be cured . in another embodiment , other polymerization enhancing compounds such as adhesion promoters , or additives such as urethanes which improve elongation before tear properties are added to all , or some subset , of the pses . in such a way , peel strength can be further enhanced . one possible polymer are acrylic adhesives which have excellent optical clarity as well as the availability of a wide selection of manufactured optical grade versions of the material . other polymers that might also be used are , for instance , epoxies or urethanes , though typically these classes of polymers do not have the optical properties equal to those of the acrylics . acrylic adhesives are reactive cross - linking structural adhesives that cure by means of free - radical initiation . they are based on the methacrylate monomers and cure by addition polymerization . the formation of free radicals initiates a sudden and rapid chain reaction and curing of the adhesive . condensation polymerization , on the other hand , typified by urethane and epoxies , proceeds at an approximately constant , usually lower reaction rate . generation of free radicals for initiation of polymerization of acrylic based adhesives can be accomplished by a redox reaction such as that involving dimethyl aniline and peroxide . because of the nature of the chain reaction , the free radicals can propagate from monomer to monomer and the cure itself can propagate up to 2 . 5 mm from the point of polymerization initiation . as a result of this cure propagation phenomenon , the accelerator and monomer do not have to be fully intermixed to achieve a full cure . this leads to several other methods for curing , where the accelerator can be in the form of a lacquer or thin layer on one surface allowing for the priming and storing of parts . in another related cure method termed ‘ honeymoon ’ or ‘ no - mix ’ in industry parlance , a two part adhesive is used which when brought into contact with each other ( without any intermixing necessary ) will result in the generation of sufficient free radicals to fully polymerize all the material . acrylics can also be cured by exposure to ultraviolet light less than 400 nm in wavelength , and in some instances by light in the visible range as well . in the case of photocurable adhesives , the free radical source is termed a photoinitiator and results in the formation of free radicals on exposure to light . compounds which act as photoinitiators with light in the range of 200 - 300 nm are benzoine ethers , activated benzophenones and related compounds ; benzyl dialkyl amino morpholinyl ketone is an example of a visible wavelength - activated photoinitiator . photoinitiators are disassociated into segments forming free radicals by light in a process known as scission . one example of an equal mix curing system is embodied in u . s . pat . no . 4 , 331 , 795 which uses a cobalt salt accelerator in one component and a hydroperoxide in the other element . epoxies may also be formulated that can be uv - cured via cationic polymerization by incorporating reactive diluents and cyclic monomers . uv - initiated cationic curing of urethanes may be accomplished , for instance , by basing the formation on vinyl ether and polyurethane oligomers such as that manufactured by allied signal inc . a great variety of embodiments of the invention may be practiced . the rate of photopolymerization may be controlled by adjusting the intensity of the light source . the spacer elements may be porous structures , and the prepolymer is then allowed to absorb into the porous matrix in order to provide better interpenetration of the polymer and spacing , thus providing better adhesion . the spacer elements may be composed of glass , typically in the form of beads or rods , which are then etched to increase the surface area for improved adhesion . one or more layers of a an adhesion promoter such as a silane coupling agent may be coated onto the glass spacers which may or may not have been etched , prior to the coating of the glass spacers with the prepolymer . the spacer elements may be admixed to the prepolymer in concentrations higher than what would be desired in regions of the display that are active image areas ; the mixture is then deposited onto the substrate via printing or pipette methods into the interpixel regions or the perimeter where no image is presented , thus provided additional support without adversely affecting the image contrast or quality . the initiator may be solely heat activated or heat activated as well as photo - activated or other activation method . the polymer is chosen so as to contract following initial bonding to the substrates and upon curing ; the two substrates are thus drawn together , increasing durability of the display ; this is particularly effective when the polymer is localized around the spacer element , as has been previously described . the spacer element may be one or more sheets of an extensible porous membrane that when laminated in between the substrates is the element that determines the spacing between the substrates . one or more of the substrates may be of glass or other rigid material . | 6 |
the electrochemical properties of a tubular cell illustrated in fig1 , having developed specific surface area / roughness on both its faces s and s ′, were analysed . the architecture of the tubular cell is described in fig1 a . the unit consisted of : a ( 8 mol %) ysz dense solid electrolyte having , on either side , tie surfaces ( tl ) and ( tl ′), of specific surface area ( s ω , s ′ ω )/ roughness ( r , r ′) of the same type ( identical coating thicknesses : t ′= t ″); a cathode ( pe ) based on strontium - doped lanthanum manganite ( lsm ), in this case lsm ( la 0 . 9 sr 0 . 1 mno 3 − ); a cathode current collector ( cc ) based on ag - lsm ( 50 / 50 by volume ) cermet coated with a “ protective ” layer ( cl ) obtained from the family of lanthanum ferrocobaltites , in this case lscofe ( la 0 . 8 sr 0 . 2 co 0 . 8 fe 0 . 2 o w ); an anode ( pe ′) based on strontium - doped lanthanum manganite ( lsm ), in this case lsm ( la 0 . 9 sr 0 . 1 mno 3 − ); an anode current collector ( cc ′) ( oxygen : high oxygen pressure & gt ; 50 bar ) is a cermet based on gold - lscofe , with no “ protective ” layer ( cl ′). after each layer , “ tie ” layers ( tl ) and ( tl ′), electrodes ( pe ) and ( pe ′), current collectors ( cc ) and ( cc ′), protective layer ( cl ) had been deposited , the tube was sintered in air at temperatures between 800 and 1200 ° c . for a few hours , with temperature holds of between 0 . 25 hours and 6 hours . the system was not symmetrical in terms of deposition . layer ( dl ) [( 8 mol % ysz )]: 0 . 5 to 1 . 5 mm tie layer ( tl ) and ( tl ′) [ ysz ( 8 mol %)] solid electrolyte : 10 - 100 μm electrodes ( pe ) and ( pe ′) ( lsm layers ): 60 - 70 μm ; cathode current collector ( cc ) ( ag - lsm ): 100 - 120 μm anode current collector ( cc ′) ( au - lscofe ): 50 - 100 μm protective layer ( cl ) ( lscofe ): 50 - 90 μm fig1 b to 1d show sem micrographs of the microstructures of various gold - based anode current collectors of the cell described above in terms of the sizes and shapes of particles and surface states . in the micrograph of fig1 b , the anode current collector consists of a gold lacquer . in the micrograph of fig1 c , the anode current collector consists of a porous gold lacquer coming from a gold / pore - former ( 50 / 50 by volume ) mixture . in the micrograph of fig1 d , the anode current collector consists of a gold lacquer / perovskite ( lscofe ) ( 50 / 50 by volume ) mixture . it may be seen that in the case of a collector made of gold lacquer , the presence of a very low amount of porosity is observed . the addition of 50 vol % of pore - forming agents ( corn starch : pore size of around 10 to 15 μm ) induces the formation of porosity and the direct observation of the subjacent layer ( lsm electrode ). in operation , this opening of the pores must allow the oxygen on the anode side to be removed . the size of the gold particles (& gt ; 5 μm ) should be noted . in the case of the gold / perovskite ( lscofe ) cermet , a stacking porosity is observed within the perovskite ( lscofe ), a material having a particle size of less than one micron , allowing not only good ionic / electronic hybrid conductivity ( predominantly electronic ) but also removal of the oxygen . influence of the structure / microstructure of the anode current collector of ysz ( 8 mol %) ceramic cells / operating parameters — temperature : 750 - 780 ° c . ; pressure ( external oxygen pressure ): 1 × 10 5 pa ( 1 bar ); current : 3 - 10 a several tubular electrochemical cells 1 mm thick ( cell 1 to cell 3 ) were prepared , these consisting of : a solid electrolyte made of ( 8 %) ysz ( length : 350 mm , active surface area : 68 cm 2 , inside diameter : 9 mm ). the solid electrolytes of cells 1 and 2 do not have a “ tie ” layer ( tl ) and ( tl ′) unlike that of cell 3 . two electrodes ( pe ) and ( pe ′) made of strontium - doped lanthanum manganite ( lsm : la 0 . 9 sr 0 . 1 mno x ) thickness : ( 10 - 30 μm , porosity : 30 - 50 %); a cathode current collector ( cc ) made of ag - lsm ( 50 / 50 by volume ) cermet ( thickness : 50 - 70 μm , porosity between 30 and 50 %); and , a “ protective ” layer ( cl ) on the cathode face of the lscofe ( la 0 . 8 sr 0 . 2 co 0 . 8 fe 0 . 2 o w ) membrane ( thickness : 30 μm , porosity : 20 - 70 %) ( deposition conditions : 800 ° c ./ 0 . 25 - 1 h ). an anode current collector ( cc ′) consisting a gold lacquer ( cell 1 ); a porous gold lacquer obtained from a gold / pore - former ( 50 / 50 vol %) mixture ( cell 2 ). ; a gold lacquer / perovskite ( lscofe ) ( 50 / 50 by volume ) mixture ( cell 3 ). the average thicknesses of the coatings ( cc ′) for the three cells being around 50 - 100 μm . the gold - based current collectors were deposited directly on the lsm electrode and were not covered with a “ protective ” layer . in the high - pressure application case , air ( cathode ) circulates on the inside of the tube closed at one end . oxygen is produced on the outside and is confined in a closed chamber so as to be able to rise in pressure ( 50 - 150 bar ). the coatings of the various layers ( electrodes , anode and cathode current collectors , cathode protective layer ) were produced by the technique of dip coating . the tie layers ( tl ) and ( tl ′) were of the same kind as the dense solid electrolyte ( 8 mol % ysz ). the internal and external coatings were produced either by spraying or by dip coating on the presintered solid electrolyte . the membrane was then sintered before the various layers were deposited . the tubular units operated continuously for at least 10 days ( 250 hours ) under 1 × 10 5 pa ( 1 bar ) of oxygen at 750 or 780 ° c . the lifetime of the units depended on the architecture and on the structure / microstructure of the anode current collector ( cc ′) chosen . in all situations , the coulombic efficiency ( ratio of the experimental o 2 output to the theoretical output ) was 100 %. the use of the gold lacquer resulted in high performance levels in terms of electrochemical potential ( around 1 . 8 - 1 . 9 v , 5 % degradation after 100 h ) for a low productivity (& lt ; 0 . 05 a / cm 2 ). in light of fig1 b , this is the consequence of a very low porosity within the anode current collector , not allowing the oxygen formed to be removed . the addition of pore - forming agents to the current collector ( particle size around 10 - 15 μm ), for a productivity increased by a factor of 1 . 6 - 2 ( 0 . 06 - 0 . 08 a / cm 2 ), resulted in a lower cell potential ( 1 . 4 v ), but higher degradation ( 20 % rise in the potential after 100 h operation ). opening of the porosity resulted in improving the electrochemical performance but also in a system that is unstable over time . after operation , the units exhibited delamination phenomena at the anode electrode ( pe ′)/ pore - former - au current collector ( cc ′) interfaces , which may be explained either by excessive removal of gas and / or or by local joule effects . the unit having tie layers ( tl ) and ( tl ′)″ and an au / lscofe anode current collector ( cc ′) had a potential that was stable in operation ( 1 . 4 v ; degradation & lt ; 100 % over 100 h ) for a productivity increased by a factor of 3 - 3 . 5 ( 0 . 14 - 0 . 16 a / cm 2 ) compared with the gold lacquer . the fact of developing a “ tie ” layer on the solid electrolyte , of modifying the nature of the current collector ( au / lscofe cermet ) and of modifying the sintering conditions for the coatings resulted in an improvement in the electrochemical performance ( increase in productivity ) and stability of the unit ( absence of delamination at the electrode / current collector interface after operation ). the results are given in fig2 and in table 1 . fig2 shows the functions v = f ( t ) of each of cells 1 to 3 and demonstrates the electrochemical performance at p ( o 2 )= 10 5 pa ( 1 bar ) of cell 3 having tie layers on the solid electrolyte , which thus develops specific surface area and roughness , compared with cells 1 and 2 that do not have tie layers , at p ( o 2 )= 1 bar . a solid electrolyte made of yttrium - stabilized zirconia [ ysz ( 8 %)] having a length of 350 mm , a thickness of 0 . 92 mm , an active area of 68 cm 2 and an inside diameter of 9 mm , ( cell 4 and cell 5 ); two tie layers ( tl ) and ( tl ′) exhibiting specific surface area / roughness on both surfaces of the ysz solid electrolyte and of the same nature , and with a roughness r and r ′ of between 10 μm and 100 μm ( cell 5 ); two electrodes ( pe ) and ( pe ′) made of strontium - doped lanthanum manganite ( lsm : la 0 . 9 sr 0 . 1 mno x ) with a thickness of 15 to 30 μm and a porosity of 30 to 50 % ( cell 4 and cell 5 ); a cathode current collector ( cc ) made of an ag - lsm ( 50 / 50 by volume ) cermet ; thickness : 120 to 130 μm ; porosity : between 30 and 50 %) ( cell 4 and cell 5 ); a protective layer ( cl ) on the cathode face of the lscofe ( la 0 . 8 sr 0 . 2 co 0 . 8 fe 0 . 2 o w ) membrane , thickness : 60 - 80 μm , and porosity : 20 - 70 % ( cell 4 and cell 5 ) ( deposition conditions : 800 ° c ./ 0 . 5 - 2 h ). an anode current collector ( cc ′) consisting a gold lacquer ( cell 4 ); gold / lscofe ( 50 / 50 by volume ) cermet ( cell 5 ). the various layers ( tie surface , electrodes , current collectors , protective layers ) were deposited by the technique of dip coating . the operating temperature was 800 - 830 ° c . with a temperature gradient of around +/− 200 ° c . in the active area . in both cases , the cell potentials were stable at high oxygen pressure : 140 × 10 5 pa ( 140 bar ) ( cell 4 ) and 120 × 10 5 pa ( 120 bar ) ( cell 5 ). they were around 1 . 6 - 1 . 7 v ( cell 4 ) and 1 . 8 v ( cell 5 ) for applied currents of 3 . 5 a ( cell 4 ) and 7 a ( cell 5 ), i . e . 0 . 05 and 0 . 1 a / cm 2 respectively . cell 5 was stable under reaction conditions ( degradation & lt ; 1 % over 100 h ) at 120 bar . unlike example 1 and for an equivalent potential , the applied current was lower , respectively 1 . 4 v / 10 a / p ( o 2 )= 1 bar / 750 ° c . in the case of cell 3 and 1 . 8 v / 7 a / p ( o 2 )= 120 bar / 800 ° c . in the case of cell 5 . this difference cannot be explained only by the overvoltage associated with the nernst law . it mainly has its origin , as indicated above , in the very poor temperature gradient in the chamber under pressure ( 800 +/− 200 ° c . in the active area ) unlike the test at 1 bar of oxygen ( 750 +/− 10 ° c . in the active area ). the coulombic efficiencies under p ( o 2 ) of between 120 and 140 × 10 5 pa ( 120 and 140 bar ) are equal to 100 % after around 100 hours of operation . the results are given in fig3 and table 2 . fig3 shows the functions v = f ( t ) for each of cells 1 to 3 and demonstrates the electrochemical performance at p ( o 2 ) between 120 and 140 × 10 5 pa ( 1 bar ) of cell 5 having tie layers on the solid electrolyte , which thus develops specific surface area and roughness , compared with cell 4 which does not have tie layers . in both the examples described above , the use of a current collector based on a metal / perovskite cermet , and more particularly au / lscofe , instead of systems based on a gold lacquer or on gold / pore former as anode current collector , very substantially improves the electrochemical performance of the cells ( productivity , initial potential ) and very greatly slows down the ageing phenomenon , and does so for oxygen pressures of between 1 and 150 × 10 5 pa ( 1 and 150 bar ). the development of specific surface area / roughness on the dense solid electrolyte allows better “ bonding ” of the successive coatings , principally for the electrode and the anode and cathode current collectors , and increases the number of what are called “ triple ” points in electrochemistry ( points of contact between the solid electrolyte , the electrode and the gas ( o 2 )). there is delocalization of the electrode reaction within the volume , and no longer only at the solid electrolyte / electrode “ plane ” interface . the consequences of the development of this tie layer , particularly on high - pressure units , of the same nature as the solid electrolyte and / or the electrode , combined with an electrode / anode current collector au / perovskite or noble metal / perovskite structure , are numerous : stabilization of the degradation of the cells to less than 1 %/ 100 h of operation on these units for current densities of around 0 . 15 a / cm 2 and temperatures of between 750 and 800 ° c . at high oxygen pressure ( 1 - 150 bar ); operating conditions of the units , compared with “ conventional ” ceramic membrane systems without a tie layer and with an anode current collector of the gold lacquer type , more severe in terms of productivity ( 3 - 3 . 5 times ) for lower initial potentials ; constancy of the productivity ( coulombic efficiency ) at 1 - 150 bar of oxygen ; and purity of the oxygen produced greater than 99 . 9 % for oxygen pressures between 1 and 150 bar . as further examples giving the advantageous results described above , there are electrochemical cells in which : the anode current collector ( cc ′) is a metal / perovskite - based cermet deposited either directly on the solid electrolyte having a developed surface area / roughness , or deposited on an electrode . the materials employed in the anode current collector may be of the same nature as those employed in the cell ( solid electrolyte , electrode , cathode current collector and cathode protective layer ) and / or of a different nature ; the tie layers ( tl ) and ( tl ′) developed on both faces of the dense solid electrolyte are formed from the same material as the latter . however , it may be made of other constituent materials of the cell , mainly of the same nature as the electrode . in general , these may be materials of ionically conducting crystal structure ( dense solid electrolyte : aurivillius , fluorite phases ) and / or mixed ( brown - millerite , perovskite , pyrochlore ) phases ; the protective layer ( cl ), in the case of units for producing oxygen at high pressure , is not necessarily developed on the anode current collector ; the tie layers ( tl ) and ( tl ′) are characterized by the fact that they may , if they are of the same nature as the dense solid electrolyte , be inseparable from the latter . the ceramic membrane is then characterized by a membrane possessing on its faces , on both sides , a specific surface area / roughness . the formation of this tie layer may be achieved either , after sintering , from a ceramic membrane , for example by isostatic pressing , or from a presintered membrane , or from a green membrane ; the intermediate layers ( l ij ) and ( l ′ ij ) are defined as consisting of materials resulting from the subjacent and superjacent coatings ( i ) and ( j ). the thermal expansion coefficient of this layer is less than that of the superjacent layer and greater than that of the subjacent layer . the tie layer may be defined as being an intermediate layer between the solid electrolyte and the electrode . the intermediate layers ( l ij ) and ( l ′ ij ) must be sufficiently porous and of controlled thicknesses and must not influence the electrochemical performance of the cell . they consist either of ionically conducting materials , or of hybrid conducting materials , or of electronically conducting materials or of a mixture of the aforementioned materials ; the protective layer consists ( cl ) of a perovskite of the lscofe or other type , possessing hybrid conductivity properties at low temperature (& lt ; 800 ° c .). it may also consist of other ionically or hybrid conducting , crystal structures ( aurivillius , brown - millerite , pyrochlore , fluorite , etc . phases ); the protective layer ( cl ), in the case of units for producing oxygen at high pressure , is not necessarily developed on the anode current collector ; the protective layer ( cl ) does not possess hybrid , ionic or electronic conduction properties . it may be an insulator . however , the layer must be sufficiently porous and of controlled thickness in order to allow oxygen to diffuse within the system and must not influence the electrochemical performance of the cell ; beads of mullite or zirconia or alumina ( diameter between 0 . 2 and 1 mm ) may fill the tube so as to chemically fasten the internal silver wire . these beads may optionally be covered with a current collector layer , of the same nature as the current collector layer deposited on the tubular system ( silver lacquer , silver - lsm ( 50 / 50 vol %) mixture , gold lacquer , etc . ); the internal silver wire may be fastened , no longer by mullite or zirconia or alumina beads , but either by a silver tube or by a quartz tube allowing the influx of air at the closed end by the unit ; the high - pressure cell may be either symmetrical in terms of materials , architecture and structure / microstructure , or unsymmetrical as in examples 1 and 2 . | 1 |
[ 0011 ] fig1 is an sms fixed - network scenario having two fixed - network terminals 1 , 2 , whereby the first terminal , “ terminal x ”, is 1 , and the second terminal , “ terminal y ”, is 2 . the terminals 1 , 2 are respectively configured as a private branch exchange ; for example , in the form of a cordless base station as per the dect standard or a telecommunications system . the terminals 1 , 2 are operated or connected on a fixed - network connection 3 which is configured , for example , as an analog a / b connection . the first terminal configured as a private branch exchange , “ terminal x ” 1 , has three extensions 10 , 11 , 12 ( a first extension , “ extension x_int1 ” 10 , a second extension , “ extension x_int2 ” 11 , and a third extension , “ extension x_int3 ” 12 ), for internal subscribers , of which the first extension , “ extension x_int1 ” 10 and the second extension , “ extension x_int2 ” 11 , are configured , - for example , as cordless portable units connected to “ terminal x ” 1 via a radio interface 4 , while the third extension , “ extension x_int3 ” 12 , is - configured , for - example , as a normal telephone connected to “ terminal x ” 1 via a line interface 5 . the second terminal configured as a private branch exchange , “ terminal y ” 2 , has two extensions 20 , 21 ( a first extension , “ extension y_int1 ” 20 and a second extension , “ extension y_int2 ” 21 , for internal subscribers ), of which the first extension , “ extension y_int1 ” 20 , is - configured , for - example , as a cordless portable unit and is connected to “ terminal y ” 2 via a radio interface 6 , while the second extension , “ extension y_int2 ” 21 , is - configured , for - example , as a normal telephone connected to “ terminal y ” 2 via a line interface 7 . according to the sms fixed - network scenario shown in fig1 a single - digit numeric identifier ti in the range 0 . . . 9 , known as the terminal identifier , is used in such a way that several ti values are assigned to the first terminal , “ terminal x ” 1 , namely ti = 0 , 1 , 2 , 3 , 4 , and to the second terminal , “ terminal y ” 2 , namely ti = 5 , 6 , 7 , 8 , 9 , instead of only a single ti value being respectively assigned to “ terminal x ” 1 and to “ terminal y ” 2 as in the prior art . in other words : the first terminal , “ terminal x ” 1 , responds to the ti values ti = 0 , 1 , 2 , 3 , 4 , while the second terminal , “ terminal y ” 2 , responds to the ti values ti = 5 , 6 , 7 , 8 , 9 . in this way , sms messages can be addressed to the extensions 10 , 11 , 12 , 20 , 21 , which are assigned to the terminals 1 , 2 as shown in fig1 whereby , taking into account the ti values assigned to the respective terminal 1 , 2 in question , the following ti values being assigned , for example : the ti values ti = 0 , 1 , 2 are assigned to the internal subscriber at the first extension , “ extension x_int1 ” 10 , belonging to the first terminal “ terminal x ” 1 ; the ti values ti = 2 , 4 are assigned to the internal subscriber at the second extension , “ extension x_int2 ” 11 , belonging to the first terminal “ terminal x ” 1 ; the ti value ti = 3 is assigned to the internal subscriber at the third extension , “ extension x_int3 ” 12 , belonging to the first terminal “ terminal x ” 1 ; the ti value ti = 5 is assigned to the internal subscriber at the first extension , “ extension y_int1 ” 20 , belonging to the second terminal “ terminal y ” 2 ; and the ti values ti = 6 , 7 , 8 , 9 are assigned to the internal subscriber at the second extension , “ extension y_int2 ” 21 , belonging to the second terminal “ terminal y ” 2 . it should be pointed out at this stage that , in principle , the single - digit numeric identifiers from 0 to 9 may be arbitrarily distributed among the terminals and extensions involved in the sms fixed - network scenario , provided it is ensured that several numeric identifiers are assigned to each terminal 1 , 2 operated on the network termination 3 . in practice , though , it is preferable to allocate to a terminal configured as a private branch exchange only as many numeric identifiers as there are extensions operated behind the private branch exchange . if , in the illustrated sms fixed - network scenario of the service center specially configured for the sending and receiving of short messages , known as the “ short message service center ”, which is connected to the public telephone network , an sms call with the ti value ti = 2 is now received via the network termination 3 at the terminals 1 , 2 connected to it , then the first terminal , “ terminal x ” 1 , would respond to the call and would transfer or forward it in accordance with the illustrated distribution of ti values to the internal subscribers at the assigned first extension , “ extension x_int1 ” 10 , and to the internal subscribers at the assigned second extension , “ extension x_int2 ” 11 . this corresponds to the message flow printed in bold in fig1 . [ 0024 ] fig2 shows an sms fixed - network scenario in which the two fixed - network terminals 1 , 2 ( the first terminal , “ terminal x ” 1 , and the second terminal , “ terminal y ” 2 ) which are configured as a private branch exchange , such as in the form of a cordless base station as per the dect standard or a telecommunications system , are operated or connected on the fixed - network connection 3 ; for example , as an analog a / b connection . the first terminal configured as a private branch exchange , “ terminal x ” 1 , again has the three extensions 10 , 11 , - 12 ( the first extension , “ extension x_int1 ” 10 , the second extension , “ extension x_int2 ” 11 , and the third extension , extension x_int3 ” 12 ), for internal subscribers , of which the first extension , “ extension x_int1 ” 10 and the second extension , “ extension x_int2 ” 11 are configured , for example , as cordless mobile units connected to “ terminal x ” 1 via the radio interface 4 , while the third extension , “ extension x_int3 ” 12 , is configured , for example , as a normal telephone connected to “ terminal x ” 1 via the line interface 5 . the second terminal configured as a private branch exchange , “ terminal y ” 2 , again has the two extensions 20 , 21 ( the first extension , “ extension y_int1 ” 20 , and the second extension , “ extension y_int2 ” 21 ), for internal subscribers , of which the first extension , “ extension y_int1 ” 20 is configured , for example , as a cordless mobile unit connected to “ terminal y ” 2 via the radio interface 6 , while the second extension , extension y_int2 ” 21 , is configured , for example , as a normal telephone connected to “ terminal y ” 2 via the line interface 7 . according to the sms fixed - network scenario shown in fig2 a two - digit numeric identifier ti in the range 0 . . . 9 , known as the terminal identifier , is used in such a way that the first terminal , “ terminal x ” 1 , and the second terminal , “ terminal y ” 2 , are each assigned an initial digit from the two - digit numeric identifier for the purpose of addressing the respective terminals ; namely , the digit “ 1 ” to the first terminal “ terminal x ” 1 , and the digit “ 2 ” to the second terminal , “ terminal y ”. moreover , the extensions 10 , 11 , 12 , 20 , 21 assigned to the first and second terminals are each assigned at least one second digit of the two - digit numeric identifier , wherein : the first extension , “ extension x_int1 ” 10 , of the first terminal “ terminal x ” 1 , is assigned either the digit “ 1 ” or the digits “ 0 , 1 , 2 , 3 ”, resulting in the ti values ti = 11 or ti = 10 , 11 , 12 , 13 for the first extension , “ extension x_int1 ” 10 ; the second extension , “ extension x_int2 ” 11 , of the first terminal , “ terminal x ” 1 , is assigned either the digit “ 2 ” or the digits “ 4 , 5 , 6 ”, resulting in the ti values ti = 12 or ti = 14 , 15 , 16 for the second extension , “ extension x_int2 ” 11 ; the third extension , “ extension x_int3 ” 12 , of the first terminal , “ terminal x ” 1 , is assigned either the digit “ 3 ” or the digits “ 7 , 8 , 9 ”, resulting in the ti values ti = 13 or ti = 17 , 18 , 19 for the third extension , “ extension x_int3 ” 11 ; the first extension , “ extension y_int1 ” 20 , of the second terminal “ terminal y ” 2 , is assigned either the digit “ 1 ” or the digits “ 0 , 1 , 2 , 3 , 4 ”, resulting in the ti values ti = 21 or ti = 20 , 21 , 22 , 23 , 24 for the first extension , “ extension y_int1 ” 20 ; and the second extension , “ extension y_int2 ” 21 , of the second terminal “ terminal y ” 2 , is assigned either the digit “ 2 ” or the digits “ 5 , 6 , 7 , 8 , 9 ”, resulting in the ti values ti = 22 or ti = 25 , 26 , 27 , 28 , 29 for the second extension , “ extension y_int2 ” 21 . in other words : the first terminal , “ terminal x ” 1 , responds to the ti values ti = 1x , where x is a digit from the range 0 . . . 9 , while the second terminal , “ terminal y ” 2 , responds to the ti values ti = 2x , where x is a digit from the range 0 . . . 9 . it should be noted at this stage that a numeric identifier with more than two digits also can be used instead of a two - digit numeric identifier . this would permit an alternative type of configuration . in this way , sms messages may be addressed either directly - or , because of free - configurability , indirectly to the extensions 10 , 11 , 12 , 20 , 21 , which are assigned to the terminals 1 , 2 as shown in fig1 as an alternative to the first exemplary embodiment . it again should be pointed out at this stage that , in principle , the two - digit numeric identifiers from 0 to 9 may , in each case , be arbitrarily distributed among the terminals and extensions involved in the sms fixed - network scenario . in practice , though , it is preferable to allocate to a terminal configured as a private branch exchange only as many numeric identifiers as there are extensions operated behind this private branch exchange . if , in the illustrated sms fixed - network scenario of the service center specially configured for the sending and receiving of short messages , known as the “ short message service center ”, which is connected to the public telephone network , an sms call with the ti value ti = 21 is now received via the network termination 3 at the terminals 1 , 2 , connected to it , then the second terminal , “ terminal y ” 2 , would respond to call and would transfer or forward it in accordance with the illustrated distribution of ti values to the internal subscribers at the associated first extension , “ extension y_int1 ” 20 . this corresponds to the message flow printed in bold in fig2 . although the present invention has been described with reference to specific embodiments , those of skill in the art will recognize that changes may be made thereto without departing from the spirit and scope of the present invention as set forth in the hereafter appended claims . | 7 |
a preferred embodiment of the present invention will be described hereinafter with reference to the accompanying drawings . in the following description , the same drawing reference numerals are used for the same elements , even in different drawings . a detailed construction and circuit elements are described only to assist in a comprehensive understanding of the invention . thus , it will be apparent that the present invention can be carried out without these particulars . also , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . furthermore , although many particular details such as circuit components or blocks are to be shown in the following description , they are provided for a better understanding of the invention to the reader by way of example only , but not limited to those details disclosed herein . referring now to fig3 , description is made to the improved cell configuration in the mobile communication system according to a preferred embodiment of the present invention . although a typical mobile communication system consists of a large number of individual cells , the cell configuration in fig3 illustrates only three cells for the sake of convenience in explanation . the mobile communication system according to the present invention is configured in such a way that a respective base station 100 , 102 and 104 in each cell 10 , 20 and 30 is provided with a fixed number of safety channels , in which the each base station 100 , 102 and 104 usually assigns 3 × n bins for the safety channels of a communication bandwidth , wherein “ n ” is a given integer . these bins may consist of at least three sets of bins , each set having one or more bins , wherein those sets of bins are allocated to different frequency bands . in this embodiment of the invention , the safety channels in the sets of bins with the different frequency bands are indicated by symbols 0 , 1 and 2 , by way of example . each cell is assigned two safety channels of the three safety channels so that any one cell is overlapped with only one safety channel of its adjacent cell . referring then to fig4 a to 4 c , a more detailed description is made to the safety channels assigned to the base stations with the cell configuration , as described with reference to fig3 , in each cell 10 , 20 and 30 in the mobile communication system with the cell configuration according to the preferred embodiment of the present invention . base station 100 of cell 10 is assigned frequency bands 0 and 1 for the safety channels , as seen in fig4 a , while in the base station 102 of the cell 20 the frequency bands 1 and 2 are assigned for the safety channels , as seen in fig4 b , and similarly , in the base station 104 of the cell 30 the frequency bands 0 and 2 are assigned for the safety channels , as seen in fig4 c . as such , the two cells 20 and 30 located adjacent to the cell 10 are provided with either one of safety channels 0 and 1 assigned to the base station 100 of the cell 10 and provided in common with the safety channel 2 . according to the embodiment of the invention , any adjacent cells of a reference cell are assigned a pair of two safety channels , one of them being overlapped with those of the reference cell and the other not being overlapped with those of the reference cell . referring to fig5 a , a method of safety channel allocation for adjacent cells around a serving cell a is illustrated , by way of an example , using the basic cell configuration according to the invention . within a typical cell area enveloped in a bold line , the serving cell a is assigned with the safety channels 0 and 1 , while its adjacent cells surrounding the serving cell a are assigned with either one of those safety channels 0 and 1 , and with the common safety channel 2 . hence , it is appreciated that the cell configuration is arranged so that every cell overlaps only one safety channel with its adjacent cells , as seen in fig5 b more clearly . hereinafter , the operation in the base station for a channel allocation from a serving cell to a mobile terminal will be described in accordance with the aforementioned cell configuration . once the base station in the serving cell 10 receives a request for safety channel allocation from the mobile terminals 110 and 112 , the base station 100 assigns to mobile terminals 110 and 112 bins of the safety channel 2 that is not retained by itself . further , if the reported carrier to interference ratio ( c / i ) is not less than a specified threshold value , then a channel other than the safety channel is assigned . in the meantime , if the mobile terminals 110 and 112 are communicating with each other using the cell as a serving cell , at least one of them enters into a boundary area between the serving cell 10 and its adjacent cells 20 and 30 to force the c / i value to go down below the specified threshold level , then the c / i value is to be reported to the base station 100 of the serving cell 10 to make a request for safety channel allocation . then , once the allocation of the safety channel from the base station 100 has been made , the mobile terminals are controlled to maintain their communication channel through the allocated safety channel and subsequently , if the c / i value becomes greater than the specified threshold value , the base station discontinues the safety channels concerned . at this moment of operation , the mobile terminals 110 and 112 check the c / i values and , on a periodical basis , compare the c / i with the specified threshold value for determining the relation to the level of interference from those adjacent cells , consequently reporting the result of comparison to the base station . now , referring to fig6 , a description is made of the control sequence for carrying out with the least possible interference from any adjacent cells to a mobile terminal located at a cell boundary area in the mobile communication system with the aforementioned cell configuration . fig6 shows a flow chart diagram for controlling the channel allocation between the mobile terminal and the base station in accordance with the first embodiment of the present invention . the mobile terminal is assumed to be terminal 112 affected by the interference applied from three cells as shown in fig3 , but the operation will be the same for terminal 110 . while the mobile terminal 112 is communicating with the base station 100 of the serving cell 10 in step 600 , the carrier to interference ( c / i ) value in the serving cell 10 is checked in step 602 to determine if it is not greater than a specified threshold value . thereafter , if it is not greater than the threshold value , then the mobile terminal 112 transmits the c / i value to the base station 100 with a view to making a request for safety channel allocation in step 604 to prevent any interference from the adjacent cells during communication . in step 606 , the base station 100 having received this c / i value assigns to the mobile terminal 112 a few of bins of the safety channel band other than the safety channels retained by the base station itself . referring again to fig5 b , a detailed description will be made to the safety channel allocation from the mobile terminal 112 in the base station 100 . first of all , the safety channels 0 and 1 are assigned to the serving cell 10 , while the identical safety channel 2 other than those safety channels of the serving cell 10 is assigned to the adjacent cells 20 to 70 . if the c / i value measured by the mobile terminal 112 is not greater than the specified threshold value , then the base station 100 assigns to the mobile terminal 112 the safety channel 2 in a frequency band not occupied by the adjacent cells , thereby carrying out a channel allocation so that no interference from the adjacent cells is made to the mobile terminal 112 . as all the adjacent cells surrounding the serving cell 10 are configured to have the safety channel 2 in common , the mobile terminal will not be necessary to inspect the preambles of received frames for searching for a safety channel , as in the prior art , but it will be only enough to make a request for safety channel allocation to the base station . as understood from the above description , the safety channel assigned by the base station is incorporated into ul - map ( uplink map ) or dl - map ( downlink map ) for transmission to the mobile terminal 112 , and the mobile terminal 112 carries out data communication with the base station 100 through the assigned safety channel , in step 610 . hence , at this stage , the mobile terminal 112 performs the wireless communication with the base station without any interference from those adjacent cells , since it carries out the wireless communication through the safety channel 2 that is of the frequency band not occupied by any mobile terminals in those adjacent cells . if it is determined in step 612 that the c / i value of the serving cell 10 is not less than the specified threshold value with respect to the received frames , then the mobile terminal 112 transmits the c / i value to the base station in step 614 , thereby requesting the termination of the safety channel . accordingly , the base station 100 recognizes in step 616 that it will not be necessary for the mobile terminal 112 to use any safety channels because the interference from the adjacent cells is at a critical level , and it assigns to the corresponding mobile terminal a fresh common data channel other than the safety channel . such an assigned data channel is transmitted to the mobile terminal via ul - map or dl - map , and the mobile terminal 112 having received this channel continues to communicate with the base station 100 via the assigned channel . further , if the c / i value is not less than the threshold value in step 616 , then an operation sequence may be carried out that the safety channel is terminated and a fresh channel assigned , or alternatively , another operation sequence may be implemented so that while the safety channel is maintained , a fresh channel is assigned and upon completion of setup , the safety channel is terminated . referring now to fig7 , the control sequence for carrying out the optimum channel allocation between the mobile terminal and the base station in the mobile communication system according to the second embodiment of the present invention will be described . while the mobile terminal 112 is communicating with the base station 100 of the serving cell 10 in step 700 , the c / i value of the serving cell 10 is checked in step 702 to determine if it is less than a specified threshold value . thereafter , if it is not greater than the threshold value , the c / i value is transmitted to the base station 100 in step 704 in order to request a channel allocation . the mobile terminal 112 transmits the c / i value to the base station 100 to make a request for safety channel allocation to prevent any interference from the adjacent cells during communication . in step 706 , the base station 100 having received this c / i value assigns to the mobile terminal 112 bins of the safety channel band other than the safety channels retained by the base station itself . subsequently , the mobile terminal 112 carries out data communication with the base station 100 through the assigned safety channel , in step 710 . then , the mobile terminal 112 makes a periodic measurement on the c / i values with respect to the received frames in step 712 and transmits the measured value to the base station . if it is determined in step 714 that the received c / i value is not less than the specified threshold value with respect to the received frames , then the control proceeds to step 716 to terminate the safety channel and then assign to the mobile terminal 112 a fresh channel for the data communication other than the aforementioned safety channel . as an alternative , the control sequence may be implemented so that in step 716 , when the received c / i value is greater than the specified threshold value with respect to the received frames , the safety channel is maintained and a new channel is assigned , thereby terminating the safety channel upon completion of the setup for channel allocation . as seen in the foregoing description , the timing sequence of channel termination and channel allocation for a safety channel may be changed , provided that the wireless communication between the mobile terminals and the base station can be fulfilled in a smooth and efficient manner . such an assigned data channel is transmitted to the mobile terminal 112 via ul - map or dl - map , and the mobile terminal 112 having received this channel continues to communicate with the base station 100 via the assigned channel , in step 718 . as understood from the foregoing , the mobile communication system according to the present invention is configured so that any adjacent cells around a reference cell are assigned with the identical safety channel , in common , different from a safety channel assigned to a base station in the reference cell , so the system is subject to less interference from those adjacent cells , assigning to a mobile subscriber terminal located in the cell boundary area the safety channel assigned in common to the adjacent cells except for a serving cell . as apparent from the foregoing description , the present invention can eliminate the interference induced by all the adjacent cells except for the serving cell . furthermore , the system according to the invention has an advantage in that when a mobile terminal sends a request for a safety channel allocation to a base station , without any need for separately performing a scanning operation to look for an extra safety channel , the base station of the serving cell having received this request assigns to the mobile terminal a remaining safety channel except for its own safety channel , therefore improving complexity in the system construction . as such , in the case of assignment of safety channels in advance , sub - carriers used by the user terminals located in the cell boundary area are in frequency band not occupied by any adjacent cells , so a boosting of its transmission power can be accomplished . moreover , the present invention also improves the link power margin required for formation of a wireless link in the cell boundary area , which will essentially leads to remarkable improvements in the hand - off performance of a mobile terminal as well as the wireless transmitting and receiving performance thereof . while the present invention has been heretofore shown and described with reference to preferred embodiments , it will be understood by those skilled in the art that various changes and modifications in form and details may be made therein and the equivalents may be substituted for elements thereof , without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
embodiments of the present invention provide a phased - array antenna radiator for a super economical broadcast system . according to one aspect of the present invention , cell spacing , i . e ., the distance between adjacent btss , is advantageously increased relative to conventional cellular systems while providing a consistent quality of service ( qos ) within each cell . preferred embodiments of the present invention increase the range of each bts . conventional macrocells typically range from about ¼ mile ( 400 meters ) to a theoretical maximum of 22 miles ( 35 kilometers ) in radius ( the limit under the gsm standard ); in practice , radii on the order of 3 to 6 mi ( 5 - 10 km ) are employed except in high - density urban areas and very open rural areas . the present invention provides full functionality at the gsm limit of 22 mi , for typical embodiments of the invention , and extends well beyond this in some embodiments . cell size remains limited by user capacity , which can itself be significantly increased over that of conventional macrocells in some embodiments of the present invention . commensurate with the increase in cell size , the bts antenna tower height is increased , retaining required line - of - sight ( for the customary 4 / 3 diameter earth model ) propagation paths for the enlarged cell . preferred embodiments of the present invention increase the height of the bts antenna tower from about 200 feet ( 60 meters ) anywhere up to about 1 , 500 ft ( about 500 m ). in order for the transmit power and receive sensitivity of a conventional cellular transceiver ( user &# 39 ; s hand - held mobile phone , data terminal , computer adapter , etc .) to remain largely unchanged , both the eirp and receive sensitivity of the tower - top apparatus for the sec system are increased at long distances relative to conventional cellular systems and reduced near the mast . these effects are achieved by the phased - array antenna and associated passive components , as well as active electronics included in the present invention . standard bts equipment , such as transceivers , electric power supplies , data transmission systems , temperature control and monitoring systems , etc ., may be advantageously used within the sec system . generally , from one to three or more cellular operators ( service providers ) may be supported simultaneously at each bts , featuring , for example , 36 to 96 transceivers and 216 to 576 erlang of capacity . alternatively , more economical bts transmitters ( e . g ., 0 . 1 w transmitter power ) may be used by the cellular operators , further reducing cost and energy consumption . these economical btss have a smaller footprint and lower energy consumption than previous designs , due in part to performance of transmitted signal amplification and received signal processing at the top of the phased - array antenna tower rather than on the ground . fig1 presents a perspective view of a bts antenna , in accordance with an embodiment of the present invention . the base transceiver station 10 includes an antenna tower 12 and a phased - array antenna 14 , with the latter disposed on an upper portion of the tower 12 , shown here as the tower top . the antenna 14 in the embodiment shown is generally cylindrical in shape , which serves to reduce windload , and has a number of sectors 16 , such as , for example , 6 sectors , 8 sectors , 12 sectors , 18 sectors , 24 sectors , 30 sectors , 36 sectors , etc ., that collectively provide omnidirectional coverage for a cell associated with the bts . each sector 16 includes a number of antenna panels 18 in a vertical stack . each elevation 20 includes a number of antenna panels 18 that can surround a support system to provide 360 ° coverage at a particular height , with each panel 18 potentially belonging to a different sector 16 . each antenna panel 18 includes a plurality of vertically - arrayed radiators , which are enclosed within radomes that coincide in extent with the panels 18 in the embodiment shown . feed lines , such as coaxial cable , fiber optic cable , etc ., connect cellular operator equipment to the antenna feed system located behind the respective sectors 16 . at the input to the feed system for each sector 16 are diplexers , power transmission amplifiers , low - noise receive amplifiers , etc ., to amplify and shape the signals transmitted from , and received by , the phased - array antenna 14 . in one embodiment , the feed system includes rigid power dividers to interconnect the antenna panels 18 within each sector 16 , and to provide vertical lobe shaping and beam tilt to the panels 18 in that sector . in another embodiment , flexible coaxial cables may be used within the feed system . fig2 depicts a perspective view of a partial antenna panel 100 , in accordance with an embodiment of the present invention . a single rectangular box extrusion 102 has four internal chambers 104 , operative as discrete , grounded signal line outer conductors , in addition to any number of structural chambers 106 , functional at least as stiffeners . outer surfaces of the chambers 106 further serve , along with external surfaces of the signal line chambers 104 , to establish a continuous reflector face ( backplane ) 108 proximal to a plurality of radiators 110 . fig3 depicts an arbitrary group of four , proximate crossed - dipole radiators 110 , in accordance with an embodiment of the present invention . radiators 110 , including transverse quadrilateral crossed dipoles 140 , 142 , are mounted on a face 108 of the antenna panel 100 ( shown in fig2 ), and arranged in a staggered configuration . in at least one embodiment , radiators 110 are similar , in some respects , to radiators disclosed within u . s . patent application publication no . 2007 - 0254587 ( published nov . 1 , 2007 ), which is incorporated herein by reference in its entirety . radiators 110 advantageously exhibit intrinsic low cross coupling between their respective dipoles 140 , 142 . when spaced vertically about a wavelength apart , they further exhibit intrinsic low mutual coupling between proximal radiators 110 . in one preferred embodiment , radiators 110 transmit and receive signals in the 900 mhz frequency range . radiators 110 are arranged in two staggered vertical rows 144 , 146 of radiators 110 , so that the dipoles 140 , 142 in each row are , in some instances , oriented end - to - end with dipoles on proximal radiators 110 in the other row , or oriented orthogonally thereto ; these dipoles are substantially non - interacting . the remaining dipoles 140 , 142 in alternate rows 144 , 146 are parallel , and spaced between 0 . 5 and 0 . 7 wavelengths apart . these dipoles are sufficiently close to affect impedance of one another . in compensation , the termination impedance of the feed system may be altered , by a process such as that described below . vertical spacing between the radiators 110 is substantially equal and uniform within each of the staggered rows 144 , 146 . spacing may be selected to provide maximum radiative efficiency , to provide beam shaping , or for other purposes . horizontal spacing between rows 144 , 146 may be selected to maintain isolation between orthogonal dipoles , which can be realized using a 45 degree angle between radiators 110 as shown . vertical separation between radiators 110 may be greater or less in some embodiments , provided horizontal spacing is adjusted along with vertical spacing to control impedance and coupling characteristics . excessive separation can produce grating lobes in some embodiments . the modified quadrilateral , or “ cloverleaf ,” construction of the dipoles 140 , 142 and their spacing further provides a voltage standing wave ratio ( vswr ) that is low over at least a bandwidth required for cellular telephony , namely about 7 . 6 % for the basic 900 mhz gsm band , or up to 9 . 1 % for the p -, e -, or r - extended versions of that band . for the 1 . 8 ghz gsm band , bandwidth is again about 9 . 1 %, with the gap between transmit and receive frequencies roughly equal to that of the e - gsm band . the individual monopoles of each dipole have straight portions parallel to straight portions of adjacent monopoles of the other dipole ; spacing and length of these parallel portions can be selected to cause them to function as transformers with particular values of coupling . this can control an extent of isolation between the orthogonal dipoles within a radiator . design variants can be configured to realize specific azimuth beam widths . for example , 30 degree and 45 degree widths are readily implemented , and the design further supports beam narrowing to 22 . 5 degrees or less and broadening to 60 degrees or more . beam width is determined by details of the “ clover leaf ” shape of the dipoles 140 , 142 , by the spacing , number , and size of parasitics 170 , supported by spacer insulators 168 , by implementation of alternate backplane 108 geometries , such as basket , lip , or curved surfaces of different widths , and by other alterations . these variants permit the number of sectors making up an omnidirectional antenna to be at least 12 - around or 8 - around , for 30 degree and 45 degree radiator beam widths , respectively , with greater and lesser numbers likewise realizable . selection of azimuth beam width , as well as selection of a total number of sectors serving a cell , such as eight , 12 , 16 , or 24 sectors , for example , may be determined by requirements such as the number of service providers operating within a cell and sharing the antenna , the number of mobile units to be served , a preferred limit of frequency reuse , and the like . fig4 depicts an exploded view of crossed - dipole radiator 110 , in accordance with an embodiment of the present invention . coupling from the suspended stripline terminations within the backplane to the respective dipoles 140 , 142 is by outer conductors 154 and inner conductors 152 that cross over in the form of unbalanced feed straps 166 and tuned stubs 150 that jointly form balanced terminations . advantageously , embodiments of the present invention include feed lines , such as , for example , rigid coaxial line feeding each dipole 140 , 142 within the radiators 110 , each of which includes an inner conductor 152 which , after passing out through the end of an outer conductor 154 , which also provides structural support , crosses the center of the dipole 140 , 142 by a feed strap 166 and couples by a tuned conductive feed stub 150 to another outer conductor 156 , which also provides structural support . the respective inner conductors 152 and outer conductors 154 form coaxial feed lines having characteristic impedances based on diameter ratios between the inner 152 and outer 154 conductors and the dielectric constants of any insulators / fill materials 158 . the feed stubs 150 likewise have diameter ratios with the outer conductors 156 , lengths , and dielectric fillers 160 chosen to establish termination impedances that couple signal energy to the first monopoles 162 over the selected frequency range . the feed straps 166 are unbalanced , and the spacing between the radiators further affects input impedance , so the selected lengths of the feed stubs 150 are factors in termination matching at the level of the entire antenna . in one preferred embodiment , radiators 110 transmit and receive signals in the 900 mhz range . in this embodiment , the outer conductors 154 , 156 are approximately 3 . 4 ″ long , 0 . 07 ″ thick and 0 . 5 ″ in diameter , the inner conductors 152 are approximately 4 . 4 ″ long and 0 . 15 ″ in diameter , the feed straps 166 are approximately 1 . 5 ″ long , and the stubs 150 are approximately 2 . 4 ″ long and 0 . 15 ″ in diameter . the monopole radiating elements 162 , 164 are generally rectangular in shape , with one truncated corner , are approximately 2 . 6 ″ long on each side and have a square cross section of approximately 0 . 2 ″. these dimensions are , of course , not intended to be limiting and may be adjusted by one skilled in the art , in accordance with the teachings of the present invention , to accommodate other applications , frequency ranges , etc . advantageously , embodiments of the present invention have appreciably lower transmit signal levels and has receive functionality , each of which increases pim product susceptibility . as a consequence , both highly smoothed component shape and uniformity of material composition within each component are potentially beneficial , while electromechanical joints are potential sources of pim products . for example , prototyping of the antenna embodiments illustrated in the figures can result in pim products being manifested repeatedly and to some extent unpredictably . construction of the parts shown from larger numbers of simple screw - machine formed and / or cut and stamped parts , assembled with screws , is associated with pim production . disassembly / reassembly activities that eliminate one pim may introduce another . slightly - damaged screw slots , variations in assembly torque , traces of oils in connection points , and the like all represent potential sources of pim - related defects detectable at the receiver , requiring prolonged troubleshooting to overcome . in a preferred embodiment , subgroups of the parts making up each radiator and each panel may be candidates for consolidated into single parts as shown , and enhanced processes for realizing connection uniformity may be adopted with a view to preventing generation of pim products . for example , each of the outer conductors 154 , 156 may be formed as a single piece with its associated monopole 162 , 164 , such as by investment casting or a comparable high - precision metal forming process . indeed , all four may be cast with a common base in some embodiments . similarly , the inner conductors 152 and stubs 150 , along with feed straps 166 , may be one piece as shown , whether cast , forged , molded from a powder - metal slurry and fired to final size , or the like . the extruded backplane 108 , shown in fig3 , is likewise a product of such reduction in pim vulnerability , since preferred embodiments have unitized construction with a continuous , substantially smooth interior that functions as a stripline reference ground . it is to be observed that any holes drilled through the extruded backplane 108 for radiator connection or stripline mounting require rigorous deburring on blind sides thereof ( i . e ., removal of burrs formed on interior surfaces of the extruded backplane 108 as a result of drilling inward from an external surface thereof ) to suppress still other pim product sources . materials for configurations addressed herein may vary . as previously noted , copper , copper - bearing alloys , and aluminum alloys are generally usable for at least some parts of apparatus incorporating the invention . for casting , forging , and related processes , some zinc - rich alloys exhibit desirable properties , subject to further enhancement by tin , copper , and / or alloy plating , similar to present processes for manufacturing u . s . one - cent pieces ( pennies ). zinc &# 39 ; s lower conductivity ( than copper , aluminum , and some other alloys ) may be of little effect in view of the low surface current densities of antennas according to the invention . for other forming processes , other materials may be preferred . plating of conductive materials over less - conductive cores may be practical , such as electrodeposition of copper over cores molded from carbon fiber reinforced epoxy . indeed , carbon fiber - reinforced units may be sufficiently conductive for use alone in some embodiments . climate - driven degradation of metallic structural and bond integrity from electronegativity differences has been shown in previous applications to be a minor aspect of at least some combinations of materials in typical environments , but may require verification . insulating coatings may be beneficial , with the understanding that effects on transmitting and receiving characteristics from applying thin layers of dielectrics may require compensation . joining conductive or conductive - surface parts is required in substantially all embodiments . in the instance of copper - over - tin plated cast zinc feeds joined to copper striplines , conventional soft or hard soldering can provide rapid , high - yield , reworkable joints . brazing or welding processes may narrow material choices , while conventional practice for such processes introduces positioning challenges and may tend to produce spatter that can be difficult to find and remove in enclosed spaces . screw assembly , such as in the prototype assembly procedure described above , may require more extensive testing to verify that pim products are absent . fig5 depicts a crossed dipole radiator , in accordance with another embodiment of the present invention . in this embodiment , crossed - dipole radiator 210 transmits and receives signals in the 1 . 8 ghz frequency range . similar in configuration to radiator 110 , the size of the constituent components is respectively reduced to accommodate the higher frequency . so , for example , crossed - dipole radiator 210 includes , inter alia , inner conductors 252 , outer conductors 254 , feed straps 266 , monopole radiating elements 264 , parasitic elements 270 , etc . the many features and advantages of the invention are apparent from the detailed specification , and thus , it is intended by the appended claims to cover all such features and advantages of the invention which fall within the true spirit and scope of the invention . further , since numerous modifications and variations will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation illustrated and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . | 7 |
the following examples illustrate the invention but in no way limit it . a ) 1 . 5 % by volume of 2 - pyrrolidone ( γ - butyrolactam ) and 0 . 285 g of sodium azide were added to 300 ml of antiserum against human apolipoprotein a - i ( from rabbits ), and the antiserum was then sterilized by filtration . following filter sterilization , the antiserum was bottled in 5 ml volumes under sterile conditions . the course of the standard curve did not alter after storage of the antiserum at from + 2 ° to + 8 ° c . over periods of 7 , 16 and 24 months . all the bottled antiserum samples were clear . 300 ml of antiserum against human apolipoprotein a - i ( from rabbits ), but without 2 - pyrrolidone ( γ - butyrolactam ), were sterilized by filtration as described under example 1a ), bottled and stored at from + 2 ° to + 8 ° c . the antiserum exhibited turbidity in all the bottles after only 7 months , and a nephelometric determination of apolipoprotein a - i was not possible without prior filtration . the sera were tested by subjecting a standard series to nephelometric measurement . for this purpose , a standard serum was employed which contained 1 , 620 mg / l apolipoprotein a - i ; the standard series was diluted from 1 : 5 to 1 : 160 using automated equipment , i . e . concentrations of from 324 to 10 mg / l were obtained . 10 μl of standard dilution together with 40 μl of antiserum against human apolipoprotein a - i were employed for the measurement . table 1__________________________________________________________________________ scattered light signal ( bit ) after 16 months after 24 months without with without with after bottling supplement - supplement - supplement - supplement - standard without with after without after withoutdilution supplement supplement filtration filtration filtration filtration__________________________________________________________________________1 : 5 1 , 589 1 , 560 1 , 475 1 , 377 1 , 452 1 , 5021 : 10 1 , 074 1 , 067 1 , 098 1 , 096 982 1 , 0361 : 20 593 589 622 623 546 5711 : 40 287 279 274 304 260 2721 : 80 129 119 92 126 104 1141 : 160 52 42 22 49 22 46value without 2 2 13 0 - 1 2added serumvalue without 2 0 8 3 0 2added serumvalue without 0 - 1 - 4 0 11 0added serumas blank valuemv 2 , 750 160 3 , 700 280 4 , 700 270opt . contr . turbidity clear turbidity clear turbidity clear__________________________________________________________________________ a ) 3 . 0 % by volume of 2 - pyrrolidone ( γ - butyrolactam ) and 0 . 475 g of sodium azide were added to 500 ml of antiserum against human igg ( from rabbits ), and the antiserum was then sterilized by filtration . following filter sterilization , the antiserum was bottled in 5 ml volumes under sterile conditions . the course of the standard curve did not alter following storage of the antiserum at from + 2 ° to + 8 ° c . over a period of 28 months . all the bottled antiserum samples were clear . b ) 500 ml of antiserum against human igg ( from rabbits ), but without 2 - pyrrolidone ( γ - butyrolactam ), were sterilized by filtration as described under example 2a ), bottled and stored at from + 2 ° to + 8 ° c . after 2 years , the antiserum exhibited turbidity and flocculations in all the bottles and was no longer suitable for the nephelometric determination of igg without being filtered once again . the sera were examined by a standard series being subjected to nephelometric measurement . for this purpose , a standard serum containing 12 , 000 mg / l igg was employed ; the standard series was diluted from 1 : 80 to 1 : 2 , 560 using automated equipment , i . e . concentrations of from 150 to 4 . 6 mg / l were obtained . 100 μl of standard dilution together with 40 μl of antiserum against human igg were employed for the measurement . table 2______________________________________ scattered light signal ( bit ) after 24 months without with after bottling supplement - supplement - standard without with after withoutdilution supplement supplement filtration filtration______________________________________1 : 80 1 , 122 1 , 113 1 , 071 1 , 1051 : 160 802 774 782 7581 : 320 520 506 511 4781 : 640 300 283 295 2601 : 1 , 280 146 129 130 1261 : 2 , 560 64 54 47 52value without 0 2 4 1added serumvalue without 0 2 1 3added serumvalue without - 1 2 3 0added serumas blank valuemv 600 270 1 , 600 340opt . contr . clear clear turbidity clear______________________________________ a ) 1 . 5 % by volume of 2 - pyrrolidone ( γ - butyrolactam ) and 0 . 095 g of sodium azide were added to 100 ml of antiserum against human α 1 - antitrypsin ( from rabbits ), and the antiserum was sterilized by filtration . following filter sterilization , the antiserum was bottled in 5 ml volumes under sterile conditions . the course of the standard curve did not alter after storage of the antiserum at from + 2 ° to + 8 ° c . over a period of 1 month . all the bottled antiserum samples were clear . b ) 100 ml of antiserum against human α 1 - antitrypsin ( from rabbits ), but without 2 - pyrrolidone ( γ - butyrolactam ), were sterilized by filtration as described under example 3a ), bottled and stored at from + 2 ° to + 8 ° c . the antiserum exhibited turbidity and flocculations in all the bottles after only 1 month . it was only suitable for the nephelometric determination of α 1 - antitrypsin after renewed filtration . the sera were examined by subjecting a standard series to nephelometric measurement . for this purpose , a standard serum was employed containing 1 , 650 mg / l α 1 - antitrypsin ; the standard series was diluted from 1 : 5 to 1 : 160 using automated equipment , i . e . concentrations of from 330 to 10 . 3 mg / l were obtained . 20 μl of standard dilution together with 40 μl of antiserum against human α 1 - antitrypsin were employed for the measurement . table 3______________________________________ scattered light signal ( bit ) after 1 month without with after bottling supplement - supplement - standard without with after withoutdilution supplement supplement filtration filtration______________________________________1 : 5 1 , 490 1 , 410 1 , 416 1 , 4561 : 10 993 983 957 9811 : 20 608 591 601 5981 : 40 306 318 321 2971 : 80 133 130 134 1301 : 160 48 45 57 46value without 0 0 10 1added serumvalue without 0 0 12 1added serumvalue without 0 0 1 1added serumas blank valuemv 160 120 5 , 430 250bit 7 16 412 13opt . contr . clear clear turbidity clear______________________________________ a ) 1 . 5 % by volume of 2 - pyrrolidone ( γ - butyrolactam ) and 0 . 095 g of sodium azide were added to 100 ml of antiserum against human α 1 - antitrypsin ( from rabbits ), and the antiserum was sterilized by filtration . following filter sterilization , the antiserum was bottled in 5 ml volumes under sterile conditions . the course of the standard curve did not alter after storage of the antiserum at from + 2 ° to 8 ° c . over a period of 6 months . all the bottled antiserum samples were clear . b ) 100 ml of antiserum against human α 1 - antitrypsin ( from rabbits ), but without 2 - pyrrolidone ( γ - butyrolactam ), were sterilized by filtration as described under example 4a ), bottled and stored at from + 2 ° to + 8 ° c . the antiserum exhibited turbidity and flocculations in all the bottles after only 6 months . the standard curve could not be used for the α 1 - antitrypsin determination . the sera were examined by subjecting a standard series to nephelometric measurement . for this purpose , a standard serum was employed containing 2 , 000 mg / l α 1 - antitrypsin ; the standard series was diluted from 1 : 5 to 1 : 160 using automated equipment , i . e . concentrations of from 400 to 12 . 5 mg / l were obtained . 20 μl of standard dilution together with 40 μl of antiserum against human α 1 - antitrypsin were employed for the measurement . table 4______________________________________ scattered light signal ( bit ) after 6 months without with after bottling supplement - supplement - standard without with after withoutdilution supplement supplement filtration filtration______________________________________1 : 5 1 , 670 1 , 705 1 , 685 1 , 8061 : 10 1 , 264 1 , 276 1 , 214 1 , 3501 : 20 841 855 817 8871 : 40 474 507 471 5131 : 80 241 255 232 2791 : 160 113 126 125 128value without 0 2 57 14added serumvalue without 3 6 48 9added serumvalue without 2 8 47 11added serumas blank valuemv 60 100 11 , 140 280opt . contr . clear clear turbidity clear______________________________________ 1 . 5 % of δ - valerolactam and 0 . 095 g of sodium azide were added to 100 ml of antiserum against human α 1 - antitrypsin ( from rabbits ), and the antiserum was sterilized by filtration , bottled and stored at from + 2 ° to + 8 ° c . after 6 months without the addition of the agent according to the invention , the antiserum exhibited massive flocculations , whereas the preparation containing added δ - valerolactam ( prepared in accordance with the invention ) was completely clear and without flocculations or turbidity . a ) 1 . 5 % by volume of 2 - pyrrolidone ( γ - butyrolactam ) and 0 . 095 g of sodium azide were added to 100 ml of antiserum against human prealbumin ( from rabbits ), and the antiserum was sterilized by filtration . following filter sterilization , the antiserum was bottled in 2 ml volumes under sterile conditions . the course of the standard curve did not alter after storage of the antiserum at from + 2 ° to + 8 ° c . over a period of 1 month . all the bottled samples were completely clear and without flocculations . b ) 100 ml of antiserum against human prealbumin ( from rabbits ), but without 2 - pyrrolidone ( γ - butyrolactam ), were sterilized by filtration as described under example 6a ), bottled and stored at from + 2 ° to + 8 ° c . the antiserum exhibited substantial turbidity in all the bottles after only 1 month . it was only possible to use the antiserum for determining prealbumin once the flocculations had been removed by filtration . the sera were examined by subjecting a standard series to nephelometric measurement . for this purpose , a standard serum was employed containing 310 mg / l prealbumin ; the standard series was diluted from 1 : 2 . 5 to 1 : 80 using automatic equipment , i . e . concentrations of from 124 to 3 . 9 . mg / l were obtained . 50 μl of standard dilution together with 40 μl of antiserum against human prealbumin were employed for the measurement . table 5______________________________________ scattered light signal ( bit ) after 2 months without with after bottling supplement - supplement - standard without with after withoutdilution supplement supplement filtration filtration______________________________________1 : 2 . 5 1 , 283 1 , 257 1 , 275 1 , 2781 : 5 995 970 978 9751 : 10 620 612 612 6151 : 20 339 332 347 3351 : 40 183 167 189 1681 : 80 84 71 95 78value without 0 3 10 0added serumvalue without - 1 0 12 1added serumvalue without 2 1 9 3added serumas blank valuemv 120 150 2 , 810 200bit 16 5 389 6opt . contr . clear clear turbidity clear______________________________________ a ) 3 . 0 % by volume of 2 - pyrrolidone ( γ - butyrolactam ) and 0 . 475 g of sodium azide were added to 500 ml of antiserum against human apolipoprotein b ( from rabbits ), and the antiserum was sterilized by filtration . after bottling in 5 ml volumes , the samples were stored at from + 2 ° to + 8 ° c . the samples exhibited neither turbidity nor flocculation after 3 years . 45 . 3 g of sodium azide were added to 47 710 ml of antiserum against human apolipoprotein b ( from rabbits ), and the antiserum was sterilized by filtration and bottled in 5 ml volumes . the bottled samples , which were stored at from + 2 ° to + 8 ° c ., exhibited turbidity and flocculations after 30 months . preparation of a control serum ( human ) for rheumatoid factors , anti - streptolysin o and crp 50 ml samples of rheumatoid factor - positive serum ( human ) from each of 4 different donors were mixed . 19 ml of this serum pool , having a content of 674 iu / ml rf , were diluted with 81 ml of an isotonic solution of sodium chloride and 100 ml of a 1 . 8 % solution of human γ - globulin having a content of approximately 1 , 800 iu / ml asl ( purity , at least 95 %). 10 mg / ml of crp , 0 . 2 g of sodium azide , 5 ml of butyrolactam and 0 . 4 g of benzamidinium chloride were then added . following filter sterilization and bottling , samples were stored at from + 2 ° to + 8 ° c ., at room temperature and at + 37 ° c . without the addition of butyrolactam , the control serum exhibited flocculation after only 2 weeks , whereas the bottled samples to which butyrolactam had been added in accordance with the invention were completely clear and without flocculations after 6 months . a ) 3 . 0 % by volume of 2 - pyrrolidone ( γ - butyrolactam ) and 0 . 475 g of sodium azide were added to 500 ml of antiserum against human α 2 - macroglobulin ( from rabbits ), and the antiserum was sterilized by filtration . after bottling in 5 ml volumes , the bottles were stored at from + 2 ° to + 8 ° c . the bottled samples are completely clear after 2 , 5 , 17 and 26 months . b ) 0 . 475 g of sodium azide was added to 500 ml of antiserum against human α 2 - macroglobulin ( from rabbits ), and the antiserum was sterilized by filtration . the bottled samples , which were stored as in example 7a ), exhibited turbidity and flocculations only 9 weeks after filter sterilization and bottling . the sera were examined by subjecting a standard series to nephelometric measurement . for this purpose , a standard serum was employed containing 1 , 790 mg / l α 2 - macroglobulin ; the standard series was diluted from 1 : 5 to 1 : 160 using automated equipment , i . e . concentrations of from 358 to 11 . 2 mg / l were obtained . 20 μl of standard dilution together with 40 μl of antiserum against human α 2 - macroglobulin were employed for the measurement . table 6__________________________________________________________________________ scattered light signal ( bit ) after 6 months after 18 months without with without with after bottling supplement - supplement - supplement - supplement - standard without with after without after withoutdilution supplement supplement filtration filtration filtration filtration__________________________________________________________________________1 : 5 1 , 208 1 , 141 1 , 300 1 , 190 1 , 304 1 , 2051 : 10 739 687 844 772 836 7331 : 20 421 373 446 421 488 4191 : 40 198 172 230 196 248 1861 : 80 95 75 91 86 111 851 : 160 47 31 45 38 38 33value without 6 1 1 - 6 7 1added serumvalue without 5 0 1 7 0 0added serumvalue without 16 0 2 4 0 0added serumas blank valuemv 1 , 400 140 7 , 460 170 3 , 860 190 90 27opt . contr . clear clear turbidity clear turbidity clear__________________________________________________________________________ | 6 |
fig1 is a diagrammatic view of an advanced field programmable gate array ( fpga ) architecture 100 that includes several different types of programmable logic blocks . for example , the fpga architecture 100 in fig1 has a large number of different programmable tiles , including multi - gigabit transceivers ( mgts ) 101 , configurable logic blocks ( clbs ) 102 , random access memory blocks ( brams ) 103 , input / output blocks ( iobs ) 104 , configuration and clocking logic ( config / clocks ) 105 , digital signal processing blocks ( dsps ) 106 , specialized input / output blocks ( i / o ) 107 ( e . g . configuration ports and clock ports ), and other programmable logic 108 such as digital clock managers , analog - to - digital converters , system monitoring logic , and so forth . the fpga 100 also includes dedicated processor blocks ( proc ) 110 . in the fpga 100 , each programmable tile includes a programmable interconnect element ( int ) 111 having standardized connections to and from a corresponding interconnect element in each adjacent tile . therefore , the programmable interconnect elements taken together implement the programmable interconnect structure for the illustrated fpga . the programmable interconnect element ( int ) 111 also includes the connections to and from the programmable logic element within the same tile , as shown by the examples included at the top of fig1 . for example , a clb 102 can include a configurable logic element ( cle ) 112 that can be programmed to implement user logic plus a single programmable interconnect element ( int ) 111 . a bram 103 can include a bram logic element ( brl ) 113 in addition to one or more programmable interconnect elements . typically , the number of interconnect elements included in a tile depends on the height of the tile . in the pictured embodiment , a bram tile has the same height as five clbs , but other numbers ( e . g ., four ) can also be used . a dsp tile 106 can include a dsp logic element ( dspl ) 114 in addition to an appropriate number of programmable interconnect elements . an iob 104 can include , for example , two instances of an input / output logic element ( iol ) 115 in addition to one instance of the programmable interconnect element ( int ) 111 . as will be clear to those of skill in the art , the actual i / o pads connected , for example , to the i / o logic element 115 typically are not confined to the area of the input / output logic element 115 . in the pictured embodiment , a columnar area near the center of the die ( shown shaded in fig1 ) is used for configuration , clock , and other control logic . horizontal areas 109 extending from this column are used to distribute the clocks and configuration signals across the breadth of the fpga . in other embodiments , the configuration logic may be located in different areas of the fpga die , such as in the corners of the die . some fpgas utilizing the architecture illustrated in fig1 include additional logic blocks that disrupt the regular columnar structure making up a large part of the fpga . the additional logic blocks can be programmable blocks and / or dedicated logic . for example , the processor block proc 110 shown in fig1 spans several columns of clbs and brams . fig1 illustrates one exemplary fpga architecture . for example , the numbers of logic blocks in a column , the relative width of the columns , the number and order of columns , the types of logic blocks included in the columns , the relative sizes of the logic blocks , the locations of the logic blocks within the array , and the interconnect / logic implementations included at the top of fig1 are purely exemplary . in an actual fpga , more than one adjacent column of clbs is typically included wherever the clbs appear , to facilitate the efficient implementation of user logic , but the number of adjacent clb columns varies with the overall size of the fpga . fig2 is a diagrammatic view of another fpga architecture 200 that is an alternative embodiment of and uses the same general architecture as the fpga of fig1 , and that includes several different types of programmable logic blocks . the fpga 200 of fig2 includes clbs 202 , brams 203 , i / o blocks divided into “ i / o banks ” 204 ( each including 40 i / o pads and the accompanying logic ), configuration and clocking logic 205 , dsp blocks 206 , clock i / o 207 , clock management circuitry ( cmt ) 208 , configuration i / o 217 , and configuration and clock distribution areas 209 . in the fpga 200 of fig2 , an exemplary clb 202 includes a single programmable interconnect element ( int ) 211 and two different “ slices ”, slice l ( sl ) 212 and slice m ( sm ) 213 . in some embodiments , the two slices are the same ( e . g . two copies of slice l , or two copies of slice m ). in other embodiments , the two slices have different capabilities . in some embodiments , some clbs include two different slices and some clbs include two similar slices . for example , in some embodiments some clb columns include only clbs with two different slices , while other clb columns include only clbs with two similar slices . fig3 is a circuit schematic showing a conventional circuit 301 that is an integral portion of each of the fpga architectures of fig1 and 2 . the circuit 301 has two input terminals 306 and 307 , and two output terminals 308 and 309 . the input terminals 306 and 307 receive a differential data signal , in the form of a signal pair data_in and data_in_b . the circuit 301 supplies to the output terminals 308 and 309 a differential signal , in the form of a signal pair data_out and data_out_b . the circuit 301 includes a receiver 312 of a type known in the art , and two current sources 316 and 317 of a type known in the art . the receiver 312 and the current sources 316 and 317 are coupled in series with each other across a power source , represented in fig3 by different voltages vcc and gnd . the receiver 312 is disposed electrically between the current sources 316 and 317 . the receiver 312 has a positive input coupled to the input terminal 306 , and a negative input coupled to the input terminal 307 . the receiver 312 also has two complementary outputs that are respectively coupled to the output terminals 308 and 309 . fig4 is a circuit schematic showing the circuit 301 of fig3 , with a different configuration for the input signal . in particular , the input terminal 307 of the circuit 301 is coupled within the ic to a predetermined reference voltage vref , and the input terminal 306 is coupled to a non - differential data input signal data_in . some users will prefer that the circuit 301 of fig3 and 4 provide high performance without regard to power consumption , whereas other users will prefer that the circuit 301 operate with low power consumption , even if there is a sacrifice in performance . the pre - existing circuit 301 of fig3 and 4 can be designed to provide high performance , but in that case it does not optimally meet the requirements of users who need low power consumption . alternatively , the circuit 301 can be designed to provide low power consumption . but in that case it does not optimally meet the requirements of users who need high performance . consequently , regardless of which design approach is used , some users will not be entirely satisfied . fig5 is a circuit schematic showing circuitry 331 that may be an integral portion of an integrated circuit , for example each of the fpga architectures depicted in fig1 and 2 , and that embodies aspects of the invention . as discussed in more detail later , the circuitry 331 is capable of operating in any one of three different operational modes . in a first of these operational modes , the circuitry 331 is disabled . a second operational mode is a high performance mode , where power consumption is a secondary consideration . the third operational mode uses less power , but also provides a lower level of performance . a user can selectively specify which of these three modes the circuit 331 will operate in , depending on the needs of that particular user . in particular , the user can specify that the circuit 331 will be disabled , will operate in a high performance mode , or will operate in a low power mode . the circuit 331 includes a mode control circuit 332 , and a receiver circuit 333 . in the embodiment of fig5 , the mode control circuit 332 contains two memory cells that are not separately shown , and that each store a single binary bit . the mode control circuit 332 has two outputs that each correspond to a respective memory cell , and that are each coupled to the receiver circuit 333 . as discussed above , fpga architectures of the type shown in fig1 and 2 have some capability to be configured or programmed by an end user . as part of this programming process , the user will specify whether each of the two memory cells in the mode control circuit 332 is to store a binary “ 0 ” or a binary “ 1 ”. the state of the binary bits in the memory cells will determine whether the receiver circuit 333 is disabled , operates in the high performance mode , or operates in the low power mode . the receiver circuit 333 has two data input terminals 336 and 337 , and two data output terminals 338 and 339 . the input terminals 336 and 337 receive a differential input signal , in the form of a signal pair data_in and data_in_b . the receiver circuit 333 supplies to the output terminals 338 and 339 a differential output signal , in the form of a signal pair data_out and data_out_b . the receiver circuit 333 also includes a receiver 342 of a type known in the art , and two current sources 343 and 344 of a type known in the art . the receiver 342 and the current sources 343 and 344 are coupled in series with each other across a power source , represented in fig5 by different voltages vcc and gnd . the receiver 342 is disposed electrically between the current sources 343 and 344 . the receiver 342 has a positive input coupled to the input terminal 336 , and a negative input coupled to the input terminal 337 . the receiver 342 also has two complementary outputs that are respectively coupled to the output terminals 338 and 339 . the receiver circuit 333 also includes two additional current sources 351 and 353 , which are each a circuit of a type known in the art . the current source 351 is coupled in parallel with the current source 343 . the current source 353 is coupled in parallel with the current source 344 . the current sources 343 , 344 , 351 and 353 each have an enable input . the enable inputs of the current sources 343 and 344 are coupled to one output of the mode control circuit 332 , and the enable inputs of the current sources 351 and 353 are coupled to the other output of the mode control circuit . as mentioned above , the receiver circuit 333 has three operational modes . in the first operational mode , the memory cells in the mode control circuit 332 each contain a binary “ 0 ”, and the current sources 343 , 344 , 351 and 353 are all disabled , thereby effectively disabling the entire receiver circuit 333 . in a second operational mode , the memory cells in the mode control circuit 332 each contain a binary “ 1 ”, and the current sources 343 , 344 , 351 and 353 are all enabled . the current sources 343 , 344 , 351 and 353 serve to provide a generous flow of current to the receiver 342 , so that the receiver 342 provides a high level of performance , but with a correspondingly high level of power consumption . in a third operational mode , one of the memory cells in the mode control circuitry 332 contains a binary “ 1 ”, and the other memory cell contains a binary “ 0 ”, such that the current sources 343 and 344 are enabled , but the current sources 351 and 353 are disabled . as a result , only the current sources 343 and 344 provide current to the receiver 342 , and less current therefore flows through the receiver than when the current sources 343 , 344 , 351 and 353 are all enabled . consequently , the receiver circuit 333 consumes less power , but also provides a lower level of performance . although fig5 shows one extra current source 351 coupled in parallel with the current source 343 , and one extra current source 353 coupled in parallel with the current source 344 , it would alternatively be possible to have a larger number of current sources coupled in parallel with each of the current sources 343 and 344 , and the mode control circuit 332 could optionally control each of the extra current sources . the current sources may be of equal or different sizes . for instance , each extra current source coupled in parallel may provide double the current of the precious current source . as a different alternative , fig5 shows the mode control circuit 332 controlling each of the current sources 343 , 344 , 351 and 353 . however , the mode control circuit 332 could control only the current sources 351 and 353 . the current sources 343 and 344 could operate independently of the mode control circuit , and always be enabled . in this configuration , the receiver circuit would have just two operational modes , in particular the high performance mode and the low power mode . in another embodiment , current sources 351 and 353 may be larger than current sources 343 and 344 , and an additional mode may be added where current sources 351 and 353 are enabled , and current sources 343 and 344 are disabled , where the additional mode may offer intermediate performance and power consumption . fig6 is a circuit schematic showing the circuitry 331 of fig5 , but with a different input configuration . in particular , the two input terminals 336 and 337 do not receive a differential signal . instead , the input terminal 337 is coupled within the ic to a predetermined reference voltage vref . the input terminal 336 receives a data signal data_in that is not a differential signal . fig7 is a circuit schematic showing circuitry 361 that may be an integral portion of an integrated circuit , for example each of the fpga architectures of fig1 and 2 , and that embodies aspects of the invention . the circuitry 361 includes a mode control circuit 362 , and a receiver circuit 363 . the mode control circuit 362 contains two memory cells that are not separately shown . each of these memory cells can be programmed by a user to contain either a binary “ 1 ” or a binary “ 0 ”. the mode control circuit 362 has two outputs that each correspond to a respective memory cell , and that are each coupled to the receiver circuit 363 . the receiver circuit 363 has two data input terminals 366 and 367 , and these input terminals receive a differential data signal , in the form of a signal pair data_in and data_in_b . the circuit 363 also has two output terminals 368 and 369 , and the receiver circuit 363 supplies to the output terminals 368 and 369 a differential signal , in the form of a signal pair data_out and data_out_b . the receiver circuit 363 includes two receivers 371 and 372 of a known type , and four current sources 376 , 377 , 378 and 379 of a known type . the receiver 371 and the current sources 376 and 377 are coupled in series with each other across a power source , represented here by different voltages vcc and ground . similarly , the receiver 372 and the current sources 378 and 379 are coupled in series with each other across the same power source . the receiver 371 is disposed electrically between the current sources 376 and 377 , and the receiver 372 is disposed electrically between the current sources 378 and 379 . the receivers 371 and 372 each have a positive input that is coupled to the input terminal 366 , and a negative input that is coupled to the input terminal 367 . further , the receiver 371 has complementary outputs that are respectively coupled to the output terminals 368 and 369 , and the receiver 372 has complementary outputs that are respectively coupled to the output terminals 368 and 369 . the receivers 371 and 372 each have an enable input . the enable input of the receiver 371 is coupled to one output of the mode control circuit 362 , and the enable input of the receiver 372 is coupled to the other output of the mode control circuit 362 . the receiver circuit 363 has three operational modes . in the first operational mode , the memory cells in the mode control circuit 362 each contain a binary “ 0 ”, and the receivers 371 and 372 are each disabled . in a second operational mode , the memory cells in the mode control circuit 362 each contain a binary “ 1 ”, and the receivers 371 and 372 are both enabled . the receiver circuit 363 provides high performance , but with a correspondingly high level of power consumption . in a third operational mode , one of the memory cells in the mode control circuitry 362 contains a binary “ 1 ”, and the other memory cell contains a binary “ 0 ”, such that the receiver 371 is enabled and the receiver 372 is disabled . the receiver circuit 363 therefore consumes less power , but also provides a lower level of performance . fig8 is a circuit schematic showing the circuitry 361 of fig7 , but with a different input configuration . in particular , the input terminal 367 is coupled within the ic to a pre - determined reference voltage vref . the input terminal 366 receives a non - differential data input signal data_in . although the circuitry 361 of fig7 and 8 has two receivers 371 and 372 that can each be selectively enabled and disabled , it would alternatively be possible to provide a larger number of receivers that can be selectively enabled and disabled . although selected embodiments have been illustrated and described in detail , it should be understood that a variety of substitutions and alterations are possible without departing from the spirit and scope of the present invention , as defined by the claims that follow . | 7 |
with reference to the accompanying drawings , fig1 generally illustrates in somewhat exaggerated relation the provision of a ventilating hatch 10 of the present invention as it might be viewed on the fore portion of the deck d of a sailing craft wherein ventilating air is admitted through a slotted opening 12 in an outer hatch shell portion 24 , the air passing therethrough and along a tortuous path for delivery into the space below decks as in a cabin or elsewhere . with regard to fig3 wherein the unique hatch 10 in its simplest form is seen in cross section , an inner generally rigid shell member 14 includes a substantially planar central area 16 bounded by a forward transverse elongated protuberance 18 and a generally similar protuberance 20 at the rear thereof . the inner shell 14 further preferably includes a peripheral flange therearound as indicated at 22 . disposed thereof over and cooperating therewith is a generally similar outer shell member 24 which includes a central portion 26 substantially planar in nature and which is visibly of smaller extent that the planar area 16 of the inner shell . the shells 14 , 24 are preferably formed from sheets of heavy gauge plastic as by the thermoforming and have sufficient rigidity and structural strength to bear the weight of personnel who might be expected to step thereon and other rough usage . it is desirable that the plastic material be transparent or translucent in aiding illumination below the hatch . as set forth more fully hereinafter , the inner shell provides substantial support to and for the outer shell , whereby relatively transparent materials as acrylic and polycarbonate resins may be employed . while plastic is a preferred material due to ease of handling , corrosion resistance and available transparency , other material as sheet metal might be employed if desired . as with the inner shell , the outer shell includes forward and rear protuberances respectively at 28 and 30 . it will be seen that the respective inner and outer members 24 , 14 complementarily generally nest one within the other and more particularly , the front wall 32 of inner shell rear protuberance 20 is in spaced relation to the front wall 34 of outer shell rear protuberance 30 . in like manner , it will be seen that the rear wall 36 of forward protuberance 18 of inner shell 14 is in spaced relation to the rear wall 38 of the forward protuberance 28 of the outer member 24 . further , the slope of the rear wall 38 in such that the adjacent planar central section 26 is in vertically spaced relation to the planar section or area 16 of the inner shell member . as above noted , the front wall 34 of the outer shell rear protuberance is transversely slotted or apertured at 12 and it will be seen that the rear wall 36 of the forward protuberance 18 of the inner shell 14 is similarly slotted at 40 . further , the rearwardly - facing slot 40 has its lower edge in vertically spaced relation to the planar central area 16 . the outer member 24 is also peripherally flanged as at 42 so as to sit upon in overlying relation to the like flange 22 on the inner shell . this is with the exception of drain areas 44 about the outer shell flange is elevated with respect to flange 22 so that drainage may occur from within the nested shells and between the flanges at such spaced locales . as seen in the drawings , the outer member 24 is firmly supported by engagement within the protuberances 28 , 30 thereof of the inner shell protuberances 18 , 20 . in order to further reinforce the construction thereby to rigidify the same for encountered rough use or necessary stepping thereupon , the inner member along the inner planar portion 16 is provided with one or more upstanding embossments 46 which vertically span the distance between the planar portion 16 and that of the outer member at 26 so as to engage the latter thereat and support the same . the inner shell may further include small bosses 47 adjacent the flange which extend toward and may contact the inner face of outer shell 24 and aid in properly centering the shells when initially nested . as with the interfitting engagement of respective elongated protuberances , the embossments 46 may be mechanically or chemically bonded by adhesives to the adjacent surface if desired , along with the interfitting protuberances and overlying flanges to form a unit - handled assembly . it is desirable that insects as well as pieces of trash and the like be precluded from entering the hatch . to this end a length of screening as at 48 may be secured to the periphery of the outer shell slotted opening 12 . it should be noted that air inlet opening 12 is spaced rearwardly of and somewhat protected by forward protuberance 28 against accidental impact . further , it may be necessarily desirable that ventilation or air flow be controlled or shut - off through the ventilating hatch of the present invention when undesired or unnecessary . to this end closure means are provided in the nature of a valve assembly 50 . in a preferred and effective form thereof , the valve assembly 50 includes an elongated closure plate 52 of an area as great as the slot 12 . plate 52 is supported on a plurality of rods 54 connected to a handle or like member 56 disposed in front wall 32 of the rear protuberance 20 of the inner member 14 and is thus accessible from below . seal means in the nature of grommets 58 of rubber or the like serve to support and provide frictional restraint for the rods 54 of the valve assembly 50 , whereby with the handle 56 from within the cabin or otherwise beneath the hatch assembly , the closure plate 52 may be shifted forwardly to completely block the slot 12 or may be moved rearwardly as desired and frictionally held in the space between the front walls 34 , 32 of the rear protuberances of the inner and outer shell members as is evident . in this manner , highly effective and simple control of the ventilating action is achieved . the ventilating hatch in use is secured about an opening through the deck to space below . in the form shown for simple and permanent installation , the peripheral flanges 22 , 42 are provided with screw holes for securing the same . it is within the scope of the invention that the hatch might be mounted for upward pivoting as a unit about one edge for general access through the port or for uncontrolled ventilation . in like manner , the hatch assembly may be associated with spaced parallel channels on opposite sides thereof so that the hatch as a unit may slide in a rectilinear manner to uncover the deck opening when desired . such pivot hinge and slide mountings per se for hatch covers are well known in the art and form no part of the instant invention . in use , it will be seen that with the hatch 10 in position upon the deck of a boat , or indeed upon the roof of a building or a vehicle such as a van , camper or the like , ventilating air may pass into the hatch through the slot 12 in the outer shell 24 and thence impinge against the forward wall 32 of the inner protuberance so as to be reversed in flow and directed forwardly between the upper and lower planar portions 16 , 26 of the shells and thence through slot 40 in the rear wall 36 of the forward protuberance 18 , and thence downwardly into the cabin , building , vehicle or the like . screen 48 precludes entry of larger trash , while the tortuous airflow path will permit many other dirt and dust particles to fall onto the central planar portion 16 and not be carried into the cabin . similarly , spray , rain or other moisture passing through the screen will collect on the planar portion 16 of the lower shell , and cannot readily pass upwardly along wall 36 and into air flow slot 40 . any excess moisture or liquid will readily pass laterally outwardly through drains 44 back onto the deck or other comparable surface . it will be seen that the ventilating hatch thus described is of minimum vertical height and provides the least possible impediment to crewmembers who may work therearound or other personnel that may necessarily work in proximity to such ventilating hatch constructions , while yet providing highly effective ventilation . further , note that the top portions of outer shell protuberances 28 , 30 are substantially flat to aid footing thereon . while in the prefered embodiment the low - profile hatch of the invention is substantially square and has a single air inlet 12 , it is within the scope of the invention to provide elongate or larger hatches with two or more air inlets , depending upon the construction and ventilating needs of the vessel . an illustrative modification is shown in fig5 wherein hatch 60 includes a fore - to - aft elongated configuration with two spaced air inlets 12 . the construction is essentially two duplicate assemblies conforming to fig3 with each shell formed from a single sheet . other modifications will be apparent to those skilled in the art . one actual form of the invention , the respective inner and outer shell members comprise thermoformed sheets of heavy gauge transparent plastic on the order of 1 / 8 inch . the hatch is on the order of 13 inches square , with a total height of only about 21 / 2 inches . it will be seen that substantial ventilation is thus achieved comparable or superior to a dorade box or the like , yet with an exceeding low profile . with the mutual support between the shells at the protuberances embossments and flanges , an exceptionally rigid , durable and rugged construction is provided . | 1 |
fig1 shows the general layout of the safety lighting system of a trailer 10 . at the front end 12 of the trailer is a front receptacle 14 . the front receptacle 14 is used to connect a multi - wire cable or wiring harness ( not shown ) from the tractor . front marker lights 16 are located in opposite top corners of the trailer &# 39 ; s front end , and are provided electrical power via cables 18 emanating from the front receptacle 14 . a main multi - wire cable 20 runs longitudinally along the floor 22 of the trailer from the front receptacle 14 to a rear receptacle 24 . electrical power is provided to the rear marker lights 28 , identification lights 29 , and stop , tail , and turn lights 30 , from the rear receptacle 24 via cables 32 . fig2 shows two trailers in tandem alignment . the leading trailer 34 and the second trailer 36 are electrically connected by a power cord or jumper cable assembly 38 between the rear receptacle of the leading trailer and the front receptacle of the second trailer . the rear receptacle 24 may be a standardized seven - conductor electrical connector receptacle socket 42 for a tractor - trailer jumper cable , as standardized by the society of automotive engineers ( sae standard j560 jun93 ), with a configuration as shown in fig3 . the connector socket 42 contains six male ( prong ) contacts 44 radially located at approximate 60 ° intervals around the arc of the connector and a seventh male contact 44 in the center . ( analogizing to a clock face , the male contacts 44 are located at 12 , 2 , 4 , 6 , 8 , and 10 o &# 39 ; clock positions and the center position ). the seven contacts are color coded in the following manner : beginning at the top position and moving clockwise , white , black , yellow , red , green , brown and blue in the center . corresponding female contacts are on a plug of the jumper cable assembly 38 . the power supply connector of the present invention is a modification of the standard receptacle , as shown in fig4 and 5 and generally indicated by the numeral 60 . the connector 60 includes a housing 62 with a hinged cover 64 , which houses the receptacle socket 42 containing the seven male contacts 44 . the housing is generally cylindrical in shape and fashioned from cast aluminum or plastic . the cover 64 is hingeably attached to the housing 62 at a hinge joint 68 . in the closed ( unconnected ) position of fig4 the cover 64 lies flat across the top of the connector 60 , closing off its upper end . as described earlier with reference to fig1 electrical power is provided to the stop , tail , and turn (&# 34 ; s / t / t &# 34 ;) lights 30 from the rear receptacle 24 via cables 32 . primary power from blue ( number seven ) circuit to abs 33 ( fig2 ) and back - up power for abs is conventionally derived from the cable associated with the red ( number four ) contact of the standardized seven - conductor receptacle . [ following the standardized receptacle : white ( number one )-- ground return to towing vehicle ; black ( number two )-- clearance , side marker , and identification lamps ; yellow ( number three )-- left turn signal and hazard lamps ; green ( number five )-- right turn signal and hazard lamps ; brown ( number six )-- tail and license plate lamps ; and blue ( number seven )-- abs power ]. in the present invention , however , the connection to the stop lights is re - routed via an electrical lead 77 that couples the red male contact 76 to a switch 80 . the stop light cable ( shown as 78 in fig4 and 5 ) is also connected to switch 80 in the manner described below . the switch 80 is enclosed in a housing 81 secured to the exterior of the connector housing 62 . the switch comprises a first breaker bar 82 and a longer second breaker bar 84 , each breaker bar 82 , 84 having a contact button 86 , 88 , preferably gold - plated . the lead 77 is connected to a terminal end of a conductive breaker bar 82 , and cable 78 is connected to a terminal end of another conductive breaker bar 84 . an aperture 92 through the switch housing 81 and the connector plug housing 62 contains a roller 94 and a lever 96 to actuate , or open and close the switch 80 . the roller 94 and lever 96 assembly serve as an actuator . when the switch 80 is closed , as shown in fig4 the roller 94 is positioned such that about one - half of its cross - sectional diameter extends into the interior 98 of the connector plug housing 62 . the lever 96 is connected to the roller 94 and extends through the aperture 92 to connect to the open end of the second breaker bar 84 . the breaker bars are spring - biased to the closed position of fig4 . when the switch 80 is closed , the electrical circuit providing power to the rear stop lights on the trailer is closed , thus routing power to the lights when the appropriate control switches in the tractor are activated . when a second trailer 36 is connected in tandem with the first trailer 34 , a jumper cable 38 is inserted into the connector 60 as shown in fig5 . the cover 64 is raised to enable the insertion . the jumper cable 38 is a standard seven conductor jacketed cable for truck - trailer connections ( sae j1067 ) having a cable plug 110 with seven female contacts that engage the corresponding seven male contacts 44 of the connector plug 60 . the insertion of the plug 110 into the connector 62 pushes the roller 94 into the aperture 92 , away from the receptacle housing 62 , which in turn causes the lever 96 to move up overcoming the spring force on the breaker bars and causing the contacts 86 , 88 to separate , thus opening the switch 80 . the open switch 80 interrupts current from being supplied to the stop lights of the first trailer . as a result , approximately 4 amps of current is saved , and may be diverted for other uses such as the abs circuitry . although the present invention has been described in detail in connection with the above embodiments , it should be understood that there can be other embodiments and that variations can be made by those skilled in the art without departing from the spirit of the invention . for example , the function of the switch 80 may instead be accomplished by a different type of contact switch , or by a proximity sensor switch or other type of current or power interrupter , all of which should be encompassed by the term &# 34 ; switch &# 34 ; as used in the claims . the switch could also be activated by opening of the cover instead of insertion of the plug . the invention may also be easily modified for incorporation in other multi - conductor cable standards , such as twelve , thirteen and fifteen conductor systems being considered as iso future standards . | 1 |
30 . an effective hbv dna vaccine provides advantages over a protein subunit vaccine because dna is stable under a variety of conditions . this allows for ease in storage and shipping , especially in lesser developed countries . because the vaccine need not contain an adjuvant ( see example i below ), raw material costs and manufacturing costs are lower . like hbv subunit vaccines , hbv dna vaccines are safer than vaccines based on live vectors such as viruses or bacteria . additional advantages include the production of a more native antigen conformation , ease of modifying the amino acid sequence of the antigen , and ability to co - deliver nucleic acids that can express other antigens or polypeptide adjuvants ( e . g ., cytokines ). 31 . the nucleic acid vaccines of the invention can be used as prophylactic vaccines in naive individuals , or as therapeutic vaccines in individuals already infected with hbv . 33 . an hbcag polypeptide encoded by a nucleic acid used in the methods or compositions of the invention is any protein or polypeptide sharing an epitope with a naturally occurring hbcag . such functionally related hbcag polypeptides can differ from the wild type hbcag sequence by additions or substitutions within the hbcag amino acid sequence . amino acid substitutions may be made on the basis of similarity in polarity , charge , solubility , hydrophobicity , hydrophilicity , and / or the amphipathic nature of the residues involved . 34 . nonpolar ( hydrophobic ) amino acids include alanine , leucine , isoleucine , valine , proline , phenylalanine , tryptophan , and methionine . polar neutral amino acids include glycine , serine , threonine , cysteine , tyrosine , asparagine , and glutamine . positively charged ( basic ) amino acids include arginine , lysine , and histidine . negatively charged ( acidic ) amino acids include aspartic acid and glutamic acid . 35 . hbcag variants with altered amino acid sequences can be obtained by random mutations to hbcag dna ( see u . s . pat . no . 5 , 620 , 896 ). this can be achieved by random mutagenesis techniques known in the art . following expression of the mutagenized dna , the encoded polypeptide can be isolated to yield highly antigenic hbcag . alternatively , site - directed mutations of the hbcag coding sequence can be engineered using techniques also well - known to those skilled in the art . 36 . in designing variant hbcag polypeptides , it is useful to distinguish between conserved positions and variable positions . to produce variants with increased antigenicity , conserved residues preferably are not altered . alteration of non - conserved residues are preferably conservative alterations , e . g ., a basic amino acid is replaced by a different basic amino acid . similar mutations to the hbcag coding sequence can be made to generate hbcag polypeptides that are better suited for expression in vivo . 37 . the nucleic acids useful in the methods and compositions of the invention include at least three components : ( 1 ) a hbcag coding sequence beginning with a start codon , ( 2 ) a mammalian transcriptional promoter operatively linked to the coding sequence for expression of the hbcag , and ( 3 ) a mammalian polyadenylation signal operably linked to the coding sequence to terminate transcription driven by the promoter . in this context , a “ mammalian ” promoter or polyadenylation signal is not necessarily a nucleic acid sequence derived from a mammal . for example , it is known that mammalian promoters and polyadenylation signals can be derived from viruses . 38 . in addition , complete hbcag nucleic acid sequences are known . see , e . g ., pasek et al ., nature 282 : 575 - 579 ( 1979 ), which discloses a sequence available under genbank accession no . j02202 . 39 . the nucleic acid vector can optionally include additional sequences such as enhancer elements , splicing signals , termination and polyadenylation signals , viral replicons , and bacterial plasmid sequences . such vectors can be produced by methods known in the art . for example , nucleic acid encoding the desired hbcag can be inserted into various commercially available expression vectors . see , e . g ., invitrogen catalog , 1998 . in addition , vectors specifically constructed for nucleic acid vaccines are described in yasutomi et al ., j virol 70 : 678 - 681 ( 1996 ). 41 . the nucleic acids of the invention can be administered to an individual , or inoculated , in the presence of substances that have the capability of promoting nucleic acid uptake or recruiting immune system cells to the site of the inoculation . for example , nucleic acid encapsulated in microparticles have been shown to promote expression of rotaviral proteins from nucleic acid vectors in viva ( u . s . pat . no . 5 , 620 , 896 ). 42 . a mammal can be inoculated with nucleic acid through any parenteral route , e . g ., intravenous , intraperitoneal , intradermal , subcutaneous , intrapulmonary , or intramuscular routes . it can also be administered , orally , or by particle bombardment using a gene gun . muscle is a useful tissue for the delivery and expression of hbcag - encoding nucleic acid because mammals have a proportionately large muscle mass which is conveniently accessed by direct injection through the skin . a comparatively large dose of nucleic acid can be deposited into muscle by multiple and / or repetitive injections . multiple injections can be used for therapy over extended periods of time . 43 . administration of nucleic acids by conventional particle bombardment can be used to deliver nucleic acid for expression of hbcag in skin or on an mucosal surface . particle bombardment can be carried out using commercial devices . for example , the accell iiυ ( powderject vaccines , inc ., middleton , wis .) particle bombardment device , one of several commercially available “ gene guns ”, can be employed to deliver nucleic acid - coated gold beads . a helios gene gun ( bio - rad ) can also be used to administer the dna particles . information on particle bombardment devices and methods can be found in sources including the following : yang et al ., proc natl acad sci usa 87 : 9568 [ 1990 ]; yang , crc crit rev biotechnol 12 : 335 [ 1992 ]; richmond et al ., virology 230 : 265 - 274 [ 1997 ]; mustafa et al ., virology 229 : 269 - 278 ( 1997 ); livingston et al ., infect immun 66 : 322 - 329 ( 1998 ) and cheng et al ., proc natl acad sci usa 90 : 4455 [ 1993 ]. 44 . in some embodiments of the invention , an individual is inoculated by a mucosal route . the hbcag - encoding nucleic acid can be administered to a mucosal surface by a variety of methods including nucleic acid - containing nose - drops , inhalants , suppositories , or microspheres . alternatively , a nucleic acid vector containing the hbcag gene can be encapsulated in poly ( lactide - co - glycolide ) ( plg ) microparticles by a solvent extraction technique , such as the ones described in jones et al ., infect immun 64 : 489 ( 1996 ); and jones et al ., vaccine 15 : 814 ( 1997 ). for example , the nucleic acid is emulsified with plg dissolved in dichloromethane , and this water - in - oil emulsion is emulsified with aqueous polyvinyl alcohol ( an emulsion stabilizer ) to form a ( water - in - oil )- in - water double emulsion . this double emulsion is added to a large quantity of water to dissipate the dichloromethane , which results in the microdroplets hardening to form microparticles . these microdroplets or microparticles are harvested by centrifugation , washed several times to remove the polyvinyl alcohol and residual solvent , and finally lyophilized . the microparticles containing nucleic acid have a mean diameter of 0 . 5 μm . to test for nucleic acid content , the microparticles are dissolved in 0 . 1 m naoh at 100 ° c . for 10 minutes . the a 260 is measured , and the amount of nucleic acid calculated from a standard curve . incorporation of nucleic acid into microparticles is in the range of 1 . 76 g to 2 . 7 g nucleic acid per milligram plg . 45 . microparticles containing about 1 to 100 μg of nucleic acid are suspended in about 0 . 1 to 1 ml of 0 . 1 m sodium bicarbonate , ph 8 . 5 , and orally administered to mice or humans , e . g ., by gavage . 46 . regardless of the route of administration , an adjuvant can be administered before , during , or after administration of the nucleic acid . an adjuvant can increase the uptake of the nucleic acid into the cells , increase the expression of the antigen from the nucleic acid within the cell , induce antigen presenting cells to infiltrate the region of tissue where the antigen is being expressed , or increase the antigen - specific response provided by lymphocytes . 48 . before administering the vaccines of this invention to humans , efficacy testing can be conducted using animals . in an example of efficacy testing , mice are vaccinated by intramuscular injection . after the initial vaccination or after optional booster vaccinations , the mice ( and negative controls ) are monitored for indications of vaccine - induced , hbcag - specific immune responses . methods of measuring hbcag - specific immune responses are described in the examples below and also in townsend et al ., j virol 71 : 3365 - 3374 ( 1997 ); kuhober et al ., j immunol 156 : 3687 - 3695 ( 1996 ); kuhrober et al ., int immunol 9 : 1203 - 1212 ( 1997 ); geissler et al ., gastroenterology 112 : 1307 - 1320 ( 1997 ); and sallberg et al ., j virol 71 : 5295 - 5303 ( 1997 ). 49 . anti - hbcag serum antibody levels in vaccinated animals can be determined using the core anti - hbc kit ( cat . no . 2259 - 20 , abbott gmbh , weisbaden , germany ). the concentrations of anti - hbcag antibodies are standardized against a readily available reference standard of the paul - ehrlich institute ( langen , germany ). 50 . cytotoxicity assays can be performed as follows . spleen cells from immunized mice are suspended in complete mem with 10 % fetal calf serum and 5 × 10 − 5 m 2 - mercapto - ethanol . cytotoxic effector lymphocyte populations are harvested after 5 days of culture , and a 5 - hour 51 cr release assay is performed in a 96 - well round - bottom plate using target cells . the effector to target cell ratio is varied . percent lysis is defined as ( experimental release minus spontaneous release ) / ( maximum release minus spontaneous release )× 100 . 51 . the invention is further illustrated by the following examples . the examples are provided for illustration only , and are not to be construed as limiting the scope or content of the invention in any way . example 1 : administration of hbcag nucleic acid by intramuscular injection into mice 52 . to construct an expression vector for use as the hbcag nucleic acid vaccine , two plasmids were used ( fig2 ). the pjw4303 plasmid containing a cytomegalovirus immediate - early promoter with intron a and a bovine growth hormone polyadenylation signal was described in yasutomi et al ., j virol 70 : 678 - 681 ( 1996 ). the fragment containing the hbcag - coding sequence was derived from plasmid pyta1 , which was described in yie et al ., chinese j virol 4 : 312 - 318 ( 1988 ). the hindiii - bamhi fragment of pyta1 included the full coding sequence of hbcag without any precore viral sequences upstream of the hbcag start codon . the hbcag nucleic acid vaccine vector was generated by inserting the hindiii - bamhi fragment of pyta1 into the hindiii and bamhi sites in the polylinker of pjw4303 , the polylinker being just downstream of the cytomegalovirus intron a in pjw4303 . the new vector was designated pjw4303 / hbc . 53 . to test for expression of hbcag from the new plasmid , pjw4303 / hbc was used to transfect 293t cells . 48 hours after transfection , the cell lysates were harvested and subjected to elisa and western blotting . transient expression of hbcag in 293t cells was clearly demonstrated by both methods . 54 . after confirming that the pjw4303 / hbc drove expression of hbcag in vitro , the plasmid was used to vaccinate mice by intramuscular injection . a total of 100 μg of pjw4303 / hbc in saline was bilaterally injected into the quadriceps muscles of a balb / c mouse and a c57bl / 6 mouse . a second balb / c mouse and c57bl / 6 mouse received 100 μg of pjw4303 in like fashion as controls . the mice were supplied by taconic farms , inc . and maintained in the animal colony facility of the university of massachusetts medical center . all mice were 6 - 8 weeks old females at the time of the first inoculation . the injections were repeated at 4 and 8 weeks after the first inoculation . 55 . at 0 , 4 , 8 , and 12 weeks after the initial immunization ( bleedings 1 - 4 , respectively ), serum samples were taken from all four mice . end - point titration of anti - hbc antibodies was performed by elisa using a microtiter plate coated with recombinant hbcag protein ( 0 . 1 μg / well ). three - fold serially diluted serum samples were incubated in the coated wells for 30 minutes . the liquid was then removed , and the wells washed . the wells were then incubated with biotinylated goat anti - mouse igg for 30 minutes , followed by washing . streptavidin - linked horseradish peroxidase ( hrp , vector laboratories , inc .) was then added and incubated for 30 minutes , followed by washing . hrp substrate 3 , 3 ′, 5 , 5 ′- tetramethylbenzidine ( tmb ) was then added to the wells to develop color , and the amount of converted substrate was read in a microplate reader . 56 . as shown in fig3 a , the anti - hbcag antibody levels in the balb / c mouse receiving pjw4303 / hbc ( hatched bars ) was above that of the balb / c mouse receiving the control plasmid ( solid bars ) by the third bleeding . as shown in fig3 b , the anti - hbcag antibody levels in the c57 / bl6 mouse receiving the pjw4303 / hbc plasmid was above that of the control mouse by the second bleeding . the titers determined by elisa were confirmed using the corezyme kit ( abbott ), which was standardized against the serum standard available from the paul - ehrlich institute . it was determined that the titer of about 150 , 000 by the fourth bleeding in hbcag immunized mice represented an unexpected titer of at least about 500 pei units / ml . previous publications have described anti - hbcag antibody responses of no more than 10 pei units / ml in animals receiving a hbcag nucleic acid vaccine ( kuhober et al ., j immunol 156 : 3687 - 3695 [ 1996 ] and kuhrober et al ., int immunol 9 : 1203 - 1212 [ 1997 ]). 57 . to determine if any cytotoxic t cell response against hbcag was generated in immunized mice , the mice were sacrificed at 12 weeks after the third inoculation . single spleen cell suspensions were prepared . cytotoxic effector lymphocyte populations were harvested after 6 days of culture and resuspended at 1 × 10 6 cells / ml . a 4 - hour 51 cr release assay was performed in a 96 - well round - bottom plate using p815 cells ( h - 2 d - restrictive , for balb / c mice ) or el - 4 cells ( h - 2 b restrictive , for c57 / bl6 mice ) as the target cells . the synthesized h - 2 d - restricted peptide syvntnmgl , ( seq id no : 2 ) was added to the balb / c spleen cell reaction at 10 μg / ml , and the synthesized h - 2 b - restricted peptide ( mglkfrql ; seq id no : 3 ) was added to the c57 / bl6 spleen cell reaction , also at 10 μg / ml . the effector cell to target cell ( e : t ) ratios used were 12 : 1 , 6 : 1 , 3 : 1 , 1 : 1 , and 0 . 5 : 1 . percent lysis was defined as ( experimental release - spontaneous release ) / ( maximum release - spontaneous release )× 100 . 58 . as shown in fig4 a , at least 50 % specific lysis could be achieved by an e : t ratio of above 6 : 1 in balb / c mice vaccinated with pjw4303 / hbc . a similar immune response was observed in the c57 / bl6 mice . as shown in fig4 b , at least 50 % specific lysis could be achieved by an e : t ratio of 12 : 1 in mice vaccinated with pjw4303 / hbc . thus , the pjw4303 / hbc nucleic acid vaccine , without adjuvants , elicited both significant antibody and cell - mediated immune responses in animals . 59 . to test another route of administration , the pjw4303 / hbc and the pjw4303 control dna was delivered intradermally by particle bombardment . the accell ii ™ particle bombardment device ( powderject vaccines , inc ., middleton , wis .) was employed to deliver dna - coated gold beads to the epidermis of two balb / c and two c57 / bl6 mice , one of each pair receiving the hbcag plasmid and the other of each pair receiving the control dna . 60 . for delivery by particle bombardment , dna was precipitated onto 0 . 95 or 1 - to 3 - μm gold beads ( degussa , south plainfield , n . j .) with 100 mm spermidine and 2 . 5 m cacl 2 at 1 μg of dna per 0 . 5 mg gold shot ( eisenbraun et al ., dna cell biol 12 : 791 - 797 [ 1993 ]). 61 . mice were anesthetized with 30 μl of ketaset / rompun ( 10 : 2 ). abdominal target areas were shaved and thoroughly rinsed with water prior to gene delivery . nucleic acid - coated gold particles were delivered into abdominal skin with the accell ii ™ gene gun , which employed a helium discharge as the motive force . each animal received six nonoverlapping deliveries per immunization , each delivery at 300 - 400 pounds per square inch . the immunization was repeated at 4 weeks and 8 weeks after the first immunization . 62 . antibody and cytotoxic t cell responses were determined as described in example 1 above . as shown in fig5 a , the immunization elicited an antibody titer of over 300 , 000 ( corresponding to at least about 1000 pei units / ml ) in a balb / c mouse by the third bleeding . again , like the intramuscular results in example 1 , this antibody response was unexpectedly high as compared to previous studies . the antibody response elicited in the c57 / bl6 mouse was comparable to that for the balb / c mice ( fig5 b ). as shown in fig6 a and 6b , the cytotoxic responses in the two strains of mice receiving pjw4303 / hbc were similar to that for the intramuscular results described in example 1 above . greater than 50 % specific lysis was observed at an e : t ratio of 12 for both strains of mice . 63 . these results indicated that the hbcag nucleic acid vaccine described herein produced humoral and cell - mediated immune responses by a variety administration methods . 64 . the expression vector ( pjw4303 / hbc ) described in examples 1 and 2 was also used as an hbcag nucleic acid vaccine to vaccinate monkeys . after confirming that the pjw4303 / hbc vector drove expression of hbcag in vitro , the plasmid was used to vaccinate monkeys by intramuscular injection . 65 . monkeys in group i ( animals # 1 and # 2 ) were immunized with hbcag nucleic acid vaccine while the other two monkeys in group ii (# 3 and # 4 ) received control plasmid dna vector without the hbc insert . each animal received 2 . 0 mg of dna plasmids intramuscularly ( im ) at each inoculation ( delivered equally as 500 μg shots at four muscle sites ). the dna inoculations were given every two months . animal sera were collected prior to each inoculation and elisa was done to detect anti - hbv antibody responses . 66 . table 1 below shows antibody responses induced by the hbcag nucleic acid vaccine in monkeys . monkeys immunized with the hbcag nucleic vaccine (# 1 and # 2 ) clearly had hepatitis b core specific antibody responses after one immunization ( animal # 1 ) or two immunizations ( animal # 2 ), respectively . two negative control monkeys ( animal # 3 and # 4 ) had no antibody responses against the hepatitis b core antigen . in table 1 (+) indicates a positive antibody response for hepatitis b core antigen , while (−) means a negative antibody response for hepatitis b core antigen . n / d indicates a test was not done . animal # 1 died of unrelated diseases before sample collection at the 4th month . 67 . because it is more difficult to induce immune response by im dna immunization in primates , the hbcag nucleic acid vaccine demonstrated its highly efficient potential to be developed as a clinical vaccine for human use . | 0 |
a mixture of alkali lactate and lactic acid is first of all prpared in process steps ( a ) and ( b ). this can be done by mixing alkali lactate with lactic acid in the specified amounts or by neutralizing the lactic acid with such amounts of alkali hydroxide or carbonate , so that a mixture of alkali lactate and lactic acid in the desired mixing ratio is formed . if a water - containing lactic acid is used , such as , for example , the 88 % commercial lactic acid , it is advisable to subsequently remove the water . this mixture may now be esterified with citric acid and the partial glycerides of fatty acids by one of two alternative processes . in the two - step process , the mixture of lactic acid and alkali lactate is initially reacted at temperatures of 120 ° to 140 ° c . with removal of the water of reaction by , for example , the application of a vacuum . subsequently , this mixture , consisting of lactic acid and citric acid , is esterified with the aforementioned amounts of partial glycerides of fatty esters , the water of reaction again being removed by known procedures . however , it is also possible to carry out the process in one step . in this case , the mixture of alkali lactate and lactic acid is directly esterified with a mixture of citric acid and the partial glycerides of fatty acids in the above - specified amounts at temperatures of 120 ° to 140 ° c . with removal of the water of reaction . the esterification temperatures , which are between 120 ° and 140 ° c . for both processes , are limited by the fact that , at lower temperatures , the esterification reaction proceeds too slowly , and , at higher temperatures , discolorations take place in which the citric acid may be decomposed , condensed or converted to products which are not always absolutely physiologically safe . for the process of the present invention , a partial glyceride of fatty acid is used which preferably contains at least 50 weight % of a monoester . the use of a molecularly distilled partial glyceride of fatty acid , with a monoester content of about 90 weight % is preferred . the fatty acids of the partial glyceride may be saturated or unsaturated . when using fatty esters whose fatty acids are relatively long - chained and saturated , solid , brittle products are formed which can be sprayed to a fine , flowable powder which do not form lumps . as the content of the unsaturated fatty acids or saturated , relatively short - chained fatty acids increases , wax - like to pasty substances are formed . the alkali content , calculated as sodium , can be varied between about 0 . 5 and 5 . 5 weight %, and the fatty acids , corresponding to the lipophilic emulsifier portion , between 26 and 60 weight %. from this it can be seen that the lipophilichydrophilic balance ( hlb value ) of the inventively prepared surface - active substances comprises the very wide range of about hlb 8 to hlb 14 . the ph of the aqueous solutions is 2 . 9 to 5 . 5 . the inventively prepared products are dispersable or soluble in cold water . the products of the present process are exceptionally suitable for use in pharmacy and cosmetics , as well as in foods and animal feeds . the products have a neutral odor . in general , it is unnecessary to subject the process products to any particular further treatment . however , for special applications , it is possible to treat them with activated charcoal or other substances of high adsorption capability , such as , for example , silica gel . the color of the products is bleached by such a treatment and the taste occasionally becomes more neutral . the inventive process is explained in greater detail in the following examples . the acid number given represents the mg / koh , which are required to neutralize the substance . the ph was measured at 22 ° c . in a 4 % aqueous solution . 5 . 6 g of sodium lactate ( 0 . 5 moles ), 90 g of lactic acid ( 1 mole ), 192 g of citric acid ( 1 mole ) and 800 g of 90 % glycerol monostearate ( 2 moles ) are heated with stirring for 21 / 2 hours at 140 ° c . an ivory - colored , brittle , wax - like product is formed . a solution of 64 g of potassium lactate ( 0 . 5 moles ), 65 g of sodium lactate ( 0 . 5 moles ) and 135 g of lactic acid ( 1 . 5 moles ) are heated with 192 g of citric acid for 30 minutes under vacuum at 125 ° c . to the clear , syrup - like reaction mass , 400 g of molecularly distilled lard monoglyceride ( 1 mole ) and 400 g of molecularly distilled soybean oil monoglyceride ( 1 mole ) are added and heated for 3 hours at 135 ° c . the amber - colored pasty end product has an acid number of 40 and a ph of 5 . 1 . 40 g of sodium hydroxide ( 1 mole ) are reacted with 308 g of lactic acid ( 88 %, 3 moles ), reacted at 70 ° c . with 800 g of molten , 90 % glycerol monostearate ( 2 moles ) and 192 g of citric acid ( 1 mole ) and then heated under vacuum to 130 ° c . after 4 hours , and ivory - colored , wax - like , brittle product is formed . 65 g of potassium hydroxide ( 86 %, 1 mole ) and 205 g of lactic acid ( 88 %, 2 moles ) are dehydrated under vacuum at 100 ° c . subsequently mixed with 940 g of a 50 % glycerol monostearate ( 2 moles ) and 192 g of citric acid ( 1 mole ) and heated for 4 hours at 135 ° c . a yellowish , hard , wax - like product is formed . 128 g of potassium lactate ( 1 mole ) 90 g of lactic acid ( 1 mole ) 400 g of 90 % monostearate ( 1 mole ) and 192 g of citric acid ( 1 mole ) are heated for 4 hours at 130 ° c . the bright yellow , brittle product has an acid number of 78 and a ph of 4 . 2 . 112 g of sodium lactate ( 1 mole ), a 180 g of lactic acid ( 2 moles ), 400 g of glycerol monostearate ( 1 mole ) and 192 g of citric acid ( 1 mole ) are heated for 3 hours at 140 ° c . a glassy , transparent , hard brittle product is formed . 60 g of sodium hydroxide ( 1 . 5 moles ) are reacted with 308 g of lactic acid ( 88 %, 3 moles ) and heated with 400 g of glycerol monostearate ( 1 mole ) and 192 g of citric acid ( 1 mole ) for 31 / 2 hours at 135 ° c . the final product has an amber - like appearance , is transparent and brittle . 256 g of potassium lactate ( 2 moles ), 90 g of lactic acid ( 1 mole ), 400 g of glycerol monostearate ( 1 mole ) and 192 g of citric acid ( 1 mole ) are heated for 21 / 2 hours at 140 ° c . a shiny , ivory - colored , hard product is formed . 112 g of sodium lactate ( 1 mole ), 180 g of lactic acid ( 2 moles ), 384 g of citric acid ( 2 moles ) and 400 g of glycerol monostearate ( 1 mole ) are heated for 41 / 2 hours at 125 ° c . a shiny , slightly tacky , hard product is formed . 336 g of sodium lactate ( 3 moles ), 360 g of lactic acid ( 4 moles ), 384 g of citric acid ( 2 moles ) and 400 g of glycerol monostearate ( 1 mole ) are heated for 5 hours at 120 ° c . a transparent , glassy , slightly tacky , amber - colored product is formed . | 2 |
[ 0017 ] fig1 schematically illustrates a tubular , dual cage ei ion source 2 . a thoriated tungsten ribbon filament 4 , advantageously having a width of 0 . 75 mm , a thickness of 25μ and a length of 30 mm , serves as an electron emitter , producing a typical emission current of 10 ma . preferably , filament 4 is initially carborized for achieving higher emission currents at lower filament temperatures . the ionizing electrons are repelled by an electron repeller 6 , biased 30 - 150 v below the filament potential . surrounding the commonly used internal cage 8 , there is provided a second , external cage 10 , biased positively in comparison with the potential on the filament 4 , and thus forming a dual - cage ion source . ionization is performed in chamber 12 within internal cage 8 . ion source 2 has an input port 14 , preferably constituted by a molecular beam collimator 16 , serving for collimation and spatial definition of the molecular beam of a sample introduced via the input port and propelling axially through the ion source . typically , the diameter d 1 of the beam collimator is 2 . 3 mm . at the opposite side of the ion source 2 , there is formed an output port 18 , advantageously constituted by a disk 20 positioned at the bottom of the ion source , having a tubular portion 22 projecting toward chamber 12 . typically , the diameter d 2 of output port 18 is 4 . 5 mm , the diameter of internal cage 8 is 10 mm , and the diameter of external cage 10 is 14 mm . the mounting clamps for filament 4 and electrical insulators are not shown . during a typical operation , the filament 4 is biased on − 66 v for achieving 70 ev electron energy , the external cage 10 is biased at + 5 v , and the internal ion cage 8 is biased at + 4 v , which constitutes the electrical ion energy applied . the actual ion energy , however , is 4v + the initial kinetic energy of the neutral beam compounds . both cages 8 and 10 are made of fine , 50 - mesh , gold - coated tungsten ( 25μ wire diameter and 0 . 5 mm unit cell length ) having 90 % electron transmission and mounted on three tungsten rods having a diameter of 0 . 5 mm . the heated filament emits electrons that are attracted to the external cage 10 and then travel to and through chamber 12 within inner ion cage 8 . upon the scattering of electrons from the sample compounds , ions are formed . these ions can be slightly attracted by a focusing lens 24 , having a low voltage of 0 - 2 v , for their attraction and extraction . there is also provided an ion lens 26 , which serves for background ion filtration by low voltage biasing . for achieving effective background filtration , a low positive voltage such as 0 . 3 v is applied to the outer ion lens 26 , serving to practically eliminate residual vacuum background ions , while transmitting ions with initial directional neutral kinetic energy above this value . the ion cage 8 has a close to zero field inside it ; thus , ions formed from thermal vacuum background compounds are not extracted and are eventually neutralized . on the other hand , ions formed from species in a supersonic molecular beam move axially to the ion source lenses 24 , 26 and are extracted with minimal vacuum background . the dual cage ion source 2 has been tested and it performed well and in full agreement with computer - based ion trajectory simulations . it was found that the addition of a second , external cage , i . e ., cage 10 , shields the internal ion cage 8 and , as a result , the ion source 2 possesses several unique features , providing the following advantages over the standard brink type ion source : 1 ) improved background ion filtration is achieved . thus , there is a lower magnitude of chemical noise . the proper shielding of the ion cage resulted in considerably narrower ion energy distribution function . as a result , only + 0 . 3 v is required to be applied to ion lens element 26 for the full elimination of thermal ions formed from the vacuum background . without the addition of the outer cage , about + 2 v were required . this feature is desirable for gc - ms with smb . in addition , it is especially useful for lc - ms with smb , in view of the considerably lower kinetic energy of its smb species , due to the use of methanol or water as the carrier gas instead of the much lighter helium or hydrogen . 2 ) the obtainable emission current is , surprisingly , slightly improved , despite the addition of the second cage . this emission current increase originates from the ability to locate the filament closer to the second cage than it is in the standard ei ion source to the ion cage , since we were not concerned with filament field penetration into the ion cage . a closer filament position results in a higher electron extraction field for a given voltage difference between the filament and outer cage and thus , there is less space charge hindrance . furthermore , a more open mesh was used , having 90 % transmission instead of 80 %, to compensate for the loss of emission due to the added second cage , since the ion cage was properly shielded and thus did not require a dense mesh faraday cage . 3 ) the resulting ion beam optics were improved and had straight axial trajectories ; thereby , the ion signal was increased , mostly due to reduced filament potential penetration to the ion cage and the elimination of its attraction effect on the ion trajectories . 4 ) the operational ( signal ) reproducibility and long term stability were improved , since variations in the position of the filament due to its thermal expansion and aging did not affect the ion trajectories and ion optics . in time , and depending on the composition of residual vacuum compounds and analysis history , the filament work function may change and accordingly the filament temperature which is required to provide a given predetermined electron emission current , may also change . as a result , the filament may expand at higher temperatures , change its position , and consequently , the resulting magnitude of field penetration into the ion cage will change , in a single cage design . 5 ) the obtained mass spectra are more reproducible and have lower mass spectral distortion , due to lower losses of low mass fragments through the background filtration process . 6 ) increased maximum emission current are obtained at low electron energies . in fact , both the repeller and outer cage potentials may be biased on the filament potential and thus , a change of the electron energy will not produce any change in the electrical fields between the filament and the outer cage . the emission current is thus uniquely unaffected , due to variations of the electron energy . this feature is of considerable importance for achieving soft ei with molecular ion only at low electron energies and for obtaining effective negative ion ei through low electron energy electron attachment . 7 ) fast automated switching between 70 ev and 20 ev electron energies ( or any other electron energy value , including scanning of the electron energy ) is achieved , since the filament heating current may now become independent on the electron energy . this feature can serve for alternate scans switching of the electron energy in gc - ms or lc - ms with smb . 8 ) the addition of the second cage enables the use of a longer filament in a circular filament configuration since the diameter of the filament circle is larger , as it relates to a given distance from the larger outer cage instead of the inner cage . circular filament mounting is advantageous over axial filament mounting when a short ion source is desirable in order to be closer to the supersonic nozzle for the ionization of higher molecular beam density and thus achieve improved ionization efficiency . on the other hand , the proper mounting of a circular filament is more difficult than that of a straight filament . the use of a circular filament was tested , and it was found that its performance is independent on its location along the ion cage axis and is similar to that of the standard axial filament . however , upon positioning the circular filament near the entrance of the ion source , a larger smb collimator can be used , having an anticipated higher ionization yield at the price of increased smb carrier gas load on the ion source vacuum chamber . improved ion beam intensity , by a factor of 2 . 6 +− 0 . 6 , was measured with the dual cage ion source , over the same ion source without the outer cage . this sensitivity enhancement factor was measured through the delivery of a constant flux of hexadecane into the ion source using a direct sample introduction device , as well as through single ion monitoring results with gc - ms analysis of pyrene , using a gc - ms with smb . furthermore , the vacuum background noise was also reduced and thus , the signal - to - noise ratio measured with the gc - ms analysis of pyrene was improved by a factor of 6 . 4 +− 2 , in comparison with the performance of the same ion source with a single cage . with electron energies below 20 ev , the sensitivity improvement factor was lower than expected , since while the emission current could be higher , the adverse effect of filament field penetration with a single cage ion source was lower at low electron energies . the actual gain in sensitivity depended on how low the electron energy was . this ion source was used with electrons for sample ionization . however , it is easy to realize that photons provided by either a lamp or a laser can also be used for sample ionization , especially in smb , for achieving superior background ion filtration and sensitivity . the ionizing photons can be introduced axially or perpendicular to the ion cage , directly through the dual cage meshes . while a heated filament is the most convenient source of electrons , plasmas can also be employed for the provision of large currents of ionizing electrons . a plasma electron source involves high electrical fields and thus can induce field penetration into the ion cage , which is minimized with the dual ion cage configuration . while the additional cage was used for the elimination of filament and electron repeller field penetration into the ion cage , this shielding can also be achieved by other means . for example , one can use a denser mesh at the ion cage , with the sacrifice of reduced ionizing electron current inside the ion cage and substantially reduced contribution of electron multiple paths to the ionization efficiency . it is noted that since the outer cage is positioned about 2 mm around the inner cage , the dual cage design provides much better shielding against external field penetration than a single mesh with the same transmission as that of the two cages of the dual cage ion source . this observation is understood in terms of the greater distance of the filament from the inner cage , and the fact that two separated cages provide more effective electrical shielding than a single cage with a mesh of twice the thickness . naturally , three or more cages can also be provided for even better shielding , however , usually this is not required . a larger ion cage volume can be used for better shielding of the central volume of the beam species , but this may also result in increased ionization of the vacuum background and thus more noise . furthermore , the filament can more easily lose its proper orientation with respect to the center of the cage and induce background ionization instead of preferential smb species ionization . a single cage ion source with ion cage diameter of 14 mm exhibited surprisingly poor performance in comparison with a 10 mm diameter single cage , due to suspected internal space charge effects that are not fully understood . the electron source can be further removed from the ion cage and even a separate electron gun can be used for the elimination of the filament potential penetration , at a cost of increased complexity . however , only the dual cage design is capable of providing all of the improvement features described above . the dual cage ion source can be effectively used with a few advantages in several applications , including : 2 ) lc - ms with supersonic molecular beams . in this system , the smb species kinetic energy is limited in view of the use of methanol , water or acetonitrile vaporized solvents as the carrier gas . thus , the achievement of vacuum background filtration is more challenging and therefore the use of this ion source in lc - ms with smb system is desirable . 3 ) negative ion source . the considerably higher low electron energy electron current can substantially improve the negative ion formation yield and provide an effective electron attachment negative ion source . 4 ) molecular beam detection . while with hyperthermal supersonic molecular beams , vacuum background filtration can be relatively easily achieved , based on the large difference in ion energies at the ion cage , this filtration is much harder to achieve with pure ( unseeded ) supersonic or other types of molecular beams . however , the feature of a close to zero field in the ion cage with the dual cage ei ion source could enable vacuum background filtration even for the lower energy beam compounds in pure smb . 5 ) chemical process studies . in many cases the products of chemical reactions , photo dissociation , high - energy electron , ion , or atom - induced surface sputtering , or any other energetic chemical processes may lead to species with some directional kinetic energy . with the dual cage ion source , even a small amount of initial axial ion energy can be used for achieving vacuum background filtration and thus considerable improvement in the achievable signal - to - noise ratio and measurement sensitivity . 6 ) in ion guns based on the use of supersonic molecular beams , the achievement of vacuum background filtration can help in the chemical purification of the ion beam and also improve its collimation and narrow its ion energy distribution function . it will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrated embodiments and that the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . | 7 |
referring now to fig1 , an electronic data system 10 suitable for use with the present invention may , for example , provide a server 12 providing one or more processors 14 communicating with electronic memory 16 . the server 12 may also communicate with a mass storage device 20 , for example , holding a database of information viewable by a user or functions executable by a user ( either by client - side or server - side applications ). the server 12 may also communicate with a network 22 connected with various user terminal devices 24 including , for example , desktop computers , as well as tablets and other mobile devices . the user terminal devices 24 , as will be understood in the art , may provide for display screens and user input devices such as keyboards , mice , etc ., coordinated through an associated processor and memory holding an operating system and one or more application programs or the like . typically the user terminal devices 24 will execute browser functionality to display data elements and to execute functions in coordination with server 12 as is generally understood in the art . the memory 16 of the server 12 ( in communication with the mass storage device 20 ) may include , for example , a database program 26 and a network server program 25 as coordinated by an operating system 31 as is generally understood in the art , for example , a windows or linux operating system . the electronic memory 16 may also include an adaptive menu program 30 of the present invention as will be described below providing multiple hotlists 34 associated with individuals as will be discussed below . the adaptive menu program 30 will operate to invoke various functions 28 , for example , for the display or manipulation of data in the storage device 20 . referring now to also to fig2 , the adaptive menu program 30 may control the appearance of the displays of the terminal devices 24 providing the user with information or functions . in one nonlimiting example , the display may provide information or functions arranged in a set of ordered tabs 32 typically representing a subset of a larger set of information or functions . as will be understood in the art , individual information or function elements may be selected by selecting individual tabs 32 that typically include labels to guide the user for that purpose . such selection may , for example , be provided by touching the tab 32 using a touchscreen or clicking on the tab 32 using a mouse or the like to allow the user to review the information or interact with the function or information . for example , tabs 32 may provide for functions or information related to allowing the user to : ( 1 ) browse a catalog , ( 2 ) make a quick order , ( 3 ) review the user &# 39 ; s order history ; ( 4 ) review messages to the user ; and ( 5 ) review approvals to make orders . the tabs 32 will be logically associated with a hotlist 34 including a set of logical rows of list elements 33 , each row related to one tab 32 , and each row having different logical columns related to different categories of information or type of function . each list element 33 , for example , may link tab information 36 , for example , pointing to particular information or a program executable when the tab 32 has focus , to a list - order number 38 used to determine the order of the list elements 33 and hence the tabs 32 as displayed on the terminal device 24 . the list - order numbers 38 also define a subset of tabs 32 that will be displayed , the subset normally being the “ top ” tabs 32 according to a sorting of the hotlist list - order numbers 38 . in this regard , it will be appreciated that a wide variety of different displays can be associated with a hotlist 34 other than one incorporating tabs 32 including the pulldown menu displays , bulleted lists of hotlinks , tree displays , text lists and the like . henceforth these different application elements ( tabs 32 , pulldown menu elements , bulleted lists , etc .) will be termed collectively display elements 32 . as will now be discussed , the list - order numbers 38 of the hotlist 34 are adjusted according to recent interactions by the user with the associated functions or information for each list element 33 , for example , measured by how often the menu item is invoked or “ clicked ”. changing the list - order numbers 38 changes the display order of the display elements 32 in the hotlist 34 and hence defines which display elements 32 are displayed and the order of the display of the display elements 32 . generally , a different hotlist 34 may be associated with each different user so that the hotlist provides a personalized user experience . this may be done , for example , by providing a different hotlist linked to a user identification 35 for each user based on the user &# 39 ; s login information . similarly , hotlist 34 may be associated with departments or functions within a business so as to contain a historical “ memory ” of transactions within that department or business that may be shared by all users . in this case the user identification 35 may be a department embracing a variety of login credentials . likewise a hotlist 34 may be associated with particular activities by a user for which all of the elements of the hotlist 34 may be relevant but may have different importance . multidimensional hotlist 34 may relate to particular combinations of individuals tasks or departments coded in the user identification 35 referring now to fig2 and 3 , the list - order numbers 38 of the hotlist 34 may be arbitrarily initialized to a set of unique numbers ( for example , sequential integers held in floating - point variables ) by the program 30 before any user interaction . this ordering may reflect a before - the - fact expectation of frequency of use of each menu element 32 . in a preferred embodiment , these initialized list - order numbers 38 may then be normalized to an average value , such as one , by dividing each number by the current mean ( average ). the highest list element 33 in the hotlist 34 will have the highest list - order number 38 . at any time after this initialization , as indicated by process block 42 , a new list element 33 may be entered into the hotlist 34 by assigning it a list - order number 38 within the range of list - order numbers . when the new list element 33 is intended to be inserted between two other list elements 33 , the assigned list - order number 38 of the new list element 33 will be numerically between the list - order numbers 38 of the flanking list elements 33 . thus , for example , if element c is to be placed between element a , the latter having an list - order number 38 of 1 . 3 and element b , the latter having an list - order number of 1 . 4 , element c may be given an list - order number of 1 . 35 . one method of selecting this list - order number is simply to average the list - order numbers of the flanking display elements 32 . if the new list element 33 is to be the top list element , it may be given a list - order number 38 larger than any other list element 33 . thus , for example , if element c is to be placed at the top of the hotlist 34 and the currently highest valued list - order number is 1 . 4 , element c may be given a list - order number of 2 . 4 . one method of selecting such a list - order number is to add one to the highest value of the existing list - order numbers . a list element 33 may be removed at any time without adjustment of the list - order numbers 38 of the remaining list elements 33 . the list element 33 may be removed or its list order - number removed ( i . e . set to a null value ) to similar effect it will be appreciated that this change in the hotlist 34 will be accompanied by corresponding graphical changes in the display of the display elements 32 to insert the menu element 32 in a particular location between existing display elements 32 , or to place a new menu element 32 on the display ( typically removing a lower ranked menu element ) or to remove a menu element 32 promoting a lower ranked menu element 32 and those elements below that menu element 32 . once the elements of the hotlist 34 have been assembled , their ordering may be changed upon interaction by the user with a given menu element and corresponding hotlist element 33 ( designated e i in fig3 ) having index ii as indicated by process block 44 where i is the relative order of list - order numbers 38 of the hotlist 34 such as will generally be in accordance with relative values of the list - order numbers 38 . list - order number i is zero for the uppermost list element 33 having the highest list - order number 38 . per process block 44 , interaction can be flexibly defined , for example , to mean a viewing of particular data elements associated with the list element 33 or invoking a function associated with the element 33 . in one example , any menu element 32 that has “ focus ” as defined by the operating system may be counted as an interaction at the time of receiving focus . note that focus may be distinguished from the visibility of the menu element 32 in that a visible menu element 32 may still not have focus attained by clicking on the tab with the mouse or the like . at decision block 46 , a determination is made as to whether element 33 associated with i i ( being the subject of interaction ) is the uppermost element ( e . g ., having a list - order number 38 designated i 0 ). if not , the program 30 proceeds to process block 48 and an updated list - order number i i is calculated computing the difference between i i of the current element and the list - order number of the next highest element i i - 1 , adding to that difference a constant fractional value c between zero and one ( in this example 0 . 1 ) and dividing that entire quantity by a step value d greater than one ( in this example 2 ) per the following equation ( 1 ): referring now to fig4 , consider the list element 33 designated c and being the subject of recent interaction and having list - order number 38 of i i of 4 . assume that the next highest list element 33 designated b has a list - order number 38 of 3 . the height of these list elements s and c as depicted in fig4 will be generally representative of the relative size of its list - order number 38 with respect to other list elements 33 . the modification of equation ( 1 ) will increase the value of i i for list element c by one half the distance between element c and the next highest element b plus a small increment c as indicated by arrow 50 . specifically , the list - order number 38 for c will increase from 3 to 3 . 55 per the following calculation : in this way , in the next interaction with c , the height of element c ( and hence its list - order number 38 ) will be such as to have taken over the position of second place list element 33 ( b ) per arrow 52 upon a succeeding sorting of the list elements 33 at process block 54 shown in fig3 . the parameter d roughly determines how many interactions with a given list element 33 are necessary to bring a given list element above the next higher list element . this number of necessary interactions is largely independent of the separation between the given list element 33 and the next higher list element 33 thus preventing a given list element from being submerged for a long period of time beneath a higher list element that was previously popular over a long period of time but is no longer popular . the increment c prevents ties between successive list elements 33 as they are promoted ( e . g ., being the ease where both have the same list - order number 38 ) and prevents the step distance of rising element c ( being determined with respect to its distance from element b ) from carrying over into the transition of rising element c with respect to element a . it will be appreciated that the system is sensitive to the history of interactions between the user and the user interface beyond the most immediate interaction ( the history being proportional to d ) but does not require separate history data to be stored because this history is implicitly stored within the list - order numbers 38 . at process block 56 , after the sort block of 54 , each of the list - order numbers 38 for each list element may be re - normalized by dividing them by the mean value although it will be recognized that this process need not occur upon each change of an element because the sorting will remain unaffected by this step which is intended simply to prevent long - term overflow . at process block 58 , the display on the terminal devices 24 as provided by the server 12 may be changed according to the new sorting of the hotlist 34 , for example , as shown in fig2 by providing a new set of display elements 32 or changing the ordering of the display elements 32 , for example , so that the most frequently used tab is farthest to the right ( as shown in the figure ) and initially is visible albeit without “ focus ”. referring now to fig3 and 5 , if at decision block 46 the given list element 33 having interaction is the uppermost list element having an list - order number i 0 , then at process block 49 the amount of upward movement ( e . g ., the incrementing of i 0 upon each interaction ) is determined with respect to the element proceeding element i 0 ( e . g ., i 1 ) by computing the difference between the list - order number i 0 and i 1 , adding to that difference the constant fractional value c and dividing that entire quantity by the step value d as before and per the following equation ( 2 ): the result is that list element 33 associated with list - order number i 0 continues to rise as indicated by arrow 60 albeit not in a way that prevents lower elements 33 from quickly catching up to it . the program 30 then proceeds through process blocks 54 , 56 , and 58 as discussed above before looping back to either of process blocks 42 or 44 depending on the next interaction . while the example shows the list - order numbers as floating - point fractional numbers , it will be appreciated that they may also be integers , for example , normalized to a large number , for example , 10 , 000 , to ensure adequate space for introduction of new list elements . calculations described above may then be performed with integer arithmetic . certain terminology is used herein for purposes of reference only , and thus is not intended to be limiting . for example , terms such as “ upper ”, “ lower ”, “ above ”, and “ below ” refer to directions in the drawings to which reference is made . terms such as “ front ”, “ back ”, “ rear ”, “ bottom ” and “ side ” describe the orientation of portions of the component within a consistent but arbitrary frame of reference which is made clear by reference to the text and the associated drawings describing the component under discussion . such terminology may include the words specifically mentioned above , derivatives thereof , and words of similar import . similarly , the terms “ first ”, “ second ” and other such numerical terms referring to structures do not imply a sequence or order unless clearly indicated by the context . when introducing elements or features of the present disclosure and the exemplary embodiments , the articles “ a ”, “ an ”, “ the ” and “ said ” are intended to mean that there are one or more of such elements or features . the terms “ comprising ”, “ including ” and “ having ” are intended to be inclusive and mean that there may be additional elements or features other than those specifically noted . it is further to be understood that the method steps , processes , and operations described herein are not to be construed as necessarily requiring their performance in the particular order discussed or illustrated , unless specifically identified as an order of performance . it is also to be understood that additional or alternative steps may be employed . references to any computing device can be understood to include one or more computing devices that can communicate in a stand - alone and / or a distributed environment ( s ), and can thus be configured to communicate via wired or wireless communications with other processors , where such one or more processor can be configured to operate on one or more processor - controlled devices that can be similar or different devices . furthermore , references to memory , unless otherwise specified , can include one or more processor - readable and accessible memory elements and / or components that can be internal to the processor - controlled device , external to the processor - controlled device , and can be accessed via a wired or wireless network . it is specifically intended that the present invention not be limited to the embodiments and illustrations contained herein and the claims should be understood to include modified forms of those embodiments including portions of the embodiments and combinations of elements of different embodiments as come within the scope of the following claims . all of the publications described herein , including patents and non - patent publications , are hereby incorporated herein by reference in their entireties . | 6 |
referring to fig1 there is shown a nozzle support structure 10 with a planar impingement plate 12 . liner 14 has a plurality of arcuate sections 16 with axially extending linear portions 18 located between the arcuate portions . airflow openings 20 located in the impingement plate direct cooling air against the liner 16 with this air convectively cooling the liner as it passes aft and out the end . interlocking clip pairs 22 are each comprised of a first clip 24 located on the linear portion of the liner and a second clip 26 located on the impingement plate . fig2 is a top view of the assembly with liner 16 removed . clips 24 secured to the liner are , however , shown in one portion of the drawing to illustrate their relationship to clips 26 . clips 26 located on impingement plate 20 are spaced and have a tapered edge 28 to facilitate assembly with clips 24 . a flat bar 30 extends substantially the length of the liner with clips 24 extending therefrom at spaced locations . these clips 24 engage corresponding clips 26 as shown . for installation the clips ( 24 and 26 ) are placed out of engagement , the surface is pressed together , and the liner slid axially for engagement as shown . cantilever spring 32 retains the liner in position as described in more detail hereinafter . it is noted , however , that this retainer spring 32 need not be located with every bar 30 and preferably is at two or three locations . referring to fig3 an optional spring travel retainer 34 is shown . this limits the travel of the spring beyond its uncompressed condition as shown and the fully required depressed condition against the impingement plate . the travel limiter 34 must be located at such a point that it does not interfere with axial travel of clip 24 on liner 14 . the liner 14 is placed with the clips ( 24 and 26 ) out of engagement as described above and slid into place . clip 24 engages stop 36 located on impingement plate 12 which limits and retains axial motion in a first direction . spring 32 which has been depressed below clip 24 for initial installation springs upwardly and abuts the end of clip 24 to prevent axial travel in the other direction . this functions to retain the liner against axial movement while the opposite end of the liner is free to expand as required . an opening 38 in the liner permits inspection to determine that the spring is released and engaged . it also provides access for depressing the spring for later disassembly and removal of the liner . a rivet 40 or any other appropriate closing means may be used to close this hole against air leakage during operation . fig4 illustrates in more detail the spring arrangement with the liner omitted . clip 26 secured to liner 12 can be seen with the leading edge 28 tapered . the spring travel retainer is omitted in this view . stop 36 is brazed , and may be bolted to the planar impingement plate 12 . fig5 is similar to fig4 but illustrates the liner in place with clip 24 abutting stop 36 . spring 32 abuts or is closely spaced from clip 24 . the clearance between the spring and the clip 24 plus the clearance between the clip 24 and the stop is nominally on the order of 0 . 030 inches ( 0 . 762 mm ). access opening 38 is shown in the liner . thus , there is provided an apparatus for retaining the liner wherein the liner is easy to install and also easy to remove when required . there is no interference with either the cooling airflow or the gas flow passing through the nozzle . it eliminates access cover plates and eliminates welding and fitting . it provides a means for inspecting for positive engagement of the stop . | 8 |
in the art of using formwork in the building of concrete structures , wet or plastic concrete is poured inside an assembly of formwork . the formwork is comprised of flat panels , panels that can be preformed to assume a curvilinear shape , forms that have a predetermined , fixed curvilinear shape , corner forms , and a variety of other forms for both general and specific applications such as are known in the art . these forms have a face sheet or the like against which the plastic concrete is poured and which , accordingly , determines the contour of the final concrete structure in the area of the form . in many instances , the individual forms are placed adjacent other forms and are held in place by clamps , fasteners , connectors , walers , shoring posts , and the like . by combining the variety of forms into a formwork assembly , virtually any desired shape of building structure can be formed . plastic concrete is a heavy fluid that can exert very large forces on the formwork until the concrete has sufficiently cured . accordingly , it is critical that the shoring and other support apparatus used to hold the forms in place be sufficiently strong to resist the forces of the plastic concrete . this has become of even greater importance in recent years with the increased use of modem concrete formulations which have a lower viscosity and allow higher heads of plastic concrete to be used in the formwork . it is also important that proper registry of the forms is achieved during initial assembly of the formwork and maintained throughout the pouring of concrete inside the formwork . customarily , a plurality of form panels are used to form part of a concrete structure . the panels are arranged so that face sheets of the panels define the surface of the concrete structure being formed . often , it is desired that the finished concrete structure be smooth and uniform , relatively free of form marks or the like that may result in the area of transition from one form to the adjacent form . the likelihood of such undesirable markings is reduced or eliminated if the forms are designed and manufactured to close tolerances and then assembled and held in place with the face sheets of adjacent panels in contact engagement along the length of the adjacent edges of the forms and the adjacent forms are oriented so that there is a smooth transition from one face sheet to the next . in the particular example of form panels having planar face sheets , a smooth transition is achieved if the face sheets are coplanar upon assembly . in another example wherein a cylindrical column is being formed using forms having a predetermined , fixed and constant radius of curvature , a smooth transition is achieved if the adjacent forms are oriented so that their shared radius of curvature defines a common central longitudinal axis . in the example of a planar form panel and a form of fixed curvature being used adjacent to each other , a smooth transition is achieved if the plane of the form panel is coincident with the tangent of the fixed curvature form along the adjacent edge . as seen in fig4 , the form panels 12 are held in place most typically be attaching the shoring and other support apparatus to the perimeter flanges 16 a , 16 b or the reinforcing ribs ( not pictured ) or both . in the present invention , a clamp 20 is used to assist in proper registry of the form panels 12 during assembly and to hold the form panels 12 in the desired orientation and registry while the concrete is being poured and cured . in fig1 - 6 , the form clamp 20 is used to connect individual form panels 12 into larger assemblies . the clamp 20 has a fixed jaw 22 , a pivoting jaw 24 , and a tapered pin or wedge 26 . when the wedge 26 is driven into the closed position , the wedge 26 brings the fixed jaw 22 and the pivoting jaw 24 together and aligns the panels together using the holes in the panels . the fixed jaw 22 has a clamping end portion 28 and a pivot axis or wedge - receiving end portion 30 . the end portion 30 includes a pair of parallel , spaced - apart ear members 32 and 34 forming a channel therebetween , each of which has a slot - shaped opening 36 and 38 , respectively . the pivoting jaw 24 has a clamping end portion 40 and a wedge - receiving end portion 42 which has an slot - shaped opening 44 . upon assembly , the end portion 42 of the pivoting jaw 24 is positioned inside the ear members 32 and 34 of the fixed jaw 22 with the opening 44 put into substantial coaxial alignment with the openings 36 and 38 . the wedge 26 is inserted into the aligned openings 44 , 36 , and 38 . the wedge 26 has a closing end 58 and an opening end 60 , which may include a button - strike surface 61 . ( fig6 ). the pivoting jaw 24 is accordingly mounted on the fixed jaw 22 for pivotable and translatable movement relative thereto , moving the clamping end portion 40 of the pivoting jaw 24 toward and away from the clamping end portion 28 of the fixed jaw . an aligning pin or tooth 46 projects from the clamping end portion 28 of the fixed jaw 22 in the direction of travel toward the pivoting jaw 24 . ( fig3 ). a corresponding opening 48 is formed in the clamping end portion 40 of the pivoting jaw 24 . ( fig5 ). as the pivoting jaw 24 is moved toward the fixed jaw 22 , the tooth 46 will be received in the opening 48 . as seen in fig2 and 4 , the wedge 26 allows for two different types of motion between the fixed jaw 22 and the pivoting jaw 24 . when the wedge 26 is in the open position ( see fig2 ), the pivoting jaw 24 can translate and pivot outward and away from the fixed jaw 22 . the pivoting jaw 24 includes three stops 70 , 72 , and 74 to limit the range of motion of the pivoting jaw 24 . in the open position , pivoting jaw 24 moves translatably away from the fixed jaw 22 . once stop 70 on the pivoting jaw 24 has cleared the fixed jaw 22 , the pivoting jaw 24 can then rotate , which allows the clamp 20 to release the forms . in the open position , stops 72 and 74 limit the rotation of the pivoting jaw 24 . in the closed position , stops 70 , 72 , and 74 limit the rotation of the pivoting jaw 24 . in fig4 , each form panel 12 has perimeter flanges 16 a and 16 b that include a plurality of corresponding openings 19 that , when a pair of form panels are oriented side - by - side with their face sheets in a coplanar relationship , are in coaxial alignment with the corresponding openings in the adjacent perimeter flange of the other panel . in use of the clamp 20 , a pair of form panels 12 are brought into closely adjacent positions with their face panels roughly parallel to and in alignment with each other . the clamp 20 is put into its fully open condition and positioned so that the tooth 46 in the fixed jaw 22 is at least roughly aligned with one of the openings in a first one of the panels along the adjacent perimeter flange 16 . the pivoting jaw 24 is pivoted toward the fixed jaw 22 , bringing the tooth 46 into the corresponding opening of the second one of the panels 12 . the wedge 26 is then moved in a direction to pivot the pivoting jaw 24 to the clamped position . the tooth 46 causes the corresponding openings in the two panels are brought into coaxial alignment . use of two or more clamps 20 on the adjacent perimeter flanges 16 will ensure that the face sheets 14 a and 14 b of the two form panels 12 a and 12 b will be substantially coplanar . to secure the clamp 20 and the form panels 12 , a hammer or similar tool is used to impact the closing end 58 of the pin 26 , wedging the pin 26 in the openings 36 , 38 , and 40 so that it will not be accidentally dislodged during use of the assembled form panels 12 in constructing a formwork assembly or during pouring and curing concrete in the formwork assembly . the clamp 20 can be easily released by impacting the opening end 60 of the pin 26 with a hammer or similar tool . in the preferred embodiment , the fixed jaw 22 , pivoting jaw 24 , and wedge 26 are made of investment cast steel . these parts may also be manufactured using alternate methods , including forging . although the invention has been described with respect to a preferred embodiment thereof , it is to be also understood that it is not to be so limited since changes and modifications can be made therein which are within the full intended scope of this invention as defined by the appended claims . | 4 |
referring now to fig1 and 2 , in a first exemplary embodiment of the invention , an apparatus 10 absorbs energy in a collapsible steering column of a vehicle by being deformable in response to excessive frontal impacting force to the steering column so that injury to the vehicle operator is reduced . the apparatus 10 includes a first steering column member 12 and a second steering column member 14 . one of the first and second steering column members 12 , 14 is fixedly connected to the vehicle . the first and second steering column members 12 , 14 are connected to one another for sliding movement 16 . the first and second steering column members 12 , 14 can be inner and outer steering column jackets , upper and lower steering column jackets , brackets , or capsules . the apparatus 10 also includes a first anvil 18 associated with the first steering column member 12 and an energy absorbing member 20 having a first portion 22 extending around an operable to be drawn over the first anvil 18 in response to the sliding movement 16 . the energy absorbing member 20 also includes a second portion 24 connected to the steering column member 14 . for example , the apparatus 10 also includes a second anvil 34 associated with the second steering column member 14 and the second portion 24 of the energy absorbing member 20 extends around and is operable to be drawn over the second anvil 34 . the energy absorbing member 20 also includes a third portion 26 spaced from the first portion 22 . the third portion 26 is deformable in response to the sliding movement 16 before the first portion 22 is drawn over the first anvil 18 and / or before the second portion 24 is drawn over the second anvil 34 . the third portion 26 defines a crooked path between the first and second portions 22 , 24 . for example , in the first exemplary embodiment of the invention , the third portion 26 defines a first semi - circular loop portion 28 . when the first and second steering column members 12 , 14 move relative to one another in sliding movement 16 , the loop portion 28 is straightened before the first portion 22 is drawn over the first anvil 18 and / or before the second portion 24 is drawn over the second anvil 34 . the third portion 26 also includes a second semi - circular loop portion 30 and a substantially straight portion 32 disposed between the first and second loop portions 26 , 30 . the loop portions 26 , 30 would be straightened in response to a sliding movement before the second portion 24 is drawn over the anvil 34 and / or before the first portion is drawn over the anvil 18 . the third portion 26 can also define an elliptical loop 38 for dissipating energy before the energy absorbing member 20 is drawn over one of the anvils 18 , 34 . for example , in the first exemplary embodiment , the second portion 24 defines the loop portion 38 and the loop portion 38 is deformed to a be a substantially cylindrical loop , similar to the first portion 22 , in response to the sliding movement 16 before the first portion 22 is drawn over the anvil 18 and before the second portion 24 is drawn over the anvil 34 . the apparatus 10 also includes a locking device 36 associated with the energy absorbing member 20 to selectively lock the second portion 24 relative to the second anvil 34 . the locking device 36 includes a pin 40 that is selectively removable from an aperture 42 defined by the energy absorbing member 20 . the energy absorbing member 20 can be drawn over the first anvil 18 or the second anvil 34 . in the first exemplary embodiment of the invention , when the pin 40 is positioned in the aperture 42 and sliding movement 16 occurs , the first portion 22 is drawn over the first anvil 18 . if the pin 40 were removed and sliding movement 16 occurs , the second portion 24 would be drawn over the second anvil 34 before the first portion 22 would be drawn over the first anvil 18 because the radius of the second anvil 34 is greater than the radius of the first anvil 18 . referring now to fig3 , in a second exemplary embodiment of the invention , an apparatus 110 includes a first steering column member 112 and a second steering column member 114 connected for sliding movement 116 . a first anvil 118 is associated with the first steering column member 112 and a second anvil 134 is associated with the second steering column member 114 . an energy absorbing member 120 includes a first portion 122 extending around an operable to be drawn over the first anvil 118 in response to the sliding movement 116 . the energy absorbing member 120 also includes a second portion 124 extending around an operable to be drawn over the second anvil 134 in response to the sliding movement 116 . the energy absorbing member 120 also includes a third portion 126 spaced from the first portion 122 . the third portion 126 is deformable in response to the sliding movement 116 before the first portion 122 is drawn over the first anvil 118 . the third portion 126 defines a crooked path such as a first semi - circular loop portion 128 between the first and second portions 122 , 124 . the semi - circular loop portion 128 is straightened before the first portion 122 is drawn over the first anvil 118 . the third portion 126 also includes a second semi - circular loop portion 130 and a substantially straight portion 126 disposed between the first and second semi - circular loop portions 128 , 130 . the second semi - circular loop portion 130 is straightened before the second portion 124 is drawn over the second anvil 134 . the apparatus 110 also includes a locking device 136 associated with the energy absorbing member 120 to lock one of the first and second portions 122 , 124 relative to the respective anvil 118 , 134 . in the second exemplary embodiment , the locking device 136 selectively locks second portion 124 relative to the second anvil 134 . the locking device 136 engages the substantially straight portion 132 to lock the energy absorbing member 120 . the locking device 136 includes a pin 140 selectively insertable in an aperture 142 . the pin 140 includes a cam follower portion 54 which is moveable by a cam 56 . the cam 56 is moved by an actuator 58 controlled by a controller 60 . the controller 60 can communicate with sensors ( not shown ) disposed in the vehicle to selectively withdraw the pin 140 from the aperture 142 by engaging the actuator 58 to move the cam 56 and urge the cam follower portion 56 downward with respect to the orientation of fig3 . the sensors communicating with the controller 60 can sense one or more factors including , but not limited to , the speed of the vehicle , the rate of deceleration of the vehicle , a frontal impact of the vehicle , the weight of the driver , the proximity of the driver to the steering wheel , and whether the driver is restrained by a seat belt . the controller 60 can receive communications from the sensors corresponding to sensed conditions and , based on programmable and executable logic stored in memory of the controller 60 , selectively engage the actuator 58 . referring now to fig4 - 8 , in a third exemplary embodiment of the invention , an apparatus 210 absorbs energy in a collapsible steering column of a vehicle by being deformable in response to an excessive frontal impacting force to the steering column so that injury to the vehicle operator is reduced . the apparatus 210 includes a first steering column member 212 and a second steering column member 214 connected to one another for sliding movement 216 . the apparatus 210 also includes a first anvil 218 having a first axis 238 and associated with first steering column member 212 . the apparatus 210 also includes a second anvil 234 having a second axis 240 and associated with a second steering column member 214 . the apparatus 210 also includes an energy absorbing member 220 having a first portion 222 extending around and operable to be drawn over the first anvil 218 about the first axis 238 and also includes a second portion 224 extending around and operable to be drawn over the second anvil 234 about the second axis 240 . the first and second axis &# 39 ; 238 , 240 are transverse with respect to one another . for example , in the third exemplary embodiment , the axis &# 39 ; 238 , 240 are perpendicular to one another . in alternative embodiments of the invention , the axis &# 39 ; 238 , 240 could extend at a non - perpendicular angle relative to one another . the energy absorbing member 220 defines a rectangular cross section . a shorter edge 44 of the rectangular cross section contacts the anvil 218 and a longer edge 46 of the rectangular cross section contacts the anvil 234 . because of the rectangular cross - section of the energy absorbing member 220 , the energy absorption characteristics associated with drawing the energy absorbing member 220 over the first anvil 218 are different than the energy absorption characteristics associated with drawing the energy absorbing member 220 over the second anvil 234 . for example , more energy will be dissipated when the first portion 222 is drawn over the first anvil 218 because the shorter edge 44 faces the first anvil 218 . the energy absorption characteristics can be further differentiated by sizing the anvils 218 , 234 differently with respect to one another . the apparatus 210 also includes a locking device 236 to selectively lock the second portion 224 with respect to the anvil 234 . the locking device 236 includes a pin 48 supporting the anvil 234 . the locking device 236 also includes a pin releasing device 50 engaged with the pin 48 . the pin releasing device 50 can retract the pin 48 from the anvil 234 and allow the anvil 234 to move relative to the second steering column member 214 . as best seen in fig8 , the energy absorbing member 220 will be pinched between the anvil 234 and the second steering column member 214 when the pin 48 is released . fig7 shows the first and second steering column members 212 , 214 moving relative to one another in sliding movement 216 in response to a relatively low impacting force . the pin 48 is maintained in position and the second portion 224 is drawn over the anvil 234 . in fig8 , the first and second steering column members 212 , 214 are moving relative to one another in sliding movement 216 in response to a relatively high impacting force . the pin 48 has been retracted and the anvil 234 is urged toward the second steering column member 214 . as a result , the first portion 222 is being drawn over the first anvil 218 . referring now to fig9 - 13 , in a fourth exemplary embodiment of the invention , an apparatus 310 includes a first steering column member 312 and a second steering column member 314 connected to one another for sliding movement 316 . the first and second steering column members 312 , 314 can be inner and outer steering column jackets , upper and lower steering column jackets , or can be defined as brackets or capsules . the apparatus 310 also includes a first anvil 318 associated with the first steering column member 312 and having a first axis 338 . the apparatus 310 also includes a second anvil 334 associated with the second steering column member 314 and having a second axis 340 . the apparatus 310 also includes an energy absorbing member 320 having a first portion 322 extending around and operable to be drawn over the first anvil 318 about the first axis 338 in response to the sliding movement 316 . the energy absorbing member 320 also includes a second portion 324 extending around and operable to be drawn over the second anvil 334 about the second axis 340 in response to the sliding movement 316 . the first and second axes 338 , 340 are transverse with respect to one another . in the fourth exemplary embodiment of the invention , the axes 338 , 340 are substantially perpendicular to one another . however , in alternative embodiments of the invention , an angle of less than 90 degrees can be defined between the first and second axes 338 , 340 . the energy absorbing member 320 defines a rectangular cross - section . the rectangular cross - section includes a shorter edge 344 and a longer edge 346 . the shorter edge 344 contacts the first anvil 318 and the longer edge 346 contacts the second anvil 334 . as a result , the rate of energy absorption associated with drawing the first portion 322 over the anvil 318 is greater than the rate of energy absorption associated with drawing the second portion 324 over the anvil 334 when the anvils 318 , 334 are sized similarly . the rate of energy absorption can be further differentiated by sizing the anvils 318 , 334 differently . the apparatus 310 also includes a locking device 336 associated with the energy absorbing member 320 to lock the second portion 324 relative to the second anvil 334 . the second anvil 334 is supported on a pin 348 . the locking device 336 includes a pin retracting device 350 . as best shown in fig1 , in response to a relatively low impacting force , the pin 348 is maintained in place to support the second anvil 334 and the second portion 324 is drawn over the anvil 334 to absorb energy . as best shown in fig1 , in response to a relatively high impacting force , the pin retracting device 350 retracts the pin 348 and , in response to the sliding movement 316 , the second anvil 334 is moved in a direction 52 by the energy absorbing member 320 and the first portion 322 is drawn over the first anvil 318 . the energy absorbing member 320 also includes a third portion 326 spaced from the first portion 322 . the third portion 326 is deformable in response to the sliding movement 316 before the first portion 322 is drawn over the first anvil 318 and before the second portion 324 is drawn over the second anvil 334 . the third portion 326 defines a crooked path , such as a first semi - circular loop portion 328 , between the first and second portions 322 , 324 . as best shown in fig1 and 13 , the loop portion 328 is straightened in response to the sliding movement 316 . the size of the loop portion 328 corresponds to the distance along the path of sliding movement 316 associated with the release of the steering column from the vehicle . for example , steering columns are often connected to vehicles with capsules . the capsules provide a rigid connection to the vehicle during normal vehicle handling but will break in response to an impacting force . in current steering columns , the energy absorbing member is not engaged until the capsules have been broken . the present invention provides the third portion 326 of the energy absorbing member 320 to absorb energy during the breaking of the capsule . in other words , the loop portion 328 can be sized such that it defines a crooked path before the impacting force is applied to the steering column but is substantially straight once the capsules that connect the steering column to the vehicle have been broken . while the invention has been described with reference to an exemplary embodiment , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims . | 1 |
the chute feed assembly of the invention is generally shown in fig1 and 2 . the chute feed assembly consists of a supply 10 driven by motor 12 which receives fibers and delivers them through circular feed duct 14 first substantially vertically and then horizontally toward cabinet 16 . the horizontal section of feed duct 14 connects at its end with a rectangular shaped connective duct 18 which has its upper and lower surfaces extending first along a horizontal plane and then along a diagonal plane . connecting duct has a cross - section which measures about 11500 m 2 while the cross - section of feed duct 14 is about 49 , 062 mm 2 . these sizes may change between larger or smaller , however , the ratio between the ducts should stay substantially the same . the upper portion of cabinet 16 mounts infeed chute 20 across its width . the upper end of infeed chute 20 mounts hood 22 which is generally rectangular in shape and includes closed sides , a top , an end wall , and an open lower area which is received over the upper end of the infeed chute . a second end is open and connects with connecting duct 18 . a section 24 of the top portion of hood 22 is arranged along a diagonal plane which aligns with the plane of the top portion of connecting duct 18 . air and air suspended fibers are moved through feed duct 14 at an air speed of about 10 meters per second . as the air suspended fibers move into connecting duct 18 , a portion of the fibers along the upper extremity of the air stream strike and are deflected downwardly by the upper surface of the connecting duct . as the air stream and fibers move into the inner area of hood 22 , upper surface 24 also serves to deflect most of the fibers downwardly . the action of the upper surfaces of connecting duct 18 and hood 22 cause the fibers to fall out of the air stream to be distributed evenly across the width of infeed chute 20 . arranged in connecting duct 18 is a fiber retention assembly 26 which comprises a housing 28 carrying a pivoting panel 30 controlled by motor 42 between an upper position , indicated in fig2 in which it forms a section of the lower surface of connecting duct 18 through housing 28 . the second position for panel 30 is a lowered position shown best in fig4 . an inner wall 32 , of a screen material , forms a side of connecting duct 18 through housing 28 . wall 32 extends completely down to and connects with the lower surface of housing 28 . a fiber storage bin 34 is formed in the area of housing 28 located beneath the upper position of panel 30 . a forward wall 36 , which comprises a screen , is contoured to follow the end of panel 30 as it moves between upper and lower positions . an exhaust duct 38 connects with housing 28 opposite forward wall 36 . it is noted that fiber storage bin 34 extends across connecting duct 18 as does panel 30 . therefore , when panel 30 is in its raised position it separates duct 38 from the air flow passing through connecting duct 18 which allows the air flow carrying the suspended fibers to pass on into hood 22 . when panel 30 is moved into its lowered position as shown in fig4 the air flow and suspended fibers are directed downward as the air passes both through screen 32 and through the opening created by the downward movement of panel 30 as it is drawn out through screen 36 and duct 38 . the fibers are collected in bin 34 . a pair of sensors 40 , which are secured with infeed chute 20 , control motor 42 between positions . the fiber retention assembly 26 is provided to insure that infeed chute 20 is not overfilled to a degree as to become clogged . a first of sensors 40 detects when the level of fibers in chute 20 reaches an upper limit and activates motor 42 to move panel 30 to its lower position . the air now passes out through duct 38 and the fibers are collected in bin 34 . a second of sensors 40 activates motor 42 to return panel 30 to its upper position reinstating the flow of air and fibers into hood 22 upon the fiber supply reaching a selected lower limit . it is noted that panel 30 , when moved from its lowered position to its upper position , returns the fibers collected in bin 34 into the air stream thereby providing an instant fiber supply for start - up . turning now to fig5 - 8 , the infeed chute is described in detail . infeedl chute 20 is formed generally rectangular with its upper end connecting with hood 22 . the infeed chute includes an adjustable throat 44 formed across its side walls at an intermediate area thereof . throat 44 includes a pair of panels 46 at least one of which is adjustably connected for inward and outward movement relative to the inner surfaces of chute 20 for controlling the fiber flow . at least one of panels 46 is formed as a reed which allows air from the stream to migrate out . the lower end of infeed chute 20 is connected with and passes through the upper end of cabinet 16 . feed roll 48 forms with the end of infeed chute 20 and a discharge opening 50 . feed roll 48 is covered with the usual teeth about its outer surface which engage the fibers and move them through opening 50 . the inner surface of feed chute 20 , or at least the lower half of feed chute 20 , is formed with raised dimples which could be diamond shaped as shown in fig7 . these raised dimples bring about improved air flow which prevents fibers from clinging with the walls of the chute . also , the dimpled inner surface is coated with or formed of a non - friction material which further assist fiber flow . housing 56 connects with discharge opening 50 . a beater 54 is positioned in housing 56 and is driven by motor 52 in either direction as indicated by the arrows . feed roll 48 , also driven by motor 52 , engages the fibers and moves them through opening 50 into engagement with beater 54 . the outer circumference of beater is covered with wire teeth which engage and remove the fibers from feed roll 40 and opening 50 and expel the opened fibers into channel 58 or 60 where they are carried out second through exit opening 62 . a switch 64 &# 39 ; actuates motor 52 which through transmission 64 allows selective control of the direction in which beater 54 is driven . transmission 64 also allows the relative speed of feed roll 48 and beater 54 to be controlled to desired relative speeds . feed roll 48 and beater 54 are of any known construction and forms no part of the instant invention . feed roll 48 is always driven in the clockwise direction . beater 54 is normally driven in the clockwise direction which moves the fibers move through channel 58 when short and reclaimed fibers are being processed . for long and virgin fibers , it has been found that more desirable results are obtained with the beater moving in the counterclockwise direction which moves the fibers through channel 60 as shown in fig6 . channel 58 begins at opening 50 and progressively increases in size until it merges with opening 62 . channel 60 , although slightly shorter is similarly constructed . the fibers are delivered from either channel 58 or 60 through opening 62 into the upper end of batt forming chute 66 . an air chamber 68 is formed beneath the upper surface of cabinet 16 and extends completely across the cabinet . at least three circulating fans 70 are located across the lower surface of cabinet 16 and are connected with air chamber 68 by conduits 72 . each fan 70 is driven by an electric motor 74 . a control 76 is associated with each fan motor 74 and is capable of controlling the speed of that motor . this allows selected volumes of air to be delivered to air chamber 68 across the width of cabinet 16 . the forward lower end of air chamber 68 connects with a wedge shaped air channel 78 . air channel 78 , which extends across the width of cabinet 16 , connects with the open upper end of batt forming chute 66 . positioned in channel 78 is baffe 80 which is adjustably secured with the end wall 82 of air chamber 68 . by selectively positioning the baffle vertically along wall 82 the size of channel 78 is varied , thus selectively controlling the volume of densified air passing into the upper end of batt forming chute 66 . baffle 80 may be in segments so that it may be variably positioned across the width of channel 78 thereby creating variable air flow across the width of the channel . control 76 may also be interconnected with positioning members for baffe 80 . this allows baffle 80 and fans 74 to be controlled synchronously in accordance with the batt profile requirements . channel 78 is located above opening 62 which causes the flow of densified air to be moving opposite the direction of movement of the fibers through exit opening 62 as processed in fig5 and with the direction of fiber movement as process in fig6 . batt forming channel consists of a pair of side walls , not shown , connected with front wall 84 . front wall 84 connects with housing 56 at the end of lower delivery channel 58 . front wall 84 and the end walls may be formed with dimpled inner surfaces of nonfriction material . rear wall 86 extends behind opening 62 and merges with the rear wall 86 of channel 78 . a rocker plate 90 is pivotally mounted at the lower end of rear wall 86 . a usual drive mechanism 88 , is connected with rocker plate 90 at its lower end and is driven by motor 92 to cause rocker plate 90 to move in the usual manner . compression rolls 93 are mounted at the lower end of batt forming chute 66 . compression rolls receive and compress the formed fiber batt as it emerges from the batt forming chute and is delivered to conveyor 94 for delivery to further processing systems . motor 92 may also drive rolls 93 and conveyor 94 through known drives . rocker plate 90 is formed with a reed 96 adjacent is upper end . below reed 96 are formed a plurality of upwardly slanted slits 98 which extend completely across the width of the batt forming chute . reed 96 and slits 98 open into chamber 100 formed on the rear side of rocker plate 90 . chamber 100 has a plurality compartments 102 arranged across its upper end as best shown in fig9 and 10 . each compartment is formed with a pair of openings and associated closures 104 . closures 104 may be positioned by drive units controlled by control 76 . control 76 is therefore capable of controlling the air flow through baffe 80 , conduits 72 , and compartments 102 simultaneously . reed 96 and slits 98 allow densified air coming from air chamber 68 to migrate out of batt forming chute 66 as the fibers become compressed during movement toward compression rolls 92 . the rate of migration of the densified air passing through rocker plate 90 and into chamber 100 and further into the interior of cabinet 16 is controlled by the position of closures 104 . once in cabinet 16 , the air is recaptured by fans 70 and re - circulated through the system . in operation , the fibers are delivered into the supply chute 20 as earlier described . as they pass down supply chute 20 , feed roll 48 engages and delivers them through opening 50 into engagement with beater 54 . beater 54 rotating in a selected direction opens and moves the fibers through delivery channel 58 or 60 to second opening 62 . here the fibers are propelled into batt forming channel 66 and are engaged by densified air passing downward through channel 78 . it is noted that the air flow through channel 78 is opposite the flow of fibers traveling into batt forming channel 66 through channel 58 as shown in fig6 . as the densified air urges the fibers toward compression rolls 93 it begins to migrate out of the batt forming channel through reed 96 and slits 98 . the fibers are urged through compression rolls 93 and delivered onto conveyor 94 for delivery to further processing apparatus . it is noted that drive motors 12 , 42 , 52 , 74 , and 92 are all located outside the chute structure . this is because compressed air carrying fibers generates heat . by locating all of the drive motors outside of the closure , the heat which they generate remains outside and does not add to the heat already in the system . while a preferred embodiment of the invention has been described using specific terms , such description is for illustrative purposes only , and it is to be understood that changes and variations may be made without departing from the spirit or scope of the following claims . | 3 |
fig1 depicts an artificial tooth structure 1 comprising a dental implant 2 , an abutment 3 and a dental prosthesis 4 . the dental implant 2 is anchored into a jaw bone 5 and consists , for instance , of titanium , stainless steel , ceramics or another osseointegratable material . the abutment 3 is arranged on the dental implant 2 in such a way that the abutment 3 has a contact surface 6 at its apical end with the coronal side of the implant 2 . the abutment 3 is rigidly connected to the implant 2 by means of a connector portion 7 protruding from the center of the contact surface 6 . the connector portion 7 is cylindrically shaped and has an outer thread that is engaged with an inner thread of a receiving bore in the implant 2 . the abutment 3 further comprises a body portion 8 which constitutes a prolongation of the implant 2 in a coronal direction along the longitudinal axis l . at the surface of the body portion 8 the dental prosthesis 4 is attached . the abutment 3 is composed of a resin that is reinforced with fibers extending over the total length of the body portion 8 to the contact surface 6 . according to a first embodiment , the fibers are uniformly directed in parallel with respect to the longitudinal axis l of the body portion 8 . according to a second embodiment , the fibers are arranged in the manner of a braided netting in a biaxial or multiaxial orientation . the resin consists of a polymer derived from a methacrylate monomer , preferably methyl methacrylate ( mma ) or urethane dimethacrylate ( udma ). mineral particles , preferably ytterbium flouride and or ytterbium oxide , are homogenuosly distributed within the resin . the fibers are constituted by glass fibers , wherein the fiber content represents ideally 80 % of the volume of the body portion 8 . the fibers are treated with silane as a coupling agent to the resin matrix . the abutment 3 exhibits several advantageous mechanical properties , in particular an elastic modulus similar to natural dentine that is anisotropic with respect to the longitudinal axis l and varying in between 13 to 45 gpa . yet the abutment 3 has a high flexural strength of ca . 1600 mpa for fracture resistance and durability . moreover , the interlaminate shear strength ( iss ) of the bond between the fibers and the resin matrix is larger than 90 mpa , leading to an improved value of its fatigue under stress as compared to competing materials such as titanium , stainless steel or ceramics . the shape of abutment 3 can be easily reworked by means of common cutting tools such as diamond burs and / or discs . furthermore , the abutment 3 has several advantageous optical properties . first , the incorporation of the mineral particles is chosen so that the material composition of glass fibers , resin and mineral particles yields an index of refraction of 1 . 52 . this value corresponds closely to the refractive index of natural dentine ( 1 . 540 ). secondly , the particular arrangement of the fibers in the resin allows good light conduction through the body portion 8 . this can be exploited for a proper polymerization of a setting product , such as resin cement , in particular for fixing the abutment at its contact surface 6 . the mineral particles with a high atomic number embedded in the resin lead to a radiopacity of the body portion 8 that is larger than 200 % to the value of aluminium , more preferred above a value of 400 % of aluminium . the chemical composition of the resin material similar to composite resin cement permits a chemically profound bonding - interaction between the abutment 3 and the dental prosthesis 4 and / or the implant 2 . the artificial tooth structures shown in fig2 - 4 comprise the dental implant 2 , the dental prosthesis 4 and an abutment with essentially identical properties with respect to the material and shape of its body portion 8 as the abutment of fig1 . the connection means at the contact surface 6 of the abutment is modified . fig2 depicts an abutment 11 of an artificial tooth structure 10 that is rigidly connected to the implant 2 by means of a receiving bore 12 at the center of the contact surface 6 . the receiving bore 12 is cylindrically shaped and has an inner thread that is engaged with a connector portion protruding from the coronal end of implant 2 . fig3 depicts an abutment 16 of an artificial tooth structure 15 that is connected to the implant 2 by means of a receiving bore 17 at the center of the contact surface 6 . the receiving bore 17 is octogonally shaped and receives an adequately shaped connector portion of the implant 2 in a form - fitted manner . a rigid connection in between the abutment 16 and implant 2 at the contact surface 6 is established by means of resin cement . fig4 depicts an abutment 21 of an artificial tooth structure 20 that is connected to the implant 2 by means of a connector portion 22 protruding from the center of the contact surface 6 . the connector portion 22 is octogonally shaped and is inserted in a adequately shaped receiving bore in the implant 2 in a form - fitted manner . a rigid connection in between the abutment 21 and implant 2 at the contact surface 6 is established by means of resin cement . in fig5 - 9 various abutments with a different shape of the body portion are depicted , which is symmetrical along the longitudinal axis of the abutment . fig5 shows an abutment 25 with a cylindrical shaped body portion 26 . fig6 shows an abutment 27 with a hyperboloidal body portion 28 . fig7 shows an abutment 29 with a conical body portion 30 . fig8 shows an abutment 31 with a substantially spherical body portion 32 . the body portion 32 comprises a cylindrical apical end 33 to be contacted with the implant 2 . fig9 shows an abutment 34 with a cono - cylindrically shaped body portion 35 . the body portion 35 comprises a conical coronal part 36 and a cylindrical apical part 37 . in fig1 and 11 an alternative embodiment of the abutments 25 , 27 is depicted . three retention grooves 40 , 41 , 42 are provided at the lateral surface of the body portion 26 , 28 . each of the retention grooves 30 , 31 , 32 extends over a different circumferential portion of this surface in order to avoid a weakening of the structure and a risk of breakage . the course of retention grooves 30 , 31 , 32 substantially extends in the apical direction and over part of the circumference of the body portion 26 , 28 such that they are partially wrapped around the surface . in this way , the retention properties can be greatly improved when the filling member 10 is fixed in the cavity by means of resin cement . preferably , the grooves 30 , 31 , 32 extend over the total length of the body portion 26 , 28 to increase mechanical retention along the total device length . the retention grooves 30 , 31 , 32 can be analogously applied on the body portion 30 , 32 , 35 of the abutments 29 , 31 , 34 . the above described preferred embodiments are intended to illustrate the principles of the invention , but not to limit the scope of the invention . various other embodiments and modifications to those preferred embodiments may be made by those skilled in the art without departing from the scope of the present invention . | 0 |
in fig1 an elongated photoconductive material pm follows a bifilar spiral form and ends in exterior electrical terminals k1 and k2 . the material forms a photoresistor or photoconductive cell fw1 whose sensing area sa is defined by the phantom lines . the material pm is illustrated as unidimensional for convenience . however , it should be noted that the elongated material has a depth as well as width and is packed within the sensing area to achieve maximum density . however , each increment is electrically connected to the adjacent increments only along the direction of elongation but is insulated from the adjacent &# 34 ; turns &# 34 ; of the bifilar path . it is this separation which is more clearly visible by showing the material pm as being unidimensional . according to an embodiment of the invention , the material pm is composed of a single length of properly arranged material in the form of a thin coat . according to another embodiment of the invention , the material pm is composed of a plurality of series connected individual photosensitive members either long or short . it has been discovered that a cell such as fw1 exhibits a higher electrical resistance when a sharp image is focused upon the sensing area sa than when a blurred image is focused on the same sensing area . this arises in part because the cell fw1 exhibits a lower resistance to high contrast light changes along any length in the longitudinal direction of the material pm . the explanation for this phenomenon is described at a later point . in fig2 the photoresistor or cell fw1 and an identical photoresistor or cell fw2 cooperate to control a motor m which drives an objective 1 of a camera c as shown in fig3 . in fig3 the circuit of fig2 is identified as cc . here , light passing through the objective 1 strikes a mirror 2 which deflects the light to a beam splitting prism 3 . the latter splits the beam evenly and applies it to the photoconductive cell fw2 whose forward sensing surface is mounted directly on the surface of the beam splitter 3 . the light traveling toward the cell fw1 passes through a transparent spacer plate separating the light sensing front surface of the cell fw1 from the prism 3 by a predetermined distance . the cell fw1 and the plate 4 are mounted on the prism 3 together with the cell fw2 . the plate 4 effectively extends the distance of the sensing surface of the cell fw1 from the objective 1 relative to the distance from the objective 1 from the sensing cell fw2 . the prism 3 holds the cells fw1 and fw2 at positions such that when the objective 1 focuses sharply on the film , i . e ., the desired focal plane , it also focuses sharply upon a first high definition plane hd1 passing through the plate 4 and located a distance s ahead of the photosensitive surface of the cell fw1 equal to half the thickness of the plate 4 . at the same time the objective 1 focuses upon a high definition plane hd2 a distance equal to s behind the light sensitive surface of the photoresistor fw1 . the material pm in fig1 is preferably in the form of a light - sensitive coat so that its thickness or depth is minimal . thus during sharp focusing , sharp images appear at a distance s = 1 / 2 the thickness of the plate 4 ahead of the photosensitive coat of the cell fw1 and the same distance behind the corresponding coat of the photoresistor fw2 . as mentioned , the cells fw1 and fw2 are connected in the circuit cc as shown in fig2 . here , the two photoconductive cells fw1 and fw2 form a voltage divider between the positive and negative terminals plus b and minus b of a voltage source . the voltage divider point p1 between the cells controls the gate of a field effect transistor t1 . the latter is connected as a source follower , i . e ., a drain switch , with a resistor r1 and two diodes di1 and di2 so as to exhibit a high - ohmic input resistance and thereby avoid undesired loading of the high resistance photoconductive cells fw1 and fw2 , whose resistances are of the order of a megohm each . the divider circuit renders the divider point p1 virtually independent of over several decimal powers of illumination changes when the conductive cells are illuminated equally . the source follower connected field effect transistor t1 operates a double push - pull driver composed of complementary transistors t2 , t3 , t4 , and t5 as well as resistor r2 to r9 . two pairs of series connected diodes , namely pair di1 and di2 and pair di3 and di4 , generate the necesssary base bias voltages between the bases of the driver transistors t2 and t3 on the one hand , and t4 and t5 on the other . the first pair of diodes di1 and di2 appear in the path of main current flow of the field effect transistor t1 . the second pair of diodes di3 and di4 appear between the terminals + b and - b interposed between divider resistors r10 , r11 , and r12 . the resistor r12 is variable and serves as a trimming resistor so that the circuit can be adjusted for symmetry . resistors r 2 to r 9 bias the transistors . the driver stage drives an output or power double push - pull circuit composed of complementary transistors t6 , t7 , and t8 , t9 whose bases are coupled with the circuit points p2 , p3 , and p4 , p5 , of the driver stage . the power stage energizes a dc motor m connected across opposite point p7 and p8 of the bridge formed by the driver stage . the motor m drives the objective 1 as shown in fig3 . a variable feedback resistor r13 connects the switching point p7 to a switching point p6 between the diodes di3 and di4 . in operation , the field effect transistor p1 of fig2 controls the bases of the double push - pull driver stage in such a way that only one pair of diagonally opposed complementary transistors is opened . these transistors in turn open the complementary transistors of the respective diagonals in the double pus - pull connection of the power transformers . if the objective of fig3 is directed onto an object , and a sharper image appears on the photoconductive cell fw2 than on the photoconductive cell fw1 , the resistance of photoconductive cell fw2 will exceed that of cell fw1 . this raises the potential of the voltage dividing point p1 and hence the gate potential of the field effect transistor t1 . the source voltage which is dependent upon the gate voltage and which exceeds the gate voltage by the pinch - off voltage of about one volt , similarly increases and opens the transistor t2 . the emitter line le common to all four driver transistors t2 to t5 opens the pnp transistor t5 . this action turns on the pnp power transistor t6 and the npn power transistor t9 and connects the terminal k3 of the motor m to the positive pole and the terminal k4 to the negative pole of the voltage source b . the dc motor rotates in the direction determined by the polarity of the supply voltage . it drives the range finder of the objective through a reduction gear not shown until both photoconductive cells fw1 and fw2 exhibits the same resistance values . as was previously stated the objective 1 , when it produces a sharp image on the focal plane of the camera , produces sharp images in the planes hd1 and hd2 . this produces an approximately equally blurred or sharp image on each of the cells fw1 and fw2 . when the objective 1 is moved forward within the camera , thereby blurring the image in the focal plane , one focus control image departs from the plane hd1 and moves further from the sensing surface of the cell fw1 , while the other image departs from the plane hd2 and moves closer to the sensing surface of the cell fw2 . under these circumstances the cell fw2 is subjected to a sharper image than the cell fw1 and thereby exhibits a higher resistance . if the objective 1 is moved closer to the focal plane than the ideal focusing position , the image projected upon the cell fw1 is sharper than the image projected upon the cell fw2 . thus the cell fw1 exhibits the higher resistance . since the motor m moves the objective 1 toward the position of equality of the two resistances of the cells , the objective 1 ultimately reaches the position corresponding to the one in which it focuses precisely upon the camera &# 39 ; s focal plane . in the case described with respect to fig2 a sharper image is produced on the coat of the photoconductive cell fw2 than on the coat of the photoconductive cell fw1 . in this case the plane of optimum definition before adjustment is closer to the coat of photoconductive cell fw2 than to the coat of photoconductive cell fw1 , that is , it has moved in the direction of the objective . this means that the image distance is small and that the object is farther away from the objective of the camera than the momentary required distance for sharp focusing . thus , the motor moves the objective in the direction of a greater distance until the images are again in the vicinity of the nominal planes hd1 and hd2 of the photoconductive cells fw1 and fw2 , with the exception of a residual error . this produces sharp focusing . the principles upon which operation of the cells fw1 and fw2 in fig1 to 3 operate , as well as the dimensioning rules for making each photoconductive cell definition - sensitive according to the invention will be described with respect to fig4 to 10 . for the purpose of this analysis , one horizontal strip of the photoconductive material pm in the cell fw1 is considered . it is assumed that a photographic objective produces a substantially sharp image of an original on the surface of the photoconductive cell , and that along the horizontal strip the image is composed of a periodic arrangement of vertical bands with an illumination distribution varying periodically along the horizontal . fig4 shows such a strip having a rectangular cross - section within a coordinate system . the illumination distribution varies in the direction of the x axis . ______________________________________width : δy = y . sub . 2 - y . sub . 1length : δx = x . sub . 2 - x . sub . 1 = ∫ dxthickness : δz = z . sub . 2 - z . sub . 1______________________________________ the number of light - dark periods per mm of the curtain pattern reproduced by the objective on this photoconductive cell layer , that is , the spatial frequency n , is selected so that at least one full period falls on the rectangular photoconductive cell layer . the electrical behavior of this arrangment may be considered by calculating the means resistance r x per period by integrating over such a period . at any instant , when an object is sharply focused upon the photoconductive material , the illumination distribution , i . e ., the brightness , along the horizontal axis varies according to the following function maximum and minimum illumination values appear at the following points of the pattern . particularly maximum illumination equal to the fine contrast of this pattern is defined by the ratio of the maximum to the minimum illumination , namely , ## equ3 ## thus , the fine contrast , and hence the definition , depend on the ratio of the amplitude variation b to the mean value a in such a way that both increase with increasing amplitude variation b . each optical system , hence the objective lens , acts like a low - pass filter having a maximum bandwidth at maximum definition . fig5 illustrates the influence of this low - pass filter characteristic on the amplitude of the variations ( alternation amplitude ) b with the selected spatial frequency n 1 of the pattern for three different fine contrast values 1 , 2 , and 3 . this calculation is also started with an elongated rectangular photoconductive cell , or portion of a cell , or a so - called photoconductive cell row , as shown in fig4 . here the elementary or differential region has the following volume at the point x . for this calculation it is assumed that the light is directed perpendicularly onto the photoconductive cell in the direction of the z axis . each elementary or differential region has a specific local conductance σ ( x ). this specific conductance is , as a first approximation , directly proportional to the illumination b ( x ) at that location . with the previously mentioned indicated changes in illumination on the surface of the photoconductive cell , this specific conductance , in the above equation , qa is the mean specific conductance while qb is the amplitude of the sinusoidal variation of the specific conductance , and n is the spatial frequency in periods per mm . the resistance dr x of one of the series connected differential or elementary regions measured in the x direction as shown in fig3 is ## equ4 ## the conductance of one of the differential region , as illustrated in fig5 is ## equ5 ## this conductance is , of course , connected in parallel to the conductances of the adjacent differential volumes . in the direction of the x axis , the partial or differential resistances dr x of the differential regions add up , between the points x 1 and x 2 , to a total resistance ## equ6 ## of particular interest in this periodic distribution of illumination b ( x ) is the mean resistance r x per period with α = 2πnx , and the period of this argument - π ≦ α ≦ π we obtained ## equ7 ## because of the singularity of tan ( α / 2 ) when α 1 = - π , and α 2 = + π , the integral is first solved for α 1 o & gt ; - π ; α 2 & lt ; + π and then the passage to the limit α 2 → - π ; α 2 → π is effected . thus ## equ10 ## in the passage of the limits α 1 → - π ; α 2 → π , the integration limits ( α 1 , α 2 ) causes the values tan (| α 1 |/ 2 ) and tan ( α 2 / 2 ) to increase drastically , so that the summand b can be neglected and both arctan functions tend toward the same limit value π / 2 . hence , the mean resistance r x per period is ## equ13 ## the mean resistance r x depends upon the ratio of the amplitude b of the variation to the mean value a of the illumination b ( x ) according to the following equation : ## equ14 ## according to other embodiments of the invention , the cells fw1 and fw2 of fig1 and 2 are formed of a plurality of photo diodes arranged as a mosaic in the image plane along the bifilar paths and connected to each other so as to form an or gate or an and gate which generates a control signal on a common load resistance in dependence on the image detail brightness . examples of such embodiments are shown in fig1 to 14 . in fig1 an or gate is composed of n voltage dividers . the first voltage divider is composed of a series connected photo diode fd 1 , potential equalizing diodes pd 1 and operating resistance r 1 all arranged between the terminals + b and - b of a voltage source . the remaining voltage dividers include photo diodes fd 2 . . . fd n , equalizing diodes pd 2 . . . pd n and working resistances r 2 . . . r n . the forward direction of the photo diode is opposite to the forward direction of the potential equalizing diodes . respective gate diodes gd 1 , gd 2 . . . gd n connect divider points p 1 , p 2 . . . p n to the load resistance r which is common to all the gate diodes . the load resistance is connected between the gate diodes and the negative terminal - b of the source . for simplicity the photo diodes will be referred to as fd , the potential equalizing diodes pd , the gate diodes gd , the operating resistance r , and the points p without their subscripts . in this or circuit the photo diode fd whose light sensitive coat receives the greatest illumination exhibits the lowest resistance . the potential of the corresponding divider point p is then highest , that is , most positive . this potential then determines the output potential of the or circuit which therefore assumes its maximum value at optimum definition , due to the fact that it is then that the image detail brightness is greatest . in contrast to this circuit , the circuit of fig1 operates as an and gate where the maximum image detail brightness produces the lowest voltage drop on the resistance r . here , like reference characters designate like parts . within each voltage divider current passes from the positive terminal + b of the source through the operating resistor r , the potential equalizing diode pd , and the photo diode fd . a gate diode gd connects the divider point p to the load resistor r whose other side is connected to the positive terminal + b of the source . again in this circuit , the photo diode with the greatest illumination determines the output potential but the potential of this voltage divider is lowest , that is , most negative so that the output potential assumes a minimum value at optimal definition . this is so because the image detail brightness is then greatest . fig1 illustrates another version of an or gate which supplies the maximum output potential with minimum image detail brightness . the voltage dividers forming the elements of the or gate are composed of the following order of elements , namely operating resistance r , potential equalizing diode pd , and photo diode fd . a gate diode gd again connects the divider point to the resistor r . in this circuit , the potential is highest at the point p whose corresponding photo diode is subject to least illumination . that is , this point is most positive and determines the output potential of the load resistance r which therefore assumes a maximum value at optimum definition . this is due to the fact that the image detail brightness is then lowest . fig1 illustrates another embodiment of an and gate . here the output potential assumes a minimum value on the common load resistance r with minimum image detail brightness . the order of the structural elements in the voltage divider has been changed relative to that of fig1 . current flows from the positive terminal + b of the source s through the photo diode fd , the potential equalizing diode pd , the divider point p , and the operating resistor r . gate diodes gd connect the respective points p to the load resistance r . the potential on the divider point p of the voltage divider whose photo diode is subject to the least illumination is lowest , that is , most negative . this determines the output potential of the and circuit which therefore assumes a minimum value at optimal definition . this is due to the fact that it is then that the image detail brightness is lowest . it should be noted that the term &# 34 ; photoconductive cell &# 34 ; is used interchangeably with the term &# 34 ; photoresistor &# 34 ; in the context of this application . while embodiments of the invention have been described in detail , it will be obvious to those skilled in the art that the invention may be embodied otherwise without departing from its spirit and scope . | 6 |
like components are indicated by like reference numerals in the figures , wherein not every repeating component is designated separately . fig1 shows the structure of an exemplary embodiment of a geothermal power plant facility 1 according to the disclosure . some of the elements of the geothermal power plant 1 are firstly a geothermal energy supply source 2 comprising a supply line 2 a and a return line 2 b . with the aid of the supply source 2 , geothermal energy can be conveyed from the interior of the earth , for example in the form of heated brine b from the soil or subsoil u . in the present exemplary embodiment , the heated brine is firstly supplied to a vaporizer 3 and subsequently to an optional preheater 4 and is returned into the subsoil . a heat supply circuit i is thus obtained . a further preferable element of the geothermal power plant facility 1 is a working fluid circuit ii . the working fluid circuit ii is implemented to carry out an orc method and comprises , in addition to the vaporizer 3 and the optional preheater 4 , in the conveyance direction of the working fluid , a turbine 5 , an air - cooled condenser 6 , and also a water - cooled condenser 7 as well as a conveyor pump 8 . a generator 9 for power generation is driven by the turbine 5 . a drive connection w is simultaneously present between the turbine 5 and the conveyor pump 8 , via which the pump drive of the conveyor pump 8 is ensured . this connection can be of a mechanical or electrical nature . between these components , the organic working fluid is moved in a cycle in a line system and firstly passes , after the vaporization in the vaporizer 3 , the turbine 5 via the line section a . subsequently , the line section b conducts the working fluid to a line branching point 11 , by which a first partial flow of the working fluid is supplied via the line section c to the air - cooled condenser 6 and another , second partial fluid flow is supplied via the line section d to the water - cooled condenser 7 . the condensed working fluid from the air - cooled condenser 6 is conducted via the line sections e and f into a line unification point 12 , into which the condensate from the water - cooled condenser 7 is also discharged via the line section g . the unified condensates of the working fluid leave the line unification point 12 via the line section h and are supplied there to the conveyor pump , which supplies the working fluid via the line section i firstly to the preheater 4 and subsequently to the vaporizer 3 again . the entirety of the line sections a to i in this case designates the line system 10 , in which the working fluid is conducted between the individual functional units , such as for example the vaporizer , the conveyor pump , the turbine , and the two condensers . in this basic structure that the working fluid is supplied downstream of the line branching point 11 proportionally either exclusively to the air - cooled condenser 6 or , in parallel thereto , to the water - cooled condenser 7 via the line sections c and d . the volume flow of the working fluid coming from the turbine is therefore split into two partial flows , which are spatially and functionally separated and at the same time are subjected to the condensation process essentially simultaneously to each other . a parallel arrangement of the air - cooled condenser 6 and the water - cooled condenser 7 thus results . a successive passage of both condensers 6 and 7 by the working fluid is precluded and also is not intended . via the line unification point 12 , the condensate flows of the working fluid are unified again downstream of the air - cooled condenser 6 and the water - cooled condenser 7 and are jointly supplied via the conveyor pump 8 to the vaporization process again . the line unification point 12 therefore has a total of three fluid inlets , two of which being assigned to the air - cooled condenser 6 ( tube sections e and f ) and one to the water - cooled condenser 7 ( line section g ). both the air - cooled condenser 6 and also the water - cooled condenser 7 are implemented as surface condensers . mixing of the cooling medium with the working fluid therefore does not take place . the cooling medium of the air - cooled condenser 6 is external ambient air and the cooling medium of the water - cooled condenser 7 is cooling water . the latter is circulated in the present exemplary embodiment inside a cooling water circuit iii . the basic elements of the cooling water circuit are a wet cooling tower comprising a distribution unit 14 , a collecting basin 15 , a water reservoir 16 ( wherein the water reservoir 16 can also be a direct part of the collecting basin 15 ), a cooling water pump 17 , and the water - cooled condenser 7 . the cooling water is conducted in this case via a line system having the line sections k ( between the water - cooled condenser 7 and the wet cooling tower 13 ), l ( between the collecting basin 15 and water reservoir 16 ), m ( between the water reservoir 16 and the cooling water pump 17 ), and n ( between the cooling water pump 17 and the water - cooled condenser 7 ). the water reservoir 16 is used for the present basic construction , the storage volume v of which ideally corresponds to the range “ 1 hour × vb max & lt ;= v & lt ;= 20 hours × vb max ”. the maximum water consumption vb max corresponds in this case to the maximum available quantity of water in cubic meters per hour , which is specified by the operator . this value is specific to the facility and is typically specified by the purchaser of the geothermal power plant facility 1 . a typical value is , for example , 50 m 3 / hour . in the present exemplary embodiment , the geothermal power plant facility 1 further comprises a control unit 18 , which controls a valve , which is not shown in greater detail , inside the line branching point 11 . with the aid of the control unit 18 , the proportion of the working fluid ( volume flow ) conducted to the air - cooled condenser 6 and to the water - cooled condenser 7 can therefore be varied via the valve . control variables which can be considered by the control unit 18 are , for example , the temperature of the external ambient air , the fill level of the water reservoir 16 , the temperature of the working fluid in the line section b and / or in the line section h , etc . fig2 relates to a variant of the exemplary embodiment of fig1 , wherein only the differences are discussed below while otherwise reference is made to the above statements . the facility is shown starting at the line section a and up to the line section i in the orc circuit , so that the circuit i is not indicated in fig2 for reasons of comprehensibility . the geothermal power plant facility 1 shown in fig2 comprises a total of two turbines 5 , which jointly drive a generator g . the working fluid flowing out of the two turbines 5 is respectively cooled , in cooling circuits which are separate from one another , in an air - cooled and in a water - cooled condenser 6 , 8 for each turbine 5 . subsequently , the condensates of both circuits are guided together in the line section h ′ and centrally again subjected to the vaporization procedure using geothermal energy . each turbine 5 therefore has its own condensers 6 and 7 . a further special feature is that the cooling water circuit of the two water - cooled condensers 7 runs together in a shared wet cooling tower 14 . both condensers are therefore jointly supplied by a cooling water circuit with cooling water via the line section n ′, which discharges in a corresponding line branching point into the line sections n to the two water - cooled condensers 7 . furthermore , a supply line is indicated with the line section z in fig2 , using which water losses within the cooling water circuit can be compensated for . for this purpose , for example , brine , condensate , and / or treated water can be used . the quantity of water available for this supply finally specifies the value vb max . in the wet cooling tower 14 shown in fig2 , the collecting basin 15 is furthermore implemented sufficiently large that it simultaneously functions as a water reservoir 16 . a water reservoir 16 which is separate and spatially separated from the collecting basin 15 is accordingly no longer needed . fig3 illustrates the method sequence for operating the geothermal power plant facility 1 . the method steps are in this case firstly the vaporization of the working fluid in the vaporizer 3 in step 19 with the aid of geothermal energy . subsequently , the operation 20 of the turbine 5 is performed with the aid of the working fluid vaporized in step 19 . after the working fluid exits from the turbine 5 or downstream of the turbine 5 , in step 21 , a separation of the working fluid is performed into a partial fluid flow conducted to the air - cooled condenser 6 and a partial fluid flow conducted to the water - cooled condenser 7 . the two partial fluid flows are now condensed in parallel to one another in steps 22 ( in the air - cooled condenser 6 ) and 23 ( in the water - cooled condenser 7 ). however , the condensation is performed spatially and functionally separated from one another using the two condensers 6 and 7 , which have cooling media that differ from one another , specifically water and air . the condensates of both condensed partial fluid flows are unified again in step 24 downstream of the two condensers 6 and 7 and are subsequently jointly supplied to the vaporizer 3 again in step 25 . the cycle is thus closed . steps 26 , 27 , and 28 indicate preferred refinements of this method . thus , in particular the water - cooled condenser 7 in step 23 can be integrated in a cooling water circuit iii according to the above statements , in particular comprising a wet cooling tower 13 , wherein optionally the transitional temporary storage 27 of cooling water in a water tank 16 can furthermore be provided here . the operational reliability of the method according to the disclosure can be substantially improved in this manner . a control of the separation 21 of the working fluid into the two partial fluid flows is provided as a further preferred refinement alternative in step 28 . for this purpose , for example , the valve in the line branching point 11 is controlled and thus the volume flow proportion of the partial fluid flow conducted to the air - cooled condenser 6 is varied in relation to the partial fluid flow conducted to the water - cooled condenser 7 . this step can be part of a closed - loop control process , which can be a corresponding control as a function of closed - loop control variables such as , for example , the external temperature of the ambient air and further variables . the above - described geothermal power plant facility 1 can also be obtained by a method for retrofitting a conventional geothermal power plant facility 1 , which only provides an air - cooled condenser 6 for condensing the working fluid , for example . steps 29 , 30 , and 31 , which are used for the retrofitting , are specified in greater detail in fig4 . an introduction 29 of the line branching point 11 downstream of the turbine 5 before the already existing air - cooled condenser 6 is followed in step 30 by an introduction of the line unification point 12 upstream of the pump 8 , so that thus a total of two connections is obtained between the line branching point 11 and the line unification point 12 for the additional water - cooled condenser 7 to be connected in step 31 . a parallel connection of the air - cooled condenser 6 to the water - cooled condenser 7 is thus achieved . in the retrofitting process , according to step 32 , the connection of the water - cooled condenser 7 to the cooling water circuit iii , in particular comprising the wet cooling tower 13 , can furthermore optionally be performed . the retrofitting operation or the retrofitting interfaces are illustrated in greater detail in fig1 with dashed line iv . according to the method shown in fig3 , the region to the right of dashed line iv including the line branching point 11 and the line unification point 12 is therefore to be retrofitted . an alternative to this retrofitting method , which is not described in greater detail , can also consist , of course , in the air - cooled condenser 6 being retrofitted in addition to a water - cooled condenser 7 . | 8 |
the present invention discloses a dual prodrug compound , including its pharmaceutically - acceptable salts , of the formula ( i ) below , z is an alicyclic or polyalicyclic group of the trialicyclic adamantane or monoalicyclic neramexane type as shown below by formulae ( a ) and ( b ), respectively , r , r 1 , r 2 , ŕ 1 , ŕ 2 , ŕ 3 , ŕ 4 and ŕ 5 are each independently h or ch 3 ; c 1 - c 6 straight chain or branched alkyls , c 3 - c 6 cycloalkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl ; c 6 - c 10 aryl unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , nitro , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 mercaptoalkyl ; alkylaryl ( c 6 - c 10 ), such as a benzyl group unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl ; and alkyldiaryls such as diphenylmethyl in which the aryls may be bridged by — ch 2 — ch 2 — or o or s ; where the alkyldiaryls may be unsubstituted or substituted with c 1 — straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl ; ŕ 1 and ŕ 2 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ 3 and ŕ 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ is h or c 1 - c 4 straight - chain alkyl ; y is a moiety of formulae ( c ), ( d ), or ( e ) shown below , r 1 is independently selected from the group consisting of straight or branched chain c 1 - c 6 alkyl , c 3 - c 6 cycloalkyl ; c 2 - c 6 alkenyl ; c 2 - c 6 alkynyl ; c 6 - c 10 aryl such as phenyl , naphthyl , and the like , or a heteroaryl such as furanyl , imidazolyl , pyrollyl , triazolyl , pyridyl , and the like , unsubstituted or substituted with one or more c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , nitro , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 mercaptoalkyl ; and straight or branched chain alkylaryl ( c 6 - c 10 ), such as a benzyl group , or an alkyl heteroaryl wherein the aryl or the hetroaryl group may be unsubstituted or substituted with one or more c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl , and alkyldiaryls , such as diphenylmethyl in which the aryls may be bridged by — ch 2 — ch 2 — or o or s ; and the alkyldiaryls may be unsubstituted or substituted with c 1 - c 6 alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl ; x − is a pharmaceutically - acceptable inorganic or organic counter ion ; r 2 is hydrogen or an easily cleavable group under acidic or neutral conditions , such as a t - butyl group or an alkylaryl group wherein the aryl group may be unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 3 - c 6 cycloalkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , and c 1 - c 6 dialkylamino ; r 3 to r 6 are independently selected from the group consisting of hydrogen ; hydroxyl ; c 1 - c 6 straight chain or branched alkyl ; c 3 - c 6 cycloalkyl ; c 6 - c 10 aryl , such as phenyl , naphthyl , and the like , unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl ; and alkylaryl ( c 6 - c 10 ) unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl , c 1 - c 6 carboxyalkyl , c 1 - c 6 acylamino , c 1 - c 6 sulfonatoalkyl , c 1 - c 6 sulfamylalkyl , and c 1 - c 6 phosphanatoalkyl ; r 3 and r 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; and r 5 and r 6 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring . the preferred embodiments of formula ( i ) are shown in formulae 1 - 4 and formulae 5 - 8 , respectively , shown below . in all these compounds r and ŕ of formula ( i ) are shown as h as a preferred embodiment . r 1 and r 2 are h or ch 3 ; x − is any pharmaceutically - acceptable organic or inorganic counter ion ; and r 1 and r 2 are h or ch 3 ; r 3 to r 6 are independently selected from the group consisting of hydrogen ; hydroxyl ; c 1 - c 6 straight chain or branched alkyl ; c 3 - c 6 cycloalkyl ; c 6 - c 10 aryl , such as phenyl , naphthyl , and the like , unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl ; and alkylaryl ( c 6 - c 10 ) unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl , c 1 - c 6 carboxyalkyl , c 1 - c 6 acylamino , c 1 - c 6 sulfonatoalkyl , c 1 - c 6 sulfamylalkyl , and c 1 - c 6 phosphanatoalkyl ; r 3 and r 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; and r 5 and r 6 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring . r 1 and r 2 are h or ch 3 ; x − is any pharmaceutically - acceptable organic or inorganic counter ion ; r 1 is independently selected from the group consisting of straight or branched chain c 1 - c 6 alkyl , c 3 - c 6 cycloalkyl ; c 2 - c 6 alkenyl ; c 2 - c 6 alkynyl ; c 6 - c 10 aryl such as phenyl , naphthyl and the like , or a heteroaryl such as furanyl , imidazolyl , pyrollyl , triazolyl , pyridyl or the like , unsubstituted or substituted with one or more c 1 - c 6 alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , nitro , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 mercaptoalkyl ; and straight or branched chain alkylaryl ( c 6 - c 10 ), such as a benzyl group , or an alkyl heteroaryl wherein the aryl or the hetroaryl group may be unsubstituted or substituted with one or more c 1 - c 6 alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl , and alkyldiaryl such as diphenylmethyl in which the aryls may be bridged by — ch 2 — ch 2 — or o or s . the alkyldiaryls may be unsubstituted or substituted with c 1 - c 6 alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl . r 1 and r 2 are h or ch 3 ; x − is any pharmaceutically - acceptable organic or inorganic counter ion ; r 3 to r 6 are independently selected from the group consisting of hydrogen , hydroxyl , c 1 - c 6 straight chain or branched alkyl ; c 3 - c 6 cycloalkyl ; c 6 - c 10 aryl , such as a phenyl or naphthyl group , unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl ; and c 5 - c 6 arylalkyl unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl , c 1 - c 6 carboxyalkyl , c 1 - c 6 acylamino , c 1 - c 6 sulfonatoalkyl , c 1 - c 6 sulfamylalkyl , and c 1 - c 6 phosphanatoalkyl ; r 3 and r 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; and r 5 and r 6 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; and r 2 is hydrogen or an easily cleavable group under acidic or neutral conditions , such as a t - butyl group or an alkylaryl group wherein the aryl group may be unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 3 - c 6 cycloalkyl , c 1 - c 6 alkoxyls , 1 , 3 - dioxolanyl , and c 1 - c 6 dialkylamino . ŕ 1 , ŕ 2 , ŕ 3 , ŕ 4 and ŕ 5 are independently h or ch 3 ; c 1 - c 6 straight chain or branched alkyls , c 3 - c 6 cycloalkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl ; c 6 - c 10 aryl unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , nitro , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 mercaptoalkyl ; and alkylaryl ( c 6 - c 10 ), such as a benzyl group unsubstituted or substituted with c 1 - c 6 alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl ; ŕ 1 and ŕ 2 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ 3 and ŕ 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; x − is a pharmaceutically - acceptable inorganic or organic counter ion . ŕ 1 , ŕ 2 , ŕ 3 and ŕ 4 are independently h or c 1 - c 6 straight chain or branched alkyls , c 3 - c 6 cycloalkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl ; c 6 - c 10 aryl unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , nitro , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 mercaptoalkyl ; and alkylaryl ( c 6 - c 10 ) or an alkylheteroaryl unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl ; ŕ 1 and ŕ 2 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ 3 and ŕ 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ 5 is h or c 1 - c 6 straight chain or branched alkyl ; r 1 is independently selected from the group consisting of straight or branched chain c 1 - c 6 alkyl , c 3 - c 6 cycloalkyl , c 2 - c 6 alkenyl ; c 2 - c 6 alkynyl ; c 6 - c 10 aryl unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , nitro , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 mercaptoalkyl ; and alkylaryl ( c 6 - c 10 ) or an alkylheteroaryl unsubstituted or substituted with c 1 - c 6 alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl , and alkyldiaryls such as diphenylmethyl in which the aryls may be bridged by — ch 2 — ch 2 — or o or s . the alkyldiaryls may be unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl . ŕ 1 , ŕ 2 , ŕ 3 and ŕ 4 are independently h or c 1 - c 6 are straight chain or branched alkyls , c 3 - c 6 cycloalkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl ; c 6 - c 10 aryl unsubstituted or substituted with c 1 - c 6 alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , nitro , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 mercaptoalkyl ; and alkyl aryl ( c 6 - c 10 ) such as benzyl , unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , and c 1 - c 6 mercaptoalkyl ; ŕ 1 and ŕ 2 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ 3 and ŕ 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; r 3 to r 6 are independently selected from the group consisting of hydrogen , hydroxyl , c 1 - c 6 straight chain or branched alkyl ; c 3 - c 6 cycloalkyl ; c 6 - c 10 aryl such as phenyl , naphthyl and the like , unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl ; and alkylaryl ( c 6 - c 10 ) such as benzyl unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl , c 1 - c 6 carboxyalkyl , c 1 - c 6 acylamino , c 1 - c 6 sulfonatoalkyl , c 1 - c 6 sulfamylalkyl , and c 1 - c 6 phosphanatoalkyl ; r 3 and r 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; r 5 and r 6 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ 5 is h or c 1 - c 6 straight chain or branched alkyl ; x − is a pharmaceutically - acceptable inorganic or organic counter ion . ŕ 1 , ŕ 2 , ŕ 3 and ŕ 4 are independently h or c 1 - c 6 straight chain or branched alkyls , c 3 - c 6 cycloalkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl ; c 6 - c 10 aryl such as phenyl , naphthyl and the like , unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , nitro , trihaloalkyl , c 1 - c 6 acyl , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 mercaptoalkyl ; and alkylaryl ( c 6 - c 10 ) such as benzyl unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c1 - c6 alkoxyl , 1 , 3 - dioxolanyl , cyano , halo , trihaloalkyl , c1 - c6 acyl , c1 - c6 dialkylamino , and c 1 - c 6 mercaptoalkyl ; ŕ 1 and ŕ 2 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ 3 and ŕ 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; r 3 to r 6 are independently selected from the group consisting of hydrogen , hydroxyl , c 1 - c 6 straight chain or branched alkyl ; c 3 - c 6 cycloalkyl ; c 6 - c 10 aryl unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 acylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl ; and alkylaryl ( c 6 - c 10 ) such as benzyl , unsubstituted or substituted with c 1 - c 6 alkyl , hydroxyl , c 1 - c 6 alkoxyl , 1 , 3 - dioxolanyl , cyano , trihaloalkyl , carboxyl , c 1 - c 6 acyl , c 1 - c 6 hydroxyalkyl , amino , c 1 - c 6 alkylamino , c 1 - c 6 dialkylamino , c 1 - c 6 alkylthio , c 1 - c 6 alkoxycarbonyl , c 1 - c 6 carboxyalkyl , c 1 - c 6 acylamino , c 1 - c 6 sulfonatoalkyl , c 1 - c 6 sulfamylalkyl , and c 1 - c 6 phosphanatoalkyl ; r 3 and r 4 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; r 5 and r 6 may be optionally tethered together to form 3 - to 7 - membered alicyclic ring ; ŕ 5 is h or c 1 - c 6 straight chain or branched alkyl ; x − is a pharmaceutically - acceptable inorganic or organic counter ion ; and r 2 is hydrogen or an easily cleavable group under acidic or neutral conditions such as a t - butyl group or an alkylaryl group such as a benzyl group , wherein the aryl group may be unsubstituted or substituted with c 1 - c 6 straight chain or branched alkyl , c 3 - c 6 cycloalkyl , c 1 - c 6 alkoxyls , 1 , 3 - dioxolanyl , and c 1 - c 6 dialkylamino . in all the formulae of this invention , the following terms are to be understood , unless specifically stated otherwise : halo , when used alone or as part of a compound or moiety , is to be the ion of chloro , bromo , or iodo . alkyl , when used alone or as part of a compound or moiety , is either straight chained or branched when at least 3 carbon atoms or greater and if no number of carbon atoms are specified then it is understood to be from 1 through 4 carbons . pharmaceutically - acceptable counter ions , are well known in the art and are discussed in numerous references such as for example physicians desk reference and merck index . a preferred embodiment of formula 1 is represented by formula 1 ( a ) below , r 1 and r 2 are h or ch 3 ; these compounds of formula 1 ( a ) may exist as mixtures of diasteroisomers , if r 1 and r 2 are different , or when r 1 and r 2 are the same , as a single stereoisomer , d ( s )— or l -( r )— at the carnitine chiral center , or as a mixture of both isomers . individual isomers may be prepared starting with chiral starting components or separated from mixtures of isomers by methods well known in the art . a further preferred embodiment of the compounds of formula 1 are those shown by formula 1 ( b ) below , r 1 and r 2 are h or ch 3 ; a preferred embodiment of formula 2 is represented by formula 2 ( a ) below and its pharmaceutically - acceptable salts , r 3 , r 4 , r 5 and r 6 are independently selected to be hydrogen , methyl , ethyl , hydroxyl , alkoxyl , substituted benzoyloxy , or substituted benzyloxy . the compounds of formula 2 ( a ) may exist as mixtures of diasteroisomers , if r 1 , r 2 , r 3 , r 4 , r 5 and r 6 are different , or when these are the same , as a single stereoisomer , d -( s )— or l -( r )— at the carnitine chiral center , or as a mixture of both isomers . individual isomers may be prepared starting with chiral starting components or separated from mixtures of isomers by methods well known in the art . a further preferred embodiment of formula 2 is represented by formula 2 ( b ) below and its pharmaceutically - acceptable salts , r 1 and r 2 are h or ch 3 ; these compounds of formula 2 ( b ) exist as a single stereoisomer of l -( r )— configuration . a preferred embodiment of formula 3 is represented in formula 3 ( a ) below and its pharmaceutically - acceptable salts , r 1 and r 2 are h or ch 3 ; x − is any of the pharmaceutically - acceptable counter ions , and these compounds of formula 3 ( a ) may exist as a single stereoisomer , d -( s )— or l -( r )—, or as a mixture of both isomers . individual isomers may be prepared starting with chiral starting components or separated from mixtures of isomers by methods well known in the art . a further embodiment of compounds of formula 3 is represented in formula 3 ( b ) below , r 1 and r 2 are h or ch 3 ; x − is any of the pharmaceutically - acceptable counter ions ; and these compounds of formula 3 b exist as a single stereoisomer of l -( r )— configuration . a preferred embodiment of formula 4 is represented by formula 4 ( a ) below and its pharmaceutically acceptable salts , r 1 and r 2 are h or ch 3 ; r 3 , r 4 , r 5 , r 6 are independently selected to be hydrogen , methyl , ethyl , hydroxyl , alkoxyl ; and r 2 is an easily cleavable group under acidic or neutral conditions such as a t - butyl group or an alkylaryl group wherein the aryl group may be unsubstituted or substituted with straight chain or branched c 1 - c 6 alkyl , c 3 - c 6 cycloalkyl , c 1 - c 6 alkoxyls , 1 , 3 - dioxolanyl , and c 1 - c 6 dialkylamino . a further embodiment of formula 4 is represented by formula 4 ( b ) below and its pharmaceutically - acceptable salts , r 1 and r 2 are h or ch 3 ; these compounds of formula 4 ( b ) exist as a single stereoisomer of l -( r )— configuration . a preferred embodiment of formula 5 is represented by formula 5 ( a ) below and its pharmaceutically - acceptable salts , ŕ 1 , ŕ 2 , ŕ 3 and ŕ 4 are independently h or ch 3 . x − is a pharmaceutically - acceptable inorganic or organic counter ion . these compounds of formula 5 ( a ) may exist as mixtures of diastereoisomers . individual isomers may be prepared starting with chiral starting components or separated from mixtures of isomers by methods well known in the art . a further embodiment of formula 5 is represented by formula 5 ( b ) below and its pharmaceutically - acceptable salts , ŕ 1 , ŕ 2 , ŕ 3 , ŕ 4 and ŕ 5 are h or ch 3 ; x − is a pharmaceutically acceptable inorganic or organic counter ion . these compounds of formula 5 ( b ) exist as a single stereoisomer of l -( r )— configuration . a preferred embodiment of formula 6 is represented by formula 6 ( a ) below and its pharmaceutically - acceptable salts , ŕ 1 , ŕ 2 , ŕ 3 , ŕ 4 are independently h or ch 3 ; x − is a pharmaceutically - acceptable inorganic or organic counter ion . a preferred embodiment of formula 6 is represented by formula 6 ( b ) below and its pharmaceutically - acceptable salts , ŕ 1 , ŕ 2 , ŕ 3 , ŕ 4 and ŕ 5 are h or ch 3 ; x − is a pharmaceutically - acceptable inorganic or organic counter ion . these compounds of formula 6 ( b ) exist as a single stereoisomer of l -( r )— configuration . a preferred embodiment of formula 7 is represented by formula 7 ( a ) below and its pharmaceutically - acceptable salts , ŕ 1 , ŕ 2 , ŕ 3 , ŕ 4 are independently h or ch 3 ; r 3 , r 4 , r 5 , and r 6 are independently selected to be hydrogen , methyl , ethyl , hydroxyl , alkoxyl . a further embodiment of formula 7 is represented by formula 7 ( b ) below and its pharmaceutically - acceptable salts , ŕ 1 , ŕ 2 , ŕ 3 , ŕ 4 and ŕ 5 are h or ch 3 ; x − is a pharmaceutically - acceptable inorganic or organic counter ion ; and these compounds of formula 7 ( b ) exist as a single stereoisomer of l -( r )— configuration . a preferred embodiment of formula 8 is represented by formula 8 ( a ) below and its pharmaceutically - acceptable salts , ŕ 1 , ŕ 2 , ŕ 3 and ŕ 4 are independently h or ch 3 ; x − is a pharmaceutically - acceptable inorganic or organic counter ion ; r 3 , r 4 , r 5 and r 6 are independently selected to be hydrogen , methyl , ethyl , hydroxyl , alkoxyl ; and r 2 is hydrogen or an easily cleavable group under acidic or neutral conditions such as a t - butyl group or an alkylaryl group such as a benzyl group wherein the aryl group may be unsubstituted or substituted with straight chain or branched c 1 - c 6 alkyl , c 3 - c 6 cycloalkyl , c 1 - c 6 alkoxyls , 1 , 3 - dioxolanyl , and c 1 - c 6 dialkylamino . a further embodiment of formula 8 is represented by formula 8 ( b ) below and its pharmaceutically - acceptable salts , ŕ 1 , ŕ 2 , ŕ 3 , ŕ 4 and ŕ 5 are h or ch 3 ; x − is a pharmaceutically - acceptable inorganic or organic counter ion ; these compounds of formula 8 ( b ) exist as a single stereoisomer of l -( r )— configuration . compounds 3 -( 3 , 5 - dimethyladamantan - 1 - ylcarbamoyl )-( r )- 2 - hydroxypropyl )- trimethyl ammonium chloride [ formula 1 ( b ); r 1 and r 2 are ch 3 ; n = 0 ], and 3 - benzyloxycarbonyl -( r )- 2 -{[( 3 , 5 - dimethyladamantan - 1 - ylcarbamoyl )- propionyloxy ] propyl }- trimethyl ammonium bromide [ formula 4 ( b ); r 1 and r 2 are ch 3 ; n = 0 ; r 3 , r 4 , r 5 , r 6 are hydrogen ; and r 2 is a benzyl group ] were selected for in vivo testing in mice , since both are potential prodrugs for memantine and l - carnitine through in vivo enzymatic hydrolysis of either an amide or ester linkages . since memantine has n - methyl - d - aspartate ( nmda ) antagonist properties , it was assumed that the above compounds would share these properties and therefore a test was utilized that identifies nmda antagonist activity in vivo . briefly , this test measures seizure activity and lethality in mice produced by the administration of nmda antagonists which block these parameters in a dose - dependent manner ( see leander , j . d ., et al ., brain res . 448 , 115 - 120 ( 1988 ), n - methyl - d - aspartate acid - induced lethality in mice : selective antagonism by phencyclidine - like drugs ; parsons , c . g ., et al ., neuropharmacol . 34 , 1239 - 1258 ( 1995 ). test protocol : male , nih - swiss mice weighing 25 - 30 grams were pretreated with either compound by the subcutaneous ( sc ) route of administration and 30 minutes later nmda ( 200 mg / kg ) was administered intraperitoneally ( ip ). animals were observed for 30 minutes and the number of seizure episodes , and whether death occurred was recorded , as well as the time to produce each seizure event and the time of death . memantine ( 30 mg / kg ; sc ) was used as a positive control in each experiment and there were n = 8 mice / group for all conditions . results : 3 -( 3 , 5 - dimethyladamantan - 1 - ylcarbamoyl )-( r )- 2 - hydroxypropyl )- trimethyl ammonium chloride slightly increased the time to lethality following the sc administration of 120 mg / kg ; however , toxicity ( e . g . tremors , lethality in n = 3 mice ) was observed at this dose . a dose of 60 mg / kg ( sc ) was inactive . 3 - benzyloxycarbonyl -( r )- 2 -{[( 3 , 5 - dimethyladamantan - 1 - ylcarbamoyl )- propionyloxy ] propyl }- trimethyl ammonium bromide at a dose of 90 mg / kg ( sc ) markedly increased the time to produce clonic seizures and death . these results are suggestive of nmda antagonist activity . the pharmaceutical composition may also contain physiologically tolerable diluents , carriers , adjuvants , and the like . the phrase “ pharmaceutically - acceptable ” means those formulations which are , within the scope of sound medical judgment , suitable for use in contact with the tissues of humans and animals without undue toxicity , irritation , allergic response and the like , and are commensurate with a reasonable benefit / risk ratio . pharmaceutically - acceptable salts are well - known in the art , and are described by berge et al ., j . pharm . sci . 66 , 1 - 16 ( 1977 ), incorporated herein by reference . representative salts include , but are not limited to , acetate , adipate , alginate , citrate , aspartate , benzoate , benzenesulfonate , chloride , bromide , bisulfate , butyrate , camphorate , camphor sulfonate , gluconate , glycerophosphate , hemisulfate , heptanoate , hexanoate , fumarate , maleate , succinate , oxalate , citrate , hydrochloride , hydrobromide , hydroiodide , lactate , maleate , nicotinate , 2 - hydroxyethansulfonate ( isothionate ), methane sulfonate , 2 - naphthalene sulfonate , oxalate , palmitoate , pectinate , persulfate , 3 - phenylpropionate , picrate , pivalate , propionate , tartrate , phosphate , glutamate , bicarbonate , p - toluenesulfonate , undecanoate , lithium , sodium , potassium , calcium , magnesium , aluminum , ammonium , tetramethyl ammonium , tetraethylammonium , methylammonium , dimethylammonium , trimethylammonium , triethylammonium , diethylammonium , and ethylammonium , and the like . the pharmaceutical compositions of this invention can be administered to humans and other mammals enterally or parenterally in a solid , liquid , or vapor form . parenteral route includes intravenous , intramuscular , intraperitoneal , intrasternal , and subcutaneous injection or infusion . the compositions can also be delivered through a catheter for local delivery at a target site , via an intracoronary stent ( a tubular device composed of a fine wire mesh ), or via a biodegradable polymer . the active compound is mixed under sterile conditions with a pharmaceutically acceptable carrier along with any needed preservatives , excipients , buffers , or propellants . ophthalmic formulations , eye ointments , powders and solutions are also contemplated as being within the scope of this invention . actual dosage levels of the active ingredients in the pharmaceutical formulation can be varied so as to achieve the desired therapeutic response for a particular patient . the selected dosage level will depend upon the activity of the particular compound , the route of administration , the severity of the condition being treated , and prior medical history of the patient being treated . this evaluation of dose is well within the ability of the medical staff to determine . the phrase “ therapeutically effective amount ” of the compound of the invention means a sufficient amount of the compound to treat disorders , at a reasonable benefit / risk ratio applicable to medical treatment . it will be understood , however , that the total daily usage of the compounds and compositions of the present invention shown by formula ( i ) will be decided based on clinical experience . the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated , the severity of the disorder ; activity of the specific compound employed ; the number of doses administered in a specified time ; the specific composition employed ; age , body weight , general health , sex , diet of the patient ; the time of administration , route of administration , and rate of excretion of the specific compound employed ; and the duration of the treatment . the compounds of the present invention may also be administered in combination with other drugs , if medically necessary , to treat the disorder concerned . compositions suitable for parenteral injection may comprise physiologically acceptable , sterile aqueous or nonaqueous solutions , dispersions , suspensions or emulsions and sterile powders for reconstitution into sterile injectable solutions or dispersions . examples of suitable aqueous and nonaqueous carriers , diluents , solvents or vehicles include water , ethanol , polyols propylene glycol , polyethyleneglycol , glycerol , and the like ), vegetable oils ( such as olive oil ), injectable organic esters such as ethyl oleate , and suitable mixtures thereof . these compositions can also contain adjuvants such as preserving , wetting , emulsifying , and dispensing agents . prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents , for example , parabens , chlorobutanol , phenol , sorbic acid , and the like . it may also be desirable to include isotonic agents , for example sugars , sodium chloride and the like . suspensions , in addition to the active compounds , may contain suspending agents , as for example , ethoxylated isostearyl alcohols , polyoxyethylene sorbitan esters , microcrystalline cellulose , aluminum metahydroxide , bentonite , agar - agar and tragacanth , or mixtures of these substances , and the like . prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption , for example , aluminum monostearate and gelatin . proper fluidity can be maintained , for example , by the use of coating materials such as lecithin , by the maintenance of the required particle size in the case of dispersions , and by the use of surfactants . in some cases , in order to prolong the effect of the drug , it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection . this can be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility . the rate of absorption of the drug then depends upon its rate of dissolution which , in turn , may depend upon crystal size and crystalline form . alternatively , delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle . injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide - polyglycolide . depending on the ratio of drug to polymer and the nature of the particular polymer employed , the rate of the drug release can be controlled . examples of other biodegradable polymers include poly ( orthoesters ) and poly ( anhydrides ). depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues . the injectable formulations can be sterilized , for example , by filtration through a bacterial - retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use . dosage forms for topical administration include powders , sprays , ointments , patch and inhalants . solid dosage forms for oral administration include capsules , tablets , pills , powders and granules . in such solid dosage forms , the active compound may be mixed with at least one inert , pharmaceutically acceptable excipient or carrier , such as sodium citrate or dicalcium phosphate and / or a ) fillers or extenders such as starches , lactose , sucrose , glucose , mannitol , and silicic acid ; b ) binders such as carboxymethylcellulose , alginates , gelatin , polyvinylpyrrolidone , sucrose and acacia ; c ) humectants such as glycerol ; d ) disintegrating agents such as agar - agar , calcium carbonate , potato or tapioca starch , alginic acid , certain silicates and sodium carbonate ; e ) solution retarding agents such as paraffin ; f ) absorption accelerators such as quaternary ammonium compounds ; g ) wetting agents such as cetyl alcohol and glycerol monostearate ; h ) absorbents such as kaolin and bentonite clay and i ) lubricants such as talc , calcium stearate , magnesium stearate , solid polyethylene glycols , sodium lauryl sulfate and mixtures thereof . in the case of capsules , tablets and pills , the dosage form may also comprise buffering agents . solid compositions of a similar type may also be employed as fillers in soft and hard - filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like . the solid dosage forms of tablets , dragees , capsules , pills and granules can be prepared with coatings and shells such as enteric coatings and other coatings well - known in the pharmaceutical formulating art . they may optionally contain opacifying agents and may also be of a composition such that they release the active ingredient ( s ) only , or preferentially , in a certain part of the intestinal tract , optionally in a delayed manner . examples of embedding compositions which can be used include polymeric substances and waxes . the active compounds can also be in micro - encapsulated form , if appropriate , with one of more of the above - mentioned excipients . liquid dosage forms for oral administration include pharmaceutically acceptable emulsions , solutions , suspensions , syrups and elixirs . in addition to the active compounds , the liquid dosage forms may contain inert diluents commonly used in the art such as , for example , water or other solvents , solubilizing agents and emulsifiers such as ethyl alcohol , isopropyl alcohol , ethyl carbonate , ethyl acetate , benzyl alcohol , benzyl benzoate , propylene glycol , 1 , 3 - butylene glycol , dimethyl formamide , oils ( in particular , cottonseed , groundnut , corn , germ , olive , castor and sesame oils ), glycerol , tetrahydrofurfuryl alcohol , polyethylene glycols and fatty acid esters of sorbitan and mixtures thereof . besides inert diluents , the oral suspending agents , sweetening , flavoring perfuming agents . compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the compounds of this invention with suitable non - irritating excipients or carriers such as cocoa butter , polyethylene glycol or a suppository wax which are solid are room temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound . the present invention also provides pharmaceutical compositions that comprise compounds of the present invention formulated together with one or more non - toxic pharmaceutically acceptable carriers . compounds of the present invention can also be administered in the form of liposomes . as is known in the art , liposomes are generally derived from phospholipids or other lipid substances . liposomes are formed by mono - or multi - lamellar hydrated liquid crystals which are dispersed in an aqueous medium . any non - toxic , physiologically acceptable and metabolizable lipid capable of forming liposomes can be used . the present invention compositions in liposome form can contain , in addition to a compound of the present invention , stabilizers , preservatives , excipients and the like . the preferred lipids are natural and synthetic phospholipids and phosphatidyl cholines ( lecithins ) used separately or together . methods to form liposomes are known in the art [ e . g ., liposomes in biomedical applications : drug targeting and delivery , vol . 6 , by p . n . shek , pub . crc ( aug . 3 , 1995 )]. the examples which follow are presented to describe preferred embodiments and utilities of the invention and are not meant to limit the invention . the description is intended as a non - limiting illustration , since many variations will become apparent to those skilled in the art in view thereof . it is intended that all such variations are within the scope and spirit of the appended claims . changes can be made in the composition , operation , and arrangement of the method of the present invention described herein without departing from the concept and scope of the invention . by a similar sequence of steps , compounds of formula ( i ), specifically formulae 5 and 6 may be prepared by a similar sequence of steps , compounds of formula ( i ), specifically formulae 7 and 8 may be prepared e ) tscl , pyr . ; [ bellamy , f . d ., et al ., tetrahedron lett . 3 , 7323 - 7326 ( 1990 )] h ) memantines , thf / δ [ huang , g . et al ., tetrahedron 54 , 1355 - 1360 ( 1998 ); zang , j . et al ., j . carbohydr . chem . 17 , 341 - 358 ( 1998 )] by a similar sequence of steps , compounds of formula ( i ), specifically formula 5 may be prepared the synthesis of representative conjugates 1 - 4 of l - carnitine with memantine and neramexane are shown in schemes 6 - 9 . in general , the succinate ester and isobutyrate ester of l - carnitine were prepared and coupled with both neramexane ( jirgenson , a , et al ., synthesis 12 , 1709 - 1712 ( 2002 ), and u . s . pat . no . 6 , 034 , 134 ) and commercially available memantine ( acros ). unlike in the previous literature preparations of the succinate ester ( see johnson , d . w ., chem . phys . lipids 129 ( 2 ), 161 - 172 ( 2004 ), and isobutyrate ester of l - carnitine ( gaskell , s . j ., et . al ., anal . chemistry 58 ( 13 ), 2801 - 2805 ( 1986 ); cipollone , m ., et . al ., j . med . chem . 35 , 903 - 911 ( 2000 ), l - carnitine was first protected as the benzyl ester . the benzyl ester of l - carnitine ( 1 - 04 ) was treated with an excess of either succinic anhydride or isobutyric anhydride in the presence of pyridine . after purification by column chromatography , the succinate ester of carnitine benzyl ester was coupled with either neramexane ( 3 - 01 ) or memantine ( 4 - 01 ) with the use of dcc . the succinate - bridged compounds were then purified by column chromatography until pure by nmr . the isobutyrate ester of l - carnitine benzyl ester ( 1 - 03 ) was hydrogenated to remove the protective benzyl ester . the free acid ( 1 - 02 ) was coupled to either neramexane or memantine using dcc . finally , the protective isobutyrate esters were removed with potassium carbonate ( in methanol ) to generate the l - carnitine amide with neramexane ( 1 ) or memantine ( 2 ). both amides were purified by column chromatography until pure by nmr . once pure , all four compounds were freeze - dried under high vacuum at room temperature until a constant weight was achieved . a portion of the dried compounds was analyzed by nmr , optical rotation , hplc , hrms , and chn . in order to verify that the carnitine present in 1 and 2 maintained the r - configuration , several attempts were made to prepare the ( r )- and ( s )- mosher &# 39 ; s esters of the products . it was clear from the experiments that the mosher &# 39 ; esters were not stable in the presence of base and rapidly eliminated methoxy -( trifluoromethyl ) phenyl acetic acid after the ester formed . this was not completely unexpected . both the final precursors ( 1 - 01 and 2 - 01 ) eliminated isobutyric acid in the presence of base . in order to determine the stereochemical purity of 3 - 01 and 4 - 01 , the material was hydrogenated to remove the benzyl ester , complexed with mucic acid ( see u . s . pat . no . 5 , 952 , 379 ), to improve stability , and compared by chiral hplc to standards prepared in the same fashion from ( s )- carnitine . the hplc data indicated that less than 1 % of the s - isomer was present in 3 and 4 . since all compounds were produced under similar conditions , it is likely that 1 and 2 maintained their stereochemical purity as well . for the following examples the various equipment and methods were used to run the various described tests for the results reported in the examples below . the synthesis of compounds 1 , 2 , 3 - 01 and 4 - 01 was carried out in several batches ( 0 . 3 - 10 . 0 g ). reagents were purchased at the highest obtainable purity from lancaster , sigma - aldrich , or acros , except for solvents , which were purchased from either fisher scientific or mallinckrodt . high - resolution mass spectra were obtained from the chemistry department at the university of florida . the combustion ( chn ) analysis for the final compounds was done at atlantic microlab ( norcross , ga . 30091 ). the nmr and high - resolution mass spectra obtained for the final compounds are consistent with the proposed structures . each final compound had a small negative optical rotation as expected . some problems were observed with the hplc data . the impurities tended to be better chromophores than the desired products , leading to hplc data that were not consistent with the nmr data . also , suitable hplc conditions could not be found for 3 - 01 and 4 - 01 , using a series of columns and conditions . a portion of the material did not adhere to the column and the remainder came off as a series of peaks . this behavior was also seen during column chromatography , and was more pronounced when a gradient system was used . finally , the chn analysis for each compound did not match the calculated value , primarily due to hygroscopicity of the samples . each compound appears to contain 1 . 5 - 3 equivalents of water . in the case of 1 and 2 , dichloromethane was used to prepare the chn samples ( in order to drive off some of the water ). unfortunately , additional drying at atlantic microlab failed to remove all of the dichloromethane , leading to the high chlorine levels found for those compounds . the invention will be further clarified by a consideration of the following examples , which are intended to be purely exemplary of the present invention . a mixture of the benzyl ester of l - carnitine bromide ( 1 - 04 , 10 . 0 g , 0 . 030 mol ), isobutyric anhydride ( 20 . 0 g , 0 . 126 mol ), pyridine ( 10 ml ), and dichloromethane ( 10 ml ) was stirred at room temperature for 20 hours under an argon atmosphere . after 20 hours , toluene ( 200 ml ) was added and the precipitate was filtered . the precipitate was stirred with diethyl ether ( 100 ml ) at room temperature for 1 hour under an argon atmosphere . the precipitate was filtered a second time and dried under high vacuum at room temperature until the weight was constant . the experiment produced the isobutyric ester of l - carnitine benzyl ester ( 1 - 03 , 11 . 01 g , 90 . 9 % yield ) as a light brown , wax - like solid . its spectra are : 1 h nmr ( 300 mhz , dmso ): δ 7 . 39 ( 5h , m ), 5 . 52 ( 1h , m ), 5 . 13 ( 2h , s ), 3 . 92 - 3 . 76 ( 2h , m ), 3 . 15 ( 9 hs ), 2 . 87 ( 2h , dd , j = 6 . 6 , 6 . 3 hz ), 2 . 50 ( 1h , m ), 1 . 04 ( 3h , d , j = 7 . 5 hz ), 1 . 02 ( 3h , d , j = 7 . 8 hz ); and 13 c nmr ( 75 mhz , dmso ): δ 174 . 84 , 168 . 62 , 135 . 45 , 128 . 28 , 128 . 04 , 66 . 87 , 66 . 04 , 64 . 64 , 52 . 59 , 37 . 08 , 18 . 39 , 18 . 23 . the benzyl protected isobutyric ester of l - carnitine ( 1 - 03 , 10 . 60 g , 0 . 026 mol ) was dissolved in ethanol ( 100 ml ) and added to 10 % palladium - on - carbon ( 2 . 0 g ). the mixture was hydrogenated in a small parr apparatus for 6 hours at room temperature under 42 psi hydrogen . the mixture was filtered through a pad of celite 521 ( 20 g ) and concentrated under reduced pressure . the remaining solid was dried at room temperature under high vacuum until the product weight was constant ( 6 hours ). the experiment produced the isobutyric ester of l - carnitine ( 1 - 02 , 6 . 8 g , 82 % yield ) as an off - white , wax - like solid . its spectra are : 1 h nmr ( 300 mhz , cd 3 od ): δ 6 . 62 ( m , 1h ), 3 . 93 ( dd , 1h , j = 14 . 4 , 8 . 7 hz ), 3 . 75 ( d , 1h , j = 14 . 4 hz ), 3 . 24 ( s , 9h ), 2 . 77 ( d , 2h , j = 5 . 7 hz ), 2 . 60 ( m , 1h ), 1 . 18 ( d , 6h , j = 6 . 9 hz ); and 13 c nmr ( 75 mhz , cd 3 od ): δ 177 . 19 , 172 . 30 , 69 . 53 , 66 . 31 , 54 . 70 , 38 . 00 , 35 . 35 , 19 . 32 , 19 . 05 . a mixture of the isobutyric ester of l - carnitine benzyl ester ( 1 . 94 g , 6 . 21 mmol ), neramexane ( 0 . 95 g , 5 . 61 mmol ), and n , n ′- dicyclohexylcarbodiimide ( dcc , 1 . 20 g , 5 . 81 mmol ) in dichloromethane ( 10 ml ) was stirred at room temperature for 2 hours under an argon atmosphere . the precipitated dcu was removed by filtration , and the dichloromethane solution was directly purified by column chromatography on silica gel ( 25 g ) eluting with 15 % methanol in dichloromethane . the product containing fractions were combined and concentrated under reduced pressure . the remaining gel was dried under high vacuum at room temperature until the weight was constant . the experiment produced 1 - 01 as a light yellow gel ( 0 . 50 g , 19 % yield ). its spectra are : 1 h nmr ( 300 mhz , cd 3 od ): δ 7 . 16 ( s , 1h ), 5 . 57 ( m , 1h ), 3 . 82 ( dd , 1h , j = 14 . 1 , 8 . 1 hz ), 3 . 65 ( d , 1h , j = 14 . 1 hz ), 3 . 15 ( s , 9h ), 2 . 53 ( m , 3h ), 2 . 16 ( d , 2h , j = 14 . 4 hz ), 1 . 26 - 1 . 21 ( m , 4h ), 1 . 11 ( s , 3h ), 1 . 04 - 0 . 96 ( m , 9h ), 0 . 83 ( br s , 6h ); and 13 c nmr ( 75 mhz , cd 3 od ): δ 177 . 13 , 170 . 15 , 69 . 91 , 66 . 72 , 56 . 06 , 54 . 98 , 54 . 73 , 52 . 82 , 50 . 00 , 40 . 70 , 36 . 48 , 35 . 30 , 32 . 44 , 30 . 77 , 29 . 03 , 28 . 96 , 19 . 25 , 19 . 16 . the isobutyric ester ( 1 - 01 , 0 . 50 g , 1 . 07 mmol ) was dissolved in anhydrous methanol ( 10 ml ). dry potassium carbonate ( 1 . 0 g , 7 . 23 mmol ) was added and the mixture was vigorously stirred for 5 hours at room temperature under an argon atmosphere . the excess potassium carbonate was removed by filtration and the methanol solution was acidified with concentrated hydrochloric acid ( 1 . 0 ml ) in methanol ( 20 ml ). the methanol was concentrated under reduced pressure and the residual gel was dissolved in a small volume of diuf water ( 5 ml ) and purified on ods - silica gel ( 20 g ), eluting with 50 % methanol in dilute hydrochloric acid ( 0 . 05 %). the product containing fractions were combined and the volume was reduced by 50 % under reduced pressure . the remaining aqueous portion was freeze - dried until a constant weight was achieved . the experiment generated 1 ( 0 . 32 g , 80 % yield ) as a colorless foam . its spectra are : 1 h nmr ( 300 , dmso - d 6 ): δ 7 . 16 ( s , 1h ), 4 . 37 ( m , 1h ), 3 . 34 ( m , 2h ), 3 . 14 ( s , 91 ), 2 . 34 - 2 . 15 ( m , 4h ), 1 . 24 ( m , 1h ), 1 . 20 ( s , 3h ), 1 . 05 ( s , 61 ), 1 . 02 - 0 . 91 ( m , 31 , 0 . 83 ( s , 6h ); 13 c nmr ( 75 mhz , dmso - d 6 ): δ 169 . 42 , 69 . 65 , 62 . 71 , 53 . 59 , 53 . 41 , 51 . 40 , 46 . 69 , 46 . 52 , 42 . 25 , 35 . 85 , 31 . 07 , 30 . 03 , 28 . 08 , 28 . 03 ; hplc analysis : 35 % acn / 65 % phosphate buffer ( 25 mmol , ph = 2 . 5 ), gemini c18 , 5μ , 4 . 6 × 250 mm ( serial # 262049 - 2 ), 40 c , 1 ml / min . room temperature = 8 . 363 min ., purity = 91 . 4 % ( at 205 nm ); hrms : lsims ( fab ) [ m - cl − ] + ; theoretical 313 . 2850 , found 313 . 2845 ; specific rotation : [ α ] d 25 =− 8 . 08 deg ( 25 ° c ., c = 0 . 00321 g × ml − 1 , ethanol , 589 nm ); and calculated : c , 61 . 96 ; h , 10 . 69 ; n , 8 . 03 ; cl , 10 . 16 ( c 18 h 37 cln 2 o 2 ); best fit : c , 55 . 50 ; h , 10 . 43 ; n , 7 . 13 ; cl , 12 . 02 ( c 18 h 37 cln 2 o 2 + 1 . 66h 2 o + 0 . 16 ch 2 cl 2 , ch 2 cl 2 used in sample transfer , not present in original sample ). a mixture of the isobutyric ester of l - carnitine ( 1 - 02 , 0 . 97 g , 3 . 10 mmol ), memantine ( 0 . 50 g , 2 . 78 mmol , obtained by base treatment of the hydrochloride and extracting the free base in dichloromethane ), and n , n ′- dicyclohexylcarbodiimide ( dcc , 0 . 58 g , 2 . 81 mmol ) in dichloromethane ( 10 ml ) was stirred at room temperature for 2 hours under an argon atmosphere . the precipitated dcu was removed by filtration , and the dichloromethane solution was purified by column chromatography on silica gel ( 20 g ) eluting with 0 - 25 % methanol in dichloromethane . the product containing fractions were combined and concentrated under reduced pressure . the remaining gel was dried under high vacuum at room temperature until the weight was constant . the experiment produced 2 - 01 as an off - white gel ( 0 . 36 g , 27 % yield ). its spectra are : 1 h nmr ( 300 mhz , cd 3 od ): δ 5 . 68 ( m , 1h ), 3 . 87 ( dd , 1h , j = 14 . 1 , 8 . 1 hz ), 3 . 73 ( d , 1h , j = 14 . 1 hz ), 3 . 21 ( s , 9h ), 2 . 63 - 2 . 56 ( m , 3h ), 2 . 10 ( m , 1h ), 1 . 83 ( m , 2h ), 1 . 63 ( m , 4h ), 1 . 34 ( m , 4h ), 1 . 19 - 1 . 14 ( m , 6h ), 0 . 84 ( br s , 6h ); and 13 c nmr ( 75 mhz , cd 3 od ): δ 177 . 14 , 169 . 50 , 69 . 82 , 66 . 80 , 54 . 83 , 54 . 66 , 51 . 78 , 48 . 29 , 43 . 84 , 40 . 85 , 40 . 69 , 35 . 35 , 33 . 38 , 31 . 66 , 30 . 87 , 19 . 42 , 19 . 15 . the isobutyric ester ( 2 - 01 , 0 . 36 g , 0 . 76 mmol ) was dissolved in anhydrous methanol ( 12 ml ). dry potassium carbonate ( 0 . 5 g , 3 . 61 mmol ) was added and the mixture was vigorously stirred for 5 hours at room temperature under an argon atmosphere . the excess potassium carbonate was removed by filtration and the methanol solution was acidified with concentrated hydrochloric acid ( 1 . 0 ml ) in methanol ( 20 ml ). the methanol was concentrated under reduced pressure and the residual gel was dissolved in a small volume of diuf water ( 5 ml ) and purified on ods - silica gel ( 20 g ), eluting with 50 % methanol in dilute hydrochloric acid ( 0 . 05 %). the product containing fractions were combined and the volume was reduced by 50 % under reduced pressure . the remaining aqueous portion was freeze - dried until a constant weight was achieved . the experiment generated 2 ( 0 . 18 g , 66 % yield ) as a colorless foam . its spectra are : 1 h nmr ( 300 mhz , dmso - d 6 ): δ 7 . 55 ( s , 1h ), 4 . 34 ( m , 1h ), 3 . 32 ( d , 2h , j - 5 . 4 hz ), 3 . 12 ( s , 91 ), 2 . 23 ( m , 2h ), 2 . 05 ( m , 1h ), 1 . 74 ( br s , 2h ), 1 . 56 ( br s , 4h ), 1 . 26 ( m , 4h ), 1 . 08 ( br s , 2h ), 0 . 79 ( s , 6h ); 13 c nmr ( 75 mhz , dmso - d 6 ): δ 168 . 52 , 69 . 72 , 62 . 72 , 53 . 36 , 52 . 46 , 52 . 35 , 50 . 24 , 46 . 99 , 42 . 32 , 41 . 78 , 31 . 86 , 30 . 16 , 29 . 51 ; hplc analysis : 97 . 42 % purity ( at 205 nm ), room temperature = 8 . 107 min , 35 % acn , 65 % phosphate buffer ( 0 . 25 mmol , ph = 2 . 5 ), gemini c18 , 5μ , 4 . 6 × 259 mm (# 262049 - 2 ), 1 ml / min ., 40 ° c ., 20 μl injection volume ; specific rotation : [ α ] d 25 =− 6 . 40 deg ( 25 ° c ., c = 0 . 0050 g × ml − 1 , ethanol , 589 nm ); hrms : lsims ( fab ) [ m — cl − ] + : theoretical 323 . 2693 , found 323 . 2689 ; and calculated : c , 63 . 58 ; h , 9 . 83 ; n , 7 . 80 ; cl , 9 . 88 ( c 19 h 35 cln 2 o 2 ); best fit : c , 54 . 96 ; h , 9 . 68 ; n , 6 . 66 ; cl , 12 . 64 ( c 19 h 35 cln 2 o 2 + 2 . 25h 2 o + 0 . 25 ch 2 cl 2 dichloromethane used in chn sample preparation , not in original sample ). a mixture of the benzyl ester of l - carnitine ( 1 - 04 , 5 . 0 g , 0 . 015 mol ), succinic anhydride ( 10 . 0 g , 0 . 10 mol ), pyridine ( 5 ml ), and dichloromethane ( 3 ml ) was stirred at room temperature for 20 hours , under an argon atmosphere . after 24 hours , the mixture was concentrated under reduced pressure and dried under high vacuum at room temperature until the weight was constant . the crude material ( 19 . 2 g ) was purified by column chromatography on silica gel ( 100 g ), eluting with methanol in dichloromethane ( gradient 2 - 20 %). the product containing fractions were combined , concentrated under reduced pressure , and dried under high vacuum at room temperature until the weight was constant . the experiment produced the succinic ester of l - carnitine benzyl ester ( 3 - 02 , 2 . 73 g , 44 % yield ) as a light , brown foam . its spectra are : 1 h nmr ( 300 mhz , cd 3 od ): δ 7 . 38 ( m , 5h ), 5 . 70 ( m , 1h ), 5 . 16 ( s , 2h ), 3 . 91 ( dd , 1h , j = 14 . 4 , 8 . 7 hz ), 3 . 77 ( d , 1h , j = 14 . 4 hz ), 3 . 22 ( s , 9h ), 2 . 87 ( d , 2h , j = 5 . 7 hz ), 2 . 68 - 2 . 42 ( m , 4h ); and 13 c nmr ( 75 mhz , cd 3 od ): δ 175 . 67 , 173 . 34 , 170 . 50 , 137 . 05 , 129 . 63 , 129 . 48 , 69 . 18 , 68 . 11 , 66 . 40 , 54 . 83 , 38 . 18 , 30 . 31 , 29 . 61 . a mixture of the succinic ester of l - carnitine benzyl ester ( 3 - 02 , 0 . 91 g , 2 . 10 mmol ), neramexane ( 0 . 34 g , 2 . 0 mmol ) 1 , and n , n ′- dicyclohexylcarbodiimide ( dcc , 0 . 42 g , 2 . 0 mmol ) in dichloromethane ( 10 ml ) was stirred at room temperature for 2 hours under an argon atmosphere . the precipitated dcu was removed by filtration , and the dichloromethane solution was purified twice by column chromatography on silica gel ( 25 g ) eluting with 0 - 25 % methanol in dichloromethane . the product containing fractions were combined and concentrated under reduced pressure . the remaining gel was dissolved in diuf water ( 100 ml ) and freeze - dried under high vacuum at room temperature until the weight was constant . the experiment produced 3 - 01 as an off - white gel ( 0 . 31 g , 28 % yield ). its spectra are : 1 h nmr ( 300 mhz , cd 3 od ): δ 7 . 37 ( m , 5h ), 7 . 03 ( s , 1h ), 5 . 67 ( m , 1h ), 5 . 16 ( s , 2h ), 3 . 93 ( dd , 1h , j = 14 . 4 , 8 . 7 hz ), 3 . 78 ( d , 1h , j = 14 . 4 hz ), 3 . 24 ( s , 9h ), 2 . 87 ( d , 2h , j = 6 . 0 hz ), 2 . 56 - 2 . 38 ( m , 4h ), 2 . 25 ( m , 2h ), 1 . 30 ( d , 2h , j = 13 . 8 hz ), 1 . 25 ( s , 3h ), 1 . 10 ( m , 6h ), 1 . 00 ( d , 21 , j = 13 . 5 hz ), 0 . 88 ( m , 6h ); 13 c nmr ( 75 mhz , cd 3 od ): δ 173 . 47 , 173 . 37 , 170 . 51 , 137 . 02 , 129 . 60 , 129 . 56 , 129 . 44 , 69 . 11 , 68 . 03 , 66 . 30 , 55 . 58 , 54 . 80 , 52 . 90 , 48 . 37 , 38 . 13 , 36 . 81 , 32 . 42 , 32 . 32 , 30 . 84 , 30 . 37 , 28 . 70 , 28 . 58 ; specific rotation : [ α ] d 25 =− 4 . 5 deg ( 25 ° c ., c = 0 . 0011 g × ml − 1 , ethanol , 589 nm ); hrms : lsims ( fab ) [ m - br − ] + : theoretical : 503 . 3479 , found : 503 . 3469 ; and calculated : c , 64 . 60 ; h , 8 . 79 ; n , 5 . 20 ( c 29 h 47 brn 2 o 5 ); best fit : c , 54 . 63 ; h , 8 . 38 ; n , 4 . 39 ( c 29 h 47 brn 2 o 5 + 3h 2 o ). a mixture of the succinic ester of l - carnitine benzyl ester ( 3 - 02 , 0 . 6 g , 1 . 38 mmol ), memantine ( 0 . 25 g , 1 . 38 mmol ), and n , n ′- dicyclohexylcarbodiimide ( dcc , 0 . 28 g , 1 . 38 mmol ) in dichloromethane ( 5 ml ) was stirred at room temperature for 4 hours under an argon atmosphere . the precipitated dcu was removed by filtration , and the dichloromethane solution was purified twice by column chromatography on silica gel ( 25 g ) eluting with 0 - 25 % methanol in dichloromethane . the product containing fractions were combined and concentrated under reduced pressure . the remaining gel was dissolved in diuf water ( 100 ml ) and freeze - dried under high vacuum at room temperature until the weight was constant . the experiment produced 4 - 01 as an off - white gel ( 0 . 24 g , 29 % yield ). its spectra are : 1 h nmr ( 300 mhz , cd 3 od ): δ 7 . 37 ( m , 6h ), 5 . 68 ( m , 1h ), 5 . 16 ( s , 2h ), 3 . 96 ( dd , 1h , j = 14 . 1 , 8 . 7 hz ), 3 . 78 ( d , 1h , j = 14 . 1 hz ), 3 . 24 ( s , 9h ), 2 . 88 ( d , 2h , j = 6 . 3 hz ), 2 . 56 - 2 . 38 ( m , 4h ), 2 . 09 ( m , 1h ), 1 . 83 ( m , 2h ), 1 . 62 ( m , 4h ), 1 . 39 - 1 . 26 ( m , 4h ), 1 . 13 ( br s , 2h ), 0 . 83 ( s , 6h ); 13 c nmr ( 75 mhz , cd 3 od ): δ 173 . 40 , 172 . 89 , 170 . 51 , 137 . 00 , 129 . 61 , 129 . 57 , 129 . 44 , 69 . 13 , 68 . 04 , 66 . 29 , 54 . 79 , 54 . 56 , 51 . 78 , 48 . 44 , 43 . 84 , 40 . 92 , 38 . 15 , 33 . 33 , 31 . 90 , 31 . 61 , 30 . 92 , 30 . 66 , 27 . 09 , 26 . 19 ; specific rotation : [ α ] d 25 =− 2 . 0 deg ( 25 ° c ., c = 0 . 0022 g × ml − 1 , ethanol , 589 nm ); hrms : lsims ( fab ) [ m - br − ] + : theoretical : 513 . 3323 , found : 513 . 3315 ; and chn analysis : calculated : c , 65 . 62 ; h , 8 . 26 ; n , 5 . 10 ( c 30 h 45 brn 2 o 5 ); best fit ; c , 56 . 42 ; h , 7 . 89 ; n , 4 . 39 ( c 30 h 5 brn 2 o 5 + 2 . 5h 2 o ). although the invention has been described with reference to its preferred embodiments , those of ordinary skill in the art may , upon reading and understanding this disclosure , appreciate changes and modifications which may be made which do not depart from the scope and spirit of the invention as described above or claimed hereafter . | 2 |
referring to fig1 a basic usage of the invention is disclosed . a central processing unit 30 sends an instruction to an arithmetic unit 32 , requesting the addition or subtraction of two floating - point numbers . the data to be added or subtracted is then transmitted by the arithmetic unit 32 to a floating - point apparatus 40 . within the floating - point apparatus 40 there is both a full precision adder 33 and a low precision adder 34 . the low precision adder 34 only performs an addition or subtraction on a number of most significant bits ( msb ), for example eight , of each of the numbers to be added or subtracted . this enables an approximation to the result of the full addition or subtraction which can be used to calculate the normalization amount in sufficient time , so that a one can be added to the lsb - 1 location of the 64 - bit result prior to normalization . referring to fig2 the low precision adder 34 is coupled in parallel with the full precision adder 33 of the prior art . before either operation , an exponent subtract 10 compares the exponents of the two floating point numbers . as in conventional systems , the difference between the two exponents represents the amount to which the mantissa associated with the smaller exponent will have to be aligned and the exponent incremented so the exponents of the two numbers are equal prior to the arithmetic operation . referring to fig3 the basic elements the low precision adder 34 are disclosed : two 8 - bit registers 52 , 51 , two 8 - bit addition or subtraction apparati 57 , 67 , two priority encoders 16 , 26 and a comparator 46 . the low - precision adder 34 only operates with the eight most significant bits of the two floating - point numbers to be added . consequently , prior to the alignment of the 64 - bit mantissa associated with the smaller exponent , the eight msb of that number are transferred to a register 51 and the eight most significant bits of the unaligned 64 - bit number are transferred to a register 52 to be used by the 8 - bit adders 57 , 58 . this enables the alignment of the eight most significant bits of the 64 - bit addend independent of the full 64 - bit alignment so that the low precision adder 34 can begin operating before the full 64 - bit alignment is completed . the result of the exponent comparison fig2 is then used to align the eight most significant bits of the 64 - bit addend in a register 51 , in addition to aligning the 64 - bit addend 55 , which will be used by the 64 - bit adder 58 . the lower - order bits , guard bits 22 , which are shifted out of the least significant bit locations of the 64 - bit aligned number are saved and used by a pre - round logic 18 at a later point to determine if there will be a carry - in 60 to the add / sub stage 58 of the full adder 33 . while the 64 - bit mantissa is being aligned , the low precision adder 34 is performing an addition / subtraction on the 8 - msb of the two addends 52 , 51 to be operated upon . since a calculation of the normalization amount based on the result of an 8 - msb addition can be incorrect because a carry from the low order bits may be missing , the invention provides for two low precision adders to work simultaneously . fig3 . one 8 - bit adder 57 of the low precision adder 34 receives a carry during the add / sub stage 57 and the other 8 - bit adder 67 does not . upon completion of the addition / subtraction , priority encoders 16 , 26 , associated with the two separate 8 - bit adders 57 , 67 , respectively , then separately calculate the normalization amount for each result . the results are then compared in the comparator 46 . if the normalization amount is the same for both results of the 8 - bit additions 57 , 67 then the normalization amount is correct and that normalization amount is then transmitted to a pre - round logic fig2 . since an accurate normalization amount has been detected early , the result of the floating - point addition / subtraction will be available to the other elements of the center processor shortly . the low precision adder 34 sends a signal 82 to a multiplexer 85 to notify it to select data from the fast , short normalization path 80 and to inform the next processing element that the floating point operation will be completed shortly 82 . the pre - round logic 18 receives the normalization amount from the priority encoder 16 and then pre - normalizes the one , known as the round bit , which is to be added to the guard bits 22 at the lsb - 1 location of the result , to determine if there will be a carry - in 60 at the 64 - bit addition stage 58 . for example , if the normalization amount is two then the pre - normalized one to be added to the lsb - 1 will have a value of / 001 , since it is shifted two bit locations to the right ( this assumes the one , the round bit , is represented as / 1 prior to being shifted .) with this pre - normalized round bit , the round bit can be added to the lower order guard bits 22 prior to the normalization of the result . adding the round bit at this early stage will accomplish the same result as waiting until the 64 - bit floating - point result of the addition / subtraction 58 is normalized 70 and then adding the round bit to the least significant bit minus one ( lsb - 1 ) location of the normalized result 71 . the pre - round logic 18 begins operating once the guard bits 22 become available . the pre - round logic 18 has available to it the guard bits 22 associated with the aligned floating point number 55 , which is in essence the bits shifted to the right during the alignment . out of the guard bits 22 available to the pre - round logic 18 , the pre - round logic 18 only utilizes the two most significant bits of the guard bits and the additional lower - order bits are fed through or gate logic wherein the result from that logic operation becomes the third bit , the sticky bit , used by the pre - round logic 18 . ( in essence , the sticky bit is the or of the other bits shifted off the 64 - bit number beyond the two most significant bits .) the pre - normalized round bit is then added to the guard bits 22 to determine if there will be a carry - in 60 at the 64 - bit addition stage 58 . upon completion of the full addition of the 64 - bit numbers 55 , 54 , the 64 - bit floating - point result is normalized 72 . the result of the addition of the guard bits 22 and the pre - normalized round bit is transmitted 88 to the short fast normalization 72 to be shifted into the lower bit locations of the 64 - bit result in accordance with the necessary normalization . since the round bit had been added in at the pre - round logic stage 18 , upon normalization 72 , the result is complete and can be quickly transmitted to the element of the processor waiting for the result . a brief example will easily explain the operation of this invention . assume the addition of the numbers 0 . 10110101xxx . . . 101 × 2 2 and 0 . 00010101xxx . . . 000 × 2 4 , stored in registers 55 and 54 , respectively . since we are dealing with an addition , the exponents must be equal before the operation can be performed . the subtraction of the exponents of these numbers indicates that the smaller exponent ( 2 2 ), associated with 0 . 10110101xxx . . . 101 , will have to be increased by two and the mantissa will have to be shifted to the right by two to compensate for the increase in the exponent . consequently , the new aligned 64 - bit number is represented by 0 . 0010110101xxx . . . 1 / 01 × 2 4 , where the least significant bits 01 , which were shifted out of the register , are retained as the guard bits 22 . the eight most significant bits of the aligned and unaligned numbers , to be operated upon by the low precision adder 34 , are located in registers 51 and 52 , respectively , and were shifted into these locations and aligned prior to the 64 - bit alignment . the eight most significant bits , 0 . 00101101 and 0 . 00010101 are then added together by the two 8 - bit adders fig3 , 67 , of the low precision adder 34 , wherein one adder 57 adds a carry to the lsb during the addition process and the other does not 67 . the result of the two additions is 0 . 01000010 , without a carry and 0 . 01000011 with a carry . these results are then sent to their respective priority encoders 26 , 16 where the normalization amount for the two results is calculated . the comparator 46 compares the normalization result for both numbers . in this case the value is one for both numbers which indicates the low precision adder 34 was successful . the priority encoder 16 then sends the normalization amount to the pre - round logic fig2 and the comparator fig3 sends a signal fig2 to the multiplexer 85 to indicate that the result will be from the short , fast normalization cycle 72 . the pre - round logic 18 uses the normalization amount to pre - normalize the round bit so that the round bit can be added to the guard bits 22 before the 64 - bit normalization . consequently , a normalization amount of one means the one (/ 1 ) to be added to the lsb - 1 location of the result , the round bit , is shifted to the right by one to become / 01 . this pre - normalized one is then added to the guard bits 22 ( a ) / 010 -- assume a 0 sticky bit --( the slash is used merely to designate bit places ) which have been saved after the 64 - bit alignment . the result of the addition of the guard bits to the pre - normalized round is ( a ) / 100 . as is apparent , the addition of the guard bits 22 to the pre - normalized round bit did not result in a carry to the next significant bit place ( a ). therefore , there will be no carry to the 64 - bit adder 58 . the result of this addition of the guard bits 22 to the pre - normalized round bit , within the pre - round logic 18 , is saved to replace any bits shifted to the left when the 64 - bit number is normalized . after the 64 - bit addition , since the normalization amount is known , the 64 - bit result , 0 . 01000010xxxxx . . . / 100 × 2 4 , can be normalized by one . the shift of the result one place to the left to normalize creates the number 0 . 1000010xxxx . . . 1 / 00 × 2 3 , as the normalized result of the 64 - bit addition ( the exponent is decreased by one to compensate for the left - ward shift of the mantissa by one ). the one in the lsb location is the most significant bit from the addition of the guard bits to the pre - normalized round , which occurred at the pre - round stage 18 and is sent 88 to the normalization cycle 72 . it is shifted into that place to compensate for the bit which had been shifted to the left during normalization . now the result 0 . 1000010xxx . . . 1 × 2 3 can be transmitted to the element of the processor waiting for the result and the addition of a round bit after normalization has been avoided . in the situation where the low precision adder 34 is unable to accurately pre - determine the normalization amount , because the results of the two priority encoders fig3 , 26 , associated with the two eight bit adders 57 , 67 were different , the true normalization will have to be detected after the full 64 - bit addition / subtraction . to indicate this , the comparator 46 sends a signal fig2 to the multiplexer 85 to notify it to select the data from the full 64 - bit normalization 70 and the priority encoder fig3 disables the pre - round logic fig2 so the full - adder will proceed to add the two floating - point numbers in the manner currently done in the prior art . in the full 64 - bit normalization detection logic of the prior art , the priority encoder 28 determines the normalization amount , the normalization then occurs 70 and round bit is added to the normalized result 71 . no time has been wasted , in implementing the low precision addition 34 first , because since the low precision adder 34 is only operating on eight bits , the addition cycle and testing stage associated with the low precision adder 34 is completed very rapidly . in essence , it is completed before the 64 - bit alignment is finished . consequently , the multiplexer 85 already knows from which data path 80 or 81 the result will be coming , and the pre - round logic 18 is disabled when a full 64 - bit normalization calculation will be required . one skilled in the art will clearly see that although the disclosure is directed towards the addition of two positive 64 - bit floating - point numbers , this invention can be utilized with bits of any length , provided that some set of the most significant bits of the two numbers are used by the low - precision adder to approximate the normalization amount . moreover , this invention can be extended to subtraction as well as conducting operations on floating - point numbers with different signs . | 6 |
turning to fig1 of the drawings there is illustrated an apparatus designated generally by the numeral 10 for inserting a tag or label into a bale of hay or the like . the apparatus includes a support and bracket member 12 of a generally flat rectangular configuration having a forward end formed of or to which is attached a somewhat triangular blade configuration 14 having a belved edge 16 facing into the path of hay or other bale materials . the forward end 14 extends through a slot 18 in a baler chamber wall or housing wall 20 into the bale chamber . a guiding and feeding mechanism includes a reciprocating slide member 22 which reciprocally mounted on the underside of the support member 12 and is reciprocated by means of a fluid actuated ram 24 . other forms of actuation including a solenoid or the like can be utilized . the feeding or slider mechanism 22 engages and advances individual tags or a strip of tags from a roll 26 mounted on the feeding mechanism , with a strip of tickets 28 extending into a slot 40 beneath the support member 12 and is dispensed outward from a slot with individual tickets 30 extending outward inside the bale chamber 32 in the path of bale material . the individual ticket or tag extends outward onto the or beneath the blade 14 and is engaged and stripped or torn from the roll by means of the advancing bale material 34 . the general configuration and operation of the typical hay baler is illustrated and described in u . s . pat . no . 3 , 890 , 891 the disclosure of which is fully incorporated herein by reference . as pointed out therein the conventional formation of a bale of hay or the like is formed by a ram in the bale forming chamber in layers by ramming layers of materials intermittingly fed thereinto . the bales are tied at particular lengths by a tying mechanism which on modern machines includes one or more needles that are forced through the bale . in the present invention it is contemplated that the tag is to be selectively inserted anywhere along the length of the bale depending on the particular producer or the like . this forms a code indicating the location of the tag . the activation of the slider and thus the dispensing of each selected tag can be controlled by an activating mechanism which is responsive to either the tying mechanism of the baler or any other mechanism indicating the beginning of a bale of hay . the activation can then be timed such that the tag is inserted in or dispensed into the chamber after the ram had withdrawn from a compressive stroke in preparation for receiving a charge of material to be baled . the construction as contemplated herein eliminates the need for knives or the like for cutting the tags from the roll . preferably the roll is perforated to separate individual tags as illustrated in fig6 . with this arrangement each individual tag can be torn from the end of the roll by means of the advancing charge of baled material . the tag 30 is thus wiped or torn from the end of the roll simply by the advancing charge of hay or the like . the preferred construction of a guide way or slot for the ticket strip 28 is best shown in fig4 . in the preferred construction the slide member 22 is formed in a generally u - shaped configuration as illustrated and rests in grooves formed at 36 and 38 in the face support member 12 . this arrangement provides a generally rectangular cross section slot 40 through which the tags are fed . the slide member 22 as best seen in fig2 includes a shoulder 42 adapted to engage one side of a stop member 44 and a shoulder at 46 adapted to engage the other side of stop 44 . this limits the stroke of the slide member 22 . preferably adjustable stops means may be provided so that the stroke of the slide member 22 may be adjusted to the length of the ticket or tag being dispensed . a bracket or arm 50 extends beneath the slide member 22 and has a shoe 51 which supports the slide member and is adjustable by means of screw 52 into the proper spacing engagement or spacing from the guide member 12 as in fig3 . this adjusts the spacing between the members and thus the guide slot 40 for the passage of the tickets . the slide and the support members preferably include pawls 53 and 54 as shown best in fig5 which alternately engage perforations within the strip 28 of tickets for advancing and holding the tickets in a predetermined position . this pawl mechanism for advancing and for engaging and holding the tickets in the advanced positions may either engage individual perforations especially placed on the tags for this purpose . as best seen in fig6 perforations 55 may be selectively placed in each tag 30 for engagement by the respective pawl members . the unit is stabilized against wall 20 by a face plate 66 fixed perpendicularly to support member 12 . the forward end of face plate 66 is attached to wall 20 by a hinge 68 and the rear end is secured by a shear pin 70 through a bracket 72 . if any obstruction or solid matter in the baler is driven against blade 14 with sufficient force to cause damage , the shear pin 70 will break and allow the blade to swing outwardly . turning to fig7 there is illustrated a schematic of a control system for activation of the tag feeding mechanism . this control mechanism includes a source of pressurized fluid such as hydraulic or a gas supplied from a source 56 through means of a control valve 58 which may be controlled , for example , by a solenoid 60 supplying fluid to the ram 24 . the ram may be either single or double acting and in the case of a single acting or action would be spring returned . the solenoid 60 would be actuated by means of a electrical circuit as illustrated which would be preferably controlled by some sequence of the bale length indicating means such as the tying or threading mechanism 62 and the ram advancing or activating system 64 . thus the feeding mechanism can be thus selectively activated at a particular length of the bale . thus upon retraction of the ram at a time when the length of the bale has advanced to its position to activate the bale length switch the ram switch will be similarily activated completing the circuit to activate the ram 24 . a ticket will then be advanced into the bale chamber and thus into the formed bale . while i have illustrated and described my invention by means of specific embodiments , it is to be understood that numerous changes and modifications may be made therein without departing from the spirit and scope of the invention as defined in the appended claims . | 0 |
for simplicity and clarity , elements shown in the drawings have not necessarily been drawn to scale . for example , the dimensions of some of the elements of particular interest may be exaggerated relative to other elements . referring to fig1 ( a ), a top - down illustration of an aluminum annulus 1 connected to an aluminum strap 2 is shown . in the etch process for the through - silicon via , the chemistry used has little or no effect on the aluminum since aluminum etching requires a chlorine based chemistry not present in a tsv etch . preferably , the annulus 1 has a 20 μm opening in the center , and an aluminum width of 4 μm . the aforementioned dimensions can be achieved by utilizing a lithography tool having an overlay specification greater or equal to 4 μm , permitting to use less advanced photoresist , since the sidewall of the resist becomes irrelevant in view of the rie being shaped by the aluminum annulus . additionally , once the tsv is completed and filled with conductor material , the aluminum annulus that masks the tsv can be fully integrated as part of a beol interconnect of the chip . fig1 ( b ) shows a cross - section view of the aluminum structure atop the substrate 3 . the aluminum is deposited and patterned using conventional methods , the aluminum thickness ranging from 0 . 6 μm to 4 μm . for illustrative purposes , 1 . 2 μm will be used hereinafter . photoresist is patterned , and the aluminum is etched using a chlorine based chemistry plasma reactive ion etching . referring now to fig2 , a conformal insulating layer is deposited on the substrate 3 . the preferred insulating material includes silicon nitride , silicon dioxide , fluorinated oxide or any combination thereof . initially a layer of silicon nitride , in the order of 100 angstroms ( å ) to 1000 å is preferably deposited . for illustrative purposes , 1000 å will be used . a silicon oxide layer is then deposited on the substrate followed by another silicon nitride layer . the silicon oxide thickness ranges from 0 . 5 μm to 2 μm , and the silicon nitride ranging from 100 å to 1 μm . hereinafter , 1 μm and 0 . 5 μm , respectively , will be used . referring to fig3 , photoresist 110 is applied on top of the insulator layer 4 , and patterned to form window 6 . this window is aligned with annulus 1 to be subsequently opened in the aluminum structure 2 . fig4 shows a cross - section of the features after the reactive ion etching to create an opening in the insulating layer 4 that corresponds to the opening in the resist 6 . the plasma etch is typically a cf 4 / o 2 / ar flow based etch for the silicon nitride and co / cf 4 / ar for silicon oxide . if a tin layer is used to passivate the aluminum , a cf 4 / ar chemistry can then be used to remove it from the open surface . the final silicon nitride etch ideally has an over etch time after completing the etch . the over etch components can run as long as 100 % of the total etch time , but for practical purposes , a 60 % over etch is sufficient to ensure that the annulus in the aluminum feature 2 is cleared of insulating material from layer 4 . in fig5 , a deep silicon etch is preformed using , e . g ., a process advanced by amat or lam research . a typical process consists of etching for a short time and then switching the process to deposit polymer that coats the sidewalls and then switching back to the etching process . by cycling back and forth , the feature can form a deep trench with uniform sidewalls 9 having an angle greater than 89 °. in the present invention , the annulus 1 in the aluminum feature 2 defines the width ( i . e ., diameter ) of the top of the deep trench 10 . an ash process is preferably used as the last step of the etching to remove any residual photoresist , i . e ., oxygen plasma that volatizes carbon containing constituents . insulator layer 9 ( e . g . oxide ) is conformally deposited to form a sidewall . typically , a greater thickness is deposited on the surface of the substrate than on the sidewalls of the etched feature . it is normal to have 60 - 70 % of the surface thickness deposited on the sidewalls . referring to fig6 , a low power etch removes the insulating material on top of the annulus , while leaving the insulator in the deep trench . those familiar with etching sidewall spacer used for semiconductor devices can use for illustrative purposes the process described in u . s . pat . no . 6 , 350 , 696 . referring now to fig7 , the substrate is subject to a metal fill 12 , for illustrative purposes with copper , although other metals can also be used . a liner and a seed are then deposited , e . g ., a ta based liner with a copper seed layer for subsequent electroplating the substrate . in fig8 , the substrate is exposed to chemical mechanical polish ( cmp ). this process planarizes the substrate by removing metal from undesired locations . the topography used to create aluminum feature 2 is transferred through the insulating layer 4 , and a plane of copper is formed between the aluminum features horizontally , although separated vertically by insulating layer 4 . however , if the user does not require a grounding plane , the topography may need to be eradicated . preferably , insulator si 3 n 4 is removed , stopping at the sio 2 insulating layer . the selectivity is reversed compared to normal silica slurry . in one embodiment , the slurry can be prepared from commercially available fumed silica , stabilized at alkaline ph ( ph ranging from 9to 12 ). the ph is then advantageously adjusted to 2 . 4 ( range 2 . 2 - 2 . 6 ), with a 1 : 10 dilution in water of 86 % phosphoric acid . still referring to the cmp process , in one embodiment , a conventional polish tool , such as westech 372 can be advantageously used . a conventional urethane top pad ( ic1000 ), non - woven sub - pad ( suba iv ) can be utilized , while maintaining a slurry flow at 150 ml / min ( range 75 - 250 ml / min ) with a down force of 3 psi . ( range 1 - 8 psi ) at a speed of 25 platen , 50 carrier ( adjusted to achieve the best uniformity ). the preferred wafer backside pressure should be adjusted to 2 psi to achieve a better uniformity . the pad conditioning consists of diamond grit , 70 μm , 0 . 5 psi , for 45 sec after each polish . fig9 and 10 illustrate an embodiment preferably performed prior to forming the structure shown in fig1 . in fig9 , a feature is created in the longitudinal portion of the aluminum structure 2 , i . e ., away from the annulus 1 . photoresist 110 is deposited on top of insulator layer 4 and patterned , to be followed by etching window 101 down to the aluminum structure 2 . this feature is preferably formed using the same lithographic and rie processes described with reference to fig3 and 4 . the window 101 thus constructed is used to provide electrical connections ( not shown ). in fig1 , a thin silicon nitride layer 112 having a thickness of approximately 100 å is deposited , and is followed by an aluminum layer 111 deposited and patterned using lithography and rie , as described with reference to fig1 ( a ) and 1 ( b ). at this point , the substrate is subjected to the processes previously described with reference to fig1 through 9 that allow forming a tsv , a ground plane and a capacitor that are metal filled and concurrently polished . it should be noted that a capacitor can be created on the annulus itself . however , given topography challenges that may ensue , it is not recommended until a cmp , i . e ., the planarization process , is developed that eliminates an undesired topography . another embodiment of the invention consists of forming the aluminum feature on the substrate previously discussed with reference to fig1 and followed by the insulator layer , as shown in fig2 . however , the present embodiment preferably forms an insulator deposition having a thickness greater than that of the aluminum . the insulator deposition includes forming a silicon nitride si 3 ni 4 cap followed by silicon oxide sio 2 and again by si 3 ni 4 . for illustrative purposes , a 1 . 2 μm thick aluminum feature 2 , a 1000 å si 3 ni 4 cap and a 1 μm silicon oxide deposition are followed by a 5000 å deposition of si 3 ni 4 . an insulator polish is then used on the silicon nitride and , selectively , on the silicon oxide . the silicon oxide polish rate is substantially lower than the silicon nitride rate . this allows the user to eliminate the topography caused by having the aluminum elevated over the substrate . this is possible if the user does not wish to have a ground plane above the aluminum features , although not directly above them . any silicon oxide slurry commercially available can advantageously be used , preferably including a silicon oxide polish slurry that is selective to silicon nitride and is followed by a second silicon oxide polish . this allows the user to achieve a substantially planar insulator surface 4 . the benefit of the polishing sequence and planarized surface is that a deep silicon via filled with metal and polished will dispense having a ground metal plane on the surface of the insulator , as it is evident from fig9 . fig1 a , 11 b and 11 c illustrate an embodiment wherein an annulus 121 is shown having an opening 122 formed on the substrate . the feature 123 a , 123 b and 123 c are openings in the photoresist , in which , in fig1 a , the photo - patterning is shifted to the right ; in fig1 b , the opening is shifted to the left . in fig1 c , the opening is enlarged . in all three of these circumstances , the tsv etch will generate the same feature . in an embodiment of the present invention , an issue of supplying sufficient current to the chip can arise when the design requires c4 solder bumps that are smaller than normal . if the c4 solder bumps are in the range of 25 μm , the current they carry is limited . therefore , more than one small c4 will be required to supply the necessary current to the tsv ( s ). in fig1 , a large block or plate of aluminum 132 is formed on the substrate . aluminum is formed with openings therein that create one or more tsvs 131 , after which a multiple of small c4s can be utilized to supply the necessary current needed to enable the chip for adequate operation . while the present invention has been particularly described in conjunction of a simple illustrative embodiment , it is to be understood that one of ordinary skill in the art can extend and apply the invention in many obvious ways . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiments were chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . | 7 |
a leakage detector assembly 1 has an inlet pipe 2 , an inlet flange 3 and an isolating valve 4 . the inlet pipe 2 communicates with an inlet 5 of a diffusion pump 6 via a diaphragm or constriction which can be constituted by an adjustable draw - off valve 11 . a spectrometric measuring cell 8 of a spectrometer is connected to the diffusion pump 6 via a pipe 9 . further , the outlet 7 of the diffusion pump 6 is connected by a pipe 10 and a measuring valve 12 to a connection point between the valves 4 and 11 on the pipe 2 . during use , the inlet flange 3 of the detector 1 is connected by a pipe 13 to an auxiliary pumping unit 14 which includes a vane pump 15 with an isolating valve 16 and a flange 17 for connecting to an installation ( not shown ) which is to be tested . operation is as follows . in this apparatus , a helium flux q which comes from the installation could give a helium flux q1 = nq in the looped circuit of the spectrometer , where n & gt ; 1 . the ratio n is related to the pumping speeds at the inlet of the spectrometer spectrometric measuring cell 8 and of the auxiliary pump of this unit . the apparatus is therefore a flux amplifier apparatus . in conventional apparatus , where the outlet pipe 7 of the diffusion pump 6 is connected to an auxiliary vane pump , in the circuit of the spectrometer , the helium flux q which enters the installation gives a smaller flux q = q / n where n & gt ; 1 , n also being a function of the pumping speeds at the inlet of the spectrometer and at the inlet of the auxiliary pump . with this apparatus , gas can be drawn from the inlet circuit , and by closing the inlet valve 4 the gas can be maintained for some time for measuring purposes . indeed , the flux q1 circulates at a constant value in the circuit of the closed loop of the diffusion pump 6 . it is possible to obtain the reading of the flux q entering the installation by closing the valve 12 on the pipe 10 . the flux is then measured by closing the valve 12 and the isolating valve of the auxiliary pump 15 after the flux q1 has been established . the flux q thus flows from the inlet 3 to the outlet 7 of the diffusion pump 6 closed by the valve 12 . helium accumulates in the volume of pipe 10 situated between the outlet 7 and the valve 12 . this is not a drawback since the diffusion pump prevents helium from being diffused back towards the spectrometric cell 8 . another advantage of this apparatus is that a detector without a vane pump and without an extra connecting flange for such a vane pump can be formed . in a variant , if it is necessary to protect the spectrometric cell 8 , some kind of trap can be inserted between the diffusion pump 6 and the cell 8 . the trap may be of the liquid nitrogen , ion or , even , zeolite type , for example . further , to improve pumping , it is also possible to place a trap between the draw - off valve 11 and the inlet 5 of the diffusion pump 6 . | 6 |
referring now to fig1 , 2 a , and 2 b , various views are presented of illustrating one embodiment of multi - accessory hammer of the present invention is hammer 10 having a conventional wooden handle 15 . one end of hammer 10 is attached to head 20 through eye 22 . butt end 26 is attached to rapid release accessory change mechanism 30 . a portion of handle 15 adjacent butt end 26 is indented to form tenon 28 that is shown in fig2 a in a position for insertion into orifice 32 of base 40 of rapid release accessory change mechanism 30 . housing 42 , as shown in fig1 , preferably made of stainless steel , includes base 40 and cap 50 having opening 52 therethrough . resilient means , preferably a coil spring 54 , has end 55 for positioning within recess 56 in inner surface 58 of base 40 of housing 42 . accessory locking device 60 within housing 42 includes : ( a ) spindle 62 that has protrusion 64 that fits within end 65 of spring 54 , ( b ) hook end 66 at the opposite end from protrusion 64 , and ( c ) side arm 68 . after tenon 28 is inserted within orifice 26 of base 40 , fastener means 70 unites tenon 28 of handle 15 through channel 72 . specifically , spacer 74 has protrusion 76 , which in turn has opening 77 . protrusion 76 is designed to fit the dimensions of channel 72 without clearance . bolt 78 passes through opening 77 of protrusion 76 and is threaded onto nut 80 that is lodged within indent 81 on one side of base 40 . plates 82 and 84 are respectively force fitted into an indent ( not shown ) on the other side of base 40 and orifice 81 . an epoxy is used to insure that the indents remain securely fastened to handle 15 . the use of nuts and bolts can be replaced by a variety of other fasteners well known in the art including rivets . after base 40 is securely fastened to handle 15 , cap 50 , which has its outer dimensions substantially the same as the outer dimensions of base 50 , is fastened to base 40 by means of bolts 90 through holes 92 and into threaded holes 94 in base 40 . internal spacer 98 serves to maintain the necessary internal spacing within housing 42 to accommodate accessory locking device 60 . after cap 50 is securely fastened to base 40 , side arm 68 , preferably having finger grooves 100 , is passed though opening 110 formed by gaps 110 a and 110 b in cap 50 and base 40 , respectively . in addition , hook end 66 is passed through opening 52 in cap 50 and is in the accessory receiving position . hook end 66 is designed to mate and prevent lateral motion of the accessory that is attached to accessory change mechanism 30 . after assembly , spring 54 is positioned between shoulder 128 on spindle 62 and the inner bottom of recess 56 and functions in the manner discussed in greater detail below . end 120 of cap 50 , opposite the portion of cap 50 that is attached to base 40 , has wedge 125 extending outwardly therefrom and has opening 52 therethrough . cap 50 with wedge 125 is preferably is cast as a single unit of stainless steel . wedge 125 is formed by two inwardly slanting and diverging walls 130 as shown in fig2 a and 2b . the scale shown in these figures is approximately the dimensions of existing prototypes of this embodiment of the present invention . the degree of overhang of the inwardly slanting walls is important to assure that no reasonable force during use of the accessory allows for accessory change mechanism 30 to unintentionally release from handle 15 . referring now to fig3 a and 3b , another embodiment of multi - accessory hammer of the present invention is hammer 210 having a partially hollow glass fiber handle 225 . insert 228 having hole 232 to match hole 234 in protrusion 236 of base 240 of accessory change mechanism 250 . the same fasteners are used to attach mechanism 250 to handle 225 that are described above in connection with hammer 10 . all of the remaining elements of mechanism 250 are the same as those of mechanism 30 described above . fig4 a – 4e show several types of accessories for attachment to any of the embodiments of the multi - accessory hammer of the present invention , such as crowbar accessory 410 , fastener removal accessory 420 , elastic striking element accessory 440 , e . g ., hard rubber striking element , metal striking element accessory 450 , e . g ., stainless steel striking element , and retractable tape measure accessory 460 . the foregoing types of accessories are those for which prototypes have been made . however , it is apparent to one skilled in the art that many other accessories can be designed to fit the butt end of a hammer or other striking tool of the various embodiments of the present invention . fig4 f shows mating end 470 common to each of the types of accessories and preferable is made of stainless steel . mating end 470 contains notch 480 that is capable of mating with inwardly slanting and diverging walls 130 of wedge 125 on the outside portion of the cap , end 120 . the purpose of mating inwardly slanting and divergent walls on each of wedge 125 and notch 480 is to prevent movement of the accessory in a first direction that is transverse to the direction the accessory moves along outer surface 510 of wedge 125 . mating end 470 also contains recess 500 that is capable of mating with hook end 66 of spindle 62 . the purpose of accessory locking device 60 is to prevent movement of the accessory along surface outer surface 510 of wedge 125 and to permit rapid attachment of accessory to locking device 60 as described below . a typical configuration of the hammer of one of the embodiments of the present invention is to include tape measure accessory 460 , one of the most practical accessories to have at the butt end of a hammer . if a user wishes to change to crow bar accessory 410 , as shown in fig5 a and 5b , the user would holds one hand on handle 15 or handle 225 of hammer 10 or 210 adjacent side arm 68 and urge side arm 68 toward butt end 26 along the direction the arrow shown in fig2 b is pointed . this causes spindle 62 to compress spring 54 , which in turn causes hook end 66 to move so that it is flush with the surface 510 of wedge 125 . the user then slides accessory 460 along surface 510 until the walls of notch 480 are completely free of the walls of wedge 125 . once accessory 460 has been removed , the user releases side arm 68 . this causes spring 54 to return to its original position and causes hook end 66 to spring through opening 52 . because of the matching diverging walls , slide crow bar accessory 410 , assuming that is the next accessory to be attached , can only slide along the outer surfaces of wedge 124 in one direction . in this direction , bottom surface 520 of the accessory pushes against angled side 530 of hook end 66 causing spring 54 to compress until end 66 is directly over recess 500 . at this point , end 66 is urged into recess 500 as the result of the uncoiling of spring 54 . once hook is locked into place in recess 500 , no further movement of accessory is possible until the user urges slide arm 66 toward the butt end as described above . this entire change can be done in less than a second of time assuming the user has the accessories readily available , such as in a shop apron or a pant pocket . the relatively small size of all accessories for the hammer of this invention allows a large number of accessories to be readily available for change at any given time . various modifications of the multi - accessory hammer of the present invention in addition to those shown and described above will become apparent to those skilled in the art from the foregoing description and accompanying drawings . such modifications are intended to fall within the scope of the appended claims . | 1 |
in the following detailed description of the preferred embodiments , reference is made to the accompanying drawings illustrating embodiments in which the invention may be practiced . it should be understood that other embodiments may be utilized and changes may be made without departing from the scope of the present invention . the following terminology and features of hypertext markup language ( html ), version 4 . 01 , are important to an understanding of the present embodiment . an html page can contain embedded client - side scripts which are executed as the page is parsed by the browser . alternatively , the scripts may be in a file or files separate from but referenced in the html page . ( script parsing can be deferred by a browser only if the “ defer ” attribute of the script tag is set true . in its absence , scripts are parsed as they are encountered .) furthermore , html link elements can contain a script snippet instead of a url . when a link containing a script snippet is dereferenced , the script is executed . a client - side script is a program that may accompany an html document or be embedded directly in it . the script executes on the client &# 39 ; s machine . authors may attach a script to a html document such that it gets executed every time a specific event occurs , such as , for example , when the user activates a link . such scripts may be assigned to a number of elements via the intrinsic event attributes . script support in html is independent of the scripting language . javascript is one example of a widely used scripting language that is supported by netscape &# 39 ; s navigator and microsoft &# 39 ; s internet explorer browsers . html 4 . 01 also specifies several intrinsic events and the interfaces through which client - side scripts can be invoked when different events occur . two specific events that can invoke a script attached to a document are : onload ( ): in the context of a document , the onload handler is triggered when a document and its embedded elements have been fully loaded . in addition , javascript provides an onload handler for image objects that is triggered when the image has been fully loaded . onunloado ( ): triggered when a document is about to be unloaded to make room for a new document , or when the browser is being closed . the following terms are specific to the present embodiment and are used herein . a bundle is a set of web pages that have been instrumented to measure client - perceived response times . the verifier instruments the web pages to insert necessary measuring and reporting instructions . these may be html or non - html pages , and could be static files or dynamically generated content . the html pages in the bundle may contain links to each other , enabling users to traverse the bundle by dereferencing hyperlinks . there can be two kinds of links : instrumented and uninstrumented . an instrumented link points to a page whose response time we want to measure when the link is dereferenced . an uninstrumented link points to a page whose response time is not interesting . this distinction allows for flexibility in the measurements . for example , “ hot ” or frequently accessed web pages may be instrumented , while pages that are only accessed under special circumstances may be omitted . users arrive at a specific page within a bundle in one of two ways , causing it to be loaded in their browser . first , the user may have dereferenced an instrumented link from another page within the bundle . this an instrumented entry into the page . alternatively , they may have directly entered the page &# 39 ; s url into the browser , through the browser &# 39 ; s bookmark , or may have followed a link from a page not within the bundle . this is an outside entry into the page . according to one of the embodiments , a third party verifier , for a fee , processes and modifies the contents of the web page for the purpose of measurement and reporting . all links for which the response time is to be measured are instrumented . thus , there is a degree of flexibility inherent in this invention , in which the overhead of measurement and reporting can be tailored according to customer &# 39 ; s needs . the third party , for a fee , can also insert code to add instrumentation to dynamically generated pages as desired . the response time is determined for all instrumented entries to html pages in the bundle . furthermore , the present embodiment also provides a scheme to determine the response time of all images contained within an html page . the embodiment includes i ) a time keeping aspect , which concerns reading time related data at certain instants and using the data to compute elapsed times , i . e ., response time samples , and ii ) a “ librarian ” aspect , which concerns storage and retrieval of the data according to a well - defined interface . these actions are carried out using the above described html events and scripts . that is , time keeping uses the two intrinsic html events , onload and onunload and the feature permitting a script to be invoked when a link is activated . every web page in the instrumented bundle is set up such that a timekeeper script is invoked when a user clicks on a link . referring first to fig1 system 100 is shown according to an embodiment of the invention . a business person 102 is shown to represent a person or business association having an interest in a web site . the term “ web site ” refers to blocks of information formatted in a conventional html format , commonly referred to as “ web pages ,” and maintained on the server of a host 109 , accessible to users via conventional hyper text transfer protocol over the internet . the “ internet ” is shown here as a network 140 . one typical user 149 is shown . the user 149 accesses the network 140 by a computer system referred to herein as the “ user &# 39 ; s client ” 150 . a portion of the host &# 39 ; s server 110 is shown , including first storage unit 115 , which originally has web pages 31 through 33 stored therein . in accordance with the embodiment , these pages are sent to verifying agent 180 , so that the pages 31 - 33 can be “ instrumented ” by the agent 180 , using the verifying agent &# 39 ; s server 185 , a portion of which is shown . to instrument the pages 31 - 33 , verifying agent &# 39 ; s server 185 inserts scripts 210 , 220 and 230 , or at least reference thereto , into these web pages 31 - 33 . ( herein reference to a script “ attached to ” a page , is meant to include both the case of the script itself being inserted in the page , and the case of a reference to the script being included in the page , so that while the script itself is not included in the page , the script is nevertheless called by the reference .) server 185 then sends the pages 131 - 133 , which have the scripts 210 - 230 attached , back to the host &# 39 ; s server 110 for replacing the web pages in storage unit 115 , as shown . these web pages 131 - 133 are all part of the same bundle 200 of pages which the verifying agent &# 39 ; s server 185 has instrumented . that is , to each one of a number of uninstrumented pages 31 , 32 and 33 that the host server 110 originally had stored , respective references to first script 210 , second script 220 and third script 230 have been added to create the bundle 200 of instrumented pages 131 , 132 and 133 . at least the first time a user 149 requests one of the instrumented pages 131 - 133 , the scripts associated with the page are also delivered to the user &# 39 ; s client 150 . once delivered , the scripts 210 - 230 are executed by the client 150 responsive to certain events . as a result of this client - side execution , a measure is produced by the client 150 of service provided to the client 150 by the network 140 and the server 110 , and a report 195 is sent to the verifying agent &# 39 ; s server 185 . in alternative embodiments , the report 195 may be sent to the host server 110 or the business 102 . referring now to fig2 bundle 200 of first , second and third web pages , 131 , 132 and 133 are shown . in particular , an instrumented link 205 is shown on first web page 131 , with an associated first script 210 . likewise , each of the other pages 132 and 133 have links 205 to web pages . each one of the links 205 that references one of the web pages in the bundle 200 has a reference to the first script 210 . note that the second and third web pages 132 and 133 each have a link 205 which does not reference one of the pages in the bundle , so these links do not reference first script 210 . note also , the second web page 132 has two links 205 that reference other pages in the bundle , so page 132 has two references to the first script 210 . likewise , each of the pages 131 , 132 and 133 of the bundle 200 has a second script 220 included in its respective onload handler 215 . ( the script 220 may constitute the entire script for the handler 215 , or it may be included with some other handler - related script , so reference is made herein to the script 220 being included in or associated with the onload handler 215 to encompass both possibilities .) in similar fashion , each of the pages 131 through 133 has reference to third script 230 included in its respective onunload handler 225 . ( similarly , the script 230 may constitute the entire script for the handler 225 , or it may be included with some other handler - related script , so reference is made herein to the script 230 being included in or associated with the onload handler 225 to encompass both possibilities .) the first script 210 and second script 220 include instructions for measuring a response time . likewise , in various embodiments , the third script 230 includes instructions which aggregate response times , or calculate statistics about response times . thus , a set of the scripts 210 , 220 and 230 , associated with loading and unloading page 132 , is shown in fig2 as “ measuring instructions ” 250 . the third script 230 includes instructions for generating reports , so script 230 is also shown in fig2 as “ reporting instructions ” 260 . it should be understood that although numerous instances of the scripts 210 , 220 and 230 are shown , this may be merely figurative . in a preferred embodiment , only one instance of each script actually exists for bundle 200 . that is , the scripts may be in separate files stored on the server 110 , and each one is delivered to the client the first time the client receives a page , such as page 131 , which references the script . moreover , it should be understood that all the scripts may even be in one file . herein , reference to a first script 210 , second script 220 , etc . should be understood to include reference to a first function , second function , etc ., where the functions may all be defined in a single script file . referring now to fig3 and also with reference to fig2 an example is illustrated . in the first page 131 , the link 205 links the page 131 to the second web page 132 . at time t 1 , shown in fig3 when a user clicks on the link 205 in web page 131 , the browser program 160 ( fig1 ) begins executing the associated first script 210 . the script 210 directs the browser program 160 ( fig1 ) to determine the current time and record it as a “ sendtime .” then normal browser action dereferences the link 205 , loading the second web page 132 . ( this recorded first reference time is also referred to herein as a “ start time ,” or a “ starting time .”) next , at time t 2 , responsive to the second page 132 being fully loaded by the browser 160 , the second script 220 for the second page 132 begins executing . the script 220 directs the browser program 160 ( fig1 ) to get the current time , retrieve the sendtime , and calculate the response time , that is , the difference between the current time and the “ sendtime .” ( this second reference time is also herein referred to as an “ end ” or “ ending ” or “ now ” time .) following the loading of second instrumented page 132 , the page is eventually unloaded at time t 3 , either by the user directing the browser to load another page or to close the browser window . if the instrumented second page 132 is unloaded responsive to the user clicking on a link therein to another instrumented page , that is , responsive to an instrumented entry back to the first page 131 or to third page 133 , then , the browser 160 ( fig1 ) begins executing the first script 210 again , in association with a link 205 in the second page 132 , to calculate another instance of a response time ( not shown in fig3 ). if the second page is unloaded in a way that is not an instrumented entry , that is , due to the user either : i ) directly typing a url , instead of clicking a link , ii ) closing the browser window , or iii ) clicking a link to a page not in the bundle 200 , then neither of the first scripts 210 on the second page 132 are invoked and no new response time is calculated . however , the third script 230 associated with the second page 132 onunload handler 225 is invoked , and performs other steps as shown in fig3 which may include sending a report of the response time now , or accumulating the response time with others previously calculated , for sending later , and may also include computing statistics for the response times for sending either now or later . these steps will be discussed further hereinbelow , but first , the following describes how distinctions are made in the various types of unloading . as stated above , an issue arises calling for different steps in response to different ways of unloading a page . conventional html specifications stipulate that if a currently loaded document has an onunload event handler specified , that handler must be invoked before the new document is loaded . the onunload handler is also invoked if the user closes the browser window . thus , the onunload handler may be invoked regardless of whether a document is being unloaded for an instrumented entry or some due to some other action . however , the third script 230 is associated with the onunload handler 225 for each page 131 - 133 in the bundle 200 , and unless some distinction is made , the script 230 will be executed for each invocation of the onunload handler 225 , regardless of the context . therefore , a distinction must be made among the various circumstances of invocations of the onunload handler 225 . this distinction is made in the present embodiment by including in the first script 210 instructions for setting a variable “ cleanup ” in the window object , and including instructions in the third script 230 for checking the variable . according to this embodiment , responsive to the user clicking on the link 205 in the first page 131 , which initiates loading of the second page 132 , the variable “ cleanup ” is set . the variable is then checked by third script 230 in the first page 131 . that is , responsive to the requested first page 131 unloading the third script 230 begins execution . the browser program 160 checks whether variable “ cleanup ” is set in the window object . if the variable is found to be set , this indicates that the current page , that is first page 131 , is being displaced to make room for another instrumented page in the bundle , and another response time is calculated . in one of the embodiments , wherein response times are reported upon exiting the bundle 200 , no report is generated if the variable is set , however , if the variable is found not set , further steps in the third script 230 are performed to generate a report . in one embodiment , sending a report 195 includes the third script 230 causing the browser 160 to open a web page with a special url . that is , the third script 230 composes a special url that includes response times appended to the internet name of the verifying agent server 185 , or host server 110 , or whatever server is to receive the report 195 . next , the script 230 causes the newly composed url to be loaded in a “ communication ” window of the browser display . the verifying agent server 185 is set up such that it extracts the data from the url and responds to the client 150 with a page that closes the window . closing is done by delivering a page containing an onload =“ self . close ( )” tag in the body element . to mitigate the undesirable effect on user 149 of the communication window being opened as a separate window on the desktop , the communication window can be made small . however , the window cannot be made invisible without the universal browser write privilege being granted . the privilege granting process involves the user and is generally obtrusive . preferably , therefore , the same hidden frame 411 that is used to save sendtimes 310 , as described in the related patent application , is used as the communication window . referring now to fig4 the hidden frame 411 is shown . according to this embodiment , each instrumented web page , such as the first web page 131 , has a corresponding frameset document . the frameset document definition in the page causes the browser to divide the browser window 165 into two frames , responsive to loading the instrumented page 131 . as shown in fig4 first frame 411 is used to save sendtime 310 and responsetime 330 , and the second frame 412 is for displaying the web page 131 . the first frame is set to zero size and is therefore not visible to the user . according to this alternative , visiting the instrumented site through a browser window causes the following actions to take place . on the first outside entry to an instrumented page , the javascript actions of table two of the cross - referenced patent application cause the corresponding frameset document to be loaded . as long as the user makes instrumented entries to the other pages in the bundle , the hidden , response time frame 411 stays in the top - level browser window . this hidden frame needs to be reloaded only if the user makes an uninstrumented entry to a page in the bundle . in another embodiment , which is suitable if the client 150 browser has cookies enabled and the host 110 is the receiver of the report 195 , the script 230 causes the response time to be saved in a cookie for transmission at a later date . the host server 110 causes the cookie to expire as soon as a request carrying the cookie is sent to the host server 110 , so that the cookie is not sent out on future requests . ( due to javascript security restrictions that control script cookie access , the host server 110 ( and not any agent on the www ) must be the one that receives the response time samples in this case . referring now to fig5 a flow chart is shown illustrating method steps for measuring numerous instances of response times , calculating statistics for the response times and sending a report , according to an embodiment of the invention . in step 505 , a user clicks on a first link in a first page of a bundle . the link references to a second page in the bundle . in step 510 , first script 210 reads the current time and saves it as a sendtime . at step 515 , the second page is loaded , which invokes second script 220 referenced in the second page , resulting in retrieving the sendtime , reading a new current time , and calculating a response time , at step 520 . next , at step 525 , the user clicks on a link in the second page which references to a third page in the bundle . first script 210 , associated with the link in the second page , executes at step 535 to read another current time and save it as a new sendtime . also , before the third page is loaded , the second page begins unloading at 530 , and the second page &# 39 ; s onunload handler is invoked , including third script 230 , which causes the first calculated response time to be saved at 540 , such as in a hidden frame , as described hereinabove . next , at step 545 , the third page is loaded , which triggers the onload handler for the third page , including second script 220 , and retrieves the sendtime that was saved in step 535 . also , the script 220 reads a new current time and uses it and the sendtime to calculate a second response time , that is , the response time for the time to load the third page . next , at 560 , the user clicks on a non - instrumented link in the third page , that is , a link to a page that is not in the current bundle . this causes the third page to begin unloading , so the third page &# 39 ; s onunload handler is invoked , including third script 230 , which causes the both the second calculated response time to also be saved , and also causes statistics about the response times to be calculated at step 565 . for example , the average of the saved response times is calculated in one embodiment . particularly in situations where there are more than two response times , other statistics are calculated in embodiments of the invention . in one embodiment the longest and shortest response times are determined , as well as the variance of all the times . also at step 565 , according to this illustrated embodiment , a report is sent due to the third page unloading in connection with the user having clicked on a link to a page outside the bundle . next , the steps of the present embodiment end at step 570 . referring now to fig6 a flow chart is shown illustrating method steps for one of the third scripts 230 determining when to send a report , according to an embodiment of the invention . in step 610 , a determination is made whether the number of response times exceeds some number n . if yes , then the method proceeds to step 670 , and a report is sent . if no , the method proceeds to step 620 , and a determination is made whether the script 230 has been invoked in connection with the client linking to a page that is in the bundle . if no , then the method proceeds to step 670 , and a report is sent . if yes , the method proceeds to step 630 , and a determination is made whether the script 230 has been invoked in connection with the client linking to a page stored on a different server . if yes , then the method proceeds to step 670 , and a report is sent . if no , the method proceeds to step 640 , and a determination is made whether the most recent response time exceeds a threshold value x . if yes , then the method proceeds to step 670 , and a report is sent . if no , the method proceeds to step 650 , and a determination is made whether the current time and date exceed a preset time or date y . if yes , then the method proceeds to step 670 , and a report is sent . if no , the method proceeds to step 660 , and a determination is made whether the client has an identity z . if yes , then the method proceeds to step 670 , and a report is sent . if no , then the method ends at step 680 . in a further sending related aspect , it should be understood that the report may be hypertext transfer protocol formatted for convenience of sending to the server 185 of the verifying agent via the internet . with reference now to fig7 a block diagram of a data processing system 700 is illustrated . instances of this system 700 are generally applicable for the systems shown in fig1 namely , host &# 39 ; s server 110 , user &# 39 ; s client 150 and the verifying agent &# 39 ; s server 185 . data processing system 700 employs a peripheral component interconnect ( pci ) local bus architecture . although the depicted example employs a pci bus , other bus architectures , such as micro channel and isa , may be used . processor 702 and main memory 704 are connected to pci local bus 706 through pci bridge 708 . pci bridge 708 may also include an integrated memory controller and cache memory for processor 702 . additional connections to pci local bus 706 may be made through direct component interconnection or through add - in boards . in the depicted example , local area network ( lan ) adapter 710 , scsi host bus adapter 712 , and expansion bus interface 714 are connected to pci local bus 706 by direct component connection . in contrast , audio adapter 716 , graphics adapter 718 , and audio / video adapter ( a / v ) 719 are connected to pci local bus 706 by add - in boards inserted into expansion slots . expansion bus interface 714 provides a connection for a keyboard and mouse adapter 720 , modem 722 , and additional memory 724 . in the depicted example , scsi host bus adapter 712 provides a connection for hard disk drive 726 , tape drive 728 , cd - rom drive 730 , and digital video disc read only memory drive ( dvd - rom ) 732 . typical pci local bus implementations will support three or four pci expansion slots or add - in connectors . an operating system runs on processor 702 and is used to coordinate and provide control of various components within data processing system 700 in fig7 . the operating system may be a commercially available operating system , such as os / 2 , which is available from international business machines corporation . “ os / 2 ” is a trademark of international business machines corporation . an object oriented programming system , such as java , may run in conjunction with the operating system , providing calls to the operating system from java programs or applications executing on data processing system 700 . instructions for the operating system , the object - oriented operating system , and applications or programs are located on a storage device , such as hard disk drive 726 , and may be loaded into main memory 704 for execution by processor 702 . those of ordinary skill in the art will appreciate that the hardware in fig7 may vary depending on the implementation . for example , other peripheral devices , such as optical disk drives and the like , may be used in addition to or in place of the hardware depicted in fig7 . the depicted example is not meant to imply architectural limitations with respect to the present invention . for example , the processes of the present invention may be applied to multiprocessor data processing systems . it is important to note that while the present invention has been described in the context of a fully functioning data processing system , those of ordinary skill in the art will appreciate that the processes of the present invention are capable of being distributed in the form of a computer readable medium of instructions and a variety of forms and that the present invention applies equally regardless of the particular type of signal bearing media actually used to carry out the distribution . examples of computer readable media include recordable - type media such a floppy disc , a hard disk drive , a ram , and cd - roms and transmission - type media such as digital and analog communications links . it should be understood from the foregoing , that it is a particular advantage of the invention that performance of both the host server and the network are verified in a thorough and objective way that does not add substantially to traffic on the server or network , and does not interfere with the user &# 39 ; s experience . the description of the present embodiment has been presented for purposes of illustration , but is not intended to be exhaustive or to limit the invention to the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art . for example , it should be understood that while fig6 shows an embodiment where any one of numerous conditions or events may trigger a report , it would be within the spirit and scope of the invention to encompass an embodiment wherein a report is triggered only upon occurrence of more than one of the events or conditions . even occurrence of numerous ones of the events or conditions may be required before a report is sent in one embodiment . likewise , in one embodiment of the invention , a report is sent every time a response time is calculated . to reiterate , the embodiments were chosen and described in order to best explain the principles of the invention , the practical application , and to enable others of ordinary skill in the art to understand the invention . various other embodiments having various modifications may be suited to a particular use contemplated , but may be within the scope of the present invention . | 6 |
embodiments of a jack in accordance with the present invention will be described hereinafter with reference to the accompanying drawings . a jack 11 is provided in a mobile audio device 12 as shown in fig1 , and includes a plug inlet 17 for receiving a plug 15 connected to a pair of stereo - type earphones 14 or headphones ( not shown ) through a cable 13 . such a mobile audio device 12 includes a plurality of control switches 12 a operable to play and stop audio data stored in the device 12 and further to control the volume of sound . in the present embodiment , the jack 11 will be described as provided in the mobile audio device 12 . however , the scope of the present invention is not limited to such an application . the jack 11 in accordance with the present invention may be used in mobile phones or mounted on other electric appliances . fig2 shows the plug 15 insertable into the jack 11 of the present invention . the plug 15 includes a tip 21 provided at a distal end thereof to act as an electrode for stereo audio signals outputted to the left earphone . the plug 15 further includes a ring 22 acting as an electrode for stereo audio signals outputted to the right earphone , and a sleeve 23 , the ring 22 and the sleeve 23 being arranged in the mentioned order from adjacent the distal end of the plug . insulating rings 24 are mounted between the tip 21 and the ring 22 for insulating one from the other . a further insulating ring 24 is provided between the ring 22 and the sleeve 23 as well . the sleeve 23 is connected to a shield layer used for protecting the right and left stereo audio signals from outside noise in the cable 13 . thus , the tip 21 and ring 22 are connected to the jack for transmitting audio signals from the mobile audio device 12 to the earphones 14 through the cable 13 . the sleeve 23 is connected to have the same potential as the ground of the mobile audio device 12 . the plug inlet 17 is provided in a body 16 of the jack 11 for receiving the plug 15 . outside of the body 16 ( the side facing away from the plug inlet 17 in fig2 ) are provided a plurality of terminal electrodes 1 to 7 connected to a plurality of electrodes provided inside the body , respectively . these terminal electrodes 1 to 7 are insulated from one another by a separator 8 formed of an insulating material for preventing short - circuits of those electrodes . further , each of the terminal electrodes 1 to 7 includes a soldered portion ( not shown ) formed thereon to facilitate wiring with the exterior . fig3 is an exploded view of the jack 11 showing the terminal electrodes and the like . the jack 11 includes a spring 1 , a tip spring 2 , a ring spring 3 , a first b - armature 4 , a first t - armature 5 , a second b - armature 6 and a second t - armature 7 , all of which act as the electrodes . since the sleeve 23 is connected to have the same potential as the ground as noted above , the spring 1 for contacting the sleeve 23 will be referred to as the earth spring 1 and described in detail hereinafter . the earth spring 1 according to the present invention is movable under its spring action and includes an earth spring fixing portion 1 a provided in a proximal part 100 thereof for fixing the earth spring 1 to the body 16 of the jack 11 . at a free end part 101 of the earth spring is provided a pressing portion 1 b which is bent for pressing a side surface of the plug 15 when the earth spring 1 contacts the sleeve 23 of the plug 15 inserted into the jack 11 . also , as shown in fig3 , the earth spring 1 includes a first contact portion 1 c at a distal end thereof extending from the pressing portion 1 b and bent at a substantially central portion thereof . further , the free end part 101 has a slot 1 d formed therein with an opening edge acting as a second contact portion 1 e . as shown in fig3 , a boundary portion defined between the proximal part 100 and the free end part 101 is also bent . thus , the first contact portion 1 c and the second contact portion 1 e are arranged along the plug inlet 17 at opposite sides of the pressing portion 1 b . fig4 is a prospective view of the jack 11 and the earth spring 1 showing the relationship therebetween . the body 16 includes a first opening 31 and a second opening 32 formed parallel to each other adjacent the inlet opening of the plug inlet 17 for receiving the plug 15 . a bar 30 is formed between the first opening 31 and the second opening 32 , to have a projection 33 formed at a distal end thereof to extend through the slot 1 d of the earth spring 1 . the bar 30 and the projection 33 act together as a guide mechanism for preventing out - of - plane displacement of the pressing portion 1 b from a predetermined position where the earth spring 1 is movable with reference to the proximal part 100 when the plug 15 is inserted and the pressing portion 1 b presses the side surface of the plug 15 . fig5 ( a ) is a side view of the earth spring 1 and the body 16 showing how these elements are held with each other , while fig5 ( b ) is a bottom view thereof . it should be noted that the bar 30 and the projection 33 are made of a reinforced resin . thus , even when a torsional force occurs as the plug 15 is inserted to apply a twisting force to the earth spring 1 , the projection 33 made of the reinforced resin extends through the slot 1 d of the earth spring 1 , which allows outer surfaces of the bar 30 and the projection 33 to act as a retaining portion 102 . not only is the plug 15 is pressed by the pressing portion 1 b , both the first contact portion 1 c and the second contact portion 1 e contact the bar 30 , thereby preventing poor contact resulting from out - of - plane displacement between the pressing portion 1 b and the sleeve 23 which should properly contact each other . fig6 is a circuit diagram showing connection among the terminal electrodes of the jack 11 . as noted above , the jack 11 includes the earth spring 1 , tip spring 2 , ring spring 3 , first b - armature 4 , first t - armature 5 , second b - armature 6 and second t - armature 7 . when the plug 15 is not inserted into the plug inlet 17 , the first b - armature 4 and first t - armature 5 are electrically connected to each other , and the second b - armature 6 and second t - armature 7 are also electrically connected to each other as shown in fig6 ( a ). on the other hand , when the plug 15 is inserted into the plug inlet 17 , the first b - armature 4 and first t - armature 5 are disconnected from each other , and the second b - armature 6 and second t - armature 7 are also disconnected from each other as shown in fig6 ( b ). the details will be described later . fig7 shows the jack 11 viewed from the side where the terminal electrodes formed outside the jack 11 are provided ( from the side facing away from the plug inlet 17 in fig2 ). fig8 ( a ) shows the jack 11 taken along the line viii - viii of fig7 without the plug being inserted . inside the jack 11 are the tip spring 2 to be connected , along with the earth spring 1 , to the tip 21 of the plug 15 , and the ring spring 3 to be connected to the ring 22 of the plug 15 . the earth spring 1 is fixed to the body 16 by the earth spring fixing portion 1 a . similarly , the tip spring 2 and ring spring 3 are fixed to the body 16 by a tip spring fixing portion 2 a and a ring spring fixing portion 3 a , respectively . fig8 ( b ) shows the jack 11 taken along the line viii - viii of fig7 with the plug being inserted . the tip 21 contacts tip contact portions 2 b when the plug 15 is inserted . then , the ring 22 contacts a ring contact portion 3 b while the sleeve 23 contacts the pressing portion 1 b of the earth spring 1 . the earth spring 1 is pressed by the plug 15 by virtue of its spring action , whereby the first contact portion 1 c and the second contact portion 1 e contact the bar 30 . it should be noted that a conventional jack is not provided with the second contact portion 1 e , which brings the pressing portion 1 b into contact the sleeve 23 and allows only the first contact portion 1 c to contact the bar 30 . thus , the three points provided by the pressing portion 1 b , first contact portion 1 c and earth spring fixing portion 1 a constitute a plate spring . on the other hand , according to the jack 11 of the present invention , the first contact portion 1 c and second contact portion 1 e arranged at opposite sides across the pressing portion 1 b provide two points for contacting the bar 30 , and these three points constitute the plate spring noted above . in comparison between the present invention and the conventional art , a distance between the pressing portion 1 b and first contact portion 1 c is the same while a distance between the pressing portion 1 b and the earth spring fixing portion 1 a in the prior art corresponds to the decreased distance between the pressing portion 1 b and the second contact portion 1 e in the present invention . since the plate spring shape is formed to have a small distance , the posture of the spring is stabilized thereby to enhance the strength against torsional forces . fig9 is a sectional view of the jack 11 taken along the line ix - ix of fig7 without the plug being inserted . the first b - armature 4 contacts the first t - armature 5 while the second b - armature 6 contacts the second t - armature 7 . the separator 8 is provided in the central portion of the jack assembly . when the plug 15 is inserted , the separator 8 receives a pressing force to expand in the direction of arrows shown in fig9 . due to this pressing force , the separator 8 expands the first t - armature 5 and second t - armature 7 outward . as a result , the first t - armature 5 is disengaged from the first b - armature 4 and the second t - armature 7 is also disengaged from the second b - armature 6 . according to the above embodiment , the second contact portion is formed in the slot 1 d . however , the scope of the present invention is not limited to this arrangement . naturally , for instance , cutout portions 35 may be provided as shown in fig1 instead of the opening such as the slot 1 d . with such an arrangement , as shown in fig1 ( a ) and 11 ( b ), two bars 30 are provided to extend from the body 16 thereby to hold the earth spring 1 therebetween . this allows the pressing portion 1 b to press the sleeve 23 while the first contact portion 1 c and the second contact portion 1 e contact the bars 30 as in the above - noted embodiment . thus , naturally , it is possible to secure the functions and effects of the present invention for providing a countermeasure against a torsional force in fig1 , the cutout portions 35 are provided at the opposite sides of the earth spring 1 . however , the scope of the present invention is not limited to this arrangement . for example , it is also possible to provide a single cutout portion 35 at only one side of the earth spring 1 and dispense with the other side cutout portion 35 , thereby allowing the earth spring 1 to be pressed and fixed directly to the body . according to the first embodiment , the electrodes provided for the plug 15 include the tip 21 , ring 22 and sleeve 23 . however , the scope of the present invention is not limited to this arrangement . for example , even if only the two electrodes , the tip 21 and sleeve 23 , are provided , it is possible , naturally , to enhance the countermeasure against a torsional force according to the present invention by using the pressing portion 1 b , first contact portion 1 c and second contact portion 1 e . the present invention is also applicable where the number of terminal electrodes is increased as where a remote controller is provided between the earphones 14 and plug 15 . in the first embodiment , the earth spring 1 acts as one of the electrodes . however , the scope of the present invention is not limited to this arrangement . for example , the earth spring 1 may be provided to simply act as a reinforcing jig , instead of the electrode , operative against a torsional force . according to the first embodiment , the pressing portion 1 b , first contact portion 1 c and second contact portion 1 e contact the sleeve 30 and bar 30 , respectively , to enhance the strength against a torsional force . however , the scope of the present invention is not limited to this arrangement . naturally , for example , it is possible to allow an edge opposed to the edge of the slot 1 d acting as the second contact portion 1 e to act as a third contact portion and contact the bar 30 , thereby enhancing the strength against a torsional force . further , the projection 33 acting as the guide mechanism is formed along the plug inlet 17 in the first embodiment . however , the scope of the present invention is not limited to this arrangement . for example , it is also possible to provide the projection 33 to extend across the plug inlet in a direction from an outer periphery toward the center of the plug inlet . with this arrangement , the position of the second contact portion 1 e is shifted to the opposite edge of the slot 1 d , which makes it possible to secure the functions and effects of the present invention for counteracting a torsional force by using the second contact portion 1 e as well as the pressing portion 1 b and the first contact portion 1 c . | 7 |
with reference to the figures , the reference numeral 1 generally designates the sprayer provided with means for coupling , in particular a thread 2 for coupling to the end 3 of a flexible hose 4 comprised within a faucet 5 . more specifically , the thread 2 protrudes from a water conveyance body , generally designated by the reference numeral 6 and described hereinafter , which is comprised within an external enclosure 7 . the reference numerals 8 and 9 designate two wings that protrude monolithically from the body 6 and are inclined so as to provide substantially portions of screw threads that are designed to enter , following a translational motion in the direction of the axis of the sprayer , respective notches provided in a bush 10 , which is locked at the end of the faucet 5 , and to make contact , following a rotary motion imparted by the user to the sprayer , with abutments , such as inclined planes that are adjacent to said notches and are also formed within the bush 10 : in this way , the wing 8 is designed to enter a notch 8 a and make contact with an adjacent inclined plane 8 b , while the wing 9 , after entering a notch not shown in the figures , is designed to make contact with an inclined plane 9 a . it clearly appears that the sprayer assumes , during engagement with the faucet 5 , a helical motion that leads it to a stable engagement position , with the assurance of making contact with the terminal rim of the faucet 5 , thus protecting at the same time functional and aesthetic requirements . obviously , the inclined planes 8 b and 9 a can be replaced with different abutments , so long as they are capable of ensuring the condition of helical motion of the sprayer as described above . the water conveyance body 6 is now described with particular reference to fig5 , 8 and 9 ; said body is provided , as mentioned , at the inlet of the threaded portion 2 , with a connection to the flexible hose 4 and is associated at its output with a disk 11 , which comprises a central port 12 , provided with a ring 13 for containing an aerator , not shown in the figures , and peripheral ports such as 14 . it is indeed the association with the disk 11 that achieves the locking of the body 6 with respect to the external enclosure 7 , the protrusion 7 a whereof remains indeed closed between the body 6 and the disk 11 . the body 6 accommodates a switching device , which comprises a flow control element 15 associated with a rod 16 , which has , at one end , a button 17 , and accommodates a lever 18 , which is associated with the button 17 at a first end , is pivoted at the body at the center , and is shaped like a further button at a second end 18 a ; a hood 19 , made of an elastic material such as rubber , covers the button 17 and the end 18 a of the lever . the switching device is per se known ; it is enough to note that the situation of fig5 provides the connection , illustrated by the arrows , of an inlet duct 20 to the second duct that conveys the water to ports such as 14 , thus achieving the peripheral jet , while the situation of fig6 provides the connection , also illustrated by the arrows , of the inlet duct 20 to the first duct that conveys the water to the port 12 , thus providing the central jet . the body 6 is divided into two sections , respectively designated by the reference numerals 6 a and 6 b , each of which contains a portion of said water conveyance ducts : accordingly , the section 6 a contains a portion 21 a and the section 6 b contains a portion 21 b of the second duct that conveys water to the peripheral ports , and the section 6 a contains a portion 22 a and the section 6 b contains a portion 22 b of the first duct that conveys water to the central port . in this manner it is particularly easy to provide said ducts . the two sections 6 a and 6 b are detachably connected to each other by way of connection means that comprise the l - shaped tabs 23 and 24 , which protrude from the section 6 b and are adapted to enter with a translational motion a notch provided in the section 6 a , such as 23 a for a tab 23 , and to then make contact , as a consequence of a rotary motion , with an inclined - plane contact region that is adjacent to said notch , such as 23 b again for the tab 23 , obtaining therefrom a helical relative motion of the two sections that causes their engagement : cavities or seats such as 25 and 26 , formed respectively in the section 6 b and in the section 6 a , are intended to be arranged so that they face each other in the position for engaging the two sections that is shown in fig9 , so as to allow accommodation of a pin that is adapted to ensure the stability of the coupling . the l - shaped element and the corresponding contact region may of course assume any configuration , so long as it is capable of ensuring the above cited helical motion condition . going back now to the switching device , it is noted that the button 17 is associated with the end of the rod 16 by means of a thread , and that a stud 27 is provided that is inserted in the hood region 19 that lies above the end 18 a of the lever , so as to provide an element that allows strong tactile identification . finally , on the lever 18 there are two tabs 18 b and 18 c , which have good elastic characteristics and which , by making contact with the wall of the duct portion 21 a ensure stable placement of said lever in every functional condition . the described invention is susceptible of numerous modifications and variations in addition to the ones already mentioned , all of which are within the scope of the appended claims : thus , for example , the notches for the passage of the wings 8 and 9 or of the tabs 23 and 24 may assume any shape . the disclosures in italian patent application no . mn2004a000005 from which this application claims priority are incorporated herein by reference . | 4 |
[ 0030 ] fig1 illustrates a front cross - sectional view of an electronic structure 10 having a chip 14 over a substrate 12 , in accordance with embodiments of the present invention . an underfill 16 is disposed between the chip 14 and the substrate 12 , and the underfill 16 encapsulates a peripheral portion of the chip 14 . the underfill 16 accommodates strain induced during thermal cycling due to a differential coefficient of thermal expansion ( cte ) between the chip 14 and substrate 12 . the substrate 12 , which may comprise a chip carrier , includes a top surface 13 , a peripheral surface 15 , and a peripheral edge 17 . see fig1 , 12 , and 13 , each described infra , for top views depicting the chip 14 , the underfill 16 , and the peripheral edge 17 . note the fig1 , 12 , and 13 show the portion of the underfill 16 which encapsulates the peripheral portion of the chip 14 , but does not show a portion 56 of the underfill 16 that is directly under the chip 14 . the following discussion presents three embodiment classes of the present invention . the first embodiment class is illustrated by fig1 - 5 and 11 . the second embodiment class is illustrated by fig1 , 6 - 8 , and 12 . the third embodiment class is illustrated by fig1 , 9 - 10 , and 13 . fig1 - 5 and 11 illustrate a first embodiment class of the present invention . fig2 illustrates fig1 after a dam 20 of a first adhesive material that has been dispensed on the surface 13 of the substrate 12 . as dispensed , the first adhesive material is uncured . the first adhesive material may comprise , inter alia , a first epoxy material that includes a first thixotrope at a thixotropic concentration such that the first adhesive material remains in place upon being dispensed . the dam 20 has an outer surface 21 that meets the substrate 12 in a planar area bounded by an inner contact curve 18 and an outer contact curve 19 . see fig1 , described infra , for a top view depicting the dam 20 , the inner contact curve 18 , and the outer contact curve 19 . although the dam 20 may be dispensed at any desired location on the surface 13 of the substrate 12 , it may be advantageous to place the dam 20 beyond any electrical circuitry or other valuable structure in the substrate 12 in order to minimize potential damage to electrical circuitry or other valuable structure in the substrate 12 , as will be discussed infra . the dam 20 will constitute a dam portion of a fillet 27 that is depicted infra in fig5 . returning to fig2 the outer surface 21 of the dam 20 makes a contact angle θ 1 with the outer contact curve 19 . θ 1 is approximately constant along the outer contact curve 19 and θ 1ave denotes an average value of value of θ 1 ; i . e ., an average contact angle along the outer contact curve 19 . test results , which will be discussed infra , show small standard deviations in the contact angle of 5 % to 7 % of the average contact angle , which supports the preceding statement that θ 1 is approximately constant along the outer contact curve 19 . [ 0034 ] fig3 illustrates fig2 after an inner bead 22 of a second adhesive material has been dispensed on top surface 11 of the chip 14 and around a periphery of the chip , resulting in a gap 28 disposed between the inner bead 22 and the dam 20 . as dispensed , the second adhesive material is uncured . the second adhesive material may comprise , inter alia , a second epoxy material that includes a second thixotrope at a thixotropic concentration such that the second adhesive material remains in place upon being dispensed . the second adhesive material may be chosen to be the same as , or to differ from , the first adhesive material . the second adhesive material may differ from the first adhesive material with respect to one or more of : the epoxy material , the thixotrope , and the thixotropic concentration . the inner bead 22 will constitute an inner bead portion of the fillet 27 that is depicted infra in fig5 . note that the second adhesive material of the inner bead 22 may be dispensed either before or after the first adhesive material of the dam 20 has been dispensed . [ 0035 ] fig3 also illustrates a thermally conductive member 24 ( e . g ., a heat spreader ) placed on the inner bead 22 and above the top surface 11 of the chip 14 . see fig1 , described infra , for a top view depicting the inner bead 22 and the thermally conductive member 24 . note the fig1 does not show a portion 52 of the inner bead 22 that is directly above the chip 14 , and disposed between the chip 14 and the thermally conductive member 24 . returning to fig3 a force 23 is applied to the thermally conductive member 24 in a direction 8 toward the chip 14 . the force 23 causes the second adhesive material of the inner bead 22 to be redistributed . fig4 illustrates fig3 after the force 23 has been applied to the thermally conductive member 24 , resulting in a second gap 29 that replaces the first gap 28 . [ 0037 ] fig5 illustrates fig4 after the second gap 29 has been filled with a third adhesive material 26 . see fig1 for a top view of the electronic structure 10 of fig5 including the third adhesive material 26 . as dispensed , the third adhesive material 26 is uncured . the third adhesive material 26 may comprise , inter alia , a third epoxy material that includes a third thixotrope at a thixotropic concentration such that the third adhesive material 26 flows upon being dispensed into the second gap 29 . the third adhesive material 26 differs from both the first adhesive material and the second adhesive material with respect to one or more of : the epoxy material , the thixotrope , and the thixotropic concentration . if the third adhesive material 26 includes the same epoxy material and thixotrope as the first adhesive material and / or the second adhesive material , then the third adhesive material 26 must have a lower thixotropic concentration than the thixotropic concentration of the first adhesive material and / or the second adhesive material . allowable ranges of thixotropic concentration are case dependent and vary with the epoxy material and the thixotrope used . for a variety of epoxy materials and thixotropes , a representative thixotropic concentration of the third adhesive material 26 is less than about 1 . 5 % by weight , and a representative thixotropic concentration of the first and / or second adhesive material 26 is greater than about 1 . 5 % by weight . while the discussion supra associated with fig3 - 5 disclosed applying the force 23 ( see fig3 ) to the thermally conductive member 24 prior to filling the second gap 29 with the third adhesive material 26 ( see fig4 - 5 ), the preceding steps could be reversed as follows . the first gap 28 ( see fig3 ) could first be filled with the third adhesive material 26 , followed by applying the force 23 to the thermally conductive member 24 which would redistribute the second adhesive material of the inner bead 22 . regardless of whether the force 23 is applied to the thermally conductive member 24 before or after filling the second gap 29 ( or the first gap 28 ) with the third adhesive material 26 , the structure in fig5 relating to the third adhesive material 26 will result . after being dispensed , the third adhesive material 26 , flows and takes a shape that conforms to boundaries imposed by the inner bead 22 and the dam 20 . the third adhesive material 26 constitutes an extended fillet portion of the fillet 27 . thus , the fillet 27 includes the inner bead portion ( i . e ., the inner bead 22 ), the extended fillet portion ( i . e ., the third adhesive material 26 ), and the dam portion ( i . e ., the dam 20 ). after being dispensed , the third adhesive material 26 interacts with the first adhesive material of the dam 20 in a manner that reduces the contact angle with the outer contact curve 19 to a lower value θ 2 in comparison with θ 1 ( see fig2 ). if θ 2ave denotes an average value of θ 2 around the outer contact curve 19 ( see fig1 ), then θ 2 & lt ; θ 1 and thus θ 2ave & lt ; θ 1ave . [ 0040 ] fig1 presents test results which show the contact angle ( as exemplified by θ 1 of fig2 and θ 2 of fig5 ) as a function of time for four data points 1 , 2 , 3 , and 4 . the indicated standard deviation ( std ) corresponds to averaging over four contact angles at each of the data points 1 , 2 , 3 , and 4 . the four angles for averaging purposes correspond to four spatial points on the outer contact curve 19 of fig1 . the data point 1 represents an initial condition at ambient room temperature ( i . e ., about 21 ° c .) at which the inner bead 22 and the dam 20 , but not the third adhesive material 26 of fig5 are on the substrate 12 . an initial contact angle θ 1 is 41 ± 3 degrees ( i . e , the average contact angle θ 1ave is 41 degrees subject to a standard deviation of 3 degrees ). after the initial condition , the third adhesive material 26 is dispensed . the data point 2 occurs at ambient room temperature and 15 minutes after the third adhesive material 26 has been dispensed during which the contact angle has been reduced to 29 ± 3 degrees . the data point 3 occurs at ambient room temperature and 30 minutes after the third adhesive material 26 has been dispensed during which time the contact angle has been reduced to 25 ± 1 degrees . at about 60 minutes after the third adhesive material 26 had been dispensed , the electronic structure 10 was placed in a heated chamber at 130 ° c . for curing and was removed for final measurement of the contact angle θ 2 at about 30 minutes after being placed in the heated chamber . accordingly , the data point 4 occurs after a total exposure of 60 minutes to the ambient room temperature and an additional exposure of 30 minutes to a temperature of 130 ° c . the final measured contact angle θ 2 associated with the data point 4 is 20 ± 1 degrees . thus , an unknown portion of the final 5 degree contact angle reduction from the data point 3 to the data point 4 occurs at ambient room temperature , and a remaining unknown portion of the final 5 degree contact angle reduction occurs at 130 ° c . note that the standard deviation for the data points 1 , 2 , 3 , and 4 is only 5 % to 7 % of the average contact angle , which shows that the contact angle is approximately constant on the outer contact curve 19 of fig1 . the aforementioned test results show a total reduction in average contact angle of a factor of about 2 ( i . e ., from 41 degrees to 20 degrees ), and a reduction in average contact angle of at least 1 . 6 ( i . e ., from 41 degrees to 25 degrees ) during temperature exposure to only ambient room temperature . the reduction of the contact angle to 25 degrees or less ( which is a satisfactory low contact angle ) during temperature exposure to only ambient room temperature allows for pre - cure inspection of the contact angle , which enables parts having unacceptable contact angles to be discarded or reworked without incurring the cost and time of curing . returning to fig5 the contact angle reduction from θ 1 to θ 2 is caused by surface tension between the third adhesive material 26 and the first adhesive material of the dam 20 . in particular , the aforementioned surface tension generates a force which pulls the first adhesive material at the surface 21 of the dam 20 toward the third adhesive material 26 in a direction 9 which results in the contact angle reduction from θ 1 to θ 2 . after the third adhesive material 26 has been dispensed , the first adhesive material , the second adhesive material , and the third adhesive material 26 are cured at an elevated temperature . the elevated temperature is application dependent and is a function of the first adhesive material , the second adhesive material , and the third adhesive material 26 . the time for substantial completion of curing is a decreasing function of the cure temperature . a representative cure temperature and cure time is 130 ° c . for 4 hours . a cure temperature and associated cure time suitable for the intended application may be determined empirically without undue experimentation by one of ordinary skill in the art . as shown supra in the test results of fig1 , the contact angle reduction to 25 degrees or less takes place before curing . the aforementioned contact angle reduction to about 20 - 25 degrees or less for θ 2 and θ 2ave substantially prevents cracks from forming during thermal cycling on the surface 13 of the substrate 12 in a vicinity of the planar area bounded by the inner contact curve 18 and the outer contact curve 19 ( see fig1 ). the following table summarizes test results showing a percentage of parts that have developed one or more cracks as a function of the average contact angle that an outer surface of a fillet makes with a substrate surface . average contact parts with cracks (%) angle ( degrees ) at 310 cycles at 675 cycles at 1053 cycles 48 19 50 75 38 6 50 63 29 6 31 69 26 6 25 25 18 0 0 13 in the above table , 16 parts were tested at each contact angle in a wet thermal shock test having a temperature range of − 55 ° c . to 125 ° c . in each cycle . the test results indicate that 63 - 75 % of parts had crack formation during 1053 thermal cycles if the average contact angle θ 2 was 29 degrees or more . in contrast , only 13 - 25 % of parts had crack formation during 1053 thermal cycles if the average contact angle was 26 degrees or less . returning to fig5 for thermal stress on the surface 13 induced during thermal cycling , crack formation is caused by a geometric stress concentration . the stress concentration at the outer contact curve 19 is a monotonically increasing function of the contact angle θ 2 , because as θ 2 increases , the height in the direction 7 of the third adhesive material 26 at the outer contact curve 19 increases , resulting in a corresponding increase in stiffness imposed on the substrate at the outer contact curve 19 . in the limit of θ 2 approaching zero degrees , the discontinuity in stress concentration across the outer contact curve 19 from inside the dam 20 to outside the dam 20 vanishes . thus below a threshold contact angle θ 2 , the stress concentration is sufficiently low to render crack formation unlikely . based on the test data presented supra , the threshold contact angle θ 2 is about 25 degrees . the actual values of θ 2 which may be obtained with the embodiment of the present invention , as described by fig1 - 5 and 11 , are case dependent and depend on the geometry of the third adhesive material 26 in relation to the geometry of the inner bead 22 and the dam 20 . for example , in order to effectuate a low contact angle , such as θ 2 , less than about 25 degrees , an exposed surface 30 of the third adhesive material 26 must be concave upward ; i . e ., concave in a direction 7 . whether the exposed surface 30 is concave upward depends on the relative heights ( in the direction 7 ) of the third adhesive material 26 , the inner bead 22 , and the dam 20 . accordingly , θ 2 may be controlled or influenced by adjusting the volume of the third adhesive material 26 for a given size of the gap 29 ( see fig4 ) in consideration of the heights of the inner bead 22 and the dam 20 . whether the exposed surface 30 is concave upward also depends on the width ( in the direction 9 ) of the third adhesive material 26 , which may be adjusted by where the dam 20 is placed on the surface 13 of the substrate 12 . in consideration of the preceding variables in relation to the aforementioned case - dependent determination of θ 2 , one skilled in the art may determine , without undue experimentation , how to use the present invention to obtain desired contact angles θ 2 . the present invention , as embodied in fig1 - 5 and 11 may protect electrical circuitry or other valuable structure in the substrate 12 in either or both of two ways . a first way of accomplishing said protecting is by locating the dam 20 at specific locations on the surface 13 above or near electrical circuitry or other valuable structure in the substrate 12 needing protection , such that the contact angle θ 2 at the dam 20 is less than about 25 degrees at said specific locations . as stated supra , a contact angle θ 2 of less than about 25 degrees protects the surface 13 against cracking . a second way of accomplishing said protecting is by locating the dam 20 at specific locations on the surface 13 not above or near electrical circuitry or other valuable structure in the substrate 12 needing protection , so that even if cracking at the outer contact curve 19 at the dam 20 should occur , there would be no nearby electrical circuitry or other valuable structure to be damaged . depending on how electrical circuitry or other valuable structure within the substrate 12 is distributed , the second way of accomplishing said protecting may include , inter alia , positioning the dam 20 such that the outer contact curve 19 is at a distance no greater than a specified distance from the peripheral edge 17 of the substrate 12 . fig1 , 6 - 8 , and 12 illustrate a second embodiment class of the present invention . fig6 illustrates fig1 after a bead 32 of an adhesive material has been dispensed on a top surface of the chip 14 and around a periphery of the chip 14 , and after a thermally conductive member 24 has been placed on the bead 32 and over the top surface of the chip 14 . as dispensed , the adhesive material of the bead 32 is uncured . the adhesive material of the bead 32 may comprise an epoxy material that includes a thixotrope at a low thixotropic concentration ( e . g ., at a thixotropic concentration of less than about 1 . 5 % by weight for many thixotrope - epoxy combinations ) such that the viscosity of the adhesive material of the bead 32 initially decreases upon being heated . the bead 32 has an outer surface 33 that meets the substrate 12 in a planar area bounded by an outer contact curve 35 . see fig1 for a top view of the electronic structure 10 of fig6 depicting the bead 32 , the thermally conductive member 24 , and the outer contact curve 35 . note the fig1 does not show a portion 53 of the bead 32 that is directly above the chip 14 , and disposed between the chip 14 and the thermally conductive member 24 . returning to fig6 a force 63 is applied to the thermally conductive member 24 in the direction 8 toward the chip 14 . the force 63 causes the adhesive material of the bead 32 to be redistributed . fig7 illustrates fig6 after the force 63 has been applied to the thermally conductive member 24 . fig7 shows the outer surface 33 of the bead 32 making a contact angle θ 3 with the surface 13 of the substrate 12 . the outer contact curve 35 of the bead 32 may be sufficiently close to the chip 14 so that the contact angle θ 3 is rather steep such as about 45 ° or more . θ 3 is approximately constant along the outer contact curve 35 . noting that θ 3 may have minor variations along the contact curve 35 , θ 3ave denotes an average value of value of θ 3 ; i . e ., an average contact angle along the outer contact curve 35 . next , the adhesive material of the bead 32 is thermally cured at an elevated temperature . the elevated temperature is application dependent and is a function of the adhesive material of the bead 32 . the time for substantial completion of curing is a decreasing function of the cure temperature . a cure temperature and associated cure time suitable for the intended application . may be determined empirically without undue experimentation by one of ordinary skill in the art . at the onset of curing ( i . e ., during an initial time interval at the cure temperature ), the viscosity of the adhesive initially decreases before the curing later increases the viscosity of the adhesive . the initial viscosity decrease reduces the contact angle to a value θ 4 that is less than about 25 degrees . thus , the reduction of the contact angle from θ 3 to θ 4 occurs substantially during the aforementioned curing step . the low value of θ 4 ( i . e ., less than about 25 degrees ) prevents cracks from forming during thermal cycling on the surface 13 of the substrate 12 in a vicinity of the planar area bounded by the outer contact curve 35 , as explained supra in conjunction with the analogous contact angle θ 2 of fig5 . fig1 , 9 - 10 , and 13 illustrate a third embodiment class of the present invention . fig9 illustrates fig1 after a bead 42 of a high - thixotropic adhesive material ( e . g ., at a thixotropic concentration of at least about 1 . 5 % by weight for many thixotrope - epoxy combinations ) has been dispensed on a top surface of the chip 14 and around a periphery of the chip 14 , and after a thermally conductive member 24 has been placed on the bead 42 and over the top surface of the chip 14 . as dispensed , the adhesive material of the bead 42 is uncured . the high - thixotropic adhesive material of the bead 42 may comprise the high - thixotropic adhesive material such that the adhesive material remains in place upon being dispensed . the bead 42 has an outer surface 43 that meets the substrate 12 in a planar area bounded by an outer contact curve 45 . see fig1 for a top view of the electronic structure 10 of fig9 depicting the bead 42 , the thermally conductive member 24 , and the outer contact curve 45 . note the fig1 does not show a portion 54 of the bead 42 that is directly above the chip 14 , and disposed between the chip 14 and the thermally conductive member 24 . returning to fig9 a force 73 is applied to the thermally conductive member 24 in the direction 8 toward the chip 14 . the force 73 causes the adhesive material of the bead 42 to be redistributed . fig1 illustrates fig9 after the force 73 has been applied to the thermally conductive member 24 , after which an outer surface 43 of the bead 42 makes a contact angle θ 5 with the surface 13 of the substrate 12 . the bead 42 is positioned on the surface 13 of the substrate 12 in a manner that results in the contact angle θ 5 having a value of about 25 degrees or less . such positioning of the bead 42 requires that a height h of a surface 38 of the thermally conductive member 24 above the surface 13 of the substrate 12 be sufficiently small in relation to a lateral distance d between the the thermally conductive member 24 and the outer contact curve 45 . an exact relation between h and d to keep the contact angle θ 5 to about 25 degrees or less is application dependent and depends on the high - thixotropic adhesive material of the bead 42 . for a given lateral distance d of about 100 mils , a representative height h is about 42 mils . a suitable relation between h and d for the intended application may be determined empirically without undue experimentation by one of ordinary skill in the art . noting that θ 5 has minor variations along the contact curve 45 , θ 5ave denotes an average value of value of θ 5 ; i . e ., an average contact angle along the outer contact curve 45 . the aforementioned low value of θ 5 prevents cracks from forming during thermal cycling on the surface 13 of the substrate 12 in a vicinity of the planar area bounded by the outer contact curve 45 , as explained supra in conjunction with the analogous contact angle θ 2 of fig5 . next , the high - thixotropic adhesive material of the bead 42 is cured at an elevated temperature . the elevated temperature is application dependent and is a function of the high - thixotropic adhesive material of the bead 42 . the time for substantial completion of curing is a decreasing function of the cure temperature . a representative cure temperature and cure time is 130 ° c . for 4 hours . a cure temperature and associated cure time suitable for the intended application may be determined empirically without undue experimentation by one of ordinary skill in the art . the curing does not change the contact angle θ 5 . while particular embodiments of the present invention have been described herein for purposes of illustration , many modifications and changes will become apparent to those skilled in the art . accordingly , the appended claims are intended to encompass all such modifications and changes as fall within the true spirit and scope of this invention . | 7 |
the pipe cutting device shown in the drawing has a two - part housing consisting of a bearing housing 1 and a chuck housing 2 . moreover , it is possible to construct the housing as a one - part member . the bearing housing 1 is detachably connected to the chuck housing 2 by means of screws 26 , for instance setscrews . for a rapid connection of the two housings , the bearing housing 1 has recesses 27 into which the screws 26 are introduced , see fig6 . as can be seen in fig1 the chuck housing 2 is secured to a worktable 22 by screws 23 and chuck jaws 25 are displaceable by means of a threaded spindle 24 , as is conventional in pipe vises in which coaxial clamping of a pipe 9 to the cut is used . as shown in fig1 a bore 29 in the housing 1 is concentric with the workpiece axis 28 . a ring 3 is rotatably mounted within the bearing housing 1 and is guided in the axial direction by means of spaced parallel ring disks 14 , 15 each bearing on one of the two end faces of the ring . in addition , the ring disks 14 , 15 also bear on guide surfaces 30 , 30 &# 39 ;, respectively , on the bearing housing . while the outer surface of the ring is concentric to the workpiece axis 28 , the surface of the inner bore 4 of the ring is eccentric to the workpiece axis and its amount of eccentricity 5 , note fig2 is selected in accordance with the maximum adjustment path of a cutting tool 7 relative to the workpiece 9 . the maximum adjustment path also includes the extent of penetration of the cutting tool into the workpiece . the ring disks 14 , 15 located on the opposite sides of the ring 3 have a larger outside and smaller inside diameter as compared to the ring and are detachably connected to it by means of screws 31 . on the surface of bore 29 in the interior of the bearing housing 1 , a locking groove 16 is provided into which a slide 17 , extending radially outwardly from the ring 3 , seats so that a lock 10 is established between the bearing housing and the ring . as its end within the locking groove 16 , the slide 17 is preferably equipped with a roller 18 , for example , a ball bearing , and the opposite or radially inner end of the slide is provided with compression springs 21 which bear against the radially inner end face 33 of the guide in the ring 3 which supports the slide . the springs hold or bias the slide 17 in the locking position , note fig5 . other types of locks , for instance a ball lock , can also be used . the lock 10 defines the rest position of ring 3 and , at the same time , fixes the position of the eccentric center 32 of the bore 4 relative to the workpiece axis 28 . for the manual operation of the slide 17 , a release lever 34 extends through the ring disk 15 from the exterior of the bearing housing , note fig1 and is connected to the slide by means of screws 35 . on the opposite side of the bearing housing from the release lever 34 , the ring 3 is provided with a arcuate groove 19 and the ring disk 14 contains an arcuate slot 20 in register with the groove and a clamping screw 36 extends from the exterior of the ring disk 14 through the slot into the groove and forms , together with a knurled nut 37 screwed onto the clamping screw , a clamping device for securing a stop 11 positioned between the knurled nut and the ring disk . by means of the clamping device 36 , 37 , the stop 11 can be adjustably moved along the slot 20 and a scale 41 is provided on the outer surface of the ring disk and indicates the different dimensional designations or diameter range of workpieces which can be cut by the device . the slot 20 can also be provided with locks for the clamping screw 26 or the stop 11 corresponding to the individual dimensions indicated on the scale . rotatably mounted in bore 4 is a cutting support 6 which has a bore or opening 42 extending laterally about and spaced outwardly from the workpiece 9 . the cutting support 6 is guided in the axial direction between the ring disks 14 , 15 . a driving motor 8 is flanged on the cutting support 6 and transmits driving motion to a tool spindle 38 which drives a circular saw blade 7 mounted on the spindle . the saw blade 7 serves as the cutting tool for dividing the workpiece into individual sections . as can be seen in fig2 a driving pin 12 is secured to the cutting support 6 and extends outwardly beyond the bore 4 . in fig2 the driving pin 12 is shown in full lines in the rest position of the cutting support 6 , that is , the position in which the blade 7 mounted on the cutting support is spaced the maximum adjusted distance from the surface of the workpiece located on the axis of the bearing housing 1 . by rotating the cutting support 6 about the eccentric axis 32 of bore 4 , the stop 12 is moved about the workpiece or bearing housing axis 28 into contact with the adjustable stop 11 . the extent of the adjustment path of the cutting tool 7 also includes the extent of penetration of the tool into the workpiece 9 . a stop 13 is provided in the path of the housing containing the driving motor 8 which limits the movement of such housing in the counterclockwise direction as viewed in fig2 . the stop 13 is connected by screws 43 to the ring 3 , note fig7 . this fixed rest position of cutting support 6 also corresponds to its stable position . in cutting the workpiece 9 held in the chuck housing 2 , the stop 11 is positioned on the scale 41 to the dimension of the workpiece to be cut . subsequently , the cutting support 6 is pivoted about the eccentric axis 32 and the cutting support along with the driving pin 12 is rotated into the position indicated in broken lines in fig2 with the driving pin in contact with the stop 11 . due to the pivotal movement , the cutting blade 7 supported on the cutting support 6 is guided along an arcuate path of travel inwardly into contact with the workpiece 9 for subsequently cutting the workpiece . since the driving pin 12 is in contact with the stop 11 , the ring 3 mounted concentrically to the workpiece 9 is carried along by the further pivotal movement of the cutting support 6 with the combined rotational movement of the ring 3 and the cutting support 6 being guided about the axis 28 of the workpiece with the cutting tool held in engaging position until a section of the workpiece is separated after one revolution of the ring 3 . in carrying out the cutting operation , the lock 10 between the ring 3 and the bearing housing 1 is released by the lever 34 . following the separating process , the cutting tool 7 is returned by an opposite pivotal movement of the cutting support 6 until the cutting support contacts the stop 13 and the ring 3 is returned into its locked position with the cutting support also being brought into its rest position so that a subsequent cutting operation can be performed . while the workpiece has been referred to as a pipe or tubular member it can be appreciated that the invention would also be applicable to other types of workpieces which are adaptable to the chuck housing 2 and are to be cut into sections . while a specific embodiment of the invention has been shown and described in detail to illustrate the application of the inventive principles , it will be understood that the invention may be embodied otherwise without departing from such principles . | 1 |
referring now to the drawing , and more particularly to fig1 and 3 thereof , there is shown a preferred embodiment of the invention . the reader module includes several distinct subsystems . these include : a sample holder with a motion control . the magnetic bound complex samples for measurement reside on the holder , and the same also provides the necessary relative motion within the system . a magnetizer or magnetic field source applies the excitation signals to the samples . sensors , such as sensing coils , act as the signal pick - up for the signals generated in the samples . a drive circuit supplies the drive current to the coils of the magnetic field source . an amplifier / phase detector / digitizer is coupled to the sensor to receive and process the output signals therefrom . a microcomputer chip provides two - way communication between the external personal computer ( pc ) and the reader module . magnetic particles are coupled to analyte or target particles by conventional methods to create magnetic bound complex samples . the analyte particles may include atoms , individual molecules and biological cells , among others . it is noted here that the terms “ target particle ” and “ analyte particle ” are used substantially interchangeably . it is further noted that the term “ target ” is not intended to be limited to the definition of that term as used in the field of dna recombinant technology . the magnetic bound complex samples are deposited in accumulations of several to several hundred particles at a number of predetermined positions 11 near the perimeter of a sample holder , such as disc 12 ( fig3 ). other sample holders which may be substituted include lateral flow membranes , plastic strips , or holders employing lateral flow but without membranes . an embodiment employing lateral flow membranes is described in more detail below . another type of sample holder may employ microfluidics . a microfluidics system may have a sample sensing chamber and appropriate channeling to move a sample in or out of the sensing chamber using variations in pressure . for example , referring to fig9 a microfluidic system 151 is shown having an inlet channel 152 . the inlet channel 152 is connected to a mixing chamber 164 . a number of reagent chambers 154 , 156 , and 158 may be provided to hold various chemicals or reagents . as described below , they may also hold magnetically susceptible particles if desired . near the periphery , or elsewhere , a sample analysis chamber 166 may be located . the location of this chamber is a predefined location and is where the sample magnetic measurement would occur . accordingly , the sample holder must be configured to allow this chamber to be accessible to the sensor and the magnetic field source . otherwise , the magnetic measurement may proceed as described elsewhere in this specification . further processing may occur after the magnetic measurement . for this reason , a measurement chamber 168 is provided , which may also have its own reagent chamber 160 . more reagent chambers may be provided if desired . an optional outlet or exit channel 162 may be provided . such channels may not be necessary if the device is only a single - use device . not shown in this figure for convenience but which may also be provided are various pressure inlets and valves which allow analyte particles , magnetically susceptible particles , and reagents to be shuttled around from chamber to chamber . analyte particles may be quantitatively measured via measuring their bound magnetically susceptible particles in the microfluidic system , the samples may be introduced via the inlet channel as combinations of analyte and magnetically susceptible particles . alternatively , the analyte particles may be introduced via the inlet channel and the two may be combined and mixed in the mixing chamber 164 . variations of this system may be manyfold . for example , the sensor may be located directly on the microfluidic chip to match the region of analysis especially well . in another variation , a different parameter on the chip may be varied at the same time or at a different time , such as temperature . temperature control means may be located on the chip or outside of the chip , such as in the case of laser heating within the mixing chamber . such a system requires an optical window , as would be understood . other parameters which may be varied may be anything that affects the presence or property of the magnetic tag , i . e ., the magnetically susceptible particle , or its binding to the analyte particle . the ways the bound complexes may be adhered to the predefined spots on the disc are known and may employ standard technology . the disc is mounted on an axial shaft 13 which extends downwardly to a toothed wheel 14 . an appropriate rotational device , such as a stepper motor 16 , has a shaft 17 extending therefrom with a worm gear member 15 at the distal end thereof . the motor provides controlled rotary motion of disc 12 pursuant to signals applied from a pc 66 through a number of wires 18 . of course , wireless coupling between the pc and the system of the invention could be used if desired . in one preferred embodiment , as presently contemplated , disc 12 is about 47 mm in diameter and about 0 . 25 mm thick . it may be made of glass , plastic or silicon , for example . its thickness range , for practical functional purposes , would be about 0 . 1 mm to about 1 . 0 mm . in the case where the sample holder is a lateral flow membrane , the sample holder may be made partially porous so that passage of the analyte particles through the porous portion of the holder may be another parameter to be varied . in this case , the magnetically susceptible particles may be bound to the porous sample holder . for example , passage of the analyte particles through a porous portion of a holder may likely depend on the mass or size of the particles . thus , the location of the particles within the porous portion may be mass - dependent or size - dependent . as the analyte particles pass through the porous sample holder , they may bind preferentially and in a predetermined manner to the bound magnetically susceptible particles . the bound samples , containing analyte particles combined with magnetically susceptible particles , may then be measured magnetically using the device embodied herein . the porous portion of the holder may be replaced with , e . g ., a filter as is known in the art . such filters may be chosen to provide a suitable mass - or size - dependency according to the requirements of the process . for example , referring to fig7 a lateral flow membrane 101 is shown . analyte particles may be flushed into a release pad 102 where they are released into a flow membrane 103 . the particles may then flow by capillary action down the membrane and past a test line 106 on which bound magnetically susceptible particles are located . a control line 108 may also be provided . finally , an absorbent pad 104 may be located downstream if desired to collect the unbound analyte particles . in operation , the test line may include colloidal iron particles coated with a material that specifically binds to a material in the analyte of interest . in this way , the test line collects analyte particles preferentially . the control line 108 may have a known amount of colloidal iron for calibration or other such purposes . it should be clear that such a lateral flow membrane may be replaced with , e . g ., a gel electrophoresis test area . in this case , of course , the samples are not immobilized but may be moving past the sensing area . the sample holder may also employ a reference device , such as a bar code , to provide a unique machine - readable tag to identify or locate an individual region or regions and the assay ( s ) that are associated thereby . the reference device may spatially index the location of an individual region or regions of analysis . the reference device gives a convenient way to identify a sample of magnetic complex material . besides bar codes , the reference device may alternatively employ a magnetic strip , a microchip , an optical reference , and so on . the reference device may be optically aligned with its corresponding sample for ease of reference . the computer / cpu may read the reference information along with the magnetic ( assay ) signal and then display and store the assay results in the appropriate context . for example , an assay to measure the presence of e . coli would likely have results displayed in a different form than an assay testing for the presence of binding of oligonucleotides . since the substrate may be prepared specifically for each kind of assay , this information can be encoded on the substrate as a bar code or using one of the techniques described above . in this particular exemplary embodiment , motor 16 rotates wheel 14 , which is connected to disc 12 by shaft 13 , through a 120 - tooth worm gear reduction . of course , rotational drives having different particulars could also be employed . a magnetic field source 21 may be moved linearly with respect to disc 12 by a rotational device , such as a stepper motor 22 , having a 40 turn - per - circle lead screw 23 on a motor shaft 24 . a boss 25 is configured with a hole having internal threads to which the spiral lead screw threads are coupled . the control signals are applied from microcomputer 65 to motor 22 through a number of wires 26 . again , the specifics of the rotational drive are set out here as an example only . other appropriate elements having different characteristics could also be used . for example , while the above system describes a situation where the magnetic field source is moved linearly with respect to the sample holder , another embodiment may be used in which the sample holder is moved relative to the magnetic field source . in this latter embodiment , the sample holder may be mounted to a shaft and mechanical drive system similar to the drive system shown in fig3 . the drive system may move the sample holder into the gap of the magnetic field source in a controlled manner . numerous types of drive systems may be employed . these include stepper motors , screw and motor arrangements , hydraulics , magnetic drives , configurations in which a human operator physically moves the sample holder relative to the magnetic field source and relative to the sensor , pressure drives , pinch rollers , conveyor systems , etc . the above describes the motion of the sample holder from a location in which samples may be loaded , such as on a disc , to a location near the magnetic field caused by the magnetic field source . another motion that occurs in the system is the movement of the sample holder past the sensor . various motions may be caused to accommodate this . for example , two - dimensional motion may be accommodated between the sensor and the sample holder . in the embodiment of fig3 one degree of freedom motion ( e . g ., along an arc of a circle ) is shown using motor 16 . the drive system of motor 22 may also be employed to translate the sensor along another degree of freedom . alternatively , another motor may be used to move the sample holder 12 along a similar degree of freedom . finally , it should be noted that , by using appropriate gearing , the same motor may be used to provide any combination of the above or different motions . in other exemplary embodiments , the drive system may include a pinch roller which grasps a plastic strip on which a sample is disposed , moving the same past the sensor in a controlled fashion . such an embodiment may be particularly useful where the sample is placed in a strip on a plastic card similar to a credit card , which is then “ grabbed ” by a device similar to that used in atm machines . of course , the drive system may also be any of the systems described above as well as other alternate systems . referring to fig4 a ferrite toroid core 31 , which is about 30 mm in diameter in the particular embodiment being described , is formed with a gap 32 , which is about 1 . 5 mm wide . a drive coil 33 is wound as a single layer over about 270 of toroid 31 , symmetric with respect to the gap . a feedback loop 34 encircles the toroid body at a location about 180 from ( opposite ) the gap . loop 34 may be outside of coil 33 or between coil 33 and the toroid core . it may include a few or many turns , as necessary and appropriate for the feedback function . the purpose of the feedback loop is to sense or represent the field in gap 32 and enable the signal processing or output circuit to self - correct for variations such as temperature drift . this loop is used to enhance precision and is not essential to proper operation of the system . various other magnetic field sources may also be used . for example , while most all employ electromagnets , the electromagnets may be in the form of , e . g ., toroids or so - called “ e - core ” s which are magnets employing the shape of an “ e ” ( see fig8 ). in ecores , the middle segment of the “ e ” is made somewhat shorter than the outer segments . referring to fig8 two e - cores 112 and 112 ′ are placed with their open sides facing each other . the shorter middle segments then define a small gap 114 therebetween . a sample on , e . g ., a plastic strip 116 may then be situated in this small gap . the sensor used to measure the oscillation of the magnetizations may be on a separate substrate 118 also located in the small gap or may alternatively be disposed on the end of one or both of the shorter middle segments . in any of the embodiments , in fact , the sensor may be disposed on a magnetic pole piece or other such element that forms a perimeter of the gap . in this way , the unit may be made more modular and the coil placement more uniform and consistent . in other embodiments , no gap is needed at all . referring to fig1 , a single magnetic pole piece 201 may be situated with a sensor disposed thereon or disposed on a separate strip . in fig1 , the sensor is shown as two sensing coils 202 and 204 . the pole piece can alternate the magnetic field , and the sensor can measure the oscillating magnetizations as above . referring back to fig3 the toroidal magnetic field source assembly is mounted in insulative housing 35 , which may be formed from fiberglass . housing 35 has a slot 36 corresponding to the position of gap 32 . this slot / gap is shaped and configured to selectively receive the edge of rotatable disc 12 , and provides space for the sensing coil substrate , which is described in detail below . a sensor is used to measure the magnetic field strength of the samples . in this embodiment , the method used is ac susceptibility . a number of types of sensors may be employed . in the embodiments below , sensing coils connected in a gradiometer configuration are described . it should be noted that the gradiometer configuration is not necessarily required ; moreover , other types of sensors may be used . these sensors may include hall sensors , gmr sensors , or other such sensors capable of measuring magnetic field strength or magnetic flux . with particular reference now to fig2 and 4 a , insulative substrate 41 is disposed in slot 36 in housing 35 and extends into gap 32 . bonding pads 40 , 42 are provided at a proximal end of substrate 41 and a sensor , in particular sensing coils 43 , is mounted adjacent a distal end of substrate 41 . preferably the substrate is made of sapphire or silicon and the sensing elements are thin film copper coils . standard thin film fabrication techniques can be used to construct the substrate and sensing coils , where the leads to and from each coil are on separate different layers . for example , incoming traces 49 may be laid on the substrate surface by standard photolithographic processing methods , a layer of sputtered quartz may then cover the incoming leads , then coils 43 and output leads 44 are similarly applied and a protective layer of quartz may then be added on top . the usual means for connecting between the layers would be used . the sensing coils , which are connected in series opposition creating a gradiometer configuration , are connected to bonding pads 40 and 42 by conductive traces 44 and 49 , and thence to signal processing circuitry by twisted - pair wires 45 . the twisted pair arrangement is employed to assist in reducing stray signal or interference pickup . in the spiral form shown in fig2 the coil traces may be about 5 microns in width with about a 10 - micron pitch between spiral traces . the thickness of the sensing coil traces may be about 1 micron . the diameter of each completed coil is about 0 . 25 mm . by making substrate 41 relatively long and narrow , bonding pads 40 , 42 are relatively far away from the toroid gap , which helps minimize stray pickup in soldered leads 45 . metal shield 46 ( fig4 b ) may be employed around the bonding area to further contribute to the reduction of stray signals or interference pickup . the shield is essentially a short piece of a thick - walled cylinder , typically formed of copper . the shield provides electrical shielding and facilitates mechanical handling , but is not essential to operation of the embodiment of the invention . the connection ( proximal ) end of the substrate is slid into slot 50 after the wire connections are made . an alternative embodiment of the sensing coils is shown in fig5 . the planar configuration of coils 47 is an elongated rectangle . the trace dimensions are about the same as for the fig2 coils and the composite coil width is also about 0 . 25 mm . the coil length is about 1 - 2 mm and the coils are connected to bonding pads 52 , 53 by means of leads 48 , 51 . in another alternative embodiment , two sets of coils may be used . one set of coils may be used as described above , to measure the magnetic moment of the sample . another set of coils may be employed within the same substrate as a reference set of coils . this reference set of coils may be disposed , e . g ., on the side of the substrate opposite that of the sample set of coils . in any case , the reference set of coils is disposed far enough from the sample that the effect of the sample magnetic moment is not detected by the reference set of coils . the reference set of coils is then used to measure the strength of the signal from an analysis region containing a predetermined amount of magnetic material or reference analyte . by comparison of the magnetic field detected by the sample set of coils with the magnetic field detected by the reference set of coils , an even more accurate measurement of the sample magnetic moment may be made . to provide another reference , a magnetic standard may be employed as one of the samples . when such a standard sample is measured , the results may be used to calibrate the system for future or previous measurements . this calibration may significantly help to reduce noise in the system . auto - calibration may also be employed with such a system , using the differential between signals , to zero the signal . the magnetic drive circuit , shown at the left side of fig4 is built around a pair of high - current , high - speed operational amplifiers 54 , 55 . with the power provided by transformer primary winding 56 , the amplifiers can provide in excess of about one ampere of drive current to magnetizing or drive coil 33 at about 200 khz . this drive circuit is highly balanced to minimize common - mode noise pickup in sensing loops or coils 43 , 47 . small secondary winding 57 coupled to loop 34 around the magnetizing coil provides a feedback voltage to operational amplifiers 54 and 55 to sustain oscillations at a well - regulated amplitude and frequency . this secondary winding 57 also provides an optimum reference signal for the phase - detector circuitry , described below . this embodiment describes an alternating field as the driving source for the complex of magnetic and analyte particles . in a separate embodiment , the driving source may be non - sinusoidal , e . g ., may be a field pulse or a square wave . a variety of other such waveforms may also be used . a low - noise integrated instrumentation amplifier is the basis for this circuitry , although somewhat better noise performance could be obtained using discrete components . amplifier 61 is transformer coupled to the sensing coils in order to reduce common - mode noise signals and to facilitate a convenient way to null out imbalance in the magnetic field source and in the sensor . the transformer coupling is conventional , is located in amplifier 61 , and is not specifically shown in the drawing . in an alternative embodiment , amplifier 61 may be replaced by or supplemented with a preamplifier disposed on the substrate . in other words , substrate 41 may have patterned thereon a preamplifier to modify the signals from the sensor prior to the phase - sensitive detection step . phase sensitive detector 62 is also designed around a special purpose integrated circuit . phase sensitive detector 62 may be a phase - locking device or alternatively any other type of phase - sensitive device . the output of the phase detector is applied to low - pass filter 63 and is then digitized in a / d converter 64 . the converter may be a high resolution , 20 - bit sigma - delta converter , for example . such a converter chip has adequate hum rejection at both 60 and 50 hz , which proves to be very helpful in maximizing the sensitivity of the instrument . it is an off - the - shelf item , available from several manufacturers . microcomputer 65 includes a microprocessor chip , such as a motorola hc 11 , and has a built - in port which supports two - way serial communication to pc 66 by plugging into the serial port of the pc . it also has specialized ports for communication with serial a / d converter 64 and stepper motors 16 and 22 . a simple command language programmed directly into microcomputer 65 allows the pc to send commands and receive responses and data . microcomputer 65 may also perform many of the functions previously described above . for example , microcomputer 65 may be equipped with a phase - sensitive device of its own , such as a digital lock - in . such a microcomputer 65 may acquire the signals , separate data from noise , and display the results . the pc provides the operational command for the system . the pc runs the system through an rs - 232 interface , e . g ., from the microcomputer . the pc provides a display of the results of the measurements . the display may be , e . g ., a computer monitor display or any other form of computer - assisted readout . in a relatively straightforward and known manner , a well - defined dot or pattern of the magnetic particle complexes comprising the samples is deposited on disc 12 at one or more locations 11 near the periphery thereof . pursuant to control signals from the pc , stepper motor 22 is energized to rotate lead screw 23 to move the magnetic field source assembly towards sample disc 12 . when a sample position 11 near the peripheral edge of disc 12 is aligned with a sensor such as sensing coils 43 , 47 in the middle of toroidal gap 32 , stepper motor 22 stops and a high amplitude ( 1 ampere , for example ), high frequency ( 200 khz ) signal is applied to toroidal drive coil 33 . again , while sensing coils are described below , it should be understood that a variety of sensors may be employed . a signal from pc 66 then energizes stepper motor 16 to rotate the disc and thereby move the sample dot past the sensing coils . the high amplitude , high frequency magnetic field in gap 32 thereby excites the magnetic particles of the sample in the gap . the applied current is intended to drive the toroid to saturation , resulting in the field in the gap have a magnitude of about 1000 oersted . the particles then oscillate magnetically at the excitation frequency , behaving as a localized dipole . given the close physical proximity of the magnetic particles to the sensing coils , the magnetic fields from the sample are closely coupled to the gradiometer configured sensing coils . because of the gradiometer configuration of the sensing coils , the output of the sensing coils due to the large , uniform excitation field is substantially null or zero . in order to obtain the largest possible response , the geometry of the sensing coils is configured to match the spatial pattern of the samples . that is , the sample pattern dots are no larger than about 0 . 25 mm across . the response signal varies distinctively with the relative position of the sample and the coils . the signal from the sensing coils in the presence of the drive field and in the absence of a sample may serve as the reference signal to the signal processing portion of the system . as the sample moves past one sensing coil and then the other , the phase of the coil output signal reverses by 180 as shown in fig6 thereby providing a very powerful detection technique . as shown in fig6 the output may be shown as the response of the sensing coils versus the position of the sample with respect to the sensing coils . the induced voltage is amplified by amplifier 61 and processed by phase detector 62 . that signal is filtered and digitized and passed to the pc through microcomputer 65 to provide the output signals to the pc . indicator 67 may be any type of useable device to provide information to the system operator . indicator 67 could be a visual indicator , conveying information numerically or graphically , or could also be a variety of lighting systems , audible indicators , or any combination of these or other possible indicators . the output signal amplitude is modulated by moving the sample with respect to the array of the sensing coils . this permits rejection of signals due solely to system and external inputs and not due to the sample itself . the digitized shape of the signal amplitude with respect to sample position is compared to the theoretical response shape stored in pc 66 using appropriate curve fitting techniques . these techniques may include phase - sensitive techniques or other techniques yielding similar results . the result of this operation is a very accurate estimate of the magnetic content of the sample to the exclusion of inherent instrument noise and drift . while a preferred embodiment of the invention has been presented above , some alternatives should be mentioned . two sensor coil shapes have been shown but numerous other configurations may be employed . moreover , as indicated above , sensors may be used which are patterned directly on one or more of the magnetic field source pole pieces . furthermore , other varieties of sensors could be employed besides the types of coils disclosed . for example , balance hall sensors may be employed . in appropriate configurations , these may yield a frequency independent signal . other sensors which may be advantageously employed include giant magnetoresistance ( gmr ) sensors , squid sensors , magneto - resistance sensors , etc . in other variations , the magnetic field source is shown as moving with respect to the sample disc , but the disc and coupled stepper motor could be configured to move with respect to the magnetic drive assembly if desired . the toroid core is shown with a rectangular cross section but other shapes are also feasible . as to the number of sample particles in a dot 11 on disc 12 , by way of example , a 0 . 25 mm dot of sample elements could contain about 10 five - micron size magnetic particles , or about 1200 one - micron size particles . thus , in view of the above description , it is possible that modifications and improvements may occur to those skilled in the applicable technical field which are within the spirit and scope of the accompanying claims . | 8 |
fig1 shows my counter display 1 in folded form , as it would be when being shipped . fig2 and 3 show it set up in its narrow form and in its expanded form , respectively . counter display 1 includes a base 3 and two hinged back sections 5 . base 3 is formed of a central member 7 , running fore and aft , having spaced fingers 9 extending laterally out each side , and two end pieces 11 , one on each side of the central member 7 , the end pieces each having spaced fingers 13 extending laterally toward the central member 7 . an end cap 17 may be positioned on the front edge of central member 7 for displaying price or other information . all parts can be molded of any suitable plastic material . fingers 9 are dimensioned to interfit in the spaces between fingers 13 , and fingers 13 are dimensioned to interfit in the spaces between fingers 9 . the fingers and the spaces between them are complementary to one another . this interfitting is best seen in fig4 and 8 to 10 . where they interfit , the two sets of fingers can , if desired , provide a substantially continuous upper surface . this surface is used to hold goods for display . alternatively , the fingers may be present only adjacent the front and back of the base , to provide structural integrity for the base , with gaps 22 in the middle . preferably , all of the fingers have a cross - section made up of a base 15 and an upper &# 34 ; cantilevered &# 34 ; shelf 16 , having what i call a z - shaped cross - section . this cantilevering results in the shelf of one finger projecting over a portion of the base of an adjacent finger . this gives the unit more integrity , with no vertical slot between fingers that runs from the top to the bottom of the fingers . it also prevents the fingers 9 from getting out of parallelism with fingers 13 which would be undesirable because this could result in an uneven surface . in fig2 the fingers 13 of the end pieces 11 have been interfitted with fingers 9 of the central member 7 to the maximum extent , that is , end pieces 11 and fingers 13 have been pressed inwardly toward central member 7 as far as they can go . this provides the minimum width counter display 1 and also provides the most uniform upper surface 21 . backs 5 are close together , so they can hold a commensurately narrow display card 25 in card holder 23 . in fig3 by contrast , fingers 13 have not been interfitted as much , resulting in a wider counter display . as can be seen , backs 5 are more removed from one another , allowing for a display card 25 of similarly greater width . the counter display can , of course , be given any width intermediate the narrowest width of fig2 and the widest width of fig3 by suitable adjustment . the display cards have several lugs 26 extending from their side edges . these lugs fit within slots 24 in card holders 23 to hold the display cards in position . to the extent that the fingers are not all the way interfitted ( i . e ., in the wider versions ), there will be gaps in surface 21 representing the spaces between adjacent fingers 9 near the central member7 and the spaces between adjacent fingers 13 adjacent the end pieces 11 of the counter display . accordingly , unless the goods are held on a merchandise holder 27 , the shelves 16 of the fingers 9 and 13 should be dimensioned with a width ( transverse of their longitudinal direction ) such that the gaps are not objectionably wide . they should be narrower than the narrowest dimension of any items to be displayed . i have found that one satisfactory dimension is to have the width of the fingers 16 about 0 . 100 inch ± 0 . 005 inch . the bases 15 of the fingers should have the same width , with the shelves cantilevered out from the bases for about half of their width . to allow for axial movement of both sets of fingers relative to one another , adjacent fingers 9 should be separated from one another by slightly more than their widths , approximately 0 . 009 inch more . the spacing of fingers 13 should be similar . the side surfaces of each of the fingers may be angled slightly , about 5 degrees ( see fig9 ), to provide additional clearance . this dimensioning will provide structural integrity between the central member 7 and the end pieces 11 . accordingly , the same counter display 1 can be used in different widths at different times , depending upon the items to be displayed and the dealer &# 39 ; s desires . goods can be carried by the display itself or on a merchandise holder 27 , which may have separate openings or compartments 28 for the goods . if the display has been designed with gaps 22 , a tray should be used . backs 5 are hinged on hinge mounts 19 at the back of end pieces 11 , one to each end piece . these hinges are used to fold the display for shipping or storage , but are designed to lock the back sections 5 in their upright , vertical position when the counter display is assembled for use . the structure of the hinges is best seen in fig4 , 10 , and 11 . two hinge mounts 19 are molded along the back edges of end sections 11 . two complementary hinge brackets 31 are formed at the back of each back section 5 toward the bottom , brackets 31 each carrying a hinge pin 33 to fit within an opening 32 on each hinge mount 19 . pins 33 face away from each other and opening 32 face each other so that the pins 33 will be held in place in openings 32 . this structure permits the back to swing from its shipping and storage position ( fig1 ) to its assembled position ( fig2 and 3 ). a spring - pressed locking arm 35 , with a locking detent 37 at its lower end , extends downwardly at the lower end of back section 5 . it is positioned such that detent locks with shoulder 39 on the back of end section 11 . thus , when the back is moved from its folded position under the end section to its upright , vertical position , locking detent 37 will engage with shoulder 39 and hold the back in position . when it is desired to fold the stand , detent 37 can , of course , be released by applying disengaging pressure to it . different positions of hinge 29 can be seen in dotted outline in fig1 . alternatively , the locking detent can be on the end piece and the complementary shoulder on the back . if desired , my counter display can be made using only two end pieces 11 with the fingers 13 of the two sections being so dimensioned and spaced as to be able to interengage in a manner similar to the interengagement of fingers 9 and 13 . fig1 to 20 show a modification of my invention in which the base is used as a shelf extender for store displays . only the base 3 is used , since it is unnecessary to have backs 5 . the base has a structure like that in the previously - described unit for changing its width , including a central member 7 and end pieces 11 , the same type of interengaging fingers , and preferably no gap 22 . in this instance the fingers are used to vary the width of the display , so that it will be the same width as the depth of the shelf end to which it is attached . however , it does not have any of the hinge structure , but has an extension 49 extending outwardly from the back of the central section 7 . this extension is bolted with bolts 51 to a u - shaped mounting bracket 45 , which in turn fits about a shelf 43 and is held in place with thumb screw 47 . | 0 |
in one exemplary embodiment , a dispersion of functionalized graphene in a solvent is prepared and applied as a coating onto a substrate . exemplary substrates include silicon , thermal oxide , silicon oxide , aluminum oxide , hafnium oxide , silicon nitride , tungsten , tungsten / titanium , aluminum , copper , and other known insulators , semiconductors , or metallic surfaces . functionalized graphene may be prepared by starting with manufactured graphene fragments . such graphene fragments are typically prepared by mechanical exfoliation of graphite , and are commercially available . other techniques may also be used such as opening of carbon nanotubes to form graphene nanoribbons ( e . g ., in a solution of potassium permanganate and sulfuric acid or by plasma etching of cnt &# 39 ; s partially embedded in a polymeric film followed by dissolution of the polymeric film ). another technique to form a graphene based solution is to oxidize high ordered pyrolitic graphite ( hopg ) or graphite , which is a known process in the art that uses h 2 so 4 , nano 3 , and kmno 4 to form graphite oxide . after forming graphite oxide , the flakes can be dispersed in h 2 o and then sonicated to form one to several layers of oxidized graphene . in one exemplary embodiment , the graphene fragments are functionalized with functional groups along the edges of the graphene fragments to promote dispersion in a solvent such as a polar or non - polar solvent . exemplary functional groups include , but are not limited to , hydroxyl groups , carboxyl groups , nitrile groups , and functionalizing resulting from fluorination . in one exemplary embodiment , graphene fragments may be functionalized by reaction with a strong oxidative etching agent such as hno 3 , h 2 o 2 , h 2 so 4 , or the like . other functionalizations can be utilized as known in the art . in an exemplary embodiment , reaction with the strong oxidative etching agent may be conducted under conditions of boiling under reflux . the oxidative etching agent may help to shorten graphene nanoribbons ( e . g ., to widths less than 20 nm ), which may assist in producing semiconducting graphene instead of semimetallic graphene . oxidation can also attach hydrogen groups to the graphene . functionalization with hydrogen has been shown to produce hydrogenated graphene with semiconducting characteristics while functionalization with hydroxyl groups tends to provide more insulating characteristics . the oxidized graphene or functionalized graphene fragments are dispersed in a solvent to form a dispersion for coating . exemplary solvents include water , isopropanol , methanol , ethanol , dichlorobenzene ( substituted at the 1 , 2 - 1 , 3 - or 1 , 4 - positions ), chlorobenzine , n - methylpyrolidinone , dimethylformamide , dimethylsulfoxide , acrylonitrile , hexane , toluene , methylene chloride , and chloroform . the concentration of oxidized graphene or functionalized graphene fragments in solvent can vary widely depending on the specific properties of the fragments , solvent , and substrate . typical exemplary concentrations may range from about 0 . 25 - 5 g / l . of course , other concentrations may be used as well , as would be understood by one skilled in the art . centrifugation and sonication of the dispersion may be performed to remove larger nanoribbons or fragments , remove heavy contaminants such as silica particles , and further disperse the oxidized / functionalized graphene fragments into solution . the dispersion of functionalized graphene fragments in solvent may then be coated onto a substrate using a variety of known coating techniques , including but not limited to spin - coating , spray - coating , dip - coating , or electro - deposition coating ( which would require a conductive substrate ), effectively creating a fabric of functionalized graphene . using the spin - coating technique , a uniformly dispersed monolayer of graphene can be deposited over any size wafer using standard semiconductor photoresist coating and developing track , for example by spinning the substrate at about 1000 rpm while depositing the dispersion onto the substrate . alternatively , a desired amount of dispersion can be deposited onto the substrate followed by spinning after the dispersion has been deposited onto the substrate , the residual solvent may then be optionally dried by spinning at about 4000 rpm until dry or by heating . in an exemplary embodiment , the spin - coating process produces regions of a single to multiple atomic layer sheets , depending on the solution optical density ( measure of carbonaceous material in solution ) and the number of coats . in another exemplary embodiment , a coating method produces a coating having a thickness of at least 100 å , which may be reduced to a thickness of less than 10 å ( before or after converting the layer to graphene ) by etching . in a more specific exemplary embodiment , the initial coating thickness may be 12 to 15 å , and may be reduced to a thickness of less than 7 . 5 å . in a still further exemplary embodiment , the layer is reduced to a thickness corresponding to a single atomic layer thickness ( i . e ., monolayer ) graphene sheet . the etching process , which may be referred to in some exemplary embodiments as atomic layer etching , may be accomplished in different ways . in one exemplary embodiment , such etching may be accomplished by exposing the layer to a remote plasma comprising hydrogen or an inductively coupled plasma comprising hydrogen . in another exemplary embodiment , such etching may be accomplished by adsorbing the layer with a monolayer of hydrogen ( e . g ., through exposure to a hydrogen gas ) or oxygen ( e . g ., through soaking in deionized water ) groups ( unless working with graphene before it has been defunctionalized ) and then annealing under conditions sufficient to etch the layer . in an exemplary embodiment , such annealing conditions may include a temperature between 800 ° c . and 1200 ° c . in another exemplary embodiment , the annealing may be conducted for period between 0 . 5 minutes and 5 minutes . longer durations may be used , although additional etching ( if any ) achieved during such extended periods may be limited . after removing the solvent from the above - described coated layer , the oxidized or functionalized graphene is defunctionalized ( i . e ., by removing or driving off the functional groups , or by dehydrogenating ) to form a graphene layer . graphene may be defunctionalized by annealing , for example at a temperature greater than 400 ° c ., in a non - oxidizing environment . the graphene may also be defunctionalized by a chemical reduction with a reducing agent such as hydrazine to form a graphene - like film , as is known in the art by reaction of graphite oxide with reducing agents such as hydrazine . in another exemplary embodiment , a graphene layer can be formed by depositing carbon onto a substrate using deposition techniques such as chemical vapor deposition ( cvd ), atomic layer deposition ( ald ), or sputtering . cvd and ald can deposit graphene sheets onto the substrate through the use of a graphene - forming catalyst such as a thin film or sheet of nickel , copper , platinum , ruthenium , palladium , gold , rhodium , or iridium . the catalyst layer can be deposited using known techniques such as physical vapor deposition ( pvd ). the use of such a catalyst is optional for ald , but without the catalyst , ald will deposit amorphous carbon . sputtering may be used to deposit amorphous carbon . in order to deposit carbon using cvd , the substrate is pre - heated ( e . g ., to about 500 ° c .) and a carbon feedstock ( e . g ., methane , ethylene , acetylene , and / or other carbon - containing gases ) in a carrier gas such as an inert gas ( e . g ., argon ) or a reductant ( e . g ., hydrogen ) is used to deposit carbon in a chemical vapor deposition ( cvd ) process at elevated temperatures ( e . g ., 800 - 900 ° c .). control of the cvd process parameters ( e . g ., temperature ) can provide control over the properties of the deposited carbon . the extremely thin metal catalyst layer ( e . g ., about 1 - 2 nm ) will generally diffuse or vaporize during cvd deposition , and altering the thickness of the metal catalyst layer can provide additional control of the relative proportions of graphitic carbon versus amorphous carbon . the graphene layer may be patterned by depositing a pattern of a sacrificial material or resist over the substrate after pvd of the metal catalyst layer , thus preventing deposition of carbon in the patterned area , and then removing the sacrificial material after the cvd process . after deposition of the carbon layer , it may be annealed to convert amorphous carbon to graphitic carbon through ordering of the carbon crystal structures to form a single crystal to a polycrystalline granular structure . annealing may be performed in a non - oxidizing environment ( e . g ., vacuum , argon , nitrogen ) at temperatures of 800 ° c . to 1200 ° c . in an exemplary embodiment , this annealing may be carried out for a period from 0 . 5 minutes to 1 hour . in another exemplary embodiment , the annealing may be carried out for a period of from 0 . 5 minutes to 5 minutes . grain size in the polycrystalline granular carbon film may be controlled by varying the temperature and / or duration of this annealing process . carbon deposition techniques such as cvd , sputtering , and ald , and certain coating applications , may produce layer thicknesses of over 5 nm , or over 10 nm in some circumstances , which thickness needs to be reduced to form a graphene layer segment useful for nanoelectronic device applications . it may be desirable to reduce layer thicknesses even for layer thicknesses as low as 2 nm . conventional etching processes may not be adequate to produce the tightly controlled thickness reductions necessary for etching at the atomic layer scale . therefore , according to exemplary embodiments of the invention , the carbon layer may be etched to a thickness of less than 1 nm by etching techniques that remove 1 to 100 å of carbon layer thickness per application . in another exemplary embodiment , the carbon layer may be etched to a thickness that produces a thickness equivalent to a single atomic layer graphene sheet . in yet another exemplary embodiment , the carbon layer may be etched to a thickness that produces a thickness equivalent to a two atomic layers of graphene sheet ( i . e ., a graphene bi - layer ). in still another exemplary embodiment , the carbon layer may be etched to a thickness that produces a thickness equivalent to a three atomic layers of graphene sheet ( i . e ., a graphene tri - layer ). in the literature , the term “ graphene ” is often used to describe a single layer of graphene , and perhaps hilayers and tri - layers of graphene , while materials having more layers of graphene may be referred to as “ graphite ”. however , as used herein , the term “ graphene ” includes both films that comprise multiple layers of graphene sheets stacked one upon another ( prior to etching to reduce layer thickness ), as well as thinner graphene layers after etching ( e . g ., mono -, bi -, and tri - layer graphene ). in one exemplary embodiment , the carbon layer thickness can be reduced by functionalizing the layer with mono layered oxygen or hydrogen groups ( e . g ., by soaking in deionized water or exposure to hydrogen gas ), and then annealing under conditions sufficient to etch the layer . in an exemplary embodiment , such annealing conditions may include a temperature between 800 ° c . and 1200 ° c . in another exemplary embodiment , the annealing may be conducted for period between 0 . 5 minutes and 5 minutes . longer durations may be used , although additional etching ( if any ) achieved during such extended periods may be limited . oxygen content in the annealing chamber may be controlled in order to control the amount of carbon loss , with amounts in a non - oxidizing atmosphere being on the order of 1 a , and greater carbon loss amounts ( e . g ., & gt ; 10 å ) potentially being produced if oxygen is present . the level of adsorbed moisture on the surface of the carbon layer may be increased by soaking in water to further enhance layer thickness reduction . depending on the starting layer thickness , the annealing step can be repeated by refunctionalizing the surface of the carbon layer and annealing again to achieve further layer reductions . also , atomic layer etching of the carbon layer may be performed before , during , or after conversion of any amorphous carbon in the layer to graphitic carbon , and in an exemplary embodiment the step of annealing to reduce carbon layer thickness may be combined with and performed simultaneous with step of annealing to convert amorphous carbon in the layer to graphitic carbon . in another exemplary embodiment , the thickness of the carbon layer is reduced by exposing it to a remote or inductively - coupled plasma comprising hydrogen . a remote or downstream plasma is utilized in order to avoid the excessive disruption to the remaining graphene layer that could result from direct contact with a plasma stream . in an exemplary embodiment , the plasma contains 1 - 10 percent hydrogen and 90 - 99 percent inert gas ( e . g ., nitrogen , argon ), although higher amounts of hydrogen may be used as well , including even a hydrogen - only plasma . in another exemplary embodiment , the plasma is at a temperature of 100 ° c . to 300 ° c . in yet another exemplary embodiment , the plasma may be at 0 to 25 w . in still another exemplary embodiment , the pressure of the plasma is at 0 . 5 to 2 torr . of course , other etch - back conditions may be utilized to tailor the etching and hydrogen absorption characteristics . using these exposure conditions , an etch rate of about 2 . 4 to 2 . 9 å / second for the etch - back process may be achieved . fig1 shows the etch rate data for an approximately 400 å carbon film , where the thickness was measured with x - ray fluorescence ( xrf ) ( e . g ., measures the mass of carbon species on the wafer ) from five sites over the wafer . according to certain aspects , using the etch rate calculated from the fit of the curves in fig1 , a second example is demonstrated where a 55 to 60 å carbon film is etched - back to a target of 10 to 15 å , which may correspond to one to two monolayers of graphene . after etching two monitor wafers for about 15 . 5 seconds and 20 seconds , the wafers measured 15 . 6 å and 9 . 0 å , respectively . the monitor wafers were then patterned with photolithography and an o 2 reactive ion etch ( rie ) process , permitting measurement of the thickness of the patterned carbon films with atomic force microscopy ( afm ). fig2 a shows a dark field optical image of the patterned carbon film after etching that has been etched - back to less than 15 å with the downstream hydrogen process . afm measurements were then performed on the patterned etch - backed carbon films ( primarily the 13 . 4 å film ), as shown in fig2 b . height measurements demonstrated that the carbon film is about 10 å thick , which may correlate to one to two layers of graphene . according to certain aspects , following a post 900 ° c . anneal for about one minute , the thickness further decreased to 13 . 4 å and 6 . 5 å , respectively . thus , the surface of the carbon film may be terminated with hydrogen ( resulting from exposure to the plasma ), causing the surface of the carbon film to be etched during the anneal . this may allow for an atomic layer etching ( ale ) process of the layer to more accurately control the formation of a single layer or bi - layer of graphene . in some aspects , a monolayer of hydrogen adsorbed on the surface of the graphite may be used as an ale process to further thin the carbon layers . in some aspects , the adsorbed hydrogen can be utilized to create a band - gap in the zero - gap graphene films , thus providing the graphene with an altered electrical state that may be useful for some applications . turning now to fig4 a and 4b , a process is shown for patterning the graphene fabrics according to an exemplary embodiment . it is noted for fig4 - 7 that identical reference numbers will be used to identify similar components and elements in different figures . fig4 a shows a nanoelectronic structure 10 having a substrate 12 with a graphene layer or fabric 14 thereon . photoresist layer 16 is disposed on top of a portion of the graphene layer 14 . standard lithography techniques such as deep - uv photolithography may be employed to pattern the photoresist layer 16 . in one exemplary embodiment , a bottom anti - reflective coatings ( barcs ) is not used in order to avoid exposing the graphene layer to the o 2 ash process required to remove the barc layer . in the absence of barc , low exposure doses of uv radiation may be used . besides deep - uv lithography , alternative lithography techniques such as euv , electron beam lithography , nano - print lithography , etc . can also be used to pattern the photoresist layer 16 and thus , the graphene fabric 14 . the graphene fabric 14 is then etched away in areas not covered by the photoresist layer 16 , and the photoresist layer then removed by dissolution with solvent to form the structure shown in fig4 b . in one exemplary embodiment , the graphene fabric 14 is a semiconductor and has a width less than 20 nm , and is over - etched . the graphene fabric may be etched , for example , with an o 2 reactive ion etching ( rie ) process . because of the directionality of the etch and the small thickness of the graphene film , controllable over - etches can be performed to significantly reduce the thickness of the photoresist pattern from about 100 nm ( close to the lower limit for current 248 nm deep uv lithography with appropriate optics ) to about 20 nm , i . e ., about 60 nm of lateral loss , which is sufficient for a & lt ; 350 nm thick resist . to reduce the aspect ratio of the resist , a pre - etch before exposure and developing may be used to thin the resist . a hard mask technique ( not shown ) can also be used to pattern the graphene layer . the advantage of a hard mask process is that barc can be employed ; however , it may be more difficult to reduce the width of the graphene layer . another exemplary embodiment is shown in fig5 a - 5c . in this embodiment , a multilayered graphene film ( graphite ) nanoelectronic structure 10 as shown in fig5 a can be masked and etched as described above in fig4 a - 4b to form a patterned graphene structure . a second mask layer 16 ′ is then be applied as shown in fig5 b , followed by application of a layer thickness - reducing etch ( as described hereinabove ) to form a mono layered graphene layer segment 14 ′ connected to the graphene fabric 14 as shown in fig5 c . in this exemplary embodiment , the graphene is not fully removed in the patterned areas but is instead etched down to a layer thickness of less than 10 å in one exemplary embodiment , less than 7 . 5 å in another embodiment , and a monolayer thickness in yet another embodiment . such a technique would be useful for the fabrication of mono layered graphene fet structures that are connected to more highly conducting graphite or graphene interconnect lines ( e . g ., with thickness greater than 20 å ) without the need for multiple carbon depositions . fig6 a and 6b depict the deposition and patterning of metal electrodes on top of the patterned graphene fabric from fig4 b . fig6 a shows deposition of metal layer 18 onto the structure of fig4 b . standard semiconductor - compatible metals can be deposited ; however , to limit damage of the graphene film , metal such as a modified cvd tin ( with hydrogen plasma conditions altered to prevent i limit hydrogen exposure to graphene ), cvd w , modified ionized metal plasma ( imp ) deposition of ti ( with rf power conditions modified to prevent sputter damage ), or any combination of metallization can be used . after deposition , the metal layer 18 may be selectively etched relative to the graphene fabric 14 . because standard metal etch processes may damage the graphene fabric , low power , high pressure chlorine - based metal exposures are used in an exemplary embodiment for patterning the metal layer 18 to form metal electrodes 18 ′ and 18 ″, shown in fig6 b , without damaging the electrical properties of the graphene fabric . after the rie etch , an anneal process as described above may be performed to remove any unwanted functional groups from the graphene fabric 14 . fig7 a through 7h show a process to passivate graphene nanoelectronic devices as well as form high density stacked graphene devices ( e . g ., 3 - d field effect transistors ( pet &# 39 ; s ) or graphene fets plus graphene switches , etc .) according to exemplary embodiments of the invention . fig7 a shows a graphene layer 14 that is coated with a protective sacrificial layer 20 . in an exemplary embodiment , the protective sacrificial layer 20 may be a si layer or ge layer , which may be applied by plasma - enhanced chemical vapor deposition ( pecvd ). for simplicity , only the example of si may be mentioned in the remainder of the disclosure ; however , it should be understood that a variety of materials could be used as the sacrificial protective layer . for compatibility with a front - end process , epitaxial si can also be used as the sacrificial protective layer 20 . the sacrificial protective layer 20 may function as a hard mask ( although the graphene fabric can be patterned before deposition of the film ), protects the graphene during processing , and may function as a sacrificial layer to form a cavity above the graphene . the properties of the graphene layer 14 may be influenced by interaction with surrounding substrates and materials . therefore , in one exemplary embodiment of the invention , it may be beneficial to provide a cavity region adjacent to the graphene layer 14 in order to limit the perturbation of graphene &# 39 ; s electrical ( optical , thermal , chemical , mechanical , etc .) properties from surrounding interfaces . it can also be envisioned that the graphene film is fully suspended in the active region by creating a lower sacrificial cavity region ( not shown ). after deposition of the sacrificial protective layer 20 , photolithography and etching may be performed to pattern the si and graphene layers to result in the structure shown in fig7 b . rie may be used for these etches , using materials and conditions as are known in the art . in fig7 c , an insulator layer 22 is applied over the structure of fig7 b to encapsulate the patterned graphene layer 14 and sacrificial protective layer 20 . any known insulator material may be used , such as sio 2 , silicon nitride , or other insulator such as ald alumina or ald hfo 2 , etc . because of the sensitivity of the thin graphene fabric , the si layer 20 protects the graphene layer during insulator deposition . after insulator deposition , vias 24 , 24 ′ are etched into the insulator layer 22 as shown in fig7 d . the etching process used here should be selective to the si protective sacrificial layer 20 using known rie conditions . in fig7 e , the protective sacrificial layer 20 has been removed to leave cavity 26 above and passivating the graphene layer 14 . a protective sacrificial layer such as an si layer may be removed with a vapor phase etch such as xef 2 . note that a wet etch ( e . g ., nf 4 oh in deionized water for silicon ) may also be used ; however , capillary forces may prevent effective removal of the sacrificial material . a post etch anneal may also be performed to remove any functionalized molecules on the graphene layer 14 . once the cavity 26 is formed , metal layer 28 is deposited over the structure so as to fill the vias 24 , 24 ′, as shown in fig7 f . because the graphene fabric 14 is passivated , a wider process window for metal deposition is possible since there is no need to etch the metal 28 in a fashion so as to be selective to the thin graphene fabric 14 . depending on the metal deposition technique and the route for further processing , the deposited metal can either be planarized using chemical mechanical planarization ( cmp ), leaving metal interconnects 30 , 30 ′ in the vias in electrical contact with the graphene layer 14 , as shown in fig7 g . alternatively , the metal layer in 28 from fig7 f can be patterned and / or selectively etched to leave metal contacts 32 , 32 ′ in contact with interconnects 30 , 30 ′ in the vias in electrical contact with the graphene layer 14 , as shown in fig7 h . the electrical contacts 32 , 32 ′ may form an integral part of further nanoelectric circuitry components to be formed on or above the insulator layer 22 . fig8 a and 8b illustrate the ability to perform additional processing to form additional nanocircuitry components on top of the passivated graphene nanoelectronic device from fig7 g . fig8 a shows a single graphene device that has been interconnected with a second metal , forming metal components 32 , 32 ′, and then further encapsulated with metal two and further encapsulated with second insulator layer 22 ′. fig8 b shows an example of a stacked graphene nanoelectronic device where a second graphene layer 14 ′ has been deposited on top of the structure from fig7 g and protected with a second protective sacrificial layer ( not shown ) for passivation as was done for graphene layer 14 . second metal component 32 is also deposited on top of the structure from fig7 g , and the structure is encapsulated by second insulator layer 22 ′. vias for electrical interconnects 30 ″, 30 ′″, 30 ″″ are then etched into the second insulator layer 22 ′ and the second protective sacrificial layer is removed to passivate the second graphene layer 14 ′, followed by deposition of metal into the vias to form electrical interconnects 30 ″, 30 ′″, 30 ″″. the structure shown in fig8 b could be the basis of a simple graphene inverter ( gate electrodes not shown for simplicity ), other graphene gates , or any high - density stacked graphene nanoelectronic architecture . embodiments of the present invention may be used in a variety of electronic applications , including but not limited to advanced sensors , memory / data storage , semiconductors and other applications . a reference to an element in the singular is not intended to mean “ one and only one ” unless specifically stated , but rather “ one or more .” the term “ some ” refers to one or more . underlined and / or italicized headings and subheadings are used for convenience only , do not limit the invention , and are not referred to in connection with the interpretation of the description of the invention . all structural and functional equivalents to the elements of the various embodiments described throughout this disclosure that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and intended to be encompassed by the invention . moreover , nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the above description . while the invention has been described in detail in connection with only a limited number of embodiments , it should be readily understood that the invention is not limited to such disclosed embodiments . rather , the invention can be modified to incorporate any number of variations , alterations , substitutions or equivalent arrangements not heretofore described , but which are commensurate with the spirit and scope of the invention . additionally , while various embodiments of the invention have been described , it is to be understood that aspects of the invention may include only some of the described embodiments . accordingly , the invention is not to be seen as limited by the foregoing description . | 2 |
preferred embodiments of the present invention will now be described with reference to the drawings . fig1 a illustrates a detachable wafer chuck 5 c , i . e . a substrate holder , according to a first embodiment of the present invention . fig1 b is an enlarged view of section a in fig1 a . the wafer chuck 5 c of the first embodiment corresponds to the structure shown in fig1 , but is additionally provided with an o - ring sealant 17 , i . e . an elastic sealing member , which is in contact with the undersurface of the wafer 12 . specifically , the o - ring sealant 17 is disposed along the periphery of the undersurface of the wafer 12 while being in contact with an inner peripheral portion of the undersurface of the wafer 12 . a structure for preventing a leakage of immersion liquid to a wafer suction unit will now be described with reference to fig1 a and 1b . in fig1 a and 1b , a vacuum - chuck component 5 d provided in the wafer chuck 5 c vacuums the wafer 12 so as to fixedly support the wafer 12 . as shown in fig1 b , the o - ring sealant 17 is disposed adjacent to a circumferential projection ( a ring - shaped projection ) 5 p provided along the outermost portion of the vacuum - chuck component 5 d . by providing the o - ring sealant 17 , the leakage 105 f shown in fig1 b is prevented even if foreign matter attaches to the surface of the wafer chuck 5 c and / or the undersurface of the wafer 12 , or if a scratch is present on the surface of the wafer chuck 5 c and / or the undersurface of the wafer 12 . thus , the o - ring sealant 17 prevents the immersion liquid 16 from entering the openings provided in the vacuum - chuck component 5 d or prevents vacuum errors from occurring . consequently , this prevents problems , such as lowering of the liquid level of the layer of the immersion liquid 16 . with respect to the structure shown in fig1 in which the electrostatic - chuck component 5 e is provided , an example shown in fig2 is additionally provided with the o - ring sealant 17 according to the first embodiment . similarly , in such an electrostatic technique , the o - ring sealant 17 prevents the immersion liquid 16 from entering the undersurface of the wafer 12 . accordingly , this prevents problems related to the leakage of immersion liquid 16 , such as a leakage of voltage or lowering of the liquid level of the layer of the immersion liquid 16 . the first embodiment may additionally be provided with a detector which detects a leakage through the o - ring sealant 17 , i . e . the elastic sealing member , based on , for example , air pressure or air volume in a case where a leakage occurs through the o - ring sealant 17 . if the detector detects such a leakage , the wafer 12 or the wafer chuck 5 c holding the wafer 12 may be ejected from , for example , the wafer stage 5 or the exposure apparatus without supplying any immersion liquid 16 to the wafer 12 . alternatively , the first embodiment may additionally be provided with a detector for detecting a leakage through the o - ring sealant 17 just after the start of the supply of the immersion liquid 16 ; and a drier for drying the interior of the wafer chuck 5 c . in such a case , if a leakage is detected , the drier dries the interior of the wafer chuck 5 c . fig3 a to 3c illustrate a second embodiment of the present invention . in place of the elastic o - ring sealant 17 provided in the first embodiment , the second embodiment is provided with a differential exhaust unit . specifically , the differential exhaust unit is disposed along a periphery of a wafer - suction surface of the wafer chuck 5 c while facing the inner peripheral portion of the undersurface of the wafer 12 . referring to fig3 c , the differential exhaust unit is disposed along the outermost portion of the vacuum - chuck component 5 d in a ring - like manner . the differential exhaust unit includes an exhaust duct a ( 5 f ), an exhaust duct b ( 5 g ), and an exhaust duct c ( 5 h ) which are independent of one another . according to the second embodiment , the exhaust duct a ( 5 f ) is used for atmospheric pressure , the exhaust duct b ( 5 g ) is used for low vacuum pressure ( intermediate pressure ), and the exhaust duct c ( 5 h ) is used for suction - holding pressure . consequently , by gradually decreasing the exhaust pressure towards the exterior of the wafer chuck 5 c using multiple differential exhaust ducts , a leakage is thoroughly prevented from occurring . this prevents the immersion liquid 16 from entering the vacuum - chuck component 5 d or prevents vacuum errors from occurring even if foreign matter attaches to the surface of the wafer chuck 5 c and / or the undersurface of the wafer 12 , or if a scratch is present on the surface of the wafer chuck 5 c and / or the undersurface of the wafer 12 . as a result , the leakage 105 f shown in fig1 b is prevented from occurring , meaning that the immersion liquid 16 is prevented from entering the openings provided in the vacuum - chuck component 5 d or that vacuum errors are prevented from occurring . consequently , this prevents problems , such as lowering of the liquid level of the layer of the immersion liquid 16 . fig3 b illustrates an example in which the wafer suction unit according to the second embodiment includes the electrostatic - chuck component 5 e in place of the vacuum - chuck component 5 d . even in this case , like the structure described above , the differential exhaust unit used in the electrostatic technique prevents the immersion liquid 16 from entering the undersurface of the wafer 12 so as to prevent problems related to the leakage of the immersion liquid 16 . fig4 a to 4c illustrate a third embodiment of the present invention . in place of the elastic o - ring sealant 17 in the first embodiment , the third embodiment is provided with a liquid - sealant pool disposed along an outer peripheral portion of the wafer chuck 5 c . referring to fig4 c , a circumferential liquid - sealant groove 5 k is disposed around the outer periphery of the vacuum - chuck component 5 d . moreover , a liquid - sealant supplier for supplying a liquid sealant 5 j to the liquid - sealant groove 5 k is also provided . the liquid sealant 5 j should be formed of a material that cannot be easily diffused into the immersion liquid 16 while still having sealability . for this reason , the liquid sealant 5 j should be a type of liquid having relatively high viscosity and density . for example , the liquid sealant 5 j may be a fluorinated inert refrigerant , fluorinated oil , or a gelatinous polymer material . fig4 b illustrates an example in which the wafer suction unit according to the third embodiment includes the electrostatic - chuck component 5 e in place of the vacuum - chuck component 5 d . even in this case , like the structure described above , the liquid - sealant groove 5 k and the liquid - sealant supplier used in the electrostatic technique prevent the immersion liquid 16 from entering the undersurface of the wafer 12 so as to prevent problems related to the leakage of the immersion liquid 16 . in the first to third embodiments , the entire wafer 12 is immersed in the immersion liquid 16 during the liquid - immersion exposure operation . on the other hand , a fourth embodiment of the present invention shown in fig5 a and 5b provides a liquid - immersion exposure apparatus in which the immersion liquid 16 from the immersion - liquid tank 14 is supplied only to an area directly below the step - and - repeat lens 3 , which is the area subject to the exposure operation . according to such a technique , the immersion liquid 16 is supplied via a liquid - supplying nozzle 18 to the area on the top surface of the wafer 12 directly below the step - and - repeat lens 3 . the immersion liquid 16 is continuously supplied via the liquid - supplying nozzle 18 and is continuously retrieved from a liquid - retrieving nozzle 19 . the liquid - immersion exposure apparatus of the fourth embodiment which supplies the immersion liquid 16 only to the area on the wafer 12 subject to the exposure operation achieves the same effect as that achieved by the liquid - blocking sealant structure according to the first to third embodiments . the fourth embodiment is advantageous especially in a case where an outer region of the wafer 12 is subject to the exposure operation . fig6 a to 6c illustrate a fifth embodiment of the present invention . the fifth embodiment is provided with the circumferential liquid - sealant groove 5 k around the outer periphery of the vacuum - chuck component 5 d in the wafer chuck 5 c as in the third embodiment , but unlike the third embodiment , the entire wafer 12 is not immersed in the immersion liquid 16 . instead , like the fourth embodiment , the immersion liquid 16 is supplied only to the area subject to the exposure operation , which is directly below the step - and - repeat lens 3 . referring to fig6 c , in the fifth embodiment , the liquid - sealant supplier ( including a liquid - sealant supplying duct ) and the circumferential liquid - sealant groove 5 k are disposed around the outer periphery of the vacuum - chuck component 5 d . moreover , a circumferential liquid - sealant - exhaust groove 5 l is disposed around the outer periphery of the liquid - sealant groove 5 k . the liquid sealant 5 j is supplied to the liquid - sealant groove 5 k , and is then discharged into a liquid - sealant exhaust duct 5 m via the liquid - sealant exhaust groove 5 l . in this case , the liquid sealant 5 j is supplied at a constant rate of flow so as to maintain a predetermined liquid level of the liquid sealant 5 j . an excess amount of the liquid sealant 5 j is transferred to the liquid - sealant exhaust groove 5 l , and is then discharged into the liquid - sealant exhaust duct 5 m connected to the liquid - sealant exhaust groove 5 l . furthermore , in order to completely remove the liquid sealant 5 j , both the liquid - sealant supplier of the liquid sealant 5 j ( including the liquid - sealant supplying duct ) and the liquid - sealant exhaust duct 5 m may be vacuumed . according to the first to fifth embodiments , the elastic o - ring sealant 17 , the differential exhaust unit , or the liquid - sealant groove 5 k is provided between the undersurface of the wafer 12 and the wafer chuck 5 c , i . e . the wafer suction unit . thus , a substrate - holding technique that prevents the immersion liquid 16 from entering the undersurface of the wafer 12 , i . e . a substrate , is provided . this prevents leakages of the immersion liquid 16 into the wafer suction unit , and can prevent problems that may occur in the liquid - immersion exposure apparatus , such as a substrate suction error , an error in the wafer chuck 5 c caused by a leakage of voltage , or an error due to lack of immersion liquid 16 . accordingly , a liquid - immersion exposure apparatus with high reliability and productivity can be provided . referring to fig7 , a sixth embodiment of the present invention will now be described . fig7 is a flow chart illustrating a method for fabricating a micro - device using the above - mentioned liquid - immersion exposure apparatus . such a micro - device may include , for example , a semiconductor chip such as an ic and an lsi , a liquid - crystal panel , a ccd , a thin - film magnetic head , or a micro - machine . in step 1 , pattern designing ( circuit designing ) of a micro - device is performed . in step 2 , a mask of the designed pattern is fabricated ( mask fabrication ). in step 3 , a wafer is fabricated using , for example , silicon or glass ( wafer fabrication ). step 4 is called a former step in which an actual circuit is formed on the wafer by lithography using the mask fabricated in step 2 ( wafer processing ). step 5 is called a latter step in which the wafer processed in step 4 is made into a semiconductor chip ( assembly process ). specifically , step 5 includes sub - steps , such as an assembly sub - step ( dicing , bonding ) and a packaging sub - step ( chip enclosing ). subsequently , step 6 is an inspection step in which the semiconductor micro - device formed in step 5 is inspected for , for example , operationability and durability . the fabrication process of the micro - device is thus completed , and in step 7 , the micro - device is shipped . fig8 is a flow chart illustrating the wafer processing step , i . e . step 4 , in further detail . in step 11 , the surface of the wafer is oxidized ( oxidization ). in step 12 , an insulating layer is formed over the wafer ( cvd ). in step 13 , an electrode is formed on the wafer by vapor deposition ( electrode formation ). in step 14 , ions are embedded into the wafer ( ion embedding ). in step 15 , a sensitizer is applied over the wafer ( resist processing ). in step 16 , the circuit pattern of the mask is exposed and printed onto the wafer by using the exposure apparatus described above ( exposure process ). in step 17 , the wafer having the circuit pattern disposed thereon is developed ( development process ). in step 18 , segments on the wafer other than the developed resist segments are etched ( etching process ). in step 19 , the resist segments no longer needed after the etching process are removed ( resist removal ). by repeating these steps , a multilayer circuit pattern is formed on the wafer . by using the fabrication method according to the sixth embodiment , a highly - integrated micro - device can be manufactured at a low cost . aspect 1 . a liquid - immersion exposure apparatus according to aspect 1 projects a pattern included in an original onto a substrate and operates a stage unit in order to move both the original and the substrate or only the substrate relatively with respect to an optical projection unit . thus , the pattern of the original is repeatedly exposed on the substrate while an immersion - liquid layer is disposed in at least a part of a light - transmitting space between the optical projection unit and the substrate . the liquid - immersion exposure apparatus according to aspect 1 is provided with a blocking unit disposed between the immersion - liquid layer and a substrate suction unit provided in a substrate holder . the blocking unit prevents a leakage of the immersion liquid by substantially blocking the immersion - liquid layer from the substrate suction - surface or the substrate suction unit . there are generally two types of liquid - immersion exposure apparatuses . one is a movable - pool type in which a wafer , i . e . the substrate , is completely immersed in the immersion liquid . the other is a local - fill type in which the wafer is partially immersed in the immersion liquid such that a region in the wafer with the immersion liquid can be shifted . the present invention can be applied to either types . the blocking unit is preferably ring - shaped such that the blocking unit substantially surrounds the undersurface of the substrate . in other words , if the substrate is circular , the blocking unit is circular , and if the substrate is rectangular , the blocking unit is also rectangular so that the blocking unit can be disposed along the periphery of the substrate . for example , an elastic sealing member is used as the blocking unit . the blocking unit may include at least one of the elastic sealing member , at least one circumferential exhaust duct , and a liquid - sealant supplier . specifically , the elastic sealing member is in contact with the periphery of the substrate and / or an inner portion of the undersurface of the substrate positioned along the periphery of the substrate ( referred to as an inner peripheral portion hereinafter ) when the substrate is being held by the substrate holder . on the other hand , at least one circumferential exhaust duct is disposed on the substrate - holding surface of the substrate holder and faces the inner peripheral portion of the undersurface of the substrate when the substrate is being held by the substrate holder . the liquid - sealant supplier supplies liquid that does not mix with the immersion liquid along the periphery of the substrate and / or the inner peripheral portion of the undersurface of the substrate when the substrate is being held by the substrate holder . aspect 2 . according to the exposure apparatus of aspect 1 , the blocking unit is preferably the elastic sealing member which is in contact with the substrate . aspect 3 . according to the exposure apparatus of one of aspects 1 and 2 , the blocking unit or the elastic sealing member is detachably disposed on the substrate holder . aspect 4 . according to the exposure apparatus of aspect 1 , the blocking unit may include at least one circumferential exhaust duct disposed on the substrate - holding surface of the substrate holder . at least one circumferential exhaust duct preferably includes a plurality of circumferential exhaust ducts so as to define a differential exhaust unit . aspect 5 . according to the exposure apparatus of aspect 1 , the blocking unit may include the liquid - sealant supplier for supplying a liquid sealant substantially along the outer peripheries of the substrate holder and the substrate . aspect 6 . according to the exposure apparatus of aspect 5 , the density of the liquid sealant supplied along the outer peripheries of the substrate holder and the substrate is greater than that of the immersion liquid . aspect 7 . according to the exposure apparatus of aspect 5 , the liquid sealant supplied along the outer peripheries of the substrate holder and the substrate is retrieved or discharged respectively by a retrieving unit or a drainage unit provided in the substrate holder . aspect 8 . according to the exposure apparatus of one of aspects 1 to 7 , the substrate holder is detachably disposed on the stage unit . accordingly , by providing the blocking unit , such as the elastic sealing member , the differential exhaust unit , and the liquid - sealant supplier , between the substrate holder and the substrate , the immersion liquid is prevented from entering the substrate suction unit so as to prevent leakages . while the present invention has been described with reference to what are presently considered to be the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . on the contrary , the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions . this application claims priority from japanese patent application no . 2003 - 409446 , entitled “ substrate holder , exposure apparatus provided with the substrate holder , and method for manufacturing device using the exposure apparatus ” and filed dec . 8 , 2003 , which is hereby incorporated by reference herein . | 6 |
features of the invention may work by themselves or in combination as shall be apparent to one skilled in the art . the lack of repetition is meant for brevity and not to limit the scope of the claim . unless otherwise indicated , all terms used herein have the same meaning as they would to one skilled in the art of the present invention . the present invention can be used in and with any fluid conduit , e . g ., tubes , manifolds , pipes , spigots , and so on . the present invention is particularly useful where a downstream conduit needs to be connected to an upstream one for fluid delivery , but when the two are disconnected , it is desirable to stop the fluid flow from the upstream conduit . referring to fig1 , an example where the present invention may be practiced is provided . a postmix beverage dispenser 50 is shown here with the front door removed , and one of the two parallel production lines is depicted in a partly exploded view on the right side . the dispenser 50 mixes a concentrate , e . g ., orange juice concentrate , with a diluent , e . g ., potable water , inside a mixing chamber 52 before dispensing the product into a receptacle 54 through a nozzle 56 that is housed , in part , inside the mixing chamber 52 . the concentrate is delivered through a bag - in - box system where a sealed bag of the concentrate ( not shown ) is placed inside a holder 58 . a drainage tube 60 extends from the bag and out of the holder 58 , and the tube &# 39 ; s outlet 61 is eventually attached to a tube adapter 62 on the top of a pump head 64 . the pump head 64 houses a piston ( not shown ) that transfers the delivered concentrate into the mixing chamber 52 into which pressurized water is delivered as well . when the drainage tube 60 is removed from the tube adapter 62 , e . g ., to change the flavor of the concentrate for the dispenser 50 , it would be desirable if the drainage tube 60 automatically closes or seals off its outlet end 61 so that the content does not spill out or drip . further details of the postmix beverage dispenser 50 is provided in co - owned international application no . pct / us2005 / 045087 filed on dec . 12 , 2005 , the entire disclosure of which is hereby incorporated by reference to the extent permitted by relevant patent laws . referring now to fig2 and 3 , a connector or fitting 70 is provided with a one - directional valve or check valve 72 housed inside a tubular housing or body 74 . the tubular body 74 has an upstream inlet end 76 and a downstream outlet end 78 . the fitting &# 39 ; s upstream inlet end 76 attaches to an upstream conduit , such as the drainage tube 60 ( fig1 ) from a bag of concentrate . the fitting &# 39 ; s downstream outlet end 78 attaches to a downstream conduit , such as the tube adapter 62 ( fig1 ) of a pump head . therefore , the direction of fluid flow inside the fitting is from end 76 to end 78 , as indicated by the arrow 81 . on both ends of the fitting 70 , which can be sized to fit onto their corresponding connecting conduits , structures may be provided to ensure a seal is formed with the upstream or downstream conduit . in one embodiment , the upstream inlet end 76 has an annular barb 80 on the outside wall , and the downstream outlet end 78 has an annular ring 82 on the inside wall , to engage and seal against the corresponding conduit . the valve 72 has a pointed portion 84 that points towards the upstream inlet end 76 . the pointed portion 84 can have a variety of configurations that , in general , taper towards a closure point or slit 86 . the pointed portion 84 is biased to remain closed or checked at the closure slit 86 , preventing fluid flow through the fitting 70 . the pointed portion 84 includes multiple lips 88 biased to remain closed . the pressure from the fluid inside the fitting 70 , especially if the fitting is positioned in a vertical orientation with its inlet end 76 on top as shown in fig2 , helps to push the valve lips 88 shut . accordingly , in some embodiments , the valve lips 88 do not need to be preloaded . those lips 88 , for example , can be a pair of substantially flat portions resembling duckbills facing each other . such duckbill check valves are commercially available from manufacturers such as red valve co ., inc . of carnegie , pa ., clippard instrument laboratory , inc . of cincinnati , ohio , and vernay laboratories , inc . of yellow springs , ohio . the valves may be made of a variety of materials such as elastomeric compounds including rubber . in one embodiment , the valves are made by liquid silicone injection molding — valve manufacturers that use such technique include liquid molding system , inc . of midland , mich . the valve 72 can also use other configurations and structures , such as umbrella valves , for the purpose of the present invention . to open the valve 72 , an elongated object , e . g ., a downstream conduit ( not shown ), is inserted into the fitting 70 through its outlet end 78 , in the direction opposite the arrow 81 . once the downstream conduit contacts the underside of the valve &# 39 ; s pointed portion 84 , the operator can use the conduit to apply the necessary pressure to force open the lips 88 . in one way to use the invention , the operator thrusts the conduit past the lip &# 39 ; s closure slit 86 until it lodges in the portion of the tubular body 74 that is upstream to the valve . fluid flow in the direction of the arrow 81 will proceed from the fitting 70 into the downstream conduit . when the downstream conduit is withdrawn or otherwise separates from the fitting 70 , the valve lips 88 will close automatically , effectively shutting off the fluid flow . for fluids of relatively low viscosity such as some types of juice concentrates , it is preferred that the lips of the duckbill check valve be elongated and / or thin so that they remain checked in the closed position and little or no leakage or dripping results . the valve can be reopened when the downstream conduit is inserted back in and past the valve . a retainer 90 ( fig3 ) can be found downstream from the valve 72 , resting against the annular ring 82 , to prevent the valve 72 from being removed with the downstream conduit from the tubular body 74 . still referring to fig2 and 3 , the fitting 70 may also have an integrated collar 92 to aid in the removal and connection to the upstream and downstream conduits . the collar 92 can also act as a locator to prevent abnormal insertion . the fitting 70 can be made integrally with the upstream conduit , of course , such that the tubular body 74 is simply an integral portion of the conduit and constitutes part of its discharging / outlet end . a detachable fitting 70 , as depicted in fig2 and 3 , however , allows reuse of the check valve 72 for different conduits and connections . other aspects of making and using the invention , the embodiments of which have been described , would be obvious to one skilled in the art . while the invention has been described with certain embodiments so that aspects thereof may be more fully understood and appreciated , it is not intended to limit the invention to these particular embodiments . on the contrary , it is intended to cover all alternatives , modifications and equivalents as may be included within the scope of the invention as defined by the appended claims . | 8 |
as described in my previous u . s . pat . no . 4 , 023 , 459 , issued may 17 , 1977 , the bridge of the present invention should be made by hand and custom fitted to the particular instrument . since each bridge is individually formed , no two will be exactly alike . therefore , the description that follows is only a representation of the structural form of a bridge , rather than an accurate or precise dimensional description . the dimensions given are only supplied by way of example and are not intended to limit the scope of the invention . also , as noted in my above - mentioned u . s . patent , the present invention may be adapted to any stringed instrument played with a bow . in order to more clearly describe the invention it will be assumed that the bridge is used with a violin , with the g - string notch appearing on the right and the e - string notch appearing on the left as shown in fig1 . referring in detail to fig1 the bridge 10 shown in front elevation , is best made from a single piece of wood having uniform gain and texture . the bridge 10 should be carved by hand from naturally dried wood cut on the quarter , as is well known in the prior art . the initial piece of wood should be about 2 square inches and 1 / 4 inch thick . the bridge 10 has a body portion 11 and legs 11a and 11b . body portion 11 is roughly fan - shaped , having a broad front and rear face . the upper surface 11c is smooth , except for the symmetrically spaced receiving grooves 12e , 12a , 12d & amp ; 12g . each of these grooves , are say 1 / 2 the diameter of the string and are roughly 7 / 16 inches apart . legs 11a and 11b extend down from body portion 11 and have a u - shaped indentation between them . when the bridge is installed on the violin , the legs 11a and 11b are individually cut or shaved so that if conforms to the particular violin . other distinguishing characteristics of the bridge of the present invention include the winged lateral edges 11f and 11g of upper surface 11c . also , lateral indentation 11h and 11i constrict the upper portion of legs 11a and 11b . the finished bridge , when adapted for use with a violin , should be about 1 11 / 16 inch high , but will vary according to the exact needs of each violin . the width of the bridge is about 1 13 / 16 inch , but as previously mentioned , the exact dimensions are dictated to conform to the specific violin . the total width of the body 10 should be selected to produce the most superior sound . preferably , the overall weight of the bridge is near the total weight of the portion of the four strings which are strung on the violin , or about 2 . 6 g . the shape of the face together with the inverted u - shaped indentation between the legs , presents the most favorable support for the strings which produces maximum vibration characteristics . further details for the construction of a suitable bridge and its optimum dimensions are disclosed in my above - mentioned prior u . s . patent , and that description is herein incorporated by reference . in the present invention body 10 of the bridge 1 is provided with a patterned series of holes 20 . the latter is arranged in roughly four linear sets of five holes each emanating from the lower central portion of body 10 and terminating below each of the grooves 12e , 12a , 12d and 12g accomodating the e , a or g strings , respectively . the holes 20 are all of uniform diameter , for example 7 / 64 inch , except for the last holes of each set , adjacent each of the strings , which are about 9 / 64 inch in diameter . these larger holes have been found to free - up the stoic attitudes of the instrument as is well known in the art . the degree of sensitivity of the bridge is determined by the size of the holes bored through . the greater the size of the holes ( i . e . the less wood between the violin and the strings ) the greater the sensitivity of the bridge . it is apparent that the more weight that is removed from the bridge between the strings and the violin the greater degree of sound and tonal quality will be attained . fig2 & amp ; 3 show a side elevation and vertical cross - section respectively of the bridge of the present invention . the thickness of the bridge may vary to meet the particular needs of each instrument , but generally the thickness ranges between 3 / 16 and 1 / 16 inch at various points along the bridge . the bridge is thickest at its lower end ( the base of legs 11a and 11b ) and tapers slightly to the highest point ( at the upper curved surface 11c ). it is noted that a precise dimension or description of the same shape and thickness can not be given as the bridge is made by hand and each bridge will vary slightly from the rest according to human variations . an alternate embodiment of the bridge is shown in fig4 . the modification of the bridge 100 of fig4 over that of bridge 10 of fig1 - 3 is that some or all of the holes 20 include diametrical slots 125 therethrough . these slots serve to remove further weight from the bridge to further increase its sensitivity . slots 125 may fully cross each of the holes 120 ( as shown by slots 126 ), or may extend from only one side of the holes ( as shown by slot 127 ). the slots provide for a more pure sound , particularly for the &# 34 ; highs &# 34 ; and &# 34 ; lows &# 34 ;. the location , size and number of slots can be made to suit the desired need . | 6 |
the following description is intended to provide a detailed description of examples of some embodiments and aspects of the invention and should not be taken to be limiting of the invention itself . rather , any number of variations may fall within the scope of the invention , which is defined in the claims following the description . the present disclosure includes a method , a data processing system and a computer program product that compiles a source code program into a several object code files where the method includes the steps of defining a set of computerized statistical models and their functional interactions ; determining changes that require an optimizing compilation and linking action ; dynamically vending programmatic libraries for accessing and interacting with the models ; executing model interaction in a performant , scalable , and simultaneous manner ; and optionally propagating experimental model results as feedback for continuous and automatic optimization either in terms of execution performance or accuracy . as will be appreciated by one skilled in the art , aspects of the present invention may be embodied as a system , method or computer program product . accordingly , aspects of the present invention may take the form of an entirely hardware embodiment , an entirely software embodiment ( including firmware , resident software , micro - code , etc .) or an embodiment combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” furthermore , aspects of the present invention may take the form of a computer program product embodied in one or more computer readable medium ( s ) having computer readable program code embodied thereon . aspects of the present invention are described below with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ) and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer program instructions . these computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which are implemented via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer program instructions may also be stored in a computer readable medium that can direct a computer , other programmable data processing apparatus , or other devices to function in a particular manner , such that the instructions stored in the computer readable medium produce an article of manufacture including instructions which implement the function / act specified in the flowchart and / or block diagram block or blocks . the computer program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other devices to cause a series of operational steps to be performed on the computer , other programmable apparatus or other devices to produce a computer implemented process such that the instructions which are implemented on the computer or other programmable apparatus provide processes for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . referring to the system overview diagram of fig1 , the server 100 is the central mechanism for providing the functionality described herein . accessed by one or more clients 101 , the server 100 allows access to the analytics system through the api ( application programming interface ) access layer 102 . it should be understood that a typical computer system providing the server 100 or a client 101 contains many other components not shown , which are not essential to an understanding of the present invention . in one embodiment , the access layer 102 is presented through an http ( hypertext transfer protocol ) communication over an ip ( internet protocol ) computer network connection . in this particular embodiment , the http communication , which may be optionally cryptographically secured through a tls ( transport layer security ) application layer implementation , provides access through a rest ( representational state transfer ) api with json ( javascript object notation ) elaboration of structures and base64 encoded raw data . the client 101 access is built on top of a base client library available in multiple programming languages . this base client library provides authentication , rbac ( role based access control ), transparent error recovery , data marshalling , and a “ native ” interface for the programming language of choice . the access layer 102 interfaces with the base client library to provide a model specific programmatic interface through the interface generator 103 . this generator creates a programming library in the client &# 39 ; s language of choice ( the “ target programming language ”) that directly matches the model &# 39 ; s attributes and functionality for optimal convenience and efficiency of the client developer . illustrative target programming languages may include without limitation any or all of the following : the interface generator 103 generates the interface based on the data model 200 stored within the data model manager 104 , which is a dynamic container of meta - information about all analytical models in the server 100 . preferably the model manager 104 provides for the creation , deletion , enumeration , and use of the models in their various subsystems . when a specific model task , such as the creation of a new model , is specified by the access layer 102 to the data model manager 104 , the task may be passed to a task dispatcher 105 which enables parallelized task completion while maintaining consistent , known model state . this standard goal of parallel programming is thereby provided upstream of the client 101 , greatly simplifying and streamlining a traditionally complex area of optimization . a wide variety of data models can be implemented . models may contain programming scripts as part of their definition to provide complex functionality . the server &# 39 ; s 100 scripting system 106 preferably provides a large set of mathematical , statistical , textual , and logical functions available in a deterministic and highly efficient context . in one particular embodiment of the present invention , this efficiency is gained by trans - compiling the scripts to the highly performant “ c ” programming language as part of the source generation of the models by the model source generator 107 , which converts the model to “ c ” source files . these source files are then compiled by an optimizing “ c ” compiler and dynamically linked back into the server 100 process space by the compiler and linker 108 system . the scripting language has a strictly deterministic operation allowing real - time performance characteristics primarily through preventing all looping outside of list enumeration . this intentional limitation includes “ while ”- style conditional loops , “ goto ”, and recursion . as a purely functional language , no side - effects or modifiable variables are permitted within the script functions . outside of the special case of analysis reduction functions 804 , there is intentionally no facility for defining functions visible across scripts , nor common programming - in - the - large idioms such as object - oriented programming , complex type definition , namespaces , etc . though without sophisticated facilities for developing reusable libraries , the scripting language includes a large set of mathematical , statistical , textual , and logical functions built - in and these are automatically available to all scripts . similar to the lisp programming language , scripts are composed entirely of nested programmatic s - expressions each with a function name and its arguments , and each returning a result . as such , the syntax is minimal and there are no operator symbols such as “+”, order of operation rules , and other complexities contained in most other programming languages . the scripting language may be written in either parenthesized prefix notation ( lisp - style ) or function notation ( fortran - style ). prefix and function notation may also be freely mixed , although this is generally not advisable due to reducing programmer readability . the following two example scripts , though using different notational styles , do the same function ( i . e . return the boolean value , ‘ true ’, if var_x and var_y add up to 10 ; else return ‘ false ’). as discussed further below , scripts may be used in defining mapping transforms 402 , defining filter criteria 702 , defining data reductions for analysis 802 , and as noted in otherwise defining a data model structure and its initialization 502 . fig2 is a block diagram showing a presently preferred set of model subsystems available in the model manager &# 39 ; s 104 data models 200 . the model 200 provides for the lookup of specific model instance events which particular embodiments or instantiations of the model structure through the event lookup index 202 . the memory mapped storage 203 contains the disk - backed memory access to the events so indexed . the interface generator &# 39 ; s 103 source may be cached within the model &# 39 ; s 200 source interface cache 205 . the access layer 102 preferably interfaces directly with the compiled and linked machine code for each of the model &# 39 ; s 200 api subsystems 201 . these apis 201 are directly executable through the dynamically linked function table 204 and include the model &# 39 ; s 200 structures 300 , mappings 400 , generators 500 , events 600 , filters 700 , and analyses 800 , described in more detail in the subsequent figures . fig3 illustrates a structure subsystem 300 . before a model 200 can be used by a client 101 , it must be defined and these foundational definitions are known as structures 300 . internally , a structure 300 may comprise a list of named variables and their formats . for example , a structure 300 , “ tire ”, might have variables such as “ mileage ”, “ wet_grip ”, “ retreadability ”, “ dry_handling ”, and so on . variables may include the following types with their corresponding constraints : text : a sequence of bytes that are frequently utf - 8 or iso - 8859 encoded characters with a fixed maximum length . the given length preferably is pre - allocated for each instance ( event ) of this data . a text variable &# 39 ; s constraints must include its length . blob : a sequence of data bytes or encoded characters with a potentially unbound length . a structure that contains blobs will be much slower for certain operations than one that only contains the other variable types due to optimizations available with a fixed structure size . a blob variable &# 39 ; s constraints may include its length . integer : a signed integer number without a fractional component such as “ 771 ” or “ 0 ”. the potential range depends on the “ size ” constraint which selects between 32 - bit , 64 - bit , and arbitrary precision . arbitrary precision integers are much slower than other numerical formats . integer constraints include its minimum , maximum , and size (“ 32 ”, “ 64 ”, or “ arbitrary ”). real : a floating point number with fraction and exponent components such as “ 3 . 14 ” or “ 2 . 5 − 68 ”. the precision is selectable from single - and double - precision with moderately faster performance for single - precision . real constraints include minimum , maximum , and precision (“ single ” or “ double ”). boolean : a simple binary flag with only “ true ” ( 1 ) or “ false ” ( 0 ) as possible values . enum : an efficient and easily testable selection between [ among ??] a list of given named labels . structures may have many variables to track the different data occurring in each recorded event . these data form the basis for the other functions and features in the model 200 as further described below . the api for the structure 300 may include the command to list structures 301 , which returns a list of all structures 300 available in the server 100 . additionally , the client 101 may create a new structure 302 , which requires the structure name and a list of variables . the client 101 may also delete a previously created structure 303 . finally , the client 101 , through the interface generator 103 , may expand out the particular functionality of a given structure 300 with a specific target programming language through the command to interface with the structure 304 . the command returns the programming library for that specific structure and language . in other words , the interface generator component preferably is configured to generate a model specific interface library that is conformant with a syntax of the target programming language and that matches the defined structure of the stored data model . this is one of several features designed to improve performance while enabling the application programmer ( client 101 ) to operate in a target programming language of her choosing . creating 302 or deleting 303 a structure 300 triggers the compilation and linking 108 system and modifies the interface models created by the interface generator 103 . fig4 shows an example of a mapping subsystem 400 . once a structure 300 has been defined , a transformed or partial view of it may be created through a mapping 400 belonging to the structure 300 . additionally , mappings 400 can be derived from another mapping 400 , except for circular references . mappings 400 may provide their own set of transformed variables through pure functions using the scripting system 106 . in an embodiment , mapping functions may use any of the following to generate a mapped transform variable : the mapped transform &# 39 ; s type may be set as with structure variables , but must be the same or castable from the return value . mapped transforms have no constraint pre - conditions as they are not directly set by the client or generated . mapped transform names may be different or identical to parent variable / transform names , but the mapping name itself must be unique among all structures and mappings . the api for the mapping 400 may include the command to list mappings 401 , which returns a list of all mappings 400 available in the server 100 for a given structure 300 . additionally , the client 101 may create a new structure 402 , which requires the mapping name , the name of the parent structure 300 or mapping 400 , and a list of mapping transforms . the client 101 may also delete a previously created mapping 403 . creating 402 or deleting 403 a mapping 400 triggers the compilation and linking 108 system and modifies the interface models created by the interface generator 103 . fig5 shows the generator subsystem 500 . when the client 101 wishes to store data , it needs to first generate an instance of the target structure 300 . this newly generated instance , known as an “ event ” 600 , is generated according to rules of a previously defined generator 500 . a generator acts similar to a constructor in oop ( object - oriented programming ), providing initialization that can potentially be programmatically complex . while initialization can also be done in client code , the use of generators can improve efficiency , convenience , and consistency across multiple client environments . generators 500 contain a list of initializers for a set of the structure &# 39 ; s 300 variables . each initializer does the work of automatically setting the starting value of its corresponding variable using a programming script . unlike mapping 400 transforms , the generator &# 39 ; s 500 initializers do not need to be idempotent ( the property of certain operations in mathematics and computer science that can be applied multiple times without changing the result beyond the initial application ). this allows for generators 500 that can , for example , use random values for some variables . if a generator 500 does not initialize one of the event &# 39 ; s variables , the client 101 should set it explicitly before saving the event . using custom defined generators 500 is optional as each structure 300 automatically has an implicit generator 500 created for it which simply requires all variables to be explicitly set . the api for the generator 500 may include a command to list generators 501 , which returns a list of all generators 500 available in the server 100 for a given structure 300 . additionally , the client 101 may create a new generator 502 , which requires the generator name , the name of the parent structure 300 , a list of generator initializers , and a list of settings which are input variables with name , type , and constraints that are to be provided during generation and which may be used by the initializers . the client 101 may also delete a previously created generator 503 . finally , the client 101 may generate 504 a new event 600 for the structure 300 according to the rules of the generator 500 . if settings were provided when the generator 500 was created 502 , they must be provided during generation 504 . the generated event 600 must be explicitly saved in order to be visible and persisted within the server 100 . creating 502 or deleting 503 a generator 500 triggers the compilation and linking 108 system and modifies the interface models created by the interface generator 103 . fig6 shows an example of the event subsystem 600 . an event 600 is a particular instantiation of a structure &# 39 ; s 300 model . all data in the server 100 is stored and processed as recorded events . events 600 may be interacted with as “ plain old objects ” within the client language , providing an easy and natural interface to the underlying data model . saveable events 600 can only exist for structures 300 while unsaveable events can be returned by filters 700 applied to mappings 400 . events 600 must have all variables set either explicitly or through a generator 500 in order to be saved . events 600 may not be saved more than once or modified after saving ; a new event 600 must be created or an existing event 600 cloned . in addition to their variable values , events 600 preferably have the following intrinsic meta - information which may be accessed : the api for the event 600 includes the command to store the event 601 to the server 100 . additionally , a previously saved event may be deleted 602 given a particular globally unique event id . fig7 shows an example of a filter subsystem 700 . filters 700 are used for querying the server 100 and enumerating events 600 . filters 700 have one or more criteria which preferably are themselves script functions with access to all structure 300 variables or mapping 400 transforms , and return boolean values . all criteria must return “ true ” in order for the filter 700 to accept an event 600 ; if a single criterion returns “ false ”, the filter will skip the tested event . each structure 300 or mapping 400 may have an implicit filter 700 with no criteria which returns all events 600 for the structure 300 or mapping 400 . the api for the filter 700 may include a command to list filters 701 , which returns a list of all filters 700 available in the server 100 for a given structure 300 or mapping 400 . additionally , the client 101 may create a new filter 702 , which requires the filter name , the name of the parent structure 300 or mapping 400 , a list of filter criteria , and a list of settings which are input variables with name , type , and constraints that are to be provided during filtering and which may be used by the criteria . the client 101 may also delete a previously created filter 703 . further , the client 101 may count 704 all events 600 for a specified filter 700 . if settings were provided when the filter 700 was created , they must also be provided when counting 704 . finally , the client 101 may enumerate 705 a given filter 700 , i . e . enumerate the filtered results , returning entire event instances 600 up to a given fetch size along with a cursor . the cursor may be passed back on an additional call to the filter 700 in order to continue the enumeration from the last returned event . if no cursor is returned , all events have been retrieved . if settings were provided when the filter 700 was created , they must also be provided when enumerating 705 . creating 702 or deleting 703 a filter 700 triggers the compilation and linking 108 system and modifies the interface models created by the interface generator 103 . fig8 shows the analysis subsystem 800 . an analysis 800 is a process that iteratively analyzes multiple events 600 , reducing the data to a normally much smaller set of outputs . functional scripts used to provide the reducing functions , each passed the enumerated 705 set of filtered events 600 . if no event data 600 has been added or deleted since the last analyzing with given settings , a cached result may be returned . in a preferred embodiment , reduction functions must be pure , while analyses 800 have the special property of being available to generator 500 and filter 700 scripts as callable functions . this allows for easy creation of incremental optimization and adjustment mechanisms . furthermore , unlike all other scriptual references , analyses 800 of other structures 300 or their mappings 400 may be used as functions , permitting complex scenarios where variant experiments or data models can be related automatically . the api for the analysis 800 may include a command to list analyses 801 , which returns a list of all analyses 800 available in the server 100 for a given structure 300 or mapping 400 . additionally , the client 101 may create a new analysis 802 , which requires the analysis name ; the name of the parent structure 300 or mapping 400 ; a list of analysis reductions including the name , type , and script of each reduction ; and a list of settings which are input variables with name , type , and constraints that are to be provided during analyzing and which may be used by the outputs . the client 101 may also delete a previously created analysis 803 . finally , the client 101 may analyze 804 a given analysis 800 , returning a set of reductions given the analysis name , settings if they were provided during analysis creation 802 , the filter 700 to use with the analysis 800 , and settings for the given filter 700 if any are required . creating 802 or deleting 803 an analysis 800 triggers the compilation and linking 108 system and modifies the interface models created by the interface generator 103 . thus the fundamental data management process may be summarized as comprising : accept high level structural and processing definitions through the api convert these definitions into efficient ( for example , c ) source code representations compile and dynamically link this source code forming internal models - as - libraries provide clients with native programmatic access to these model libraries for storing , filtering , and analyzing their data . fig9 illustrates flow of a client access process in a preferred embodiment . upon start 900 , the client 101 loads the base client libraries 901 and authenticates its connection 902 to the server 100 . after completing connection and authentication , model access is provided by checking whether the programmatic model interface is available 903 . if it is not available , the client 101 acquires and loads 904 it from the interface generator 103 . the client 101 may then select which action 905 it would like to perform on the model 200 . the client may wish to manage the model 910 , by which it will access the various model subsystem apis 201 to manage the structures 911 , mappings 912 , generators 913 , filters 914 , and analyses 915 . alternatively , the client may wish to directly programmatically interact with the event data 600 . in this case it may wish to generate a new event instance 906 , enumerate a given filter 907 , perform analysis reductions 908 , or store a generated instance 909 . this sequence may be continued via decision 916 until the client 101 has completed access 917 to the server 100 . fig1 shows the flow of the model compilation process . upon start 1000 the server 100 receives a compilation command 1001 such as following a structure generation task 302 . the server verifies 1002 that the model does , indeed , need compilation by comparing the changes with the previous meta - data for the model 200 and terminates compilation if it is not needed 1003 . if compilation is needed , the model is locked 1004 . in one preferred embodiment this is done using a mutual exclusion thread lock . the model is then prepared for compilation 1005 including validation and consistency checking . the native source code for the model is then generated 1006 as further described below . this source code is then compiled and relinked 1007 dynamically into the server &# 39 ; s 100 process space . the model &# 39 ; s references are suitably updated 1008 including the function table 204 and the model is unlocked 1009 , completing 1010 the compilation and linking process . fig1 shows an illustrative process diagram of a generic optimization process whereby the optimization is target is setup 1100 with a set of controlled and experimental variable , a test 1101 is conducted to produce the results of that configuration , the results 1102 measured and analyzed according to some metric or metrics of success or error , and these data are fed back 1103 into the setup process . as a simple example of this type of generic optimization , consider an artillery cannon designed to fire at a remote target with a variably stronger or weaker gunpowder charge . the given amount of gunpowder is the setup 1100 , the firing of the cannon is the test 1101 , establishing the delta between the intended target and the place of impact is the measurement 1102 , and the adjustment of the following charge is the feedback 1103 . fig1 shows the flow of an exemplary experimental optimization process . the present invention enables this kind of optimization that is oriented towards a relatively free - form optimization that may be human guided or completely automated , using a basic pattern of experimentation and analysis . upon start 1200 , the client 101 generates initial control events 1201 using seed initializers 1202 . analysis on these control events 1203 yields control reductions 1204 which are used in reference to experimental initializers 1206 when generating newly - effected events 1205 . these newly - effected events are further analyzed 1207 and their reductions 1208 measured 1209 for the target effect . this process if iteratively 1210 repeated until the desired optimization is complete 1211 . fig1 shows the flow of an exemplary predictive tuning optimization process . the present invention enables this kind of optimization that is oriented towards weighted prediction graphs and backpropagation , such as for an online product recommender . upon start 1300 , the client 101 sets up 1301 the initial weightings 1302 for the prediction variables . these weightings are used as settings with an analysis 1303 of some set of sample data to further derive a reduced set 1304 of weightings ( this analysis may be skipped for a less “ trained ” version of this algorithm ). these weightings are then used to generate a prediction 1307 based on a test case sample 1306 . this is compared 1309 with the actual outcome 1308 and further tuning 1310 may be done , potentially using the resulting comparison , until the tuning is complete 1311 . fig1 shows the flow of an exemplary genetic algorithm optimization process . the present invention enables this kind of optimization that is oriented towards the gradual , unguided evolution of optimization using genetic algorithms with fully or partially random mutation and fitness criteria . unlike the other example optimization algorithms , the genetic algorithm approach involves changing programmatic scripts . the present invention &# 39 ; s high efficiency allows for such algorithmically designed scripts to execute with particularly high performance , making evolutionary optimization applicable to wider range of scenarios than otherwise . upon start 1400 , an initial seed algorithm is randomly generated 1401 and used to create the desired subsystems and test 1402 . the test is performed and the actual outcome 1403 is compared 1405 against the desired outcome 1404 . if further tuning 1406 is sought , the results are analyzed 1407 and reduced 1408 into a descendant algorithm 1409 for further testing 1402 . otherwise , the optimization is complete 1410 . fig1 shows the flow of the native source code generation process . this process is performed for each structure 300 in the model manager 104 and for all of the structure &# 39 ; s 300 dependent objects such as mappings 400 or filters 700 . upon start 1500 , initial boilerplate code is generated and the structure 300 source code is created 1501 as a c “ struct ” element in the preferred embodiment , shown in the pseudo - code output 1502 with all of the dependent properties of an event 600 as this forms the raw memory storage for all events . in the preferred embodiment , variables are directly named and included in the “ struct ” element as var_name where name is replaced with the variable identifier rather than the array representation shown in the pseudo - code 1502 . for each 1503 mapping 400 the preferred embodiment creates 1504 a new mapping c “ struct ” element and a new mapping function , as shown in the pseudo - code 1505 . the mapping “ struct ” transforms are directly named and includes as transform_name where name is replaced with the transform identifier rather than the array representation shown in the pseudo - code 1505 . the mapping function takes the parent structure or map ( either or , depending on whether the parent is a structure or map ) and calls the corresponding transform script for each transform in the mapping 400 , returning a new mapping_type instance . for each 1506 generator 500 the preferred embodiment creates 1507 a new generation function 504 , as shown in the pseudo - code 1508 . this function accepts the generator &# 39 ; s 500 settings and calls the corresponding initializer script with the settings for each initializer , returning a new event instance 600 of the structure_type upon completion . for each 1509 filter 700 the preferred embodiment creates 1510 a new counting function 704 and a new enumeration function 705 , as shown in the pseudo - code 1511 . the counting function 704 accepts the filter &# 39 ; s 700 settings and calls the criterion script for each criterion on each structure_type event instance 600 in the database . the count of how many event instances 600 matched the criteria is returned . the enumeration function accepts the filter &# 39 ; s 700 settings , an optional cursor object to page through results , and a fetch size parameter . the enumeration function 705 calls the criterion script for each criterion on each structure_type event instance 600 within the cursor and fetch size page window , returning the actual event data of structure_type for all event instances 600 matching the criteria . for each 1512 analysis 800 the preferred embodiment creates 1513 an analysis reduction type to hold analysis results and an analysis function 804 , as shown in the pseudo - code 1514 . the analysis function 804 accepts the analysis &# 39 ; 800 settings , a filter 700 , and settings for the filter . this function 804 then calls the reduction script with the setting , filter , and filter settings for each of the analysis &# 39 ; 800 reductions , reducing across the parameterized filter events for each reduction variable . once reduction is complete , the analysis function 804 returns the resulting analysis_type object . having completed generation of all “ structs ” and functions , the finishing boilerplate code is created 1515 , source generation 1006 is complete , and compilation and relinking 1007 may commence . any combination of one or more computer readable medium ( s ) may be utilized in connection with implementation of various embodiments . the computer readable medium may be a computer readable signal medium or a computer readable storage medium . a computer readable storage medium may be , for example , but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , or device , or any suitable combination of the foregoing . more specific examples ( a non - exhaustive list ) of the computer readable storage medium would include the following : an electrical connection having one or more wires , a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , a portable compact disc read - only memory ( cd - rom ), an optical storage device , a magnetic storage device , or any suitable combination of the foregoing . in the context of this document , a computer readable storage medium may be any tangible medium that can contain , or store a program for use by or in connection with an instruction implementation system , apparatus , or device . a computer readable signal medium may include a propagated data signal with computer readable program code embodied therein , for example , in baseband or as part of a carrier wave . such a propagated signal may take any of a variety of forms , including , but not limited to , electromagnetic , optical , or any suitable combination thereof . a computer readable signal medium may be any computer readable medium that is not a computer readable storage medium and that can communicate , propagate , or transport a program for use by or in connection with an instruction implementation system , apparatus , or device . program code embodied on a computer readable medium may be transmitted using any appropriate medium , including but not limited to wireless , wire line , optical fiber cable , rf , etc . or any suitable combination of the foregoing . computer program code for carrying out operations for aspects of the present invention may be written in any combination of one or more programming languages , including an object oriented programming language such as java , smalltalk , c ++ or the like and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may be implemented entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). it will be obvious to those having skill in the art that many changes may be made to the details of the above - described embodiments without departing from the underlying principles of the invention . the scope of the present invention should , therefore , be determined only by the following claims . | 6 |
hereafter , a detailed description will be given of an embodiment of the invention . fig1 is a diagram showing a configuration of a dc - dc converter control circuit according to an embodiment of the invention . the dc - dc converter control circuit according to the embodiment of the invention shown in fig1 is configured in such a way that there is provided a voltage reduction comparator 100 that outputs an interrupt signal when a feedback voltage vd of an output voltage vout 44 of the dc - dc converter is lower than a voltage reduction threshold value ( hereafter referred to as “ vref − δv ”) set lower than a reference voltage vref , and an interrupt signal is supplied to a pwm signal generator circuit 200 in accordance with a level value of an output vus 102 of the voltage reduction comparator 100 obtained from the result of a comparison by the voltage reduction comparator 100 of the feedback voltage vd 53 and the voltage “ vref − δv ” set to be lower than the reference voltage vref 11 by the predetermined voltage δv 101 . as a configuration other than this is the same as the configuration of a heretofore known dc - dc converter control circuit shown in fig4 , a description thereof will be omitted . with regard to the voltage reduction threshold value “ vref − δv ”, by inputting the reference voltage vref 11 into one input terminal of the voltage reduction comparator 100 and causing the voltage reduction comparator 100 to generate an input offset voltage of the predetermined voltage δv 101 , a configuration equivalent to one wherein “ vref − δv ” is input into a voltage reduction comparator with no input offset voltage may be realized , and a voltage lower by δv than the reference voltage vref 11 may be generated and supplied . to describe in detail , in fig1 , the output vus 102 of the voltage reduction comparator 100 is at a high level when the feedback voltage vd 53 is higher than “ vref − δv ”, and the pwm signal generator circuit 200 , based on an output voltage vea 12 of an error amplifier 10 , carries out a normal pwm control ( a fixed frequency pwm control ), in the same way as with the configuration of the heretofore known dc - dc converter control circuit shown in fig4 . meanwhile , in fig1 , the output vus 102 of the voltage reduction comparator 100 is at a low level when the feedback voltage vd 53 is lower than “ vref − δv ”. on vus 102 changing to a low level , the pwm signal generator circuit 200 interrupts the normal pwm operation , and carries out an operation of activating a switch sw 30 for an on time determined based on the output voltage vea 12 of the error amplifier 10 , and deactivating the switch sw 30 for a predetermined off time after the on time has elapsed . by repeating this operation , when the output voltage vout 44 of the dc - dc converter drops below a predetermined value (( vref − δv )/( voltage divider circuit 50 voltage division ratio ), a pulse that continually turns the switching element on before and after the predetermined off time ( this is set to be a short time ) is supplied , and it is possible to suppress the drop of the output voltage vout 44 until the output voltage vea 12 of the error amplifier 10 rises . fig2 is a diagram showing a configuration of the pwm signal generator circuit used in the dc - dc converter control circuit shown in fig1 . an operation of the pwm signal generator circuit shown in fig2 will be described while referring to the waveform diagrams shown in fig3 a and 3b . in the embodiment , it is assumed that the switch 30 is turned on when a switch drive signal vdrv 22 is at a high level , and that the switch 30 is turned off when the switch drive signal vdrv 22 is at a low level , but the invention is not limited to this . for example , in a case in which the switch 30 is turned off when the switch drive signal vdrv 22 is at a high level , and the switch 30 is turned on when the switch drive signal vdrv 22 is at a low level , it is sufficient to add an inverter circuit ( inverting gate element ) to the output of an and circuit 211 . with the pwm signal generator circuit in fig2 , as vrst 202 , which is the output of a nor circuit 213 , is always at a low level when the output vus 102 of the voltage reduction comparator 100 is at a high level ( refer to 5 of fig3 a ), the pwm signal generator circuit 200 carries out the normal operation ( the fixed frequency pwm control ). at this time , a capacitor cosc 203 is charged by a constant current supplied from a current source iosc ( 204 ), and when vosc 205 reaches vp 206 , the output of a first comparator osccomp 207 changes to a high level ( refer to 4 of fig3 a ), the gate input of a discharge transistor msw 209 changes to a high level via a trailing edge delay circuit 208 , and cosc 203 is discharged . because of this , vosc 205 becomes a gnd potential , and the output of the first comparator osccomp 207 returns to a low level ( refer to 4 of fig3 a ) ( strictly speaking , the output of the first comparator osccomp 207 returns to a low level at a timing at which vosc 205 becomes smaller than vp 206 , but as the discharge of cosc 203 is momentary , the timing at which vosc 205 becomes smaller than vp 206 and the timing at which vosc 205 becomes the gnd potential are essentially the same ). subsequently , the output of the trailing edge delay circuit 208 returns to a low level after a predetermined delay time td has elapsed ( refer to 7 of fig3 a ). because of this , msw 209 is turned off , and vosc 205 starts to rise again . by this being repeated , vosc 205 becomes a sawtooth wave ( refer to 1 of fig3 a ). meanwhile , a second comparator pwmcomp 210 outputs at a high level when the output voltage vea 12 of the error amplifier 10 is greater than vosc 205 ( refer to 3 of fig3 a ). consequently , the higher vea 12 is , the longer the period for which the second comparator pwmcomp 210 outputs at a high level . furthermore , by taking the logical product of the output of the second comparator pwmcomp 210 , and a signal wherein the output of the trailing edge delay circuit 208 is inverted in an inverter circuit 212 , in the and circuit 211 , the minimum value td of the off time is provided so that the output (= switch drive signal ) vdrv 201 of the and circuit 211 is always at a low level during the period for which the output of the trailing edge delay circuit 208 is at a high level ( refer to 2 and 7 of fig3 a ). meanwhile , in fig2 , when the output vus 102 of the voltage reduction comparator 100 is at a low level , the output (= switch drive signal ) vdrv 201 of the and circuit 211 changes to a high level ( refer to 2 of fig3 b ) at a point at which the output of the trailing edge delay circuit 208 changes to a low level ( refer to 7 of fig3 b ). meanwhile , when the output vus 102 of the voltage reduction comparator 100 is at a low level , vrst 202 , which is the output of the nor circuit 213 , changes to a high level only at a point at which the output of the second comparator pwmcomp 210 changes to a low level , and is at a low level at times other than this ( refer to 5 of fig3 b ). because of this , the trailing edge delay circuit 208 outputs at a high level when the output of the second comparator pwmcomp 210 changes to a low level ( refer to 7 of fig3 b ). because of this , as the gate input of msw 209 is at a high level , cosc 203 is discharged . when vosc 205 becomes the gnd potential , the output of the second comparator pwmcomp 210 returns to a high level ( refer to 3 of fig3 b ) ( strictly speaking , the output of the second comparator pwmcomp 210 returns to a high level at a timing at which vosc 205 becomes smaller than vea 12 , but as the discharge of cosc 203 is momentary , the timing at which vosc 205 becomes smaller than vea 12 and the timing at which vosc 205 becomes the gnd potential are essentially the same ). subsequently , the output of the trailing edge delay circuit 208 returns to a low level after the predetermined delay time td has elapsed , msw 209 is turned off , and vosc 205 starts to rise again ( refer to 1 of fig3 b ). as a result of this , the output (= switch drive signal ) vdrv 201 of the pwm signal generator circuit changes to a high level again after the predetermined time ( minimum off time ) td determined by the trailing edge delay circuit 208 has elapsed ( refer to 7 of fig3 b ). as a period from the output of the second comparator pwmcomp 210 changing to a low level until cosc 203 is discharged and the output of the second comparator pwmcomp 210 returns to a high level is momentary , the time for which the output of the trailing edge delay circuit 208 is at a high level is equivalent to td . then , as a period for which the output of the second comparator pwmcomp 210 is at a low level is momentary , a period for which the output (= switch drive signal ) vdrv 201 of the and circuit 211 is at a low level is also equivalent to td . that is , when the output vus 102 of the voltage reduction comparator 100 is at a low level , the on time of the switching element is determined based on the output voltage vea 12 of the error amplifier 10 , and the off time is the predetermined off time td . | 7 |
upon examination of the following detailed description the novel features of the present invention will become apparent to those of ordinary skill in the art or can be learned by practice of the present invention . it should be understood that the detailed description of the invention and the specific examples presented , while indicating certain embodiments of the present invention , are provided for illustration purposes only . various changes and modifications within the spirit and scope of the invention will become apparent to those of ordinary skill in the art upon examination of the following detailed description of the invention and claims that follow . the present invention relates to barriers that separate fuel and oxidant gases in high temperature systems . the invention is described with respect to high temperature solid oxide fuel cells ( sofc ) and cell stacks operating with air and hydrogen - containing fuel gas . however , it will be apparent to those skilled in the art that the following detailed description is similarly applicable to other types of high temperature systems . examples include molten carbonate fuel cells , and fuel processors that require barriers and seals between reducing and oxidizing substances . fig1 illustrates a metallic barrier useful in the present invention , where the metallic barrier ( e . g ., in the form of a metallic plate ) preferably provides a dynamic balance between fuel diffusion and oxygen diffusion . as shown in fig1 , a metallic plate 1 is exposed to hydrogen - containing fuel gas 5 on a first surface 2 of the metallic plate 1 , and is exposed to oxidant gas 6 on a second surface 3 of the metallic plate 1 . an adherent oxide layer 4 can be formed on the second surface 3 . without fuel gas present , the oxide layer tends to grow thicker over time through a combination of oxygen diffusion inward ( toward the metallic plate 1 ) and metal ion diffusion outward through the oxide layer 4 . a metal such as nickel forms a metal - deficient oxide that contains vacancies at metal sites in a crystal lattice . the vacancy concentration increases toward the metal - metal oxide interface because of the presence of oxygen in the air , and the concentration gradient decreases as the oxide layer grows thicker . metal ions migrate to the metal - metal oxide interface by hopping from metal vacancy to metal vacancy under the influence of the vacancy concentration gradient . as used herein , the “ metal - metal oxide interface ” is defined as a region in which the oxide layer 4 contacts the metallic plate 1 . with the fuel gas 5 present on the other side of the metallic plate 1 , hydrogen diffuses through the metallic plate 1 to the metal - metal oxide interface . in practice , the hydrogen contained in the fuel gas 5 diffuses through the metallic plate 1 as monatomic hydrogen . the monatomic hydrogen loses electrons more easily than a relatively noble metal such as nickel in electron - deficient oxidizing environments . as a result , the hydrogen sacrificially ionizes to satisfy the electron deficiency , forming protons and leaving the metal of the metallic plate 1 unchanged . the protons migrate to the metal - metal oxide interface by hopping from metal vacancy to metal vacancy , and combine with oxygen to form water vapor that escapes into the air . under steady - state conditions , an equilibrium metal oxide layer thickness is reached . this equilibrium thickness is a function of the fuel gas 5 and oxidant gas 6 composition and pressures , metal function of the vacancy migration rate and the hydrogen diffusion rates through the metallic plate 1 . the oxide layer is expected to be thin compared to the metal layer , since hydrogen diffuses more rapidly in metal than vacancies in the oxide layer . if operating conditions shift to favor a thicker oxide layer , metal is oxidized and transported to the surface . if operating conditions shift to favor a thinner oxide layer , then oxide at the metal - metal oxide interface is reduced to metal , forming water vapor . the water vapor then diffuses through the oxide layer along grain boundaries and through pores . the metallic plate 1 may be selected from a variety of elemental metals , alloys , and cermets containing ceramic particles in a metallic matrix . it may also be a layered structure in which the composition changes through the thickness of the plate . the metallic plate 1 should be suitably capable of forming an adherent oxide layer having a higher resistance to oxidation than hydrogen . nickel and copper are examples of elemental metals with these characteristics . fig2 a shows a deposited metal film bipolar separator embodying the invention as fabricated before it is put in service . the substrate 20 is a porous sofc cathode , which can be made of doped lanthanum manganite , for example . an electronically conductive porous refractory layer 21 , which can be made of doped lanthanum chromite , for example , is applied to the substrate 20 by plasma spraying or another suitable technique , such that particles 22 comprising the layer 21 preferably are in conductive contact with the substrate . the metallic plate 1 is formed over the porous layer 21 by a deposition process such as sputtering that provides a dense metallic layer . plate 1 has a free first surface 2 and an opposite second surface 3 contacting the porous layer 21 . the second surface 3 is divided into areas 23 that are bonded to the particles 22 and areas 24 that bridge gaps between the particles 22 . fig2 b shows the metal film bipolar separator of fig2 a during service at high temperature with fuel gas contacting surface 2 and oxidant gas contacting surface 3 ( see , e . g ., fuel gas 5 and oxidant gas 6 of fig1 ). this results in the formation of an adherent oxide layer 4 on areas 24 that are in contact with the oxidant gas . the areas 23 are shielded from the oxidant gas by the particles 22 , and hydrogen diffusing into the plate 1 from the first surface 2 limits the penetration of the oxide layer 4 into the areas 23 . this assures that metallic contact and electronic conductivity are maintained near approximately the centers of the areas 23 over a range of conditions . the porous layer 21 also has the effect of reducing the oxygen diffusion of the system , since only the areas 24 contribute to the oxygen diffusion area . this reduces the amount of hydrogen that must be used to maintain the metallic structure . fig3 a shows a metal foil or plate bipolar separator embodying the invention as fabricated before it is put in service . the substrate is the metal foil or plate 1 . an electronically conductive porous refractory layer 21 , which can be made of doped lanthanum chromite , for example , is applied to the plate 1 by plasma spraying or another suitable technique such that particles 22 comprising the layer 21 preferably are in close conductive contact with the plate . the plate 1 has a free first surface 2 and an opposite second surface 3 contacting the porous layer 21 . the second surface 3 is divided into areas 23 that are bonded to the particles 22 and areas 24 that bridge the gaps between the particles 22 . fig3 b shows the system of fig3 a during service at high temperature with fuel gas contacting surface 2 and oxidant gas contacting surface 3 . as in the metal film bipolar separator of fig2 a and 2b , this results in the formation of an adherent oxide layer 4 on areas 24 that are in contact with the oxidant gas . the areas 23 are shielded from the oxidant gas by the particles 22 , and hydrogen diffusing into the plate 1 from the first surface 2 limits the penetration of the oxide layer 4 into the areas 23 . this assures that metallic contact and electronic conductivity are maintained near approximately the centers of the areas 23 over a range of conditions . the porous layer 21 also has the effect of reducing the oxygen diffusion of the system , since only the areas 24 contribute to the oxygen diffusion area . this reduces the amount of hydrogen that must be used to maintain the metallic structure . fig4 illustrates a seal 40 according to the invention . the seal 40 is clamped between first and second members 41 and 42 , respectively , thereby separating fuel gas in region 43 from oxidant gas in region 44 . the seal 40 includes a metal shell 45 preferably covering approximately three sides of a porous core 46 , the porous core 46 being arranged such that fuel gas contacts an open fourth side thereof . the porous core 46 preferably allows the fuel gas to contact an inside 47 of the metal shell 45 . the clamping force applied by the first and second members 41 and 42 can deform the surface of the metal shell 45 , forming barrier zones 49 and 50 between the fuel and oxidant gases in regions 43 and 44 , respectively . the oxidant gas contacts an exposed outside surface 51 of the metal shell 45 , forming an oxide layer 48 . the hydrogen from the fuel cell region 43 which contacts the inside 47 of the metal shell 45 diffuses into the metal of the metal shell 45 , thereby limiting the penetration of the oxide layer 48 . oxygen cannot effectively form an oxide layer on portions 52 and 53 of the metal shell 45 , because oxidant gas contact is blocked by the barrier zones 49 and 50 , and the reducing action of the hydrogen dominates . this results in the formation of transition regions near the barrier zones 49 and 50 where the oxide layer 48 thins and vanishes . the overall effect is that the seal 40 is a metal barrier that is maintained in a compliant , metallic state by the diffusion of a small amount of hydrogen that limits the oxide layer growth . the metal shell 45 may be selected from a variety of elemental metals , alloys , and cermets containing ceramic particles in a metallic matrix . it may also be a layered structure in which the composition changes as a function of the thickness of the metal shell 45 . preferably the selected material of the metal shell 45 is capable of forming an adherent oxide layer and has a higher resistance to oxidation than hydrogen . nickel and copper are examples of elemental metals with these characteristics . the porous core 46 may be any material stable in a high temperature fuel gas environment that allows the passage of gas , and provides the desired levels of compliance and support . the porous core 45 can be omitted in cases where the metal shell 45 is self - supporting to the extent that the required gas access is maintained . more broadly , any configuration of metal shell 45 that contains internal passages or porosity that bring fuel gas within diffusion distance of the oxide layer is within the scope of the invention . coatings , including conductive or non - conductive refractory particles that reduce the oxygen diffusion area through the surfaces exposed to oxidant gas , are also within the scope of the invention . the foregoing embodiments of the present invention have been presented for the purposes of illustration and description . these descriptions and embodiments are not intended to be exhaustive or to limit the invention to the precise form disclosed , and obviously many modifications and variations are possible in the light of the above disclosure . the embodiments were chosen and described in order to best explain the principle of the invention and its practical applications to thereby enable others skilled in the art to best utilize the invention in its various embodiment and with various modifications as are suited to the particular use contemplated . it intended that the invention be defined by the following claims . the term “ refractory ” is used in the claims to designate solid materials that remain unaffected by oxidant and fuel gases at elevated temperatures . | 7 |
at least some embodiments in accordance with the present invention relate to systems and processes through which a user may design data center configurations . these systems may facilitate this design activity by allowing the user to create models of data center configurations from which performance metrics may be determined . both the systems and the user may employ these performance metrics to determine alternative data center configurations that meet various design objectives . further , in at least one embodiment , a system will provide an initial layout of data center equipment and conduct a cooling analysis on the layout in real time . as described in u . s . patent application ser . no . 12 / 019109 , titled “ system and method for evaluating equipment rack cooling ”, filed jan . 24 , 2008 ( referred to herein as “ the &# 39 ; 109 application ”), and in u . s . patent application ser . no . 11 / 342 , 300 , titled “ methods and systems for managing facility power and cooling ” filed jan . 27 , 2006 ( referred to herein as “ the &# 39 ; 300 application ”), both of which are assigned to the assignee of the present application , and both of which are hereby incorporated herein by reference in their entirety , typical equipment racks in modern data centers draw cooling air in the front of the rack and exhaust air out the rear of the rack . the equipment racks , and in - row coolers are typically arranged in rows in an alternating front / back arrangement creating alternating hot and cool aisles in a data center with the front of each row of racks facing the cool aisle and the rear of each row of racks facing the hot aisle . adjacent rows of equipment racks separated by a cool aisle may be referred to as a cool aisle cluster , and adjacent rows of equipment racks separated by a hot aisle may be referred to as a hot aisle cluster . as readily apparent to one of ordinary skill in the art , a row of equipment racks may be part of one hot aisle cluster and one cool aisle cluster . in descriptions and claims herein , equipment in racks , or the racks themselves , may be referred to as cooling consumers , and in - row cooling units and / or computer room air conditioners ( cracs ) may be referred to as cooling providers . in the referenced applications , tools are provided for analyzing the cooling performance of a cluster of racks in a data center . in these tools , multiple analyses may be performed on different layouts to attempt to optimize the cooling performance of the data center . in typical prior methods and systems for designing and analyzing the layout of clusters in a data center , the methods and systems are either limited for use with simple clusters having two equal - length rows and no gaps or openings in the rows , or if not limited to simple clusters , involve the use of complex algorithms that typically cannot be performed in real - time . in data centers , there are many equipment groupings that have unequal row length or contain gaps and are not proper clusters easily analyzed by prior techniques . for at least one embodiment , an improper cluster is defined herein as including a two - row grouping of racks , and potentially coolers , around a common cool or hot aisle in which there are gaps in the rows or unequal - length rows . a single row may constitute an improper cluster . a continuous break between equipment in a row greater than three feet may constitute a break in the row and the row may be divided into multiple proper and improper clusters , or considered to be one improper cluster . in at least one embodiment , a method is provided for predicting the cooling performance of an improper cluster in a data center in real - time . the method may be incorporated in a system having capabilities for predicting the cooling performance of proper clusters and for performing other design and analysis functions of equipment in a data center . the aspects disclosed herein in accordance with the present invention , are not limited in their application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings . these aspects are capable of assuming other embodiments and of being practiced or of being carried out in various ways . examples of specific implementations are provided herein for illustrative purposes only and are not intended to be limiting . in particular , acts , elements and features discussed in connection with any one or more embodiments are not intended to be excluded from a similar role in any other embodiments . for example , according to one embodiment of the present invention , a computer system is configured to perform any of the functions described herein , including but not limited to , configuring , modeling and presenting information regarding specific data center configurations . further , computer systems in embodiments of the data center may be used to automatically measure environmental parameters in a data center , and control equipment , such as chillers or coolers to optimize performance . moreover , the systems described herein may be configured to include or exclude any of the functions discussed herein . thus the invention is not limited to a specific function or set of functions . also , the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use herein of “ including ,” “ comprising ,” “ having ,” “ containing ,” “ involving ,” and variations thereof is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . various aspects and functions described herein in accordance with the present invention may be implemented as hardware or software on one or more computer systems . there are many examples of computer systems currently in use . these examples include , among others , network appliances , personal computers , workstations , mainframes , networked clients , servers , media servers , application servers , database servers and web servers . other examples of computer systems may include mobile computing devices , such as cellular phones and personal digital assistants , and network equipment , such as load balancers , routers and switches . further , aspects in accordance with the present invention may be located on a single computer system or may be distributed among a plurality of computer systems connected to one or more communications networks . for example , various aspects and functions may be distributed among one or more computer systems configured to provide a service to one or more client computers , or to perform an overall task as part of a distributed system . additionally , aspects may be performed on a client - server or multi - tier system that includes components distributed among one or more server systems that perform various functions . thus , the invention is not limited to executing on any particular system or group of systems . further , aspects may be implemented in software , hardware or firmware , or any combination thereof . thus , aspects in accordance with the present invention may be implemented within methods , acts , systems , system elements and components using a variety of hardware and software configurations , and the invention is not limited to any particular distributed architecture , network , or communication protocol . fig1 shows a block diagram of a distributed computer system 100 , in which various aspects and functions in accord with the present invention may be practiced . distributed computer system 100 may include one more computer systems . for example , as illustrated , distributed computer system 100 includes computer systems 102 , 104 and 106 . as shown , computer systems 102 , 104 and 106 are interconnected by , and may exchange data through , communication network 108 . network 108 may include any communication network through which computer systems may exchange data . to exchange data using network 108 , computer systems 102 , 104 and 106 and network 108 may use various methods , protocols and standards , including , among others , token ring , ethernet , wireless ethernet , bluetooth , tcp / ip , udp , http , ftp , snmp , sms , mms , ss7 , json , soap , and corba . to ensure data transfer is secure , computer systems 102 , 104 and 106 may transmit data via network 108 using a variety of security measures including tsl , ssl or vpn among other security techniques . while distributed computer system 100 illustrates three networked computer systems , distributed computer system 100 may include any number of computer systems and computing devices , networked using any medium and communication protocol . various aspects and functions in accordance with the present invention may be implemented as specialized hardware or software executing in one or more computer systems including computer system 102 shown in fig1 . as depicted , computer system 102 includes processor 110 , memory 112 , bus 114 , interface 116 and storage 118 . processor 110 may perform a series of instructions that result in manipulated data . processor 110 may be a commercially available processor such as an intel pentium , motorola powerpc , sgi mips , sun ultrasparc , or hewlett - packard pa - risc processor , but may be any type of processor or controller as many other processors and controllers are available . processor 110 is connected to other system elements , including one or more memory devices 112 , by bus 114 . memory 112 may be used for storing programs and data during operation of computer system 102 . thus , memory 112 may be a relatively high performance , volatile , random access memory such as a dynamic random access memory ( dram ) or static memory ( sram ). however , memory 112 may include any device for storing data , such as a disk drive or other non - volatile storage device . various embodiments in accordance with the present invention may organize memory 112 into particularized and , in some cases , unique structures to perform the aspects and functions disclosed herein . components of computer system 102 may be coupled by an interconnection element such as bus 114 . bus 114 may include one or more physical busses , for example , busses between components that are integrated within a same machine , but may include any communication coupling between system elements including specialized or standard computing bus technologies such as ide , scsi , pci and infiniband . thus , bus 114 enables communications , for example , data and instructions , to be exchanged between system components of computer system 102 . computer system 102 also includes one or more interface devices 116 such as input devices , output devices and combination input / output devices . interface devices may receive input or provide output . more particularly , output devices may render information for external presentation . input devices may accept information from external sources . examples of interface devices include keyboards , mouse devices , trackballs , microphones , touch screens , printing devices , display screens , speakers , network interface cards , etc . interface devices allow computer system 102 to exchange information and communicate with external entities , such as users and other systems . storage system 118 may include a computer readable and writeable nonvolatile storage medium in which instructions are stored that define a program to be executed by the processor . storage system 118 also may include information that is recorded , on or in , the medium , and this information may be processed by the program . more specifically , the information may be stored in one or more data structures specifically configured to conserve storage space or increase data exchange performance . the instructions may be persistently stored as encoded signals , and the instructions may cause a processor to perform any of the functions described herein . the medium may , for example , be optical disk , magnetic disk or flash memory , among others . in operation , the processor or some other controller may cause data to be read from the nonvolatile recording medium into another memory , such as memory 112 , that allows for faster access to the information by the processor than does the storage medium included in storage system 118 . the memory may be located in storage system 118 or in memory 112 , however , processor 110 may manipulate the data within the memory 112 , and then copies the data to the medium associated with storage system 118 after processing is completed . a variety of components may manage data movement between the medium and integrated circuit memory element and the invention is not limited thereto . further , the invention is not limited to a particular memory system or storage system . although computer system 102 is shown by way of example as one type of computer system upon which various aspects and functions in accordance with the present invention may be practiced , aspects of the invention are not limited to being implemented on the computer system as shown in fig1 . various aspects and functions in accord with the present invention may be practiced on one or more computers having a different architectures or components than that shown in fig1 . for instance , computer system 102 may include specially - programmed , special - purpose hardware , such as for example , an application - specific integrated circuit ( asic ) tailored to perform a particular operation disclosed herein . while another embodiment may perform the same function using several general - purpose computing devices running mac os system x with motorola powerpc processors and several specialized computing devices running proprietary hardware and operating systems . computer system 102 may be a computer system including an operating system that manages at least a portion of the hardware elements included in computer system 102 . usually , a processor or controller , such as processor 110 , executes an operating system which may be , for example , a windows - based operating system , such as , windows nt , windows 2000 ( windows me ), windows xp or windows vista operating systems , available from the microsoft corporation , a mac os system x operating system available from apple computer , one of many linux - based operating system distributions , for example , the enterprise linux operating system available from red hat inc ., a solaris operating system available from sun microsystems , or a unix operating system available from various sources . many other operating systems may be used , and embodiments are not limited to any particular implementation . the processor and operating system together define a computer platform for which application programs in high - level programming languages may be written . these component applications may be executable , intermediate , for example , c −, bytecode or interpreted code which communicates over a communication network , for example , the internet , using a communication protocol , for example , tcp / ip . similarly , aspects in accord with the present invention may be implemented using an object - oriented programming language , such as . net , smalltalk , java , c ++, ada , or c # ( c - sharp ). other object - oriented programming languages may also be used . alternatively , functional , scripting , or logical programming languages may be used . additionally , various aspects and functions in accordance with the present invention may be implemented in a non - programmed environment , for example , documents created in html , xml or other format that , when viewed in a window of a browser program , render aspects of a graphical - user interface or perform other functions . further , various embodiments in accord with the present invention may be implemented as programmed or non - programmed elements , or any combination thereof . for example , a web page may be implemented using html while a data object called from within the web page may be written in c ++. thus , the invention is not limited to a specific programming language and any suitable programming language could also be used . further , in at least one embodiment , the tool may be implemented using vba excel . a computer system included within an embodiment may perform additional functions outside the scope of the invention . for instance , aspects of the system may be implemented using an existing commercial product , such as , for example , database management systems such as sql server available from microsoft of seattle wash ., oracle database from oracle of redwood shores , calif ., and mysql from mysql ab of uppsala , sweden or integration software such as web sphere middleware from ibm of armonk , n . y . however , a computer system running , for example , sql server may be able to support both aspects in accord with the present invention and databases for sundry applications not within the scope of the invention . example system architecture fig2 presents a context diagram including physical and logical elements of distributed system 200 . as shown , distributed system 200 is specially configured in accordance with the present invention . the system structure and content recited with regard to fig2 is for exemplary purposes only and is not intended to limit the invention to the specific structure shown in fig2 . as will be apparent to one of ordinary skill in the art , many variant system structures can be architected without deviating from the scope of the present invention . the particular arrangement presented in fig2 was chosen to promote clarity . information may flow between the elements , components and subsystems depicted in fig2 using any technique . such techniques include , for example , passing the information over the network via tcp / ip , passing the information between modules in memory and passing the information by writing to a file , database , or some other non - volatile storage device . other techniques and protocols may be used without departing from the scope of the invention . referring to fig2 , system 200 includes user 202 , interface 204 , data center design and management system 206 , communications network 208 and data center database 210 . system 200 may allow user 202 , such as a data center architect or other data center personnel , to interact with interface 204 to create or modify a model of one or more data center configurations . according to one embodiment , interface 204 may include aspects of the floor editor and the rack editor as disclosed in patent cooperation treaty application no . pct / us08 / 63675 , entitled methods and systems for managing facility power and cooling , filed on may 15 , 2008 , which is incorporated herein by reference in its entirety and is hereinafter referred to as pct / us08 / 63675 . in other embodiments , interface 204 may be implemented with specialized facilities that enable user 202 to design , in a drag and drop fashion , a model that includes a representation of the physical layout of a data center or any subset thereof . this layout may include representations of data center structural components as well as data center equipment . the features of interface 204 , as may be found in various embodiments in accordance with the present invention , are discussed further below . in at least one embodiment , information regarding a data center is entered into system 200 through the interface , and assessments and recommendations for the data center are provided to the user . further , in at least one embodiment , optimization processes may be performed to optimize cooling performance and energy usage of the data center . as shown in fig2 , data center design and management system 206 presents data design interface 204 to user 202 . according to one embodiment , data center design and management system 206 may include the data center design and management system as disclosed in pct / us08 / 63675 . in this embodiment , design interface 204 may incorporate functionality of the input module , the display module and the builder module included in pct / us08 / 63675 and may use the database module to store and retrieve data . as illustrated , data center design and management system 206 may exchange information with data center database 210 via network 208 . this information may include any information required to support the features and functions of data center design and management system 206 . for example , in one embodiment , data center database 210 may include at least some portion of the data stored in the data center equipment database described in pct / us08 / 63675 . in another embodiment , this information may include any information required to support interface 204 , such as , among other data , the physical layout of one or more data center model configurations , the production and distribution characteristics of the cooling providers included in the model configurations , the consumption characteristics of the cooling consumers in the model configurations , and a listing of equipment racks and cooling providers to be included in a cluster . in one embodiment , data center database 210 may store types of cooling providers , the amount of cool air provided by each type of cooling provider , and a temperature of cool air provided by the cooling provider . thus , for example , data center database 210 includes records of a particular type of crac unit that is rated to deliver airflow at the rate of 5 , 600 cfm at a temperature of 68 degrees fahrenheit . in addition , the data center database 210 may store one or more cooling metrics , such as inlet and outlet temperatures of the cracs and inlet and outlet temperatures of one or more equipment racks . the temperatures may be periodically measured and input into the system , or in other embodiments , the temperatures may be continuously monitored using devices coupled to the system 200 . data center database 210 may take the form of any logical construction capable of storing information on a computer readable medium including , among other structures , flat files , indexed files , hierarchical databases , relational databases or object oriented databases . the data may be modeled using unique and foreign key relationships and indexes . the unique and foreign key relationships and indexes may be established between the various fields and tables to ensure both data integrity and data interchange performance . the computer systems shown in fig2 , which include data center design and management system 206 , network 208 and data center equipment database 210 , each may include one or more computer systems . as discussed above with regard to fig1 , computer systems may have one or more processors or controllers , memory and interface devices . the particular configuration of system 200 depicted in fig2 is used for illustration purposes only and embodiments of the invention may be practiced in other contexts . thus , embodiments of the invention are not limited to a specific number of users or systems . in at least one embodiment , which will now be described , a tool is provided that predicts cooling performance for an improper hot aisle cluster in real time and displays results of the prediction along with a model of the improper cluster . fig3 shows a model of an improper cluster of racks 300 . the improper cluster includes two rows of racks a and b separated by a hot aisle 302 . each row includes racks r and coolers c . row a includes 6 racks and 3 coolers and row b includes 4 racks and 1 cooler . row b also includes two gaps 304 and 306 . in one embodiment , the racks are standard nineteen inch equipment racks having an overall width of 24 inches and the coolers have a width of 12 inches . however , embodiments of the invention may be used with racks and coolers of other sizes . gap 304 is approximately two feet wide and gap 306 , representing a difference in lengths of the rows a and b , is approximately 4 feet wide . as shown in fig3 , in accordance with some embodiments , the results of the prediction of cooling performance may be displayed directly on the racks in the model . in fig3 , the results are shown as capture index ( in percentage ) on each of the racks in the model . in embodiments of the invention , different performance metrics can be used to evaluate the cooling performance of an improper cluster . in one embodiment , the performance metric is capture index . capture index , and methods of determining capture index are described in greater detail in the &# 39 ; 109 and &# 39 ; 300 applications referenced above . the cold - aisle capture index for a rack is defined in at least some embodiments as the fraction of air ingested by the rack which originates from local cooling resources ( e . g ., perforated floor tiles or local coolers ). the hot - aisle capture index is defined as the fraction of air exhausted by a rack which is captured by local extracts ( e . g ., local coolers or return vents ). ci therefore varies between 0 and 100 % with better cooling performance generally indicated by greater ci values . in a cold - aisle analysis , high ci &# 39 ; s ensure that the bulk of the air ingested by a rack comes from local cooling resources rather than being drawn from the room environment or from air which may have already been heated by electronics equipment . in this case , rack inlet temperatures will closely track the perforated - tile airflow temperatures and , assuming these temperatures are within the desired range , acceptable cooling will be achieved . in a hot - aisle analysis , high ci &# 39 ; s ensure that rack exhaust is captured locally and there is little heating of the surrounding room environment . while good ( high ) ci values typically imply good cooling performance ; low ci values do not necessarily imply unacceptable cooling performance . for example , in a rack in a raised - floor environment which draws most of its airflow from the surrounding room environment rather than from the perforated tiles , the rack &# 39 ; s cold - aisle ci will be low ; however , if the surrounding room environment is sufficiently cool , the rack &# 39 ; s inlet temperature may still be acceptable . in this case , the rack &# 39 ; s cooling needs are met by the external room environment rather than perforated tiles within the rack &# 39 ; s cluster . if this process is repeated many times across the data center , facility cooling will be complex and may be unpredictable . high ci values lead to inherently scalable cluster layouts and more predictable room environments . in one embodiment , a tool operable on one or more computer systems described above determines capture index for racks of an improper cluster . in doing so , the improper cluster is first analyzed as a proper cluster , with all gaps and any row - length mismatches filled with blanking panels ( or “ dummy ” racks with zero airflow ). the capture index is determined for each of the racks in the proper cluster using any of a number of techniques for determining the ci , including the algebraic , neural network and pda - cfd techniques described in the &# 39 ; 109 and &# 39 ; 300 applications referenced above . once the ci is determined for the proper cluster , a corrector model is applied to the results to correct for the negative effects created by gaps in the improper cluster . gaps in the rows of an improper cluster provide an opening to allow air to escape from the aisle between the two rows in a cluster having a negative effect on the capture index . the corrector model determines the percentage of reduction of the ci for each rack in the improper cluster . the final ci for a rack i in an improper cluster can be expressed as follows using equation ( 1 ): ci i blank is the “ benchmark ” ci value for rack i when all the gaps and row length mismatches in the cluster are replaced by blanking panels . corrector i is the percentage reduction ( expressed as a decimal value ) of the ci of rack i . in equations discussed herein , rack locations are designated as a i and b j . the designation a or b indicates which row the rack is contained in and the subscript i or j indicates the slot in the row containing the rack , which may be counted from left or right . for example , in the cluster of fig3 , row a includes 6 racks and 3 coolers for a total of 9 objects or 30 6 - inch slots and row b includes 4 racks , one cooler and two gaps for a totally of 7 objects or 30 6 - inch slots . the ci corrector is related to the distance between the rack of interest and all the gaps in the improper cluster where each 6 - inch “ slot ” ( in an open “ gap section ” like 304 or 306 of fig3 ) is typically considered one gap . in one embodiment , the percentage reduction of the ci value of a certain rack at location a i can be adequately represented as follows : corrector ai is the percentage reduction ( expressed as a decimal value ) of the ci of rack i in row a δx ( i , j ) is the horizontal distance between locations ( slots ) i and j . in equation ( 2 ), the numerator is equal to zero when there are no gaps and hence the corrector ai becomes zero . in this case , the cluster is a proper cluster and no correction is needed . the closer a gap is to a rack , the larger the corrector for that rack and hence the lower the ci of the rack . the empirical constants x , y and z can be determined by comparing the calculations for a large number of layouts to corresponding “ benchmark ” cases typically created by cfd simulation . the constants in the model are then adjusted to give the best overall agreement with the benchmark cases based on various metrics including ci . the corrector described herein can be applied to any type of improper cluster , which might include hot aisle improper clusters with row - based coolers and cold aisle improper clusters with row - based coolers and / or perforated tiles . in one example , for hot aisle improper clusters with row - based coolers , constants x and y are fixed for all cluster configurations , but constant z varies with aisle width as shown in the table below . for a single - row improper cluster , z is 2 . in one example , for cold aisle improper clusters with row - based coolers , constants x and y are fixed for all cluster configurations , but the constant z varies with aisle width as shown in the table below . for a single row improper cluster , z is 2 . in one example , for cold aisle improper clusters with perforated tiles , constants x and y are fixed for all cluster configurations , but constant z varies with aisle width as shown in the table below . for a single row improper cluster , z is 0 . 18 . in one example , for cold aisle improper clusters with both row - based coolers and perforated tiles , the calculation of constant x can be expressed as follows using equation ( 3 ): where , x pt is the constant x used in the cold - aisle - cluster - with - perforated - tiles applications for the same cold aisle width ; x ir is the constant x used in the cold aisle cluster - with - row - based - coolers applications for the same cold aisle width ; and α is the fraction of supply airflow delivered by the perforated tiles . constants y and z are be determined in a similar manner . it is noted that the effect of the presence of gaps on cooling performance is greater for layouts with row - based coolers than for raised floor applications due to the strong horizontal airflow patterns associated with row - based coolers . fig4 provides a flow chart of a process 400 for determining the ci for equipment racks of an improper cluster using the corrector model described above in accordance with one embodiment . first at stage 402 of the process 400 , information regarding the layout for the improper cluster is loaded into the tool . the information may include power consumption values for each of the racks , cooling capacities of each of the coolers and location of the racks and coolers in the layout . at least some of the information may have previously been stored in a database contained in a computer system implementing the tool transmitted to the computer system via a network or loaded into the system by a user . at stage 404 , gaps are identified in the improper cluster , and the gaps ( including mismatches at the end of a row ) are covered in the layout with blanking panels or replaced with racks having no airflow . the ci for each rack in the improper cluster is then determined ( stage 406 ) using one of a number of techniques as discussed above . as part of stage 406 , the corrector for each rack is determined and applied to the ci . at stage 408 , the model is then displayed ( and may be printed ) with the corrected ci for each of the racks . at stage 410 , the process ends . in some embodiments , the displayed model may provide additional indications for out of tolerance ci values , such as warning labels or through the use of color codes . further , in some embodiments , when an out of tolerance condition is indicated , a user may be prompted to rearrange the racks to find a more satisfactory solution . in another embodiment , a tool for determining ci for equipment racks in improper hot aisle clusters utilizes an embedded algebraic model . this embedded algebraic model may be included within existing algebraic models ( or similar models ) for proper clusters or may be implemented as a stand alone tool . one example of an algebraic model with which the embedded algebraic model may be used is described in the &# 39 ; 109 and &# 39 ; 300 applications referenced above . in the embedded algebraic model of one embodiment , airflow which passes through gaps is explicitly estimated in order to account for the unfavorable effects of gaps on the ci of each rack . in general , there are two types of airflows through any given gap : an inflow , q gap in , and an outflow , q gap out . both “ in ” and “ out ” airflows may be simultaneously present in the same gap . the model of airflows used in at least one embodiment of the tool need not have a direct , accurate physical interpretation for the tool to be effective . in other words , if the “ in ” term computed by the tool is , for example , 375 cfm ; it does not mean that the actual inflow through the gap must be 375 cfm for the tool to be effective . rather , the use of the “ in ” and “ out ” flow terms allow for more degrees of freedom in the tool with which the tool may be “ tuned .” the inflow , q gap in , is determined by the cooler airflow rate as well as the distance between all the coolers and the gap . it has been found that the airflow rate which comes in through a gap i in row a into a hot aisle can be adequately represented as shown in equation ( 4 ) below : ( q ai ) gap in is the airflow rate that comes in through the gap at location a i ( q aj ) cap self is the airflow rate captured by the cooler at location a j ( q bj ) cap self is the airflow rate captured by the cooler at location b j δx ( i , j ) is the horizontal distance between locations ( slots ) i and j x 1 and y 1 are empirical constants and x 3 is the empirical “ coupling ” constant accounting for effects from the opposite row . similarly , the outflow , q gap out can be determined by the rack airflow rate as well as the distance between all the racks and the gap . it has been found that the airflow rate which leaves the hot aisle through a gap i in row a can be adequately represented as : ( q ai ) gap out is the airflow rate that leaves through the gap at location a i ( q aj ) sup self is the airflow rate supplied by the rack at location a j ( q bj ) sup self is the airflow rate supplied by the rack at location b j δx ( i , j ) is the horizontal distance between locations ( slots ) i and j x 2 and y 2 are empirical constants and y 3 is the empirical “ coupling ” constant accounting for effects from the opposite row . the constants are , again , determined by comparing the calculations for a large number of layouts to corresponding “ benchmark ” cases typically created by cfd simulation . the constants in the model are then adjusted to give the best overall agreement with the benchmark cases based on various metrics including ci . when calculating the net airflow that can be supplied to a particular location a i using the current hot - aisle algebraic calculator , the tool accounts for the airflow which escapes the hot aisle through all the gaps . to accomplish this , two extra terms are subtracted from the equation to calculate the ( q aj ) cap net ( from the &# 39 ; 109 application referenced above ) one for row a and one for row b as shown by equation ( 6 ) below : ( q ai ) cap net is the net maximum airflow that can be captured at location a i including contributions from all coolers in the cluster ( q aj ) cap self is the airflow captured by the cooler at location a j ( q bj ) cap self is the airflow captured by the cooler at location b j ( q aj ) gap out is the airflow rate that leaves through the gap at location a j ( q bj ) gap out is the airflow rate that leaves through the gap at location b j δx ( i , j ) is the horizontal distance between locations ( slots ) i and j a , b , x 4 , and y 4 are empirical constants c is an empirical “ coupling ” constant accounting for effects from the opposite row similarly , the airflow which enters the hot aisle through gaps can also be accounted for by adding two extra terms , q gap in one for row a and one for row b , when calculating the ( q aj ) sup net as shown by equation ( 7 ) below : ( q ai ) sup net is the net maximum airflow that can be supplied to location a i including contributions from all racks in the cluster ( q aj ) sup self is the airflow supplied by the rack at location a j ( q bj ) sup self is the airflow supplied by the rack at location b j ( q aj ) gap in is the airflow rate that comes in through the gap at location a j ( q bj ) gap in is the airflow rate that comes in through the gap at location b j δx ( i , j ) is the horizontal distance between locations ( slots ) i and j e , f , x 5 , and y 5 are empirical constants d is an empirical “ coupling ” constant accounting for effects from the opposite row all the empirical constants can be determined by comparing the calculations for a large number of layouts to corresponding “ benchmark ” cases typically created by cfd simulation . the constants in the model are then adjusted to give the best overall agreement with the benchmark cases based on various metrics including ci . in one example , empirical constants are determined as shown in the following table : the ci is then equal to the ratio of net airflow captured and net airflow supplied at any location expressed as a percentage with values capped at 100 %. in the embodiments above , an embedded algebraic model is provided for determining capture index for equipment racks in the hot aisle of an improper cluster of racks . as readily understood by one of ordinary skill in the art , analogous models may be created for determining the capture index for equipment racks in other layouts including cold aisles with row - based coolers , cold aisles with perforated tiles , and cold aisles with both row - based coolers and perforated tiles . using the algebraic method described above , the ci for racks in an improper cluster may be determined . the results of the analysis can then be used to layout equipment in a data center as described above or to rearrange the layout to ensure that specified cooling requirements are met . in one embodiment , calculations are typically performed for every 6 - inch slot along both rows of a cluster so that the tool may be used with standard - width equipment racks ; results are averaged over the actual entire rack width before being presented . in methods of at least one embodiment of the invention , after successful modeling of an improper cluster , the results of the model may be used as part of a system to order equipment , ship equipment and install equipment in a data center . in at least some embodiments of the invention discussed herein , the performance of assessments and calculations in real - time refers to processes that are completed in a matter of a few seconds or less rather than several minutes or longer as can happen with complex calculations , such as those involving typical cfd calculations . having thus described several aspects of at least one embodiment of this invention , it is to be appreciated various alterations , modifications , and improvements will readily occur to those skilled in the art . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and scope of the invention . accordingly , the foregoing description and drawings are by way of example only . | 6 |
the present invention relates to a soap bar having novel hydrogel fillers . preferably the hydrogel fillers are coreless . preferably the hydrogel fillers are composites . the present invention also relates to methods of making soap bars having hydrogel fillers . introducing a unique hydrogel phase to the soap structure provides new flexibility for designing and making soap and also can bring other performance benefits to the consumer . in an embodiment , the soap bar of the present invention includes fillers in a hydrogel phase in particle form , preferably the particle is coreless . such solid soap can be used for cleansing purposes as toilet soap or laundry soap , such as for cleaning hands , washing clothes , etc . as used herein , the term “ soap bar ” refers to a unit of solid soap after it is made into a shape suitably stable in general commercial room condition and ready to be used . the bar may have various shapes in sectional view , such as round , oval , rectangle , square , star , etc ., as known to the skilled artisans . as used herein , the term “ coreless ” refers to a form of hydrogel in which a unit of hydrogel wherein the inner central part does not have a higher concentration of hydrogel gelling material ( such as carrageenan ) than the more peripheral regions of the unit ( e . g ., particle ). the term “ included constituent ” or “ constituent included ” as used herein regarding material in hydrogel refers to an ingredient , especially a nonwater material ingredient that is included in the hydrogel . preferably , when in the finished soap bar , an included constituent is present in higher concentration in the hydrogel phase particles than in the soap matrix material outside said particles . in describing the present invention , the following terms will be employed , and are intended to be defined as indicated below . as used in this specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural references unless the text content clearly dictates otherwise . as used herein , the term “ thermoreversible ” as applied to hydrogel refers to a hydrogel that is a flowable ( which can flow under gravity ) sol or liquid at elevated temperature at or above 90 ° c . and forms a non - flowable hydrogel that has a phase surface in atmosphere at room temperature ( about 25 ° c .) wherein the hydrogel can become flowable liquid again when heated to the elevated temperature . the term “ hydrogel solution ” refers to a solution in which more than 90 % of the hydrogel gelling material has been dissolved or is in colloidal form . the solution can , but need not , be a clear solution . “ beneficial agent ” is to be construed in its broadest sense to mean any material that is intended to produce some biological , beneficial , therapeutic , or other intended useful effect , such as enhancing permeation , improving sensory feel , and moisturizing . fig1 illustrates an embodiment of a soap bar according to this invention . the solid soap bar 4 includes hydrogel phase particles 6 dispersed in soap matrix 8 , which is composed of soap base material and other additives but excluding the hydrogel phase particles 6 . the soap matrix is the material in which the hydrogel phase particles are embedded . the hydrogel phase particles 6 preferably have well defined phase boundary surface 10 separating the content of the hydrogel phase particles 6 from the soap base material 8 . the particle surface need not be smooth , since many of the particles can be formed by breaking up larger pieces of hydrogel . because the hydrogel solution is mixed well before gelling , the hydrogel gelling agent and water , as well other beneficial agents are evenly distributed in the hydrogel solution . as the hydrogel solution material gels and eventually forms hydrogel particles that are embedded in the matrix , the content in the hydrogel particles continue to remain in uniform or substantially uniform distribution . in the resulting soap bar , under commercial storage condition at room temperature ( such as at 25 ° c .) even over a period of time , during which time water or other vaporizable or liquid material may diffuse away from the hydrogel phase particles into the soap matrix , the diffusion process is slow that such content materials in the hydrogel particles , except for the microscopic boundary conditions at the phase surface , would substantially be distributed evenly in the hydrogel phase particles at the vast majority of the particles . for example , constituents included in the hydrogel , such as talc and glycerin are distributed substantially uniformed within the bulk in the hydrogel phase particles ( i . e ., in the interior of the particle away from the boundary conditions ). as used herein , the term “ phase ” when referred to the hydrogel particle refers to separation of hydrogel material from soap base material by a boundary of the hydrogel unit ( such as a particle ) in which the content material ( such as water ) is distributed substantially uniformly within the unit , whereas such material is present in substantially different distribution outside of the boundary . to facilitate processing , such hydrogel phase particles preferably are of a gel material having gel strength that gives a hardness to the sensory feel of the consumer at a large enough particle size ( e . g ., 5 μm to 2 mm diameter ) the particles provides a grainy or granular feel to a consumer . beneficial agents that can be included in the hydrogel phase particles , such as vitamins , fragrance , moisturizing agents , etc ., can benefit the skin as the hydrogel phase particles come into contact with the skin . further , such beneficial agents can migrate slowly past the phase surface boundary into the soap matrix material with time and eventually come into contact with skin to provide beneficial effect when the soap bar is used . one of the ingredients of the solid soap bar of the present invention is fatty acid soap , which is generally provided in the form of soap noodles in the soap making process . the term of fatty acid soap denotes alkali salts of carboxylic fatty acid . the soap may be derived from any of the triglycerides conventionally used in soap manufacture . consequently the carboxylate anions in the soap may contain from 8 to 22 carbon atoms . the fatty acid soap can be made from the usual fatty acid sources such as animal fats and vegetable oils or combinations thereof , which can include palm oil , palm kernel oil , caster oil , rice bran oil , sunflower oil , coconut oil , soybean oil , peanut oil , tallow , lard , fish oil , and blends thereof , and the like . typical blends of palm and palm kernel oils , palm and coconut kernel oils , can be at blend ratios of about 40 / 60 to 97 / 3 of various oils and fats . as mentioned above , techniques and processes of making soap from fats and oils are well known in the art . generally , the fatty acid soap material ( which is the same as tfm ) can constitute about 40 wt % to 90 wt %, preferably about 50 wt % to 90 wt %, more preferably about 60 wt % to 80 wt %, preferably 70 wt % or less of the soap bar of the present invention . preferably , the fatty acid soap material is provided as soap noodles , such as those made from saponification processes . the soap noodles can be mixed and further processed with hydrogel to result in the final soap bar through mixing , milling , extruding , and stamping , etc . from the soap noodle type , the tfm can be determined . typically , the soap noodle manufacturer provides the information on the tfm of the soap noodle . for example , soap noodle of a palm and palm kernel oils blend of 80 : 20 has a tfm of about 82 wt %. depending on the weight percentage of the soap noodle used in making the soap bar , the percent of tfm in the soap bar can then be calculated . although synthetic soap bars can be made to include the hydrogel particles of the present invention , to provide physical property such that the soap can have the quality of a hard , milled bar , it is preferred that the soap bar is made from soap noodles . as used herein , the term “ synthetic soap bar ” refers to a soap bar that is made by molding a composition that contains synthetic surfactants and binders and rather than fatty acid alkali salt from soap noodles . other than sodium hydroxide and traditional natural fatty acids in or from animal fats and vegetable oils , soap can also be made from other alkali metal or alkanol ammonium alkali and alkane - or alkene monocarboxylic acids . sodium , magnesium , potassium , calcium , mono -, di - and tri - ethanol ammonium cations , or combinations thereof can be used . the salts formed from the reaction between fatty acids and such cations are considered fatty acid alkali salts herein . the soaps can be made from fatty acids having about 8 to 22 carbon atoms , preferably about 12 to about 18 carbon atoms . the soap ( such as soap noodles ) forms a soap base in which hydrogel can be mixed with and processed into soap bars that have the hydrogel phase particulate material in which a significant amount of water is bound . the present invention enables the replacement of soap noodles by water - containing fillers by utilizing hydrogel , and also provides a new method of introducing hydrogel phase material to process with soap noodle to make low tfm composition bars . generally , fillers are materials that can replace soap in a soap bar without adversely affecting the cleansing property of the soap bar . the present invention utilizes hydrogel as a filler . a hydrogel is a gel which contains water but is not soluble in water . for example , when water is put on top of a hydrogel , the hydrogel and the water are clearly separated into two phases . preferably , this hydrogel phase material is a three dimensional , metal - ions - caused , physically cross - linked network formed by polymer gelling agents , preferably polysaccharides or derivatives thereof . preferably , the gelling agent is hydrophilic polymeric material that can form a three dimensional , physically cross - linked structure . preferably the physical cross - link is thermoreversible such that the gelling is thermoreversible . although hydrogel particles can be made by chemical cross - linking polymeric material , such as poly ( 2 - hydroxyethyl methacrylate ), carboxylated methylstarch , hydrolyzate of acrylonitrile - grafted starch , polyacrylamide , poly ( acrylic acid ) salt , hydrolyzate of vinyl acetatemethyl acrylate copolymer , polyoxyethylene , poly ( vinyl pyrrolidone ), polystyrene sulfonate , poly ( vinyl alcohol ), etc ., by chemical reaction , radiation , or the like , the preferred physically cross - linked hydrogels , especially thermoreversible hydrogels , enable the hydrogels to be processed into particulate units of desirable physical and chemical property in the resulting soap bars . the preferred polymeric gelling agent is a polysaccharide ( which can include natural polysaccharides or derivatives thereof ) that can be easily dissolved in water at suitable temperature and form hydrogel when cooled to a lower temperature , e . g ., room temperature , in some cases through the use of cations . suitable polysaccharide - related materials suitable for forming the hydrogel include carrageenan , konjac gum , agar / agarose , locust bean gum ( carob gum ), cassia gum , gellan gum , alginate , and combinations thereof . a preferred gelling agent is carrageenan . carrageenan is a high molecular weight linear polysaccharide comprising repeating galactose units and 3 , 6 - anhydrogalactose ( 3 , 6 ag ), both sulfated and non - sulfated , joined by alternating α -( 1 , 3 ) and β -( 1 , 4 ) glycosidic links . the main species of rhodophyceae used in the commercial production of carrageenan include euchema cottonii and e . spinosum . generally the types of carrageenans include kappa , iota , and lambda , the molecular weight of the carrageenans is from 5 × 10 4 to 70 × 10 4 dalton . different types of carrageenans might form gels of different softness or toughness characteristics . due to the better gelling property , kappa and iota carrageenans are more preferred , and kappa carrageenan is even more preferred for forming hydrogels for the soap bar of the present invention . carrageenans are available as stable sodium , potassium , and calcium salts or , most generally , as a mixture of these . all carrageenans are dispersible in cold water , and when heated above 80 ° c . they are completely dissolved . during cooling process kappa and iota carrageenans form double helix molecular structures cross - linked by potassium and calcium ions , forming a tridimensional gel - type network . it has been found that carrageenan has to be dispersed well before its solubilization to avoid the formation of lumps and to obtain its complete functionality . carrageenan is preferably premixed with other dry ingredients , adding into cold liquid with agitation to solubize the carrageenan . to achieve the more preferred gelling / melting point , potassium is the most effective metal ion to modify the gelling / melting point of carrageenan . it has been found that there is a synergetic interaction between selected polysaccharides and other small molecules to improve the gel properties , especially between carrageenan and konjac gum . a combination of carrageenan and konjac gum is a more preferred gelling material because they provide gels of especially suitable gelling strength and processing parameters conducive for easy processing , such as mixing and forming hydrogel particles of the desirable sizes . preferably , the ratio of carrageenan to konjac gum in wt % is about 1 : 10 to 10 : 1 , more preferably about 6 : 4 to 4 : 6 . with such preferred ranges , the resultant hydrogel can contain a large amount of water , is easily processed , and yet produces particulates of desirable sizes in the soap bar . it was found that higher gel rigidity improves the breaking up of the hydrogel chunks to form smaller particles as the soap mix is being mixed . thus , the synergistic interaction of carrageenan and konjac improves gel strength and leads to smaller particles which reduce the grainy feeling of the resultant soap bar . konjac contains the konjac mannan in their tubers . konjac mannan is a heteropolysaccharide consisting of β - d - glucose ( g ) and β - d - mannose ( m ), with a g / m ratio of 1 to 3 . the typical average range of konjac &# 39 ; s molecular weight is 0 . 1 × 10 5 to 10 × 10 6 dalton . the primary gelling agent or polysaccharide ( such as carrageenan ) builds up the three - dimensional cross - linked network to hold the structure and bind water . any synergistic interaction with the three dimensional cross - linked network by other polymers ( such as konjac ) that can be used to enhance the structure or increase the water retention capability can be used for the formation of hydrogel . similar to the synergetic interaction between carrageenan and other gums , locust bean gum ( carob gum ) or konjac gum or selected polyols can be used to help improve the hydrogel water retention capability . it is desirable that the hydrogel particles are small enough that they do not produce a sensation of roughness to the consumers and small enough to allow beneficial material , such as glycerin or fragrance enclosed in the hydrogel particles to be released . it is desired that 95 % ( by number %, not wt %) of the diameter of the hydrogel particles is in the range of about 1 μm to 200 μm , more preferably about 5 μm to 100 μm , more preferably 5 μm to 60 μm . generally in soap bars , once the particle size is smaller than 60 μm , it will not be noticeable in daily use for consumers . if the particle size is larger than 60 μm , the consumer will be able to notice the particles . if the particles are hard , such as certain inorganic fillers , talc , calcite and so on , they will result in a highly undesirable grittiness feel to consumers . if the particles are soft or elastic , they provide a massaging function , which is considered pleasurable to some consumers . the present invention also provides a robust formulation design with a wide range of particle size distribution . it is contemplated that the polysaccharides can be modified to form derivatives slightly different from the natural polymers and still retain significant water binding ability . the polysaccharide can be modified , e . g ., to form hydroxyalkyl ( e . g ., hydroxypropyl ) derivatives , cationic derivatives , and the like . methods of making hydroxyalkyl and cationic polymers from polysaccharides are known in the art . to allow the hydrogel phase particles to form well , in one aspect , it is preferred that the hydrogel is a thermoreversible gel . in thermoreversible gels , the gel network is a physically cross - linked network in which the physical cross - links can be disrupted by heat therefore allowing the gel to melt and yet to re - gel again when the heat is removed , rather than a network chemically cross - linked by covalent bonds . other than carrageenan , konjac , and agar , other thermoreversible gels , such as synthetic materials can also be used . u . s . pat . no . 5 , 306 , 501 is an example illustrating thermoreversible polyoxyalkylene block copolymers . the thermoreversible gel is advantageous because the hydrogel solution can be charged into a mixer and allowed to form a gel that is easy to break into chunks and particles . the hydrogel is dispersed among the soap noodle material and cools in the mixer to form a gel , which gets broken down into small pieces and particles . the hydrogel particles can be dispersed among the soap noodle material . on the contrary , nonthermoreversible covalently cross - linked gels are hard to break and therefore would have been hard to mix well with soap noodles . hydrogel particles of the present invention can be used to replace soap noodle to a significant amount . the hydrogel can be used at any percentage of the final soap formulation up to about 50 wt %, preferably about 5 wt % to 45 wt %, more preferably about 5 wt % to 35 wt %, and even more preferably about 5 wt % to 25 wt %. the preferred ranges of hydrogel amount result in soap bars that are relatively easy to process and produce desirable cleansing property . in terms of water content in the finished soap bar , the finished soap bar generally contains 15 wt % to 50 wt %, preferably 15 wt % to 30 wt %, preferably 15 wt % or more , more preferably 20 wt % to 25 wt % of water . in terms of the amount of hydrogel content in the soap bar , the gelling material ( such as a polysaccharide such as kappa carrageenan , or a combination of gellants ) constitutes preferably about 0 . 05 wt % to 10 wt %, more preferably about 0 . 1 wt % to about 5 wt % of the soap bar . the inclusion of hydrogel phase material in the soap bar provides advantages over soap bars in which the gelling material is not a hydrogel that gels from a true hydrogel solution , not merely swollen gelling particles . in the hydrogel phase particulates of the present invention , included constituents are incorporated into the hydrogel solution when the gel is made before the hydrogel is broken up into particulate units . thus , the included constituents are more evenly distributed in the hydrogel particles and do not easily leach out of the hydrogel particles during the soap - bar - making process , even under pressure or in an elevated temperature , such as those present in the mixing , milling , extruding and stamping processes . this significantly reduces the loss of fragrance during process ( if fragrance is included ), reduces the viscosity to allow easier mixing if glycerin in included , and facilitates mixing and the breaking of hydrogel chunks into smaller particulates if talc or other inorganic powdery materials are included in the hydrogel . in the present invention , the hydrogel is made to include a large amount of water when it is mixed with the soap noodle in an amalgamator or mixer . since the hydrogel is made by dissolving in hot water and then gelled , it is a hydrogel with a cross - linked network binding water in a more or less uniform fashion over the whole gel . particles formed from this hydrogel can therefore be formed coreless . in fact , as the hydrogel particles become affixed in the soap bar , some of the water from the hydrogel may become lost to the soap base and to the atmosphere , the concentration of water at the inner or more central part of the hydrogel particle is no less than that at the more peripheral part of the hydrogel . hydrogel constituents such as talc , humectant , certain fragrance , etc ., that do not cross the hydrogel phase into the soap base or leave the hydrogel particle easily , would remain at a relatively uniform concentration in the hydrogel bulk even if the hydrogel containing soap bar is placed in commercial storage in a stable condition for a period of time . thus , the hydrogel particles are unlike gelling particles that are simply mixed in the soap mix or in a liquid with wetting the gelling material . gelling particles if merely dispersed in the soap base mixed with water or dispersed in an aqueous solution or water to absorb water without dissolving will simply swell . such swelling requires water to slowly migrate into a dry core . thus , the gelling material will form a swollen particle with a core that has less water than the peripheral part of the particle . in some cases , the core may never even become hydrated since the peripheral part of the particle impedes water penetration and water does not diffuse into dry material . thus , the outer part of the swollen particle may be very wet but the inside may be dry . such swollen particles if formed by absorbing an aqueous solution via dispersing the gelling agent in an aqueous solution may lose a significant amount of the aqueous solution original held in the swollen particles when the swollen particles are placed under pressure causing the soap mix ( i . e ., the material that includes soap base and hydrogel that is being mixed ) to become soft or mushy during processing , as when the soap mix is processed through milling , extruding and stamping , etc . thus , excipients such as vitamins , fragrance , etc ., that are originally absorbed into the gelling material during wetting by the aqueous solution can easily be lost during processing of the soap mix into a soap bar . in the formation of certain hydrogel particles , such as from carrageenan material , waiting for the hydrogel solution to start to gel before mixing into the soap noodle base allows the hydrogel to form into phase chunks and particles to be mixed with the soap base in the mixer rather than as a mixture of water and gelling material particles . comparing with the traditional soap finishing process , in the present invention , only an extra pre - mixer is needed for making hydrogel solution . the following indicates a set of general steps for a modified soap finishing process . to make a thermoreversible hydrogel , water is put into a pre - mixer , and gelling agent ( e . g . polysaccharides such as carrageenan and konjac gum ) and other additives ( e . g ., talc and glycerin ) are added into the water , and the material is agitated and heated ( for example , to about 90 ° c .). the relevant salts ( e . g ., kcl for carrageenan ), if needed , are then added to the mixture solution . the mixture solution is then cooked for a period of time , e . g ., 4 - 10 minutes to ensure that the gelling material is dissolved well to form a homogenous solution mixture . insoluble materials such as talc , if included , may be present in the hydrogel solution mixture . preferably such insoluble materials are also relatively well mixed in the solution such that when made into particles , the insoluble materials particles will be distributed substantially uniform in a particle . at this time , the hydrogel solution is charged into a mixer to be mixed with soap noodle and other additives immediately . as the hydrogel solution gels as it is being mixed by agitators with the soap noodle and other additives , it becomes well dispersed among the soap noodle material and forms the hydrogel particles in - situ when the temperature drops during the mixing , the larger pieces and chunks of hydrogel are broken into smaller pieces . the hydrogel phase particles will eventually become embedded in the soap matrix after a soap bar is formed . the mixed material is then processed further by other processing steps such as milling , extruding and stamping , etc . fig2 illustrates a flow chart of a typical process of the present invention . the illustrative process includes premixing the hydrogel agent with ingredient materials and water in a heated pre - mixer 16 . the premixed material is charged into a mixer 18 and mixed with soap noodles . the mixed material is then further processed in a refiner 20 , miller 24 , plodder 28 , and a stamper 32 , which are well known soap making machines . generally , the material is mixed by extrusion through orifices in a refiner , extruded into thin sheets in a miller , and extruded into solid soap rods in a plodder . the soap rod is cut and stamped into soap bars . through this process , the material becomes well mixed in the soap base mix and particulate ingredients in the soap base mix are dispersed and well distributed in the resultant soap bar . in a simple form , the soap making method of the present invention will not require great changes the traditional soap finishing process , but merely the inclusion of a simple pre - heating pre - mixer vessel for making the hydrogel solution . using the hydrogel as the soap noodle replacement , the replacement percentage range can be achieved up to 45 wt % based on formulation , preferably up to 35 wt %. to make sure the polysaccharides solution can form gels that can act as the solid filler , the gel strength and gelling point can be control for effective processing . metal cations , polyols and synergetic interaction between polysaccharides can be used to facilitate the hydrogel formation for this invention . it is contemplated that the hydrogel solution can be formed into small particles before being mixed with the soap noodles . it is contemplated that the hydrogel solution can be sprayed or spun into droplets to mix with soap noodles , thereby forming hydrogel phase particles in the soap base mix . it is further contemplated that the hydrogel can gel and broken up into particles before mixing into with the soap noodles . apart from thermoreversible gels , other polysaccharide gels or their derivatives that can form hydrogels can also be used to form soap bars of the present invention . for example , alginate , gellan gum , carob gum , and the like , can be made to gel by interacting with certain cations . for example , alginate or gellan gum can be made to gel by introduction of calcium ions and carob gum can be made to gel at about ph 5 . 5 to 7 in the presence of sodium borate . by using the appropriate amount of the cations in relation to a suitable amount of gelling material and water , gelling can be controlled so that as the gel solution is gelling , the gelling solution is charged into the mixer to be mixed with the soap base to form the soap mix . such gels are cross - linked by physical interactions with the aid of ions , which can be controlled easier and therefore more preferred than covalently cross - linked gels . for example , the gelling of the gellan gum can be controlled by the amount of cations added and the temperature . thus , the cross - linking in the cation controlled hydrogels , e . g ., gellan gum , alginate , etc ., are based on the physical interference between strands of the gellant polymer , rather than by covalent bonds . as the hydrogel is formed and broken down by mixing and agitation , hydrogel particles of the right dimensions can be made . many different ingredients can be advantageously used in the hydrogel particles . suitable materials can be solid , liquid , semi - liquid , etc ., and can be hydrophilic or even hydrophobic . for a hydrophobic material , dispersing aids such as emulsifiers can be used to interact with various ingredients so as to allow even distribution of the ingredients in the hydrogel . flavor and fragrances , such as those traditionally known in the art , can be incorporated into the hydrogel by use of gelling agents . dispersing aids , emulsifiers , etc ., and other aids for aiding the incorporation of hydrophobic materials , such as fragrance oils , are known in the art and widely used for flavor release technology . making use of different gelling mechanisms and interactions with the flavoring compounds , the flavor release can be easily controlled . for example , by controlling the hydrogel particle size , the hardness of the gel , the water content , the emulsifying system , etc ., the release of the flavor or fragrance can be controlled in the soap design . with the benefit of the present invention disclosure , fragrance release benefit can be easily achieved using hydrogel particles . another useful ingredient in the hydrogel is processing aid , such as inorganic powdery material , e . g ., talc , calcite , kaolin , silicon dioxide , titanium dioxide , diatomaceous earth , etc . we found that such inorganic powdery material included in the hydrogel facilitates the breaking up of the hydrogel in the mixing process with the soap noodles so that hydrogel particles can be made into particles of suitable sizes with high efficiency . talc , calcite and kaolin are preferred material . an even more preferred inorganic powdery materials are talc and calcite . generally , the inorganic powdery material is added to make the hydrogel solution in the range of a weight percentage of inorganic powdery material to hydrogel of 1 . 0 wt % to 40 wt %, more preferably from about 2 . 0 wt % to 30 %, and even more preferably about 5 wt % to about 25 wt % of the hydrogel . preferably the inorganic powdery material in the soap bar is about 0 . 05 wt % to 16 wt %, more preferably from about 0 . 1 wt % to 12 wt %, and more preferably about 0 . 25 wt % to about 10 wt %. generally , the particle size of the inorganic powdery material is higher than about 200 meshes . water is major component of the hydrogel phase particles . preferably , more water is contained in the hydrogel phase particles than in the soap base material outside of the hydrogels . preferably , most of the water that is in the resultant soap bar is in the hydrogel phase particles and there is less , preferably very little water in the soap bar outside of the hydrogel phase particles . preferably , more than 90 % of the water is in the hydrogel particles . in this way , the hydrogel , containing an amount of water and acting as fillers , will interfere less with the soap noodle mixing than the equivalent amount of free water directly in the soap base mix . in the hydrogel phase particles , preferably water constitutes more than about 50 wt %, more preferably about 50 wt - 90 wt %, more preferably about 50 wt % to 75 wt %. it has been found that after the hydrogel solution has been charged into the mixer and the soap base mix processed into soap bars , the weight loss due to water evaporation is less than about 2 . 0 % of the water present in the formulation . it has been found that the water that is in the hydrogel phase does not migrate rapidly out of the hydrogel particles into the soap matrix material rapidly with time . thus , as observable by average consumers , the soap bar does not become wet or mushy in storage under normal ambient room condition . soap noodles themselves sometimes contain a little water , such as about 8 wt % to 15 wt %. thus , knowing the approximate water content of the soap noodle , the water content of the soap bar after manufacture can be estimated , and can also be determined by experiments , such as by removing all the water by evaporation . the hydrogel phase can optionally further contain a humectant . humectants can be selected from the group consisting of polyhydric alcohols ( polyols ), water soluble alkoxylated nonionic polymers , and mixtures thereof . the humectants contained in the hydrogel can be used at levels of the composition from about 0 . 1 wt % to 30 wt %, more preferably from about 0 . 5 wt % to 25 %, and more preferably about 5 % to about 20 % of the hydrogel . polyhydric alcohols useful herein include glycerin , sorbitol , propylene glycol , butylene glycol , hexylene glycol , ethoxylated glucose , 1 , 2 - hexane diol , hexanetriol , dipropylene glycol , erythritol , trehalose , diglycerin , xylitol , maltitol , maltose , glucose , fructose , and mixtures thereof . water soluble alkoxylated nonionic polymers such as polyethylene glycols and polypropylene glycols are useful as well . a particularly useful humectant is glycerin . humectants can benefit users as moisturizers when contacting the skin . it is noted that it is a well known facts that humectants , such as glycerin , glycols , etc ., that are viscous liquids tend stick to other materials to make the mixing process difficult to control if present in the material being mixed . thus , if gelling material and humectants are directly mixed with soap noodles and water , the mixing material tends to become highly viscous and difficult to handle . for the present invention , in which the humectant ( s ) are included in the hydrogel instead of being present in substantial quantity in the soap base mix material , the viscosity of the mixing material is reduced substantially compared to having the humectants in the soap base directly . the humectant , e . g ., glycerin , can be present in the hydrogel in an amount of 0 . 1 wt % to 60 wt %, more preferably from about 5 wt % to 50 wt %, and even more preferably about 10 wt % to about 40 wt % of the hydrogel . it is noted that surfactants also can be added into the hydrogel filler to further improve the lathering properties and skin feeling during use . the synthetic surfactants can be used in this invention include anionic , amphoteric , nonionic , zwitterionic , and cationic surfactants . synthetic surfactants can generally be used in the present hydrogel filler at a level of from 0 . 1 wt % to about 40 wt % in hydrogel filler , preferably from about 0 . 5 wt % to about 20 wt %. examples of anionic surfactants include but are not limited to alkyl sulfates , anionic acylsarcosinates , methyl acryl taurates , n - acyl glutamates , acyl isethionates , alkyl ether sulfates , alkyl sulfosuccinates , alkyl phosphate esters , ethoxylated alkyl phosphate esters , trideceth sulfates , protein condensates , mixtures of ethoxylated alkyl sulfates and the like . alkyl chains for these surfactants are c8 - c22 , preferably c10 - c18 . zwitterionic surfactants can be exemplified by those which can be broadly described as derivatives of aliphatic quaternary ammonium , phosphonium , and sulfonium compounds , in which the aliphatic radicals can be straight chain or branched and wherein one of the aliphatic substituents contains from about 8 to 18 carbon atoms and one contains an anionic water - solubilizing group , for example , carboxy , sulfate , sulfonate , phosphate , or phosphonate . examples include : 4 -[ n , n - di ( 2 - hydroxyethyl )- n - octadecylammonio ]- butane - 1 - carboxylate ; 3 -[ n , n - dipropyl - n - 3 - dodecoxy - 2 - hydroxypropylammonio ]- propane - 1 - phosphonate . examples of amphoteric surfactants which can be used in the hydrogel filler are those which can be broadly described as derivatives of aliphatic secondary and tertiary amines in which the aliphatic radical can be straight chain or branched and wherein one of the aliphatic substituents contains from 8 to about 18 carbon atoms and one contains an anionic water solubilizing group , e . g ., carboxy , sulfonate , sulfate , phosphate , or phosphonate . examples of compounds falling within this definition are sodium 3 - dodecylaminopropionate , sodium 3 - dodecylaminopropane sulfonate ; n - alkyltaurines , such as the one prepared by the reacting dodecylamine with sodium isethionate according to the teaching of u . s . pat . no . 2 , 658 , 072 ; n - higher alkyl aspartic acids , such as those produced according to the teaching of u . s . pat . no . 2 , 438 , 091 . other amphoterics such as betaines are also useful in the hydrogel filler . examples of betaines useful herein include the high alkyl betaines such as coco dimethyl carboxymethyl betaines , lauryl dimethyl carboxy - methyl betaine , lauryl dimethyl alpha - carboxyethyl betaine , cetyl dimethyl carboxymethyl betaine , lauryl bis -( 2 - hydroxylethyl ) carboxymethyl betaine , stearyl bis -( 2 - hydroxylpropyl ) carboxymethyl betaine , oleyl dimethyl gamma - carboxypropyl betaine , and the like . examples of suitable cationic surfactants include stearyldimethylbenzyl ammonium chloride ; dodecyltrimethylammonium chloride ; nonylbenzylethyldimethyl ammonium nitrate ; tetradecylpyridinium bromide ; laurylpyridinium chloride ; cetylpyridinium chloride ; luarylpyridinium chloride ; laurylisoquinolium bromide ; dilauryldimethyl ammonium chloride ; and stearalkonium chloride ; and other cationic surfactants known in the art . nonionic surfactants used in the hyrdogel filler can be broadly defined as compounds produced by the condensation of alkylene oxide groups ( hydrophilic in nature ) with an organic hydrophobic compound , which many be aliphatic or alkyl aromatic in nature . the hydrogel filler can optionally contain other beneficial agents , including hydrophilic and / or hydrophobic beneficial agents . beneficial agents include other polyols , vitamins , drugs , nutrients , permeation enhancers , colorants , sunblocks , anti - bacterial ingredients , etc . many of such beneficial agents are well known and commercially available . further , in the soap bar , external to the hydrogel filler particles , many optional materials can also be included . beneficial agents , surfactants , salts , fatty acids , structurants , other fillers ( such as inorganic fillers ), colorants , fragrance , processing aids , etc ., as known to those skilled in the art , and can also be included as such optional material in the soap bar . if needed , the ph range of the hydrogel can be adjusted to be compatible with some of the beneficial agents . the following examples illustrate the soap bars that can be formed with the present invention . all percentages are wt % unless clearly specified otherwise in the content . the following method was used in making soap bars : charge the amount of water and sorbitol according to the formula into the pre - mixer , stir at room temperature , and add the talc ( or calcite or other powdery material ) into the pre - mixer . stir the material in the pre - mixer at 500 - 600 rpm for a few minutes to disperse the ingredients evenly . heat the solution to 50 - 60 ° c ., add the carrageenan into the solution , increase the stirring speed to 800 rpm , continue to heat the solution to 85 ° c ., and maintain the temperature until the carrageenan is totally dissolved . then add the kcl to the solution and keep the temperature for a few minutes to totally dissolve the kcl . charge the soap noodle and other additives into a double sigma mixer to mix for a few minutes until the soap noodle is totally broken down to very small powdery form , then charge the hot hydrogel solution into the double sigma mixer once the solution is ready . mix them for a few minutes and charge them into the refining machine and follow by milling , extruding , extruding , and stamping . table 1 shows the characteristics of milled soap bars made with the above described process . the carrageenan used in these examples was kappa - carrageenan , code name e407 , obtained from shanghai brilliant gum co ., ltd . in table 1 , the hydrogels were formed from water , carrageenan and kcl and in some cases included talc as an ingredient . for comparison , a control bar was made of soap noodles ( 98 . 7 wt %), edta , fragrance , and 0 . 2 wt % titanium dioxide without any other filler material . the hydrogel soap bars all contained the same wt % in relation to the soap bar formulation of edta and fragrance as the control , and either 0 . 2 wt % or 0 . 3 wt % of titanium oxide present in the base mix ( i . e ., the base material that does not have hydrogel fillers ). the gel strength was measured using the standard test method used in food industry using a ta . xtpius texture analyzer with a 0 . 5 inch ( 1 . 27 cm ) radius cylinder ( p / 0 . 5r ) cylinder probe . the international standard test method named iso 9665 : 1998 ( e ) can be used with the following settings : test mode is compression , pre - test speed is 0 . 5 mm / sec , test speed is 0 . 5 mm / sec , post - test speed is 0 . 5 mm / sec , target mode is distance , trigger type is force , trigger force is 5 g . said iso 9665 : 1998 ( e ) testing method , as described in international method — adhesives - animal glues — methods of sampling and testing , iso 9665 , second edition ( 1998 - 09 - 15 ) is herein incorporated by reference . all gel strength measurements in this application were done with this method . the gelling point was tested by the following method : put the polysaccharide solution into a 95 ° c . water bath to make sure the solution would not form a gel . control the temperature decreasing rate of the water batch at 1 ° c ./ min , and record the temperature when the solution forms the hydrogel . we were able to incorporate from about 10 to 20 wt % of water into the soap formulation and form stable soap bars with the traditional mixing , refining , milling , extruding , and stamping processes . table 2 shows the foaming performance of the soap bars of table 1 . the forming method used was the ross - mile test method ( iso696 - 1975 or gb7462 - 87 ) at soap concentration of 0 . 5 g / l and a water hardness of 150 ppm . the same method was used in all foaming performance tests in this application . it is generally accepted by skilled artisans in soap technology that foaming performance ( foam volume / cm ) is a representation of the cleansing property of a soap bar . table 2 shows that the soap bars of table 1 have similar cleansing property . thus , the soap bars that contain a large amount of water in hydrogel fillers performed similarly well as the control bar that did not contain any water containing filler . a the hydrogel solution of this number 14 example was very viscous and paste - like . it gelled very quickly during the transferring from the glass beaker into the container . the gel formed before it could be put into the container . so the gel strength and gelling point were not tested by the test methods we used for measuring these two parameters in the other samples . table 3 shows the formulations of soap bars that contain hydrogel phase fillers made from carrageenan , konjac , kcl , and water and include ingredients selected from glycerin , sorbitol and talc . the hydrogel dosage varied from about 11 wt % to 36 wt % in the formulation and the amount of water in the hydrogel fillers varied from about 10 wt % to 17 . 5 wt %. the soap noodle content varied from 63 wt % to 88 wt %. it was observed that in general , the higher the gelling point of the hydrogel , the sooner the polysaccharides solution will form the hydrogel phase during mixing with soap noodles . thus , higher water retention during mixing with soap noodle for hydrogel can be achieved . preferably , the soap bars of the present invention are made from hydrogels that have a gelling temperature of about 35 ° c . to 95 ° c ., more preferably 45 ° c . to 85 ° c . also , it was observed that the higher gel strength the hydrogel , the higher the water retention capability that can be achieved . preferably , the soap bars of the present invention are made from hydrogels that have gel strength of 200 g / cm 2 to 15000 g / cm 2 , more preferably 600 g / cm 2 to 6500 g / cm 2 . table 4 shows the foaming performance of the soap bars of table 3 . the forming method used was the ross - mile test method at soap concentration of 0 . 5 g / l at a water hardness of 150 ppm . table 2 and table 4 show that the soap bars of the two tables have similar cleansing property . thus , the soap bars that contain a large amount of water in hydrogel fillers performed similarly well as the control bar that did not contain any water containing filler . table 5 shows the formulations of hydrogel soap bar made from agar . agar is a strongly gelling hydrocolloid from marine algae . its main structure is chemically characterized by repetitive units of d - galactose and 3 , 6 - anhydro - l - galactose , with few variations , and also a low content of sulfate esters . useful molecular weight of agar is from 1 × 10 4 to 5 × 10 6 dalton . the agar used in these examples was obtained from shanghai brilliant gum co ., ltd , with a code name blr6001 . the hydrogel dosage varied from 13 wt % to 29 wt %. the water content in the hydrogel varied from about 12 . 5 wt % to 17 . 5 wt % of the soap bar formulation material . a the glycerin bar was a savlon bar with aloe vera ( a soap product of johnson & amp ; johnson for india market , made by vvf limited , ingredients : sodium palmate , sodium palm kernelate , glycerin , water , fragrance , triclosan , aloe barbadensis leaf extract , ci 74260 , ci 11680 ) table 6 shows the foaming performance of the soap bars of table 5 and a commercial glycerin bar . table 2 and table 6 show that the soap bars of the two tables have similar cleansing property . thus , the soap bars that contained a large amount of water in agar hydrogel fillers performed similarly well as the control bar and the savlon glycerin bar that did not contain any water containing filler . further , comparing table 4 and table 6 shows that glycerin bars can be made according to the present invention with hydrogel fillers that perform similarly with nonhydrogel commercial glycerin bars . table 7 shows the formulations of hydrogel soap bar made from sodium alginate , which is not thermoreversible . the hydrogel dosage varied from 13 wt % to 18 wt %. the water content in the hydrogel varied from about 12 . 5 wt % to 17 . 5 wt % of the soap bar formulation material . alginate is a family of unbranched binary copolymers of ( 1 → 4 ) linked β - d - mannuronic acid ( m ) and α - l - guluronic acid ( g ) residues of widely varying composition and sequence with a molecular weight range from 3 × 10 4 to 1 × 10 6 dalton . for example , the commercial alginates produced from laminaria hyperborean , macrocystis pyrifera , laminaria digitata , ascophyllum nodosum , laminaria japonica , eclonia maxima , lessonia nigrescens , durvillea antarctica and sargassum can be used for the soap bars of this invention . for the hydrogel formed by alginate without cacl 2 , as an illustration , the 0 . 26 wt % alginate was dispersed into the 12 . 5 wt % water , and the resulting solution was heated to 80 ° c . the solution was stirred continually at 800 rpm for adequate time until the alginate was totally dissolved . the solution was cooled to room temperature , at which point the solution formed a highly viscous paste and was charged into the mixer and mixed it with soap noodle and other ingredients . for the hydrogel formed by alginate with cacl 2 , the 0 . 10 wt % cacl 2 and 0 . 17 wt % edta were dissolved into a 1 wt % water portion , and the 0 . 35 wt % alginate was dissolved into a 16 . 5 wt % water portion to form the solutions containing the 17 . 5 wt % water . the alginate solution was heated to 60 ° c . the cacl 2 / edta solution was added into the alginate solution slowly to ensure that the hydrogel can be formed properly . after the hydrogel solution has been formed , it was cooled to room temperature and charged into the mixer and mixed it with soap noodle and other ingredients . table 8 shows that the soap bars that contained a large amount of water in sodium alginate hydrogel fillers performed similarly well as the control bar . table 9 shows the formulations of hydrogel soap bar made from gellan gum , which is not thermoreversible . the hydrogel dosage varied from 13 wt % to 16 wt %. the water content in the hydrogel varied from about 12 . 5 wt % to 15 wt % of the soap bar formulation material . the gellan gum used was an extracellular polysaccharide secreted by the micro - organism sphingomonas elodea previously referred to as pseudomonas elodea with a molecular weight range from 3 × 10 4 to 2 × 10 6 dalton . the primary structure of gellan gum used in this design is composed of a linear tetrasaccharide repeat unit : → 3 )- β - d - glcp -( 1 → 4 )- β - d - glcpa -( 1 → 4 )- β - d - glcp -( 1 → 4 )- α - l - rhap -( 1 →. the gellan gum was obtained from cp kelco with a brand name kelcogel cg - ha for high acyl gellan gum and kelcogel cg - la for low acyl gellan gum . the gellan gum hydrogel were made by the following process : the cacl 2 was dissolved in de - ionized ( di ) water to make a cacl 2 solution , gellan gum was added into di water , and the dispersion was heated to 50 - 60 ° c . to dissolve the gellan gum . after the gellan gum was totally dissolved in the water , the cacl 2 solution was added into the gellan gum solution , the solution was cooled to room temperature to form the hydrogel . the hydrogel was charged into the mixer and mixed with the soap noodle and other ingredients . table 10 shows that the soap bars that contain a large amount of water in gellan gum hydrogel fillers perform similarly well as the control bar . the practice of the present invention will employ , unless otherwise indicated , conventional methods used by those in soap product development within those of skill of the art . embodiments of the present invention have been described with specificity . the embodiments are intended to be illustrative in all respects , rather than restrictive , of the present invention . it is to be understood that various combinations and permutations of various parts and components of the schemes disclosed herein can be implemented by one skilled in the art without departing from the scope of the present invention . further , where a substance is described to comprise certain ingredients , it is contemplated that a substance in some cases can also be made consisting essentially of the ingredients . all patent documents cited herein are incorporated by reference in their entireties herein . | 2 |
the personal security door arrangement of the invention comprises a conventional inner door 1 and a protective outer door 2 , which affords full vision to the outside , both doors being hingedly mounted to the same jamb 3 of the door frame . as may be seen in fig1 to 3 , the inner door 1 is of normal construction , with a latch bolt 4 operated by a door handle 5 , the lock bolt having been omitted for simplification of the drawing . the inner door is provided with means 6 for coupling it to the outer door 2 , interlocking means 7 , retaining means 8 and releasing means 9 . the outer door 2 is of a special grille , glazed or similar construction and may be provided with openings 10 which , apart from facilitating a view of the outside , allow the passage of small objects with the door closed . the door 2 is provided with lock 13 having a latch bolt 12 operated by a cylinder 11 , provided with a polygonal shaped rod 14 on the inner surface thereof . the said doors 1 and 2 , as illustrated in fig4 are mounted to the frame 3 by sets of hinges 15 , formed by a common support 16 and male pivot 17 , on which there are seated an arm 18 for the inner door 1 and an arm 19 for the outer door 2 . the mutual relationship between the said doors 1 and 2 , in the embodiment of fig5 and 7 , is attained by the coupling means 6 . this means comprises a shaft 20 crossing through the inner door 1 and provided with a terminal portion 21 having a recess 22 for receiving the rod 14 , and a radially extending arm 23 . the said coupling means 6 is actuated by the interlocking means 7 , which is constituted , as shown in fig6 by an intermediate lever 24 mounting a unidirectionally articulated rocker arm 25 pulled by a recovery spring 26 , all fixedly attached to the shaft 20 and actuated by a crank 20a . the lever 24 is not visible in fig5 and 7 as its extends downwardly into the drawings while the handle or lever arm of crank 20a extends upwardly out of the drawings . on the other hand , there is disposed in the outer door 2 , concentrically with the rod 14 , an opening 27 having a radially extending notch 28 facing the terminal portion 21 in such a way that in the closed position of the inner door 1 , the radially extending arm 23 of the coupling means 5 coincides with the said radially extending notch 28 and the recess 22 fits over the rod 14 . the retaining means 8 , in the embodiment of fig5 and 7 , is comprised of a flexible leaf spring 30 , on which said rocker arm 25 may rest , and which is provided with a cam 31 engageable by the releasing means 9 . the releasing means 9 , located in the inner door 1 to inactivate the retaining means 7 , is comprised of a sliding rod 32 , horizontally disposed in a support 33 and having its rear end biassed against the door jamb 3 by a spring 34 in engagement with a stop 35 . said rod 32 is provided with a head portion 36 carrying a pawl 37 attracted by a spring 38 and having an arm 39 biassed against a stop 40 on the head portion 36 and a further arm 41 engageable with the cam 31 of the retaining means 8 . an adjustable stop member 42 allows the range of movement of the rod 32 within the door to be adjusted . in the normal closed position of the doors 1 and 2 , as seen in fig5 the terminal portion 21 and arm 23 of the coupling means are inserted in the door 2 through the opening 27 and notch 28 thereof and in turn , the rod 14 is inserted on the recess 22 . on receipt of a call from the outside , the inner door 1 is opened by way of the handle 5 , as shown in fig2 with the outer door 2 remaining closed , which enables the person calling to be recognised , a conversation to be held or , as the case may be , money , documents or other small objects to be handed over or exchanged through the openings 10 formed between the bars of the grille forming the said door 2 . if it is wished to allow the caller in , the inner door 1 must be reclosed , the crank 20a must be rotated as illustrated in fig6 so that the coupling means 6 function in such a way as for the shaft 20 to locate the arm 23 out of the notch 28 , inside the inner door , the latch of the inner door 1 being opened , whereby the rod 14 is rotated to open the latch 12 of the lock 13 , at the same time as the outer door 2 is pulled open , as illustrated in fig3 and 6 . the opening of the doors 1 and 2 from the outside is feasible by a key for the cylinder 11 of the lock 13 in the outer door 2 , in the cases illustrated in fig5 and 7 and by another key for the latch 4 lock of the inner door 1 . the purpose of the retaining means 8 is to hold the coupling means 6 in the operative position thereof . in the coupling position for the opening of the doors 1 and 2 , the lever 24 has been rotated by the shaft 20 whereby the rocker arm 25 , overcoming the bias of the spring 26 , rides over the leaf spring 30 , as observed in fig6 . this position is held while the doors 1 and 2 are being opened together . when the doors are being closed , as illustrated in fig7 the rod 32 is pushed by the frame 3 , thereby pushing the pawl 37 , rigid in this direction , against the leaf spring 30 , by the arm 41 which presses the cam 31 , causing lateral flexing of the leaf spring 30 to release the rocker arm 25 and , consequently , the lever 24 , as illustrated in fig7 whereby the shaft 20 , under the bias of the spring of lock 13 rotates to place the coupling arm 23 in the release position relative to the opening 27 of the outer door 2 . fig8 , 10 , 11 and 12 illustrate a particular preferred embodiment of the security door arrangement mechanisms , in which the retaining means 8 have , on the one hand , two levers 50 and 51 mounted on the sprindle 52 of the lock 53 situated in the inner door , allowing the bolt 54 of the latch 4 to be moved via a fixed pin 55 . said bolt 54 is supported and guided by supports 56 and is provided with a pair of springs 57 and 58 . the levers 50 and 51 act on a pair of catch fingers 59 and 60 mounted on a core portion on the shaft 20 of the coupling means 6 and engage the interlocking means 7 through an arm 61 , having a recovery spring 62 and a detent 63 on the core portion . the said shaft 20 carries the terminal member 21 with radially extending arm 23 and recess 22 for coupling in the opening 27 and with the rod 14 of the outer door , as has been previously explained . in this embodiment , the rod 14 is attached to a lever 64 engageable with a pin 65 of the bolt 66 of the latch 12 , the bolt being provided with a recovery spring 67 . the outer door 2 is provided with an opening 68 for the passage of a key 43 , for the purpose of opening the lock 53 of the inner door 1 . also , on the other hand , the retaining means 8 is provided with a rocker lever 73 mounted on a shaft 74 and provided with a cam tooth 75 and is engageable with the detent 63 of the core portion . said interlocking means 7 is provided with a manually operated control 70 mounted in brackets 71 and having a recovery spring 72 , which is engageable with the arm 61 to locate the coupling means 6 in the operative position thereof , in which the arm 23 rotates and is retained in the opening 27 as having been rotated beyond the notch 28 . said manual control 70 may be replaced by any other device having the same effect , such as a push button combined with a rocking member engageable with the arm 61 . the releasing means 8 is composed of the horizontal sliding rod 32 previously described , which is provided with a terminal portion jointed at 76 to a crank 77 capable of rocking around one end 78 and carrying at the other end thereof a pawl 79 rotatable around a point 80 , the movement of said pawl being limited by a stop member 81 , said pawl being engageable with the cam tooth 75 of the retaining means 8 . a spring 82 damps the movements of the crank 77 and a stop member 83 limits the movement thereof . in the present embodiment , the behaviour of the security door arrangement is the same as described hereinbefore . when the inner door 1 is to be opened and the outer door 2 is to remain closed , it is only necessary to rotate the handle 5 whereby the latch 4 of the inner door 1 is withdrawn and the inner door may be opened , while the outer door 2 remains closed . when it is desired to open both doors 1 and 2 together , the inner door 1 must of necessity be closed , in which case the combined door may be opened from the inside or from the outside . if the combined door is to be opened from the outside , as illustrated in fig1 , the lock 53 of the inner door 1 is operated by the key 43 , whereby the lever 51 draws with it the latch 4 and actuates the catch finger 60 , thereby coupling the doors together by way of the shaft 20 , arm 23 , opening 27 and rod 14 , which actuates the latch 12 via the lever 64 . if the combined door is to be opened from the inside , the control 70 must be actuated to locate catch finger 59 in the path of the lever 50 actuated by the handle 5 . in such situation , see fig9 the doors have been coupled together by rotation of the shaft 20 and , in the same way as described hereinbefore , the combined door may be opened by actuation of the handle 5 , as seen in fig1 . when the combined door is closed , the rod 32 of the releasing means 9 is pushed by the door jamb 3 , raising thereby the crank 73 and releasing the core portion of the catch fingers 59 and 60 as seen in fig1 , whereby the mechanism is positioned to allow the combined door to be opened by the key 43 from the outside , or the inner door 1 alone from the inside by the handle 5 . the mechanism comprises , as seen in fig1 , a rod 90 housed along the top of the outer door 2 and being provided with a latch 91 and a biassing spring 92 bearing against a wall 93 and a pin 94 and a further rod 95 , housed across the fixed door jamb 3 and provided with a biassing spring 96 bearing against a stop member 97 , engageable with a shoulder 98 formed as a cam on the hinge 18 of the inner door 1 . the jamb 3 is provided with extensions of bores 99 and 100 in the housings thereof for the rods 90 and 95 , respectively . as shown in fig1 , when both doors 1 and 2 are closed , the rods 90 and 95 are in the forward position biassed by the respective springs 92 and 96 thereof . if the inner door 1 is opened by the handle 5 or lock 53 , see fig1 , the rod 95 is pushed towards the bore 100 and intercepts the reverse movement of the rod 90 , namely , the latch 91 is retained in its closed position and the outer door 2 may not be opened , even when the locking elements are forced or the coupling means , in this case the rod 14 , are tampered with . the outer door 2 blocking mechanism is applicable to prevent the person located on the outside of the outer door 2 from being able to force the outer door by manipulating the coupling means 6 when the inner door 1 is open . when the combined door is opened , since the two doors are properly coupled together and the respective latches 4 and 12 being withdrawn at the same time as the possible auxiliary latches 91 are withdrawn by a control lever 101 , the rod 90 penetrates in the bore 99 , whereby the combined door may be opened , by rotation on the hinges 15 . the shoulder 98 gradually pushes the rod 95 which does not interfere with the rod 90 because the latter is leaving the bore 99 with the rotation of the door , leaving room for the passage of the rod 95 into the bore 100 . as will be seen , the security door arrangement of the present invention attains all the security conditions proposed . a further condition to be covered is the case of small children trying to open the doors 1 and 2 hastily from the inside , on a call being heard , that is , without taking the inherent precautions . this is covered by locating the control members , namely , the lever 70 of the interlocking means 7 , or equivalent member , at a height not directly within the reach of such young children . | 4 |
as seen from fig1 to 3 , guiding tube 11 for medical instruments according to one embodiment of the present invention comprises a tubular body opened at opposite ends in the shape of a hollow tube for guiding a rod - like medical instrument such as a catheter and converged at one end in contact with an inner needle , not shown , and enlarged at the other cylindrical base . the tubular body is formed , as shown in fig2 with brittle portions 12a and 12b so made at two parts of the circle of the body , i . e ., at two positions opposite to each other in the radial direction along the length of the tubular body or along the entire length of the body except the opposite end that the splitting strengths are smaller than those of the other circular portion . brittle portions 12a and 12b of the tubular body are formed with extrusion molding machine or extruder 13 as shown , for example , in fig4 and 5 . molding machine 13 comprises a pair of baffles 15a and 15b so positioned oppositely to each other on the inner peripheral surface of inner die 16 and projected oppositely from the inner peripheral surface of die 16 in the radial direction in annular passageway 18 in the vicinity of a nozzle of annular die 14 that the molded parts of the tubular body passing baffles 15a and 15b naturally become brittle portions 12a and 12b . baffles 15a and 15b may be determined at the positions and in the heights properly in relation to the type and the mixture of synthetic resin to be used . when distance l between the end positions of baffles 15a and 15b and the end of die 14 is 0 to 5 mm and distance h between the upper ends of baffles 15a , 15b and the inner wall of die 17 is set to h : h = 0 to 1 / 2 : 1 , preferably 0 to 1 / 5 : 1 to the interval h of resin passageway 18 , brittle portions 12a , 12b having desired splitting strength are provided . when the tubular body of the guiding tube for the medical instrument is molded by the extruder provided with baffles 15a and 15b near the nozzle of die 14 under the above - mentioned conditions , softened resin guided into die 14 by a screw , not shown , is fed in die 14 temporarily substantially split state by baffles 15a , 15b , is again bonded to each other in the nozzle or in the vicinity of the nozzle of die 14 to be molded in a tubular shape . the tubular body thus molded is formed substantially smoothly at a glance in a continuous circular shape , but is formed with welding lines , i . e ., brittle portions 12a , 12b in the portions passing baffles 15a , 15b . since brittle portions 12a , 12b remarkably decrease in bonding strength between synthetic resins of other circular portion , portions 12a , 12b are readily broken by applying an external stress thereto , and are , for example , readily split as shown in fig3 . the splitting strength of brittle portions 12a , 12b may be regulated by adjusting the positions , the heights and the widths ( lengths or thicknesses ) of baffles 15a , 15b or arbitrarily adjusting the mixture of two or more resins . thermoplastic resins such as polypropylene , fluorinated plastics , chlorinated polyethylene , blend polymer of polyolefin resin and ethylene / vinyl acetate copolymer are used properly selectively as the material of the tubular body of the guiding tube for the medical instruments . the case that the extruder in which baffles 15a , 15b are projected on the inner die has been used has been described as shown in fig5 and 6 . however , the present invention is not limited to the particular embodiment . various other changes and modifications may be made within the spirit and scope of the present invention . in the embodiment described above , other arbitrary molding means may be employed . for example , as shown in fig6 and 7 , the same baffles 15a , 15b as those which have been described with reference to fig4 and 5 may be positioned oppositely to the annular die 14 ( in which symbols designate all the same as those in fig4 and 5 ). further , though not shown , similar baffles may be projected oppositely to annular and inner dies . in any case , the positions ( l ), the heights ( h ) and the sizes of the baffles may be regulated and selected similarly to the case of fig4 and 5 . a method of using the guiding tube for the medical instrument of the present invention will be described . guiding tube 11 of the present invention is , for example , mounted to syringe 2 as shown in fig8 with respect to guiding tube 1 , and is then positioned together with the inner needle of syringe within a blood vessel , as shown in fig9 . under this condition , inner needle 3 is withdrawn from the blood vessel , with guiding tube 11 kept attached to blood vessel 4 . then , a catheter is inserted into guiding tube 11 so that catheter is positioned within the blood vessel . then , in withdrawing guiding tube 11 after use from the catheter , an external stress is applied to guiding tube 11 as shown in fig3 to cut the base ends of brittle portions 12a , 12b , and tube 11 is split through the base ends of brittle portions 12a , 12b . then , guiding tube 11 can be readily withdrawn from catheter 5 . in the embodiments described above , the catheter has been guided as the guiding tube for the medical instruments . however , the present invention is not limited to the catheter , but may be applied to the case that all types of rod - shaped medical instruments are positioned within a living body . the above - mentioned brittle portions to be split are not limited to the two linear bodies as in the embodiments described above , but may be provided with one or three or more linear bodies of the brittle portions . the guiding tube for the medical instrument according to the present invention as described above is not necessarily provided with the linear bodies formed of a synthetic resin foreign to the material forming the tubular body of the guiding tube as the conventional art but is molded of a sole plastic composition . thus , the linear body can avoid to be unintentionally cracked during the after - treatment , such as cutting or edge - processing of the guiding tube , the guiding tube can be manufactured readily , leading to a low manufacturing cost of the guiding tube . a pair of baffles having 22 mm long and 0 . 5 wide were provided , as shown in fig7 in contact with the inner wall of the inner die at the annular die of an extruder so that the tip thereof was disposed at the position of 0 . 5 mm before the nozzle of the die ( i . e ., &# 34 ; l &# 34 ;= 0 . 5 mm in fig7 ). then , a guiding tube fitting a 16g inner needle was prepared by polypropylene . even when the tip of the guiding tube was processed in contact with the 16g inner needle , the guiding tube was found to be free of problems such as cracking of the tip portion . also , the pin portion of the guiding tube was free from roughening , cracking , etc . when the guiding tube was stuck in a blood vessel of a dog together with the inner needle . further , the linear body was readily peeled from the tubular body in removing the guiding tube . a catheter guiding tube was prepared by extrusion molding similarly to the example 1 except that the similar baffles to those in the example 1 were disposed at a position of 6 mm before the nozzle of the die . however , in this case , the guiding tube was not substantially molded with brittle portions and could not be split . similar baffles to those of the example 1 were projected on the inner wall of the annular die having 5 mm of inner diameter . however , in this case , the heights of the baffles were separated 0 . 6 mm from the peripheral surface of the inner die having 4 mm of outer diameter , and the ends of the baffles were positioned 0 . 5 mm before the nozzle of the die . when a catheter guiding tube was molded similarly to the example by this extruder , a brittle portion was not substantially molded and the guiding tube could not be split . | 0 |
fig1 shows a schematic diagram of a dual - spool , low - bypass ratio turbofan engine 10 , in which the advantages of the inlet guide vane inner air seal surge retention system of the present invention is particularly well illustrated . although , in other embodiments the present invention is applicable to other types of gas turbine engines such as high - bypass ratio turbofans including geared turbofans . engine 10 comprises a low pressure spool , comprising low pressure fan 12 , low pressure shaft 14 and low pressure turbine ( lpt ) 16 ; and a high - pressure spool , comprising high pressure compressor ( hpc ) 18 , high pressure shaft 20 and high pressure turbine ( hpt ) 22 . engine 10 also includes combustor 24 , which is nested between hpc 18 and hpt 22 , and exhaust section 26 , which is used to accelerate exiting gases to produce thrust . the low pressure spool and the high pressure spool are each concentrically disposed around longitudinal engine centerline cl . low pressure fan 12 includes one or more fan blade stages and , in various embodiments , includes a low pressure compressor section . low pressure fan 12 is encased in fan case 27 and intermediate case 28 , which is connected with hpc case aft duct 30 and bypass duct 32 such that split flow - paths are each concentrically disposed around longitudinal engine centerline cl . aft duct 30 typically comprises split upper and lower portions such that it is easily assembled around low pressure shaft 14 . rotatable inlet guide vanes ( igvs ) 34 are disposed between intermediate case 28 and hpc 18 to moderate airflows within engine 10 for improving engine performance . inlet guide vanes 34 are secured at their inner diameters to intermediate case 28 with inner air seal surge retaining mechanism 36 of the present invention . inlet air a enters engine 10 and it is divided into streams of primary air a p and secondary air a s by flow divider 38 after it passes through fan 12 . low pressure fan 12 is rotated by low pressure turbine 16 through shaft 14 to accelerate secondary air a s ( also known as bypass air ) into bypass duct 32 and through exit guide vanes 40 within exhaust section 26 , thereby producing a portion of the thrust output of engine 10 . primary air a p ( also known as gas path air ) is also directed first into low pressure fan 12 and then routed to inlet guide vanes 34 in front of high pressure compressor ( hpc ) 18 by divider 38 . hpc 18 is rotated by hpt 22 through shaft 20 . low pressure fan 12 and hpc 18 work together to incrementally step up the pressure of primary air a p to provide compressed air to combustor section 24 . the compressed air is delivered to combustor section 24 , along with fuel through injectors 42 , such that a combustion process can be carried out to produce the high energy gases necessary to turn turbines 22 and 16 . primary air a p continues through gas turbine engine 10 whereby it is passed through exhaust nozzle 44 to produce thrust . in order to improve the performance of engine 10 , it is desirable to increase the compression of primary air a p and secondary air a s as they flow through low pressure fan 12 and hpc 18 . accordingly , engine 10 is provided with inlet guide vane 34 that redirects entering primary air a p to optimize its incidence on the first stage blades within hpc 18 . the igv also modulates the airflow through the hpc , thus reducing the occurrence of compressor surges . compressor surges occur when an excessive increase in axial air pressure along the flow path causes flow instability or reversal within the hpc . particularly , an axial air pressure increase causes the laminar gas - flow at the blades and vanes to become turbulent . the turbulent flow separates from the blades and vanes , detrimentally impacting compressor efficiency and causing high - pressure gases downstream to lurch or “ surge ” forward . surges may fatigue various engine components such as the igv . engine performance is further enhanced by sealing the flow path , which volumetrically reduces the flow path cavity to increase compression efficiency . in order to seal the flow path around primary air a p , and to stabilize inlet guide vanes 34 , inlet guide vanes 34 are provided with inner air seal surge retaining mechanism 36 . fig2 shows inner air seal surge retaining mechanism 36 positioned between intermediate duct 28 and hpc case aft duct 30 of engine 10 . primary air a p is directed from within intermediate duct 28 to hpc 18 by divider 38 , while secondary air a s is routed outside of hpc aft duct 30 , past hpc 18 . hpc 18 includes an array of first - stage blades and vanes , including first - stage blade 46 and first - stage vane 48 , that extend radially from engine centerline cl . first - stage blade 46 of hpc 18 rotates as it is driven by shaft 20 and hpt 22 to drive air past first - stage vane 48 to increase the pressure of primary air a p . igv 34 and first - stage vane 48 are adjustable to control the flow incidence to first - stage blade 46 . the outer diameter ends of igv 34 and first - stage vane 48 include trunnions 50 and 52 , respectively , which are secured within bores in aft duct 30 . trunnions 50 and 52 are connected to actuation mechanisms , such as a bell crank 53 , so that the pitch of the vanes can be adjusted to alter the airflow of primary air a p . the inner diameter end of first - stage vane 48 includes trunnion 54 , which is configured for rotation within split - ring inner diameter shroud 56 . likewise , igv 34 includes inner diameter trunnion 58 , which is configured for rotation in split - ring inner diameter shroud 60 . split - ring inner diameter shroud 60 and inner diameter shroud 56 stabilize the inner diameter ends of igv 34 and vane 48 , respectively . shrouds 60 and 56 also enable synchronized rotation of igv 34 and vane 48 on trunnions 54 and 58 , respectively , by fixing the circumferential spacing of the vanes . thus , inlet guide vane 34 and first - stage vane 48 are suspended from aft duct 30 such that they are cantilevered within the airflow of primary air a p . typically , for compressor vanes no other inner diameter support is necessary . compressor vanes , including first - stage vane 48 , are generally comprised of a high - strength material such as nickel and have a generally sturdy construction such that the combined radial strength , as provided by inner diameter shroud 56 , typically provides enough resistance to the bending stresses sustained during operation of engine 10 . additionally , compressor vanes are generally short such that the bending stress imparted to them is small . however , for igv 34 , which is generally longer than a compressor vane , additional inner diameter retention and support is typically required . inlet guide vane 34 is typically comprised of titanium rather than nickel since it is not subjected to as high of temperatures as vane 48 or other compressor vanes . titanium is relatively less strong than nickel and is therefore more susceptible to bending stress . furthermore , igv 34 is subjected to oscillations due to the operation of engine 10 and , in particular , to surge events . typically during operation of engine 10 , pressure builds up within hpc 18 such that igv 34 is normally pushed forward within engine 10 . during surge events , however , flow direction within hpc 18 can instantaneously change and igv 34 will bend back toward first - stage blade 46 , potentially resulting in contact with first - stage blade 46 . thus , vane - angle of igv 34 and first - stage vane 48 is actuated to control pressure within hpc 18 to alleviate surge conditions . therefore , in addition to potentially large bending during surge events , igv 34 is subjected to low - frequency bending cycles during normal engine operation as the vane - angle of igv 34 and vane 48 are adjusted . in order to reduce the bending moment of igv 34 during operation , and in particular during surge events , igv 34 is restrained at its inner diameter end with inner air seal surge retaining mechanism 36 . inner air seal surge retaining mechanism 36 provides a means for restraining axial movement of the inner diameter end of igv 34 in the downstream or aft direction . retaining mechanism 36 includes surge retainer 62 and carrier 64 . inner air seal carrier 64 includes leading and trailing edge bent - flanges that slide into corresponding grooves on the leading and trailing edges of shrouds 60 , while surge retainer 62 comprises a spring - like member secured to intermediate case 28 . surge retainer 62 engages carrier 64 to restrain downstream movement of the inner diameter end of igv 34 . however , surge retainer 62 engages with carrier 64 so as to also permit sealing of the flow path along which primary air ap flows . in order to increase the efficiency of hpc 18 , blade 46 is sealed at its inner and outer diameter ends . blade 46 includes rotatable sealing elements 66 and 68 for engaging with stationary sealing elements 70 and 72 of igv 34 and vane 48 , respectively . aft duct 30 also includes stationary sealing element 74 for engaging with the outer diameter end of blade 48 . blade 46 rotates between igv 34 and vane 48 at high speeds , while igv 34 , vane 48 and aft duct 30 remain stationary . in order to improve compression ratios of hpc 18 and to reduce the overall size of hpc 18 , it is desirable to reduce the distance between blade 46 and the stationary components surrounding it , while also preventing undesirable contact . accordingly , aft duct 30 includes sealing element 74 , which comprises an abradable or sacrificial material such as honeycomb , that will yield upon contact of a rotating blade 46 . thus , the outer diameter end of blade 46 can be held in close proximity with aft duct 30 to prevent leakage of primary air a p around the tip of blade 46 without much risk of interference . likewise , the inner diameter end of blade 46 is sealed by bringing rotating sealing elements into close proximity with stationary sealing elements 70 and 72 , respectively . stationary sealing elements 70 and 72 also comprise abradable or sacrificial material such as honeycomb such that contact with rotating sealing element 66 or 68 is sustainable . rotating sealing elements 66 and 68 comprise knife - edge surface or the like that upon rotational contact with stationary sealing elements 70 and 72 cut into or wear away the abradable honeycomb material . thus , sealing elements 66 and 68 can be brought into close contact with sealing elements 70 and 72 to prevent escape of primary air a p into the interior of engine 10 . carrier 64 and stationary sealing member 70 of inner air seal surge retaining mechanism 36 thus permit the inner diameter end of igv 34 to be stabilized to prevent damage caused by bending , yet also permit the inner diameter end of blade 46 to be sealed in a compact manner . both retainer 62 and rotating seal member 66 engage carrier 64 from the innermost radial extent , or bottom , of carrier 64 such that blade 64 is brought into close proximity to igv 34 to reduce the size of cavity c . fig3 shows inlet guide vane inner air seal surge retaining mechanism 36 restraining the inner diameter end of inlet guide vane 34 . retaining mechanism 36 includes split - ring inner diameter shroud 60 , surge retainer 62 , carrier 64 , stationary sealing member 70 , mounting bolt 76 , shroud bolt 78 and shroud nut 80 . igv 34 is suspended from hpc aft duct 30 ( fig2 ) such that the inner diameter of igv 34 is suspended within the flow path of primary air a p . inner diameter trunnion 58 of igv 34 is secured within split - ring inner diameter shroud 60 , which comprises forward shroud 60 a and aft shroud 60 b such that they can be secured to each half of aft duct 30 . shroud bolt 78 and shroud nut 80 clamp forward shroud 60 a and aft shroud 60 b around inner diameter trunnion 58 such that the inner diameter end of igv 34 is held in a fixed relationship to other igvs of engine 10 within the air flow path . carrier 64 is clamped around shroud 60 to prevent nut 80 from backing off of bolt 78 . carrier 64 comprises a thin , sheet metal clip that can be deformed to fit around forward shroud 60 a and aft shroud 60 b to prevent nut 80 from disengaging bolt 78 . aft shroud 60 b includes pocket 82 that permits nut 80 to be recessed within aft shroud 60 b allowing carrier 64 to easily fit around shroud 60 . forward shroud 60 a includes notch 84 and aft shroud 60 b includes notch 86 that engage with flanges 88 and 90 , respectively , of carrier 64 to prevent carrier 64 from disengaging shroud 60 in the radial direction . flange 88 abuts the leading edge of bolt 78 within notch 84 , while flange 90 engages notch 86 above nut 80 . carrier 64 also includes jog 92 for engaging with surge retainer 62 , and stationary seal member 70 for engaging with rotating seal member 66 . jog 92 is positioned on the forward portion of carrier 64 , while seal member 70 is positioned on an aft portion of carrier 64 . surge retainer 62 is thus permitted to engage carrier 64 between jog 92 and seal member 70 . surge retainer 62 is secured to intermediate duct 28 with a circular pattern of bolts 76 , or some other such fastener . surge retainer 62 includes radial extension arm 94 , axial extension arm 96 and axial retention hook 98 . radial extension arm 94 comprises an elongate extension that permits retainer 62 to extend radially from the connection at bolt 62 to carrier 64 . axial extension arm 96 permits retainer 62 to extend axially from intermediate case 28 to carrier 64 . axial retention hook 98 extends radially from axial extension arm 96 to engage with jog 92 to prevent axial movement of the inner diameter end of igv 34 . surge retainer 62 is comprised of a continuous circular structure such that it abuts intermediate case 28 continuously around engine centerline cl . however , in other embodiments , retainer 62 may comprise a split - ring configuration , or may comprise a crenellated or scalloped structure for weight reduction . axial extension arm 96 and axial retention hook 98 are shaped to match the profile of jog 92 . in the embodiment shown , jog 92 comprises a rectangular - like projection or corrugation in carrier 64 , and axial retention hook 98 comprises a similarly shaped flange . however , in other embodiments jog 92 can have other shapes . in still other embodiments , jog 92 comprises a projection , protrusion or other such outcropping attached to carrier 64 . in any embodiment , axial retention hook 98 engages a downstream or aft facing portion of jog 96 to prevent movement of igv 34 in the downstream direction . retainer 62 is also configured to prevent forward or upstream movement of igv 34 . radial extension arm 94 and axial extension arm 96 are shaped and configured such that they provide a spring - like biasing force against jog 92 after assembly of inlet guide vane inner air seal surge retaining mechanism 36 . for example , radial extension arm 94 lays flush with intermediate case 28 such that intermediate case 28 provides bending resistance to and stiffens retainer 62 . thus , the force of axial extension arm 96 against jog 92 prevents forward movement of igv 34 and , in other embodiments can be used to pin carrier 64 against intermediate duct 28 . thus , in the various embodiments , retainer 96 is not rigidly affixed to carrier 64 such that igv 34 is not rigidly restrained , but is permitted some degree of movement in the axial direction . additionally , axial retention hook 98 engages jog 92 without interfering with rotating seal member 66 of blade 48 . stationary seal member 70 is placed on carrier 64 away from jog 92 to permit axial retention hook 98 to access carrier 64 between jog 92 and seal member 70 . seal member 70 is placed toward the trailing edge of carrier 64 such that seal member 66 does not need to extend far beyond blade 48 . seal member 70 is also wide enough such that any small movements of igv 34 due to surge or other engine events do not disrupt the seal between seal member 70 and seal member 66 . additionally , carrier 64 and seal member 70 do not extend beyond the trailing edge of igv 34 such that blade 48 can be brought into close proximity to igv 34 , thus reducing the cavity size c between igv 34 and first - stage blade 48 . specifically , seal member 70 and jog 92 are positioned underneath igv 34 on the innermost diameter surface of carrier 64 . in the embodiment shown , stationary seal member 70 and rotating seal member 66 comprise a knife - edge seal / honeycomb material interface . however , in other embodiments , other sealing arrangements such as brush seals may be used . in still other embodiments , stationary seal member 70 can be configured as a knife - edge seal , and rotational seal member 66 can be configured as an abradable material . inlet guide vane inner air seal surge retaining mechanism 36 provides a lightweight and inexpensive means for securing the inner diameter end of igv 34 in a sealed manner . surge retainer 62 and carrier 64 comprise thin , sheet metal structures making the raw materials necessary for construction inexpensive and easily repairable or replaceable . in other embodiments , surge retainer 62 and carrier 64 are machined from a ring structure . additionally , retainer 62 and carrier 64 are easily manufactured in that the sheet metal is readily shaped or bended to form the components . furthermore , seal member 70 is readily brazed to carrier 64 . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention . | 5 |
fig2 a schematically illustrates the perspective view of the openable blocking cover 30 and the optical read / write drive 32 in accordance with the first preferred embodiment of the present invention . fig2 b illustrates the cross - sectional side view of the front portion of the optical read / write drive 32 and the openable blocking cover 30 and the spacial relationship between them . this invention discloses an optical read / write drive 32 comprising a case 31 have a slot 34 formed thereupon wherein an optical disk is drawn out of / into the slot - in optical read / write apparatus 32 through the slot 34 and an openable blocking cover 30 , which can be utilized to cover the slot 34 and to isolate the interior of the optical read / write drive 32 from the exterior . according to the first preferred embodiment of the present invention , the openable blocking cover 30 includes a swingable cover 302 and a fitting pad 304 , wherein the fitting pad 304 can be a soft pad . when the slot 34 is covered by the openable blocking cover 30 , the fitting pad 304 is tightly inserted in the slot 34 so that the dust and exterior object has been prevented from entering the optical read / write drive 32 via the slot 34 and the internal operation noise has been isolated from scattering out of the optical read / write drive 32 via the slot 34 . the schematic side view of the openable blocking cover 30 is shown in fig2 b , and the schematic perspective view of the openable blocking cover 30 from inward surface is shown in fig3 . according to the first preferred embodiment of the present invention , the swingable cover 302 is used to expose / block the slot 34 , wherein the fitting pad 304 is adherent to the swingable cover 302 , and is positioned between the swingable cover 302 and the slot 34 . when blocking the slot 34 , please referring to fig2 b , the swingable cover 302 forces the fitting pad 304 to insert in the slot 34 . as shown in fig3 , the size of the fitting pad 304 make itself lodge in as well as block the slot 34 , thus the interior of optical read / write drive 32 has been sealed to improve the dust - proof , intruding - object - proof , and sound - proof efficiency ; being fitted to the slot 34 , the fitting pad 304 makes the swingable cover 302 keep close even when an unexpected external force applied thereon . as depicted in the first preferred embodiment of the present invention , the material of the fitting pad can be made of rubber , soft material ( such as soft plastic or foamed plastic ) or elastic material . fig4 a schematically illustrates the perspective view of the openable blocking cover 30 and the optical read / write drive 32 in accordance with the second preferred embodiment of the present invention . fig4 b illustrates the cross - sectional side view of the front portion of the optical read / write drive 32 and the openable blocking cover 30 and the spacial relationship between them . according to the second embodiment of the present disclosure , the an optical read / write drive 32 comprising a case 31 have a slot 34 formed thereupon wherein an optical disk is drawn from / into the slot - in optical read / write apparatus 32 through the slot 34 and an openable blocking cover 30 , which can be utilized to block the slot 34 and to isolate the interior of the optical read / write drive 32 from the exterior . in addition , the openable blocking cover 30 includes a swingable cover 302 , a fitting pad 304 , and a impetus part 306 , wherein the fitting pad 304 can be a soft pad . when the slot 34 is covered by the openable blocking cover 30 , the fitting pad 304 is tightly inserted in the slot 34 so that the dust and exterior object has been prevented from entering the optical read / write drive 32 via the slot 34 and the internal operation noise has been isolated from scattering out of the optical read / write drive 32 via the slot 34 . one longitudinal side of the swingable cover 302 is axially jointed on the case 31 and adjacent to one edge of the enclosure surrounding the slot 34 , i . e ., is axially jointed to one edge of the slot 34 . as obviously depicted in fig4 b , the other longitudinal side of the swingable cover 302 can swing , thus enabling the swingable cover 302 to pivot on the axis parallel to the longitudinal side of the swingable cover 302 , which is jointed to the foregoing edge of the slot 34 , and the swingable cover 302 can expose / block the slot 34 thereby . in the second preferred embodiment of the present disclosure , please referring back to fig4 a , there are two pivots 36 located on two ends of the foregoing longitudinal side of the swingable cover 302 respectively . each pivot 36 correspondingly engages one of the two bearings 38 , which are respectively positioned on two ends of the foregoing edge of the enclosure surrounding the slot 34 . thus the swingable cover 302 can pivot on the direction parallel to the foregoing edge of the slot 34 . according to the second embodiment of the present disclosure , the schematic side view of the openable blocking cover 30 is shown in fig4 b , and the schematic perspective view of the openable blocking cover 30 is shown in fig3 . according to the second embodiment of the present invention , the swingable cover 302 is used to expose / block the slot 34 , wherein the fitting pad 304 is adherent to the swingable cover 302 , and is positioned between the swingable cover 302 and the slot 34 . when blocking the slot 34 , please referring to fig4 b , the swingable cover 302 forces the fitting pad 304 to cover and block the slot 34 . in addition , the size of the fitting pad 304 make itself lodge in as well as block the slot 34 , thus the interior of optical read / write drive 32 has been sealed to improve the dust - proof , intruding - object - proof and sound - proof efficiency . being fitted to the slot 34 , the fitting pad 304 makes the swingable cover 302 keep close even when an unexpected external force applied thereon . as depicted in the second preferred embodiment of the present disclosure , the material of the fitting pad can be made of rubber , soft material ( such as soft plastic or foamed plastic ) or elastic material . please refer to fig4 b , the impetus part 306 is protruded and positioned at outward surface of the swingable cover 302 , which is adjacent to simultaneously perpendicular to the surface facing the slot 34 . in other words , the impetus part 306 is located at the outward surface of the swingable cover 302 from the slot 34 . the swingable cover 302 can swing in an expected direction responding to a force applied on the impetus part 306 , and the slot 36 is opened / closed . because it is manually operated , the type of impetus part 306 mentioned above can be utilized in the swingable cover 302 referred as a manual type . in addition , in the third embodiment of the present invention , the swingable cover 302 can automatically swing to expose / block the slot 34 without manual force . to roughly illustrate the construction , please refer to fig5 , in side view , it schematically illustrates the cross section of the front portion of the optional read / write drive 32 including the openable blocking cover 30 , which utilizes a certain mechanism such as a gear drive to enable the swingable cover 302 to swing without manual force . because the mechanism operates responds to an electric signal , and is driven by electricity , this type of swingable cover 302 can be referred as electricity driven type . the gear drive mentioned above , according to the third embodiment of the present invention , includes a fixed gear wheel 40 being a semicircle gear wheel in this embodiment fixed on the inward surface of the swingable cover 302 , a gear wheel unit 42 and a driving device 44 electrically coupled to a button 46 . the gear wheel 40 is engaged to the gear wheel unit 42 , and the gear wheel unit 42 is driven by driving device 44 such as a motor which is driven by the power from electricity . the driving device 44 is activated by a control signal ( for example an electric signal ) generated responding to pushing the button 46 on the outward surface of the optional read / write drive 32 . thus , by pushing the button 46 , the user can easily control the swinging of the swingable cover 302 , thereby exposing / blocking the slot 34 easily . in order to more firmly fix the swingable cover 302 in position while the swingable cover 302 blocking the slot 34 , in the fourth embodiment of the present invention , please refer to fig6 , the swingable cover 302 and the edge of the slot 34 respectively include the positioning post 48 and positioning hole 50 formed thereon . this construction can also be applied to all other aspects of all embodiments of the present invention . the two positioning posts 48 are adherent to the inward surface of the swingable cover 302 , and are longitudinally separated by the fitting pad 304 , accordingly , the two positioning holes 50 are formed in the front of the case 31 of the optional read / write drive 32 and positioned corresponding to the two positioning posts 48 respectively , thus enabling the two positioning posts 48 inserting into the two positioning holes 50 when the swingable cover 302 blocking the slot 34 . solo squeezing the fitting pad 304 into the slot 34 sometimes can not provide enough force to hold the swingable cover 302 , so the fourth embodiment of the present invention use the positioning post 48 and the positioning hole 58 to provide additional force to prevent the swingable cover 302 from unexpected opening and to keep the swingable cover 302 in position . according to the foregoing description , the swingable cover 302 of the optical read / write drive 32 in the present invention can avoid dust and small object invasion from the exterior , and prevent the interior - generated noise from spreading out of the optical read / write drive 32 . so the life of the optical read / write drive 32 according to the present invention can be prolonged , and the value of this product can be raised . in addition , the fitting pad 304 adherent to the inward surface of the swingable cover 302 is to be squeezed into the slot 34 , so the present invention can further improve dust - proof , intruding - object - proof and sound - proof efficiency . furthermore , in order to make the optical read / write drive 32 a handy device , a impetus part 306 is added to the outward surface of the swingable cover 302 , thus the user can open the swingable cover 302 to expose the slot 34 more easily when the user wants to access the cd . while the preferred embodiments of the present invention have been set forth for the purpose of disclosure , modifications of the disclosed embodiments of the present invention as well as other embodiments thereof may occur to those skilled in the art . accordingly , the appended claims are intended to cover all embodiments which do not depart from the spirit and scope of the present invention . | 6 |
a preferred method of introducing the nucleic acid segments into plant cells is to infect plant cells with a . tumefacient carrying an inserted dna construct . the nucleic acid segments or constructs can be introduced into appropriate plant cells , for example , by means of the ti plasmid of a . tumefaciens . the t - dna is transmitted to plant cells upon infection by a . tumefaciens , and is stably integrated into the plant genome . under appropriate conditions known in the art , the transformed cells develop further into plants . the agrobacterium strains customarily employed in the art of transformation are described , for example see especially u . s . pat . no . 5 , 188 , 958 and ep 0 270 615 b1 , incorporated herein by reference . ti plasmids contain two regions essential for the production of transformed cells . one of these , named transfer dna ( t dna ), induces tumour formation . the other , termed virulent region , is essential for the introduction of the t dna into plants . the transfer dna region , which is transferred into the plant genome , can be increased in size by the insertion of the foreign nucleic acid sequence without its ability of transfer being affected . by removing the tumour - causing genes so that they no longer interfere the modified ti plasmid (“ disarmed ti vector ”) can then be used as a vector for the transfer of the gene constructs of the invention into an appropriate microspores . in the binary system , to have infection , two plasmids are needed : a t - dna containing plasmid and a vir plasmid ( see especially ep 116718 b1 and ep 120 516 b1 ). besides transformation using agrobacteria there are many other techniques for the introduction of dna available . these techniques include , e . g . the protoplast transformation ( see ep 164 575 ) the micro injection of dna , the introduction of dna via electroporation as well as biolistic methods and virus mediated infection . from the transformed cells applying suitable media and techniques whole plants can be regenerated ( see mccormick et al . ( 1986 ) in plant cell reports 5 : 81 - 84 ). the regenerated plants may be preferably used to cross them with existing breeding lines to improve their growth characteristics as well . the dna constructs used in instant invention consist of a transcription initiation region and , under the control of the transcription initiation region , a dna sequence to be transcribed . the dna sequence may comprise a natural open reading frame including transcribed 5 ′ and 3 ′ flanking sequences . alternatively , it may comprise an anti - sense sequence that encodes the complement of an rna molecule or portion thereof ( as described in ep 140 308 b1 and ep 223 399 b1 ) in order to suppress the expression of the internally expressed glutamine synthetases . the initiation regions may be used in a variety of contexts and in combination with a variety of sequences . the rna coded sequences of a gene may be those of a natural gene , including the open reading frame for protein coding and frequently the 5 ′ and 3 ′ untranslated sequences . the rna translational initiation sequences are included in the constructs , either from the promoter domain or from the attached coding sequences . attached to the above sequences are appropriate transcription termination and polyadenylation sequences . the dna constructs used in the transformation process according to instant invention may comprise sequences coding for naturally occurring or genetically modified transit peptides ( see for example ep 189 707 b1 ). examples of additionally expressed sequences or genes to be expressed from the constructs of the subject invention include : especially antisense or sense genes ( for gene suppression or cosuppression ); as well as additionally nutritionally important proteins : growth promoting factors ; yield enhancing genes or factors , e . g . an invertase gene , a citrate synthase , a polyphosphate kinase ; proteins giving protection to the plant under certain environmental conditions , e . g . proteins giving resistance to metal or other toxicity ; stress related proteins giving tolerance to extremes of temperature , freezing , etc . proteins of specific commercial value ; genes causing increased level of proteins , e . g ., enzymes of metabolic pathways , genes causing increased levels of products of structural value to a plant host , e . g ., herbicide resistance , fungus resistance , e . g . chitinase genes , glucanase genes , proteins synthesis inhibitor genes , ribosome inhibitory protein genes , viral resistance , e . g . ribozymes , virus coat protein genes . the subject constructs will be prepared employing cloning vectors , where the sequences may be naturally occurring , mutated sequences , synthetic sequences , or combinations thereof . the cloning vectors are well known and comprise prokaryotic replication systems , markers for selection of transformed host cells , and restriction sites for insertion or substitution of sequences . for transcription and optimal expression , the dna may be transformed into plant cells for integration into the genome , where the subject construct is joined to a marker for selection or is co - transformed with dna encoding a marker for selection . the selection of transformed cells is enabled by the use of a selectable marker gene which is also transferred . the expression of the marker gene confers a phenotypic trait that enables the selection . examples for such genes are those coding for antibiotics or herbicide resistance , e . g . genes causing resistance against glutamine synthetases inhibitors , e . g . bialaphos or phosphinothricin resistance conferred by genes isolated from streptomyces hygroscopicus or viridochromogenes ( bar / pat ). other examples are the neomycin phosphotransferase or the glucuronidase gene . the class of transgenic plants which are covered by this invention is generally as broad as the class of higher plants susceptible to transformation , including both monocotyledonous and dicotyledonous plants . it is known that theoretically all plants can be regenerated from cultured totipotent cells , including but not limited to all major cereal crop species , sugarcane , sugar beet , cotton , fruit and other trees , legumes and vegetables . examples of families that are of special interest are poaceae , but also solanaceae , malvaceae and brassicaceae . some suitable species include , for example , species from the genera fragaria , lotus , medicago , onobrychis , trifolium , trigonella , vigna , citrus , linum , geranium , manihot , daucus , arabidopsis , brassica , raphanus , sinapis , atropa , capsicum , hyoscyamus , lycopersicon , nicotiana , solanum , petunia , digitalis , majorana , ciohorium , helianthus , lactuca , bromus , asparagus , antirrhinum , hererocallis , nemesia , pelargonium , panicum , pennisetum , ranunculus , senecio , salpiglossis , cucumis , browaalia , glycine , lolium , zea , triticum , sorghum , and datura . tobacco , nicotiana tabacum l . tomato , lycopersicon esculentum mill , potato , solanum tuberosum l ., canola / rapeseed , brassica napus l ., cabbage , broccoli , kale etc ., brassica oleracea l ., mustards brassica juncea l ., brassica nigra l ., sinapis alba l . ( brassicaceae ), petunia , petunia hybrida ( solanaceae ) sugar beet , beta vulgaris , ( chenopodiaceae ), cucumber , curcurbita sp . ( curcurbitaceae ), cotton , gossypium sp ., ( malvaceae ), sunflower , helianthus annuus , lettuce lactuca sativa , ( asteraceae = compositae ), pea , pisum sativum , soybean , glycine max and alfalfa , medicago sp . ( fabaceae = leguminoseae ), asparagus , asparagus officinalis ; gladiolus , gladiolus sp ., ( lilaceae ); corn , zea mays ; rice , oryza sativa ( poaceae ); wheat , triticum aestivum ( poaceae ); and barley , hordeum vulgare ( poaceae ). in an preferred embodiment the invention covers transformed potato , tobacco , corn , sugar beet , cotton , rape seed , soy bean , lupine , rice and wheat . especially preferred are potatoes . the invention additionally relates to transformed plants which have been regenerated out of different cell types and which have been transformed according to instant invention . the transformation can be carried out as described in the following examples , provided by way of illustration only . in general , preparation of plasmid dna , restriction enzyme digestion , agarose gel electrophoresis of dna , southern blots , dna ligation and bacterial transformation were carried out using standard methods . ( maniatis et al ., molecular cloning , a laboratory manual , cold spring harbor laboratory ( 1982 ), referred to herein as “ maniatis ” and hereby incorporated by reference .) fusion of a bacterial asparagine synthetase gene to the nucleotide sequence for a duplicated chloroplast transit peptide based on the complete nucleotide sequence of the asn - a gene from e . coli ( nakamura et al . ( 1981 ) or ep 511 979 ) the gene was cloned as a hga 1 / pst 1 fragment into the vector puc18 . by means of pcr based in vitro mutagenesis a sph1 site was created at the atg translational start codon changing the nucleotide sequence from aaa atg aaa acc gct ( seq id no : 1 ) into ggc gcatg cag aaa acc gct ( seq id no . : 2 ). this mutation introduced an additional codon for glutamic acid into the gene directly following the atg translation start codon . the nucleotide sequence of the modified transit peptide from the small subunit of ribulosebiphosphate carboxylase from pea was isolated from the vector pni6 / 25 ( wasmann , c . c . et at ( 1986 ) mol . gen . genet . 205 : 446 - 453 ) as a hind3 / sph1 fragment . as described by wasmann et al ., the pni6 / 25 vector was derived by cloning ecorv - bamhi fragments containing the modified transit peptide sequence into a vector fragment produced from ptac / tpnptii by digestion with ecorv and bamhi . the ptac / tpnptii vector was derived from ptpk1 , which was constructed by ligating an ecori - bamhi vector fragment from pkm109 / 15 with the handiii - bamhi fragment of ptp2 that contains the transit peptide coding sequence and the ecori - hindiii fragment of ptac12 / hind that carries the tac promoter . pkm109 / 15 contains the nptii gene with an upstream bamhi site . plasmid ptp2 was derived from ptp1 , which carries the ecori - sphi fragment of ppsr6 ( cashmore , ( 1983 ) in : genetic engineering of plants — an agricultural perspective ; ed . kosuge et al . plenum publishing , ny , pp . 29 - 38 ) that codes for the promoter and transit peptide of the small subunit in pbr327 ( soberon et al . ( 1980 ), gene 9 : 287 - 305 ). the modified transit peptide ( seq id no : 3 ) contains a duplication of 20 amino acids compared to the natural transit peptide ( seq id no : 4 ). the 20 amino acid duplication results in increased transport into chloroplasts over that observed with the natural transit peptide ( wasmann et al .). the sequence of the duplicated transit peptide and asn - a gene were fused by ligating the sph1 sites resulting in tpasn . the tpasn gene was exised as a hind3 / pst1 fragment and after changing the hind3 site into a kpn1 site cloned between camv 35s promoter and - terminator of the vector pdh51 δ kpn . the 35s - promoter / tpasn gene / 35s - terminator cassette from pdh51 δ kpn was isolated as an ecor1 fragment , hind3 linkers were added and the fragment was cloned into the hind3 site of the vector phoe6 / ac , which confers phosphinothricin resistance to plants . the resulting vector was called phoe6ac / tpasn . this vector was transformed into the c58 agrobacterium strain mp9ork ( koncz et al ., mol . gen . gen ., 204 , 383 - 396 ( 1986 )). tobacco and rape seed plants were transformed following published procedures . plants were regenerated on murashige and skoog based media . transformed plants were selected because of their resistance to the herbicide phosphinothricin ( ppt ). ppt resistant plants were analysed for the presence of the bacterial asparagine synthetase gene . in a northern blot analysis asn - a specific rna was detected in the plants . with polyclonal antibodies it is demonstrated that the protein was targeted into the chloroplasts . the 35s - promoter / tpasn gene / 35s - terminator cassette from pdh51 δ kpn was isolated as an ecor1 fragment , hind3 linkers were added and the fragment was cloned into the hind3 site of the vector pb2 / 35sac resulting in pb35sac / tpasn . this vector was used to transform maize protoplasts according to published procedures ( ep 511 979 or ep 164 575 ). plants were regenerated on murashige and skoog based media . transformed plants were selected because of their resistance to the herbicide phosphinothricin ( ppt ). ppt resistant plants were analysed for the presence of the bacterial asparagine synthetase gene . in a northern blot analysis asn - a specific rna was detected in the plants . with polyclonal antibodies it is demonstrated that the protein was targeted into the chloroplasts . inhibition of chloroplastic glutamine synthetase by expression of the antisense gene in tobacco and rape seed the coding sequences for the chloroplastic isoenzymes of nicotiana sylvestris and brassica napus were cloned by pcr methods from the genomic dna of the respective plants . the resulting fragments were cloned as apal fragments in antisense orientation between 35s - promoter and - terminator from camv located on the vector prt100 . the 35s - promoter / gs - antisense / 35s - terminator cassettes were isolated as pst1 fragments and cloned into the pst1 site of the vector phoe6 / ack3 . this vector was transformed into the c58 agrobacterium strain mp9ork ( koncz et al . supra ( 1986 )). tobacco and rape seed plants were transformed following published procedures . plants were regenerated on murashge and skoog based media with reduced amounts of ammonia as described . transformed plants were selected because of their resistance to the herbicide phosphinothricin ( ppt ). ppt resistant plants were screened with southern blot hybridization for the presence of the asn - a gene . southern positive plants were analysed for the inactivation of the chloroplastic glutamine synthetase gene by northern blots . plants with the most reduced gs rna level were selected . inhibition of chloroplastic glutamine synthetase by expression of the respective antisense gene in maize the coding sequences for the chloroplastic isoenzymes of zea mays , was cloned by pcr methods from the genomic dna . the resulting fragment was cloned as apal fragment in antisense orientation between 35s - promoter and terminator from camv located on the vector prt100 . the 35s - promoter / gs - antisense / 35s - terminator cassette was isolated as pst1 fragment and cloned into the vector pb2 / ack3 . this vector was used to transform maize protoplasts according to published procedures . plants were regenerated on murashige and skoog based media with reduced amounts of ammonia as described . transformed plants were selected because of their resistance to the herbicide phosphinothricin ( ppt ). ppt resistant plants were screened with southern blot hybridization for the presence of the asn - a gene . southern positive plants were analysed for the inactivation of the chloroplastic glutamine synthetase gene by northern blots . plants with the most reduced gs rna level were selected . leaf material from wild type and different ransgenic asparagine synthetase expressing plants was homogenized in buffer . the extracts were run over a biotronic amino acid analyser . concentration of the amino acid asparagine were measured and are given in pmol / μl of extract . the concentration of asparagine correlated with the expression of the asparagine synthetase gene as measured on northern and western blots . production of transgenic potato lines carrying the bacterial asparagine synthetase gene the above mentioned construct was used to transform potato plants ( solanum tuberosum l . cv . desiree 25 ). the control , non - transformed plant material went through an in vitro regeneration process comparable to the transformants . the tuber tissues were transformed according to the process as described above using the agrobacterium technology . the presence of the bacterial asna gene was proven by hybridization of genomic plant dnas with a chimeric gene specific fragment . the experiments confirmed that the transformants expressed the transferred gene while the control plants lacked the enzyme . northern analysis was carried out by hybridization of total rna from the transformed potato lines , the hybridization experiment indicated the presence of specific mrna in the transformants whereas the control plant lines showed again no detectable signal . transgenic asparagine synthetase expressing plants and transgenic asparagine synthetase expressing plants with reduced glutamine synthetase activity were grown side by side with wild type plants in the greenhouse . the transgenic plants showed a more vigorous growth and flowered earlier than wild type plants . field experiments with transgenic potato plants carrying the bacterial asparagine synthetase gene having thus described in detail preferred embodiments of the present invention , it is to be understood that the invention defined by the appended claims is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention . | 2 |
the following detailed description of the present subject matter refers to subject matter in the accompanying drawings which show , by way of illustration , specific aspects and embodiments in which the present subject matter may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the present subject matter . references to “ an ”, “ one ”, or “ various ” embodiments in this disclosure are not necessarily to the same embodiment , and such references contemplate more than one embodiment . the following detailed description is demonstrative and not to be taken in a limiting sense . the scope of the present subject matter is defined by the appended claims , along with the full scope of legal equivalents to which such claims are entitled . the present subject matter of the invention relates generally to method and apparatus for tagging patient sessions when fitting hearing aids . a hearing aid fitting system is typically controlled via standard mouse and keyboard input . these audiologist or dispenser has access to a mouse and keyboard while tending to a patient . fig1 shows a fitting system with gesture sensing according to various embodiments of the present subject matter . computer 102 is adapted to execute fitting software 103 that takes typical inputs from devices such as keyboard 105 and mouse 107 for fitting one or more hearing aids 120 . it is understood that the user may be the wearer of one or more hearing aids or can be a clinician , audiologist or other attendant assisting with the use of the fitting system 100 . the system 100 includes memory 114 which stores and displays on display 130 one or more tags for the fitting system . it is understood that the configuration shown in fig1 is demonstrative and is not intended in an exhaustive or exclusive sense . other configurations may exist without departing from the scope of the present subject matter . for example , it is possible that the memory 114 may be encoded in firmware , software , or combinations thereof . it is possible that the system may omit a mouse or a keyboard or may include additional input / output devices without departing from the scope of the present subject matter . other variations are possible without departing from the present subject matter . the present subject matter allows an end user to associate one or more word tags to a fitting session in hearing aid fitting software . in various embodiments , these tag values may be used by the fitting software manufacturer , the hearing aid manufacturer , the hearing aid fitting professional , and others to evaluate the effectiveness of a fitting for patients and / or the efficacy of the hearing aid itself . in various embodiments , the tag values are associated to different aspects of the hearing aid product being fit . for example , such associations include , but are not limited to , one or more of the particular hearing aid being fit , the adjustments made , the audiogram of the patient , fitting formula and / or other fitting session parameter values . it is understood that the information may be made anonymous to protect the privacy of the patient . in various applications , the tags are pre - populated with values including , but not limited to , examples such as : effective , ineffective , follow up visit , first visit , requires follow up , 1 star rating , 2 star rating , 3 star rating , 4 star rating , 5 star rating , easy fit , and / or difficult fit . in various embodiments of the present subject matter , the user is prompted to tag the fitting at the time they save the fitting session . in various embodiments of the present subject matter , the user can save tags as desired and at any time . in various embodiments of the present subject matter , the system is programmable to automatically tag when certain conditions occur . for example , an automatic tag can be generated when a hearing aid is not fitted within a certain predetermined amount of time . for example , if a particular fitting screen is active for over 20 minutes , the system can automatically tag the fitting as involving potentially improper hearing aid selection . other automatic tags are possible , such as if an active feedback intercept is used more than a predetermined number of times , the aid can be flagged as being a high return risk . for example , the system can automatically flag the fitting session and the aid if active feedback intercept is used more than two times . these examples are given to demonstrate the present subject matter . it is understood that other fitting parameters , limits , settings , and conditions may be used to automatically tag a fitting session and / or hearing aid , and the present subject matter is not limited by the examples given herein . in various embodiments the user can search fittings based on their tags . the open session screen will be augmented with a tag list that allows the end user to look at fittings that were tagged with their tags . the user can also opt in to a “ customer improvement program ” where their tags and anonymous fitting session data will be uploaded to the hearing aid manufacturer via the internet to assist the hearing aid manufacturer in improving the fitting software for future releases . in various applications the tags are used to alert the user to other high rated fitting sessions based on fitting session variables . this alert system is programmable to save time spent with a patient and allow an audiologist to create libraries of good fittings that they can apply to their patient base . the tags can also be used to store feedback from the users of the fitting software . in various embodiments , a fitting system is adapted to perform the present subject matter disclosed herein . in various embodiments , the tagging is performed by an interface for a fitting system for performing the tagging discussed herein . it is understood that the present subject matter can be used with a variety of fitting systems including present systems and future fitting systems . the present subject matter is demonstrated in the fitting of hearing aids , including but not limited to , behind - the - ear ( bte ), in - the - ear ( ite ), in - the - canal ( itc ), or completely - in - the - canal ( cic ) type hearing aids . it is understood that behind - the - ear type hearing aids may include devices that reside substantially behind the ear or over the ear . such devices may include hearing aids with receivers associated with the electronics portion of the behind - the - ear device , or hearing aids of the type having receivers in the ear canal of the user . the present subject matter can also be used in hearing assistance devices generally , such as cochlear implant type hearing devices . it is understood that other hearing assistance devices not expressly stated herein may be used in conjunction with the present subject matter . this application is intended to cover adaptations or variations of the present subject matter . it is to be understood that the above description is intended to be illustrative , and not restrictive . the scope of the present subject matter should be determined with reference to the appended claims , along with the full scope of legal equivalents to which such claims are entitled . | 7 |
referring to the drawings in detail , and particularly to fig1 there is shown a component reforming and repackaging machine 20 . the components processed are preferably any selected electrical component 22 having at least two generally parallel leads 24 extending from their bodies . upon completion of the process , the leads 24 will be coaxial leads . the machine 20 comprises a component supply arrangement 26 that feeds the electrical components 22 onto a conveying arrangement 28 . the conveying arrangement 28 includes a wheel 30 that rotates to bring each electrical component 22 thereon to a succession of processing stations , whereupon the leads 24 are reformed from the generally parallel configuration to a generally coaxial configuration . the final operation includes unloading the reformed components 22 on to a taping and reeling arrangement 32 or alternatively they may be unloaded directly into a printed circuit board component inserting machine , which will be mentioned below . more particularly , the component reforming and repackaging machine 20 , as shown in fig1 with its component supply arrangement 26 , includes a generally linear presentation of electrical components 22 taped to a narrow strip of cardboard 34 , or the like . the cardboard strip 34 is held against a support channel 36 by a plurality of rotatable channel - biased wheels 38 that permit movement therebetween , yet prevent the strip 34 from falling from the channel 36 . an endless chain 40 is movably supported in the horizontal plane just beneath the channel 36 . the chain 40 has protrusions thereon which engage the leads 24 of the components 22 . the chain 40 moves and causes the cardboard strip 34 and the components 22 thereon to move along the channel 36 to a first processing station . the components 22 therefore are successively moved to the first component processing station 42 which is shown more clearly in fig2 , 4 and 5 . the first processing station 42 comprises a pressure activatable pivotable piston cylinder 44 mounted generally vertically adjacent the cardboard strip 34 which carries the linear array of components 22 . the pressure activatable piston cylinder 44 has a piston rod 46 extending therefrom . a finger 48 is attached to the lower end of the piston rod 46 . the finger 48 has a cam and follower mechanism 50 associated with a frame member 49 of the machine 20 that permits the finger 48 to approach each component 22 as the piston cylinder 44 is activated . the piston cylinder 44 pivots about its uppermost end permitting the two - direction motion of the cam and follower mechanism 50 . the cam and follower mechanism 50 thereupon guides the finger 48 while it pushes the component out of engagement with the tape covered cardboard strip 34 and into a pair of open jaws 51 comprising grippers 52 which are mounted in a spaced relationship on the circumference of the rotary wheel 30 . each jaw 51 has a pivotal relationship with its other respective jaw 51 both of which comprise a gripper 52 . the grippers 52 are caused to close about a point on the leads 24 of the component 22 , which action finishes the loading operation of the first processing station 42 . the grippers 52 have a spring 54 that biases them in the closed condition . a spring loaded latch member 56 engages a radially inner end of one of the jaws 51 . the latch member 56 may be tripped to permit the jaws 51 of the gripper 52 to snap into the closed condition by a lever 58 pivoted about a pin 59 supported on a front plate 60 . the lever 58 is moved by a pressurizable piston cylinder member 62 that is synchronized to the motion of the rotary wheel 30 . as each successive component 22 is pushed down into the awaiting open jaws 51 of the gripper 52 , the lever 58 trips the latch 56 out of the way so that the jaws 51 snap shut on the leads 24 . the rotary wheel 30 then rotates in a counterclockwise direction , in this embodiment , to bring a next open gripper 52 into the loading station 42 . the conveying arrangement 28 is rotated by a motor driven indexer 64 as shown in fig2 . the indexer 64 also drives , through a system of pulleys 66 , gear mechanisms 67 and drive belts 68 , the component supply arrangement 26 , and the taping and reeling arrangement 32 . the component supply arrangement 26 and the rotary wheel 30 , each driven by the indexer 64 , are shown in a later sequence of operation in fig4 . the finger 48 which is attached to the lower end of the vertically disposed piston rod 46 is at its lowest point of travel and has moved a component 22 from its loading strip 34 to a clip 70 that is supported from the frame 49 just radially inwardly of the jaws 51 of any gripper 52 as it waits its turn in the first processing station 42 . the clip 70 has a cross section that is channel shaped in this embodiment to permit seating of the component 22 therein . after closing of the jaws 51 upon the leads 24 , the body of the component merely slides out of the clip 70 in a circumferential direction as the rotary wheel 30 moves the gripper 52 to its next processing station . the vertically mounted piston cylinder 44 is mounted in a vertically disposed bracket 72 which is attached to the frame 49 of the machine 20 . a set screw 74 is adjustably arranged on a lip portion 76 of the radially innermost end of the bracket 72 . the set screw 74 prevents excessive travel of the finger 48 in the radially inward direction , and it also permits flexibility in receiving any desired lead 24 length of any component 22 utilized therewith . fig5 shows the vertically oriented gripper 52 in its loaded condition and the piston rod 46 in its withdrawn state within the piston cylinder 44 . the rotary wheel 30 shown in fig6 has the loaded gripper 52 in a second processing station 78 . the second processing station 78 comprises a generally horizontally directed piston cylinder 80 having a piston rod 82 therewith . the piston rod 82 is in engagement with a plunger mechanism 84 . the plunger mechanism 84 comprises a multiple - sided cam member 86 , a pair of cam followers 88 , and a pair of pivotally - biased arms 90 , one attached to each cam follower 88 , which is shown more clearly in fig7 . each pivotally - biased arm 90 is rigidly attached to a rotatable rod 91 , which is movable also along its longitudinal axis and biased by a spring member 93 toward the multiple - sided cam member 86 . each pivotally - biased arm 90 also haa a tab portion 92 directed toward and disposed between one another . each tab portion 92 has an extremity or lip member 94 on its furthermost end from is respective arm member 90 . each arm 90 is also biased by a spring 96 about a pivot point , which comprises the axis of the rods 91 . a cam follower 95 is disposed on the radially outer end of each pivotally - biased arm 90 . a cam surface 87 is disposed on the back side of the multiple - sided cam member 86 , and a cam surface 99 is disposed on the top and bottom sides of the multiple - sided cam member 86 . as the piston cylinder 80 of the second processing station 78 is pressurized , the piston rod 82 is extended radially inwardly toward the center of the conveyor member 28 . the piston rod 82 causes the cam member 86 to move in the same direction to the right , as shown in fig6 and 7 . the cam followers 88 ride apart of the cam surfaces 99 of the cam member 86 . immediately before the cam followers 88 follow the cam surfaces 99 , the biased arms 90 swing in a direction transverse to and just in front of the direction of travel of the cam member 86 . this is because the cam follower 95 on each arm 90 rides on the cam surface 87 on the back side of the multiple - sided cam member 86 just prior to the pair of cam followers 88 meeting their respective cam surfaces 99 . this causes the arms 90 to pivot about the rods 91 . that is , the lip members 94 become disposed between the radially outwardly extending component leads 24 . the cam followers 88 thereupon cause the arms 90 and , hence , the lips 94 to move apart from one another . this action causes a bending and reforming of the leads 24 from a generally parallel orientation to one that is generally coaxial . upon activation of the proper signal the piston cylinder 80 of the second processing station 78 is depressurized , and a spring 81 attached to a bracket 79 pushes the piston rod 82 back into the piston cylinder 80 , causing the plunger mechanism 84 to move radially away from the conveyor member 28 , which in this embodiment is to the left , as shown in the drawings . this causes the cam followers 88 to bring the arms 90 to pivot so that both the lips 94 are pulled away from the plane defined by the pair of reformed leads 24 . the leads are reformed to a standoff length , which comprises their proximal ends , or the length of leads which will support the component body above the circuit board ; the remaining portions , or the distal ends of the leads , which are cut and formed or bent for clinching plus a range of selected leg spacing as dictated by the spacing of preformed lead receiving holes in the board . it is to be noted that the leads 24 could be formed to configurations other than coaxial . for instance , they could have an obtuse and / or an acute angle with their standoff portions by appropriately contouring the edges of the lips 94 that actually bend the leads 24 . the rotary wheel 30 , which comprises the conveyor member 28 , may then rotate to a next processing station 97 , as shown in fig8 and 9 , wherein a light emitter 98 and a sensor 100 determine whether there is a component 22 between the jaws 51 of each gripper 52 going therepast . each jaw 51 has a slot 101 through which a beam of light from the emitter 98 may pass . if the light is received by the sensor 100 then no component 22 is indicated as being disposed within the gripper 52 . if perchance there actually is no component 22 within the gripper 52 , the sensor 100 sends a signal to a declutching mechanism 102 , which is shown in fig2 and described later . if a component 22 is , however , disposed within the gripper 52 , a t - shaped plunger 104 is moved toward the component because a proper signal is thereupon sent to another piston cylinder 106 supported by the frame 49 of the machine 20 . this piston cylinder 106 pushes the t - shaped plunger 104 in a radially inwardly direction toward the conveyor member 28 to further form the leads 24 in a true 90 ° angle . it is to be noted that the plunger 104 could be &# 34 ; arrow ˜ shaped instead of the preferred t - shape . the plunger 104 has arm portions 105 . each arm portion 105 has a groove 107 extending therealong . the grooves 107 receive and insure that the leads 24 line up correctly prior to a discharge of the component at a final processing station 109 , as shown in fig1 through 14 . the conveyor member 28 at this last station discharges the components 22 on to a tape system for winding upon a reel or spool 110 , which is shown in fig2 . as the gripper 52 is rotated to the unloading or discharging processing station 109 , an upper and a lower pair of bifurcated fingers 112 , 114 move to grip the leads 24 and place them in spaced arrays of crenels 116 . the leads 24 extend beyond the sides of the fingers 112 , 114 . each array of crenels 116 is disposed on the periphery of a rotating pickup wheel or disc 118 . each rotating disc 118 has a circumferentially disposed trough 120 . a strip of tape 122 is fed across each trough 120 , sticky side out , from a pair of tape reels 124 , shown in fig1 , which feed the tape 122 thereto . an additional tape cover is shown in fig2 where another pair of tape reels 124 &# 39 ; feeds a pair of strips of tape 122 &# 39 ;, around a pair of rollers 123 , the rollers 123 pressing their peripheries into the trough 120 to insure contact between the mating sticky surfaces of the tape 122 and 122 &# 39 ; which is sandwiched about each end of the leads 24 . the components 22 attached to the reformed leads 24 are disposed then between parallel strips of the double layers of tape 122 and 122 &# 39 ;. the components may then be wound on the take - up reel 110 . returning to fig1 , wherein there is shown a pressurized air nozzle 126 that blows air upon the components 22 just prior to the disposition of the second layer of tape 122 &# 39 ;. the pressurized air causes the components 22 to lay in a generally flat manner , permitting easier and more efficient winding and storage thereof on the reel 110 . at the initial point in the discharge operation , the gripper 52 is radially adjacent the pickup wheel 118 . upon activation of the proper signal the bifurcated fingers are caused to move their position as shown in fig1 to that in fig1 by pressurization of a first piston cylinder 132 . whereupon the lower pair of bifurcated fingers 114 are caused to be pivoted by a pressurization of a second piston cylinder 130 whereupon a piston rod 113 and an arm 117 swing about a generally horizontal pivot pin 115 to permit the pairs of bifurcated fingers 112 and 114 to be generally parallel with one another . the first piston cylinder 132 has a piston rod 131 therewith and is attached to a frame 134 , which supports both bifurcated fingers 112 and 114 . activation of the first piston cylinder 132 causes the fingers 112 and 114 to move toward the leads 24 where they are held by the gripper 52 . in proper sequence , and upon a proper signal , the second piston cylinder 130 is activated to cause the lower bifurcated finger 114 to pivot upwardly about the pivot pin 115 . the first piston cylinder 132 is pressurized to move both the upper and the lower bifurcated fingers 112 and 114 around the leads 24 of the component 22 , as shown in fig1 . the jaws 51 of the gripper 52 move apart because a piston cylinder unit 140 , as shown in fig2 upon a proper signal , is pressurized , which causes the moving of a piston rod 142 against a strike plate 144 , which compresses the spring 54 and permits the biased latch 56 to swing on to the strike plate 144 . this holds the jaws 51 apart since the jaw 51 on the front side of each gripper 52 is fixedly attached and pivotable with its respective strike plate 144 . the biased latch 56 shown in fig4 then pivots across the front of and hooks on to the strike plate 144 and holds the gripper 52 open to permit release of the component 22 . the gripper 52 stays in the open condition until it is triggered shut . this occurs back in the first processing station 42 by the piston cylinder 62 &# 34 ; unlatching &# 34 ; the latch 56 by knocking it off its holding position , as explained earlier . a third piston cylinder unit 136 , which is generally vertically oriented in this example , as shown in fig1 through 14 , is also attached to the bifurcated finger support frame 134 and causes vertical movement thereof . upon pressurization of the third piston cylinder 136 upon a proper signal , a piston rod 138 , which movably passes through the frame 134 , is rigidly attached to the upper bifurcated finger 112 and extends downwardly to permit the displacement of the component 22 radially away from the vicinity of the gripper 52 into one pair of crenels 116 , one each on the periphery of each synchronized intermittently rotatable pickup wheel 118 . the leads 24 , which overhang beyond the outer edges of the bifurcated fingers 112 and 114 each touch the outwardly directed sticky surface of the tape 122 lying in the trough 120 of the pickup wheel 118 , as shown in fig1 . depressurization of the second piston cylinder 130 causes the piston rod 113 to retract , making the lower bifurcated finger member 114 pivot about the pivot pin , as shown in fig1 . the first piston cylinder 132 is depressurized to cause the withdrawal of the rod 131 and attached frame 134 . this completely releases the component 22 to the sticky tape 122 in the pickup reel 118 whose leads 24 are then stuck thereto , and whose leads 24 extend into their respective crenels 116 . the pickup wheel 118 thereupon rotatably advances one crenel 116 due to a signal sent to the indexer 64 from a response from the previous station 97 . the pickup wheel 118 has a declutch mechanism 102 that permits the intermittent rotative motion thereof upon a stated signal . the machine 20 repeats the cycle each time a gripper 52 receives a component 22 at the loading operation station 42 . the taped reformed components 22 are then wound on the takeup reel 110 ready for installation later in a component inserting machine or for hand installation into circuit boards . alternatively , the machine 20 may directly feed a pickup belt 170 of a component inserting machine 172 , as shown in fig1 , instead of having the components wound on a takeup reel 110 . in another alternative embodiment , the rotary wheel 28 could revolve around a cam member 150 , as shown in fig1 . each gripper 52 would have a cam follower 154 on its radially inner end which could thereby permit changing the length of the leads 24 from what they were as presented normally in the supply strip 34 because the radial distance that the gripper 52 could change due to the action between the cam 150 and follower 154 . additionally , a cutting blade 160 , as shown in fig2 could be attached to a radially outer point on the finger member 48 which would sever the leads 24 just as the finger member 48 engages the component 22 . it is therefore seen that the present invention provides a machine which will receive linear packages of components having generally parallel leads as merchandised by manufacturers and automatically reform the leads to convenient lengths and configurations , which make them ready to insert in printed circuit boards , either by machine insertion or hand insertion . though the invention has been described with a certain degree of particularity , it is understood that it is the claims that define the invention which are not to be interpreted in a limiting sense . | 7 |
referring to fig1 there is shown a ladder 18 to which has been attached the levelling device 9 according to the prior art as disclosed in applicant &# 39 ; s prior u . s . patent . the levelling device comprises u - shaped tubular member 10 having extendable legs 11 reciprocally sliding within the open ends 3 of tubular member 10 . the u - shaped tubular member 10 is attached to the ladder by means of clamps ( not shown ) or such other suitable arrangement known to one skilled in the art . fig2 shows in greater detail the levelling means of applicant &# 39 ; s prior u . s . patent . the ball chain 4 is shown attached to each of the extendable legs 11 and extending through the tubular member 10 in a continuous fashion . the locking means 13 shown in fig2 includes the arcuate chamber 14 having pins 15 which project downwardly so as to be located between the balls 5 on the ball chain 4 . hence , when weight is applied to the ladder , extendable legs 11 self - adjust until equal force is applied upwardly on the connecting ball chain 4 . this causes the chain 4 to be deflected upwardly into the arcuate chamber 14 and the balls 5 are prevented from further longitudinal movement by the pins 15 projecting between the balls 5 . as will be evidenced from fig2 however , if weight is removed from either one of the two legs 11 , the ball chain 4 will drop down to the unlocked position thereby permitting the extendable legs 11 to reciprocally move within the tubular member 10 and , as in the example previously described , the ladder would be free to tip over . the basic structure of applicant &# 39 ; s improved device is similar to the prior art device illustrated in fig1 and 2 . the improvement , however , resides in the locking means 30 which is shown in detail in fig3 through 6 . as indicated in fig3 the locking device includes a central passage 31 which is coextensive with the u - shaped tubular member 40 as best seen in fig4 . in accordance with a preferred embodiment of the invention , the locking means 30 includes end sections 32 which are of an appropriate diameter to surround the tubular member 40 and which upon trapping by means of screws 35 and nuts 36 secure the means to the tubular member . as illustrated in fig4 the locking means 30 when installed on the tubular member 40 , is positioned so that the chamber 42 is located in the same plane but forward or rearward of the longitudinal axis of the tubular member 40 . as best seen in fig3 the chamber has complimentary socket means 47 which , when the device is in its operable position on the tubular member 40 , provides a ball receiving surface 48 which surrounds substantially one half of the ball or sphere 50 shown in fig7 . the socket means 47 are spaced by islands 49 which are of substantially the same dimension as spacers 52 between the balls or spheres which will be described hereinafter . fig5 and 6 illustrate the ball chain 60 in the unlocked and locked modes respectively . for the sake of simplicity , the ball chain 60 is shown with balls or spheres 50 only and without the central core and spacers which are illustrated in fig7 . as noted in fig5 the ball chain 60 is in the central passage 31 coextensive with the tubular member 40 . in this mode , the ball chain 60 or interconnecting member is free to reciprocally slide longitudinally in the passage 31 and the tubular member 40 so that the slidable or adjustable legs 70 secured to the ball chain in the manner described in u . s . pat . no . 3 , 794 , 141 may self adjust to accommodate an uneven surface . when the adjustable legs 70 have been positioned so that the ladder is in an upright position and the adjustable legs 70 are positioned so as to accommodate this orientation , downward force on the ladder causes the slidable legs 70 to be forced upwardly which force acts on the connecting element or ball chain 60 and effectively forces the connecting element 60 to be compressed within the tubular member 40 . obviously , this compression force will cause the connecting element 60 to take the path of least resistance which means that the ball chain or connecting element 60 is initially forced upwardly which is the natural direction of force caused by the upward force generated by the legs 70 . after the connecting element 60 has moved upwardly to the furthest extent , it will be forced at right angles thereto into the socketed chamber 42 . as indicated hereinbefore , the ball or sphere receiving sockets 47 are of an appropriate size to receive and hold the balls or spheres 50 wherein they are positively locked . in this locked position , if the ladder is tipped so that upward force is removed from one of the legs 70 thereby increasing the force on the opposite leg , the upward force of the opposite leg will act on the spheres 50 of the ball chain 60 to further force it into the sockets 47 . the downward force created by the weight of the unsupported free leg will also pull the ball or sphere 50 against the edge of the socket 47 thereby reinforcing the positive locking mechanism . hence , if someone using the ladder reaches out beyond the safe distance thereby shifting all of the weight on one of the legs so as to lift the other leg off of the supporting surface , the free leg will not be lowered but will remain in the original locked position . hence , the ladder is much safer to use on uneven ground . of course , by simply lifting upward on the ladder after the weight has been removed therefrom , the ball chain 60 will be returned to the position shown in fig5 and the legs will be in the unlocked mode . the preferred form of the ball chain 60 is illustrated in fig7 . in this figure , the ball chain 60 is shown as it traverses one of the rounded corners of the u - shaped member 40 . as illustrated in fig7 the balls or spheres 50 are of an appropriate diameter so as to be substantially the same diameter as the bore of the tubular member . the central core 53 which is in the form of a wire and , more particularly , in the form of a stainless steel wire , has sufficient flexibility to allow the connecting member to curve around the corners and to be forced into the chamber in the locking means . the core 53 , however , is also such that when weight is removed from both legs 70 , the ball chain 60 will quickly snap back to the unlocked position as shown in fig5 . the spacers 52 between the balls 50 are shown in fig7 . these spacers 52 have a central bore 59 to allow the core 53 to pass through and have curved end faces 55 of suitable shape to mate with the sphered shape of the balls 50 . it will also be apparent from fig7 that in accordance with a preferred embodiment of the invention , each of the balls 50 has two different diameter bores 57 , 58 . the central bore 57 is of substantially the same diameter of the stainless steel wire core 53 . the diameter of both ends of the bore 58 , however , is slightly larger as will be apparent from fig7 . the central bore 57 ensures that the balls 50 stay in the proper orientation within the tubular member 40 . if the bore is too large , the wire core 53 will deflect within the ball 50 which will result in uneven movement of the ball chain 60 or premature rupturing of the core 53 . it was found , however , that if the bore at either ends was the same dimension as the core , the spacers 52 would not provide continuous contact with the balls 50 again resulting in uneven movement of the ball chain 60 within the tubular member 40 again resulting in premature rupturing of the core . with the larger diameter bore 58 at either end , the core 53 is able to deflect sufficiently so that the spacers 52 will remain in intimate contact with the balls 50 as the ball chain 60 is forced to curve such as around the curved portion of the tubular member 40 or into the locking chamber 47 . as indicated previously , the tubular member 40 may be a downwardly open u - shaped section as shown in the prior art . there is shown in fig8 a a further embodiment of the tubular member 140 . it will be noted from fig8 a that the member 140 includes in addition to the first tubular member 142 , a second tubular member 144 spaced from but parallel to the first member 142 . the two tubular members 142 , 144 are interconnected by web means 146 which may be used to attach the support to a ladder . the webs 146 also , of course , keep the tubular members 142 , 144 in a fixed relationship one to the other . as shown in fig1 , a first rung means 150 seen in fig8 b may be interconnected between the free ends of the tubular member 140 so as to provide strength and additional support . as shown in fig9 an alternate embodiment of the extendable legs 160 are arranged so as to fit into the tubular member 140 of fig8 a . the interconnecting ball chain ( not shown ) is joined to the longer arm 162 of the extendable leg 160 . preferably , pivotable feet 164 are attached to the lower end of the legs 160 as shown in fig1 . thus , when the leveling device is attached to a ladder and the ladder is positioned beside a vertical surface so that the lower end of the ladder is removed from the vertical wall , the pivotal feet 164 will mean that the entire surface of the feet are resting on the supporting surface . fig1 is an illustration of the ladder levelling device of the second embodiment attached to a ladder and in use on a set of stairs . although the foregoing disclosure does not specifically refer to materials and methods of manufacture , it is to be understood that the locking device including the passage and the socket chamber will be constructed of either aluminum or of one of the suitable plastics . as indicated in the disclosure , the central core of the ball chain or connecting element is , in a preferred embodiment , a stainless steel wire whereas the balls or spheres are made of steel or of suitable plastic . similarly , the spacers located between the balls or spheres are made of steel or suitable plastic . the tubular members are preferably made of coated steel because of its superior strength and resistance to abuse . from the foregoing description of the preferred embodiment of the invention , it will be apparent to one skilled in the art that various modifications may be made therein . thus , it is intended in the appended claims to cover all such modifications that fall within the scope of the invention . | 4 |
motion tracking systems include one or more transponders which are physically integrated or mounted at various locations over or around the desired tracking workspace . each transponder emits a signal . the transponders may employ different tools or signals to track motion , including , but not limited to , cameras , sound , infrared , inertial , optical , electromagnetic or any other known , or future developed motion tracking tool or methodology . the transponders may be mounted about a tracking workspace as a single , individual transponder , or grouped together to be mounted in a housing . the transponder housing may be shaped as a strip , as a wing , at an angle or as any other desirable shape or arrangement . following installation or mounting of the one or more transponders , the transponders require calibration to properly define the dimensions of the desired tracking workspace . calibration requires precise measurement of the cartesian x , y , z coordinates of each transponder . the coordinate measurements are used to create a transponder location map or constellation file which defines the placement and arrangement of the transponders about the tracking workspace . an accurate constellation file is necessary to properly track movement within the tracking workspace , as the coordinate measurements in the constellation file act as fixed points of comparison for tracking motion . the signal emitted by each transponder may be received by a tracked device or station or sensor . the sensor may include a variety of structural arrangements and be positioned near the transponder , may be positioned at a second location around the desired tracking workspace , or may be positioned on the user . for example , the sensor may be hand held , may mount to virtual reality interface gloves , may be mounted to the head of a user , may include a wand and stylus , may include a joystick , or may be mounted to any desirable portion of the user &# 39 ; s body or in the tracking workspace . the transponder and / or sensor output positional information within the tracking workspace , for example cartesian coordinates corresponding to an x , y , z position . further , the transponder and / or sensor may output orientation information within the tracking workspace , for example pitch , yaw , and roll . the transponder and / or sensor communicate with a microprocessor controller to convey the positional and / or orientation information . the microprocessor controller also stores the constellation file . the microprocessor controller receives the positional and / or orientation information , compares the information with the constellation file and transforms the information into spatial or range measurements to compute a position within the tracking workspace . the microprocessor then communicates the computed position and / or range measurements with one or more master processors controlling the simulated environment . the simulated environment processors utilize the computed position and / or range measurements to responsively change or alter the simulated environment . as an example , the is - 900 ™ motion tracking system employs a transponder which utilizes sound to track movement . specifically , the is - 900 ™ transponder transmits ultrasonic pulses . the ultrasonic pulses are received by one or more ultrasonic microphones integrated into the sensor . using the speed of sound , range measurements are obtained and transmitted to a processor . the is - 900 ™ processor uses the range measurement data to ascertain the position of a sensor and any associated movement in relation to the transponders . this process includes a comparison of the range measurement data to the constellation file , which is stored on the is - 900 ™ processor . the is - 900 ™ processor may then communicate with a separate master processor which controls a simulated environment to responsively change or alter the simulated environment . additional description of the exemplary system and associated computations is disclosed in u . s . pat . no . 6 , 314 , 055 , issued on nov . 6 , 2001 , and entitled range measuring system . integration of a motion tracking system with a simulated environment or visualization system has numerous practical advantages . for example , a motion tracking system with a simulated environment enhances a user &# 39 ; s experience by minimizing or eliminating external controls which are unrelated to the simulated environment . further , motion tracking systems enable a user to physically interact with the simulated environment , enhancing awareness retention by engaging the entire brain of a user through physical and sensory immersion . in addition , motion tracking systems increase the realism of the simulated environment . the following presents one or more examples of embodiments of an automatically addressable configuration system 100 for a motion tracking system 150 . for ease of discussion and understanding , the following detailed description and illustrations refer to an acoustic or sound based motion tracking system 150 , specifically an is - 900 ™ motion tracking system , available from intersense , inc . ( located in bedford , mass .). it should be appreciated that the illustrated motion tracking system 150 is provided for purposes of illustration , and the automatically addressable configuration system 100 may be used with any type , style or arrangement of motion tracking system which has one or more transponders positioned about a tracking area or tracking workspace and which are calibrated to include at least one transponder location map or constellation . in addition , for ease of discussion and understanding , the following detailed description and illustrations refer to a motion tracking system 150 operating in association with a multi - display immersive visualization system 400 . it should be appreciated that the illustrated multi - display immersive visualization system 400 is provided for purposes of illustration , and the automatically addressable configuration system 100 and associated motion tracking system 150 may be used with any type , style , arrangement or device suitable for use with a motion tracking system 150 . fig1 illustrates an automatically addressable configuration system 100 in accordance with one of more examples of embodiments of the present invention . the visualization system 100 may include a user touch panel or regulator or user interface 110 in communication with a visualization system controller 130 through a network switch or router 120 . a master computer system or master programmable computer ( pc ) 140 may be in communication with the visualization system controller 130 and / or user interface 110 , also through router 120 . further , the master computer system 140 may be in communication with a motion tracking system 150 . the user touch panel or regulator or user interface 110 includes a push button or toggle switch or dial or lever or input control 111 . the user interface 110 may be a touch panel or touch screen control , for example an amx ™ touch panel available from amx , llc ( located in richardson , tex .). in one or more examples of embodiments , the user interface 110 may be any brand or type of touch screen control , a graphical user interface ( gui ) controller , a control panel or any other type of control assembly enabling a user to selectively input a command and / or transmit a control signal . the user interface 110 may be in communication with the visualization system controller 130 through a router 120 . the user interface 110 may be in communication with the router 120 by a communication link 112 adapted to transmit a signal . the communication link 112 may be a category 5 or cat5 cable . in one or more examples of embodiments , communication link 112 may be any suitable communications protocol and associated transmission device to transmit commands from user interface 110 , including , but not limited to , wireless communication , transmission control protocol / internet protocol ( tcp / ip ), ethernet , or universal serial bus ( usb ). further , in one or more examples of embodiments , the user interface 110 may be in direct communication with the master computer system 140 . the router or network switch or network assembly or hub 120 includes a plurality of network ports 124 . at least one network port 124 receives communication link 112 . the router 120 creates a common address or communication scheme to allow the connected electronic devices to communicate with each other over a local area network ( lan ). the router 120 may be or include any suitable known or future developed network communication device . in one or more examples of embodiments , the router 120 may be in wireless communication with the user interface 110 , visualization system controller 130 and / or master computer system 140 . as shown in fig1 , the visualization system controller 130 is in communication with router 120 via a second communication link 132 . communication link 132 may be identical to communication link 112 . communication link 132 may be connected to a network port 124 on router 120 and a corresponding network port 134 on the visualization system controller 130 . in one or more examples of embodiments , communication link 132 may be any transmission device to receive and / or transmit commands . further , in one or more examples of embodiments , the visualization system controller 130 may be in direct communication with the master computer system 140 . the visualization system controller 130 is a centralized controller or programmable computer programmed to control and automate any associated devices . as illustrated in fig1 , the visualization system controller 130 is in communication with a visualization system 400 . accordingly , the visualization system controller 130 includes programming to control and automate portions of the visualization system 400 . the visualization system controller 130 may include any suitable programmable controller for control and automation of any associated devices . for example , the visualization system controller 130 may be an amx ™ ni - 2100 integrated controller . the ni - 2100 controller utilizes netlinx ™ programming language , which includes an interface enabling utilization of java ™ based programming modules . referring to fig1 , the master computer system or master personal computer ( pc ) 140 is in communication with router 120 by a third communication link 142 . communication link 142 may be identical to communication links 112 , 132 . communication link 142 may be connected to a network port 124 on router 120 and a corresponding network port 144 on the master computer system 140 . in one or more examples of embodiments , communication link 132 may be any transmission device to receive and / or transmit commands . master computer system 140 is a programmable computer system including random access memory ( ram ) 145 , a computer readable storage medium or storage device or hard drive 146 and a processor 147 . the master computer system 140 stores or carries an automatically addressable configuration application 200 . further , a user may employ the master computer system 140 to operate the automatically addressable configuration application 200 . in one or more examples of embodiments , the master computer system 140 may be any known or future developed programmable computer processor system suitable to store data and operate the automatically addressable configuration application 200 . further , in one or more examples of embodiments , the computer readable storage medium 146 may include any data storage device which can store data that can be thereafter read by a computer system . examples of computer readable medium 146 may include read - only memory , cd - rom , cd - r , cd - rw , dvd , dvd - rw , magnetic tapes , universal serial bus ( usb ) flash drive , or any other optical or other suitable data storage device . the computer readable medium 146 may also be distributed over a network coupled or in communication with master computer system 140 so that the computer readable code or application , including the automatically addressable configuration application 200 , is stored and executed in a distributed fashion . the motion tracking system 150 is in communication with the master computer system 140 by a fourth communication link 152 . as illustrated in fig1 , the communication link 152 is a serial cable connected to a first serial port interface or network port 148 associated with the master computer system 140 and a second serial port interface or network port 158 associated with the motion tracking system 150 . in one or more examples of embodiments , communication link 152 may be identical to communication links 112 , 132 , 142 , or may be any suitable transmission control protocol / internet protocol ( tcp / ip ), ethernet , universal serial bus ( usb ), or suitable communications protocol and associated transmission device to transmit commands between the master computer system 140 and motion tracking system 150 . further , in one or more examples of embodiments , the motion tracking system 150 may be in wireless communication with the master computer system 140 , through a wireless device or assembly ( not shown ). the motion tracking system 150 may include a programmable microprocessor controller 153 . the programmable microprocessor controller 153 may carry or house the second serial port interface or network port 158 . the programmable microprocessor controller 153 includes a computer readable storage medium or storage device or hard drive 154 and a processor 155 . in one or more examples of embodiments , the computer readable medium 154 may include any data storage device which can store data that can be thereafter read by a computer system , in particular the programmable microprocessor controller 153 . examples of computer readable storage medium 154 may include read - only memory , cd - rom , cd - r , cd - rw , dvd , dvd - rw , magnetic tapes , universal serial bus ( usb ) flash drive , or any other optical or other suitable data storage device . the motion tracking system 150 may include one or more transponders 156 . as shown in fig1 , the one or more transponders 156 is in communication with the programmable microprocessor controller 153 . the transponders 156 emit a signal to track motion within a designated or defined area or a tracking workspace . to this end , the transponders 156 may employ different tools or signals to track motion , including , but not limited to , cameras , sound , infrared , inertial , optical , electromagnetic or any other known , or future developed motion tracking tool or methodology . the transponders 156 may be mounted about a tracking workspace or defined area of movement 410 . as illustrated in fig4 and 5 , a plurality of transponders 156 a and 156 b , are installed on a multi - display immersive visualization system 400 above or about the tracking workspace 410 . in one or more examples of embodiments , a single , individual transponder 156 or a plurality of transponders 156 grouped in a housing may be attached or mounted about the tracking workspace 410 . to this end , the transponder housing may be shaped as a strip , as a wing , at an angle or as any other desirable shape . the transponders 156 are calibrated to properly define the dimensions of the tracking workspace 410 . calibration involves measurement of the cartesian x , y , z coordinates of each respective or group of transponders 156 about the tracking workspace 410 . the coordinate measurements are used to create a transponder location map or constellation file or constellation module 256 . each constellation file or module 256 defines the placement and arrangement of specified transponders 156 about the tracking workspace 410 . as illustrated in fig1 , two constellation files or modules 256 a , 256 b may reside or be stored or carried by the master computer system 140 on the computer readable medium 146 . constellation file or module 256 a corresponds with the arrangement or placement of transponders 156 a , shown in fig4 and 5 . constellation file or module 256 b corresponds with the arrangement or placement of transponders 156 b , also shown in fig4 and 5 . in one or more examples of embodiments , any number of constellation files or modules 256 may exist or be stored on the master computer system 140 . the motion tracking system 150 may include one or more sensors 157 . referring to fig1 , the sensor 157 is in communication with the programmable microprocessor controller 153 . the sensor 157 receives the signal emitted by transponders 156 to assist with tracking motion within the designated or defined area or tracking workspace 410 . the sensor 157 may include a variety of structural arrangements and associated positions . to this end , the sensor 157 may be positioned near the transponder 156 , may be positioned at a second location away from transponder 156 around the desired tracking workspace 410 , or may be positioned on a user . for example , the sensor 157 may be hand held , may mount to virtual reality interface gloves , may be mounted to the head of a user , may include a wand and stylus , may include a joystick , or may be mounted to any desirable portion of the user &# 39 ; s body or in the tracking workspace 410 . the foregoing presents an example of an embodiment of an automatically addressable configuration system 100 . the system 100 also includes the automatically addressable configuration application or configuration module or dynamic code set 200 . as shown in fig1 , the automatically addressable configuration application or module or dynamic code set 200 is a machine - readable medium carried or stored or operated in association with the master computer system 140 or computer readable storage medium 146 . the automatically addressable configuration application 200 is prepared or written in java ™ based programming language . however , in one or more examples of embodiments , the automatically addressable configuration application 200 may be prepared or written in any suitable programming language . as illustrated in fig2 , 3 a and 3 b , the automatically addressable configuration application or module or dynamic code set 200 includes configuration parameters or a script or program which functions to control or facilitate automatically a series of steps to selectively install and configure a motion tracking system 150 . the automatically addressable configuration system 100 and automatically addressable configuration application 200 enable the automatic loading and configuration of a specified arrangement of transponders 156 and corresponding constellation file 256 associated with a motion tracking system 150 . the illustrated system 100 is operationally associated with a multi - display immersive visualization system 400 . as illustrated in fig4 and 5 , the multi - display immersive visualization system 400 includes two sets of transponders 156 a and 156 b . referring to fig5 , transponders 156 a are associated for tracking motion or use with the visualization system 400 when an image 420 , shown in broken lines , is projected from an overhead projector 425 to a floor screen 430 of the visualization system 400 . referring to fig4 , transponders 156 b are associated for tracking motion or use with the visualization system 400 when an image 440 , shown in broken lines , is projected from overhead projector 425 to a ceiling screen 450 of the visualization system 400 . in one or more examples of embodiments , the multi - display immersive visualization system 400 may have any number or sets of transponders 156 . referring to fig2 , the automatically addressable configuration application 200 includes a series of processing instructions or steps , which is depicted in flow chart or flow diagram form . the master computer system 140 is powered on or started at step 202 . the master computer system 140 may be powered on directly by a user or automatically in association with the automatically addressable configuration system 100 . next , the application 200 is started or initiated or executed at step 204 . the application 200 may start manually , for example by manual activation of an executable file by a user or operator , or may start automatically , for example by automatic execution during the master computer system 140 start - up sequence . once the application 200 starts , it opens or initiates communication with the local area network at step 206 . communication with the local area network may be opened through communication link 142 to router 120 , as illustrated in fig1 . referring to fig2 , once the application 200 starts and the network connection is initiated , the application automatically acts as a listener program . accordingly , the application 200 listens and awaits a command from a device associated with the local area network , for example the user interface 110 or visualization system controller 130 . in one or more examples of embodiments , the application 200 may listen for a command from a device hosting application 200 . at step 208 , the automatically addressable configuration application 200 and associated configuration parameters operates automatically without user input as the process is managed by code . at step 208 , the application 200 automatically actively listens to ascertain whether it has received a recognizable command . if no command is received , the application 200 automatically returns to or maintains active listening at step 209 . the application 200 automatically continues the sequence of listening for a command 208 , and if no command is received , returning to listening for a command 209 , until a recognizable command is received . at step 210 , the application 200 has automatically received a recognizable command from a device associated with the local area network . once the recognizable command has been received , the application 200 automatically identifies what the command is at step 212 . identification step 212 involves automatically ascertaining the appropriate command in order to execute associated command scripts . once the application 200 identifies the recognizable command , the application automatically moves to respond to a first recognizable command or first command at step 214 or moves to respond to a second recognizable command or second command at step 216 . the step chosen by the application 200 depends upon the recognized command received . in one or more examples of embodiments , application 200 may automatically recognize any number of commands and include associated steps to automatically respond to said commands . at step 214 , the application 200 automatically recognizes a first command , for which the application 200 automatically activates an associated first script or executable file at step 220 . the activation or execution of the first script or executable file is set out in greater detail in fig3 a . the application 200 automatically executes an associated first script or first executable file at step 221 . upon automatic execution of the first executable file , the application 200 communicates or issues a command at step 222 to the programmable microprocessor controller 153 to clear or delete the currently existing constellation file 256 associated with the controller 153 . the constellation file 256 stored on hard drive 154 is subsequently deleted or cleared . at step 224 , the application 200 next automatically acquires a constellation file 256 associated with the first command , here constellation file 256 a . next , at step 226 , the application 200 automatically communicates or issues a command to the programmable microprocessor controller 153 , transferring a second or replacement or associated constellation file 256 a to the controller 153 . at step 228 , the application 200 automatically directs the controller 153 to save or store or use the uploaded constellation file 256 a . accordingly , the controller 153 now stores and uses the uploaded constellation file 256 a to track motion or movement in accordance with the motion tracking system 150 described above . at step 229 , the first executable file automatically closes , and returns the automatically addressable configuration application 200 to step 208 in order to listen for another command , as shown in fig2 . accordingly , through execution of the first script or executable file , the automatically addressable configuration application 200 selectively loads a desired constellation file 256 a associated with a command , providing automatic loading and configuration of a selected transponder arrangement or constellation file . further the loading of constellation file 256 a occurs quickly without the need of additional , outside steps by a user . referring to fig2 , at step 216 , the application 200 recognizes a second command , for which the application 200 automatically activates an associated second script or executable file at step 230 . the activation of the second script or executable file is set out in greater detail in fig3 b . the application 200 automatically executes associated second script or second executable file at step 231 . upon automatic execution of the second executable file , the application 200 automatically communicates or issues a command at step 232 to the programmable microprocessor controller 153 to clear or delete the currently existing constellation file 256 associated with the controller 153 . the constellation file 256 stored on hard drive 154 is subsequently deleted or cleared . at step 234 , the application 200 next automatically acquires a constellation file 256 associated with the second command , here constellation file 256 b . next , at step 236 , the application 200 automatically communicates or issues a command to the programmable microprocessor controller 153 transferring the second or replacement or associated constellation file 256 b to the controller 153 . at step 238 , the application 200 automatically directs the controller 153 to save or store or use the uploaded constellation file 256 b . accordingly , the controller 153 now stores and uses the uploaded constellation file 256 b to track motion or movement in accordance with the motion tracking system 150 described above . at step 239 , the first executable file automatically closes , and returns the automatically addressable configuration application 200 to step 208 in order to listen for another command , as shown in fig2 . accordingly , through execution of the second script or executable file , the automatically addressable configuration application 200 selectively loads a desired constellation file 256 b associated with a command , providing automatic loading and configuration of a selected transponder arrangement or constellation file . further the loading of constellation file 256 ba occurs quickly without the need of additional , outside steps by a user . accordingly , the foregoing presents a machine - readable medium including instructions , which , when executed by a machine , cause the machine to perform operations . the instructions in one or more examples of embodiments are configuration parameters managed by a computer and which are arranged to acquire , transfer and install instructions on an additional machine or computer or computer readable storage medium . in operation and use , the automatically addressable configuration system 100 and all associated components are initially powered on . once power is supplied , a user may initiate the automatically addressable configuration application 200 . once all components and applications are operational , a user may input a command into user interface 110 , for example , actuating a control directing or commanding the visualization system 400 to open the ceiling screen 450 and project an image 430 to the floor screen 430 . the user interface 110 will communicate the command through a first communication link 112 to router 120 . in turn , router 120 will communicate or transfer or route the command to the visualization system controller 130 through the second communication link 132 . the visualization system controller 130 receives the “ open ” command and directs the visualization system 400 to open the ceiling screen 450 . the opening or retracting of the ceiling screen 450 is best illustrated by comparing the position of ceiling screen 450 in fig4 to its position in fig5 . in fig5 , the ceiling screen 450 is fully retracted and the visualization system 400 is in the “ open ” configuration . simultaneously , the automatically addressable configuration application 200 receives the recognizable “ open ” command across the third communication link 142 ( at step 208 of fig2 ). the application 200 automatically recognizes the command as “ open ” or a first command ( at step 214 of fig2 ) and activates or executes the associated first script or executable file ( at steps 220 , 221 of fig2 and 3a ). referring to fig1 and 3a , the application 200 subsequently automatically communicates with the programmable microprocessor controller 153 of motion tracking system 150 through the fourth communication link 152 . the application 200 automatically instructs the controller 153 to delete or clear the existing constellation file 256 on hard drive 154 ( at step 222 of fig3 a ). the application 200 then automatically acquires the constellation file 256 a associated with the arrangement of transponders 156 a used for tracking motion when the visualization system 400 is in the “ open ” configuration ( at step 224 of fig3 a ). the application 200 automatically transfers constellation file 256 a to controller 153 , which is accordingly saved on hard drive 154 ( at steps 226 and 228 of fig3 a ). the application 200 also automatically instructs controller 153 to use constellation file 256 a , and the associated transponders 156 a , to track motion ( step 228 of fig3 a ). the application 200 then automatically returns to the listening step to await another recognizable command ( steps 229 and 208 of fig2 ). the motion tracking system 150 now tracks motion using transponders 156 a and the associated constellation 256 a . the loading of the constellation 256 a associated with the “ open ” configuration of visualization system 400 occurred quickly and automatically following the input of a command into user interface 110 . in one or more examples of embodiments , the automatically addressable configuration application 200 may receive or interpret a command from the user interface 110 or the visualization system controller 130 . to convert or transform the visualization system 400 into the “ closed ” configuration , a user may input a command into user interface 110 , for example , actuating a control directing or commanding the visualization system 400 to close the ceiling screen 450 and project an image 440 to the ceiling screen 450 . the user interface 110 communicates the command through a first communication link 112 to router 120 . in turn , router 120 communicates or transfers or routes the command to the visualization system controller 130 through the second communication link 132 . the visualization system controller 130 receives the “ closed ” command and directs the visualization system 400 to close the ceiling screen 450 . the closing or extension of the ceiling screen 450 is best illustrated by comparing the position of ceiling screen 450 in fig5 to its position in fig4 . in fig4 , the ceiling screen 450 is fully extended and the visualization system 400 is in the “ closed ” configuration . simultaneously , the automatically addressable configuration application 200 receives the recognizable “ closed ” command across the third communication link 142 ( at step 208 of fig2 ). the application 200 recognizes the command as “ closed ” or a second command ( at step 216 of fig2 ) and automatically activates or executes the associated second script or executable file ( at steps 230 , 231 of fig2 and 3b ). referring to fig1 and 3b , the application 200 subsequently automatically communicates with the programmable microprocessor controller 153 of motion tracking system 150 through the fourth communication link 152 . the application 200 instructs the controller 153 to delete or clear the existing constellation file 256 on hard drive 154 ( at step 232 of fig3 b ). the application 200 then automatically acquires the constellation file 256 b associated with the arrangement of transponders 156 b used for tracking motion when the visualization system 400 is in the “ closed ” configuration ( at step 234 of fig3 b ). the application 200 automatically transfers constellation file 256 b to controller 153 , which is accordingly saved on hard drive 154 ( at steps 234 and 238 of fig3 b ). the application 200 also automatically instructs controller 153 to use constellation file 256 b , and the associated transponders 156 b , to track motion ( step 238 of fig3 b ). the application 200 then automatically returns to the listening step to await another recognizable command ( steps 239 and 208 of fig2 ). the motion tracking system 150 now tracks motion using transponders 156 b and the associated constellation 256 b . the loading of the constellation 256 b associated with the “ closed ” configuration of visualization system 400 occurs quickly and automatically following the input of a command into user interface 110 . in one or more examples of embodiments , the automatically addressable configuration application 200 may receive or interpret a command from the user interface 110 or the visualization system controller 130 . the foregoing embodiments provide advantages over currently available devices and systems . the automatically addressable configuration system and associated automatically addressable configuration application described herein provides a user of a motion tracking system the ability to utilize two or more arrangements of transponders or constellation files in a simple and efficient manner . the system and application enables a user to automatically load or upload and install a constellation file with a single command . this not only reduces the time required to load a constellation file , but eliminates the need for an extensive , multi - step process to install a constellation file . further , the system and application allow for two or more constellation files or transponder arrangements to be locally stored or saved . this may provide a user with numerous constellation options with the ability to automatically upload the constellation . in addition , the system and application eliminates the need for a user to manually install a constellation file . aspects of the automatically addressable configuration application 200 described herein can be implemented on software running on a computer system . the system herein , therefore , may be operated by computer - executable instructions , such as program modules , executable on a computer . program modules may include routines , programs , objects , components , data structures and the like which perform particular tasks or implement particular instructions . the software program may be operable for supporting the transfer of information within a network of trusted partner sites using artifacts . the computers for use with the system and various components described herein may be programmable computers which may be special purpose computers or general purpose computers that execute the system according to the relevant instructions . the computer system can be an embedded system , a personal computer , notebook computer , server computer , mainframe , networked computer , handheld computer , personal digital assistant , workstation , and the like . other computer system configurations may also be acceptable , including , cell phones , mobile devices , multiprocessor systems , microprocessor - based or programmable electronics , network pc &# 39 ; s , minicomputers , and the like . preferably , the computing system chosen includes a processor suitable in size to efficiently operate one or more of the various systems or functions . the system or portions thereof may also be linked to a distributed computing environment , where tasks are performed by remote processing devices that are linked through a communications network . to this end , the system may be configured or linked to multiple computers in a network , including , but not limited to a local area network , a wide area network , a wireless network , and the internet . therefore , information and data may be transferred within the network or system by wireless means , by hardwire connection or combinations thereof . the computer can also include a display , provision for data input and output , etc . furthermore , the computer or computers may be operatively or functionally connected to one or more mass storage devices , such as , but not limited to a database . the memory storage can be volatile or non - volatile and can include removable storage media . the system may also include computer - readable media which may include any computer readable media or medium that may be used to carry or store desired program code that may be accessed by a computer . the invention can also be embodied as computer readable code on a computer readable medium . to this end , the computer readable medium may be any data storage device that can store data which can be thereafter read by a computer system . examples of computer readable medium include read - only memory , random - access memory , cd - rom , cd - r , cd - rw , magnetic tapes , and other optical data storage devices . the computer readable medium can also be distributed over a network coupled computer system so that the computer readable code is stored and executed in a distributed fashion . although various representative examples of embodiments of this invention have been described above with a certain degree of particularity , those skilled in the art could make numerous alterations to the disclosed embodiments without departing from the spirit or scope of the inventive subject matter set forth in the specification and claims . in some instances , in methodologies directly or indirectly set forth herein , various steps and operations are described in one possible order of operation , but those skilled in the art will recognize that steps and operations may be rearranged , replaced , or eliminated without necessarily departing from the spirit and scope of the present invention . it is intended that all matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative only and not limiting . changes in detail or structure may be made without departing from the spirit of the invention as defined in the appended claims . moreover , some portions of the detailed descriptions herein are presented in terms of procedures , steps , logic blocks , processing , and other symbolic representations of operations on data bits that can be performed on computer memory . these descriptions and representations are the means used by those skilled in the data processing arts to most effectively convey the substance of their work to others skilled in the art . a procedure , computer executed step , logic block , process , etc ., is here , and generally , conceived to be a self - consistent sequence of steps or instructions leading to a desired result . the steps are those requiring physical manipulations of physical quantities . usually , though not necessarily , these quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated in a computer system . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the discussions herein , it is appreciated that throughout the present invention , discussions utilizing terms such as “ receiving ,” “ sending ,” “ generating ,” “ reading ,” “ invoking ,” “ selecting ,” and the like , refer to the action and processes of a computer system , or similar electronic computing device , including an embedded system , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system . although the present invention has been described with reference to particular embodiments , persons skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention . | 6 |
now referring to the figures , set forth is a fishing vessel 10 having a centrally located console 12 with a t - top 14 extending over the console 12 providing an area of shade for the those occupants standing around the console . the outrigger assembly 20 of the instant invention includes a base member 22 securable to the t - top 14 having a drive handle positioner 24 mounted beneath the structure 14 . operation of the drive handle positioner 24 allows the outrigger to have rotational positioning in a horizontal plane relationship to the base member . in this manner the positioner 24 provides positive movement of the distal end 112 of the outrigger pole between a stowage position and a trolling position . for ease of illustration , this specification will be directed to the use of a manual rotatable crank which is not limiting but rather for purposes of illustration . the telescoping outrigger assembly of the instant invention consists of a radial base tube 49 for coupling to an outrigger positioner such as that disclosed in u . s . pat . no . 6 , 769 , 377 , the contents of which is incorporated herein by reference . the radial base tube 49 may be part of the outrigger drive assembly mounted to a vessel or may be part of the instant telescoping pole assembly depending upon the coupling necessary . a base collar 52 is secured to the radial base tube 49 providing a coupling between the radial base and a first extension tube or member tube 50 having a predetermined length . additionally , the base collar 52 provides an internal stop so that a proximal end of member tube 64 cannot slip past the base collar 58 while in a stowage position . it should be noted that the length of the radial base tube 49 may be most any size and is dependant upon the manufacturer &# 39 ; s preference for making the overall telescopic length and the mounting mechanism of the outrigger to a vessel . it should also be noted that longer telescoping poles may require a thicker and larger radial base for proper support . referring now to fig2 - 4 set forth is a member tube 50 as coupled to the base collar 52 by use of fasteners 51 . in this embodiment , first member tube 50 has a predetermined length ending with a bushing 56 and large collar 58 secured to the distal end of member tube 50 by the use of fasteners 57 . before securement of the large collar 58 onto the member tube 50 , the second member tube 62 is made ready for securement to the first member by placement of a plunger base 64 into the open end of member tube 62 which is constructed and arranged for slidable insertion with the member tube 50 but not through the large collar 58 . it is noted that the plunger base 64 is secured after the member tube 62 is placed through the collar 58 , and once fastened to the tube the plunger base 64 does not extend beyond the large collar 58 . the plunger base 64 forms part of a locking mechanism consisting of a plunger 68 biased by a spring 70 and a threaded shoulder bolt 72 . the end of the plunger includes a plastic tip 69 that prevents the scratching of the inner surface of a member tube thereby maintaining the corrosion resistance of the tube . the threaded shoulder bolt 72 is threaded into the plunger base 64 along aperture 80 . the aperture is constructed and arranged to entrap the spring 70 between the shoulder bolt 72 and an internal collar 81 which is formed by the reduction of the aperture to a size allowing the plunger 68 to extend into but not pass through . the plunger having a lip for engaging the collar 81 wherein the plunger may extend through the aperture but not pass through . the plunger base 64 effectively operates as a stop to prevent the second member 62 from pulling out of a coupling engagement with the first member 50 . the second member 62 is of a predetermined length preferably matching the length of member 50 and is coupled to the plunger base 64 in combination with an isolating plunger base sleeve 82 . the plunger base sleeve 82 is sized to correspond with the outer diameter of the plunger base 64 and is sized to slidably move within the inner chamber of the tube 50 so as to allow slideable insertion with minimal effort . the plunger base sleeve is preferably made of aluminum allowing for ease of movement , alternatively the plunger base sleeve may be formed from delrin or other non - metallic material . tube member 62 is moved from a storage position by inserting the end of tube member 62 into tube member 50 wherein the extension of plunger 68 through the aperture 80 of the plunger base 62 may engage the locking aperture 92 of the first member 54 to position adjoining member 62 in a deployed position . the second member 62 may rotate in relation to the first member 50 when the plunger is not engaged . the plunger base 64 is sized to place the plunger 68 in a position to engage the aperture 92 of first member 50 wherein a rotation of the second member 62 in relation to the first member 50 will allow for the spring biased insertion of the plunger 68 into the aperture 92 . similarly to the assembly of components on the first member 50 , the use of a second collar 94 , be it smaller than the first collar 58 , and is coupled to the member tube 62 by use of fasteners 96 such as allen screws 57 . the bushing 98 provides ease of slidable movement of the tube and prevents galling from its connection with the second member tube 62 . the use of a smaller plunger base 102 is inserted before mounting of the collar 94 in bushing 98 . the final member of this embodiment includes the plunger base sleeve 104 which is mounted to the smaller plunger base 102 and secured by placement of the plunger 106 , spring 108 , and shoulder bolt 110 . a tip point 112 extends from the end of the tube for aesthetic purposes , as well as to prevent matter from entering the hollow tube . it should be noted that additional tubes could be mounted to the telescoping pole , albeit the 3 sections being a preferred embodiment . eye hooks 99 are placed along the length of the telescoping pole for use in the directional control of conventional spreader lines . referring now to fig5 , set forth is an illustration of the assembly in an extended position . tube member 50 is shown engaged with tube member 62 by use of the plunger 68 that is biased in position by spring 70 . as previously described , the plunger is assembled by placement through aperture 80 of end bolt 64 . the spacer sleeve 82 is shown with a lower engagement point 105 that abuts against the plunger base 64 and an upper engagement point 107 that abuts the large bushing 56 . the bushing 56 is held in position by collar 58 and with an edge 109 that is spaced apart from the outer surface of the tube 62 to prevent metal to metal contact yet provide sufficient support to the bushing 56 . the plunger is shown inserted through aperture 92 for a deployed position . referring now to fig6 , set forth is an illustration of the assembly in a collapsed position . tube member 50 is shown disengaged with tube member 62 placement of the plunger 68 in a compressed position by depressing spring 70 and placing the plunger body 68 along the inner surface of tube member 50 . as previously described , the plunger is assembled by placement through aperture 80 of plunger base 64 . the spacer sleeve 82 is shown with a lower engagement point 105 that abuts against the plunger base 64 and an upper engagement point 107 that is now abutted against the large bushing 56 . the plunger tip 69 is preferably formed from a material that will not gall the inner surface of the member tube 50 . the radial base tube 49 is shown in its position within the lower end of member tube 50 providing structure reinforcement thereby allowing the use of a thinner base tube 50 . the radial base tube 49 is sized a length to operate as a stop for the plunger base 64 which abuts the end 53 of the radial tube while in a collapsed position . the radial tube is secured to member tube 50 by use of a collar having fastening bolt 51 extending to fastening nut 55 . fig7 is a cross section view of a 15 ′ telescoping pole embodiment in a collapsed position measuring about 6 ′ 9 ″. the plunger base 64 and 102 are juxtapositioned with tube member 50 encompassing a majority of tube member 62 which further encompasses a majority of tube member 100 . fig8 is a cross section view of a 15 ′ telescoping pole embodiment in an extended position measuring about 15 ′. the plunger bases 64 and 102 are each engaged with their respective tube member affixing the pole in a deployed position for use . eye hooks 99 secured to the collars providing line guides . eye hook 99 is used in combination with the tip 112 for securing to the tube member 100 . in operation the plunger 106 is secured to the third member tube 100 and locked in position when placed through the second member tube aperture 114 . similarly plunger 68 is placed through aperture 92 of first member tube 50 while in a deployed position . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives an obtain the ends and advantages mentioned , as well as those inherent therein . the embodiments described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims . | 0 |
referring to fig1 , a finishing apparatus 10 for cutting , shaping and polishing the edges of a hard material is illustrated . the finishing apparatus includes a guide - way 12 having a horizontal member 14 constructed and arranged for being secured parallel with and juxtaposed to an upper surface 16 of a hard material workpiece 18 to provide rigidity in a first plane , and a vertical member 20 extending upwardly with respect to the upper surface of the workpiece 16 to provide rigidity in a second plan . the horizontal member 14 includes a first bearing surface 22 and the vertical member 20 includes a second bearing surface 24 . a first carriage 26 is slidably secured to the guide - way 12 for movement along the length thereof . the carriage includes at least one , and preferably two , first bearing follower ( s ) 28 constructed and arranged for sliding cooperation with the first bearing surface 22 . the carriage also includes at least one , and preferably two , second bearing follower ( s ) 30 constructed and arranged for sliding cooperation with the second bearing surface 24 . a second linear guide - way 32 is secured to the first carriage 26 defining an axis of approach for a rotatable tool 34 ( fig3 ). the second guide - way 32 extends upward and outward at an acute angle a with respect to the horizontal member 14 . in a most preferred embodiment the axis of approach is 22 . 5 degrees . however , it should be noted that an axis of approach between 3 and 87 degrees may be utilized without departing from the scope of the invention . the axis of approach reduces uneven tool wear and improves surface finish by distributing tool pressure across a larger area of the rotatable tool 34 as the tool is advanced into the workpiece . the axis of approach also maintains a more consistent cutting speed at the interface between the rotatable tool 34 and the workpiece 18 . this is especially true when a corner rounding cutting tool is used for rounding the edge of a workpiece . a second carriage 36 is slidably secured to the second guide - way 32 and a motor 38 and rotatable tool 34 are operably secured to the second carriage . in a most preferred embodiment the motor and rotatable tool are components of an angle grinder 40 ( fig1 ). angle grinders are readily available in the marketplace and therefore worn and / or broken components are easily replaced . in addition , various saw blades and shaped cutters are available for use on the device . in this manner , the rotatable tool may be advanced into an edge of a workpiece along the axis of approach and the first carriage may be traversed back and forth along the guide - way for finishing an edge of said workpiece via handle ( s ). referring to fig9 - 10 , one embodiment of the instant invention is illustrated . in this embodiment the second carriage includes two substantially parallel plates 42 . the top portion of the plates each include an arcuate slot 44 for attachment of the top portion of the angle grinder 40 while the bottom portion of the plates includes an aperture and pin arrangement 46 defining an axis of rotation for the angle grinder . as illustrated in fig9 , hand levers 48 may be loosened to allow the top portion of the rotary tool to be pivoted throughout the range of the arcuate slots . this arrangement permits bevels and the like to be easily formed along the edge ( s ) of the workpiece . referring to fig1 - 8 , a preferred embodiment of the instant invention is illustrated . in this embodiment , the arcuate slots 44 each further include a vertical slot 50 and the bottom portion of the rotary tool is secured to a pivoting elevator plate 52 . the elevator plate 52 is pivotable between a substantially horizontal position , as shown in fig5 , and a substantially vertical position , as shown in fig7 , whereby pivoting the elevator plate from the horizontal position to the vertical position causes the centerline of the rotary tool to move in a vertical manner . this construction is particularly adapted to allow the use of the outer periphery of the rotatable tool 34 for working along the upper surface of the workpiece as illustrated in fig3 , or the face of the rotatable tool may be utilized for working the edge of the material as illustrated in fig9 - 10 . in addition , rotating knob 33 is provided to allow precise incremental upward and downward movements of the cutting tool and lock handles 66 allow the elevator plate to be locked into a desired position . referring to fig2 , 3 , 8 - 10 , the first and second bearing surfaces 22 , 24 are constructed as shaped extrusions having a hard surface coating . in a most preferred embodiment the bearing surfaces are square or rectangular in shape to prevent lifting and / or canting of the first carriage 26 as it is traversed . the first and second follower surfaces 28 , 30 are preferably constructed from a polymeric material such as teflon to include a substantially conjugate shape to the bearing surfaces . the follower surfaces are provided with a pressurized lubrication system 54 . the pressurized lubrication system is constructed and arranged to deliver liquid under pressure to the follower surfaces during operation of the device to provide lubrication and flush away debris . in a most preferred embodiment , the pressurized lubrication system delivers water to the bearing surfaces , however oil or a combination of water and soluble oil may also be delivered to bearings without departing from the scope of the invention . the pressurized lubrication system may be provided with a manual flow control valve 56 or a solenoid valve 57 to control the flow of liquid to the bearing surfaces . referring to fig2 and 4 , the finishing apparatus may include a pneumatic cylinder 58 connected between the first carriage 26 and the second carriage 36 for providing a motive force to cause the second carriage to move along the axis of approach into the workpiece . the pneumatic cylinder may cooperate with a regulator 59 and air lines 55 to allow an operator to establish a predetermined pressure between the workpiece and the rotatable tool . a stop 60 for limiting the movement of the carriage along the axis of approach may also be provided . in this manner , the operator can select a tool pressure and a stop point for the rotary tool prior to machining the edge of the hard material . the finishing apparatus can then be moved back and forth along the guide - way until the stop is reached . uneven edges and the like are automatically compensated for by the pneumatic cylinder that allows for even tool pressure until the stop is met . the device is generally constructed and arranged to machine , but should not be limited to , man - made stone , natural stone , glass , concrete , ceramic and suitable combinations thereof . it should be noted that in the preferred embodiments the components of the guide - ways , first carriage and second carriage are preferably constructed of aluminum having a hard anodized surface for oxidation control , wear properties and appearance . however , other materials well known in the art suitable for construction of the guide - ways , carriages and bearing surfaces could be utilized without departing from the scope of the invention . such materials may include , but should not be limited to , metals , plastics , and suitable composites . it should also be noted that the guide - way can be constructed with slots 62 which cooperate with clamps 64 for securing the portable finishing apparatus to a piece of hard material . it should also be noted that while the angle grinder is the preferred embodiment for rotation of the rotatable tool , other motors such as pneumatic motors , hydraulic motors , remote motors with cable drives and the like , suitable for providing smooth controlled rotation to the rotatable tool , may be utilized without departing from the scope of the invention . it should also be noted that while the finishing device is illustrated with one rotatable tool , it is also considered to be within the scope of the invention to include more than one rotatable tool on the second carriage . all patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . all patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . it is to be understood that while a certain form of the invention is illustrated , it is not to be limited to the specific form or arrangement herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and any drawings / figures included herein . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned , as well as those inherent therein . the embodiments , methods , procedures and techniques described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims . | 1 |
fig1 briefly introduces ieee 802 . 3ae pcs ( physical coding sublayer ) and the associated scrambling and descrambling with polynomial x 58 + x 39 + 1 . pcs upper interface ( 100 ) is the so - called ‘ 10 gigabit media independent interface ’ or xgmii which provides for the attachment of data communications equipment irrespective of the physical mode of transport of the streams of data to be forwarded ( 102 ) or received ( 104 ). lower interface ( 110 ) provides for physical attachment to the transmission medium ( 115 ) e . g ., a serial optical transmission . data are transmitted in 66 - bit blocks ( 120 ) comprised of a 64 - b scrambled payload with a b ′ 01 ′ preamble ( 122 ). there are also 66 - b control blocks ( 130 ) including an 8 - bit type field preceded by a b ′ 10 ′ preamble . both the block type and the remaining 56 - bit data / control field of a control block are scrambled . preambles , that allow block alignment , bypass the scrambler . transmit path ( 140 ) includes a scrambler ( 144 ) which improves the transmission characteristics so that sufficient transitions are present in the physical bit streams e . g ., to make clock recovery possible at the receiver . the 64b / 66b transmission code has a high transition density and is a run - length - limited code . the encode ( 142 ) and gear box ( 146 ) functions are necessary to map data and control characters to the blocks and to adapt formats . they are not necessary to the understanding of the invention thus , are not further described . receive path ( 150 ) includes a descrambler ( 154 ) to recover the original stream of bits . synchronization on the preambles is achieved first ( 156 ). pcs also includes a function ( 160 ) that monitors the bit error rate over the transmission medium . there is a decode function ( 152 ) which is the counterpart of the transmit encode . apart from the scrambler and descrambler , none of these functions need to be further described to understand the invention . they are shown here for the sake of accuracy on what is exactly the 10 gbe physical coding sublayer and to understand the context where the invention better applies . those skilled in the art will realize that although the invention is described in the particular context of 10 gbe it could be practiced as well in a different environment and will know , from the here after description , how to adapt it to other applications , especially for applications where a different scrambling polynomial would be used . fig2 shows the conventional representation of the 10 gbe scrambler and descrambler , i . e . implementing according to the standard ( see however the remark at the end of fig3 ), the polynomial : g ( x )= 1 + x 39 + x 58 scrambler ( 200 ) and descrambler ( 210 ) are linear feedback shift register ( lfsr ) to perform respectively , continuous division and multiplication of binary strings i . e ., in an algebra modulo 2 modulo g ( x ), one bit at a time . adders are xor &# 39 ; s such as ( 205 ). the two 58 - bit shift registers have taps at indexes 0 , 39 and 58 corresponding to the powers of the three terms of g ( x ), a primitive irreducible polynomial thus capable of generating a pseudo - random maximum length sequence . the sequence will repeat only after 2 58 − 1 shifts , i . e . never for all practical purposes . even though there would be one shift possible every 1 pico ( 10 − 12 ) second , the time to wrap around the sequence would still be larger than the time that has elapsed since the creation of the universe . scramblers and descramblers have been in use for decades and are used to randomize strings of bits in order to obtain a better behavior of various electronic pieces of equipment mainly in the field of transmission . the chief applications being to allow that signals obtained be , on the average , dc balanced and to get enough transitions to be able to recover timing references from them . as an example of this , the first all - zero 64 - bit sequence ( 220 ) gives , after scrambling , the 64 - bit pattern ( 221 ) which is comprised of a good proportion of 0 &# 39 ; s and 1 &# 39 ; s ( 38 1 &# 39 ; s for 26 0 &# 39 ; s ). after de - scrambling , the all - zero sequence is restored ( 222 ). obviously , because of the randomness of the lfsr and of the length of the pseudo - random sequence no two identical input sequences are ever going to be encoded identically as this is illustrated here where the two successive all - zero input sequences ( 220 , 230 ) gives different scrambled patterns ( 221 , 231 ). however , an undesirable well - known effect of scrambling is illustrated with the second example of an all - zero pattern ( 230 ) to transmit . this , after scrambling , gives pattern ( 231 ) in which an error is assumed to flip 5th bit from left ( 233 ) when the signal is propagated through the transmission medium . then , after descrambling , not only 5th bit is false but two more errors are created ( 237 , 239 ) in the restored pattern ( 232 ). the three errors are spread at distances corresponding to the powers of g ( x ) terms . indeed , scrambling multiplies the errors by a number corresponding to the number of terms of the polynomial in use , e . g . 3 with the 10 gbe polynomial . moreover , because errors are largely spread ( errors thus span here on 59 bits ), they are not generally going to stay confined to a single 64 - bit block . for example , the all - one third pattern ( 240 ) gives , after scrambling , pattern ( 241 ) in which an error is assumed to affect the 36th bit from left ( 243 ). after de - scrambling only bit 36 ( 245 ) is going to be false in the current 64 - bit block . however , the following transmitted block ( not shown ) will have two errors in it since errors are nevertheless multiplied and spaced by the de - scrambler as in previous example . hence , implementing an error correcting code in an attempt to improve the bit error rate ( ber ) of transmissions using the 64b / 66b 10 gbe code , for the reasons discussed in the background section , is problematic since each error occurring during the transmission is not only multiplied by three but is also largely spread . performing fec is thus becoming much complicated and normally - requires many more redundant ecc bits and the use of sophisticated codes , such as a bch ( bose - chaudhuri - hocquenghem ). bch codes are the type of codes that can be tailored to correct any occurrence of up to three errors in a string of scrambled bits . however , implementing a tec code , e . g . a triple error correction code , at the expense of having to compute and decode a complex code adds to system cost and complexity , especially at the multi - gbps transmission speeds considered by the invention . another approach is illustrated by u . s . pat . no . 6 , 349 , 138 entitled ‘ method and apparatus for digital transmission incorporating scrambling and forward error correction while preventing bit error spreading associated with desrambling ’. the above patent manages to perform fec after scrambling and before descrambling to get rid of its spreading effect and in order to continue to use a simple code such as a hamming code capable of correcting single bit errors . however , the immediate consequence is that only part of the transmitted string of bits is actually scrambled and has the necessary properties for a good transmission . redundant ecc bits that are calculated after scrambling must be concatenated as is to the scrambled string of bits . the following description of the invention shows how a simple hamming code can still be used on top of scrambling to circumvent the effect of error spreading . fig3 reviews the cases of errors resulting from the error bit spreading and discusses the overhead introduced by fec . the invention assumes that fec is performed at a physical level , above scrambling , so as to take care of the transmission errors on high speed links . although fec could be carried out with each transmitted packet , this would require having one redundant byte i . e ., 8 bits , reserved per transmitted block . along with the 2 - bit preamble necessary for synchronization this would give an overhead of ( 2 + 8 )/( 64 − 8 ) or 18 % for the 64b / 66b code that would include a per - block fec . although this is better than the 25 % overhead of the 8b / 10b code often used for transmission on high speed links this fails meeting the objective of this code which is to require much less overhead i . e ., 2 / 64 or 3 % to operate . hence , fec should be devised so as to protect a series of blocks ( 300 ), rather than a single block , to keep overhead at a low value while allowing on - the - fly corrections of errors so as the transmission on high - speed links can indeed be considered error - free . a common data unit often manipulated by modern data communications devices , such as switches and routers , is a 64 - byte or 512 - bit data packet requiring eight 64b / 66b blocks of the kind shown in fig1 ( 120 ). fec applied at packet level i . e ., over eight 8 - byte or 64 - bit blocks ( 300 ), requires 11 bits as this is discussed in detail in the following description of the invention . hence , in this case , overhead becomes ( 8 × 2 + 11 )/( 512 - 11 ) or 5 . 4 %, which is a modest increase over the original 3 % overhead of the 64b / 66b , while permitting single - bit transmission error corrections . since , in practice more than a weird 11 - bit field would likely have to be reserved in a 512 - bit payload , a maximum of 6 . 4 % may have to be considered if a 2 - byte field would be reserved for practical considerations . hence , fec requires that redundant bits be taken from the payload under the form of a fcs ( field check sequence ) generally placed at the end of the packet ( 310 ). whichever packet size is considered , the kinds of errors that the invention assumes to be correctable are all shown in fig3 . the common case is when the three errors , resulting of the de - scrambling , are all confined to a single packet ( 320 ). although , for a sake of accuracy , the 2 - bit preambles are shown here ( 370 ), it must be understood that they are neither included in the scrambling nor are participating into fec since they are only used for block synchronization by the physical coding sublayer shown in fig1 . the other error types are : a single - bit error ( 340 ) preceded by a double - bit error in previous packet . a double - bit error ( 330 ) preceded by a single - bit error in previous packet . a single - bit error ( 350 ) followed by a double - bit error in next packet . a double - bit error ( 360 ) followed by a single - bit error in next packet . all these error cases , resulting from a single error occurring in the transmission links , are correctable according to the method of the invention further described . it is worth noting here that fig3 shows blocks and packet in a traditional way , i . e . with block preamble and beginning of packet ( bop ) shown on the left . the most left bit is considered as the most significant bit and is transmitted first , from left to right , so the fcs is transmitted last with the end of packet ( eop ). however , this is not consistent with the representation of the scrambler and descrambler by the standard as shown in fig2 . by referring to this figure one can notice that the msb , i . e . 2 58 , is shown to be the most right bit of the shift register . by referring to the proper literature on the subject for example : ‘ error - correcting codes ’, peterson & amp ; weldon , 2nd edition , the mit press , 1972 , and more specifically to chapter 7 ‘ linear switching circuit ’ it can easily be found that scrambler and de - scrambler of the 10 gbe standard are implementing the reciprocal of the polynomial quoted above i . e . : g ( x )= x 58 + x 19 + 1 and scrambler and de - scrambler should rather be indexed from 58 to 0 , from left to right ( so as the middle term is 2 19 ). this does not change anything in practice . both polynomials have exactly the same properties . however , the invention needs to consider the right indexing to be understood . hence , the rest of the description assumes that the polynomial is actually g ( x )= x 58 + x 19 + 1 with , as usual , the most significant term on the left as with ordinary numbers . fig4 discusses the properties of the correcting code which allows the correction of the kind of errors shown in fig3 . in the following , a syndrome must be understood as the result of the packet fec checking . if , e . g ., fcs is 11 - bits wide , then the syndrome is an all - zero ( 405 ) 11 - bit binary vector when no error has occurred . otherwise it is generally different from 0 . the set of values ( 2048 with 11 redundant bits added for correction ) is the syndrome ( 400 ). first , all shifts of three - bit errors ( 410 ) spaced as g ( x ), i . e . at indexes 58 , 19 and 0 and entirely contained in the packet payload ( including fcs ), must have unique syndrome values once a packet is fec checked so that they can be unambiguously corrected . these errors are of the kind shown in fig3 ( 320 ). when this happens no single - bit error or double - bit error respectively of the type ( 330 ) and ( 340 ) shown in fig3 may have possibly occurred in previous packet . second , all single - bit ( 420 ) and double - bit ( 430 ) errors occurring at the end of a packet ( eop ), corresponding respectively to cases ( 350 ) and ( 360 ) of fig3 must give unique syndromes too ( different of the above three - bit error syndromes ) so they can be unambiguously corrected in current packet too . there are 58 − 19 = 39 single - bit errors of this category ( 350 ) possibly affecting the 39 most - right bits of a packet including fcs . additionally , there are 19 double - bit errors of this kind affecting the 19 most - right bits of a packet . when this occurs ( single - bit and double - bit errors occurring at the end of a packet ) this must be remembered ( 441 , 442 ) since next packet should have respectively , a double - bit or single - bit error at its beginning ( bop ). third , all single - bit ( 450 ) and double - bit ( 460 ) errors occurring at the beginning of a packet , corresponding respectively to cases ( 330 ) and ( 340 ) of fig3 must have unique syndromes . however , they need not to be unique versus all the others ( first and second case above ) and even together since , as mentioned above , one remembers for one packet cycle that an error at the end of previous packet has occurred and the type of this error , single ( 441 ) or double ( 442 ). in other words , since single and double - bit errors , having unique syndromes , have occurred in the previous packet , double or single - bit errors respectively , at the beginning of the next packet are to be expected . thus , syndromes of such errors need not be unique . they only need to be unique per type ( single or double ). then , the set of syndromes must comply with what is shown in fig4 so as state diagram of fig5 hereafter can apply allowing correction after de - scrambling of all single - bit errors occurring during transmission of packets . the syndromes that do not fit must be considered uncorrectable errors . the corresponding packet should be flagged and / or discarded . fig5 is the state diagram of the method according to the invention . each time a packet is received a syndrome is computed ( 500 ). if different from the all - zero syndrome a correction must be attempted . a first step is to check if an error has been found at the end of previous packet ( 505 ). if not , the syndrome is further checked . if it corresponds to a triple - bit error ( 520 ) a correction can be performed ( 550 ). if the syndrome however belongs to the ones of a double - bit error at the end of a packet ( 515 ), this is remembered ( 530 ) for the processing of the next packet ( and only for next packet ). the syndrome may also match the ones of the end - of - packet single - bit errors ( 510 ) in which case this is remembered ( 525 ) as with the end - of - packet double bit error . in both cases a correction is performed ( 550 ). if , at step ( 505 ), a double - bit error or a single - bit error was found to have been corrected in the previous packet , then the current computed syndrome must be checked against respectively , the set of single - bit error syndromes ( 535 ) and the set of double - bit errors syndromes ( 540 ) that occur at the beginning of a packet ( bop ). if there is a match a correction can be performed ( 550 ). if none of the above match ( 545 ), the syndrome does not fit the model of errors . an uncorrectable error ( 555 ) is therefore detected . fig6 explains how an fec code can be derived that complies with the requirements discussed in previous figures , especially with fig4 . the invention is hereafter exemplified using the following code generator polynomial : g ( x )=( x + 1 ) ( x 10 + x 9 + x 7 + x 6 + x 4 + x 1 + 1 ). this type of polynomial , which is the product by ( x + 1 ) of a primitive irreducible polynomial , here of degree 10 , is known to produce a sec / ded ( single error correction / double error detection ) type of code . because of the multiplication by ( x + 1 ), vectors of the code are all odd - weight so that it is easy to split the syndromes in two disjoint sets . single bit error syndromes are odd while double bit error syndromes are all even . this property has been extensively used to implement what is referred to as an odd - weight extended hamming code . on this , and on error correction in general , one may refer for example to ‘ error - correcting codes for semiconductor memory applications : a state - of - the - art review ’, c . l . chen and m . y . hsiao , ibm journal of research and development , volume 28 , number 2 , march 1984 . a list of irreducible polynomials in a binary gf ( galois field ) of the kind corresponding to the right term of g ( x ), and much theory on the field of error correction , can be found in the book already cited above , i . e . in ‘ error - correcting codes ’, peterson & amp ; weldon , 2nd edition , the mit press , 1972 . the degree - 10 right polynomial chosen to illustrate the invention is listed , in appendix c of this book , in octal notation , as ‘ 3323 ’. the reason of the choice of this particular polynomial will become clear in the following description of the invention . from g ( x ) it is possible to form a finite group under multiplication of odd - weight vectors ( 600 ), ranked from 0 to 1022 and noted α 0 to α 1022 , comprising 2 10 − 1 or 1023 vectors , a number which corresponds to the degree of the right term of g ( x ). vectors at beginning and end of the multiplicative group plus some intermediate vectors are shown . as mentioned , they are all comprised of an odd number of ones . for the sake of readability , 0 &# 39 ; s are replaced by a dot (.) in the binary vectors shown . in this group , since it is a multiplicative group , the following holds : α x × α y = α x + y modulo 1023 . however , it is still possible to define an addition of three vectors ( even though this is not a field ) that always returns a vector of the group so that α x + α y + α z = α w . this is always true because group is made of all possible odd - weight vectors . adding three vectors together gives again an odd vector that belongs to the group . moreover , following holds too : α x + n + α y + n + α z + n = α w + n . as an example of this , one can easily verify from what is listed in ( 600 ) that α 0 + α 3 + α 5 = α 1012 and that α x1 + α 4 + α 6 = α 1013 and so on . hence , it is possible to compute the addition of the three group vectors that corresponds to the terms of the scrambler polynomial , namely 58 , 19 and 0 . adding α 58 + α 19 + α 0 gives α 166 and , α 58 + 856 + α 19 + 856 + α 0 + 856 + α 166 + 856 = α 1022 ( 610 ) the last vector of the group . therefore there are 1022 −( 166 − 1 ) i . e . : 857 successive combinations of triple - bit errors , spaced as scrambler polynomial powers , that give unique syndromes spanning from α 166 to α 1022 . the polynomial chosen has been selected to maximize the range of usable vectors . among all possibilities of primitive irreducible polynomials listed in peterson and weldon book mentioned previously , polynonial ‘ 3323 ’ ( in octal notation ) the right term of g ( x ) i . e . : x 10 + x 9 + x 7 + x 6 + x 4 + x 1 + 1 , is a good choice since it gives a low value for the addition of three vectors of the group spaced as 58 , 19 and 0 . choosing another polynomial gives a higher value for the addition of α 58 + α 19 + α 0 , reducing the range of possible unique combinations as this is further discussed . it is worth noting here that this results from the fact that all galois fields which can be generated with different primitive irreducible polynomials , are isomorphic in the mathematical sense of this term . that is , all fields of degree n contain all 2 n − 1 non - zero vectors . they just differ by the order in which these vectors appear in the field . the vector addition table thus varies greatly from one choice of polynomial to another . this behavior is carried over to the multiplicative group obtained after multiplication by x + 1 , resulting from the fact that there are better choices to obtain a large range of three - bit error combinations that have unique syndromes . the above requires that code generated with suggested polynomial g ( x )=( x + 1 ) ( x 10 + x 9 + x 7 + x 6 + x 4 + x 1 + 1 ) be shortened so combinations of three errors cannot return a vector greater than α 1022 for the reason that the next value would be α 0 ( since the group is a finite cyclic group ). indeed , the eop single - bit errors , i . e . ( 350 ) in fig3 , need to be unique according to the invention . as they are using the 39 starting vectors ( 620 ) of the multiplicative group they cannot be used by the three - bit error combinations . this is obtained by excluding the use of group vectors ( 630 ) beyond α 914 ( the 915th vector of the group ), i . e . the 857 three - bit error combinations + 58 , the degree of the polynomial . as far as the two - bit errors are concerned , the addition of two vectors of the group does not belong to the multiplicative group ( on the contrary of the addition of three vectors ). it returns an even - weight vector that neither belongs to the three - bit error syndromes nor to the single - bit error syndromes which exceeds the requirements discussed in fig4 . therefore , by limiting the code to the protection of packets of up to 915 bits it is possible to correct all errors , after scrambling , according to the method of fig5 . the impact of shortening the code to obtain this result is however minimized by choosing a polynomial where the sum of three vectors , spaced as in scrambler polynomial , i . e . 58 , 19 , and 0 , corresponds to a low displacement ( 610 ) in the multiplicative group so fewer vectors have to be excluded ( 630 ). fig7 is the list of syndromes corresponding to all error cases shown in fig3 , for polynomial of fig6 , assuming that packets to protect are up to 915 - bit long . the code can obviously be further shortened to adapt to any lower packet size as shown in fig8 here after . the single - bit and triple - bit error syndromes are listed according to their rank into the multiplicative group of fig6 . the left column ( 750 ) is the number of bits in error . the double - bit error syndromes ( 710 ) and ( 750 ) do not belong to the multiplicative group of fig6 . their ranks listed are taken out of the dual multiplicative group made of all even vectors ( not shown ). hence , ranks of double - bit errors cannot and need not be compared to the odd multiplicative group . however , double - bit errors at the beginning of packet ( 710 ) and double - bit errors at the end of packet , can be , and should be compared to each other , to check that they are unique allowing to unambiguously correct all double - bit errors . from the bop there are 19 single - bit errors ( 700 ). these errors correspond to case ( 340 ) of fig3 . they are followed by 39 double - bit errors corresponding to case ( 330 ) of fig3 . after which starts ( 760 ) all the shifts of triple - bit errors , a down sequence from rank 1022 to rank 166 ( 770 ). there are again 19 double - bit errors at the end of packet ( 720 ) corresponding to case ( 360 ). finally , there are 39 eop single - bit errors ( 730 ). eop single - bit errors ( 730 ), all triple - bit errors from ( 760 ) to ( 770 ) and double - bit errors ( 720 ) have unique syndromes and can be corrected directly . single - bit errors at the beginning of packet ( 700 ) are unique alone but have duplicates in the set of triple - bit errors which is permitted by the algorithm of fig5 . therefore , all errors resulting from a single - bit error during the transmission of 64b / 66b blocks can be corrected after de - scrambling . all syndromes of errors that do not fit in list of fig7 are uncorrectable errors . since , in this particular example , there are 2047 ( 2 11 − 1 ) possible non - zero syndrome combinations and 973 − 19 = 954 unique combinations used for the corrections ( the first 19 bop syndromes have all a duplicate in the set of triple - error syndromes ) the difference , 1093 combinations , may serve to detect directly uncorrectable errors according what is shown in fig5 ( 555 ). more uncorrectable errors are possibly detected by the algorithm of fig5 since , even though a syndrome matches one of the bop single and double error syndromes , a corresponding error must have been found in previous packet to allow a correction . if this is not the case an uncorrectable error is detected too . fig8 shows , as an example among numerous possibilities , an implementation of the invention . the choice of a particular implementation is highly dependent on the performance required and of the technology available . communications devices , for which the invention is devised , are generally implemented in high - speed asic &# 39 ; s ( application specific integrated circuits ) that may be comprised of millions of logic gates and latches . to achieve the necessary level of performance with a cost - performance , relatively slow , technology as cmos ( complementary metal oxide semiconductor ), logic designers tend to favor wide buses and parallel processing of information data . hence , the particular implementation of fig8 assumes that , e . g ., a 512 - bit wide packet ( 800 ) is checked with a large block of combinatorial logic implemented with exclusive or gates ( xor &# 39 ; s ) and shown here under the form of a matrix ( 810 ), the so - called h - matrix of the code , where 1 &# 39 ; s are xor inputs . the matrix corresponds to what is shown in fig6 , however further shortened , for illustrating the case of a typical 64 - byte packet . logic block ( 810 ) thus allows generation of an 11 - bit syndrome ( 820 ) which is decoded ( 830 ) to perform a correction if necessary . correction consists of inverting the bits found in error . input data , i . e . the whole packet which is applied ( 800 ) over the matrix that generates the syndrome ( 820 ), is also applied to the series of xor &# 39 ; s ( 840 ) to invert the bits found in error by the decode of the syndrome ( 830 ). as discussed previously eop errors must be remembered ( 850 ), for one packet cycle , so that the information can be used for the next packet for correction ( 860 ) when necessary . also , decoding the syndrome allows the finding of the uncorrectable errors ( 870 ). implementation is not further described since it uses techniques and methods well known from the art of logic design , especially the design of the asic &# 39 ; s used for communications devices . the generation of the eleven ecc bits on the transmit side is trivial . generation is equivalent to checking except that the eleven ecc bits ( 805 ) are set to 0 so that the matrix ( 810 ) returns the fcs ( instead of the syndrome ) to be inserted at the end of the message as shown in fig3 before it is forwarded . again , all of these are standard practices well known from the art . finally , those skilled in the art will recognize that , although the invention is described for the particular case of the 10 gbe scrambler it is straightforward to adapt it to all other primitive scrambler polynomials . a list of such primitive polynomials , up to degree 300 , can be found in ‘ built - in test for vlsi , pseudorandom techniques ’, paul h . bardell and al ., john wiley & amp ; sons , 1987 . it must also be understood that the choice of a code to correct the errors after scrambling can be different from the one suggested while still practicing the invention . especially , if longer or shorter packets must be protected , different polynomial may be chosen so as to adapt the number of necessary redundant bits to a particular application of the invention . also , the particular implementation of fig8 does not preclude a completely different approach . because the invention only requires that code be shortened , generation and checking can still be performed cyclically , with a state machine , that would compute fcs and syndrome n - bit or n - byte at a time instead of using a single combinatorial block of logic . while the invention has been particularly shown and described with references to an embodiment , it will be understood by those skilled in the art that various changes in both form and detail may be made therein without departing from the scope and spirit of the invention . having thus described our invention , what we claim is as follows : | 7 |
referring now more specifically to the drawings , and to fig1 in particular , a web slitting machine designated as a whole by numeral 100 draws a wide paper web 10 from a roll 1 and leads the web via guide rollers 2 , 3 , a spreader roll 4 , two further guide rollers 5 , 6 and a further spreader roller 7 to and through a cutting station which is designated as a whole by 20 . the cutting station includes two guide rollers 8 , 9 which are disposed one above the other and between which , for each longitudinal cut , a pair consisting of a lower blade 21 and a pivotally mounted upper blade 22 is disposed . the sub - webs created by the longitudinal cutting are conducted jointly between a guide roller 11 and a pressure roller 12 , and are divided above rollers 11 and 12 in that a sub - web or narrower web 10 &# 39 ; is conducted to the left support roller 13 in fig1 and the adjacent narrower sub - web 10 &# 34 ; is conducted to the support roller 14 , which is disposed on the right in fig1 at the same level as the support roller 13 . the sub - web 10 &# 39 ; following the sub - web 10 &# 34 ; as viewed perpendicularly to the plane of the drawing , is again conducted to the left support roller 13 , and the then again following sub - web 10 &# 34 ; to the right support roller and so on . thus , adjacent sub - webs 10 &# 39 ;, 10 &# 34 ; are always conducted to different support rollers 13 , 14 . the sub - webs 10 &# 39 ; and 10 &# 34 ;, which are partially wrapped around the support rollers 13 and 14 , which are constructed as suction rollers and can firmly hold the sub - webs 10 &# 39 ; and 10 &# 34 ;, are wound onto the winding tubes or cores 15 which bear at the top of the support rollers 13 , 14 . the winding tubes or cores correspond in their length to the width of the sub - webs 10 &# 39 ;, 10 &# 34 ; and are held at their ends by clamping means which are not shown in fig1 and which are arranged on support arms 16 and 17 which engage from the outside over the support rollers 13 , 14 and are mounted in pairs on carriages 18 , 19 which are displaceable transversely of the web 10 . the support arms 16 , 17 are pivotal about axes 24 , 25 mounted parallel to the axes of the support rollers 13 , 14 on the carriages 18 , 19 to deposit finished sub - rolls 26 , 26 &# 39 ; and 27 , 27 &# 39 ; respectively , which may have very different diameters , on the tables 28 and 29 respectively , from where they are removed . while the sub - webs 10 &# 39 ;, 10 &# 34 ; are wound onto the winding tubes or cores 15 to form sub - rolls rolling on the support rollers 13 , 14 , pressure roller pairs 32 mounted on roller cranks 31 pivotal about transverse axes 34 bear on the sub - rolls from above and ensure the formation of firm and uniform rolls . the roller cranks or oscillating arms 31 are pivotable by means of the linear actuators 33 which are constructed for example as pneumatic cylinders , and which , on the one hand , pivot the roller cranks 31 to an inoperative position 31 &# 39 ; indicated in dashed line in fig1 and , on the other hand , can press the pressure roller pairs 32 with a predetermined force onto the forming rolls during the winding operation . just like the support arms 16 and 17 , the roller cranks 31 are pivoted corresponding to the increasing roll diameter . whereas the cutting station 20 is disposed beneath the support rollers 13 , 14 and the material web 10 or the sub - webs 10 &# 39 ;, 10 &# 34 ; are brought up to the support rollers 13 , 14 from below , the winding tubes or roll cores 15 are supplied by a supply apparatus which is arranged above the support rollers 13 , 14 and is designated as a whole by numeral 60 . the core supply apparatus includes a core receiver 30 for the winding tubes or cores , a transfer mechanism 40 and a guide device 50 , which will be described in detail with reference to fig3 to 10 . the core supply apparatus 60 is arranged beneath a box girder or beam 80 which extends in the center above the support rollers 13 , 14 transversely over the web and includes guide rails 81 , 82 which also carry the roller cranks or oscillating arms 31 with the linear actuators 33 . as apparent from the side view of fig2 associated with each sub - web 10 &# 39 ;, 10 &# 34 ; is its own take - up unit which , depending on the position of the sub - webs 10 &# 39 ;, 10 &# 34 ;, is displaceable in the transverse direction , i . e . along the box beam 80 . the take - up unit for the sub - web 10 &# 34 ; illustrated on the left in fig2 includes the roller crank 31 which , like the linear actuator 33 , is mounted pivotally about transverse axes on a carriage 35 displaceable along the guide rails 81 , 82 of the box beam 80 . at the free end of the roller cranks 31 , the pairs of pressure rollers 32 are mounted in roller rockers 36 which are pivotal about a transverse axis with respect to the roller crank 31 by means of a linear actuator 37 . associated with the arrangement described above is a pair of support arms 17 which include , at the free ends , clamping means 38 which engage into the winding tube or core 15 from the ends . the sub - rolls 39 &# 39 ; and 39 &# 34 ; forming from the sub - webs 10 &# 39 ; and 10 &# 34 ; roll on the surface of the support rollers 13 and 14 respectively , being guided by the clamping means 38 , with pressure being applied by the pressure rollers 32 engaging from above . the sub - rolls 39 &# 39 ; run on the support roller 13 and the sub - rolls 39 &# 34 ; on the support roller 14 with the winding axes a and b . the separating points 41 correspond to the position of the longitudinal cuts formed by the blades 21 and 22 . the purpose of the different winding axes a and b is apparent from fig2 . although the sub - rolls 39 &# 39 ;, 39 &# 34 ; adjoin each other at the edges , there is room for the support arms 17 , 17 with the clamping means 38 , 38 to be able to engage from both sides from the outside . the position of the separating points 41 may change , depending on the number and width of the sub - webs 10 &# 39 ;, 10 &# 34 ; into which the wide web 10 is to be divided . the sub - webs 10 &# 39 ;, 10 &# 34 ; need not all have the same width during one slitting operation . depending on the position of the separating points 41 or of the sub - webs 10 &# 39 ;, 10 &# 34 ; the cores and support arms for the individual sub - webs 10 &# 39 ;, 10 &# 34 ; are displaced in the transverse direction of the web or in the longitudinal direction of the box beam 80 , the carriages 35 being positioned such that they are arranged in the center between the associated support arm pair . according to fig3 the core receiver 30 includes a tubular tube or roll core magazine 42 which consists of two troughs or shells 43 which are curved longitudinally and face each other . the shells are mounted pivotally about transverse shafts 44 at their upper edges , and can be pivoted out of the closed position shown in fig3 into the open position shown in fig5 by the operation of linear actuators 45 . a set of winding tubes or cores 15 can be introduced end - to - end into the tubular magazine 42 from the side , i . e . parallel to the axes of the support rollers 13 and 14 . the lengths of the winding tubes correspond to the widths of the respective sub - webs 10 &# 39 ;, 10 &# 34 ; to be wound thereon , the tubes being arranged one behind the other and inserted in such a manner that , in the fully inserted state , the separating points between the individual winding tubes or cores 15 are located at the level of the separating points 41 ( fig2 ) of the sub - webs 10 &# 39 ;, 10 &# 34 ;. thus , for each winding operation in each case , only one set of winding tubes 15 is inserted into the machine . changing to a different cutting program requires simply making ready correspondingly cut winding tubes 15 outside the machine and inserting the new set , while also displacing the carriages 35 and the support arm pairs 17 , 17 accordingly . to distribute the winding tubes 15 supplied to one point , i . e . in the receiver 30 , coaxially in series among the two winding axes a , b ( fig9 ) the transfer mechanism 40 and the guide device 50 are used . the transfer mechanism 40 is arranged directly beneath the receiver 30 , and includes shell - shaped or stirrup - shaped , upwardly open transfer elements 46 , 47 , each associated with a single sub - web 10 &# 39 ; or 10 &# 34 ;. the transfer elements 46 are associated with the support roller 13 and at their left edge as shown in fig3 are pivotal about a transverse shaft 48 which is disposed on the left beneath the tubular magazine 42 . beginning from the transverse shaft 48 , the transfer elements 46 extend beneath the tubular magazine 42 up to and beyond the center thereof . similarly , the transfer elements 47 are associated with the support roller 14 , and are pivotal about a transverse shaft 49 disposed on the right beneath the tubular magazine 42 . the transfer elements 47 extend from the shaft 49 beneath the tubular magazine 42 and up to and beyond the center of the tubular magazine . the pivoting of the transfer elements 46 , 47 is controlled by linear actuators 51 mounted on the carriages 35 . by corresponding actuation of the linear actuators 51 , the transfer elements 46 , 47 can be opened beyond the position of fig6 into the position of fig7 . provided beneath the transfer mechanism 40 is a guide device 50 , which consists of an inverted &# 34 ; v &# 34 ; or roof - shaped carrier 52 which extends just above the support rollers 13 , 14 over the entire width of the machine . the roof - shaped carrier 52 has a crosssection of substantially the shape of an upright equilateral triangle , the tip 53 forming the ridge of the &# 34 ; roof &# 34 ; being disposed in the center beneath the tubular magazine 42 . angle stops 56 , pivotal about a transverse shaft 54 by means of linear actuators 55 are provided at each side of the carrier 52 , and have one leg for continuing downwardly sloping surfaces 57 of the carrier 52 , and another leg projecting upwardly perpendicularly to the first leg . in fig3 a working phase is shown in which the preceding winding operation has just been completed . the finished sub - rolls 39 &# 39 ;, 39 &# 34 ; are deposited on the tables 28 , 29 ( see fig1 ), which are not shown in fig3 . the roller cranks 31 are pivoted upwardly , and the roller rockers 36 with the pressure rollers 32 are retracted into the position shown . a new set of winding tubes 15 is inserted into the tubular magazine 42 . in the working phase shown in fig4 the sub - rolls 39 &# 39 ;, 39 &# 34 ; have already been deposited on the tables , and the support arms 16 and 17 , which are indicated only by their center lines , have been pivoted back into the vicinity of the support rollers 13 and 14 , and are ready for clamping the new cores . the carriages 35 , with the roller cranks 31 and the pressure rollers 32 , are positioned on the center of the respective sub - webs 10 &# 39 ;, 10 &# 34 ;. the roller cranks 31 are pivoted downwardly so that the pressure rollers 32 are disposed in the vicinity of the support rollers 13 and 14 . the roller rockers are pivoted so that the plane formed by the axes of the respective pressure roller pair extends substantially parallel to the longitudinal extent of the roller cranks 31 . in the working phase shown in fig5 the distribution of the winding tubes 15 has been initiated . by actuating the linear actuators 45 the shells 43 forming the tubular magazine 42 have been opened by pivoting about the transverse axes 44 , and the winding tubes 15 have dropped out downwardly . the free ends 46 &# 39 ; and 47 &# 39 ; of the transfer elements 46 and 47 , extending beyond the center of the tubular magazine 42 , catch the respective winding tubes as the winding tubes fall from the tubular magazine . due to the curvature of the transfer elements , the winding tubes roll from the center outwardly along the transfer element , the separation of the winding tubes 15 into the groups intended for the two support rollers 13 , 14 thus being initiated . the winding tubes 15 &# 39 ; intended for the support roller 13 move along the transfer elements 46 to the left side , according to fig5 of the apex or ridge 53 of the guide device 50 , and the winding tubes 15 &# 34 ; intended for the support roller 14 move along the transfer elements 47 to the right side of the apex or ridge 53 . the respective winding tubes are in stable equilibrium in the curvature of the transfer elements 46 , 47 . in the working phase shown in fig6 the transfer elements 46 and 47 have started their outward pivotal movement while still holding the winding tubes 15 &# 39 ;, 15 &# 34 ;, the separation of which can be clearly seen in fig6 . in the working phase shown in fig7 the transfer elements 46 , 47 have continued their outward pivotal movement to the end position and have tipped the winding tubes 15 &# 39 ;, 15 &# 34 ; onto the downwardly sloping surfaces 57 of the roof - shaped carrier 52 . the tubes immediately roll downwardly over the surfaces 57 in the manner indicated in dot - dash lines until the tubes are stopped at the angular stops 56 , just above the support rollers 13 , 14 . in the working phase according to fig8 the angular supports 56 have been pivoted by the linear actuators 55 outwardly , and have tipped the winding tubes 15 &# 39 ;, 15 &# 34 ; onto the support rollers 13 , 14 whereupon the winding tubes move over the surface of the support rollers 13 or 14 until they come to bear on a further stop 58 which is disposed at the outer end of the roller rockers 36 and formed by a rod , or the like , extending in the transverse direction , and which is arranged beneath the pressure rollers 32 , 32 . the roller cranks 32 , since the working phase of fig4 have retained their position which , as apparent in particular from fig8 is such that it does not obstruct the rolling of the winding tubes 15 &# 39 ;, 15 &# 34 ; over the angular stops 56 and the upper side of the support rollers 13 , 14 but nevertheless permits the defined retaining of the winding tubes 15 &# 39 ;, 15 &# 34 ; by the further stops 58 beneath the outer pressure roller 32 . in the position shown in fig8 the winding tubes 15 &# 39 ;, 15 &# 34 ; are gripped by the clamping means 38 disposed at the ends of the support arms 17 ( fig2 ). the shells 43 forming the tubular magazine 42 have meanwhile again been pivoted together , in readiness to receive a new set of cores or tubes 15 . the transfer elements 46 , 47 are still in the open position . in the working phase shown in fig9 the start of the winding operation is shown . the ends of the sub - webs 10 &# 39 ;, 10 &# 34 ; have been secured to the associated winding tubes 15 &# 39 ;, 15 &# 34 ;. the roller rockers 36 have been pivoted with respect to the roller cranks 31 in such a manner that the two pressure rollers 32 bear from above on the respective winding tubes 15 &# 39 ;, 15 &# 34 ; so that the tubes are satisfactorily entrained by friction at the support rollers 13 , 14 , and , in addition , support is provided against sagging caused by the web tension between the clamping means . since the roller rockers 36 experience torque acting differently with regard to the linear actuators effecting the pivoting thereof , in the right linear actuator 59 in fig1 the piston 59 &# 39 ; and in the left linear actuator 59 , the piston 59 &# 34 ; must be activated . the support rollers 13 and 14 , the winding tubes 15 &# 39 ; and 15 &# 34 ; driven thereby and the pressure rollers 32 start moving at the beginning of the winding operation in the direction of rotation indicated by the arrows in fig9 . in the working phase according to fig1 , the sub - rolls 39 &# 39 ;, 39 &# 34 ; are already partially formed on the winding tubes 15 &# 39 ;, 15 &# 34 ;. with increasing winding diameter of the sub - rolls 39 &# 39 ;, 39 &# 34 ; the support arms 17 move upwardly , the winding tubes 15 &# 39 ;, 15 &# 34 ; and the instantaneous winding axes a and b formed by their axes moving along the circular arc indicated by numeral 61 . the roller cranks 31 are likewise pivoted upwardly . the roller rockers 36 adapt themselves in their orientation to the roller cranks 31 so that both pressure rollers 31 always bear on the sub - rolls 39 &# 39 ;, 39 &# 34 ;. the winding is continued until the sub - rolls 39 &# 39 ;, 39 &# 34 ; have reached the desired diameter . in the meantime , a new set of winding tubes 15 is inserted into the tubular magazine , and the transfer elements 46 , 47 are pivoted back into the starting position shown in fig3 beneath the tubular magazine 42 . the starting situation corresponding to fig3 is thus again reached . in fig1 and 12 , an alternative embodiment is shown in which , instead of the two support rollers 13 and 14 , a single support roller 63 of correspondingly larger diameter is present , on which winding is carried out at two locations . the receiver 30 is constructed differently from the embodiment according to fig3 to 10 . in this embodiment , a guide device 50 is also not required . the function thereof is performed by the upper side of the single support roller 63 . with regard to the transfer elements 46 , 47 , the roller cranks 31 and the parts mounted thereon , as well as the carriages 35 and the entire function cycle , the embodiment according to fig1 and 12 corresponds to the previous embodiment . the receiver 30 &# 39 ; includes downwardly slit bearing rings 65 which are mounted on vertical supports 64 on the lower side of the box beam 80 . the slot of the bearing rings 65 is defined by two parallel walls 66 which are spaced apart a distance which is slightly greater than the outer diameter of the winding tubes 15 . several such bearing rings 65 are distributed over the width of the web . in the bearing rings 65 a matching magazine tube 67 is rotatably mounted which extends continuously over the width of the web and which is longitudinally slit , the longitudinal slot 69 having parallel walls 68 spaced apart corresponding to the spacing of the walls 66 . the walls 68 lead tangentially up to the inner periphery of the magazine tube 67 , the inner diameter of which corresponds to the outer diameter of the winding tubes 15 . the magazine tube 67 is pivotal about its longitudinal axis through at least about 90 ° by a drive which is not shown . with large supply roll widths , the magazine 67 may also be divided in the center or at several locations along its length , and provided with pivot drives at each section thereof . the winding tubes 15 are inserted lengthwise consecutively from one side of the roll cutting machine into the magazine tube 67 , which is then in the position shown in fig1 , in which the slot 69 defined by the walls 68 is directed to the right and against the inner periphery of the bearing rings 65 . the winding tubes 15 thus cannot fall out of the receiver 30 &# 39 ; forming a tubular magazine . the working phase of fig1 generally corresponds to that shown in fig4 for the previous embodiment . in fig1 , working phases are shown which correspond to those of fig5 and 7 . to discharge the winding tubes 15 from the tubular magazine 42 &# 39 ;, the magazine tube 67 is rotated from the position according to fig1 through 90 ° clockwise so that the slot 69 points downwardly , and the walls 68 of the slot in magazine tube 67 align with the walls 66 of the slot of the bearing rings 65 . the winding tubes 15 then drop out of the magazine tube 67 downwardly into the ready - to - receive transfer elements 46 , 47 which engage beneath the tubular magazine 42 &# 39 ; and which are shown in full line in fig1 in this position . this phase corresponds to fig5 . thereafter , the transfer elements 46 , 47 are moved by the linear actuators 45 through an intermediate position in which the separation of the winding tubes 15 &# 39 ;, 15 &# 34 ; belonging to the two winding axes has already been completed , into a final position shown in dot - dash line in which the winding tubes 15 &# 39 ; and 15 &# 34 ; roll down over the upper side of the support roller 63 along both sides , until the winding tubes come to bear on the further stops 58 at the outer side of the roller rockers 36 . this corresponds to the phase according to fig7 . the initial winding then takes place in the manner described for the previous embodiment . the magazine tube 67 is then returned to the position shown in fig1 in which the slot defined by the walls 68 points to the right , so that when the new set of winding tubes 15 is inserted the tubes cannot prematurely drop out downwardly . the embodiment of fig1 and 12 is somewhat simpler in construction and stability than that of fig3 to 10 because the receiver 30 &# 39 ; encloses only the rotatable magazine tube 68 . this embodiment is also more compact because the guide device 50 is replaced by the upper side of the single support roller 63 , and is therefore no longer necessary . if , however , the embodiment according to fig1 and 12 is used in a winder having two support rollers , then a guide means 50 will normally be required because the released winding tubes may otherwise drop between the two support rollers . while several embodiments of a core loading mechanism for web cutting machines have been shown and described in detail herein various other changes and modifications may be made without departing from the scope of the present invention . | 1 |
the pole top light 10 for flagpoles shown in fig1 comprises an aerodynamic housing 11 facing downward with an umbrella like illumination 15 a projecting through a transparent cover 15 upon a flag illumination zone 15 b shown in broken lines . zone 15 b is representative of a flag or pennant fixed at a top corner of a vertical edge at or near flange 22 by way of a closeable clip or carribeaner clip passing through opening 23 and a grommet at said corner and then also releasably and rotatably fixed at a lower corner of the same flag edge to the flagpole 24 . flange 22 laterally extends from rotatable band 21 , which is supported from cylindrical band 24 a and rotatably engages the top of flagpole 24 . metal loop 16 a provides rotating inducing connection between flange 22 and rotation connector 16 extending downward from cover 15 . when a flag in zone 15 b is made to rotate to another of diverse radial angles from a flagpole axis than that shown in fig1 , housing 11 is drawn by its connection to flange 22 in path 25 so that it maintains its illumination 15 a over a flag in zone 15 b at all times . housing 11 comprises an axial end 14 arranged to be supported from an exposed portion of a support bolt extending downward from decorative sphere 17 through axial end 14 , threaded through nut 19 , and finally secured by threaded connection to pole top adapter 20 , which is insertable into an open end flagpole 24 , which supports rotatable band 21 . housing 11 also comprises a lateral extension end 12 , an upper surface 13 of which bears a substantial solar panel which will absorb the sun &# 39 ; s radiation and convert it to electrical power stored in batteries within housing 11 . in the side view of fig1 , a vertical thickness of housing 11 and cover 15 is between 1 . 00 to 2 . 50 inches , and more preferably between 1 . 25 and 1 . 75 inches . peripherally , housing 11 is substantially arcuately sloped from a lowest outer edge upward to upper surface 13 to achieve substantially unobstructed air flow from above or from any side of housing 11 , forcing such air flow over an upper side of the solar panel and cleaning and scouring its surface of radiation blocking dirt or deposits . locating said solar panel at an elevation typical of a flagpole and having such an arcuately sloped peripheral edge takes advantage of the stronger winds and precipitation to keep the invention pole top light functioning longer to absorb solar radiation at relatively full strength with a self - cleaning solar panel . fig2 shows additional detail of each normally separable part of the invention pole top light 10 , where sphere 17 further comprises a bolt top 26 and a threaded bolt end 27 and a top rotation fitting 18 comprises an upper water tight seal 28 and first lower section 29 extending down from seal 28 with a cylindrical diameter greater than that of second lower section 30 . a bottom rotation fitting 31 comprises a larger diameter section 33 from which extends upward a cylindrical section 32 of the same diameter as that of section 30 of top rotation fitting 18 . a nut 19 is adapted to be threaded to the end of bolt end 27 after it passes sequentially through top rotation fitting 18 , axial end 14 of housing 11 , and bottom rotation fitting 31 , whereafter nut 19 is threaded sufficiently upward on bolt end 27 so that top rotation fitting 18 and bottom rotation fitting 31 compress respectively top and bottom edges of an inner race of a bearing secured within axial end 14 with sufficient threaded length extending from a bottom side of nut 19 to be threaded into adapter 20 to support the entire assembly above it . adapter 20 comprises a top end 34 defining a threaded bolt hole , a flange skirt 35 extending out from top end 34 to support the entire assembly above it from rotatable band 21 , and a cylindrical insert 36 extending down from skirt 35 , which firmly engages inside cylindrical walls of a top end of flagpole 24 . a rotatable cap in the present specific example comprising a simple cylindrical band 24 a fixed at just below a top of flagpole 24 which supports the rotatable band 21 from which laterally extends flange 22 . rotatable band 21 rotates about flagpole 24 when wind causes a flag attached to flange 22 to be drawn in a different radial direction . such firm engagement supports the entire superior assembly for long term use for the objects of the invention . fig3 shows side cross sections of top rotation fitting 18 ( with smooth bore 37 ), housing 11 , bottom rotation fitting 31 ( with smooth bore for receiving bolt end 27 ), nut 19 ( with a threaded bore ), and adapter 20 ( with threaded bore 53 for receiving bolt end 27 support the entire structure above adapter 20 ). referring now to the cross section of housing 11 , top surface 13 is seen to define an impression in which solar panel 38 is secured , preferably by gluing or other long lasting adhesive means . housing 11 is preferably formed from aluminum or other corrosion and erosion resistant materials and forms a substantial downward facing cavity 11 a , which is sealingly covered with a transparent cover 15 and comprises connector 16 with bore 16 a . cover 15 further comprises openings for passage of screws 48 through aligned holes in a reflective shield 45 , which is about the same size as cover 15 , and allows screws 48 to be threaded into screw extensions 44 , thereby securing cover 15 to shield 45 , and both secured to the underside of housing 11 . cover 15 is curved downward from a flat reflective shield 45 ( preferably comprising a thin metal sheet ) to accommodate extension through shield 45 of 10 light emitting diodes 47 from circuit board 46 b to a bottom side of shield 45 so that a mirrored and / or reflective underside of shield 45 causes lighted led &# 39 ; s 47 to provide the umbrella of light according to the objects of the invention . an object of the invention is to provide for a rotatable poletop light having instantly replacable parts . the device of fig3 provides for a microprocessor circuit board 46 to be glued or releasably attached to an inside ceiling of housing 11 . microprocessor 46 comprises a microprocessor and circuitry required for operation of the invention device , such that batteries 50 ( preferably 3 metal hydride type batteries secured in battery pack 50 , which is attached by screws to housing 11 ), led &# 39 ; s 47 , and solar panel 38 all comprise removable plug connections 46 a to circuit board 46 , allowing for quick and inexpensive replacement of any of those components , including circuit boards 46 and 46 b . the electrical components have been designed for separable replacement according to an optimization of cost and replacement times . referring now to axial end 14 of housing 11 of fig3 , a downwardly open cylindrical bearing holder 43 maintains therein a cylindrical bearing 41 by way of nut 19 threading to bolt end 27 to compress a lower edge of section 29 of top rotation fitting 18 onto a top edge of an inner race 42 while an upward facing edge of section 33 of bottom rotation fitting compresses upon a bottom edge of inner race 42 , with sections 30 and 32 providing intervening support for bearing 41 from bolt end 27 as it passes through to engage nut 19 and adapter 20 . a weather and water tight seal is formed when a lower surface of the decorative sphere 17 is impressed upon a top portion of section 28 of top rotation fitting 18 and a skirt underside of section 28 is impressed into a receiving cylindrical impression defined by rim 39 at the top surface of axial end 14 . opening 40 defined in the axial end 14 provides for passage of section 29 into said axial end 14 . referring again to fig3 , it will be appreciated that assembly of the components results in the device shown in fig1 , whereby , as shown in fig5 and 6 , ring 16 a connects connector 16 extending from cover 15 to flange 22 of rotatable band 21 . thus , the assembly of the decorative sphere and housing 11 and its integral components ( including cover 15 ) are effectively made rotatable upon any rotation of rotatable band 21 via flag 56 ( a top vertical corner being shown and being attached via carribeaner clip 55 to flange 22 ) being rotated about a vertical axis of flagpole 24 , resulting in flag 56 being illuminated by lighting provided according to the objects of the invention . further describing adapter 20 , a threaded bolt hole 53 is defined in flange skirt 35 , which extends out from an upper periphery of cylindrical insert 36 , which , upon insertion into an open top end of flagpole 24 , engages its inside cylindrical walls 24 c . a rotatable cap in the present specific example comprising the simple cylindrical band 24 a fixed at just below a top of flagpole 24 which supports the rotatable band 21 ( which may also include a plastic cylindrical sleeve 21 a to reduce friction between an outside surface of flagpole 24 and an inside surface of rotatable band 21 ) from which laterally extends flange 22 . a broken away section shows an exemplary lower flag rotatable band 21 b with sleeve 21 c and lateral flange 22 a , which is supported on flagpole 24 by way of attachment to a lower corner of an attached flag , providing rotational attachment for that lower corner in cooperating with rotatable band 21 . referring again to fig3 , circuit board 46 comprises a microprocessor operating by way of a control program to provide for solar panel charging of batteries and turning led &# 39 ; s on and off . an input to the microprocessor is compared with a pre - set limit of ambient illumination led &# 39 ; s 47 turn on when ambient illumination is below a pre - set level , such as at nighttime , and turning led &# 39 ; s 47 off at times of high ambient illumination . said input may comprise either of falling of solar panel charging below a pre - set level ( indicating reduction in ambient light ) or from input from an light sensor ( not shown ). said microprocessor also provides means for charging batteries 51 via input from solar panel 13 and for powering led &# 39 ; s 47 from said batteries 51 . circuit board 46 is releasably attached to housing 11 for easy removal and replacement . batteries 51 are also easily replaced , as is cover 15 , shield 45 , bearing 41 , and solar panel 38 . failure of any component of the invention light requires only quick replacement of a low cost component , not the rest of housing 11 and its integral components and parts . the invention light is provided with means for inexpensive and quick replacement for any failed component . fig4 shows housing 11 and cover 15 separated with screws 48 with drawn from their securing positions . led &# 39 ; s 47 are shown in a u - shaped pattern extending through reflective shield 45 , which is raised to battery pack 50 , bottom rotation fitting 31 and bearing 41 in axial end 14 . a peripheral edge 55 seals to an inside surface of housing 11 when assembled , whereby opening 54 provides for passage of bottom rotation fitting therethrough for assembly as well . screws 48 a are provided to attach shield 45 to housing 11 . fig7 shows housing 11 with its cover and shield removed , with a slight inward extension 53 to accommodate definition of a recess for solar panel 38 ( as shown in fig8 ). battery pack 50 is adapted to provide an on - off switch 52 for turning electrical battery power on and off for the circuitry . bearing holder 43 is shown as having an inner cylindrical diameter just larger than an outside diameter of bearing 41 , allowing housing 11 and its other integral components to rotate about a flagpole axis either entirely upon a compressed inner race of bearing 41 or in combination with contact of housing 11 through holder 43 with the outer race of bearing 41 . such distribution of rotational forces extends the life of bearing 41 , which is critical in a difficult to reach installation location as the top of a flagpole . a further object of the invention is to provide a laterally extending and rotatable poletop light for flagpoles where a center of gravity of the light assembly is within about 4 inches of an axial rotation connection with the flagpole . forming the housing of aluminum and locating the battery pack adjacent to a rotation bearing results in an unloading of force on said bearing , whereby the center of gravity of the entire assembly is close to the battery pack . preferred dimensions for the invention housing and integral cover attached are a lateral extending length of from 8 to 15 inches , and more preferably from 10 to 12 inches , a widest width at the lateral extension end 12 of from 3 to 6 inches , and more preferably from 4 to 5 inches , and a depth as described above . the above design options will sometimes present the skilled designer with considerable and wide ranges from which to choose appropriate apparatus and method modifications for the above examples . however , the objects of the present invention will still be obtained by that skilled designer applying such design options in an appropriate manner . | 5 |
referring to fig1 the illustrated mask 1 is made from one or more layers of flexible sheet filter material cut from a blank , folded and welded to form a cup - shaped structure to be worn over the nose and mouth of the user . it is in particular shaped in accordance with the invention in gb - 2046102 , to which reference is directed for a fuller description of the method of forming the mask from a flat blank . in use the peripheral edge of the mask forms a seal against the wearer &# 39 ; s face and it is held in place by elastic headbands 2 and a deformable wire nose clip 3 as well known in the art . at a suitable location in the side wall of the mask 1 an aperture is formed in which an exhalation valve 4 is fitted , the structure of which is more clearly illustrated in fig2 to 5 . the illustrated valve 4 comprises two interfitting moulded plastics housing members 5 and 6 , and an elastomeric flap 7 which in the assembled valve is trapped at one end between the housing members . the upper housing member 5 as viewed in fig2 is also seen from its opposite face in fig3 . it has inlet ports 8 passing through it which on the downstream side are surrounded by a seal ridge 9 a / 9 b / 9 c of generally trapezial planform . the lower housing member 6 as viewed in fig2 is of dished form with a series of outlet ports 10 , and snaps onto the member 5 by means of a pair of integral lateral lugs 11 engaging in slots 12 formed in member 5 . the flap 7 is of generally trapezial planform sized to fit over the seal ridge and is formed from a thin and highly flexible piece of elastomer , e . g . 0 . 5 mm thick latex natural rubber having a shore micro hardness of about 30 . the flap 7 is positioned in the valve by a notch 13 at one end embracing a block 14 on housing member 5 , and when the housing members are snapped together that end of the flap becomes trapped between the adjacent portion 9 a of the seal ridge and a profiled block 15 upstanding from housing member 6 . that is to say it is mounted in the valve in cantilever fashion . in its natural state , if the flap 7 is held horizontally at one end it will tend to bow longitudinally under the force of gravity , i . e . so that its opposite end droops down considerably from the plane of its fixed end . both the block 15 and the facing portion 9 a of seal ridge are , however , curved so as to impart to the flap a transversely arched configuration in the assembled valve , as seen particularly in fig4 and 5 . in the illustrated embodiment this arching is accentuated for the central part of the flap by means of a second profiled block 16 upstanding from the housing member 6 in front of and to a slightly greater height than the block 15 , although this is not essential in all embodiments of the invention . the arching of the flap stiffens it sufficiently to prevent it drooping away from any part of the seal ridge under zero pressure differential conditions , whatever the orientation of the valve . the preferred orientation of the valve is in fact with the outlet ports 10 directed with a downward component , as indicated in fig1 so that the user &# 39 ; s exhalate will not mist any associated eyewear , and if the user lowers his head the valve may become oriented with the flap 7 lying wholly below the housing member 5 . in use , therefore , the flap 7 seats upon the seal ridge to prevent the passage of any air into the mask through the valve 4 while the user is not exhaling . at the commencement of exhalation , as soon as a minimum “ cracking ” pressure differential is applied to the flap 7 from the interior of the mask the free end of the flap will lift away from the seal ridge in the sense of the arrow x in fig4 and flexure of the flap will progress rapidly along its length towards the fixed ( root ) end , to a position determined by the instantaneous rate of flow of exhalate out through ports 8 and 10 . when exhalation ceases , the restorative effect of the arched mounting of the flap will cause the flap as a whole rapidly to reseat upon the seal ridge , to minimise the risk of any inward leakage of contaminant through the valve in the period between the end of exhalation and the commencement of inhalation . in particular , the flap 7 does not depend for its closure upon the subsequent application of an inhalatory pressure differential . from fig3 it will be seen that while the portion 9 a of the seal ridge at the root end of the flap has a concave curvature the remainder 9 b / 9 c of the ridge has a flat surface . from fig3 and 4 it will also be seen that the portion 9 c of the seal ridge at the free end of the flap rises further from the plane of the member 5 than does the root end portion 9 a , and the two side portions 9 b are straight but inclined as viewed in elevation . the combined effect of this configuration is that the transverse curvature of the flap 7 decreases towards its free end , which lies flat against seal ridge portion 9 c , while a degree of longitudinal curvature is also imparted to the central section of the flap ( but not to its side edges which lie flat against the ridge portions 9 b ). this has been found to enhance the stability of the flap in its closed condition while minimising the opening pressure differential for the particular embodiment illustrated . in other embodiments , however , there may be no longitudinal curvature of the flap and / or its transverse curvature may extend throughout its whole length , in the latter case the seal ridge portion 9 c being modified to a concave form as indicated in broken line in fig3 . | 5 |
the invention consists of a system for flame detection and analysis typically of gas and fuel oil , using optical devices , typically photo detectors or cameras , located in the rear part of a furnace or in locations where they can target the flame reaction zone . the optical signals are transmitted to processing and control module , typically a computer system , that uses specific algorithms to process the optical signals , generating indicators to diagnose the combustion quality and to optimize equipment operation in terms of its efficiency and polluting emissions . this flame detection and analysis system can be used as an autonomous system to diagnose industrial equipment or as part of a combustion control system in existing burners , boilers or industrial furnaces . in the second option , air control can be decoupled from the fuel control system , which is novel compared to traditional control schemes . for this reason , the system includes a control strategy that interacts with typical control equipment , optimizing the use of combustion air . a ) a sensor ( photo detectors or cameras ) that it is targeted by an optical path towards the flame reaction zone ; b ) a processing and control module ; c ) an actuator , to manipulate the air flow . the system constantly seeks to maintain the equipment operating at maximum , and preferably ideal , performance with the lowest levels of pollutant emissions . the photo detectors ( photodiodes or radiometer ) use the spectral information from the flames to generate a control index for optimizing the combustion process . using emissions of the free radicals ch and c2 , centered at 432 and 516 nm respectively , a control strategy based on the ratio between the c2 / ch can be established . this parameter is a good indicator of combustion quality since it can detect the conditions under which the burner operates with low pollutant emission levels ( co and soot ) yet at high performance . in the case of oil , the spectral information will correspond to soot emissions in wave lengths between 400 and 750 nm . the sensors ( ccd camera or photodiode ) must be placed focusing towards the flame &# 39 ; s reaction zone , sending the optical signals to a processing unit to be processed . the processing unit generates a combustion state index that is used to identify the best operational conditions and then acts on the actuator , which in turn acts on the servomotor to regulate the combustion air . the silicon photodiodes of the present invention use filters that restrict the intensities received from the flame to narrow bands relative to radical c2 and ch emission . this strategy implies the use of at least 2 photodiodes . the invention contemplates software for real - time analysis of flames using ccd cameras . a set of images are averaged and then processed according to a predefined method (“ clustering ”, “ inter - class ”, “ metric ”, “ entropy ”, “ moments ” or manually ). this process is performed in different color spaces ( rgb , hsv , hsl , hsi ), where a number of pixels of 2d histograms , corresponding to regions of the flame correlated with the formation of pollutant species ( co , soot and nox ), is calculated . this estimated value is used as an index to control the combustion process . summarizing , the present invention encompasses a detection and analysis system for gas and oil flames based on optical devices ( photo detectors or cameras ) and algorithms to diagnose combustion quality and to optimize operation in terms of performance and pollutant emissions . the developed system achieves reductions in fuel consumption and emissions . additionally , it has the following advantages compared with conventional systems : on - line monitoring and control . traditional systems do not have direct control over the combustion air . as a result , in practice , systems require sporadic regulation by specialized personnel . in traditional systems , oxygen and carbon monoxide are monitored independently and no connection to define optimal operation is established between these two variables . the developed system synthesizes in a single index combustion criteria required to optimize performance and to control unburned products . the proposed system provides faster monitoring and control responses . the system monitors the combustion process at its origin , i . e . “ the flame &# 39 ; s reaction zone ”, differing from systems based on gas analysis , whose monitors are normally located in the chimney . optical sensors are not intrusive . indeed , measuring flame characteristics by optical methods does not alter boiler or furnace functioning in any way . thus , system maintenance costs are lower than control systems using a gas analyzer that must be regularly recalibrated due to depositions of soot particles in the measurement probe . the maintenance cost is low since the devices are easily available in the market . additionally , their useful life can be from several months to years , depending on the operating conditions , and they can be easily replaced in case of failure . the proposed system can be configured as either a flame monitoring system or a as a backup control system in the case of main control system failure . for the users , the system provides the followings economic benefits : fuel savings , operational costs savings , and lower risk of sanctions due to polluting emissions . the system can also provide additional safety and support to an already existing control system . the technology has been implemented in a boiler of 150 kw . in all the cases considered of burner power , it was observed that if the co emission increases , the control variable c2 / ch reaches a maximum value . this result is a clear indication that , in the case of the studied system , the relative presence of radicals does not depend on the power . therefore , it is possible to work with very low emissions and high performances under different power conditions . 1 . slope based 2 . gradient method . 3 . quadratic algorithm for extreme searching . the search strategy for the slope value is based on a simple comparison algorithm , which determines the slope between the ratio c2 / ch and the damper opening in order to compare it to the desired slope . since in this case , the slope is zero at the point of maximum operation , the control strategy changes burner power . the results obtained using this method are depicted in fig1 and 2 . this method takes nearly 10 minutes to find the optimal point of burner operation . the boiler efficiency obtained is 86 % and the co emission is under the 100 ppm . in fig1 , the line with rhombuses corresponds to damper opening and the line with triangles corresponds to boiler efficiency . in fig2 , the line with rhombuses corresponds to the ratio c2 / ch and the line with squares corresponds to co emissions . the gradient method is based on the equilibrium condition , where the method determines to open or close the damper in order to obtain the position where ratio c2 / ch is maximized . this method needs to know the gradient between the ratio c2 / ch and the damper opening . fig3 and 4 show the results obtained using this method , where the boiler efficiency is over 84 % and the co emissions under the 100 ppm . the quadratic algorithm method fits the curves obtained from the ratio c2 / ch for different burner power levels to a taylor series ( equation 1 ), discarding the terms larger than the third order . thus , it is possible to obtain the damper opening that maximizes the ratio c2 / ch . fig5 shows the application of the control strategy , using a ccd camera installed in the boiler for an operation with natural gas . in fig5 , it can be observed how the image index , obtained by post - processing software , is able to follow the changes in the regulation variable that corresponds to the opening of the air input valve . indeed , it can be especially observed that the increased signal corresponds to a condition when the combustion deteriorates . the system then marks the guideline to control the equipment to reach an ideal point in order to obtain maximum boiler efficiency with co emissions at acceptable levels according to international standards . summarizing , fig6 depicts the general control scheme implemented in a boiler &# 39 ; s burner . we can see : the combustion chamber where the flame lodges ( 1 ), the sensor ( 2 ) that records the selected signals emitted by the flame , the processing and control module ( 3 ) and the actuator ( 4 ) that acts on the burner damper . | 5 |
the present invention is directed to a broadband network architecture that allows a group of users to share communication infrastructure . the figures and description provided herein are merely illustrations and should not limit the scope of the present invention . one of ordinary skill in the art would recognize other variations , modifications , and alternatives . the schematic diagram of network of present invention , which derives pots at the rt , is shown in fig1 . the xdsl services are provided by one or multiple types of dc equipment ; dslam ; ethernet switch and or router ; vodsl gateway ; digital switches as shown in fig3 . these are collectively called dc equipment , shown in fig1 . the aggregator and separator ( agsep ) system is located at the dc is referred to as dc - agsep system in fig1 . the drop cables from the dc equipment are connected to the dc input output module ( dciom ) of the dc - agsep system . another agsep system is located at cl and is referred to as rt - agsep system in fig1 . the dc - agsep and rt - dgsep systems are connected using high - speed link . one or more subscriber equipment shown in fig4 and fig5 are connected the rt - agsep system using drop cables . at the dciom of the dc - agsep system , the xdsl line from the dc xdsl equipment is separated to receive and transmit signal frequencies as provisioned , if the line is uses a single drop cable for transmitting and receiving . if the line uses a separate transmit and receive drop cables , the transmit drop cable is used for transmit signal . the transmit signal is fed to the dc signal grooming module ( dcsgm ). the dcsgm combines the analog transmit signals from one or more inputs , to a sub channel of a programmable bandwidth . the number of transmit signals to be groomed are provisioned by the dc - agsep system &# 39 ; s craft interface . in the preferred embodiment of the invention using , a six - mega hertz bandwidth is used for sub channel . the choice of the sub channel in the preferred embodiment is to harness the components used in cable television networks . however , other channel bandwidth is used as needed to accommodate the efficient multiplexing of signals . the sub channel is up converted to an intermediate frequency ( if ) by the dcif converter module . the converted if frequency signal is fed to the dc combiner module ( dccm ). the dccm receives the if signals from a plurality of if converters . the dccm is provisioned by the dc - agsep craft interface to convert the specific if input to a rf range . the if input is up converted to the provisioned rf frequency . the rf combiner module combines the rf frequency inputs to form an outward rf stream . the dccm is capable of multiplexing xdsl signal using different modulation techniques , such as 2b1q , cap , dmt and qam into a sub channel . the dccm is capable of using multiple sub channels for a single xdsl input to accommodate higher bandwidth xdsl channel . the rf stream can be carried over coaxial cable , fiber , and free air in specific embodiments of the invention . the rf stream of the rf combiner module is fed to the rf to optic converter unit , in the preferred embodiment of the present invention . the rf to optic converter module modulates the rf stream , using linear modulation technique . a 1540 nm laser diode is used . a pair of single mode fiber is used to connect the dc - agsep and rt - agsep systems one for transmitting signals and one for receiving signals . at the rt , optical to rf converter module converts the optical signal to electrical rf stream . the rf stream in fed to if down converting module . the down converted signals are fed to rt signal separator module ( rtssm ). the rt - ssm separates the down converted signal to sub channels of the xdsl streams . the rtssm is capable of de - multiplexing xdsl signal using different modulation techniques , such as 2b1q , cap , dmt and qam from a sub channel . the entire sub channel may contain a single xdsl component . a set of sub channels may contain a single xdsl component . a fixed group of sub channels is dedicated to communication between dc - agsep , rt - agsep and optionally to and from subscriber equipment . this channel , referred to as the management channel , carries the provisioning information , status information , statistical information and other management information a set of sub channels is dedicated for voice traffic . the provisioning information for voice channel is used to derive voice services at the rt . in the preferred embodiment , hdsl is used for voice services . the rt ssm separates the hdsl stream form the sub channel and feed it to the voice module . the voice module provides pots services . the functionality of voice module is well known in the art and it is not described here . using the provisioning data the rtssm separates the sub channels to individual component xdsl signals . the component xdsl signals are then fed to input output module ( rtiom ). if the subscriber line is provisioned to get the transmit signal on a separate drop cable , this component signal is sent to the subscriber transmit drop cable . if the subscriber line is provisioned to use the same drop cable for receive and transmit signals , the component xdsl signal is coupled on to the subscriber &# 39 ; s line using diplexer . if the subscriber line is provisioned for the pots service , the pots lines from the voice module is frequency multiplexed with the subscriber xdsl signal . the subscriber xdsl signal is sent to the subscriber equipment using drop cables , connected to rtiom . in the preferred embodiment , a separate drop cable is used for each type of xdsl and a sub channel per drop cable . however , it is obvious multiple xdsl channels or multiple sub channels can be carried over a single drop cable . at the rt input output module ( rtiom ) of the rt - agsep system , the xdsl line from the subscriber equipment is separated to receive and transmit signal frequencies as provisioned , if the line is uses a single drop cable for transmitting and receiving . if the line uses a separate transmit and receive drop cables , the transmit drop cable is used for transmit signal . if the subscriber line is provisioned for the pots service , the pots signals from the subscriber line is decoupled and the pots signal is fed to the voice module . the transmit signal is fed to the rt signal grooming module ( rtsgm ) which is similar to dcsgm . the rtsgm combines the analog transmit signals from one or more inputs , to a sub channel of a programmable bandwidth . the number of transmit signals to be groomed are provisioned by the dc - agsep system using the management channel . the sub channel is up converted to an intermediate frequency ( if ) by the rt if converter module . the converted if frequency signal is fed to the rt combiner module . the rt combiner module receives the rt if signals from a plurality of if converters . the rt combiner module is provisioned , using the communication channel , to convert the specific if input to a rf range . the rt if input is up converted to the provisioned rf frequency . the rt rf combiner module combines the rf frequency inputs to form rt rf stream . the rt rf stream of the rt rf combiner module is fed to the rt rf to optic converter unit . the rf to optic converter module modulates the rf stream , using linear modulation technique . a 1510 nm laser diode is used . a pair of single mode fibers is used to connect the dc - agsep and rt - agsep systems . at the dc - agsep system , dc optical to rf converter module converts the received optical signal from rt , to electrical rf stream . the rf stream in fed to dc if down converting module . the down converted signals are fed to dc - ssm . the dcssm separates the down converted signal to sub channels of the xdsl streams . using the provisioning data the dcssm separates the sub channels to individual component xdsl signals . the component xdsl signals are then fed to dciom . if the dc line is provisioned to get the transmit signal on a separate drop cable , this component signal is sent to the dc equipment transmit drop cable . if the subscriber line is provisioned to use the same drop cable for receive and transmit signals , the component xdsl signal is coupled on to the dc equipment line using diplexer . | 7 |
fig1 generally depicts a subscriber communication unit 100 such as a subscriber telephone and a fixed network communication unit 130 such as a cellular telephone base site and switching center . the subscriber communication unit 100 is comprised of a microprocessing stage 118 which performs many of the preferred embodiment authentication and encryption steps by accessing a non - volatile memory unit 106 and a radio frequency ( rf ) stage 122 . additional elements which may be accessed by the microprocessing stage 118 include a data input stage 102 such as a key entry pad on a telephone ( to enter a telephone number -- data ), voice , or other data to be transmitted , a random number generator 104 ( for generating a random challenge ), and an encryption / decryption device 120 . within the non - volatile memory unit 106 resides the serial number 110 ( for the subscriber unit ), and the subscriber telephone number 108 ( which can have , for example , characteristics of a mobile identification number ( min ) and can be used as a first subscriber unit identifier ). the serial number 110 is used as a second subscriber unit identifier which is known only to the subscriber unit and the fixed network unit . for example , it should not be available to an installer of the subscriber unit , it should only be available to a legitimate user of a subscriber unit and a fixed network communication unit database . these identifiers need not necessarily be numbers but may correspond to any attribute capable of being identified by the fixed network communications unit . an alternative embodiment , for example , in a cellular system , may include a stored look up table containing multiple sets of serial numbers , and telephone numbers with each set of identifiers corresponding to a specific cellular area or fixed network communication unit . the memory unit 106 also serves as a storage location for keys generated by the encryption / decryption device 120 . these keys may include first shared secret data 112 ( ssd a ), second shared secret data 114 ( ssd b ), and third shared secret data 116 ( i . e ., a packetized data key ). the network communication unit 130 includes a switching center 128 which is comprised of a microprocessing stage 148 which , like the subscriber unit 100 , operates in conjunction with a database 136 and a link to a base site radio frequency stage 152 to perform authentication and encryption processes . in the preferred embodiment the microprocessor stage 148 includes an authentication center 149 . alternatively , the authentication center 149 could be located in a separate processor in the switch center 128 or in an independent unit in communication with the fixed communication unit 130 . additional elements accessed by the microprocessing stage 148 include a random number generator 134 and an encryptor / decryptor 150 . additionally , the switching center 128 has an interface to the public switched telephone network ( pstn ) 132 . the pstn link can be used for &# 34 ; visited &# 34 ; switching center to &# 34 ; home &# 34 ; switching center communications as required for authentication and billing of roaming subscriber units . the database includes information regarding several subscriber units such as a serial number 140 and the associated subscriber telephone number 138 as well as keys associated with the telephone number 138 which may be generated by the encryption / decryption device 150 or received from a &# 34 ; home &# 34 ; switching center . these keys may include first shared secret data 142 ( ssd a ), second shared secret data 144 ( ssd b ), and third shared secret data 146 ( i . e ., a packetized data key ). communication between the subscriber communication unit 100 and the fixed network communication unit 130 is accomplished via rf transmissions 126 between antennae 124 and 154 , respectively , of the two units in accordance with well understood cellular system techniques . a method of performing detection of an unexpected authentication message in the authentication center 149 according to a preferred embodiment is illustrated in fig2 . when a base station challenge message is received , at 202 , a check is made , at 204 , to determine whether a previous ssd update order was sent by the fixed communication unit 130 . if a previous update order was sent , then normal authentication processing continues at 208 . otherwise , an unexpected and unsolicited message has been received at 201 and in response a first internal counter ( auth -- 1 ) is incremented at 206 . the first counter ( auth -- 1 ) keeps a count of the number of unexpected messages have been detected . the first counter is then compared to a first threshold at 210 . the first threshold is preferably a predetermined number of detected unexpected messages allowed before updating the ssd key for the subscriber . if the threshold value is not exceeded then no additional action is necessary and the process is exited at 220 . however , if the first counter value exceeds the first threshold then processing continues at 212 where a second counter labeled auth -- 2 is incremented . further , since the first counter exceeded the threshold value the process proceeds to initiate an update of the subscriber &# 39 ; s ssd at 214 . next , the second counter auth -- 2 is compared with a second threshold at 216 . preferably , the second counter ( auth -- 2 ) keeps a count of the number of ssd updates that have been performed for the subscriber . the second threshold value preferably represents the number of ssd updates allowed before updating a subscriber &# 39 ; s a - key . if the second counter does not exceed the threshold value then processing ends at 220 . however , if the second counter exceeds the second threshold value then the subscriber is tagged for an a - key update at 218 , and the process is completed at 220 . those skilled in the art will appreciate that the first threshold value and the second threshold value may be programmable so that an operator may adapt these values for a particular application . preferably , the threshold value should be set at a level such that a fraudulent user cannot obtain enough information to derive an encryption key value . by setting the first threshold at such a level , the preferred embodiment provides protection against a fraudulent user who is sending many challenge messages to provoke response messages for later analysis since the ssd , or a - key , encryption key will be updated before the fraudulent user has enough response messages to determine the encryption key . in addition , the costly process of updating an ssd value is reduced since the ssd value is only updated when necessary to prevent fraudulent access . in this manner the method described with respect to fig2 advantageously provides a flexible and efficient process for improving authentication by reducing the probability of fraud in the communication system . fig3 illustrates a preferred method of performing authentication within the authentication center 149 with respect to detection of a unique challenge message by the base station 152 and the switch center 128 . when a unique challenge response message is received , at 230 , a check is made to determine whether a unique challenge order was previously sent at 232 . if a unique challenge was previously sent then normal authentication and ssd update processing continues , at 234 . however , if a unique challenge order was not previously sent , an unexpected and unsolicited message has been detected at 220 . processing then continues , at 236 , by incrementing a first counter , labeled auth -- 1 . the first counter is then compared to a first threshold value at 238 . if the first threshold has been exceeded then processing continues , at 240 , where a second counter labeled auth -- 2 is incremented . thereafter , the subscriber unit 100 is tagged for an ssd update at 242 . tagging a subscriber with an ssd update is similar to setting an internal flag , and will lead to further processing within the switch center 128 that will thereafter instruct the base station 152 to send appropriate messages over the air interface to the subscriber unit 100 so that the ssd value is updated within the subscriber unit 100 . the specific details of the process of updating the ssd value depends on the actual air interface standard used between the subscriber unit 100 and the fixed communication unit 130 and is known in the art . next , the second counter auth -- 2 is compared with a second threshold value at 244 . if the second counter exceeds the second threshold value then the subscriber is tagged with an a - key update at 246 . otherwise , the process is completed at 248 without performing an a - key update . although only two unexpected messages have been described above , the base station challenge message of fig2 and the unique challenge message of fig3 those skilled in the art will appreciate that the techniques described herein may also be applicable to other unexpected or unsolicited messages within an authentication process used with a variety of particular air interfaces . in addition both fig2 and 3 illustrate a process where two separate counters are used . those skilled in the art will understand that the present invention is not limited by the particular number of counters used . also although the preferred embodiment refers to the ssd value and the a - key value , other encryption key data may alternatively be updated . further , the present invention is suitable for use in a wide variety of wireless communication systems including code division multiple access , time division multiple access , and frequency division multiple access cellular systems . in addition , further advantages and modifications will readily occur to those skilled in the art . for example , although the first and second counters are preferably a part of the authentication center the counters may instead reside in any of the other devices such as the base station or the switching center . in this case , the other device would compare the counter to a threshold and would notify the authentication center when the counter exceeded the threshold . the invention , in its broader aspects , is therefore not limited to the specific details , representative apparatus , and illustrative examples shown and described herein . various modifications and variations can be made to the above specification without varying from the scope or spirit of the invention , and it is intended that the present invention cover all such modifications and variations provided they come within the scope of the following claims and their equivalents . | 7 |
this study includes six dmd patients affected by different mutations ( table 1 ). patient dl 515 . 2 carries an exon 45 - 50 deletion ; hence exon 51 skipping would be frame correcting . patient dl 363 . 2 has a deletion of exon 45 - 54 ; the reading frame for this patient would be corrected by an exon 44 skip . for patient 50685 . 1 , who is affected by an exon 48 - 50 deletion , reading frame correction requires an exon 51 skip . patient dl 589 . 2 has an exon 51 - 55 deletion ; the reading frame would be corrected by an exon 50 skip . patient 53914 . 1 carries a single - exon 52 deletion . notably , in this case , both the skipping of exon 51 or exon 53 would be frame correcting . finally , patient 50423 . 1 has a deletion of a single base pair in exon 49 , at position 7389 on cdna level , resulting in a frame - shift and a premature stop codon in exon 49 . since exon 49 is an in - frame exon , skipping of this exon would correct the reading frame for this patient . we have previously identified aons with which the skipping of the mentioned target exons 44 , 49 , 50 , 51 and 53 can be induced at concentrations of 1 μm ( 23 ). in subsequent dose - response experiments , however , we have obtained substantial skipping efficiencies with lower concentrations of 500 nm or 200 nm , and even 100 nm for most aons ( data not shown ). this had the extra advantageous effect of lower doses of pei required for transfection , which significantly reduced the levels of cytotoxicity as found in our earlier transfection experiments . myotube cultures from the six dmd patients were transfected with the relevant aons . on average , 70 % to 90 % of cells showed specific nuclear uptake of fluorescent aons . rna was isolated 24 hours post - transfection and analyzed by rt - pcr ( fig1 ). in all patients , the targeted exons were skipped at high efficiencies , and precisely at the exon boundaries , as confirmed by sequence analysis of the novel shorter transcripts ( fig1 ). for patient 50685 . 1 , an additional transcript fragment was found ( fig1 , panel c ). sequence analysis showed that this was generated by the activation of a cryptic splice site in exon 51 . this was previously also observed in human control cells treated with the same aon ( 23 ). remarkably , low levels of spontaneous exon skipping were observed in untreated cells derived from patients dl 363 . 2 ( exon 44 skip ), dl 589 . 2 ( exon 50 skip ), and 53914 . 1 ( exon 53 skip ). rt - pcr analysis on several larger areas of the dmd gene transcript did not reveal additional , unexpected , aberrant splicing patterns induced by the aon - treatment . the resulting in - frame transcripts should restore dystrophin synthesis . indeed , immuno - histochemical analysis of transfected myotube cultures detected dystrophin in the majority of myotubes for each patient ( fig2 ). the therapeutic efficiency was determined by double staining , using antibodies against myosin , to identify sufficiently differentiated myotubes and dystrophin . on average , 75 % to 80 % of myosin - positive myotubes showed dystrophin expression . we observed clear membrane - bound dystrophin for patients dl 363 . 2 , dl 589 . 2 and 53914 . 1 two days post - transfection ( fig2 , rows b , d , and e ). the presence of dystrophin was confirmed for each patient by western blot analysis ( fig3 ). for patients 50685 . 1 and dl 363 . 2 , we performed time course experiments , which indicated that dystrophin can be detected as soon as 16 hours post - transfection ( fig3 , panel d ) and at increasing levels up to seven days post - transfection ( fig3 , panel b ). the dystrophin proteins from patients dl515 . 2 , dl 363 . 2 and dl 589 . 2 are significantly shorter than the human control , which is due to the size of the deletion . for one patient , dl 363 . 2 , we also assessed whether the induction of the dystrophin synthesis resulted in the restoration of the dgc ( fig4 ). prior to aon treatment , we found reduced , mainly cytoplasmatic alpha , beta , gamma sarcoglycan and beta - dystroglycan signals ( 30 %, 30 %, 40 % and 80 %, respectively ) ( fig4 , row a ). following aon transfection , increased levels of mainly membrane - bound alpha -, beta - and gamma - sarcoglycans and beta - dystroglycan were detected in 70 %, 90 %, 90 % and 80 % of the treated myotube cultures , respectively ( fig4 , row b ). the reading frame correction strategy for dmd patients is aimed at antisense - induced , targeted exon skipping . this would convert a severe dmd phenotype into a mostly milder bmd phenotype . we determined the broad applicability in six patients , carrying five different deletions and a point mutation in an exon 49 ( table 1 ). following aon treatment , we show for each patient the precise skipping of the targeted exon on the rna level , and a dystrophin protein in 75 % to 80 % of the treated myotubes . in particular , we here report , for the first time , the application of a single aon treatment ( i . e ., the induced skipping of exon 51 ) to correct the reading frame for several different deletions . interestingly , the levels of exon skipping observed in the dmd patient cells are significantly higher than those previously obtained in human control cells ( 23 ). typically , the novel skip transcript is the major product . this can be explained by the action of the nonsense - mediated decay ( nmd ) process ( 25 , 32 ). in control cells , the skip of an out - of - frame exon results in an out - of - frame transcript , which will be susceptible to nmd . in patient cells , the skip of a target exon results in an in - frame transcript that would be resistant to nmd and thus more stable than the out - of - frame transcript originally present . for three of the patients ( dl 363 . 2 , dl 589 . 2 and 53914 . 1 ), we detected low levels of spontaneous skipping of exons 44 , 50 and 53 in untreated cells . this phenomenon has previously also been described for so - called revertant muscle fibers ( 33 - 35 ). these dystrophin - positive fibers are present in low amounts ( 2 % to 10 %) in dmd muscles and are considered to be the result of secondary somatic mutations and / or alternative splicing that restore the reading frame . the existence of revertant fibers has been suggested to correlate with the severity of the disease ( 36 , 37 ). restoration of the dystrophin synthesis could be detected as soon as 16 hours post - transfection . at two days post - transfection , dystrophin was detected at the membrane , indicating that these novel bmd - like proteins are likely in part functional . furthermore , we show that restoration of the dystrophin synthesis appears to re - establish the formation of the dystrophin - glycoprotein complex . in patients dl 363 . 2 and dl 589 . 2 , the targeted exon skipping enlarged the deletions to span exons 44 - 54 and 50 - 55 , respectively . so far , these deletions have not been reported in dmd or bmd patients . this means that they either do not exist or generate a very mild phenotype not diagnosed as bmd . considering both the large variety of bmd mutations and the markedly lower incidence of bmd observed , we consider the last explanation more plausible than the first . the out - of - frame deletions from patients dl 515 . 1 , 50685 . 1 and 50423 . 1 were converted into in - frame deletions as observed in bmd patients carrying deletions of exon 45 - 51 , exon 48 - 51 and exon 49 ( 30 , 38 - 40 ); noteworthy , the exon 48 - 51 deletion has even been described in an asymptomatic person ( 40 ). on the other hand , however , there are also dmd patients carrying such deletions ( 38 , 41 - 43 ). since most of these theoretical in - frame deletions have been detected on the dna level only , we hypothesize that the dystrophin deficiency in these dmd patients may be caused by additional aberrant splicing patterns on the rna level , resulting in an out - of - frame transcript . it is feasible to correct over 75 % of the mutations reported in the leiden dmd - mutation database ( 30 ). our results indicate that antisense - induced reading frame correction will be a promising therapeutic approach for many dmd patients carrying different deletions and point mutations . towards the establishment of clinical trials , we are currently investigating and optimizing delivery methods in muscle tissue of mice in vivo . the aons applied ( table 1 ) were previously described ( 23 ). they contain a 5 ′ fluorescein group ( 6 - fam ), a full - length phosphorothioate backbone and 2 ′- o - methyl modified ribose molecules ( eurogentec , be ). to avoid interference with the fluorescent signals of the secondary antibodies , unlabelled aons were used for immuno - histochemical analyses . primers for rt - pcr analysis ( sequences available upon request ) were synthesized by eurogentec ( be ) or by isogen bioscience bv ( nl ). primary human myoblasts from patients dl 515 . 2 ( deletion exon 45 - 50 ), dl 363 . 2 ( deletion exon 45 - 54 ), 50685 . 1 ( deletion exon 48 - 50 ), dl 589 . 2 ( deletion exon 51 - 55 ) and 53914 . 1 ( deletion exon 52 ) were isolated from a muscle biopsy and cultured as described ( 44 ). cultures were seeded in collagen pre - coated flasks and plates ( vitrogen 100 , cohesion ). myotubes were obtained from confluent myoblast cultures , following 7 to 14 days of serum deprivation . they were subsequently transfected using polyethylenimine ( pei ) for three hours in low - serum medium , according to the manufacturer &# 39 ; s instructions ( exgen500 ; mbi fermentas ), and with 3 . 5 μl pei applied per μg of transfected aon . for rt - pcr analysis , concentrations of 500 nm aon were used . at this concentration , the highest skipping levels can be obtained , albeit with moderate levels of cell death . because more viable myotubes are required for immunohistochemical and western blot analysis , concentrations of 200 nm were applied . for patient 50423 . 1 , who carries a point mutation in exon 49 , only fibroblasts were available . following infection ( moi 50 - 100 ) with an adenoviral vector containing the myod gene ( ad50myod ), the fibroblasts were forced into myogenesis according to protocols described previously ( 45 - 47 ). two hours post - infection , the medium was replaced by low - serum medium , and cells were incubated for eight to ten days until myotubes were formed . transfection conditions were identical to those described above . at 24 hours post - transfection , total rna was isolated from the myotube cultures ( rna - bee rna isolation solvent , campro scientific , nl ). 300 ng of total rna was used for rt - pcr analysis using c . therm polymerase ( roche diagnostics , nl ) in a 20 μl reaction at 60 ° c . for 30 minutes , primed with different dmd gene - specific reverse primers ( table 1 ). primary pcrs were performed by 20 cycles of 94 ° c . ( 40 seconds ), 60 ° c . ( 40 seconds ) and 72 ° c . ( 60 seconds ). one μl of these reactions was then reamplified in nested pcrs by 32 cycles of 94 ° c . ( 40 seconds ), 60 ° c . ( 40 seconds ) and 72 ° c . ( 60 seconds ). pcr products were analyzed on 1 . 5 % or 2 % agarose gels . noteworthy , no evidence for a significant preference for the amplification of shorter fragments was obtained in pcr analyses on a defined series of mixtures of known quantities of the normal and shorter transcript fragments ( data not shown ). rt - pcr products were isolated from agarose gels using the qiaquick ® gel extraction kit ( qiagen ). direct dna sequencing was carried out by the leiden genome technology center ( lgtc ) using the bigdye terminator cycle sequencing ready reaction kit ( pe applied biosystems ) and analyzed on an abi 3700 sequencer ( pe applied biosystems ). protein extracts were isolated from treated myotube cultures ( 25 cm 2 flasks ), using 150 μl of treatment buffer ( 75 mm tris - hcl ph 6 . 8 , 15 % sds , 5 % b - mercaptoethanol , 2 % glycerol , 0 . 001 % bromophenol blue ), at two to four days post - transfection , depending on the survival rate of the myotubes . for the time course experiments , protein extracts were isolated 4 hours , 8 hours , 16 hours , 24 hours and 48 hours post - transfection ( for patient 50685 . 1 ) or at 2 days , 4 days and 7 days post - transfection ( for patient dl 363 . 2 ). polyacrylamide gel electrophoresis and western blotting were performed as described by anderson et al ., with some minor adjustments ( 48 ). briefly , samples ( 75 μl ) were run overnight at 4 ° c . on a 4 % to 7 % polyacrylamide gradient gel . gels were blotted to nitrocellulose for five to six hours at 4 ° c . blots were blocked for one hour with 5 % non - fat dried milk in tbst buffer ( 10 mm tris - hcl , 0 . 15 m nacl , 0 . 5 % tween 20 , ph 8 ), followed by an overnight incubation with ncl - dys2 ( which recognizes dystrophin ) diluted 1 : 50 . hrp - conjugated anti - mouse ( santa cruz ) diluted 1 : 10 , 000 was used as a secondary antibody . immuno - reactive bands were visualized using lumi - lightplus western blotting substrate and scanned with a lumi - imager ( roche diagnostics , nl ). treated myotube cultures were fixed in − 20 ° c . methanol at one to four days post - transfection , depending of the survival rate of the myotubes . prior to reaction with the different antibodies , the cells were incubated for one hour in a blocking solution containing 5 % horse serum ( gibco brl ) and 0 . 05 % tween - 20 ( sigma ) in pbs ( gibco brl ). all antibodies used were diluted in this blocking solution . the following antibodies were applied : desmin polyclonal antibody ( icn biomedicals ) diluted 1 : 100 , myosin monoclonal antibody diluted 1 : 100 ( mf20 ; developmental studies hybridoma bank , university of iowa ), myosin polyclonal antibody l53 diluted 1 : 100 ( a gift from dr . m . van den hoff , amc , nl ), mandys1 ( a gift from dr . g . morris , north east wales institute , uk ) diluted 1 : 10 and ncl - dys2 ( novacastra laboratories ltd ) diluted 1 : 10 to detect dystrophin , ncl - a - sarc ( novacastra laboratories ltd ) diluted 1 : 75 , ncl - b - sarc ( novacastra laboratories ltd ) diluted 1 : 50 , ncl - g - sarc ( novacastra laboratories ltd ) diluted 1 : 50 and ncl - b - dg ( novacastra laboratories ltd ) diluted 1 : 50 to detect α - sarcoglycan , β - sarcoglycan , γ - sarcoglycan and β - dystroglycan , respectively . after one hour incubation , slides were rinsed and incubated for one hour with the secondary antibodies alexa fluor 594 goat anti - rabbit conjugate diluted 1 : 1000 or alexa fluor 488 goat anti - mouse conjugate diluted 1 : 250 ( molecular probes inc ). the slides were analyzed using a leica confocal microscope equipped with epifluorescence optics . digital images were captured using a ccd camera ( photometrics ). a series of aons ( two per exon , see table 2 ) was designed to bind to exon - internal target sequences showing a relatively high purine - content and , preferably , an open secondary pre - mrna structure ( at 37 ° c . ), as predicted by the rna mfold version 3 . 1 server [ 22 ]. the aons varied in length between 15 and 24 bp , with g / c contents between 26 and 67 %. they were synthesized with the following chemical modifications : a 5 ′- fluorescein group ( 6 - fam ), a full - length phosphorothioate backbone and 2 ′- o - methyl - modified ribose molecules ( eurogentec , be ). the primers used for reverse transcription - polymerase chain reaction ( rt - pcr ) analysis ( table 3 ) were synthesized by eurogentec ( be ) or by isogen bioscience bv ( nl ). primary human myoblasts were isolated from a muscle biopsy from a non - affected individual ( km108 ) by enzymatic dissociation . briefly , the tissue was homogenized in a solution containing 5 mg / ml collagenase type viii ( sigma ), 5 mg / ml bovine albumin fraction v ( sigma ), 1 % trypsin ( gibco brl ) in pbs ( gibco brl ). following serial incubation steps of 15 minutes at 37 ° c ., suspensions containing the dissociated cells were added to , and pooled in , an equal volume of proliferation medium ( nut . mix f - 10 ( ham ) with glutamax - 1 , gibco brl ) supplemented with 20 % fetal bovine serum ( gibco brl ) and 1 % penicillin / streptomycin solution ( gibco brl ). after centrifugation , the cells were plated and further cultured in proliferation medium , using flasks that were pre - coated with purified bovine dermal collagen ( vitrogen 100 ; cohesion ). the myogenic cell content of the culture , as determined by the percentage of desmin - positive cells in an immunohistochemical assay , was improved to 58 % by repetitive pre - plating [ 23 ]. myotubes were obtained from confluent myoblast cultures following 7 to 14 days of incubation in low - serum medium ( dmem ( gibco brl ), supplemented with 2 % glutamax - 1 , 1 % glucose , 2 % fetal bovine serum and 1 % penicillin / streptomycin solution ). for transfection of the myotube cultures , we used polyethylenimine ( pei ; exgen 500 ) according to the manufacturer &# 39 ; s instructions ( mbi fermentas ). the cultures were transfected for three hours in low - serum medium with 1 mm of each aon linked to pei at a ratio - equivalent of 3 . 5 . rna isolation and rt - pcr analysis at 24 hours post - transfection , total rna was isolated from the myotube cultures using rnazol b according to the manufacturer &# 39 ; s instructions ( campro scientific , nl ). one microgram of rna was then used for rt - pcr analysis using c . therm . polymerase ( roche diagnostics ) in a 20 μl reaction at 60 ° c . for 30 minutes , primed with different dmd gene - specific reverse ( rt ) primers ( table 3 ). primary pcrs were carried out with outer primer sets ( see table 3 ), for 20 cycles of 94 ° c . ( 40 seconds ), 60 ° c . ( 40 seconds ), and 72 ° c . ( 90 seconds ). one microliter of this reaction was then reamplified in nested pcrs using the appropriate primer combinations ( table 3 ) for 32 cycles of 94 ° c . ( 40 seconds ), 60 ° c . ( 40 seconds ), and 72 ° c . ( 60 seconds ). pcr products were analyzed on 1 . 5 or 2 % agarose gels . sequence analysis rt - pcr products were isolated from agarose gels using the qiaquick ® gel extraction kit ( qiagen ). direct dna sequencing was carried out by the leiden genome technology center ( lgtc ) using the bigdye ® terminator cycle sequencing ready reaction kit ( pe applied biosystems ), and analyzed on an abi 3700 sequencer ( pe applied biosystems ). aons were empirically analyzed for the induction of exon skipping following transfection into human control myotube cultures , using the cationic polymer polyethylenimine ( pei ). as determined by the nuclear uptake of the fluorescent aons , average transfection efficiencies of 60 - 80 % were obtained . at 24 hours post - transfection , transcripts were analyzed by rt - pcr using different primer combinations encompassing the targeted exons ( table 3 ). of the 30 aons tested , a total of 21 ( 70 %) reproducibly generated shorter transcript fragments with sizes corresponding to the specific skipping of the targeted exons ( fig5 and table 2 ). in fact , as confirmed by sequence analysis of the shorter transcripts ( data not shown ), we could induce the specific skipping of 13 out of the 15 exons targeted ( five out of the seven in - frame exons , and eight out of the eight out - of - frame exons ). no skipping of exons 47 and 48 was detected ( fig5 , panels e and g ). in the specific transcript regions that were screened in these experiments , we observed in the non - transfected control myotubes , alternative splicing patterns around exons 2 and 29 ( fig5 , panels b and c ). the alternative products were sequenced and found to be due to the skipping of exons 2 - 7 ( in - frame ), exons 3 - 7 ( out - of - frame ), exons 28 - 29 ( in - frame ), and exons 27 - 29 ( in - frame ). this genuinely occurring exon skipping was also detected previously in human skeletal muscle [ 24 , 25 ]. remarkably , the level of the alternative splicing was significantly enhanced by the aon treatment of the transfected myotube cultures . also noteworthy is the observation that h2aon1 not only induced exon 2 skipping in the normal transcript , but also in one of the alternative transcripts consisting of exons 1 and 2 spliced to exon 8 ( fig5 , panel b ). the majority of aons induced the precise skipping of the targeted exons , using the original splice sites of the adjacent exons . however , in response to h51aon2 , an in - frame cryptic splice site was used in exon 51 ( fig5 , panel h ). the level of this alternatively spliced product was variable in serial transfection experiments . finally , in some of the transfection experiments , additional aberrant splicing fragments were detected due to the co - skipping of adjacent exons . their incidence , however , was inconsistent , and at very low levels . hoffman e . p ., r . h . brown jr ., and l . m . kunkel . dystrophin : the protein product of the duchenne muscular dystrophy locus . cell 1987 , 51 : 919 - 928 . monaco a . p ., c . j . bertelson , s . liechti - gallati , h . moser , and l . m . kunkel . an explanation for the phenotypic differences between patients bearing partial deletions of the dmd locus . genomics 1988 , 2 : 90 - 95 . koenig m ., a . h . beggs , and m . moyer , et al . the molecular basis for duchenne versus becker muscular dystrophy : correlation of severity with type of deletion . am . j . hum . genet . 1989 , 45 : 498 - 506 . zubrzycka - gaarn e . e ., d . e . bulman , and g . karpati , et al . the duchenne muscular dystrophy gene product is localized in sarcolemma of human skeletal muscle . nature 1988 , 333 : 466 - 469 . yoshida m . and e . ozawa . glycoprotein complex anchoring dystrophin to sarcolemma . j . biochem . ( tokyo ) 1990 , 108 : 748 - 752 . ervasti j . m . and k . p . campbell . membrane organization of the dystrophin - glycoprotein complex . cell 1991 , 66 : 1121 - 1131 . koenig m ., a . p . monaco and l . m . kunkel . the complete sequence of dystrophin predicts a rod - shaped cytoskeletal protein . cell 1988 , 53 : 219 - 226 . van deutekom j . c ., s . s . floyd and d . k . booth , et al . implications of maturation for viral gene delivery to skeletal muscle . neuromuscul . disord . 1998 , 8 : 135 - 148 . mayeda a ., y . hayase , h . inoue , e . ohtsuka and y . ohshima . surveying cis - acting sequences of pre - mrna by adding antisense 20 - o - methyl oligoribonucleotides to a splicing reaction . j . biochem . ( tokyo ) 1990 , 108 : 399 - 405 . galderisi u ., a . cascino and a . giordano . antisense oligonucleotides as therapeutic agents . j . cell . physiol . 1999 , 181 : 251 - 257 . baker b . f . and b . p . monia . novel mechanisms for antisense - mediated regulation of gene expression . biochim . biophys . acta 1999 , 1489 : 3 - 18 . kole r . and p . sazani . antisense effects in the cell nucleus : modification of splicing . curr . opin . mol . ther . 2001 , 3 : 229 - 234 . sicinski p ., y . geng , a . s . ryder - cook , e . a . barnard , m . g . darlison and p . j . barnard . the molecular basis of muscular dystrophy in the mdx mouse : a point mutation . science 1989 , 244 : 1578 - 1580 . dunckley m . g ., m . manoharan , p . villiet , i . c . eperon and g . dickson . modification of splicing in the dystrophin gene in cultured mdx muscle cells by antisense oligoribonucleotides . hum . mol . genet . 1998 , 7 : 1083 - 1090 . mann c . j ., k . honeyman and a . j . cheng , et al . antisense - induced exon skipping and synthesis of dystrophin in the mdx mouse . proc . natl . acad . sci . u . s . a . 2001 , 98 : 42 - 47 . wilton s . d ., f . lloyd and k . carville , et al . specific removal of the nonsense mutation from the mdx dystrophin mrna using anti - sense oligonucleotides . neuromuscul . disord . 1999 , 9 : 330 - 338 . takeshima y ., h . wada , m . yagi , et al . oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a duchenne muscular dystrophy patient . brain dev . 2001 , 23 : 788 - 790 . pramono z . a ., y . takeshima , h . alimsardjono , a . ishii , s . takeda and m . matsuo . induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence . biochem . biophys . res . commun . 1996 , 226 : 445 - 449 . watakabe a ., k . tanaka and y . shimura . the role of exon sequences in splice site selection . genes dev . 1993 , 7 : 407 - 418 . tanaka k ., a . watakabe and y . shimura . polypurine sequences within a downstream exon function as a splicing enhancer . mol . cell . biol . 1994 , 14 : 1347 - 1354 . van deutekom j . c ., m . bremmer - bout , a . a . janson , et al . antisense - induced exon skipping restores dystrophin expression in dmd patient - derived muscle cells . hum . mol . genet . 2001 , 10 : 1547 - 1554 . mathews d . h ., j . sabina , m . zuker and d . h . turner . expanded sequence dependence of thermodynamic parameters improves prediction of rna secondary structure . j . mol . biol . 1999 , 288 : 911 - 940 . richler c . and d . yaffe . the in vitro cultivation and differentiation capacities of myogenic cell lines . dev . biol . 1970 , 23 : 1 - 22 . surono a ., y . takeshima , t . wibawa , z . a . pramono and m . matsuo . six novel transcripts that remove a huge intron ranging from 250 to 800 kb are produced by alternative splicing of the 50 region of the dystrophin gene in human skeletal muscle . biochem . biophys . res . commun . 1997 , 239 : 895 - 899 . shiga n ., y . takeshima , h . sakamoto , et al . disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for becker muscular dystrophy . j . clin . invest . 1997 , 100 : 2204 - 2210 . wells d . j ., k . e . wells , e . a . asante , et al . expression of human full - length and minidystrophin in transgenic mdx mice : implications for gene therapy of duchenne muscular dystrophy . hum . mol . genet . 1995 , 4 : 1245 - 1250 . sironi m ., u . pozzoli , r . cagliani , g . p . comi , a . bardoni and n . bresolin . analysis of splicing parameters in the dystrophin gene : relevance for physiological and pathogenetic splicing mechanisms . hum . genet . 2001 , 109 : 73 - 84 . this study includes two dmd patients affected by different frame - disrupting mutations in the dmd gene that require the skip of two exons for correction of the reading frame ( table 5 ). patient dl 90 . 3 carries a nonsense mutation in exon 43 . considering that this single exon is out - of - frame , the skipping of exon 43 would remove the nonsense mutation but not restore the reading frame . since the combination with exon 44 is in - frame , in this patient , we aimed at double - exon skipping , targeting both these exons . patient dl 470 . 2 is affected by a deletion of exons 46 to 50 . frame restoration would require a double - exon skipping of both exons flanking the deletion . myotube cultures from both patients were transfected with a mixture of exon 43 - and 44 - specific aons ( dl90 . 3 ) or exon 45 - and 51 - specific aons ( dl470 . 2 ). the individual aons ( table 5 ) were previously highly effective in single - exon skipping . transfection efficiencies were typically over 80 %, as indicated by the number of cells with specific nuclear uptake of the fluorescent aons . rt - pcr analysis at 24 to 48 hours post - transfection , indeed demonstrated the feasibility of specific double - exon skipping in both samples ( fig6 and 7 ). this was confirmed by sequence analysis ( data not shown ). additional shorter transcript fragments were obtained due to single - exon skipping : in patient dl90 . 3 , exon 44 skipping ( fig6 ), and in patient dl470 . 2 , exon 51 skipping ( fig7 ). the splicing of exon 44 directly to exon 52 ( as induced in dl470 . 2 ) generates an in - frame transcript . we hypothesized that by inducing the skipping of the entire stretch of exons in between , i . e ., multi - exon skipping , we would induce a bmd - like deletion ( 45 - 51 ) that covers and restores several known , smaller , dmd mutations . this would further enlarge the group of dmd patients that would benefit from one type of frame correction . the feasibility of multi - exon skipping was first shown in human control myotubes that were treated with a mixture of the exon 45 - and 51 - specific aons ( fig7 ; km 109 ). we then applied it to myotubes from a third dmd patient carrying an exon 48 - 50 deletion ( 50685 . 1 ). by the aon - induced skipping of the ( remaining ) stretch of exons in between and including exons 45 and 51 , we obtained the anticipated smaller in - frame transcript with exon 44 spliced to exon 52 ( fig7 ). the skipping of more than one exon from one pre - mrna molecule requires that both aons are present in the same nucleus , targeting the same molecule . to enlarge this chance , we here studied the feasibility of one combined aon carrying both aons specific for exons 45 and 51 ( h45aon5 and h51aon2 ) linked by ten uracil nucleotides ( table 5 ). following transfection of this “ u - linker aon ” into myotubes from human control and the dmd patients dl470 . 2 and 50685 . 1 , rt - pcr analysis demonstrated its efficacy to generate the anticipated in - frame transcript with exon 44 spliced to exon 52 ( fig7 ). this multi - exon skipping occurred specifically and precisely at the exon boundaries as confirmed by sequence analysis ( data not shown ). in contrast to patient dl 470 . 2 , the u - linker aon was a slightly more efficient than the mixture of aons in the human control and in patient 50685 . 1 . aons ( table 5 ) targeting exons 43 , 44 and 51 were previously described ( aartsma - rus , 2002 ). aons targeting exon 45 were newly designed ( sequences upon request ). all aons contain a 5 ′ fluorescein group ( 6 - fam ), a full - length phosphorothioate backbone and 2 ′- o - methyl modified ribose molecules ( eurogentec , be ). to avoid interference with the fluorescent signals of the secondary antibodies , unlabelled aons were used for immuno - histochemical analyses . primers for rt - pcr analysis ( table 5 , sequences available upon request ) were synthesized by eurogentec ( be ). at 24 to 48 hours post - transfection , total rna was isolated from the myotube cultures ( rna - bee rna isolation solvent , campro scientific , nl ). 300 ng of total rna were used for rt - pcr analysis using c . therm . polymerase ( roche diagnostics , nl ) in a 20 μl reaction at 60 ° c . for 30 minutes , primed with different dmd gene - specific reverse primers ( table 5 ). primary pcrs were performed by 20 cycles of 94 ° c . ( 40 seconds ), 60 ° c . ( 40 seconds ) and 72 ° c . ( 60 seconds ). one μl of these reactions was then re - amplified in nested pcrs by 32 cycles of 94 ° c . ( 40 seconds ), 60 ° c . ( 40 seconds ) and 72 ° c . ( 60 seconds ). pcr products were analyzed on 1 . 5 % or 2 % agarose gels . for quantification of the transcript products , nested pcrs were performed using 24 cycles . pcr products were analyzed using the dna 7500 labchip ® kit and the agilent 2100 bioanalyzer ( agilent technologies , nl ). rt - pcr products were isolated from agarose gels using the qiaquick gel extraction kit ( qiagen ). direct dna sequencing was carried out by the leiden genome technology center ( lgtc ) using the bigdye terminator cycle sequencing ready reaction kit ( pe applied biosystems ) and analyzed on an abi 3700 sequencer ( pe applied biosystems ). expression vectors encoding a transcript comprising an oligonucleotide of the invention due to the defined turnover rate of both the dystrophin pre - mrna and the aons , our dmd frame - correction therapy would require repetitive administrations of aons . in addition , relatively high levels of antisense rna will be necessary within the nucleus , where transcription and splicing of the dystrophin pre - mrna occur . therefore , we have set up a vector system in which specific aon sequences are incorporated into a modified gene . in this example , this embodiment is described for u7 small nuclear rna ( u7snrna ). u7snrna is the rna component of the u7 ribonucleoprotein particle ( u7snrnp ) that is involved in the processing of the 3 ′ end of histone pre - mrnas . inherent to its function , u7snrna is efficiently transported back from the cytoplasm to the nucleus in which it gets subsequently incorporated into very stable u7snrnp complexes . a similar approach was successfully applied in aon - based gene therapy studies on β - thalassemia ( 53 , 54 ). in these studies , different plasmids were engineered containing a modified u7snrna gene from which the natural antisense sequence directed to the histone pre - mrna was replaced with antisense sequences targeted to different β - thalassemia - associated aberrant splicing sites in the β - globin gene . following transfection of these plasmids , correct splicing and expression of the full - length β - globin protein could be restored with an efficiency of up to 65 % in cultured cells expressing the different mutant β - globin genes . various u7snrna gene constructs were engineered as described in reference 53 with the modification that the β - globin sequences were exactly replaced by the antisense sequences derived from the different aons . in this example , the sequences were replaced by the antisense sequences of m46aon4 , 6 , 9 , or 11 that were effective in inducing the skipping of mouse exon 46 . a sense construct was included as negative control ( m46son6 ). following construct validation by sequencing , the plasmids were tested in vitro by transfection into cultured c2c12 mouse myoblasts . the u7snrna - m46aon6 construct was most efficient . to enhance delivery of the aon - u7snrna gene constructs , we have cloned them into recombinant adeno - associated viral ( raav ) vectors . aav is a single - stranded dna parvovirus that is non - pathogenic and shows a helper - dependent life cycle . in contrast to other viruses ( adenovirus , retrovirus , and herpes simplex virus ), raav vectors have demonstrated to be very efficient in transducing mature skeletal muscle . because application of raav in classical dmd “ gene addition ” studies has been hindered by its restricted packaging limits (& lt ; 5 kb ), we applied raav for the efficient delivery of the much smaller u7snrna antisense constructs (& lt ; 600 bp ) to mature murine skeletal muscle . the raav - u7 - aon vectors also contain the gene for green fluorescence protein ( gfp - cdna ), which allows analysis of transduction efficiencies in muscle post - injection . high titer virus productions were effective in inducing exon skipping . 1 . hoffman e . p ., r . h . brown jr ., and l . m . kunkel ( 1987 ) dystrophin : the protein product of the duchenne muscular dystrophy locus . cell 51 : 919 - 928 . 2 . hoffman e . p ., k . h . fischbeck , r . h . brown , m . johnson , r . medori , j . d . loike , j . b . harris , r . waterston , m . brooke , l . specht , et al . ( 1988 ) characterization of dystrophin in muscle - biopsy specimens from patients with duchenne &# 39 ; s or becker &# 39 ; s muscular dystrophy . n . engl . j . med . 318 : 1363 - 1368 . 3 . den dunnen j . t ., p . m . grootscholten , e . bakker , l . a . blonden , h . b . ginjaar , m . c . wapenaar , h . m . van paassen , c . van broeckhoven , p . l . pearson , and g . j . van ommen ( 1989 ) topography of the duchenne muscular dystrophy ( dmd ) gene : fige and cdna analysis of 194 cases reveals 115 deletions and 13 duplications . am . j . hum . genet . 45 : 835 - 847 . 4 . koenig m ., a . h . beggs , m . moyer , s . scherpf , k . heindrich , t . bettecken , g . meng , c . r . muller , m . lindlof , h . kaariainen , et al . ( 1989 ) the molecular basis for duchenne versus becker muscular dystrophy : correlation of severity with type of deletion . am . j . hum . genet . 45 : 498 - 506 . 5 . tuffery - giraud s ., s . chambert , j . demaille , and m . claustres ( 1999 ) point mutations in the dystrophin gene : evidence for frequent use of cryptic splice sites as a result of splicing defects . hum . mutat . 14 : 359 - 368 . 6 . prior t . w ., c . bartolo , d . k . pearl , a . c . papp , p . j . snyder , m . s . sedra , a . h . burghes , and j . r . mendell ( 1995 ) spectrum of small mutations in the dystrophin coding region . am . j . hum . genet . 57 : 22 - 33 . 7 . moser h . ( 1984 ) duchenne muscular dystrophy : pathogenetic aspects and genetic prevention . hum . genet . 66 : 17 - 40 . 8 . emery a . e . ( 2002 ) the muscular dystrophies . lancet 359 : 687 - 695 . 9 . yoshida m . and e . ozawa ( 1990 ) glycoprotein complex anchoring dystrophin to sarcolemma . j . biochem . ( tokyo ), 108 : 748 - 752 . 10 . ervasti j . m . and k . p . campbell ( 1991 ) membrane organization of the dystrophin - glycoprotein complex . cell 66 : 1121 - 1131 . 11 . di blasi c ., l . morandi , r . barresi , f . blasevich , f . cornelio , and m . mora ( 1996 ) dystrophin - associated protein abnormalities in dystrophin - deficient muscle fibers from symptomatic and asymptomatic duchenne / becker muscular dystrophy carriers . acta neuropathol . ( berl ), 92 : 369 - 377 . 12 . ervasti j . m ., k . ohlendieck , s . d . kahl , m . g . gaver , and k . p . campbell ( 1990 ) deficiency of a glycoprotein component of the dystrophin complex in dystrophic muscle . nature 345 : 315 - 319 . 13 . matsumura k ., a . h . burghes , m . mora , f . m . tome , l . morandi , f . cornello , f . leturcq , m . jeanpierre , j . c . kaplan , p . reinert , et al . ( 1994 ) immunohistochemical analysis of dystrophin - associated proteins in becker / duchenne muscular dystrophy with huge in - frame deletions in the nh2 - terminal and rod domains of dystrophin . j . clin . invest . 93 : 99 - 105 . 14 . monaco a . p ., c . j . bertelson , s . liechti - gallati , h . moser , l . m . kunkel ( 1988 ) an explanation for the phenotypic differences between patients bearing partial deletions of the dmd locus . genomics 2 : 90 - 95 . 15 . clemens p . r . and f . j . duncan ( 2001 ) progress in gene therapy for duchenne muscular dystrophy . curr . neurol . neurosci . rep . 1 : 89 - 96 . 16 . khan m . a . ( 1993 ) corticosteroid therapy in duchenne muscular dystrophy . j . neurol . sci . 120 : 8 - 14 . 17 . de angelis f . g ., o , sthandier , b . berarducci , s . toso , g . galluzzi , e . ricci , g . cossu and i . bozzoni ( 2002 ) chimeric snrna molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre - mrna induce exon skipping and restoration of a dystrophin synthesis in delta 48 - 50 dmd cells . proc . natl . acad . sci . usa 99 : 9456 - 9461 . 18 . mann c . j ., k . honeyman , a . j . cheng , t . ly , f . lloyd , s . fletcher , j . e . morgan , t . a . partridge and s . d . wilton ( 2001 ) antisense - induced exon skipping and synthesis of dystrophin in the mdx mouse . proc . natl . acad . sci . usa , 98 : 42 - 47 . 19 . van deutekom j . c ., m . bremmer - bout , a . a . janson , i . b . ginjaar , f . baas , j . t . den dunnen and g . j . van ommen ( 2001 ) antisense - induced exon skipping restores dystrophin expression in dmd patient - derived muscle cells . hum . mol . genet . 10 : 1547 - 1554 . 20 . wilton s . d ., f . lloyd , k . carville , s . fletcher , k . honeyman , s . agrawal and r . kole ( 1999 ) specific removal of the nonsense mutation from the mdx dystrophin mrna using antisense oligonucleotides . neuromuscul . disord . 9 : 330 - 338 . 21 . dunckley m . g ., m . manoharan , p . villiet , i . c . eperon and g . dickson ( 1998 ) modification of splicing in the dystrophin gene in cultured mdx muscle cells by antisense oligoribonucleotides . hum . mol . genet . 7 : 1083 - 1090 . 22 . takeshima y ., h . wada , m . yagi , y . ishikawa , r . minami , h . nakamura and m . matsuo ( 2001 ) oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a duchenne muscular dystrophy patient . brain dev . 23 : 788 - 790 . 23 . aartsma - rus a ., m . bremmer - bout , a . janson , j . den dunnen , g . van ommen and j . van deutekom ( 2002 ) targeted exon skipping as a potential gene correction therapy for duchenne muscular dystrophy . neuromuscul . disord . 12 , s71 . 24 . shiga n ., y . takeshima , h . sakamoto , k . inoue , y . yokota , m . yokoyama and m . matsuo ( 1997 ) disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for becker muscular dystrophy . j . clin . invest . 100 : 2204 - 2210 . 25 . cartegni l ., s . l . chew and a . r . krainer ( 2002 ) listening to silence and understanding nonsense : exonic mutations that affect splicing . nat . rev . genet . 3 : 285 - 298 . 26 . schaal t . d . and t . maniatis ( 1999 ) multiple distinct splicing enhancers in the protein - coding sequences of a constitutively spliced pre - mrna . mol . cell . biol . 19 : 261 - 273 . 27 . takeshima y ., h . nishio , h . sakamoto , h . nakamura and m . matsuo ( 1995 ) modulation of in vitro splicing of the upstream intron by modifying an intra - exon sequence which is deleted from the dystrophin gene in dystrophin kobe . j . clin . invest . 95 : 515 - 520 . 28 . pramono z . a ., y . takeshima , h . alimsardjono , a . ishii , s . takeda , and m . matsuo ( 1996 ) induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence . biochem . biophys . res . commun . 226 : 445 - 449 . 29 . koenig m ., a . p . monaco and l . m . kunkel ( 1988 ) the complete sequence of dystrophin predicts a rod - shaped cytoskeletal protein . cell 53 : 219 - 226 . 30 . den dunnen j . ( 1996 ) the leiden muscular dystrophy pages ; http :// www . dmd . nl . 31 . mann c . j ., k . honeyman , g . mcclorey , s . fletcher and s . d . wilton ( 2002 ) improved antisense oligonucleotide - induced exon skipping in the mdx mouse model of muscular dystrophy . j . gene med . 4 : 644 - 654 . 32 . kerr t . p ., c . a . sewry , s . a . robb and r . g . roberts ( 2001 ) long mutant dystrophins and variable phenotypes : evasion of nonsense - mediated decay ? hum . genet . 109 : 402 - 407 . 33 . klein c . j ., d . d . coovert , d . e . bulman , p . n . ray , j . r . mendell and a . h . burghes ( 1992 ) somatic reversion / suppression in duchenne muscular dystrophy ( dmd ): evidence supporting a frame - restoring mechanism in rare dystrophin - positive fibers . am . j . hum . genet . 50 : 950 - 959 . 34 . sherratt t . g ., t . vulliamy , v . dubowitz , c . a . sewry and p . n . strong ( 1993 ) exon skipping and translation in patients with frameshift deletions in the dystrophin gene . am . j . hum . genet . 53 : 1007 - 1015 . 35 . lu q . l ., g . e . morris , s . d . wilton , t . ly , o . v . artem &# 39 ; yeva , p . strong and t . a . partridge ( 2000 ) massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion . j . cell biol . 148 : 985 - 996 . 36 . nicholson l . v ., m . a . johnson , k . m . bushby and d . gardner - medwin ( 1993 ) functional significance of dystrophin - positive fibers in duchenne muscular dystrophy . arch . dis . child 68 : 632 - 636 . 37 . vainzof m ., m . r . passos - bueno , r . i . takata , c . pavanello rde and m . zatz ( 1993 ) intrafamilial variability in dystrophin abundance correlated with difference in the severity of the phenotype . neurol . sci . 119 : 38 - 42 . 38 . singh v ., s . sinha , s . mishra , l . s . chaturvedi , s . pradhan , r . d . mittal and b . mittal ( 1997 ) proportion and pattern of dystrophin gene deletions in north indian duchenne and becker muscular dystrophy patients . hum . genet . 99 : 206 - 208 . 39 . melacini p ., m . fanin , g . a . danieli , g . fasoli , c . villanova , c . angelini , l . vitiello , m . miorelli , g . f . buja , m . l . mostacciuolo , et al . ( 1993 ) cardiac involvement in becker muscular dystrophy . j . am . coll . cardiol . 22 : 1927 - 1934 . 40 . melis m . a ., m . cau , f . muntoni , a . mateddu , r . galanello , l . boccone , f . deidda , d . loi and a . cao ( 1998 ) elevation of serum creatine kinase as the only manifestation of an intragenic deletion of the dystrophin gene in three unrelated families . europ . j . paediatr . neurol . 2 : 255 - 261 . 41 . onengut , s ., g . n . kavaslar , e . battaloglu , p . serdaroglu , f . deymeer , c . ozdemir , f . calafell and a . tolun ( 2000 ) deletion pattern in the dystrophin gene in turks and a comparison with europeans and indians . ann . hum . genet . 64 : 33 - 40 . 42 . rosenberg c ., l . navajas , d . f . vagenas , e . bakker , m . vainzof , m . r . passos - bueno , r . i . takata , g . j . van ommen , m . zatz and j . t . den dunnen ( 1998 ) clinical diagnosis of heterozygous dystrophin gene deletions by fluorescence in situ hybridization . neuromuscul . disord . 8 : 447 - 452 . 43 . sertic j ., n . barisic , m . sostarko , z . brzovic and a . stavljenic - rukavina ( 1997 ) deletion screening of the duchenne / becker muscular dystrophy gene in croatian population . coll . anthropol . 21 : 151 - 156 . 44 . rando t . a . and h . m . blau ( 1994 ) primary mouse myoblast purification , characterization , and transplantation for cell - mediated gene therapy . j . cell biol . 125 : 1275 - 1287 . 45 . murry c . e ., m . a . kay , t . bartosek , s . d . hauschka and s . m . schwartz ( 1996 ) muscle differentiation during repair of myocardial necrosis in rats via gene transfer with myod . j . clin . invest . 98 : 2209 - 2217 . 46 . roest p . a ., a . c . van der tuijn , h . b . ginjaar ; r . c . hoeben , f . b . hoger - vorst , e . bakker , j . t . den dunnen and g . j . van ommen ( 1996 ) application of in vitro myo - differentiation of non - muscle cells to enhance gene expression and facilitate analysis of muscle proteins . neuromuscul . disord . 6 : 195 - 202 . 47 . havenga m . j ., a . a . lemckert , o . j . ophorst , m . van meijer , w . t . germeraad , j . grimbergen , m . a . van den doel , r . vogels , j . van deutekom and a . a . janson , et al . ( 2002 ) exploiting the natural diversity in adenovirus tropism for therapy and prevention of disease . j . virol . 76 : 4612 - 4620 . 48 . anderson l . v . and k . davison ( 1999 ) multiplex western blotting system for the analysis of muscular dystrophy proteins . am . j . pathol . 154 : 1017 - 1022 . 49 . neugebauer k . m . et al ., j . cell . biol . 129 : 899 - 908 ( 1995 ). 50 . tacke r . and j . l . manley , proc . soc . exp . biol . med . 220 : 59 - 63 ( 1999 ). 51 . graveley b . r . et al ., curr . biol . 9 : r6 - 7 ( 1999 ). 53 . gorman l , suter d , emerick v , et al . stable alteration of pre mrna splicing patterns by modified u7 small nuclear rnas . proc . natl . acad . sci . usa 1998 , 4929 - 4934 . 54 . suter d , tomasini r , reber u , et al . double target antisense u7 snrnas promote efficient skipping of an aberrant exon in three human beta thalassemic mutations . hum . mol . genet . 1999 , 8 : 2415 - 2423 . a two aons were tested per exon . their different lengths and g / c contents (%) did not correlate to their effectivity in exon skipping ( 1 , induced skipping , 2 , no skipping ). the aons were directed to purine ( a / g ) - rich sequences as indicated by their ( antisense ) u / c content (%). skipping of the target exons resulted in either an in - frame ( if ) or an out - of - frame ( of ) transcript . | 2 |
the present invention is predicated , in part , on the observation that muscle cramps in a subject can be alleviated by the oral administration of a composition comprising an inhibitory neurotransmitter amino acid . accordingly , one aspect of the present invention contemplates a method for the treatment and / or prophylaxis of muscle cramps and / or muscle stiffness in a mammal comprising administering to said mammal an effective amount of an inhibitory neurotransmitter amino acid and / or a precursor thereof , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for a time and under conditions sufficient to reduce , inhibit or otherwise down - regulate the duration , severity and / or frequency of muscle cramp and / or muscle stiffness . more particularly , the present invention contemplates a method for the treatment and / or prophylaxis of skeletal muscle cramps and / or skeletal muscle stiffness in a mammal comprising administering to said mammal an effective amount of an inhibitory neurotransmitter amino acid and / or a precursor thereof , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for a time and under conditions sufficient to reduce , inhibit or otherwise down - regulate the duration , severity and / or frequency of skeletal muscle cramp and / or skeletal muscle stiffness . reference herein to an “ neurotransmitter ” is to be understood as a reference to a molecule which directly or indirectly modulates the permeability of an ion channel affecting the membrane potential of a muscle cell . reference herein to an “ inhibitory neurotransmitter ” means a molecule which directly or indirectly reduces the likelihood that a muscle cell will generate an action potential . accordingly , the term encompasses “ neuromodulators ” as well as direct “ neurotransmitters ” of synaptic activity . appropriate neurotransmitter agonists or antagonists or neurotransmitter receptor agonists and antagonists are also within the scope of the present invention and within the scope of the term “ inhibitory neurotransmitter ” used herein . examples of neurotransmitters are acetylcholine , histamine , endorphin , gaba ( g - aminobutyric acid ) and glycine . the neurotransmitter of the present invention may be administered as an active or as an inactive precursor molecule . threonine , which may be converted into glycine in vivo , is a particularly contemplated example of a precursor molecule . reference herein to “ an inhibitory neurotransmitter amino acid ” should be understood as a reference to an amino acid which functions as an inhibitory neurotranmitter . reference herein to “ functional derivative , chemical equivalent , mimetic , analogue or homologue thereof ” of an amino acid inhibitory neurotransmitter or of glycine or threonine should be understood to include reference to molecules from natural , synthetic or recombinant sources exhibiting at least one of the functional activities of an inhibitory neurotransmitter amino acid or of glycine or threonine and may be , for example , molecules obtained following natural - product screening . derivatives include those made by chemical modification by addition or removal of one or more moieties . even still more particularly , the present invention contemplates a method for the treatment and / or prophylaxis of skeletal muscle cramps and / or skeletal muscle stiffness in a mammal comprising administering to said mammal an effective amount of glycine and / or a precursor thereof such as threonine , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for a time and under conditions sufficient to reduce , inhibit or otherwise down - regulate the duration , severity and / or frequency of skeletal muscle cramp and / or skeletal muscle stiffness . even more particularly , the present invention contemplates a method for the treatment and / or prophylaxis of skeletal muscle cramps and / or skeletal muscle stiffness in a mammal comprising administering to said mammal an effective amount of glycine and / or a precursor thereof such as threonine , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for a time and under conditions sufficient to reduce , inhibit or otherwise down - regulate the duration , severity and / or frequency of skeletal muscle cramp and / or skeletal muscle stiffness . even still more particularly , the present invention contemplates a method for the treatment and / or prophylaxis of skeletal muscle cramps and / or skeletal muscle stiffness in a mammal comprising administering to said mammal an effective amount of glycine and / or threonine , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for a time and under conditions sufficient to reduce , inhibit or otherwise down - regulate the duration , severity and / or frequency of skeletal muscle cramp and / or skeletal muscle stiffness . in a particular embodiment of this aspect of the present invention , both glycine and threonine are administered . without limiting the present invention to any one theory or mode of action , it is thought that glycine enhances the ability of muscle cells to inhibit efferent alpha - motor neurone activity . furthermore , it is thought that threonine crosses the blood brain barrier where it is converted to glycine to permit the inhibitory neurotransmitter activity of glycine within the central nervous system . reference herein to the treatment and / or prophylaxis of “ muscle cramp and / or stiffness ” should be understood as a reference to the symptoms of involuntary muscle contraction which are associated with a very wide range of conditions found in mammalian subjects . for example , muscle cramps and / or stiffness is found in exercise - induced muscle - fatigued subjects as well as in subjects suffering from inherited or acquired neurological , neuromuscular or muscular disorders or ataxia &# 39 ; s , spasticity , dystonia ; occupational , nocturnal or writers cramp . reference herein to “ treatment ” and “ prophylaxis ” is used in its broadest sense . the term “ treatment ” does not mean that muscle cramps or stiffness is totally cured . similarly , “ prophylaxis ” does not mean that the subject will never develop cramps or muscle stiffness . accordingly , these terms include amelioration of the condition including a reduced duration , severity , or frequency of muscle cramps or muscle stiffness . the subject of treatment and / or prophylaxis herein is generally a mammal such as for example a human , primate , livestock animal ( eg sheep , pig , cow , horse , donkey ) companion animal ( eg cat , dog ) laboratory test animal ( eg mouse , rabbit , rat , guinea pig , hamster ) captive wild animal ( eg fox , deer ). preferably , the mammal is a human or primate . most preferably , the mammal is a human . another aspect of the present invention provides a composition comprising an inhibitory neurotransmitter amino acid and / or a precursor thereof , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for use in the treatment and / or prophylaxis of muscle cramp and / or muscle stiffness in a mammalian subject . another related aspect of the present invention provides a composition comprising an inhibitory neurotransmitter amino acid and / or a precursor thereof , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for use in the treatment and / or prophylaxis of skeletal muscle cramp and / or skeletal muscle stiffness in a mammalian subject . still another aspect of the present invention contemplates a composition comprising glycine and / or a precursor thereof such as threonine , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for use in the treatment and / or prophylaxis of muscle cramp and / or muscle stiffness in a mammalian subject . still yet another aspect of the present invention contemplates a composition comprising glycine and / or a precursor thereof such as threonine , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof when used in the treatment and / or prophylaxis of muscle cramp and / or muscle stiffness in a mammalian subject . another aspect of the present invention contemplates a composition comprising glycine and / or threonine , or a functional derivative , chemical equivalent , mimetic , analogue or homologue thereof for use in the treatment and / or prophylaxis of skeletal muscle cramp and / or skeletal muscle stiffness in a mammalian subject . administration of the composition of the present invention may be by any convenient route . oral administration is generally preferred , although pharmaceutical forms of the present composition may be suitable for injectable use such as sterile aqueous solutions ( where water soluble ) and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions . the composition must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi . the carrier can be a solvent or dispersion medium containing , for example , water , ethanol , polyol ( for example , glycerol , propylene glycol and liquid polyethylene glycol , and the like ), suitable mixtures thereof and vegetable oils . the proper fluidity can be maintained , for example , by the use of a coating such as lecithin . the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents , for example , parabens , chlorobutanol , phenol , sorbic acid , thimerosal and the like . in many cases , it will be preferable to include isotonic agents , for example , sugars or sodium chloride . prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption , for example , aluminum monostearate and gelatin . sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above , as required , followed by filtered sterilization . in the case of sterile powders for the preparation of sterile injectable solutions , the preferred methods of preparation are vacuum drying and the freeze - drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile - filtered solution thereof . the compositions may be orally administered , for example , with an inert diluent or with an assimilable edible carrier , or it may be enclosed in hard or soft shell gelatin capsule , or it may be compressed into tablets , or it may be in powdered form or incorporated directly with the food of the diet . for oral therapeutic and / or prophylactic administration , the active compound may be incorporated with excipients and used in the form of ingestible tablets , buccal tablets , troches , capsules , elixirs , suspensions , syrups , wafers , and the like . such compositions and preparations should contain at least 1 % by weight of active compound . the percentage of the compositions and preparations may , of course , be varied and may conveniently be between about 5 to about 80 % of the weight of the unit . the amount of active compound in such therapeutically useful compositions in such that a suitable dosage will be obtained . preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0 . 01 μg and about 2000 mg of active compound . alternative amounts include between about 1 . 0 μg and about 1500 μg , between about 1 μg and about 1000 mg and between about 10 μg and about 500 mg . the tablets , troches , pills , capsules and the like may also contain the components as listed hereafter : a binder such as gum , acacia , corn starch or gelatin ; excipients such as dicalcium phosphate ; a disintegrating agent such as corn starch , potato starch , alginic acid and the like ; a lubricant such as magnesium stearate ; and a sweetening agent such a sucrose , lactose or saccharin may be added or a flavouring agent such as peppermint , oil of wintergreen , or cherry flavouring . when the dosage unit form is a capsule , it may contain , in addition to materials of the above type , a liquid carrier . various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit . for instance , tablets , pills , or capsules may be coated with shellac , sugar or both . a syrup or elixir may contain the active compound , sucrose as a sweetening agent , methyl and propylparabens as preservatives , a dye and flavouring such as cherry or orange flavour . of course , any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non - toxic in the amounts employed . in addition , the active compound ( s ) may be incorporated into sustained - release preparations and formulations . pharmaceutically acceptable carriers and / or diluents include any and all solvents , dispersion media , coatings , antibacterial and antifungal agents , isotonic and absorption delaying agents and the like . the use of such media and agents for pharmaceutical active substances is well known in the art . except insofar as any conventional media or agent is incompatible with the active ingredient , use thereof in the therapeutic compositions is contemplated . supplementary active ingredients can also be incorporated into the compositions . it is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage . dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated ; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier . the specification for the novel dosage unit forms of the invention are dictated by and directly dependent on ( a ) the unique characteristics of the active material and the particular therapeutic effect to be achieved , and ( b ) the limitations inherent in the art of compounding such an active material for the treatment of particular conditions in living subjects . the principal active ingredient or ingredients are compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form . a unit dosage form can , for example , contain the principal active compounds in amounts ranging from 0 . 01 μg to about 70 g / 100 grams . expressed in proportions , the active compound is generally present in from about 0 . 5 μg to about 2000 mg / ml of carrier . in the case of compositions containing supplementary active ingredients , the dosages are determined by reference to the usual dose and manner of administration of the said ingredients . alternatively , amounts administered may be represented in terms of amounts / kg body weight . in this case , amounts range from about 0 . 001 μg to about 1000 mg / kg body weight may be administered . preferred ranges include from about 50 μg to 500 mg 1 kg body weight 500 mg / kg body weight or about 0 . 01 μg to about or above 0 . 1 μg to about 250 mg / kg body weight are contemplated by the present invention . for use in the treatment and / or prophylaxis of muscle cramp and / or muscle stiffness in a mammalian subject . even yet another related aspect of the present invention contemplates the use of a composition comprising : in the manufacture of a medicament for treatment and / or prophylaxis of muscle cramp and / or muscle stiffness in a mammalian subject . the present invention is now further described with reference to the following non - limiting examples . [ 0085 ] fig1 shows the motor nerve supply to most non - cranial nerve muscles . the central signal comes from the brain via the α - motor neurone with secondary signals to the muscle spindle from the β nerve route . the α - motor neurone initiates the contraction of the muscle whilst the muscle spindle and the golgi tendon organ provide negative or inhibitory feedback to the α - motor neurone to inhibit the neurone . the neurotransmitter that controls the inhibitory response is the amino acid glycine . glycine acts on the α - motor neurone by regulating the resting membrane potential . the glycine signal causes a change in chloride ion pumping which results in this change in resting potential . falls in the availability of glycine in the central nervous system will therefore resulting a reduction of the ability to inhibit the α - motor neurone . there are several methods by which changes in this system can effect the development of cramps : 1 ) the reduction in glycine availability . a low level of threonine and or high level of serine will be able to reduce glycine availability in the central nervous system , the neurones and their synapses . increased glycine conjugation in the liver through the glycine conjugation mechanisms will also reduce the available glycine and threonine ( kasuya et al ., 1996 ). 2 ) threonine transport disorders . a low level of threonine and or high level of serine will be able to reduce glycine uptake into the central nervous system or into the neurones and their synapses . threonine availability is important as it is transported across the blood brain barrier where as glycine is not . once threonine is transported it may then be converted to glycine for use in the cns . 3 ) electrolyte problems . sodium and chloride availability are significantly influenced by the amount of fluid and electrolyte replacement associated with exercise — particularly in competitive sport . these alterations may also be seen in various disease conditions where electrolyte availability is influenced by the disease process . 4 ) fall in high energy phosphate levels . this is usually associated with high exercise periods in sports people but may also occur in certain disease states . compound mg per gram l - glycine 350 mg l - threonine 150 mg sodium chloride 250 mg sodium phosphate 125 mg sodium bicarbonate 125 mg a 37 year old male had nocturnal muscle cramps for over 15 years and had tried all available drugs and remedies to correct the problem . one single 300 mg dose of the composition exemplified in example 2 prevented the development of cramps during the night for the first time in all those years . the patient was monitored on a regular basis over 2 years . the subject takes a small amount of the composition exemplified in example 2 every 1 - 2 weeks and has not developed nocturnal muscle cramps since the time of the first dose . a 27 year old sporting person who developed cramps regularly during sports events ( cricket ) took a 300 mg dose the supplement of example 2 before every cricket game and has not developed cramps since that time whilst playing cricket over a summer of sport . those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described . it is to be understood that the invention includes all such variations and modifications . the invention also includes all of the steps , features , compositions and compounds referred to or indicated in this specification , individually or collectively , and any and all combinations of any two or more of said steps or features . kasuya f , igarashi k , fukui m . participation of a medium chain acyl - coa synthetase in glycine conjugation of the benzoic acid derivatives with the electron - donating groups . biochem pharmacol ; 51 : 805 - 809 , 1996 . | 0 |
in describing preferred embodiments illustrated in the drawings , specific terminology is employed for the sake of clarity . however , the disclosure of this patent specification is not intended to be limited to the specific terminology so selected and it is to be understood that each specific element includes all technical equivalents that operate in a similar manner . referring how to the drawings , wherein like reference numerals designate identical or corresponding parts throughout the several views , particularly to fig3 , a switching regulator according to exemplary embodiments are described . fig3 illustrates an example of a basic configuration of a switching regulator circuit 200 according to an exemplary embodiment of the present disclosure . fig4 illustrates circuit blocks of a pwm controller 16 shown in fig3 in more detail . the switching regulator circuit 200 includes two reference voltage circuits 11 and 14 , bleeder resistances , an error - amp 12 , a comparator 13 similar to the conventional switching regulator . further , the switching regulator circuit 200 includes a ring oscillator 10 a and the pwm controller 16 instead of the triangular - pulse generator 10 and the pwm comparator 15 . the ring oscillator 10 a includes constant current inverters to oscillate with rectangular pulses . the pwm controller 16 includes a voltage - current converter circuit 18 , an inverter 21 , a capacitor 19 , a current source 22 , a third reference voltage ( vref 3 ) circuit 23 , a comparator 24 and an and circuit 25 as shown in fig4 . similar to the conventional switching regulator , the error - amp 12 inputs an output voltage vout of the switching regulator and an output voltage of the bleeder resistances and outputs a difference voltage between these two voltages . the comparator 13 inputs the output signal of the error - amp 12 and a second reference voltage vref 2 of the second reference voltage circuit 14 and judges whether the output signal of the error - amp 12 is higher than the output voltage vref 2 of the second reference voltage circuit 14 . the output signal of the error - amp 12 controls a current source 22 arranged in the pwm controller 16 via a voltage - current transfer circuit 18 as shown in fig4 . further , the output signal of the error - amp 12 controls an on time of a switching transistor arranged outside the switching regulator circuit 200 . the comparator 13 changes an oscillation frequency of the ring oscillator 10 a based on a comparing result of the output signal of the error - amp 12 with the reference voltage vref 2 . the output signal of the ring oscillator 10 a is inverted by the inverter 21 . the current of the inverter 21 is determined by the current source 22 which is controlled by the output signal of the error - amp 12 . a delay time is generated by the current of the inverter 21 and the capacitor 19 which is arranged between the output of the inverter 21 and a power terminal . fig5 illustrates operation waveforms of the switching regulator circuit 200 of fig3 . in fig5 , the output waveform of the ring oscillator 10 a is illustrated . the output waveform of the ring oscillator 10 a is changed from a narrower width pulse to a wider width pulse due to a change of a load . more specifically , the output signal of the error amp 12 , indicated by error amp output , is increased from a low voltage to a high voltage with respect to the reference voltage vref 2 in fig5 while the load is changed from heavier to lighter . a waveform of the output signal of the inverter 21 is illustrated as inverter output in fig5 while the output voltage of the inverter 21 is high gradually . during a time period the output voltage of the error amp 12 is lower than the reference voltage vref 2 , the ring oscillator 10 a generates a rectangular pulse with a constant cycle time . during a time period the output voltage of the error amp 12 is higher than the reference voltage vref 2 , the ring oscillator 10 a outputs pulses with longer high time . the inverter 21 outputs pulses having longer cycle time in accordance with the output pulses of the ring oscillator 10 a . a waveform of the output voltage of the comparator 24 , comparator 2 output , is illustrated in fig5 , and is based on comparison of the output voltage of the inverter 21 , inverter output , to a reference voltage vref 3 . the reference voltage , vref 3 , is set to be lower value ( approximately 0 . 5 v ) than a supply voltage of the ring oscillator 10 a and the inverter 21 . the output signal of the pwm controller 16 is the output signal of the and circuit 25 which performs and calculation with the output of the comparator 24 and the output signal of the ring oscillator 10 a . fig6 illustrates a boost dc / dc converter 300 which includes a switching regulator as an example of the application of the switching regulator . the boost dc / dc converter 300 includes a power input terminal vin , a bleeder resistor 8 , a switching transistor 9 , a first reference voltage generator 11 , a first error amp 12 , a current detection circuit 13 a , a second error amp 17 , a pwm controller 36 and a gate drive circuit 15 a . the power input terminal vin inputs a power supply . the bleeder resistor 8 is connected to a load load in parallel . the first error amp 12 amplifies a difference voltages between a divisional voltage from the bleeder resistor which is proportional to a load voltage , vout , and a first reference voltage , vref 1 . the current detection circuit 13 a detects a current which flows through the switching transistor 9 and depends on a load current . the second error amp 17 amplifies an output signal of the current detection circuit 13 a . the gate drive circuit 15 a drives the switching transistor 9 . the pwm controller 36 is a current - control type controller which converts a voltage to a current and modulates an oscillation signal from the oscillation circuit based on the converted current value . the load may be a compact equipment with a battery as a power source , in the exemplary embodiment . the boost dc / dc converter 300 includes a first and second feedback circuits . the first feedback circuit is formed by the first error amp 12 and the pwm controller 36 and the second feedback circuit is formed by the switching transistor 9 and the pwm controller 36 . to detect a change of the load voltage , vout , it is more effective to directly detect the current flow of the switching transistor 9 which is reflected to the load current . namely , the change of the load can be detected more quickly and in more precise by a detection of an output signal of the second error amp 17 in comparison with a detection of an output signal of the first error amp 12 . the boost dc / dc converter 300 can instantly detect the voltage change of the load by employing this double feedback control . namely , it is possible to accelerate a rising speed of the load voltage quickly when the load voltage is decreasing and to slow a falling speed of the load voltage when the load voltage is increasing . it is difficult to control to make the load voltage falling in a short time only by the first error amp 12 due to time lag . the feedback voltage goes higher or lower than a predetermined voltage because of a control timing shift . if an unstable condition has been continued for a certain period , the boost dc / dc converter 300 may begin to oscillate due to this over swing . in the switching regulator according to an exemplary embodiment , the current of the switching transistor 9 which is controlled by the gate drive circuit 15 a is being sensed . the sensed signal is amplified by the second error amp 17 . the pwm controller 36 controls the duty of the control signal for the gate drive circuit 15 a . as a result , it is possible to avoid the oscillation due to the change of the load condition by this feedback . fig7 illustrates a switching regulator 400 according to another exemplary embodiment . the switching regulator 400 includes a gate drive circuit 15 a , a nmos driver transistor 9 , a mirror transistor 19 , a resistor 29 , a second error amp 17 , a pwm controller 36 , a first reference voltage source 11 , a first error amp 12 , a second reference voltage source 14 , a comparator 13 and a ring oscillator ( osc ) 10 a . in fig7 , the output signal of the pwm controller 36 is input to the gate drive circuit 15 a . the nmos driver transistor 9 is driven by the gate drive circuit 15 a and the mirror transistor 19 is connected in parallel to the nmos driver transistor 9 . the comparator 13 compares an output signal of the first error amp 12 and the second reference voltage vref 2 of the second reference voltage circuit 14 . a current of the nmos driver transistor 9 is detected by the mirror transistor 19 and the resistor 29 connected to a source of the mirror transistor 19 as a voltage of the resistor 29 . the detected current is amplified by the second error amp 17 and is output to the pwm controller 36 . thus , the current detection circuit is formed of the mirror transistor 19 and the resistor 29 . the first error amp 12 amplifies the difference voltage between the load voltage vout and the first reference voltage circuit 11 . the comparator 13 compares the output voltage of the error amp 12 with the reference voltage of the second reference voltage circuit 14 and outputs a control signal to control the ring osc 10 a . fig8 illustrates waveforms at each terminal of the pwm controller 36 . fig9 illustrates a detailed block diagram of the pwm controller 36 of fig8 . when the load capacity is increased , the current of the nmos driver transistor 9 in fig7 is increased . the resistor 29 generates a voltage corresponding to the increase of the current of the nmos driver transistor 9 . the second error amp 17 detects the voltage of the resistor 29 as a voltage signal . the second error amp 17 amplifies the voltage signal of the resistor 29 . referring to fig9 , the output signal from the second error amp 17 is input to a current source 22 through a voltage - to - current converter 18 . as described in fig7 , the first error amp 12 amplifies the difference voltage between the load voltage vout and the first reference voltage of the first reference circuit 11 . the output signal from the first error amp 12 is also input to the current source 22 through a voltage - to - current converter 28 as shown in fig9 . the current source 22 controls a current of the inverter 21 . furthermore , the oscillation signal is controlled by adjusting the current of the inverter 21 and by comparing the output of the inverter 21 with a third reference voltage vref 3 of a third reference voltage circuit 23 . as a result , a duty of the switching operation of the switching regulator 400 is controlled . the waveforms of the exemplary embodiment will be discussed referring to fig8 comparing to the waveforms of the conventional basic circuit shown in fig5 . in the waveforms of the basic circuit fig5 , the current source 22 of the pwm controller 16 outputs a current signal corresponding to pulses of the ring oscillator 10 a when the output voltage of the error amp 12 is low and the output voltage of the inverter 21 , inverter output , is higher than the third reference voltage vref 3 . the current source 22 of the pwm controller 16 outputs a narrower pulse than the pulse width of the ring oscillator 10 a while the output voltage of the error amp 12 is higher . similar control is performed in the exemplary embodiment of fig8 , but , the pwm controller 36 is also controlled by the output signal of the second error amp 17 . fig5 illustrates that the output signal of the error amp 12 is changing from a lower voltage to a higher voltage . however , fig8 illustrates that the output signal of the error amp 12 is changing from a higher voltage to a lower voltage . in fig5 , two output signals i . e ., the output signal of the ring oscillator 10 a ( ring oscilltor output ) and the output signal of the first error amp 12 ( error amp output ) are referred . however , in fig8 , three voltages i . e ., the output signal of the ring oscillator 10 a ( ring oscilltor output ) and the output signals of the first and second error amps 12 and 17 , ( error amp output , current amp output ) are referred . thus , the output signal of the switching regulator 400 is controlled by the effect of the second error amp 17 additionally . when the load capacity is being increased , the current of the nmos driver transistor is increased in accordance with the increase of the load current and the output signal of second error amp 17 is becoming higher . the output signal of the first error amp 12 is shifting from a higher voltage to a lower voltage as shown by a notation “ a ” in fig8 . further , the output signal of the second error amp 17 is increased at each pulse as shown by a notation “ b ” in fig8 . at a time period shown by the notation “ b ”, the output pulse width of the pwm controller 36 is made narrower gradually and the duty cycle is becoming smaller . a part of the output signal of the inverter 21 at corresponding portion shown by “ b ” in fig8 is lower than the output voltage of the reference voltage circuit 23 as referred to the waveforms inverter output and reference voltage ( vref 3 ). for the time period , the pulse width of the high level of the pwm controller 36 is shorten . when the load capacity becomes lighter , the current of the nmos driver transistor becomes smaller and the output signal of the second error amp 17 becomes lower . in this condition , the output pulse width of the pwm controller 36 is depended on the output signal of the first error amp 12 . as described , the current source 22 outputs the current signal corresponding to pulses of the ring oscillator 10 a when the output voltage of the first error amp 12 is low and the output voltage of the inverter 21 is higher than the third reference voltage vref 3 . the current source 22 outputs a narrower pulse than the pulse width of the ring oscillator 10 a when the output voltage of first error amp 12 is higher . meanwhile , when the load capacity becomes lighter , the output voltage of the second error amp 17 begins to fall . the output pulse width of the pwm controller 36 is made wider at each pulse of the ring oscillator 10 a . thus the output pulse width of the pwm controller 36 is controlled . in the exemplary embodiment of the switching regulator , the current of the switching transistor is detected and the detected current is amplified by the second error amp 17 . the output signal of the second error amp 17 is input to the pwm controller 36 . in parallel , the difference voltage between the load voltage and the first reference voltage is amplified by the first error amp 12 . the comparator 13 compares the output voltage of the first error amp 12 and the second reference voltage and outputs a control signal to control the ring oscillator 10 a . the pwm controller 36 inputs the output voltage of the first and second error amps 12 and 17 and the output signal of the ring oscillator 10 a . the duty cycle of the switching regulator is controlled by the signal of the ring oscillator 10 a based on the feedback voltage of the load voltage and the feedback current in accordance with the load current . the comparator 24 compares the controlled output signal of the ring oscillator 10 a with the reference voltage ( vref 3 ). the and gate 25 outputs a control signal to drive the switching transistor based on the output signal of the comparator 24 and the output signal of the ring oscillator 10 a . the switching regulator of the present disclosure can be used in any of a number of manners . for example , as should be apparent from this disclosure , the switching regulator of this disclosure can be employed in portable electronic devices which use a battery as a power source . numerous additional modifications and variations are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the disclosure of this patent specification may be practiced otherwise than as specifically described herein . for example , elements and / or features of different examples and illustrative embodiments may be combined with each other and / or substituted for each other within the scope of this disclosure and appended claims . this patent specification is based on japanese patent application , no . 2005 - 281758 filed on sep . 28 , 2005 in the japan patent office , the entire contents of which are incorporated by reference herein . | 7 |
the &# 34 ; translation initiation region &# 34 ; or tir , as used herein refers to a region of rna ( or its coding dna ) determining the site and efficiency of initiation of translation of a gene of interest . ( see , for example , mccarthy et al . trends in genetics 6 : 78 - 85 ( 1990 ).). a tir for a particular gene can extend beyond the ribosome binding site ( rbs ) to include sequences 5 &# 39 ; and 3 &# 39 ; to the rbs . the rbs is defined to include , minimally , the shine - dalgarno region and the start codon , plus the bases in between , but can include the expanse of mrna protected from ribonuclease digestion by bound ribosomes . thus , a tir can include an untranslated leader or the end of an upstream cistron , and thus a translational stop codon . a &# 34 ; secretion signal sequence &# 34 ; or &# 34 ; signal sequence &# 34 ; as used herein refers to a sequence present at the amino terminus of a polypeptide that directs its translocation across a membrane . typically , a precursor polypeptide is processed by cleavage of the signal sequence to generate mature polypeptide . the term &# 34 ; translational strength &# 34 ; as used herein refers to a measurement of a secreted polypeptide in a control system wherein one or more variants of a tir is used to direct secretion of a polypeptide encoded by a reporter gene and the results compared to the wild - type tir or some other control under the same culture and assay conditions . for example , in these experiments translational strength is measured by using alkaline phosphatase as the reporter gene expressed under basal level control of the phoa promoter , wherein secretion of the phoa polypeptide is directed by variants of the stii signal sequence . the amount of mature alkaline phosphatase present in the host is a measure of the amount of polypeptide secreted , and can be quantitated relative to a negative control . without being limited to any one theory , &# 34 ; translational strength &# 34 ; as used herein can thus include , for example , a measure of mrna stability , efficiency of ribosome binding to the ribosome binding site , and mode of translocation across a membrane . &# 34 ; polypeptide &# 34 ; as used herein refers generally to peptides and polypeptides having at least about two amino acids . the instant invention demonstrates that translational strength is a critical factor in determining whether many heterologous polypeptides are secreted in significant quantities . thus , for a given tir , a series of amino acid or nucleic acid sequence variants can be created with a range of translational strengths , thereby providing a convenient means by which to adjust this factor for the optimal secretion of many different polypeptides . the use of a reporter gene expressed under the control of these variants , such as phoa , provides a method to quantitate the relative translational strengths of different translation initiation regions . the variant or mutant tirs can be provided in the background of a plasmid vector , thereby providing a set of plasmids into which a gene of interest may be inserted and its expression measured , so as to establish an optimum range of translational strengths for maximal expression of mature polypeptide . thus , for example , signal sequences from any prokaryotic or eukaryotic organism may be used . preferably , the signal sequence is stii , ompa , phoe , lamb , mbp , or phoa . mutagenesis of the tir is done by conventional techniques that result in codon changes which can alter the amino acid sequence , although silent changes in the nucleotide sequence are preferred . alterations in the tir can include , for example , alterations in the number or spacing of shine - dalgarno sequences , along with alterations in the signal sequence . one preferred method for generating mutant signal sequences is the generation of a &# 34 ; codon bank &# 34 ; at the beginning of a coding sequence that does not change the amino acid sequence of the signal sequence ( i . e ., the changes are silent ). this can be accomplished by changing the third nucleotide position of each codon ; additionally , some amino acids , such as leucine , serine , and arginine , have multiple first and second positions that can add complexity in making the bank . this method of mutagenesis is described in detail in yansura et al . ( methods : a companion to methods in enzymol . 4 : 151 - 158 ( 1992 )). basically , a dna fragment encoding the signal sequence and the beginning of the mature polypeptide is synthesized such that the third ( and , possibly , the first and second , as described above ) position of each of the first 6 to 12 codons is altered . the additional nucleotides downstream of these codons provide a site for the binding of a complementary primer used in making the bottom strand . treatment of the top coding strand and the bottom strand primer with dna polymerase i ( klenow ) will result in a set of duplex dna fragments containing randomized codons . the primers are designed to contain useful cloning sites that can then be used to insert the dna fragments in an appropriate vector , thereby allowing amplification of the codon bank . alternative methods include , for example , replacement of the entire rbs with random nucleotides ( wilson et al ., biotechniques 17 : 944 - 952 ( 1994 )), and the use of phage display libraries ( see , for example , barbas et al ., proc . natl . acad . sci . u . s . a . 89 : 4457 - 4461 ( 1992 ); garrard et al ., gene 128 : 103 - 109 ( 1993 )). typically , the tir variants will be provided in a plasmid vector with appropriate elements for expression of a gene of interest . for example , a typical construct will contain a promoter 5 &# 39 ; to the signal sequence , a restriction enzyme recognition site 3 &# 39 ; to the signal sequence for insertion of a gene of interest or a reporter gene , and a selectable marker , such as a drug resistance marker , for selection and / or maintenance of bacteria transformed with the resulting plasmids . promoters suitable for use with prokaryotic hosts include the β - lactamase and lactose promoter systems ( chang et al ., nature 275 : 617 - 624 ( 1978 ); and goeddel et al ., nature 281 : 544 - 548 ( 1979 )), alkaline phosphatase , a tryptophan ( trp ) promoter system ( goeddel , nucleic acids res . 8 ( 18 ): 4057 - 4074 ( 1980 ) and ep 36 , 776 ) and hybrid promoters such as the tac promoter ( deboer et al ., proc . natl . acad . sci . u . s . a . 80 : 21 - 25 ( 1983 ). suitable promoting sequences for use with yeast hosts include the promoters for 3 - phosphoglycerate kinase ( hitzeman et al ., j . biol . chem . 255 ( 24 ): 12073 - 80 ( 1980 )) or other glycolytic enzymes ( hess et al ., j . adv . enzyme reg . 7 : 149 - 67 ( 1968 )); and holland , biochemistry 17 : 4900 - 4907 ( 1978 )), such as enolase , glyceraldehyde - 3 - phosphate dehydrogenase , hexokinase , pyruvate decarboxylase , phosphofructokinase , glucose - 6 - phosphate isomerase , 3 - phosphoglycerate mutase , pyruvate kinase , triosephosphate isomerase , phosphoglucose isomerase , and glucokinase . other yeast promoters , which are inducible promoters having the additional advantage of transcription controlled by growth conditions , are the promoter regions for alcohol dehydrogenase 2 , isocytochrome c , acid phosphatase , degradative enzymes associated with nitrogen metabolism , metallothionein , glyceraldehyde - 3 - phosphate dehydrogenase , and enzymes responsible for maltose and galactose utilization . suitable vectors and promoters for use in yeast expression are further described in hitzeman et al ., ep 73 , 657a . yeast enhancers also are advantageously used with yeast promoters . any reporter gene may be used which can be quantified in some manner . thus , for example , alkaline phosphatase production can be quantitated as a measure of the secreted level of the dhoa gene product . other examples include , for example , the β - lactamase genes . preferably , a set of vectors is generated with a range of translational strengths into which dna encoding a polypeptide of interest may be inserted . this limited set provides a comparison of secreted levels of polypeptides . the secreted level of polypeptides can be determined , for example , by a functional assays for the polypeptide of interest , if available , radioimmunoassays ( ria ), enzyme - linked immunoassays ( elisa ), or by page and visualization of the correct molecular weight of the polypeptide of interest . vectors so constructed can be used to transform an appropriate host . preferably , the host is a prokaryotic host . more preferably , the host is e . coli . further details of the invention can be found in the following examples , which further define the scope of the invention . all references cited herein are expressly incorporated by reference in their entirety . all of the plasmids described in this patent application were constructed from a basic backbone of pbr322 ( sutcliffe , cold spring harb symp ouant biol 43 : 77 - 90 ( 1978 )). while the gene of interest expressed in each case varies , the transcriptional and translational sequences required for the expression of each gene were provided by the phoa promoter and the trp shine - dalgarno sequence ( chang et al ., gene 55 : 189 - 196 ( 1987 )). additionally , in the cases noted , a second shine - dalgarno sequence , the stii shine - dalgarno sequence ( picken et al ., infect immun 42 ( 1 ): 269 - 275 ( 1983 )), was also be present . secretion of the polypeptide was directed by the stii signal sequence or variants thereof ( picken et al ., infect immun 42 ( 1 ): 269 - 275 ( 1983 )). the phoa promoter , trp and stii shine - dalgarno sequences and the sequence of the wild - type stii signal sequence are given in fig1 . the plasmid pls33 was derived from phgh1 ( chang et al ., gene 55 : 189 - 196 ( 1987 )), which was constructed for the expression of des ( 1 , 3 )- igf - i . in the plasmid pls33 , the gene encoding this version of insulin - like growth factor i ( altered from the original sequence ( elmblad et al ., third european congress on biotechnology iii . weinheim : verlag chemie , pp . 287 - 292 ( 1984 )) by the removal of the first three amino acids at the n - terminus ) replaced the gene encoding human growth hormone . the construction pls33 maintained the sequences for the phoa promoter , trp and stii shine - dalgarno regions and the wild - type stii signal sequence described for phghi . however , the 3 &# 39 ; end following the termination codon for des ( 1 , 3 )- igf - i was altered from that described for phgh1 . in the case of pls33 , immediately downstream of the termination codon a hindiii restriction site was engineered , followed by the methionine start codon of the tetracycline resistance gene of pbr322 ( sutcliffe , cold spring harb symp ouant biol 43 : 77 - 90 ( 1978 )). a diagram of the plasmid pls33 is given in fig2 . a plasmid library containing a variable codon bank of the stii signal sequence ( pstiibk ) was constructed to screen for improved nucleotide sequences of this signal . the vector fragment for the construction of pstiibk was created by isolating the largest fragment when pls33 was digested with xbai and bsteii . this vector fragment contains the sequences that encode the phoa promoter , trp shine - dalgarno sequence and amino acids 16 - 67 of des ( 1 , 3 )- igf - i . the coding region for amino acids 3 - 15 of des ( 1 , 3 )- igf - i was provided by isolating the draiii -- bsteii fragment ( approximately 45 bp ) from another igf - i expression plasmid , pls331amb . the variations in the nucleotide sequence for the stii signal were derived from the two strands of synthetic dna listed below : ## str1 ## these two strands of synthetic dna were annealed and treated with dna polymerase i ( klenow fragment ) to form duplex dna of approximately 101 bp . this duplex dna was then digested with xbai and draiii to generate the fragment of approximately 82 bp encoding the stii signal sequence with variable codons and the first two amino acids of des ( 1 , 3 )- igf - i . these fragments were then ligated together as shown in fig3 to construct the library , pstiibk . the plasmid library containing a variable codon bank of the stii signal sequence ( pstiibk ) was screened for improved growth of transformants and increased secretion of igf - 1 . basically , plasmids were transformed into host strain 27c7 ( see below ) and screened for enhanced ability to grow in a low phosphate medium ( see chang et al ., supra ) plus carbenicillin ( 50 μg / ml ) based on od 600 measurements of cell density . candidate colonies were tested for increased levels of igf - 1 secretion as follows . colonies were inoculated into 3 - 5 ml lb plus carbenicillin ( 50 μg / ml ) and grown at 37 ° c . with shaking for about 5 - 15 hours . cultures were diluted 1 : 100 into 1 - 3 ml low phosphate medium plus carbenicillin ( 50 μg / ml ) and induced for 24 hours shaking at 37 ° c . the induced cultures were centrifuged in microcentrifuge tubes for 5 minutes . supernatants were diluted into igf ria diluent and stored at - 20 ° c . until assayed . the amount of igf - 1 secreted into the medium was measured by a radioimmunoassay . the level of expression of igf - 1 , as measured by the amount of igf - 1 detected in culture supernatants , was compared for pls33 , pstiibk # 131 , and pstiic , in fig4 . the variant # 131 consistently improved igf - 1 expression over the &# 34 ; original &# 34 ; or wild - type stii signal sequence . pstiic showed some slight improvement in expression over the wild - type sequence . pstiibk # 131 differed from the wild - type stii in 12 codons and in the deletion of one shine - dalgarno sequence . pstiic was constructed as described below as a control plasmid having only one shine - dalgarno sequence and three codon changes near the extreme 3 &# 39 ; end of the signal . in pstiic the stii shine - dalgarno sequence was removed from the plasmid pls33 . in addition , by incorporating silent mutations near the 3 &# 39 ; end of the stii signal , an mlui site was engineered into pstiic . the identical fragments described for the construction of pstiibk ( the vector from pls33 and the approximately 45 bp draiii -- bsteii fragment from pls331amb ) were used for the construction of this plasmid . however , the synthetic dna differed from that described above for the construction of pstiibk . for the construction of pstiic , the synthetic dna coding for the stii signal sequence and the first two amino acids of des ( 1 , 3 )- igf - i was as follows : ## str2 ## these fragments were ligated together as illustrated in fig5 to construct the plasmid pstiic . the plasmid pstiilys contained an stii signal sequence that differs from the signal sequence of pstiic by only one nucleotide change at the position of the second codon . this signal sequence was constructed from synthetic dna and placed in a pbr322 - based vector for the expression of the polypeptide rantes ( schall et al ., j immunol 141 ( 3 ): 1018 - 1025 ( 1988 )). the xbai -- mlui vector fragment for this construction was isolated from the plasmid pbk131ran ( a derivative of the plasmid pstiibk # 131 with the gene encoding rantes replacing the gene encoding des ( 1 , 3 )- igf - i ). this vector contained the phoa promoter , trp shine - dalgarno sequence , the last three amino acids of the stiic signal sequence and the gene encoding the polypeptide rantes . as illustrated in fig6 this fragment was then ligated with the following strands of synthetic dna to construct the plasmid pstiilys ( seq id no : 3 ): ## str3 ## in order to determine a quantitative tir value for each of the stii signal sequences described , the alkaline phosphatase gene of e . coli was used as a reporter gene . in each of these constructions , the phoa gene was placed downstream of the phoa promoter , trp shine - dalgarno sequence and a version of the stii signal sequence . the plasmids ppho21 , ppho31 , ppho41 and ppho51 contained the signal sequences derived from pstiic , pls33 , pstiibk # 131 and pstiilys , respectively . in the case of ppho31 , the construction also contained the stii shine - dalgarno region . the vector fragment for the construction of ppho21 was created by digesting pbr322 with ecori and bamhi and isolating the largest fragment . the phoa promoter , trp shine - dalgarno sequence and stiic signal sequence ( amino acids 1 - 20 ) were provided by isolating the approximately 484 bp fragment of pcn131tsc following digestion with ecori and mlui . an identical fragment of approximately 484 bp could have also been generated from pstiic , a plasmid which has been described previously . the phoa gene fragment ( approximately 1430 bp ) encoding amino acids 24 - 450 of alkaline phosphatase was generated from the plasmid pb0525 following digestion with bsp1286 and bamhi ( inouye et al ., j bacteriol 146 ( 2 ): 668 - 675 ( 1981 )). this bsp1286 -- bamhi fragment also contains approximately 142 bp of sv40 dna ( fiers et al ., nature 273 : 113 - 120 ( 1978 )) following the termination codon of alkaline phosphatase . synthetic dna was used to link the stii signal sequence with the phoa gene . the sequence of this dna encoding the last three amino acids of the stiic signal sequence and amino acids 1 - 23 of alkaline phosphatase was as follows : ## str4 ## in order to facilitate the construction of this plasmid , the synthetic dna was preligated to the ecori -- mlui fragment of pcn131tsc . this preligation generated a new fragment of about 575 bp . as illustrated in fig7 the fragment generated from the preligation was then ligated together with the other fragments described to construct ppho21 . the vector fragment for the construction of this plasmid was the identical vector described for ppho21 . the phoa promoter , trp shine - dalgarno sequence , stii shine - dalgarno sequence and stii signal sequence ( amino acids 1 - 20 ) were generated from pjal55 . the necessary fragment ( approximately 496 bp ) from pjal55 was isolated following digestion with ecori and mlui . this ecori - mlui fragment only differed from the same region of pls33 by an engineered mlui site starting at amino acid 20 of the stii signal sequence ( as described for pstiic ). the last three amino acids of the stiic signal sequence and the sequence encoding the phoa gene were provided by digesting the plasmid ppho21 with mlui and bamhi and isolating the approximately 1505 bp fragment . these fragments were ligated together as shown in fig8 to yield ppho31 . the vector fragment for the construction of this plasmid was the identical vector described for ppho2l . the phoa promoter , trp shine - dalgarno sequence and stii signal sequence with pstiibk # 131 codons ( amino acids 1 - 20 ) were provided by isolating the approximately 484 bp ecori -- mlui fragment of pngf131 . an identical fragment could have also been generated from pstiibk # 131 . the last three amino acids of the stiic signal sequence and the sequence encoding the phoa gene were provided by digesting the plasmid ppho21 with mlui and bamhi and isolating the approximately 1505 bp fragment . as illustrated in fig9 these three fragments were then ligated together to construct ppho41 . the vector fragment for the construction of ppho51 was generated by digesting the plasmid pls18 with xbai -- bamhi and isolating the largest fragment . the plasmid pls18 is a derivative of phgh1 ( chang et al ., gene 55 : 189 - 196 ( 1987 )) and an identical vector would have been generated had phgh1 been used in place of pls18 . this xbai -- bamhi vector contains the phoa promoter and the trp shine - dalgarno sequence . the stii signal sequence ( amino acids 1 - 20 ) with pstiilys codons was provided by isolating the approximately 67 bp fragment generated when pstiilys was digested with xbai and mlui . the last three amino acids of the stiic signal sequence and the sequence encoding the phoa gene were provided by digesting the plasmid ppho21 with mlui and bamhi and isolating the approximately 1505 bp fragment . a diagram for the construction of ppho51 is given in fig1 . a second variable codon library of the stii signal sequence , pstiicbk , was constructed . this second codon library was designed only to focus on the codons closest to the met initiation codon of the stii signal sequence . as illustrated in fig1 , pstiicbk was a pbr322 - based plasmid containing the gene encoding the polypeptide rantes ( schall et al ., j immunol 141 ( 3 ): 1018 - 1025 ( 1988 )) under the control of the phoa promoter and the trp shine - dalgarno sequence . in this plasmid , secretion of rantes is directed by an stii signal sequence codon library derived from the following two strands of synthetic dna : ## str5 ## these two strands of synthetic dna were annealed and treated with dna polymerase i ( klenow fragment ) to form duplex dna of approximately 86 bp . this duplex dna was then digested with xbai and mlui to generate a fragment of approximately 67 bp encoding the first 20 amino acids of the stii signal sequence with variable codons at positions 2 - 6 . to increase the number of stii signal sequences available with differing relative tir strengths , a convenient method of screening the codon library of pstiicbk was required . the plasmid pstbkphoa was constructed as a solution to this problem . in the plasmid pstbkphoa , the stii codon library of pstiicbk was inserted upstream of the phoa gene and downstream of the phoa promoter and the trp shine - dalgarno sequence . phoa activity thus provided a means by which to discriminate between different versions of the stii signal sequences . the vector fragment for this construction was created by isolating the largest fragment when p131tgf was digested with xbai and bamhi . an identical vector could have also been generated from phgh1 ( chang et al ., gene 55 : 189 - 196 ( 1987 )). this vector contained the phoa promoter and the trp shine - dalgarno sequence . the codon library of the stii signal sequence was provided by isolating the approximately 67 bp fragment generated from pstiicbk following digestion with xbai and mlui . the last three amino acids of the stiic signal sequence and the sequence encoding the phoa gene were provided by digesting ppho2l with mlui and bamhi and isolating the approximately 1505 bp fragment . as illustrated in fig1 , the fragments were then ligated together to construct pstbkphoa . the plasmids pstbkphoa # 81 , 86 , 107 , 116 were selected from the codon library of pstbkphoa based on their basal level phoa activity ( fig1 ). as listed in fig1 , each had a different nucleotide sequence encoding the stii signal sequence . this version of the stii signal sequence , st116 , combined the double shine - dalgarno sequence described by chang et al . ( gene 55 : 189 - 196 ( 1987 )) with the codons of the selected stii sequence pstbkphoa # 116 . this signal sequence was initially constructed in a plasmid designed for the secretion of the pro region of nt3 ( pnt3pst116 ) and then was transferred into a plasmid containing the phoa gene to obtain a relative tir measurement ( pst116pho ). the vector for this construction was generated by digesting the plasmid pls18 with xbai and bamhi and isolating the largest fragment . the plasmid pls18 was a derivative of phgh1 ( chang et al ., gene 55 : 189 - 196 ( 1987 )) and an identical vector could have been generated from phgh1 . this xbai -- bamhi vector contained the phoa promoter and the trp shine - dalgarno sequence . a fragment ( approximately 682 bp ) containing the last three amino acids of the stii signal sequence and the coding region for amino acids 19 - 138 of pront3 ( jones et al ., proc natl acad sci 87 : 8060 - 8064 ( 1990 )) was generated from the plasmid pnt3p following digestion with mlui and bamhi . the plasmid pnt3p was a pbr322 - based plasmid containing the phoa promoter , stiibk # 131 version of the stii signal sequence and the coding region for amino acids 19 - 138 of pront3 . the strands of synthetic dna listed below provided the sequence for the stii shine - dalgarno sequence and the first 20 amino acids of the stii signal sequence : ## str6 ## these fragments were then ligated together as shown in fig1 to construct pnt3pst116 . the vector for the construction of this plasmid was the identical vector described for the construction of pnt3pst116 . the stii shine - dalgarno sequence and the first 20 amino acids of the stii signal sequence ( pstbkphoa # 116 codons ) were generated by isolating the approximately 79 bp fragment from pnt3pst116 following digestion with xbai and mlui . the last three amino acids of the stiic signal sequence and the sequence encoding the phoa gene were isolated from pstbkphoa # 116 following digestion with mlui and bamhi ( approximately 1505 bp fragment ). as illustrated in fig1 , ligation of these three fragments resulted in the construction of pst116pho . in these experiments the altered tir constructs utilizing the phoa reporter gene were assayed for relative translational strengths by a modification of the method of amenura et al . ( j . bacteriol . 152 : 692 - 701 , 1982 ). basically , the method used was as follows . plasmids carrying altered sequences , whether in the tir , the shine - dalgarno region , the nucleotide sequence between the shine dalgarno region and the start codon of the signal sequence , or the signal sequence itself , whether amino acid sequence variants or nucleotide sequence variants , were used to transform e . coli strain 27c7 ( atcc 55 , 244 ) although any phoa -- strain of e . coli could be used . transformant colonies were inoculated into luria - bertani medium ( lb ) plus carbenicillin ( 50 μg / ml , sigma , inc .). cultures were grown at 37 ° c . with shaking for 4 - 8 hr . the equivalent of 1 od 600 of each culture was centrifuged , then resuspended in 1 ml strict ap media ( 0 . 4 % glucose , 20 mm nh 4 cl , 1 . 6 mm mgso 4 , 50 mm kcl , 20 mm nacl , 120 mm triethanolamine , ph 7 . 4 ) plus carbenicillin ( 50 μg / ml ). the mixtures were then immediately placed at - 20 ° c . overnight . after thawing , 1 drop toluene was added to 1 ml of thawed culture . after vortexing , the mixtures were transferred to 16 × 125 mm test tubes and aerated on a wheel at 37 ° c . for 1 hr . 40 μl of each toluene treated culture was then added to 1 ml 1m tris - hcl ph 8 plus 1 mm pnpp ( disodium 4 - nitrophenyl phosphate hexahydrate ) and left at room temperature for 1 hr . the reactions were stopped by adding 100 ml 1m sodium phosphate ph 6 . 5 . the od 410 was measured within 30 minutes . enzyme activity was calculated as micromoles of p - nitrophenol liberated per minute per one od 600 equivalent of cells . table 1______________________________________determination of tir relative strength : use of phoa as a reporter gene standard relativetir phoa activity . sup . 1 deviation strength______________________________________pbr322 0 . 0279 0 . 0069 -- ppho51 . sup . 2 0 . 0858 0 . 0165 1pstbkphoa # 86 0 . 1125 0 . 0246 1pstbkphoa # 107 0 . 1510 0 . 0267 2ppho41 . sup . 3 0 . 1986 0 . 0556 3pstbkphoa # 81 0 . 2796 0 . 0813 4ppho21 . sup . 4 0 . 4174 0 . 1145 7pstbkphoa # 116 0 . 5314 0 . 1478 9ppho31 . sup . 5 0 . 5396 0 . 0869 9pst116pho 0 . 7760 0 . 1272 13______________________________________ . sup . 1 micromoles of pnitrophenol / min / o . d .. sub . 600 cells . sup . 2 same stii variant as pstiilys . sup . 3 same stii variant as pstiibk # 131 . sup . 4 same stii variant as pstiic . sup . 5 wildtype stii + mlui site , last codon gcc . the plasmids used in these examples were all very similar in design as described above . rather than describe in detail each construction , the expression plasmids are described here in general terms . although a different polypeptide of interest was expressed in each example , the only significant variation between these constructions was the nucleotide sequence following the 3 &# 39 ; end of each coding region . thus , for descriptive purposes , these plasmids were loosely grouped into the following two categories based on their 3 &# 39 ; sequence : category a : within about 25 bp 3 &# 39 ; to the termination codon of each gene of interest began the sequence encoding the transcriptional terminator described by scholtissek and grosse ( nucleic acids res . 15 ( 7 ): 3185 ( 1987 )) followed by the tetracycline resistance gene of pbr322 ( sutcliffe , cold spring harb symp ouant biol 43 : 77 - 90 ( 1978 )). examples in this category included plasmids designed for the secretion of mature ngf ( ullrich et al ., nature 303 : 821 - 825 ( 1983 )), mature tgf - β1 ( derynck et al ., nature 316 : 701 - 705 ( 1985 )) and domains 1 and 2 of icam - 1 ( staunton et al ., cell 52 : 925 - 933 ( 1988 )). a schematic representation of these plasmids is given in fig1 . category b : examples in this category included plasmids designed for the secretion of mature vegf ( leung et al ., science 246 : 1306 - 1309 ( 1989 )), mature nt3 ( jones et al ., proc . natl . acad . sci . u . s . a . 87 : 8060 - 8064 ( 1990 ), rantes ( schall et al ., j immunol 141 ( 3 ): 1018 - 1025 ( 1988 )), and phoa . the termination codon in each of these plasmids is followed in the 3 &# 39 ; direction by a segment of untranslated dna ( vegf : approximately 43 bp ; mature nt3 : approximately 134 bp ; rantes : approximately 7 bp ; phoa : approximately 142 bp ). following this 3 &# 39 ; untranslated region , the sequence of pbr322 was re - initiated beginning with either the hindiii site ( as in the mature nt3 secretion plasmid ) or the bamhi site ( phoa , vegf , rantes secretion plasmids ). a schematic representation of the plasmids included in this category is illustrated in fig1 . these plasmids were used to transform the host e . coli strain 27c7 . transformant colonies were inoculated into 3 - 5 ml lb + carbenicillin ( 50 μg / ml ). the cultures were grown at 37 ° c . with shaking for 3 - 8 hours . the cultures were then diluted 1 : 100 into 3 ml low phosphate medium ( chang et al ., supra ) and grown for about 20 hours with shaking at 37 ° c . for each culture , an 0 . 5 od 600 aliquot was centrifuged in a microfuge tube . each 0 . 5 od 600 pellet was then prepared for gel analysis as follows . each pellet was resuspended in 50 μl te ( 10 mm tris ph7 . 6 , 1 mm edta ). after the addition of 10 μl 10 % sds , 5 μl reducing agent ( 1m dithiothreitol or 1m β - mercaptoethanol ), the samples were heated at about 90 ° c . for 2 minutes and then vortexed . samples were allowed to cool to room temperature , after which 500 μl acetone was added . the samples were vortexed and then left at room temperature for about 15 minutes . samples were centrifuged for 5 minutes . the supernatants were discarded , and the pellets resuspended in 20 μl water , 5 μl reducing agent , 25 μl novex 2x sample buffer . samples were heated at about 90 ° c . for 3 - 5 minutes , then vortexed . after centrifugation for 5 minutes , supernatants were transferred to clean tubes and the pellets discarded . 5 - 10 μl of each sample was loaded onto 10 well , 1 . 0 mm novex manufactured gel ( san diego , calif .) and electrophoresed for 1 . 5 - 2 hr at 120 volts . gels were stained with coomassie blue to visualize polypeptide ( fig1 - 21 ). to provide further quantitation of the results , some gels were analyzed by densitometry . these results are displayed in table 2 below . both the polypeptide gels and the densitometry results indicate that the heterologous polypeptides tested were consistently secreted more efficiently when an stii variant of reduced translational strength was used to direct secretion of that polypeptide . table 2______________________________________examples of improved polypeptide secretion by tirmodification : densitometer scans of polypeptide gels amount secreted tir ( relative (% total hostpolypeptide strength ) polypeptide ) ______________________________________vegf 9 0 . 6 3 5 . 9ngf 9 1 . 6 7 1 . 8 4 5 . 7 1 5 . 5rantes 9 0 . 3 9 0 . 2 7 0 . 4 4 3 . 9 3 3 . 6 2 3 . 5 1 * 1 . 6 1 1 . 7tgf - β1 7 1 . 7 3 9 . 2______________________________________ * pstbkphoa # 86 signal sequence __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 23 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 88 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 1 : gcatgtctagaattatgaaraaraayathgcnttyctnctngcntcnatg50ttygtnttytcnathgctacaaacgcgtatgccactct88 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 36 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 2 : ttcagcaccgcacagagtggcatacgcgtttgtagc36 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 82 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 3 : ctagaattatgaaaaagaatatcgcatttcttcttgcatctatgttcgtt50ttttctattgctacaaacgcgtatgccactct82 ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 75 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 4 : gtggcatacgcgtttgtagcaatagaaaaaacgaacatagatgcaagaag50aaatgcgatattctttttcataatt75 ( 2 ) information for seq id no : 5 :( i ) sequence characteristics :( a ) length : 67 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 5 : ctagaattatgaagaagaatatcgcatttcttcttgcatctatgttcgtt50ttttctattgctacaaa67 ( 2 ) information for seq id no : 6 :( i ) sequence characteristics :( a ) length : 67 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 6 : cgcgtttgtagcaatagaaaaaacgaacatagatgcaagaagaaatgcga50tattcttcttcataatt67 ( 2 ) information for seq id no : 7 :( i ) sequence characteristics :( a ) length : 79 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 7 : cgcgtatgcccggacaccagaaatgcctgttctggaaaaccgggctgctc50agggcgatattactgcacccggcggtgct79 ( 2 ) information for seq id no : 8 :( i ) sequence characteristics :( a ) length : 71 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 8 : ccgccgggtgcagtaatatcgccctgagcagcccggttttccagaacagg50catttctggtgtccgggcata71 ( 2 ) information for seq id no : 9 :( i ) sequence characteristics :( a ) length : 83 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 9 : gcatgtctagaattatgaaraaraayathgcntttcttcttgcatctatg50ttcgttttttctattgctacaaacgcgtatgcc83 ( 2 ) information for seq id no : 10 :( i ) sequence characteristics :( a ) length : 27 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 10 : agtggcatacgcgtttgtagcaataga27 ( 2 ) information for seq id no : 11 :( i ) sequence characteristics :( a ) length : 79 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 11 : ctagaggttgaggtgattttatgaaaaaaaacatcgcatttcttcttgca50tctatgttcgttttttctattgctacaaa79 ( 2 ) information for seq id no : 12 :( i ) sequence characteristics :( a ) length : 79 bases ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : seq id no : 12 : cgcgtttgtagcaatagaaaaaacgaacatagatgcaagaagaaatgcga50tgttttttttcataaaatcacctcaacct79 ( 2 ) information for seq id no : 13 :( i ) sequence characteristics :( a ) length : 506 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 13 : gaattcaacttctccatactttggataaggaaatacagacatgaaaaatc50tcattgctgagttgttatttaagcttgcccaaaaagaagaagagtcgaat100gaactgtgtgcgcaggtagaagctttggagattatcgtcactgcaatgct150tcgcaatatggcgcaaaatgaccaacagcggttgattgatcaggtagagg200gggcgctgtacgaggtaaagcccgatgccagcattcctgacgacgatacg250gagctgctgcgcgattacgtaaagaagttattgaagcatcctcgtcagta300aaaagttaatcttttcaacagctgtcataaagttgtcacggccgagactt350atagtcgctttgtttttattttttaatgtatttgtaactagtacgcaagt400tcacgtaaaaagggtatctagaggttgaggtgattttatgaaaaagaata450tcgcatttcttcttgcatctatgttcgttttttctattgctacaaatgcc500tatgca506 ( 2 ) information for seq id no : 14 :( i ) sequence characteristics :( a ) length : 23 amino acids ( b ) type : amino acid ( d ) topology : linear ( xi ) sequence description : seq id no : 14 : metlyslysasnilealapheleuleualasermetphevalphe151015serilealathrasnalatyrala2023 ( 2 ) information for seq id no : 15 :( i ) sequence characteristics :( a ) length : 90 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 15 : tctagaggttgaggtgattttatgaaaaagaatatcgcatttcttcttgc50atctatgttcgttttttctattgctacaaaygcstatgcm90 ( 2 ) information for seq id no : 16 :( i ) sequence characteristics :( a ) length : 78 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 16 : tctagaattatgaaaaagaatatcgcatttcttcttgcatctatgttcgt50tttttctattgctacaaacgcgtatgcm78 ( 2 ) information for seq id no : 17 :( i ) sequence characteristics :( a ) length : 78 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 17 : tctagaattatgaagaagaatattgcgttcctacttgcctctatgtttgt50cttttctatagctacaaacgcgtatgcm78 ( 2 ) information for seq id no : 18 :( i ) sequence characteristics :( a ) length : 78 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 18 : tctagaattatgaagaagaatatcgcatttcttcttgcatctatgttcgt50tttttctattgctacaaacgcgtatgcm78 ( 2 ) information for seq id no : 19 :( i ) sequence characteristics :( a ) length : 78 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 19 : tctagaattatgaaaaaaaacatcgcatttcttcttgcatctatgttcgt50tttttctattgctacaaacgcgtatgcm78 ( 2 ) information for seq id no : 20 :( i ) sequence characteristics :( a ) length : 78 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 20 : tctagaattatgaaaaaaaacattgcctttcttcttgcatctatgttcgt50tttttctattgctacaaacgcgtatgcm78 ( 2 ) information for seq id no : 21 :( i ) sequence characteristics :( a ) length : 78 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 21 : tctagaattatgaagaaaaacatcgcttttcttcttgcatctatgttcgt50tttttctattgctacaaacgcgtatgcm78 ( 2 ) information for seq id no : 22 :( i ) sequence characteristics :( a ) length : 78 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 22 : tctagaattatgaaaaagaacatagcgtttcttcttgcatctatgttcgt50tttttctattgctacaaacgcgtatgcm78 ( 2 ) information for seq id no : 23 :( i ) sequence characteristics :( a ) length : 90 bases ( b ) type : nucleic acid ( c ) strandedness : double ( d ) topology : linear ( xi ) sequence description : seq id no : 23 : tctagaggttgaggtgattttatgaaaaaaaacatcgcatttcttcttgc50atctatgttcgttttttctattgctacaaacgcgtatgcm90__________________________________________________________________________ | 2 |
we first give a brief description of an ofdm system that uses our invention , and then provide a detailed description of the method and system according to our invention . fig1 shows a baseband equivalent representation of an ofdm system 100 that uses our invention . the system includes a transmitter 101 coupled to a receiver 102 by a wireless multipath fading channel 103 . in the following description , we consider one ofdm symbol at a time for the reason justified below . each serial input data symbol of the input data 111 is converted 110 into m parallel data streams 112 , where m is the size of the ofdm symbol . each data stream is modulated 120 according to phase and amplitude modulation schemes , such as qpsk , 16qam or 64qam . the modulated complex data symbols x ( 0 ), . . . , x ( m − 1 ) 121 are transformed by an inverse fast fourier transform ( ifft ) 130 , and the parallel outputs , x ( 0 ), . . . , x ( m − 1 ) 131 are converted 140 back to serial data ( symbols ) 141 for transmission . guard intervals are inserted 150 between the symbols . the guard interval can include cyclic prefix pilot signals . the ofdm symbols are transferred over the multipath fading channel 103 to the receiver 102 . the frequency response ( h ) of the multipath fading channel represents the channel characteristics in the frequency domain , and the impulse response ( h ) represents the channel characteristics in the time domain . the channel is subject to additive white gaussian noise ( awgn ) 155 . in the receiver 102 , the guard intervals are removed 160 . when the intervals are longer than the spread of the channel delay , removing the guard intervals eliminates intersymbol interference ( isi ) between ofdm symbols . therefore , our system can be analyzed based on just one ofdm symbol . after converting 170 the serial data 171 to m parallel data streams , a spectral decomposition of the received symbols y ( 0 ), . . . , y ( m − 1 ) 172 is determined by a fft 180 , and the recovered complex data symbols , y ( 0 ), . . . , y ( m − 1 ) 181 are demodulated 190 and restored 195 in serial order to output data symbols 199 . the output of the multipath fading channel 103 , that is the received signal , can be expressed as : y ( k ) = ∑ l = 0 l - 1 h l , k x ( k - l ) + n ( k ) , ( 1 ) where l is the length of the channel memory , k − l is the channel response at symbol time k due to an impulse applied at symbol time k l , and n ( k ) is the additive white gaussian noise ( awgn ) 155 . we assume that the fading in the channel 103 is slow , i . e ., the channel is substantially constant during one ofdm symbol time . this assumption is valid as long as f d t ≦ 0 . 01 is satisfied , where f d is the maximum doppler frequency , and t is the length of the ofdm symbol interval . if the input data rate is r bits / second and the number of sub - channels is m , then for qpsk modulation , we have t = 2m / r . for a transmitter or receiver moving at speed v , the maximum doppler frequency is f d = f c v / c , where f c is the carrier frequency and c is the speed of light . with these assumptions , the relationship that we need to satisfy the slow fading assumption is : for example , if the data rate is 2 mbps and the transmitter is traveling at 66 mph with respect to the receiver , and the carrier frequency is 1 ghz , then it is safe to assume a constant channel during one ofdm symbol time as long as we choose the number of sub - channels to be less than a hundred . under the above assumption , our channel model can be expressed as : y ( k ) = ∑ l = 0 l - 1 h l x ( k - 1 ) + n ( k ) , 0 ≤ k ≤ m - 1 . ( 3 ) cyclic prefix pilot signals can be used for the guard intervals in order to avoid intercarrier interference in a multipath channel . the ofdm symbol with the cyclic prefix of length n can be written as : x (− n ), . . . , x (− n ), . . . , x (− 1 ), x ( 0 ), . . . , x ( m − 1 ), x ( m - n ) = 1 m ∑ m = 0 m - 1 x ( m ) exp j2π ( m - n ) m m = 1 m ∑ m = 0 m - 1 x ( m ) exp j2π ( - n ) m m , y ( m ) = ∑ k = 0 m - 1 y ( k ) exp - j2π k m m , 0 ≤ m ≤ m - 1 , ( 5 ) y ( m ) = ∑ l = 0 l - 1 h l 1 m ∑ i = 0 m - 1 x ( i ) exp - j2π il m ∑ k = 0 m - 1 exp j2π k ( i - m ) m + n ( m ) ( 6 ) = ∑ l = 0 l - 1 h l exp - j2π m l m x ( m ) + n ( m ) , 0 ≤ m ≤ m - 1 , ( 7 ) where n ( 0 ), . . . , n ( m − 1 ) are the fourier transform of n ( 0 ), . . . , n ( m − 1 ), which are independent and identically distributed ( i . i . d .) gaussian random variables . equation ( 7 ) can also be written in terms of the impulse response of the channel , which implies y ( m )= h ( m ) x ( m )+ n ( m ), 0 ≦ m ≦ m − 1 . ( 8 ) notice that equation ( 4 ) will not hold when the guard intervals do not use the cyclic prefix . thus , y ( m ) in equation ( 7 ) depends on x ( m ) and other x ( i ), where ( i ≠ m ). our goal is to estimate the impulse response of the channel 103 . the channel frequency parameters h ( 0 ), . . . , h ( m − 1 ) are correlated . however , the impulse response parameters h 0 , . . . , h l − 1 are independent , and the number of parameters in the time domain is smaller than that in the frequency domain . therefore , it is appropriate to apply a maximum likelihood ( ml ) approximation to equation ( 7 ), i . e ., find the ml estimate of the channel &# 39 ; s impulse response in the time domain . according to the invention , we use the joint maximum likelihood estimation of the channel &# 39 ; s impulse response and the estimated transmitted signal . to simplify notation , we use x , h and y to represent the estimated transmitted signal , the impulse response of the channel , and the received signal , respectively . the joint likelihood function of the received signal y given x and h is f ( y _ ❘ x _ , h _ ) = 1 ( 2 πσ 2 ) m exp { - ∑ m = 0 m - 1 y ( m ) - ∑ l = 0 l - 1 h l exp - j2π m l m x ( m ) 2 2 σ 2 } , ( 9 ) where σ 2 is the noise variance . we need to find h and x which jointly maximize f ( y | x , h ), or equivalently , we need to minimize a distance cost function d ( h _ , x _ ) = ∑ m = 0 m - 1 y ( m ) - ∑ l = 0 l - 1 h l exp - j2π m l m x ( m ) 2 . ( 10 ) a maximum likelihood ( ml ) channel estimation procedure 200 according to the invention is described with reference to fig2 . the procedure 200 performs two inverse fast fourier transforms ( iffts ) 210 – 211 of size m on corresponding correlations of the combinations 215 of the detected signal x 201 and the received signal y 202 . in other words , the detected signal is correlated with itself and with the received signal . two discrete fourier transform ( dft ) of size l 220 – 221 operate on the output of the iffts 210 – 211 , and an inverse dft 230 produces the channel estimate h 209 from the quotients of the dfts 220 – 221 . the effect of the channel noise 155 is reduced by dropping off the outputs of the ifft 214 , 216 with indexes larger than the maximum channel length or the length of the guard interval adjacent to the ofdm symbol . note that only the first l outputs of 210 and 211 , which are lines 214 and 216 , are connected to the dfts 220 and 221 . therefore , the dfts are only performed on the remaining outputs of the ifft 210 – 211 . the steps shown in dashed block 240 can be replaced by a division of a constant c for constant modulus signals . let h l = a l + j bl be for 0 ≦ 1 ≦ l − 1 . if we know the transmitted signal x 201 , we can solve for h l by ∂ d ( h _ , x _ ) ∂ a l ❘ h _ = h _ ^ = 0 ( 11 ) ∂ d ( h _ , x _ ) ∂ b l ❘ h _ , h _ ^ = 0 , ( 12 ) ∑ l = 0 l - 1 a ^ l ℛ { s ( k - l ) } - ∑ l = 0 l - 1 b ^ l ?? { s ( k - l ) } = ℛ { z ( k ) } , 0 ≤ k ≤ l - 1 , and ( 13 ) ∑ l = 0 l - 1 a ^ l ?? { s ( k - l ) } + ∑ l = 0 l - 1 b ^ l ℛ { s ( k - l ) } = ?? { z ( k ) } , 0 ≤ k ≤ l - 1 , ( 14 ) ∑ l = 0 l - 1 h ^ l s ( k - l ) = z ( k ) , 0 ≤ k ≤ l - 1 , ( 15 ) where z ( k ) 214 and s ( k ) 216 are defined as the inverse fourier transforms 210 – 211 of z ( m )= x *( m ) y ( m ), 204 0 ≦ m ≦ m − 1 , and ( 16 ) s ( m )=| x ( m )| 2 , 206 0 ≦ m ≦ m − 1 ( 17 ) respectively . the symbol * denotes the complex conjugate . if we take discrete fourier transform ( dft ) 220 – 221 of size l on both sides of equation ( 15 ), we have ĥ ( l ) ( l ) s ( l ) ( l )= z ( l ) ( l ), 0 ≦ l ≦ l − 1 , ( 18 ) where the superscript ( l ) denotes the size of dft to distinguish from the previous fft and ifft , which are all of size m . thus , ĥ ( l ) can be obtained as the size l inverse dft ( idft ) 230 of z ( l ) ( l )/ s ( l ) ( l ) for 0 ≦ l ≦ l − 1 , i . e ., for constant modulus signals , we have | x ( m )| 2 = c for all m , where c is a constant . ĥ k = z ( k )/ c , 0 ≦ k ≦ l − 1 . ( 21 ) hence , for given x , the ml estimate of the channel ĥ k 209 is the solution given by equation ( 19 ) or ( 21 ). one problem is the unknown channel memory length l . however , because the system requires that the channel memory be less than the length of the guard intervals , we can set l to be the length of one guard interval , i . e ., l = n . a signal detection procedure 300 according to the invention is described with reference to fig3 . for a given channel impulse response h 301 or frequency response h 302 obtained from a fast fourier transform 310 , the ml estimate of the transmitted signals can be solved by { circumflex over ( x )} ( m )= arg min x ={ circumflex over ( x )} { d ( h , x )}= y ( m )/ h ( m ), 0 ≦ m ≦ m − 1 ( 22 ) the signals { circumflex over ( x )}( 0 ), . . . , { circumflex over ( x )}( m − 1 ) 312 are then passed through a hard decision block 320 , which generates the estimated signals { tilde over ( x )}( 0 ), . . . , { tilde over ( x )}( m − 1 ) 309 . as shown in fig4 , the channel estimation 200 and signal detection 300 procedures described above can be used iteratively to form a joint channel estimation and signal detection system 400 . the channel estimation and signal detection blocks shown in fig4 indicate the systems shown in fig2 and 3 , respectively . we can use the pilot signals to get an initial estimate ĥ ( 1 ) 209 of the impulse response of the multipath fading channel that minimizes the distance cost function d ( h , x ( 0 ) ), i . e ., { circumflex over ( h )} ( 1 ) = arg min h { d ( h , x ( 0 ) )}, ( 23 ) where the distance cost function d ( h , x ( 0 ) ) is defined by in this step , the input signals y to channel estimation 200 are part of the received signals , i . e ., y ( 0 ), y ( 4 ), . . . y ( m − 4 ), and the pilot signals , i . e . and the ifft 210 – 211 are of size m / 4 . fig5 shows ofdm signals with pilot signals . each column in fig5 represents an ofdm symbol , where “ x ” 501 indicates a pilot signal and “ o ” 502 represents a data signal . set ĥ ( 1 ) 209 to be the final estimation of the impulse response of the channel obtained from the previous ofdm symbol . given the initial channel estimate { circumflex over ( h )} ( i ) 209 , estimate the transmitted signal { circumflex over ( x )} ( i ) 312 that minimizes the cost function d ( ĥ ( i ) , x ), i . e ., { circumflex over ( x )} ( i ) = arg min x { d ({ circumflex over ( h )} ( i ) , x )}, ( 24 ) and output the hard decision { tilde over ( x )} ( i ) 309 . given the estimate of the detected signal { tilde over ( x )} ( i ) 309 , update for those portions corresponding to the pilot signals and re - estimate the channel impulse response { circumflex over ( h )} ( i + 1 ) 209 that minimizes the cost function d ( h ,{ tilde over ( x )} ( i ) ) i . e ., { circumflex over ( h )} ( i + 1 ) = arg min h { d ( h , { tilde over ( x )} ( i ) )} . ( 25 ) measure the difference between two successive estimates |{ circumflex over ( h )} ( i + 1 ) −{ circumflex over ( h )} ( i ) |. if the difference is less than a predetermined threshold , terminate and output as a final decision the estimated transmitted symbol { tilde over ( x )} ( i ) 409 , otherwise , increment i and repeat steps c to e . we determine the performance of our system by a simulation . in the simulation , we use 64 sub - channels with qpsk modulation on each of sub - channel . the bit error rate ( ber ) under a two - path slow rayleigh fading channel , and a three - path slow rayleigh fading channel are shown in fig6 a and 6 b , respectively , where the two - path and the three - path channels are h ( z )= 0 . 8α 0 e jθ 0 + 0 . 6α 1 e jθ 1 z − 1 ( 26 ) h ( z )= 0 . 408α 1 e jθ 0 + 0 . 816α 1 e jθ 1 z − 1 + 0 . 408α 2 e jθ 2 z − 2 , ( 27 ) respectively . the values α 0 , α 1 , and α 2 are the i . i . d . random variables with rayleigh distribution , and θ 0 , θ 1 , and θ 2 are the i . i . d . random variables with uniform distribution . the ber performance is compared with ideal cases , where the channel parameters are exactly known at the receiver . fig6 a – b show that after the first iteration , the ber performance of our method is within 0 . 3 db of that of the ideal cases where the actual channel parameters are known . although the described method and system according to our invention can use the pilot signals to start the iteration procedure , we do not have to rely completely on the precision of the pilot signals . in prior art , imprecise pilot signals can cause larger errors , or more iterations . the final result of our channel estimation and signal detection method mainly depends on the detected signals of the previous iteration . a greater number of pilot signals will give a more precise initial channel estimation . however , we can relax the requirement on the number of the pilot signals , in which case we can still apply the ml technique , in exchange for more transmitted data signals and thus improved spectral efficiency . our invention can be combined with channel error correction codes as shown in fig7 . the output 309 of the signal detection block 300 is used as the input to a decoding block 710 of error correction codes , and the decoding output 711 is used as the input signal to update the channel estimate 200 . for systems with error correction codes , the final decision 720 of the system according to the invention is better than the case without error correction codes , because at each iteration , a much better reference signal is available for updating the estimate of the channel . this invention is described using specific terms and examples . it is to be understood that various other adaptations and modifications may be made within the spirit and scope of the invention . therefore , it is the object of the appended claims to cover all such variations and modifications as come within the true spirit and scope of the invention . | 7 |
in describing preferred embodiments illustrated in the drawings , specific terminology is employed for the sake of clarity . however , the disclosure of this patent specification is not intended to be limited to the specific terminology so selected and it is to be understood that each specific element includes all technical equivalents that operate in a similar manner . referring now to the drawings , wherein like reference numerals designate identical or corresponding parts throughout the several views , particularly to fig6 a and 6b , a toner transfer apparatus according to an exemplary embodiment of the present invention is described . fig6 a is a view for explaining a method and an apparatus for transferring toner according to the present invention . as shown in fig6 a , an exemplary toner transfer apparatus 100 includes a toner storage container 70 having a drum shape , a lid 71 , arranged in an openable and closable manner , which serves as a sealing mechanism , a toner fluidization mechanism 73 , a toner transfer mechanism 76 , and a hole 78 . the toner fluidization mechanism 73 is enlarged in fig6 b . as shown in fig6 , the toner fluidization mechanism includes a circular tube 73 a , a plurality of grid pipes 73 b , a plurality of air blow parts 73 c , and an air tube 73 d for fluidizing toner . the toner transfer mechanism 76 includes a toner transfer tube 76 a and a toner suction member 76 b . the plurality of grid pipes 73 b are arranged in a matrix in an inner area of the circular tube 73 a , and are connected to the circular pipe 73 a . also , the plurality of grid pipes 73 b are connected to each other at crossing points thereof . the air blow part 73 c includes a sintered body formed by sintering an inorganic granular material so that a micropore for connection is created . the plurality of air blow parts 73 c are properly arranged under the circular tube 73 a and the grid pipe 73 b . the air tube 73 d for fluidizing toner is arranged at a single point on the circular tube 73 a . alternatively , the air tube 73 d may be arranged at a plurality of points on the circular tube 73 a . the toner transfer mechanism 76 is supported by the toner fluidization mechanism 73 , and the toner transfer tube 76 a is branched at a front portion , and each front of branches is provided with the toner suction member 76 b . the toner transfer mechanism 76 discharges toner stored in the toner storage container 70 and transfers the toner to a different location . the toner storage container 70 does not necessarily have a drum shape . any container suitable for storing toner may be used . for example , it is preferable that an area of an opening does not greatly change along a change in a surface level of stored toner as the toner is discharged and reduced . the lid 71 of the toner storage container 70 may be pivotable with a hinge . alternatively , the lid 71 may be laterally slidable . the lid 71 includes a top plate provided with the hole 78 for putting the air tube 73 d for fluidizing toner and the toner transfer tube 76 a therethrough . the toner fluidization mechanism of the toner transfer apparatus 100 according to an exemplary embodiment of the present invention is not limited to the toner fluidization mechanism 73 . further preferably , the toner fluidization mechanism 73 has such a structure that the toner fluidization mechanism 73 sinks in toner deposit stored in the toner storage container 70 after being arranged therein to uniformly fluidize the toner deposit by a method such as aeration and vibration , and that the angle of the toner fluidization mechanism 73 does not change to prevent toppling of the toner fluidization mechanism 73 along with reduction of the toner deposit . for example , the toner fluidization mechanism 73 may have a thin bottom having an area similar to the horizontal cross section of the toner storage container 70 so that the toner fluidization mechanism 73 does not topple . alternatively , the toner fluidization mechanism 73 may be provided with a bar member having a top which contacts an inner wall of the toner storage container 70 when the toner fluidization mechanism 73 tilts so that the toner fluidization mechanism 73 does not topple . alternatively , the toner fluidization mechanism 73 may be provided with a guide bar described below , or may have , for example , a cylindrical shape so that an attitude thereof does not change even when the toner fluidization mechanism 73 topples . it is preferable that the toner fluidization mechanism 73 includes a through - hole so that the toner fluidization mechanism 73 can be easily buried into toner deposit . in the method of transferring toner by using the exemplary toner transfer apparatus 100 according to an exemplary embodiment of the present invention , the toner fluidization mechanism 73 is put in the toner storage container 70 previously storing toner together with the toner transfer mechanism 76 . the air tube 73 d and the toner transfer tube 76 a are loosely inserted to the hole 78 . then , the lid 71 is closed , and the toner fluidization mechanism 73 is activated to evenly fluidize the toner in the toner storage container 70 . the toner transfer mechanism 76 is activated to suction and transfer the toner from a fluidized surface thereof . according to an exemplary embodiment of the present invention , the toner fluidization mechanism 73 is arranged on a surface of powder toner deposit stored in the toner storage container 70 , and , in a next step , is buried into the deposit from the surface , thereby ejecting fluidization gas only in the deposit so that the toner is efficiently fluidized . at the same time , the toner to be transferred into a different location may be prevented from being stirred up , and an operation for transporting the toner from the toner storage container 70 into a filling apparatus may be omitted . further , fluidized toner may be directly discharged from the toner storage container 70 and be transferred into a different location . the different location refers to , for example , a toner container such as toner bottles and toner cartridges or a developer container in a development mechanism of an electronographic copier . it is preferable that the toner fluidization mechanism 73 according to an exemplary embodiment of the present invention has an apparent density not less than the apparent powder density of toner deposit so that the toner fluidization mechanism 73 can be easily buried into the toner deposit from a surface of the toner deposit in the toner storage container 70 . such a toner fluidization mechanism 73 is conventionally known as a porous member for even ventilation . the toner fluidization mechanism 73 is , in general , connected to a vent pipe ( e . g . a flexible vent pipe ), and gas for fluidizing toner is externally introduced through the vent pipe . the vent pipe is held by , for example , a hand , and the toner fluidization mechanism 73 may be externally inserted into the toner storage container 70 and arranged on the surface of the toner deposit in the toner storage container 70 , and the toner fluidization mechanism 73 after being used may be removed from the toner storage container 70 . in other words , the toner fluidization mechanism 73 and the vent pipe may be integrally formed ( i . e . the vent pipe may be flexible , and , of course , is attachable to and detachable from the toner fluidization mechanism 73 ). therefore , the surface of the toner deposit on which the toner fluidization mechanism 73 is arranged is applied with a weight of the toner fluidization mechanism 73 ( which may preferably be a porous structure having connected holes ) and a partial weight of the vent pipe ( i . e . the porous structure ). in an exemplary embodiment of the present invention , the toner fluidization mechanism 73 is inserted to the toner storage container 70 storing the powder toner , arranged on the surface of the toner deposit , and , then , preferably enters and is buried into the toner deposit . the entry , in general , gradually progresses by , for example , vibration . the entry of the toner fluidization mechanism 73 into the toner deposit is preferably performed before fluidizing the powder toner by externally supplying fluidization gas to the toner fluidization mechanism 73 in the toner storage container 70 , during the fluidization of the powder toner , during a step of performing suction and discharge of the fluidized powder toner from the toner storage container 70 , or , while the fluidized powder toner is transferred to a different location . more preferably , the entry of the toner fluidization mechanism 73 into the toner deposit takes place before the fluidization gas is externally supplied to the toner fluidization mechanism 73 in the toner storage container 70 to fluidize the powder toner while preventing the toner from being stirred up due to commencement of aeration . at the same time , it is preferable that the entry of the toner fluidization mechanism 73 into the toner deposit takes place also in the step of performing the suction and discharge of the fluidized powder toner from the toner storage container 70 so that the toner fluidization mechanism 73 can keep the depth even when the surface level of the toner deposit falls with time . the toner fluidization mechanism 73 is preferably buried at a depth in which a top portion thereof is covered by a toner layer , although the sufficient depth may not be completely determined because the stirring up of the toner depends on intensity of aeration ( such as ventilation pressure , quantity of airflow , and an aeration zone ), and distribution and diameters of holes of the porous member of the toner fluidization mechanism 73 . in an exemplary embodiment of the present invention , as the toner fluidization mechanism 73 ejects air into the toner , the toner fluidization mechanism 73 enters into the toner deposit by self - weight . further , the toner fluidization mechanism 73 preferably includes a vibration generation apparatus 77 , as shown in fig6 b . as the vibration generation apparatus 77 included in the toner fluidization mechanism 73 vibrates , the toner fluidization mechanism 73 enters into the toner deposit by self - weight . the entry of the toner fluidization mechanism 73 into the toner deposit is achieved by self - weight of the toner fluidization mechanism 73 due to fluidization of the toner deposit . for smoother entry , it is preferable that the toner fluidization mechanism 73 is vibrated in addition to the fluidization of the toner deposit . generating vibration is particularly preferable at a first stage in which the toner deposit has not yet been fluidized . ultrasonics may be used as a means for vibrating the toner fluidization mechanism 73 , for which airflow into the toner deposit may be preferably used . ultrasonics may apply vibration to the entire toner storage container 70 . alternatively , the toner fluidization mechanism 73 may be provided with an ultrasonic transmission mechanism ( e . g . a strained steal mesh ) so that ultrasonics can apply vibration only to the toner fluidization mechanism 73 . in the case , apparent density of the toner fluidization mechanism 73 increases . further , intermittent ventilation is preferably used to apply vibration to the toner fluidization mechanism 73 . a preferred embodiment and a preferred frequency for the application of vibration are described below in detail . when the frequency of vibration is too low , sufficient entry may not be achieved . when the frequency of vibration is too high , external additive may be separated from toner particles . powder toner for use with the toner transfer apparatus 100 generally has a volume average particle size of 2 . 5 to 15 . 0 μm , an absolute specific gravity of 1 . 02 to 1 . 45 , and an apparent powder density of 0 . 20 to 0 . 90 g / cm 3 , and includes external additives . it is preferable that the powder toner increases in volume by a factor of 1 . 2 to 15 . 0 in the toner storage container 70 due to ventilated fluidization . further , it is preferable that in the step of arranging the toner fluidization mechanism 73 on the surface of the toner deposit , the toner fluidization mechanism 73 is arranged on the surface of the toner deposit in the toner storage container 70 at a slant in a range of ± 30 degrees from a horizontal position . the toner fluidization mechanism 73 is arranged at a slant of , preferably , ± 30 degrees , more preferably , ± 2 to ± 20 degrees , and even more preferably , ± 2 to ± 5 degrees ( i . e . kept substantially horizontal ) against the toner storage container 70 so that fluidization conditions on the toner surface may be kept uniform . further , when the toner fluidization mechanism 73 enters the toner deposit at an angle in the above slant angle ranges , the toner fluidization mechanism 73 keeps entering to a bottom of the toner storage container 70 without contacting a wall of the toner storage container 70 . as described above , the toner fluidization mechanism 73 is preferably able to easily achieve an airflow rate of 2 . 0 to 18 . 0 l / min , more preferably , 5 . 0 to 15 . 0 l / min , and even more preferably , 8 . 0 to 13 . 0 l / min . further , the toner fluidization mechanism 73 is preferably able to easily achieve an air pressure of 0 . 01 to 0 . 5 mpa , more preferably , 0 . 03 to 0 . 3 mpa , and even more preferably , 0 . 05 to 0 . 25 mpa . since toner is transported from a factory by a motortruck , while being shaken in a container during the transport , the container is filled with the toner at higher density than the density upon factory shipment due to the shake . as a result , the surface of the toner becomes considerably hard , making it difficult for the toner fluidization mechanism 73 to sediment depending on a toner condition even when the surface is simply fluidized . to solve the above difficulty , vibration is applied to the toner fluidization mechanism 73 so that the toner fluidization mechanism 73 can enter into in the toner storage container 70 even when the surface of the toner is hardened during the transport . it is preferable that the frequency is 300 to 40 , 000 vibrations per minute , more preferably , 10 , 000 to 30 , 000 vibrations per minute , and even more preferably , 20 , 000 to 25 , 000 vibrations per minute . the vibration generation apparatus 77 is preferably located at a position 0 . 5 to 50 . 0 mm higher than a position of the toner fluidization mechanism 73 . in order to vibrate the toner , it is preferable that the toner fluidization mechanism 73 is provided with the vibration generation apparatus 77 at approximately the center thereof , and a housing holding the toner fluidization mechanism 73 is formed of a metal or the like which better transmits vibration . vibration may be applied by a motor , air , or the like . using the air valve of the toner fluidization mechanism 73 to apply vibration allows sharing of the unit with the toner fluidization mechanism 73 , and the facility is prevented from being complicated . pressure of an air vibrator is 0 . 05 to 5 . 0 mpa , preferably , 0 . 1 to 2 . 5 mpa , and more preferably , 0 . 15 to 2 . 0 mpa . the sediment speed of the toner fluidization mechanism 73 may be controlled by changing a vibration condition . the toner fluidization mechanism 73 is provided with a guide bar for causing the toner fluidization mechanism 73 to vertically fall upon sediment . the guide bar prevents the toner fluidization mechanism 73 from hitting an internal wall of the toner storage container 70 and stopping due to shake of the toner transfer apparatus 100 . further , the toner transfer mechanism 76 is provided with a filter such as a stainless steal mesh having openings of 0 . 3 to 1 . 0 mm . the filter is provided to the toner suction member 76 b of the toner transfer mechanism 76 so that a foreign body included in the toner storage container 70 is prevented from being mixed into a toner container product . further , providing a protrusion to a lower part of the toner fluidization mechanism 73 prevents the toner fluidization mechanism 73 from reaching a bottom of the toner storage container 70 . as described above , the toner in a fluidized state has powder density of , for example , approximately 0 . 33 g / cc , and therefore the volume thereof is considerably smaller than those in background methods . the big difference between the present method and background methods is observed in a ventilation volume , in other words , air - intake . further , not pressurizing the powder toner upon transfer results in a decrease in stress imposed on the powder toner . further , as a presence of the fluidized bed improves transfer capacity of the powder toner , the transfer capacity thereof is three to four times the transfer capacity of simply ventilated toner powder . powder toner preferably used in the toner transfer apparatus 100 has a volume average particle size of 2 . 5 to 15 . 0 μm , more preferably 3 . 0 to 12 . 0 μm , and even more preferably 5 . 0 to 9 . 0 μm , and has an absolute specific gravity of 1 . 02 to 1 . 45 , and more preferably 1 . 1 to 1 . 3 . further , the powder toner preferably has a powder density of 0 . 20 to 0 . 90 g / cm 3 , and more preferably 0 . 35 to 0 . 85 g / cm 3 , and includes external additives . such powder toner achieves a remarkable effect . it is preferable to feed air in such an amount to increase the volume of the toner in the toner storage container 70 by 1 . 2 to 15 . 0 times , and preferably 1 . 5 to 5 . 0 times . further , when the quantity of air is introduced to transfer toner having powder density of , for example , approximately 0 . 47 g / cm 3 , the density of the toner immediately after the transfer is lowered to approximately 0 . 25 g / cm 3 . in detail , toner may be transferred at high density of up to approximately 0 . 35 g / cm 3 . in an exemplary embodiment of the present invention , since the pressure applied to the toner transfer apparatus 100 is not large , an electric power source with 24v to 220v can be used . a high - pressure cylinder can be used for ventilation , and a battery or natural energy such as solar and wind power can also be used . fig7 is a view for explaining a filling operation using the toner transfer apparatus 100 and the background filling apparatus 600 shown in fig5 . the toner storage container 70 shown in fig7 is provided with a roller 75 for easy transportation thereof . the toner storage container 70 is further provided with a joint 72 for connecting to a transfer tube extended from a different location ( e . g . a hopper of the background filling apparatus 600 ) so that toner may be transferred to the different location , and a tube station 74 for holding the air tube 73 d for fluidizing toner and the toner transfer tube 76 a . with the above configuration , since the toner may be transferred into the hopper of the background filling apparatus 600 from the toner storage container 70 , automation of toner transfer may be easily achieved . conventionally , toner needs to be carried in small - sized packets onto the background filling apparatus 600 , and the total amount of the toner to be carried is less than a half of a volume of the toner storage container 70 , which is at most 20 to 30 kg in a case the volume of the toner storage container 70 is approximately 80 kg . fig8 is an enlarged view for explaining exemplary fluidization of toner . in the example , the toner fluidization mechanism 73 ( shown in fig6 a and 6b ) includes a holding member 83 and a plurality of fluidization cylinders 82 as shown in fig8 . the fluidization cylinder 82 corresponds to the air blow part 73 c of the exemplary toner transfer apparatus 100 shown in fig6 a and 6b . one of the plurality of fluidization cylinders 82 fluidizes the toner within a range 81 . the fluidization range of the toner fluidization mechanism 73 is determined based on each range 81 . the configuration of the toner fluidization mechanism 73 is not limited to the configurations shown in fig6 a , 6 b , and 8 . fig9 a , 9 b , and 9 c illustrate examples of the toner fluidization mechanism 73 ( shown in fig6 a and 6b ). fig9 a illustrates an exemplary arrangement of the plurality of fluidization cylinders 82 in the toner transfer mechanism 73 . fig9 b illustrates the air blow part 73 c ( shown in fig6 a and 6b ) serving as a fluidized bed . fig9 c illustrates another exemplary arrangement in which the plurality of fluidization cylinders 82 are supported at left and right sides thereof so as to increase strength . in fig9 a , fluidization is performed along a circumference of the supporting member 83 having a circular shape . in fig9 b , fluidization is performed along a vertical direction . in fig9 c , fluidization is performed at a center and an outer circular part of the circular supporting member 83 . fig1 a illustrates an exemplary guide bar 90 provided to the toner fluidization mechanism 73 as described above . as shown in fig1 a , the toner fluidization mechanism 73 may be provided with the guide bar 90 and an exemplary guide stay 91 . using the guide bar 90 causes the toner fluidization mechanism 73 to vertically sediment in the toner storage container 70 even when the toner is reduced as the toner is transferred . using the guide bar 90 further prevents the toner fluidization mechanism 73 from hitting an internal wall of the toner storage container 70 and stopping . it is preferable that a joint of the toner fluidization mechanism 73 with the guide bar 90 includes rubber , vinyl , or a spring so that the vibration generated by the vibration generation apparatus 77 included in the toner fluidization mechanism 73 is efficiently transmitted only to the toner fluidization mechanism 73 . fig1 b illustrates an exemplary stainless steal mesh 92 provided to the toner transfer mechanism 76 ( shown in fig6 a and 6b ), which serves as the filter as described above . the stainless steal mesh 92 is provided to the toner suction member 76 b so that a foreign body included in the toner storage container 70 is prevented from being mixed into a toner container product . an exemplary filling operation was performed by using the exemplary toner transfer apparatus 100 as shown in fig6 a . the filling operation described below is an exemplary case , and does not limit a technical scope of the present invention . red toner having a weight of 80 kg , a volume average particle size of 6 . 8 μm , and a powder density of 0 . 47 / cc was transferred by using the toner transfer apparatus 100 shown in fig6 a under the following fluidization conditions . the toner transfer was completed in 30 minutes . scattering of toner particles was not observed during the toner transfer . fluidized air - intake : 12 . 0 l / min fluidized air pressure : 0 . 1 mpa frequency : 24 , 000 / minute air vibrator pressure : 0 . 2 mpa when toner transfer was performed by simply using a suction apparatus in a similar manner , toner particles scattered . a suction part of the suction apparatus was choked with toner during the transfer , and operation of the apparatus was needed to stop for cleaning a plurality of times . the toner transfer took 45 minutes . this patent specification is based on japanese patent applications , no . jp2005 - 277690 filed on sep . 26 , 2005 , and no . jp2006 - 231812 filed on aug . 29 , 2006 in the japan patent office , the entire contents of each of which are incorporated by reference herein . | 1 |
through scientific research , and over 20 + years on the professional golf tours , working with over 300 tour pros and over 3000 other golfers and coaches , sportpsych has found that the frequent winners on tour ( pga , sr . pga & amp ; lpga ) measured differently from the other tour players on 8 of 32 personality traits . this research has provided sportpsych with a unique means of developing training programs to assist professional and serious golfers on how to optimize their performance through mastering the mental techniques of the winning pros . as part of the on - going development by sportpsych to provide training and tools to the pros , a novel product family , called the mindreader product line , has been developed . the purpose of the mindreader family of products is to assist in improving a player &# 39 ; s mental game in competitive athletic events . specifically , one of the 8 personality traits — relaxation / tension , is measured , and a unique index number , a performance predictor , if you will , is generated that a coach or player uses as feedback on his mental state . then , using the mental relaxation techniques taught by sportpsych , in combination with the visual feedback of the performance predictor ( arousal number ), the player is then advised of his state while performing the physical event ( ea . swing the club ). the player and coach quickly identify the optimum arousal numbers for good performances and can then practice to achieve them during every shot . the player can also use the invention to practice relaxing and quieting their mind separately from the performance with feedback of how well they are doing . the heart rate parameter invention ( also referred to herein as the mindreader ) is an electronic device designed to measure the level of mental activity ( arousal ) or relaxation of an individual . it does this through a precise physiological measurement of the interval between every heart beat . to this measurement is applied a proprietary algorithm which , through a series of mathematical calculations , computes a unique index number which is both a predictor of human performance , and a measure of mental activity or arousal and stress . there is substantial prior art and literature that demonstrates the high degree of correlation between mental activity levels , stress and heart rate variability . this invention takes the next step to produce a unique arousal or stress index number or performance predictor , that is valuable in the training and improving of one &# 39 ; s mental game in any athletic event and in monitoring one &# 39 ; s level of stress . 2 . the mindreader — there are two models , one for the player and one for a coach . coach &# 39 ; s model features a large display and is pager - sized , designed to clip to a belt or pocket where a coach can observe numbers at distance . it may be held in coach &# 39 ; s hand near player . it can also connect to a computer or pda for coaching with proprietary software . the player &# 39 ; s model is currently similar to the coach &# 39 ; s model in size and display but does not connect directly to a computer or pda . the future planned player embodiment is a wrist - worn form for individual usage . player may use this alone , placing on the ground or hanging on belt where can he can see the display . 3 . an optional ordinary personal computer or hand - held pda , running a proprietary software application designed to provide breathing and relaxation training and , in the coaches version , so additional technical information , including a breathing metronome and graph chart of heart rate are provided . chest transmitter — the chest belt transmitter consists of sense electrodes placed on each side of the rib cage , just under the chest , and held in place with an elastic strap . state of the art devices today typically produce a 5 khz burst that lasts 20 - 25 milliseconds , upon each detected heart beat . the signal is transmitted magnetically because it is coupled to an oscillator consisting of a capacitor in parallel with an inductor , which are tuned to oscillate at 5 khz . a similarly fashioned lc oscillator is designed into the receiver for pickup . this system has severe range restrictions of 3 - 6 ft ., and currently there is no provision for interference from one user to the next . therefore , it is contemplated to replace the magnetically coupled lc oscillators with modern , secure wireless technology , such as bluetooth or 802 . 11xx ( wifi ) to improve range , eliminate unit to unit interference , and provide security . this alternative wireless transmission does not otherwise alter the novelty of the invention . pc or pda software — designed for use by coaches , pc software running in tandem with the mindreader , and during operation , produces additional visual feedback useful for training . mindreader hardware — a justification of the key hardware choices is provided in the confidential memo attached ) the core of the hardware consists of an 8 - bit microcontroller with advanced power management , runnable on a lithium coin cell if necessary , along with the following necessary attributes : a good example is the nec upd78f9418 , which was chosen for the preferred embodiment . the hardware is a conventional implementation of a portable measuring instrument , tailored for this application , thus has little novelty on its own . the microcontroller is the heart of the circuit , and is required to do all the math calculations for the performance predictor , arousal or stress number . it is attached to a two - digit lcd , where the number is output . a small serial flash or eeprom is attached for conventional serial storage of parameters and data . an unregulated power supply consists of a 3volt battery , either a single lithium or a pair of alkaline . diode d 4 provides circuit protection in case the battery is installed backwards . a single op - amp u 6 provides the analog ground signal agnd , which is ½ of the battery voltage . the analog front end consists of a conventional 5 khz receiver , an r - wave detection circuit , and an rs - 232 communications channel . the 5 khz receiver reproduces the 20 ms long burst of 5 khz signal produced by the chest transmitter , when the mindreader is close enough to the transmitter for the unit to magnetically couple to it . inductor l 1 and capacitor c 3 form the tank oscillator circuit , signal of which is amplified first by q 1 then by q 2 . the signal generated by q 2 is called 5 khz burst , and is fed through a unity gain buffer u 3 a before going to the r - wave detector . the r - wave detector consists of a full wave rectifier consisting conventionally of u 3 b , diode d 2 and resistors r 6 and r 10 . the output of this circuit is feed to an integrator , output of which rises in the presence of a 5 khz signal , stays high , and then goes low when the 5 khz tone is gone . in affect , the output of this circuit , r 14 and c 11 , provides an envelope signal around the 5 khz signal . this envelope signal is first sent to a peak detector to save its maximum height , and then to one input of the detection comparitor . the peak detector consists of u 3 c , d 3 , c 12 , r 12 and r 13 . this adaptive peak detector charges up c 12 to 85 % of the peak height of the envelope wave , and slowly bleeds down logarithmically at a 4 . 7 second time constant . this slowly declining threshold is necessary to adapt to varying signal sizes due to moving the mindreader away or towards the transmitter , and to adjust to noise bursts . when the output of the slowly declining peak detector meets the next envelope wave at the input of the comparitor , the comparitor fires , creating a digital pulse that is fed to the microcontroller interrupt pin , indicating the precise start of a heart beat . heart rate variability is a statistical calculation defined as the standard deviation of a population of heart rate measurements . its purpose is to provide a measurement of the amount of variation , or variability , in the sample set of heart rate measurements . statistical variance is the usual calculation for this , and standard deviation ( square root of variance ) is the normalized , or standardized way of viewing the data sets . hrv has many uses , including prediction of heart attack and executive stress levels prior art and the literature , as well as sportpsych &# 39 ; s own research , show that measuring heart rate variability is a commonly applied , useful technique to measure tension / relaxation levels . much literature exists to demonstrate the correlation between this physiological measurement , and mental state of activity or stress . therefore the proprietary metric of the performance predictor ( relaxation index ) is derived and mathematically related to hrv . one problem to solve was the following : the invention required that all calculations be done in the mindreader microcontroller , not in a pc , so that the mindreader could function as a stand - alone product . yet the traditional methods of calculating hrv are computational intense for a simple 8 - bit microcontroller , involving multiply , divide , square and square root operations with large floating point numbers . to do these calculations several times per second is not feasible while maintaining extremely low power operation . therefore , a new method was needed that produced the equivalent information as hrv , yet was computationally achievable in real - time within the power budget of an 8 - bit micrcontroller . in addition , the data set had to be screened in real - time against a set of empirically determined physiological rules , subjected to a fast adjustment algorithm for rapidly transitioning data , and finally scaled non - linearly to fit the final data set into a numerical range of 0 - 99 . 2 . compare this measurement to physiological rule of +/− 50 % of the average 3 . if ok , then proceed , else discard the interval as noise or an outlier . a background process tracks the number of discards , and corrects the flow if the count gets too high . note : normal human beat - to - beat variation is no more than 10 - 15 % according to the literature ( will cite a reference if necessary ) however , empirical testing at sportpsych with subjects successful with mental relaxation techniques , demonstrate that their heart rates can vary more than 30 %, much greater than the literature states . therefore , this rule is proprietary . a blanking period of 200 ms is applied and no other heartbeats can be detected . this is a physiological rule that says that no heart rates above 300 beats per minute are considered normal for the intended use of this instrument . 4 . once an interval is accepted as normal , it is placed in an 8 deep buffer , and an eight count moving average is calculated using integer arithmetic . average heart rate can then be calculated by dividing 60000 by the average value of the buffer . 5 . hrv equivalence calculation is then done according the following algorithm : sum of [ abs ( x - xave ) ]/ 16 where x and xave are the current and average millisecond interval measurements . this simplified calculation substitutes well for square root of variance ( standard deviation ). in both methods , the difference between the current sample and the average is calculated . abs ( absolute value ) takes the place of squaring , but achieves the necessary outcome of making each difference from the mean sample be a positive number . yet computational efficiency is preserved without square root and squaring . to make the hrv algorithm reactive to real - time heart rate variation , a depth of 16 difference variables was empirically determined to provide enough smoothing of the data , yet provide quick reaction to changes . the final hrv equivalent is thus determined as a 16 count moving average of the difference values ( where difference means difference between the current measured interval and average of the previous 8 ). at this point in the algorithm , a number is produced between 0 to approximately 125 , with 0 meaning no beat to beat variation ( such as a medical ecg simulator ) and 125 , which can be achieved by an aerobically fit person highly trained in sportpsych relaxation techniques , including respiration control . 6 . with two digits allowed in the display , these numbers are then scaled to a range of 0 - 99 . any variety of scaling techniques can be used . a preferred method uses an integer divide by a power of 2 , so computationally efficient shifts can be used instead of divide algorithms . an alternative is to calculate the 16 - difference value average by dividing by 20 , instead of 16 , thus scaling the numbers 0 - 125 into a range of 0 - 99 . 7 . a background process determines if the person is “ in the zone ” and a flag is set . the flag is set if 4 of the most recent values are greater than 55 . if a the flag indicating in - zone is set , and suddenly the next four in row are lower , then a one time adjustment is made to the final output value . the final value is adjusted as follows : new hrv value = hrv val / 2 + current difference val / 4 but with the additional constraint that it cannot adjust to be smaller than the current difference . this part of the algorithm has the net effect making a one time sudden change to the display value when the user has suddenly lost his mental training concentration , giving a rapid indication to the coach or the user . during preliminary testing , it was determined that test subjects thought high numbers were “ bad ” and low numbers were “ good ”, just the opposite of the final relaxation number . therefore , this final stage subtracts the current value from 100 . this produces a final display value that yields high numbers when tense , or out of the training zone , and low numbers when in the zone , and relaxed or mentally quiet . all system electronics is constructed to fit in a belt - worn pager - sized package . the system is designed so that the lowest possible power to run the circuits up to one month on a single set of batteries . to achieve the above - identified goals , the electronics system minimally consists of these major elements : ( 1 ) battery and power supply regulation ; ( 2 ) microcontroller ; ( 3 ) memory ; ( 4 ) analog amplifiers and filters ; and ( 5 ) lcd . preferably , the system is constructed to fit within a 10 × 10 mm or 12 × 12 mm package . ( pin count drives size and cost of the micro ). to achieve a small microcontroller footprint , the number of pins on the microcontroller are minimized . preferably , an off - chip memory device is utilized for the incoming ecg data stream , and variable storage arrays are used for the hrv calculations . in a typical or classic memory interface , 32 pins are dedicated to address and data for the memory . by specifying a simple two digit display , ( as opposed to using only 2 digits on a 3½ or 4 digit display ) and using it in static or duplex mode , pins normally allocated to lcd can now be used for other functions , thus reducing overall pin count . varitronix and others offer suitable off - the - shelf solutions . by using high integration operational amplifiers ( 4 per package ), the need is eliminated for power and ground on 3 amplifiers for every 4 op - amps instantiated in the design . this is good savings in circuit board real estate , and reduced pin count . selections are many , but one of the most suitable series of ultra - low power op - amps is offered by maxim , thus these will be used in the design . due to the amount of data samples taken , and the data structures required for hrv calculations , a small memory chip is required . focusing on the memory interface , i plan to use a new type of serial flash memory , backed - up by the 1 k internal sram of the microcontroller . this new memory reduces memory to 3 pins from 32 . ( these memories are the similar to the ones used in cell phones and mp3 players , and digital cameras , thus are plentiful and inexpensive ). in the hrv monitor , during operation , ecg sample data is stored in internal microcontroller sram , until reception of the next r - wave complex , when a new calculation of heart rate variability is performed . once 128 byte page is accumulated , then it is programmed into a page of the serial ram . this would occur about once per second . once per second programming keeps the active power time of the flash modulated to about 3 ms every 1 . 28 seconds ( assuming 10 ms sample rate ). assuming active current is 15 ma , this averages to 35 ua during operation . should this data one day need to be saved and played back ( future feature ) the memory would have the same 15 ma active current consumption , thus will require a similar power up - read - power down modulation technique during transmission to manage the overall power consumption . here is what we stand to gain with this new type of memory device : 1 . pin count to the memory is reduced from 32 to a 3 wire serial interface 3 . board layout and routing simplifies —( potential cost reduction of circuit board ) these are the primary serial memory attributes the hrv monitor requires , along with some benefits : 1 . 1 mbit in size — stores a running total of 15 - 20 minutes of ecg and hrv data 2 . bulk erase in less than 2 seconds , ( reasonable time to avoid accidental erasure ) 3 . 128 byte page program in less than 3 ms ( less than ½ ecg data sample time ) 5 . active current less than 15 ma during record or playback — necessary to meet battery life goals 6 . low standby of 5 ua or less eliminates power control , or simplifies power management circuitry 7 . 10 , 000 erase / program cycles ( given multiple recordings and one transmission per day as worse case , this yields greater than 10 year product life . an extension can be created architecturally , by using on one 256 k sector ( 5 minutes of memory ) until it has been cycled 10 , 000 times , and moving to the next sector for record space . only sector erase ( not bulk erase would be used in this extended life scenario ) another alternative is 100 , 000 cycle flash technology . the st microelectronics m25p10 in a 150 mil package fits . an alternative is a 100 , 000 cycle device introduced last october by silicon storage technology , inc . the 1 mbit sst45vf010 . given a reduced pin count allowed by a serial memory device , a smaller foot print micro is now possible . it is presently preferred to use the nec k0s micro family , specifically , the upd789f417 , as the micro of choice . the micros feature desired low power and have other attributes that make them effective . a simplified memory - micro structure is possible using serial flash with a small footprint micro , cutting digital real estate in half . an st m25p10 coupled to an nec upd 789417 or 789881 . coupled with a pair of maxim quad op - amps , we have a complete electronics package . through scientific research , and over 20 + years on the professional golf tours , working with over 300 tour pros and over 3000 other golfers and coaches , sportpsych has found that the frequent winners on tour ( pga , sr . pga & amp ; lpga ) measured differently from the other tour players on 8 of 32 personality traits . this research has provided sportpsych with a unique means of developing training programs to assist professional and serious golfers on how to optimize their performance through mastering the mental techniques of the winning pros . as part of the on - going development by sportpsych to provide training and tools to the pros , a novel product family , called the mindreader product line , has been developed . the purpose of the mindreader family of products is to assist in improving a player &# 39 ; s mental game in competitive athletic events . specifically , one of the 8 personality traits — relaxation / tension , is measured , and a unique index number , a performance predictor , if you will , is generated that a coach or player uses as feedback on his mental state . then , using the mental relaxation techniques taught by sportpsych , in combination with the visual feedback of the performance predictor ( arousal number ), the player is then advised of his state while performing the physical event ( ea . swing the club ). the player and coach quickly identify the optimum arousal numbers for good performances and can then practice to achieve them during every shot . the player can also use the invention to practice relaxing and quieting their mind separately from the performance with feedback of how well they are doing . the mindreader is an electronic device designed to measure the level of mental activity ( arousal ) or relaxation of an individual . it does this through a precise physiological measurement of the interval between every heart beat . to this measurement is applied a proprietary algorithm which , through a series of mathematical calculations , computes a unique index number which is both a predictor of human performance , and a measure of mental activity or arousal and stress . there is substantial prior art and literature that demonstrates the high degree of correlation between mental activity levels , stress and heart rate variability . this invention takes the next step to produce a unique arousal or stress index number or performance predictor , that is valuable in the training and improving of one &# 39 ; s mental game in any athletic event and in monitoring one &# 39 ; s level of stress . apparatus : following is the hardware description and function based on the schematics in the appendix . 5 . the mindreader — there are two models , one for the player and one for a coach . coach &# 39 ; s model features a large display and is pager - sized , designed to clip to a belt or pocket where a coach can observe numbers at distance . it may be held in coach &# 39 ; s hand near player . it can also connect to a computer or pda for coaching with proprietary software . the player &# 39 ; s model is currently similar to the coach &# 39 ; s model in size and display but does not connect directly to a computer or pda . the future planned player embodiment is a wrist - worn form for individual usage . player may use this alone , placing on the ground or hanging on belt where can he can see the display . 6 . an optional ordinary personal computer or hand - held pda , running a proprietary software application designed to provide breathing and relaxation training and , in the coaches version , so additional technical information , including a breathing metronome and graph chart of heart rate are provided . the chest belt transmitter consists of sense electrodes placed on each side of the rib cage , just under the chest , and held in place with an elastic strap . state of the art devices today typically produce a 5 khz burst that lasts 20 - 25 milliseconds , upon each detected heart beat . the signal is transmitted magnetically because it is coupled to an oscillator consisting of a capacitor in parallel with an inductor , which are tuned to oscillate at 5 khz . a similarly fashioned lc oscillator is designed into the receiver for pickup . this system has severe range restrictions of 3 - 6 ft ., and currently there is no provision for interference from one user to the next . therefore , it is contemplated to replace the magnetically coupled lc oscillators with modern , secure wireless technology , such as bluetooth or 802 . 11xx ( wifi ) to improve range , eliminate unit to unit interference , and provide security . this alternative wireless transmission does not otherwise alter the novelty of the invention . pc or pda software — designed for use by coaches , pc software running in tandem with the mindreader , and during operation , produces additional visual feedback useful for training . mindreader hardware — a justification of the key hardware choices is provided in the confidential memo attached ) the core of the hardware consists of an 8 - bit microcontroller with advanced power management , runnable on a lithium coin cell if necessary , along with the following necessary attributes : a good example is the nec upd78f9418 , which was chosen for the preferred embodiment . the hardware is a conventional implementation of a portable measuring instrument , tailored for this application , thus has little novelty on its own . referring to the schematic labeled golfpsych hrv digital circuitry , the microcontroller is the heart of the circuit , and is required to do all the math calculations for the performance predictor , arousal or stress number . it is attached to a two - digit lcd , where the number is output . a small serial flash or eeprom is attached for conventional serial storage of parameters and data . an unregulated power supply consists of a 3volt battery , either a single lithium or a pair of alkaline . diode d 4 provides circuit protection in case the battery is installed backwards . a single op - amp u 6 provides the analog ground signal agnd , which is ½ of the battery voltage . refer to the schematic labeled analog hrv circuitry . the analog front end consists of a conventional 5 khz receiver , an r - wave detection circuit , and an rs - 232 communications channel . the 5 khz receiver reproduces the 20 ms long burst of 5 khz signal produced by the chest transmitter , when the mindreader is close enough to the transmitter for the unit to magnetically couple to it . inductor l 1 and capacitor c 3 form the tank oscillator circuit , signal of which is amplified first by q 1 then by q 2 . the signal generated by q 2 is called 5 khz burst , and is fed through a unity gain buffer u 3 a before going to the r - wave detector . the r - wave detector consists of a full wave rectifier consisting conventionally of u 3 b , diode d 2 and resistors r 6 and r 10 . the output of this circuit is feed to an integrator , output of which rises in the presence of a 5 khz signal , stays high , and then goes low when the 5 khz tone is gone . in affect , the output of this circuit , r 14 and c 11 , provides an envelope signal around the 5 khz signal . this envelope signal is first sent to a peak detector to save its maximum height , and then to one input of the detection comparitor . the peak detector consists of u 3 c , d 3 , c 12 , r 12 and r 13 . this adaptive peak detector charges up c 12 to 85 % of the peak height of the envelope wave , and slowly bleeds down logarithmically at a 4 . 7 second time constant . this slowly declining threshold is necessary to adapt to varying signal sizes due to moving the mindreader away or towards the transmitter , and to adjust to noise bursts . when the output of the slowly declining peak detector meets the next envelope wave at the input of the comparitor , the comparitor fires , creating a digital pulse that is fed to the microcontroller interrupt pin , indicating the precise start of a heart beat . heart rate variability is a statistical calculation defined as the standard deviation of a population of heart rate measurements . its purpose is to provide a measurement of the amount of variation , or variability , in the sample set of heart rate measurements . statistical variance is the usual calculation for this , and standard deviation ( square root of variance ) is the normalized , or standardized way of viewing the data sets . hrv has many uses , including prediction of heart attack and executive stress levels prior art and the literature , as well as sportpsych &# 39 ; s own research , show that measuring heart rate variability is a commonly applied , useful technique to measure tension / relaxation levels . much literature exists to demonstrate the correlation between this physiological measurement , and mental state of activity or stress . therefore the proprietary metric of the performance predictor ( relaxation index ) is derived and mathematically related to hrv . the problem to solve was this : our design required that all calculations be done in the mindreader microcontroller , not in a pc , so that the mindreader can function as a stand - alone product . yet the traditional methods of calculating hrv are computational intense for a simple 8 - bit microcontroller , involving multiply , divide , square and square root operations with large floating point numbers . to do these calculations several times per second is not feasible while maintaining extremely low power operation . therefore , a new method was needed that produced the equivalent information as hrv , yet was computationally achievable in real - time within the power budget of an 8 - bit micrcontroller . in addition , the data set had to be screened in real - time against a set of empirically determined physiological rules , subjected to a fast adjustment algorithm for rapidly transitioning data , and finally scaled non - linearly to fit the final data set into a numerical range of 0 - 99 . 7 . compare this measurement to physiological rule of +/− 50 % of the average 8 . if ok , then proceed , else discard the interval as noise or an outlier . a background process tracks the number of discards , and corrects the flow if the count gets too high . note : normal human beat - to - beat variation is no more than 10 - 15 % according to the literature ( will cite a reference if necessary ) however , empirical testing at sportpsych with subjects successful with mental relaxation techniques , demonstrate that their heart rates can vary more than 30 %, much greater than the literature states . therefore , this rule is proprietary . a blanking period of 200 ms is applied and no other heartbeats can be detected . this is a physiological rule that says that no heart rates above 300 beats per minute are considered normal for the intended use of this instrument . 9 . once an interval is accepted as normal , it is placed in an 8 deep buffer , and an eight count moving average is calculated using integer arithmetic . average heart rate can then be calculated by dividing 60000 by the average value of the buffer . 10 . hrv equivalence calculation is then done according the following algorithm : sum of [ abs ( x - xave ) ]/ 16 where x and xave are the current and average millisecond interval measurements . this simplified calculation substitutes well for square root of variance ( standard deviation ). in both methods , the difference between the current sample and the average is calculated . abs ( absolute value ) takes the place of squaring , but achieves the necessary outcome of making each difference from the mean sample be a positive number . yet computational efficiency is preserved without square root and squaring . to make the hrv algorithm reactive to real - time heart rate variation , a depth of 16 difference variables was empirically determined to provide enough smoothing of the data , yet provide quick reaction to changes . the final hrv equivalent is thus determined as a 16 count moving average of the difference values ( where difference means difference between the current measured interval and average of the previous 8 ). at this point in the algorithm , a number is produced between 0 to approximately 125 , with 0 meaning no beat to beat variation ( such as a medical ecg simulator ) and 125 , which can be achieved by an aerobically fit person highly trained in sportpsych relaxation techniques , including respiration control . 6 . with two digits allowed in the display , these numbers are then scaled to a range of 0 - 99 . any variety of scaling techniques can be used . a preferred method uses an integer divide by a power of 2 , so computationally efficient shifts can be used instead of divide algorithms . an alternative is to calculate the 16 - difference value average by dividing by 20 , instead of 16 , thus scaling the numbers 0 - 125 into a range of 0 - 99 . 7 . a background process determines if the person is “ in the zone ” and a flag is set . the flag is set if 4 of the most recent values are greater than 55 . if a the flag indicating in - zone is set , and suddenly the next four in row are lower , then a one time adjustment is made to the final output value . the final value is adjusted as follows : new hrv value = hrv val / 2 + current difference val / 4 but with the additional constraint that it cannot adjust to be smaller than the current difference . this part of the algorithm has the net effect making a one time sudden change to the display value when the user has suddenly lost his mental training concentration , giving a rapid indication to the coach or the user . during preliminary testing , it was determined that test subjects thought high numbers were “ bad ” and low numbers were “ good ”, just the opposite of the final relaxation number . therefore , this final stage subtracts the current value from 100 . this produces a final display value that yields high numbers when tense , or out of the training zone , and low numbers when in the zone , and relaxed or mentally quiet . | 0 |
thermal radiation control media based on the unusual properties of photonic media have been described and claimed by applicants in copending u . s . patent application ser . no . 09 / 441 , 221 , filed on nov . 15 , 1999 , which is hereby included in its entirety . these media will be briefly discussed below , and then their application to photodetectors will be described . photonic media are materials having a spatially varying dielectric constant . this spatial variation is usually periodic , and for the present applications is generally in three - dimensions , but these conditions are not necessary . the materials of which the photonic media are composed generally exhibit low loss due to absorption in the range of photon energies in which they are intended to be used . a typical practical photonic medium is shown in fig1 . here is shown a “ woodpile ” photonic medium 10 , comprising an alternating pile of layers 11 , each layer 11 comprising an evenly spaced row of parallel strips 12 of material with a first dielectric constant . alternate layers are rotated by 90 degrees relative to the previous layer . the spaces between the strips 12 are filled by a material 13 having a second dielectric constant . for simplicity as well as high dielectric contrast , material 13 is often simply air . as light ( here meaning electromagnetic radiation in the range where the photonic medium is intended to be applied ) passes through the photonic medium , it experiences multiple scattering off the variations in the dielectric constant . it was discovered in the early 1980 &# 39 ; s that the spacing and magnitude ( or dielectric contrast ) of a periodic spatially - varying dielectric constant could be such that the resulting photonic medium would exhibit a photonic bandgap . a photonic bandgap is a range of energies within which any propagating electromagnetic mode undergoes destructive interference . the result is that photons within this range of energies cannot propagate in the photonic medium , and hence are totally reflected therefrom . the physical theory and mathematics describing this effect is analogous to that describing the formation of a bandgap in the electronic structure of a semiconductor . the question of what becomes of the forbidden propagating photon states is of fundamental interest , and has been a subject of much conjecture and little evidence since the discovery of photonic media . however , applicants now have the first experimental evidence that the forbidden states vanish . fig2 shows a recent measurement by applicants of the thermal radiation emitted by a silicon woodpile type photonic lattice , 5 layers in thickness , with a complete photonic bandgap in the 10 - 16 μm range . the figure shows the thermal radiation flux as a function of photon vacuum wavelength . the thermal radiation flux is severely reduced in the region of the photonic bandgap . this establishes that the thermal emissivity of photonic media is reduced in a manner consistent with theory . thermal radiation can be blocked by introducing a layer of photonic media between a body and an observer . however , a monolithic layer of photonic medium is difficult to apply over a large irregular object , and tends to be rather fragile . as the photonic medium must be the outermost layer ( or nearly so ) of the body being shielded , protecting the photonic medium from damage can be difficult . applicants teach use of a photonic paint for thermal radiation control . fig3 shows a schematic illustration of the typical components which make up a photonic paint . the illustration shows a substrate 30 covered by a layer 31 of photonic paint . the photonic paint comprises powdered photonic media 32 suspended in a binding medium 33 . the powdered photonic media 32 must have particle size large enough that individual powder particles exhibit the desired photonic structure — typical powder dimensions will be somewhat greater than the vacuum wavelength characterizing the photonic structure of the medium from which the powder is obtained . the proportion of the powdered photonic media by volume should be large enough that the thermal emission of the painted substrate is dominated by that of the photonic medium , and not by that of the binding medium or of the substrate surface . the optics governing the performance of photonic paint is complex enough that in any given case this proportion must be optimized by experiment . however , the issues which go into making an initial estimate are quite general , and have been discussed in applicant &# 39 ; s earlier patent application which was included earlier by reference . application of thermal emission control materials comprising photonic materials can allow uncooled operation of a photodetector while avoiding undue interference by thermal radiation from surfaces of the photodetector and its housing . one approach is shown in fig4 . this shows a photodetector 401 and mount 402 , to whose internal surfaces are added a coating of a thermal emission control medium 400 . such coating must be applied to all surfaces in direct or reflected line - of - sight of the light - sensitive area on the photodetector . thermal emission control medium 400 is designed so that it has a photonic bandgap ( or nearly so ) in the wavelength range to which the sensor is sensitive . this eliminates locally generated thermal radiation , so that the infrared radiation to which the sensor is exposed comes from the external target . substantial benefit can be obtained by substitution of a thermal emission control medium for a refrigerating system . the ratio r between the thermal radiation flux from a normal surface at temperature t o and that same surface at a cooler temperature t is approximately to give some perspective to this result , if the medium displays a factor of 100 less background thermal emission in the sensitivity range of the sensor , a level of performance which should be easy to attain , the equivalent shroud and system temperature is about 30 k . even using the simple and rather crude photonic medium used in applicants demonstration above , the equivalent shroud and system temperature is about half room temperature , near 165 k . clearly , thermal emission control media comprising photonic media can make a tremendous difference in the sensitivity of an infrared sensor . a second area of application addresses a situation in which a very narrow range of wavelengths is to be detected , while the photodetector is sensitive to a much wider range of wavelengths . it is often beneficial to restrict the range of wavelengths which can reach the sensor , e . g ., to avoid interference from unwanted signals . a filter can provide such restriction , but the photodetector is now surrounded in all directions by surfaces which are quite efficiently emitting thermal radiation in the range of sensitivity of the sensor . in this situation , proper use of the instant invention results in an elegant solution to this problem . as shown in fig5 it is only necessary to envelop the sensitive area of the sensor 501 with a thermal emission control medium including a photonic material which has both a photonic bandgap ( complete or nearly so ) covering the sensitivity band of the sensor , and also a defect structure tailored to provide defect states within the bandgap which allow light to travel through the medium at wavelengths in a narrow band surrounding the expected signal . this layer will be called thermal emission filter 500 . such defect states have been demonstrated , and are reasonably well understood both theoretically and experimentally . now , from the viewpoint of the sensor , only a tiny portion of the externally generated thermal radiation ( perhaps a part in a thousand ) is transmitted through the thermal emission filter 500 . because the thermal emission filter has a photonic bandgap , its thermal radiation in the wide range of wavelengths will be essentially zero . with such techniques the random thermal radiation background can be reduced by factors on the order of 1000 . note that in this instance coating the inside of mount 502 is not necessary . the examples and implementations described above are intended to illustrate various aspects of the present invention . the scope of the invention is set by the claims interpreted in view of the specification . | 7 |
the invention is best understood by reference to the attached drawings . in fig1 - 2 there is seen the floatable container comprising a hollow body 20 , a top cover 21 , a bottom cover 21 &# 39 ; and a bottom weight 22 . cover 21 is attached to body 20 by means of a plurality of screws 41 . a tape 25 extends from the top of the gauge well pipe to weight 22 which normally will be detached from container body 20 and be hanging near the bottom of the storage tank . the general features of the storage tank and the relation of this invention thereto is seen in fig3 - 4 . storage tank 44 is filled with a liquid stock to a level 55 , and covered by a floating roof 45 which traps air between liquid stock level 55 and the structure of roof 45 to make it float . around the edges of roof 45 there are two flexible rubber seals , i . e ., primary seal 61 and secondary seal 62 which keep vapors from escaping to the atmosphere and also keep rain water from getting into storage tank 44 . some rain water normally does get into the stock and will , of course , form a layer at the bottom of storage tank 44 which occasionally is drained out . gauge well pipe 46 is fixed rigidly to the inside of tank 44 and extends through floating roof 45 which moves up and down around fixed pipe 46 as the level 55 of stock in tank 44 changes . pipe 46 is perforated with a plurality of slotted openings 56 usually about one inch wide and about twelve inches long through the pipe wall to permit full mixing of the stock in the pipe with the stock outside of the pipe . an inspection structure 47 is built onto tank 44 with a platform 48 which extends toward the center of floating roof 45 to facilitate inspection of the tank 44 and its roof 45 . gauge well pipe 46 is placed so as to be conveniently available to a worker on platform 48 . the upper end of pipe 46 may have a closure cap to be used when pipe 46 is not being used for the taking of samples , the measurement of stock levels , or the like . when used for such , however , there is a winch means 49 strapped to pipe 46 at 51 with a universal joint 50 to adjust the arm of winch 49 to an appropriate position to place pulley 52 over the open top end of pipe 46 so as to permit tape 25 to hang down the general center axis of pipe 46 even when the cover 46 &# 39 ; is closed via lateral slot 46 &# 34 ; extending from an edge to medially of cover 46 &# 39 ;. winch means 49 is employed to crank up tape 25 and anything attached thereto when desired . at the other end of tape 25 is disc weight 22 , preferably having a centering tongue or boss 63 which slides into a corresponding recess in the bottom of container body 20 , including bottom cover 21 &# 39 ;. tape 25 is suitably connected to boss 63 by an attachment means 26 which includes a tapered pin force fit and extending through boss 63 and tape 25 , tape 25 having been positioned via a slot cut into the side of boss 63 . normally weight 22 will be located near the bottom of well pipe 46 close to or on the bottom of tank 44 when the container body 20 is used as a float and seal . tape 25 extends upwardly through a vertical pipe sheath 27 or the like extending vertically through and attached to the container body 20 and through cover 21 to winch means 49 . when container body 20 and covers 21 and 22 are functioning as a float it is not affected by tape 25 but merely slides up and down tape 25 as the level 55 of stock in tank 44 may change . the pipe sheath 27 extends through the central vertical axis of container body 20 surrounding tape 25 . top cover 21 has a sealing means 37 with a slotted passageway to permit tape 25 to freely pass into and out of container body 20 . as may be seen in fig9 the sealing means 37 includes a rubber seal 58 set in a plate 60 on top cover 21 where tape 25 passes through . a slit 59 in rubber seal 58 keeps tape 25 sealed to prevent vapor passage upwardly through passageway 27 . also , this seal 58 may be slid laterally in the same direction as slot 59 along guides 65 attached to cover 21 so as not to interfere or wipe off gauge paste which may be applied to the tape for determining liquid levels in tank 44 . it may be seen that when in the float mode container 20 will slide over tape 25 freely and the seal 58 does not interfere with such float mode . when container body 20 is to be used as a sample collector there are other features that are important . a short pipe nipple 34 or the like forms an open passageway 31 &# 39 ; which extends through for stock to enter or be poured out of container body 20 . stopper 32 normally closes the passageway 31 &# 39 ;. in order to be able to take the sample at any selected depth in the liquid stock there is a lever mechanism designed to selectively remove stopper 32 when desired . a lever 33 has a fulcrum at 34 supported by a suitable structure 35 mounted to the outside of cover 21 . at one end of lever 33 there is a connecting link 36 to stopper 32 . at the other end of lever 33 there is a slot 38 to permit tape 25 to pass through and another intersecting slot 38 &# 39 ; to permit insertion of the tape 25 into slot 38 . when the selected depth is reached , as indicated on the tape 25 or on an indicator associated with winch means 49 ( not shown ) for taking a sample , a slotted weight 57 ( see fig8 ) with cotter pin 57 &# 39 ; slidingly connects the weight to the tape 25 and such weight 57 is slid down tape 25 from above to fall upon the end of lever 33 at tape 25 . the force of the falling weight 57 acts through the lever 33 to retract stopper 32 from pipe nipple 31 as shown in fig8 . thus stock will flow through the open passageway 31 &# 39 ; into container 20 and permits a sample from the stock to be taken at the depth selected . it is of little consequence that stopper 32 is not returned to close passageway 31 &# 39 ; after the sample is taken . the upward movement of sample body 20 and cover 21 after taking the sample will not cause any material changes in the contents of the sample in container 20 . container body 20 also has two wells 64 for thermometers 39 to record the temperature of the sample . container body 20 has a sight window 40 at each well to facilitate reading the temperature . wells 64 at the bottom of the thermometers provide maintenance of the temperature of the thermometers during withdrawal of the body 20 from the gauge well 46 for more accurate reading by the operator above the tank 44 . a selectively openable vent tube 28 is also provided in container body 20 comprising a tube with an open bottom end 29 and a screw top closed with a cap 30 . vent tube 28 is principally useful when emptying container body 20 of a sample of stock . cap 30 may be removed to provide air to break any vacuum that might otherwise develop in pouring the sample out of passageway 31 . the weight 22 includes at least three legs 41 extending from below the lower surface of disc weight 22 . preferably these legs 41 are pointed so as to pierce any sludge at the bottom of the storage tank 44 when the weight 22 with or without container 20 is dropped that far , which might be the case in determining whether there is water and / or sludge at the bottom of storage tank and for gauging the tank . a measuring tape 42 or the equivalent is placed on the side of container body 20 to measure the depth of water or sludge . it is well known that a paste is applied to measuring tapes today which paste reacts to water , but not to petroleum , and in this fashion the depth of water may be determined . likewise , another paste applied to the tape at about the approximate level ( determined from outside level indicator , not shown ) of the petroleum level 55 is wiped onto the tape which reacts to petroleum and thereby gauges the level 55 . disc weight 22 is shown as having keyway slots 24 therein to fit bolt heads 23 in the bottom of container body 20 ( see especially fig7 ). if it is desired to make container body 20 sink , then disc weight 22 is attached to overcome the buoyancy of the float body 20 . such would be the case in taking samples of the stock or gauging the petroleum level or water level . another useful feature of this invention is a d - ring or handle 53 attached by screws 43 to cover 21 adjacent to tape 25 . preferably d - ring or handle 53 has a slot 53 &# 39 ; therethrough for tape 25 to freely pass , and a lateral slot 53 &# 34 ; similar to lateral slot 38 &# 39 ;. it is only necessary to have d - ring or handle 53 very close to tape 25 or the handle 53 may be formed to two spaced d - portions on opposite sides of tape 25 . the purpose of d - ring or handle 53 is to provide a catch for retrieving container body 20 in the event tape 25 should break and container body 20 should fall to the bottom of well pipe 46 . a weighted line with a grappling hook could then be suspended down well pipe 46 and manipulated to cause the hook to catch d - ring or handle 53 which could then retrieve container body 20 . well pipe 46 has spaced slotted perforations 56 to permit good mixing of stock inside and outside of well pipe 46 . these perforations , however , sometimes have burred edges inside pipe 46 which may damage or entangle a float of the type shown in the aforesaid sayles patent . it is therefore , important to have a flexible seal 54 and a smaller diameter body 20 to permit unobstructed flotation and or sinking of body 20 via the weight attachment 22 . a d - ring or handle 53 is available to retrieve container body 20 when the tape 25 is broken . the opposed perforations 56 are 180 ° apart and are offset 90 ° so that the top of the perforation on one side of the pipe 46 will be at the bottom of the perforation on the side 90 ° therefrom . as seen in fig2 and 5 the seal 54 is preferably of buna n and is connected between cover 21 and the upper end of container body 20 . seal 54 is seen to include a plurality of radial slits 54 &# 39 ; having a length of about three - fourths of an inch and which terminate short of body 20 . preferably the slits are about three - fourths of an inch apart so that they will not become hung on the slots 56 or the burrs . also , another seal 54 &# 34 ; should be mounted on the container body 20 such that the seal is just above the liquid level 55 to maximize the effectiveness of the sealing of the gauge well pipe 46 by the container 20 hereof . of course , when it is desired to remove the container 20 from the well pipe 46 , the winch means 49 is cranked up and the weight 22 engages the bottom cover 21 &# 39 ; and moves same upwardly and out the open upper end of well pipe 46 , i . e ., cover 46 &# 39 ; is pivoted or removed , as the case may be , to completely open the upper end of pipe 46 . the sayles patented device even when working freely restricts or recovers between 60 % and 70 % of the aromatics normally lost through the well pipe whereas the instant invention recovers 90 % to 98 % of same . when a float like that shown by the sayles patent was used , the float often lodged onto a burr because the outside diameter of such float was chosen to be very close to the inside diameter of the gauge well pipe . the instant container 20 is intentionally made some two inches less in diameter to the inside diameter of the gauge well pipe 46 to insure that it does not become lodged by a burr . the buna - n rubber seal 54 and / or 54 &# 34 ; conforms in shape around the burr and slots in the well pipe to maximize the effectiveness of the seal against vapor escaping through the well pipe 46 . employment of a winch and a tape improves the various attributes of the system and reduces the amount of contact by the worker with the petroleum or other chemicals in the tank 44 , i . e ., the cable of the sayles patent must be pulled up by hand , for example , after detachment from the cover , or the like . while the invention has been described with respect to certain specific embodiments , it will be appreciated that many modifications and changes may be made by those skilled in the art without departing from the spirit of the invention . it is intended , therefore , by the appended claims to cover all such modifications and changes as fall within the true spirit and scope of the invention . | 6 |
the features and advantages of the invention may be more readily understood by those of ordinary skill in the art upon reading the following detailed description . the compound of formula i can also form salt ( s ). exemplary acidic salt ( s ) of formula i can form with inorganic and / or organic acids include , but are not limited to , for example , acetates , such as are formed with acetic or trihaloacetic acid ; adipates ; alginates ; ascorbates ; aspartates ; benzoates ; benzenesulfonates ; bisulfates ; borates ; butyrates ; citrates ; camphorates ; camphorsulfonates ; cyclopentanepropionates ; digluconates ; dodecylsulfates ; ethanesulfonates ; fumarates ; glucoheptanoates ; glycerophosphates ; hemisulfates ; heptanoates ; hexanoates ; hydrochlorides ; hydrobromides ; hydroiodides ; hydroxyethanesulfonates , such as , for example , 2 - hydroxyethanesulfonates ; lactates ; maleates ; methanesulfonates ; naphthalenesulfonates , such as , for example , 2 - naphthalenesulfonates ; nicotinates ; nitrates ; oxalates ; pcctinatcs ; persulfates ; phenylpropionates , such as , for example , 3 - phenylpropionates ; phosphates ; picrates ; pivalates ; propionates ; salicylates ; succinates ; sulfates , such as , for example , are formed with sulfuric acid ; sulfonates ; tartrates ; thiocyanates ; and toluenesulfonates , such as , for example , tosylates and undecanoates . such salts can be formed in accordance with methods known to a person of ordinary skill in the art . exemplary basic salt ( s ) that compounds of formula i can form with inorganic and / or organic bases include , but are not limited to , for example , ammonium salts ; alkali metal salts , such as , for example , sodium , lithium and potassium salts : alkaline earth metal salts , such as , for example , calcium and magnesium salts ; salts formed with organic bases , such as , for example , benzathines , dicyclohexylamines , hydrabamines ( such as , for example , n , n - bis ( dehydroabietyl ) ethylenediamine ), n - methyl - d - glucamines , n - methyl - d - glycamides , and t - butyl amines ; salts formed with amino acids , such as , for example , arginine and lysine ; and salts formed by using agents , such as , for example , lower alkyl halides ( e . g . methyl , ethyl , propyl , and butyl chlorides , bromides and iodides ), dialkyl sulfates ( e . g . dimethyl , diethyl , dibutyl , and diamyl sulfates ), long chain halides ( e . g . decyl , lauryl , myristyl and stearyl chlorides , bromides and iodides ), and aralkyl halides ( e . g . benzyl and phenethyl bromides ) to quaternize basic nitrogen - containing groups . such salts can be formed in accordance with methods known to a person of ordinary skill in the art . in general , the compound of formula i can be prepared in accordance with schemes 1 and 2 and the general knowledge of one skilled in the art . scheme 1 shows the preparation of the dione intermediate which is disclosed and claimed in u . s . ser . no . 11 / 475 , 828 filed jun . 27 , 2006 , which is incorporated herein in its entirety . scheme 2 shows the reaction of the dione with a suitable brominating agent to afford compound i of the invention . compound b can be prepared by contacting an appropriately substituted compound a with an aminating agent , such as for example , hydroxylamino - o - sulfonic acid ( h 2 noso 3 h ) when r 1 is cho and monochloramine ( nh 2 cl ) when r 1 is cn in the presence of a base , such as , for example , potassium t - butoxide or an aqueous solution of potassium hydroxide . step 1 can be carried out in accordance with methods readily known to a person of ordinary skill in the art including , but not limited to , for example , the methods disclosed in the journal of heterocyclic chemistry , volume 31 , page 781 ( 1994 ) and / or the journal of organic chemistry , volume 69 , page 1368 ( 2004 ). compound c can be prepared by converting the nitrile group of compound b to a carboxamide . the nitrile group can be converted to the carboxamide in accordance with any method readily known to a person of ordinary skill in the art . for example , compound b can be contacted with an aqueous solution of a base , such as , for example , potassium hydroxide to partially hydrolyze the nitrite group and form a carboxamide group . an appropriately substituted compound c can be produced in accordance with methods readily known to a person of ordinary skill in the art including , but not limited to , for example , the methods disclosed in the journal of heterocyclic chemistry , volume 31 , page 781 ( 1994 ) and / or r . c . larock , comprehensive organic transformations , 2 nd edition , page , 1988 , wilcy - vch , new york ( 1999 ). compound v can be prepared by contacting an appropriately substituted compound c with a reagent , such as , for example , ethyl chloroformate in the presence of an appropriate base , such as , for example , pyridine , and a solvent , such as , for example , dioxane . in one embodiment , compound v is produced by heating the mixture of compound c , reagent , base , and solvent at an acceptable temperature and for an acceptable period of time to produce compound v . a person of ordinary skill in the art is readily familiar with and / or able to determine the temperature and period of time at which the mixture of compound c , reagent , base , and solvent may be heated to produce formula v compound . compound i can be prepared by heating compound v with a brominating agent , such as , for example , phosphorus oxybromide in the presence of a hunig &# 39 ; s base , such as , for example , diisopropylethylamine and a solvent . a person of ordinary skill in the art is readily familiar with and / or able to determine the temperature and period of time at which compound v and brominating agent may be heated in the presence of base and solvent to produce compound i . the invention is further defined in the following examples . it should be understood that the examples are given by way of illustration only . from the above discussion and the examples , one skilled in the art can ascertain the essential characteristics of the invention , and without departing from the spirit and scope thereof , can make various changes and modifications to adapt the invention to various uses and conditions . as a result , the invention is not limited by the illustrative examples set forth hereinbelow , but rather defined by the claims appended hereto . all temperatures are in degrees celsius (° c .) unless indicated otherwise herein . a mixture of pyrrolo [ 2 , 1 - f ][ 1 , 2 , 4 ] triazine - 2 , 4 ( 1h , 3h )- dione ( 4 . 3 gm , 28 . 47 mmol ), pobr 3 ( 24 . 5 gm , 85 . 43 mmol ) and diisopropylethylamine ( 7 . 36 gm , 56 . 95 mmol ) was heated at 120 ° c . for 14 hr . after cooling to room temperature , the syrup was poured into ice . a sat . aq . solution of nahco 3 was slowly added with stirring until the ph of the mixture reaches 7 . the dark aqueous phase was then extracted with methylene chloride . the combined organic phases were washed with brine , dried ( na 2 so 4 ), and the solvent was evaporated . silica gel column chromatography ( elution with 100 % ch 2 cl 2 ) gave 4 . 0 gm of 2 , 4 - dibromopyrrolo [ 1 , 2 - f ][ 1 , 2 , 4 ] triazine ( 1 ) ( 52 % yield ) as a solid . 1 h nmr ( cdcl 3 ): 6 . 96 ( m , 1h ), 7 . 03 ( m , 1h ), 7 . 85 ( m , 1h ); ms : 275 ( m + h ) + ; and hplc ret . time : 1 . 86 min . ( phenomenex - luna s 10 : 4 . 6 × 50 mm column , 2 min gradient , 4 ml / min ). | 2 |
fig2 shows a preferred embodiment of this invention wherein the data obtained by sampling a 50 h z alternating current wave at a frequency of 600 hz are applied to an input terminal a . the data are applied in parallel to an adder 1 and a subtractor 2 . adder 1 determines the sum of the absolute values of the two data samples having a phase difference of 90 °, whereas subtractor 2 determines the difference of the absolute values of the two data samples , providing this difference as a positive output . the outputs from the adder and subtractor are multiplied with coefficients k 1 and k 2 , respectively , by coefficient multipliers 3 and 4 and the outputs thereof are added together by a second adder 5 thus producing an output y ## equ3 ## where i m and i m - 3 represent two data samples having a phase difference of 90 ° electrical . denoting the amplitude of the ac input by i , then the data i m and i m - 3 are expressed by the following equation ( 5 ). ## equ4 ## by substituting equation ( 5 ) into equation ( 4 ) equation ( 6 ) is obtained . ## equ5 ## considering the periodicity of equation ( 6 ) the value y lies in a range expressed by the following equation ( 7 ) y = k . sub . 1 i ( sin ωt + cos ωt ) + k . sub . 2 i ( cos ωt - sin ωt ) ( 7 ) when equation ( 7 ) is modified by taking k = k 1 / k 2 , the following equation ( 8 ) is obtained = k . sub . 2 i √( k - l ). sup . 2 + ( k + l ). sup . 2 · sin ( ωt + α ) ( 8 ) fig3 a is a vector diagram showing the range of variation of y where 0 ≦ ωt ≦ π / 4 in equation ( 8 ). the variation in the value of y is minimum at α = 3 / 8 πas shown in fig3 b . when α = 3 / 8 π , the value of k is determined to be 2 . 41 by equation ( 9 ), and the range of variation of the value of y can be shown by the following equation ( 10 ) sin 3 / 8π = 0 . 924 ≦ y / { k . sub . 2 i √(- 1 ) + ( k + 1 ). sup . 2 }≦ 1 . 0 ( 10 ) as can be noted from this equation , the range of variation is ± 3 . 95 % about the center of variation . taking a value of k 2 = o . 282 , the coefficient of equation ( 8 ) becomes thus , from the output y from adder 5 , the amplitude value i can be determined with an error of ± 3 . 96 %. where a value proportional to the amplitude value i is to be determined , such value can be determined with an error of ± 3 . 95 % by selecting coefficient k 2 so as to satisfy a condition k = 2 . 41 . by neglecting the error , the operation can be made more readily . for example , when k 1 = 2 and k 2 = 1 are selected , k 2 = 2 . as a consequence , from equation ( 9 ) α = 71 . 5 ° and the error of the value of y can be calculated from equation ( 8 ) to be less than ± 5 . 5 % about the center . as above described , according to this invention , it is possible to readily calculate the amplitude value of a sinusoidal wave by using two data samples dephased 90 ° electrical without performing an operation for determining a square root although the error is slightly increased whereby the defects of the addition method and the square method are eliminated . although in fig2 two coefficient multipliers 3 and 4 are provided either one of them may be omitted by suitably selecting the coefficient . in a modified embodiment shown in fig4 a comparator 11 is provided to compare the absolute values of two data samples i m and i m - 3 having a phase difference of 90 °. a smaller one min {| i m | , | i m - 3 |} and a larger one max {| i m | , | i m - 3 |} respectively selected by the comparator 11 are multiplied with coefficients k 1 and k 2 respectively by coefficient multipliers 12 and 13 and the outputs of the coefficient multipliers are added together by an adder 14 to provide an output y y = k . sub . 1 min {| i . sub . m | , | i . sub . m - 3 |} + k . sub . 2 max {| i . sub . m |, | i . sub . m - 3 |} ( 11 ) by substituting equation ( 5 ) into equation ( 11 ), equation ( 11 ) is modified as follows . ## equ7 ## considering the periodicity of equation ( 12 ), the range of y is expressed by y = k . sub . 1 isin ω t + k . sub . 2 i cos ωt ( 13 ) = k . sub . 2 i √ k . sup . 2 + 1 sin ( ωt + α ) ( 14 ) where ## equ8 ## where 0 ≦ ωt ≦ π / 4 , the range of y expressed by equation ( 14 ) is shown by fig5 a and the variation of y is minimum when α = 3 / 8 π as shown in fig5 b . under these conditions , the value of k determined by equation 15 is equal to 0 . 414 . further from equation ( 14 ) ## equ9 ## this means that the output signal y varies within a range of ± 3 . 96 %. assume now that k 2 = 0 . 9605 , the coefficient of equation ( 14 ) becomes equal to 1 . 03961 so that it it possible to determine the amplitude value within an error range of ± 3 . 96 %. 1 α where a value proportional to the amplitude value is to be determined , such value can be determined with an error of ± 3 . 96 % by selecting coefficient k 2 so as to satisfy a condition k = 0 . 414 . it will be noted that this error is equal to the error of the first embodiment . by neglecting the error , the operation can be made more readily . for example , when k 1 = 1 and k 2 = 2 are selected k = 0 . 5 . consequently , from equation ( 15 ) δ = 63 . 4 ° and the range of variation of y can be limited to be less than ± 5 . 6 %. fig6 shows still another embodiment of this invention which comprises a comparator 20 which compares the absolute values of two data samples i m and i m - 3 also having a phase difference of 90 ° for producing a smaller one min {| i m | , | i m - 3 |} , and an adder 21 which produces the sum of the absolute values of the data i m and i m - 3 . the outputs from comparator 20 and adder 21 are multiplied with coefficients k 11 and k 12 , respectively , by coefficient multipliers 22 and 23 , and the outputs thereof are added each other by an adder 24 to produce an output y , expressed by the following equation y . sub . 1 = k . sub . 11 min {| i . sub . m |, | i . sub . m - 3 |}+ k . sub . 12 {| i . sub . m |+ | i . sub . m - 3 |} in equation ( 17 ) by putting k 1 = k 11 + k 12 and k 2 = k 12 an equation identical to equation ( 11 ) can be obtained with the result that a value proportional to the amplitude value can be obtained with an error of less than ± 3 . 96 % in the same manner as above described . putting now k = k 1 / k 2 = 0 . 414 , then k 11 = - 0 . 586 k 12 . fig7 shows still further modification of this invention which comprises a comparator 20a and an adder 21 . in this case , the comparator 20a compares the absolute values of two data samples i m and i m - 3 and produces a larger one max {| i m | , | i m - 3 |} as its output . the outputs from the comparator and the adder are multiplied with coefficients k 21 and k 22 respectively by coefficient multipliers 22 and 23 and the outputs thereof are added together by a second adder 24 thus producing an output y 2 y . sub . 2 = k . sub . 21 max {| i . sub . m | , | i . sub . m - 3 |} + k . sub . 22 {| i . sub . m | + | i . sub . m - 3 |} if we put k 1 = k 22 , k 2 = k 21 + k 22 , equation ( 18 ) becomes to have the same form as equation ( 11 ) so that y 2 represents a value proportional to the amplitude value with an error of less than ± 3 . 96 %. if k = k 1 / k 2 = 0 . 414 , k 21 = 1 . 42 k 22 . this embodiment too can calculate the amplitude value of a sinusoidal wave without calculating a square root as in the prior art method . | 6 |
referring first to fig1 thereshown is the antenna arrangement 20 of the present invention . the antenna arrangement 20 is used to transmit information from a commodity meter 22 to a remote location , such as a meter reading vehicle or stationary mounted receiving gateway . in the preferred embodiment of the invention , the commodity meter 22 measures the flow of a commodity , such as water or natural gas . the measured amount of commodity flow is transferred out of the sealed meter enclosure 24 to an antenna receptor 26 . as can be seen in fig2 the antenna receptor 26 is sealed within a plastic enclosure 27 and receives a transmitted signal from the commodity meter through the plastic outer wall of the meter enclosure 24 . specifically , the antenna receptor 26 is either inductively coupled or capacitively coupled to a transducer contained within the sealed meter enclosure . the specifics of the coupling between the antenna receptor 26 and the transducer 24 are described in commonly owned u . s . pat . no . 5 , 659 , 300 , incorporated herein by reference . the antenna receptor 26 is connected by a cable 28 to an antenna 30 , as best shown in fig2 and 5 . the antenna 30 is formed along the top surface of a circular circuit board and is configured to transmit a radio frequency signal that can be received by a radio frequency receiving station . the antenna 30 is mounted within an antenna housing 32 , which in turn is seated within an opening 34 formed in the pit lid 36 . as described in the &# 39 ; 300 patent , the pit lid 36 can be formed from metal , plastic , nylon or other material and is positioned above a meter pit in which the commodity meter 22 is located , as shown by the broken lines in fig1 . in the preferred embodiment of the invention , the antenna housing 32 is formed from molded plastic or nylon material such that the antenna 30 can transmit the radio frequency signals through a top surface 38 of the housing 32 . referring now to fig5 and 6 , the antenna housing 32 includes an outwardly tapered upper support portion 40 that is joined to a cylindrical main body portion 42 . the support portion 40 is tapered outwardly at an angle of preferably 120 °, such that the diameter of the top surface 38 is greater than the diameter of the main body portion 42 . as can be seen in fig5 the antenna 30 is positioned within the upper support portion 40 near the transition between the main body portion 42 and the upper support portion 40 . referring now to fig2 the antenna 30 is formed on a generally circular circuit board and is supported within the antenna housing 38 by a circuit board 43 . the cable 28 is soldered to the circuit board 43 . the circuit board 43 includes an upper tab 44 that is received within a mating opening 45 formed in the antenna 30 , as shown in fig5 . specifically , the circuit board 43 is soldered to the antenna 30 to complete the electrical connection between the cable 28 and the antenna 30 . referring back to fig2 and 5 , the lower end of the circuit board 43 is supported on a threaded nipple 46 . the threaded nipple 46 passes through a central opening formed within an outer can 47 that encloses the antenna housing 32 . the outer can 47 is preferably formed from a metallic material and provides a consistent ground for the antenna 30 of the invention . the outer , threaded portion of the nipple 46 receives a nut 48 that securely mounts the can to the housing 42 . the can 47 includes a tapered upper edge 49 that is received within groove 50 formed along the support portion 40 of the antenna housing 32 , as shown in fig5 . thus , tightening of the nut 48 along the threaded portion of the nipple 47 causes the tapered upper edge 49 of the can 37 to be tightly received within the groove 50 . in addition to acting as a consistent ground for the antenna , the can 47 provides a waterproof enclosure for the circuit board 43 and antenna 30 contained within the antenna housing 32 . referring now to fig6 the outwardly tapered upper support portion 40 of the antenna housing 32 contacts and engages a mating tapered surface 51 formed in the pit lid 36 . as can be seen in fig6 the tapered surface 51 increases in diameter from the bottom surface 58 to the top surface 52 of the pit lid 36 . preferably , the taper of the surface 51 is identical to the taper of the support portion 40 to create a smooth fit . as can be understood in fig6 the mating tapered surfaces 40 and 51 increase in diameter as they extend away from the antenna 30 such that the antenna 30 can radiate a signal outwardly , as illustrated by the phantom lines 53 in fig5 . since radio frequency signals are unable to pass through metal , the tapered surface 48 of the pit lid 36 allows the antenna 30 to transmit the signals over a much wider broadcast area , specifically when the antenna 30 is used in a metallic pit lid . the tapered surfaces also allow top surface 38 of the antenna housing 32 to be flush with the top surface 52 of the pit lid 36 . as can be seen in fig5 when the antenna housing 32 is mounted within the opening formed in the pit lid 36 , the antenna 30 is actually positioned below the top surface 52 of the pit lid . the tapered surface 51 that defines the opening in the pit lid 36 allows the angle of possible broadcast radio frequency waves from the antenna 30 to be increased , as compared to an opening having vertical walls . referring now to fig1 and 5 , the mounting arrangement between the pit lid 36 and the antenna housing 32 allows the top surface 38 of the antenna housing 32 to be flush with the top surface 52 of the pit lid 36 . in addition to allowing the radio frequency signals to be transmit from the antenna 30 , the mating tapered surfaces of the upper support portion 40 and the opening formed in the pit lid 36 allow the top surface 38 of the antenna housing 32 to flush mount with the top surface 52 of the pit lid 36 . this feature is unlike the prior art pit lid antenna mounting systems in which the antenna enclosure extended above the top surface 52 of the pit lid . in the prior art systems , the antenna was mounted above the top surface 52 of the pit lid to increase the effective broadcast range for the antenna . in the present system , the tapered portion of the opening formed in the pit lid 36 allows the antenna to transmit signals over the required range . referring now to fig2 and 4 , the antenna housing 32 is secured within the opening 34 formed in the pit lid 36 by the combination of a convoluted washer 54 and a compression fitting 56 . as can best be seen in fig3 the convoluted washer 54 is positioned between the bottom surface 58 of the pit lid 36 and the compression fitting 56 . the compression fitting 56 is a spring element that compresses around the cylindrical outer surface of the can 47 positioned around the antenna housing 32 . although the preferred embodiment of the invention is shown as including the compression fitting 56 , it is contemplated by the inventors that any type of device that engages the bottom surface 58 of the pit lid 36 to prevent the antenna housing 32 from moving through the opening 34 formed in the pit lid 36 would be an equivalent to the structure illustrated . as can be understood in the figures , the antenna arrangement 10 of the present invention is flush mounted with the top surface 52 of a metallic pit lid 36 . the mounting arrangement includes mating tapered surfaces on the antenna housing and the pit lid to allow the antenna to transmit a radio frequency signal over a required broadcast area . in accordance with the invention , the flush - mounted top surface of the antenna housing prevents both contact and damage to the antenna housing when the antenna housing is contained with in a pit lid 36 positioned in an area that receives both foot traffic and vehicle traffic . various alternatives and embodiments are contemplated as being within the scope of the following claims particularly pointing out and distinctly claiming the subject matter regarded as the invention . | 7 |
an important part of selecting a set of consensus sequences that can direct strong expression from a synthetic promoter is choosing the length of the sequences intervening the consensus sites . to mediate a positive effect on promoter activity , transcription factors must not only bind to the promoter sequence , the transcription factors must also be able to interact with each other optionally in order to enhance transcription from the promoter . in several cases it has been shown that even small changes in the intervening sequence between two cooperatively functioning transcription factor binding sites can drastically alter promoter activity ( see , pct international patent application wo 98 / 07846 , incorporated herein by reference ). for this reason , the length of the dna regions separating the chosen consensus boxes have been carefully chosen to mimic wild type promoters . the activity of the jet promoter has been compared to different derivatives of the ubiquitin ( ubc ) promoter using d4egfp reporter assays ( measuring the fluorescence from the expressed green fluorescent protein ) in rat hippocampal hib5 cells . here , the jet promoter drives strong and sustained expression of d4egfp to significant higher levels than the ubiquitin promoter . promoter construction . the promoter was constructed from two oligonucleotides , ojet ( seq . id . no : 7 ) and olinker ( seq . id . no : 8 ): ojet : 5 ′- atc gaattc gggcggagttagggcggaggccaatcagcgtgcgccgttcc ( seq . id . no : 7 ) gaaagttgccttttatggctgggcggagaatgggcggtgaacgccgatgatt atataaggacgcgccgggtgtggca cagctagttccgtcgcagccggg - 3 ′ [ 0018 ] olinker : 5 ′- cag ggatcc acaaacaagaaccgcgacccaa ( seq . id . no : 8 ). at cccggctgcgacggaactagctg - 3 ′ bases underlined with a single line mark the overlapping region of the two oligonucleotides . restriction endonucelase recognition sites are double underlined ( ecori site in ojet ; bam h1 site in olinker ). double stranded dna was made from the oligonucleotides by polymerization in a thermocycler : a 100 μl reaction mix consisting of 2 μm ojet , 2 μm olinker , 200 μm dntp , 2 . 5 μm mgcl 2 , 1 × taq dna polymerase buffer ( amersham pharmacia biotech , uppsala , sweden ) was subjected to heating to 96 ° for 5 minutes , 5 units taq polymerase ( amersham pharmacia biotech , uppsala , sweden ) was added followed by annealing and elongation for 10 minutes at 55 ° c . the polymerization product was run on a 2 % agarose gel . double stranded dna of the expected size ( 182 base pairs ) was purified from the gel using the qlaquick gel extraction kit ( qiagen , hilden , germany ). the term jet “ functional fragment ” refers to a polynucleotide having a sequence that is shorter than the sequence provided in seq . id . no : 1 , but which retains jet promoter activity , i . e ., enhanced promoter activity as compared to ubiquitin promoters ( see , fig2 ). cloning in reporter vector . the polymerized product was cloned in a reporter vector containing an unstable variant of enhanced green fluorescent protein , d4egfp ( clolntech , xxx ), using the ecori and bamh1 restriction sites . the vector obtained was named pjetd4e . the part of the jet promoter including the bamh1 restriction site and downstream bases ( doubly underlined in fig1 ) had been fused directly to the start codon of d4egfp by pcr . the jet promoter sequence was verified by sequencing in pjetd4e . assay of promoter activity . pjetd4e was transiently transfected in rat hippocampal hib5 cells using lipofectamine ( gibco , life technologies a / s , tåstrup , denmark ). forty - eight hr after transfection , d4egfp activity of a fixed number of cells was assayed using a fluorscanner ( fig2 ). use of the invention . typically , a promoter is operably linked to an enhancer region . an “ enhancer ” is a region of a polynucleotide ( usually cis , or on the same polynucleotide as , a promoter ) to which factors bind , thus modulating gene expression from the promoter . as used herein , the term “ modulate ” means that an promoter is controlled or regulated , resulting in the “ down - regulation ” or “ up - regulation ” of the element , depending on the desired effect . by “ operably linked ” is meant that the coding polypeptide and the promoter are functionally connected to permit gene expression when the appropriate factors are bound to the enhancer , promoter , and other regulatory regions of the polynucleotide . an enhancer operably linked to a promoter is located so that expression of a coding polypeptide can be achieved under conditions compatible with the enhancer function . the orientation or placement of the elements of the vector is not strict , so long as the operable linkage requirement is fulfilled for control of and expression of the coding polynucleotide . included in the invention is an isolated dna that includes a jet promoter . the term “ isolated ” refers to molecules separated from other dna or rna molecules that are present in the natural source of the regulatory sequence . the term also refers to a nucleic acid or peptide that is substantially free of cellular material , viral material , or culture medium when produced by recombinant dna techniques , or chemical precursors or other chemicals when chemically synthesized . an isolated nucleic acid includes nucleic acid fragments that are not naturally occurring as fragments and would not be found in the natural state . the term “ isolated ” is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides . the term “ silencer ”, also referred to herein as “ silencer element ” is intended to include regulatory elements capable of decreasing , inhibiting , or repressing transcription from a basic promoter . a “ coding polynucleotide ” is a polynucleotide that can be transcribed into mrna , which is then translated into a polypeptide . the boundaries of the coding polypeptide are determined by a translation start codon at the 5 ′- terminus and a translation stop codon at the 3 ′- terminus . a coding sequence can include , but is not limited to mrna , cdna , and recombinant polynucleotide sequences . an “ open reading frame ” ( orf ) is a region of a coding polynucleotide that encodes a polypeptide ; this open reading frame may represent a portion of a coding sequence or a total coding sequence . when a promoter is operably linked to a coding polynucleotide , the promoter can effect the expression of the coding polynucleotide . the coding polynucleotide can be a “ transgene ” is a polynucleotide inserted by artifice into a cell , so that the polynucleotide becomes part of the genome of an organism ( i . e ., either stably integrated or as a stable extrachromosomal element ) that develops from that cell . the term “ transgenic ” includes any recombinant genetic technology familiar to those in the art used to produce an organism carrying a transgene . such a transgene may include a gene which is partly or entirely heterologous ( i . e ., foreign ) to the transgenic organism , or may represent a gene homologous to an endogenous gene of the organism . the transgene can be a reporter gene . a “ reporter gene ” is a gene whose expression may be assayed . such genes include , without limitation , thymidine kinase ( tk ), neomycin transferase ( neo ), β - galactosidase ( lacz ), - glucuronidase ( gus ), amino acid biosynthetic genes ( e . g . the yeast leu2 gene ), the mammalian chloramphenicol transacetylase ( cat ) gene , an alkaline phosphatase gene , a luciferase gene ( e . g ., the luciferase gene present in pgl3 - basic ( promega corp ., madison , wis . )), or green fluorescent protein genes ( see , fig2 ). in principle , the jet promoter according to the invention can be constructed for use in any living organism , preferably for modulating gene expression of eukaryotic microorganisms and cell lines . in connection with this invention the term “ microorganism ” broadly includes prokaryotic organisms such as bacteria as well as eukaryotic microorganisms such as yeasts , other fungi and cell lines of higher organisms and , in particular , rat hippocampal hib5 cells . this invention is preferably used with organisms selected from the group consisting of eukaryotic microorganisms such as yeasts , other fungi and mammalian cell lines . an interesting eukaryotic microorganism is the yeast species saccharomyces cerevisiae , normal baker &# 39 ; s yeast . in promoters to be used in saccharomyces the consensus sequences may further comprise a transcription initiation signal ( ti box ) functioning in saccharomyces cerevisiae . the regulation of transcription initiation in the eukaryotic cell is complex compared to the prokaryote . the transcription start site is normally preceded by a so called tata box that contains the consensus sequence tataaa or parts hereof , but unlike in the prokaryote , the distance from the tata box to the transcription start site is much less defined . in saccharomyces cerevisiae this distance is typically 40 - 120 nucleotides ( oliver & amp ; warmington , in 3 the yeasts , rose & amp ; harrison , eds ., 117 - 160 ( academic press , london , 1989 )). the so - called - 35 consensus hexamer which is found in many prokaryotic promoters is absent in saccharomyces cerevisiae . instead so - called upstream activation sequences ( uas ) are found upstream of the transcription initiation site . these uas are recognised by specific dna binding proteins that can then act as activators of transcription initiation . for instance , the uas sequence that is found upstream of the genes involved in amino acid biosynthesis , uasgcn4p , consists of a dna sequence that specifies a binding site for the gcn4 protein , which activates the transcription of these genes ( hinnebusch , in the molecular and cellular biology of the yeast saccharomyces , jones et al ., eds . 319 - 414 ( gene expression . cold spring harbor laboratory press , cold spring harbor , n . y ., 1992 )). the distance between the tata box and the uas sequence in eukaryotic promoters is highly variable and may be up to about 1000 bp ( see , pct international patent application wo 98 / 07846 , incorporated herein by reference ). some genes even contain more than one copy of the uas , but one seems to be sufficient for activation . polynucleotides can encode desirable polypeptides , including peptides fused to carrier proteins . polypeptides can be encoded by either a synthetic or recombinant polynucleotide . the term “ recombinant ” refers to the molecular biological technology for combining polynucleotides to produce useful biological products , and to the polynucleotides and peptides produced by this technology . the polynucleotide can be a recombinant construct ( such as a vector or plasmid ) which contains the coding polynucleotide under the operative control of polynucleotides encoding regulatory elements such as promoters , termination signals , and the like , including the jet promoter . a control sequence operatively linked to a coding sequence is ligated such that expression of the coding sequence is achieved under conditions compatible with the control sequences . “ control sequence ” refers to polynucleotide sequences which are necessary to effect the expression of coding and non - coding sequences to which they are ligated . control sequences generally include promoter , ribosomal binding site , and transcription termination sequence . in addition , “ control sequences ” refers to sequences which control the processing of the peptide encoded within the coding sequence ; these can include , but are not limited to sequences controlling secretion , protease cleavage , and glycosylation of the peptide . the term “ control sequences ” is intended to include , at a minimum , components whose presence can influence expression , and can also include additional components whose presence is advantageous , for example , leader sequences and fusion partner sequences . a “ coding sequence ” is a polynucleotide sequence which is transcribed and translated into a polypeptide . two coding polynucleotides are “ operably linked ” if the linkage results in a continuously translatable sequence without alteration or interruption of the triplet reading frame . a polynucleotide is operably linked to a gene expression element if the linkage results in the proper function of that gene expression element to result in expression of the coding sequence ( such as is shown in fig2 for example ). “ transfection ” is the insertion of an exogenous polynucleotide ( i . e ., a “ transgene ”) into a host cell . the exogenous polynucleotide is integrated within the host genome . a polynucleotide is “ capable of expressing ” a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are “ operably linked ” to coding polynucleotides . a polynucleotide that encodes a peptide coding region can be then amplified , for example , by preparation in a bacterial vector , according to conventional methods known to those of skill in the art of molecular biology , for example , described in the standard work sambrook et al ., molecular cloning : a laboratory manual ( cold spring harbor press 1989 ). expression vehicles include plasmids or other vectors . the polynucleotides of the invention , including the jet promoter and polynucleotides under the control of the jet promoter can be prepared by chemical synthesis methods or by recombinant techniques . the polypeptides can be prepared conventionally by chemical synthesis techniques , such as described by merrifield , 85 j . amer . chem . soc . 2149 - 2154 ( 1963 ) ( see , stemmer et al , 164 gene 49 ( 1995 )). synthetic genes , the in vitro or in vivo transcription and translation of which will result in the production of the protein can be constructed by techniques well known in the art ( see , brown et al ., 68 methods in enzymology 109 - 151 ( 1979 )). the coding polynucleotide can be generated using conventional dna synthesizing apparatus such as the applied biosystems model 380a or 380b dna synthesizers ( commercially available from applied biosystems , inc ., 850 lincoln center drive , foster city , calif . 94404 ). alternatively , systems for cloning and expressing polynucleotides encoding desirable polypeptides ( using the jet promoter ) include various microorganisms and cells which are well known in recombinant technology . these include , for example , various strains of e . coli , bacillus , streptomyces , and saccharomyces , as well as mammalian , yeast and insect cells . suitable vectors are known and available from private and public laboratories and depositories and from commercial vendors . see , sambrook et al ., molecular cloning : a laboratory manual ( cold spring harbor press 1989 ). see , also pct international patent application wo 94 / 01139 ). these vectors permit infection of patient &# 39 ; s cells and expression of the synthetic gene sequence in vivo or expression of it as a peptide or fusion protein in vitro . polynucleotide gene expression elements useful for the expression of cdna encoding peptides include , but are not limited to ( a ) viral transcription promoters and their enhancer elements , such as the sv40 early promoter , rous sarcoma virus ltr , and moloney murine leukemia virus ltr ; ( b ) splice regions and polyadenylation sites such as those derived from the sv40 late region ; and ( c ) polyadenylation sites such as in sv40 . recipient cells capable of expressing the hiv vaccine candidate gene product are then transfected . the transfected recipient cells are cultured under conditions that permit expression of the desirable polypeptide products , which are recovered from the culture . host mammalian cells , such as chinese hamster ovary cells ( cho ) or cos - 1 cells , can be used . these hosts can be used in connection with poxvirus vectors , such as vaccinia or swinepox . suitable non - pathogenic viruses which can be engineered to carry the synthetic gene into the cells of the host include poxviruses , such as vaccinia , adenovirus , retroviruses and the like . a number of such non - pathogenic viruses are commonly used for human gene therapy , and as carrier for other vaccine agents , and are known and selectable by one of skill in the art . the selection of other suitable host cells and methods for transformation , culture , amplification , screening and product production and purification can be performed by one of skill in the art by reference to known techniques ( see , e . g ., gething & amp ; sambrook , 293 nature 620 - 625 ( 1981 )). another preferred system includes the baculovirus expression system and vectors . determinations of the sequences for the polynucleotide coding region that codes for the desirable polypeptide , for the jet promoter , or for polynucleotides for related uses described herein can be performed using commercially available computer programs , such as dna strider and wisconsin gcg . owing to the natural degeneracy of the genetic code , the skilled artisan will recognize that a sizable yet definite number of dna sequences can be constructed which encode the claimed peptides ( see , watson et al ., molecular biology of the gene , 436 - 437 ( the benjamin / cummings publishing co . 1987 )). recombinant genetic techniques . a recombinant polynucleotide containing a regulatory region of the invention can be constructed in a standard dna expression vector and introduced to a cell for expression within the cell . the term “ recombinant ” refers to a product of human intervention . polynucleotides for insertion into cloning vectors , for example regulatory regions , can be constructed using the polymerase chain reaction ( pcr ) to amplify appropriate polynucleotides . polynucleotide synthesis and purification techniques are described in sambrook et al ., molecular cloning : a laboratory manual ( cold spring harbor laboratory press , 1989 ); current protocols in molecular biology , ausubel et al ., eds ., ( wiley interscience , n . y . 1993 ), and molecular biology labfax ( brown , ed ., academic press , 1991 ). the pcr procedure is performed by well - known methodology ( see , for example , bangham , in protocols in molecular genetics ( humana press , 1991 )). moreover , pcr kits can be purchased from companies such as stratagene cloning systems ( la jolla , calif .) and invitrogen ( san diego , calif .). the products of pcr are subcloned into cloning vectors . the use of pcr for bacterial host cells is described , for example , by hofmann et al ., in pcr protocols and applications white , ed . ( humana press , 1993 ) pp . 205 - 210 ), and by cooper et al ., in pcr protocols and applications white , ed . ( humana press , 1993 ) at pp . 305 - 316 ). “ host cells ” are cells in which a vector can be propagated and the vector dna can be expressed . a “ vector ” is a replicon to which regulatory region is attached , so as to bring about the replication or expression of a coding polynucleotide . vectors can be used for the transformation of cells in gene manipulation bearing a coding polynucleotide corresponding to appropriate polypeptides that , when combined with appropriate regulatory region , confer specific properties on the transformed cell . recombinant vectors are constructed by cutting and joining polynucleotides from different sources using restriction enzymes and ligases . any of many vectors can be employed for this purpose . factors of importance in selecting a particular vector include the ease with which host cells that contain the vector may be recognized and selected from those host cells which do not contain the vector . vectors include cloning vectors and expression vectors . a cloning vector is a polynucleotide , such as a plasmid , cosmid or bacteriophage , that can replicate autonomously in a host prokaryotic or eukaryotic cell . cloning vectors typically contain one or a small number of restriction endonuclease recognition sites at which polynucleotide sequences can be inserted in a determinable fashion without loss of an essential biological function of the vector , as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector . suitable cloning vectors are described by sambrook et al ., molecular cloning : a laboratory manual ( cold spring harbor laboratory press , 1989 ); current protocols in molecular biology , ausubel et al ., eds ., ( wiley interscience , n . y . 1993 ), and molecular biology labfax ( brown , ed ., academic press , 1991 ). cloning vectors can be obtained , for example , from gibco / brl ( gaithersburg , md . ), clontech laboratories , inc . ( palo alto , calif . ), promega corporation ( madison , wis . ), stratagene cloning systems ( la jolla , calif . ), invitrogen ( san diego , calif . ), and the american type culture collection ( rockville , md .). cloned variants are amplified by transforming competent bacterial cells with a cloning vector and growing the bacterial host cells in the presence of the appropriate antibiotic ( see , for example , sambrook et al ., and ausubel et al . pcr is then used to screen bacterial host cells for the appropriate clones ). the resulting recombinant polynucleotide or relevant parts can be cloned from cloning vectors into expression vectors , which expression vectors have characteristics permitting higher levels of , or more efficient expression of , the resident polynucleotides . vectors of the invention . the invention further provides vectors containing the regulatory region operably linked to coding polynucleotides . many genetic constructs and methods for expressing heterologous genes in cells of mammals are known in the art and are suitable for use with the regulatory region of the invention . for example , the construction can be accomplished with conventional methods , such as those that employ viral vectors ( e . g ., vectors derived from retroviruses , adenoviruses , herpes viruses , vaccinia viruses , polio viruses , sindbis viruses , adeno - associated viruses , and other dna and rna viruses .). in addition , the invention is suitable for methods involving direct injection of recombinant polynucleotide of the invention , in which the recombinant polynucleotide is either chemically encapsulated or not ( i . e ., exists as free dna ; “ naked dna ”). expression vectors . the invention provides recombinant polynucleotides in a recombinant expression vector . the term “ expression vector ” refers to a plasmid , virus or other vehicle known in the art that has been manipulated by insertion or incorporation of the target genetic sequences . such expression vectors contain a promoter which facilitates the efficient transcription of the inserted genetic sequence of the host . the expression vector typically contains the regulatory region or the promoter of the invention . for a mammalian host , several possible vector systems are available for expression of the polynucleotide specific for a targeted transcript . some vectors use dna elements which provide autonomously replicating extra - chromosomal plasmids , generally derived from animal viruses . other vectors include vaccinia virus expression vectors . still other vectors integrate the desired polynucleotide into the host chromosome . cells which have stably integrated the introduced dna into their chromosomes can be selected by also introducing one or more markers ( e . g ., an exogenous gene ) which allow selection of host cells which contain the expression vector . the marker may provide for prototropy to an auxotrophic host , biocide resistance , e . g ., antibiotics , or heavy metals , such as copper or the like . the selectable marker gene can either be directly linked to the dna sequences to be expressed , or introduced into the same cell by co - transformation . additional elements may also be needed for optimal synthesis of mrna . these elements may include splice signals , as well as transcription termination signals . various techniques can be used for introducing these vectors into mammalian cells , such as protoplast fusion , calcium phosphate precipitation , electroporation or other conventional techniques . viral vectors . virus - like vectors are useful as vehicles for the importation and expression of recombinant polynucleotide constructs in cells . virus - derived vectors can safely deliver exogenous nucleic acid to a recipient cell . virus - derived vectors that carry a heterologous gene ( transgene ) to exploit the natural ability of a virus to deliver genomic content to a target cell are useful for gene therapy to correct genetic disease or to deliver therapeutic molecules . vectors suitable for use in the present invention include baculovirus - derived vectors for expression in insect cells ; microbial expression vectors such as recombinant bacteriophage dna , plasmid dna or cosmid dna expression vectors containing the polynucleotide of the invention ; recombinant yeast expression vectors ; plant cell recombinant virus expression vectors ( e . g ., cauliflower mosaic virus , camv ; tobacco mosaic virus , tmv ) or transformed with recombinant plasmid expression vectors ( e . g ., ti plasmid ) containing the polynucleotide coding sequence ; or animal cell recombinant virus expression vectors ( e . g ., retroviruses , adenovirus , vaccinia virus ) containing the polynucleotide coding sequence , or transformed animal cell systems engineered for stable expression . to produce recombinant viral vectors for mammalian cells , several viruses have been developed . interest has centered on four types ; retroviruses ( including lentiviruses ), adenoviruses , adeno - associated viruses and herpes simplex virus type 1 ( see , david peel , virus vectors & amp ; gene therapy : problems , promises & amp ; prospects ( mbchb special study module project report , department of microbiology & amp ; immunology , university of leicester , 1998 )). generally , such vectors do not replicate in vivo , precluding any unintended infection of non - target cells . in such cases , helper cell lines are provided which supply the missing replicative functions in vitro , thereby permitting amplification and packaging of the vector encoding the polynucleotide . a further precaution against accidental infection of non - target cells involves the use of target cell - specific regulatory sequences . when under the control of such sequences , polynucleotide constructs would not be expressed in normal tissues ( see , u . s . pat . no . 5 , 824 , 544 , which provides adenovirus vectors for use in gene therapy that prevent the generation of replication - competent adenovirus during in vitro propagation and clinical use ). retroviral vectors . retroviruses are a class of enveloped viruses containing a single stranded rna molecule as the genome . following infection , the retroviral genome is reverse transcribed into double stranded dna , which integrates into the host genome and expresses as proteins . the viral genome contains at least three genes : gag ( coding for core proteins ), pol ( coding for reverse transcriptase ) and env ( coding for the viral envelope protein ). at each end of the genome are long terminal repeats ( ltrs ) which include regulatory regions and sequences involved with reverse transcription and integration . in addition there are sequences required for packaging the viral dna ( psi ) and rna splice sites in the env gene . in addition to using retroviruses as recombinant vectors for the transfection of polynucleotides to a cell , retroviruses can be used to transform cells by integrating near to a cellular proto - oncogene and driving inappropriate expression from the ltr . this event is termed insertional mutagenesis . retroviral vectors are frequently used for or gene therapy , because of their ability to integrate into the cellular genome ( jolly , 1 cancer gene therapy 51 - 64 ( 1994 ); hodgson , 13 biotechnology 222 - 225 ( 1995 )). retroviral vectors can be based upon the moloney murine leukemia virus ( mo - mlv ). mo - mlv is an amphotrophic virus , capable of infecting both mouse and human cells . this capability enables vector development in both mouse models and human cells , thus enabling human treatment . the viral genes are replaced with the transgene of interest and expressed on plasmids in the packaging cell line . because the plasmids lacking non - essential genes lack the packaging sequence ( psi ) they are not included in the virion particle . ( that is , the plasmids containing the structural genes ( gag , pol and env ) lack the packaging signal . the structural viral genes are essential , at least for virus formation .) to prevent recombination resulting in replication competent retroviruses , all regions of homology with the vector backbone are usually removed and the non - essential genes expressed by at least two transcriptional units ( see , ory et al ., 93 ( 21 ) proc . natl . acad . sci . usa 11400 - 06 ( 1998 ), who have generated a human 293 - derived retroviral packaging cell line ( 293gpg )). the essential regions include the 5 ′ and 3 ′ ltrs and the packaging sequence lying downstream of the 5 ′ ltr . transgene expression can either be driven by the regulatory region in the 5 ′ ltr , or by the regulatory region of the invention . the exact positioning of the transgene start codon and small alterations of the 5 ′ ltr influence transgene expression . to aid identification of transformed cells selectable markers , such as neomycin and β - galactosidase , can be included and transgenes expression can be improved with the addition of internal ribosome sites . lentiviruses are a subclass of retroviruses which are able to infect both proliferating and non - proliferating cells . they are considerably more complicated than simple retroviruses , containing an additional six proteins , tat , rev , vpr , vpu , nef and vif : current packaging cell lines have separate plasmids for a pseudotype env gene , a transgene construct , and a packaging construct supplying the structural and regulatory genes in trans . the retroviral envelope interacts with a specific cellular protein to determine the target cell range . altering the env gene or or env protein can manipulate the cell range , for example by direct modifications of the binding site between the envelope protein and the cellular receptor ; replacing a portion of the env gene with 150 codons from the erythropoietin protein ( epo ) ( see , kasahara et al ., 266 science 1374 - 1376 ( 1994 ); coupling an antibody to the viral particle with affinity for a second cell specific antibody via a streptovadin bridge ( see , roux et al ., 86 proc . nat &# 39 ; l acad . sci . usa 9079 - 9083 ( 1989 ); and treating viral particles with lactose for uptake by cells , principally hepatocytes , expressing asiaglycoprotein receptors . because viruses differ with respect to their tropisms , replacing the env gene with that of another virus extends the host range in a technique known as pseudotyping . adenovirus vectors . adenoviruses are non - enveloped viruses containing a linear double stranded dna genome , which has been well - characterized through studies in classical genetics and molecular biology ( horwitz , in virology , 2nd ed ., fields et al ., eds . ( raven press , new york , 1990 ). subgroup c serotypes 2 or 5 are usually used as vectors . the life cycle does not normally involve integration into the host genome , rather adenoviruses replicate as episomal elements in the nucleus of the host cell . adenovirus - based vectors offer several unique advantages , including tropism for both dividing and non - dividing cells , minimal pathogenic potential , ability to replicate to high titer for preparation of vector stocks , and the potential to carry large inserts ( berkner , 158 curr . top . micro . immunol . 39 - 66 ( 1992 ); jolly , 1 cancer gene therapy 51 - 64 ( 1994 ). the cloning capacity of an adenovirus vector results from the deletion of certain regions of the virus genome dispensable for virus growth ( graham , j . gen . virol . 36 : 59 - 72 ( 1977 )). adenoviruses have four early transcriptional units ( e1 , e2 , e3 and e4 ), which have regulatory functions , and a late transcript , which codes for structural proteins . progenitor vectors have either the e1 or e3 gene inactivated , with the missing gene being supplied in trans either by a helper virus , plasmid or integrated into a helper cell genome ( human fetal kidney cells , 293 , graham et al ., 36 j . gen . virol . 59 - 72 ( 1977 )). second generation vectors additionally use an e2a temperature sensitive mutant ( see , engelhardt et al ., human gene therapy 5 : 1217 - 1229 ( 1994 )) or an e4 deletion ( see , armentano et al ., j . virol . 71 : 2408 - 2416 ( 1997 )). the “ gutless ” vectors contain only the inverted terminal repeats ( itrs ) and a packaging sequence around the transgene , all the necessary viral genes being provided in trans by a helper virus ( chen et al ., 94 proc . nat &# 39 ; l acad . sci . usa 1645 - 1650 ( 1997 )). adenoviral vectors are very efficient at transfecting cells in vitro and in vivo , and can be produced at high titers . transgene expression in vivo from progenitor vectors tends to be transient . the development of vectors containing fewer genes , culminating in the “ gutless ” vectors which contain no viral coding sequences , has resulted in prolonged in vivo transgene expression in liver tissue ( schieder et al ., 18 nature genetics 180 - 183 ( 1998 )). uptake of the adenovirus particle is a two stage process involving an initial interaction of a fiber coat protein in the adenovirus with a cellular receptor or receptors , then binding to the integrin family of cell surface heterodimers , allowing internalization via receptor mediated endocytosis . methods of increasing viral uptake include stimulating the target cells to express an appropriate integrin ( see , davison et al ., 71 j . virol . 6204 - 6207 ( 1997 )) and conjugating an antibody with specificity for the target cell type to the adenovirus ( see , goldman et al ., 57 cancer res . 1447 - 1451 ( 1997 )). adeno - associated viruses . adeno - associated viruses ( aav ) are non - pathogenic human parvoviruses , dependent on a helper virus to proliferate . aav are capable of infecting both dividing and non dividing cells , and in the absence of a helper virus integrate into a specific point of the host genome ( chromosome19q 13 - qter ) at a high frequency . the wild type genome is a single stranded dna molecule , consisting of two genes ; rep , coding for proteins which control viral replication , structural gene expression and integration into the host genome , and cap , which codes for capsid structural proteins . at either end of the genome is a terminal repeat ( tr ), containing an aav promoter : viral vectors that are derived from aav offer many potential advantages . recombinant aav can also efficiently integrate into the host genome , can transduce non - dividing cells , and does not induce an immune response which destroys the transfected cells . when used as a vector , the rep and cap genes are replaced by the transgene and its associated regulatory sequences . production of the recombinant vector requires that rep and cap are provided in trans , along with helper virus gene products the conventional method is to co - transfect two plasmids , one for the vector and another for rep and cap , into cells infected with adenovirus . more recent protocols remove all adenoviral structural genes and use rep resistant plasmids ( see , xiao et al , 72 journal of virology 2224 - 2232 ( 1998 )) or conjugate a rep expression plasmid to the mature virus prior to infection ( see , fisher et al ., 7 human gene therapy 2079 - 2087 ( 1996 )). interest in aav vectors has been due to aav integration into the host genome allowing prolonged transgene expression . gene transfer into hepatic cells has been reported by snyder et al ., 16 nature genetics 270 - 275 ( 1997 ). herpes simplex virus . herpes simplex virus type 1 ( hsv - 1 ) is a human neurotropic virus . consequently interest has largely focused on using hsv - 1 as a vector for gene transfer to the nervous system . the wild type hsv - 1 virus is able to infect neurons and either proceed into a lytic life cycle or persist as an intranuclear episome in a latent state . latently infected neurons function normally and are not rejected by the immune system . the hsv - 1 viral genome is a linear double stranded dna molecule . there are two unique regions , long and short ( termed ul and us ) which are linked in either orientation by internal repeat sequences ( irl and irs ). at the non - linker end of the unique regions are terminal repeats ( trl and trs ). about half of the viral genes are not essential for growth in cell culture . once these non essential genes have been deleted , foreign dna can be accommodated within the virus . three main classes of hsv - 1 genes have been identified , namely the immediate - early ( ie or α ) genes , early ( e or β ) genes and late ( l or gamma ) genes . two basic approaches have been used for production of hsv - 1 vectors , namely amplicons and recombinant hsv - 1 viruses . amplicons are bacterially produced plasmids containing col e1 ori ( an escherichia coli origin of replication ), oris ( the hsv - 1 origin of replication ), hsv - 1 packaging sequence , the transgene under control of an immediate - early promoter and a selectable . the amplicon is transfected into a cell line containing a helper virus ( a temperature sensitive mutant ) which provides all the missing structural and regulatory genes in trans . both the helper and amplicon containing viral particles are delivered to the recipient . more recent amplicons include an epstein - barr virus derived sequence for plasmid episomal maintenance ( wang & amp ; vos , 70 j . virol . 8422 - 8430 ( 1996 )). recombinant viruses are made replication deficient by deletion of one the immediate - early genes e . g . icp4 , which is provided in trans . deletion of a number of immediate - early genes substantially reduces cytotoxicity and also allows expression from promoters that would be silenced in the wild type latent virus , making these promoters of use in directing long term gene expression . replication - conditional mutants are only able to replicate in certain cell lines . these mutants are particularly useful for the treatment of cancers , killing the neoplastic cells which proliferate faster than other cell types . permissive cell lines are all proliferating and supply a cellular enzyme to complement for a viral deficiency . non - viral polynucleotides . non - viral polynucleotide constructs are also useful as vehicles for the importation and expression of recombinant polynucleotide constructs in cells . the recombinant polynucleotides of the invention can be directly injected into tissue . methods of direct injection of polynucleotides into tissue are described by blau & amp ; springer , 333 ( 23 ) n engl j med 1554 - 6 ( 1995 ). see also , blau & amp ; khavari , 3 ( 6 ) nat med 612 - 3 ( 1997 ) the recombinant polynucleotides of the invention can be chemically encapsulated for transfection , as described by wu et al ., 264 ( 29 ) j biol chem 16985 - 7 ( 1989 ). wu et al showed that a foreign gene driven by natural mammalian regulatory elements can be targeted to hepatocytes and the resultant gene expression made to persist . a soluble dna carrier system was constructed of two covalently linked components : ( 1 ) a polycation , poly - l - lysine , that can bind dna in a strong but non - damaging interaction , and ( 2 ) an asialoglycoprotein which can be targeted specifically to hepatocytes by cell surface asialoglycoprotein receptors unique to this cell type . wu et al . used a plasmid containing mouse albumin regulatory sequences ( making this system attractive for use with the recombinant polynucleotide of the invention ) and complexed to the carrier system for intravenous injection . by this system , the precombinant polynucleotide of the invention can be delivered to hepatocytes by intravenous injection in vivo using a soluble dna carrier system . gene expression targeted in this manner can be made to persist by stimulation of hepatocyte replication . the recombinant polynucleotide of the invention can also be introduced into cells by the method of kaneda et al ., 243 science 375 - 8 ( 1989 ) by this method , recombinant polynucleotide of the invention , and nuclear proteins are efficiently transferred into cells . the recombinant polynucleotide is rapidly transported into the nuclei of cultured cells . moreover , when the recombinant polynucleotide and nuclear protein are cointroduced into nondividing cells in rat liver by injection into rat portal veins , the recombinant polynucleotide is carried into liver cell nuclei efficiently by nuclear protein for expression in the rat liver . alternatively , the recombinant polynucleotide of the invention can be introduced into cells by the method of remy et al ., 92 ( 5 ) proc natl acad sci usa 1744 - 8 ( 1995 ), a modular transfection system based on lipid - coated polynucleotide particles reminiscent of enveloped viruses . the particle core is composed of the lipopolyamine - condensed polynucleotide in an electrically neutral ratio to which other synthetic lipids with key viral properties are hydrophobically adsorbed . good transfection level can be achieved simply with the neutral core particle , provided a zwitterionic lipid ( dioleoyl phosphatidylethanolamine ) is added to completely coat the recombinant polynucleotide . addition of lipids with a triantennary galactosyl residue drives the neutral nucleolipidic particles to the asialoglycoprotein receptor of liver cells , such as the human hepatoma hepg2 cells : transfection increases approximately 1000 - fold with 25 % galactolipid . these electrically silent particles provide an attractive solution for gene transfer in vivo where the external saccharide coat allows the particles to diffuse within the organism and reach target cells . the invention provides transformed cells containing the regulatory region operably linked to coding polynucleotides . a recombinant polynucleotide can be expressed in vitro by dna transfer into a suitable host cell . “ host cells ” are cells in which a vector can be propagated and its dna expressed . ( note , the replication defective vectors ( see above ) cannot be propagated in the mammalian cells ) the term also includes any progeny of the subject host cell , even those that are not identical to the parental cell due to mutations that occurred during replication . methods of stable transfer , meaning that the foreign dna is continuously maintained in the host , are known in the art . when the host cell is a eukaryote , such methods of transfection of dna as calcium phosphate co - precipitates , conventional mechanical procedures such as microinjection , electroporation , insertion of a plasmid encased in liposomes , or virus vectors may be used . eukaryotic cells can also be co - transformed with the polynucleotide of the invention , and a second foreign dna molecule encoding a selectable phenotype , such as the herpes simplex thymidine kinase gene . another method is to use a eukaryotic viral vector to transiently or stably infect or transform eukaryotic cells . host cells may be transformed with the recombinant polynucleotide of the invention and cultured in conventional nutrient media modified as is appropriate for inducing promoters , selecting transformants or amplifying genes . the culture conditions , such as temperature , ph and the like , are those previously used with the host cell selected for expression , and will be apparent to the ordinarily skilled artisan . the techniques of transforming cells with vectors are well known in the art and may be found in such general references as sambrook et al ., molecular cloning : a laboratory manual , ( cold spring harbor laboratory press , 1989 ) and current protocols in molecular biology , ausubel et al ., eds . ( wiley interscience , n . y . 1993 ) thus , the invention provides transformed cells . a “ transformed ” cell is a cell or progeny of a cell into which has been introduced , by means of recombinant genetic techniques , a polynucleotide encoding a polypeptide , including a suitable regulatory region . the transformed cell may be any cell that can be easily transfected and can express a polypeptide . any suitable source of tissue , can be used as a source for generating transformed cells , including publicly available immortalized cell lines and dividing primary cell cultures . examples of human cell lines include human neural stem or progenitor cells ; rpmi 2650 , ht - 1080 or sw - 13 epithelial cells ; hl - 60 macrophage cells ; ccrf - cem or rpmi 8226 lymphoid cells ; and wi - 38 , hell , mrc - 5 or imr - 90 fibroblast cells . other useful cell lines include cv - 1 , cos , f9 , cho , hela , nih 3t3 , hutu80 , rat2 fibroblast , ht1080 . t , chick embryo fibroblast , quail qt6 , or drosophila schneider s2 . preferably , the transformed cell contains the factors necessary for optimal gene expression using the enhancer region of the invention , for example , a liver cell , a liver - derived cell , or a cell that can express liver - specific genes , such as an embryonic cell . the transformed cell can be selected from transformed 293 , av12 , hepg2 , h2 . 35 , or e11b4d cells . a number of selection systems may be used , including but not limited to the herpes simplex virus thymidine kinase , hypoxanthine - guanine phosphoribosyltransferase , and adenine phosphoribosyl - transferase genes can be employed in tk − , hgprt − or aprt − cells respectively . also , antimetabolite resistance can be used as the basis of selection for dhfr , which confers resistance to methotrexate ; gpt , which confers resistance to mycophenolic acid ; neo , which confers resistance to the aminoglycoside g - 418 ; and hygro , which confers resistance to the hygromycin antibiotic . additional selectable genes have been described , namely trpb , which allows cells to utilize indole in place of tryptophan ; hisd , which allows cells to utilize histinol in place of histidine ; and odc ( ornithine decarboxylase ) which confers resistance to the ornithine decarboxylase inhibitor , 2 -( difluoromethyl )- dl - ornithine , dfmo . increased expression can be achieved by increasing or amplifying the vector copy number using amplification methods well known in the art . such amplification methods include , e . g ., dhfr amplification ( see , e . g ., u . s . pat . no . 4 , 470 , 461 ) or glutamine synthetase (“ gs ”) amplification ( see , e . g ., u . s . pat . no . 5 , 122 , 464 ). expression vectors containing the geneticin ( g418 ) or hygromycin drug selection genes are also useful . these vectors can express both a coding polynucleotide of interest and a gene conferring resistance to selection with toxin such as g418 or hygromycin b . the g418 resistance gene codes for aminoglycoside phosphotransferase ( aph ) which enzymatically inactivates g418 added to the culture medium . only those cells expressing the aph gene will survive drug selection usually resulting in the expression of the second biologic gene as well . the hygromycin b phosphotransferase ( hbh ) gene codes for an enzyme that specifically modifies hygromycin toxin and inactivates it . genes cotransfected with or contained on the same plasmid as the hygromycin b phosphotransferase gene will be preferentially expressed in the presence of hygromycin b . pharmaceutical compositions . the invention provides pharmaceutical compositions containing the regulatory region . the pharmaceutical compositions are the recombinant polynucleotides of the invention in a pharmaceutically acceptable excipient . the invention also provides methods for using the regulatory region for increasing gene expression . the method involves providing a transformed cell containing a recombinant polynucleotide , a regulatory region of the invention operably linked to a coding polynucleotide , and expressing the coding polynucleotide in the cell . the invention provides methods for using the recombinant polynucleotide of the invention . for example , the invention provides a method for introducing recombinant polypeptide into a cell . the cell is contacted with a recombinant polynucleotide of the invention under conditions that permit the recombinant polypeptide to enter the cell . the contacting can occur in vitro or in vivo . in one embodiment , the contacting involves perfusing tissue with a liquid containing the recombinant polynucleotide . in another embodiment , the contacting is by a route of administration that is intravenous , intramuscular , intradermal , subcutaneous , oral , or topical . the recombinant polynucleotides of the invention have application in gene therapy for the treatment of diseases that require that a gene be transferred to recipient cells for the purpose of correcting a missing or defective gene , or for the purpose of providing a therapeutic molecule for treatment of a clinical condition . the vectors of the present invention can be adapted to ex vivo and in vitro gene therapy applications . thus , the invention provides method for providing therapy for a subject . the recombinant polynucleotide of the invention is administered to a subject in need of gene therapy , such that the administering of the recombinant polynucleotide involves expressing the coding polynucleotide for a therapeutic polypeptide . in one embodiment , the subject is human . administration of the polynucleotides . the polynucleotides of the invention can be administered to a subject by any common route ( oral , nasal , buccal , rectal , vaginal , or topical ), or by subcutaneous , intramuscular , intraperitoneal , or intravenous injection . “ administering ” the polynucleotides of the invention may be accomplished by any means known to the skilled artisan . by “ subject ” is meant any mammal , preferably a human . polynucleotides of the invention can be administered in the form of a pharmaceutical composition . a “ pharmaceutical composition ” contains the polynucleotide of the invention in a pharmaceutically acceptable excipient . examples of pharmaceutically acceptable excipients are provided below . polynucleotides of the invention can be administered in vivo or ex vivo . polynucleotides of the invention can be administered ex vivo by transfer of genetic material to cells , for example hematopoietic stem cells , located outside a subject . ex vivo transfer , as used herein , utilizes available techniques known to those skilled in the art to remove cells from a subject and introduce into these cells a therapeutic amount of genetic material . following transfer of the genetic material , the transfected cells can be implanted back in the host subject . in vivo transfer , as used herein , uses available techniques known to those skilled in the art to transfer genetic material into a host cell while the host cell remains part of , or contained in , a multicellular organism . the pharmaceutical compositions of the invention can be administered topically , intravenously , orally or parenterally or as implants , but even rectal use is possible in principle . suitable solid or liquid pharmaceutical preparation forms are , for example , granules , powders , tablets , coated tablets , ( micro ) capsules , suppositories , syrups , emulsions , suspensions , creams , aerosols , drops or injectable solution in ampule form and also preparations with protracted release of active compounds , in whose preparation excipients and additives and / or auxiliaries such as disintegrants , binders , coating agents , swelling agents , lubricants , flavorings , sweeteners or solubilizers are customarily used as described above . the pharmaceutical compositions are suitable for use in a variety of drug delivery systems ( for a briefreview of standard methods for drug delivery , see , langer , 249 science 1527 - 1533 ( 1990 )). a pharmaceutical composition in the form of injectable compositions is typically administered in a pharmaceutically acceptable solvent or diluent and other suitable , physiologic compounds . the composition may contain polynucleotide and about 10 mg of human serum albumin per ml of a phosphate buffer containing nacl . other pharmaceutically acceptable excipients include non - aqueous or aqueous solutions and non - toxic compositions including salts , preservatives , buffers and the like . non - aqueous solutions include propylene glycol , polyethylene glycol , vegetable oil and injectable organic esters such as ethyloleate . aqueous solutions include water , alcoholic / aqueous solutions , saline solutions , parenteral vehicles such as sodium chloride , ringer &# 39 ; s dextrose , etc . intravenous vehicles include fluid and nutrient replenishers . preservatives include antimicrobial , anti - oxidants , chelating agents and inert gases . the ph and exact concentration of the various components the pharmaceutical composition are adjusted according to routine skills in the art . a preferred pharmaceutical composition for topical administration is a dermal cream or transdermal patch . a pharmaceutical composition can also be administered by injection as an oily suspension . suitable lipophilic solvents or vehicles include fatty oils , such as sesame oil , or synthetic fatty acid esters , such as ethyl oleate or triglycerides . moreover , vectors may be combined with a lipophilic carrier such as any one of a number of sterols including cholesterol , cholate and deoxycholic acid . a preferred sterol is cholesterol . aqueous injection suspensions may contain substances which increase the viscosity of the suspension include , for example , sodium carboxymethyl cellulose , sorbitol , and / or dextran . optionally , the suspension also contains stabilizers . liposome encapsulation provides an alternative formulation for the administration of pharmaceutical compositions of the invention . liposomes are microscopic vesicles that consist of one or more lipid bilayers surrounding aqueous compartments ( see , generally , bakker - woudenberg et al ., 12 ( suppl . 1 ) eur . j . clin . microbiol . infect . dis . s61 ( 1993 ), and kim , 46 drugs 618 ( 1993 )). liposomes are similar in composition to cellular membranes and as a result , liposomes can be administered safely and are biodegradable . depending on the method of preparation , liposomes may be unilamellar or multilamellar , and liposomes can vary in size with diameters ranging from 0 . 02 μm to greater than 10 μm . a variety of agents can be encapsulated in liposomes : hydrophobic agents partition in the bilayers and hydrophilic agents partition within the inner aqueous spaces ( see , for example , machy et al ., liposomes in pharmacology ( john libbey 1987 ), and ostro et al ., 46 american j . hosp . pharm . 1576 ( 1989 )). moreover , it is possible to control the therapeutic availability of the encapsulated agent by varying liposome size , the number of bilayers , lipid composition , as well as the charge and surface characteristics of the liposomes . recombinant polynucleotides and vectors can be encapsulated within liposomes using standard techniques . a variety of different liposome compositions and methods for synthesis are known to those of skill in the art ( see , for example u . s . pat . nos . 4 , 844 , 904 , 5 , 000 , 959 , 4 , 863 , 740 , and 4 , 975 , 282 ). the compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host for treatment of disease attributable to a defect in gene or protein function . the compounds may also be used to enhance function . the therapeutic agents may be administered in a variety of ways , orally , topically , parenterally e . g . subcutaneously , intraperitoneally , by viral infection , intravascularly , etc ., as described above . inhaled treatments are of particular interest . depending upon the manner of introduction , the compounds may be formulated in a variety of ways . the pharmaceutical compositions can be prepared in various forms , such as granules , tablets , pills , suppositories , capsules , suspensions , salves , lotions and the like . pharmaceutical grade organic or inorganic carriers or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically - active compounds . diluents known to the art include aqueous media , vegetable and animal oils and fats . stabilizing agents , wetting and emulsifying agents , salts for varying the osmotic pressure or buffers for securing an adequate ph value , and skin penetration enhancers can be used as auxiliary agents . the pharmaceutical compositions are preferably prepared and administered in dose units . solid dose units are tablets , capsules and suppositories . the terms “ treating ,” “ treatment ,” and the like mean obtaining a desired pharmacologic or physiologic effect . the effect may be prophylactic in terms of completely or partially preventing a disorder or sign or symptom thereof , or may be therapeutic in terms of a partial or complete cure for a disorder or adverse effect attributable to the disorder . “ treating ” covers any treatment of a medical disorder in a subject , and includes : ( a ) preventing a disorder from occurring in a subject that may be predisposed to a disorder , but has not yet been diagnosed as having it ; ( c ) relieving or ameliorating the disorder , e . g ., cause regression of the disorder . the term “ ameliorate ” denotes a lessening of the detrimental affect of the medical disorder in the subject receiving therapy . the term “ therapeutically effective ” means that the amount used is of sufficient quantity to ameliorate the disorder . by the term “ effective amount ” is meant an amount sufficient to obtain the desired effect . an effective amount is generally determined by the physician in each case on the basis of factors normally considered by one skilled in the art to determine appropriate dosages , including the age , sex , and weight of the subject to be treated , the condition being treated , and the severity of the medical condition being treated . the dosage administered varies depending upon known factors such as the pharmacodynamic characteristics of the particular agent , and its mode and route of administration ; age , health , and weight of the recipient ; nature and extent of symptoms , kind of concurrent treatment , frequency of treatment , and the effect desired . usually a daily dosage of active ingredient can be about 0 . 01 to 100 mg per kilogram of body weight . the administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administration of subdivided doses at specific intervals . ordinarily 1 . 0 to 5 , and preferably 1 to 10 mg per kilogram per day given in divided doses 1 to 6 times a day or in sustained release form is effective to obtain desired results . one of one of ordinary skill in the art can use the following teachings describing the methods and techniques for determining clinical dosages to determine the appropriate dosage to use : spilker , guide to clinical studies and developing protocols ( raven press books , ltd ., new york , 1984 ) pp . 7 - 13 , 54 - 60 ; spilker , guide to clinical trials ( raven press , ltd ., new york , 1991 ) pp . 93 - 101 ; modern pharmacology , 2d ed . craig & amp ; stitzel , eds . ( little , brown and co ., boston , 1986 ) pp . 127 - 33 ; avery &# 39 ; s drug treatment : principles and practice of clinical pharmacology and therapeutics , 3d ed ., speight , ed . ( williams and wilkins , baltimore , 1987 ) pp . 50 - 56 ; tallarida et al ., principles in general pharmacology ( springer - verlag , new york , 1988 ) pp . 18 - 20 . typically , dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition , and animal models may be used to determine effective dosages for treatment of particular disorders . various considerations are described , e . g ., in goodman and gilman &# 39 ; s : the pharmacological basis of therapeutics , 8th ed ., gilman et al . eds . ( pergamon press , 1990 ); and remington &# 39 ; s pharmaceutical sciences , 17th ed . ( mack publishing co ., easton , pa . 1990 ). identifying trans - acting factors that bind to jet promoter sequences . also provided are methods of identifying compounds that bind to the jet promoter . these compounds include trans - acting factors can include , e . g ., polypeptides such as transcription factors , which interact preferentially with jet promoter , or small molecules . in one embodiment , a compound is identified by performing assays in which a cis - acting kim - 1 nucleic acid sequence is incubated with a test compound . binding of the compound to the nucleic acid is detected using methods known in the art for assessing nucleic acid binding . for example , binding can be measured using electrophoretic mobility shift assays ( emsa ). one way in which an emsa can be prepared is to incubate together a dna , which is preferably labeled , containing a kim - 1 - derived cis - acting regulatory sequence and the test compound . the mixture is then subjected to electrophoresis , and the migration of the labeled nucleic acid in the presence of the test compound is compared to the migration of the labeled nucleic acid in the absence of the test compound . a difference in mobility indicates that the test compound binds to regulatory sequence . any suitable compound can be used as the test compound . in some embodiments , the test compound is obtained from a cellular extract known to contain , or to be suspected of containing , a trans - acting factor . suitable cells include kidney cells , e . g ., cos cells . cell - based methods can also be used to identify compounds that modulate activity . for example , a cell containing a jet promoter operably linked to a nucleic acid encoding a reporter molecule is contacted with a test compound and the reporter molecule mrna or translated product is measured . mrna levels and protein levels can be determined using any method known in the art , e . g . using northern blot hybridization analysis , immunoprecipitations , or immunohistochemistry . the trans - acting factors can also be identified using in vivo assays . for example , a reporter construct can be constructed in which a reporter gene is under the control of any of the jet promoter disclosed herein . the reporter gene can be any gene encoding a protein that can readily be detected . the reporter gene is preferably a gene encoding luciferase . cells are transfected with the reporter construct that includes a jet promoter . transfection can be transient or stable . if desired , the cells are transfected with more than one reporter construct . the transfected cells can then be incubated in the presence or absence of a test compound for an appropriate amount of time and the level of expression of the reporter gene is determined . similar assays can also be performed using a cell or nuclear extract instead of cells . thus , in one embodiment , the invention provides a method for identifying a compound which modulates jet promoter activity . the method includes incubating a reporter construct that includes any of the regulatory elements according to the invention with a nuclear or cellular extract , or isolated nuclei , in the presence or absence of test compound . expression of the test compound is then measured , e . g ., by including a labeled nucleotide in the reaction and measuring the amount of label incorporated in the product transcribed from the reporter construct . other methods can also be used to determine the amount of reporter gene expression in this system , such as the measure of the amount of protein encoded by the reporter gene . in yet another embodiment , compounds that modulate the regulatory elements of the present invention in vivo can be identified in non - human animals . in one embodiment of the invention , a non - human animal , e . g ., a mouse , is treated with a compound , such as a compound identified in one of the assays described above . after an appropriate amount of time , the level of activity is determined and compared to its activity in a mouse that has not received the test compound . kits . the invention provides kits for use in methods of gene expression . the kit is compartmentalized to receive , in close confinement , one or more containers . one container contains a polynucleotide of the invention . a second container may contain a nucleic acid probe that hybridizes to the other of two strands of polynucleotide of the invention . the details of one or more embodiments of the invention are set forth in the accompanying description above . although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention , the preferred methods and materials are now described . other features , objects , and advantages of the invention will be apparent from the description and from the claims . in the specification and the appended claims , the singular forms include plural referents unless the context clearly dictates otherwise . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . all patents and publications cited in this specification are incorporated by reference . the foregoing description has been presented only for the purposes of illustration and is not intended to limit the invention to the precise form disclosed , but by the claims appended hereto . | 2 |
for purposes of describing the invention , the encapsulation of a single beam - leaded semiconductor chip is illustrated in fig1 a - 1b and the basic steps depicted in fig2 . it will be appreciated that this chip could be part of a hybrid integrated circuit including many chips along with other circuit elements , or could be part of an integrated circuit package . it will be clear in any event that many such chips may be simultaneously encapsulated by the inventive method . in fig1 a , a portion of a typical workpiece is shown comprising a silicon integrated circuit chip , 10 , which is contacted by beam leads , two of which are shown as 11 . the beam leads have been thermocompression bonded by standard techniques to metallization 12 formed on a major surface of insulating substrate 13 , which typically comprises a ceramic material . as a result of the thermocompression bonding , the chip is left slightly raised from the surface of the substrate . the gap between chip and substrate is usually of the order of 0 . 001 - 0 . 003 inch . as illustrated in fig2 an encapsulant , in the form of a dispersion , ( 14 of fig1 b ) is then applied over the workpiece including the integrated circuit chip . the method employed for applying the encapsulant is a standard flowcoating procedure . this involves generally providing the encapsulant in a dispenser under controlled pressure and discharging the material so that it flows over essentially the entire workpiece . the thickness of encapsulant is typically in the range of 0 . 040 to 0 . 080 inch , as applied and 0 . 010 and 0 . 030 inch after solvent removal and curing . as mentioned previously , this encapsulant is in the form of a dispersion of the encapsulating material in a suitable solvent . in a particular example , the dispersion comprised a solvent of xylene and solids comprising the silicone polymer , silica filler , pigment and carbon black , crosslinker , catalyst , and othe associated ingredients required for stabilization and proper curing . the ratio was approximately 67 % xylene and 33 % solids by weight . such an encapsulant is sold by dow corning co . under the designation dc 96 - 084 rtv dispersion . it should be clear that this encapsulant is only illustrative and many other standard materials may be used . for example , aother encapsulant successfully tested was that supplied by sws silicone corporation under the designation 296 type rtv . in general , the present invention could find use with any dispersion of an encapsulating material which cures by reaction with water vapor . another since air bubbles are often trapped under the chip after flowcoating , the workpiece is then &# 34 ; de - aired &# 34 ; by placing it in a vacuum chamber for a few minutes under a pressure near 20 torr . this is in accordance with standard practice . at this stage , the workpiece looks essentially as depicted in fig1 b with the encapsulant shown as 14 . the liquid dispersion has completely filled the area under the chip . however , the problem with the prior art practice was keeping the area under the chip filled during and after the curing of the encapsulant . in accordance with a main feature of the invention , the workpiece next undergoes a pre - cure treatment . this involves placing the workpiece in a standard isolation chamber which contains a flowing ambient of low humidity and includes a suitable exhaust system . the purpose of this step is to evaporate essentially all of the solvent ( i . e ., at least 99 %) while retarding crosslinking of the encapsulating material . it was found that in order to accomplish this , the ambient should be less than 5 % relative humidity , and optimum benefit was achieve at a relative humidity of less than 1 per cent . in this particular example , the ambient introduced was dry nitrogen with a relative humidity of approximately 0 . 25 per cent . it appears however that any dry ambient , including air , may be used within the humidity constraints mentioned . the nitrogen ambient is preferred primarily because of its nonreactivity with the encapsulant and because it will not produce an explosive atmosphere when mixed with xylene vapors . in accordance with a further feature of the invention , the flow rate of the ambient is preferably adjusted so that the time for evaporation of the solvent is at least 1 hour . it was found that when evaporation times were below this value , complete under - chip coverage was not always obtained . for optimum benefit , it is recommended that the evaporation time be at least three hours . the precise ambient flow rate necessary to achieve this evaporation rate will of course depend on the size of the workpiece and the configuration of the chamber . such determinations are easily within the skill of the art . in a particular example , the chamber measured 2 ft × 2 ft × 4 in , and the circuit measured approximately 1 . 25 × 0 . 50 inches . it was found that a flow rate of approximately 5 liters / min . of dry nitrogen effected complete evaporation after approximately 5 hours when 120 of the above - mentioned circuits were processed . next , as illustrated in fig2 the workpiece undergoes the standard curing procedure . this usually involves leaving the workpiece in air at room temperature for approximately two hours and heating in air at 120 ° c for approximately six hours . curing can also be done entirely at room temperature . for optimum curing , the relative humidity of the air ambient both at room temperature and 120 ° c should be in the range 20 - 60 % as measured at room temperature to promote crosslinking of the silicone . the effectiveness of the present method was demonstrated using both simulated glass chips and actual beam - leaded silicon integrated circuits . in one set of experiments , for example , simulated glass chips of 0 . 160 , 0 . 240 and 0 . 320 inches on a side were utilized . encapsulant from several different &# 34 ; lots &# 34 ; of commercially supplied rtv dispersion was applied to the chips . half the chips underwent the present method including the pre - cure treatment while half were cured by the conventional practice . complete under - chip filling was obtained on all chips processed in accordance with the invention . underchip filling using conventional practice varied widely and depended upon the &# 34 ; lot &# 34 ; of encapsulant . in some cases filling was not complete under the 0 . 160 inch chips . it should be pointed out that it has been found that the size of simulated glass chips which can be completely filled underneath with a given dispersion and process is approximately twice that which can be realized on actual beam - leaded chips on electronic circuits . further , in studies utilizing a 0 . 125 × 0 . 150 inch beam - leaded integrated circuit chip , complete underchip filling was always obtained using the present method while essentially none of the cips encapsulated with the prior art procedure showed adequate filling . based on these and other experiments , it is believed that the inventive method is particularly desirable for chips having an area of 0 . 0036 in . 2 or greater . it is not entirely clear at this point why the pre - cure treatment is so effective in obtaining complete underchip filling . it is theorized , however , that as the solvent is evaporated , an area of low pressure is created under the chip , and as long as the remaining material is sufficiently fluid , it will flow under the chip to replace the solvent removed . thus , if the solvent is removed according to the prior art practice during curing , the encapsulant will crosslink and greatly decrease its fluidity ( increase its viscosity ) before it has a chance to replace the evaporated solvent under the chip . during the pre - cure treatment in accordance with the invention , however , crosslinking of the encapsulant is retarded and the material is permitted to flow in order to fill the gap . this theory is offered as a possible explanation for the effectiveness of the inventive method and is not intended to limit the scope of the invention thereby . in addition to the improvement of the underchip filling , it was also found that the present invention eliminates the cracking of the encapsulant which can result in certain circuits such as those including closely spaced applique chip capacitors and those made on very small substrates . various modifications of the present invention will become apparent to those skilled in the art . all such variations which basically rely on the teachings through which the invention has advanced the art are properly considered within the spirit and scope of the invention . | 8 |
fig1 shows a schematic side view of part of a printer 10 with an endless conveyor belt 1 , which is tightened around a first deflection roller 14 and a second deflection roller 16 , which drive the conveyor belt 1 . the first deflection roller 14 , the second deflection roller 16 , and the conveyor belt 1 revolve in the direction shown by the respective arrows . a printing module 21 that applies a specific color onto a print 3 , conveyed by a conveyor belt 1 , is arranged above the conveyor belt 1 . the printing module 21 or printing mechanism includes an imaging device 22 to transfer an electrostatic image to an imaging cylinder 23 and an intermediate cylinder 25 to transfer an image from the imaging cylinder 23 to the print 3 . marks 4 to adjust the register are also printed by the imaging device 22 on conveyor belt 1 during a calibration pass of the printer 10 . the imaging device 22 includes components necessary for the transfer of an image , essentially a charging device to apply an electrical charge to the surface of the imaging cylinder 23 , a controlled light source to generate a latent electrical image on the electrically charged surface , and an inking device to apply toner to the electrically charged sites , during which a visible image is formed on the surface of the imaging cylinder 23 . the toner is transferred from the imaging cylinder 23 to the intermediate cylinder 25 and from it to the print 3 , so that finally an image formed from the toner is present on print 3 . a first counter pressure roller 27 on the opposite side of conveyor belt 1 , which rolls in the direction of the arrow on conveyor belt 3 , furnishes a counterforce to intermediate cylinder 25 . while one printing module 21 or printing mechanism is shown in fig1 , additional printing modules can also be present , especially an additional printing module 21 for each color used in the printer 10 . behind printing module 21 , viewed in the transport direction , a fixing device 30 is arranged , which serves to reliably fix the printed image applied by the printing module 21 or printing modules onto the print 3 in which the toner , which forms the printing image , meshes with the print 3 . the fixing device 30 includes a heated fixing roller 35 , which rolls in the direction of the arrow on print 3 and applies pressure and heat to the print 3 with toner . on the opposite side of transport conveyor belt 3 , a second counter pressure roller 37 is arranged , which provides a force opposite the fixing roller 35 and rolls in the opposite direction of rotation on the bottom of conveyor belt 3 . a delivery device 33 , filled with a fixing aid , is arranged in fixing device 30 in association with fixing roller 35 . a roller , subsequently also a metering roller 32 , rotates in the delivery device 33 on a non - woven fabric and absorbs a certain amount of fixing aid , usually fixing oil . an additional roller rolls on metering roller 32 , subsequently donor roller 31 , which absorbs the fixing aid from the metering roller 32 and conveys it to the fixing roller 35 by rolling on it . the fixing aid serves to facilitate release of the fixing roller 35 from the print 3 . a drawback during the use of the fixing aid is that it is transported in an undesired manner by the printer 10 and deposited on parts of the printer 10 . the printed image on the print 3 thus can be adversely affected by the fixing aid , for example , oil spots can form on the printed image , or the printed image can exhibit streaks . a first sensor 12 at the beginning of the conveyor belt 1 detects the front edge of the print 3 during the printing process , in this case a sheet of paper , and transmits the information to a control device 20 . based on the information relative to the front edge of print 3 and other available data , the control device 20 sends a signal to the imaging device 22 , which then initiates the imaging process , as described . in this manner , the printed image is applied to the desired site on the print 3 or , in the case of marks 4 , to the conveyor belt 1 . during a calibration pass of the printer to set the precise position of the printed image , the marks 4 are usually printed on the conveyor belt 1 . a second sensor 13 behind the printing modules 21 detects the mark 4 and transmits corresponding signals to the control device 20 . usually , one mark 4 is printed on the conveyor belt 1 from each printing module 21 , for each color that is printed by a printing module 21 . in the control device 20 of the printer , each mark 4 is evaluated to assure the mark is situated in an error - free position , i . e ., whether the register is correct or whether the marks 4 have a position deviation and a register error is present . fig2 shows four functional trends of the register errors of four different colors , these being the colors yellow , magenta , cyan , and black in the example . the numbers of the measurements of the register are plotted on the abscissa , and 86 measured values for each color are entered . the registers ( in millimeters ) around a value of zero are plotted on the ordinate , which marks an error - free register . the deviations of the register are shown , i . e ., the register errors , which are deviations in the positions of the printed image from their error - free position at the zero point . for example , here a register error is described in the transport direction , the so - called in “ track error ”. this means the depicted register error is characterized by position deviations of marks 4 in the transport direction of conveyor belt 1 , and the marks 4 are situated in front of or behind the error - free position on the conveyor belt 1 in the direction of the arrow . the register error is preferably recorded by means of marks 4 , especially during a calibration run of the printer , which is conducted before the printing process , and serves essentially to adjust the correct register . each curve trend in fig2 is provided with a reference number , the curve trend being for black with the first curve 5 , for cyan with the second curve 6 , for yellow with the third curve 7 , and for magenta with the fourth curve 8 . it is apparent in fig2 that the values of curves 5 , 6 , 7 , and 8 of the register deviate in different ways from the zero value , both in the positive and negative range . the long , double - sided arrows on the bottom of the coordinate system each denote a group of measured values that consist of eight measured values . the small double - sided arrows on the top of the coordinate system denote measured values that are recorded after running a cleaning pass of the printer 10 , as described below . it is readily apparent that all four curves 5 , 6 , 7 , 8 have qualitatively similar trends and tend toward register errors in the direction of negative values . the measured values of 4 to 7 are considered , in which trend the register error for black , the first curve 5 , drops from about 0 . 05 mm to − 0 . 21 mm . for yellow , the third curve 7 , the corresponding measured values drop from about − 0 . 05 mm to about − 0 . 27 mm . especially the measured values for black , which is printed by the appropriate printing module 21 , have a strong dependence on oil entry , and contamination of the printer 10 with fixing aid , especially fixing oil . in an uncontaminated printer 10 , the measured values for black lie at about 0 . 05 mm , whereas in a printer 10 , which is contaminated by the fixing aid , they are at − 0 . 05 mm and less . the described curve trends can vary during different measurements and external influences . curves 5 , 6 , 7 , and 8 then do not show a constant trend , as shown in fig2 . the register errors are recorded in the control device 20 of the printer 10 and evaluated . in the prior art , these are used to appropriately calibrate printer 10 , in order to apply the marks 4 and , during the subsequent printing process , the printed image in the transport direction in the error - free position , i . e ., to eliminate the “ in track error ” of the register . in the present application , it is determined , based on the measured values in the control device , that contamination of the printer 10 with fixing aid from the fixing roller 35 is present . the control device 20 recognizes this state by the fact that subsequent values of the function trends diminish and , in particular , the value falls short of a certain tolerance range , for example , the seventh value of curve 5 , 6 , 7 , 8 , and the values with the numbering on the abscissa being 10 , 13 , 16 , 19 , 22 , 25 , 28 , 31 , and 34 . if a conspicuously sharply diminishing measured value is present , which falls below a certain value stored in the control device 20 , this is an indication that contamination of the printer 10 with fixing aid from the fixing roller 35 is present . the control device 20 of the printer 10 in this case recognizes that a cleaning pass of the printer 10 is necessary . this is started by the control device 20 during which , for example , three hundred sheets of paper in the din a 3 + format are supplied by the printer . the sheets of print 3 are covered with about 30 % dry toner in each toner color , so that the printer 10 is appropriate freed of fixing aid . the next measured value after the cleaning run , and according to the minimum of the function trends of curves 5 , 6 , 7 , and 8 according to fig2 , shows a register error around the zero value , for example , each of the measured values 8 for all curves 5 , 6 , 7 , and 8 . the measured values for the registers that are recorded after the cleaning pass of the printer are situated within the vertical lines according to fig2 , which are marked by the double - sided arrows in the upper region of the coordinate system , and these are the measured values : 8 , 11 , 14 , 17 , 20 , 23 , 26 , 29 , 32 , and 35 . the individual measured values are recorded at distinct time intervals , and significant printer running times lie between the individual values . the measured values are therefore , not recorded immediately after each other by the second sensor 13 . in printer 10 , as already described , necessary controls of contamination by the fixing aid are regularly saved . the printer running times are increased and the frequency of maintenance is reduced . a cleaning pass of the printer 10 is only conducted when contamination makes this necessary . the control device 20 executes the cleaning pass automatically when measured values are determined as described , with operation by a person not being necessary in this case . the cleaning pass can be conducted during a running - print order or calibration run , in which the printer order or calibration is continued after the cleaning pass . | 6 |
fig1 illustrates an example circuit breaker 100 according to aspects of the invention . circuit breaker 100 includes a stationary contact 105 connected to a line terminal 110 . the line terminal receives electricity from a power source such as a generator ( not shown ), which in some applications is supplied by a power company . a movable contact 115 is disposed on a movable contact arm 120 which can be moved between a closed position 125 and open positions 200 and 300 ( fig2 and 3 ) by pivoting on a first pivot 135 and second pivot 170 . the movable contact arm 120 is connected to a tripping mechanism 140 by a linkage 145 . as shown , tripping mechanism 140 is in an untripped state . the linkage may include a spring mechanism ( not shown ), which is biased to move the movable contact arm from the closed position to the open position when tripping mechanism 140 is tripped . a fault detector 150 is connected to the movable terminal and is configured to activate the tripping mechanism 140 when a fault condition occurs , such as excess current . in some applications , the fault detector is a solenoid which is disposed inline with the circuit . if the current through the solenoid exceeds a certain level , the solenoid generates an electromagnetic field sufficient to activate the tripping mechanism . the solenoid may also optionally incorporate a plunger or other armature which activates the tripping mechanism when the current exceeds a certain level . it is understood that other fault detection methods may also be employed , which trip the tripping mechanism upon the occurrence of a specific condition . movable contact 115 is connected to load terminal 199 through fault detector 150 and connector 116 . when movable contact 115 is in a closed position , as shown in fig1 , stationary contact 105 and moveable contact 115 are in contact with each other , and electricity can flow from line terminal 110 to load terminal 199 through contacts 105 and 115 . a handle 160 is also provided for resetting the tripping mechanism 140 , or for manually tripping the tripping mechanism 140 . the moveable contact arm 120 includes a guide channel 165 which allows moveable contact arm 120 to slide and / or pivot around second pivot point 170 . moveable contact arm 120 also includes a lever 175 . the lever may be formed in one piece with the movable contact arm 120 , or may be a separate piece that is attached to the movable contact arm 120 . actuator solenoid 180 has a plunger 185 which is connected to lever 175 . the lever 175 , movable contact arm 120 , and guide channel 165 are disposed such that when tripping mechanism 140 is in an untripped condition , as shown , and actuator solenoid 180 is activated , plunger 185 moves in the direction of arrow 190 , moving movable contact arm 120 from closed position 125 to a second open position ( 200 , fig2 ) by pivoting movable contact arm 120 around pivot point 135 and sliding guide channel 165 along second pivot point 170 . incorporating an actuator such as actuator solenoid 180 to open and close contacts 105 and 115 in this way can have the advantage of allowing the number of manual operational cycles of the circuit breaker to be increased without incurring the additional costs associated with increasing the robustness of trip mechanism 140 and its associated components , as they are not actuated when the contacts are opened via the actuator solenoid . in this way , operational life can be increased to approximately 200 , 000 cycles in a typical application . actuator solenoid 180 may be activated using a remote signal . actuator solenoid 180 may be a bistable or latching solenoid , incorporating a permanent magnet 192 . in this case , plunger 185 will hold its position unless actuator solenoid 180 is energized with the correct polarity . a polarity switch 194 may be connected to actuator solenoid 180 using connector 196 . polarity switch 194 can provide a pulse signal of either polarity to actuator solenoid 180 in order to extend or retract plunger 185 . when no signal is present , plunger 185 is held in place by solenoid 180 . permanent magnet 192 may also be disposed such that when actuator solenoid 180 is de - energized , plunger 185 is drawn in the direction of arrow 190 , opening the circuit by moving movable contact 115 from closed position 125 to second open position ( 200 , fig2 ). a biasing spring 198 may optionally be disposed to bias lever 175 such that plunger 185 only needs to provide force in one direction . fig2 illustrates example circuit breaker 100 in a state where as in fig1 , the tripping mechanism 140 is untripped , but where movable contact arm 120 is in a second open position 200 . fig3 illustrates example circuit breaker 100 in a state where tripping mechanism 140 is tripped . here , movable contact lever 120 has been moved by tripping mechanism 140 via linkage 145 such that movable contact 115 is held at open position 300 . with tripping mechanism 140 in a tripped state , movable contact 115 cannot return to a closed state with stationary contact 105 regardless of the position of plunger 185 . this means that it is impossible to re - engage the circuit breaker after a fault using a remote system via actuator solenoid 180 . when the tripping mechanism 140 is in an untripped state as shown in fig1 and 2 , contacts 115 and 105 may be freely opened and closed by actuating solenoid 180 . however , when the tripping mechanism 140 is in a tripped state , contacts 115 and 105 cannot be brought back into a closed state by actuating solenoid 180 . this can have the advantage of increasing safety by allowing an operator who is directly in the presence of circuit breaker 100 to override any attempts to re - close the breaker remotely or automatically which would result in a hazardous condition . similarly , if power to polarity switch 194 is lost preventing actuation of actuation solenoid 180 while it is in the extended position , it remains possible to open contacts 115 and 105 using tripping mechanism 140 or handle 160 , and to close contacts 115 and 105 using handle 160 . however , if power to polarity switch 194 is lost preventing actuation of actuation solenoid 180 while it is in the retracted position , it is impossible to re - close the contacts using handle 160 . this can have the advantage of increasing safety by preventing any attempts to re - close the breaker by operating handle 160 that would result in a hazardous condition . in some applications , an additional mechanism ( not shown ) may be incorporated to allow plunger 185 of actuation solenoid 180 to be moved to the extended position without requiring power to polarity switch 194 . fig4 is a table illustrating the various combinations of circuit breaker positions possible according to an example embodiment of the invention . when both the circuit breaker mechanism 140 and the lever 175 are in the on position ( state a ), the movable contact arm is in the closed position , and current can flow through the circuit breaker 100 . from state a , if the circuit breaker mechanism 140 is toggled , e . g . by tripping the circuit breaker mechanism 140 manually or via an overcurrent condition , the moveable contact arm 120 moves to the first open position 300 , and current can no longer flow through the circuit breaker 100 . from state a , if the lever 175 is toggled , e . g . by remotely activating an actuation solenoid , the moveable contact arm 120 moves to the second open position , and current can no longer flow through the circuit breaker 100 . when both the circuit breaker mechanism 140 and the lever 175 are in the off position ( state b ), the contact arm is in the first open position 300 , and current cannot flow through the circuit breaker 100 . from state b , if the circuit breaker mechanism 140 is toggled , e . g . by resetting the circuit breaker mechanism , the movable contact arm 120 moves to the second open position , and current still cannot flow through the circuit breaker 100 . this can have the advantage of enabling a remote operator to prevent current flow even if a local operator were to reset the circuit breaker , for example , when a safety hazard is known to the remote operator . from state b , if the lever 175 is toggled , e . g . by remotely activating an actuation solenoid , the moveable contact arm 120 moves to the first open position 300 , and current still cannot flow through the circuit breaker 100 . this can have the advantage of enabling a local operator to prevent current flow even if a remote operator attempts to switch on the breaker , for example , when a safety hazard is known to the local operator . when the circuit breaker mechanism 140 is in the on position and the lever 175 is in the off position ( state c ), the movable contact arm is in the second open position , and current cannot flow through the circuit breaker . from state c , if the circuit breaker mechanism 140 is toggled , e . g . by tripping the circuit breaker mechanism 140 manually or via an overcurrent condition , the moveable contact arm 120 moves to the first open position 300 , and current still cannot flow through the circuit breaker 100 . from state c , if the lever 175 is toggled , e . g . by remotely activating an actuation solenoid , the movable contact arm moves to the closed position , and current can flow through the circuit breaker 100 . when the circuit breaker mechanism 140 is in the off position and the lever 175 is in the on position ( state d ), the movable contact lever 175 is in the first open position 300 , and current cannot flow through the circuit breaker 100 . from state d , if the circuit breaker mechanism 140 is toggled , e . g . by resetting the circuit breaker mechanism , the movable contact lever 175 moves to the closed position , and current can flow through the circuit breaker 100 . from state d , if the lever 175 is toggled , e . g . by remotely activating an actuation solenoid , the movable contact arm moves to the first open position 300 , and current still cannot flow through the circuit breaker 100 . fig5 is a state diagram illustrating the different state transitions possible according to an example implementation of the invention , and as reflected in the table of fig4 . the only state which allows current to flow through the circuit breaker is state a . it is clear from the state diagram that it is impossible to transition directly from state b to state a without first passing through either state d or state c . thus , state b can be thought of as a safety state of the circuit breaker 100 . a transition to state a from state d is controlled by the circuit breaker mechanism 140 , e . g ., the local operator who can reset the mechanism . a remote operator can initiate a transition from state b to state a only by encountering state d , which is controlled by the local operator . similarly , a transition to state a from state c is controlled by a lever operator , e . g ., a remote operator actuating the lever 175 using solenoid 180 . a local operator can initiate a transition from state b to state a only by encountering state c , which is controlled by the remote operator . in this way , the circuit breaker 100 can be configured to provide an added layer of safety by requiring logical agreement between the operators of the circuit breaker 100 before energizing a protected circuit . although the invention has been described with reference to a particular arrangement of parts , features and the like , these are not intended to exhaust all possible arrangements or features , and indeed many modifications and variations will be ascertainable to those of skill in the art . | 7 |
hereinafter , a semiconductor device according to embodiments of the present invention will be described in detail with reference to the attached drawings . fig2 a is a plan view showing a configuration of a semiconductor device according to a first embodiment of the present invention . fig2 b is a cross sectional view of the semiconductor device according to the first embodiment of the present invention along a line 2 b - 2 b in fig2 a . points 2 ba , 2 bb , 2 bc , and 2 bd on the line 2 b - 2 b shown in fig2 a correspond to division lines 2 ba , 2 bb , 2 bc , and 2 bd of the cross sectional view shown in fig2 b , respectively . meanwhile , a mold resin 270 to be described below is omitted in the plan view of fig2 a and a layer of a solder resist 260 to be described below is made transmissive . components of the semiconductor device shown in fig2 a and 2b will be described . the semiconductor device according to the present embodiment includes a semiconductor chip 210 , a laminate substrate 220 , bonding wires 250 and the mold resin 270 . the semiconductor chip 210 includes signal pads 211 and ground pads 212 . the laminate substrate 220 includes conductor layers 230 a and 230 b , an insulator layer 240 a , vias 241 , ball lands 239 , and solder resist 260 . here , a case where the laminate substrate 220 includes the two conductor layers 230 a and 230 b and the insulator layer 240 a will be described . the first conductor layer 230 a includes lead lines 236 , lands 237 , a power supply point 233 , a patch antenna 232 , plated lines 234 and 238 , and the solder resist 260 . the second conductor layer 230 b includes various types of wirings 235 , the ball lands 239 , and the solder resist 260 . here , it is supposed that the insulator layer 240 a is formed of a resin 243 such as fr4 . generally , unlike the fr4 and the solder resist 260 , the mold resin 270 is featured by including metal oxide such as silicon dioxide of 85 % or more in weight % as a filler . the mold resin 270 has sufficient hardness , and can suppress a warp resulting from a junction between the semiconductor chip 210 and the laminate substrate 220 , and a deformation of the antenna , by covering at least a part of the semiconductor chip 210 , the laminate substrate 220 , and the patch antenna 232 . in addition , the mold resin 270 can have a larger deformation resistance , when being formed to have a sufficient thickness , as in case of being thicker than the laminate substrate 220 . it should be noted that the total number of components and the features of each of these components are only an example , and accordingly the present invention is not limited to this example . a connection relation and a position relation between the components of the semiconductor device 200 shown in fig2 a and 2b will be described . the first conductor layer 230 a , the insulator layer 240 a , and the second conductor layer 230 b are laminated in this order from the top . the surface of the first conductor layer 230 a is covered with the solder resist 260 with the exception of an opening portion 261 and the like provided in a part of the surface . in addition , the surface of the second conductor layer 230 b is also covered with the solder resist 260 with the exception of a connecting portion and the like of the ball land 239 . further , the solder resist 260 may be filled in the inside of the vias 241 . in the first conductor layer 230 a , one - side end portions of a part of the lead lines 236 is exposed from the opening portion 261 of the solder resist 260 . the exposed portions of the lead lines 236 are connected to the signal pads 211 or the ground pads 212 in the semiconductor chip 210 by the bonding wires 250 . the vias 241 are formed to partially or completely pass through the laminate substrate 220 in a thickness direction . each of the vias 241 is connected to the first and second conductor layers 230 a and 230 b at the respective both ends , in order to electrically connect the first and second conductor layers 230 a and 230 b each other across the insulator layer 240 a . the semiconductor chip 210 is mounted on the first conductor layer 230 a . the signal pad 211 of the semiconductor chip 210 is electrically connected to the power supply point 233 of the patch antenna 232 through the bonding wire 250 and the lead line 236 . the ground pad 212 of the semiconductor chip 210 is electrically connected to the wiring 235 through another bonding wire 250 , another lead line 236 and a via 241 . it is preferred that the patch antenna 232 is arranged at a corner portion of the first conductor layer 230 a . this is because an area sufficient to some extent can be easily secured in the first conductor layer 230 a where a large number of the lead lines 236 are arranged around the semiconductor chip 210 . in addition , it is preferred that the patch antenna 232 is arranged in such a manner that a direction of the radiation pattern can be a direction orthogonal to a direction to the semiconductor chip 210 so that the direction to the semiconductor chip 210 can be avoided . this is because the existence of the semiconductor chip 210 does not hinder the radiation from the patch antenna 232 . for example , as shown in fig2 a , when the patch antenna 232 has a rectangular shape , the semiconductor chip 210 and the laminate substrate 220 have a square shape , and the semiconductor chip 210 is arranged at a center of the laminate substrate 220 , a position relation is preferred in which the rectangular shape of the patch antenna 232 is divided in a line - symmetry with a diagonal line of the laminate substrate 220 . because the patch antenna 232 has a relatively large area , it would be necessary to provide the plated line 234 directly connected to the patch antenna 232 , when the patch antenna 232 is arranged on a corner portion of the laminate substrate 220 . in this case , it is preferred that easiness of the calculation of property based on the shape of the patch antenna 232 is considered , so that the plated line 234 is arranged on a corner portion of the patch antenna 232 . here , a region immediately above and around the patch antenna 232 may be configured so that the solder resist 260 is omitted and the mold resin 270 directly protects the patch antenna 232 . a change to the configuration can be achieved only by arbitrarily changing the shape of a mask used in forming the solder resist 260 . as a result , the manufacturing variations of antenna characteristics of the patch antenna 232 can be suppressed . this is because the thickness of the mold resin is uniquely determined , while manufacturing variations of the film thickness of the solder resist is wide . in any case , so - called wavelength shortening effect can be obtained by covering the patch antenna 232 with the mold resin 270 , the solder resist 260 , and the like each having a dielectric constant larger than that of the air . that is , since an effective dielectric constant around the patch antenna 232 becomes larger than the effective dielectric constant when the patch antenna 232 is exposed to the air , an effective wavelength is shortened , and the size of the patch antenna 232 can be reduced . an operation of the semiconductor device shown in fig2 a and 2b will be described . fig2 c is a diagram partially showing a position relation between the patch antenna 232 and the semiconductor chip 210 according to the first embodiment of the present invention , and shows an example of a voltage standing wave distribution obtained by supplying power to the patch antenna 232 . fig2 c shows a position relation among the semiconductor chip 210 , the signal pad 211 , the bonding wire 250 , the lead line 236 , the power supply point 233 , the patch antenna 232 , the plated line 234 , a first magnetic current 291 , a second magnetic current 292 , and the laminate substrate 220 . fig2 c further shows a graph 290 showing amplitude of a voltage standing wave distributed in a width direction of the patch antenna 232 . when electric power is supplied to the patch antenna 232 arranged as shown in fig2 a to 2c , the magnetic current and the voltage standing wave distribution shown in fig2 c are obtained . the first and second magnetic currents 291 and 292 in fig2 c appear along two sides extending in a direction to the semiconductor chip 210 in the rectangular patch antenna 232 . in addition , the amplitude of the voltage standing wave in the graph 290 of fig2 c takes the maximum value at the two sides at which the magnetic currents 291 and 292 appear , and takes the minimum value in the intermediate region between the sides . this means that a radiation pattern spreading in direction in which the radiation is not blocked by the semiconductor chip 210 can be obtained . after preparation of a plurality of semiconductor devices according to the present embodiment , the semiconductor devices are arranged in a suitable position relation for the radiation pattern of fig2 c , and a wireless communication between the semiconductor devices can be carried out through the patch antenna 232 . it should be noted that it is preferred that a ground plane is formed in a portion of the second conductor layer 230 b corresponding to the back surface of the patch antenna 232 . additionally , instead of the patch antenna 232 , antennas having various shapes and being able to be formed in the first conductor layer 230 a , such as a dipole antenna , a monopole antenna , a loop antenna , and a log periodic antenna can be used . in this case , not only the ground plane , but wirings necessary for forming the above - mentioned types of antennas may be formed in the portions of the second conductor layer 230 b corresponding to the back surface of the antenna , and vias through which the above - mentioned antenna and wirings are arbitrarily connected may be provided to pass through the insulator layer 240 a . in addition , instead of the mold resin 270 , a shield for protecting the semiconductor chip 210 may be employed . fig2 d is a cross sectional view of the semiconductor device according to the first embodiment of the present invention in which the shield is employed . the cross section is along the line 2 b - 2 b . the semiconductor device shown in fig2 d is equivalent to the semiconductor device shown in fig2 b in which the mold resin 270 is replaced with a shield 280 . however , since it is not preferred that the patch antenna 232 is entirely covered with the shield , it is supposed that a portion of the patch antenna 232 is sufficiently protected by the mold resin 270 . moreover , a space between the shield 280 and the first conductor layer 230 a may be filled with the mold resin 270 . it should be noted that other components of the semiconductor device shown in fig2 d are the same as those shown in fig2 b , and accordingly further detailed description will be omitted . fig3 a is a plan view showing a configuration of the semiconductor device according to a second embodiment of the present invention . fig3 b is a cross sectional view of the semiconductor device according to the second embodiment of the present invention along the line 3 b - 3 b in fig3 a . points 3 ba , 3 bb , 3 bc , and 3 bd on the line 3 b - 3 b shown in fig3 a correspond to division lines 3 ba , 3 bb , 3 bc , and 3 bd of the cross sectional view shown in fig3 b , respectively . it should be noted that in fig3 a , the plan view is shown through a molded layer 370 to be described below and the layer of the solder resist 260 . the semiconductor device according to the present embodiment shown in fig3 a and 3b is equivalent to the semiconductor device obtained by modifying the semiconductor device shown in fig2 a and 2b according to the first embodiment of the present invention , as described below . at first , the semiconductor device is manufactured by a method in which the peripheral region is not sealed with the mold resin , such as a method of over molded pad array carrier ( hereinafter , to be referred to as ompac ). in this case , to seal the semiconductor chip 210 , the mold resin 370 that is formed in the shape of an eight - sided pyramid having a taper in each side of the bottom surface is employed as an example in the present embodiment , instead of the rectangular - parallelepiped mold resin 270 shown in fig2 a . as the result , a part of the patch antenna 232 protrudes from the region sealed by the mold resin 370 . next , the number of layers of the laminate substrate 220 is changed . the laminate substrate 220 according to the present embodiment has first to fourth conductor layers 230 a to 230 d and first to third insulator layers 240 a to 240 c . in the laminate substrate 220 according to the present embodiment , the first conductor layer 230 a , the first insulator layer 240 a , the second conductor layer 230 b , the second insulator layer 240 b , the third conductor layer 230 c , the third insulator layer 240 c , and the fourth conductor layer 230 d are laminated in this order . here , the first conductor layer 230 a according to the present embodiment is configured in the same manner as that of the first conductor layer 230 a according to the first embodiment of the present invention . in the second conductor layer 230 b according to the present embodiment , a ground plane 231 is mainly formed . in the conductor layer 230 c according to the present embodiment , a wiring 235 is mainly formed . the fourth conductor layer 230 d according to the present embodiment is configured in the same manner as that of the second conductor layer 230 b according to the first embodiment of the present invention . the vias 241 according to the present embodiment connect the first and fourth conductor layers 230 a and 230 d at their ends , and entirely pass through the laminate substrate 220 . it should be noted that it is not necessarily required that all of the above - mentioned changes are combined , and only a part of the changes may be applied to the semiconductor device according to the first embodiment of the present invention . in addition , the other components of the semiconductor device according to the present embodiment are the same as those of the case of the first embodiment of the present invention , and accordingly further detailed description will be omitted . in case of the ompac , the peripheral region not sealed with the mold resin 370 in the semiconductor device has an approximately 1 mm to 2 mm width . however , the peripheral region is also protected by the solder resist 260 as well as the center region sealed with the mold resin 370 . accordingly , it is not necessarily required that a part of or a whole of the metal patch antenna 232 is sealed with the mold resin 370 . additionally , in the semiconductor device according to the present embodiment , the patch antenna 232 has a portion sealed with the mold resin 370 and a portion protruding from the mold resin 370 . accordingly , a dielectric constant around the patch antenna 232 will be uneven or not uniform . however , by means of arbitrary design before manufacturing or arbitrary adjustment after the manufacturing to be described later in other embodiments , a problem caused by the unevenness of the dielectric constant is avoided . rather , especially in a high - frequency band such as a millimeter wave , greater advantages can be expected totally in the semiconductor device in improvement of design flexibility of wiring arrangement inside the laminate substrate 220 and in adjustment of antenna characteristics , because the peripheral region of the 1 to 2 mm width can be additionally used to form the patch antenna 232 . moreover , the patch antenna 232 can be exposed by arbitrarily changing the shapes of the mold resin 370 and the solder resist 260 . in this case , the antenna characteristics of the patch antenna 232 becomes hard to receive influence of the mold resin 370 and the solder resist 260 , and accordingly it is expected that the design related to wireless communication of the semiconductor device can be made easier . fig4 a is a plan view showing a configuration of a semiconductor device according to a third embodiment of the present invention . fig4 b is a cross sectional view of the semiconductor device according to the third embodiment of the present invention along the line 4 b - 4 b in fig4 a . points 4 ba , 4 bb , 4 bc , and 4 bd on the line 4 b - 4 b shown in fig4 a correspond to division lines 4 ba , 4 bb , 4 bc , and 4 bd of the cross sectional view shown in fig4 b , respectively . it should be noted that in fig4 a , the layers of the mold resin 370 and the solder resist 260 are made transmissive , as in fig3 a . the semiconductor device according to the present embodiment shown in fig4 a and fig4 b is equivalent to a semiconductor device obtained by modifying the semiconductor device shown in fig2 a and 2b according to the first embodiment of the present invention , as described below . specifically , the shape of the patch antenna 232 is changed from the typical rectangular shape in which the characteristics can be easily calculated , to a shape which can be used as a mold gate 432 shown in fig4 a . in other words , in the present embodiment , the mold gate 432 formed in manufacturing the semiconductor device is applied to the patch antenna 432 after the manufacturing . it should be noted that a tip portion of the mold gate 432 is arranged in an end portion of the laminate substrate 220 as a plated gate 434 . in the semiconductor device according to the present embodiment , a circuit area in the first conductor layer 230 a can be saved by using the mold gate 432 as the patch antenna 432 . the shape of the patch antenna 432 according to the present embodiment has a feature as the mold gate . that is , in an example of fig4 a , the patch antenna 432 has a portion having a wide width in a rim of the semiconductor device . in addition , the tip portion of the patch antenna 432 perpendicularly contacts to the rim of the semiconductor device . the shape of the mold gate 432 includes a curved line extending from the plated gate 434 to the power supply point 233 . the above - mentioned curved line has a possibility to attain that a directivity of the patch antenna 432 can be enlarged . it should be noted that other components of the semiconductor device according to the present embodiment are the same as those of the first embodiment of the present invention , and accordingly further detailed description is omitted . fig5 a is a plan view showing a first configuration of a semiconductor device according to a fourth embodiment of the present invention . fig5 b is a cross sectional view of the semiconductor device according to the fourth embodiment of the present invention along the line 5 b - 5 b in fig5 a . points 5 ba , 5 bb , 5 bc , and 5 bd on the line 5 b - 5 b shown in fig5 a correspond to division lines 5 ba , 5 bb , 5 bc , and 5 bd of the cross sectional view shown in fig5 b , respectively . it should be noted that in the plan view of fig5 a , the mold resin 270 is omitted from the plan view , and the layer of the solder resist 260 is made transmissive as in the plan view of fig2 a . the semiconductor device according to the first configuration of the present embodiment is equivalent to a semiconductor device obtained by modifying the semiconductor device according to the first embodiment of the present invention shown in fig2 a and 2b , as described below . that is , the configuration of the laminate substrate 220 is the same as that of the second embodiment of the present invention . next , adjustment vias 541 to 543 for electrically connecting the patch antenna 232 to the wirings in the third or fourth conductor layer 230 c or 230 d are added . moreover , impedance elements 581 and 582 are added to change the characteristics of the patch antenna 232 . in the third conductor layer , end portions of the adjustment vias 541 to 543 are connected to the other wirings 235 , to allow the characteristics of the patch antenna 232 to be variously adjusted . it should be noted that in fig5 b , two adjacent adjustment vias connected by the impedance element are shown as an example . however , the present invention is not limited to this example , and all of or a part of the adjustment vias may be connected to a common ground pattern of the conductor layer 230 d through the impedance elements . here , not only a mere short - circuit wiring but also the impedance elements 581 and 582 such as a resistance , a capacitance , and an inductance may be added to a connecting portion between the adjustment vias 541 to 543 and the other wiring 235 , so that the characteristics of the patch antenna 232 can be adjusted in various directions . for this purpose , it is preferred to previously provide many adjustment vias 541 to 543 at a plurality of locations in the patch antenna 232 , and to arbitrarily select one of the adjustment vias 541 to 543 through which one of the impedance elements 581 and 582 should be connected to one of the wirings 235 . here , the attention should be paid to the fact that the addition of the wiring 235 and the impedance elements 581 and 582 , that is , the adjustment of the characteristics of the patch antenna 232 can be accomplished to the semiconductor device after the manufacture without disassembling the semiconductor device . fig5 c is a plan view partially showing a second configuration of the semiconductor device according to the fourth embodiment of the present invention . fig5 d is a cross sectional view of the semiconductor device according to the fourth embodiment of the present invention in the second configuration along the line 5 d - 5 d in fig5 c . fig5 e is an enlarged view when the cross sectional view along the line 5 d - 5 d in fig5 c showing a second configuration of the laminate substrate 220 according to the fourth embodiment of the present invention is enlarged in a thickness direction . points 5 da , 5 db , 5 dc , and 5 dd on the section line 5 d - 5 d shown in fig5 c correspond to division lines 5 da , 5 db , 5 dc , and 5 dd of the cross sectional views shown in fig5 d and 5e , respectively . it should be noted that in the plan view of fig5 c , the mold resin 270 is omitted from the plan view , and the layer of the solder resist 260 is made transmissive as in the plan view of fig2 a . the semiconductor device according to the second configuration of the present embodiment is equivalent to a semiconductor device obtained by modifying the semiconductor device according to the first embodiment of the present invention shown in fig2 a and 2b , as described below . that is , it is supposed that the configuration of the laminate substrate 220 is the same as that of the second embodiment of the present invention . next , ground vias 544 to 546 are added to electrically connect the patch antenna 232 to the ground plane 231 in the second conductor layer 230 b . moreover , adjustment vias 547 to 548 may be added to electrically connect the patch antenna 232 to the wiring 235 in the third or fourth conductor layer 230 c or 230 d . in the semiconductor device according to the second configuration of the present embodiment shown in fig5 c to 5e , one side of the rectangular patch antenna 232 is grounded to the ground plane 231 through the plurality of ground vias 544 to 546 arranged along the side . an operation of the semiconductor device shown in fig5 c to 5e will be described . fig5 f is a diagram partially showing a position relation between the patch antenna 232 and the semiconductor chip 210 according to the second configuration of the fourth embodiment of the present invention and showing an example of a distribution of voltage standing wave obtained by supplying power to the patch antenna 232 . fig5 f shows a position relation between the semiconductor chip 210 , the signal pad 211 , the bonding wire 250 , the lead line 236 , the power supply point 233 , the patch antenna 232 , the ground vias 544 to 546 , the plated line 234 , the magnetic current 591 , and the laminate substrate 220 which are shown in fig5 c . fig5 f further shows a graph 590 representing amplitude of voltage standing wave distributed in a width direction of the patch antenna 232 . when power is supplied to the patch antenna 232 arranged as shown in fig5 c to fig5 f , the voltage standing wave distribution shown in fig5 f is obtained . the magnetic current 591 in fig5 f appears along one of two sides extending in a direction to the semiconductor chip 210 in the rectangular patch antenna 232 . it should be noted that the ground vias 544 to 546 are connected along the other one of the two sides . in addition , the amplitude of voltage standing wave in the graph 590 of fig5 f takes a maximum value on the side on which the magnetic current 591 appears , and takes the minimum value on the side to which the ground vias 544 to 546 are connected . this means that , according to the semiconductor device of the present embodiment , even if an area of the patch antenna is not changed , different frequency characteristics from that of the first embodiment of the present invention shown in fig2 c can be obtained , as well as a radiation pattern spreading toward a direction in which the radiation is not prevented by the semiconductor chip 210 can be obtained . in addition , in case of the first configuration of the present embodiment shown in fig5 a and 5b , the adjustment vias 541 and 542 can be grounded through the other vias and wirings even after manufacturing of the semiconductor device . that is , according to the semiconductor device of the present embodiment , adjustment can be realized to further substantially change the characteristics of the patch antenna 232 , after the manufacturing of the semiconductor device . fig6 a is a plan view showing a configuration of the semiconductor device according to a fifth embodiment of the present invention . fig6 b is a plan view partially showing a configuration of a system board 620 according to the fifth embodiment of the present invention . fig6 c is a cross sectional view of the semiconductor device and the system board according to the fifth embodiment of the present invention along the line 6 c - 6 c in fig6 a and 6b . fig6 d is an enlarged view when the cross sectional view of the laminate substrate 220 and the system board 620 according to the fourth embodiment of the present invention is enlarged in a thickness direction . points 6 ca , 6 cb , 6 cc , and 6 cd on the section line 6 c - 6 c shown in fig6 a and 6b correspond to division lines 6 ca , 6 cb , 6 cc , and 6 cd of the cross sectional views shown in fig6 c and 6d , respectively . it should be noted that in the plan view of fig6 a , the mold resin 270 is omitted from the plan view and the layer of the solder resist 260 is made transmissive as in the plan view of fig2 a . the semiconductor device according to the present embodiment shown in fig6 a , 6 c , and 6 d is equivalent to a semiconductor device obtained by modifying the semiconductor device according to the first configuration of the fourth embodiment of the present invention shown in fig5 a and 5b , as described below . that is , in the semiconductor device according to the present embodiment , end portions of the adjustment vias 541 to 543 on the fourth conductor layer 230 d side are connected to ball lands 239 . other components of the semiconductor device according to the present embodiment are the same as those of the first configuration according to the fourth embodiment of the present invention shown in fig5 a and 5b , and accordingly further detailed description will be omitted . components of the system board 620 according to the present embodiment shown in fig6 b to 6d will be described . the system board 620 includes a first conductor layer 630 a , a dielectric layer 640 , a second conductor layer 630 b , and vias 641 a to 641 d . wirings including connection terminal portions of the vias 641 a to 641 d formed corresponding to arrangement of the ball lands 239 of the semiconductor device according to the present embodiment are provided for the first conductor layer 630 a of the system board 620 . wirings including connection terminal portions of the vias 641 a to 641 d are provided for the second conductor layer 630 b of the system board , in the same manner as that of the fourth conductor layer 230 d in the semiconductor device according to the fourth embodiment of the present invention . a case where the system board 620 includes two conductor layers 630 a and 630 b and one dielectric layer 640 will be described here . it should be noted that the total number of these components and features of these components are only an example , and accordingly the present invention is not limited to the example . a connection relation and a position relation between the components of the system board 620 according to the present embodiment will be described . the first conductor layer 630 a , the dielectric layer 640 , and the second conductor layer 630 b are laminated in this order from the top . the vias 641 a to 641 d pass through the dielectric layer 640 , and electrically connects a terminal portion in the first conductor layer 630 a to a terminal portion in the second conductor layer 630 b . a connection between the semiconductor device and the system board 620 according to the present embodiment will be described . in the present embodiment , the semiconductor device is mounted on the system board 620 . specifically , the ball lands 239 in the fourth conductor layer 630 d of the semiconductor device are electrically connected to the wirings in the first conductor layer 630 a of the system board 620 . accordingly , the adjustment vias 541 to 543 connected to the patch antenna 232 are electrically connected to the wirings of the second conductor layer 630 b in the system board 620 through the ball lands 239 in the semiconductor device and the first conductor layer 630 a and the vias 641 a to 641 d in the system board 620 . in this case , various types of devices such as a wiring for short - circuit , a resistance element , a variable resistance element , a capacitance element , a variable capacitance element , and an inductance are arbitrarily added and connected in the second conductor layer 630 b of the system board 620 , so that the end portions of the adjustment vias 541 to 543 , the wirings , and the like in the semiconductor device can be indirectly connected . on the contrary , the connection relation between the adjustment vias 541 to 543 may be released by cutting the wirings provided previously between the adjustment vias 541 to 543 . in examples of fig6 c and 6d , the system board 620 further includes two impedance elements 681 and 682 . both ends of the first impedance element 681 are connected to the end portions of two vias 641 c and 641 d on the second conductor layer 630 b side , respectively . both ends of the second impedance element 682 are connected to the end portions of two vias 641 a and 641 b on the second conductor layer 630 b side , respectively . as the result , the same effect as that of the first configuration according to the fourth embodiment of the present invention shown in fig5 b can be obtained . it should be noted that in fig6 c and 6d , two adjacent adjustment vias connected by the impedance element are shown as an example . however , the present invention is not limited to the example , and all of or a part of the adjustment vias may be connected to a common ground pattern of the conductor layer 630 b through the impedance element . according to the present embodiment , the addition of the wiring and the impedance elements 681 and 682 , that is , the adjustment of the characteristics of the patch antenna 232 can be accomplished under a condition that the semiconductor device is already mounted on the system board 620 . fig7 a is a plan view showing a configuration of a semiconductor device according to a sixth embodiment of the present invention . fig7 b is a cross sectional view of the semiconductor device according to the sixth embodiment of the present invention along the line 7 b - 7 b in fig7 a . fig7 c is an enlarged view when the cross sectional view along the line 7 b - 7 b of fig7 a showing a configuration of a laminate substrate 220 according to the sixth embodiment of the present invention is enlarged in a thickness direction . points 7 ba , 7 bb , 7 bc , and 7 bd on the section line 7 b - 7 b shown in fig7 a correspond to division lines 7 ba , 7 bb , 7 bc , and 7 bd of the cross sectional views shown in fig7 b and fig7 c , respectively . it should be noted that in the plan view of fig7 a , the mold resin 270 is omitted from the plan view and the layer of the solder resist 260 is made transmissive , as in the plan view of fig2 a . the semiconductor device according to the present embodiment shown in fig7 a to 7c is equivalent to a semiconductor device obtained by modifying the semiconductor device according to the first embodiment of the present invention shown in fig2 a and 2b , as described below . that is , firstly , the configuration of the laminate substrate 220 is the same as that of the second embodiment of the present invention . next , instead of the semiconductor chip 210 for the bonding connection according to the first embodiment of the present invention , a semiconductor chip 710 for the flip - chip connection is employed in the present embodiment . in addition , in accordance with the above changes , the wirings in the first conductor layer 630 a of the laminate substrate 220 are changed to wirings for the flip - chip mounting . the semiconductor chip 710 according to the present embodiment includes copper fillers 737 that are pillar conductors formed of copper , and connecting solders 739 provided to the tip of the filler on the element forming surface . the semiconductor chip 710 is mounted on the laminate substrate 220 in the flip - chip connection by use of the connecting solders 739 . the other components of the semiconductor device according to the present embodiment are the same as those of the first embodiment of the present invention , and accordingly further detailed description is omitted . in the first embodiment and so on of the present invention , the bonding wire 250 for connecting the semiconductor chip 210 to the patch antenna 232 on the laminate substrate interferes with adjacent other bonding wires 250 , and there is a risk of generating a crosstalk noise . according to the semiconductor device of the present embodiment , influence of the crosstalk noise can be reduced . fig8 a is a plan view showing a configuration of a semiconductor device according to a seventh embodiment of the present invention . fig8 b is a cross sectional view of the semiconductor device according to the seventh embodiment of the present invention along the line 8 b - 8 b in fig8 a . fig8 c is an enlarged view when the cross sectional view at the section line 8 b - 8 b in fig8 a showing a configuration of a laminate substrate 220 according to the seventh embodiment of the present invention is enlarged in a thickness direction . points 8 ba , 8 bb , 8 bc , and 8 bd on the line 8 b - 8 b shown in fig8 a correspond to division lines 8 ba , 8 bb , 8 bc , and 8 bd of the cross sectional views shown in fig8 b and 8c , respectively . the semiconductor device according to the present embodiment shown in fig8 a to 8c is equivalent to a semiconductor device obtained by modifying the semiconductor device according to the first embodiment of the present invention shown in fig2 a and 2b , as described below . that is , firstly , the configuration of the laminate substrate 220 is the same as that of the second embodiment of the present invention . next , in addition to the first semiconductor chip 210 for sending and receiving a signal to and from the patch antenna , the semiconductor device according to the present embodiment further includes another second semiconductor chip 710 . here , a case where the semiconductor device has two semiconductor chips 210 and 710 , and further the first semiconductor chip 210 is mounted on the second semiconductor chip 710 will be described . however , the number and types of the semiconductor chips 210 and 710 and their position relation are only one example , and accordingly the present invention is not limited to the example . moreover , a combination of the first and second semiconductor chips 210 and 710 may be a semiconductor chip for rf ( radio frequency ) and a semiconductor chip for logic calculation , may be a semiconductor chip for analog signal and a semiconductor chip for digital signal , may be a silicone semiconductor chip and a gallium arsenide semiconductor chip , and both of the semiconductor chips may be a type to be connected in a bonding connection . in the semiconductor device according to the present invention shown in fig8 a to 8c , a configuration of a portion related to the flip - chip connection between the second semiconductor chip 710 and the laminate substrate 220 is the same as that of the sixth embodiment of the present invention shown in fig7 a and 7b . in the semiconductor device according to the present invention shown in fig8 a to 8c , configurations of the other components are the same as those of the first embodiment of the present invention shown in fig2 a and 2b . accordingly , further detailed description of the configurations of the semiconductor device according to the present embodiment shown in fig8 a to 8c will be omitted . in an example shown in fig8 a to fig8 c , when being mounted on the second semiconductor chip 710 , the first semiconductor chip 210 is arranged on an approximately center position of the second semiconductor chip 710 . this is a result from preferentially considering reduction of influence caused by deformation of the semiconductor device as a whole , and the present invention is not limited to this choice . giving priority to save the bonding wire 250 , the first semiconductor chip 210 may be arranged on one end portion of the second semiconductor chip 710 , for example . it should be noted that it is generally better in terms of noise reduction that a path between the semiconductor chip and the patch antenna is short , and accordingly the first semiconductor chip 210 connected to the patch antenna 232 may be arranged under the second semiconductor chip 710 . as shown in fig8 a to 8c as an example , when the first semiconductor chip 210 is arranged on the second semiconductor chip 710 , the bonding wires 250 become longer in comparison with a case where the first semiconductor chip 210 is arranged under the second semiconductor chip 710 . however , at this time , the characteristics of the patch antenna 232 can be adjusted intensively to increase impedance . furthermore , in case of a semiconductor device in which another third semiconductor chip is stacked , the first semiconductor chip 210 may be arranged between the second and third semiconductor chips . in these cases , in order to suppress the influence of crosstalk noise , the bonding wire 250 which mediates the connection between the first semiconductor chip 210 and the patch antenna 232 is desired to have a different profile from those of other bonding wires connected to the second or third semiconductor chip . for example , the bonding wire 250 mediating the connection between the first semiconductor chip 210 and the patch antenna 232 is extended to the longest length in comparison with the lengths of other bonding wires , and a distance from the bonding wire 250 to the laminate substrate 220 at a point where the distance between the bonding wire 250 and the laminate substrate 220 becomes the maximum distance is set to be higher than those of other bonding wires . in this case , the influence of crosstalk noise can be suppressed based on difference of loop profiles between the bonding wire 250 and other bonding wires . the converse case is equivalently true , and accordingly , even if the bonding wire 250 has the shortest length and the distance to the laminate substrate 220 is the minimum distance , the same effect can be obtained . in the above description , the case where a plurality of semiconductor chips included in the same semiconductor device are vertically laminated will be described . however , a part of or all of the plurality of semiconductor chips may be arranged along a plan direction on the laminate substrate . fig9 a is a plan view showing a configuration of a semiconductor device according to an eighth embodiment of the present invention . fig9 b is a cross sectional view of the semiconductor device according to the eighth embodiment of the present invention along the line 9 b - 9 b in fig9 a . points 9 ba , 9 bb , 9 bc , and 9 bd on the section line 9 b - 9 b shown in fig9 a correspond to division lines 9 ba , 9 bb , 9 bc , and 9 bd of the cross sectional view shown in fig9 b , respectively . it should be noted that in the plan view of fig9 a , the mold resin 270 is omitted from the plan view and the layer of the solder resist 260 is made transmissive , as in the plan view of fig2 a . the semiconductor device according to the eighth embodiment of the present invention shown in fig9 a and 9b is equivalent to a semiconductor device obtained by modifying the semiconductor device according to the first embodiment of the present invention shown in fig2 a and 2b , as described below . that is , firstly , the configuration of the laminate substrate 220 is the same as that of the second embodiment of the present invention . next , the semiconductor device according to the present embodiment further includes a second patch antenna 932 , a second power supply point 933 , and a second plated line 934 . the second patch antenna 932 is connected to the semiconductor chip 210 through the second power supply point 933 , another lead line 236 , another bonding wire 250 , and another signal pad 211 in the same manner as those of the first patch antenna 232 . when the semiconductor chip 210 supplies power independently from or in synchronization with the first and second patch antennas 232 and 932 , the first and second patch antenna 232 and 932 are able to emit a radio signal independently or synchronously . the other components of the semiconductor device according to the present embodiment are the same as those of the first embodiment of the present invention , and accordingly further detailed description will be omitted . here , the number of the patch antenna is two , but the number is just an example . accordingly , the present invention is not limited to the example , and the number of the patch antennas may be much larger . in addition , the plurality of patch antennas may operate independently from each other , and may operate as a synchronized adaptive array antenna . the features of the semiconductor device according to the above - described embodiments of the present invention can be arbitrarily combined within a technically consistent scope . although the present invention has described above in connection with several ( exemplary ) embodiments thereof , it would be apparent to those skilled in the art that those ( exemplary ) embodiments are provided solely for illustrating the present invention , and should not be relied upon to construe the appended claims in a limiting sense . | 7 |
fig1 to 3 describe the state of the art . although in fig1 a relatively long acceleration time was selected , a typical pressure resonance oscillation occurs in the system . toward the end of the ramp the oscillation fades out , so that this solution is still acceptable . in fig2 a relatively steep acceleration ramp was applied by a corresponding increase of the oil flow . the plot for the drive pressure ( d - p ) shows extreme resonance oscillations . even more critical is the fact , that also the velocity ( v ) of the moving mass starts to oscillate with some phase shift . such a velocity plot is not acceptable in practical applications . such a system is no longer controllable . also shocks and forces occur toward the end of the movement , which are very undesirable . fig3 shows the plots for the main parameters like in fig2 . a first segment is recognizable with the start - up acceleration , the second segment is the constant velocity and the third segment is the deceleration at the end of the movement . two important statements can be made from this graph . the resonance oscillations continue till the end of the movement . also corresponding acceleration forces occur till the end of the movement . therefore neither an exact path description over time , nor much less the accurate movement behavior at the end of the movement is predictable . both facts necessitate reduction of velocity for the moving mass . this increases the cycle time . fig4 shows the same main parameters for measurement on a machine according to the invention , with the pressure being set in this case . if one compares the plot for the pressure control signal ( p - c ) with the plot for the acceleration pressure ( d - p ), it shows a surprisingly close similarity , which means that the acceleration pressure is truly controlled or set . there are no more sinusoidal waves like in fig3 neither for the pressure nor for the acceleration , especially no more disturbance at the end of the movement . the movement of the mass is completely under control and therefore for the first time the mass movement is truly regulated . hereby it does not matter if the mass movement is controlled in relation to the velocity profile or the position profile . for both the control &# 34 ; fits &# 34 ;. the concrete selection of the control components depends first of all on the suitability of the respective sensors . for the first time it has been possible to select extremely short ramps with completely constant movement following the acceleration phase . either the complete profile according to the invention or only a part of it can be realized in applications . fig5 illustrates with much concrete detail the basic configuration of a design solution according to the invention . as the mass m all mass components such as the plunger 1 , the rod 2 , and the mold mass 3 must be combined . in the hydraulic cylinder 4 the pressure side is on the left ( 5 ) and the counter pressure side is on the right ( 6 ). according to the law of hydrostatics is f1 opposite of f2 . f1 minus f2 represents the acceleration force or just a constant sliding force or a deceleration force , if f2 exceeds f1 . s indicates the closing movement and 0 the opening movement . the oil return line is shown with oil reservoir symbol 7 , as is the oil pressure pump with the symbol 8 . on the pressure side the pump 8 is connected with pressure line 9 to the pressure limiting valve 10 , which is connected with a return line to the oil reservoir 7 . the pressure limiting valve 10 is the main stage , which is regulated by a pilot valve 11 . the pilot valve is a known electrically controlled proportional pressure adjustment valve . the pilot valve 11 is driven by an electronic computer 12 , which is symbolically shown as a pc with keyboard 13 . the pressure line 9 is not directly connected with pressure side 5 of piston 1 but rather via a position logic or a corresponding directional valve 14 and an acceleration pressure line 16 and connects to the counter pressure side 6 via the counter pressure line 17 . the required control signals are provided by the computer 12 via the electrical solenoid actuators 15 and 15 &# 39 ; respectively . according to the example of fig5 the return oil of the directional valve flows through a manually adjustable pressure limiting valve 18 to the oil reservoir 7 . the pressure setting can be adjusted by the pilot needle valve with manual adjustment screw 19 . in principle , the pressure limiting valve 18 can be the same design as the pressure limiting valve 10 . the electric control wires from the computer 12 are not designated in detail . the mold mass 3 is schematically sliding a measuring rod through the sensor 22 , so that the sensor 22 can recognize velocity v or position w respectively or both , dependent on the selection of specific sensor elements . the measured values are fed back to the computer 12 via the signal line 23 . as shown in fig4 it is important that the plot of the actual acceleration pressure matches the corresponding pressure setting signal closely . it has been shown that for that purpose the valve as shown in swiss patent 499824 ( corresponding to u . s . pat . no . 3 , 433 , 256 ) ( fig2 for example ) is most suitable . the patent document covers a complete functional description of this valve . this valve provides a direct proportionality from modulated electrical current to the controlled pressure . the solenoid coil 30 builds a magnetic field and the magnetizable material becomes a magnet 31 which can hold the armature 32 , which is also made from magnetic material , in desired positions . between armature 32 and magnet 31 is a gap through which oil flows from a ball valve 33 , which is controlled by armature 32 . the plate like configuration of armature 32 allows to build electromagnetic fields with relatively large forces , significantly larger than the forces from acting oil pressure , so that with the corresponding setting signals from the computer for variable electric voltage a desired pressure profile is modulated . in the example of fig5 only the acceleration pressure according to the desired position or velocity profile of the mold mass 3 is controlled . the counter pressure fixed setting is adjusted with pressure limiting valve 18 , which must be considered in the computer program . fig6 is a simple hydraulic control arrangement for the application in an injection molding machine . a shield 40 , with an attached mold half 3 &# 39 ; is in the position of the beginning of the mold closing movement s . the shield 40 is guided in 4 columns 41 and the machine frame 42 . the counter mold half 3 &# 34 ; is stationary fixed to the machine frame 42 . for the molding process this example also shows a locking device 43 , supporting the holding force during the injection . in both the pressure and counter pressure side the hydraulic pressure is modulated with the electrical signal settings . fig6 a shows a simplified velocity - position profile for the injection molding machine , in which b indicates the acceleration phase , k the phase of constant velocity and v the deceleration phase . the velocity profile shows a possible ideal trapezoid . fig7 is a further detailed arrangement , in which instead of the simple position logic a switchable cartridge valve bridge is used . fig8 demonstrates another arrangement , with pressure accumulator 50 replacing pump 8 . in the main stage the pressure limiting valve 10 ( as used in fig5 ) is replaced by a pressure reducing valve 51 . the remaining arrangement for the hydraulic control system with accumulator can be identical to any of the pump systems . for the pilot valve 52 an electrically controlled proportional pressure adjustment valve is used . applications according to the invention are not limited to injection molding machines , but also can be used in die casting machines or in hydraulic presses . major advantages with the new invention result in devices for injection molding and pressing of mass produced parts with very short cycle times , in which case a hydraulic pressure drive system is designated to the closing part , or the fast moving machine mechanism , respectively , and wherewith computing equipment and a corresponding control arrangement a modulated oil pressure is provided to control a selectable velocity or position profile . | 1 |
referring to the lower left portion of fig1 there is shown at 10 a master art work provided with several openings at precise retangular coordinate points . one such opening is indicated at 11 . as indicated by the x and y arrows , the art work 10 can move in an x - y plane . this movement can be effected by appropriate x and y axis servo systems operating a table which might support a printed circuit board requiring that holes be drilled at the precise rectangular coordinate points defined by the openings in the art work 10 such as the opening 11 . this one example is depicted clearly in fig1 of our heretofore referred to u . s . pat . no . 3 , 716 , 716 . in accord with the present invention , an image of the hole 11 is projected onto a screen 12 shown in the upper right hand portion of fig1 . screen 12 includes x axis and y axis cross hairs 13 and 14 . the projection of the hole 11 is accomplished by a light source 15 shown disposed between the art work 10 in the lower left portion of fig1 and a projection lens 16 above the hole 11 . mirrors 17 and 18 define a lengthened light path permitting magnification of the image so as to provide a relatively large sized light image on the screen 12 as shown . it can be seen that movement of the art work or member 10 along the x and y axes will move the hole 11 relative to the light source 15 and projection lens 16 . when the hole 11 is precisely centered on the optical axis of the light from the light source 15 to the projection lens 16 the projected image will have its center exactly coinciding with the intersection of the cross hairs 13 and 14 on the screen 12 . in this respect , it is important to understand that the screen 12 the light source 15 , and the projection lens 16 as well as the mirrors 17 and 18 are all fixed . as a result movement of the art work will result in movement of the image relative to the cross hairs along the x and y axis on the screen 12 . still referring to fig1 in the upper right hand portion , there is shown a first light responsive cell 19 on the end of a flexible reed 20 supported within a housing 21 . housing 21 incorporates appropriate electrical drive means for oscillating the reed 20 to oscillate the first light responsive cell 19 back and forth at a constant frequency along the direction of the x axis cross hair 13 equal distances on either side of the intersection point of the cross hairs . in other words , the cell 19 at its rest position will appear at the exact intersection point of the cross hairs 13 and 14 when viewed in a direction normal to the x - y plane of the screen 12 . the first light responsive cell 19 generates signals as will be described subsequently passed from the housing 21 to an integrator and summing circuit 22 in turn providing an output signal to an x axis servo 23 . this signal may also be recorded in a memory 24 . in addition to the first light responsive cell 19 moving back and forth along the direction of the x axis , there is provided a second light responsive cell 25 movable at the same constant frequency as the first light responsive cell up and down ; that is , equal distances along the direction of the y axis cross hair 14 on either side of the intersection point . as in the case of the first light responsive cell 19 , the second light responsive cell 25 is supported on the end of a reed 26 so that the same can be rapidly oscillated by appropriate electrical drives in a housing 27 . signals generated by the second light responsive cell 25 pass to a further integrator and summing circuit 28 from which a y axis control signal passes to a y axis servo 29 . this signal may also be stored in a memory 30 . the control of movement of the art work member 10 by the servo system in an x direction is independent of the control of movement in a y direction . in other words , the first and second light responsive cells 19 and 25 operate entirely independently of each other and in exactly the same manner . therefore , a detailed description of the manner in which centering along the x axis is accomplished by the first light responsive cell 19 will suffice for an explanation of the operation of the second light responsive cell 25 in centering along the y axis . thus , referring to fig2 and 3 , there is shown the first light responsive cell 19 secured to the end of the reed 20 in its center or neutral position . drive coils 31 and 32 when energized will effect oscillation of the reed 20 and thus the first light responsive cell 19 back and forth along an arc corresponding substantially to the direction of the x axis . in this respect , when the movement is described as corresponding to the direction of the x axis cross hair or the y axis cross hair , it is to be understood that substantial correspondence takes place even though the movement is along a slight arc . the center or neutral position of the light responsive cell 19 and reed 20 is monitored by a center signal generating photo cell 33 . in other words , cell 33 provides a center signal whenever the reed 20 passes the exact neutral or center point shown in solid lines in fig2 in its oscillations . this signal passes to a center signal sensor 34 which in turn utilizes the signals to trigger an integrator as will be described subsequently . also provided in the housing 21 is an amplitude sensing photo cell 35 in a fixed position to define the amplitude limit of oscillation of the reed 20 and first light responsive cell 19 . thus , when the reed 20 intercepts the cell 35 , an amplitude signal is generated and passed to an amplitude sensor which in turn controls the pulse width of a driving signal for the coils 31 and 32 limiting the energy imparted to the reed 20 so that a given amplitude is not exceeded . referring to fig3 the manner in which the electrical drive signals for the coils 31 and 32 are derived as well as the drive signals for the corresponding coils for the second light responsive cell 25 and reed 26 for the y axis is shown . referring first to the upper portion of fig3 there is shown a square wave oscillator 38 providing a square wave signal of four times the frequency at which the respective reeds are to vibrate . the square wave oscillator output signal is divided by two by means of a j - k flip flop 39 . the x axis amplitude sensor 36 and x axis pulse width control 37 described briefly in fig2 are shown in fig3 designated by the same numerals 36 and 37 . one output from the flip flop 39 passes to the x pulse width control 37 as shown . this output provides an x pulse , the width of which is then controlled by the output from the x axis amplitude sensor 36 . similarly , there is provided a y axis amplitude sensor indicated at 40 in fig3 for controlling the width of a y axis pulse in block 41 provided by the other output from the flip flop 39 . the pulse widths from the blocks 37 and 41 pass through further divide by two flip flops 42 and 43 respectively for providing output signals to the coils on either side of the respective x and y axis reeds , the coils 31 and 32 corresponding to those described in fig2 for the x axis reed . these signals are provided through appropriate and gates 44 , 45 , 46 and 47 , these gates being enabled by signals from the x and y pulse width control blocks 37 and 41 . the coils for the y axis reed are indicated at 48 and 49 in fig3 . in order to avoid possible interference between the x axis and y axis oscillating cells 19 and 25 , the driving coils can be synchronized to be 90 ° out of phase so that when the x axis first light responsive cell 19 is in a center position , the second light responsive cell 25 for the y axis is at one of its amplitude limits . this phase locking or synchronization is effected by using a square wave oscillator which has a frequency four times that of the reeds , so that one oscillation covers a 90 ° movement of the reeds . the divide by two j - k flip flop 39 alternately shifts driving power back and forth between the reeds every 90 ° so that they are locked into a 90 ° phase difference . to prevent the x - axis reed from shifting 180 ° ( depending on its direction of start - up ), leads 50 and 51 are connected from the j and k outputs of the divide by two flip flop 43 to the j and k inputs to the flip flop 42 as illustrated in fig3 . referring now to fig4 the manner in which automatic centering is accomplished will become clear . in fig4 it is assumed that the hole image is slightly off - center along the x axis direction as shown . the first light responsive cell 19 is oscillating between amplitude limits on either side of the intersection point of the x and y axis cross hairs 13 and 14 . the left amplitude limit is indicated at 19l and the right amplitude limit is indicated at 19r . the distance of swing on either side of the intersection point of the cross hairs is equal since the neutral or center position of the cell 19 corresponds to the intersection point of the cross hairs . the center sensing photo cell 33 described in fig2 will generate a signal whenever the first light responsive cell 19 crosses the center point ; that is , the intersection point between the x and y cross hairs . as shown , this intersection point is not centered with the center of the projected hole image shown at 52 . as the oscillating first light responsive cell 19 passes the intersection point , an x axis center signal will be generated by the photo cell 33 described in fig2 . as the cell continues to move to the left as viewed in fig4 the cell itself will generate a left edge signal when it passes the boundary point 53 of the light image 52 ; that is , the change in light from light to dark . when the first light responsive cell moves to the right , another x axis center signal will be generated when it passes the intersection point by the cell 33 and then a right edge signal will be generated at point 54 when the cell passes the boundary of the image 52 from light to dark . it will be appreciated that the time interval between the x axis center signal generated by the cell 33 and the generation of the left edge signal at point 53 is longer than the time interval from the x axis center signal generated by cell 33 and the right edge signal occurring at boundary 54 . this difference in time intervals is a consequence of the off - centering along the x axis as depicted in fig4 . referring to fig5 there is illustrated the output of the integrator 22 described in fig1 . as shown , an integrator output voltage will be generated as indicated by the line 55 at the start point when the reed for the first light responsive cell 19 is at the center position and will then stop integrating the output voltage when a light change occurs ; that is , at the boundary 53 or at the boundary 54 depending upon the position of the moving cell . it will be immediately appreciated that the magnitude of the integrated output voltage is a direct function of the time that the integration takes place and since the time interval that the moving cell is to the left of the intersection point is greater than the time interval that the moving cell is to the right of the intersection point in a lighted area of the image , then the respective integrated voltages will have different magnitudes . the foregoing can better be understood by referring to the wave forms in fig6 . in the top wave form , the sine wave 56 depicts the oscillating motion of the first light responsive cell 19 . it passes the center or intersection point of the cross hairs of fig4 at the point 57 in the top diagram of fig6 . it then moves to the left edge boundary indicated in the top wave form of fig6 at 58 . thereafter , the oscillating cell will again pass the intersection point depicted at 59 in fig6 and then moved to the right boundary indicated at 60 . referring to the wave forms below the sine wave 56 in fig6 there is schematically illustrated at 61 and 62 the integrated output voltages from the integrator occurring during the time intervals described . for convenience of control the signals generated whenever the cell is moving to the left as depicted in fig4 are inverted so as to be negative relative to the generated integrated signal when the cell is moving to the right . the time intervals described heretofore are indicated at t1 and t2 in fig6 and these time intervals are proportional to the distances x1 and x2 as also shown in fig4 demarking the swing on either side of the intersection point before a boundary is reached . it will be appreciated that if the intersection point of the cross hairs is directly coincident with the center of the image 52 , then the time intervals t1 and t2 will be equal . therefore , if the signals 61 and 62 shown in fig6 are summed together , the net output signal would be zero . in the example given in fig6 however , off - centering occurs resulting in a greater time interval for t1 than t2 and therefore a greater signal 61 than signal 62 . the peak values of the signals 61 and 62 are respectively stored in capacitors to thereby result in voltage levels indicated by the horizontal lines v1 and v2 in the diagram of fig6 . summing of these signals will thus result in a net negative voltage indicated by the level 63 in the bottom diagram of fig6 . this voltage level 63 is used to drive the x axis servo to move the artwork 10 described in fig1 in a direction to cause the image 52 in fig4 to move to the right so that it will become centered on the intersection point of the cross hairs . as the artwork moves to the right , the time intervals t1 and t2 approach equality and thus the summing of the positive and negative signals v1 and v2 results in an output signal approaching zero . at exact center position , the output signal will be zero and the movement of the artwork will stop . identical centering is accomplished along the y axis in fig4 should there be any off - centering of the image 52 along the y axis . the oscillation of the first and second light responsive cells is preferably made to correspond to the natural resonant frequency of the reeds and in a specific example might be 45 cps . there is thus a sampling on either side of the intersection point of the cross hairs ninety times each second and a very rapid response to any off - centering results . in addition , it can be appreciated that even should the light area defined within the image 52 be non - uniform , it is the abrupt change in lighting that generates the signals at the left and right borders or the top and bottom edges and therefore any non - uniformity in lighting of the opening will not effect the precise centering . as a further consequence of generating signals only when a change in the light occurs , the image can be negative wherein the hole area is dark and the opaque area is light . as described heretofore , the centering information provided from hole to hole in the artwork can be recorded in the memories 24 and 30 described in fig1 for subsequent use in programming movement of a printed circuit board for drilling operations , exact centering always being assured . from all of the foregoing , it can now be appreciated that the present invention has provided a greatly improved method and apparatus for effecting two axis centering , particularly useful in automatically directing a programming table to a center target on circuit board artwork pads . | 6 |
the dtcl operation can best be explained in the example provided in table 1 . the channel binary information is coded in the positions ( phases ) of the peaks of the waveform . thus the data 1 0 0 0 1 0 0 1 0 1 , are coded by four peaks ( transitions ). the peaks are separated by 4 , 3 , and 2 synchronous data clock intervals , respectively . the binary data can be represented by the sequence 4 , 3 , 2 . the example assumes that noise or distortion shifts the output of the peak detector to 4 . 3 , 2 . 4 , 2 . 6 . this output can be provided by the asdd channel disclosed in the above - cited melas et al reference , or by converting the output from a conventional analog peak detector to digital samples . because the original data are known to consist of integers , rounding off the peak detector output will give the sequence 4 , 2 , 3 . this yields two errors . the first type of dtcl of this invention ( type 1 ) applies an error correcting factor to each transition detection number before rounding . the second type of dtcl of this invention ( type 2 ) also applies a similar factor to the asynchronous sampling clock period , t . in table 1 , the initial error e is assumed to be zero . the corrected input z i in the first column is therefore equal to the input pkd i . the new error e i - 1 is computed as the difference between rounded output n i , and z i . in the last two columns , the error e i - 1 computed in the previous column is used to correct pkd i before rounding . this results in correct recovery of the original data for this example . table 1 illustrates the operation of a type 1 dtcl , correcting phase error only . the interval t is the reconstructed data ( synchronous ) clock interval normalized to the sampling ( asynchronous ) clock interval . t is assumed to be constant but may vary because of medium speed fluctuations , such as with magnetic tape or linear - angular disk drive speed variations . a second correction may be applied to the interval t , for example , t i + 1 = t i +. 0625e i . for simplicity of exposition , these corrections are assumed to depend on one previous phase error only . in its most general form , they are the weighted sums of ( n ) previous errors . ## equ1 ## ______________________________________illustrative type 1 dtcluser written data : 1 0 0 0 1 0 0 1 0 1 = 4 3 2distorted peak detector output : pkd = 4 . 3 2 . 4 2 . 6simple clockless detection gives rnd ( pkd ) = 4 2 3normalized data clock interval , t = 1 = t . sub . d / t . sub . sweighting factors ; a = 0 . 8 , b = 0 . 0625 . i = 1 i = 2 i = 3______________________________________pkd . sub . i 4 . 3 2 . 4 2 . 6e . sub . i - 1 0 . 3 -. 36z . sub . i = pkd . sub . i + . 8e . sub . i - 1 4 . 3 2 . 64 2 . 31n . sub . i = rnd z . sub . i / t . sub . i 4 3 2e . sub . i = z . sub . i - n . sub . i t . sub . i . 3 -. 36 . 31t . sub . i - 1 = t . sub . i + . 0625e . sub . i type 2 dtcl only______________________________________ except for type 1 , the two - parameter type 2 dtcl is the simplest to implement and has been shown to perform well in both tape and disk applications . however , under certain special situations , performance can be improved with additional parameters . the following equations describe the type 2 version of the dtcl procedure illustrated in table 1 . ## equ2 ## { n i } is the decoded output sequence . { e i } and { t i } are intermediate variables . w 1 and w 2 are linear weighted sums of all past values of e i . the type 1 dtcl algorithm sets t i - 1 = t i by setting w 2 ( e i )= 0 . two - parameter dtcl formula : eqns . 1 , 3 and 4 form a linear system of equations and thus can be expressed using z - transforms . eqn . 2 is nonlinear , but can be ignored if the decoded output sequence { n } is error free and made up or the same integer n . thus , a transfer function relating the output { e } and the input { pkd } can be obtained . as is well - known , z - 1 represents a time delay of n clock intervals , the time interval required for each pkd detection . for the two - element embodiment of this invention , only a 1 and b 0 are nonzero . thus , ## equ3 ## recall that the unit delay z - 1 above is equal to n clock periods . fig2 to 5 show transient responses of a two - parameter dtcl , using a 1 = 0 . 7372 and b 0 = 0 . 01 . the inventors computed the transient responses directly from the above dtcl formula . fig2 shows the effect of constant recording medium acceleration . fig3 shows the effect of a rapid step in recording medium velocity . fig4 - 5 illustrate the effects of cell - shifts in peak detection such as may arise from noise . a similar three - parameter dtcl embodiment is also useful . the b 1 factor is made nonzero , adding a third parameter , but b 1 is limited to a function of the remaining two parameters . thus : 0 & lt ; b . sub . 0 & lt ; 1 ; b . sub . 1 =- b . sub . 0 a . sub . 1 ; b . sub . j = 0 for j & gt ; 1 ( eqn . 9 ) the parameter b 1 is dependent on the other two . eqn . 4 is rewritten as to eliminate b 1 altogether . the transfer function of this three - parameter formula is given by ## equ4 ## an interesting feature of eqn . 11 is that the poles of this transfer function are always real . thus , the transient response is never underdamped . modified ( divisionless ) dtcl algorithm : the inventors have developed an alternate formula that uses only addition , subtraction and multiplication operations . this is more suitable for high - speed monolithic digital implementation . the division operation is eliminated from eqn . 2 by normalizing each received signal pkd i to the corresponding t i = t d / t s . the following formula results : ## equ5 ## in the above , the prime mark indicates that the variable is normalized to t i because the normalized pkd i is used in the computation . the un - normalized version of e i is recreated to keep eqn . 17 compatible with eqn . 4 . there remains a division operation in eqn . 12 , that can be eliminated with variable substitution . to eliminate it , a new variable is first defined as f i = 1 / t i . eqn . 12 is then rewritten as : secondly , an approximation is applied to permit direct calculation of f i : ## equ6 ## inspection of eqns . 16 and 19 shown that f i has not yet completely replaced t i in the formula . a second approximation is applied to complete this process : in this approximation , the normalized residue is used to compute the weighted sum . at the same time , the weighted sum multiplier is reduced from f i 2 to a single power of f i , eliminating division . this merely assumes that the ratio of t i - j and t i is approximately unity for all non - negative integers { j }, or in the special case where only b 0 is non - zero , a less stringent requirement that the ratio of t i - 1 and t i is approximately unity , which is reasonable for low - speed variations in self - clocked data rate . the last approximation leads to the following divisionless procedure : ## equ7 ## the z - transform analysis method cannot be used on this modified divisionless procedure because the system is non - linear even when n i = n for all { i }. however , the inventors have shown through direct numerical simulation of the transient responses that the modified dtcl procedure behaves closely to the general dtcl procedure . for example , a set of transient responses similar to those shown in fig2 to 5 can be made for the divisionless dtcl using the same parameter values . a maximum difference of less that 1 % phase - error was noted between the general and the modified dtcl in all the transient responses tested . further approximation can be made by replacing f i with a constant value f 0 that may then be multiplied by b 0 to form a single constant weighting factor . this simplified divisionless dtcl behaves closely to the general dtcl so long as f i remains substantially constant ; that is , when the ratio of the actual synchronous data clocking frequency and the asynchronous sampling frequency remains fairly constant . fig1 shows the elements of a typical digital data recording channel . the discrete time control loop ( dtcl ) 20 of this invention is shown within the recording channel , which also includes the asynchronous sampling digital detector ( asdd ) 22 disclosed in the above - cited melas et al reference . fig1 shows the relationship between these two elements and the optical or magnetic data storage medium 24 . medium 24 may be the linear tape in a multi - track tape drive 26 , which varies widely in speed from startup to operating velocity . medium 24 may also include the magnetic disk surface within a direct access storage device 28 , which offers much more stable velocity . moreover , medium 24 may be an optical disk surface in an optical disk data device 30 of the type known in the art . magnetic or optical transitions in medium 24 are sensed by a transducer 32 in any useful manner known in the art . the transducer output signal 34 is presented to the usual plurality of analog functions 36 . these functions include preamplification , automatic gain control ( agc ), and anti - aliasing ( low - pass ) filtering . the resultant analog data signal waveform 38 is presented to asdd 22 for data detection . although fig1 shows asdd 22 as the means for detecting waveform transition times and creating a series of digital words describing these transition times , any suitable means known in the art may also be used to provide the digital inputs required by dtcl 20 of this invention . an important feature of this invention is the unrestricted asynchronous sampling rate f s = 1 / t s . for high - speed operation , f s should be made as low as possible . the synchronous data clock rate f i is set by design but permitted to vary by several percentage points about the nominal design value to account for component and manufacturing variances . the asynchronous sampling clock rate f s is set by design to be proportional to the nominal synchronous data clock rate f d . that is , the ratio f i ( nominal )= f d ( nominal )/ f s is set by design to a fixed value . the precise value of f i is then calculated within dtcl 20 . the sampling clock f s comes from an independent sampling clock generator 39 , whose frequency is set only by the microcontroller of the drive ( not shown ). the f s clock line 46 is the only temperal clock line in the entire detector . the synchronous data clock frequency f d is never actually generated by dtcl 20 . f d is known only implicitly from the calculated ratio f i = f d / f s , which is a digital word held in one of the registers in dtcl 20 . the digital inputs required for dtcl 20 are shown in fig1 as pke , qntr , and qptr . pke is the digital representation of the fractional clock interval at which a waveform transition is detected . qntr and qptr are two flags that signal the presence or absence of a transition within the present sampling clock interval t s . for pwm detection , qntr flags all qualified negative - going threshold transitions and qptr flags all qualified positive - going threshold transitions . for peak detection , qntr flags qualified positive peaks and qntr flags qualified negative peaks . internally , dtcl 20 first converts the information carried on pke bus 40 , qntr line 44 and qptr line 42 to { pkd } on the pkd bus 60 . pkd i is the digital count of the number of sampling clock periods t s between the most recent waveform transition detection and the present waveform transition detection . in fig1 this conversion occurs schematically in a decoding logic 52 . the outputs from dtcl 20 include the digital data { d } on a data output bus 48 indicating the number of data clock periods t d between the most recent transition detection and the present transition detection . also , the phase - error values { e &# 39 ;} are provided at an error output bus 78 . these phase - error values { e &# 39 ;} can be used within asdd 22 to provide additional detection improvement , as described in an example in the above - cited copending melas et al patent application . decoding logic 52 merely combines the two flags on lines 42 and 44 with the series of pke i digital words to produce the differential pulse location words pkd i on bus 60 . to appreciate this process , consider the example discussed above in connection with table 1 , assuming t s is substantially equal to t d . the pke signal on bus 40 would be x 1 0 0 0 x 2 0 0 x 3 0 x 4 , representing the user - written nrzi data 1 0 0 0 1 0 0 1 0 1 . in this example , { x i } ( i = 1 , 2 , 3 , 4 ) represent the fractions of the current sampling interval t s at which the peak or transition detection occurs . decoding logic 52 performs the calculations ( 1 - x 1 )+ 2 + x 2 to generate pkd 3 , ( 1 - x 2 )+ 2 + x 3 to generate pkd 2 and ( 1 - x 2 )+ 1 + x 4 to generate pkd . sub . 3 . in table 1 , pkd 1 = 4 . 3 , pkd 2 = 2 . 4 and pkd 3 = 2 . 6 . the error correction logic 56 is the essential element of dtcl 20 , converting the { pkd } values into digital data { d } on bus 48 as each becomes available . thus , logic 56 is driven by pkd 1 events instead of the sampling clock frequency f s . each digital datum d i represents the number of synchronous data clock intervals t d between a consecutive signal transition pair recovered from medium 24 . data { d } can be considered to be the final output of dtcl 20 . if a nrzi output is desired , each digital datum d i can be later converted to a bit stream having d i - 1 zeros followed by a 1 . direct implementation of the logic 56 portion of the modified dtcl procedure is straightforward . fig6 shows the block diagram equivalent of the 2 - parameter ( eqns . 5 and 6 ) modified dtcl procedure described in eqns . 20 - 23 . the symbols and forms are well - known in the discrete - time system arts . the dtcl correction and decoding procedure is driven by the occurrence of new events , that is , new pkd i inputs . for the highest possible hardware speed , it may be necessary to limit the number arithmetic operations in a register - to - register data path . this is normally done by pipelining the arithmetic operations in a manner known in the art . in fig6 the { pkd } inputs are received on bus 60 . the { d } outputs are provided on bus 48 . the normalized phase or timing errors { e &# 39 ;} are output on bus 78 . the remaining buses are internal to the dtcl operation . the operation of the circuit in fig6 can be best understood with reference to eqns . 20 - 23 . a multiplier 64 combines pkd i with f i to produce the normalized peak detection pkd i &# 39 ; on bus 66 . pkd i &# 39 ; is adjusted for a weighted error ( a 1 e i - 1 &# 39 ;) at a summing device 68 to produce the adjusted peak detection z i &# 39 ; on bus 70 . the digital word presenting z i &# 39 ; on bus 70 contains integer and fractional parts . the integer portion is separated out onto bus 72 as int ( z i &# 39 ;) and the fractional remainder on bus 74 as ( z i &# 39 ;- int ( z i &# 39 ;)). the fractional remainder is then processed in a combination logic 76 to create the rounded fraction minus the fractional remainder . this results in the normalized timing error e i &# 39 ; on error bus 78 . similarly , the fractional remainder on bus 74 is simply rounded in a logic 80 to create the rounded value of 0 or 1 on the bus 82 . this rounded number is summed with int ( z i &# 39 ;) on bus 72 to create the rounded corrected normalized waveform transition detection time n i &# 39 ;= rnd ( z i &# 39 ;). a register 84 delays this digital word n i &# 39 ; by one pkd event to give the d i output . similarly , a multiplier 86 combines the previous value for the normalized data clock frequency f i - 1 with a weighted error ( b 0 e i &# 39 ;) and a summing device 88 combines this with f i - 1 to create f i , which is the value of the normalized data clock frequency needed for the next pkd interval . a register 90 delays the new value f i by one pkd event so it becomes the old value f i - 1 on the bus 92 for the next pkd event . the 2 - parameter modified dtcl procedure may also be implemented in an implicit manner , which the inventors prefer . the outputs discussed above for asynchronous sampling digital detector ( asdd ) 22 in fig1 describe the peak positions of a series of qualified data pulses or transitions . the two flag outputs on lines 42 and 44 can be combined to form a single pkq signal ( fig7 ). pkq is a logical flag that is asserted over any asynchronous sampling clock interval in which a qualified transition or peak is located . the output pke on data bus 40 indicates the relative temporal position of a transition or peak within an asynchronous interval . with these asdd detection outputs , two different approaches are useful for performing data clock recovery and data detection . the first approach converts the peak position information into peak - to - peak distance ( pkd ) information . data detection is then performed using the direct implementation of the dtcl procedure discussed above in connection with fig6 . this approach is hampered by the large register and bus size required for the large pkd values that will arise because of large code run lengths . the second approach uses the pkq and pke signals directly . in essence it merges &# 34 ; decoding &# 34 ; logic 52 into &# 34 ; correction &# 34 ; logic 56 . the idea it to limit pkd i size . an example of such an implementation is given in fig7 . this two - parameter implicit implementation of the modified or divisionless dtcl procedure required extensive experimentation by the inventors , who were obliged to make the tests discussed below to verify that this particular implicit implementation is equivalent to the explicit implementation discussed above in connection with fig6 . the pkq flag operates as an enablement signal , permitting updates to certain parts of the circuitry only upon occurrence of a new signal transition event pkd i . these pkq inputs are shown in five locations labelled 98 , 100 , 101 , 102 and 104 in fig7 . a register 108 forms the accumulator of an implicit pkd &# 39 ; counter . a truncation logic 109 acts to prevent register 108 from holding a number greater than or equal to 1 . 0 by passing only fractional values . this is done merely by passing all least significant bits ( lsbs ) and setting the output most significant bit ( msb ) to zero . the combinatorial logic 116 signals the expiration of one synchronous data clock period t d when the number on the bus 118 exceeds or equal 1 . 0 . this is accomplished merely by passing the msb from bus 118 onto line 50 . after summing with the normalized pke value on bus 96 , the output of register 108 gives a value q i , which provides the timing or phase - error value e i &# 39 ; on the bus 114 when q i is passed through the combinatorial logic 112 upon pkq = enable . this q i value differs from the z i &# 39 ; value used in the direct implementation ( fig6 ) by some integral number + 0 . 5 . combinatorial logic 112 converts q i merely by inverting the second msb of the bus 113 , replicating it into the msb , and passing the two modified msbs together with the other unmodified lsbs onto bus 114 as e i &# 39 ;. the phase error value e i &# 39 ; on bus 114 is multiplied with b 0 and f i - 1 to generate the new value f i - 1 in much the same way as is discussed above in connection with fig6 . however , because the phase - error value e i &# 39 ; is valid only when the enabling pkq flag is asserted , register 106 is updated only when enabled by pkq on line 98 . thus , the f i value is updated only by an equivalent pkd event . a multiplexer 130 is also used to pass valid values of the normalized phase error e i &# 39 ; after multiplication by a constant ( 1 - a 1 ). multiplexer 130 is part of the implicit pkd &# 39 ; counter loop . the logic gates associated with data ready line 50 together with the comparator 124 form a nrzi data decoder for this dtcl implementation . output data { d } on bus 48 are a stream of nrzi zeros and ones , which are not necessarily valid in all asynchronous clock intervals . a valid nrzi data bit is present on line 48 only when the data ready line 50 is high . this implicit implementation ( fig7 ) does not yield exactly the same behavior as the direct implementation ( fig6 ) because the update to the normalized synchronous data clock frequency f i occurs on the asynchronous sampling clock interval boundaries instead of the equivalent peak boundaries where it occurs in the direct implementation of fig6 . however , exact numerical computations show that the transient responses for the implicit implementation using parameter values given in fig2 to 5 deviate in phase from the exact results in fig2 thru 5 by no more that 1 %. the only obvious qualitative difference occurs in the acceleration response ( fig8 ), where the slight wiggles of less than 1 % phase error result from updating the normalized data clock frequency f i on the asynchronous clock boundary instead of the equivalent pkd i boundary . the example shown in fig8 uses an asynchronous clock frequency that is nominally two times the expected data ( synchronous ) clock frequency , but the implementation in fig7 will perform adequately with any oversampling rate greater than unity . the inventors have evaluated dtcl performance using a software model of an asynchronous sampling digital detector ( asdd ) on a read - back data signal from a test stand using a kazuza ii disk and a tdk mig head . fig9 shows the phase error distribution of the peaks in the read - back signal of a pseudo - random rll ( 1 , 7 ) code . the inventors also fabricated a hardware prototype of an asdd channel coupled to a type 1 dtcl . fig1 shows the prototype phase - error distribution compiled from measurements of the phase - error at the prototype output . fig9 and 10 show similar results . the differences result from the 11 - bit integer arithmetic used in the hardware prototype instead of the 32 - bit floating point arithmetic used in the software channel simulation . there were no errors in the decoding of the read - back signal in either case . in a sampled detection system , the data is contained in samples of a waveform function . this requires synchronous sampling at the correct phase within the bit period . the dtcl of this invention can be used with the asdd in fig1 to provide these sampling points . when initial sampling of the waveform is asynchronous , the distance between an asynchronous sample and the nearest synchronous sampling point must be determined . the amplitude at that synchronous sampling point is then found by interpolation . because of the features available in the asdd and dtcl , this interpolation will succeed even with intervening extrema in the waveform . for example , assume that some synchronous sampling points occur at waveform peaks . the asdd operates to determine the distance between a signal peak and the nearest asynchronous sample , and also finds the distance pkd between consecutive zero - crossings , which is then provided to the dtcl . the dtcl intermediate phase error e is merely the distance between a synchronous sampling point and the closest zero - crossing , pke . thus , distance between asynchronous samples and synchronous sampling points can be derived as e - pke . fig1 shows a waveform function with asynchronous samples ( squares ) and synchronous positions ( circles ). in this example , e = 0 and the distance pke is 39 from the peak at 500 to the nearest sample at 539 . synchronous sampling positions are the peaks ( or derivative zero - crossings ) at 100 , 300 , 500 , 700 and 900 . knowing pke and f i , which is the ratio of synchronous sampling frequency to asynchronous sampling frequency , the amplitude of the waveform function at the synchronous sampling positions can be estimated by asdd interpolation . clearly other embodiments and modifications of this invention will occur readily to those of ordinary skill in the art in view of these teachings . therefore , this invention is to be limited only by the following claims , which include all such embodiments and modifications when viewed in conjunction with the above specification and accompanying drawing . | 6 |
in the most preferred embodiment of the invention , an adjustable mount 100 supports a standard telescopic sight 10 . while the construction , details or features of sight 10 , including the telescopic nature , are not critical to the present invention , sight 10 will typically and most preferably have internal adjustable cross - hairs or similar sighting aids which are adjustable for fine deviations in both of two axes . typically , a first adjustment 20 will adjust the up and down movement of the sighting aid , while a second adjustment 30 will change the left and right direction . those skilled in the art of sights will understand that the up - down adjustment 20 is typically used to set a particular distance to a target , to compensate for vertical height lost during the travel of a projectile from the sight to target , while the left - right adjustment 30 is used to compensate for side deviations such as might occur with a cross - wind . the use of this type of sight 10 is not critical to the invention , but is preferred since very fine adjustments are complimentary to the preferred embodiment mount 100 , as will be described herein below . a support bar 110 spans two generally u - shaped vertical yokes 112 and 114 , and also provides an interconnection to a rifle , gun , or other device through base 102 for which a sight of the nature of sight 10 or mount 100 is desired . vertical yokes 112 , 114 support sight clamping rings 120 and 130 , respectively . in the preferred embodiment mount 100 illustrated herein , clamping rings 120 , 130 are each made from two generally semicircular segments that are held together with bolts or similar fasteners . clamping ring 120 has a lower semicircular segment 127 and an upper semicircular segment 128 , each visible in fig1 while clamping ring 130 has a right semicircular segment 132 visible in fig1 . each clamping ring 120 , 130 is most preferably designed to have an inner diameter which is slightly larger than the outer diameter of the sight 10 about which the clamping ring will be affixed , to fit securely thereto without crushing . a slight difference in diameters ensures that clamping rings 120 , 130 will always be adjustable to be clamped tightly against sight 10 , regardless of small manufacturing tolerances . while this method of attachment is most preferred , it is not critical to the operation of the invention , and other techniques for fastening to telescopic scope 10 may be provided as known in the art . nevertheless , split rings as illustrated or similar known techniques are preferred to ensure distribution of forces transmitted from the gun barrel to sight during firing , thereby preventing damage or deformation of the sight . this distribution of forces , rather than point forces created by others in the prior art , is important for continued operation of the mount and sight . clamping ring 120 is adapted to slide within a center of yoke 112 , thereby raising or lowering sight 10 . however , clamping ring 130 only pivots about shoulder bolts 116 with respect to yoke 114 . therefore , raising or lowering ring 120 with respect to yoke 112 changes the sighting point on a target . said another way , raising or lowering clamping ring 120 within yoke 112 will change the angle between the axis of scope 10 and the longitudinal axis of support bar 110 . consequently , a point within the cross - hairs will be shifted higher or lower as a result of the movement of clamping ring 120 within yoke 112 , without changing where the rifle barrel is directed . those familiar with sighting will recognize that this is the basic goal of an adjustable sight . this adjustment allows a rifleman to change the angle between scope and gun barrel to compensate for changes in distance or air currents between gun and target . most preferably , yoke 112 will restrain clamping ring 120 to motion only along the arcuate path pivoting about the front clamping ring 130 , and will restrain against motion perpendicular to this arcuate path . shoulder bolts 116 comprise the preferred embodiment method of providing a pivotal connection between yoke 114 and clamping ring 130 . nevertheless , other techniques for providing the necessary pivotal motion may be used alternatively , such as precision bearings or the like . most preferably , the pivotal connection will restrict motion in any direction other than about the pivotal axis . visible in fig1 are also two small bolts 108 which pass through a plate 113 , through arcuate slots 119 cut in yoke 112 , and into mating holes in clamping ring 120 , where they are secured . the tightening of screws 108 will create force between plate 113 and yoke 112 , thereby locking clamping ring 120 in place with respect to yoke 112 . by using a total of four screws 108 , two on each side of yoke 112 , the careful tightening thereof will keep clamping ring 120 centered , and consequently not affect the windage adjustment described herein below . other fasteners or fastening means may be provided . an important feature , however , is the provision of balanced forces about the yoke 112 and clamping ring 120 to maintain proper longitudinal orientation of the sight with respect to gun barrel . arcuate slots 119 may actually be straight or only slightly arced , depending upon the width of the slot and the amount of travel required . the difference in width between arcuate slot 119 and outer thread diameter of screws 108 will provide some tolerance that reduces the amount of arcing required , and which will in some cases eliminate the need for any arcing at all . at the top of yoke 112 is a gauge 150 , which in the preferred embodiment is a very precise instrument such as a long travel micrometer - type gauge or head commonly used on precision measuring instruments . the type of gauge used in the implementation of the preferred embodiment is not critical , and other measuring instruments , either electronic , electromechanical , mechanical , sonic or otherwise will be selected by those skilled in the art after a reading of the present disclosure . fig3 illustrates the internal connection of gauge 150 to yoke 112 and clamping ring 120 by cross - section along line 3 ′ of fig2 . surrounding a perimeter of gauge 150 are four fasteners 151 , 152 that pass through plate 158 and into corresponding holes at a top surface of yoke 112 . in order for mount 100 to operate precisely and repetitively , a pair of pins 153 are also provided that pass into mating and precisely fitting holes . this combination of fasteners and pins is used not only to fasten gauge 150 to yoke 112 , but similar combinations of fasteners and pins are used elsewhere . this combination of pins and fasteners provides the benefits of ready self alignment through the pins , precision positioning , and durability to withstand the repeated shocks of bullets or other projectiles being fired . without the pins , the plates may shift by necessary tolerances between bolts and threaded holes during recoil , which would alter critical alignment and make repeat shots less reproducible . adapter 154 is used to mount gauge 150 into plate 158 and allow relative adjustment there between , as will be described herein below . in a central region of adapter 154 is an adjustably extended tip 155 , which extends from gauge head 150 . as is known in the industry , gauge 150 may be rotated to extend tip 155 by very small , precise and repeatable amounts . this extended tip 155 will most preferably be used to push clamping ring 120 down relative to plate 158 , thereby precisely controlling the angular orientation of scope 10 with respect to support bar 110 . while tip 155 could be of ordinary softer materials , as could clamping ring 120 , most preferably clamping ring 120 has been provided with a surface 122 having a cylindrical groove 123 therein . pressed into groove 123 and thereby retained therein is a cylindrical bearing 124 or the like , which preferably extends slightly above the surface 122 . bearings are preferred , owing to their intrinsic hardness and durability , which coincides with the needs of the present invention . as is known in the field , a rifle or gun recoils . while various weights and devices are commonly provided to reduce the total amount of recoil , there is nevertheless some shock delivered through the firearm and into the mount and sight . a hardened surface prevents this shock from denting or deforming either ring 120 or gauge 150 . preferably tip 155 and bearing 124 will both be a hard alloy or treated material such as used in the manufacture of bearings . until screws 108 are tightened down , plate 113 will slide freely up and down along groove 119 . the maximum amount of vertical travel is limited by tip 155 , the length of groove 119 , and the spacing between the end of sight 10 and the rifle barrel . the elevation of yokes 112 , 114 above support bar 110 can be increased or decreased to allow more or less longitudinal tilt in sight 10 . under the bottom side of ring 120 , between ring 120 and support bar 110 , springs may optionally be provided which will then compress between ring 120 and yoke 112 and serve to bias ring 120 away from support bar 110 . in the preferred embodiment , no springs are used , and ring 120 will be manually biased prior to locking by tightening screws 108 . in operation , base 102 will be fastened onto a rifle barrel or other device for which precisely adjustable sighting is desired through large distance or elevation deviations . base 102 may be machined or formed differently than illustrated herein , to accommodate a particular barrel or mounting arrangement . base 102 will then vary from one application to another , and will typically be designed to accommodate only one or a few select models , such as a particular manufacturer &# 39 ; s rifle , gun or the like . once mounted to the rifle barrel or the like , shoulder bolts 116 should be sufficiently loose to allow pivoting of clamping ring 130 with respect to yoke 114 . similarly , bolts 108 are sufficiently loose to allow clamping ring 120 to slide up and down within yoke 112 . with these bolts 108 , 116 so loosened , the user will press bearing 124 against tip 155 . adjustment of gauge 150 will raise or lower extendible tip 155 with respect to the end of yoke 112 , thereby raising or lowering clamping ring 120 with respect to support bar 110 . in the preferred embodiment , this adjustment will serve as a potentially large but relatively coarse adjustment . once this adjustment is made , finer variations , such as are used to change deviation over shorter distances , may be made through the scope up - down adjustment 20 . most preferably , yokes 112 , 114 will be held to very tight tolerances , as will clamping rings 120 , 130 . this allows rings 120 , 130 to nest tightly into yokes 112 , 114 , thereby preventing any left and right angular deviation that might otherwise occur . if , as shown in the preferred embodiment , a micrometer gauge is used , an adjustment screw 159 such as shown in fig2 may be provided , which allows gauge 150 to be “ sighted in ”, or precisely set for a particular angle of elevation or distance of trajectory , ensuring the accuracy of gauge 150 . adjustment screw 159 in the preferred embodiment illustrated herein interacts with adapter 154 to allow gauge 150 to be rotated , raised or lowered with respect to plate 158 , or to alternatively lock adapter 154 in position relative to plate 158 . in use , a standard telescopic sight will only provide adjustment that allows sighting through distances measured in hundreds of yards or meters . while this is adequate for close range target shooting or hunting , the present invention expands the capability of sighting by providing adjustment through distances that are measured in thousands of yards and even miles or kilometers . to use adjustable mount 100 , the distance between target and rifleman is first determined . various ballistics tables are available that show the drop of a particular bullet through a particular distance . these tables are used as is known to calculate the angular adjustment required by a sight . if this is greater than the capability of sight 10 , then bolts 108 , 116 may be loosened , gauge 150 adjusted to set the new angular orientation very precisely , to attempt to zero the sight at the intended distance , and then bolts 108 , 116 once again tightened . in the event the bullet or projectile passes higher or lower than intended , or varies right to left , final adjustment to the sight may then be made through up - down and left - right adjustments 20 , 30 already available in telescopic sight 10 . alternatively , the process of loosening and tightening bolts 108 , 116 may be repeated . once elevation compensation is selected for bullet drop compensation , windage may also be adjusted . this may occur either prior to or after bullet drop compensation , owing to the independence of function provided by the present invention . windage is adjusted through the setting of a second gauge 160 which resembles gauge 150 in both feature and function . an adapter 164 is provided for mounting gauge 160 into support bar 10 and a pin 111 is rigidly anchored into base 102 . the gauge 160 may be adjusted with interaction between tip 165 and pin 111 to accurately set windage . as will now be apparent , gauge 150 may be calibrated to read either in fractions of an inch or millimeters , or may alternatively be calibrated to a specific firearm and bullet to read specifically in target distance . the present invention may therefore be readily adapted through a variety of specific embodiments to accommodate a wide range of sights used with firearms , weapons or other devices in concert with a telescopic scope . consequently , while the foregoing details what is felt to be the preferred and additional alternative embodiments of the invention , no material limitations to the scope of the claimed invention are intended . the variants that would be possible from a reading of the present disclosure are too many in number for individual listings herein , though they are understood to be included in the present invention . further , features and design alternatives that would be obvious to one of ordinary skill in the art are considered to be incorporated also . the scope of the invention is set forth and particularly described in the claims herein below . | 5 |
the present invention is concerned with a method of and apparatus for measuring coolant quenching rates . the inventive apparatus and method facilitate measuring heat transfer parameters , especially at elevated temperatures , such as those encountered under actual rolling and casting conditions in metallurgical processes . temperatures of interest with aluminum , broadly speaking , can range from about 200 ° f . to about 1200 ° f . temperatures of special interest are around 900 ° f . to about 1200 ° f . which are within the normal quenchant &# 39 ; s film boiling zone . for instance , temperatures encountered during hot rolling of aluminum can range between about 900 ° f . and about 1050 ° f . the inventive method and apparatus provide improvements over prior art systems by providing quantification of heat flux as a result of spray quenching using different types of coolants and / or lubricants . using the inventive apparatus and method , breakthrough temperatures such as the temperature at which nucleate boiling begins or ends can be determined for various quenching intensities and types of coolants . referring to fig1 an apparatus for measuring coolant quenching rates is generally designated as reference numeral 10 and includes a metallic disk 1 of approximately 1 &# 34 ; thickness by 3 &# 34 ; diameter having a top surface 3 and a bottom surface 5 . the disk 1 should be constructed of a metal with a relatively high melting point and high thermal conductivity such as copper . the circular shape of the disk sample 1 and high conductivity facilitate obtaining an essentially one - dimensional temperature gradient across the thickness of the disk sample . the disk sample 1 is shown being fitted with three thermocouples 7 . three thermocouples 7 should be of small diameter , 1 / 16 &# 34 ; or less , and inserted into the disk 1 via machined holes in the side surface of the disk ( not shown ), and should be precisely aligned along the center axis line 9 of the disk . although three thermocouples are shown at a given configuration , more or less thermocouples may be used at various spacings along the axis 9 of the disk 1 at precisely known distances from the bottom surface of the disk . one advantage of placing the thermocouples inside the disk is that they are protected from the intense heat of the torch used in a preferred embodiment to heat the disk . also , means other than thermocouples can be used to measure the changes of temperature with time . the metallic disk 1 is aligned and supported by placement upon a tube 11 of low thermal conductivity material , such as quartz or ceramic . a spray nozzle 13 aligned axially with the tube 11 is connected via tubing 15 to a reservoir of cooling or quenching media ( not shown ) and provides a spray 17 of coolant 19 supplied through tubing 15 to the bottom surface 5 of the metallic disk 1 . the flow rate of coolant and the spacing between the nozzle 13 and disk 1 are adjustable so that the spray pattern covers the entire bottom surface 5 of the disk 1 . the coolant , after having contacted the metallic surface is contained within the tube 11 and drains to a spent coolant reservoir ( not shown ) and discarded . preferably , the flow of coolant is started prior to heating of the disk 1 . if the lower surface is not cooled prior to heating of the disk , there is an increased possibility of the bottom surface of the disk getting too hot so that particles in the coolant will fuse to the surface thereby altering the heat transfer characteristics of the disk . the metallic disk 1 is rapidly heated to the desired temperature by use of a gas torch 21 , such as an oxy - acetylene or propane torch , the arrows 23 representing heating by the torch flame . flame impingement is preferred over resistance or other electrical heating to rapidly achieve the high temperatures used in the process . the disk should be heated to a temperature above the upper temperature of interest by approximately 100 ° f . the torch is then removed and the sides and top of the disk are insulated by placement of insulating material 25 immediately after the torch 21 has been raised . the insulating material may be rigid or flexible and may comprise a type such as kaowool . the insulated side and top surfaces , the cooling of the bottom surface and the high thermal conductivity of the metallic disk result in the heat flow through the disk to be essentially one dimensional from the top of the disk to the bottom . the one dimensional flow of heat greatly facilitates and simplifies the calculation of quenching rates . it should be noted that the insulation material 25 , in addition to covering the disk 1 , can cover upper portions of the side wall of the tube 11 . slits may be provided in the insulation for the leads connected to the thermocouples 7 . the objective is reduce the amount of heat lost through the top and sides of the disk 1 . preferably , the disk 1 is provided with an annular seat , as illustrated in fig1 that allows the disk to sit in the top of tube 11 . the surface of the seat , in one embodiment , is roughened to reduce heat flow between the disk 1 and the tube 11 . it is desireable to have the disk 1 removable from the tube 11 to facilitate cleaning of the disk &# 39 ; s lower surface . any contaminant or oxide build up on this surface has a tendency to reduce measurement accuracy . from the temperature profile through the thickness of the disk 1 as measured by the thermocouples 7 , the temperature of the bottom surface of the disk and the heat flux through the disk can be calculated throughout the quenching cycles by the use of suitable heat transfer models , which are known in the art . the temperature data should be sampled at a rate of 5 hertz or greater but other intervals may also be used . the heat flux through the disk is approximately equal to the rate of heat removal by the coolant , i . e ., the quenching intensity . under steady - state conditions , heat flow is calculated using the following equation : ## equ1 ## where &# 34 ; k &# 34 ; is the thermal conductivity of the disk , &# 34 ; a &# 34 ; is the surface area of the disk , &# 34 ; t &# 34 ; is the temperature gradient across the disk , and &# 34 ; x &# 34 ; is the disk thickness . the quenching curve is presented as a plot of heat flux or quenching intensity as a function of the bottom surface temperature of the metallic disk . an exemplary method and additional measuring apparatus components are shown by the block diagram of fig2 . the coolant or quenching media 19 is charged to a fresh coolant reservoir 29 where the temperature is controlled using a temperature controller 31 and control thermocouple 33 . the coolant is pumped using a pump 35 such as a constant volume pump through a flow meter and valve 37 . the control valve 37 is used to control the flow rate of the coolant . the pressure in the spray nozzle is monitored using a pressure transducer 39 . the spray nozzle 13 and metallic sample disk 1 are shown in greater detail in fig1 . the gas torch 21 is automatically controlled by means of a temperature controller 41 and control thermocouple 43 . the spent coolant is routed to the spent coolant reservoir 45 . vapors 47 from the boiling coolant are collected and removed using a vacuum pump 49 . electrical signals from the temperature , pressure and flow sensors are sampled and analyzed by an automatic data acquisition and master control system 51 at a frequency of approximately 5 hertz . the master control system 51 may be a computing or microprocessing means capable of controlling temperature controllers 31 and 41 , and flow meter valve 37 to provide a single control system during testing . the entire testing period may be about 5 minutes but can vary depending on the type of quenching test performed . multiple tests are conducted for each coolant to determine variability and statistical confidence intervals . the quenching curve typically takes the form shown in fig3 . by plotting quenching intensity versus surface temperature , the temperature ranges of film boiling , i . e ., low and stable heat transfer rates , and nucleate boiling , i . e ., contact of the coolant with the surface resulting in high boiling rates and high heat transfer rates , can be observed . important attributes of the quenching curve can be quantified such as average heat transfer rates over the temperature range of interest and the temperature range over which the heat transfer mechanism changes from nucleate boiling to film boiling . the following examples illustrate monitoring different types of quenching parameters when using the apparatus for and method of measuring coolant quenching rates . however , the invention is not considered to be limited thereto as obvious variations thereon will be apparent to those skilled in the art . the apparatus described above was used to measure the quenching curves of water as a function of water temperature and water quality . the results are shown in fig4 which show that quenching intensity decreases with increasing purity and increasing temperature . such information contributes in developing , monitoring and controlling aqueous quenching media as applied to metallurgical processes . the apparatus described was used to measure the quenching curves of various quenching media . the quenching curves of water , an aged hot rolling emulsion and a freshly - prepared hot rolling emulsion are compared in fig5 . this demonstrates that the apparatus can be used to differentiate between different quenching media and monitor the changes in quenching intensity over time . as the emulsion aged during the hot rolling process , peak quenching rates decreased . this information can be used to monitor effectiveness of quenching media which is repeatedly used . the apparatus described above was used to monitor the average quenching intensity of an oil / water emulsion used in the hot rolling of aluminum alloy . the average quenching intensity was determined from an integration of the quenching curve over the temperature range typically encountered by an ingot during the rolling process . twenty - one samples of rolling emulsions were tested over a period of 52 days . the average quenching intensity as a function of days of operation is plotted in fig6 . the precision of the measurements is also plotted (± 1 standard deviation ). this demonstrates that the apparatus can be used to measure the process variability of quenching intensity which would have application in quality assurance and quality control . the apparatus described above was used to measure the quenching intensity of contact water from two separate facilities used to cast aluminum ingot . results are given in fig7 . significant differences were measured in the quenching curves that would affect the rate at which the ingot is cooled during casting which , in turn , could affect overall ingot quality . chemical analysis revealed that the contact water from the two facilities differed regarding hardness and oil content as follows : ______________________________________ hardness oil & amp ; grease ( as ppm caco . sub . 3 ) ppm______________________________________casting water no . 1 175 . 7 4 . 3casting water no . 2 99 . 4 & lt ; 1 . 0______________________________________ as can be seen from fig7 the casting water having lower hardness and lower oil and grease content provided higher quenching intensity during nucleate boiling but lower quenching intensity during film boiling . although a single spray nozzle has been depicted for applying a coolant to the bottom surface of the metallic disk sample , multiple spray nozzles may also be used . in addition , the spray nozzle in conjunction with the flow rate of coolant should be adjusted to ensure that the complete bottom surface of the metallic disk is covered so as to provide accurate quenching intensity data . an exemplary flow rate for a 3 inch diameter metallic disk would include about 8 gallons per hour . the schematic diagram illustrated in fig2 may also include a filtering means to remove debris and other material from the coolant flow prior to contacting the metallic disk . the filtering means may be any known type and should be constructed such that testing may be performed with or without filtration in the cooling flow . the coolant temperature used during the measuring process should approximate those temperatures used in actual plant practice . for example , in an aluminum rolling operation , a typical heated coolant would range between 120 °- 150 ° f . as such , an invention has been disclosed in terms of preferred embodiments thereof which fulfill each and every one of the objects of the invention as set forth hereinabove and provides a new and improved apparatus for and method of measuring coolant quenching rates of great novelty and utility . of course , various changes , modifications and alterations in the teachings of the present invention may be contemplated by those skilled in the art without departing from the intended spirit and scope thereof . as such , it is intended that the present invention only be limited by the terms of the appended claims . | 6 |
fig1 sets forth a partial section view of a catheter constructed in accordance with the present invention and referenced by numeral 10 . catheter 10 includes an elastic tube beginning at rounded end 16 of drain head 30 and ending in two divided sections at the opposite end , one of the sections branching off from collector fitting 12 and progressing through check valve 18 , hypodermic syringe connection 19 to hypodermic syringe 20 , which is removable ; the other section terminates in flexible container 26 for receiving the fluid being drained . proximate rounded end 16 of drain head 30 is an entrance hole 14 through which the fluid to be drained can enter and flow through main channel 28 , ending in flexible container 26 . in some cases , flexible container 26 is replaced by a long tube which ends in a conveniently placed open container . molded into the wall of the catheter parallel to the main channel are four secondary medicating channels 24a , 24b , 24c and 24d which extend from drain head 30 , where they are closed and sealed , to collector fitting 12 wherein they are all joined and feed into fitting outlet 17 . this flow line now passes through check valve 18 and hypodermic syringe connection 19 to hypodermic syringe 20 . at three - eights inch spacing or thereabout spacing along each medicating channel 24a , 24b , 24c , and 24d are slits 22 , which are made with a sharp piercing blade from the outside diameter 11 of catheter 10 through into medicating channels 24a , 24b , 24c and 24d . no material is removed from catheter 10 in making slit 22 , causing slit 22 to close up when the blade is withdrawn after cutting the slit . slits 22 are 0 . 06 or thereabout in length , their actual length being dependent upon the thickness of the wall from the outside diameter 22 to the closest wall of channel 24 and the durometer of the elastomeric material selected for the catheter . the determining factor is the pressure required in channels 24 provided by hypodermic syringe 20 to force the slit to open and release the anti - microbial agent to outside of catheter 10 . by providing this pressurized system , it is assured that all slits will open simultaneously and release the injected anti - microbial agent when hit with a pressure of more than that required to open the shortest slit . collector fitting 12 is sealingly attached to catheter 10 by adhesion or other method , which will not leak under the pressure of the fluid being pumped by the hypodermic syringe . catheter 10 is preferably constructed of a biocompatible polymer such as latex , polyvinyl chloride , polyurethane or silicone . fig2 sets forth an enlarged cross section view of catheter 10 showing four medicinal channels 24a , 24b , 24c and 24d and slits 22 passing from catheter outside diameter 22 through to channels 24a , b , c , and d . main channel 28 is shown passing through the center of catheter 10 . fig3 and 4 show further enlarged views of secondary medicinal channel 24a and slit 22 . typical of the operation of the present invention infection - resistant catheter is its use as a ureteral catheter . in this usage , the catheter is inserted through the urethra and into the bladder in order to control the outflow of urine from the bladder . for this purpose a material is selected which is a compromise -- it must be as soft as possible while still retaining enough stiffness to allow its insertion by compression against the resistance of the wall of the urethra . the outside diameter is 14f , a standard catheter designation . each f unit is 0 . 33 mm , therefore the diameter is 4 . 62 mm or 0 . 18 inches . after the catheter is in place with the catheter head inside the bladder and the drain outlet attached to an empty flexible container , a hypodermic syringe with the prescribed anti - microbial agent in its barrel is attached to the hypodermic connection and the syringe &# 39 ; s piston driver is pressed firmly and swiftly to the completely closed position , ejecting the anti - microbial agent into the secondary channels of the catheter . the collector fitting directs the agent to all secondary medicating channels simultaneously . the pressure exerted on the fluid by the syringe opens all slits simultaneously and flows the medicine outward and into the area between the urethra and the catheter outside diameter . a certain amount of the medicine will remain within the medicinal channels and is contained therein by the check valve located in front of the hypodermic syringe . after ejecting the medicine , the hypodermic syringe is removed . at regularly scheduled intervals , more anti - microbial fluid may be added or another medicine introduced . thus , the reader will see that the present invention provides a highly reliable , economical device which addresses a serious problem in health science . this basic improvement in catheters can result in prolonged life and reduced suffering for large numbers of ill people . with the continuous discovery of improved antibiotics the present invention provides a way of utilizing these medicines to their best advantage . while our description above contains many specific details , these should not be construed as limitations on the scope of the invention , but rather as an example of one of the many variations which are possible . for example , the slits indicated in the preferred embodiment may be replaced by needle punctures in which no material is removed but which provide a very small fluid passage when put under pressure . a balloon may be provided for catheter anchorage . the number of medicating channels may be reduced to as few as one or increased to more than four . anti - microbial , of course , includes anti - fungal and anti - viral activity as well . new discoveries in plastics may provide materials which are better suited to the application than those listed . while the embodiments described are typical of ureter catheters , the present invention can be adapted for use in wound drainage , transtrachial oxygen delivery , and other catheter requirements , accordingly , the scope of the invention should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents . | 0 |
in the description of the figures hereunder , the same reference signs are used for the same or functionally equivalent components , respectively . the sls or slm laser processing machine 1 shown in fig1 serves for producing components by way of a layer - by - layer construction from a material powder 2 and for the layer - by - layer sintering or melting of the material powder 2 by means of at least one laser beam 3 . the laser processing machine 1 in a manner known includes powder - conducting elements such as , for example , a process chamber 4 having a construction platform 5 and having a powder coater 6 for the layer - by - layer application of a material powder 2 to the construction platform 5 , and a powder reservoir 7 for the material powder 2 that is to be infed to the powder coater , and a powder recovery / preparation 8 , as well as non - powder - conducting elements such as , for example , a laser 9 for generating the one laser beam 3 , and a deflection unit 10 for aligning the laser beam 3 in a two - dimensional manner to the material powder 2 that is applied to the construction platform 5 . the laser 9 and the deflection unit 10 are disposed above the process chamber 4 . in the laser processing machine 1 , a component is constructed layer - by - layer by sintering or melting the material powder 2 by means of the laser beam 3 . the material powder 2 is applied all - over to the construction platform 5 by the powder coater 6 , and the layers are sintered or melted step - by - step into the powder bed by actuating the laser beam 3 according to the layered contour of the component . the construction platform 5 is subsequently lowered by the amount of a layer thickness , and the material powder 2 is applied from anew . this cycle is repeated until all layers of the component have been sintered or applied by melting , respectively . as is shown in fig2 , the laser processing machine 1 is releasably assembled from a process chamber module 11 1 and from a radiating module 12 , wherein the process chamber module 11 1 shown in fig3 a includes all powder - conducting elements , that is to say presently the process chamber 4 , the construction platform 5 , the powder coater 6 , the powder reservoir 7 , and the powder recovery / preparation 8 , and the radiating module 12 shown in fig3 b includes the non - powder - conducting elements , that is to say presently the laser 9 and the beam guide 10 . the radiating module 12 is preferably embodied so as to be stationary , while the process chamber module 11 1 is mounted so as to be displaceable on rollers 13 . two side plates 14 between which the process chamber module 11 1 can be plug - fitted to an exact fit are fastened to either side on the radiating module 12 . the laser beam 3 that exits in a downward manner from the radiating module 12 is coupled into the process chamber 4 by way of a process chamber window 15 on the upper side . the supply of the process chamber module 11 1 with power , water , controller data , etc ., is performed exclusively by way of the radiating module 12 , wherein the connectors and interfaces required to this end on the process chamber module 11 1 and on the radiating module 12 are not shown . the process chamber module 11 1 per se does not have any dedicated controller for the production of components but is connected to the controller 16 of the radiating module 12 . the radiating module 12 thus controls / regulates not only the laser 9 and the deflection unit 10 but also the powder management in the process chamber 4 . furthermore , an external display / operator panel 17 is attached to the radiation module 12 . another laser processing machine 1 which is releasably assembled from a process chamber module 11 2 and two radiating modules 12 is shown in fig4 . the radiating modules 12 are of identical construction to the radiating module 12 of fig1 to 3a and 3b , while the process chamber module 11 2 is embodied so as to be double the width of the process chamber module 11 1 of fig1 to 3a and 3b . the two radiating modules 12 are fastened to one another in a side - by - side manner , and on the end side each have two side plates 14 between which the process chamber module 11 2 is plug - fitted to an exact fit . the two radiating modules 12 , in terms of control technology , are connected in the manner of a master / slave concept and are optically inter - referenced in order for the processing field of the process chamber 4 to be distributed among mutually overlapping processing part - fields 18 of the two laser beams 3 of the radiating modules 12 . each radiating module 12 has a controller interface ( not shown ) for connecting to the controller interface of the other radiating module , so as to interconnect the controllers 16 of the two radiating modules 12 . for example , the controller interface can be a wireless interface or an electronic machine interface which is disposed on either side on a radiating module 12 , so as to connect to the machine interface of an adjacent radiating module 12 . the one radiating module 12 is operated as the master module , and the other radiating module 12 is operated as a slave module that is controlled by the master module . the two radiating modules 12 each have one optical sensor 19 ( for example a camera ), the detection range of said optical sensor 19 being configured for detecting at least part of the processing part - field 18 of the respective other radiating module . for example , the master radiating module 12 by means of the laser beam 3 thereof can thus carry out a processing procedure or illuminate fixed calibration points which in turn are detected by the sensor 19 of the adjacent slave radiating module 12 , the latter thus calibrating its own positioning in relation to the master radiating module . in the case of further radiation modules that are lined up beside one another , the next slave radiating module can then be calibrated in relation to an already calibrated slave radiating module and so forth until all slave radiating modules have been calibrated in relation to the master radiating module . the supply of the process chamber module 11 2 with power , water , controller data , etc ., is performed exclusively by way of the radiating modules 12 , wherein the connectors and interfaces required to this end on the process chamber module 11 2 and on the radiating modules 12 are not shown in the drawing . the process chamber module 11 2 per se does not have any dedicated controller but is connected to the master controller 16 of the master radiating module 12 . the master controller 16 thus controls / regulates not only the laser 9 and the deflection units 10 of the two radiating modules 12 but also the powder management in the process chamber 4 . furthermore , the external display / operator panel 17 which is used for both radiating modules 12 is attached to the radiating modules 12 . fig7 shows a modular system 20 for assembling laser processing machines 1 , said modular system 20 being composed of a plurality of process chamber modules 11 1 , 11 2 , 11 3 of different widths , and from a plurality of radiating modules 12 of identical construction . the width of the process chamber module 11 1 herein corresponds to the width of a radiating module 12 , the width of the process chamber module 11 2 corresponds to the width of two radiating modules 12 , and the width of the process chamber module 11 3 corresponds to the width of n ( n ≧ 3 ) radiating modules 12 . moreover , the modular system 20 also has at least two side plates 14 and at least one external display / operator panel 17 . depending on the desired size of the process chamber , the respective process chamber module 11 1 , 11 2 , 11 3 is selected , and the respective number of radiating modules 12 are lined up beside one another . in the lining up of the radiating modules 12 , the controller 16 of each further connected radiating module 12 follows the controller 16 of the first radiating module 12 , the latter thus defining the master module . as is shown in fig8 , the process chamber 4 of the process chamber modules 11 1 to 11 3 , with the exception of a gas inlet 31 and a gas outlet 32 , can be embodied so as to be gas - tight , so as to be able to evacuate the process chamber 4 or to purge the process chamber 4 with an inert gas . furthermore , a screen 33 is provided that is inclined at an angle in relation to the horizontal and a collection container 34 is provided that is disposed below the at least one screen 33 in such a manner that material powder 2 that is not capable of being screened moves in a manner aided by gravity along the one screen 33 and is collectable in the collection container 34 . the screen 33 is advantageously driven by a drive 35 so as to move in an oscillating manner . the material powder 2 in the process chamber module is conducted in a self - contained powder circuit which includes the at least one screen 33 and at least one conveying section ( not shown ) for infeeding the material powder 2 that has been screened by the at least one screen 33 into the powder reservoir 7 . the construction platform 5 is preferably embodied so as to be separable in a gas - tight manner from other elements of the powder circuit . the powder reservoir 7 furthermore includes detection means 36 , for example a balance , for detecting the quantity of powder , and a closable powder inlet 37 for infeeding powder in a metered manner into the powder reservoir 7 or into the powder circuit . for example , a cartridge with a material powder 2 can be connected to the powder inlet 37 . the detection means 36 weighs the material powder 2 remaining in the powder reservoir 7 or powder circuit , respectively , following the production of a component , and opens the powder inlet 37 on demand . moreover , supply stations ( not shown ) to which the process chamber module 11 1 to 11 3 can be connected and which , like the radiating module 12 , have a power , water , gas , and / or data connector , can be provided . powder preheating / component cooling can be carried out with power in a regulated manner by the process chamber 4 ; water can likewise be used for the cooling of components or for cooling other elements of the process chamber . this function can be performed either by a simple controller in the process chamber 4 or by controlling the supply station via a data connector . the gas connector can provide a protective gas atmosphere in the process chamber 4 , for example when the component is to be retrieved . whether controllers required for the process chamber modules are accommodated in this module or in the radiating modules and supply stations depends in particular on whether the radiating modules are rather used in a docked manner as a master and slave , or rather used individually . however , there will usually be more process chamber modules than radiating modules , since the process chamber modules are preferably always used for only one material , and only those process chamber modules are used with the materials required at any given time . there will furthermore be process chamber modules in which the component is being cooled or powder is being preheated . it can thus be more favorable for only the radiating stations to be equipped with a controller for the application of powder in the process chamber module than for all process chamber modules to be thus equipped . the same applies in an analogous manner to controllers for other functions of the powder circuit / heaters , etc . in the case of very wide process chamber modules , in which a plurality of radiating modules are always required , it would however be more favorable for only the process chamber modules to be equipped with controllers for the process chamber module rather than for each radiating module to be thus equipped . it can also be advantageous for the controller to be embodied so as to be modular , and for the radiating modules or the process chamber modules to be equipped with controllers , depending on production . a number of embodiments have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are within the scope of the following claims . | 8 |
preferred embodiments of the present invention will be described herein below with reference to the accompanying drawings . in the following description , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . descriptions provide a technique for selecting a relay mode depending on channel status of relay links in a multihop relay broadband wireless communication system . the relay mode includes amplify and forward ( af ), decode and forward ( df ), selection decode and forward ( sdf ), and incremental amplify and forward ( iaf ). the af scheme and the df scheme are for understanding . the relay links refer to a link between a bs and an rs ( bs - rs link ) and a link between the rs and an ms ( rs - ms link ). the following explanation relates to a multiple input multiple output ( mimo ) orthogonal frequency division multiple access ( ofdma ) wireless communication system . the present invention is applicable to other multiple access schemes . fig3 depicts signal link flows for selecting a relay mode at an rs according to the present invention . referring to fig3 , a bs 301 sends a downlink ( dl ) signal to an ms 303 and an rs 305 in steps 311 and 312 . the ms 303 sends an uplink ( ul ) signal to the bs 301 and the rs 305 in steps 313 and 316 . upon receiving the dl signal from the bs 301 , the rs 305 relays the dl signal to the ms 303 in step 314 . upon receiving the ul signal from the ms 303 , the rs 305 relays the ul signal to the bs 301 in step 315 . at this time , the rs 305 checks the channel status of the relay links ( bs - rs link and rs - ms link ) using the signals received from the bs 301 and the ms 303 , selects a relay mode ( af scheme or df scheme ) based on the channel status of each link , and then relays the signals . since the rs 305 has the multiple antennas , the channel status of each link is determined according to an eigenvalue between antennas , mutual information based on the eigenvalue , or probability error . fig4 shows an rs transceiver apparatus for selecting a relay mode of a relay link in a multihop relay mimo system according to the present invention . as shown in fig4 , the rs includes a transmitter and a receiver . the receiver includes a radio frequency ( rf ) processor 401 , an analog / digital converter ( adc ) 403 , a transmission mode processor 405 , a header extractor 407 , a symbol duplicator 409 , switches 411 , 413 , and 421 , a cyclic prefix ( cp ) eliminator 415 , a fast fourier transform ( ttf ) operator 417 , a decoder 419 , a channel information calculator 423 , and a relay mode selector 425 . the rf processor 401 down - converts an rf signal , which is received at the mimo antenna from the bs or the ms , to a baseband signal and then outputs the baseband signal . the adc 403 digitizes the baseband analog signal fed from the rf processor 401 . the transmission mode processor 405 reprocesses the digital signal fed from the adc 403 based on a transmission mode of the signal sent from the bs or the ms and outputs the reprocessed signal to the header extractor 407 and the symbol duplicator 409 . the transmission mode includes diversity , multiplexing , and beam forming . the header extractor 407 extracts a header from the signal provided from the transmission mode processor 405 . the receiver can reduce a channel prediction time by predicting a channel using a pilot signal contained in the header extracted by the head extractor 407 . the symbol duplicator 409 duplicates the entire symbol of the signal provided from the transmission mode processor 405 . the first switch 411 selectively forwards the signals of the header extractor 407 and the symbol duplicator 409 to the next stage under the control of the relay mode selector 425 . specifically , to select a relay mode of the received signal , the first switch 411 channels the output signal of the header extractor 407 to the cp eliminator 415 under the control of the relay mode selector 425 . next , when the relay mode of the received signal is determined , the first switch 411 forwards the entire receive symbol duplicated at the symbol duplicator 409 to the second switch 413 under the control of the relay mode selector 425 . the second switch 413 sends the signal from the symbol duplicator 409 to the cp eliminator 415 or a power amplifier 427 according to the relay mode determined at the relay mode selector 425 . specifically , when the determined relay mode is the af relay mode , the second switch 413 sends the signal from the symbol duplicator 409 to the power amplifier 427 . when the determined relay mode is the df relay mode , the second switch 413 sends the signal from the symbol duplicator 409 to the cp eliminator 415 . the cp eliminator 415 removes a cp from the output signal of the header extractor 407 , which is fed from the switch 411 , or from the output signal of the symbol duplicator 409 , which is fed from the second switch 413 . the fft operator 417 transforms the time domain signal fed from the cp eliminator 415 to a frequency domain signal through the fft . the decoder 419 demodulates and decodes the frequency domain signal fed from the fft operator 417 according to the corresponding modulation level ( modulation and coding scheme ( mcs ) level ). the third switch 421 sends the decoded signal from the decoder 419 to either the channel information calculator 423 or the transmitter under the control of the relay mode selector 425 . under the control of the relay mode selector 425 , the third switch 421 sends the header information decoded at the decoder 419 to the channel information calculator 423 to determine the relay mode . when the df relay mode is selected , the third switch 421 sends the signal decoded at the decoder 419 to the transmitter under the control of the relay mode selector 425 . the channel information calculator 423 estimates channel information using the decoded header information fed from the third switch 421 . next , the channel information calculator 423 calculates eigenvalues for the respective antennas of the relay links ( bs - rs link and rs - ms link ) using the estimated channel information . using the estimated channel information , the channel information calculator 423 issues control signals to control the transmission mode processor 405 and the power amplifier 427 of the transmitter . the relay mode selector 425 selects the relay mode of the received signal by comparing the link eigenvalues fed from the channel information calculator 423 with a predefined reference value . for instance , the relay mode selector 425 selects the relay mode using the link eigenvalues as shown in fig7 . fig7 depicts a standard for selecting the relay mode at the rs according to the present invention . as shown in fig7 , the relay mode selector 425 selects the af scheme 703 as the relay mode when the calculated link eigenvalues ( λ bs - rs and λ ms - rs ) are greater than or equal to the reference value . when at least one of the link eigenvalues is less than the reference value , the relay mode selector 425 selects the df scheme 701 as the relay mode . the relay mode selector 425 issues control information for controlling the switches 411 , 413 , 421 , 429 , and 431 of the transmitter and the receiver . specifically , the relay mode selector 425 issues control signals to control the first switch 411 and the third switch 421 to select the relay mode of the received signal . next , when the relay mode is determined , the relay mode selector 425 issues control signals to control the first switch 411 and the second switch 413 according to the determined relay mode . also , to map the signals to be relayed to the respective antennas depending on the af scheme or the df scheme at the transmitter , the relay mode selector 425 issues control signals to control the fourth switch 429 and the fifth switch 431 . now , the transmitter includes the power amplifier 427 , the switches 429 and 431 , a digital / analog converter ( dac ) 433 , an rf processor 435 , an encoder 437 , an inverse fast fourier transform ( ifft ) operator 439 , a cp inserter 441 , and a transmission mode processor 443 . when the relay mode is determined to the af scheme , the power amplifier 427 amplifies the received signals for the respective antennas , which are fed from the second switch 413 , under control of the channel information calculator 423 and then outputs the amplified signals . the fourth switch 429 maps the signals amplified at the power amplifier 427 to the respective antenna paths under control of the relay mode selector 425 . when the relay mode is determined to the df scheme , the encoder 437 encodes and modulates the encoded receive signals for the respective antennas , which are fed from the third switch 421 , according to the corresponding modulation level ( mcs level ), and then outputs the encoded and modulated signals . the ifft operator 439 transforms the frequency domain signal fed from the encoder 437 to a time domain signal through the ifft , and then outputs the time domain signal . the cp inserter 441 inserts a cp to the data fed from the ifft operator 439 to eliminate intersymbol interference which occurs due to the multipath fading of the radio channel , and outputs the cp - inserted data . the transmission mode processor 443 converts and outputs the signal fed from the cp inserter 441 according to the corresponding transmission mode . the transmission mode includes diversity , multiplexing , and beam forming . the fifth switch 431 maps the signal from the transmission mode processor 443 to the corresponding antenna path under control of the relay mode selector 425 . the dac 433 receives the digital signals for the respective antennas from the fourth switch 429 or the fifth switch 431 and converts the digital signals to analog signals . the rf processor 435 up - converts the baseband signals for the respective antennas , which are fed from the dac 433 , to rf signals and transmits the rf signals to the ms or the bs via the mimo antenna . according to the present invention , the rs selects the relay mode by calculating the eigenvalue . alternatively , the channel information calculator 423 can include modules which calculate mutual information and probability error as well as the eigenvalue , and the rs can select the relay mode using the mutual information or the probability error as shown in fig5 . referring to fig5 , the channel information calculator 423 includes an eigenvalue calculator 501 , a mutual information calculator 503 , and a probability error calculator 505 . the eigenvalue calculator 501 calculates the eigenvalue from the estimated channel information using the decoded header information . the mutual information calculator 503 calculates the mutual information using the acquired eigenvalue . the mutual information is expressed as equation ( 1 ). i m = log 2 det ( i m r + e / m t n 0 hh h ) bps / hz , m t , m r = 1 , 2 , 3 ( 1 ) in equation ( 1 ), i m denotes the mutual information , i m r denotes a unit matrix , e / m t n 0 denotes a signal to noise ratio ( snr ) of the received signal , and m t denotes the number of tx antennas . when the bs is aware of the channel status , hh h in equation ( 1 ) can be expressed as the eigenvalue in equation ( 2 ). in equation ( 2 ), i m denotes the mutual information , e / m t n 0 denotes the snr of the received signal , and m t denotes the number of tx antennas . | λ m | denotes an eigenvalue of the m - th largest hh h and n denotes a rank with respect to h . the mutual information can be acquired using the eigenvalue based on equation ( 2 ). the probability error calculator 505 calculates a probability error value from the decoded header which is fed from the third switch 421 . fig6 shows a relay mode selecting procedure at the rs according to the present invention . the following description explains that the relay mode is selected using the eigenvalue of the relay link by way of example . referring to fig6 , the rs checks whether signals are received from the bs and the ms in step 601 . upon receiving the signals from the bs and the ms , the rs extracts headers from the received signals in step 603 . in step 605 , the rs calculates eigenvalues of the relay links ( bs - rs link and rs - ms link ) using pilot signals contained in the extracted headers of the received signals . in step 607 , the rs compares the acquired relay link eigenvalues with a preset reference value . when each eigenvalue is greater than or equal to the reference value ( λ bs - rs , λ ms - rs ≧ reference value ), the rs selects the af mode as the relay mode in step 609 . for instance , when both eigenvalues of the bs - rs link and the ms - rs link are greater than or equal to the preset reference value , the rs selects the af mode 703 as the relay mode , as shown in fig7 . upon selecting the af mode as the relay mode , in step 611 , the rs amplifies the power of the signal received from the bs or the ms according to the channel status value of each link which is estimated in step 605 . next , in step 613 , the rs transmits the power - amplified signal to the bs or the ms . that is , the rs amplifies the power of the signal received from the bs and then sends the amplified signal to the ms . also , the rs amplifies the power of the signal received from the ms and sends the amplified signal to the bs . next , the rs terminates the process . by contrast , when each link eigenvalue is less than the reference value ( λ bs - rs , λ ms - rs & lt ; reference value ), the rs selects the df mode as the relay mode in step 615 . for instance , when one of the eigenvalues of the bs - rs link and the ms - rs link is less than the preset reference value , the rs selects the df mode 701 as the relay mode , as show in fig7 . after selecting the df mode as the relay mode , the rs demodulates and decodes the signals received in the respective links according to the corresponding modulation level ( mcs level ) in step 617 . after decoding the received signals , in step 619 , the rs encodes the signals according to the channel status of the link in which the decoded signal is to be relayed . that is , the signal received from the bs is encoded and modulated according to the modulation level which is determined based on the channel status of the rs - ms link . the signal received from the ms is encoded and modulated according to the modulation level which is determined based on the channel status of the bs - rs link . in step 613 , the rs forwards the signal from the bs to the ms . also , the rs forwards the signal from the ms to the bs . next , the rs terminates the process . it has been shown that the relay mode is selected by calculating the eigenvalue by way of example . additionally , the relay mode can be selected using the mutual information or the probability error , which is acquired from the eigenvalue . while the signals are relayed by selecting the relay mode for the respective antennas at the rs having the mimo antenna , the rs having the single antenna can relay the signal by selecting the relay mode based on the channel status in the similar manner . in a multihop relay broadband wireless communication system , an rs relays signals by selecting a relay mode based on channel status ( e . g ., eigenvalue , mutual information and probability error ) of a bs - rs link and an rs - ms link . thus , reliability of the relayed signal can be enhanced and capacity of the signal link can be increased . furthermore , since the channel is estimated using merely the header of the received signal , it is possible to reduce a time taken to process the channel estimation . while the invention has been shown and described with reference to certain preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
the compensating support arrangements shown in the drawings , in essence , have a bottom surface or base plate 2 and a top surface or bearing plate 1 , on which comes to rest the envelope stack and , as a function of the particular embodiment , one or more spring elements 3 and a further support element , namely a movable capstan or spider 8 , as well as a fixed linkage 9 with a movable supporting surface 10 . bearing plate 1 has a supporting surface which supports the envelope stack and which lies substantially in one plane . the embodiment diagrammatically shown in fig1 and 2 shows a bottom surface 2 means for holding and guiding bearing plate 1 in position relative to base plate 2 which is illustrated as , a leg or legs 11 , a bearing plate 1 , which is made movable by a joint 4 , as well as a spring element 3 , which is located in a spring retainer or holder 5 between the base plate 2 and the bearing plate 1 . in the case of din c 5 / 6 format envelopes , the envelope flap located either on the long or on the wide side causes a greater pressure in this area . this fact is now utilized in that on the side where the flap is located and the pressure is higher , on the movable bearing plate 1 , the spring element 3 brings about an inclining of the envelope , which is compensated up to the top envelope in the stack , so that the then top envelope , which is received from the suction device 7 , is positioned horizontally . in the case of the second envelope adjusting mechanism embodiment shown in fig3 on the base plate 2 there are two spring elements 3 in spring retainers or holders 5 , as well as means for holding and guiding bearing plate 1 in position relative to base plate 2 , namely a movable capstan 8 , which produces the connection with the bearing plate 1 . the envelope stack , not shown in fig3 again rests on the bearing plate 1 . this embodiment serves to bring about the horizontal positioning of the top din c 5 format envelope on the envelope stack . these envelopes are folded on a long side and a narrow side , folded on the other long side and glued in three - layer form , while on the second narrow side on which the flap is located , the fold is added to the three - layer structure . this means that the level differences , in contrast to the first - described embodiment , not only occurs on one long side and one narrow side , but instead the level difference when stacking the envelopes occurs in different form on all four sides . thus , the compensation must cover all sides of the envelope . thus , between the bearing plate 1 and the base plate 2 are provided at least two spring elements 3 , which fundamentally fulfil the same function as in the first embodiment , but additionally a movable support element , namely a movable capstan 8 is installed , which ensures that the bearing plate 1 can move upwards or downwards in each direction of any side , as a function of the pressure increase caused by the number of layers and folds . capstan 8 is a means for holding and guiding bearing plate 1 in position relative to base plate 2 . thus , as in the first embodiment , the top envelope in the stack is received in the horizontal position from the suction device . in the case of the third embodiment shown in fig4 between the bearing plate 1 and the base plate 2 , there are once again spring elements 3 in spring retainers 5 , as well as a movable capstan 8 . in addition , between the spring elements 3 and the capstan 8 in the center of the bottom surface 2 is fitted a fixed linkage 9 guided by the bearing plate 1 and to which is applied a movable supporting surface 10 . this embodiment solves the following problem . in the case of din c 4 envelopes and larger , the problem arises that as from a certain number of stacked envelopes , due to the limited physical nature of the envelopes , they sag and consequently it is not possible to ensure the horizontal position of the top envelope in the stack . thus , in contrast to the last - described embodiment , it is not sufficient to bring about level compensation by means of spring elements 3 and the movable capstan 8 . in addition there is the effect of the movable supporting surface 10 on the fixed linkage 9 . as can be gathered from fig4 the envelope stack mainly rests on the supporting surface 10 of the fixed linkage 9 . an opening is provided in the bearing plate 1 through which the fixed linkage 9 projects , and , as a result of the function of the spring elements 3 and the movable capstan 8 , the bearing plate 1 is movable , so that the level compensation is , on the one hand ; and , ensured by the spring elements 3 and , the movable capstan 8 and , on the other , by the fixed linkage 9 with the movable supporting surface 10 . thus , as described for the different embodiments of the compensating support arrangement , the top envelope of the stack in each case is received in the horizontal position from the suction device . while the foregoing description and drawings represent the preferred embodiments of the present invention , it will be obvious to those skilled in the art that various changes and modifications may be made therein without departing from the true spirit and scope of the present invention . | 1 |
an embodiment of a universal fit burner is depicted in the perspective view of fig1 . as shown in fig1 , burner assembly 100 includes a generally hollow main burner body 102 and a movable venturi assembly 104 . specifically , venturi assembly 104 , which includes a venturi tube 106 and an aspirator 108 , is slidably received in the main burner body and can be moved from the extended position shown in fig1 , to a retracted position for lengthening or shortening the tube relative to the burner body . in the retracted position , at least a substantial portion of the venturi tube is received within a cavity 110 of the main burner body so that the aspirator generally abuts an end of the main burner body . fig2 is an exploded , schematic diagram depicting the embodiment of the burner assembly of fig1 in greater detail . in particular , fig2 depicts the main burner body 102 , the venturi assembly 104 that includes venturi tube 106 , aspirator 108 , gas inlet 109 , air inlet 111 , and cavity 110 , which is formed in the main body housing . additionally , a burner extension 112 , a gas inlet valve 113 , a block - off plate 114 and associated screw 116 , a set screw 118 for securing a position of the venturi tube within the cavity , a mounting bracket 120 and associated mounting screws 122 and 124 , and a clip pin 126 for mounting the burner assembly 100 to a barbecue grill also are depicted . the gas valve 113 is affixed to a control panel or the like ( not shown ) on a barbecue grill ( not shown ). as noted , the adjustability feature of the burner allows the burner to fit many different sized grills between two fixed points , the gas valve and the inner wall of the firebox of the grill ( not shown ). the aforementioned components also are depicted , with the exception of the set screw 118 and clip pin 126 , in the exploded , perspective views of fig3 and 4 . notably , however , the front 130 of burner extension 112 is depicted in fig3 , whereas the back 132 of the burner extension is depicted in fig4 . as shown in greater detail in fig5 , the venturi tube 106 of venturi assembly 104 can be received within cavity 110 of the main body 102 so that the aspirator 108 is positioned close to an end face 136 of the main burner body . this is the retracted position of the venturi assembly . in the retracted position , the overall length of the burner assembly 100 is reduced so that the burner assembly can be mounted within correspondingly sized grills . note also that , in fig5 , the block - off plate 114 is mounted against end 136 of the main burner body to substantially prevent a flow of gas from the main burner body in a direction of the aspirator . in fig6 , the venturi assembly 104 has been moved to its extended position , in which the aspirator is moved farther from the end 136 of the main burner body . in this configuration , the burner assembly 100 can be mounted within a larger grill that requires a longer length of venturi tube . fig7 depicts a burner assembly 100 with a burner extension 112 being installed . as shown in fig7 , burner extension 112 includes a cavity 140 through which the venturi tube 106 is inserted . typically , the burner extension is used when a grill in which the burner assembly is being mounted has room to accommodate a burner of greater length than that provided by the main burner body 102 alone . thus , as depicted fully assembled in fig8 , the burner extension increases the length of the burner . notably , however , the configuration depicted in fig7 and 8 includes the block - off plate 114 installed . block - off plate 114 obstructs the gas ports 142 ( fig7 ) that could otherwise be used to provide gas to an end of the burner . the configuration that includes the burner extension 112 but which excludes the block - off plate 114 is depicted in fig9 . in such a configuration , gas is permitted to exit the ports 142 for providing increased gas and heat output at an end of the main burner body . thus , by using the burner extension 112 , extending the venturi assembly 104 to the extended position , and not using the block - off plate 114 , the burner assembly can be configured with its longest available length and largest flame area . details of several embodiments of constituent components of burner assembly 100 will now be described with respect to fig1 a - 16 . specifically , an embodiment of a burner extension 112 will now be described with respect to the schematic diagrams of fig1 a - 10d . as shown in fig1 a , burner extension 112 includes a front surface 150 through which gas ports 142 are formed . burner extension 112 also includes cavity 140 for receiving a venturi tube , and an orifice 152 for receiving a fastener , such as a screw , for mounting a block - off plate . as shown in greater detail in fig1 b , burner extension 112 includes a burner ledge 154 that extends outwardly from surface 150 . ledge 154 shields the gas ports 142 located at the surface 150 from grease or other drippings or materials that can tend to fall into and otherwise obstruct the gas ports . note also , the gas ports 142 are located along a side surface 156 of the body extension . as shown in fig1 c and 10d , body extension 112 includes a recessed portion 158 that functions as a manifold for providing a flow of gas from the venturi tube to the gas ports 142 . as shown in fig1 a and 11b , the block - off plate 114 ( in this embodiment ) is a substantially flat component . a periphery of the block - off plate 114 is generally configured to match the exterior of a corresponding burner extension 112 with the exception of the upper edge 160 . in particular , upper edge 160 is shaped to enable the block - off plate to seat beneath the ledge 154 of the burner extension . an embodiment of a main burner body 102 is shown in greater detail in the schematic diagram of fig1 a through 12e . as shown in these figures , main burner body 102 incorporates an integrated ledge 162 that runs lengthwise along each side . the ledges 162 shield the gas ports 142 from drippings as described with respect to the burner extension 112 . as shown most clearly in fig1 b , body 102 includes an orifice 166 that is adapted to receive a set screw , which is used for securing the venturi assembly in its various positions . body 102 also includes orifices 168 and 170 that are used to receive mounting screws , such as mounting screws 122 and 124 of fig2 , for mounting a mounting bracket ( bracket 120 of fig2 ) to the underside of the body 102 . as best shown in fig1 c , cavity 140 , which is used for receiving a venturi tube , communicates with a gas distribution manifold 174 via an internal orifice 176 . manifold 174 is oriented generally along a length of the body 102 and extends through an end 178 of the body as depicted in fig1 e . when assembled with a corresponding burner extension , such as burner extension 112 , manifold 178 of the main burner body 102 communicates with the manifold 158 of the burner extension to provide gas through gas ports 142 located at an end 150 of the burner extension . an embodiment of a venturi assembly 104 is shown in greater detail in the schematic diagrams of fig1 a through 13d . as shown therein , venturi assembly 104 includes a venturi tube 106 and an aspirator 108 . in this embodiment , the aspirator includes air inlet vents 180 and 182 , as well as a gas receiving orifice 184 . detail of an embodiment of a mounting bracket 120 is shown in fig1 a through 16 . as shown in fig1 a through 14c , mounting bracket 120 is a substantially symmetrical component that includes a mounting tab 190 that extends outwardly from base 192 . as shown in fig1 a , base 192 includes opposing wing portions 194 and 196 , each of which includes an orifice that is adapted to receive a fastener . in this embodiment , the orifices are configured as slots 198 and 200 that can receive mounting screws 122 and 124 of fig2 . notably , this embodiment is formed of a single piece of material that is bent to form the tab 190 . also , tab 190 includes an orifice 202 that can receive a fastener , such as clip pin 126 of fig2 , for securing the mounting bracket within a grill . another embodiment of a mounting bracket is shown installed to the underside of a main burner body in fig1 and 16 . as shown in fig1 , the mounting bracket 120 is installed in a first position wherein mechanical fasteners are located toward the end of the bracket that includes the tab 190 . in contrast , fig1 depicts the mounting bracket moved in relation to the main burner body , with the screws 122 and 124 located at the opposite end of the mounting bracket . clearly , the ability to reposition the mounting bracket with respect to the burner body enables adaptation to various configurations of grills . also note that in the embodiment of fig1 and 16 , the slots include preformed recesses 210 for receiving the mounting screws in various locations . while an embodiment and modifications thereof have been shown and discribed in detail herein , various additional changes and modifications may be made without departing from the scope of the appended claims . | 5 |
before any embodiments of the invention are explained in detail , it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the following drawings . the invention is capable of other embodiments and of being practiced or of being carried out in various ways . also , it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . unless specified or limited otherwise , the terms “ mounted ,” “ connected ,” “ supported ,” and “ coupled ” and variations thereof are used broadly and encompass both direct and indirect mountings , connections , supports , and couplings . further , “ connected ” and “ coupled ” are not restricted to physical or mechanical connections or couplings . the following discussion is presented to enable a person skilled in the art to make and use embodiments of the invention . various modifications to the illustrated embodiments will be readily apparent to those skilled in the art , and the generic principles herein can be applied to other embodiments and applications without departing from embodiments of the invention . thus , embodiments of the invention are not intended to be limited to embodiments shown , but are to be accorded the widest scope consistent with the principles and features disclosed herein . the following detailed description is to be read with reference to the figures , in which like elements in different figures have like reference numerals . the figures , which are not necessarily to scale , depict selected embodiments and are not intended to limit the scope of embodiments of the invention . skilled artisans will recognize the examples provided herein have many useful alternatives and fall within the scope of embodiments of the invention . fig1 a illustrates a perspective view of a servo motor 10 according to one embodiment of the invention . the servo motor 10 can include a housing 12 , a heat sink 14 , a stand 16 , and connectors 18 . the heat sink 14 can include ribs 20 , which can be positioned around a perimeter of the housing 12 . the stand 16 can be used to securely mount the servo motor 10 in a suitable location . the connectors 18 can be used to supply power to the servo motor 10 . in some embodiments , a controller 22 can be housed within the servo motor 10 . in other embodiments , the controller 22 can be coupled to the housing 12 of the servo motor 10 . the controller 22 can include a connector 24 , which can enable the controller 22 to connect to additional electronic equipment . in some embodiments , the connector 24 can be used to supply power to the controller 22 . fig1 b illustrates a cross - sectional view of the servo motor 10 according to one embodiment of the invention . the servo motor 10 can include a rotor shaft 26 , one or more rotors 28 , and a stator 30 . the rotor shaft 26 can be coupled to the housing 12 with one or more bearings 32 enabling the rotor shaft 26 to rotate with respect to the housing 12 . the rotor shaft 26 can include a first end 34 and a second end 36 . the first end 34 can include a coupling 38 , which can enable the servo motor 10 to connect to peripherals , such as , for example , pumps . the second end 36 can extend beyond the housing 12 . in some embodiments , the second end 36 can extend into the controller 22 . the second end 36 can include projections 40 . a sensor 42 can be positioned adjacent to the second end 36 . the sensor 42 can include an encoder and / or a resolver . the sensor 42 can measure a rotor shaft speed and / or a rotor shaft angle , such as disclosed in u . s . pat . nos . 6 , 084 , 376 and 6 , 525 , 502 issued to piedl et al ., the entire contents of which are herein incorporated by reference . in some embodiments , the rotor 28 can be a permanent - magnet rotor . the rotor 28 can be positioned inside the stator 30 . the stator 30 can include a stator core 44 and stator windings 46 . in some embodiments , the rotor 28 can rotate to drive the rotor shaft 26 , while the stator core 44 and the stator windings 46 can remain stationary . the connectors 18 can extend into the housing 12 toward the rotor shaft 26 . the connectors 18 can be coupled to the stator 30 . in some embodiments , the sensor 42 can be built into the motor housing 12 to accurately indicate the position and / or speed of the rotor shaft 26 . in other embodiments , the sensor 42 can be included in the controller 22 .. in some embodiments , the speed of the rotor shaft 26 of the servo motor 10 can be substantially continually monitored via a feedback device , such as an encoder , resolver , hall effect sensors , etc . in other embodiments , the speed of the rotor shaft 26 of the servo motor 10 can be measured without a physical sensor ( e . g ., by extracting information from a position of the rotor shaft 26 ). the term “ servo motor ” generally refers to a motor having one or more of the following characteristics : a motor capable of operating at a large range of speeds without over - heating , a motor capable of operating at substantially zero speed and retaining enough torque to hold a load in position , and / or a motor capable of operating at very low speeds for long periods of time without over - heating . the term “ torque ” can be darned as the measured ability of the rotor shaft to overcome turning resistance . servo motors can also be referred to as permanent - magnet synchronous motors , permanent - field synchronous motors , or brushless electronic commutated motors . the servo motor 10 can be capable of precise torque control . the output torque of the servo motor 10 can be highly responsive and substantially independent of a position of the rotor 28 and a speed of the rotor shaft 26 across substantially the entire operating speed range . in some embodiments , a current draw of the servo motor 10 can be sent to the controller 22 and can be used to compute the torque necessary to drive the servo motor 10 . a conventional dc electric motor can rely on pulse width modulation ( pwm ) control for operating a peripheral at low rotations per minute ( rpm ). especially when the peripheral includes moving a high load , pwm control of a conventional dc electric motor can compromise accurate speed control in order to prevent a stall condition . the use of the servo motor 10 can simplify the actuation and operation of the peripheral . as a result , the servo motor 10 can enable a smooth operation of the peripheral . in some embodiments , the use of the servo motor 10 can allow a smooth operation of the peripheral even at low rpm , which can result in an optimized speed control . in some embodiments , the servo motor 10 can help decrease mechanical wear of the peripheral . the controller 22 can be external to the servo motor 10 or housed inside the servo motor 10 . as shown in fig2 , the controller 22 can include a digital signal processor ( dsp ) 48 , and memory 50 . the memory 50 can include random access memory ( ram ), read only memory ( rom ), and / or electrically erasable programmable read only memory ( eeprom ). in some embodiments , the controller 22 can include an analog / digital ( a / d ) converter and / or a digital / analog ( d / a ) converter in order to process different input signals and / or to interface with other devices and / or peripherals . in some embodiments , the dsp 48 and / or the memory 50 can be positioned inside or near the servo motor 10 while in other embodiments , the dsp 48 and / or the memory 50 can be housed separately and positioned some distance away from the servo motor 10 . in some embodiments , space restrictions and / or thermal loads generated by the servo motor 10 can dictate a position of the controller 22 . fig3 is a schematic block diagram illustrating connections between the servo motor 10 , electrical components , and / or electronic equipment according to one embodiment of the invention . on a line 52 , the controller 22 can receive an external command to operate the servo motor 10 . in some embodiments , the external command can be indicative of a base speed at which the servo motor 10 should be operated . if the servo motor 10 is not running , the external command can be transmitted directly to the servo motor 10 over a line 54 . once the servo motor 10 is running , the dsp 48 can process one or more of the following signals from the servo motor 10 : the speed of the rotor shaft 26 ( line 56 ), the angle of the rotor shaft 26 ( line 58 ), the current draw of the servo motor 10 ( line 60 ), and a temperature of the servo motor 10 ( line 62 ). any suitable combination of these signals or additional signals can be used by the dsp 48 to modify and / or override the external command to provide closed - loop control . in some embodiments , the actual speed of the rotor shaft 26 of the servo motor 10 can be transmitted back to the dsp 48 via the line 54 . in some embodiments , the dsp 48 can use a difference between the base speed and the actual speed of the rotor shaft 26 to modify the operation of the servo motor 10 . in some embodiments , the controller 22 can use one or more of the speed of the rotor shaft 26 , the torque of the rotor shaft 26 , and the position of the rotor shaft 26 to operate the servo motor 10 . in some embodiments , the controller 22 can provide drive diagnostics for the servo motor 10 , which can be downloaded for further processing . a technician can use the drive diagnostics to analyze any errors of the servo motor 10 and / or the controller 22 . the drive diagnostics can include error messages specifically for the servo motor 10 . in some embodiments , the servo motor 10 can communicate the following types of errors to the controller 22 : one or more components of the servo motor 10 exceed threshold temperatures , the servo motor 10 requires a higher current for the operation than a threshold current ( which can be referred to as “ current fold back ”), and the servo motor 10 is experiencing a stall condition . if an error is communicated from the servo motor 10 to the dsp 48 via a line 64 , the controller 22 can stop the servo motor 10 . in some embodiments , the controller 22 can be capable of detecting an interrupted connection between electrical components and / or electronic equipment and can generate an error . in some embodiments , the rapid compute time of the controller 22 can allow for several evaluations and / or modifications of the external command per rotation of the rotor shaft 26 . this can result in rapid adjustments to varying parameters and / or conditions of the servo motor 10 and / or the peripheral , while helping to provide a substantially uninterrupted and smooth operation of the servo motor 10 . as shown in fig3 , the servo motor 10 can be powered by an external power source 66 . the external command can be sent from the dsp 48 via the line 54 to a power device 68 , which can be connected to the external power source 66 . depending on the external command received from the dsp 48 , the power device 68 can provide the appropriate power ( e . g ., the appropriate current draw ) to the servo motor 10 . in some embodiments , the power device 68 can supply the servo motor 10 , the controller 22 , and additional electrical components and / or electronic equipment with power . in some embodiments , the power device 68 can be integrated with the controller 22 . in some embodiments , a load dump protection circuit 70 can be used to operate the servo motor 10 . in some embodiments , the load dump protection circuit 70 can be part of the power device 68 . the load dump protection circuit 70 can prevent an over - voltage peak from causing damage to the servo motor 10 , the controller 22 , and other electrical components and / or electronic equipment . in some embodiments , the load dump protection circuit 70 can protect at least part of the electrical components and / or electronic equipment from an under - voltage condition and / or a wrong polarity of the external power source 66 . in some embodiments , the load dump protection circuit 70 can disconnect the electrical components and / or electronic equipment , if the voltage of the external power source 66 is negative , below a minimum , or above a specified level . fig4 illustrates the load dump protection circuit 70 according to one embodiment of the invention . the load dump protection 70 can include a sensing circuit 72 , a relay contact 74 , a relay coil 76 , a capacitor 78 , a first diode 80 , a second diode 82 , and a current source 84 . the relay coil 76 can be connected to the sensing circuit 72 . the relay coil 76 can energize and de - energize the relay contact 74 . before the relay contact 74 closes , the current source 84 can charge the capacitor 78 with a limited current to enable a “ soft start .” once the capacitor 78 is charged to the correct level , the current source 84 and the second diode 82 can be bypassed by the relay contact 74 enabling the high currents of normal operation to flow . the first diode 80 and the second diode 82 can prevent damage to the sensing circuit 72 and / or other electronic equipment , if the voltage supplied from the external power supply 66 has the wrong polarity . for example , if the external power supply 66 is a battery , which is being disconnected for maintenance and / or repair procedures , the first diode 80 and the second diode 82 can prevent damage to the electronic equipment , if the battery is re - connected incorrectly . in some embodiments , the sensing circuit 72 can withstand an over - voltage peak . the sensing circuit 72 can also rapidly detect the over - voltage peak or an under - voltage condition . the sensing circuit 72 can detect the over - voltage peak or the under - voltage condition substantially independent of a power status of the servo motor 10 and / or the controller 22 . in some embodiments , the sensing circuit 72 can detect the over - voltage peak or the under - voltage condition even if the servo motor 10 and / or the controller 22 are not running . the sensing circuit 72 can de - energize the relay contact 74 through the relay coil 76 . as a result , all of the internal power supplies can be switched off almost immediately . in some embodiments , the current source 84 can charge the capacitor 78 with the limited current before the relay contact 74 is re - energized again . the sensing circuit 72 can re - energize the relay contact 74 and can re - connect all internal power supplies once no over - voltage conditions , such as over - voltage peaks , or under - voltage conditions are being detected . in some embodiments , the relay contact 74 can be re - energized once no over - voltage conditions or under - voltage conditions are being detected and the capacitor 78 is charged to the correct level . once the relay contact 74 is re - energized , the second diode 82 and the current source 84 can be bypassed by the relay contact 74 to enable the supply of normal operating currents . for example , if welding is being performed in the vicinity of the servo motor 10 for repairs , maintenance , or equipment installation , over - voltage peaks can travel toward the servo motor 10 . the load dump protection circuit 70 can help prevent possible damage to the servo motor 10 and the electronic equipment caused by the over - voltage peaks . fig5 is a flow chart describing a load dump protection method 200 according to one embodiment of the invention . in some embodiments , the sensing circuit 72 can sense ( at step 202 ) a voltage u supply . if the voltage u supply is less than a maximum threshold u max but higher than a minimum threshold u min ( at step 204 ), the sensing circuit 72 can sense ( at step 202 ) the voltage u supply again . if the voltage u supply is higher than the maximum threshold u max or below the minimum threshold u min ( at step 204 ), the sensing circuit 72 can disconnect ( at step 206 ) the electronic equipment including the servo motor 10 , the controller 22 , and / or other electronics substantially before the over - voltage condition or the under - voltage condition can cause damage to the electronic equipment . in some embodiments , the sensing circuit 72 can disengage the relay 74 to disconnect the electronic equipment . once disconnected , the sensing circuit 72 can continue to sense ( at step 208 ) the voltage u supply substantially until the voltage u supply has dropped below the maximum threshold u max or has risen above the minimum threshold u min ( at step 210 ). the sensing circuit 72 can re - connect ( at step 212 ) the electronic equipment , before the load dump protection method 200 is restarted ( at step 202 ). in some embodiments , the relay 74 can be re - energized in order to re - connect the electronic equipment . the servo motor 10 can generates heat , especially at high rpm . the servo motor 10 can include passive heat controls , such as heat sinks , vent holes , etc . in some embodiments , as shown in fig6 , the servo motor 10 can use a power management control method 300 to actively prevent over - heating . in some embodiments , the duty cycle of the current supplied to the servo motor 10 can be altered to prevent over - heating . fig6 illustrates the power management control method 300 according to one embodiment of the invention . in some embodiments , the dsp 48 can measure ( at step 302 ) a temperature ( t motor ) of the servo motor 10 . the dsp 48 can measure the temperature of any suitable component of the servo motor 10 . in some embodiments , the dsp 48 can measure the temperature of multiple components . the dsp 48 can determine ( at step 304 ), if the temperature t motor is approaching a maximum temperature t max ( i . e ., if the temperature t motor is within a range ε ). the maximum temperature t max can be stored in the memory 50 , and , if multiple components of the servo motor 10 are monitored by the dsp 48 , the maximum temperature t max can be component specific . if the maximum temperature t max does not approach the temperature t motor , the controller 22 can operate ( at step 306 ) the servo motor 10 with the external command . the dsp 48 can restart ( at step 302 ) the power management control method 300 by measuring the temperature t motor . if the temperature t motor approaches the maximum temperature t max , the dsp 48 can determine ( step 308 ) whether the maximum temperature t max has been exceeded . if the maximum temperature t max has been exceeded at step 308 , the servo motor 10 can be shut down ( at step 310 ) and the dsp 48 can start a timer ( at step 312 ). the timer can be set for a time period long enough to allow the servo motor 10 to cool . in some embodiments , the timer can be set for a time period of about one minute . after the timer has been started ( at step 312 ), the dsp 48 can continue to monitor ( at step 314 ) the temperature t motor of the servo motor 10 . if the temperature t motor has dropped below the maximum temperature t max , the dsp 48 can determine whether the timer has expired ( at step 316 ). once the timer has expired ( at step 314 ), the dsp 48 can restart ( at step 318 ) the servo motor 10 and can measure ( at step 302 ) the temperature t motor again . if the temperature t motor is below the maximum temperature t max but within the range ε , can the dsp 48 can shut down ( at step 320 ) the motor 10 for a first time interval ti 1 . the dsp 48 can turn on ( at step 322 ) the servo motor 10 for a second time interval ti 2 . in some embodiments , the first time interval ti 1 and / or the second time interval ti 2 can be a default value and / or a previously stored value in the controller 22 . in some embodiments , the servo motor 10 can run continuously during the second time interval ti 2 , while in other embodiments , the servo motor 10 can be pulsed with a certain frequency f pulse . the temperature t motor can be compared ( at step 324 ) to a previously stored temperature t prev . in some embodiments , the temperature t prev can be a default value during initialization , ( i . e ., if no temperature has been previously stored in the memory 50 since the last power - up of the servo motor 10 ). if the temperature t prev is lower than the temperature t motor , the dsp 48 can increase ( at step 326 ) the first time interval ti 1 , decrease ( at step 328 ) the second time interval ti 2 , and / or decrease ( at step 330 ) the frequency f pulse . the dsp 48 can store ( at step 332 ) the temperature t motor as the temperature t prev in the memory 50 . the dsp 48 can operate ( at step 334 ) the servo motor 10 with the first time interval ti 1 and the second time interval ti 2 resulting in a pulsing of the servo motor 10 . in some embodiments , the pulse frequency resulting from the first time interval ti 1 and the second time interval ti 2 can be substantially lower than the frequency f pulse , at which the servo motor 10 can be operated during the second time interval ti 2 . in some embodiments , the frequency f pulse can be less than about 20 kilohertz . if the temperature t motor is not higher than the temperature t prev ( at step 324 ), the dsp 48 can determine ( at step 336 ) whether the temperature t prev is higher than the temperature t motor . if the temperature t prev is higher than the temperature t motor , the dsp 48 can decrease ( at step 338 ) the first time interval ti 1 , increase ( at step 340 ) the second time interval ti 2 , and / or increase ( at step 342 ) the frequency f pulse . the dsp 48 can store ( at step 332 ) the temperature t motor as the temperature t prev in the memory 50 . the dsp 48 can pulse ( at step 334 ) the servo motor 10 with the first time interval ti 1 and the second time interval ti 2 . if the temperature t prev is substantially equal to the temperature t motor , the servo motor 10 can be pulsed ( at step 334 ) with the first time interval ti 1 and the second time interval ti 2 . after step 334 , the dsp 48 can restart ( at step 302 ) the power management control method 300 . in some embodiments , the power management control method 300 can be self - adapting and can learn the optimal values for at least one of the first time interval ti 1 , the second time interval ti 2 , and the frequency f pulse . as a result , the servo motor 10 can operate at high rpm over prolonged periods of time before having to shut down due to an over - temperature condition . in some embodiments , the power management control method 300 can adjust at least one of the first time interval ti 1 , the second time interval ti 2 , and the frequency f pulse over a short period of time , while maximizing a work output of the servo motor 10 under the given circumstances without exceeding the maximum temperature t max and / or shutting down . in some embodiments , the period of time in which the power management control method 300 can learn the optimal values for pulsing the servo motor 10 can be within about 10 rotations of the rotor shaft 26 . in some embodiments , the operation of the servo motor 10 with the frequency f pulse can result in power losses in the servo motor 10 itself , the controller 22 , and / or the power device 68 . the power losses can increase the temperature of the respective component and / or equipment . in some embodiments , the frequency f pulse can be used to determine a physical location of the power losses . in some embodiments , the frequency f pulse can be increased to reduce the power losses in the servo motor 10 in order to assist the power management control method 300 in preventing the servo motor 10 from overheating . as a result , the increase frequency f pulse can increase the power losses in the controller 22 and / or the power device 68 . to prevent overheating of the controller 22 and / or the power device 68 , the frequency f pulse can be decreased in order to limit the power losses . as a result , the decreased frequency f pulse can be used to increase the power losses in the servo motor 10 . in some embodiments , the power management control method 300 can be used to adjust the frequency f pulse to balance the power losses . in some embodiments , the power management control method 300 can vary the frequency f pulse in order to prevent overheating of the servo motor 10 and / or any other electronic equipment . in some embodiments , the power management control method 300 can determine a certain frequency f pulse depending on an operation point and / or condition of the servo motor 10 . in some embodiments , varying the frequency f pulse can maximize the overall system efficiency for the operation of the servo motor 10 . fig7 a through 7d illustrate various tailored pulse shapes 400 according to some embodiments of the invention . the tailored pulse shapes 400 can include a step pulse shape 402 ( fig7 a ), a linear ramp pulse shape 404 ( fig7 b ), a polynomial pulse shape 406 ( fig7 c ), and a trigonometric pulse shape 408 ( fig7 d ). in some embodiments , a beginning and / or an end of a pulse can be tailored in order to derive the tailored pulse shapes 400 . the polynomial pulse shape 406 can be approximated by any suitable higher polynomial and / or rational function . the trigonometric pulse shape 408 can be approximated by any trigonometric function including sine , cosine , tangent , hyperbolic , arc , and other exponential functions including real and / or imaginary arguments . in some embodiments , the power management control method 300 can use the tailored pulse shapes 400 . the tailored pulse shapes 400 can be adjusted to minimize the mechanical wear of the servo motor 10 . in some embodiments , the tailored pulse shapes 400 can minimize mechanical stresses being transferred from the servo motor 10 onto the peripheral . the tailored pulse shapes 400 can be adjusted to optimize the amount of work output for the amount of power supplied to the servo motor 10 . in some embodiments , the tailored pulse shapes 400 can be modified to lower a thermal shock of the servo motor 10 . heat generated by the servo motor 10 at a high rpm can be reduced so that the servo motor 10 can continue to operate at the high rpm over prolonged periods of time without shutting down due to an over - temperature condition and / or changing the first time interval ti 1 , the second time interval ti 2 , and / or the frequency f pulse . fig8 is a flow chart describing a current fold back protection method 500 according to some embodiments . the current fold back protection method 500 can prevent damage to the servo motor 10 from drawing a high current that would damage the servo motor 10 . the current fold back protection method 500 can optimize the operation of the servo motor 10 . in some embodiments , the current fold back protection method 500 can maximize the work output of the servo motor 10 . the current fold back protection method 500 can be performed by the controller 22 . in some embodiments , the dsp 48 can perform the current fold back protection method 500 . the controller 22 can sense ( at step 502 ) the speed of the rotor shaft 26 . the controller 22 can sense ( at step 504 ) the rotor shaft torque and / or an actual phase current i phase supplied to the servo motor 10 . in some embodiments , the controller 22 can compute the torque of the rotor shaft 26 with the phase current i phase . the controller 22 can compute ( at step 506 ) a maximum motor phase current i motor , max , which can be the highest allowable current being supplied without damaging the servo motor 10 and / or the controller 22 . in some embodiments , the maximum motor phase current i motor , max can vary with the speed of the rotor shaft 26 . in some embodiments , the controller 22 can multiply the speed of the rotor shaft 26 , the torque of rotor shaft 26 , and an efficiency parameter of the servo motor 10 in order to compute the maximum motor phase current i motor , max . if the phase current i phase is less than the maximum motor phase current i motor , max ( at step 508 ), the controller 22 can compute ( at step 510 ) a difference δ between a continuous current limit i cont and the phase current i phase . the continuous current limit i cont can be the maximum current at which the servo motor 10 can substantially continuously run without resulting in an over - temperature of the servo motor 10 and / or the controller 22 . in some embodiments , the continuous current limit i cont can be based on an overall thermal capacity of the servo motor 10 . the continuous current limit i cont can be stored in the memory 50 . if the continuous current limit i cont is larger than the phase current i phase , the difference δ is positive and can be used , to optimize ( at step 512 ) the operation of the servo motor 10 , for example to increase the efficiency of the peripheral . if the difference δ is negative , the controller 22 can determine ( at step 514 ) whether the continuous current limit i cont can be exceeded . to determine whether the continuous current limit i cont can be exceeded , the controller 22 can evaluate a history of supplied currents to operate the servo motor 10 and / or the difference δ . in some embodiments , the history of supplied currents to operate the servo motor 10 can include computing a root mean square ( rms ) value of the supplied current and / or squaring the supplied current and multiplying the time . if the continuous current limit i cont can be exceeded , the controller 22 can operate ( at step 516 ) the servo motor 10 with the phase current i phase . if the continuous current limit i cont may not be exceeded , the controller 22 can operate ( at step 518 ) the servo motor 10 with the continuous current limit i cont . if the phase current i phase is larger than the maximum motor phase current i motor , max ( at step 508 ), the servo motor 10 can be operated with the maximum motor phase current i motor , max ( at step 520 ). at step 522 , the controller 22 can store either one of the phase current i phase , the continuous current limit i cont , and the maximum motor phase current i motor , max , which has been supplied to the servo motor 10 , in the memory 50 . the controller 22 can then restart the current fold back protection method 500 by sensing ( at step 502 ) the speed of the rotor shaft 26 . if the phase current i phase is limited to the maximum motor phase current i motor , max or the continuous current limit i cont , the servo motor 10 can be operated with the maximum motor phase current i motor , max ( at step 520 ) or the continuous current limit i cont ( at step 518 ). operating the servo motor 10 at the maximum motor phase current i motor , max or the continuous current limit i cont can prevent damage to the servo motor 10 . due to the maximum motor phase current i motor , max and / or the continuous current limit i cont being lower than the current draw necessary to operate the servo motor 10 , operating the servo motor 10 at the maximum motor phase current i motor , max or the continuous current limit i cont can result in a stall of the servo motor 10 . the controller 22 can detect the stall of the servo motor 10 . in one embodiment , the angle of the rotor shaft 26 of the servo motor 10 can be used to identify a stall condition of the servo motor 10 . other embodiments of the invention can use the speed of the rotor shaft 26 of the servo motor 10 to detect a stall condition of the servo motor 10 . once a stall condition has been detected , the servo motor 10 can attempt to operate again after a certain time interval . in some embodiments , the time interval can be about one second so that the servo motor 10 can regain operation again substantially immediately after the stall condition has been removed . a power stage rating of the servo motor 10 and / or the controller 22 can be determined by a continuous operating current and a peak operating current . the continuous operating current can influence the heat generated by the servo motor 10 and / or the controller 22 . the peak operating current can determine the power rating of the servo motor 10 and / or the controller 22 . in some embodiments , the servo motor 10 can be designed to achieve a specific torque constant . multiple parameters can influence the torque constant . in some embodiments , the torque constant can depend on the number of windings 46 , the number of poles of the rotors 28 , the pattern of the windings 46 , the thickness of the wire used for the windings 46 , the material of the wire , the material of the stator 30 , and numerous other parameters . in some embodiments , the temperature of the servo motor 10 can influence the torque constant . as a result , the torque constant can vary because the temperature of the servo motor 10 can change significantly over the course of its operation . in some embodiments , the dsp 48 can include a mapping procedure to compensate for the temperature variation and the resulting change in the torque constant . as a result , the torque of the rotor shaft 26 that is necessary to drive the servo motor 10 can be accurately computed over a large range of temperatures . the torque constant can be stored in the memory 50 . in some embodiments , the torque constant can be accessed by the dsp 48 . in some embodiments , the dsp 48 can compute the torque of the rotor shaft 26 that is necessary to drive the servo motor 10 based on the torque constant and the current draw of the servo motor 10 . the torque constant can influence the peak operating current . a large torque constant can result in a low power stage rating of the servo motor 10 . the high torque constant can reduce the peak operating current . in some embodiments , the peak operating current can be reduced from about 110 amperes to about 90 amperes . the heat generation during peak operation of the servo motor 10 can be reduced by increasing the torque constant . the large torque constant can lengthen a time period during which the servo motor 10 can operate at peak operating current without overheating . in some embodiments , the servo motor 10 can be driven with high torque values down to substantially zero rpm . the high torque values can be achieved by an increased back electromotive force ( bemf ) constant of the servo motor 10 . in some embodiments , the bemf constant can be proportional to the torque constant . the increased bemf constant can reduce the current necessary to drive the servo motor 10 . as a result , the servo motor 10 can achieve a certain torque of the rotor shaft 26 at the reduced current . the increased bemf constant can reduce power losses in the controller 22 and / or other electronic equipment . in some embodiments , the bemf constant can be related to the highest expected load the servo motor 10 is designed to be capable of moving . in some embodiments , the bemf constant can be at least 3 . 5 volts root mean square per thousand rpm ( vrms / kprm ). in some embodiments , the ratio of the bemf constant to a voltage driving the servo motor 10 can be constant . a high bemf constant can reduce the maximum speed of the rotor shaft 26 at which the servo motor 10 can be driven . in some embodiments , the bemf constant and the maximum speed of the rotor shaft 26 of the servo motor 10 can be directly proportional . for example , if the bemf constant is doubled , the maximum speed of the rotor shaft 26 of the servo motor 10 can be halved . the bemf constant can be a compromise between a low speed requirement , a high speed requirement , and a thermal load requirement of the servo motor 10 . in some embodiments , the low speed requirement of the servo motor 10 can dictate a certain bemf constant , which can result in the servo motor 10 not being able to fulfill the high - speed requirement in order to fulfill a specific point of operation . in some embodiments , the servo motor 10 can use a phase angle advancing technique for the supplied power in order to increase the maximum speed of the rotor shaft 26 . a commutation angle can be advanced by supplying a phase current at an angle increment before the rotor 28 passes a bemf zero crossing firing angle . the phase angle advancing technique can retard the commutation angle by supplying the phase current at the angle increment after the at least one rotor 28 has passed the bemf zero crossing firing angle . in some embodiments , the phase angle advancing technique can influence the bemf constant . in some embodiments , advancing the commutation angle can decrease the bemf constant . the servo motor 10 can be optimized to a certain point of operation . the angle increment of the phase angle advancing technique can be related to the speed of the rotor shaft 26 . in one embodiment , the angle increment can be about +/− 45 electrical degrees . in some embodiments , the servo motor 10 can be used to drive a pump . driving the pump without the phase angle advancing technique can result in a flow rate of 4 gallons per minute ( gpm ) at a pressure of 150 pounds per square inch ( psi ). in one embodiment , the phase angle advancing technique can increase the flow rate to about 5 gpm , which can be delivered at the pressure of 150 psi . in some embodiments , the servo motor 10 can be operated with a direct current ( dc ) power supply ( e . g ., a battery of a vehicle ). in other embodiments , the servo motor 10 can be operated with an alternating current ( ac ) power supply ( e . g ., a generator or alternator of a vehicle or a mains power supply in a building ). in some embodiments , the servo motor 10 can be powered with different voltages . the voltages can include one or more of 12 volts , 24 volts , 48 volts , 120 volts , and 240 volts . the stator windings 46 can be adapted to a specific voltage . the stator windings 46 can be adapted so that the servo motor 10 can operate with more than one power source ( e . g ., with a dc power supply or an ac power supply ). other embodiments can include different input power stages that allow the servo motor 10 to selectively operate with different voltages and / or power sources . for example , if the servo motor 10 is used for a sprinkler system in a building , the servo motor 10 can be driven by the 120 volts ac mains power supply . if mains power is lost , the controller 22 can automatically switch to a 12 volts dc battery power supply to continue the operation of the sprinkler system . fig9 illustrates a rectification bridge 600 according to one embodiment of the invention . the rectification bridge 600 can be used to operate the servo motor 10 with an ac power supply . the rectification bridge 600 can include two or more transistors 602 , an ac bus 604 , and a dc bus 606 . the ac bus 604 can connect to the external power supply 66 . the dc bus 606 can be used to supply power to the servo motor 10 . the transistors 602 can each include an intrinsic diode 608 . in some embodiments , the transistors 602 can include metal oxide semiconductor field effect transistors ( mosfets ). in some embodiments , the transistors 602 can be n - type mosfets , while in other embodiments , the two transistors 602 can be p - type mosfets . in some embodiments , the transistors 602 can include a first transistor 610 , a second transistor 612 , a third transistor 614 , and a fourth transistor 616 configured in an h - bridge . in some embodiments , the controller 22 can sense an incoming current i ac at a first location 618 on the ac bus 604 . in other embodiments , the controller 10 can sense the incoming current i ac at a second location 620 along with a third location 622 of the rectification bridge 600 . sensing the incoming current i ac of the rectification bridge 600 can result in a much higher level of electrical noise immunity instead of , for example , sensing voltages . if the incoming current i ac is below a threshold current i limit , the intrinsic diodes 608 can be used to rectify the incoming current i ac . if the incoming current i ac is above the threshold current i limit , the transistors 602 can be used to rectify the incoming current i ac . to rectify the incoming current i ac , the transistors 602 can be turned on by control signals from the controller 22 . the rectification bridge 600 can provide the correct timing for the switching of the transistors 602 . in some embodiments , the control current can prevent a discharge of the dc bus 606 and / or a shortening of the ac bus 604 . in some embodiments , a voltage drop across the transistors 602 can be lower than a voltage drop across the intrinsic diodes 608 . as a result , the switching of the transistors 602 can limit the power losses of the rectification bridge 600 , if the incoming current i ac exceeds the threshold current i limit . in some embodiments , the threshold current i limit can be low enough to prevent the rectification bridge 600 from overheating due to the power losses of the intrinsic diodes 608 , but high enough to provide substantial immunity to interference and noise on the ac bus 604 . the rectification bridge 600 can have much lower power losses than a conventional rectification bridge including diodes only . as a result , the use of the rectification bridge 600 can enable a higher efficiency and an operation in higher ambient temperatures . in some embodiments , the rectification bridge 600 can limit the power losses to about 30 watts at an ambient temperature of about 70 ° c . ( 160 ° f .). in some embodiments , the threshold current i limit can include hysteresis to increase an immunity to the noise on the ac bus 604 . fig1 illustrates a rectification method 700 according to one embodiment of the invention . the incoming current i ac can be sensed ( at step 702 ). if the absolute value of the incoming current i ac is below the current threshold i limit ( at step 704 ), the intrinsic diodes 608 can rectify the incoming current i ac and the rectification method 700 can be restarted ( at step 702 ) with sensing the incoming current i ac . if the absolute value of the incoming current i ac is above the current threshold i limit ( at step 704 ), the controller 22 can determine ( at step 706 ) whether the incoming current i ac is negative . if the incoming current i ac is positive , the controller 22 can supply ( at step 708 ) the control current to the transistors 602 . in some embodiments , the controller 22 can use the first transistor 610 and the fourth transistor 616 , which can be positioned diagonally across from one another in the rectification bridge 600 . if the incoming current i ac is negative , the controller 22 can supply ( at step 710 ) the control current to the transistors 602 . in some embodiments , the controller 22 can use the second transistor 612 and the third transistor 614 , which can be positioned diagonally across from one another in the rectification bridge 600 . after step 708 and / or step 710 , the rectification method 700 can be restarted by sensing the incoming current i ac so that the intrinsic diodes 608 can be substantially immediately used for the rectification , if the incoming current i ac drops below the current threshold i limit . it will be appreciated by those skilled in the art that while the invention has been described above in connection with particular embodiments and examples , the invention is not necessarily so limited , and that numerous other embodiments , examples , uses , modifications and departures from the embodiments , examples and uses are intended to be encompassed by the claims attached hereto . the entire disclosure of each patent and publication cited herein is incorporated by reference , as if each such patent or publication were individually incorporated by reference herein . various features and advantages of the invention are set forth in the following claims . | 7 |
several preferred embodiments of the invention are described for illustrative purposes , it being understood that the invention may be embodied in other forms not specifically shown in the drawings . while the digitized music as described in the preferred embodiments is referred to as “ bedtime beats ” music , it is understood that the invention contemplates any music having a tempo of between about 60 and about 80 beats per minute . turning to fig1 , the embodiments of the present invention comprise a chip 100 having a memory 102 for storing digitized music , a digital audio signal processor 104 for processing the digitized music , an output component such as a speaker 106 for outputting the digitized music and a power source 108 for supplying power to the system . embodiments further comprise a housing 110 which can take on varying forms as would occur to a person of ordinary skill in the art , select examples of which are described in more detail below . the housing 110 may include an input 112 for receiving digital music to be stored to the memory 102 and an actuator 114 for beginning playback of the digital music . in one embodiment of the present invention as shown in fig2 , a clock 200 is embedded with 120 minutes of bedtime beats music , or other predeterminable length of time as desired . the clock housing 202 may feature a “ secret to sleep ” button or other music actuator feature 204 that the user may use to start playback of the bedtime beats music . upon activation , the bedtime beats music will play for the predetermined length of time . the clock may also feature an adjustable timer 206 and the user may be able to select the length of the music &# 39 ; s playing time ( for example , 120 , 60 , 30 , 15 minutes , or other length of time as desired ). the chip containing the bedtime beats music is housed inside the clock 200 . the clock has a speaker 208 for playing the music for the sleeper . in varying embodiments , the clock housing may contain the features of an alarm clock , a “ fall asleep ” clock , a personal music device docking station , or any combination of these features , or other features of a clock that would occur to a person of ordinary skill in the art . this technology may be featured in similar types of device housings such as clock radios , portable audio devices , home audio devices , and docking devices for portable audio and / or video devices ( e . g ., ihome docking device for apple ipod ), as will be apparent to those of ordinary skill in the art . in another embodiment of the present invention , the clock as previously described may be portable and may contain the same features as the home clock and may include 60 minutes of music , or other length of time as desired . in another embodiment of the present invention , a pillow 300 is embedded with 60 minutes of bedtime beats music , or other length of time as desired . the pillow housing 302 may be made of therapeutic foam or other soft material and may contain a protective compartment 304 to hold the chip , speaker and power source . the pillow 300 may contain an actuator for beginning playback of the music such as by squeezing the pillow 300 . in another embodiment of the present invention , a travel pillow may be similar to the standard size pillow 300 previously described but having a smaller size to facilitate easy transport during travel . the exterior may be covered in soft fleece or other soft material . turning to fig4 , shown therein is a sleep mask embodiment 400 with ear bud speakers 402 and an embedded chip containing 30 minutes of bedtime beats music , or other length of time as desired . the sleep mask 400 may have a piece of fabric , padding , or other material 404 for covering the eyes and an elastic band 406 or other mechanism for securing the mask over the eyes of the wearer . the mask may have ear bud speakers 402 attached to the fabric material 404 or , alternatively , to the elastic band 406 which allow the wearer to listen to the bedtime beats music while wearing the sleep mask 400 . in another embodiment of the present invention as shown in fig5 , a very soft , washable plush toy (“ sleepie ”) 500 is embedded with a speaker 502 and the chip containing 30 minutes of bedtime beats music , or other length of time as desired . the speaker 502 and chip may be placed in a protective compartment 504 and may be removable so that the sleepie 500 can be washed . the sleepie 500 may include an actuator 506 for beginning playback of the bedtime beats music by some action by the user such as squeezing the sleepie 500 . the toy may be in the form of a stuffed animal , plush ball , a soft / fabric book , or other soft toy for infants . the toy may also be in the form of a stationary infant toy such as a song box or other toy that may be placed on a child &# 39 ; s dresser or other location near the child &# 39 ; s place of sleep . turning to fig6 , in another embodiment of the present invention , a musical mobile 600 is embedded with a speaker 602 and a chip containing 30 minutes of bedtime beats music , or other length of time as desired . the mobile 600 may contain 6 small , rotating toys 604 , or such other number as desired . the toys 604 may be constructed of a plush material or other material and designed to take the form of animals , shapes , vehicles , or other forms . the mobile 600 may have a clip 606 for attaching it to a crib . in another embodiment , the mobile may include a stand so that it may rest on a dresser , desk , or other flat surface . in another embodiment of the present invention as shown in fig7 , a crib 700 is embedded with speakers 702 and a chip containing 30 minutes of bedtime beats music , or other length of time as desired . the crib 700 may feature a “ secret to sleep ” button 704 or other music activation feature for starting playback of the bedtime beats music . the crib 700 may also feature an adjustable timer 706 and a user may be able to select the length of the music &# 39 ; s playing time ( for example , 120 , 60 , 30 , 15 minutes , or other length of time as desired ). in another embodiment of the present invention as shown in fig8 , shown therein is an infant bouncy seat or swing 800 inside of which a child rests . typically positioned on the floor , the seat or swing is moveable . the baby swing 800 generally swings back and forth creating a rocking motion and can be battery operated or plugged in to a wall outlet . the swing 800 is embedded with speakers 802 and a chip containing 30 minutes of bedtime beats music , or other length of time as desired . the baby swing 800 may feature a “ secret to sleep ” button 804 or other music activation feature for starting playback of the bedtime beats music . the baby swing 800 may also feature an adjustable timer 806 and a user may be able to select the length of the music &# 39 ; s playing time ( for example , 120 , 60 , 30 , 15 minutes , or other length of time as desired ). similar to the baby swing 800 , the infant bouncy seat is a stand alone infant seat which contains a seat for the infant to sit inside of . the infant &# 39 ; s legs are free to touch and push off the floor to create a bouncing motion . bedtime beats music is embedded in this device as in the infant bouncy seat 800 . another embodiment of the present inventions is shown in fig9 , wherein a baby monitor 900 is embedded with a chip containing 30 minutes of bedtime beats music , or other length of time as desired . typically , a baby monitor consists of a pair of speaker / microphone combination devices , one in the parental bedroom and one in the child &# 39 ; s bedroom that allows a parent to hear , speak to , and monitor the child remotely . the bedtime beats baby monitor housing 902 contains a speaker 904 which acts as both a speaker for the parents to monitor and hear the child and for administering of bedtime beats music which can play from the parental unit 908 on the child &# 39 ; s speaker 904 . the child &# 39 ; s unit 910 will also house the bedtime beats chip and can play music when an actuator 906 is switched over to “ play ” function . the units may be battery powered or plugged in to a standard wall outlet . the parental unit 908 and the child unit 910 may be of identical design to allow for interchangeability . turning to fig1 , described therein is the process flow 1000 of the bedtime beats chip . in process step 1002 , a user activates the bedtime beats device . in process step 1004 , a preset timer begins to run . in process step 1006 , the bedtime beats music begins to play . in process step 1008 , if time remains on the timer , the music continues to play . if time has expired , the bedtime beats stops playing as shown in process step 1010 . although certain presently preferred embodiments of the disclosed invention have been specifically described herein , it will be apparent to those skilled in the art to which the invention pertains that variations and modifications of the various embodiments shown and described herein may be made without departing from the spirit and scope of the invention . accordingly , it is intended that the invention be limited only to the extent required by the appended claims and the applicable rules of law . | 0 |
referring to the drawings in particular , the invention embodied in fig1 comprises a utility or industrial boiler 40 containing multiple burners shown as a single burner 42 , located in a water tube wall lined furnace chamber 46 . in the normal operation of the boiler 40 , combustion air and fuel are supplied to the burner 42 , and the fuel is burned as shown at 44 in the lower portion of furnace space 46 . heating gases flow upwardly through space 46 , thence to a convection pass or passage 48 and then successively over and between the tubes of a secondary superheater 50 , a reheater 52 , and a primary superheater 54 and downwardly through a gas passageway 70 . the economizer , air heater , dust collector and stack successively located downstream gas flow - wise in and from the passageway 70 and normally associated with a utility or industrial boiler are not shown . it should be recognized that in accordance with well - known practice , the secondary superheater 50 , the reheater 52 and the primary superheater 54 extend across the full width of the convection pass 48 and are formed for serial flow of steam by multiple looped tubes . wall openings 63 provide an access or entrance to the boiler flue gas passageway known as the convection pass 48 . in accordance with the present invention , as shown at fig2 and 3 , there are provided at each wall opening 63 , a liquid no x inhibitor conduit 62 and a temperature sensor 69 . a slide seal 80 is located in each wall opening 63 so that conduit 62 can be slideably inserted into and out of the convection pass 48 . a nozzle 64 is located on the outlet end of conduit 62 in order to spray a liquid no x inhibitor reagent into the flue gases flowing through the convection pass 48 . the gas temperature sensor 69 is operatively positioned , as shown at fig2 at the wall opening 63 and is used to monitor the flue gas temperature and locate the proper temperature window , preferably about 1600 - 1900 ° f ., within the convection pass 48 . as the temperature sensor 69 monitors the flue gas temperature within the convection pass 48 , it relays the temperature reading to a control means 74 . based on the temperature reading relayed from the temperature sensor 69 to the control means 74 , the control means will activate a drive 68 which is responsible for moving the liquid no x inhibitor conduit 62 in order to position nozzle 64 into the convection pass 48 so as to spray reagent into the flue gases . the seal 80 may be of any conventional type and may be established , for example , by directing a continuous stream of air around and against the conduit 62 and into the convection pass 48 to substantially preclude any leaking of flue gases from the convection pass 48 , around the slideable mounted conduit 62 . the temperature sensor 69 is an optical temperature monitor sold by diamond power specialty company of lancaster , ohio . fig2 shows the temperature sensor 69 positioned adjacent the wall opening 63 for continuously monitoring the temperature of the flue gases flowing across the sensing path in the convection pass 48 . when the preferred temperature range of 1600 - 1900 ° f . is sensed thereby activating the liquid no x inhibitor conduit drive 68 , the temperature sensor 69 is moved away from the wall opening 63 by drive means , not shown , so as to allow the conduit to be slideably inserted into the boiler convection gas pass 48 and thus enable nozzle 64 to spray the reagent into the flue gases as shown at fig3 . although the conduit 62 , as shown at fig2 and 3 , is mounted for movement in a direction perpendicular to the direction of flow of flue gases , it should be recognized that the conduit may be mounted for movement at an angle or in a curved path . the motion must be generally along the path of temperature change . it should be further recognized that comminuted solids or gaseous reagents may be substituted for the liquid reagent used in conjunction with the invention . while the specific embodiments of the invention have been shown and described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles . | 1 |
the methods and arrangements of the present invention may be implemented in a umts network as shown in fig1 . a radio network controller ( rnc ) 102 is connectable to a umts network and to a plurality of user equipments ( ues ) 108 wherein the ues are capable of being in the states , ura pch , cell pch , cell fach or cell dch . the object of the present invention to reduce the delay at an initiation of a data transfer is achieved by transferring the ue from the ura pch or the cell pch state directly to the cell dch state . that is achieved by a transmission of a data transfer initiating message from the unit , i . e . the ue or the rnc in the utran , that initiates the data transfer . the data initiating message comprises delay reducing information that is used for the transition of the ue from the ura pch or the cell pch state directly to the cell dch state . thus the rnc comprises according to the present invention means for handling a data transfer initiating message and means for introducing a delay reducing information in the data transfer initiating . the rnc comprises further means for transferring the ue from the ura pch or the cell pch state directly to the cell dch state by means of the delay reducing information in the data transfer initiating message . accordingly , the ue comprises according to the present invention means for handling a data transfer initiating message and means for introducing delay reducing information in a data transfer initiating message . the ue comprises further a transmitter for transmitting the data transfer initiating message and a receiver for receiving a message from the rnc 102 comprising information for transferring the ue 108 from the ura pch or the cell pch state directly to the cell dch state by means of the delay reducing information in the data transfer initiating message . according to one embodiment of the present invention , the data transfer initiating message is an uplink cell update message transmitted by the ue . it is known that the cell update message can be extended with a traffic volume measurement . however , due to limitations on the air interface and the fact that the cell update is transmitted on rlc transparent mode it is not desirable to extend the message size to the extent that would be needed . a solution to the problem described above is to modify the cell update message in a way that provides certain delay reducing information about the traffic volume without significantly increasing the message size . the general idea is that instead of indicating the traffic volume explicitly , it is indicated in relation to a threshold , e . g . if the traffic volume is above a previously configured threshold . this threshold can be configurable by utran . normally the traffic volume measurements in the ue are configured in such a way that measurement reports in cell_fach are transmitted if the traffic volume exceeds a threshold and potentially the same value as used to trigger the transmission of a measurement report could be used for setting the flag in the cell update message . this method would mean that no downlink signalling would need to be changed . however , the threshold for the cell update message can also be configured separately . in addition to the traffic volume information it could be beneficial to indicate further delay reducing information , e . g . if the uplink data is available on a user radio bearer or a signalling radio bearer . this is also indicated in the cell update message according to one embodiment . the benefit with this additional info would be that the utran may choose not to move ues to cell_dch if the data comes from a signalling radio bearer since the transmission on signalling radio bearers is not expected to be extended in time . in order to reduce the dch setup time from cell_pch and ura_pch it is an object of the present invention to be able to perform a direct switch to cell_dch . to facilitate a direct switch the present invention proposes to modify the format of the cell_update message to indicate , e . g ., whether the ue has a traffic volume above a configured threshold , which is preferably the same as the threshold for triggering of the traffic volume measurement . as it would imply a significant increase of the size of an enhanced cell_update message with the information about the available ul traffic volume such that it would no longer fit into one rlc pdu , an alternative is to indicate with a flag if the traffic volume is , e . g ., above the traffic volume threshold configured for the traffic volume measurement . this information is considered sufficient to assist the utran in the decision if a ue should be moved to cell_dch or not and could facilitate the direct transfer to cell_dch from cell / ura_pch . the following describes by means of non - limiting examples two conceivable embodiments to indicate said information . in one embodiment of the present invention , the delay reducing information is indicated in an extension of the cell update message . the cell update message is extended with a flag , e . g . a single bit , indicating the relation to a threshold value , e . g . if the traffic volume in the ue is above a threshold . potentially a second bit is used to be able to separate if the traffic volume is available on an srb or an rb ( or both ). this would extend the message size with a few bits including those needed for coding of the message extension . another embodiment of the present invention uses currently reserved code points . in the current cell update message there exist some spare values , i . e . the code points that are currently not used but may be transmitted with the existing message coding . thus , it would be a possible embodiment of the present invention to use one of the reserved code points in the cell update message to indicate the traffic volume , e . g . if the traffic volume is above the threshold . potentially , up to several code points are used to be able to separate if the traffic volume is available on an srb or an rb ( or both ). for example , a code point i could indicate a traffic volume above the threshold on an rb , a code point ii could indicate a traffic volume above the threshold on an srb , and a code point iii could indicate a traffic volume above the threshold on both srb and rb . this method would not increase the message size at all . the method according to the present invention makes it possible to move user equipments quickly to cell_dch in case the traffic volume is large and to move user equipments to cell_fach in case the traffic volume is small . the method facilitates direct transition to dch which reduces the dch setup time significantly . the method can thus greatly improve the performance for applications where the ue is typically in cell_ura_pch when data needs to be transmitted , e . g . web surfing . when a utran initiated transition from cell_pch / ura_pch to cell_dch is performed the ue transits directly to cell_dch without exchanging messages in cell_fach state in between according to the present invention . thus , the cell_pch / ura_pch transition to cell_dch is made faster since the paging message contains the dch configuration according to a further embodiment of the present invention . this results in a signaling sequence as shown in fig6 . in this embodiment , the utran orders the ue to cell_dch already in the data transfer initiating message , paging type 1 message in step 1 . the ue responds with a radio bearer reconfiguration complete message in step 2 and can then start to receive data on dch . in order to make this solution possible a number of information elements need to be added to the paging type 1 message . in fact , content that is present in cell update confirm in fig5 may be beneficial to add to the paging message . also compared to the content of cell update confirm the identity used in the paging type 1 message is u - rnti and not c - rnti . examples of the delay reducing information in the data transfer initiating message , the paging type 1 message , are according to this embodiment of the present invention : physical - and transport channel configuration parameters , code allocation and radio bearer configuration , such as frequency , ul dpch info ( e . g . scrambling code , spreading factor , tfci configuration ), dl dpch info ( e . g . spreading factor , rate matching , power offsets ) dl rl info ( e . g . primary cpich ), power control configurations and potential hs - dsch configurations . some other information related to rb and transport channels may also be beneficial , but since the paging type 1 message is sent in transparent mode and without segmentation or re - transmissions the size need to be limited , only the crucial information have been listed here . it could be noted that normally the cell where the ue is located is not known when the ue is in ura_pch state , so the invention is of limited use for this scenario . this is because utran needy to know already when sending the paging message in which cell the ue is located in order not to establish a dedicated channel for the ue in all cells belonging to the ura . this could of course be done but would potentially mean waste of radio resources . therefore the invention is in particular beneficial for cell_pch ues . for ura_pch ues there is a benefit in case the ue has made its presence in a cell known to utran rather recently . the following describes by means of non - limiting examples two conceivable embodiments to indicate the delay reducing information in an extension of the paging type 1 message : explicit indication : the paging type 1 message is extended with the explicit information needed to perform the direct transition to cell_dch . implicit indication : in order to save space in the paging type 1 message a previously transmitted downlink message ( e . g . a rb reconfiguration message ) moving the ue to cell_pch / ura_pch comprises the delay reducing information , i . e . all or a part of the configurations needed to perform the direct transition to cell_dch at a later stage . the paging type 1 message itself that may be sent a long time later , and then only comprises the actual code that the ue should use and / or a pointer to the already sent physical channel configuration . as an alternative to extending the paging message with dch information , the cell update confirm message is modified to be transmitted on the paging channel ( step 1 in fig5 ) instead of the fach . the method makes it possible to move ues quickly to cell_dch in case the traffic volume is large . the method facilitates direct transition to dch which reduces the dch setup time significantly . the method can greatly improve the performance for applications where the ue is typically in cell_pch / ura_pch when data needs to be transmitted to the ue ( e . g . push - to - talk services ). thus the rnc in accordance with present invention comprises means for transmitting a paging message on a paging channel , pch , to the ue and means for receiving a cell update message from the ue the rnc comprises further means for transmitting a cell update confirm message on a forward access channel , fach , and means for transferring the ue from the ura pch or the cell pch state directly to the cell dch state . accordingly , the ue comprises means for receiving a paging message on a paging channel , pch , from the rnc and means for transmitting a cell update message to the rnc . the ue further comprises means for receiving a cell update confirm message on a forward access channel , fach , and means for transferring the ue from the ura pch or the cell pch state directly to the cell dch state . in the drawings and specification , there have been disclosed typical preferred embodiments of the invention and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being set forth in the following claims . | 7 |
explanation shall be made in reference to fig1 in which 1 is an ocular lens frame , 2 is an ocular lens , 3 is a pentagonal roof prism , 3a is a roof or surface , 3b is a front plane or surface , 3c is a bottom plane , 3d is a plane or surface or eyepiece at ocular side and forms an exit surface , 4 is a light receiving element such as a photo - sensitive device such as a cds cell , 6 is a condenser lens , and 7 is a focusing plate . that is , the light flux of the counter upper light i ( shown by broken line ) from the ocular lens 2 is determined by the ocular lens frame 1 and goes through the ocular lens 2 , then is internally reflected within the pentagonal roof prism 3 in the order of 3d → 3c → cb → 3a → 3b → 3c → 3d , thus enters into the photocell exit surface 4 from 3d . or as shown in fig2 the lower light flux ( ii ) goes through the ocular lens 2 and is internally reflected within the pentagonal prism in the order of the plane 3b → 3a → 3b → 3c → 3d , then enters into the photocell 4 from the exit surface 3d . in both cases such light flux overlaps with the regular light from the focusing plate 7 , causing measuring error by the photocell 4 , and as a result it causes insufficient exposure in photographing . now the present invention shall be explained by the examples shown in the drawings . fig3 is a side elevation of an example of using the prism of the present invention , and fig4 is a top view of the same , wherein 5 is a prism used in the present invention , 5b is its totally reflecting plane or surface , 5a shows its incident plane or surface . in fig3 upper counter light i enters into an ocular lens and enters into the pentagonal prism 3 through its surface 3d , then after a series of internal reflection it is reflected from the bottom surface 3c at an angle of θ o degree against an imaging optical axis and goes out of the surface 3d . then and there in a conventional device the counter light i directly enters into a photocell 4 , but as a prism 5 is provided in the present invention the light transmits through the surface 5a of the prism 5 and is totally reflected at the surface 5b which forms an angle θ with the optical axis , therefore its direction is largely changed and will not reach the photocell 4 , yet the ordinary regular light ( shown by solid line ) from a focusing plate transmits through and is refracted at the surface 5b and reaches the photocell 4 . the angle θ formed by said surface must be within the scope defined by the following formula : in the above formula , n is the refractive index of the prism , and ω ° is the photometric acceptance angle of the finder , while the left side of the formula indicates the condition for the undesired counter light to be totally reflected at the bottom surface 5b , and the right side indicates the condition for the regular light to be refracted and transmitted . ω ° differs depending on the position of the photocell and on the finder . as shown above in the present invention such prism , as having a surface which forms , with the optical axis on the plane of a pentagonal prism facing the ocular lens side or at rear of the same , an angle θ falling within the scope defined by : or having an effect equivalent to the above , is placed between the pentagonal prism and the photocell thus the undesired light which is the counter light entering the ocular lens from upper direction and further entering into the pentagonal prism , and then tends to reach the photocell is totally reflected at the inner surface of the above mentioned prism in front of the photocell so that only ordinary imaging light transmits through the above - mentioned prism . therefore , the measuring device of a single lens reflex camera with such arrangements just mentioned has the advantages that it can easily eliminate conventionally undesired effects of the counter light from the upper direction of an ocular lens or eyepiece by internal reflection within the pentagonal prism and it can largely reduce the error in measuring , and that in case of regular light , the position of the photocell can be moved upward from the conventional pentagonal bottom surface by the refractive effect of the prism so that leak in measurement is small and the arrangement ( positioning ) of component parts can be made compact . next another example of the present invention shall be explained by fig5 and fig6 . fig5 is a side elevation of an example of use of the prism of the present invention , and fig6 is its top view , wherein 5 is a prism used in the present invention , 5b is a totally reflective surface , and 5a is an incident surface . in fig5 the lower counter light ii from somewhat lower direction from the center of an ocular lens enters a pentagonal prism from its plane 3d and after a series of internal reflections is reflected at the plane 3c at an angle of θ o ° against the optical axis and goes out of the place 3d . now in the conventional method or device the counter light ii directly enters into the photocell , but in the present invention by adopting the prism 5 , the above mentioned counter light transmits through the surface 5a of the prism and is totally reflected at the surface ( 5b ) which forms an angle θ with the optical axis , therefore its proceeding direction is greatly changed so that it will not reach the photocell 4 , although the ordinary regular light ( shown by solid line ) from a focusing glass or plane is defracted at the surface 5b and transmits through the same thus reaching the photocell 4 . the angle θ must be within the scope defined below : wherein n is refractive index of the prism . the left side of the formula shows the condition for the counter harmful light to be totally reflected at the surface 5b , and the right side of the formula shows the condition for the regular light to be refracted at and transmits through the surface 5b . as shown above , the present invention is so arranged that a prism , having a surface forming with the optical axis , on the surface of the pentagonal prism facing the ocular lens side or at the rear of the pentagonal prism an angle θ which falls within the scope shown below : or having such effect as equivalent to the above , is placed between the pentagonal prism and the photocell so that the undesired counter light , which enters the ocular lens from a lower direction then enters into the pentagonal prism reaching the photocell , is totally reflected at the inner surface of the above mentioned prism before the photocell , thus only the ordinary imaging light transmits through the same . fig7 shows another example , wherein the present invention is applied so that the light flux proceeding to both sides ( left and right ) of the ocular lens , out of the light fluxes other than the effective flux used by the finder coming out of the surface of the pentagonal prism facing the ocular lens , is properly measured . the undesired light i ( shown by broken line ) entering into the ocular lens from upper direction enters into the pentagonal prism 3 from the plane facing the ocular lens and is reflected at its inner bottom surface , thus the light is subjected to a series of internal reflections then is reflected again at the bottom surface and transmits again through the plane facing the ocular lens . while the light will be directly entering into the photocell 4 in the conventional device , the light is , by the wedge shape prism 5 for the examples to which the present invention is applied , totally reflected internally , thus the undesired light i is prevented from entering into the photocell 4 . on the other hand , the regular light ( shown by solid line ) from the focusing plate is after coming out of the pentagonal prism refracted at and transmits through the prism 5 thus reaching the photocell 4 . fig8 shows an example wherein the present invention is applied in order to properly measure the light flux proceeding to the upper direction of the ocular lens out of the light fluxes other than the effective flux used at the finder coming out of the pentagonal prism at its surface facing the ocular lens . the light ii ( shown by broken line ) undesired for measuring entered into the ocular lens from somewhat lower portion thereof enters into the pentagonal prism 3 at its surface facing the ocular lens and after a series of reflections within the pentagonal prism 3 it is finally reflected at the bottom surface then comes to the surface of the pentagonal prism 3 facing the ocular lens , wherein while the light enters into the photocell 4 in a conventional device , the light is totally reflected by the wedge shape prism 5 in the example to which the present invention is applied . thus the undesired light is prevented from proceeding to the photocell . on the other hand , the regular light ( shown by solid line ) from a focusing plate is , after coming out of the pentagonal prism , refracted at and transmits through the prism 5 reaching the photocell 4 . in fig7 and fig8 a prism , having such surface that its angle θ falls within the scope of ( wherein n is the refractive index of the prism ) or having such effect as equivalent to the above , is placed between the photocell and the pentagonal prism . while the examples shown in fig7 and fig8 show a case wherein the light flux proceeding to both sides ( left and right ) of the ocular lens is measured and a case wherein the light flux proceeding to the upper direction of the ocular lens is measured , respectively , both kinds of light flux may be simultaneously measured . fig1 shows such case as mentioned and fig1 shows a modified wedge shape prism . fig1 shows , being different from the foregoing examples , an example wherein such a prism is provided as having the surfaces by which the counter light , which comes from the ocular lens and is totally reflected at the bottom surface of the pentagonal prism thus proceeding toward the ocular lens , is made to transmit the same and the regular light from a focusing glass and is totally reflected . in the drawing the undesired light i ( shown by broken line ) entering into the ocular lens from upper direction transmits through the reflecting surface 5b of the prism 5 . and the undesired light ii ( shown by broken line ) entering into the ocular lens from lower direction transmits through the reflecting surface 5c of the prism 5 . on the other hand , the regular light ( shown by solid line ) is reflected at the reflecting surface and enters into the photocell provided at lower position in the drawing . the angle θ by the reflective surface must fall within the scope defined below : wherein n is refractive index of the prism and ω ° is the measuring scope of the finder . as have been explained above in the present invention a prism , having such surface as forming with the optical axis on the surface of the pentagonal prism facing the ocular lens side or at the rear of the prism an angle θ which falls within the scope defined by the above mentioned formula or having an effect equivalent to the above , is provided between a pentagonal prism and a photocell . the prism shown in fig1 or fig1 are modifications of the prism 5 of the foregoing examples . as shown in the above mentioned examples the present invention provides a simple yet great improvement over the effect on the measuring error by the counter light from an ocular lens , which constituted disadvantages of such system as measuring the light other than the finder effective light flux coming out of the surface of the pentagonal prism facing the ocular lens . | 6 |
illustrated in fig1 is a representation of a compact 10 to be pressed under high pressure and high temperature ( hpht ) to form a polycrystalline diamond compact ( pdc ) for use as a cutter on a rotary drag bit . the compact 10 includes a substrate 14 , layer of either powdered solvent catalyst 15 or a solid disc of catalyst 15 , a first layer of diamond powder 12 , a sacrificial layer or second layer 12 ′ of diamond powder , and a sink 16 . the compact 10 includes two layers of diamond powder , a first layer of diamond powder 12 typically having a particle size in the range of about 5 microns to about 40 microns and a second more coarse sacrificial layer 12 ′ of diamond powder having particle size in the range of about 100 microns to about 500 microns or multi - modal particle size distributions thereof for forming a diamond table for cutting . the layer of powdered solvent catalyst 15 , such as cobalt , while illustrated as a separate layer of powdered cobalt , may be mixed within primarily the powdered diamond 12 , if desired . the sacrificial layer 12 ′ of diamond powder acts as a catalyst for forming the diamond table and for attaching the polycrystalline diamond table to a substrate 14 . the substrate 14 typically comprises a cermet material ( i . e ., a ceramic - metal composite material ) such as , for example , cobalt - cemented tungsten carbide 14 for forming a backup substrate , after pressing . the sink 16 acts as a getter that can react favorably with or adsorb any catalyst , or any suitable metal catalyst , in the diamond powder 12 and in the sacrificial layer 12 ′ of diamond powder to reduce the concentration of the catalyst , or other suitable metal catalyst , in the diamond powder 12 , which may be swept into the diamond grains of diamond powder 12 from either the substrate 14 , or the layer of powder solvent catalyst 15 , or solid catalyst disc 15 , during sintering . during sintering , each of substrate 14 and the layer of catalyst 15 serves as catalyst material for forming the inter - granular diamond - to - diamond bonds and , the resulting diamond table , from the diamond grains . in other methods , a layer of powdered catalyst material 15 , or any suitable metal catalyst material 15 , may additionally be mixed with the diamond grains prior to sintering in a hthp process . upon formation of a diamond table 12 using a hthp process , catalyst material may remain after pressing and cooling to form diamond microstructure for the diamond table 12 of the compact 10 . the sacrificial layer 12 ′ may comprise coarse diamond , carbide , graphite , ceramic , metal , or any suitable mixtures thereof as well as any suitable materials that promote fracturing of the sacrificial layer 12 ′ and allow the migration of catalyst 15 therethrough . the sink 16 may be any suitable material such as fine diamond , graphite , metals , or metal alloys which will react at or , preferably , above the reactivity level of the diamond powder . by placing the sink 16 over the diamond powder 12 and sacrificial layer 12 ′, the sink 16 causes a solvent gradient to occur across the diamond powder 12 and sacrificial layer 12 ′ for the solvent catalyst in the diamond powder 12 and sacrificial layer 12 ′ to migrate to the sink 16 during high pressure and high temperature formation of the compact 10 . the sacrificial layer 12 ′ of diamond powder acts as a sacrificial layer to be removed after the high pressure high temperature ( hpht ) portion of the process by any suitable means , such as direct separation of the sacrificial layer 12 ′ of diamond powder from diamond layer 12 or cutting or grinding , or lapping , etc . the sacrificial layer 12 ′ of diamond powder should not remain on the compact 10 , although in some instances it may be retained . while coarse diamond powder for the sacrificial layer 12 ′ is preferred to be used , any diamond powder may be used and may include a minimally reacting material therein , if so desired . the sacrificial layer 12 ′ of coarse diamond powder may be in powder form , mixed with a suitable metal , layered , or in any combination thereof . the sacrificial layer 12 ′ of diamond powder should react minimally with the diamond powder layer 12 allowing the catalyst to pass freely through the sacrificial layer 12 ′ of diamond powder with minimal reactivity therewith and should be easily removable from the diamond powder layer 12 . in certain instances , the sacrificial layer 12 ′ of diamond powder may not be used and only the solvent catalyst layer 15 used , if the solvent catalyst layer 15 may be easily separated from the powdered diamond layer 12 and the solvent catalyst layer 15 retains the activity thereof without the sacrificial layer 12 ′ of diamond powder after high temperature and high pressure formation of the compact 10 . as illustrated in fig1 a , if desired , the layer 15 may consist of a solid metal disc 15 or metal alloy disc 15 having reduced catalytic activity , such as a nickel disc 15 . the disc 15 includes a plurality of apertures 18 therein to control the migration of catalyst contained within the substrate 14 into the diamond layer 12 and sacrificial layer 12 ′ to the sink 16 . the thickness of the disc 15 , or layer of powdered catalyst 15 , may be any thickness in the range of approximately 1 micron to approximately 100 microns . the shape of the apertures 18 may be any desired shape , such as circular , square , rectangular , oval , ellipsoid , triangular , or any desired combinations thereof in any desired patterns thereof . the length and width of the apertures 18 may be any desired diameter thereof or length and width thereof convenient for the size of the compact 10 . the apertures 18 may have any desired pattern , such as symmetrical , asymmetrical , any desired combinations thereof , etc . referring back to fig1 , the initial concentration of the solvent catalyst 15 below diamond powder 12 or in the diamond powder 12 is illustrated by the graphic representation 15 ′ on the right side fig1 showing that the diamond powder 12 and sacrificial layer 12 ′ of diamond powder each have some concentration of solvent catalyst 15 therein while the highest concentration of solvent catalyst 15 is in the catalyst layer 15 at or near the interface of the layer of diamond powder 12 . if desired , the wettability of the diamond powder 12 and sacrificial layer 12 ′ can be enhanced with a graphite coating or any other agent to allow the catalyst 15 to migrate more easily to the sink 16 from the diamond powder 12 and sacrificial layer 12 ′. illustrated in fig2 is a representation of a compact 10 of fig1 , or with the solid disc 15 of fig1 a , after high pressure and high temperature pressing of the compact 10 . as illustrated on the right side of the compact 10 , during high pressure and high temperature pressing of the compact 10 , the affinity of the sink material 16 has caused the solvent catalyst material 15 to migrate to the sink 16 . as illustrated , the sink 16 has the highest concentration of the cobalt solvent catalyst 15 , after high pressure and high temperature pressing of the compact 10 . as illustrated , the polycrystalline diamond table 12 formed from the diamond powder 12 and sacrificial layer 12 ′ of diamond powder includes , at or near the wc substrate 14 , a first level 12 a of concentration of catalyst material having a level of concentration of catalyst of about two times or more of the level of concentration of catalyst in the wc substrate 14 , a second level 12 b of concentration of catalyst having a level 12 b of concentration of about the same level of concentration of catalyst as in the wc substrate 14 , and a third level 12 c of concentration of catalyst having a level 12 c of concentration of catalyst decreasing from about the same level of concentration 12 b of catalyst as in the wc substrate 14 to a minimum level of concentration approaching almost no catalyst in the diamond table 12 at the upper end or upper surface thereof , although the amount or concentration of catalyst is as minimal as required for formation of the diamond table 12 of the compact 10 . the level of concentration of catalyst in the sacrificial layer 12 ′ of coarse diamond powder 12 ′ is significantly less than that of the level of concentration of the catalyst in the wc substrate 14 with the sink 16 having a level of concentration of catalyst peaking at a level of about three times or more of the level of concentration of the catalyst , in the wc substrate 14 . the solvent catalyst layer 15 may be deleted , if desired , when sufficient catalyst material from the substrate 14 is available during hpht of the compact 10 . it will be appreciated that the volume or mass of the material comprising the sink 16 must be at least approximately equal to or larger than the volume or mass of catalyst material , such as from the catalyst layer 15 and any catalyst that may migrate from the substrate 14 that is to be to be removed from the diamond powder 12 and sacrificial layer 12 ′ of diamond powder . otherwise , the volume or mass of the sink 16 will not be effective for the removal of the desired amount of catalyst material from the layer of catalyst powder 15 , or from a solid disc 15 , from the layer of diamond powder 12 , and from sacrificial layer 12 ′ of diamond powder . illustrated in fig3 is another representation of an alternative embodiment of the present invention where a compact 10 is to be pressed under high pressure and high temperature to form a pdc for use as a cutter on a rotary drag bit . the compact 10 includes a substrate 14 , a powdered catalyst layer 15 , a diamond powder layer 12 , a sacrificial layer or second layer 12 ′ of coarse diamond powder , and a sink or reactive layer 16 . as illustrated , the compact 10 includes at least two layers of diamond , one of diamond powder 12 ( pdc feed ), typically having a particle size of about 5 microns to about 40 microns , and another of sacrificial layer 12 ′ of coarse diamond particles , typically having a particle size of about 100 microns to about 500 microns , for forming a diamond table for cutting . a layer of powdered solvent catalyst 15 , such as cobalt powder , or a solid solvent catalyst disc 15 , such as an iron and cobalt alloy disc , contacts the powdered diamond 12 for forming the diamond table from the diamond powder 12 and sacrificial layer 12 ′ of diamond powder and attaching the diamond table to a substrate 14 which is formed from tungsten carbide powder for forming a backup substrate for the diamond table after pressing . a sink 16 which acts as a getter that can react favorably with the cobalt solvent catalyst 15 to reduce the concentration of the cobalt solvent catalyst in the diamond powder 12 and sacrificial layer 12 ′, after pressing and cooling to form the diamond microstructure of a diamond table 12 of the compact 10 . the sink 16 may be any suitable material , such as fine diamond , graphite , metals , or metal alloys which will react at or , preferably , above the reactivity level of the diamond powder . by placing the sink over the tungsten carbide powder , the catalyst layer 15 , the diamond powder layer 12 , and sacrificial layer 12 ′, the sink causes a solvent gradient to occur across the tungsten carbide powder 14 for the cobalt solvent catalyst therein and the catalyst in the catalyst layer 15 to migrate to the sink 16 during high pressure and high temperature formation of the compact 10 . because the coarse diamond powder of the sacrificial layer 12 ′ has a particle size in the range of about 100 microns to about 500 microns , the sacrificial layer 12 ′ will not strongly bond to the diamond layer 12 at the interface therebetween during high pressure and high temperature pressing . the overall permeability of the diamond layer 12 and the permeability of the sacrificial layer 12 ′ of coarse diamond powder is determined by the mean free path of open porosity , which is formed by the interstitial regions between individual grain boundaries between grains , and fractures that form under pressure and determines the effectiveness at which any solvent catalyst migrates therethrough during the high pressure and high temperature process of forming the compact 10 as the closed porosity of the diamond layer 12 and the closed porosity of the sacrificial layer 12 ′ of coarse porous diamond prevents any substantial migration of the catalyst 15 thereacross . when there is a greater amount of permeability in the diamond layer 12 and permeability in the sacrificial layer 12 ′ of coarse porous diamond particle layer , the solvent catalyst 15 will migrate through the diamond layer 12 and the sacrificial layer 12 ′ of coarse porous diamond . if a diamond powder 12 is used that has a mean free path of open porosity below the percolation threshold for the grain size distribution , the permeability of the diamond layer 12 may be such that the catalyst 15 cannot effectively migrate thereacross in any reasonable period of time for the compact formation process . illustrated in fig4 is another representation of an alternative embodiment of the present invention where a compact 10 is to be pressed under high pressure and high temperature to form a pdc for use as a cutter on a rotary drag bit . the compact 10 includes a substrate 14 , a layer of powdered cobalt catalyst 15 , a layer of diamond powder 12 , another layer of coarse diamond powder 12 ′, and a sink 16 of fine graphite powder . the compact 10 includes at least two layers of diamond , one of diamond powder 12 having a particle size of about 5 microns to about 40 microns and another of sacrificial layer 12 ′ of coarse diamond particles having a particle size of about 100 microns to about 500 microns for forming a diamond table for cutting . a layer of powdered cobalt solvent catalyst 15 contacts the powdered diamond 12 for attaching a diamond table to a substrate formed from tungsten carbide powder 14 for forming a backup substrate for the diamond table formed from the diamond powder 12 and sacrificial layer 12 ′ of coarse diamond particles having the diamond table secured thereto after pressing . a fine graphite powder as a sink 16 which acts as a getter that can react favorably with the cobalt solvent catalyst 15 to reduce the concentration of the cobalt solvent catalyst in the diamond powder 12 after pressing and cooling to form diamond microstructure of a diamond table of the compact 10 . the fine crystalline graphite powder 16 will react at or , preferably , above the reactivity level of the diamond powder 12 ( pcd feed ). by placing the sink 16 opposite the tungsten carbide powder for forming the substrate 14 , the cobalt catalyst layer 15 , the diamond powder 12 , and the sacrificial layer 12 ′ of coarse diamond powder , the sink 16 causes a solvent gradient to occur across the tungsten carbide powder 14 , the cobalt powder catalyst layer 15 , the diamond powder layer 12 and the sacrificial layer 12 ′ for any cobalt solvent catalyst to migrate to the sink 16 during high pressure and high temperature formation of the compact 10 . if desired , a solid solvent catalyst disc 15 may be placed between the diamond layer 12 and the substrate 14 , rather than a layer of powdered cobalt catalyst 15 . if the sacrificial layer 12 ′ of coarse porous diamond powder has an average particle size in the range of about 100 microns to about 500 microns , the sacrificial layer 12 ′ of coarse porous diamond particle layer will not strongly bond to the diamond layer 12 at the interface therebetween . the overall permeability of the diamond layer 12 and the permeability of the sacrificial layer 12 ′ of coarse diamond powder determines the effectiveness at which any solvent catalyst migrates therethrough during the high pressure and high temperature process of forming the compact 10 as the closed porosity of the diamond layer 12 and the closed porosity of the sacrificial layer 12 ′ of coarse diamond powder prevents or limits any migration of the catalyst 15 thereacross . when there is greater permeability of the diamond layer 12 and the permeability of the sacrificial layer 12 ′ of coarse diamond powder , the solvent catalyst will migrate with greater effectiveness through the diamond layer 12 and the sacrificial layer 12 ′ of coarse diamond powder . if a diamond powder 12 is used that has a mean free path of open porosity below the percolation threshold for the grain size distribution , the permeability of the diamond layer 12 may be such that the solvent catalyst 15 cannot effectively migrate thereacross in any reasonable period of time for the compact formation process . illustrated in fig5 is another representation of an alternative embodiment of the present invention where a compact 10 is to be pressed under high pressure and high temperature to form a pdc for use as a cutter on a rotary drag bit . the compact 10 includes a substrate 14 , a layer of diamond powder 12 , a small or thin sacrificial layer of coarse diamond powder 12 ′, when compared to the thickness of the layer 12 of diamond powder , and a reactive sink layer 16 . the compact 10 includes at least two layers of diamond , one of diamond powder 12 , typically having a particle size of about 5 microns to about 40 microns , and another of sacrificial layer 12 ′ of coarse diamond powder , typically having a particle size of about 100 microns to about 500 microns that are used for forming a diamond table for cutting . a powdered solvent catalyst , such as cobalt powder , is mixed with the diamond powder 12 . a sacrificial layer 12 ′ of coarse diamond powder is for forming the diamond table from the diamond powder 12 and sacrificial layer 12 ′ of coarse diamond powder and attaching the diamond table to a substrate 14 formed from tungsten carbide powder for forming a backup substrate for the diamond table after pressing . a sink 16 ( a reactive layer ) acts as a getter that can react favorably with any cobalt solvent catalyst to reduce the concentration of the cobalt solvent catalyst in the diamond powder 12 and sacrificial layer 12 ′ of diamond powder after pressing and cooling to form diamond microstructure of a diamond table 12 of the compact 10 . the sink 16 may be any suitable material such as fine diamond , graphite , metals , or metal alloys which will react at or , preferably , above the reactivity level of the diamond powder . by placing the sink 16 opposite the tungsten carbide powder of the substrate 14 , diamond powder 12 , the sacrificial layer 12 ′ of coarse diamond powder , the sink 16 causes a solvent gradient to occur across the diamond powder layer 12 ( pcd feed ) having cobalt solvent catalyst therein for the cobalt solvent catalyst to migrate to the sink 16 during high pressure and high temperature formation of the compact 10 . because the sacrificial layer 12 ′ of coarse diamond powder has a particle size in the range of about 100 microns to about 500 microns , the sacrificial layer 12 ′ of coarse porous diamond particle layer 12 ′ will not strongly bond to the diamond layer 12 at the interface therebetween . the overall permeability of the diamond layer 12 and the permeability of the sacrificial layer 12 ′ of diamond powder determines the effectiveness at which the solvent catalyst migrates therethrough during the high pressure and high temperature process of forming the compact 10 as the closed porosity of the diamond layer 12 and the closed porosity of the sacrificial layer 12 ′ of coarse diamond powder prevents any substantial migration of the catalyst thereacross . when there is a large amount of permeability in the diamond layer 12 and permeability in the sacrificial layer 12 ′ of coarse diamond powder , any solvent catalyst in the diamond powder 12 will migrate with a greater effectiveness through the diamond layer 12 and the sacrificial layer 12 ′ of coarse diamond powder . if a diamond powder 12 or a sacrificial layer 12 ′ of coarse diamond powder is used that has mean free path of open porosity below the percolation threshold for the grain size distribution , the permeability of the diamond layer 12 and the sacrificial layer 12 ′ may be such that the catalyst cannot effectively migrate thereacross in any reasonable period of time for the compact formation process . illustrated in fig6 is another representation of an alternative embodiment of the present invention where a compact 10 is to be pressed under high pressure and high temperature to form a pdc for use as a cutter on a rotary drag bit . the compact includes a substrate 14 , a catalyst layer 15 , a layer of powdered diamond 12 , a sacrificial layer 12 ′ of diamond powder extending around the top surface and circumference of the layer of powdered diamond 12 , extending around the circumference of the catalyst layer 15 , and extending around the circumference of the substrate 14 , and a reactive layer forming a sink 16 extending over the top or upper surface and over or around the entire circumference of the sacrificial layer 12 ′ of diamond powder . the compact 10 includes at least two layers of diamond , one of diamond powder 12 , typically having a particle size of about 5 microns to about 40 microns , and another of sacrificial layer 12 ′ of coarse diamond powder , typically having a particle size of about 100 microns to about 500 microns , for forming a diamond table for cutting , each layer 12 and 12 ′ extending around a portion of the tungsten carbide powder 14 . a layer of powdered solvent catalyst 15 , such as cobalt powder , or solid solvent catalyst disc 15 , such as an iron and cobalt alloy disc , contacts the substrate 14 and contacts the powdered diamond 12 for forming the diamond table from the diamond powder 12 and sacrificial layer 12 ′ of diamond powder and attaching the diamond table to a substrate 14 formed from tungsten carbide powder for forming a backup substrate for the diamond table after pressing . a sink or reactive layer 16 extends around the diamond layers 12 and 12 ′ as well as the tungsten carbide powder 14 with the sink or reactive layer 16 acting as a getter that can react favorably with the solvent catalyst 15 to reduce the concentration of the solvent catalyst in the diamond powder 12 and sacrificial layer 12 ′ of coarse diamond powder after pressing and cooling to form diamond microstructure of a diamond table 12 of the compact 10 . the sink may 16 be any suitable material such as fine diamond , graphite , metals , or metal alloys which will react at or , preferably , above the reactivity level of the diamond powder . by placing the sink 16 opposite and around the diamond powder 12 and sacrificial layer 12 ′ of diamond powder , the sink 16 causes a solvent gradient to occur across the tungsten carbide powder 14 the diamond powder 12 , and the sacrificial layer 12 ′ for any solvent catalyst 15 to migrate to the sink or reactive layer 16 during high pressure and high temperature formation of the compact 10 . because the coarse diamond powder 12 ′ has a particle size in the range of about 500 microns to about 1000 microns , the sacrificial layer 12 ′ of coarse diamond powder will not strongly bond to the diamond layer 12 at any interface therebetween . the overall permeability of the diamond layer 12 and the permeability of the sacrificial layer 12 ′ of coarse diamond powder determines the effectiveness at which solvent catalyst 15 migrates therethrough during the high pressure and high temperature process of forming the compact 10 as the closed porosity of the diamond layer 12 and the closed porosity of the sacrificial layer 12 ′ of coarse diamond powder prevents any substantial migration of the solvent catalyst 15 thereacross . when there is a large amount of permeability in the diamond layer 12 and permeability in the sacrificial layer 12 ′ of coarse diamond powder , the solvent catalyst 15 will migrate with greater effectiveness through the diamond layer 12 and the sacrificial layer 12 ′ of coarse diamond powder . if a diamond powder 12 and / or sacrificial layer of coarse diamond powder 12 ′ is used that has a mean free path of open porosity below the percolation threshold for the grain size distribution , the permeability of the diamond layer 12 and / or the sacrificial layer 12 ′ of coarse diamond powder may be such that the catalyst 15 cannot effectively migrate thereacross in any reasonable period of time for the compact formation process . illustrated in fig7 is another representation of an alternative embodiment of the present invention where a compact 10 is to be pressed under high pressure and high temperature to form a pdc for use as a cutter on a rotary drag bit . the compact 10 includes a substrate 14 , a catalyst layer 15 , a layer of diamond powder 12 ( pdc feed ), and a reactive layer forming a sink 16 . the compact 10 includes a layer of diamond powder 12 , typically having a particle size of about 5 microns to about 40 microns , for forming a diamond table for cutting . a powdered solvent catalyst 15 , such as cobalt powder , extends around the diamond powder 12 on all sides thereof including the circumference thereof and an upper portion of the tungsten carbide powder 14 for forming a backup substrate for 14 the diamond table after pressing . a sink or reactive layer 16 extending around the upper surface and circumference of the powdered solvent catalyst layer 15 , and a portion of the tungsten carbide powder 14 . the sink or reactive layer 16 acts as a getter that can react favorably with the solvent catalyst 15 to reduce the concentration of the solvent catalyst 15 in the diamond powder 12 after pressing and cooling to form diamond microstructure of a diamond table 12 of the compact 10 . the sink may be any suitable material such as fine diamond , graphite , metals , or metal alloys which will react at or , preferably , above the reactivity level of the diamond powder . by placing the reactive sink layer 15 around the solvent catalyst 15 and the tungsten carbide powder 14 , the sink causes a solvent gradient to occur across the tungsten carbide powder 14 for the any solvent catalyst 15 to migrate to the sink 16 during high pressure and high temperature formation of the compact 10 . the overall permeability of the diamond layer 12 determines the effectiveness at which the solvent catalyst migrates therethrough during the high pressure and high temperature process of forming the compact 10 as the closed porosity of the diamond layer 12 prevents any substantial migration of the solvent catalyst 15 thereacross . when there is a large amount of permeability in the diamond layer 12 , the solvent catalyst 15 will migrate with greater effectiveness through the diamond layer 12 . if a diamond powder 12 is used that has a mean free path of open porosity below the percolation threshold for the grain size distribution , the permeability of the diamond layer 12 may be such that the solvent catalyst 15 cannot effectively migrate thereacross in any reasonable period of time for the compact formation process . illustrated in fig8 is another representation of an alternative embodiment of the present invention where a compact 10 is to be pressed under high pressure and high temperature to form a pdc for use as a cutter on a rotary drag bit . the compact 10 includes a substrate 14 , a layer of diamond powder 12 , a layer of powdered catalyst 15 contacting the layer of diamond powder 12 on the top side and circumference thereof and an upper portion of the substrate 14 , and a reactive layer forming a sink 16 . the compact 10 includes a layer of diamond powder 12 ( pcd feed ), typically having a particle size of about 5 microns to about 40 microns , for forming a diamond table for cutting , a powdered solvent catalyst 15 , such as cobalt powder extending around the diamond layer 12 on the upper surface thereof and around the circumference and an upper portion of the tungsten carbide powder 14 , any desired amount , for forming the diamond table from the diamond powder 12 and attaching the diamond table to a substrate 14 formed from tungsten carbide powder for forming a backup substrate for the diamond table after pressing . a sink or reactive layer 16 extending around the solvent catalyst layer 15 , and a portion of the tungsten carbide powder 14 , any desired amount , acting as a getter that can react favorably with the solvent catalyst 15 around the diamond powder layer 12 and any solvent catalyst in the substrate 14 to reduce the concentration of the solvent catalyst 15 in the diamond powder 12 after pressing and cooling to form diamond microstructure of a diamond table 12 of the compact 10 . the sink 16 may be any suitable material such as fine diamond , graphite , metals , or metal alloys which will react at or , preferably , above the reactivity level of the diamond powder 12 . by placing the sink 16 around the diamond powder 12 and the substrate 14 , the sink 16 causes a solvent gradient to occur across the tungsten carbide powder of the substrate 14 for any solvent catalyst 15 to migrate to the sink 16 during high pressure and high temperature formation of the compact 10 . the overall permeability of the diamond layer 12 determines the effectiveness at which the solvent catalyst 15 migrates through the diamond powder 12 during the high pressure and high temperature process of forming the compact 10 as the closed porosity of the diamond powder of the layer 12 prevents any substantial migration of the catalyst thereacross . when there is a large amount of permeability in the diamond powder layer 12 , any solvent catalyst 15 will migrate with greater effectiveness through the diamond layer 12 . if a diamond powder 12 is used that has a mean free path of open porosity below the percolation threshold for the grain size distribution , the permeability of the diamond powder layer 12 may be such that the catalyst cannot effectively migrate thereacross in any reasonable period of time for the compact formation process . while particular embodiments of the invention have been shown and described , numerous variations and alternate embodiments will occur to those skilled in the art . accordingly , it is intended that the invention be limited in terms of the appended claims . | 2 |
as shown in fig1 , a first embodiment of the present invention consists of a source of compressed video data , encoder 1 , which encodes data both at a low bit - rate r l , which may have a value of for example 500 kbits − 1 , and a high bit - rate r h , of for example 1500 kbits − 1 . the compression codec used is h . 263 but equally may be any other codec , such as mpeg4 . encoder 1 takes ‘ live ’ video data as its input , for instance a broadcast of a sporting event . the two encoded data streams are transmitted via separate logical connections to the video streamer 2 at a transmission rate te . the video streamer 2 may be on the same premises as the encoder 1 and linked via an intranet . the video streamer 2 runs on a server computer , for instance one comprising a pentium iii 700 mhz , 256 mb ram which has access to the internet . a video viewer , hitherto referred to as the client , running on a pc ( a , b , c etc in fig1 ) suitably configured to have access to the internet , may connect to the video streamer 2 via the internet and thus the client is able to access content . a suitable pc terminal is a 266 mhz pentium ii laptop pc . the video streamer 2 can support a large number of clients ( typically up to 1000 ) viewing the same stream . for a live broadcast , the encoder 1 will transmit at a transmission rate te which is real - time . the two streams of data r l and r h coded at different bit - rates offer different quality video reproduction , but each data stream has the same transmission rate , t e . the data must be decoded at this rate for the program to play back in real - time . fig2 shows the arrangement of the video streamer 2 . low quality encoded video data encoded at a low bit - rate r l and high quality encoded video data encoded at a high bit - rate r h from the encoder 2 is received at the input connections 21 and 22 respectively and fed to buffers 23 and 24 respectively . it should be noted that there is provided one buffer per channel of encoded video data that is received by the video streamer 2 . encoded video data is read out from each buffer 23 , 24 via a switch 26 which selects which encoded video data stream is to be sent to the output connection 27 . there is provided a buffer manager 25 which is capable of controlling the rate at which data is read out from each of the buffers 23 , 24 and thus defines the transmission rate t s of the video streamer 2 . the buffer manager is also in connection with the switch 26 and is further capable of receiving signals from connection 28 . t s is selected by varying the time delay between the transmission of each packet , such that t s may be less than , equal to or greater than the encoder transmission rate t e . those skilled in the art will realise that the limiting factor on the sustainability of transmission where t s & gt ; t e is the size of the buffer 23 , 24 such that a buffer of size s kbits will be able to sustain a transmission rate of t s = 2t e for twice as long as a buffer of size s / 2 kbits . through the control of both switch 26 and the transmission rate ts the buffer manager is able to control the bit - rate which is output from the video streamer 2 on two scales ; by adjusting the transmission rate t s fine control of the bit - rate is achieved , and by switching between the two encoded data streams encoded at bit - rates r l and r h control of the bit - rate on a coarse scale may be achieved . the buffer manager 25 makes adjustments to t s or switches the output between buffers in response to signals received from connection 28 . fig3 shows the arrangement of the client running on a pc 3 a , b , c etc . the encoded video data that is sent from the video streamer 2 is received at the client via a connection 27 and checked for completeness by a packet loss detector 31 . the data is then sent into a client buffer 32 which is of a size suitable to absorb fluctuations in network throughput . the client buffer 32 is connected directly to a decoder 33 and from there decoded data is sent to be displayed at the client screen ( not shown ). a client status monitor 34 is connected to the packet loss detector 31 and client buffer 32 . the client status monitor 34 is able to send signals via connection 28 . the packet loss detector 31 monitors incoming packets . if packet loss is detected then a signal is sent to the client status monitor 34 , which is informs the buffer manager at the video streamer 2 via connection 28 . missing packets can be retransmitted . the buffer manager 25 steadily increases the transmission rate ts until a consistent pattern of packet loss occurs , indicating that the maximum bandwidth is being utilised . in the interest of maintaining a congestion free network , the transmission rate ts may then be exponentially reduced . the client status monitor 34 monitors the volume of data in the client buffer 32 such that a signal is sent via connection 28 to the buffer manager 25 at the video streamer 2 when the client buffer 32 becomes sufficiently full of data . the system of video streamer 2 and client 3 as described above allows user - friendly video streaming , i . e . the client buffer 32 enables the quality of the video to be despite variations in network conditions , which might otherwise have a detrimental effect on the overall perceived quality of the media . the operation of the present embodiment of the invention will now be described with reference to fig4 . the video streamer 2 is initialised , which involves filling the buffers 23 , 24 with a quantity of data from the encoder 1 . for a live broadcast , data is constantly fed into the buffers 23 , 24 and is subsequently discarded after an amount of time defined by the size of the buffer and the quality of data being received . a pc running browser software to browse web pages on the internet may be used to select a link to , for example , a live broadcast on a site hosted by the entity providing streamed video . being interested in viewing the particular clip or broadcast , the user clicks ( selects ) the link at 40 . the browsing software detects that streamed video data has been requested and launches the video viewing client software at 42 which embodies the client 3 . the client 3 issues a “ send data ” command at 44 via connection 28 to the buffer manager 25 , which sets switch 26 to read encoded video data from the low bit - rate data buffer 23 and requests a transmission rate of t s = 2t e . the data is transmitted to the data connection 27 and thence to the client 3 . using the example encoding bit - rate cited above of 500 kbits − 1 for r l , data flows into the network to the client at a rate of 1000 kbits − 1 . the client 3 receives the encoded video data at 46 and sends it via the packet loss detector 31 to the client buffer 32 which is supplied at the rate 2t e . when data is detected in the buffer 32 the encoded video data is promptly read out at 48 to the decoder 33 at a rate of t e . therefore the buffer 32 fills at a rate t e while the decoded data from the decoder 33 is displayed . thus the user is provided with video pictures without having to wait for the client buffer 32 to fill . the client monitor 34 waits at 50 for the quantity of r l , data in the client buffer 32 to reach a specified level , upon which a “ switch buffer ” command is sent at 52 to the buffer manager 25 at the video streamer 2 via the connection 28 . the buffer manager 25 then switches the flow of data from the low bit - rate data buffer 23 to the high bit - rate data buffer 24 and instructs transmission at a rate t s = t e . using the example encoding rate cited above , data is transmitted on the network at 1500 kbits − 1 . the client buffer 32 will then begin filling with high quality data which will be placed behind the low quality data . after a length of time the r h data will begin to be read into the decoder 33 , whereupon the user will perceive an increase in the picture quality . at this point , the client 3 has a full buffer and the user is watching images of a quality which is consistent with the capacity of the network link . the video streamer 2 can support a number of clients ( typically 1000 ). each client is initially given a unique read - out point for the start - up phase , whereupon , after equilibrium of the client buffer 32 has been reached and the video streamer 2 is supplying high bit - rate data from the buffer 24 , the read - out point can be amalgamated with other client read - out points . read - out points may have to be devolved as discrepancies in network capacity demand increasing or decreasing the transmission rate for a particular client . the skilled person will appreciate that the low bit - rate data buffer 23 should be of a size which will allow data to be read from it at a rate 2t e for a period of time which is long enough to provide the client buffer 32 with a suitable quantity of data . for example , in order to buffer 5 seconds worth of 500 kbits − 1 data at the client 3 , the video streamer 2 must supply 1000 kbits of data for 5 seconds , 500 kbits of which will be consumed by the decoder 33 per second and 500 kbits will build up in the buffer per second until 5 seconds has elapsed . therefore the low bit - rate data buffer must be able to hold at least 5 mbits of data ( 5 × 1000 kbits ), or just over 0 . 5 mb . the skilled person will appreciate that there are problems associated with ‘ tapping into ’ a stream of encoded data when data is initially read out of a buffer . the compression technology typically employed by the encoder 1 involved coding a frame of video data , termed an anchor frame or an i - frame and from this frame an estimate is made as to what the next frame will look like , this estimated frame being termed a b - frame . in this way the quantity of data representing a series of frames may be greatly reduced . however , if the first frame to be read from either of the data buffers 23 , 24 is a b - frame then the first few frames of decoded data may be unintelligible as the decoder tries to reconstruct frames based on an estimate . in a further embodiment of the invention , an extra buffer of data is supplied in parallel with the data buffers 23 , 24 consisting solely of i - frames . the first frame to be transmitted is read from the i - frame buffer and thus gives the decoder a reliable point from which to start decoding . data is then switched to be read from either of the data buffers 23 , 24 . the system allows user - friendly video streaming , i . e . the quality of the video does not fluctuate rapidly as network conditions vary , which can have a detrimental affect on the overall perceived quality of the media . in the event of packet loss being reported by the client , the system can exponentially reduce its transmission rate . this need not result in an immediate switching of the video source , as there may be data buffered at the client . immediately after the packet loss it is possible that the transmission rate is lower than the encoding rate , and the client is supplementing received data with buffered data in order to meet the demands of the video decoder , with the result that the client &# 39 ; s buffer is emptying . in the event of isolated packet loss , the system can again ramp up the transmission rate , initially slowing the rate at which the client &# 39 ; s buffer is emptying before eventually returning to a state of filling it . the skilled person will appreciate that the ability to transmit data at variable rates for a period of time enables the streamed data to be elastic and allows tcp - friendly transmission . detection of sustained packet loss by the packet loss detector 31 is indicative of network congestion . the buffer manager 25 at the video streamer 2 reacts to notification of packet loss by instructing a reduction in the transmission rate of data from the high bit - rate data buffer 24 . the high bit - rate data buffer 24 should be appropriately sized to cope with such an event . if packet loss persists at the reduced transmission rate for longer than the high bit - rate data buffer can sustain , then the buffer manager 25 will switch to supply data from the low bit - rate data buffer 23 . effective management protocols are necessary to prevent rapid switching between data buffers 23 and 24 as the data capacity of the network fluctuates , because this will cause changes in the perceived quality of the played back video . while a user will tolerate low quality playback , rapid changes in quality can be irritating to a user . there is no limit to the number of encoded data streams that may be provided to the video streamer . maximum bandwidth utilisation may be achieved thus : starting by reading data from a low bit - rate data buffer , the transmission rate is increased . finding that no packets are lost at this transmission rate , the output is switched to a higher bit - rate data buffer , whereupon the transmission rate is increased . if this transmission rate encounters no obstacle then a higher still bit - rate data buffer can be switched in , and so on until the maximum bandwidth is employed . the buffer manager 25 located at the video streamer 2 is enabled to decide how to adjust the transmission rate t s and when to switch buffers . equally , instructions may be sent from the client 3 to the video streamer 2 about transmission rate t s and which buffer to feed data from . the location of the buffer manager 25 in the embodiments described has been chosen because it is practical to situate the control centre close to the centre which is responsible for charging for the service , which in this case is the isp . the example of video data is chosen as an example of multimedia data to illustrate the above embodiments . the invention is equally suited to any other form of time - sensitive data , such as audio data or a multimedia presentation . in the embodiment described above , data is supplied by the encoder 1 . equally , compressed video data may be held in a library of program data files , for example a library of feature films , which may be accessed when required . the video streamer 2 may be remote from the encoder 1 , such that the video streamer 2 and the encoder 1 are connected via the internet . it is likely that the video streamer 2 would be operated by an internet service provider ( isp ) and remote connection of the video streamer 2 and encoder 1 , would allow the isp to make content available to the client from many encoders . | 7 |
referring to fig1 the present invention is practiced in a miniature ion mobility spectrometer ( ims ) 10 employing a pulsed corona discharge ion source as shown in fig1 . fig2 shows a second miniaturized embodiment of the apparatus featuring a microelectronic cpu 51 . in fig1 and 2 , the device has a cylindrical body 11 comprised of ten ( 10 ) stacked , annular metal electrodes 12 - 19 , 22 and 23 which are separated by annular spacers 21 ( 5 - mm thick and 8 mm id ) of a dielectric material such as teflon . this forms a drift channel 24 which can be in the range from 1 . 7 mm - 2 . 5 mm in diameter and 35 - 50 mm in effective length . in fig1 the drift channel is specifically 2 . 5 mm in diameter and 47 mm in length , respectively . nine miniature resistors ( not shown ), each with 2 mω resistance , 1 % tolerance , are connected between the electrodes 12 - 19 , 22 and 23 to form a voltage divider . the first electrode 12 is biased with a power supply 20 to provide an ion drift voltage , with the voltage being distributed to the intermediate electrodes 13 - 19 , 22 and 23 through these resistors . the last electrode 23 is connected to an electrical ground 40 . the next to the last electrode 22 is connected to a 470 - pf capacitor 39 to suppress transients . an ion detector electrode 25 is located in the drift chamber 24 between the last electrode 23 and the next to last electrode 22 . positive or negative potentials can be applied to the detection electrode 25 for detecting positive and negative ions , respectively . a nickel - tipped electrode 26 of non - radioactive ( non - doped ) material with an end radius of curvature of approximately 25 μm is mounted at the entrance of the drift chamber 24 . the second drift channel electrode 13 is used as the counter electrode for corona discharge with the distance to the tip 26 being larger than the threshold distance for discharge zone as illustrated in fig5 . the corona - producing tip 26 , together with the second electrode 13 of the ims channel , formed a tip - ring corona discharge element . a sample gas is supplied from reservoir 38 in fig1 through a flow meter 37 to an inlet into the corona discharge end of the drift chamber 24 . a carrier gas , in this case , nitrogen , is supplied from a source 35 through a filter 34 and a second flow meter 33 to an inlet into the detection end of the drift chamber 24 . these gases exit the drift chamber through valve 41 and outlet 42 . in fig2 where parts similar to fig1 have the same number , a sample gas is received from a source 43 , while dry air enters from a supply 53 into an entrance at the opposite end of the drift chamber 24 . the dry air includes both drift gas and reactant gas . all of these gases exit from exit 42 . a corona is produced at the electrode 26 by applying an electrical pulse having a width of from 40 ns to 100 μs , a pulse height varying from 0 . 2 - 3 . 3 kv and a repetition rate ( frequency ) of 20 hz . the pulse is generated as a base dc voltage component originating at a high voltage source 36 and a varying pulse component generated by a pulse generator comprising high voltage source 29 , amplifier 28 and pulse generator 27 , which generates pulses on the order of 5 volts before they are amplified . these pulses are summed with a base dc voltage through capacitor c 1 . the resulting amplified high - voltage pulse is applied to the corona tip electrode 26 , which is seen in fig1 . during the high voltage pulse , ions are generated in the vicinity of the tip 26 . after the pulse , the ions move along the drift channel 24 through the carrier gases under the influence of the drift field bias provided by voltage supply 20 . the corona discharge pulse also provides a start signal for timing the ion mobility movements . for each pulse , ions are separated according to their travel time to reach the ion detector 25 located at the end of the channel 24 . there , an ion current is produced and is transmitted to a current amplifier 30 connected to electrode 25 . the time difference between the start signal and arrival of ions is detected by a time - to - digital converter ( tdc ) 31 and is transmitted to a computer 32 for analysis . if a digital oscilloscope 31 is used instead of time - to - digital converter 31 , the start pulse triggers the oscilloscope . the ion arrival signal is recorded by the scope and sent to the computer 32 . the detector 25 is connected to an amplifier 30 in fig1 which amplifies the signals . the oscilloscope is connected to an apple macintosh computer 32 running a labview application program in fig1 . this is a lab prototype embodiment for demonstrating the operation of the invention . in fig2 the components in fig1 are designed for reduced size in a commercial embodiment . ion mobility spectra of both positive and negative ions were measured as a function of pulse width . for positive ions , the ion current increased with pulse width and saturated . for negative ions , the ion current peaked rapidly and then decayed with increased pulse width . ion mobility spectra of negative ions produced by pulsed corona discharge and by ionization of air were measured as a function of drift bias voltage from − 600 vdc to − 1700 vdc as seen in fig3 . the pulses had 1 . 08 μs width and + 2600v amplitude . the sample air was at atmospheric pressure and room temperature . the drift gas was n 2 , which was fed from a source 35 through a filter 34 and flow meter 33 at the detector end of the ims channel 24 with a flow rate of 20 sccm ( standard cubic centimeter per minute ). a typical mobility spectrum of positive ions generated by pulsed corona discharge ionization of air is shown in fig4 . for producing positive ions , the pulse potential applied to the tip 26 was also positive , the same polarity as used for generating negative ions , with a height of 3100 vdc and a width of 14 . 5 μs . the corona discharge properties depend on the distance between the tip 26 and the counter electrode 13 . the counter electrode can be either a ring or a tip . this is illustrated in fig5 . for distances less than 1 . 96 mm , no ionization occurred until a threshold of potential , about 1900 vdc was reached . at and above the threshold , spark breakdown occurred , which preceded the establishment of a stable corona . the voltage threshold was found to increase as a function of distance , as shown in fig5 up to 2400 volts at 1 . 96 mm . stable corona discharge conditions could not be found in this distance range . when the distance was larger than 1 . 96 mm , corona discharge occurred at a threshold that was a function of the drift bias . corona discharge was also generated by a combination of a base dc potential in combination with a pulsed voltage potential . as seen in fig1 a dc voltage supply 36 is connected to a dc pulse generator 27 , an amplifier 28 and a second dc supply 29 through capacitor c 1 . as seen in fig2 dc voltage supply 45 is connected to a pulse amplifier 47 and a pulse height control circuit 48 through a capacitor 46 . in fig2 the pulse is commanded by the microelectronic cpu 51 through a digital - to - analog converter 49 . the base dc potential , which varied from 0 to 3000 volts , was superimposed on the pulsed potential . the combined potentials permit independent variation of the dc potential , pulse height , and pulse width to the corona tip . for a given pulse height , the ion mobility spectrum current can be measured as a function of dc bias voltage . for a higher pulse voltage , the current exhibited a threshold for the dc bias and increased to a saturation level . the dc threshold was found to linearly decrease from 3000 vdc to 200 vdc as the pulse height was increased from 200 vdc to 3000 vdc , as shown in fig6 . therefore , ions could be generated with lower voltage pulses if the dc base voltage were raised . the detector 25 in fig2 is connected in close proximity to an amplifier 44 which amplified the small signal . this signal is then digitized by digitizer 50 to filter noise , and is then read by the microelectronic cpu 51 . for a specific substance , thresholds are set , and if a threshold is exceeded , a visual indication is provided to a user through an alarm display 52 , such as by illuminating an icon or changing the color of an object on a display screen . the electronic circuits 20 and 44 - 52 in fig2 can be made quite compact and can be mounted on circuit boards . these can be packaged with the drift chamber body 11 in a package the size of a lightweight notebook computer of the type having a titanium case . the pulsed corona ionization source of the present invention eliminates the need for the ion gate of the prior art near the ion source . it also provides for a smaller drift chamber and a smaller body for housing the drift chamber . the invention also provides a method for timing the movement of the ions between the source and the detector . the use of a dc voltage comprising a pulse element and a base voltage element reduces the pulse component , which reduces noise and power consumption . this has been a description of detailed examples of the invention . it will apparent to those of ordinary skill in the art that certain modifications might be made without departing from the scope of the invention , which is defined by the following claims . | 6 |
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . referring to fig1 , a prior art transmitter 10 is shown for generating a composite quadrature phase shift keyed ( qpsk ) signal from a satellite 12 . the transmitter typically forms a portion of a transponder that is carried by the satellite . the satellite in this example is a positioning satellite of the gps iif system , although it will be appreciated that the teachings of the present disclosure could be applied to any satellite transponder where it is desired to achieve a high level of control and accuracy over the downlink power used for the downlink signals transmitted from a transponder of a satellite . in this example the composite qpsk signal is received by a user receiver and used to determine a geographic location of the user receiver . however , due to temperature variations experienced by the transponder , fluctuations may exist at the input to its radio frequency ( rf ) amplifier that ultimately cause phase delay changes in the transmitted composite qpsk signal . in fig1 the composite qpsk signal is generated by the prior art transmitter 10 by initially receiving a carrier signal from a frequency synthesizer at the input of a power divider 14 . the power divider 14 splits the carrier signal into two signals that are transmitted from outputs 16 and 18 , where the two signals have the same power . a second power divider 20 receives the carrier signal at its input 22 and further splits the power such that all components of the carrier signal that are at a zero degree phase angle are applied to output 24 thereof , and all components of the carrier signal that are 90 degrees out of phase from the zero phase are applied to output 26 . the signal from output 26 is then applied to a binary phase shift keyed ( bpsk ) q channel modulator 28 that modulates the component of the carrier signal in accordance with information from navigation data code d1 ( t ) from a navigation data unit ( ndu ), which is not shown in fig1 . similarly , the component of the carrier signal at output 24 is applied to a bpsk i channel modulator 30 that also receives code d3 ( t ) from the ndu . the q channel modulator 28 outputs a modulated carrier signal to a first variable attenuator 32 that is controlled by an external controller ( not shown ). the first variable attenuator 32 outputs a signal represented by the designation “ a1pk ”, which represents an attenuated version of the peak output from the q channel modulator 28 , to an input 34 of a power combiner 36 . similarly the i channel modulator 30 generates an output to a third attenuator 38 , which in turn generates an attenuated signal designated by the notation “ a3pk ”, which is the attenuated version of the peak output from the i channel modulator 30 . the attenuated signal a3pk signal is likewise applied to an input 38 of the signal combiner 36 . the output of the signal combiner 36 represents a partial formation of the qpsk signal containing the carrier being modulated with code 1 on the q channel and the carrier being modulated with code 3 on the i channel . the signal at output 18 of power divider 14 is also applied to a power divider 20 a which as power divider 20 , also has one output at zero degrees phase shift with respect to the input and the second output at a 90 degree phase shift with respect to the input forming an i channel and a q channel respectively . components in the upper half of the drawing in common with those in the lower part of the drawing have been designated with the same reference numbers , but that also include a prime “′” symbol . the only difference being that code d 4 ( t ) is applied to the i channel modulator 30 a and code d 2 ( t ) is applied to the q channel modulator . the output from the signal combiner 36 a represents the other partial formation of the qpsk signal containing the carrier being modulated with code 2 on the q channel and the carrier being modulated with code 4 on the i channel . outputs from combiners 36 and 36 a are routed to a final combiner 40 where the complete composite qpsk signal is finally formed containing d1pk = a1pk + a2pk and d2pk = a1pk − a2pk on the q channel and d3pk = a3pk + a4pk , and d4pk = a3pk − a4pk in the i channel . from fig1 it will be apparent that changing just the level of attenuator 32 or 32 a will affect both d1pk and d2pk , since a1pk is used in forming both d1pk and d2pk . similarly , changing either of one of attenuators 38 and 38 a will have the affect of altering the value of both d3pk and d4pk . thus , changing the power level of the modulated signal associated with any one of the four navigation codes will affect the power level of the modulated signal associated with the other codes . the system and method of the present disclosure provides a unique approach to solving the complex problem of adjusting the code powers for each of the four navigation data codes used to make up the composite qpsk signal . referring now to fig2 , a system 100 in accordance with one embodiment of the present disclosure is provided for adjusting the code powers of each one of the four navigation data codes d 1 ( t ), d 2 ( t ), d 3 ( t ) and d 4 ( t ) used in constructing the composite qpsk signal . the system 100 initially uses a sample of the composite qpsk signal that is output from the transmitter and feeds the sample to an input 102 of a power divider 104 . the power divider 104 generates two signals at its outputs 106 and 108 that are of equal power and applies one of the two signals to a phase detector 110 of a first subsystem 112 . the other one of the signals from output 108 is applied to a phase detector 110 a of a second subsystem 112 a . since subsystems 112 and 112 a are functionally identical , only the operation of subsystem 112 will be provided , with it being understood that the components of subsystem 112 a operate in identical fashion to those of subsystem 112 . furthermore , the components of subsystem 112 a in common with those of subsystem 112 have been designated with the same reference numbers used for subsystem 112 but also include a prime “′” symbol . subsystem 112 may be termed the “ q channel ” and subsystem 112 a may be termed the “ i channel ”. a power divider pd 1 is used to receive the carrier signal from a local oscillator and to split it into two signal components of equal power , with those components that are at zero degrees phase being applied to the phase detector 110 a of subsystem 112 a and those that are 90 degrees from zero phase being applied to the phase detector 110 . the signal at the output of the phase detector 110 is routed to a low pass filter 114 . the signal components of the demodulated signal output from the phase detector 110 will correspond to the codes on the q - channel and those at the output of phase detector 110 a to the codes on the i - channel . the low pass filter 114 removes the residual carrier from the demodulated signal and generates a filtered signal to an input of a peak detector 116 . the output from the peak detector 116 represents the peak of the rf signal on the q - channel applied to the power combiner 104 . the output from peak detector 116 a represents the peak of the rf signal on the i - channel , which is also applied to the power combiner 104 . the output of the peak detector 116 is applied to two sample and hold circuits 118 and 120 . an exclusive or - gate 122 is used to receive the navigation codes d 1 ( t ) and d 2 ( t ) on its inputs , and its output is coupled to each of the sample and hold circuits 118 and 120 . an inverter 124 is interposed between the output of the exclusive or - gate 124 and the sample and hold circuit 118 . when the d 1 ( t ) and d 2 ( t ) codes are different the exclusive or - gate 122 outputs a logic “ 1 ” level signal . this turns on the sample and hold circuit 120 , and turns off sample and hold circuit 118 because of inverter 118 . when the d 1 ( t ) and d 2 ( t ) codes are the same , the output of the exclusive or - gate is a logic 0 level , which turns on sample and hold circuit 118 and turns off sample and hold circuit 120 . the d 1 ( t ) and d 2 ( t ) codes are received from the ndu unit ( not shown ). when sample and hold circuit 118 is active it captures the peak of the sampled d 1 ( t ) signal , which can be designated as “ d1spk ”. this signal can be viewed as being equal to the sampled sum ( a1spk + a2spk ) of the peak outputs from attenuator 1 ( labeled 32 in fig1 ) and attenuator 2 ( labeled 32 a in fig1 ). the signal d1spk is then passed through a low pass filter 126 and then through an analog - to - digital ( a / d ) converter 128 . the output from the a / d converter 128 is a digital representation of the d1spk signal . similar operations occur at sample and hold circuit 120 which generates an output that is the sampled peak of the d 2 ( t ) navigation code , and which can be labeled as “ d2spk ”. the value of d2spk will also be equal to a1spk − a2spk , which is the difference between the sampled , peak outputs from attenuators 1 and 2 ( components 32 and 38 ) in fig1 . this signal is input to a low pass filter 130 and then a / d converted by a / d converter 132 . thus , the output of the a / d converter 132 represents a digital value for d2spk . the i channel subsystem 112 a operates identically to the q channel subsystem 112 described above but rather operates on the in - phase signal components of the sampled composite qpsk signal . thus , the exclusive or - gate 122 a receives codes d 3 ( t ) and d 4 ( t ) on its inputs to control the on / off operation of the sample and hold circuits 118 a and 120 a . sample and hold circuit 118 a generates the sampled , peak signal for code d 3 ( t ), which is labeled as d3spk in fig2 . the value d3spk is equal to a3spk + a4spk , which are the sampled , attenuated outputs from attenuators 3 and 4 ( components 38 a and 32 a respectively in fig1 ). similarly , the output of sample and hold circuit 120 a is the sampled , peak of code d 4 ( t ), which is labeled in fig2 as d4spk , which is equal to a3spk − a4spk . thus , the outputs d1spk , d2spk , d3spk and d4spk represent the actual peak , sampled values for each of the navigation codes d 1 ( t ), d 2 ( t ), d 3 ( t ) and d 4 ( t ). these values are obtained essentially in real time by the system 100 . a processor 140 , which may be a microprocessor , is used to receive the outputs from each of the a / d converters 128 . the processor 140 also receives the uploaded ( i . e ., “ commanded ”) d1 , d2 , d3 and d4 code power levels that need to be used by the transmitter 10 ( fig1 ) to form the composite qpsk signal . the processor 140 calculates the power level correction that needs to be applied to each of attenuators 1 - 4 ( components 32 , 32 a , 38 and 38 a ) of the transmitter 10 to bring the actual power levels for each of the d 1 ( t ), d 2 ( t ), d 3 ( t ) and d 4 ( t ) codes into conformity with their uploaded ( i . e ., commanded ) code power levels . the formulas used for calculating the corrections signals for attenuator 1 and attenuator 2 are labeled as equations 1 and 2 , respectively in fig3 b . fig3 a shows the derivation for equations 1 and 2 . the equations used for the corrections needing to be applied to attenuators 3 and 4 are the same as equations 1 and 2 , respectively . referring briefly to fig4 , 5 and 6 , one example is shown using a mathematical computer simulation model 200 generated with the vissim / comm ™ computer simulation program available from visual solutions , inc . of westford , mass . the fig4 and 6 include mathematical operations that correspond to the functions of certain components of the system 100 , and those operations have been designated by using the reference numbers used to describe the system 100 , but designated with a prime “′” symbol , so that the reader is better able to correlate the mathematical operations that the simulation model 200 implements to the operations and components of the actual system 100 . boxes 117 in fig4 and 6 represent mathematical algorithms that are used to convert the peak signal to dbm values for codes 1 and 2 . the boxes that include the terminology “ l = 31 pn ” and “ l = 63 pn ” convey that the lengths of the pseudorandom codes used are 31 bits and 63 bits respectively . it will also be noted that the codes have different frequencies of 1 hz and 2 hz . so in this simulation example , the two codes being operated on are different in both length and frequency , which adds to the complexity of the simulation . the simulation model 200 shows how the present system and method corrects code power errors for just the q channel subsystem 112 of fig2 ( i . e ., handling just the d 1 ( t ) and d 2 ( t ) codes ). it will be appreciated that the i channel subsystem 112 a operates in identical fashion on the d 3 ( t ) and d 4 ( t ) codes . in fig4 , attenuators 1 and 2 ( components 32 and 32 a in fig1 ) are set for 1 . 8 db and 15 . 7 db respectively , as indicated at the left side of the figure . the uploaded code 1 has a scaled power of 7 dbm and uploaded code 2 has a scaled power of 4 dbm , as indicated at the far right side of the figure . the measured , scaled power of code 1 ( in dbm ) is 6 . 77631 , which is significantly off from the uploaded scaled code power of 7 dbm for code 1 in fig4 . similarly , the measured ( i . e ., actual ) scaled power of 3 . 22124 dbm for code 2 is significantly off from the uploaded code power of 4 dbm for code 2 . fig5 illustrates the calculations that the processor 140 of the system 100 performs , using the just - mentioned uploaded and measured scaled power measurements for codes 1 and 2 , to generate the needed code power corrections signals . in fig5 , the correction signal needed to be applied to attenuator 1 ( component 32 in fig2 ) to bring the measured , scaled power for code 1 into close conformity with the 7 dbm uploaded code power value is represented by δa tt1 , which in this example produces a value of − 0 . 457 dbm . this is the change that has to be applied to attenuator 1 to bring the measured , scaled code power ( 6 . 77631 dbm in this example ) up to the uploaded , scaled code power of 7 dbm . similarly , δa tt2 represents the code power level change that has to be applied to attenuator 2 ( component 32 a in fig4 ) to bring the measured , scaled code power for code 2 up from 3 . 22124 to the uploaded code power value of 4 dbm for code 2 . referring to fig6 , applying the δa tt1 and δa tt2 values of − 0 . 457 db for code 1 and 0 . 833 db for code 2 , respectively , shows a new measured , scaled code power of 7 . 02962 dbm for code 1 and a new measured , scaled power for code 2 of 3 . 97621 db . these values are a significant improvement over the uncorrected , measured scaled code power values produced in fig4 and cause the measured , scaled code powers to virtually exactly match the uploaded code powers . it is to be noted that both changes should be applied simultaneously to both attenuators to obtain the desired power on both codes since each attenuator interacts with the power of both codes . in other words , these power settings are not independent of each other . referring to fig7 , a flowchart 300 is illustrated that summarizes major operations of the system 100 . at operation 302 a sample of the composite qpsk modulated signal emanating from the satellite transponder output is obtained . at operation 304 the four code components ( d 1 ( t ), d 2 ( t ), d 3 ( t ) and d 4 ( t )) of the composite qpsk signal are separated using demodulators 110 and 110 a in fig2 . at operation 306 each of the four codes are digitally sampled and their individual code powers are measured using the processor 140 . at operation 308 , the processor 140 compares the measured code powers to their corresponding uploaded code power settings . at operation 310 the processor 140 uses the equations shown in fig3 to generate the code power correction signals needed to drive the measured code power errors essentially to zero . at operation 312 the code power correction signals are applied to the four attenuators ( components 32 , 32 a , 38 and 38 a ) in fig2 . the system and method of the present disclosure takes advantage of the fact that , at the output of the transmitter 10 , the composite qpsk signal is known . put differently , the transmitter 10 knows exactly what signals it is sending and when . this allows the implementation of a relatively inexpensive system to demodulate and measure the code power levels of each of the four navigation data codes being used to form the composite qpsk signal . the system 100 of the present disclosure provides the significant advantage of operating in real time ( i . e ., essentially instantaneously ) to monitor the composite qpsk signal , sample it , demodulate it , measure the sampled power levels of the four independent codes making up the composite qpsk signal , and to determine the needed correction values for each of the codes . the system 100 is relatively compact and relatively inexpensive to construct . while various embodiments have been described , those skilled in the art will recognize modifications or variations which might be made without departing from the present disclosure . the examples illustrate the various embodiments and are not intended to limit the present disclosure . therefore , the description and claims should be interpreted liberally with only such limitation as is necessary in view of the pertinent prior art . | 7 |
in the drawings , a designates a carding machine portion of the apparatus of the invention . cotton material such as regenerate cotton is fed at a constant rate from a hopper 1 and passed through feed rollers 2 , take in 3 , breast roll 4 , transporter 5 , strippers 6 , and walkers 7 to be thereby gradually processed and then fed into a space between a cylinder 8 and a doffer 9 . the space between the cylinder 8 and the doffer 9 is slightly increased to form processed cotton having a nap or waffle pattern on one of its surfaces . the strip of processed cotton thus formed by the carding machine a is turned by a turn - over roller 10 and further carried forward on a belt conveyor 11 . a spreader 12 is provided above a second belt conveyor 13 and arranged to spread liquid fertilizer from a front nozzle 14 and liquid binder from the rear nozzle 15 to a back side of the strip of processed cotton carried thereunder . a dryer 16 dries the strip of processed cotton with said liquid binder and liquid fertilizer on its back side while the strip is passed therethrough on the belt conveyor 13 , to produce a dried nursery cotton . a second spreader 17 therebeyond has at its bottom many equidistantly arranged nozzles 18 which leach quick drying synthetic resin liquid continuously onto the back side of the strip of nursery cotton as it emerges from the dryer 16 , to form longitudinal streaks on said strip for increasing tensile strength in the longitudinal direction . at the terminal end of the belt conveyor 13 is provided in one embodiment a take - up roller assembly 19 adapted to wind up the strip of nursery cotton . a feed roller assembly 20 delivers the strip of nursery cotton onto a belt conveyor 21 with the nep napped surfaces thereof facing upwardly . a seeder b comprising several juxtaposed seed tanks 22 is arranged above and transversely to the belt conveyor 21 so that different kinds of seeds may be sown successively under the control of motors 23 or other means from the bottom of the respective tanks 22 onto the front or upper surface of the strip of nursery cotton . a vibrator 24 vibrates the belt conveyor 21 so that the seeds sown on the surface of the strip of nursery cotton thereon will be settled stably in the nep nap . also provided above said belt conveyor 21 is a further spreader 25 adapted to spread liquid fertilizer from a front nozzle 26 and liquid binder from a rear nozzle 27 over the surface of said nursery cotton strip on which the seeds have been sown . a press bonding mechanism c bonds a non - woven fabric or similar net - like material , which is delivered from a feed roller assembly 28 , to the upper surface of the nursery cotton strip by press bonding rollers 29 . a take - up roller assembly 30 winds up the completed lawn nursery strip for transporting and storage . thus , according to the above - described sequence of the present invention , the inexpensive cotton material such as regenerated cotton fed into the carding machine a is formed into a strip of processed cotton having a nep napped , balled , or waffled surface . said strip is then turned over by the roller 10 and further carried forward on the belt conveyor 11 and beneath the spreader 12 , where liquid binder and possibly liquid fertilizer are spread over its rear surface . the strip is then passed through the dryer 16 for drying said liquid binder and fertilizer on said strip surface , thereby forming a strip of dried nursery cotton which is increased in tensile strength by said liquid binder and also impregnated with fertilizer . thereafter , quick drying synthetic resin ldiquid is continuously leached to the rear side of the strip of nursery cotton from nozzles 18 arranged at the bottom of the spreader 17 so as to form longitudinal streaks designed to increase the strip &# 39 ; s tensile strength . the thus treated strip may be wound up by the take - up roller assembly 19 before being successively delivered out from a delivery roller assembly 20 onto a further belt conveyor 21 with the napped surface of the strip facing upwards . the strip is carried by said belt conveyor 21 beneath the seeder b where various kinds of lawn seeds differing in size and weight , such as spring - sown seeds and autumn - sown seeds , and stored in the respective seed tanks 22 arranged in a row above and transversely to said belt conveyor 21 are sown uniformly while controlled by motors 23 or other means onto the napped surface of the strip which has been carried thereto , and the thus sown seeds are settled stably in the spaces between the nep naps by the vibrator 24 provided below said belt conveyor 21 , followed by additional spreading of liquid binder and liquid fertilizer over said strip surface by the spreader 25 . then a non - woven fabric or net delivered from a delivery assembly 28 of the press bonding machine c provided above the belt conveyor 21 is press - bonded to the binder - applied strip surface and the thus formed lamination is wound up by the take - up roller assembly 30 . thus , according to the present invention , it is possible to successively and automatically produce lawn nursery strips in which the seeds held in the spaces in the nap will not shift during transportation and the strip is resistant to cutting and tearing during placement and which also requires no fertilization during initial growth of the lawn . in the above - described embodiment of the present invention , the nursery strip formed with longitudinal streaks of synthetic resin on its surface from the spreader 17 is once wound up by take - up roller assembly 19 and then transferred to the feed roller assembly 20 , but is also possible to turn over the strip by using an inversion roller or other layout to carry the strip continuously to the seeder b . although various modifications might be suggested by those versed in the art , it should be understood that i wish to embody within the scope of the patent warranted hereon all such modifications as reasonably and properly come within the scope of my contribution to the art . | 0 |
fig1 shows a schematic depiction of the functional units participating in a data transfer between a data processing means zr and peripheral means lan 1 , . . . , lann . a processor cpu of the data processing means zr is connected to a main memory mem via a cpu bus . programs for the processing by the processor cpu as well as appertaining data are stored in the main memory mem . the peripheral means lan 1 , . . . , lann are connected to each other via a pci bus . i / o controllers i / o 1 , . . . , i / on control the interface between the peripheral means lan 1 , . . . , lann and the pci bus . data which are transmitted from the peripheral means lan 1 , . . . , lann to units of the main computer system zr , or from these to the peripheral means lan 1 , . . . , lann are temporarily stored in the i / o controllers i / o 1 , . . . , i / on . the cpu bus and the pci bus are connected to each other for a data transfer via a coupling means bridge . fig2 shows a schematic depiction of the functional units of the coupling means bridge . the coupling means bridge comprises two functional units a , b . the first functional unit a serves the transmission of data which are to be transmitted to a peripheral means lan 1 , . . ., lann or from this to the processor cpu on the basis of a request of the processor cpu . the second functional unit b serves the transmission of data which are to be transmitted from the appertaining peripheral means lan 1 , . . . , lann to the main memory mem or from this to the peripheral means lan 1 ,. . . , lann on the basis of a request of an i / o controller i / o 1 , . . . , i / on . the first functional unit a of the coupling means bridge comprises a temporary storage unit fifo ( first in first out ) which is connected to the cpu bus via a first module cpu - slave and to the pci bus via a second module pci - master . the temporary storage unit fifo is arranged in two submemories r , w , whereby in the first submemory r data are written by the second module pci - master and read by the first module cpu - slave . in the second submemory w of the temporary storage unit fifo data are written by the first module cpu - slave and read by the second module pci - master . the second functional unit b of the coupling means bridge comprises a temporary storage unit fifo 1 , . . . , fifon for each peripheral means lan 1 , . . . , lann connected to the pci bus , this storage unit being specific to each individual means . the means - specific temporary storage units fifo 1 , . . . , fifon of the second functional unit b are connected to the cpu bus via a third module cpu - master and to the pci bus via a fourth module pci - slave . as in the first functional unit a , the means - specific temporary storage units fifo 1 , . . . , fifon comprise a first submemory r in which data are written by the fourth module pci - slave and read by the third module cpu - master . in a second submemory w of the means - specific temporary storage units fifo 1 , . . . , fifon data are written by the third module cpu - master and read by the fourth module pci - slave . if the processor cpu requires data from a peripheral means lan 1 , . . . , lann it sends a corresponding message to an arbitration module ( not depicted ) for the cpu bus . if the arbitration module for the cpu bus allocates the master function for the cpu bus to the processor cpu , this outputs a read request to the cpu bus along with the address of the i / o controller i / o 1 , . . . , i / on allocated to the peripheral means lan 1 , . . . , lann . the master function is assigned to the processor cpu by the arbitration module for the cpu bus until the requested data are readied on the cpu bus . the first module cpu - slave of the first functional unit a recognizes the address of the i / o controller i / o 1 , . . . , i / on and transmits the read request to the second module pci - master . this subsequently transmits a message to an arbitration module ( not depicted ) for the pci bus . if the master function for the pci bus is allocated to the second module pci - master by the arbitration module for the pci bus , this outputs the read request to the pci bus along with the appertaining address of the i / o controller i / o 1 , . . . , i / on . the master function is assigned to the second module pci - master by the arbitration module for the pci bus until the requested data are held ready on the pci bus . the addressed i / o controller i / o 1 , . . . , i / on recognizes the read request directed thereto and outputs the requested data onto the pci bus . the second module pci - master takes over the data and writes them into the first submemory r of the temporary storage unit fifo of the first functional unit a . the first module cpu - slave reads the data from the first submemory r of the temporary storage unit fifo and outputs them to the cpu bus . from there the data is read by the main memory and stored at the corresponding location in the main memory mem . when the processor cpu transmits data to a peripheral means lan 1 , . . . , lann it transmits a corresponding message to the arbitration module for the cpu bus . if the arbitration module for the cpu bus allocates the master function for the cpu bus to the processor cpu , this applies a write request , and subsequently applies the data to be transmitted , along with the address of the i / o controller i / o 1 , . . . , i / on allocated to the peripheral means lan 1 , . . . , lann , at the cpu bus . the first module cpu - slave of the first functional unit a recognizes the address of the i / o controller i / o 1 , . . . , i / on and transmits the write request to the second module pci - master . it simultaneously writes the data to be transmitted into the second submemory w of the temporary storage unit fifo of the first functional unit a . the second module pci - master transmits a message to the arbitration module for the pci bus . if the master function of the pci bus is allocated to the second module pci - master by the arbitration module for the pci bus , then this outputs the write request to the pci bus along with the appertaining address of the i / o controller i / o 1 , . . . , i / on . the addressed i / o controller i / o 1 , . . . , i / on recognizes the write request directed thereto and signals its readiness to receive data to the module pci - master . the module pci master then reads the data from the second submemory w of the fifo memory of the functional unit a and outputs these to the pci bus , from which the addressed i / o controller i / o 1 , . . . , i / on takes them over . fig3 depicts a flow diagram for a data transfer between a first peripheral means lan 1 and the main memory mem , this being initiated by a first i / o controller i / o 1 . if on the basis of a request of a first i / o controller data are transmitted from the appertaining first peripheral means lan 1 to the main memory mem , the first i / o controller i / o 1 transmits a corresponding message to the arbitration module for the pci bus . if the arbitration module for the pci bus allocates the master function for the pci bus to the first i / o controller i / o 1 , this outputs the data to the pci bus along with the address at which the data are to be stored in the main memory mem . the fourth module pci - slave of the second functional unit b recognizes the address in the main memory mem and writes the data with this address into the first submemory r of the first temporary storage unit fifo 1 , which is allocated to the first peripheral unit lan 1 . data are written into the first submemory r of the first temporary storage unit fifo 1 until an upper memory fill value is exceeded . only then does the third module cpu - master transmit a message to the arbitration module for the cpu bus . if the arbitration module for the cpu bus allocates the master function for the cpu bus to the third module cpu - master , the third module cpu - master reads the data from the first submemory r of the first temporary storage unit fifo 1 and outputs them to the cpu bus along with the address at which the data are to be stored in the main memory mem until the first submemory r of the first temporary storage unit fifo 1 is emptied . the main memory mem recognizes the address and stores the transmitted data at the corresponding location in the main memory mem . fig4 a depicts a flow diagram for a read request for a data transfer from the main memory mem to a first peripheral means lan 1 , this request being initiated by a first i / o controller i / o 1 . if data are to be read from the main memory mem on the basis of a request of a first i / o controller i / o 1 , then the first i / o controller i / o 1 transmits a corresponding message to the arbitration module for the pci bus . if the arbitration module for the pci bus allocates the master function for the pci bus to the first i / o controller i / o 1 , the first i / o controller i / o 1 outputs the corresponding read request onto the pci bus along with the address of the requested data in the main memory mem . the master function is allocated to the first i / o controller i / o 1 by the arbitration module for the pci bus until the requested data are retrieved onto the pci bus ( continuation of the process , see fig4 b , mark “ ii ”). the fourth module pci - slave of the second functional unit b recognizes the address in the main memory mem and transmits the read request to the third module cpu - master along with the address of the requested data in the main memory mem . the third module cpu - master then transmits a message to the arbitration module for the cpu bus . if the arbitration module for the cpu bus allocates the master function for the cpu bus to the third module cpu - master , the third module cpu - master outputs the read request onto the cpu bus along with the address of the requested data in the main memory mem . the master function for the cpu bus is allocated to the third module cpu - master until the requested data are held ready on the cpu bus along with the address of the first i / o controller i / o 1 ( continuation of the process , see fig4 b , mark “ i ”). in addition to the data requested by the first i / o controller i / o 1 the third module cpu - master additionally requests data subsequently stored in the main memory mem ( data prefetching ). the main memory mem recognizes the read request and outputs the data requested by the third module cpu - master onto the cpu bus . the address up to which additional data from the main memory mem are written onto the cpu bus is individually adjustable for each peripheral means lan 1 , . . . , lann . the amount of the data which are read out of the main memory mem is limited by the size of the temporary storage units fifo 1 , . . . , fifon , which is specific to the individual means . fig4 b depicts a flow diagram for a data transfer from the main memory mem to the first peripheral means lan 1 , this being initiated by a first i / o controller i / o 1 . after the data requested by the first i / o controller i / o 1 and the other data from the main memory mem has been outputted onto the cpu bus ( continuation of marker “ i ” in fig4 a ), the third module cpu - master of the second functional unit b takes over the data from the cpu bus and writes the data , along with the address of the first temporary storage unit fifo 1 , into the second submemory w of the first temporary storage unit fifo 1 . the fourth module pci - slave recognizes the data requested by the first i / o controller i / o 1 and outputs these along with the address of the first i / o controller i / o 1 to the pci bus . the first i / o controller i / o 1 reads the requested data from the pci bus and forwards these to the first peripheral means lan 1 . if the first i / o controller i / o 1 requests the other data , then these are promptly written onto the pci bus on the basis of a new read request by the fourth module pci - slave . but if the first i / o controller i / o 1 requests data which are not temporarily stored in the second submemory w of the first temporary storage unit fifo 1 of the second functional unit b , then the other data are deleted from the second submemory w . the invention is not limited to the particular details of the method depicted and other modifications and applications are contemplated . certain other changes may be made in the above described method without departing from the true spirit and scope of the invention herein involved . it is intended , therefore , that the subject matter in the above depiction shall be interpreted as illustrative and not in a limiting sense . | 6 |
fig1 shows a general - purpose buffer amplifier with an output stage according to the present invention . this example of the output stage is designed to have an output range of - 10 volts to + 10 volts with a current capability of 10 milliamperes into 1 kilohm . it is intended that the circuit be capable of withstanding a 300 - volt overvoltage appearing across its output terminals . the input signal appears at the left of r26 , and the output - stage output appears at the junction of diodes d56 and d60 . resistors r42 , r46 , r48 , r50 and r72 constitute a bias network both for pnp transistor q52 and for npn transistor q64 . due to the fact that the circuit depends only on operational amplifier 28 for its accuracy , q52 and q64 can be chosen for their high breakdown voltages alone . in order that amplifier transistors q52 and q64 have approximately the same quiescent operating points , r42 has the same value as r72 , and r46 has the same value as r50 . the wiper of potentiometer r48 is used to adjust the operating points of q52 and q64 so that the output voltage at the junction of d56 and d60 is zero when the voltage at the ouptut terminal of operational amplifier 28 is zero . resistors r44 and r74 provide negative feedback to transistors q52 and q64 , respectively . this feedback acts to limit the maximum current that either amplifier transistor can carry to approximately 15 milliamperes , and this limitation insures that the amplifier transistors are not damaged due to internal power dissipation when the output is subjected to an overvoltage that has an amplitude insufficient to cause associated protective circuitry to turn off the transistor . q52 constitutes part of a transistor amplifier in which r42 , r44 , r46 , r48 , r50 , r72 , and the + 15 - volt and - 15 - volt sources constitute a bias circuit . r44 is a first resistive path between a first constant - voltage source , the +.- volt source , and the emitter of a first transistor , q52 . a second resistive path between a first constant - voltage source and a second constant - voltage source , the - 15 - volt source , comprises r42 , r46 , r48 , r50 and r72 ; it contains the wiper of r48 , which is a first node communicating with the output terminal of an amplifier , operational amplifier 28 , and the junction of r42 and r46 , which is a second node that communicates with the base of the first transistor . q64 constitutes part of another transistor amplifier in which r42 , r46 , r48 , r50 , r72 , r74 , and the + 15 - volt and - 15 - volt sources constitute the bias circuit . r74 is the first resistive path , and r42 , r46 , r48 , r50 , and r72 constitute the second resistive path , the wiper of r48 being the first node and the junction of r50 and r72 being the second node . capacitors c32 and c58 depend upon the characteristics of operational amplifier 28 and the input and load impedances seen by the circuit . their purpose is to prevent instability by reducing the gain of the circuit at those frequencies at which phase shift would cause positive feedback . d56 and c58 together constitute an output circuit associated with the q52 transistor amplifier , while d60 and c58 together constitute an output circuit associated with the q64 transistor amplifier . capacitors c10 and c12 provide power - supply filtering . assuming the condition of a zero - volt output from operational amplifer 28 , the voltage - divider effect of r42 , r46 , r48 , r50 , and r72 causes a 12 . 4 - volt potential at the base of q52 and a - 12 . 4 - volt potential at the base of q64 . the contribution of the currents at the bases of q52 and q64 was ignored in arriving at these potentials , since they are negligible in comparison with the voltage - divider current . the current at the output of operational amplifier 28 was also ignored because only a small current is necessary to balance transistors q52 and q64 . assuming silicon transistors , the emitter voltage of q52 is 13 volts , and the emitter voltage of q64 is - 13 volts , which means that approximately 7 . 4 milliamperes flows through r44 and r74 . in this quiescent state , it can be seen that the potential at the p side of d56 is 0 . 6 volt due to its diode drop , and zener diode d54 does not conduct because the voltage drop across it is approximately 14 . 4 volts , which is below its turn - on voltage of 39 volts . similarly , d62 also does not conduct . as a result , no bias current flows in the bases of q36 and q70 , so they are not conducting and therefore not contributing to the current in the bias network for q52 and q64 . the zero - volt signal at the junction of d56 and d60 is fed back through feed - back resistor r34 to the plus input terminal of operational amplifier 28 . since a zero - volt output from operational amplifier 28 has been assumed , it can be inferred that the input voltage appearing at the minus input terminal of operational amplifier 28 is the same as that at its plus input terminal , which is zero volts by assumption . with the feedback and input signals both at zero volts , diodes d18 , d20 , d22 , and d24 are all back biased and only contribute a neglibible amount of current to the rest of the circuit . if a new signal of + 10 volts , which is the limit to which the preferred embodiment is designed , appears at the input to the buffer amplifier , a more negative signal is generated at the output terminal of operational amplifier 28 . as a result , more current is drawn through the r42 - r46 - r48 portion of the bias circuit , and less current flows from r48 to r50 and r72 . thus , the base voltage of q52 decreases , causing it to draw more current through r44 . since less current is flowing through r72 , q64 is made less conductive , causing less current to flow through r74 . the difference between the current in r44 and that in r72 appears in the load impedance , causing its voltage to increase . this voltage is in turn fed back through feedback resistor r34 to the plus input of amplifier 28 , where it is compared with the input voltage . since operational amplifier 28 amplifies the difference between the feedback signal and the input signal , operational amplifier 28 drives the bias circuit to a point at which the voltage across r25 equals the signal at the negative input terminal of amplifier 28 . in the unity - gain embodiment , r25 is infinite , so the signal across it is that of the output - stage output . accordingly , the 10 - volt input signal appears at the output of the buffer . again , the voltages across d54 and d72 are not sufficient to turn them on , so q36 and q70 do not contribute to the operation of the circuit . if the buffer is to be operated as other than a unity - gain amplifier , the output voltage is divided across r34 and r25 , and the output signal is then equal to the input multiplied by ( r34 + r25 )/ r25 . ( this , of course , assumes an input small enough to avoid saturating q52 .) if it is assumed that there is a 1 - kilohm load at the output terminal of the buffer amplifier , then under the 10 - volt - input assumption there must be a 10 - milliampere difference between the collector current of q52 and the collector current of q64 if the circuit is set up for unity gain . in order to effect this change , operational amplifier 28 draws aproximately an extra 0 . 75 milliampere and changes its output voltage by something under 8 volts . this is well within the capabilities of most commercial operational amplifiers . the collector voltage of q52 is approximately 10 . 6 volts , and its emitter voltage is approximately 11 . 6 volts , so q52 is still biased to operate in its active region . q64 has an emitter voltage of around - 14 . 4 volts , so it is not turned all the way off . this discussion shows that all the elements of the circuit operate within their limits at the voltage and current limits of the circuit , so the circuit meets its objective of high current capability . in addition to high current capability , a protective function is also an objective of the circuit . this function can be observed by assuming a large overvoltage at the output terminal . an overvoltage potential impressed between ground and the output terminal of the buffer amplifier finds no current path into the upper half of the circuit because d56 is back biased . there is also no current path from the circuit output terminal to the operational - amplifier output terminal through the lower circuit because the collector - base junction of q64 is back biased , preventing current flow through that path . accordingly , operational amplifier 28 is protected from the overvoltages . however , even though operational amplifier 28 is protected , serious power dissipation in q64 caused by a large overvoltage could damage q64 , possibly causing the collector - base junction of q64 to fail short . this , of course , would remove the protection afforded operational amplifier 28 by q64 . r74 is included to alleviate this problem , as are r74 and its associated circuitry . when an over - voltage of a magnitude less than 25 volts appears on the output , operational amplifier 28 senses it and attempts to reduce it by the normal circuit action of causing q64 to draw more current . to keep this current limited so that q64 does not overheat , negative feedback is introduced by emitter resistor r74 . the potential developed across this resistor opposes the driving potential from operational amplifier 28 so that the current through q64 is limited to about 15 milliamperes , even when the output of operational amplifier 28 is at its highest potential . this limits the internal power dissipation of q64 to 0 . 6 watt , which is well within its rating . should the output overvoltage increase to a magnitude greater than 25 volts , there is at least a 40 - volt potential difference between the negative source voltage and the circuit output . this is sufficient to turn on the zener diode , allowing sufficient current to flow into the base of q70 to cause it to turn all the way on . this reduces the base potential of q64 sufficiently to turn it off . accordingly , the large power dissipation in q64 is eliminated , and q64 is able to withstand its full rated breakdown voltage . this points up one of the advantages of the circuit , which is that , because the accuracy of the circuit is determined almost completely by the accuracy of operational amplifier 28 , q52 and q64 can be chosen for their large breakdown voltages alone . commercial complementary transistors capable of withstanding 315 volts in the configuration of this specification are readily available . symmetry considerations indicate that protection would also result if a large negative overvoltage were to appear at the output terminal of the output stage . thus , d54 , r38 , r40 , q36 , and the + 15 - volt source together constitute a means for eliminating base bias voltage from the first transistor , and d62 , r66 , r68 , q70 and the - 15 - volt source also constitute such a means . q36 and q70 are both examples of the &# 34 ; second transistor &# 34 ; mentioned in the claims , while the d54 - r40 and d62 - r66 combinations are both examples of the &# 34 ; second current path &# 34 ; in the claims . the input terminals of operational amplifier 28 are also protected from output overvoltages by the circuit of the preferred embodiment . if a - 300 - volt potential is assumed at the circuit output terminal , a potential difference of approximately 285 volts results across r34 , the feedback resistor , because forward - biased diode d24 allows a - 15 . 6 - volt potential to be applied to the left side of r34 . because the tendency of the overvoltage is to draw the source voltage more negative than its rated voltage , the source tends to stop sinking current . if it were to stop completely , the r34 - r16 combination would divide the 300 - volt potential down to a potential less negative than - 15 volts , which would make the power supply start sinking current again . an equilibrium between these tendencies results in a - 15 - volt potential at the source terminal and a - 15 . 6 - volt potential at the d22 - d24 junction . thus , d22 , d24 , r14 , r16 , and the + 15 - volt and - 15 - volt sources constitute a clamping circuit . in the context of this clamping circuit , the + 15 - volt and - 15 - volt sources constitute first and second threshold - voltage sources . because of this protective function of r16 , the clamping puts no constraints on the power - supply specifications , and the 1 . 6 - watt dissipation in r34 is well within its 3 - watt capacity . also , the potential seen at the positive input terminal of operational amplifier 28 is - 15 . 6 volts , which does not constitute a very severe constraint on the specifications of the operational amplifier . symmetry considerations 1indicate that input protection will also be afforded if a large positive overvoltage were to appear at the buffer output terminal . similarly , r26 , in conjunction with d18 and d20 , provides the same protection from input overvoltages that r34 , in conjunction with d22 and d24 , provides from output overvoltages . this protection is obtained as long as r26 and the output impedance of the previous stage add to at least 42 kilohms , the amount of resistance required to drop a 300 - volt overvoltage to 15 volts when used with r14 or r16 as a voltage divider . a final refinement on this circuit can be achieved by buffering the input of the operational amplifier . overvoltages appearing at the output terminal of the output stage cause signals to be seen at the plus input terminal of the operational amplifier . this affects the current flow into the minus terminal , causing a resulting signal to occur across the output impedance of the preceding stage . the overvoltage can thereby affect the signal that is seen by the other loads of the preceding stage . in order to preclude this overvoltage feedback , the embodiment of fig2 can be employed . this embodiment uses noninverting amplifier 11 to buffer the input , providing an output impedance sufficiently low to essentially eliminate the effect of the overvoltage on the signal from the preceding stage . in addition , this arrangement permits one to set the gain by choosing r8 and r9 , which can be picked for their tracking ability , rather than attempting to choose an r25 ( see fig1 ) that tracks 3 - watt resistor r34 . with the exception of the additional buffering , the fig2 circuit is identical to that of fig1 . it is therefore apparent that the output stage of the present invention accomplishes the objective of affording an accuracy dependent almost exclusively on the characteristics of the operational amplifier while providing overvoltage protection without serious limitations on output current . | 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.