text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
fig1 is a schematic diagram of one embodiment of the present invention . input terminal 23 - 1 of circuit 40 is connected to output lead 21 of digital circuitry 20 having a potentially variable propagation delay . delay block 26 includes a plurality of delay lines , one of which is selected by multiplexer 36 . a particular delay line of delay block 26 is selected by multiplexer 36 so that a substantially constant propagation delay is provided between input terminal 19 of digital circuitry 20 and output terminal 39 , regardless of the amount of propagation delay provided by digital circuitry 20 . although delay block 26 can in practice contain any number of delay lines , delay block 26 of fig1 is shown having three such delay lines 42 , 44 , and 45 . ring oscillator 25 is a gated ring oscillator which provides to counter 37 an output signal having a frequency dependent upon the propagation delays of gates 33 , 34 , and 35 forming ring oscillator 25 . generally , circuit 20 and circuit 40 are constructed in the same piece of semiconductor material , and thus share the same power supply , the same process factors , and are at the same temperature , and thus the gate delays of gates 33 , 34 , and 35 are substantially equal and are equal to the propagation delays provided by the gates forming digital circuit 20 and the propagation delays provided by the gates of delay block 26 . counter 37 receives the output signal from ring oscillator 25 . the frequency of the signal received by the counter 37 is the actual frequency of the signal of the oscillator 25 , rather than a relative or comparison frequency as in the prior art . the counter 37 provides an output signal on port 41 which is stored in latch 50 and which in turn causes multiplexer 36 to select a particular delay line within delay block 26 having a propagation delay which corresponds to that delay necessary to provide a fixed propagation delay between input lead 19 of digital circuitry 20 and output terminal 39 . in response to a precise clock signal ( typically an externally provided crystal based clock signal ), control means 43 provides control signals which control the gating of ring oscillator 25 , the enabling and resetting of counter 37 , and the operation of latch 50 . control means 43 is itself enabled by an external controller enable input . circuit 40 has several phases during each cycle of its operation , as shown in table i . during the first phase , the gate ring oscillator signal goes high , thereby enabling ring oscillator 25 which begins to oscillate . then , the enable counter singal goes high in order to enable counter 37 , thereby causing counter 37 to count the pulses provided by ring oscillator 25 . the gate ring oscillator signal then goes low , thereby disabling ring oscillator 25 , causing counter 37 to cease incrementing its count . the latch count signal then goes high in order to enable latch 50 , thereby causing latch 50 to store the count provided by counter 37 . enable latch input terminal 13 is provided to allow coordination / synchronization between delay compensation circuit 40 and digital circuitry 20 . this coordination with digital circuitry 20 is necessary so that multiplexer 36 does not switch from a first delay element to a second delay element while a signal is propagating through the first delay element , thereby losing that signal . the clear counter signal then goes high causing counter 37 to be reset to zero . at this time , if required , the cycle begins anew . thus , periodically latch 50 is updated with a count provided by counter 37 which is representative of the frequency of oscillation of ring oscillator 25 which in turn is indicative of the propagation delays provided in the circuit , and thus the desired delay path of delay block 26 . the count stored in latch 50 serves to control multiplexer 36 which selects the desired delay path in delay block 26 . one example of a typical ring oscillator which functions in a similar fashion as ring oscillator 25 in fig1 is shown in fig2 . the signals provided on leads 55 , 56 , and 57 are shown in the voltage versus time waveforms of fig3 a , 3b and 3c , respectively . when the signal on lead 55 changes from a logical 0 to a logical 1 , after a certain propagation delay δ ( fig3 a ) characteristic of inverter 52 , inverter 52 causes the signal on lead 56 to change from a logical 1 to a logical 0 . similarly , after a propagation delay time δ ( fig3 b ) characteristic of inverter 53 , inverter 53 causes the signal on line 57 to change from a logical 0 to a logical 1 . consequently , the input signal on inverter 51 causes the output signal of inverter 51 to become a logical 0 . in this manner , the signals in ring oscillator 50 continue to alternate between logical 1 and logical 0 . naturally , a greater number of inverters can be used in the ring oscillator , as long as the number of inverters is odd . fig4 a and 4b are voltage versus time diagrams of the signals on leads 24 and 22 of fig1 respectively . when the gating signal on lead 24 is a logical 0 , the output signal of nand gate 33 is a logical 1 . when the signal on lead 24 is a logical 1 , nand gate 33 functions as an inverter thereby causing ring oscillator 25 to oscillate . thus , ring oscillator 25 provides the signal shown in fig4 . the pulses provided on output lead 22 of ring oscillator 25 while the signal on lead 24 is a logical 1 are counted by counter 37 . counter 37 ( fig1 ) is shown as a bit counter for exemplary purposes only ; counter 37 may have any number of bits depending upon the desired accuracy of measurement of the propagation delays in ring oscillator 25 . if greater accuracy is necessary , either the frequency of the signal on lead 24 is reduced or the frequency of oscillation of ring oscillator 25 is increased , thereby allowing more cycles of ring oscillator 25 to be counted . therefore , the time delays provided by the gates of ring oscillator 25 , and thus the gates of circuit 20 , is more accurately measured and counter 37 is designed with more than three bits . an alternative embodiment of delay block 26 of fig1 is shown in fig5 . in fig5 delay block 26 is formed using a plurality of inverters placed in series , as shown . a plurality of taps are provided , each tap providing a version of the input signal provided on input lead 23 - 1 having a unique propagation delay . thus , the signal provided on lead 26 - 1 will have no propagation delay , the signal provided on lead 26 - 2 will have a propagation delay equal to the propagation delay of 2 inverters , and the like . multiplexer 36 , under the control of the count stored in latch 50 ( fig1 ) selects an appropriate tap 26 - 1 through 26 - 4 in order to provide an output signal on output lead 36 - 1 having a desired propagation delay . in regard to fig5 it will again be seen that , with appropriate reference to fig1 the actual output frequency of the oscillator , rather than any comparative or relative frequencies , is measured by a means for such measuring , which produces an output signal in turn used to select the appropriate tap 26 - 1 through 26 - 4 in order to provide an output signal on output lead 36 - 1 having a desired propagation delay . fig6 shows a schematic diagram of one embodiment of controller 43 of fig1 . in this embodiment , controller 43 includes four bit counter 61 which counts the externally supplied clock signal clk applied to input terminal 60 . clock signal 60 is a highly stable clock , and is typically generated from a crystal controlled oscillator . first the controller is enabled via the external enable controller signal . as shown in table ii , when counter 61 reaches a count of 0010 , gate 62 - 1 provides a logical 1 enable counter signal which enables the counter to count . when counter 61 reaches a count of 0100 , gate 62 - 2 provides a logical 1 start ring oscillator signal which is applied to the s input terminal of rs flip flop 64 , thus causing flip flop 64 to provide logical 1 gate ring oscillator output signal on lead 24 . this causes the ring oscillator to oscillate . when counter 61 reaches a count of 1100 , gate 62 - 3 provides a logical 1 stop ring oscillator signal which is applied to the r input lead of flip flop 64 , thus causing the gate ring oscillator signal on lead 24 to go low . when counter 61 reaches a count of 1110 , gate 62 - 4 provides a logical 1 latch count signal to store results of counter 37 . when counter 61 reaches a count of 0000 , gate 62 - 5 provides logical 1 clear counter signal . at this point the controller can be disabled externally via the enable controller signal . in this manner , a very simple four bit counter 61 and a handful of gates are utilized to construct controller 43 of fig1 . other embodiments of this invention may have other instructional correlations between counter values and instructions to counter 37 . in one embodiment of this invention , the longest delay line of delay block 26 is chosen so that the delay introduced by the longest delay line is approximately equal to the difference between the longest propagation delay that may be introduced by digital circuit 20 and the shortest delay that may be introduced by digital circuit 20 . circuit 40 selects an appropriate delay line such that the output signal on output terminal 39 has a propagation delay between the input lead 19 of digital circuitry 20 to the output terminal 39 approximately equal to the longest potential delay introduced by digital circuit 20 . therefore , in accordance with the teachings of this invention , a circuit ( such as digital circuit 20 ) is constructed which includes means for adding an additional propagation delay in order to insure that the total propagation delay is constant regardless of process variations in the integrated circuitry , temperature variations , power supply voltage , or any other factor which may affect the propagation delays of the circuit . of importance , when inverters are used in delay block 26 , each delay element must have an even number of inverters in order to provide the equivalent , not the inverse , of the signal provided by the circuit ( not shown ) connected to input terminal 21 . this circuit is extremely useful in integrated circuitry where all components of an integrated circuit are subjected to the same process and temperature variations . other delay elements , such as and gates with input leads tied together may be used in place of inverters in delay block 26 . the delay element need not be provided by a delay block similar to delay block 26 . one method of selecting the delay indicated by counter 37 is to include a variable delay element with each gate . this can be accomplished by including several delay elements and a multiplexer in each logic gate of the circuit . another method is selecting the amount of current supplied to the base of merged transistor logic ( mtl , also known as integrated injection logic , 12l ) gates thereby varying the propagation delay introduced by these gates ( see holt , electronic circuits : digital and analog , fig7 - 15 ( 1978 ), which is hereby incorporated by reference ). fig7 depicts one embodiment of a pulse generator constructed in accordance with the teachings of this invention . pulse generator 70 of fig7 includes input terminal 71 for receiving an input signal defining when a pulse having a desired duration is to be provided on output terminal 77 . a plurality of propagation delay paths 72 , 73 , and 74 are shown , although naturally any number of desired propagation delay paths can be used . each delay line 72 , 73 , and 74 provides a unique propagation delay of the input signal applied to input terminal 71 . the output leads of propagation delay means 72 , 73 , and 74 are applied to input leads of multiplexer 75 which , in response to control signals applied to control leads ( not shown ) selects a desired one of delay lines 72 , 73 , and 74 . the signal selected by multiplexer 75 from the desired delay means is applied to one input lead of exclusive or gate 76 . the other input lead of exclusive or gate 76 receives as its input signal the input signal applied to terminal 71 . in this manner , exclusive or gate 76 provides an output pulse on output terminal 77 in response to each input signal applied to input terminal 71 . in one embodiment of this invention , multiplexer 75 is controlled by a count value , such as the count value stored in latch 50 of fig1 thereby to ensure that the pulse width of the output pulse generated on output terminal 77 is substantially constant over wide variations in processing , temperature , power supply voltages , and the like . in another embodiment of this invention , multiplexer 75 is controlled by control signals which allow the output pulse provided on output terminal 77 to have any one of a plurality of pulse widths , as desired . while this specification illustrates specific embodiments of this invention , it is not to be interpreted as limiting the scope of the invention . many embodiments of this invention will become evident to those of ordinary skill in the art in light of the teachings of this specification . table 1______________________________________ start cycle ( enable controller ) enable counter start ring oscillator stop ring oscillator latch count clear counter end cycle ( disable controller ) ______________________________________ table ii______________________________________ 0 . sub . 4 0 . sub . 3 0 . sub . 2 0 . sub . 1______________________________________enable counter 0 0 1 0start ring oscillator 0 1 0 0stop ring oscillator 1 1 0 0latch count 1 1 1 0clear counter 0 0 0 0______________________________________ | 7 |
[ 0043 ] fig5 is a perspective view of an embodiment of a roll for roll forming according to the present invention . the roll shown in fig5 is a convex roll 110 used as one of upper rolls of a break down roll . an axis coupling part 111 for coupling with a rotation axis is formed at the rotation center of the roll 110 and the circumference surface of the roll 110 is divided into pressure part 113 and non - pressure part 115 . pressure part 113 is disposed along the circumference of the circumference surface of the convex roll 110 and is a part to pressure corresponding part of passing sheet material . it is preferable that edge part of this pressure part 113 is round - processed so that no scratch is made on the sheet material being pressured . a plurality of this pressure parts 113 are formed with intervals and are symmetrically disposed on the left side and right side . the width , number , position , and the like of this pressure part 113 can be adjusted in line with those of pressure parts and non - pressure parts of other rolls arranged in the same roll forming apparatus . neighboring the pressure part 113 , the non - pressure part 115 is formed . the non - pressure part 115 is also disposed along the circumference of the circumference surface of the convex roll 110 and in parallel with the pressure part 113 . this non - pressure part 115 is for not pressuring corresponding part of passing sheet material . the non - pressure parts 115 are also symmetrically disposed on the left side and right side and are formed in the form of a groove . the width , number , position , and the like of this non - pressure part 115 can be adjusted in line with those of pressure parts and non - pressure parts of other rolls arranged in the same roll forming apparatus . the width , number , position , and the like of pressure parts and non - pressure parts formed on other rolls will be explained in detail later . [ 0047 ] fig6 is a perspective view of another embodiment of a roll for roll forming according to the present invention . the roll shown in fig6 is a concave roll 120 used as one of lower rolls of a break down roll . also , an axis coupling part 121 for coupling with a rotation axis is formed at the rotation center of the roll 120 and the circumference surface of the roll 120 is divided into pressure part 123 and non - pressure part 125 . here , the pressure part 123 and non - pressure part 125 are also formed on the concave circumference surface of the concave roll 120 , and except this , other things are the same as explained referring to fig5 . [ 0049 ] fig7 is a section view of a modified embodiment of a convex roll of fig5 . the convex roll 110 a shown in fig7 is installed in a back - end process after the convex roll 110 of fig5 and is also to pressure sheet material for plastic deformation . compared to the convex roll 110 of fig5 the convex roll 110 a has a short width and a smaller curvature . here , when the same number of pressure parts 113 and non - pressure parts 115 as in fig5 are disposed , the widths of the pressure part 113 and non - pressure part 115 are also shorter than those of the convex roll 110 of fig5 . [ 0051 ] fig8 is a sectional view of a modified embodiment of a concave roll of fig6 . the concave roll 120 a shown in fig8 is installed in a back - end process after the concave roll 120 of fig6 and compared to the concave roll 120 of fig6 has a short width and a smaller curvature . other things are the same as explained in fig6 . [ 0053 ] fig9 is a sectional view of a state where a sheet of material passes between the convex roll of fig5 and the concave roll of fig6 . referring fig9 on the circumference surface of the upper convex roll 110 , pressure parts 113 and non - pressure parts 115 are alternately formed , and also , on the lower concave roll 120 facing the convex roll 110 , pressure parts 113 and non - pressure parts 115 are alternately formed on corresponding locations . while passing between these convex roll 110 and the concave roll 120 , the sheet material 40 is plastic deformed at the curvature of the circumference surface of the convex roll 110 and concave roll 120 . in order not to leave roll traces on the sheet material 40 , the pressure ( σ y ) applied to the sheet material 40 should be less than the yield strength ( σ a ) of the material . that is , σ a & gt ; σ y . here , if the shear deformation resistance of the sheet material 40 is k = 173 . 2 ( n / mm 2 ); the contact length between the sheet material 40 and the rolls 110 or 120 when there is no non - pressure part 113 is 2b = 132 . 2 ( mm ); the thickness of the sheet material 40 is 2t = 4 . 5 ( mm ); the friction coefficient of the sheet material 40 and the rolls 110 and 120 is μ = 0 . 1 ; the forming curvature radius of the central surface of the sheet is r = 263 . 18 ( mm ); the maximum rotational radius of the convex roll 110 is r 1 = 129 . 68 ( mm ); and the rotational radius of the edge part of the sheet material 40 is r 3 = 120 ( mm ), the forming load is expressed as the following equation 1 : p = k · b · t 2 { cos ( b / r ) μ }·{ 4 / r + 1 / r 1 + cos ( b / r )/ r 3 }= 16 , 418 ( n ) ( 1 ) since σ y = p /( 2b × 1 ), if the yield strength of the sheet material is σ a = 306 ( mpa ), the contact length 2 b between the sheet material 40 and rolls 110 or 120 when the pressure applied to the sheet material should be equal to or greater than 53 . 65 ( mm ) so that the pressure ( σ y ) applied to the sheet material 40 does not exceed the yield strength ( σ a ) of the material . this means that the length should be 40 percent or more of the contact length ( hereinafter , referred to as the effective length ( l ) of a roll ) when there is no non - pressure part 115 and 125 , which means that the maximum contact length that can be formed by the non - pressure part 115 and 125 should be less than 60 percent . [ 0057 ] fig1 a through 10 d are sectional views of combinations of modified embodiments , respectively , of rolls for roll forming according to the present invention . depending on cases , as shown in fig1 a , in order to form a roll , the pressure parts 113 and 123 and non - pressure parts 115 and 125 of the upper convex roll 110 b and the lower concave roll 120 b may be formed alternately and more densely than the roll of fig9 . of course , when necessary , the non - pressure part 115 and 125 may be formed on only one of the convex roll 110 b and the concave roll 120 b and not formed on the other . as shown in fig1 b , on the lower concave roll 14 , the non - pressure part is not formed and the prior art roll is used as is , and only at the center of the convex roll 110 c , the non - pressure part 115 is formed and pressure parts 113 are formed at both sides of the non - pressure part 115 , and then the upper convex roll 110 c can be arranged at a desired position of the roll forming apparatus . in addition , as shown in fig1 c , the non - pressure part is not formed on the lower concave roll 14 , and three non - pressure parts 115 are formed around the center of the upper convex roll 110 d and pressure parts 113 are formed between the non - pressure parts 115 and at both sides of the non - pressure parts 115 . then , the upper convex roll 100 d can be arranged at a desired position of the roll forming apparatus . when necessary , as shown in fig1 d , the non - pressure part is not formed on the upper convex roll 12 , and the prior art roll is used as is , and only at the center of the concave roll 120 c , the non - pressure part 125 is formed and pressure parts 123 are formed at both sides of the non - pressure part 125 , and then the lower concave roll 120 c can be arranged at a desired position of the roll forming apparatus . [ 0062 ] fig1 is a conceptual diagram for explaining a roll forming method according to the present invention . in fig1 , there are four line diagrams and one graph in an orderly manner . here , when the sheet material 40 passes along the first break down roll described above , the sheet material 40 is divided into and expressed as a pressure area 43 and a non - pressure area 45 in the first line diagram 131 on the top . this is the same state as the circumference surface of part of the convex roll or the concave roll of the first break down roll . that is , the pressure area 43 corresponds to the pressure part 113 and 123 of the first roll and the non - pressure area 44 corresponds to the non - pressure part 115 and 125 of the first roll . the second line diagram 132 divides and expresses the pressure area 43 and non - pressure area 45 when the sheet material passes along the second break down roll . this is the same state as the circumference surface of part of the convex roll or the concave roll of the second break down roll . here , also , the pressure area 43 corresponds to the pressure part 113 and 123 of the second roll and the non - pressure area 44 corresponds to the non - pressure part 115 and 125 of the second roll . this is the same in the third and fourth line diagrams 133 and 134 . the graph 135 at the bottom shows the distribution in the width direction of frequencies of pressures applied to the sheet material 40 when the sheet material 40 passes all pairs of rolls . this is the same as the distribution in the width direction of cumulative pressure applied to each part of the sheet material 40 . that is , in each of the rolls which are sequentially arranged , the pressure parts 113 and 123 and the non - pressure parts 115 and 125 are alternately disposed so that the frequency of pressure or cumulative pressure applied to each part are uniformly distributed . then , predetermined part of sheet material is not excessively work hardened and the quality of products becomes even . in order to get the frequency of pressure or cumulative pressure applied to each part of the sheet material 40 as desired , the forming positions and width of the pressure parts 113 and 123 and the non - pressure parts 115 and 125 formed on each roll need to be adjusted considering the frequency of contacts of the pressure parts in connection with neighboring rolls . that is , by appropriately combining and disposing the pressure parts and non - pressure parts formed on each roll , a variety of modifications different from that in fig1 can be implemented . as shown from the above description , rolls for roll forming and the roll forming methods according to the present invention reduces work hardening in pipe material in the roll forming process . also , the rolls for roll forming and the roll forming methods according to the present invention makes work hardening occur evenly on the entire surface of a pipe . that is , when the rolls for roll forming and the roll forming methods according to the present invention are used , work hardening in roll forming material or a pipe occurs less , and the quality of the pipe is uniform such that the reprocessing properties of a pipe in hydroforming or drawing improves greatly . when work hardening occurs less and the quality of a pipe is uniform , pipe cracks do not appear in the hydroforming process and the number of processes in the drawing process can be reduced from that of the prior art . | 1 |
important properties of a material used in the manufacture of a hygiene article are its absorbent capacity , absorption rate , wicking capacity , drainage capacity , retention capacity , rewetting , softness and smoothness . the fluids concerned are urine , menstruation blood , blood , fluid matter from wounds and sores , rinsing fluid and saliva . an object of the present invention is to provide in an absorbent article such as a sanitary napkin , tampon , panty protector , incontinence guard , diaper , bed protector , wound or sore dressing , saliva absorbent and like articles , an absorbent structure which exhibits highly effective absorption properties , especially with regard to its fluid - wicking rate and its ability to retain fluid throughout the material . the material will also preferably have low rewetting and be capable of being made very thin and smooth . it is also desired to simplify the manufacturing process . a finished absorbent material in roll form which can be used without needing to be defibered would partially reduce the need for the earlier mentioned defibering equipment , pneumatic conveying systems and mat - forming equipment , and consequently there is a demand for such material . the aforesaid objects and desiderata have been achieved in accordance with the invention by using a manufacturing method in which particulate material comprising 30 - 100 %, preferably at least 50 % and most preferably at least 70 % flash - dried cellulose fibres is dry - formed to a web with a weight per unit area of between 100 - 2000 g / m2 and compressed to a density of between 0 . 3 - 1 . 0 g / cm3 and that the web without subsequent defibration and fluffing is incorporated as an absorbent structure in an absorbent article . in accordance with the invention , there is used a dry - formed product which is manufactured from particulate material as mechanical pulp or chemi - thermomechanical pulp ( ctmp ) or a corresponding product manufactured from sulphite pulp or sulphate pulp , so - called chemical cellulose pulp . cellulose fibres which have been stiffened chemically may also be used . in the dry - formed product can also be included other particulate matter as superabsorbents , thermoplastic binding fibres and other kind of fibres . non - treated dry - formed roll pulp has extremely good absorption , wicking and swelling properties , and it has been found possible to use the material immediately as an absorption material in hygiene articles without defibrating the pulp . in the case of certain absorbent articles , it has been found suitable to soften the material slightly prior to its use . one method of softening the material is described below . dry - formed roll pulp has a good integrity which means that in the case of use of superabsorbent materials in dry - formed roll pulp the granules will be well bound to the absorbent structure and will not spread during further conversion into absorbent hygiene products . dry - formed cellulose pulp can be produced , for instance , by forming a web of flash - dried paper pulp fibres in accordance with the method described in international patent application wo 90 / 05808 . cellulose pulp fibres have a so - called curl value which defines the crookedness of the fibre . curl value can be measured according to the method described by b . d . jordan , n . g . nguyen in papper och tra 4 / 1986 , page 313 . an embodiment of the present invention has a curl - value of between 0 . 20 and 0 . 40 . the material can be given a softness which renders the material highly suitable for use as an absorption material in the majority of hygiene articles , by working dry - formed roll pulp between for instance corrugated rolls . the material can be brought to different degrees of softness for different product applications , by working the material between different types of rolls and at different roll spacings . dry - formed roll pulp which has been softened in this way exhibits very good product properties , and the earlier mentioned good absorption properties are not influenced by the softening process to any great extent . the material is delaminated in the softening process as illustrated in fig1 and 13 . the unsoftened material has normally an even high density throughout the whole the thickness of the material ( 61 ). as a result of the softening process the material is delaminated so as to form a plurality of partially separated ( 63 ), thin fibre layers ( 62 ). softening and delamination of the material reduces its total density to some extent , although the original density is essentially retained in each individual layer . because a very high density is retained in the individual layers , the good fluid wicking properties of the material are retained despite the increase in bulk obtained in conjunction with the softening process . the total bulk is increased by up to 300 %, normally 1 - 100 %, as a result of the softening process , depending on the method used and the extent to which the material is softened . it will be understood that the aforesaid material softening method has been given solely by way of example and that corresponding results can be achieved with the aid of other methods . for instance , the material could eventually be softened by means of ultrasonic energy , microwaves , by moisturizing the material , or with the aid of chemical additives . the test equipment described below was used to evaluate absorption properties . a rectangular test body was punched from the material and a line was drawn transversely across the test body at a point 11 cm from one short end of the body . a fluid container was placed adjacent laboratory scales and both the scales and the container were adjusted to a horizontal position . a plexiglass plate was placed on the scales at a 30 ° slope , with one free edge of the plate extending slightly down into the container . a line had been drawn transversely across the plate at a point 11 cm from the lower edge of said plate . test fluid ( 0 . 9 % nacl - solution ) was poured into the container , until 20 mm of the plexiglass plate was located beneath the surface of the fluid . the test body was secured on the plexiglass plate so that the line drawn on the test body coincided with the line drawn on the plate while , at the same time , folding away the lower part of the test body so as to prevent it from coming into contact with the test liquid . a clock was started at the same time as the test body was laid onto the plate , with the test body extended down into the solution to the same extent as the plate . the increase in weight of the test body with time was recorded . a test product was secured in a fixture . test fluid ( 0 . 9 % nacl - solution ) was delivered to the wetting point of the product over a period of 60 minutes at the rate at which the fluid was absorbed . the amount of fluid absorbed was measured continuously and the total amount of fluid absorbed by the product constitutes the utilized absorption capacity of the test product . the test product was then placed in a fluid bath , in which it had the maximum opportunity of absorbing test fluid . the test product was then again weighed and the total absorption capacity calculated . the degree of utilization is given by the quotient between the utilized absorption capacity of the test product and the total absorption capacity . four batches of sample fluid ( 0 . 9 % nacl - solution ), each comprising 28 ml , were delivered at 20 - minute intervals . the time measurement was continued until all fluid had been absorbed . the extent to which the fluid had dispersed in the diaper was noted after each batch . subsequent to delivering the last batch of fluid , filter paper was placed over the wetting point and loaded with a weight of 1 . 1 kg for 15 seconds . the filter paper was weighed both before and after applying the load and rewetting was recorded . a diaper intended for a given weight range was weighed and then placed on a flat support surface . an adapted quantity of test fluid ( 0 . 9 % nacl - solution , 100 ml for a diaper intended for a weight range of 7 - 15 kg ) was delivered to the wetting point of the diaper . a further 100 ml of fluid was delivered after 20 minutes . when all fluid had been absorbed , a filter paper was placed over the wetting point and loaded with a weight of 1 . 1 kg for 15 seconds . the filter paper was weighed both before and after applying the load and the result was recorded as a first rewetting instance . after a further 20 minutes , another 100 ml of fluid was delivered and when all fluid had been absorbed , the procedure was repeated with a fresh filter paper and the result recorded as a second rewetting instance . a test body , 65 × 200 mm , was punched from the material . 5 ml test fluid ( 0 . 9 % nacl - solution ) were delivered to the wetting point on the test body . dispersion of the fluid was measured after about 30 minutes . a further 5 ml of test fluid ( 0 . 9 % nacl - solution ) were then delivered to the wetting point and fluid dispersion was measured after about a further 30 minutes . subsequent to the last delivery , eight filter papers were placed over the wetting point and loaded with a weight of 4 . 875 kg for 15 seconds . the filter papers were weighed both before and after applying the load and rewetting was recorded . with the intention of investigating how the material was affected at different softening roll spacings when softening the material , a material was tested under different softening conditions . for instance , in the case of a dry - formed ctmp - material having a weight per unit area of 900 g / m 2 and a density of 0 . 63 g / cm 3 , a suitable roll spacing is 1 . 7 - 2 . 4 mm during the softening process . the material is not influenced to any great extent at roll spacings which lie within this range . fig1 illustrates the absorption properties at different roll spacings . the results were determined in accordance with method 1 . d material according to the invention , roll spacing 2 . 0 mm , softened twice . e material according to the invention , roll spacing 2 . 0 mm , softened four times . the absorption properties of an inventive ctmp - material having a weight per unit area of 900 g / m 2 and a density of 0 . 63 g / cm 3 compared with those of corresponding pulp cores produced from conventionally defibred and web - formed ctmp and corresponding chemical pulp are shown in fig2 . in the absence of superabsorbent material , the absorption capacity is about 9 g of fluid for each gram of absorbent material . the results were determined in accordance with method 1 . with the intention of studying other properties of complete absorbent articles , test products were prepared in the form of conventional children &# 39 ; s diapers which comprised a t - shaped absorbent body ( t - core ), which lies nearest the wearer , and a rectangular absorbent body ( r - core ) which lies beneath the t - core , where the rectangular absorbent body in the test products was produced from an inventive ctmp - material . in the conventional products , the t - shaped absorbent body ( t - core ) and the rectangular absorbent body ( r - core ) were comprised of conventional defibred ctmp and chemical pulp . products which comprised an inventive ctmp - material exhibited an absorption in grams which was equivalent to the reference products which had corresponding pulp cores that were comprised of conventionally defibred and mat - formed ctmp and chemical pulp . the results are set forth in fig3 . the results were determined in accordance with method 2 . products in which the r - core comprised an inventive ctmp - material exhibited a shorter fluid aquisition time than the reference product . this implies that an r - core which contains inventive ctmp - material is able to drain the t - core more effectively . the results can be seen from fig4 . the results were determined in accordance with method 3 . a comparison between the degree of utilization of the absorbent body in an absorbent article which contained an inventive ctmp - material and a corresponding absorbent article which contained conventional ctmp and chemical pulp showed that the degree of utilization is about the same , although slightly on the plus side for an inventive ctmp - material . the results can be seen from fig5 . the results were determined in accordance with method 2 . the presence of superabsorbent material in an absorbent body will influence the absorption properties of the body . superabsorbent material can be incorporated in the absorbent body in different ways . for instance it may be admixed with the body material , laid in layers in the body , or disposed therein in some other way . this admixture of superabsorbent material can be effected in conjunction with manufacturing the dry - formed material , although it may also be effected during some other part of the manufacturing process . the absorption properties were compared with an inventive ctmp - material to which no superabsorbent material had been added and also with corresponding pulp cores comprised of conventional defibred ctmp and chemical pulp . the results of this comparison are shown in fig6 . the results were determined in accordance with method 1 . a chemical sulphate pulp containing 30 % superabsorbent and having a density of 0 . 125 g / cm 3 . products which comprised an inventive ctmp - material in the r - core exhibited better rewetting values than the reference product . this also implies that an r - core which contains inventive ctmp - material is able to drain the t - core more effectively . the results can be seen from fig7 . the results were determined in accordance with method 4 . in the case of blood absorption , products which comprised an inventive softened ctmp - material showed better rewetting values than non - softened products . the results also showed that when absorbing blood , products which lacked superabsorbent material exhibited lower rewetting values than material which contained superabsorbent material . material which lacks superabsorbent material also disperses blood much more effectively . the results can be seen from fig8 and 9 . the reference products comprised two different products frequently found on the market . the results were determined in accordance with method 5 . the prerequisites for this effect are that at least one layer of the pulp mat is free from superabsorbent material . of course , this does not exclude the presence of such material in other parts of the absorbent article . dry - formed roll pulp will normally have sufficient mat strength for the product applications intended here . if the network strength of certain product applications should be found insufficient , the network strength can be increased by reinforcing the structure in some suitable manner , by adding reinforcing fibres , binding fibres or binding agent to the cellulose fibre mixture . the network strength can also be increased by incorporating a reinforcing layer of , for instance , plastic , non - woven , net or threads in the absorbent structure , or by fastening a reinforcing layer or an outer sheet on one or both sides of the material . the softened pulp mat is still very thin , and consequently it is unnecessary in many cases to further compress the mat prior to its use in an absorbent article . a suitable density is 0 . 3 - 1 . 0 g / cm 3 , preferably 0 . 4 - 0 . 9 g / cm 3 and most preferably 0 . 5 - 0 . 85 g / cm 3 . a suitable weight per unit area is between 100 - 2000 g / m 2 , preferably 150 - 1500 g / m 2 and most preferably 200 - 1000 g / cm 2 . when calculating the density , the thickness of the material was measured with the aid of a mitutoyo thickness meter . fig1 illustrates a diaper constructed in accordance with one embodiment of the invention . the diaper includes , in a conventional manner , an absorbent body 11 which is enclosed between a fluid - permeable top sheet 12 , which conveniently comprises a soft non - woven material , a perforated plastic film or the like and which is intended to lie proximal to the wearer in use , and a fluid - impermeable bottom sheet 13 . the sheets 12 and 13 have parts which extend beyond the absorbent body 11 and the sheets are joined together at these protruding parts . the bottom sheet 13 is comprised of a suitable plastic material , for instance polyethylene . it will be understood , however , that other known materials can be used for the top and bottom sheets , within the scope of the invention . the absorbent body is comprised of two or more layers , an upper fluid aquisition layer 14 and one or two lower wicking layers and storage layers 15 and 16 . the inventive material is used either as a wicking layer 15 or a storage layer 16 or as both these layers . those layers in which inventive material is not used may be comprised of other types materials , for instance conventional cellulose fibre material . the purpose of the aquisition layer 14 is to rapidly take - up a given quantity of fluid . this fluid shall solely be held loosely in the fibre structure and quickly drained therefrom . the aquisition layer 14 has a relatively open fibre structure of relatively low density and contains 0 - 10 % superabsorbent material . the superabsorbent material used in the aquisition layer 14 will preferably have a high gel strength , so that an open three - dimensional fibre structure will be retained in this layer after becoming wet . the main purpose of the wicking layer 15 is to transport the fluid received in the aquisition layer 14 effectively to the storage layer 16 located beneath the wicking layer 15 and to ensure that the greatest possible part of the storage layer 16 is utilized for absorption purposes . the wicking layer 15 therefore has a relatively low superabsorbent content . a suitable superabsorbent content in the case of the wicking layer 15 is 0 - 20 %, while a suitable density range is 0 . 3 - 1 . 0 g / cm3 . a suitable weight per unit area range in the case of the wicking layer 15 is 50 - 1500 g / m2 . the purpose of the storage layer 16 is to absorb and retain the fluid which is dispersed to the storage layer 16 through the wicking layer 15 . the storage layer 16 may therefore have a relatively high superabsorbent content and a relatively high density . suitable density values are 0 . 4 - 1 . 0 g / cm3 , while a suitable superabsorbent content is 30 - 70 %. a suitable weight per unit area range in the case of the storage layer 16 is 100 - 1500 g / m2 . the wicking layer 15 and the storage layer 16 may optionally be combined to form a single layer . in this case , the single layer will have a relatively high superabsorbent content and a relatively high density . suitable density values are 0 . 3 - 1 . 0 g / cm3 , while a suitable superabsorbent content is 20 - 70 %. a suitable weight per unit area range in the case of a combined wicking and storage layer is 150 - 2000 g / m2 . when the wicking layer 15 and the storage layer 16 are combined in a single layer , the superabsorbent content of the layer can be varied throughout the product , so as to obtain a superabsorbent gradient in the depth , length and / or the breadth direction of the product . the various layers may have different forms and sizes . normally , the absorbent structure is combined with some form of elastication , inter alia in the crotch region of the product , in order to improve product efficiency . fig1 illustrates an exemplifying embodiment of an inventive saliva absorbent . the saliva absorbent includes , in a conventional manner , an absorbent body 51 which is enclosed between a fluid - permeable top sheet 52 , which is suitably comprised of a perforated plastic film or like material and which is intended to lie proximal to the wearer when used , and a fluid - impermeable bottom sheet 53 . the bottom sheet 53 is comprised of a suitable plastic material , for instance polyethylene . it will be understood , however , that the top sheet 52 and the bottom sheet 53 may be comprised of other known materials within the scope of the invention . the absorbent body 51 is comprised solely of one single layer . this layer may be comprised of inventive dry - formed material and has a relatively high density and a superabsorbent content of 20 - 80 %. a suitable density range in respect of the absorbent body 51 is 0 . 4 - 0 . 8 g / cm3 . it will be understood that the invention is not restricted to the illustrated and described exemplifying embodiments thereof and that other embodiments are conceivable within the scope of the following claims . | 3 |
referring to fig1 and 2 , disclosed herein is a method 100 and system 10 for three - dimensional reconstruction of surfaces that takes advantage of the symmetry resulting from alternating the positions of a receiver 12 e . g ., a camera , and the like , herein after denoted as camera and a source 14 , e . g . light source , lamp and the like hereinafter denoted as light source 14 . this set up allows for the use of the helmholtz reciprocity principle to recover the shape of and object 30 including smooth surfaces with arbitrary bi - directional reflectance distribution functions without requiring the presence of texture , as well as for exploiting mutual occlusions between images . for a single image pair , the key idea is to approximate the intersection of a given epipolar plane and the surface with a piecewise linear curve . this formulation provides the local context needed to estimate the components of the surface normals that are contained in the epipolar plane so that for a given point on the surface , the intensity response in the first image can be predicted from the intensity response in the second image . a cost function based on the overall prediction error is established , and the optimal approximating polygon is found using dynamic programming . in addition , mechanisms for dealing with specularities , image saturation regions of high curvature , shadow and occlusions are described . similar to many traditional dense reconstruction algorithms , the methodology utilizes dynamic programming to find an optimal matching along epipolar lines . however , it does not require any unrealistic assumption about the brdf of the scene , such as that it satisfies a lambertian or phong model . the matching is driven by the predictions of intensity values from one image to the other , which are then validated against direct image measurements . advantageously , over the prior art , the methodology disclosed herein successfully employs as few as one reciprocal light / camera pair . moreover , the methodology recovers surface depth and orientation simultaneously by determining a global minimum of an error function via dynamic programming . advantageously , since the error is a function not just of depth but of surface orientation as well , the image reconstruction is subject to tighter geometric constraints than existing techniques , and as a result , fitting to local noise is avoided because it would induce a costly global deformation in the reconstruction . in an exemplary embodiment , given a current estimate of surface geometry and intensity measurements in one image , helmholtz reciprocity is used to predict the pixel intensity values of the second image of a reciprocal image pair . a dynamic program finds the reconstruction that minimizes the total difference between the predicted and measured intensity values . this approach allows for the reconstruction of surfaces displaying specularities and regions of high curvature , which is a challenge commonly encountered in the optical inspection of industrial parts . it will be appreciated that helmholtz reciprocity has been introduced into computer vision in the context of dense image reconstruction . although dense reconstruction followed by an icp algorithm can be implemented to facilitate registration , it may readily be observed that given one image of a helmholtz stereo pair and the surface in the correct pose , the second helmholtz image can be generated exactly . thus , in an exemplary embodiment reconstruction followed by icp may be avoided and replaced by an estimated pose and comparison of a predicted image with the actual image and optimizing the estimated pose based on the comparison . continuing with the drawings , fig2 depicts a simplified block diagram implementing a methodology 100 for reconstructing images in accordance with an exemplary embodiment . the methodology 100 initiates as depicted at process block 110 with acquiring a helmholtz reciprocal image pair . the image pair may be instantly captured images , or stored images captured at some other time . in one exemplary embodiment , a camera 12 and light source 14 are positioned at known locations denoted optical centers relative to the object 30 and a first image is captured and stored . the camera 12 and light source 14 are then swapped and a second image is captured . in an exemplary embodiment a computer 20 and appropriate interfaces are utilized to facilitate the image capture , storage , and processing . continuing with fig1 and the methodology 100 , at process block 120 , the geometry associated with the image capture is determined and an epipolar geometry is established . the geometry is based on the physical location of the camera 12 and light source 14 relative to the object 30 . in an exemplary embodiment the geometry is established by calibrating the position and orientation of the camera 12 and light source 14 relative to the object 30 . in addition an epipolar geometry based on the optical centers is computed . turning now to process block 130 , a plurality of points on the epipolar line in the first image are selected and a corresponding candidate points in the corresponding reciprocal image are identified . corresponding epipolar lines in the corresponding reciprocal images are selected . on the epipolar lines , adjacent points in the first image are employed to establish matching points on the corresponding epipolar line in the second reciprocal image . finally , at process block 140 the points are matched along the corresponding epipolar lines . to perform the matching , the depths ( distance from point p to an optical center c 1 , c 2 ) and normals for given candidate matches are determined . the helmholtz reciprocity principle is applied to facilitate prediction of intensity for matched points . the predicted intensity for a given point is compared with the measured intensity for the same point on the second reciprocal image and minimized via an iterative dynamic programming process to minimize the error in the prediction . to facilitate description of the disclosed embodiment , a summary of the mathematical background is provided . referring now to fig3 as well , the brdf of a point p on a surface is defined , for a light ray at an incoming direction v 1 , the ratio between the outgoing radiance at a direction v 2 and the radiance of the incoming light ray , and it is denoted by ρ ( p , v 1 , v 2 ). helmholtz reciprocity implies that ρ ( p , v 1 , v 2 )= ρ ( p , v 2 , v 1 ). consider now a camera 12 and a point light source 14 arbitrarily positioned . let v 1 be the unit vector pointing from p to the optical center c 1 of the camera 12 , and v 2 the unit vector pointing from p to the location c 2 of the light source 14 . the radiance i 1 , 2 received by the camera 12 from p will be given by equation ( 1 ): i 1 , 2 ( p ) = ηρ ( p , v 1 , v 2 ) n · v 2 1 c 2 - p 2 , ( 1 ) where n is the surface normal at p and η is a scale factor . similarly , if the positions of the camera 12 and the light source 14 are swapped , the new radiance i 2 , 1 received by the camera 12 will be i 2 , 1 ( p ) = ηρ ( p , v 1 , v 2 ) n · v 1 1 c 1 - p 2 . ( 2 ) substituting equation ( 1 ) into equation ( 2 ), given n and the measured intensity i 1 , 2 , an estimate of the intensity of the corresponding pixel value in the other image may readily be computed as it will be appreciated that equation ( 3 ), based on helmholtz reciprocity is independent of the brdf of the surface . therefore , from equation ( 3 ) it can be seen that by acquiring a pair of images in which the positions of the camera 12 and the light source 14 are swapped ( a reciprocal pair ), the knowledge of the surface orientation and depth for a given point allows for any pixel intensity in one image to be predicted from the other image regardless of the brdf of the surface . matching algorithms may be employed using dynamic programming to reconstruct the intersection of an epipolar plane and a continuous surface , producing a global matching of points in an epipolar line in one image against a corresponding epipolar line in another image . the basic idea is to create a grid where each column is associated with an image point on the epipolar line of the first image and each row is associated with an image point of the epipolar line in the second image . each node in the graph represents a point in space that is defined by the intersection of the rays of the two image points . the rows and columns are ordered based on position along the epipolar lines so that a monotonically increasing path through the grid constitutes a valid reconstruction . this approach is known as satisfying an ordering constraint . under the assumption of a lambertian reflectance model , ( e . g ., a constant brdf ), the cost associated with a step from a node a to a node b is the cost at node a plus a normalized correlation error between an intensity window centered at the points associated with node b . referring now to fig4 as well , helmholtz reciprocity can be used to define a cost function c ( a , b ), where a and b are nodes from consecutive columns in the dynamic programming grid , that does not depend on the brdf . the nodes a and b define two points in space p a and p b . points on the line segment between these two points are given by p ( x )= xp a +( 1 − x ) p b ; 0 ≦ _x ≦ 1 ( 4 ) assuming smoothness of the surface to be reconstructed , this line segment can be used to approximate the surface so that c ( a , b ) = ∫ x = 0 x = 1 c ( x ) ⅆ x p a - p b ( 5 ) c ( x )=( i 2 , 1 ( p ( x ))− î 2 , 1 ( p ( x ))) 2 , ( 6 ) is the cost associated with the point p ( x ), î 2 , 1 is defined in equation 3 and i 2 , 1 is directly measured in the image . observe also that î 2 , 1 depends on the surface normal n , which is not available a priori . let n = n 0 + n e , where n e is the projection of the normal vector n on the epipolar plane , and n 0 is the projection of n on the direction orthogonal to the epipolar plane . the unit vectors v 1 and v 2 defined in the previous section are given by v 1 = c 1 - p ( x ) c 1 - p ( x ) and v 2 = c 2 - p ( x ) c 2 - p ( x ) . ( 7 ) since v 1 and v 2 are both in the epipolar plane , and n e can be approximated , up to an unknown scale α , as n ^ e ≈ α ( p a - p b ) × ( v 1 × v 2 ) ( p a - p b ) × ( v 1 × v 2 ) . ( 9 ) although it would be preferable to use a higher order approximation , this would violate the conditions needed for the applicability of dynamic programming as a tool for optimizing the function in ( 5 ). substituting ( 9 ) in ( 8 ) and then in ( 3 ), one obtains everything on the right hand side of equation ( 10 ) is either measured from capturing the second image , or derived from the camera geometry and the surface approximation defined by the points p a and p b . one important observation is that in the traditional approach to dense matching through dynamic programming the only effect previous matches have over future ones is by the enforcement of the ordering principle . this constraint limits the range of available matches . in the methodology disclosed herein in an exemplary embodiment , besides the constraint established from the ordering principle , the prior match will reflect on the value of the normal n e , since it depends on both p b and p a . it will be appreciated that this results in a stronger coupling of the matches and enforces geometric consistency , which places tighter constraints on the reconstruction . as a result , the technique presented herein should be less sensitive to local noise than existing methodologies . fig5 a and 5b provide a diagrammatic depiction of the impact of the ordering constraint coupled with the helmholtz stereopsis in accordance with an exemplary embodiment . fig5 a and 5b illustrate the fundamental difference between traditional correlation based matching versus the approach disclosed herein . two cameras 12 with optical centers in c 1 and c 2 observe the surface shown as a solid black line . the acceptable region corresponds to the area for which the position of the midpoint on the surface does not violate the ordering constraint . if a perturbation is forced on this midpoint the rest of the reconstruction for the traditional approach is unchanged , as shown by the dashed line in fig5 a . advantageously , with the methodology introduced herein this is not the case because the change in depth is coupled to the estimation of the surface normal , according to equation ( 10 ). this produces a global change in the rest of the reconstruction , as depicted in fig5 b , and a significant increase in the global cost function defined by equation ( 6 ). consequently , the methodology introduced can be more resistant to perturbations induced by local noise . continuing with fig4 and 5b , in an exemplary embodiment , each column and row of a dynamic programming matrix represents a ray shot from the first and second camera 12 , respectively . the column and row spacing define the distance between consecutive rays as they pierce their corresponding image planes . the reconstruction is then generated from the intersection of the row and column rays . the surface normals are calculated from line segments connecting points on consecutive column rays . in most dense matching applications that use dynamic programming , the row and column spacing are equally sampled . it will be appreciated that when the reconstruction is only concerned with depth equal sampling may be adequate . however , for an exemplary embodiment to ensure accurate approximation for surface normals , the column spacing should be set approximately 20 times greater than the row spacing . however , it will also be appreciated that the column and row spacing requirements have a direct impact on the execution time of the algorithm . the complexity of the dynamic program is o ( n c n 2 r ) where n c is the number of columns and n r is the number of rows . since n r ≈ 20n c , a direct implementation of this methodology would require approximately 400 times the processing of a standard dense matching algorithm . therefore , to address this issue , in another exemplary embodiment , a scale space approach has been adopted . multiple iterations of dynamic program are performed . initially , the row and column spacing are set to relatively large values resulting in a coarse reconstruction . subsequent iterations use tighter row and column spacing , however the number of possible matches in the next reconstruction is limited to a neighborhood of the match obtained in the prior reconstruction such that n r is effectively 10 percent of its full value . for each iteration , this reduces the run time by a factor of 100 . the process is continued until the desired resolution is achieved . turning to fig6 , a significant feature of the helmholtz stereopsis and geometry is that any point , which is simultaneously visible and illuminated in one image , must also be visible and illuminated in the other image . the interchange of the camera 12 and light source 14 locations produces a mutual occlusion effect : an occluding contour in one image will correspond to a zone of shadow in the other image . with standard stereopsis , shadows and occlusions are independent . however , with helmholtz stereopsis , shadows on one epipolar line in one image directly map as an occlusion on the corresponding epipolar line of the corresponding image and vice versa . therefore , the matching of points along epipolar lines may be carried out as a dynamic programming problem along matching segments of the epipolar lines lying between an occluding contour and the beginning of a shadow , and the end points of the segments will already be in correspondence . more particularly , points that are classified as not visible , for not meeting an intensity threshold , are deleted from the dynamic programming matrix . image points are then grouped into contiguous regions of visibility . if the image points in either image for a given pair of nodes a and b belong to different regions , the cost function c ( a , b ) is set to zero . in this way the continuity constraints are not enforced over regions where they do not apply . advantageously , application of this principle leverages the effects of shadows and occlusions to further simplify the processing issues associated with the reconstruction and further enhance the robustness of the image reconstruction . turning now to yet another feature of the disclosed exemplary embodiments , it will be appreciated that employing helmholtz stereopsis , the difficulties previously associated with specularities , saturation and blooming may readily be mitigated . in particular , specularities have confounded traditional dense matching algorithms based on static illumination because the position of the specularity shifts depending on camera position . it should be appreciated , that this is not the case with helmholtz reconstruction , because specularities are fixed in the surface to be reconstructed , as shown in fig7 , in fact , facilitating the matching of points along the epipolar lines . however , due to limitations in camera dynamic range , it is likely that specularities will also produce image saturation ( a limitation in the capability of a the camera ), corrupting the intensity profile along the saturated region , and the cost function c ( x ) defined in equation ( 6 ) will be invalid . in this situation , a reasonable cost criteria may be re - defined based on the observation that , since both images show saturation , the sum s ( x ) i 1 ( x ) 2 + i 2 ( x ) 2 is as large as possible . making the approximation : s ( x )≈ β [( { circumflex over ( n )} e · v 2 ) 2 +( { circumflex over ( n )} e · v 1 ) 2 ] ( 11 ) where β is a constant if one assumes that the point p ( x ) is approximately equidistant from the two cameras , it can be shown that s ( x ) is maximal when n e bisects v 1 and v 2 . this result is in agreement with the fact that specular reflections should occur only when the angles that the incident and reflected light make with the local surface normal are approximately the same . thus , if the two projections of p ( x ) are saturated , the cost function c ( x ) previously defined in equation ( 6 ) is set to c ( x )=( { circumflex over ( n )} e · v 1 −{ circumflex over ( n )} e · v 2 ) 2 . ( 12 ) many industrial applications require measurements of surfaces with extremely high curvature . an example of this is the need to determine the position of a point on the leading edge of a fan blade where the radius of curvature is on the order of 0 . 01 inches . a helmholtz stereopsis leading edge measurement system has been implemented and deployed on the factory floor . comparison against standard coordinate measurement machines result in an rms reconstruction error on the order of 0 . 0012 inches . consider also the possibility of performing a dense reconstruction on high curvature regions . since the surface normals along an epipolar plane change rapidly , the column and row spacing in the dynamic programming grid should preferably be maintained much smaller than a pixel . a natural extension to this work is to use a parametric model of the surface to be reconstructed . in this case , the normal vectors could be directly extracted from the current estimate of the surface , and a global nonlinear optimization algorithm would be applied to the surface shape parameters to minimize the error in the prediction of the intensity values according to equation ( 10 ). observe that that would significantly reduce the number of parameters to be optimized , but , since the estimation of the surface shape would have to be carried out by a nonlinear optimization technique , it would be necessary that a good initial estimate of the surface shape were available . advantageously , the initial estimate could be provided by the non - parametric method previously described . disclosed herein in yet another exemplary embodiment , is a methodology for image / model registration . referring now to fig8 , the methodology 200 may be summarized as three primary processes : prediction of the model appearance as depicted at process block 202 ; comparison of the predicted appearance against observed images as depicted at process block 204 ; and refinement of the model pose to optimize the match between the predicted and observed images as depicted at process block 206 . referring once again to fig1 , 2 , 3 , and 8 , given a three - dimensional ( 3d ) point cloud model of an object 30 , the helmholtz configuration is used to generate a predicted image . initially , a light source 14 is positioned at c 2 , and a camera 12 at c 1 captures an image of the object 30 . the positions of the camera 12 and light source 14 are then switched , and a second image is acquired to establish the previously mentioned helmholtz reciprocal image pair as depicted at optional process block 201 . next , the pose of the object model is estimated as depicted at process block 202 . for a given model point p , the distances from the point to the camera centers c 1 and c 2 are computed . additionally , the surface normal n at point p is determined . advantageously , it should be appreciated that it is also possible , and computationally more efficient , to pre - compute the surface normals n at each point p . the viewing directions v 1 and v 2 associated to the camera centers c 1 and c 2 are computed . a ray is then projected from c 1 to p . the intensity of the pixel through which the ray passes is recorded as i 1 , 2 . finally , utilizing equation ( 3 ), i 2 , 1 is computed . this is the predicted intensity of the same data point as seen by the camera at c 2 . this procedure is repeated for each data point in the model , generating a prediction of the image as seen from c 2 . it is beneficial to observe that this prediction is in agreement with a complete modeling of the surface &# 39 ; s brdf , without requiring the brdf to be explicitly measured . continuing now with fig8 , at process block 204 , the comparison of the predicted appearance against observed images may be based on one or more metrics . in an exemplary embodiment , several image comparison metrics as they relate to the helmholtz generative paradigm are considered . it will readily be appreciated that the choice of an appropriate metric for image comparison may exert significant influence over registration convergence and accuracy . the most direct way to measure image dissimilarity is by the root mean square of pixel differences , rms , given by : ɛ r ms = 1 n ∑ x ∑ y i 2 ( x , y ) - i ^ 2 ( x , y ) ) 2 , ( 13 ) where n is the number of pixels . fig9 shows the value of this metric for four different objects at different poses , each of which has unique geometrical and textural properties . position zero indicates perfect registration . let t =[ 0 0 0 ] t in centimeters and θ =[ 0 0 0 ] t in degrees be vectors representing the correct pose of the objects . the plots in fig9 show results of equation ( 13 ) when the pose of the object is perturbed in arbitrary translational and rotational directions , denoted by sδt with ∥ δt ∥= 8 cm and sδθ with ∥ δθ ∥= 14 °, respectively , for different values of the parameter s , which measures how big the perturbed pose deviates from the optimal one . this corresponds to a one - dimensional slice of the full six - dimensional se ( 3 ) manifold in which the pose parameters lie , and , therefore , cannot offer a full picture of the optimization landscape . however , it should be noted that on this slice at least the correct pose corresponds to the minimum of equation ( 13 ). it is clear that any gradient - based optimization algorithm would have difficulties in converging to the true solution in the case of the fish data set . the fish data set is from a highly textured surface , with a background with the same material and colors as the foreground . this problem calls for a different type of similarity measure , such as the median of the square of the pixel differences , which should produce a metric ms more robust to image outliers ms = median (( i 2 ( x , y )− î 2 ( x , y )) 2 | x , y ) ( 14 ) fig1 shows values of ms for the same four objects as in fig9 . note that the cost curve for the blade has a minimum , which is displaced from the optimal alignment position . on the other hand , the rms cost curve of the same object is quite smooth , and has a minimum very close to the position of optimal alignment . the model is perturbed from the optimal positioning the same way as used to produce the results in fig9 . it will be appreciated that , the shape of ms for this object may be because the blade is also almost textureless . these results suggest that registration should be performed using rms when dealing with objects characterized by smooth , textureless surfaces , and ms is preferred for when highly textured surfaces are concerned . yet another metric may be employed that would depend on the spatial distribution of image intensities is the mutual information mi , expressed as fig1 shows the mutual information between a predicted and actual image using both the helmholtz generative approach and the lambertian approximation scheme . in all cases , the methodology disclosed herein provides more information than a lambertian model . additionally , the lambertian scheme fails to identify the correct model pose for some instances e . g ., the fish and the doll &# 39 ; s head , whereas the helmholtz method succeeds in doing so for all four objects . it will readily be appreciated that the choice of an appropriate metric for image comparison may exert significant influence over registration convergence and accuracy . the methods and results provided herein should be understood to be exemplary only to illustrate the effect of a selected metric . while the results provided suggest that registration should be performed using rms when dealing with objects characterized by smooth , textureless surfaces , and ms is preferred for when highly textured surfaces are concerned , other metrics are possible . in fact , numerous methodologies may be employed for optimization of the estimate of the pose including , but not limited to , a gradient descent , monte carlo , an exhaustive search , and the like , as well as combinations including at least one of the foregoing . once a prediction of the model appearance is compared against an actual image , the difference between the two may be employed to drive an optimization algorithm to refine the pose of the model as depicted at process block 206 of fig8 . this can be carried out by optimizing any of the cost functions such as those illustrated in equations ( 13 ) or ( 15 ), where î 2 ( x , y ), for all pixel coordinates ( x , y ), is a function of the same parameters r and t , corresponding to a rotation matrix and a translation vector with respect to the initial pose of the model . the dependency of î 2 ( x , y ) on the orientation r and location t of the model is made explicit in equation ( 3 ), since p = p ( r , t ), n = n ( r ), and ( x , y ) are the coordinates of the projection of the point p , i . e ., ( x , y )= x = x ( p ). therefore , the pose ({ circumflex over ( r )},{ circumflex over ( t )}) of the model can be obtained as in the examples shown in this work the optimization method adopted to solve ( 16 ) or ( 17 ) was conjugate gradient , with derivatives computed via finite differences , although many other options are possible . to begin the optimization process it is necessary to have an initial estimation of the pose that is close enough to the true position so that the optimization algorithm will converge . for the registration of industrial parts it is usually the case that a good initial guess is readily available . for tracking applications , it is customary to postpone the initialization problem , and at every iteration , the current estimation of the pose provides an initial guess for the next iteration that should be close to the ground truth . because the helmholtz reciprocity principle yields an exact generative model , there should be zero difference between the predicted and observed images given perfect alignment . generally , there will be a discrepancy between the predicted image and the actual image as seen by the camera 12 at c 2 . this is a result of model misalignment ; which can be quantified using rms ( the root of mean squared differences ), lms ( the median of squared differences ), or mi ( mutual information ). with a properly chosen metric , conjugate gradient is used to update the model &# 39 ; s transformation matrix . after the model is re - positioned in the scene , another predicted image is generated , and the cost of the current orientation is again computed . this series of steps is repeated until convergence is reached . in order to validate the technique introduced here , a series of experiments was performed . a helmholtz stereo pair was established by placing point light sources 14 as close as possible to the optical center of two identical cameras 12 , but avoiding the lights from being occluded by the cameras themselves . three images were acquired for four objects , one with the lights off , to measure ambient light ; and two images for transposed lights 14 and cameras 12 . the background image was then subtracted from each image in the helmholtz pair to eliminate ambient light contributions . a 3d model for each object was obtained by sweeping the object with a laser stripe and performing stereo reconstruction . the 3d points of the model were then perturbed from they original position by a translation of 2 . 0 cm in each of the x , y and z directions , and by a rotation of 10 ° ( degrees ) around each of the x , y and z axes . it should be noted that this corresponds to a total translation of 6 . 9 cm and a rotation of 17 . 3 °. since the cameras 12 used in the 3d model reconstruction were the same used for the registration , without any change in position or parameters , optimal alignment is obtained with zero translation and rotation . the matrix r was represented through an exponential map , e . g ., r = exp ([ w ] x ), where [ w ] x is the anti - symmetric matrix built from the entries of w such that [ w ] x x = w × x for all values of x . the direction of w is the axis around which the rotation is performed and the magnitude of w is the rotation angle . the algorithm described herein in accordance with an exemplary embodiment was employed , and good alignment ( final translation of 2 mm and final rotation of 1 °) using the median of the difference of pixel intensity as a metric was achieved for all data sets except for the fish , which had to be initialized with translations of 1 . 0 cm in the x y and z directions , as well as rotation of 3 ° around the x , y and z axes . this corresponds to a total translation of 1 . 7 cm and a rotation of 5 . 20 . as a quick experiment to verify the robustness of the registration to the initial pose of the model , the initial translations and rotations applied to the models were multiplied by − 1 , and the registration algorithm was rerun . again , convergence within 2 mm and 1 ° was obtained . fig1 shows initial and final pose for each object . the difficulty in convergence for the fish model can be attributed to the cluttered background , which has the same texture as the fish itself , and to small size of this model . the disclosed exemplary embodiments introduce a technique for registration of 3d models to 2d images based on helmholtz reciprocity . by exploiting this principle the methodology facilitates prediction of the appearance of the back projected model in agreement with its brdf without that having to explicitly know the brdf . this is a great advantage over techniques , which assume a lambertian model , valid only for certain types of surfaces . in particular , such algorithms are not capable of handling shinny of specular surfaces . after the appearance of the model has been predicted , a suitable image metric is used to quantify the discrepancy between predicted and observed images . since the predicted image should be in agreement with the brdf of the object , this discrepancy can be attributed to misalignment of the object 30 , and it can therefore drive a search for optimal registration parameters . the effectiveness of this algorithm was demonstrated in a number of registration experiments with different objects , as well as by comparison with mutual information . the disclosed invention can be embodied in the form of computer or controller 20 implemented processes and apparatuses for practicing those processes . the present invention can also be embodied in the form of computer program code containing instructions embodied in tangible media 16 , such as floppy diskettes , cd - roms , hard drives , or any other computer - readable storage medium , wherein , when the computer program code is loaded into and executed by a computer or controller 20 , the computer 20 becomes an apparatus for practicing the invention . the present invention can also be embodied in the form of computer program code embodied as a data signal 18 , for example , whether stored in a storage medium 16 , loaded into and / or executed by a computer or controller , or transmitted over some transmission medium , such as over electrical wiring or cabling , through fiber optics , or via electromagnetic radiation , wherein , when the computer program code is loaded into and executed by a computer , the computer becomes an apparatus for practicing the invention . when implemented on a general - purpose microprocessor , the computer program code segments configure the microprocessor to create specific logic circuits . it will be appreciated that the use of first and second or other similar nomenclature for denoting similar items is not intended to specify or imply any particular order unless otherwise stated . while the invention has been described with reference to an exemplary embodiment , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims . | 6 |
we have discovered novel heavy metal - loaded , optically transparent polymers that are formed by reaction between an organometallic compound , preferably a metallic carboxylate , and a liquid and thermosetting resin , in which the organometallic compound is soluble , or fully dispersible . preferably the metal carboxylate has the formula : m ( rcoo ) a , wherein m is metal preferably having an atomic number of at least about 40 and preferably of at least 45 . mixtures of metals can be used . preferably , m is selected from the group consisting of antimony , barium , bismuth , cadmium , tin , thallium , cerium , lead , molybdenum , tungsten , vanadium , mercury , gadolinium , and zirconium . more preferably , m is lead , cadmium , barium , tin and gadolinium . still more preferably , m is lead . in the formula , &# 34 ; a &# 34 ; is an integer equal to the valence of the metal used . it is preferably between 2 and 4 . more preferably , the metal is one which exists in the compounds at a valence of 1 or 2 , but can also exist at a higher valence state . r is a saturated or unsaturated hydrocarbon residue , which can be unsubstituted or substituted , for example with a hydroxyl group , bromine or iodine . the hydrocarbon can have from about 3 to 20 carbon atoms , preferably , 5 - 18 carbon atoms . as the carbon number decreases below or increases above the range set forth , the optical transparency and / or mechanical properties of the resulting composition are less than optimum and can hinder the complete attainment of the objects of the present invention . typical examples of useful metal carboxylates include the hexanoate , heptanoate , octanoate ( 2 - ethylhexanoate ), nonanoate , decanoate , laureate , myristate , palmitate , stearate , arachidate , 2 - hexenoate , 9 - decenoate , linderate , laureate , myristolate , palmitoleate , petroselinate , oleate , elaidate , linoleate , linolenate , sorbate , geranate , salicylate , versalate , ricinoleate , ricinelaidate , naphthenate , octylbenzoate and the like . useful dicarboxylic acids include glutaric , adipic , pimelic , phthallic , azelaic , sebacic , suberic , and higher acids , such as dodecanedioic acid . mixtures of such mono and di - carboxlic groups can be used . as aforesaid , a preferred metal carboxylate is a lead carboxylate . examples of such lead carboxylates are lead hexanoate , lead heptanoate , lead octoate ( octanoate ), lead nonanoate , lead decanoate , lead laureate , lead myristate , lead palmitate , lead stearate , lead arachidate , lead 2 - hexenoate , lead 9 - decenoate , lead linderate , lead lauroleate , lead myristoleate , lead palmitoleate , lead petroselinate , lead oleate , lead elaidate , lead linoleate , lead linolenate , lead sorbate , lead geranate , lead salicylate , lead versalate , lead ricinoleate , lead ricinelaidate , lead naphthenate , lead octylbenzoate and the like . preferred lead carboxylates include lead octoate , lead napthenate , lead linolenate , lead oleate , lead decanoate , lead myristate , lead stearate , lead myristoleate , lead dexanoate , lead ricinoleate , lead salicylate and lead versalate . aliphatic carboxylates are typically preferred over cyclic structures , whether cycloaliphatic carboxylates or aromatic carboxylates . a lead octoate ( lead 2 - ethylhexanoate ) is presently preferred with epoxy resins because of clarity , viscosity , cost and compatibility . it is also preferred that the metal have multiple possible valence states , and furthermore , the compound selected have the metal in its lower valence state . for example , plumbous octoate , stannous heptonate , thallous hexanoate , are compounds in which the metal is in a lower valence state , i . e ., 2 or 1 , and where the metal also can exist in a higher valence state , i . e ., 4 or 3 . there is evidence that these additional available valence states play a role in the dispersibility of the carboxylate and the ultimate clarity of the metal - loaded cured polymer . the preferred metal carboxylates have the highest possible percent of metal , but also must be readily dispersible in , and not interfere with the curing reaction of , the liquid , thermosetting resin . there appears to be some tension between these two features . to achieve the highest percent of metal , the carboxylate group should be as small as possible , e . g ., an acetate or a formate . however , it has also been found that the lower molecular weight carboxylate groups are not as readily dispersed in , or interfere with the curing of , the thermosetting polymer . it is for this reason that the preferred carboxylates have at least three ( 3 ), and more preferably , at least five ( 5 ), carbon atoms . the final optically transparent polymer product preferably has a metal loading of from about 15 to about 40 weight percent of metal in the cured final product . the proportion of metal in the metal carboxylate is typically in the range of from about 25 to about 60 weight percent . for example one preferred metal carboxylate , lead octoate , contains about 42 % lead by weight . the metal carboxylates are well known compounds , the preparations for which are well known to the art ; the compounds are readily available from many sources . preferably , sufficient metal carboxylate is dissolved in the liquid and thermosetting resin to obtain a proportion of metal of at least about 15 weight percent of the total cured polymer , and preferably at least about 20 weight percent . generally , final metal loading in the cured polymer of more than about 40 , and more usually about 35 , weight percent interferes with the preparation of the optically transparent polymer . preferably , a metal loading of about 28 to 35 weight percent polymer is desired in the final curing . when the metal content exceeds 30 % by weight , the ability of the resulting polymer to set begins to decrease , eventually resulting in a non - setting viscous liquid at elevated temperatures . it is desired that a weight content of metal is provided so that the resultant cured polymer , at a thickness of 1 inch , has a metal equivalency of at least about 1 mm of solid metal , more preferably at least about 1 . 25 mm , and still more preferably , at least about 1 . 5 mm of solid metal . the liquid , thermosetting resins into which the metal carboxylate is dispersed are transparent upon curing ; to achieve this , the metal carboxylate should have an initial dispersability in the resin at the temperature of mixing . the resin and metal carboxylate may need to be heated to above room temperature so that the carboxylate will fully disperse and a fine suspension , preferably a sub - micron suspension , is obtained . the amount of heating depends upon the particular materials being mixed , and the exact reaction temperature can readily be determined empirically based upon the present disclosure . preferably , the metal carboxylate does not adversely affect the reactivity of the resin monomers to prevent polymerization and / or crosslinking of the monomers . when the underlying polymer is to be cured by preferably mixing two or more components , e . g ., the epoxy resin and amino , the metal carboxylate is first dispersed into the resin components , e . g ., the epoxy resin . to avoid entrapment of air while mixing , this can preferably be done under vacuum . this invention preferably includes the use of thermosetting resins which can be formulated with the metal carboxylate and which are clear setting . such resins can be in the form of catalyzed molding compounds , reaction injectable resins , and thermoplastic resins . suitable thermosetting resins can be selected from polyepoxides , polyesters , polyurethanes , polyisocyanurates , polyethersulfones , polyimides , and mixtures thereof . resins which are reaction injectable may be selected from polyepoxies , ethylenically unsaturated polyesters , vinylesters , polyester urethanes , vinylisocyanurates , polyurethanes , and blends thereof . other polymerizable resins include acrylics , styrenes , and tetrafluoroethylene resins . silicone rubbers such as polydimethyl siloxane may also be useful . the resin is preferably an epoxy such as a bisphenol a / epichlorohydrin resin , cycloaliphatic epoxy , novalic based epoxy , epoxy varnishes made with esters of epoxy resins , epoxy - aminoplastic resins , allylic resins , polyester , polyurethanes and silicones . more preferably the monomer is selected from the group of epoxy systems , allylic resins , and polyesters . even more preferably it is an epoxy system , such as the epichlorohydrin - bisphenol a epoxies . as indicated above , epoxy systems are most preferable . there are numerous commercially available epoxy systems available . in choosing a system one looks at a variety of criteria including that ( a ) upon cure the resultant crosslinked polyepoxy is transparent , ( b ) it has a long pot life , ( c ) it has clarity , ( d ) it has low color , ( e ) it has good strength , ( f ) it is scratch resistance and ( g ) it has low viscosity . epoxy systems are well known in the art and are available commercially . for example a summary on epoxy systems is available in kirk - othmer , encyclopedia of chemical technology , vol . 9 , pgs 267 - 290 ( 1980 ) the contents of which are incorporated herein by reference . epoxy systems are available from a wide range of manufacturers including shell chemical company , epoxy technology corporation , emerson & amp ; cumming inc ., ren plastics , marblett corp ., dexter corp ., r . h . carlson , inc ., tra - con inc ., isochemresin co ., general mills , inc ., ferro chemical company , ciba - geigy co ., etc . the first component of the epoxy system is an epoxy resin . non - limiting examples of the epoxy resin , which are known in the art , include , for example , epichlorohydrin / bisphenol a type , epichlorohydrin / bisphenol f type , glycidyl ether of tetrabromobisphenol a type , novolak type epoxy resins , hydrogenated biphenol a type , glycidyl p - oxybenzoate ether ester type , glycidyl ether of bisphenol a - propylene oxide adduct type , urethane modified epoxy resins , alicyclic epoxy resins , m - aminophenol type , diaminodiphenylmethane type , glycidyl ether of polyhydric alcohol ( e . g ., n , n - diglycidylaniline , n , n - diglycidyl - o - toluidine , triglycidylisocyanurate , polyalkyleneglycol diglycidyl ether and glycerin ), hydantoin type , epoxidized unsaturated polymers such as petroleum resin , etc . the second component includes a curing agent . non - limiting examples of the curing agent include aliphatic and aromatic amines ( e . g ., 2 , 4 , 6 - tris ( dimethylaminomethyl ) phenol , triethylenetetramine tetramethylenepentamine , diethylaminopropylamine , n - aminoethylpiperazine , diethylaminetriamine , ethylene oxide - amine , methylene dianiline , m - xylylenediamine , m - phenylenediamine ), amidoamines , polyamides , tert - amine salts , imidazoles , dicyanoamides , complex compounds of boron trifluoride , anhydrides ( e . g ., phthalic anhydride , methyl tetrahydrophthalic anhydride , dodecenylsuccinic anhydride , hexahydrophthalic anhydride , chlorendic anhydride , tetrahydrophthalic anhydride , and trimellitic anhydride ) alcohols ( diols , phenols , etc . ), carboxylic acids and mercaptans . generally , the addition of the metal carboxylates of this invention should not greatly change the proportion of amine curing agent needed at least to cure the expoy resin . typically , the curing agent is added in an amount of from about 25 to 100 parts be weight per 100 parts of the resin , more preferably , about 30 parts by weight of the curing agent are used relative to 100 parts of the epoxy resin . epichlorohydrin bisphenol a - derived systems are typically cured with anhydrides , aliphatic amines or polyamides , depending upon the desired end product . aliphatic amines are preferable . cresol novolac epoxy resins are multi functional solid polymers characterized by low ionic and hydrolyzable chlorine impurities . phenol novolac epoxy resins have a multi epoxy functionality that produces a more tightly cross - linked cured system having improved elevated temperature performance and chemical resistance than does the bisphenol a based resins . curing agents for this compound include aromatic amines , catalytic curing agents , phenolics and some anhydrides . for example , representative polyepoxides are reaction products of diglycidyl ethers of bisphenol a or cresol novolacs with various diols , polyols , halogenated polyols , and the like , in the presence of a catalyst such as a boron trifluoride amine complex . representative , commercially available components include : &# 34 ; kardura &# 34 ; e available from shell chemical company which is a glycidyl ester produced by reacting epichlorohydrin and a mixture of saturated , highly branched mainly tertiary monocarboxylic acids having c 9 , c 10 and c 11 chain lengths (&# 34 ; versatic &# 34 ; acid ): &# 34 ; genepoxy m205 which is a modified diglycidly ether of bisphenol a , available from general mills , inc . ; &# 34 ; epon &# 34 ; 812 , which is a diglycidyl ether of glycerol , available from shell chemical company ; &# 34 ; epon &# 34 ; 826 which is a substantially pure diglycidyl ether of bisphenol a , also available from shell chemical company ; and &# 34 ; epon &# 34 ; 828 which is a slightly resinified form of &# 34 ; epon &# 34 ; 826 , available from shell chemical company . &# 34 ; epicure &# 34 ; 3274 is an aliphatic amine also available from shell chemical company . &# 34 ; eb 020 a &# 34 ; is an epichlorohydrin bisphenol epoxy which represents a blend of several epoxies of different molecular weights and structures available from ferro chemical company . &# 34 ; eb 020 b &# 34 ; is a polyoxypropylene amine also available from ferro which is a second part of the system . emerson & amp ; cumming inc . make a number of epichlorohydrin bisphenol systems including &# 34 ; stycast a &# 34 ; ( the epoxy ) and &# 34 ; stycast 1268 &# 34 ; and &# 34 ; stycast 12669 a &# 34 ;. a resin derived from epichlorohydrin and cresol novolac precursors &# 34 ; ecn - 9860 &# 34 ; is available from ciba - geigy co . other components that are commercially available include &# 34 ; dc - 84 - 66 &# 34 ; from ren plastics , &# 34 ; maraglas 658 &# 34 ;, &# 34 ; maraglass 659 &# 34 ; and &# 34 ; maraglass 655 &# 34 ; all available from marblett corp ., &# 34 ; tc - 6175 ,&# 34 ; &# 34 ; tc - 9 - 6176 &# 34 ; available from the hysol division of dexter corp ., &# 34 ; cure - 290 &# 34 ; from r . h . carlson inc ., &# 34 ; tra - cast 3012 &# 34 ; from tra - con , inc ., and &# 34 ; isochem trasflex gel &# 34 ; available from isochem resin company . these can be used and blended according to manufacturer directions . in general , a first , epoxy - containing resin component is mixed with a second , curing - agent - containing compound to form a hardened , cross - linked material . the metal carboxylate can be added to the first component , and then the epoxy / carboxylate composition is cured . typically the metal carboxylate is in the form of a paste , and any impurities in it can be removed by appropriate filtration prior to its use . polyesters are primarily polyesterification products of unsaturated dicarboxylic acids and polyhydric alcohols having 2 - 26 carbon atoms and at least two hydroxyl groups ; examples of generally available polyols are ethylene glycol , diethylene glycol , propylene glycol , dipropylene glycol , glycerol , pentaerythitol , sorbitol , mannitol , sorbitan , erythitol , bisphenol a and most preferably , alkoxylated derivatives of 2 , 2 - di ( 4 - hydroxyphenyl ) propane having a range of 2 - 20 moles of ethylene oxide or propylene oxide per mole . the dicarboxylic acid can be an unsaturated dicarboxylic acid such as fumaric and maleic , an aromatic acid , such as phthalic , terephthalic , isophthalic or an aliphatic dicarboxylic acid , such as succinic , adipic , suberic , azelaic , sebacic , diethyl succinate ; and halogenated derivatives of these acids , such as tetrachloro - o - phthalic acid . polyester resins having a softening point in the range of 75 °- 120 ° c . are preferable . polyisocyanuric resins are usually monomer solutions of isocyanurate based on toluene diisocyanate and hydroxypropyl methacrylate , which are soluble in at least one of the following free radical - polymerizable , ethylenically unsaturated monomers , such as divinyl benzene , styrene , methylacrylate , methyl methacrylate , tetramethylene glycol diacrylate , trimethylol propane triacrylate , pentaerythritol triacrylate , neopentaglycol diacrylate , 1 , 3 - butylene glycol diacrylate , 2 , 3 - dibromo propylacrylate , 2 , 3 - dibromo propylmethacrylate , cyclohexyl acrylate , cyclohexyl methacrylate , acrylic acid , methacrylic acid , hydroxyethyl acrylate , hydroxyethyl methacrylate , hydroxypropyl acrylate , hydroxypropyl methacrylate , chlorostyrene , acrylonitrile , vanillylidene chloride , vinyl acetate , vinyl stearate , vinyl toluene , hexane diol diacrylate , hexane diol dimethacrylate and mixtures thereof . reaction injectable molding processable polymers can be used as resins . for example , unsaturated polyesters , flame retardant unsaturated polyesters and polyurethanes are useful matrix material . vinylisocyanurate offers high temperature properties , corrosion resistance and dimensional stability . vinylmaleate urethanes , flame retardant and corrosion resistant polyester resins ( atlac ® resins ) can also be used . in addition , the derakane ® vinylesters by dow chemicals can be employed . rim processable epoxies , and nylons are also included . polyimide prepolymers which are reaction products of active methylene compound with bismaleimides or diamines with maleic anhydride are useful per se or in combination with polysulfones or polyethersulfones . suitable aromatic polyethersulfone resins include linear polymers containing three kinds of unit bonds , consisting of an arylene bond , an ether bond and a sulfone bond . such polyethersulfone resins are available under the trademark victrex ®, from imperial chemical industries . typically , one prefers a lower weight polymer to maintain a low viscosity . the polymerization mixture can contain other additives useful for processing of this invention as desired for achieving useful properties in the resultant product . for example , viscosity diluents and depressants , ultraviolet ray adsorbents , dyes , and polyfunctional monomers , unless the purpose of the present invention is hindered by the additives . also , the polymerization mixture may be polymerized in the presence of a filler of , for example , glass fibers , uniformly distributed in the mixture or a metallic net embedded in the mixture , in order to produce a plastic material reinforced with the filler or the metallic net , which remain optically transparent . the polymerizable , or curable , resin and metal carboxylate are blended under conditions to mnimize entrapment of gas within the liquid blend , for example , under a vacuum , such as in a stirred pressure vessel reactor . typically , the metal carboxylate and resin are mixed at about 20 ° to 70 ° c ., more preferably about 30 ° to 40 ° c . the metal carboxylates generally have a paste - like consistency . as mentioned , impurities can be removed by forcing the paste through a filter , preferably having a pore size in the range of about 1 micron to about 20 microns . in addition , to reduce viscosity , the paste is preferably heated from about 30 ° c . to about 50 ° c . when one is using a multi - component epoxy system , the resin component of the epoxy system is first mixed with the metal carboxylate , for example , the bisphenol a component with the metal carboxylate . as mentioned above , this is done under vacuum to avoid entrapping air during mixing ; air bubbles in the final product reduce optical transparency . thereafter , the second component is added , and the appropriate curing agent , for example , with an epichlorohydrin - bisphenol a epoxide , an aliphatic amine . the curing of the resin typically produces a highly exothermic reaction . thus , it is preferable to maintain as low a temperature as practical before the curing agent is added , while at the same time taking care to avoid solidifying the viscous mixture . the curing reaction typically takes from 2 to 24 hours , more preferably 5 to 12 hours . thereafter , before the resultant metal - containing polymer is allowed to set , it is molded into the appropriate shape . for example one can do injection molding or any applicable forming method now known or later developed . the components can be used in forming an optically transparent plate that can be used to shield a medical or dental worker from radiation while at the same time allowing them to see a patient undergoing radiation treatment . it can also be molded into shapes that can be used to protect the worker or the patient from exposure to radiation at specific portions of the body . for example , it can be cast into shapes that can be put into medical aprons which can be used as shields . in such a use the clarity of the resultant polymer is obviously not as important . the present invention is further illustrated by the following examples . these examples are provided to aid in the understanding of the invention and are not to be construed as limitations thereof . lead octoate , which contains 42 weight percent lead , is highly viscous and has the consistency of a paste . the paste was heated to 35 ° to 44 ° c . to reduce viscosity , and mixed under vacuum in a stirred pressure vessel with an epoxy resin ( eb 020 a from ferro chemical co .) in a proportion by weight of 40 . 0 % lead octoate to 19 . 8 % epoxy resin . this mixing continued for a period of from 10 to about 60 minutes , and was then cooled to a temperature of not higher than about 35 ° c . before 7 . 4 weight percent ( of the epoxy resin ) of eb 020 b was added to the resin / lead octoate blend ; the resulting mixture was stirred for from 3 to 5 minutes . when the stirred mixture reached a temperature of 60 ° c . during the polymerization reaction , the material was pressed into a mold . to prevent polymerization from proceeding too quickly , the system was cooled , as by circulating a glycol through pipes around the mold chamber ; the glycol entered the pipes at 0 ° c . ; care must be taken to avoid excessive cooling , which could solidify the mixture too quickly . thereafter , the resultant viscous mixture was cast in a closed mold to form a rectangular hexahedral shaped block 4 feet by 4 feet by 15 / 8 ins . the block was rigid with acceptable hardness and clarity . the block had a light straw color . subjecting the block to standard x - ray attenuation tests gave data results that showed this block had radiation shield effectiveness equal to 1 . 5 mm of pure lead metal , i . e ., a lead equivalency of 1 . 5 nun . it is evident that those skilled in the art given the benefit of the foregoing disclosure may make numerous modifications thereof , and departures from the specific embodiments described herein without departing from the inventive concepts , and the present invention is to be limited solely to the scope and spirit of the appended claims . | 2 |
electronic devices may include displays . displays may be used to display visual information such as text and images to users . illustrative electronic devices that may be provided with displays are shown in fig1 , 2 , and 3 . fig1 shows how electronic device 10 may have the shape of a laptop computer having upper housing 12 a and lower housing 12 b with components such as keyboard 16 and touchpad 18 . fig2 shows how electronic device 10 may be a handheld device such as a cellular telephone , music player , gaming device , navigation unit , or other compact device . fig3 shows how electronic device 10 may be a tablet computer . these are merely illustrative examples . electronic devices such as illustrative electronic device 10 of fig1 , 2 , and 3 may be laptop computers , computer monitors with embedded computers , tablet computers , cellular telephones , media players , other handheld and portable electronic devices , smaller devices such as wrist - watch devices , pendant devices , headphone and earpiece devices , other wearable and miniature devices , or other electronic equipment . device 10 may have a housing such as housing 12 . housing 12 , which is sometimes referred to as a case , may be formed of materials such as plastic , glass , ceramics , carbon - fiber composites and other composites , metal , other materials , or a combination of these materials . device 10 may be formed using a unibody construction in which most or all of housing 12 is formed from a single structural element ( e . g ., a piece of machined metal or a piece of molded plastic ) or may be formed from multiple housing structures ( e . g ., outer housing structures that have been mounted to internal frame elements or other internal housing structures ). device 10 may have one or more displays such as display 14 . display 14 may be an organic light - emitting diode ( oled ) display or other suitable display . display layer 14 may include display pixels formed from light - emitting diodes ( leds ), organic leds ( oleds ), plasma cells , electronic ink elements , liquid crystal display ( lcd ) components , or other suitable display pixel structures compatible with flexible displays . display 14 may , if desired , include capacitive touch sensor electrodes for a capacitive touch sensor array or other touch sensor structures ( i . e ., display 14 may be a touch screen ). touch sensor electrodes may be provided on a touch panel layer that is interposed between an organic light - emitting diode display layer and a transparent cover layer ( e . g ., a cover glass layer ), may be formed on the underside of a cover layer , or may otherwise be incorporated into display 14 . the display ( sometimes referred to as the display layer , the oled display , the flexible display or flexible oled display ) may have a planar rectangular active region in its center . the rectangular active region includes an array of light - emitting diode pixels . display 14 may include an inactive portion at the edges of display 14 . the inactive portion of the display is shown as inactive border region 20 in fig1 , 2 , and 3 . to enhance device aesthetics , the width of inactive border region 20 that is visible from the front of the display may be minimized by mounting a display cover layer ( e . g ., a cover glass layer ) to the device using an adhesive that is interposed between the display cover layer and a flexible display such as an organic light - emitting diode ( oled ) display . a cross - sectional side view of an illustrative electronic device having a cover layer mounted to the device using lamination ( e . g ., an adhesive bond ) to the device display is shown in fig4 . as shown in fig4 , device 10 may include a rigid internal component such as component 32 and a display such as flexible display 14 . flexible display 14 may be attached to component 32 to form a mounting platform such as mounting platform 31 . device 10 may include a transparent cover layer such as display cover layer 30 ( sometimes referred to herein as a cover layer , a transparent cover layer , a display cover layer , a display cover glass , or a cover glass ). cover layer 30 may be mounted to mounting platform 31 using an adhesive such as adhesive 34 that is interposed between cover layer 30 and flexible display 14 . transparent cover layer 30 may be formed from glass , plastic , or other suitable transparent material . display 14 may have opposing top and bottom sides . cover layer 30 may have a bottom side such as bottom side 33 and an edge such as outermost edge 35 . as shown in fig4 , bottom side 33 of cover layer 30 may be mounted to the top side of display 14 . housing 12 may include housing structures such as housing sidewalls 13 . cover layer 30 may be mounted to mounting platform 31 ( i . e ., component 32 and flexible display 14 ) so that outermost edge 35 is mounted abutting portion 37 of housing sidewall 13 . cover layer 30 may be mounted to flexible display 14 using adhesive 34 so that interface 39 between housing structure 13 and cover layer 30 may be free of adhesive . in configurations in which cover layer 30 is attached to mounting platform 31 using adhesive 34 , housing 12 and cover layer 30 may form an enclosure for device 10 . rigid component 32 may be mounted to the bottom side of display 14 . component 32 may be mounted to the bottom side of display 14 using an adhesive material such as adhesive 36 . component 32 may be an active or inactive component of device 10 . component 32 may be a rigid support structure or may be a device component such as battery , printed circuit board ( pcb ) or other active component or electrical component . component 32 may be mounted to device housing 12 . component 32 may , for example , be mounted to device housing structures such as housing 12 using screws or other fasteners , clips , protrusions and mating recesses , grooves , and other engagement features , glue , welds , or other suitable attachment mechanisms . displays such as flexible oled displays may have display layers that are bonded together in a way that provides more internal strength than conventional displays . cover layer 30 may therefore be mounted to device 10 without mounting cover layer 30 to housing 12 ( e . g ., using an interface between cover layer 30 and housing 12 that is free of adhesive and other connecting material ). in configurations in which cover layer 30 is mounted to flexible display 14 , active display pixels such as pixels 38 in display 14 may be formed along outermost edge 35 of cover layer 30 ( e . g ., adjacent to portion 37 of housing 12 ). active display pixels along outermost edge 35 of cover layer such as cover layer 30 that is mounted to flexible display 14 may be visible to a user of device 10 under cover layer 30 . in this way , inactive portion 20 ( see fig1 ) may be reduced in size or eliminated , thereby improving the aesthetic appearance of device 10 . as shown in fig4 , housing sidewall structure 13 may have an interior surface such as inner sidewall surface 41 . flexible display 14 may have a peripheral edge 43 . display cover layer 30 may have a peripheral edge corresponding to outermost edge 35 . as shown in fig4 , peripheral edge 43 of flexible display 14 and peripheral edge 35 of display cover layer 30 may be aligned and may contact inner sidewall surface 41 of housing structure 13 . fig5 shows an illustrative mounting platform 31 that includes a component 32 that is formed from a rigid support structure for mounting display 14 ( and consequently cover glass 30 ) to device 10 . as shown in fig5 , component 32 may be formed from a rigid support structure having one or more bends 42 . bends 42 in rigid support structure 32 may allow rigid support structure 32 to be mounted to housing 12 while allowing space for additional internal components 44 . additional internal components 44 may include batteries , pcb &# 39 ; s , integrated circuits , speakers , vibrators , or other components . in the example of fig5 , rigid support structure 32 is attached to housing 12 using one or more screws such as screws 40 . portions 46 of component 32 may be provided with openings such as holes that allow screws 40 to pass through portions 46 and into housing 12 . fig6 shows an illustrative component 32 that is formed from one or more active internal components of device 10 . as shown in fig6 , display 14 may be mounted to active components 32 using a bonding material such as adhesive 36 . active internal components 32 may be electrical components , mechanical components or other active components ( e . g ., batteries , printed circuit boards , integrated circuits , communications components , etc .). active internal components 32 may be mounted to other active internal components such as other internal components 44 . other internal components 44 may be mounted to additional internal components 44 or may be mounted to housing 12 . the example of fig6 is merely illustrative . if desired , active components 32 may be mounted directly to housing 12 . components 32 may be mounted to other components 44 using adhesive , mechanical attaching members , electrical bonding material ( e . g ., solder or conductive adhesive ) or other suitable mounting methods . as shown in fig6 , cover glass 30 may be mounted to display 14 using adhesive layer 34 . cover glass 30 may be mounted to device 10 using an adhesive bond to a display such as display 14 that is mounted to active internal components such as components 32 . fig7 shows an illustrative component 32 that is formed from a rigid support structure that is substantially straight . as shown in fig7 , rigid support structure 32 may include a recess such as recess 50 . recess 50 may provide space for the head of a fastener such as screw 40 . in the example of fig7 rigid support structure 32 is formed from a single structure . recess 32 may be formed on rigid support structure 32 using a metal etching procedure , a mechanical grinding procedure or other suitable procedure for producing recess 50 . this is merely illustrative . if desired , rigid support structure 32 may be formed from more than one structure . in the scenario in which rigid support structure 32 is formed from multiple structures , the structures may be welded to form a recess such as recess 50 as shown in fig8 . in the example of fig8 , rigid support structure 32 includes an additional structure 32 w that is welded to rigid support structure 32 at weld 52 . additional structure 32 w may be welded to rigid support structure 32 so that space 50 is provided for the head of a fastener such as screw 40 . in the examples of fig8 and 9 , screw 40 may be using to attach rigid support member 32 to other components of device 10 ( e . g ., housing 12 , active components 44 , or other components ). display 14 may be attached to rigid support member 32 using adhesive 36 . cover layer 30 may be attached to device 10 by attaching cover layer 30 to display 14 using adhesive 34 . fig9 shows an illustrative component 32 that is formed from a rigid support structure having an opening for mounting a portion of a flexible display . as shown in fig9 , rigid support structure 32 may include an opening such as slot 54 . flexible display 14 may be mounted to rigid support structure 32 so that a portion such as portion 56 of flexible display 14 is bent around a portion of rigid support structure 32 into slot 54 . to ensure that flexible display 14 is not damaged during the bending process , bending operations may be performed that limit bending to an acceptable bend radius r . the value of r may be , for example , about 3 to 5 times the thickness of the bent material ( e . g ., bend radius r may be about 0 . 2 to 0 . 5 mm ). portion 56 of flexible display 14 may be attached to the sidewalls of slot 54 using adhesive 34 or may be held in slot 54 using external pressure from housing structure 13 . as shown in fig9 , additional internal components ( e . g ., pcb &# 39 ; s , integrated circuitry , or other components ) may be mounted to rigid support structure 32 . active pixels 38 may extend into portion 56 of flexible display 14 so that active pixels are visible under substantially all of cover layer 30 . a minimal edge portion of display 14 may have inactive pixels that are visible under cover layer 30 . the minimal edge portion of display 14 that remains visible may be covered with a bezel or a portion of a display cover layer that is coated on its underside with an opaque masking layer such as black ink ( as examples ). fig1 is a cross - sectional side view of a portion of an electronic device having a flexible display that is attached to a rigid support member and is mounted adjacent to a housing structure . as shown in fig1 , flexible display 14 may be attached to rigid support structure 32 using adhesive 36 . flexible display 14 may have a portion 60 that is bent such that portion 60 is substantially perpendicular to the active display area of display 14 . flexible display 14 may have a tendency to return to a substantially flat shape . this tendency to return to a substantially flat shape may cause flexible display 14 to exert a restoring force on rigid support structure 32 . in order to provide extra resistance against the restoring force of flexible display 14 , portion 60 may be positioned such that a housing sidewall such as housing structure 13 is adjacent to portion 60 thereby holding portion 60 against rigid support structure 32 . fig1 is a cross - sectional side view of an electronic device having a rigid support member that is mounted to mounting tabs on a device housing structure . as shown in fig1 , rigid support structure 32 may have a portion 66 that is bent such that portion 66 is substantially perpendicular to cover layer 30 . portions 66 of rigid support structure 32 may be provided with openings such as holes 68 . housing structure 13 may be provided with mounting members such as mounting tabs 62 . mounting tabs 62 may be configured to pass through holes 68 in portions 66 of rigid support structure 32 . during assembly of device 10 , cover layer 30 may be attached to display 14 . during assembly of device 10 , display 14 may be attached to rigid support structure 32 . during assembly of device 10 , cover layer 30 , display 14 , and rigid support structure 32 , may be inserted into device 10 in direction 70 ( i . e ., from the front side of device 10 ). portions 66 of rigid support structure 32 may be configured to have some flexibility . during assembly of device 10 , while rigid support structure 32 is moved in direction 70 , portions 66 may bend as indicated by arrows 64 . during assembly , portions 66 may bend further as rigid support structure 32 is moved further in direction 70 until holes 68 align with mounting tabs 62 of housing structures 12 . during assembly , when holes 68 align with mounting tabs 62 , portions 66 may “ snap ” onto mounting tabs 62 ( i . e ., mounting tabs 62 may enter holes 68 as portions 66 return to a substantially perpendicular position with respect to cover layer 30 ). inserting rigid support structure 32 into device 10 until mounting tabs 62 ( at least partially ) pass through holes 68 may effectively lock rigid support structure 32 into device 10 . as shown in the examples of fig1 , 11 , and 12 , display 14 may be attached to rigid support member 32 using adhesive 36 . cover layer 30 may be attached to device 10 by attaching cover layer 30 to display 14 using adhesive 34 . the example of fig1 in which display 14 covers only the portion of rigid support structure 32 that is parallel to cover layer 30 is merely illustrative . as shown in fig1 , flexible display 14 may be bent so that flexible display 14 covers all or part of perpendicular portions 66 of rigid support structure 32 . as described above in connection with fig1 , flexible display 14 may have a tendency to return to a substantially flat shape . this tendency to return to a substantially flat shape may cause flexible display 14 to exert a restoring force on rigid support structure 32 . as shown in fig1 , in order to provide extra resistance against the restoring force of flexible display 14 , device 10 may be provided with one or more tensioning members such as tensioning member 72 . tensioning member 72 may be attached to portions 66 of rigid support structure 32 . tensioning member 72 may be formed from a thin wire , a plurality of wires or may be an extended structure that extends in a direction perpendicular to the cross - sectional side view of fig1 along all or part of rigid support structure 32 . tensioning member 72 may be formed of materials such as plastics , carbon - fiber composites and other composites , metal , other materials , or a combination of these materials . if desired , tensioning member 72 may be formed from an active internal component of device 10 . as shown in fig1 , tensioning member 72 may be a printed circuit board or other active internal component of device 10 . portions 66 of rigid support structure 32 may be attached to additional support members 72 e . additional support members 72 e may be attached to printed circuit board 72 so that printed circuit board 72 may provide extra resistance against the restoring force of flexible display 14 on rigid support structure 32 . in the example of fig1 , pcb 72 is attached to additional support members 72 e using screws 74 . this is merely illustrative . rigid support structure 32 may be welded to additional support members 72 e or may be attached to additional support members 72 e using adhesive or other bonding materials . fig1 is a cross - sectional side view of a portion of an illustrative device such as device 10 in which rigid support structure 32 is mounted in a notch in a housing structure . as shown in fig1 housing structure 13 of device 10 may be provided with an opening such as notch 80 . notch 80 may run along a lateral dimension of device 10 . a portion of mounting platform 31 ( including a portion of rigid support structure 32 and a portion of display 14 ) may be mounted in notch 80 . during assembly of device 10 , rigid support structure 32 may be attached to housing 12 using any suitable attachment method . during assembly , flexible display 14 may be deformed as indicated by dashed lines 82 so that display 14 may be mounted onto rigid support structure 32 using adhesive such as adhesive 36 . during assembly , following mounting display 14 to rigid support structure 32 , cover glass 30 may be mounted onto mounting platform 31 by attaching cover glass 30 to flexible display 14 using adhesive such as adhesive 34 . in configurations in which display 14 is mounted between cover glass 30 and a rigid support structure that is mounted in notch 80 in housing structure 13 , rigid support may be provided on two sides of display 14 . cover layer 30 may be mounted to device 10 using an adhesive bond with flexible display 14 so that interface 39 between outermost edge 35 of cover layer 30 and portion 37 of housing structure 13 may remain free of adhesive . if desired , electronic device 10 may be provided with housing structures having extended portions for restraining a cover layer as shown in fig1 . in the example of fig1 , housing structure 13 includes an extended portion 82 that is substantially perpendicular to housing sidewall 13 . cover layer 30 may include a cutaway portion such as notch 84 that is configured to abut portion 82 of housing structure 13 . notched cover layer 30 may be mounted to a flexible display such as display 14 . display 14 may be mounted to a rigid support structure such as support structure 32 . during assembly of electronic device 10 , the display package that includes cover layer 30 , display 14 and rigid support structure 32 may be inserted into device 10 in direction 86 . the display package including notched cover layer 30 may be inserted in direction 86 until notch 84 comes into contact with portion 82 of housing structure 13 . cover layer 30 may therefore be mounted to device 10 by attaching cover layer 30 to display 14 using adhesive 34 and an adhesive - free contact with extended portions 82 of housing 12 . fig1 is a cross - sectional side view of a portion of an illustrative device 10 having a housing structure with a slotted portion for mounting a portion of a flexible display . as shown in fig1 , housing 12 may include an internal separating structure such as slot wall portion 12 s that forms a slot 90 between portion 12 s and housing sidewall 13 . flexible display 14 may have a portion 60 that is bent such that portion 60 is substantially perpendicular to the active display area of display 14 . portion 60 may be mounted in slot 90 . portion 90 of flexible display 14 may be mounted in slot 90 between housing structure 13 and slot wall portion 12 s . if desired , rigid support structure 32 may be attached to slot wall 12 s . rigid support structure 32 may be formed from metal or other electrically conducting or heat conducting material . as shown in fig1 , rigid support structure 32 may be formed so that rigid support structure 32 substantially surrounds one or more electrical components such as components 44 . components 44 may be mounted to a printed circuit board such as pcb 92 . rigid support structure 32 may be configured to provide shielding for components 44 from electromagnetic interference ( emi ) or may shield other device components from emi resulting from components 44 . rigid support structure 32 may be formed from heat conducting material ( e . g ., copper , aluminum , other metal , or other heat conducting material ). rigid support structure 32 may be coupled to a heat sink such as heat sink 94 . rigid support structure 32 may be configured to conduct heat away from flexible display 14 to heat sink 94 . cover layer 30 may be mounted to a flexible display such as display 14 that is mounted to a rigid support structure that serves as an electromagnetic shield for electrical components or that is configured to conduct heat away from the display . fig1 is a perspective view of an illustrative assembly system for mounting a flexible display such as flexible display 14 to a support structure such as rigid support structure 32 . the assembly system may include an applicator such as applicator 100 . applicator 100 may have a shape that corresponds to the curved shape of rigid support structure 32 . applicator 100 may be moved in direction 102 in order to press flexible display 14 into contact with rigid support structure 32 . while moving in direction 102 , the shape ( e . g ., curved portions 110 ) of applicator 100 may press flexible display 14 into contact with curved portions 112 of rigid support structure 32 . during assembly , before placing flexible display 14 onto rigid support structure 32 , if desired , adhesive 36 may be placed onto rigid support structure 32 . adhesive 36 may bond flexible display 14 to rigid support structure 32 . if desired , the assembly system may include one or more fastener delivery members such as screw delivery members 104 . screw delivery members 104 may be configured to carry fasteners such as screws 106 for fastening flexible display 14 to rigid support structure 32 . applicator 100 may include one or more openings 114 into which screw delivery members 104 may carry screws 106 . during assembly , after pressing flexible display 14 into contact with curved portions 112 of rigid support structure 32 , screw delivery members 104 may be moved ( as indicated by arrows 108 ) to insert screws 106 through openings 114 in applicator 100 so that screws 106 pass through flexible display 14 and into rigid support structure 32 , thereby fastening display 14 to rigid support structure 32 . during assembly , alignment marks may be used to align flexible display 14 with rigid support structure 32 . because rigid support structure 32 may be precisely positioned with respect to housing 12 , aligning flexible display 14 to rigid support structure 32 may provide improved alignment of display 14 with edges of housing 12 . as shown in fig1 , rigid support structure 32 may have one or more alignment marks 120 . alignment marks 120 of rigid support structure 32 may be indentations or other visible marks on rigid support structure 32 . flexible display 14 may have one or more alignment marks 120 . alignment marks 120 of flexible display 14 may be indentations , visible marks or may simply be a virtual edge such as edge 122 at which the last active display pixel 38 is located . aligning flexible display 14 to rigid support structure 32 in this way may allow the last active display pixel 38 to be precisely aligned with an edge of housing 12 . alignment of flexible display 14 and rigid support structure 32 may be performed by aligning alignment marks 120 of rigid support structure 32 with alignment marks 120 of flexible display 14 before pressing flexible display 14 into contact with curved portions 112 of rigid support structure 32 ( see fig1 ). the foregoing is merely illustrative of the principles of this invention and various modifications can be made by those skilled in the art without departing from the scope and spirit of the invention . | 6 |
illustrated in fig1 is a simplified analytical prober which includes a heavy stable base 10 which supports on side pedestals 11 a vertically movable u - shaped platen 12 . positioned on the surface of the base and below the open front of the u - shaped platen is a roll - out stage 14 having controls for fine adjustments in x , y and z directions . secured to the surface of the stage 14 is a vacuum chuck 16 and a microscope 18 is centered over the chuck . during normal operation in which temperatures are of no particular concern , a silicon wafer having a typical thickness of 250 to 600 microns and which may contain a hundred or more individual integrated circuits is secured directly to the surface of the vacuum chuck 16 and the stage 14 is adjusted to observe one of the integrated circuits in the microscope field of view . if only a few circuits are to be tested , or if the test involves contacting only two or three of the very fine conductors on the circuit then movable probe positioners , each with one probe tip , are secured by vacuum on the flat surface of the platen 12 and their probe tips are carefully adjusted to contact the desired circuit conductors . if , on the other hand , many identical devices are to be tested then a probe care 20 is inserted into an adapter secured in the open front portion of the u - shaped platen . the probe card is a typical &# 34 ; plug - in &# 34 ; circuit card with a central hole into which extend probe tips 22 corresponding in number to the number and also the location of device conductors to be contacted . thus , to perform a test on a circuit , the circuit is accurately positioned under the hole in the probe card and the stage 14 is raised by its z adjustment until contact is made with the probe tips . the probe tips 22 are coupled through the probe circuit card to appropriate associated test circuitry which performs the required test on the device . as previously mentioned , the vacuum chuck 16 may be heated for the electrical testing of devices on wafers directly coupled to the chuck , but the application of chilled fluids for cold testing results in atmospheric dew and even frost on the wafer to the detriment of the ic devices . furthermore , a considerable amount of time is required to heat an ic device on a wafer to a desired test temperature because of heat losses due to the mass of the chuck 14 , the heat conductivity between chuck and metal stage 14 , and also the need to heat the thin wafer material . in the system now to be described , the ic device directly receives the temperature controling medium at the desired extreme testing temperature and is nearly instantly brought up or down to that temperature . as illustrated in the simplified elevational view of fig1 a wafer 24 having thereon a device 26 to be tested is positioned on the surface of a heat insulating pad 29 which is positioned on the surface of the chuck 16 . temperature changes made to the device 26 and its wafer 24 cannot , therefore , be affected by the masses of the chuck 16 or stage 14 . the device 26 is aligned on the optical axis of the microscope 18 and is centered in the hole in the probe card 20 so that the various probes 22 on the card will contact the conductors on the device when the stage 14 is raised . positioned on the top surface of the probe card 20 is a toroidal nozzle 28 having a central hole coaxially aligned on the optical axis of the microscope 18 . the nozzle is formed with two annular vents that open into the central hole . a first vent 30 is directed downward through the nozzle central hole and is coupled through a perforated baffle ring 32 to an annular plenum 34 as best shown in the sectional view of fig3 . the plenum is coupled through a temperature controllable heater 36 to a source of liquid nitrogen or other extremely cold , dry , inert gas . the second annular vent 38 in the nozzle overlies the vent 30 ; it is physically shorter than the first nozzle 30 and is coupled to an annular chamber 40 which surrounds the top and exterior surface of the plenum 34 and which receives dry nitrogen after it has been heated to approximately room temperature or slightly higher . thus , the warm dry gas within the chamber 40 prevents exterior surface chilling of the nozzle and possible atmospheric dew from forming and the small amount of warm dry gas emitted through its vent 38 will drift upward to prevent possible fogging of the microscope 18 . the gas heater 36 receives nitrogen gas from an associated liquid nitrogen tank at its dew point of - 220 ° c . and heats a small portion to near room temperature for the chamber 40 and second vent 38 . the heater 36 must also heat a supply of gas to the temperature necessary for the testing of a device . this testing temperature is controlled by external controls which are not part of the invention and the selected temperature of the gas emitted through the first vent 30 is monitored by a sensor 42 located in that vent . a second temperature sensor 44 , placed in the surface of the thermal insulator pad 28 , is used during calibration so that an associated microprocessor can control the gas temperature and flow rate through the nozzle to ensure accurate temperatures of the device 26 under test . in use , the temperature regulated gas emitted from the plenum 34 and first vent 30 falls in the form of a tubular curtain to the surface of the wafer 24 and spreads over the probe tips , previously at room temperature and which could perform as heat sinks , and the ic devices on the wafer to rapidly change their temperatures to that of the gas . to prevent the intrusion of moisture laden atmospheric air , the base area of the prober instrument is substantially sealed with a surrounding baffle structure 46 or similar structure so that the dry gas introduced through the nozzle 28 and flowing down over the wafer will purge all moisture laden room air from the apparatus in the areas below the gas emitting nozzle 28 . thus , during cold testing , the system is self - correcting in that no frost can form on a wafer if it is warm due to the lack of the cold dry gas , nor will frost form when it is cold because only the dry gas can chill the wafer . | 6 |
referring to fig1 , a communications system 100 is depicted . communications system 100 includes the internet or any other type of communications network 110 . in the exemplary embodiment depicted , communications network 110 is a widely distributed communications system in which a plurality of server and client computers are coupled in communication with a plurality of other server and client computers widely distributed . for example , server computers may include server computers 120 and further may include a message - queue middleware server 130 . communications network 110 may also be coupled to a carrier network 135 which provides wireless services to mobile electronic devices . in an exemplary embodiment , server computers may further include such servers as wireless servers , content sources , web portal servers , third party content servers , and many other types of server computers having a variety of functions and resources . in the exemplary embodiment depicted in fig1 , carrier network 135 services a plurality of handheld computers or other wireless devices such as handheld computer 140 . handheld computer 140 may be any of a variety of mobile electronic devices including , but not limited to , handheld computers , personal digital assistants , palmhelds , palmtop computers , cellular telephones , wireless pagers , wireless messaging devices , laptop computers , and the like . handheld computer 140 is configured to communicate wirelessly with carrier network 135 and gain access to resources over communications network 110 through message - queue middleware server 130 . for example , a user utilizing a software application running on handheld computer 140 may wish to share data with or provide a request to server 120 , accessible over communications network 110 . handheld computer 140 is configured to place such data or request in a queue 146 on handheld computer 140 . because the communications link with carrier network 135 is a wireless link , the link may be unsatisfactorily noisy or may be unavailable because of lack of coverage , or too much traffic . accordingly , messages in queue 146 await transfer to server 120 ( via carrier network 135 and message - queue server 130 ) until the wireless connection becomes clear , or the wireless connection is re - established . similarly , responses from server 120 will be communicated over communications network 110 to message - queue server 130 . such responses will be placed in queue 132 , that is particularly associated with handheld computer 140 , to await transfer until such a time that the wireless link between carrier network 135 and handheld computer 140 becomes clear or is re - established . in an alternative exemplary embodiment , handheld computer 140 may connect directly with message - queue middleware server 130 as opposed to being connected through a separate carrier network . during an exemplary usage of a software application ( productivity application or any other type of software application ) running on handheld computer 140 , a user utilizing handheld computer 140 often wishes to provide information to , view documents from , or use applications or services communicated over communications network 110 from , sources such as servers 120 . accordingly , a user utilizing a software application running on handheld computer 140 would provide such a request by communicating an address , such as , but not limited to , a url , and a function , such as download information , request information , and the like . such a request would be placed in a communications queue 146 on handheld computer 140 . queue 146 is configured to contain a plurality of outgoing packets , messages , and the like . when a communications link with carrier network 135 and message - queue server 130 is established , messages in queue 135 , awaiting transmission , are in turn communicated over the wireless link to carrier network 135 and subsequently to message - queue server 130 . message - queue server 130 associates the received message with handheld computer 140 and submits the request to the appropriate server 120 over communications network 110 . message - queue server 130 retrieves the requested information and places the requested information ( in a single or multiple packets ) into a queue 132 , queue 132 being particularly associated with handheld computer 140 . when handheld computer 140 is in communication with carrier network 135 , message - queue server 130 begins emptying message - queue 132 to handheld computer 140 via carrier network 135 . similarly , handheld computer 140 will empty its queue 142 while communications with carrier network 140 are established . messages from queue 142 will be delivered to message - queue server 130 over carrier network 135 . such communications may be carried out in a plurality of steps 200 ( fig2 ). a request or message may be placed in queue 146 ( step 202 ) and an open wireless link to carrier network 135 is awaited . communications are then carried out after a wireless communications link is established ( step 210 ). the message - queue middleware server 130 retrieves the request from handheld computer 140 ( step 220 ) as queue 146 of handheld computer 140 is emptied . in an exemplary embodiment , the request may include not only an address and a function , but may also include data to be transmitted to a server 120 and optionally , quality of service information . quality of service information may include a time - to - live quality of service , a best effort quality of service , or others . there may be a cost associated with each type of quality of service . time - to - live quality of service implies providing a best effort to provide the communications over the wireless link . however , if the communications are not completed in a certain amount of time , the message to be communicated over the wireless link is deleted from the queue . further , a best - effort quality of service implies that communications of the message will be attempted until otherwise repealed or deleted from the queue for other reasons . once a request has been received by message - queue middleware server 130 , it is sent over communications network 110 to the appropriate server 120 associated with the address in the request ( step 230 ). the information requested is then retrieved from the appropriate server 120 over communications network 110 ( step 240 ). once the information has been retrieved , the information is put into the message - queue either in a multiplicity of packets , or in a single message packet ( step 250 ). the message - queue middleware server then holds the message or messages in a queue awaiting an open wireless link to the mobile device 140 for communicating the information thereto ( step 260 ). once an open wireless link to handheld computer 140 has been established or re - established , messages from the message - queue particularly associated with handheld computer 140 are communicated to handheld computer 140 over the wireless link ( step 270 ). this form of communications is often referred to as asynchronous communications in which the communications session is not held open , rather the communications session may be closed and re - established and picked up where left off . in another exemplary embodiment , a plurality of steps 300 , depicted in fig3 , may be used to retrieve data over a wireless communications link from a communications network 110 by a handheld computer 140 . for example , a wireless communications link with a message - queue middleware server is established ( step 310 ). once the link has been established , a request is provided to the message - queue middleware server over the wireless link . the request may be the next in line message from queue 146 of handheld computer 140 . the request includes at least an address and a function , but possibly includes other types of information such as , but not limited to data and quality of service information ( step 320 ). once the request has been provided to the message - queue middleware server , the message - queue middleware server transmits such a request to the appropriate server over communications network 110 . the server receiving the request then provides information back over communications network 110 to message - queue middleware server 130 . message - queue middleware server 130 packages the information in a format to be sent over the wireless link and places such packetized information into a queue associated with handheld computer 140 . handheld computer 140 may have a wireless communications link already open or may re - establish such a wireless communications link at any time ( step 330 ). once the communications link is established or has been re - established , a response is received over the wireless link , the response being a response to the original request . the response communicated over the wireless link is the next in line response in the queue particularly associated with handheld computer 140 ( step 340 ). for example , a user of handheld computer 140 may begin a remote banking application on handheld computer 140 . the user may wish to transfer money from a checking account to a savings account . in such a situation , the request to produce such a transfer would be placed in queue 146 of handheld computer 140 . when a wireless link to carrier network 135 is established , the request , if next in line in queue 146 , is communicated over the wireless link to message - queue middleware server 130 via carrier network 135 . message - queue middleware server 130 would then communicate such a request to a banking server such as a server 120 over communications network 110 . the banking server would then make the appropriate transfer of funds and then communicate that the transfer has been completed or request further information from handheld computer user 140 by sending the message back to message - queue middleware server 130 . if , in the meantime , the wireless link between handheld computer 140 and message - queue middleware server 130 has been broken either intentionally or unintentionally , the message received from banking server 120 would be put into queue 132 particularly associated with handheld computer 140 and held there until a communications link is re - established . once a communications link is re - established , message - queue middleware server 130 begins providing any messages in queue 132 , particularly associated with handheld computer 140 , over the wireless link to handheld computer 140 . message - queue 132 being emptied would include the confirmation or request for further information that was previously received from banking server 120 . in contrast , in a synchronous communications system , once the communications link is broken , a new link would have to be re - established and the banking application and request would have to be restarted anew whereby the handheld computer user would have to reformulate and reinitialize the funds transfer . while the detailed drawings , specific examples , and particular formulations given describe exemplary embodiments , they serve the purpose of illustration only . the hardware and software configurations shown and described may differ depending on the chosen performance characteristics and physical characteristics of the computing devices and communications networks . for example , the type of computing device , communications network , or devices used may differ . the methods and systems shown and described are not limited to the precise details and conditions disclosed . furthermore , other substitutions , modifications , changes , and omissions may be made in the design , operating conditions , and arrangement of the exemplary embodiments and steps of the exemplary embodiments without departing from the scope of the invention as expressed in the appended claims . | 7 |
the present invention requires only two - wires , yet , provides a total of four channels , two 64 kbps channels ( voice or data ), a 16 kbps channel for communications between the telephone and the line card , and a 8 kbps auxiliary channel for communications with other devices on the line , ( i . e . repeaters ) and / or with the telephone . referring to fig2 a central office ( co ) system having a central exchange ( centrex ) feature is shown . standard telephone instruments a and b are connected to the switching system , via analog subscriber lines 1 and 2 , to analog line unit 13 . the analog data received is converted to pulse coded modulation ( pcm ) by analog line unit 13 . the pcm digital data is next sent from alu 13 to originating time switch 20 . pcm data received from the other end is received by alu 13 from terminating time switch 21 . alu 13 converts the received pcm data to an analog signal which is transmitted down subscriber lines 1 and 2 . alu 13 is also connected to analog control unit 14 , which in turn , is connected to peripheral processor 70 . terminating time switch is further connected to trunk unit 18 through analog control unit 17 . trunks 3 and 4 provide access to subscribers not directly served by this system . the digital facilities line card ( dflc ) 19 of the present invention is connected to analog control unit 17 and provides an interface for up to two featurephones . the primary objective of the dflc is to appear to alu 17 and pp 70 as standard subscriber lines . this objective requires the dflc to perform a significant amount of the call processing thereby off - loading pp 70 . turning now to fig3 a block diagram illustrating the dflc is shown . the dflc interfaces to the featurephone through a single , two - wire communication link . the two - wire interface provides a high - speed , full duplex digital transmission link using echo - cancelling techniques . a total of four digital channels are provided : two 64 kbps channels , one 16 kbps channel and one 8 kbps channel . where the 64 kbps channels can be used for pcm voice or high - speed data , the 16 kbps channel is used to communicate with the featurephone , and the 8 kbps auxiliary channel is used to communicate with other devices on the line , ( i . e . repeaters ) and / or with the featurephone . the dflc interfaces to the system by a pcm interface and a sense / control interface . data over the pcm interface is transferred to originating time switch ( ots ) 208 and received from terminating time switch ( tts ) 209 . this data is either digitized voice data or circuit switched data and has a data rate of 64 kbps . ( herein : pcm data means either digitized voice or circuit switched data .) high - speed data interface 204a converts the serial data between the different bit rates of line interface 203a , and ots 208 . in addition , high - speed data interface 204a provide a time switch stage . trap register 207 is used to perform diagnostic testing and downloading of information . ( these functions are described in more detail in co - applications &# 34 ; a circuit for testing digital lines &# 34 ;, ser . no . 07 / 615 , 529 filed on nov . 19 , 1990 &# 34 ; a method of downloading data to a plurality of destinations in a telephone system &# 34 ;, ser . no . 07 / 615 , 522 filed on nov . 19 , 1990 . through the sense / control interface , pp 210 communicates with dflc processor 206 , which in turn communicates to the featurephone 202 . only high - level messages are passed through this interface as shown in fig1 . note : fig1 is discused in more detail later . the sense / control interface consists of eight data lines , four address lines , and associated control lines . when pp 210 sends a message to dflc , it writes the message into the dflc &# 39 ; s input buffer , then sets a sys - dflc flag on the dflc . the dflc , upon receiving the sys - dflc flag , reads the message and resets the flag , indicating to pp 210 that it is ready for another message . conversely , when the dflc sends a message to pp 210 , it writes the message into its output buffer and sets a dflc - sys flag . when pp 210 sees the dflc - sys bit set it reads the message from the dflc and resets the dflc - sys flag . protocol controller 205 handles the &# 34 ; bit - level &# 34 ; protocol conversion thereby providing a very reliable data link between the dflc and the featurephone . line interface 203a converts the digital data into an appropriate signal for transmission over a twisted - pair line . the signal from the line interface is transmitted to the featurephone , where an identical line interface receives the signal and reconstructs the digital data . referring now to fig4 and 5 , a more detailed description will be given . fig4 shows a more detailed block diagram of the dflc , while fig5 shows the processor complex in greater detail . transformer 401 and digital interface chip ( dic ) 402 implement line interface 203a of fig3 and transformer 406 and digital interface chip ( dic ) 407 implement line interface 203b of fig3 . the dics provide an interface between the line ( tip - and - ring ) on one side , and a time division multiplexed ( tdm ) serial data - stream on the other . each dic uses four tdm time - slots ; two channels for the high - speed data , one channel for the link with the featurephone , and a channel for control and status of the dic itself . note : the auxiliary channel is part of the control / status channel . after dic 402 finishes accessing the tdm data stream , dic 407 is signaled , allowing dic 407 access to the tdm data stream during the next four time - slots . with the present implementation , a total of eight dics can be daisy - chained onto the same bus . receive and transmit buffers 403 , 408 and 404 , 409 respectively , convert the bit - rate between the system ( pcmx and pcmr ) and the dics while preserving the overall data - rate of the channel . all four buffers are under control of timeslot assigner 416 and clock - generator 417 . timeslot assigner 416 is programmed by the external peripheral processor , and determines the time slots for each high - speed channel on the pcms and pcmr busses . clock - generator 417 produces all the timing signals needed by dics and is phased locked to a master clock signal provided by the system . under the control of clock - generator 417 , the buffers are enabled , during the proper time - slot , to receive and transmit serial data from the dics . briefly referring to fig6 and 7 the receive and transmit buffers are shown in greater detail . these figures show that the high - speed buffers are comprised of serial - to - parallel - to - serial converters , or just called serial - to - serial converters . referring back to fig4 clock - generator 417 also provides timing for c channel buffers 405 and 410 and multi - protocol serial controller ( mpsc ) 411 . the c channel buffers provide an interface between processor complex 414 and dics and monitor internal status . additionally , the c channel buffers convert the data between the parallel format of processor complex 414 and the serial format of dics 402 and 407 . the c channel buffers allow the processor complex 414 to operate asynchronously to the dics . the c channel buffer , as used in the present invention , is taught in application : &# 34 ; an interface circuit for data transmission between a microprocessor system and a time - division system &# 34 ;, u . s . pat . no . 4 , 975 , 911 . it should be noted that the auxiliary channel used to communicate with other devices on the line ( i . e . repeaters ), is transferred by the c channel buffers . mpsc 411 provides bit - level protocol functions , thereby , providing a highly reliable data link between the dflc and featurephone . because of the relatively high data rate of this channel , ( 16 kbps times two , one for each featurephone ) dma controller 412 interfaces mpsc 411 to processor complex 414 . this allows data to be transferred between the mpsc and the processor complex with very little over - head . processor complex 414 interfaces to the system through message interface 415 . through this interface , the system passes high - level commands to the dflc , upon which , the dflc performs all the low - level computing and communications with the featurephone . fig5 shows the processor complex in more detail . it is apparent that some of the components from fig4 appear here also . from this figure it is obvious to a person of ordinary skill in the art that the processor complex is of a basic microprocessor configuration , however , there are a few additions . for example , this complex has an engineerable amount of non - volatile ram 507 ( nvram ) for storing customer information . also , there is a ram key lock 503 which allows microprocessor 514 to &# 34 ; write - product &# 34 ; non - volatile ram 507 and individual 1k byte pages of ram 504 . referring to fig8 a block diagram of the featurephone is shown . the signal from the dflc is received by line interface 601 . line interface 601 is identical to the line interface on the dflc with the exception that it operates in a slave mode . in the slave mode , all timing is derived from the two - wire line , whereas in the master mode , all timing signals must be externally derived and supplied to the line interface . the digital subscriber controller ( dsc ) 602 provides bit - level protocol control and channel separation . cpu 604 provides the higher level protocol control , in addition to controlling other functions for the telephone . the featurephone does not perform any call processing functions , it simply reports events ( buttons being pushed , off - hook . . . etc .) to the dflc and performs actions that the dflc commanded ( blink led , display message , enable amp . . . etc .). unlike a pots line , here , the link between the dflc and featurephone is always active . instead of the line card detecting an off - hook , the featurephone detects the off - hook and sends the appropriate message to the dflc . referring to fig9 when the link is first activated or initialized , the various levels of the link must be connected . when the link is first powered - up , or after testing of the link , the link is in the dead state . after performing initialization of the dflc , the deactivate state is automatically entered . the link will stay in this state until the dflc receives an initialize or activate link message from the system . after receiving an initialize or activate link message the awaiting activation state is entered . during this time the line interface circuit is activated and time is allowed for the dflc line interface and the featurephone interface to synchronize . if , after a predetermined amount of time has passed , the line interfaces do not synchronize , the dflc returns to the deactivate state , and an failure message is sent to the system . after the line interfaces synchronize , the awaiting connection state is entered . during this time the protocol controller of the dflc and the featurephone are allowed to synchronize . if , after a predetermined amount of time has passed , the protocol controllers do not synchronize , the dflc returns to the deactivate state , and a failure message is sent to the system . once the protocol controllers synchronize , the dflc enters the active state . in this state , the dflc &# 39 ; s processor complex and the featurephone &# 39 ; s processor can exchange messages and calls can be originated and terminated . the active state can be exited by : ( 1 ) a message from the system to deactivate ; ( 2 ) the protocol controller losing synchronization ; ( 3 ) the line interface losing synchronization ; or ; ( 4 ) the featurephone not responding . a deactivate message from the system causes the dflc to change to the deactivate state . should the protocol controller lose synchronization , the awaiting connection state is entered . if the line interface loses synchronization or the featurephone does not respond , the link problem state is entered . her , there is an attempt to restore the link ; if the link is restored prior to time n200 expiring , the active state is reentered , and a report is sent to the system . this type of outage is generally caused by a &# 34 ; glitch &# 34 ; on the line , and is short in duration so that the protocol controllers do not lose synchronization . if the link is not restored prior to timer n200 expiring but before a predetermined time , the active state is reentered , and a report is sent to the system . it may be necessary to enter the awaiting connection state because the protocol controllers may have lost synchronization . if , after a predetermined amount of time , the link is not restored , the deactivate state is entered and an error report is sent to the system . as stated earlier , once in the active state , the dflc &# 39 ; s processor complex and the featurephone &# 39 ; s processor can exchange messages and calls can be originated and terminated . referring to fig1 some of the messages transferred between the system , dflc , and featurephone when a featurephone calls another featurephone are shown . the originating featurephone goes off - hook causing a message to be sent to the dflc . the dflc then sends a fp -- origination message to the system indicating that the featurephone is originating a call . at the same time the dflc sends to the featurephone messages to turn on the audio amp , display &# 34 ; please dial &# 34 ;, and blink on led to indicate that the line is in use . the system tells the dflc to collect -- digits . as each digit is pressed , it is sent from the featurephone to the dflc and the dflc sends the digit back to the featurephone to display . after the dflc has collected all the digits , the dflc sends them to the system . assuming a valid number was dialed , the system tell the dflc that the terminating telephone is ringing ; the dflc in turn sends to the featurephone the string &# 34 ; ringing &# 34 ; to display . the system then sends a request -- ringing message to the terminating dflc . the terminating dflc then sends to the terminating featurephone messages causing it to ring , blink on the led to indicate in - use , and display a short message and the calling parties number . when the telephone is answered , the terminating featurephone sends an off - hook message to the dflc . the dflc then sends fp -- answer to the system . simultaneously , the dflc sends to the terminating featurephone messages to stop the ringing , turn on the led , and turn on the audio . once the system receives the fp -- answer message , it sends fp -- send -- answer to the originating dflc . the dflc then tells the featurephone to display a message ( i . e . answer ) and turn on the led . both parties are talking and no further call processing is done until one party hangs up . the remainder of fig1 shows the hang - up call processing messages . from fig1 it is apparent that the dflc does a substantial amount of call processing and the featurephone is relatively a &# 34 ; dumb &# 34 ; instrument . this allows the featurephone to be less complex , leading to higher reliability , smaller size , lower power , and lower cost . all the featurephone buttons except the digits are programmable by the user . once the user initiates the programming sequence , a series of menus are displayed to aid the programming process . the entire programming process is handled by the dflc , the central office system does not participate . programming information is stored in the nonvolatile ram of the dflc . should the dflc need to be replaced , the central office system retrieves the information from the present dflc prior to removal . after the new dflc is placed into the central office system , the central office system down - loads the customers information . it should be noted that only during a dflc card replacement is the customers database ever loaded into the central office system . although the preferred embodiment of the invention has been illustrated , and that form described , it will be readily apparent to those skilled in the art that various modifications may be made therein without departing from the spirit of the invention or from the scope of the appended claims . | 7 |
in the single figure which shows a construction of an embodiment of the throttle control device according to the present invention , an acceleration pedal 1 is linked to an acceleration link 2 to which an end of an acceleration wire 3 is connected . an end of a pedal return spring 4 is connected to the acceleration link 2 to bias it in a return direction so that it is normally in an initial , idle position defined by a stopper 5 . the acceleration wire 3 is disposed in an acceleration wire guide 6 movably therethrough and has one end connected to an acceleration movable element 7 which is biased in a return direction by a return spring 8 so that it is normally in an initial position defined by a stopper 9 . a reference numeral 10 depicts an acceleration sensor provided on the movable element 7 . a throttle link 11 is connected to a throttle valve ( not shown ) and has a movable portion to which one end of a throttle wire 12 is connected . the other end of the throttle wire 12 is connected to one end of a movable element 16 . the throttle wire 12 is movable in a throttle wire guide 13 . a reference numeral 30 depicts a stopper for restricting a maximum stroke position of the movable element 16 . the throttle valve is biased in a closing direction by a throttle return spring 15 connected to the movable portion of the throttle link 11 so that it is in an initial position defined by a throttle link stopper 14 . a reference numeral 28 depicts an intermediate disc which is provided coaxially with a shaft portion 16c of the movable element 16 in contact with a front end flange 16a thereof . an intermediate spring 29 is provided between the intermediate disc 28 and a rear flange 16b of the movable element 16 . the intermediate spring 29 has a spring constant which is at least 1 . 5 times that of the throttle return spring 15 . a reference numeral 31 is a throttle sensor provided on the rear flange 16b of the movable element 16 . a wire 17 for constant speed running has one end connected to a constant speed clutch 18 connected ( cruise control ) to an actuator 19 and the other end connected to a movable element 21 for constant speed to which a return spring 20 is connected to bias it in a resetting direction so that it is normally in an initial position defined by a stopper 22 . the wire 17 is movable in a wire guide 23 . a traction wire 24 has one end connected to a traction clutch 25 connected to the actuator 19 and the other end connected to a movable element 33 for traction control . the wire 24 is connected to one end of a traction spring 26 and biased thereby to a traction side . the traction wire 24 is guided in a traction wire guide 27 . an operation of the throttle control device constructed as above will be described . normal running condition , a torque is transmitted through the acceleration link 2 connected thereto to the acceleration wire 3 , so that the latter is pulled in a direction shown by a solid arrow . when the depressing force applied to the pedal 1 is larger than the spring force of the return spring 8 , the movable element 7 is shifted rightwardly together with the acceleration wire 3 so that a compression force is applied to the intermediate spring 29 through the intermediate disc 28 . however , since the intermediate spring 29 is not compressed due to its high spring constant , and movable element 16 is shifted rightwardly , and the throttle wire 12 is pulled rightwardly to drive the throttle valve in an opening direction through the throttle link 11 . as a result , an automobile speed is controlled correspondingly to the opening of the throttle . under a constant speed running condition , the clutch 18 is energized and the wire 17 is pulled in a solid arrow direction by the actuator 19 corresponding to a deviation of the vehicle speed from a set value . therefore , the movable element 21 is shifted rightwardly and the throttle movable element 16 is also shifted rightwardly . as a result , the throttle wire 12 is pulled rightwardly to drive the throttle valve in the opening direction through the throttle link 11 , and , when the speed deviation becomes zero , the opening of the throttle valve at this time is maintained to set the constant speed running condition . assuming that outputs of the acceleration sensor 10 and the throttle sensor 31 are depicted by s1 and s2 , respectively , the following conditions are established , where s0 is an aimed throttle opening , s0 &# 39 ; is a controlled throttle opening and δs is a width of control . ______________________________________at a start of constant speed running s2 = s0 ( 1 ) during constant speed running control s2 &# 39 ; = s0 ± δ s ( 2 ) at an end of constant speed running s2 &# 34 ; = s0 &# 39 ; ≃ s0 ( 3 ) ______________________________________ under a start condition of an automobile having a manual shift , a tire slip occurring due to an abrupt depression of the accelerator pedal 1 is detected by a slip detector provided on a brake system in response to which the traction clutch 25 is energized and the traction wire 24 is pulled in a direction shown by the solid arrow until the slip detection signal disappears regardless of the amount of depression of the acceleration pedal 1 . therefore , the movable element 33 is shifted leftwardly to control the throttle to reduce its opening defined by the depressed pedal 1 through the movable element 16 and , when the opening reaches an initial throttle opening , the traction control is terminated . assuming that outputs of the acceleration sensor 10 and the throttle sensor 31 are depicted by s1 and s2 , respectively , the following conditions are established . ______________________________________at a start of traction control s1 = s2 = s0 ( 4 ) during a traction control s2 &# 39 ; = s0 - δ s ( 5 ) at an end of traction control s2 &# 34 ;= s0 &# 39 ; = s0 ( 6 ) ______________________________________ where s0 is an initial opening , s0 &# 39 ; is a controlled opening and δs is a width of control . when the acceleration pedal 1 is depressed continuously during the traction control , the intermediate spring 29 is compressed and the reactive force thereof is transmitted to the acceleration pedal 1 . therefore , the pedal feels heavy to an operator and he removes his foot to close the throttle valve . under a control - free condition where none of the controls ( i ), ( ii ), ( iii ) and ( iv ) is performed or a power switch is turned off , the throttle valve is kept at closed condition or at minimum opening condition . therefore , there is no such condition provided as an abrupt starting of the automobile . as described hereinbefore , according to the present invention which is a throttle control device , either one of the normal running control , the constant speed running control and the traction control can be performed and under the initial condition the throttle valve is kept closed or substantially closed . therefore , there is no uncontrolled starting of the automobile , resulting in an essentially safe automobile . further , since all of the driving of the device is performed by wires , the device itself can be made compact , providing a high freedom of arrangement thereof . in addition , since the acceleration opening ( or a shift amount of the acceleration wire ) and the throttle opening ( or a shift amount of the throttle wire ) are detected by the acceleration sensor and the throttle sensor , respectively , and the throttle opening control is performed according thereto , the control itself becomes highly accurate . | 1 |
referring to fig2 and 3 , a computer housing 100 according to the instant disclosure includes a front panel 10 , an outer casing 20 , a housing body 30 and a fixing mechanism 40 . the outer casing 20 is assembled onto an outer surface of the housing body 30 . the front panel 10 is fixed to a front plate 32 of the housing body 30 by the fixing mechanism 40 . the structure is described as follows . the housing body 30 includes a front plate 32 , a top plate 34 , a rear plate 36 , a bottom plate 38 and lateral plates 39 . the fixing mechanism 40 is slidably assembled on the front plate 32 . the front plate 32 includes a front portion 322 , a first lateral portion 324 and a second lateral portion 326 . the front portion 322 connects the first lateral portion 324 and the second lateral portion 326 . the first lateral portion 324 faces the second lateral portion 326 . a plurality of holes 327 are formed respectively on the front portion 322 close to the first lateral portion 324 and the second lateral portion 326 . in fig3 , five holes 327 corresponding to hooks 47 of the fixing mechanism 40 are respectively formed on locations of the front portion 322 respectively near to the first lateral portion 324 and the second lateral portion 326 . referring to fig4 a , the fixing mechanism 40 includes a first hooking plate 42 , a second hooking plate 44 , a central connecting element 46 and a spring 48 . the first and second hooking plates 42 and 44 are stripe - shaped and have respective flanges 421 and 441 respectively vertical to the surfaces thereof a plurality of hooks 47 protrude respectively from the flanges 421 and 441 and respectively perpendicular to the flanges 421 and 441 . the hooks 47 correspond to the holes 327 on the front portion 322 . the structure of the hook 47 is shown in fig5 in detail . the hook 47 has a hook portion 471 , a first slanted surface 472 and a second slanted surface 473 . the hook portion 471 is a vertical protrusion of the hook 47 and faces the flanges 421 and 441 with a predetermined distance . the first slanted surface 472 is formed on the back side of the hook portion 471 , and the second slanted surface 473 is formed under the first slanted surface 472 . referring to fig4 a , the central connecting element 46 connects the first hooking plate 42 and the second hooking plate 44 to form a u - shaped structure and move the first and second hooking plates 42 and 44 synchronously . the first hooking plate 42 and the second hooking plate 44 are respectively slidably disposed on respective inner sides of the first lateral portion 324 and the second lateral portion 326 . the spring 48 is an extension spring which is respectively assembled between the first hooking plate 42 and the front portion 322 near to the first lateral portion 324 and between the second hooking plate 44 and the front portion 322 near to the second lateral portion 326 . one end of the spring 48 is fixed to the front portion 322 near to the first lateral portion 324 or the front portion 322 near to the second lateral portion 326 , and the other end of the spring 48 is fixed to the first hooking plate 42 or the second hooking plate 44 ( shown in fig4 b ), whereby the spring 48 biases the first and second hooking plates 42 and 44 . a button 50 is disposed between the top plate 34 and the outer case 20 and connected to the central connecting element 46 . the outer case 20 has an opening 9 ( shown in fig3 ) through which the button 50 protrudes to be pushed by the user . the button 50 can be pushed to move the first and second hooking plates 42 and 44 . the structure of the button 50 is described below in detail . the front panel 10 has a first engaging plate 12 corresponding to the first hooking plate 42 and a second engaging plate 14 corresponding to the second hooking plate 44 . the first and second engaging plates 12 and 14 are assembled respectively on an inner side of the front panel 10 . a plurality of engaging slots 17 corresponding to the holes 327 and the hooks 47 are respectively formed on the first and second engaging plates 12 and 14 . a respective slope 18 extends forward from the first and second engaging plates 12 and 14 at the lower edge of the respective engaging slot 17 . the hook 47 passes through the hole 327 of and moves or slides between a first position a ( shown in fig5 ) limited by the upper edge of the hole 327 opposite to the slope 18 and a second position b ( shown in fig8 ) limited by the slope 18 . the springs 48 are pre - stretched to respectively pull the first hooking plate 42 and the second hooking plate 44 by the elastic force , whereby the respective hooks 47 thereof abut against the upper edges of the respective holes 327 and are maintained in the first position a , as shown in fig5 . referring to fig5 to 9 , since the first engaging plate 12 and the second engaging plate 14 are fixed onto the front panel 10 , for the sake of clarity , the front panel 10 is omitted and the first engaging plate 12 and the second engaging plate 14 are used to represent the front panel 10 . when the front panel 10 is assembled to the computer housing 100 , the front panel 10 is moved toward and is to be pressed onto the front plate 32 in such a manner that the engaging slots 17 of the first engaging plate 12 and the second engaging plate 14 are respectively aligned with the respective holes 327 of the first hooking plate 42 and the second hooking plate 44 . specifically , when the front panel 10 is moved and pushed toward the front plate 32 ( as shown by a right arrow in fig5 and 6 ), the upper edges of the respective engaging slots 17 push against the first slanted surfaces 472 of the respective hooks 47 to move the first hooking plate 42 and the second hooking plate 44 downward ( as as shown by the downward arrow in fig6 ) and away from the first position a . at this time , the spring 48 is thus pulled , as shown in fig6 to an extent that the hook 47 passes through the engaging slot 17 . then , the hook 47 is pulled back to the first position a by the resilient force of the spring 48 such that the hook portion 471 of the hook 47 abuts against the engaging slot 17 , as shown in fig7 . in addition , several positioning posts ( not shown ) disposed on the inner side of the front panel 10 are respectively inserted into several extruding holes ( not shown ) formed on the front plate 32 so as to assist positioning of the front panel 10 . thereby , the front panel 10 is combined to the front plate 32 . when the front panel 10 is to be removed , the button 50 is pushed to move the first hooking plate 42 and the second hooking plate 44 from the first position a to the second position b as shown in fig8 . at this time , the hook portion 471 is aligned with both the engaging slot 17 and the hole 327 to release the engagement of the hook 47 with the engaging slot 17 and the hole 327 . at this time , the spring 48 is pulled to have a resilient force applied on the first and second hooking plates 42 and 44 respectively afterwards , and the second slanted surface 473 of the hook 47 abuts against the slope 18 to product a repulsive force as shown in a left arrow in fig8 to spontaneously separate the front panel 10 from the front plate 32 as shown in fig9 . thus , the front panel 10 may be easily detached from the front plate 32 . referring to fig1 , the button 50 includes a main body 52 , a compression spring 54 and a latch mechanism 56 . one end of the compression spring 54 is fixed to the main body 52 and the other end of the compression spring 54 is fixed to the central connecting element 46 . when the main body 52 is pressed , the compression spring 54 is pushed and biases the central connecting element 46 to move the first and second hooking plates 42 and 44 from the first position a to the second position b . the latch mechanism 56 includes a rotatable element 561 and an extension element 562 connected to the rotatable element 561 . the rotatable element 561 is rotatably disposed in a depression 522 of the main body 52 . the extension element 562 extends from the rotatable element 561 through a hole 523 to beneath the main body 52 . in this embodiment , the extension element 562 is l - shaped and the main body 52 has an abutting portion 521 abutting against the outer case 20 . referring to fig1 , the abutting portion 521 is separated from the central connecting element 46 at a short distance . the extension element 562 is moved between the abutting portion 521 and the central connecting element 46 along with the rotation of the rotatable element 561 . at this time , the main body 52 is obstructed by the extension portion 562 and cannot be pressed so as to achieve the purpose of lock up . the latch mechanism 56 may lock up the button 50 to avoid improper operation and theft . in addition , the central connecting element 46 has another embodiment shown in fig1 . the central connecting element 46 is respectively connected to the first hooking plate 42 by a fixing elements 461 ( such as a screw ) and to the second hooking plate 44 by a fixing element 462 . a pivot shaft 463 is disposed at the center of the central connecting element 46 . a lower end of one spring 48 is connected to the second hooking plate 44 and an upper end thereof is connected to the front plate 32 . an upper end of another spring 48 is connected to the first hooking plate 42 and a lower end thereof is connected to the front plate 32 . when the button 50 is pushed , the second hooking plate 44 is moved downward and the central connecting element 46 is rotated counterclockwise about the pivot shaft 463 to move the first hooking plate 42 upward . in addition to the above - mentioned embodiments , the central connecting element can be eliminated , and handles are respectively disposed on the first and second hooking plates . the handles exposed from the outer case are pressed to respectively move the first and second hooking plates from the first position a to the second position b . the front panel is assembled or detached without any tool , whereby the labor and time for assembly and maintenance are saved . it is very easy to replace or assemble a fan filter or storage device via the front plate due to the simple and convenient operation of assembly or detachment of the front panel . since the button has a latch mechanism , the button of the front panel is also provided with a burglarproof function . this invention is applicable to a slim front panel design to enhance the higher rigidity of the front panel . the description above only illustrates specific embodiments and examples of the present invention . the present invention should therefore cover various modifications and variations made to the herein - described structure and operations of the present invention , provided they fall within the scope of the present invention as defined in the following appended claims . | 6 |
an exemplary embodiment of the present invention provides a method for reducing loss and latency in the event of failure of an active network device such as a router . in order to appreciate the advantages of the present invention , it will be beneficial to describe the invention in the context of an exemplary network environment . [ 0020 ] fig1 is a simplified block diagram of a local area network ( lan ) comprising a plurality of hosts 100 , 102 , 104 , 106 and a plurality of routers 110 and 116 . the routers 110 , 116 may be viewed as being coupled to the lan 108 to provide gateway access to a computer network 120 . the computer network 120 , may comprise , for example , the internet or other global or local computer networks . the routers 110 and 116 may also be coupled to one or more other lans ( not shown ). one of skill in the art will appreciate that for this invention , any data processing device in a lan may be considered a host . for example , the hosts 100 , 102 , 104 , 106 may be a terminal , personal computer , workstation , minicomputer , mainframe , etc . further , the lans in this and other embodiments may have one or more different configurations including , but not limited to , ethernet ( ieee 802 . 3 ), token ring ( ieee 802 . 5 ) and fddi ( ansi x3t9 . 5 ). at any one time , one of the routers 110 or 116 assumes the state of primary or active router . in an exemplary network , the hosts 100 , 102 , 104 , 106 are preferably configured to point to the primary router . thus , when a host needs to send data packets outside of lan 108 , it directs them to the primary router . one of skill in the art will appreciate that the present invention may be implemented in a variety of manners . for example , in one embodiment , the primary and secondary routers may be realized in a packet switching node 180 . referring to fig2 an exemplary packet switching node may comprise a plurality of line cards 124 , 126 and 128 interconnected by a switching backplane 160 . in the described exemplary embodiment , the line cards may be interconnected to respective groups of lans 130 , 132 , 134 and preferably interconnected to each other over data paths 138 , 140 , 142 via the switching backplane 160 . in accordance with an exemplary embodiment the line cards 124 , 126 and 128 may forward packets to and from their respective groups of lans 130 , 132 , 134 in accordance with one or more operative communication protocols , such as , for example , media access control ( mac ) bridging and internet protocol ( ip ) routing . the line cards 124 , 126 and 128 may communicate with other packet switching nodes or routers over a computer network 120 , which may include for example the internet and / or other global or local computer networks . in the described exemplary embodiment management cards 170 and 172 may be coupled to the switching backplane to control a variety of functions in support of the operation of the packet switching node 180 . [ 0025 ] fig3 is a simplified block diagram of an exemplary line card 150 , that may be similar to one or more of the line cards 124 , 126 and 128 of fig2 . the described exemplary line card 150 may include an access controller 154 coupled between the lans and a packet switching controller 152 . the described exemplary access controller 154 may receive inbound packets from lans and may perform flow - independent physical and mac layer operations on the inbound packets . the described exemplary access controller 154 may transmit the inbound packets to the packet switching controller 152 for flow - dependent processing . the access controller 154 may also receive outbound packets from the packet switching controller 152 . the access controller may perform physical and mac layer operations on the outbound packets and transmit the outbound packets to the lans or to a computer network , such as , for example , the computer network 120 of fig2 . the described exemplary packet switching controller 152 may receive inbound packets , classify the packets , generate application data for the inbound packets , modify the inbound packets in accordance with the application data , and transmit the modified inbound packets on a switching backplane , such as , for example , the switching backplane 160 of fig2 . in an exemplary embodiment the packet switching controller 152 may also receive outbound packets from other packet switching controllers over the switching backplane , and transmit the outbound packets to the access controller 154 for forwarding to the lans or to the computer network , such as , for example , the computer network 120 of fig2 . in other embodiments , the packet switching controller 152 may also subject one or more outbound packets to egress processing prior to forwarding them to the access controller 154 . the packet switching controller 152 may be implemented in non - programmable logic , programmable logic or any combination of programmable and non - programmable logic . in the described exemplary embodiment the management cards may manage the routing function at the network layer . the described exemplary management cards may comprise a general - purpose processor executing one or more special - purpose routing protocols , or may alternatively be implemented using special - purpose hardware . in an exemplary embodiment the management cards may maintain a routing database or routing table . the routing table reflects the overall topology of the entire network . referring back to fig2 in an exemplary embodiment of the present invention the management cards 170 and 172 may communicate in peer sessions with neighboring routers in the network via the switching backplane 160 and the line cards 124 , 126 and 128 to exchange topology - related information so that the routing tables are kept current despite changes in the network topology . thus , for example , when a new node is configured on a network segment , that information is broadcast in a peer session throughout the network to enable each router to update its routing table to reflect the current session state . in an exemplary embodiment of the present invention a forwarding table may also be stored on the line cards to map the destination address of each received packet to the identity of the route by which the packet should be forwarded . in the described exemplary embodiment , the various forwarding tables on the line cards may contain a subset of the information from the routing table stored by the management cards . in accordance with an exemplary embodiment the management cards may periodically update the individual forwarding tables on the line cards as changes to the routing table occur via a shared memory communication path 190 . in operation , when a data packet arrives at a line card , the packet switching controller 152 ( see fig3 ) may make a next hop determination based upon at least a portion of the destination address . for example , in one embodiment the packet switching controller may utilize an address matching algorithm to search the forwarding table for an entry corresponding to the destination address located in the network layer header of the received data packet . the packet switching controller may then forward the packet to the appropriate line card through the switching backplane 160 at what is referred to as wirespeed or linespeed , which is the maximum speed capability of the particular network . the receiving line card then transmits the packet onto the appropriate network segment . further , when a control message arrives at a line card during a peer session , the packet switching controller may forward the packet to the corresponding management card through the switching backplane . [ 0031 ] fig4 is a block diagram of a programmable packet switching controller 200 according to an exemplary embodiment of the present invention . the programmable packet switching controller 200 , for example , may be similar to the packet switching controller 152 of fig3 . in the described exemplary embodiment the programmable packet switching controller 200 may have flow resolution logic for classifying and routing incoming flows of packets . packet switching controllers in other embodiments may include more or less number of components . for example , a packet switching controller in another embodiment may include a pattern match module for comparing packet portions against a predetermined pattern to look for a match . the packet switching controller in yet another embodiment may include an edit module for editing inbound packets to generate outbound packets . further , packet switching controllers in still other embodiments may include other components , such as , for example , a policing engine , in addition to or instead of the components included in the programmable packet switching controller 200 . due to its programmable nature , the programmable packet switching controller 200 preferably provides flexibility in handling many different protocols and / or field upgradeability / programmability . the programmable packet switching controller 200 may also be referred to as a packet switching controller , a switching controller , a programmable packet processor , a network processor , a communications processor or as another designation commonly used by those skilled in the art . the described exemplary programmable packet switching controller 200 includes a packet buffer 202 , a packet classification engine 204 , and an application engine 206 . the programmable packet switching controller 200 preferably receives inbound packets 208 . the packets ( or data units ) may include , but are not limited to , ethernet frames , atm cells , tcp / ip and / or udp / ip packets , and may also include other layer 2 ( data link / mac layer ), layer 3 ( network layer ) or layer 4 ( transport layer ) data units . for example , the packet buffer 202 may receive inbound packets from one or more media access control ( mac ) layer interfaces over the ethernet . in an exemplary embodiment the received packets may be stored in the packet buffer 202 . the packet buffer 202 may include a packet fifo for receiving and temporarily storing the packets . the packet buffer 202 preferably provides the stored packets or portions thereof to the packet classification engine 204 and the application engine 206 for processing . the packet buffer 202 may also include an edit module for editing the packets prior to forwarding them out of the switching controller as outbound packets 218 . the edit module may include an edit program construction engine for creating edit programs real - time and / or an edit engine for modifying the packets . the application engine 206 preferably provides application data 216 , which may include a disposition decision for the packet , to the packet buffer 202 , and in one embodiment the edit program construction engine preferably uses the application data to create the edit programs . the outbound packets 218 may be transmitted over a switching fabric interface to communication networks , such as , for example , the ethernet . the packet buffer 202 may also include either or both a header data extractor and a header data cache . the header data extractor preferably is used to extract one or more fields from the packets , and to store the extracted fields in the header data cache as extracted header data . the extracted header data may include , but are not limited to , some or all of the packet header . in an ethernet system , for example , the header data cache may also store the first n bytes of each frame . in an exemplary embodiment the extracted header data is preferably provided in an output signal 210 to the packet classification engine 204 for processing . the application engine may also request and receive the extracted header data over an interface 214 . the extracted header data may include , but are not limited to , one or more of layer 2 mac addresses , 802 . 1p / q tag status , layer 2 encapsulation type , layer 3 protocol type , layer 3 addresses , tos ( type of service ) values and layer 4 port numbers . in other embodiments , the output signal 210 may include the whole inbound packet , instead of or in addition to the extracted header data . in still other embodiments , the packet classification engine 204 may be used to edit the extracted header data to be placed in a format suitable for use by the application engine , and / or to load data into the header data cache . in an exemplary embodiment the packet classification engine 204 may include a programmable micro - code driven embedded processing engine . the packet classification engine 204 may be coupled to an instruction ram ( iram ) ( not shown ). the packet classification engine preferably reads and executes instructions stored in the iram . in one embodiment , many of the instructions executed by the packet classification engine are conditional jumps . in this embodiment , the classification logic includes a decision tree with leaves at the end points that preferably indicate different types of packet classifications . further , in the described exemplary embodiment branches of the decision tree may be selected based on comparisons between the conditions of the instructions and the header fields stored in the header data cache . in other embodiments , the classification logic may not be based on a decision tree . as described above , management cards 170 and 172 may comprise a processor for performing the routing functions of the device . in an exemplary embodiment the management card processor may comprise a programmable micro - code driven embedded processing engine . the management card may further comprise an instruction ram ( iram ) ( not shown ) coupled to the processor . the processor may read and execute instructions stored in the iram . in the described exemplary embodiment one of the management cards , e . g . management card 170 in fig2 may assume the state of primary or active router . in addition , one of the management cards , e . g . management card 172 in fig2 may function as a redundant or secondary management card or router that mirrors or replicates the active state of the primary management card or router 170 . the secondary management card ( also known as the secondary router ) 172 is generally in stand - by mode unless the primary management card ( also known as the primary router ) 170 fails , at which point a fail - over to the secondary management card or router 172 is initiated to allow the secondary management card or router 172 to be substituted for the primary management card or router 170 . in the illustrative embodiment in fig2 if management card 170 is initially the primary or active router , it performs the various control functions necessary to support packet routing as previously described . for example , the primary router may participate in peer sessions with neighboring network devices to maintain the overall topology of the network . however , in the described exemplary embodiment the primary and secondary routers share state information from each peer session to maintain real time synchronization between the primary and secondary subsystems . in one embodiment , real - time synchronization may be achieved by executing the same application programs on the primary and secondary routers and passing control messages en route from or to the primary router during a peer session through the secondary or standby router . in this embodiment the secondary router may then process the packets to monitor the peer session to maintain an accurate routing table that reflects the current status of the network topology . [ 0044 ] fig5 graphically illustrates the processing of the secondary router protocol stack for an outgoing control or signaling message , i . e . a frame transmitted from the primary router to peer routers during a peer session . for example , when a secondary router operating the border gateway protocol ( bgp ) receives an outgoing tcp / ip frame it sends the message up through the interface &# 39 ; s associated network layer 300 . this layer notes that the received frame is an ip frame , strips off the message &# 39 ; s physical layer header and trailer , if any , and sends the message up to the ip layer 310 . in the described exemplary embodiment the ip layer 310 determines the destination address of the frame and may determine that the frame is a tcp frame and may pass the frame to a tcp stream handler 320 . the tcp stream handler identifies the sequence number and that the stream is a bgp stream . in the described exemplary embodiment a bgp layer 330 may examine the state information in the signaling or control message to determine if updated table entries for example are being communicated by the primary router to the peer routers . in accordance with an exemplary embodiment , routing table 30 entries added or updated by the peer routers may also be added or updated in the routing tables of the secondary router to maintain a precise awareness of the session state from the peer router ( s ) viewpoint . similarly , fig6 graphically illustrates the processing of the secondary router protocol stack for an incoming frame , i . e . a frame transmitted from a peer router across the computer network to the primary router . in accordance with an exemplary embodiment , the secondary router receives incoming frames from the computer network and routes them to the primary router . for example , when a secondary router operating the border gateway protocol ( bgp ) receives an outgoing tcp / ip frame it sends the message up through the interface &# 39 ; s associated network layer 400 . this layer notes that the received frame is an ip frame , strips off the message &# 39 ; s physical layer header and trailer , if any , and sends the message up to the ip layer 410 . in the described exemplary embodiment the ip layer determines the destination address of the frame and may determine that the frame is a tcp frame and may pass the frame to a tcp stream handler 420 . the tcp stream handler identifies the sequence number and that the stream is a bgp stream . in one embodiment the tcp layer does not generate an acknowledgement to the incoming control message during a peer session when the secondary router is operating in a backup mode . in the described exemplary embodiment a bgp layer 430 may examine the state information in the signaling or control message to determine if updated table entries for example are being communicated . the secondary router may then update the routing table accordingly to maintain a precise awareness of the session state from the primary router &# 39 ; s viewpoint . in this example , bgp and tcp are illustrated , however the present invention may be used in conjunction with a plurality of protocols such as , for example , ospf and udp as well as other protocol combinations . one of skill in the art will appreciate that the present invention may be implemented in variety of ways . for example , referring to fig7 in an exemplary embodiment of the present invention , the primary router 110 may for example forward control messages in accordance with any of a variety of routing protocols to the secondary router 116 via the switching backplane 160 . in this embodiment the secondary router may process the outgoing control frame and update it &# 39 ; s routing table in response to the processed message to reflect the session state from the peer router &# 39 ; s viewpoint . the secondary router may then forward the control frames to the switching backplane for broadcast to the protocol peers 122 . similarly , in the described exemplary embodiment the line cards associated with the primary and secondary routers may be programmed to forward incoming control or signaling messages received during a peer session to the secondary router via the switching backplane . in the described exemplary embodiment the secondary router may then process the incoming control messages and update it &# 39 ; s routing tables in response to the processed message to reflect the current session state from the primary router &# 39 ; s viewpoint . in this embodiment the secondary router may forward the control messages to the primary router via the switching backplane . one of skill in the art will appreciate that passing control messages en route from or to the primary router during a peer session through the secondary router may interrupt control plane communications with the primary router if the secondary router fails . therefore , in the described exemplary embodiment the primary router may also monitor the status of the secondary router . for example , the primary router may periodically forward a status request to the secondary router . in this embodiment , if the secondary router fails to respond with an acknowledgement the primary router may assume that the secondary router has failed . alternatively , the secondary router may automatically forward status messages to the primary router . in this embodiment , if the primary router does not receive a scheduled status message from the secondary router it may again assume that the secondary router has failed . in the described exemplary embodiment if the primary router detects a secondary router failure it may instruct the associated lines cards to forward control messages directly to the primary router . in addition , the primary router may also directly broadcast control messages to the peer routers via the switching backplane and associated line cards , bypassing the failed secondary router . although an exemplary embodiment of the present invention has been described , it should not be construed to limit the scope of the appended claims . those skilled in the art will understand that various modifications may be made to the described embodiment and that numerous other configurations are capable of achieving this same result . for example , referring to the simplified block diagram illustrated in fig8 in an exemplary alternate implementation , protocol messages are not indirectly communicated through the secondary router during a peer session . rather , the line card ( not shown ) may forward incoming routing protocol messages such as , for example , bgp messages , to both the primary router 110 and the secondary router 116 . in addition , in this embodiment , the secondary router may not process or snoop outgoing messages from the primary router to one or more peer routers on the other side of the network . therefore , the primary router does not need to monitor the secondary router to avoid peer session interruptions that might be caused by the failure of the secondary router . in operation , the secondary router typically does not respond to or acknowledge incoming protocol messages during a peer session when functioning in a backup role . rather the secondary router may again monitor the status of the primary router and upon failure of the primary router may begin responding to routing protocol messages . for example , in one embodiment , the secondary router may intermittently poll the primary router via the shared memory messaging interface 190 ( see fig2 ) and may immediately begin responding to protocol messages when the primary router has been deemed to have failed to respond . to those skilled in the various arts , the invention itself herein will suggest solutions to other tasks and adaptations for other applications . it is the applicants intention to cover by claims all such uses of the invention and those changes and modifications which could be made to the embodiments of the invention herein chosen for the purpose of disclosure without departing from the spirit and scope of the invention . | 7 |
the present invention can provide organic thin film transistors ( otfts ), which contain a quinacridone derivative or derivatives as an active charge - transporting material to facilitate charge flow in the transistors . in one embodiment , quinacridone derivatives can be used in an otft as illustrated in formula i below , which can demonstrate a hole mobility of at least 0 . 1 cm 2 v − 1 s − 1 and a current on / off ratio of at least 10 4 respectively : wherein each r 1 - r 12 is independently — h , — oh , — nh 2 , - halogen , — sh , — cn , — no 2 , — r 13 , — or 14 , — sr 14 , — nhr 14 , or — n ( r 14 ) 2 ; each r 13 is —( c 1 - c 30 ) alkyl , - phenyl , - naphthyl or thiophene ; each of which is unsubstituted or substituted with one or more —( c 1 - c 15 ) alkyl , - phenyl , - naphthyl or - thiophene ; r 14 is defined as above for illustrative examples and exemplary compounds of formulae ( i ) are listed below in table 1 : table i com - structure pound q1 q2 q3 q4 q5 q6 q7 q8 the present invention can also provide an organic field effect transistor comprising a gate electrode , a metal oxide layer , an adhesive layer , a drain electrode , a source electrode , and an active layer comprising at least one quinacridone derivative as set forth above . the gate electrode can be silicon , doped silicon or aluminum . the metal oxide layer can be silicon oxide or aluminum oxide . the adhesive layer can be a layer of titanium or a layer of tungsten , or a layer of chromium . the drain electrode can be a layer of gold or a layer of platinum . the source electrode can be a layer of gold or a layer of platinum . wherein each r 1 - r 12 is independently — h , — oh , — nh 2 , - halogen , — sh , — cn , — no 2 , — r 13 , — or 14 , — sr 14 , nhr 14 , or — n ( r 14 ) 2 ; each r 13 is —( c 1 - c 30 ) alkyl , - phenyl , - naphthyl or thiophene ; each of which is unsubstituted or substituted with one or more —( c 1 - c 15 ) alkyl , - phenyl , - naphthyl or - thiophene ; r 14 is defined as above for r 13 . in another embodiment , the quinacridone derivative can be a compound having the formula : in a further embodiment , the quinacridone derivative contacts either the drain electrode or the source electrode . in another exemplary embodiment , the quinacridone derivatives act as a hole - transporting material to conduct a current flow under a bias . in one exemplary embodiment , the current flow is at least μa . in the organic field effect transistor of the present invention , the field effect mobility is at least 0 . 1 cm 2 v − 1 s − 1 and a current on / off ratio of at least 10 4 . the transistor comprising quinacridone derivatives can be potentially employed in a flat panel display , a photovoltaic device , a sensor , or the like . the following examples are set forth to aid in understanding of the present invention but are not intended to , and should not be interpreted to limit in any way the present invention . the configuration of quinacridone derivatives - based transistor of the present invention is schematically shown in fig1 . the transistor 400 has multiple layers as shown . gate oxide 410 preferably comprising sio 2 is deposited upon gate electrode 405 , n - type si gate . thin adhesion layer 415 comprising ti is placed on the top of layer 410 . gold drain electrode 420 and gold source electrode 430 are in contact with layer 415 . an active layer 440 containing at least one quinacridone derivative is deposited on top of the layer 410 , 420 and 430 . the quinacridone derivative in layer 440 is in contact with drain electrode 420 and source electrode 430 . in a preferred embodiment , the thickness for the gate oxide 410 is 100 nm ( permittivity = 3 . 9 ) and the adhesion layer 415 is 10 nm . the active channel of transistor 400 is from 1 to 5 μm which is defined by distance between drain and source electrodes . quinacridone derivative - based transistors can be fabricated on a substrate - gate structure . gate oxide sio 2 layer ( 100 nm , permittivity = 3 . 9 ) was thermally grown on n - type si substrates ( the gate electrode ). image reversal photolithography was used to form an opening on the photoresist layer for the source and drain patterns . source and drain metal layers ( au conductive film ( 50nm )) on a thin ti adhesion film ( 10 nm ) were deposited by vacuum deposition on top of the sio 2 layer . after the deposition of source and drain electrodes , standard lift - off processes in acetone solution was used to remove the unnecessary metal films on top of the photoresist pattern . the source / drain metal patterns on gate oxide substrate were cleaned with isopropyl alcohol and deionized water respectively , followed by drying under a nitrogen atmosphere . the profile of au electrode was characterized with afm that reveal smooth slope and regular patterns along the entire channel width . all the devices have a channel length and width of 40 and 3000 μm . in this example , the patterned transistor was cleaned before the deposition of active layer . the procedures are shown as follows : first , the transistor was washed with acetone , toluene , methanol and 18 mω water in sequence . afterwards , the transistor was kept under a nitrogen atmosphere until dry and then transferred to a uv - ozone chamber . the transistor was cleaned under a uv ozone treatment for 15 min . and dried under a nitrogen atmosphere . bottom contact otft devices comprising the quinacridone derivatives as active layers were fabricated respectively . all transistors were fabricated with quinacridone derivatives ( thickness = 50 nm ; deposition rate = 2 å / s ) on top of the patterned substrates under high vacuum conditions ( 1 . 0 × 10 6 torr ) respectively . thermal stabilities of q 1 - q 8 were characterized by thermogravimetric analysis ( tga ) before vacuum deposition . the decomposition temperature ( t d ) was measured with a scanning rate of 15 ° c ./ min under a nitrogen atmosphere and the results are listed in table 2 . all quinacridone derivatives are thermally stable for vacuum thermal deposition with t d up to 406 ° c . for 4 . the field - effect mobilities in saturation regime of otfts fabricated with q 1 - q 8 were measured respectively and their performances are listed in table 2 . q 1 - q 8 have a similar chemical structure ; however , their transistor behaviors are significantly different . only q 1 and q 6 - 8 show field effect mobilities in their corresponding otfts . though q 2 - q 5 have similar chemical structures to their q 6 - 8 counterparts and differ by having no methyl groups attached to quinacridone core , no transistor behavior was observed in these quinacridone derivative - based transistors . in this invention , n , n ′- di ( n - octyl )- 1 , 3 , 8 , 10 - tetramethylquinacridone q 8 was found to exhibit the best field - effect mobility . fig2 and 3 show the output and transfer curves of an organic transistors fabricated with q 8 . the device demonstrates typical p - type fet behavior in both saturated and linear regimes , which are comparable to the conventional transistor models . a field mobility and current on / off ratio (/ on // off ) as high as 1 × 10 − 1 cm 2 v − 1 s − 1 and ˜ 10 4 was achieved . devices fabricated with n , n ′- di ( n - butyl )- or n , n ′- di ( n - hexyl )- 1 , 3 , 8 , 10 - tetramethylquinacridone q 6 and q 7 also exhibited field effect mobilities of 1 . 5 and 3 . 1 × 10 − 3 cm 2 v − 1 s − 1 . in comparison , a device fabricated with q 1 containing n , n ′- dimethyl substituents on the quinacridone core showed a mobility of 1 . 5 × 10 − 3 cm 2 v − 1 s − 1 . the field - effect mobility of quinacridone - based otfts increases with increasing the side alkyl chain length of quinacridone moiety . the film morphologies of q 1 - q 3 , q 6 , and q 8 on silicon dioxide surface were characterized by sem respectively under same condition . all films were deposited with a deposition rate of 2 ås − 1 . as shown in fig4 , q 1 exhibits a homogenous packing film with small crystal grains and the field effect mobility of q 1 - based otft was 1 . 5 × 10 − 3 cm 2 v − 1 s − 1 . q 2 and q 3 which containing n , n ′- diethyl and n , n ′- di ( n - butyl ) side chains show large - gap and discontinuous flat crystals which separate far from each others ( fig5 and 6 ). the loose - fitting flat crystals of q 2 and q 3 result in less π - π interaction between their contiguous molecules . compared to q 3 , q 6 containing n , n ′- di ( n - butyl ) groups plus four methyl substituents on the quinacridone core showed a field effect mobility of 1 . 5 × 10 − 3 cm 2 v 1 − 1 s − . this finding is supported by the sem micrograph of q 6 film ( fig7 ) where polycrystalline grain structure was observed . by increasing the chain lengths from — c 4 h 9 ( q 6 ) to — c 8 h 17 ( q 8 ), the crystal packing structure transforms from loose ( q 6 , fig7 ) to compact grains structure ( q 8 , fig8 ). evidently , a condensed crystal structure is far more preferable for charge carriers flow . thus , the field effect mobility of q 6 - based otft was 1 . 5 × 10 − 3 cm 2 v − 1 s − 1 which was two orders of magnitude less than that reported for q 8 ( table 2 ). these results reveal that the charge carrier mobility of quinacridone molecules is highly dependent on the film morphology , which in turn depends on the chemical structure of the molecules . the presence of four methyl substituents and long n , n ′- di ( n - octyl ) side chains in q 8 induce formation of a dense and squashed crystal packing structure with polycrystalline grains . the mobility of q 8 - based otft ( 10 − 1 cm 2 v − 1 s − 1 ) was about 100 times better than that of the other corresponding quinacridone derivatives (˜ 10 − 3 cm 2 v − 1 s − 1 ). the above description and examples are only illustrative of preferred embodiments which achieve the objects , features , and advantages of the present invention , and it is not intended that the present invention be limited thereto . any modifications of the present invention which come within the spirit and scope of the following claims is considered part of the present invention . the following references and other other patents , patent applications or other publications referred to in this application are incorporated by reference herein : 1 . g . horowitz , organic field - effect transistors , adv mater . 1998 , 10 , 365 - 377 . 2 . c . d . sheraw , l . zhou , j . r . huang , d . j . gundlach , t . n . jackson , m . g . kane , i . g . hill , m . s . hammond , j . campi , b . k . greening j . francl , j . west , organic thin - film transistor - driven polymer - dispersed liquid crystal displays on flexible polymeric substrates , appl . phys . lett . 2002 , 80 , 1088 - 1090 . 3 . c . bartic , a . campitelli , s . borghs , field - effect detection of chemical species with hybrid organic / inorganic transistors , appl . phys . lett . 2003 , 82 , 475 - 477 . 4 . m . l . chabinyc , a . salleo , materials requirements and fabrication of active matrix arrays of organic thin - film transistors for displays , chem . mater ., 2004 , 16 , 4509 - 4521 . 5 . y . inoue , s . tokito , organic thin - film transistors based on anthracene oligomers , j . appl phys . 2004 , 95 , 5795 - 5799 . 6 . c . d . sheraw , t . n . jackson , d . l . eaton , j . e . anthony , functionalized pentacene active layer organic thin - film transistors , adv . mater . 2003 , 15 , 2009 - 2011 . 7 . j . zhang , h . wang , x . yan , j . wang , j . shi , d . yan , phthalocyanine composites as high - mobility semiconductors for organic thin - film transistors , adv . mater . 2005 , 17 , 1191 - 1193 . 8 . b . j . batlogg , c . kloc , j . h . scnon , thin film transistors , u . s . pat . no . 6 , 284 , 562 . 9 . m . shtein , s . r . forrest , method of manufacturing high - mobility organic thin films using organic vapor phase deposition , u . s . pat . no . 6 , 734 , 038 b2 10 . d . p . knipp , j . e . northrup , r . a . street , method for producing organic electronic devices on deposited dielectric materials , u . s . pat . no . 6 , 869 , 821 b2 . 11 . h . meng , f . sun , m . b . goldfinger , g . d . jaycox , z . li , w . j . marshell , g . s . blackman , high - performance , stable organic thin - film field - effect transistors based on bis - 5 ′- alkylthiophen - 2 ′- yl - 2 , 6 - anthracene semiconductors , j . am . chem . soc . 2005 , 127 , 2406 - 2407 . 12 . m . m . payne , s . r . parkin , j . e . anthony , c . c . kuo , t . n . jackson , organic field - effect transistors from solution - deposited functionalized acenes with mobilites as high as 1 cm 2 v · s , j . am . chem . soc . 2005 , 127 , 4986 - 4987 . 13 . h . e . katz , l . torsi , a . dodabalapur , synthesis , material properties , and transistor performance of highly pure thiophene oligomers , chem . mater . 1995 , 7 , 2235 - 2237 . 14 . h . yang , t . j . shin , l . yang , k . cho , c . y . ryu , z . bao , effect of mesoscale crystalline structure on the field - effect mobility of regioregular poly ( 3 - hexyl thiophene ) in thin - film transistors , adv . funct . mater . 2005 , 15 , 671 - 676 . 15 . f . gamier , a . yassar , r . hajlaoui , g . horowitz , f . deloffre , b . servet , s . ries , p . alnot , molecular engineering of organic semiconductors : design of self - assembly properties in conjugated thiophene oligomers , j . am . chem . soc . 1993 , 115 , 8716 - 8721 . 16 . h . e . katz , j . g . laquindanum , a . j . lovinger , synthesis , solubility , and field - effect mobility of elongated and oxa - substituted α , ω - dialkyl thiophene oligomers . extension of “ polar intermediate ” synthetic strategy and solution deposition on transistor substrates , chem . mater . 1998 , 10 , 633 - 638 . 17 . v . a . l . roy , y . g . zhi , z . x . xu , s . c . yu , p . w . h . chan , c . m . che , functionalized arylacetylene oligomers for organic thin - film transistors ( otfts ). adv . mater . 2005 , 17 , 1258 - 1261 . 18 . h . sirringhaus , r . h . friend , c . wang , j . leuninger , k . mullen , dibenzothienobisbenzothiophene — a novel fused - ring oligomer with high field - effect mobility , j . mater . chem . 1999 , 9 , 2095 - 2101 . 19 . x . c . li , h . sirringhaus , f . garnier , a . b . holmes , s . c . moratti , n . feeder , w . clegg , s . j . teat , r . h . friend , a highly π - stacked organic semiconductor for thin film transistors based on fused thiophenes , j . am . chem . soc . 1998 , 120 , 2206 - 2207 . 20 . q . miao , t . q . nguyen , t . someya , g . b . blanchet , and c . nuckolls , synthesis , assembly , and thin film transistors of dihydrodiazapentacene : an isostructural motif for pentacene . j . am . chem . soc . 2003 , 125 , 10284 - 10278 . 21 . k . takimiya , y . kunugi , y . konda , n . niihara , t . otsubo , 2 , 6 - diphenylbenzo [ 1 , 2 - b : 4 , 5 - b ′] dichalcogenophenes : a new class of high - performance semiconductors for organic field - effect transistors , j . am . chem . soc . 2004 , 126 , 5084 - 5085 . 22 . e . m . gross , j . d . anderson , a . f . slaterbeck , s . thayumanavan , s . barlow , y . zhang , s . r . marder , h . k . hall , m . flore nabor , j . f . wang , e . a . mash , n . r . armstrong , r . m . wightman , electrogenerated chemiluninescence from derivatives of aluminum quinolate and quinacridones : cross - reactions with triarylamines lead to singlet emission through triplet - triplet annihilation pathways , j . am . chem . soc . 2000 , 122 , 4972 - 4979 . 23 . k . ye , j . wang , h . sun , y . liu , z . mu , f . li , s . jiang , j . zhang , h . zhang , y . wang , c . m . che , supramolecular structures and sssembly and luminescent of quinacridone derivatives , j . phys . chem . b 2005 , 109 , 8008 - 8016 . 24 . j . shi , c . w . tang , doped organic electroluminescent devices with improved stability , appl . phys . lett . 1997 , 70 , 1665 - 1667 . 25 . m . hiramoto , s . kawase , m . yokohama , photoinduced hole injection multiplication in p - type quinacridone pigment films , jpn . j . appl . phys . 1996 , 35 , l349 - l351 . | 8 |
reference will now be made to the drawings wherein like numerals refer to like parts throughout . the following description is of the best mode presently contemplated for practicing the invention . this description is not to be taken in a limiting sense but is made merely for the purpose of describing the general principles of the invention . the scope of the invention should be ascertained with reference to the issued claims . in the description of the invention that follows , like numerals or reference designators will be used to refer to like parts or elements throughout . in one embodiment , as shown in fig1 , an implantable cardiac stimulation device 10 is in electrical communication with a patient &# 39 ; s heart 12 by way of three leads , 20 , 24 and 30 , suitable for delivering multi - chamber stimulation and shock therapy . to sense atrial cardiac signals and to provide right atrial chamber stimulation therapy , the stimulation device 10 is coupled to an implantable right atrial lead 20 having at least an atrial tip electrode 22 , which typically is implanted in the patient &# 39 ; s right atrial appendage . to sense left atrial and ventricular cardiac signals and to provide left chamber pacing therapy , the stimulation device 10 is coupled to a “ coronary sinus ” lead 24 designed for placement in the “ coronary sinus region ” via the coronary sinus ostium ( os ) for positioning a distal electrode adjacent to the left ventricle and / or additional electrode ( s ) adjacent to the left atrium . as used herein , the phrase “ coronary sinus region ” refers to the vasculature of the left ventricle , including any portion of the coronary sinus , great cardiac vein , left marginal vein , left posterior ventricular vein , middle cardiac vein , and / or small cardiac vein or any other cardiac vein accessible by the coronary sinus . accordingly , an exemplary coronary sinus lead 24 is designed to receive atrial and ventricular cardiac signals and to deliver left ventricular pacing therapy using at least a left ventricular tip electrode 26 , left atrial pacing therapy using at least a left atrial ring electrode 27 , and shocking therapy using at least a left atrial coil electrode 28 . the stimulation device 10 is also shown in electrical communication with the patient &# 39 ; s heart 12 by way of an implantable right ventricular lead 30 having , in this embodiment , a right ventricular tip electrode 32 , a right ventricular ring electrode 34 , a right ventricular ( rv ) coil electrode 36 , and a superior vena cava ( svc ) coil electrode 38 . typically , the right ventricular lead 30 is transvenously inserted into the heart 12 so as to place the right ventricular tip electrode 32 in the right ventricular apex so that the rv coil electrode will be positioned in the right ventricle and the svc coil electrode 38 will be positioned in the superior vena cava . accordingly , the right ventricular lead 30 is capable of receiving cardiac signals , and delivering stimulation in the form of pacing and shock therapy to the right ventricle . the right atrial lead 20 , the coronary sinus lead 24 , and the right ventricular lead 30 can all incorporate cardiomechanical electric sensor ( cmes ) material so that the leads can function to provide cardiac mechanical motion data as described herein . as illustrated in fig2 a , a simplified block diagram is shown of the multi - chamber implantable stimulation device 10 , which is capable of treating both fast and slow arrhythmias with stimulation therapy , including cardioversion , defibrillation , and pacing stimulation . while a particular multi - chamber device is shown , this is for illustration purposes only and one of skill in the art could readily duplicate , eliminate or disable the appropriate circuitry in any desired combination to provide a device capable of treating the appropriate chamber ( s ) with cardioversion , defibrillation and pacing stimulation . the housing 40 for the stimulation device 10 , shown schematically in fig2 a , is often referred to as the “ can ”, “ case ” or “ case electrode ” and may be programmably selected to act as the return electrode for all pacemaker “ unipolar ” modes . the housing 40 may further be used as a return electrode alone or in combination with one or more of the coil electrodes , 28 , 36 and 38 , for shocking purposes . the housing 40 further includes a connector ( not shown ) having a plurality of terminals 42 , 44 , 46 , 48 , 52 , 54 , 56 , and 58 ( shown schematically and , for convenience , the names of the electrodes to which they are connected are shown next to the terminals ). as such , to achieve right atrial sensing and pacing , the connector includes at least a right atrial tip terminal ( a r tip ) 42 adapted for connection to the atrial tip electrode 22 . to achieve left chamber sensing , pacing and shocking , the connector includes at least a left ventricular tip terminal ( v l tip ) 44 , a left atrial ring terminal ( a l ring ) 46 , and a left atrial shocking terminal ( a l coil ) 48 , which are adapted for connection to the left ventricular tip electrode 26 , the left atrial ring electrode 27 , and the left atrial coil electrode 28 , respectively . to support right chamber sensing , pacing and shocking , the connector further includes a right ventricular tip terminal ( v r tip ) 52 , a right ventricular ring terminal ( v r ring ) 54 , a right ventricular shocking terminal ( rv coil ) 56 , and an svc shocking terminal ( svc coil ) 58 , which are adapted for connection to the right ventricular tip electrode 32 , right ventricular ring electrode 34 , the rv coil electrode 36 , and the svc coil electrode 38 , respectively . at the core of the stimulation device 10 is a programmable microcontroller 60 which controls the various modes of stimulation therapy . as is well known in the art , the microcontroller 60 typically includes a microprocessor , or equivalent control circuitry , designed specifically for controlling the delivery of stimulation therapy and may further include ram or rom memory , logic and timing circuitry , state machine circuitry , and i / o circuitry . typically , the microcontroller 60 includes the ability to process or monitor input signals ( data ) as controlled by a program code stored in a designated block of memory . the details of the design and operation of the microcontroller 60 are not critical to the invention . rather , any suitable microcontroller 60 may be used that carries out the functions described herein . the use of microprocessor - based control circuits for performing timing and data analysis functions are well known in the art . as shown in fig2 a , an atrial pulse generator 70 and a ventricular pulse generator 72 generate pacing stimulation pulses for delivery by the right atrial lead 20 , the right ventricular lead 30 , and / or the coronary sinus lead 24 via an electrode configuration switch 74 . it is understood that in order to provide stimulation therapy in each of the four chambers of the heart , the atrial and ventricular pulse generators 70 , 72 may include dedicated , independent pulse generators , multiplexed pulse generators , or shared pulse generators . the pulse generators 70 , 72 are controlled by the microcontroller 60 via appropriate control signals , 76 and 78 , respectively , to trigger or inhibit the stimulation pulses . the microcontroller 60 further includes timing control circuitry 79 which is used to control the timing of such stimulation pulses ( e . g ., pacing rate , atrio - ventricular ( av ) delay , atrial interconduction ( a - a ) delay , or ventricular interconduction ( v - v ) delay , etc .) as well as to keep track of the timing of refractory periods , pvarp intervals , noise detection windows , evoked response windows , alert intervals , marker channel timing , etc ., which is well known in the art . the switch 74 includes a plurality of switches for connecting the desired electrodes to the appropriate i / o circuits , thereby providing complete electrode programmability . accordingly , the switch 74 , in response to a control signal 80 from the microcontroller 60 , determines the polarity of the stimulation pulses ( e . g ., unipolar , bipolar , combipolar , etc .) by selectively closing the appropriate combination of switches ( not shown ) as is known in the art . in this embodiment , the switch 74 also supports simultaneous high resolution impedance measurements , such as between the case or housing 40 , the right atrial electrode 22 , and right ventricular electrodes 32 , 34 as described in greater detail below . atrial sensing circuits 82 and ventricular sensing circuits 84 may also be selectively coupled to the right atrial lead 20 , coronary sinus lead 24 , and the right ventricular lead 30 , through the switch 74 for detecting the presence of cardiac activity in each of the four chambers of the heart . accordingly , the atrial ( atr . sense ) and ventricular ( vtr . sense ) sensing circuits 82 , 84 may include dedicated sense amplifiers , multiplexed amplifiers , or shared amplifiers . the switch 74 determines the “ sensing polarity ” of the cardiac signal by selectively closing the appropriate switches , as is also known in the art . in this way , the clinician may program the sensing polarity independently of the stimulation polarity . each sensing circuit 82 , 84 preferably employs one or more low power , precision amplifiers with programmable gain and / or automatic gain control , bandpass filtering , and a threshold detection circuit , as known in the art , to selectively sense the cardiac signal of interest . the automatic gain control enables the device 10 to deal effectively with the difficult problem of sensing the low amplitude signal characteristics of atrial or ventricular fibrillation . the outputs of the atrial and ventricular sensing circuits 82 , 84 are connected to the microcontroller 60 which , in turn , are able to trigger or inhibit the atrial and ventricular pulse generators 70 , 72 respectively , in a demand fashion in response to the absence or presence of cardiac activity in the appropriate chambers of the heart . for arrhythmia detection , the device 10 utilizes the atrial and ventricular sensing circuits 82 , 84 to sense cardiac signals to determine whether a rhythm is physiologic or pathologic . as used herein “ sensing ” is reserved for the noting of an electrical signal , and “ detection ” is the processing of these sensed signals and noting the presence of an arrhythmia . the timing intervals between sensed events ( e . g ., p - waves , r - waves , and depolarization signals associated with fibrillation ) are then classified by the microcontroller 60 by comparing them to a predefined rate zone limit ( i . e ., bradycardia , normal , low rate vt , high rate vt , and fibrillation rate zones ) and various other characteristics ( e . g ., sudden onset , stability , physiologic sensors , and morphology , etc .) in order to determine the type of remedial therapy that is needed ( e . g ., bradycardia pacing , anti - tachycardia pacing , cardioversion shocks or defibrillation shocks , collectively referred to as “ tiered therapy ”). cardiac signals are also applied to the inputs of an analog - to - digital ( a / d ) data acquisition system 90 . the data acquisition system 90 is configured to acquire intracardiac electrogram ( iegm ) signals , convert the raw analog data into a digital signal , and store the digital signals for later processing and / or telemetric transmission to an external device 102 . the data acquisition system 90 is coupled to the right atrial lead 20 , the coronary sinus lead 24 , and the right ventricular lead 30 through the switch 74 to sample cardiac signals across any pair of desired electrodes . the microcontroller 60 is further coupled to a memory 94 by a suitable data / address bus 96 , wherein the programmable operating parameters used by the microcontroller are stored and modified , as required , in order to customize the operation of the stimulation device 10 to suit the needs of a particular patient . such operating parameters define , for example , pacing pulse amplitude , pulse duration , electrode polarity , rate , sensitivity , automatic features , arrhythmia detection criteria , and the amplitude , waveshape and vector of each shocking pulse to be delivered to the patient &# 39 ; s heart 12 within each respective tier of therapy . advantageously , the operating parameters of the implantable device 10 may be non - invasively programmed into the memory 94 through a telemetry circuit 100 in telemetric communication with the external device 102 , such as a programmer , transtelephonic transceiver , or a diagnostic system analyzer . the telemetry circuit 100 is activated by the microcontroller by a control signal 106 . the telemetry circuit 100 advantageously allows iegms and status information relating to the operation of the device 10 ( as contained in the microcontroller 60 or memory 94 ) to be sent to the external device 102 through an established communication link 104 . in the preferred embodiment , the stimulation device 10 further includes a physiologic sensor 108 , commonly referred to as a “ rate - responsive ” sensor because it is typically used to adjust pacing stimulation rate according to the exercise state of the patient . however , the physiological sensor 108 may further be used to detect changes in cardiac output , changes in the physiological condition of the heart , or diurnal changes in activity ( e . g ., detecting sleep and wake states ). accordingly , the microcontroller 60 responds by adjusting the various pacing parameters ( such as rate , av delay , v - v delay , etc .) at which the atrial and ventricular pulse generators 70 , 72 generate stimulation pulses . the stimulation device additionally includes a battery 110 which provides operating power to all of the circuits shown in fig2 a . for the stimulation device 10 , which employs shocking therapy , the battery 110 must be capable of operating at low current drains for long periods of time and then be capable of providing high - current pulses ( for capacitor charging ) when the patient requires a shock pulse . the battery 110 must also have a predictable discharge characteristic so that elective replacement time can be detected . accordingly , embodiments of the device 10 including shocking capability preferably employ lithium / silver vanadium oxide batteries . for embodiments of the device 10 not including shocking capability , the battery 110 will preferably be lithium iodide or carbon monoflouride or a hybrid of the two . as further shown in fig2 a , the device 10 is shown as having an impedance measuring circuit 112 which is enabled by the microcontroller 60 via a control signal 114 . in the case where the stimulation device 10 is intended to operate as an implantable cardioverter / defibrillator ( icd ) device , it must detect the occurrence of an arrhythmia , and automatically apply an appropriate electrical shock therapy to the heart aimed at terminating the detected arrhythmia . to this end , the microcontroller 60 further controls a shocking circuit 116 by way of a control signal 118 . the shocking circuit 116 generates shocking pulses of low ( up to 0 . 5 joules ), moderate ( 0 . 5 - 10 joules ), or high energy ( 11 to 40 joules ), as controlled by the microcontroller 60 . such shocking pulses are applied to the patient &# 39 ; s heart 12 through at least two shocking electrodes , and as shown in this embodiment , selected from the la coil electrode 28 , the rv coil electrode 36 , and / or the svc coil electrode 38 . as noted above , the housing 40 may act as an active electrode in combination with the rv electrode 36 , or as part of a split electrical vector using the svc coil electrode 38 or the la coil electrode 28 ( i . e ., using the rv electrode as a common electrode ). cardioversion shocks are generally considered to be of low to moderate energy level ( so as to minimize pain felt by the patient ), and / or synchronized with an r - wave and / or pertaining to the treatment of tachycardia . defibrillation shocks are generally of moderate to high energy level ( i . e ., corresponding to thresholds in the range of 5 - 40 joules ), delivered asynchronously ( since r - waves may be too disorganized ), and pertaining exclusively to the treatment of fibrillation . accordingly , the microcontroller 60 is capable of controlling the synchronous or asynchronous delivery of the shocking pulses . a variety of diseases such as cardiomyopathy , congestive heart failure , hypertrophic cardiomyopathy , aortic stenosis and ischemic heart disease show characteristic abnormalities in myocardial strain , myocardial tissue velocity and myocardial tissue displacement , rotation and torsion . tissue doppler imaging ( tdi ) data is used to derive myocardial strain and strain rate by analysis of regional disparities in tissue velocity or the spatial location of ultrasonic reflectors ( speckle tracking ) as a function of time . this information is used clinically to evaluate properties of myocardial motion and deformation that provide insight into the electromechanics of the heart . in some embodiments , lead - based sensors may be used as an alternative to tdi for generating quantitative information which relates to the same properties such as myocardial strain , myocardial strain rate , myocardial tissue velocity and myocardial tissue displacement , rotation and torsion . sensors capable of acquiring this data can be used for monitoring purposes and communicate information related to cardiac performance and dysynchrony to the clinician . the same data can be used as part of a closed loop system for crt timing . piezoelectric materials will generate a voltage when subject to mechanical stress or strain , with the magnitude of voltage dependent upon the magnitude of the stress or strain . in some embodiments , sensors comprised of piezoelectric material and positioned in locations optimal for detection of cardiac deformation and / or motion generate raw signals of cardiac mechanical data that can be further processed into myocardial strain , myocardial strain rate , myocardial tissue velocity and myocardial tissue displacement , rotation and torsion data . embodiments of cmess may comprise one or more piezoelectric transducers , which convert mechanical motion into electrical signals . as illustrated in cross section in fig2 b , in some embodiments , a cmes 200 comprises a tubular and / or annular piezoelectric element 210 , either self - supporting or disposed on a supporting structure . in some embodiments , conductors 220 contact the inner and outer surfaces of the tubular or annular element 210 . electrical connections 230 are coupled to the conductors 220 . in preferred embodiments , the sensor 200 is dimensioned for incorporation into a lead . for example , in some embodiments , the outer diameter of the sensor 200 is similar to the outer diameter of a lead , permitting the sensor to be disposed at any position along a lead without causing a profile change that could affect placement of the lead . in some embodiments , one or more of an electrode and / or other sensors is disposed over at least a portion of the sensor 200 . a longitudinal passageway 240 through the sensor 200 in the illustrated embodiment permits routing electrical and / or other types of connections therethrough , for example , from one or more electrodes and / or sensors disposed on the same lead . the conductors 220 comprise any suitable material known in the art , for example , titanium , titanium alloy , titanium nitride , platinum , platinum alloy , carbon , niobium , niobium alloy , tantalum , tantalum alloy , gold , combinations , and the like . in some embodiments , a patient &# 39 ; s tissue is used as one of the conductors . in some embodiments , an elastomer is disposed over the sensor 200 ( not illustrated ). preferred elastomers are biocompatible , including , for example , silicones , polyurethanes , ethylene - propylene copolymers , fluorinated elastomers , combinations , and the like . in some embodiments , the piezoelectric element comprises a relatively hard material , thereby permitting reliable measurements with only small deflections of the piezoelectric material . preferred piezoelectric materials are biocompatible , for example , ceramic piezoelectric materials , including ceramic ferroelectric particles , lead zirconate titanate ( lead zirconium titanate , pzt ), barium titanate , sodium potassium niobate , and the like . in some embodiments , the piezoelectric material comprises na 0 . 5 k 0 . 5 nbo 3 , for example , as described in u . s . pat . no . 6 , 526 , 984 . other piezoelectric materials or deformation - based sensors may also be used . one preferred sensor configuration comprises a piezoelectric material that is thin and covers a large amount of myocardial tissue surface area . covering a large surface area provides global deformation data in comparison to the local information acquired by cmes material deposited in a smaller region . in order for data to be representative of myocardial deformation the cmes preferably contacts myocardium , and thus , the cmes is preferably located along the distal portion of a lead body and contours along either a large caliber coronary sinus lead or the epicardial surface if the cmes is deployed via a limited thoracotomy ( e . g ., a pericardial or epicardial approach ). in other embodiments , the cmes comprises a conductive polymer that has a resistance that changes as a function of strain . by measuring the resistance of the conductive polymer , the strain can be determined . the conductive polymer can be polyacetylene , polyaniline , polypyrrole or any other suitable conductive polymer . in some embodiments that use piezoelectric materials , the raw cmes signal is a measurement of deformation ( strain ), and can be expressed in units of voltage . referring to fig3 a , which depicts a micrograph of some isolated cardiac muscle fibers 304 from the heart , contraction and relaxation of the myocytes may be quantified by the deformation of adjacent mechanical sensors . strain in the myocardium may be measured by the change in relevant length of myocardium : the strain ( e ) given by eq . 1 is a dimensionless quantity . strain is measure of a fractional change from unstressed dimension given by the unstressed zero length . referring to fig3 b and 3c , an expansion to the muscle fiber 304 length l 302 from the initial length lo 300 represents a positive strain , while a compression and dimensional shortening represents a negative strain l 302 . a first order derivative of the raw strain signal with respect to time generates a measure of the deformation ( strain ) rate . the calculated quantity , strain rate , with the unit 1 / s is a measure of the rate of deformation and is equivalent to the shortening or lengthening velocity per fiber length . the microcontroller 60 can also comprise circuitry to process data obtained by the cmes as described herein as part of a closed loop system . alternatively , the data obtained by the cmes can be communicated to an external device 102 and processed thereafter . fig4 depicts a velocity curve 400 of a region of the myocardium 402 generated by tissue tracking data derived from echocardiographs 404 . tissue tracking images are two - dimensional maps that display color - coded tissue velocity information and can be used to identify wall motion abnormalities and to estimate regional strain or shortening of the myocardium . tissue tracking may be particularly useful in identifying wall motion abnormalities that may be treated with resynchronization therapy or may be used to optimize resynchronization therapy . a time of integral of the velocity curve 400 yields a displacement curve 406 of the same region of myocardium . fig5 a depicts echo - generated tissue velocity curves 400 in the apical to basal regions of the heart . the y - axis 502 represents the velocity , the x - axis 504 represents time and the area under the curve 506 , which can be obtained by integrating the velocity curve 400 , represents tissue displacement . fig5 b shows a velocity curve 400 , a displacement curve 406 which can be obtained by integrating the velocity curve 400 , a strain rate curve 510 and a strain curve 512 which can be obtained by integrating the strain rate curve 510 in the apex 514 , mid - wall 516 and base 518 of the heart . as shown in fig5 a , and 5 b , along a longitudinal axis generally parallel to the spine , the heart contracts and moves from base to apex during systole . the heart relaxes and moves in the opposite direction , from apex to base , during diastole . the basal regions generally move a greater distance , an average of approximately 12 mm at most basal segments , than the apical regions , which move approximately 0 - 2 mm at cardiac apex . a measurement of the relative difference in distance that any two regions traverse will generate longitudinal deformation ( strain ) information . echocardiographic techniques such as tissue tracking demonstrate this displacement phenomenon as well as characteristics of velocity , strain and strain rate . in some embodiments , as shown in fig6 , a cmes - bearing device 600 , such as an lv lead , is positioned with respect to the left ventricle ( lv ) such that a portion of the lead incorporating cmes material 604 is substantially parallel to the cardiac central longitudinal axis ( cla ) to thereby acquire longitudinal deformation information . similar information can be acquired by positioning another cmes - bearing device 602 , such as an rv lead , such that a portion of the lead incorporating cmes material 606 is substantially parallel with the cla . both cmes devices 600 , 602 generate data related to the motion of the cardiac apex relative to the base if the cmes material 604 , 606 covers enough surface area along the cla of the heart and contacts myocardial tissue . the greater the distance ( base to apex ) the cmes material 604 , 606 traverses , the greater the amount of resultant deformation and the more global the representation of cardiac motion will be . in the case of the rv lead 602 , additional cmess 608 , 610 may be included . basally located cmes 610 will deform more than apically located cmes 608 and thus be more sensitive to changes in global cardiac geometry . in some embodiments , regional contractile information can be generated from cmes material that covers a short distance . in normal hearts or hearts with global decreases in contractility ( strain , deformation ) such a reduced surface area electrode can provide information about global cardiac contractile function because any regional properties are homogeneous with global properties ( e . g . dilated cardiomyopathy ). however , in more anisotropic conditions , whether in the space domain or time domain , such as ischemic cardiomyopathy or electromechanical dysynchrony , respectively , regional information provides little information about global cardiac contractile function . as the heart is embryologically and structurally derived from a single muscle band that has certain deformation properties , tethering effects ( e . g . regional myocardial shortening has a pulling effect on surrounding myocardium ) create some degree of interrelation between regional and global cardiac deformation . thus , cmes acquired data in the longitudinal axis will provide clinically relevant information if the material covers enough surface area ( e . g . longitudinal lead length ). relative differences in tissue velocity can be used to determine myocardial strain rate derived by using the strain rate equation . this technique is implemented in sophisticated echocardiography machines that are capable of tissue doppler imaging for quantifying regional myocardial strain rate , strain , velocity and displacement . this equation can be similarly applied herein to derive analogous indices descriptive of the same myocardial properties using implanted cmes technology . the strain rate ( sr ) equation is : where vb and va represent regional velocities at points b and a , respectively , sr = strain rate and x = length between points a and b . the calculated strain rate is representative of the myocardial deformation in the region encompassing points a and b where the tissue velocities were measured . similarly , eq . 2 can be utilized to derive estimated tissue velocity information of cardiac motion by using the strain rate between points a and b measured with a cmes sensor capable of measuring strain . taking the derivative of the strain with respect to time yields the strain rate , which can then be used in eq . 2 to determine velocity information . for example in some embodiments , as shown in fig7 , if cmes material 604 in series and in contact with the myocardium at points a 700 and b 702 , which are separated by distance x 704 , the resultant summed deformation voltage vsum that is generated by the series sensor material 604 provides strain information produced along distance x 704 and can be used to derive a deformation index . this property may also be acquired by depositing cmes material 604 along a relatively long portion of an implanted lead in contact with myocardium . in some embodiments , distance x 704 is in a range of about 4 mm to about 30 mm , preferably about 5 mm to about 20 mm , and most preferably about 5 mm to about 10 mm . the first derivative of the signal generated from cmes deformation between points a and b as a function of time , dvsum / dt = dcmes / dt , is proportionate to sr and can be used to derive a sr index that can be plotted as a function of time . the integration of the sr index can be performed to derive an index of strain , which in some embodiments is an index of longitudinal strain . the measure of strain or strain rate between points a and b can be used to detect a myocardial infarct by comparing the measured strain or strain rate values with expected or normal strain or strain rate values . abnormally low strain or strain rate values may indicate the presence of a myocardial infarct . in order to derive regional velocity information , a velocity index , vi , can be defined that is representative of the spatial velocity gradient between points a and b , having a distance x , where vb and va represent regional velocities at points b and a , respectively . rearranging eq . 2 , the strain rate equation , and substituting vi for vb − va yields : thus , by combining eq . 3 and eq . 4 , the cmes derived velocity index , vi , equals the first order derivative , d ( cmes )/ dt , multiplied by x , where x is the span of the distance between cmes electrodes a and b ( or length along a lengthy cmes electrode ). this index can be expressed in units , voltage - cm / sec . this index can be measured instantaneously by using d ( cmes )/ dt max or measured as a function of time during the cardiac cycle . this index generally parallels tissue doppler measurements of myocardial velocity . integration of this velocity waveform will provide displacement information and measurements such as peak longitudinal displacement can be derived . an alternate means of deriving an index of myocardial velocity is by defining the pure cmes signal as a measurement of motion ( e . g . velocity , acceleration ). in order for the cmes to represent motion rather than deformation , the cmes is preferably not fixated to myocardium and is instead relatively free floating . in some embodiments , as shown in fig8 a and 8b , if two or more cmess 800 , 802 are deployed in interventricular septal and lv lateral regions , respectively , information about dysynchrony can be derived . one cmes 802 can be deployed in the lv lateral region via the coronary sinus region ( fig8 a ) or by a transeptal approach ( fig8 b ). alternatively , a pericardial approach ( not shown ) may be used to place the cmes 802 in the lv lateral region . though electromechanical dysynchrony is an anisotropic property , differences between septal and lateral wall motion are often seen in patients suffering from dysynchrony and such measurements are considered specific indicators of patients who respond to cardiac resynchronization therapy ( crt ) device implants . thus , as shown in fig8 c , time of peak cmes voltage ( tcmespeak ) from the septal sensor 800 and lateral sensor 802 located in the distal portion of lead and proximate to myocardium may be used together to provide a cmes dysynchrony index or other parameter that is indicative of the time to peak myocardial strain , which is a currently utilized ultrasonic measurement of dysynchrony . in another embodiment , rv apically placed leads may generate similar information if the cmes material deformation is congruent with septal deformation during the cardiac cycle . alternatively , time to peak d ( cmes )/ dt , which will parallel measurements of time to peak sr , can be used instead to calculate the cmes dysynchrony index . other features of the cmes signal can be used for timing ( e . g . time of onset of cmes voltage waveform ( vcmes ) or time to peak dvcmes / dt ). generally , the relative timings of the cmes generated signals in opposing regions of interest , for example myocardial wall segments , can be utilized for deriving a dysynchrony index . as the cmes dysynchrony index approaches a value of one , conditions of synchrony will be present . ideally , this time will occur during the latter portion of the systolic ejection phase , when strain 512 is maximal in normal hearts , as shown in fig5 b . as changes in interval timing occur , the index may be followed and the programmed intervals that yield an index that is closest to unity will be optimal . changes in atrioventricular ( av ) and interventricular ( vv ) timing can be made such that multiple permutations of av and vv intervals are evaluated because changes in av timing and vv timing do not have mutually exclusive effects on cardiac synchrony or systolic or diastolic performance . as shown in fig9 , an array or matrix 900 of several av and vv intervals can be tested using a matrix optimization method ( mom ) while the cmes dysynchrony index ( cmes di ) is evaluated for each permutation . mom is described in greater detail in u . s . pat . no . 7 , 010 , 347 , herein incorporated by reference in its entirety . regarding cmes di evaluation , at block 904 cmes di is calculated for a set of current av and vv intervals . at block 906 the calculated cmes di is compared to unity plus or minus a default value ( e . g . a programmable standard deviation ). if the cmes di does not equal unity plus or minus the default value , the process returns to block 902 where another set of av and vv intervals are selected and block 904 where another cmes di is calculated . once cmes di equals unity plus or minus a default value , the tested av and vv intervals are programmed into the device at block 912 . the standard deviation can be derived by analysis of previous values during earlier optimization efforts . the cmes dysynchrony index may also be used with intracardiac electrogram ( iegm ) data for monitoring electromechanical dysynchrony in the heart . if electromechanical dysynchrony is detected , lead based cmes electrodes , as described herein , can be used to implement resynchronization timing therapy as part of a closed loop system . see , for example , u . s . pat . no . 7 , 010 , 347 , previously incorporated by reference . with reference to fig1 a and 10b , in some embodiments , cmess 1010 may be deployed circumferentially along the proximal to lateral portion of the main coronary sinus branch ( endovascular leads ) ( fig1 a ), or along the av groove ( pericardial leads ) ( fig1 b ). in these arrangements , parameters of radial deformation and motion can be derived . radial strain can be used as a global cardiac performance index . however , radial strain is subject to regional effects and the performance of more apical segments may not be well represented , leading to the possibility that regional pathology ( e . g . an mid - cavitary or apical infarct ) will not be detected . in some embodiments , a lead configuration where the cmes is in close proximity to tissue and not free - floating may be utilized to derive rotational velocity information using eq . 5 , thereby providing an index of basal cardiac rotational velocity . if this data is also acquired about the cardiac apex , which is preferably obtained with a pericardial or epicardial lead deployed using a sub - xyphoid approach as shown in fig1 b , relative rotational data can be acquired for derivation of a torsion index . in normal hearts , the cardiac base rotates in an opposite direction from the apex . for example , during isovolumic contraction , the base rotates counter - clockwise while the apex rotates clockwise . the opposite motion occurs during isovolumic relaxation as shown in fig1 d . in fig1 d , curve 1000 represents tissue velocity as a function of time for basilar systolic counter - clockwise rotation and diastolic counter - clockwise rotation . curve 1002 is apical systolic clockwise rotation and diastolic counter - clockwise rotation . this torsion effect is pivotal in generating forces that contribute to isovolumic contraction , aortic valve opening and systolic forward flow and a diastolic suction effect that contributes to early diastolic rapid filling during isovolumic relaxation . time t 1004 is diastolic filling time where no torsion is present and the heart translates and expands 1006 rather than rotates . identification of this timeframe using intracardiac electrograms ( e . g . just before and after the p wave ) can assist in temporal labeling of the generated cmes signals ( see below ). leads placed using a pericardial or epicardial approach are generally more appropriately oriented for generation of clinically relevant cmes signals . in some embodiments , circumferential deformation effects ( i . e . systolic circumferential shortening ) will contribute to the raw radial cmes signal data . thus , the derived rotational velocity information includes both the actual rotational velocity information plus a contribution from circumferential deformation effects . in studies using tissue velocity imaging , the estimated amount of contribution of circumferential deformation to the measured velocity data is approximately 13 % in normal patients and under 5 % in patients with class iii or iv heart failure and ejection fraction less than 40 % ( personal , unpublished data ). thus , application of eq . 5 to radially derived cmes data will provide a relatively accurate index of pure cardiac rotational velocity with some contribution from the effects of circumferential deformation . the amount of contribution of circumferential deformation and of rotational velocity to the data acquired will also relate to the amount of contact the sensor has with underlying tissue . nonetheless , this cardiac performance index is a useful blend of rotational velocity and circumferential contractile properties . if directional information can be derived ( e . g . clockwise vs . counter - clockwise ) from sensors 1010 and 1012 positioned in the apex and base , respectively , as shown in fig1 b , a torsion index can be obtained by adding the measured indices ( in essence adding the absolute values as the rotational vectors are opposite ). patients with more advanced heart failure will have less rotation and / or torsion and less circumferential deformation with a resultant translational motion without significant rotational velocities . thus , the resulting cmes rotational and torsional index will be less in these patients . integration of rotational or torsional dcmes / dt will derive a rotational or torsional displacement index , respectively . in some embodiments , embedding cmes material on an implantable lead such that the voltage generated relies on the direction of deformation will allow the derivation of more accurate representations of actual physiologic properties . for example , as shown in fig1 c , the cmes material 1014 can be placed in strips parallel 1016 to the long axis of a lead body 1018 or in a helical fashion 1020 about the lead body 1018 . if a lead placed about the av ring ( basal location ) has cmes material embedded parallel to the lead long axis , the raw voltage signal generated is more of a function of radial deformation . if the cmes material runs in a helical fashion about the long axis of the lead , the raw voltage signal generated is more a function of circumferential deformation . in some embodiments , if basal and apical cmes electrodes 1010 and 1012 are designed to derive rotational indices as shown in fig1 b , certain assumptions about direction of deformation may be made . for example , if deformation of the cmes material causes it to expand , a different voltage waveform will be generated than if the cmes material contracts . the waveform polarity will not be significantly different as the cardiac forces causing the deformation from the original length result in a voltage signal regardless of material contraction or expansion . certain characteristics of the raw voltage signal ( e . g . relative positive to negative polarity in a signal that is not rectified ), however , will be seen as a result of cmes material contraction rather than expansion and vice versa . signal processing can be applied to derive such polarity information . referring to fig1 , the timing of the voltage signal 1100 will relate to systolic ( e . g . isovolumic contraction ) and diastolic ( e . g . isovolumic relaxation ) deformation voltages , vsys and vdias , respectively . isovolumic contraction ( ivc ) causes a steep rise in longitudinal myocardial tissue velocity 1102 , rotational velocity 1104 , longitudinal and radial deformation ( strain ). ivc typically occurs shortly after depolarization . vsys will typically occur shortly after the electrocardiogram 1106 ( egm ) r wave 1108 , while vdias will typically occur thereafter , before the egm p wave 1110 . in a normal heart , deformation of a lead - based cmes with specific lead orientation and material characteristics ( e . g . parallel to lead body , parallel to the cardiac cla ) can be expected to be a result of longitudinal rather than radial deformation . similarly , inferences about whether a voltage signal is generated as a result of longitudinal systolic contraction rather than diastolic expansion may be made . for example , systolic longitudinal contraction will occur during ivc . this will lead to contraction of cmes material positioned along the length of a lead that is parallel to the cardiac cla . the resulting waveform will occur after the egm r wave and thus , the second cmes voltage waveform , vdias , can be inferred to be a result of material expansion during diastole . likewise , the egm r to vsys interval will be shorter than the egm r to vdias interval , and the interval from vdias to the next egm r will be shorter than the interval from vsys to the next egm r . furthermore , vdias will often be of lower amplitude than vsys as the forces generated from diastolic expansion ( isovolumic relaxation , ivr ) are of less amplitude and are generated more slowly than systolic contraction that occurs during ivc . identification of the temporal relationship of these waveforms to the intracardiac p wave will assist in labeling a given signal as one generated from contraction and not relaxation . these temporal and morphologic signal characteristics will allow the system to infer polarity of deformation information . apically located cmes sensors 1112 will have an assigned polarity that is different than basally located cmes sensors 1114 which is represented on bottom of fig1 as aa and ab , respectively . under normal circumstances these deflections ( with inferred polarity ) will be in the opposite direction as shown , though in patients with congestive heart failure the amplitude will be less and the direction of these signals may be similar ( secondary to translation without rotation and impaired circumferential shortening ). in the pathologic heart , these temporal and morphologic signal characteristics may be less accurate and signal processing for determination of inferred polarity will be less reliable . this is due to the increased dissociation between the electrical and mechanical properties of abnormal myocardium . because of this , material characteristics may be modified as to generate specific raw signal voltage waveforms that are more characteristically seen with contraction or expansion . with such cmes characteristics , signal processing to derive the inferred polarity can be simplified and the resulting information more accurate . in some embodiments as shown in fig1 , the apical and basal cmes signals are processed at blocks 1200 , 1202 . the processed signals are then vector labeled based on temporal and morphologic characteristics at block 1220 . at block 1240 , a subtraction function is utilized to calculate the difference in rotation between aa 1112 and ab 1114 ( bottom of fig1 ). the accuracy of the subtraction function is dependent upon appropriate vector labeling . at block 1260 a torsion calculator is optionally implemented to generate data in numerical format that is communicated 1280 from the device to the programmer via wireless telemetry . alternatively , some of the processes shown in fig1 can be performed within the programmer itself . in some embodiments , torsional velocity calculation is performed by analysis of relative values from basal and apical cmes sensors as described above . derivation of a rotational displacement index can be performed by integration of the derived rotational velocity waveform . it is noteworthy to mention that a combination of the forces generated during isovolumic contraction and relaxation will contribute to the development of the cmes signal and direction specific information may not always be able to be characterized . thus , in some embodiments , cmes data can provide a crude representation of deformation and / or motion . the more myocardial surface area the cmes material covers , the more physiologically accurate the derived indices will be at characterizing the mechanical events occurring during isovolumic contraction and relaxation . it is also noteworthy to mention that the temporal characteristics of the raw cmes voltage signal occur on or about the time of mitral valve and aortic valve closure , but are only temporally related to these events rather than representative of valvular mechanics . under circumstances where the cmes sensor is free floating , myocardial acceleration ( and possibly dp / dt , the rate of change in blood pressure at the sensor site ) and acoustical information may be derived . any and all of the data described herein can be used for monitoring cardiac performance and properties of dysynchrony . likewise , the same data can be implemented for optimization of interval timing for any multi - site pacing system in a closed loop fashion as depicted in fig9 which describes the matrix optimization method . in an alternate embodiment , periodic interval monitoring is used to derive any of the indices described herein . during time frames where diagnostic data is not collected , the voltage generated from the cmess is stored as energy to reduce the costs to the system ( e . g . battery longevity ) of operating such software . fig1 represents actual porcine animal data with an embodiment of a cmes in the ring or proximal position of a pacing electrode in the rv apex , where the electrode tip is in tissue contact but the cmes is not in close contact to myocardium . the top signal is a surface ecg 1300 , the middle signal is a first order derivative , dcmes / dt 1302 , similar in quality and in its temporal relationship to tissue doppler derived myocardial velocity time graphs depicted and described above ( fig5 b ). the integral of this data , cmes 1304 , bottom signal , is displacement . peak systolic rv apical displacement is identified in the figure by arrow 1306 . comparable data can be acquired from a larger surface area cmes that is basally located and parallel to the cardiac longitudinal axis . a higher fidelity signal more representative of global cardiac displacement can be derived from such a sensor . summation averaging of multiple waveforms will provide data with improved signal to noise ratio . fig1 represents actual porcine animal data with an embodiment of a cmes sensor in the lv anterior interventricular vein located ⅔ the distance from the apex toward the base parallel to the cardiac longitudinal axis . the sensor is in contact with the underlying tissue . the waveforms 1400 and 1402 derived are more representative of myocardial deformation and strain . thus , dcmes / dt is an index of strain rate and the integral of this provides an index of strain . the strain / strain rate time graphs are similar to those acquired using tissue doppler imaging and speckle tracking techniques described above . inversion of the waveforms 1400 and 1402 to derive an analogous vector 1500 and 1502 , as shown in fig1 , demonstrates waveforms similar to those depicted in fig5 b derived from the strain rate equation ( eq . 2 ) being applied to doppler derived myocardial tissue velocity imaging performed , for example , by ge vivid series echocardiography equipment . arrow 1504 is peak longitudinal strain . second order derivatives of displacement data or first order derivatives of velocity data can be used to calculate acceleration indices as well . as shown in fig1 , averaging of the measured mechanical stress waveforms is synchronized with the detected heart events , such as spontaneous r - waves 1600 or stimulated events such as valvular heart sounds 1602 detected by an implanted sonomicrometer , filtered and / or processed cmes signal , or a signal from an alternate sensor . synchronization of data acquisition can also be triggered by an impedance based parameter or index that relates to respiration and / or myocardial mechanics . the waveform 1608 is averaged over a predetermined number of consecutive heart cycles 1606 by taking the sample average for every time distance from the detected heart event , such as a qrs complex 1604 . the number of predetermined heart cycles could for instance be 30 . for example , if the sampling frequency is 1 khz , an averaged sample value at 24 ms distance from a qrs is calculated by taking the value at 24 ms distance from a qrs for the predetermined number of heart cycles , which is 30 in this example , and then averaging the values . the averaging is repeated for all samples in the heart interval . this will result in an averaged waveform 1610 based on the predetermined number of beats ( in the example 30 beats ). the strain calculations are then performed using the averaged waveform 1610 . the advantage is that short term variations depending on for instance respiration are cancelled out . this method of averaging is referred to as “ waveform averaging ”. having the advantage of enhancing details in the acquired waveform , the heart rate is preferably fairly stable during the process . this methodology can improve signal - to - noise ratio . data acquisition during periods of rest and relative apnea or hypopnea will further improve the signal to noise ratio ( snr ). as shown in fig1 , input from a can based accelerometer 1700 , to determine whether the patient is at rest , and respirometers 1702 , to determine whether the patient is in a state of apnea or hypopnea , can trigger times for cmes data acquisition 1704 and function in conjunction with the interval specific ensemble averaging feature describe herein and in fig1 . an alternative method to perform the averaging is to calculate the strain parameters for each non - averaged consecutive heart beat and then average the calculated parameters over the predetermined number of heart beats . this method of averaging is referred to as “ value averaging .” having the advantage of detecting beat - to - beat variations of the measured parameters , the heart rate does not have to be fairly stable during the process . this is particularly suitable when variability analysis is to be performed on the measured parameters . the average calculation above is performed using consecutive heart beats , numbered 1 , 2 , 3 . . . , and so on . alternatively , two average values can be calculated . for example , the first value can be calculated using odd numbered beats : 1 , 3 , 5 . . . , and so on . the second value can be calculated using even numbered beats : 2 , 4 , 6 . . . , and so on . the two averaged values can be expected to be equal , but during severe heart tissue ischemia two groups can be formed . this will be the result of the 2 : 1 rhythmic pattern in heart beats often seen during this condition . other manifestations are the presence of rhythmic t - wave alternans ( twa ) and pulsus alternans . processing the measured strain in this way forms a strong detector for this condition and can serve to notify the clinician that a change in physiologic status has occurred . | 0 |
fig3 is an illustration of a reconfigurable oadm 300 according to the present invention . oadm 300 comprises a switching fabric 390 , which includes two pass inputs 330 a – b and two pass outputs 360 a – b . oadm 300 also includes two add inputs 350 a – b and two drop outputs 340 a – b for a total of four inputs and four outputs to switching fabric 390 . switching fabric 390 comprises four switching nodes 315 a – d that perform the add , drop and pass - through functionality for oadm 300 . in this embodiment , the nodes 315 are arranged in a two - dimensional matrix where the rows of the matrix are defined by input / output pairs 330 a / 360 a and 330 b / 360 b , and the columns of the matrix are defined by add / drop pairs 340 a / 350 a and 340 b / 350 b . one node 315 is located at each row / column junction of the matrix . in this example , oadm 300 has one input that receives a wdm optical signal 310 carrying two channels ( i . e . two optical signals with different wavelengths ). optical signal 310 passes into wavelength division demultiplexer 320 . wavelength division demultiplexer 320 demultiplexes the signal into two channels each with a different wavelength and inputs them into switching fabric 390 through pass inputs 330 a and 330 b . in this example , each of the channels input at pass input 330 a – b can be dropped to either of the drop outputs 340 a or 340 b . in addition , either of the add inputs 350 a or 350 b can be used to add channels to either of the pass outputs 360 a or 360 b . on the output side , the two optical channels leaving switching fabric 390 are combined by wavelength division multiplexer 370 into a single wdm optical signal 380 . although fig3 and the accompanying text describe an oadm 300 with two pass inputs , two pass outputs , two drop outputs and two add inputs , the principles illustrated can be straightforwardly extended to oadm switching fabrics with varying numbers of pass inputs , pass outputs , add inputs and drop outputs . for example , fig4 is an illustration of another embodiment of the invention , oadm 400 , which has a switching fabric 490 comprising n pass inputs 410 a – n and n pass outputs 420 a – n . this configuration also has n add inputs 460 a – n and n drop outputs 470 a – n . in addition , there is a switching node 315 at each intersection of a pass input with an add / drop pair . other configurations , including those in which the number of pass inputs , pass outputs , add inputs and / or drop outputs differ from each other , will be apparent to one skilled in the art . in addition , the principles illustrated in fig3 can be straightforwardly extended to oadms with switching fabrics that provide different switching functionality . for example , in oadm 300 in fig3 , each incoming channel input to the pass inputs 330 may be dropped to either drop output 340 . similarly , each optical signal input to add input 350 may be added to either pass output 360 . other embodiments may utilize a different switching functionality . for example , in an alternate embodiment , each pass input 330 and pass output 360 may be limited to a corresponding drop output 340 and add input 350 ( or subset of drop outputs and add inputs ). for example , the “ a ” inputs / outputs may be dedicated to a first wavelength so that , for example , the pass input 330 a may only be dropped to drop output 340 a and not to drop output 340 b . similarly , the add input 350 a may be limited to pass output 360 a . as another example , the oadm switching fabric may only be partially reconfigurable , meaning that some of the inputs and outputs may be hardwired to each other while the remaining inputs and outputs are reconfigurable ( either with full crossbar functionality or a subset of fill crossbar functionality ). as a final example , the switching fabric 390 can also have architectures other than the two dimensional matrix architecture shown in fig3 and 4 . examples of other architectures include banyan and clos architectures . referring again to fig3 , the switching nodes 315 typically will include some sort of splitting and switching of optical signals which , if implemented passively , typically will result in a loss to the optical signal . the result is that optical signals leaving oadm 300 will be weaker than the optical signals entering oadm 300 . however , vertical lasing semiconductor optical amplifiers ( vlsoa ), as described herein , which have linear gain characteristics can be used to implement the switching functionality in the various nodes of an oadm , resulting in a lossless oadm switch . using a vlsoa does not avoid the loss that results from implementation of the switching function ( e . g ., resulting from redirecting , splitting , coupling , and combining ). however , the vlsoa can be used to amplify the optical signal , unlike passive switching components . this will compensate for the losses otherwise introduced . constructing an oadm from vlsoas has further advantages . vlsoas can be switched quickly so that the overall oadm can be reconfigured quickly . in addition , the electronics required to switch the vlsoas are relatively simple . in essence , the electronics need only differentiate between turning on the vlsoa ( i . e ., pumping the vlsoa sufficiently above its laser threshold ) and turning off the vlsoa . vlsoas , because of their gain - clamping characteristics , also have good crosstalk performance . this is important when the oadm adds / drops a wdm optical signal as opposed to single wavelength signals . it is more difficult to construct an oadm 300 from conventional non - lasing soas because conventional soas have poor intersymbol interference and also poor crosstalk between wdm channels , thus limiting the usefulness of any oadm based on conventional soas . fig5 a is an illustration of a portion of the switching fabric of an oadm according to one embodiment of the invention . the broken line - box 315 illustrates a single node in the switching fabric according to fig3 and 4 . the embodiment illustrated in fig5 a comprises a drop path 910 , an add path 920 , and two pass - through paths 930 a – b ( one of which goes through node 315 and one of which is external to node 315 ). the pass - through paths 930 couple the pass inputs of the switching fabric to their corresponding pass outputs . each add path is coupled to a corresponding add input of the switching fabric and each drop path is coupled to a corresponding drop output of the switching fabric . in one embodiment of the invention , the paths are waveguides . however , one skilled in the art will recognize that other embodiments for the paths are possible . for example , the paths could be optical fibers or free space . in addition , a plurality of vlsoas 500 are coupled to these paths to perform the switching required to pass optical signals to the appropriate outputs . vlsoa 500 a is coupled between pass - through path 930 b and drop path 910 . a fiber coupler 950 a splits the optical signal propagating on pass - through path 930 b . a fiber coupler 950 a is an optical component that splits the optical signal into two ( or more ) different paths . optical couplers other than fiber couplers may also be used . part of the optical signal is input to vlsoa 500 a and part is split to vlsoa 500 b . in this embodiment , the power is split 50 — 50 between vlsoas 500 a and 500 b , although different splitting ratios may be used in different designs . if the optical signal needs to be dropped to the drop path 910 so that it can be output from one of the drop outputs of the oadm , vlsoa 500 a will be turned on and will pass the optical signal to drop path 910 . fiber coupler 950 b is used to couple the output of vlsoa 500 a to drop path 910 . vlsoa 500 a preferably also amplifies the optical signal as it propagates through the active region , as described herein , to make up for the loss introduced by fiber coupler 950 a and other losses . in an alternate embodiment illustrated in fig5 b , vlsoa 500 i can be positioned on drop path 910 to make up for the losses introduced by fiber coupler 950 b and other losses . when the optical signal is dropped to drop path 910 , vlsoa 500 b can be turned off to block the optical signal from propagating further on pass - through path 930 b . in other cases , such as broadcasting , vlsoa 500 b can be turned on . by contrast , when the optical signal is not dropped to drop path 910 , vlsoa 500 b is turned on so that the optical signal continues to propagate on pass - through path 930 b . vlsoa 500 b also amplifies the optical signal as it propagates through the active region to make up for the loss introduced by fiber coupler 950 a . in addition , vlsoa 500 a is turned off so that the optical signal does not propagate on drop path 910 where it might interfere with another optical signal that has been dropped from another node onto drop path 910 . when an optical signal needs to be output to one of the pass outputs from one of the add inputs to the switching fabric , the optical signal is input on one of the add paths . in this example , suppose an optical signal is input to add path 920 that needs to be added to pass - through path 930 b . fiber coupler 950 c will split part of the optical signal to vlsoa 500 c and the remaining portion of the optical signal will continue to propagate on add path 920 . when the optical signal is added to pass - through path 930 b , vlsoa 500 b can be turned off to block any optical signal currently propagating on pass - through path 930 b . vlsoa 500 c is turned on so that the optical signal split from add path 920 can pass onto pass - through path 930 b . fiber coupler 950 d couples the output of vlsoa 500 c to pass - through path 930 b . in addition to switching the optical signal , vlsoa 500 c can amplify the optical signal to make up for loss . when an optical signal propagating on add path 920 is not to be added to pass - through path 930 b , vlsoa 500 c is turned off to block the portion of the optical signal split off from add path 920 by fiber coupler 950 c . however , vlsoa 500 b is turned on to allow the optical signal currently propagating on pass - through path 930 b to continue on pass - through path 930 b . as one can see from the fig5 a , half the power of the optical signal propagating on add path 920 is split off by each fiber coupler encountered at each pass - through path 930 . if there are a large number of pass - through paths 930 , the optical signal propagating on add path 920 may become too weak to use reliably . an alternate embodiment , illustrated in fig5 b , counters this problem by positioning vlsoa 500 h on add path 920 to make up for the loss introduced by fiber coupler 950 c and other losses . alternately , the fiber couplers 950 c could implement splitting ratios other than 50 — 50 . for example , if there were ten pass - through paths 930 , the fiber couplers 950 c could be designed so that each vlsoa 500 c receives 10 % of the power of the optical signal originally input onto add path 920 . thus , the first fiber coupler 950 c would tap 10 % of the power , leaving 90 % to propagate further down add path 920 . the second fiber coupler 950 c would tap 11 % of the power ( 11 % of 90 %= 10 %), etc . such an approach may also result in better noise performance . similar remarks apply to tapping power from the pass - through paths 930 . the embodiment in fig5 a also illustrates vlsoa 500 g coupled to add path 920 and drop path 910 using fiber couplers 950 e and 950 f , respectively . vlsoa 500 g provides a loopback function that allows an optical signal input on add path 920 to be output directly to drop path 910 . when this is desirable , vlsoa 500 g is turned on to amplify and pass the optical signal from add path 920 to drop path 910 . this aspect of the embodiment illustrated in fig5 a is optional . in another embodiment , vlsoa 500 g is removed but add path 920 is still coupled to drop path 910 . this embodiment can also be used to provide the loopback function . another embodiment of the switching fabric that can be used in an oadm is illustrated in fig5 c . once again , the functionality of this embodiment will be described using broken - line box 315 which represents a single node from the oadms illustrated in fig3 and 4 . in this embodiment , there are two pass - through paths , 930 b and 930 b 2 in each node 315 . pass - through path 930 b couples one of the pass inputs of the oadm switching fabric to one of the pass outputs of the switching fabric . pass - through path 930 b carries the optical signal input to the pass input and can either pass the optical signal to the corresponding pass output or can drop the optical signal on one of the drop paths 910 to one of the drop outputs of the switching fabric . as illustrated , pass - through path 930 b is coupled to drop path 910 through vlsoa 500 a . this part of the embodiment is similar to that in fig5 a and works in a similar way . the difference in this embodiment is that the add paths 920 are coupled to a second pass - through path 930 b 2 . this pass - through path does not couple to a switching fabric pass input or pass output . pass - through path 930 b 2 is used to carry an optical signal that needs to eventually be added to pass - through path 930 b . as illustrated in broken - line box 315 , add path 920 is coupled to pass - through path 930 b 2 through vlsoa 500 c . in essence , adding an optical signal to pass - through path 930 b 2 is similar to adding an optical signal to pass - through path 930 b in fig5 a . however , also note that pass - through path 930 b 2 is coupled to pass - through path 930 b using vlsoa 500 e ( outside of broken - line box 315 ). preferably , this is done just before pass - through path 930 b is coupled to its corresponding pass output of the switching fabric . when vlsoa 500 e is turned on , the optical signal that is output to the pass output of the switching fabric is the optical signal that was added to pass - through path 930 b 2 through one of the add paths 920 . when vlsoa 500 e is turned off , the optical signal that is output to the pass output of the switching fabric is the optical signal input on pass - through path 930 b at the switching fabric pass input . the advantage of this embodiment is that it allows an optical signal to be added from one of the add paths prior to dropping the optical signal from pass - through path 930 b , which was input from the pass input of the switching fabric , to one of the drop paths . for example , referring to fig3 , this embodiment of the switching fabric allows an optical signal to be added at add input 350 a , that is eventually output from the switching fabric 390 at pass output 360 a while at the same time allowing the optical signal input at pass input 330 a to be dropped to drop output 340 b . in the previous embodiments , this was more difficult because the optical signal added at add input 350 a would have been combined with the optical signal input from pass input 330 a . as a result , both optical signals would be dropped and passed through the switching fabric of the oadm . in another embodiment of the invention , the switching fabric of the oadm can be implemented as a full crossbar switch in which each pass input and add input of the switching fabric can be mapped to any of the pass outputs and / or drop outputs . an example of the crossbar switch can be found in copending patent application ser . no . 10 / 020 , 527 , entitled “ optical crossbar using lasing semiconductor optical amplifiers ,” by jeffrey d . walker and sol p . dijaili , filed dec . 15 , 2001 , which is herein incorporated by reference . as one skilled in the art will recognize , the configurations described above for the switching fabric can be scaled to function for any number of pass inputs , drop outputs , add inputs and pass outputs . in addition , one skilled in the art will recognize that this switching fabric allows an optical signal from any of the pass inputs to be output to any of the drop or pass outputs . similarly , this configuration allows any optical signal input on the add input to be output to any of the pass outputs . one skilled in the art will also recognize that the amplification provided by each of the vlsoas in the switching fabric can be adjusted depending on the strength of the optical signal it is amplifying . in an alternative embodiment of the oadm illustrated in fig3 and 4 , demultiplexer 320 is configured to demultiplex the incoming wdm optical signal into a plurality of wdm optical signals each having one or more optical channels ( i . e . wavelengths ). these wdm optical signals can be added , dropped or passed - through by the switching fabric of the oadm in the same manner as the single wavelength optical signals described above . as described herein , vlsoas 500 can amplify wdm optical signals with substantially less crosstalk than non - lasing soas due to the gain clamped characteristics of the vlsoa . thus , vlsoas 500 can still be used to perform the switching of the wdm optical signals in this embodiment of the invention . fig6 is a block diagram of another embodiment of the invention . in this embodiment , vlsoas 615 a – n are coupled to the pass outputs of switching fabric 610 in oadm 600 . the outputs of vlsoas 615 a – n are then coupled to wavelength division multiplexer 370 . vlsoas 615 are also coupled to microprocessor 620 . it should be noted that the switching fabric 610 of oadm 600 in this embodiment can be any conventional optical switching fabric or one of the switching fabrics of the present invention . due to the reconfigurable nature of oadm 600 , the optical channels output from the pass outputs 640 a – n of switching fabric 610 may have come from pass inputs 650 a – n or from add inputs 670 a – n of switching fabric 610 . since these signals may have come from different sources and may have traveled unrelated distances and paths to reach oadm 600 ( and even traveled different paths through oadm 600 ), it is possible that some of the optical signals output from the pass outputs 640 a – n of switching fabric 610 will have different power levels and signal strengths . by placing vlsoas 615 a – n on the path of optical channels output from pass outputs 640 a – n , vlsoas 615 can balance the signal strength of the optical signals by amplify each optical signal to ensure that they all have the same power prior to being passed into wavelength division multiplexer 370 . microprocessor 620 is coupled to each vlsoa 615 a – n so that it can supply a control signal to the vlsoas 615 a – n . for example , microprocessor 620 can selectively adjust the amplification provided by each vlsoa 615 in order to achieve the desired output signal strength . in one embodiment , the vlsoas 615 a – n are implemented as a monolithic array of vlsoas , as opposed to discrete devices . although the embodiment described above in fig6 refers to placing vlsoas 615 a – n on the pass outputs of switching fabric 610 , balancing the optical signals at other locations can be also be achieved using vlsoas 615 . for example , vlsoas 615 could also be placed on the drop outputs 660 a – n , the add inputs 670 a – n and / or the pass inputs 650 a – n to amplify and balance the optical signals on these inputs / outputs . similarly , a microprocessor 620 could also be coupled to these vlsoas to control the amplification provided by each vlsoa 615 . for oadm &# 39 ; s which use vlsoas as part of the switching fabric 610 , the amplification provided by these vlsoas can also be adjusted in order to balance the power in the optical signals . another embodiment of the invention is illustrated in fig7 . in this embodiment , vlsoas 710 and 720 are placed on the input and the output of oadm 700 respectively . the demultiplexer 730 , multiplexer 740 and the switching fabric 750 of the oadm introduce loss into the individual channels of the wdm optical signal as they are being switched to the correct output . unlike the present invention , most oadms do not have mechanisms in place to make up for these losses . as a result , the optical signals that are output from conventional oadms are often very weak . by placing vlsoa 720 on the output of oadm 700 , all of the channels of the wdm optical signal output from oadm 700 can be amplified simultaneously . in addition , if the wdm optical signal is weak before entering oadm 700 ( due to dispersion , etc .) the losses introduced by oadm 700 may degrade the optical signal to the point where the optical signal is no longer useable . amplifying the wdm optical signal in vlsoa 710 before it is input into oadm 700 helps to counteract this problem . it should be noted that the switching fabric 750 of oadm 700 in this embodiment can be any conventional optical switching fabric or the switching fabric of the present invention . in addition , vlsoas could also be placed on the add inputs or the drop outputs to amplify the optical signals being added or dropped to counteract the same problems described above . fig8 is a diagram of a vertical lasing semiconductor optical amplifier ( vlsoa ) 500 suitable for the present invention . the vlsoa 500 has an input 812 and an output 814 . the vlsoa 500 further includes a semiconductor gain medium 820 , with an amplifying path 830 coupled between the input 812 and the output 814 of the vlsoa 500 and traveling through the semiconductor gain medium 820 . the vlsoa 500 further includes a laser cavity 840 including the semiconductor gain medium 820 , and a pump input 850 coupled to the semiconductor gain medium 820 . the laser cavity 840 is oriented vertically with respect to the amplifying path 830 . the pump input 850 is for receiving a pump to pump the semiconductor gain medium 820 above a lasing threshold for the laser cavity 840 . fig9 is a flow diagram illustrating operation of vlsoa 500 when it is used as an amplifier . the vlsoa 500 receives 990 an optical signal at its input 812 . the optical signal propagates 991 along the amplifying path 830 . the pump received at pump input 850 pumps 992 the semiconductor gain medium above a lasing threshold for the laser cavity 840 . when lasing occurs , the round - trip gain offsets the round - trip losses for the laser cavity 840 . in other words , the gain of the semiconductor gain medium 820 is clamped to the gain value necessary to offset the round - trip losses . the optical signal is amplified 993 according to this gain value as it propagates along the amplifying path 830 ( i . e ., through the semiconductor gain medium 820 ). the amplified signal exits the vlsoa 500 via the output 814 . note that the gain experienced by the optical signal as it propagates through vlsoa 500 is determined in part by the gain value of the semiconductor gain medium 820 ( it is also determined , for example , by the length of the amplifying path 830 ) and this gain value , in turn , is determined primarily by the lasing threshold for the laser cavity 840 . in particular , the gain experienced by the optical signal as it propagates through each vlsoa 500 is substantially independent of the amplitude of the optical signal . this is in direct contrast to the situation with non - lasing soas and overcomes the distortion and crosstalk disadvantages typical of non - lasing soas . fig1 a – 10c are a perspective view , transverse cross - section , and longitudinal cross - section , respectively , of one embodiment of vlsoa 500 according to the present invention , with fig1 b showing the most detail . referring to fig1 b and working from bottom to top in the vertical direction ( i . e ., working away from the substrate 502 ), vlsoa 500 includes a bottom mirror 508 , bottom cladding layer 505 , active region 504 , top cladding layer 507 , confinement layer 519 , and a top mirror 506 . the bottom cladding layer 505 , active region 504 , top cladding layer 507 , and confinement layer 519 are in electrical contact with each other and may be in direct physical contact as well . an optional delta doping layer 518 is located between the top cladding layer 507 and confinement layer 519 . the confinement layer 519 includes a confinement structure 509 , which forms aperture 515 . the vlsoa 500 also includes an electrical contact 510 located above the confinement structure 509 , and a second electrical contact 511 formed on the bottom side of substrate 502 . vlsoa 500 is a vertical lasing semiconductor optical amplifier since the laser cavity 540 is a vertical laser cavity . that is , it is oriented vertically with respect to the amplifying path 530 and substrate 502 . the vlsoa 500 preferably is long in the longitudinal direction , allowing for a long amplifying path 530 and , therefore , more amplification . the entire vlsoa 500 is an integral structure formed on a single substrate 502 and may be integrated with other optical elements . in most cases , optical elements which are coupled directly to vlsoa 500 will be coupled to the amplifying path 530 within the vlsoa . depending on the manner of integration , the optical input 512 and output 514 may not exist as a distinct structure or facet but may simply be the boundary between the vlsoa 500 and other optical elements . furthermore , although this disclosure discusses the vlsoa 500 primarily as a single device , the teachings herein apply equally to arrays of devices . vlsoa 500 is a layered structure , allowing the vlsoa 500 to be fabricated using standard semiconductor fabrication techniques , preferably including organo - metallic vapor phase epitaxy ( omvpe ) or organometallic chemical vapor deposition ( omcvd ). other common fabrication techniques include molecular beam epitaxy ( mbe ), liquid phase epitaxy ( lps ), photolithography , e - beam evaporation , sputter deposition , wet and dry etching , wafer bonding , ion implantation , wet oxidation , and rapid thermal annealing , among others . the optical signal amplified by the vlsoa 500 is confined in the vertical direction by index differences between bottom cladding 505 , active region 504 , and top cladding 507 , and to a lesser extent by index differences between the substrate 502 , bottom mirror 508 , confinement layer 519 , and top mirror 506 . specifically , active region 504 has the higher index and therefore acts as a waveguide core with respect to cladding layers 505 , 507 . the optical signal is confined in the transverse direction by index differences between the confinement structure 509 and the resulting aperture 515 . specifically , aperture 515 has a higher index of refraction than confinement structure 509 . as a result , the mode of the optical signal to be amplified is generally concentrated in dashed region 521 . the amplifying path 530 is through the active region 504 in the direction in / out of the plane of the paper with respect to fig1 b . the choice of materials system will depend in part on the wavelength of the optical signal to be amplified , which in turn will depend on the application . wavelengths in the approximately 1 . 3 – 1 . 7 micron region are currently preferred for telecommunications applications , due to the spectral properties of optical fibers . the approximately 1 . 28 – 1 . 35 micron region is currently also preferred for data communications over single mode fiber , with the approximately 0 . 8 – 1 . 1 micron region being an alternate wavelength region . the term “ optical ” is meant to include all of these wavelength regions . in one embodiment , the vlsoa 500 is optimized for the 1 . 55 micron window . in one embodiment , the active region 504 includes a multiple quantum well ( mqw ) active region . mqw structures include several quantum wells and quantum wells have the advantage of enabling the formation of lasers with relatively low threshold currents . in alternate embodiments , the active region 504 may instead be based on a single quantum well or a double - heterostructure active region . the active region 504 may be based on various materials systems , including for example ialgaas on inp substrates , inalgaas on gaas , ingaasp on inp , gainnas on gaas , ingaas on ternary substrates , and gaassb on gaas . nitride material systems are also suitable . the materials for bottom and top cladding layers 505 and 507 will depend in part on the composition of active region 504 . examples of top and bottom mirrors 506 and 508 include bragg reflectors and non - bragg reflectors such as metallic mirrors . bottom mirror 508 in fig1 is shown as a bragg reflector . top mirror 506 is depicted as a hybrid mirror , consisting of a bragg reflector 517 followed by a metallic mirror 513 . bragg reflectors may be fabricated using various materials systems , including for example , alternating layers of gaas and alas , sio 2 and tio 2 , inalgaas and inalas , ingaasp and inp , algaassb and alassb or gaas and algaas . gold is one material suitable for metallic mirrors . the electrical contacts 510 , 511 are metals that form an ohmic contact with the semiconductor material . commonly used metals include titanium , platinum , nickel , germanium , gold , palladium , and aluminum . in this embodiment , the laser cavity is electrically pumped by injecting a pump current via the electrical contacts 510 , 511 into the active region 504 . in particular , contact 510 is a p - type contact to inject holes into active region 504 , and contact 511 is an n - type contact to inject electrons into active region 504 . contact 510 is located above the semiconductor structure ( i . e ., above confinement layer 519 and the semiconductor part of bragg reflector 517 , if any ) and below the dielectric part of bragg reflector 517 , if any . for simplicity , in fig1 , contact 510 is shown located between the confinement layer 519 and bragg reflector 517 , which would be the case if bragg reflector 517 were entirely dielectric . vlsoa 500 may have a number of isolated electrical contacts 510 to allow for independent pumping within the amplifier . this is advantageous because vlsoa 500 is long in the longitudinal direction and independent pumping allows , for example , different voltages to be maintained at different points along the vlsoa . alternately , the contacts 510 may be doped to have a finite resistance or may be separated by finite resistances , rather than electrically isolated . confinement structure 509 is formed by wet oxidizing the confinement layer 519 . the confinement structure 509 has a lower index of refraction than aperture 515 . hence , the effective cross - sectional size of laser cavity 540 is determined in part by aperture 515 . in other words , the confinement structure 509 provides lateral confinement of the optical mode of laser cavity 540 . in this embodiment , the confinement structure 509 also has a lower conductivity than aperture 515 . thus , pump current injected through electrical contact 510 will be channeled through aperture 515 , increasing the spatial overlap with optical signal 521 . in other words , the confinement structure 509 also provides electrical confinement of the pump current . other confinement techniques may also be used , including those based on ion implantation , impurity induced disordering , ridge waveguides , buried tunnel junctions , and buried heterostructures . the above description is included to illustrate various embodiments of the present invention and is not meant to limit the scope of the invention . from the above description , many variations will be apparent to one skilled in the art that would be encompassed by the spirit and scope of the invention . the scope of the invention is to be limited only by the following claims . | 7 |
the table unit shown in the figures is to be used especially in the field of aircraft passenger seats . these table units can also be used in ferries , trains , long - distance busses or the like . the table unit has a first table element 10 which , as shown in fig1 , rests on the subjacent other or second table element 12 . in the state shown in fig1 , the two table elements 10 , 12 end essentially flush on top of one another to the outside and form an essentially square table surface . the two table elements 10 , 12 , as will be detailed below , can be rotated relative to one another around at least two swivelling axes first , second and third articulations 18 , 20 , 22 and can be fixed relative to one another in definable positions . the possible rotating or swivelling motions of the respective table elements 10 , 12 around the two swivelling axes 14 , 16 are indicated in fig1 by double arrows . the two swivelling axes 14 , 16 are perpendicular to one another and lie in the plane of the table . with the table unit extended , the axes extend from the arm rest or the like essentially horizontally . if the upper table element 10 , viewed in the direction of fig1 , is swivelled counterclockwise around the first swivelling axis 14 , the table unit assumes its unfolded position as shown fig2 . the two table elements 10 , 12 are then next to one another forming essentially a rectangular table surface which corresponds preferably in its width to the width of the seat so that the individual in the neighboring seat in a row of aircraft passenger seats is not disturbed by the expanded table surface . in the unfolded state , the table unit is especially suited as a dining table , with food and beverages being easily accommodated on the table surface . the dining table function in this regard increases comfort when a seat user is eating . the upper table element 10 can move clockwise about the second swivelling axis 16 from its flat horizontal position as shown in fig1 into the tilted position as shown in fig3 . it can be fixed in this tilted position by a fixing means 24 . in this embodiment , the fixing means 24 has a holder 26 which can be folded out in the position as shown in fig2 . in its initial position as shown in fig2 , holder 26 is held flush in the recess of the upper table element 10 , which recess extends on the outside lateral periphery . the holder 26 is supported on the table element 10 to be able to rotate around a swivelling journal 28 . when set up , for example , the holder can assume a position as shown by the broken lines in fig3 . in the tilted position of the table element 10 , the free end of the holder 26 is supported on the top of the table element 12 . by swivelling the holder 26 and moreover by adjusting the fixing means 24 , the incline can be set and fixed according to the stipulations of the user in definable angular ranges . instead of the holder 26 , a fixing means 24 can also be implemented by a ratchet mechanism ( not shown ) in which at least the articulation 20 follows the tilt of the table element 10 , and the articulation 20 retains its swivelled position as a result of the ratchet arrangement . the third articulation 22 can follow the movement of the ratchet by restricted guidance , and in this way can ensure the tilted adjustment of the table element 10 . as the aforementioned clearly shows , each swivelling axis 14 , 16 is defined by two articulations or articulation pairs 18 , 20 and 20 , 22 at a time . the indicated articulations 18 , and 22 are located at a right angle to one another on the outside periphery on the table unit . the articulation 20 is located in one corner between the two other articulations 18 , 22 . thus , this middle articulation 20 is assigned both to first swivelling axis 14 and second swivelling axis 16 . preferably , for the unfolding and tilting motion of the table element 10 , the articulation 20 is technically implemented as a so - called universal joint . all articulations 18 , 20 , 22 have one articulation housing 30 . for all articulations 18 and 22 , the respective articulation housing 30 has a locking part 32 in the form of a locking clamp with two clamping clips 34 . each articulation housing 30 is comprised preferably of one elastically pliable plastic material to form a snap or clip locking part 32 detachably connected to a respective engagement part 36 in the manner of a connecting journal which remains on the respective table element , specifically the table element 12 ( cf . fig2 and 3 ). the journal - like engagement part 36 for the first articulation 18 is located in a u - shaped recess 36 in the corner area of the table element 12 . the engagement part 36 for the third articulation 22 in an angular recess likewise in another corner area of the table element 12 with its free end projecting into the vicinity . the engagement part 36 of the first articulation 18 extends especially within the first swivelling axis 14 . the engagement part 36 of the third articulation 22 extends along second articulation axis 16 . when the table elements 10 and 12 are folded apart into the position as shown in fig2 , swivelling motion tales place around the engagement part 36 of the first articulation 18 . when setting the incline as shown in fig3 , swivelling motion takes place for the table element 10 , around the journal - like engagement part 36 of the third articulation 22 . the second articulation 20 is made as a multiple articulation following the pertinent swivelling or tilting motion . in addition , the articulation housing 30 of the first articulation 18 has a driver 38 ( fig3 ) for the upper table element 10 . in the unfolding motion from the position as shown in fig1 into the position as shown in fig2 by the driver 38 , the respective articulation 30 is swivelled around the engagement part 36 of the first articulation 18 , and consequently , around the other table element 12 until the two table elements 10 , 12 with the two articulation housings 30 of the first articulation 18 and the second articulation 20 form the plane table surface . the driver 38 , as shown especially by fig4 a and 4 b , is formed from a dome - shaped recess located in the center and lying in the vertical arrangement ( cf . fig4 a ) and also in the horizontal arrangement ( cf . fig4 b ) in one plane to the engagement part 36 . for the indicated driver of the articulation housing 30 of the first articulation 18 , the upper table element 10 on its side facing the articulation housing 30 is provided with a spring - loaded closing part 40 . if the table element 10 is now swivelled counterclockwise from its base position as shown in fig4 a upward , the closing part 40 disengages from the hemispherical recess 42 by the closing part 40 being moved in a direction out of the recess 42 and within the table element 10 against the force of the closing spring by forced guidance . during the continued unfolding motion , the closing part 40 slides along the arc - shaped contact surface 44 of the articulation 30 until the table element 10 with its lengthwise orientation is located perpendicular to the lower table element 12 ( not shown ). in this position the closing ball 40 , spring - loaded , then locks with the driver 38 , by both force - fit and form - fit , such that upon the continued unfolding motion of the table element 10 from its vertical position ( not shown ) into the horizontal unfolded position as shown in fig2 , the articulation housing 30 is entrained in the form of a swivelling motion counterclockwise around the engagement part 36 and consequently around the swivelling axis 14 . the unfolded position corresponds to the illustration as shown in fig4 b for the first articulation 18 . in addition to the universal articulation 20 , the table element 10 is fixed by the locked closing part 40 and by the articulation housing 30 of the first articulation 18 in a horizontal alignment on the other table element 12 . the upper and lower table surfaces of the table element 10 and table element 12 then lie in one plane , with the outer sides along the lengthwise edges of the housing 30 of the first articulation 18 . the arrangement for the second articulation 20 is kept in a comparable manner . the width or height of the articulation housings 30 for the first and second articulations 18 and 20 therefore corresponds essentially to the thickness of the table elements 10 , 12 . the swivelling - back motion takes place in reverse . after the closing part 40 engages the hemispherical recess 42 , the housing 30 is moved back into its position as shown in fig4 a , such that the table element 10 has its bottom in contact with the top of the table element 12 . by another hemispherical rolling surface 46 of the articulation housing 30 of the first articulation 18 , the motion forward and away is facilitated by this rolling surface 46 being able to slide down accordingly on the adjacent free face of the table element 12 . in the unfolding motion , the third articulation 22 , by its locking part 32 , disengages from the respective engagement journal or part 36 . likewise , in the reverse sequence , locking takes place instead by the third articulation 22 , if the two table elements 10 , 12 are located on top of one another or the table element 10 is tilted about swivelling axis 16 clockwise relative to the horizontal . the articulation housing 30 of the third articulation 22 then swivels around the respective engagement journal 36 . furthermore , the two table elements 10 , 12 can be swivelled in each position relative to one another around a common axis 48 of rotation extending perpendicular to the two swivelling axes 14 , 16 . the axis 48 of rotation is part of a turntable 50 ( cf . fig1 ) by which the two table elements 10 , 12 are pivotally coupled to the table arm 52 . the turntable rotation is indicated by the double arrows . by the table arm 52 , the table unit can then , for example , be housed in the armrest of the vehicle seat or can be located on the back of the front seat with the capacity to be folded down . preferably , the table arm 52 , like the table elements 10 , 12 , is made of a durable plastic material . for reasons of saving space , the turntable 50 is an integral part of the lower table element 12 , and is integrated flush in its table surface together with parts of the table arm 52 . accordingly , on either side of the turntable 50 , free spaces are provided in the table element 12 in order not to hinder rotary or swivelling motion around the axis 48 of rotation . as fig1 to 3 show in particular , a host of table functions are integrated in the table elements 10 , 12 . these working examples can be varied accordingly . especially advantageously , a projecting lip 54 is provided , for example , as a support for a book , magazine or the like between the two articulations 20 and 22 on the top of the table element . a computer unit 56 , for example , in the form of a conventional pocket calculator or a so - called notebook may be superposed on the top of the table element . the input keyboard 58 also can provide a writing function implemented by a display or the like . viewed in the direction of fig1 and 3 , a vanity mirror 60 covered by an unfolding cover 62 is provided above keyboard 58 . the cover 62 can be housed flush in the table element 10 by a snap or clip connection 64 . to achieve a plane table surface , the vanity mirror 60 is located set recessed within the table element 10 . within the essentially rectangular cover 62 , on its inside facing the vanity mirror 60 , preferably in an outside area facing the user , a recessed storage area 66 can be provided . the lengthwise orientation of the recessed storage area 66 extends parallel to the unfolding axis 68 of the cover 62 . the unfolding axis 68 is also parallel to the swivelling axis 16 . preferably , the free path of motion of the cover 62 is limited to a certain angular degree , for example , 120 °. preferably , for a tilted table element 10 , the cover 62 with the storage area 66 should be located essentially in a horizontal plane extending parallel to the table surface of the table element 12 . the computer unit 56 has the pertinent shell - like , preferably partially transparent cover 70 . as fig2 also shows , for example , on the bottom of the table element 10 a circular recess 72 setting glasses and cups . the recess 72 can be deepened such that there is edge - side encirclement for glasses and cups in their bottom area to enable secure holding for the food in question , thus especially on a rough trip , for example when encountering turbulence . this holding possibility can be optically delineated relative to the remaining surface of the table element 10 . the holding recess 72 can empty to the outside into the area of the holder 26 which ends flush with the outside peripheral surface of the table element 10 . the holder 26 , with its free end , can engage the facing end of the articulation housing 30 of the third articulation 22 if , as shown in fig2 , the holder is folded into the table element 10 . its raised position is shown in fig3 for a definable tilt angle . integration of other table functions would be conceivable , for example , a call indicator for onboard service or the like . especially with the very restricted space available aboard aircraft or the like , the multifunctional tables of the present invention represent a clear improvement of comfort . while one embodiment has been chosen to illustrate the invention , it will be understood by those skilled in the art that various changes and modifications can be made therein without departing from the scope of the invention as defined in the appended claims . | 1 |
the present invention will hereinafter be described by way of one embodiment with reference to the accompanying drawings . referring to fig3 the numeral 1 denotes a register for holding a range a i of a previous symbol ; 2 a subtracter ; 8 a changeover unit ; 9 a changeover unit ; 5 a shifter ; 6 an arithmetic unit ; and 7 a comparator . outputted from prediction estimating unit 11 to the subtracter 2 is s ( a less probability symbol range ) from a table stored in a memory 12 containing a plurality of values on the basis of a status of a markov information source . the subtracter 2 obtains a difference a i - 1 - s between the range s and a previous symbol range a i - 1 stored in the register 1 . the subtracter 2 then outputs this difference . the comparator 7 compares a magnitude of the difference a i - 1 - s with a magnitude of the less probability symbol range s inputted directly from the prediction estimating unit 11 . a result e thereof is outputted . on the other hand , the changeover unit 8 outputs either a i - 1 - s or s as a value of the range to the present symbol . this outputting process is effected based on the difference a i - 1 - s inputted from the subtracter 2 , the output e of the comparator 7 which is inputted from the prediction estimating unit and a signal mps / lps inputted from the prediction estimating unit 11 , the signal indicating whether the markov information source is in the more probability symbol or the less probability symbol . to be more specific , the output e of the comparator 7 is set to &# 34 ; 1 &# 34 ; when a i - 1 - s & gt ; s . when a i - 1 - s ≦ s , the output e is set to &# 34 ; 0 &# 34 ;. based on this presumption : ( a ) when e = 1 , and when the symbol a i = 0 ( mps ), the changeover unit 8 outputs a i - 1 - s as a range allocated to the symbol a i ; ( b ) when e = 1 , and when the symbol a i = 1 ( lps ), the changeover unit 8 outputs s as a range allocated to the symbol a i ; ( c ) when e = 0 , and when the symbol a i = 0 ( mps ), the changeover unit 8 outputs s as a range allocated to the symbol a i ; and ( d ) when e = 0 , and when the symbol a i = 1 ( lps ), the changeover unit 8 outputs a i - 1 - s as a range allocated to the symbol a i . the changeover unit 9 outputs either the s inputted from the prediction estimating unit or the fixed valve &# 34 ; 0 &# 34 ; ( as coordinates δc of the difference with respect to the minimum coordinates of the range allocated to the previous symbol a i - 1 ) on the basis of the signal e from the comparator 7 and the symbol a i . namely : ( a ) when e = 1 , and when the symbol a i = 0 ( mps ), the changeover unit 9 outputs the fixed input s ( as coordinates δc = s of the difference between the minimum coordinates c i - 1 of the range of the previous symbol a i - 1 and the range of the least coordinates c i of the range of the symbol a i ); ( b ) when e = 1 , and when the symbol a i = 1 ( lps ), the changeover unit 9 outputs value &# 34 ; 0 &# 34 ; ( as coordinates δc = 0 of the difference between the minimum coordinates c i - 1 of the range of the previous symbol a i - 1 and the minimum coordinates c i of the range of the symbol a i ); ( c ) when e = 0 , and when the symbol a i = 0 ( mps ), the changeover unit 9 outputs the fixed output 0 ( as the difference coordinates δc = 0 ); and ( d ) when e = 0 , and when the symbol a i = 1 ( lps ), the changeover unit 9 outputs the input s ( as the difference coordinates δc = s ). an output a i of the changeover unit 8 is transmitted to the register 1 , the shifter 5 and the arithmetic unit 6 . the operations of the shifter 5 and the arithmetic unit 6 are the same as those in the prior art . fig4 is a flowchart showing the procedures in the embodiment of this invention shown in fig3 . at a step 1 , whether the symbol inputted is the more probability symbol ( mps ) or the less probability symbol ( lps ) is judged . at steps 2 and 3 , there is made a judgement as to whether or not the range a i - 1 - s allocated to the input symbol is larger than the range s allocated to the lps on the basis of the judgment result . more specifically , if judged as the lps at the step 1 , whether the range s allocated to the lps is smaller than the range a i - 1 - s allocated to the mps or not is judged at the step 2 . if smaller than the range a i - 1 - s , the operation proceeds to a step 5 . whereas if not , the operation moves to a step 4 . if judged as the mps at the step 1 , whether the range a i - 1 - s allocated to the mps is larger than the range s allocated to the lps or not is judged at the step 3 . if larger than the range s , the operation moves to the step 4 . whereas if not , the operation moves to a step 5 . when the range allocated to the mps is larger than the range to the lps wherein the input symbol is conceived as the mps , and when the range allocated to the lps is larger than the range to the mps wherein the input symbol is the lps , the minimum coordinates c i of the ranges a i for the respective inputs thereof are determined at the step 4 . when the range allocated to the mps is smaller than the range to the lps wherein the input symbol is the mps , and when the range allocated to the lps is smaller than the range to the mps wherein the input symbol is lps , the minimum coordinates c i of the ranges a i for the respective input symbols are determined at the step 5 . an initial value of the shift quantity l is set to 0 at a step 6 . at a step 7 , whether each of the ranges a i determined at the step 4 or 5 is smaller than 0 . 5 or not is judged . if smaller than 0 . 5 , the operation moves to a step 8 . whereas if larger than 0 . 5 , the operation moves to a step 9 . the range a i is doubled , and the shift quantity l is increased by one (+ 1 ) at the step 8 . the judgment of the step 7 is made once again . this routine is repeated till the range a i exceeds 0 . 5 . for effecting the arithmetic operation of the code words , at a step 9 the differential coordinates δc are added to the minimum coordinates c i - 1 of the previous symbol range which have cumulatively been added . the minimum coordinates c i for the present symbol are thus obtained . subsequently , the minimum coordinates c i are shifted by the shift quantity of bits . the range a i is added to the minimum coordinates c i shifted by l bits , thereby obtaining the maximum coordinates within the range a i . when the l - bit - shifted portion of the minimum coordinates coincides with the superordinate of the maximum coordinates , the coincident bits are outputted as code words . if not , no bit is outputted . the operation next moves to a step 10 , wherein i is updated to i + 1 for processing the next symbol . then , the operation returns to the step 1 . incidentally , when decoding on the receiving side , it is possible to know whether or not mps / lps is temporarily replaced on the transmitting side by comparing s with a i - 1 - s . decoding can correctly be carried out . next , the effects of the present invention will be quantitatively explained . let r be the probability of occurrence of the lps , and let s be the value of the fixed allocation . when a = 0 . 5 , an allocation ratio r s to the lps is maximized such as : r s = 2s . when a = 1 , the ratio is minimized such as : r s = s . when r s = 2s , a mean code length l 2s per symbol is given by : when r s = s , a mean code length l s is given by : s , which is optimal to r given is obtained ( in terms of minimizing the worst coding efficiency ) by the value of s which satisfies l 2s = l s . next , a range of the mean code length per symbol in the case of application of the present invention is the same as above when s & lt ; 1 / 4 . this range is , however , limited between ls and 1 when 1 / 4 ≦ s & lt ; 1 / 3 . fig5 is a graphic chart of 1 /( e - 1 ) where e is the coding efficiency in this embodiment . it can be understood from fig5 that the coding efficiency is improved by approximately 5 % at the maximum . note that the embodiment discussed above has dealt with an example where normally mps is taken on the upper side on the number line , while the lps is taken on the lower side . much the same effects are exhibited by adopting such a principle that the mps and lps are taken on the mutually reversed sides . as discussed above , the present invention exhibits the following effects . the magnitudes of the regions allocated to the mps and the lps are set in the following manner . the region allocated to the mps is invariably larger than the region allocated to the lps . with this arrangement , the high coding efficiency can be obtained . although the illustrative embodiment of the present invention has been described in detail with reference to the accompanying drawings , it is to be understood that the present invention is not limited to that embodiment . various changes or modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the invention . | 7 |
the four described methods of performing the invention are illustrated in fig1 through 4 , respectively . fig1 a , 2a , 3a and 4a each depict a section of a typical chip comprising a substrate 1 on which a plurality of semiconductor components have been formed by well known thin film techniques . the substrate can be any material satisfactory for thin film deposition techniques , but in this example a sapphire substrate is used . portions of islands 2 carrying selected conductors 4 which are to be connected are illustrated . the conductors 4 typically lead to electrodes of active and passive semiconductor devices ( not shown ) to be connected . for purposes of illustration it will be assumed that an air bridge connecting the conductors 4 is to pass over conductors 6 lying on islands 8 . the conductors 6 typically connect electrodes of semiconductor devices to pads which are used for connecting the chip to external circuitry . each of the four methods will be described in conjunction with its illustrative drawing figures and a table following the description which lists some specific materials utilizable in each step , along with nominal thicknesses thereof . it is to be understood that the drawing figures are not to scale and that some of the dimensions are greatly exaggerated to accommodate the great range of layer thicknesses encountered in each method . it is also to be understood that the materials listed are not all - inclusive and that the thicknesses thereof are not critical . rather they will be determined by the specific chip configuration and in accordance with the guidelines given in the descriptions of the methods . this method , which involves the use of photolithographic and etching techniques includes the following steps : 1 . ( fig1 b ) a layer of bridge support material 10 is deposited onto the conductors 4 , 6 and the substrate 1 . the thickness of the layer should be equal to the desired height of the bridges above the substrate 1 and the conductors 6 to be overpassed . the type of support material chosen should be one which resists etching by a first etching agent effective in the dissolution of the conductive material utilized to form the bridges , but which dissolves in a second etching agent which is ineffective for etching the bridge material . 2 . ( fig1 c ) a layer of photosensitive material 12 is applied to the bridge support material 10 . the layer should be of sufficient thickness to protect the support material covered thereby against etching . 3 . by using well known photomasking techniques , the photosensitive material 12 above contact regions of the selected conductors with which the bridge is to come in contact is exposed and developed to effect uncovering of the bridge support material 10 located above each of the contact regions . the material removed by developing is indicated by crosshatching . 4 . the second etching agent is applied to the uncovered bridge support material 10 to effect removal thereof and uncovering of the contact regions of the conductors 4 . 5 . a solvent is applied to the remaining photosensitive material 12 to effect removal thereof , leaving only the bridge support material 10 covering the conductors 4 , 6 and the substrate 1 ( fig1 d ). openings formed in the bridge support material by application of the second etching agent , to uncover the contact regions of the selected conductors 4 are shown at 14 . 6 . ( fig1 e ) utilizing a deposition technique such as vacuum deposition or sputtering a layer of conductive bridge material 16 is deposited onto the remaining bridge support material 10 and onto the contact regions of the selected conductors 4 . the layer should be of the desired bridge thickness . 7 . ( fig1 f ) a layer of photosensitive material 18 is applied to the conductive bridge material 16 . this layer should be of sufficient thickness to protect the bridge material covered thereby against etching . 8 . ( fig1 f ) again using photomasking techniques all of the photosensitive material 18 , except that spanning the contact regions of the selected conductors 4 , is exposed and developed ( as indicated by crosshatching ). this development effects removal of the photosensitive material covering the bridge material 16 in the areas where bridging is not desired . 9 . ( fig1 g ) the first etching agent is applied to the uncovered bridge material 16 effecting removal thereof . 10 . ( fig1 g ) a solvent is applied to the remaining photosensitive material 18 to effect removal thereof . 11 . ( fig1 g ) the second etching agent is applied to the bridge support material 10 to effect removal thereof . the finished bridge produced by method 1 is illustrated in fig1 h . note the air gaps between the conductive bridge 16 and the overpassed conductors 6 from which capacitive isolation is desired . table 1______________________________________ nominalident . thick - etching sol - number ness material agent developer vent______________________________________10 2 μm titanium fluoboric acid10 2 μm polyimide sulfuric acid12 1 μm shipley shipley ace - a - z 1315j az - 606 tone photoresist16 1 μm gold potassium iodide16 1 μm platinum aqua regia18 1 μm shipley shipley ace - a - z 1315j az - 606 tone photoresist______________________________________ this method also involves the use of photolithographic and etching techniques . it includes the following steps : 1 . ( fig2 b ) a layer of photosensitive material 20 is applied to the conductors 4 , 6 and the substrate 1 . the layer should be of a thickness equal to the desired height of the bridge above the substrate 1 and the conductors 6 to be overpassed . 2 . ( fig2 b ) by use of well known photomasking techniques the photosensitive material 20 above the contact regions of the selected conductors 4 is exposed and developed to effect removal of the exposed material and uncovering of the surface of each of these regions . the material removed by developing is indicated by crosshatching . 3 . ( fig2 c ) utilizing a deposition technique such as vacuum deposition or sputtering a layer of conductive bridge material 22 is deposited onto the remaining photosensitive material 20 and onto the uncovered contact regions of the conductors 4 . the layer should be of the desired bridge thickness . 4 . ( fig2 d ) a layer of photosensitive material 24 is applied to the conductive bridge material 22 . this layer should be of sufficient thickness to protect the bridge material covered thereby against etching . 5 . ( fig2 d ) again using photomasking techniques , all of the photosensitive material 24 except that spanning the contact regions is exposed and developed ( as indicated by crosshatching ). this development effects removal of the crosshatched material 24 and uncovering of the bridge material 22 in the areas where bridging is not desired . 6 . ( fig2 e ) an etching solution is applied to the uncovered bridge material 22 to effect removal thereof . 7 . ( fig2 e ) a solvent is applied to the remaining photosensitive material 20 and 24 to effect removal thereof . the finished bridge produced by method 2 is illustrated in fig2 f . this method is less complex than method 1 because only one etching solution is required and fewer steps are involved . nevertheless , method 2 produces crossover bridges having the same thin film dimensions and low reactance characteristics as the bridges produced by method 1 . table 2______________________________________ nominalident . thick - etching sol - number ness material agent developer vent______________________________________20 2 μm shipley shipley ace - a - z 1315 j az - 606 tone photoresist22 1 μm gold potassium iodide22 1 μm platinum aqua regia24 1 μm shipley shipley ace - a - z 1315j az - 606 tone photoresist______________________________________ this method , which involves the use of photolithographic and electroplating techniques , includes the following steps . 1 . ( fig3 b ) a layer of photosensitive material 30 is applied to the conductors 4 , 6 and the substrate 1 . the layer should be of a thickness equal to the desired height of the bridges above the substrate 1 and the conductors to be overpassed 6 . 2 . ( fig3 b ) by the use of well - known photomasking techniques , the photosensitive material 30 above the contact regions of the selected conductors 4 is exposed and developed to effect removal of the exposed material and uncovering of the surface of each of these regions . the material removed by developing is indicated by crosshatching . 3 . ( fig3 c ) a layer of conductive material 32 is deposited onto the remaining photosensitive material 30 and the contact regions of the conductors 4 . the layer should be of sufficient thickness to form an electroplating electrode and can be effectively deposited by such standard techniques as sputtering and vacuum deposition . 4 . ( fig3 d ) a layer of photosensitive material 34 is applied onto the layer of conductive material 32 . this layer should be of sufficient thickness to ensure that no defects such as pinholes exist , through which the conductive material covered thereby could be plated . 5 . ( fig3 d ) again using photomasking techniques , the photosensitive material 34 above the conductive material 32 spanning the contact regions of conductors 4 is exposed and developed ( as indicated by crosshatching ). the crosshatched material is removed by the development thus uncovering the conductive material 32 to be electroplated . a portion of the photosensitive material 34 near the edge of the wafer is also removed to uncover a contact portion of the conductive material for making an electrical connection . 6 . the wafer is immersed in an electroplating solution containing a conductive material which forms a strong bond with conductive material 32 . the uncovered contact portion of the conductive material 32 is connected to the source of potential utilized for electroplating to effect utilization of layer 32 as one electrode . the particular solution utilized will determine whether layer 32 is connected as the cathode or the anode . the area of the other electrode and the magnitude of the plating current should be selected such that plating to the desired thickness is accomplished prior to deterioration of the photosensitive layer 34 ( which tends to flake off at the high temporatures [ typically 100 ° c .] at which the plating solution is maintained ). the rate of plating can not be too high , however , or the plating material will not form a strong bond with conductive layer 32 . in one test run good results were obtained by utilizing a plating current of approximately 5 milliamps and an anode of 5 cm diameter to plate gold on a gold layered wafer of approximately the same diameter . the resulting bridge is illustrated at 36 in fig3 e . two different processes will now be described for removing the remaining photosensitive material 30 , 34 and the unplated conductive material 32 . the first of these processes , which involves an etching technique , is described in steps 7a through 11a . the second process , which involves a vibration technique , is described in steps 7b through 9b . 7a ( fig3 e ). a solvent is applied to the remainder of photosensitive layer 34 to effect removal thereof . the resulting layer configuration is illustrated in fig3 f . 8a ( fig3 g ) a layer of photosensitive material 38 is applied to both the unplated conductive material 32 and the bridge 36 . this layer should be of sufficient thickness to protect the bridge against an etching agent which will be subsequently applied to remove the unplated conductive material 32 . 9a ( fig3 g ) using standard photomasking techniques all of the photosensitive material 38 lying above the unplated conductive material 32 is exposed and developed . removal of the developed material ( indicated by crosshatching ) uncovers all of the unplated conductive material 32 . 10a ( fig3 h ) an etching agent is applied to the uncovered conductive material 32 to effect removal thereof . 11a ( fig3 h ) a solvent is applied to remove the remaining layers 30 , 38 of the photosensitive material . 7b . ( fig3 e ) a solvent is applied to the remainder of photosensitive layer 34 to effect removal thereof . 8b . ( fig3 f ) the wafer is immersed in an ultrasonic bath and vibrated to remove the unplated conductive material 32 . the strong bond between the conductive bridge 36 and conductors 4 prevents separation thereof , but only a relatively weak bond exists between layers 30 and 32 . 9b . ( fig3 f ) a solvent is applied to the remaining photosensitive material 30 to effect removal thereof . the finished bridge produced by method 3 is illustrated in fig3 i . the use of the electroplating technique results in a bridge with rounded edges giving it great strength and high resistance to vibrational separation . a further advantage of this method is minimization of the amount of waste conductive material , because the unplated conductive layer 32 which is removed need only be thick enough to form an electrode . table 3______________________________________ nominalident . thick - etching sol - number ness material agent developer vent______________________________________30 2 μm shipley shipley ace - a - z 1315j az - 606 tone photoresist32 500a gold potassium iodide32 500a platinum aqua regia34 1 μm shipley shipley ace - a - z 1315j az - 606 tone photoresist36 1 μm gold potassium iodide36 1 μm platinum aqua regia38 1 μm shipley shipley ace - a - z 1315j az - 606 tone photoresist______________________________________ this method involves the use of both photolithographic and electroplating techniques . it includes the following steps : 1 . ( fig4 b ) a layer of conductive bridge support material 40 is deposited onto the conductors 4 , 6 and the substrate 1 . the thickness of the layer should equal the desired height of the bridge above the substrate and the conductors 6 to be overpassed . the type of support material chosen should be a conductive material which is dissolvable in an etching agent which is ineffective in the dissolution of the conductive material utilized to form the bridges . 2 . ( fig4 c ). a layer of photosensitive material 42 is applied to the bridge support material 40 . the layer should be of sufficient thickness to protect the support material covered thereby against etching . 3 . ( fig4 c ) by use of well known photomasking techniques , the photosensitive material 42 above the contact regions of conductors 4 is exposed and developed to effect uncovering of the bridge support material 40 located above each of the contact regions . the material removed by developing is indicated by crosshatching . 4 . the etching agent is applied to the uncovered bridge support material 40 to effect removal thereof and uncovering of the contact regions of the conductors 4 . 5 . a solvent is applied to the remaining photosensitive material 42 to effect removal thereof , leaving only the bridge support material 40 covering the conductors 46 , and the substrate 1 ( fig4 d ). openings formed in the bridge support material by application of the etching agent , to uncover the contact regions of the selected conductors 4 , are shown at 44 . 6 . ( fig4 e ) a layer of photosensitive material 4 , 6 is applied to the conductive bridge support material 40 and the contact regions of the conductors 4 . 7 . ( fig4 e ). again using photomasking techniques , the photosensitive material 46 above the contact regions and the conductive support material 40 spanning the contact regions is exposed and developed . the crosshatched material is removed by the development , thus uncovering conductive contact regions and support material which will be used jointly as an electroplating electrode . a portion of the photosensitive material near the edge of the wafer is also removed to uncover a contact portion of the conductive support material for making an electrical connection . 8 . the wafer is immersed in an electroplating solution containing a conductive material which readily plates onto the support material and the conductors 4 , but which forms a strong bond only with the contact regions of the conductors 4 . the uncovered contact portion of the conductive support material 40 is connected to the source of potential used for electroplating to effect utilization of the electrode formed by the conductive contact regions and support material . the criteria for determining the polarity and area of the electrodes and the magnitude of the plating current are the same as those utilized in method 3 . the resulting bridge is illustrated at 44 in fig4 f . 9 . ( fig4 f ) a solvent is applied to the remaining photosensitive material 46 to effect removal thereof . 10 . ( fig4 g ) the etching agent is applied to the remaining bridge support material 40 effecting removal thereof . the finished bridge produced by method 4 is illustrated in fig4 h . the bridge has the same structural and electrical characteristics as that produced by method 3 , but method 4 requires fewer steps and none of the conductive bridge material is wasted . table 4______________________________________ nominalident . thick - etching sol - number ness material agent developer vent______________________________________40 2 μm titanium fluoboric acid42 1 μm shipley shipley ace - a - z 1315j az - 606 tone photoresist46 1 μm shipley shipley ace - a - z 1315j az - 606 tone photoresist48 1 μm gold none needed48 1 μm titanium none needed______________________________________ thus , in accordance with the present invention , methods have been provided for forming low reactance , thin film conductive bridges . although the invention has been described by a series of specific steps for each method , it is to be understood that variations in these steps are also within the scope of the invention as described by the appended claims . for example , the removal of photosensitive material from the wafer can be accomplished by use of a plasma rather than a solvent . also , the materials utilized in each method need not be limited to those listed in the accompanying tables , but can be any materials meeting the criteria set forth in the individual methods . | 7 |
the detailed description and examples will illustrate specific embodiments of the invention will enable one skilled in the art to practice the invention , including the best mode . it is contemplated that many equivalent embodiments of the invention will be operable besides these specifically disclosed . the function of the first coagulant is to break any oil - water emulsion ( oil includes grease ) existing in the process water and / or condensate to be treated . the first coagulant separates the oil and the process water and / or condensate , so the oil can be coagulated with the solids in the next step of the process . the ph of the condensate at this stage of the process is typically between 8 . 5 and 10 . 0 . the first coagulant has a colloid structure , preferably symmetrical , and has a mean diameter of from about 1 micron to about 25 microns , preferably from about 5 microns to about 15 microns . examples of the coagulants that can be used as the first coagulant include cationic electrolytes with a low molecular weight . most preferably used as the first coagulant are melamine formaldehyde cationic coagulants , particularly those having a melamine to formaldehyde ratio of about 1 : 1 to about 1 : 10 , preferably from about 1 : 2 to about 2 : 8 . the function of the second coagulant is to agglomerate the oil and suspended solids in the process water and / or condensate , so that the suspended solids can be effectively removed from the process water and / or condensate by filtration . the ph of the condensate at this stage of the process is also typically between 8 . 5 and 10 . 0 . the second coagulant has a colloid structure , preferably asymmetrical , and has a mean diameter of from about 40 microns to about 200 microns , preferably from about 50 microns to about 100 microns . methods of preparing such coagulants are described in u . s . pat . no . 4 , 558 , 080 ; 4 , 734 , 216 ; and 4 , 781 , 839 . preferably , the tannin - based coagulant is prepared with condensed polyphenolic tannins under slightly acidic conditions , where the ph is less than 7 , and where the molar ratio of the primary amine from the amino compound to the tannin repeating unit is from about 1 . 5 : 1 to about 3 . 0 : 1 . the second coagulant is added within minutes , typically within 60 seconds after the first coagulant is added to the process water and / or condensate to be treated . typically , it is added close to the inlet of the filter , and it is used to pre - coat the filter media . as was mentioned previously , it may be useful to clarify the condensate after coagulation and before filtering when the solids content is high . although any means know in the art can be used to clarify the condensate , one method that has been shown to be particularly effective , is to pass the condensate through settling device , preferably a separator , e . g . a lamella ® gravity settler / thickener , which is sold by parkson corporation . the separator reduces the suspended solids in a liquid stream . typically , the separator is used if the incoming suspended solids is higher than the filter , e . g . the dyna - sand filter , can handle effectively , e . g . typically if the turbidity is greater than 120 ntu . settling may be accomplished by a variety means . traditionally , settling was accomplished by placing the liquid containing the suspended solids in a quiescent pond such as a sedimentary basin that may be several acres , where the solids were allowed to settle . a more modern approach is to pass the liquid through a clarifier where the particle size is increased by using a polymer to increase the settling rate . the material settles faster in a clarifier than it does in a pond , because of the increased size of the suspended solids and increased density of the particulate material suspended in the fluid . the conventional clarifier is usually a large tank so the fluid velocity may be reduced to less than one or two feet per minute . the configuration may vary from a long rectangular basin that is fed from one end to a circular design fed in the middle . all use the same principal of settling the solids through the clear fluid to the bottom of the vessel . because the depth is several feet , this may take a long time . this is why the vessels are so large . recent technology involves mechanical separation augmented by the use of a polymer to change the physical character of the suspended particles to be separated . this process uses a series of parallel plates set at an angle from horizontal ( e . g . 45 to 60 degrees ) that collect the particles from the fluid that passes through them in parallel . the plates span the entire unit of the clarifier . the solids then settle only several inches onto each of the plates . the clear water passes upwards and overflows where it is channeled for end use , while the solids accumulate on the plates . large systems may use twenty or so parallel plates , while smaller system may require only eight or ten plates . although a variety of filters are useful for carrying out the filtration step of the process , the preferred filter is a fluidized bed filter , particularly an upflow sand filter . this filter utilizes a fluidized bed where the media in the fluidized bed develops a negative charge . this allows the cationic coagulants to pre - coat the filter , which causes the contaminants to stick to the media . this enables one to use less coagulant and the coagulant is removed from the stream , preventing it from becoming an impurity in the filtered fluid . particularly useful , as the filter , is the dynasand ® filter supplied by parkson corporation . this filter is a continuous - backwash , upflow , deep - bed , granular - media filter . recycling the sand internally through an airlift pipe and sand washer continuously cleans the filter media . the cleansed sand is redistributed on top of the sand bed , allowing for continuous flow of filtration and rejected water . other features of the filter include a continuously cleaned sand bed , no moving parts , low pressure drop , high solids capability , and a top - feed design . preferably , after coagulation , and possibly clarification , and filtering , the turbidity of the condensate is 1 . 0 ntu or less . after the suspended solids are removed from the condensate , there still may still dissolved materials such as sodium hydroxide , aluminum , and smaller amounts of iron , calcium , silica , organics , etc . remaining in the condensate . preferably , these materials need to be removed from the process water and / or condensate , so the condensate can be used as boiler feed water . any number of processes may be added downstream from the filter to complete this purification process , e . g . demineralization with ion exchange ( cation or anion ), reverse osmosis , evaporation , partial demineralization , decarbonation , degassification , and / or mixed bed demineralization . any proven technique for removing ionic contaminants from water streams should be effective as a second stage in this condensate recovery process . the treatment time from entering the filter to exiting the ion exchange unit varies depending upon the degree of contamination and flow rate , but typically takes less than 20 minutes , more typically from about 5 to about 15 minutes . as was pointed out previously , the subject process is particularly useful for treating process condensate generated by the bayer process used to produce alumina from bauxite . in the bayer process , condensate is generated as follows : ( 1 ) the flash steam that is produced from pressure reduction of the digester effluent is used to heat the feed to the digester . the flash steam is ultimately condensed and is the largest source of condensate that is produced . ( 2 ) further downstream in the process , solids are removed for disposal and the clear supernate ( containing caustic and dissolved alumina ) is precipitated in a series of multiple effect evaporators . these evaporators produce the second largest stream of condensate . note that both these streams are generated by the process rather than from condensed steam from the powerhouse . this is why they are so contaminated . other sources of condensate are the condensed steam from the surface condensers and steam heated process vessels . after the contaminated condensate is treated , it can be piped ( the motive pressure of the steam may be sufficient to transport it ) or pumped , if necessary , to the boiler feedwater unit , recycled in the process , or sent to a holding tank where is stored until it is ready to be used . mfc a melamine formaldehyde cationic coagulant having melamine to formaldehyde mole ratio 2 : 8 having a mean volume average of from about 10 microns . tac tannin amine coagulant having , supplied by ecolab under the tradename wcs 4110 , having a having a mean volume average of from about 50 to 100 microns . filter a fluidized bed sand filter supplied by parkson corporation under the trademark dynasand ® sand filter . while the invention has been described with reference to a preferred embodiment , those skilled in the art will understand that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims . in this application all units are in the metric system and all amounts and percentages are by weight , unless otherwise expressly indicated . removal of contaminants from condensate generated by the bayer process for producing alumina this example illustrates how the process is used to remove contaminants from the digester process water ( dpw ) and the evaporator process condensate ( epc ), generated by the bayer process for producing alumina . the alumina was produced from bauxite by the bayer process as shown fig1 . the temperature of the dpw was from about 80 ° c . to about 100 ° c . and the temperature of the epc was from about 80 ° c . to about 100 ° c . the flow rate for the condensate tested was approximately 60 gpm and tests were conducted for about a month . the sample was piped from the process and the purification took place done on - line . twenty ppm of mfc were added to samples of the dpw and the epc . ten seconds later , 15 ppm of tac were added to the dpw and the epc , which had been treated with the melamine formaldehyde emulsion breaker . the condensate was then filtered using filter . the contaminants ( cnt ) in the condensate , and their amounts before ( dpwb and epwb ) and after treatment ( dpwa and epwa ) are set forth in table i for the two different streams , the digester stream and evaporator stream , along with the change ( ch ) and percent change (% ch ). the most important contaminants in this process are total suspended solids ( tss ), oil and grease ( o & amp ; g ), iron ( fe ), and barium ( ba ). there was no significant loss of heat from the contaminated process water during the treatment process , and the time it took for the contaminated water to enter the treatment and leave the treatment process was approximately one minute . the results in table i clearly demonstrate the effectiveness of the treatment process . the amounts of several different contaminants were substantially reduced or removed when the process condensate was treated according to the process . the purified water can then be used as boiler feedwater or recycled as process water . | 2 |
referring to the drawings , fig1 illustrates a closed network 10 such as a local area network in which a central distribution server 12 controls the distribution of application software running on each of the multiple clients 14 within the network 10 . in such an environment , the version updating typically requires the server 12 to undergo a complex task of updating each client 14 individually . such procedure requires significant processor power particularly if the clients must be updated at the same time . further , a client program may be updated unnecessarily when the program is not routinely accessed at the client . in an open network architecture , such as the internet and intranets , the centralized program updating is difficult due to the fact that the individual clients are not necessarily controlled by the server . in the internet , for example , a web server communicates with a remote client on an anonymous basis and cannot easily control the parameters of the client . fig2 a illustrates a preferred method of the present invention wherein a client 22 controls the process of a software upgrade in the client utilizing one or more servers 24 on a network . more particularly , in fig2 b , a software version upgrade can be initiated through executing an application program on the client 22 . the execution command transmits a request signal 23 to the server 24 which holds the latest application components . in the preferred embodiment , the server responds by downloading a catalog of a list of the application components , each identified with the latest version number . here , the server includes either a single computer or multiple computers or other servers networked together . the catalog file is processed by the client 22 to selectively identify and retrieve required components of the application program from the server 24 . a persistent cache directory 22a on the client 22 stores a representation of the catalog file 26 , which at least includes the updated list of components and version numbers on the client , for a comparison in a subsequent version check . the components may either be stored in cache 22a or in program directories , such as 22b to 22d , specified in the catalog file 26 , for proper execution . it can be seen that only the components which require updating are downloaded , and they are only downloaded when there is a need because the program is being accessed at the client . fig3 a is a preferred flow sequence of a version updating process of the present invention . the process first involves packaging a catalog file 300 in the server . the catalog file is downloadable from the server to a client using standard network transfer protocol , such as the file transfer protocol or the hypertext transfer protocol . in the preferred embodiment , as described in fig3 b , a catalog file is prepared to include application information 320 which includes the client download directory location ( s ) and the execution command to the application program . for each component that is now required , the catalog file includes at 324 a version identification , code or data size , and the network address ( es ) where the latest version of the component is stored . the components themselves may also be included within the catalog file in certain updating situations . for each component , a cryptographic digest is computed and specified in the catalog at 326 . such an encryption is used later to verify authenticity and integrity of the component following the completion of a download in the client . the catalog further includes at 328 for each component directory or subdirectory locations on the client where the component must reside in order to allow proper execution of the application program . additionally , the catalog includes at 330 identifications of components previously required in the application program that are now obsolete in the new version . at 340 , the catalog file can also include the client &# 39 ; s system environment variables relative to the installation requirements in different client directory locations . an environment variable is a system wide parameter commonly used to store small items of information to be shared between multiple programs . in one embodiment of the invention , certain environment variables hold references to directories in which application components are stored on the client . the catalog can also include at 342 , network locations storing future versions of the catalog file and / or the associated application components . the catalog file can further include at 344 procedures necessary for executing codes after retrieval of each component or prior to and / or following the execution of the updated application program . returning to fig3 a , the catalog file is retrieved at 302 from the server in response to a call from the client . in a preferred embodiment , as illustrated in fig3 c , the client 22 of the present invention includes a launcher program 348 which is automatically activated when a user selects to run the application underlying icon 350 on a desktop window 346 of the client system 22 . the launcher 348 serves as a proxy to the application program and communicates with the server 24 over a network to request a download of the catalog file . in fig3 a , the launcher processes the downloaded catalog file at 304 and begins to unpack the catalog file to initiate a version check at 306 . the version comparison in these steps involves comparing the contents of a new catalog file 352 downloaded from the server , as shown in fig3 d , with the existing representation of the catalog file 354 stored in persistent cache 22a of the client 22 . the contents of the new catalog 352 reflect the latest component versions , and the catalog 354 in cache 22a lists the component versions presently installed on the client . the comparison described in these steps is only a basic requirement in an updating procedure . other steps , as will be discussed later , can be specified in the catalog file and executed by the launcher on the client . further referring to fig3 a , the launcher at 308 engages the server to download the required components for a proper update as defined in the catalog file in 306 . the encrypted components are authenticated at 310 through the cryptographic digests specified in the catalog file . the pre - launch code prescribed in the catalog file , such as a virus scan , is executed at 312 . the updated and verified application program is launched and executed at 314 followed by any post - launch activities at 316 also defined in the catalog file . information in the catalog file , which at least includes the updated list of components and version numbers on the client , is stored at 317 in cache on the client until the subsequent version update . the launcher program can be configured in different ways to accommodate users with different options to control and update the application program . in one embodiment , as shown in fig4 a , the launcher is a stand - alone program which can be executed through a desktop icon 400 on a client window . selecting the icon executes the launcher program which provides a user with a dialog window to either select an existing application program to update at 401 or specify the network address of the catalog file for a new application at 402 . through the launcher dialog window ( s ), a user can select any application program either to execute , or to update and execute , or simply to update the components therein . in another embodiment , as shown in fig4 b , an icon directed to the application program can be installed on the client desktop window at 404 . selecting the icon automatically launches the launcher program in the background to begin an updating process . at 405 , the launcher program in this embodiment is pre - configured with network address ( es ) of the catalog file as a parameter of the program . fig4 c through 4e further illustrate the preferred process of the present invention . in the preferred embodiment , a user may either invoke at 406 an icon directly associated with the application program or run the launcher program at 407 to select a particular application program to update . in either option , the launcher program , executes with the address of the catalog file to initiate program update at 408 . at 409 , the launcher retrieves the catalog file from the specified server address or from a local disk , and , at 410 , the launcher reads the application information in the retrieved catalog file . the application information is as described in fig3 b and includes the client download directory location ( s ) and the execution command and procedure relative to the application program . the catalog file is further examined for any environment variable pertaining to the client system which instructs the launcher as to how the components are installed on the client . at 414 , the launcher designates appropriate directories on the client where the components should be stored . the process for identifying the individual component files to download from the server begins at 416 . at 416 , the launcher reads the next component file name and version number or identification from the retrieved catalog file of the latest component versions made available on the server . each component version number is compared at 418 with the current component version numbers listed in a previous catalog file representation stored in cache on the client . if the version number is correct , the cryptographic digest is checked at 419 . any component not on the client or showing different version numbers or different cryptographic digest are selected and retrieved from the specified server location 420 . the cryptographic digest is computed on a retrieved component at 421 and confirmed at 422 . an incorrect or a corrupted component is similarly replaced at 420 . at 424 , the launcher program executes any procedure such as virus scan decryption or expansion of encrypted or compressed component files specified in the catalog file after retrieving each component . once the components have downloaded , any existing components on the client that are not no longer needed as a result of the version update are deleted at 430 . at 432 , information in the catalog file , which at least includes the list of the components of updated application program , is stored in cache on the client for use in a subsequent update . the launcher then executes at 434 the pre - launch procedures specified in the catalog , such as virus scan , prior to executing the application program at 436 . the process completes by running the post - launch procedures at 438 . the catalog file can also be specified to include a procedure to delete the components following the execution of the updated application program to free up disk space on the client . one aspect of the present invention relates to enhancing speed and efficiency with which an application program on a client is updated and executed so that the program runs with the most current data and / or coding structure . fig5 describes a preferred method of the present invention in which the client monitors and limits the time spent on an initial download of the catalog file from a server to a client . in the preferred embodiment , the catalog file previously stored on the client includes a maximum wait time interval specified as the time within which the transmission of the catalog file to the client in response to an application launch command should be completed . such a time limit is to ensure that the catalog file is delivered quickly , and to identify and break a client - server communication jam which might delay the download indefinitely if the particular session were maintained . as indicated previously , the catalog file previously stored on the client includes the network addresses of alternate servers storing the catalog file . referring to fig5 in response to an application launchfrom a client at 502 , a timer is triggered to count down the maximum wait time interval specified in the catalog file at 504 . while the catalog file is being retrieved at 506 the timer is monitored against the maximum wait limit at 508 . if the download has exceeded the time limit , the launcher in the client terminates the session and connects to a different server at 510 to initiate a new download . the timer is again activated , and the time limit is monitored until the download is completed at 514 . another aspect of the present invention relates to providing user flexibility at the client to control the updating procedures . in a preferred embodiment , as described in fig6 a and 6b , a client can be configured to adapt a number of different updating schedules . in this embodiment , an application program may be selected to run either from a client desktop at 602 or during a boot sequence at 611 , and the associated launcher is automatically executed to run a sequence of parameter checks . at 604 , if the launcher is configured to run an update on a periodic basis , such as on a daily , weekly , or monthly basis , the launcher , through an internal calendar or clock , checks to determine if a new update is due with respect to the last update at 608 , and , if so , executes an update process once within such a period at 609 . if the update is specified during a boot sequence 611 , the launcher is executed at 612 during such boot and performs the version update at 614 typically without executing the application program . in all the other configured situations the client defaults to run the launcher automatically in each application launch , unless otherwise specified by the user or in the catalog file . in the defaults , sending the launcher can be implemented as a component part of the client operating system to run invisibly in the background . yet another aspect of the invention relates to providing fully controlled client - server environment within an open network architecture , such as the internet . in one preferred embodiment , as described in fig7 a , the client is a world wide web ( web ) client , such as a web browser , and the automatic version upgrading process is implemented to run fully within such a browser . in this embodiment , a hypertext link at 704 to an application program is provided within a hypertext markup language ( html ) document displayed on a web page . such a link is a uniform resource locator directed to a server site which makes available the catalog file for download through either the file transfer protocol ( ftp ) or the hypertext transfer protocol ( http ). the launcher program which receives and processes the catalog file is embedded ( 706 ) into the browser as a &# 34 ; plug - in &# 34 ; module or as a native browser control . a plug - in module is an integrated component of a browser which enables the execution of non - web applications within the browser environment . a native browser control is built into the browser , and is hence more tightly integrated than any add - on modules on separate executables . at 708 , the launcher is engaged to process the downloaded catalog file . accordingly the components are downloaded to update the application program without leaving the web browser at 710 and the program is executed at 712 . in another embodiment , the launcher program is implemented as a browser &# 34 ; helper application .&# 34 ; in fig7 b , selecting the link directed to the catalog file on a web page initiates the download and version check on the client at 716 to 720 . the resulting updated application components are stored in the client cache directory or in the appropriate program directories 722 . the updated application program can be executed either within the web session or after exiting the web browser at 726 . the catalog file can also be specified to include a procedure to install on the client desktop an icon or a shortcut which enables the end user to run the application without accessing the web page in subsequent updates . fig7 c illustrates a preferred process in which a web client , such as a web browser , is configured not only to retrieve a component catalog file from a server but also to retrieve a launcher program to implement the update procedures on the client computer . at 728 and 730 , a user , through a standard web browser on a client , selects a link directed to the catalog file on a remote server . the browser , through a standard internet protocol , such as hypertext transfer protocol , retrieves the catalog file at 732 in response to the link . at 734 , the browser is specified to query and determine whether the client maintains a launcher program . if the launcher program is present on the client , the browser invokes the launcher at 738 to begin the update process . in the event the client does not support a launcher , the browser is directed to download a launcher program from the server and to install the launcher integrally into the browser at 736 . while the invention has been described in connection with specific methods and apparatus , it is to be understood that the description is by way of example and not as a limitation to the scope of the invention as set forth in the claims . | 6 |
fig1 a – 21 illustrate various aspects of a dual magnification folding travel mirror with annular illuminator according to the present invention . referring first to fig1 a – 8a , it may be seen that a dual magnification travel mirror with annular illuminator 20 according to the present invention includes a base 21 , an elongated , generally rectangularly - shaped handle 22 pivotably mounted at a lower end thereof to a front edge of the base by a handle pivot joint 23 , and a dual mirror assembly 24 telescopically mounted to an upper end of the handle . as shown in fig6 a – 9 , dual mirror assembly 24 includes a first , lower , or primary circular dish - shaped mirror frame 25 in which is mounted a first , lower or primary circular disk - shaped mirror 26 . as is also shown in those figures , dual mirror assembly 24 includes a second , upper or secondary circular plate - shaped mirror frame 27 in which is mounted a second , upper or secondary circular disk - shaped secondary mirror 28 . as shown in fig8 a and 9 , secondary mirror frame 27 is pivotably and swivelably coupled to primary mirror frame 25 by a dual joint hinge coupler 29 . as shown in fig7 a – 9 , hinge coupler 29 is joined to primary mirror frame 25 by a pair of circumferentially spaced apart , parallel lugs 30 l , 30 r which protrude chordally outwards from an upper peripheral portion 31 of primary mirror frame 25 . as shown in fig6 b – 6d , hinge coupler 29 includes a laterally symmetrically shaped body 32 which has a generally cylindrically - shaped lower bushing member 33 that fits between inner facing surfaces 34 l , 34 r of lugs 30 l , 30 r . bushing 33 has disposed laterally through its length a bore 35 which is coaxially aligned with and rotatable with respect to a transversely disposed pivot axle 36 which is disposed through the bore and which is fixed at opposite longitudinal ends thereof in bores 37 l , 37 r through lugs 30 l , 30 r . body member 32 of hinge coupler 32 includes a generally rectangularly - shaped , laterally elongated boss 38 which protrudes radially outwardly from lower bushing portion 33 . boss 38 has an upper surface 39 which lies in a plane above transverse pivot axle 36 and has protruding perpendicularly downwards into upper surface 39 a swivel pin bore 40 which is disposed perpendicularly to and radially outwardly from the transverse pivot axle , midway between opposite transverse sides 41 l , 41 r of bushing member 33 located at opposite longitudinal ends thereof . swivel bore 40 rotatably holds a swivel pin 42 which protrudes radially outwardly from a lower edge 43 of upper , secondary mirror frame 27 . with this arrangement , secondary mirror frame 27 is pivotable above transversely disposed pivot axle 36 , and swivelable in orthogonally disposed , radial swivel pin bore 40 , as shown in fig8 and 10 . as shown in fig6 a , 7 a , 7 d , 8 b , and 8 c , primary mirror frame 25 includes in an outer peripheral portion which borders primary mirror 26 a rearwardly or inwardly concave annular ring - shaped lamp channel 44 in which is mounted a circular ring - shaped , tubular lamp 45 , which is preferably a cold - cathode , fluorescent lamp . as shown in fig6 a , 8 a , and 8 b , lamp channel 44 has a generally flat , annular , ring - shaped cover window 46 which has light transmissive and preferably partially light - diffusive . in a preferred embodiment , primary mirror 26 has a concave , spherically - shaped reflective surface 47 which has a radius of curvature selected to yield a desired magnification factor , e . g ., between about 5 × and about 9 ×. although the dimensions of lamp channel 44 are not critical , the radial width of the channel in an example embodiment of travel mirror 20 was about ¾ inch . as shown in fig6 a , 7 a and 7 b , primary mirror 26 is mounted within a rearwardly concave , generally spherically contoured cavity 48 formed in the front surface of primary mirror frame 25 , concentrically located with respect to lamp channel 44 , by any suitable means , such as thin strips of tape 49 coated on both sides with a pressure sensitive adhesive and located between an outer annular portion 50 of rear surface 51 of the mirror , and an annular shoulder ledge 52 which protrudes radially inwardly of the outer circumferential wall of the cavity . as shown in fig6 a and 7b , shoulder ledge 52 is recessed inwardly or rearwardly of outer circumferential edge 53 of primary mirror frame 25 , sufficiently far to locate the front surface 54 of primary mirror 26 inwardly or rearwardly of annular lamp channel cover window 46 , thereby preventing contact between the front surface of the primary mirror with the front surface 55 of secondary mirror 28 , when secondary mirror frame 27 is pivoted to overlie the primary mirror , as shown in fig1 . referring to fig6 a , it may be seen that secondary mirror 28 has a circular shape , and may have a spherical concave surface which has a different radius of curvature than that of primary mirror 26 , but preferably has less curvature and thereby a smaller magnification factor . in a preferred embodiment , mirror 28 has an infinitely large radius of curvature , i . e ., is flat , and thus has a “ 1 ×” or unity magnification factor . as shown in fig6 a , 7 e , 7 f , and 11 , secondary mirror frame 27 has a shape approximating that of a thin circular plate which has a flat front surface 56 and a convex , arcuately curved rear surface 57 which has a slight curvature . front surface 56 of secondary mirror frame 27 has formed therein a concentric , circular shallow recess 58 which has a circular bottom wall 59 and a cylindrically shaped peripheral wall 60 . recess 58 has an outer circumference 61 sufficiently smaller than that of the outer circumferential edge 62 of secondary mirror frame 27 to form therebetween an annular ring - shaped bezel 63 which has a radial width approximately equal to or slightly less than that of annular ring - shaped cover window 46 of primary mirror frame 25 , e . g ., about ⅝ inch . according to the invention , at least bezel portion 63 of secondary mirror frame 27 is made of a light transmissive material . in a preferred embodiment , frame 27 is fabricated as a unitary molded part from a transparent material such as a polycarbonate or acrylic polymer plastic . secondary mirror 28 is retained within recess 58 of frame 27 by any suitable means , such as pressure sensitive adhesive 64 between rear surface 65 of the secondary mirror and upper surface 66 of bottom wall 59 of the recess . referring to fig6 a , 7 e , and 7 f , it may be seen that secondary mirror frame 27 has a sector - shaped notch formed in outer circumferential edge 62 thereof , thereby forming a straight edge wall 67 lying along a chord of the outer circumferential edge , the edge wall being bisected by a radius of the frame . chordal edge wall 67 of secondary frame 27 has a flat outer peripheral surface 68 which is perpendicular to flat front surface 56 of the frame , and has protruding radially inwardly therefrom a tapered bore 69 in which is fixed swivel pin 42 . as explained above , the outwardly protruding , lower portion 42 of swivel pin 42 is rotatably held within swivel bore 40 of hinge coupler 29 . fig1 a – 21 4 , 5 and 9 – 14 illustrate details of base 21 , handle 22 , and handle pivot joint 23 of travel mirror 20 according to the present invention . as shown in those figures , base 21 preferably includes an upper upwardly concave base half shell 70 , and a lower 27 downwardly concave base half shell 71 , each of which has in plan view a longitudinally elongated oblong shape with arcuately curved transverse end walls . thus , upper half shell 70 has an upper wall 72 which has protruding downwardly therefrom a flange wall 73 which includes straight left and right parallel longitudinally disposed side wall segments 74 , 75 and front and rear convex arcuately curved transverse end wall segments 76 , 77 , respectively , which are each symmetrically shaped about a longitudinal vertical center plane of the base , and symmetrically shaped with respect to one another through a transversely disposed central mirror plane of the base . similarly , lower base half shell 71 has a lower base wall 82 which has protruding upwardly therefrom a flange wall 83 which includes straight left and right parallel longitudinally disposed side wall segments 84 , 85 and front and rear convex arcuately curved transverse end wall segments 86 , 87 , respectively , which are each symmetrically shaped about a longitudinal vertical center plane of the base , and symmetrically shaped with respect to one another through a transversely disposed central plane of the base . as shown in fig5 and 6e , upper half shell 70 has formed in upper surface 72 u of upper wall 72 thereof a relatively wide , longitudinally elongated rectangularly - shaped handle groove 87 located centrally between left and right side walls 74 , 75 of the upper half shell . referring now to fig9 – 14 , it may be seen that upper and lower half shells 70 , 71 have inner concave spaces 90 , 91 , respectively , which , when the half shells are fastened together , form an elongated hollow interior space 92 . concave inner space 90 of upper half shell 70 contains a battery compartment 93 which is adapted to hold four aa dry cells connected in series with a pair of positive and negative output lead wires 94 , 95 which are connected in parallel with a battery eliminator jack 96 mounted in a vertically opposed pair of upper and lower slots 97 , 98 of upper and lower half shells 70 , 71 , the jack protruding rearward through upper and lower u - shaped half apertures 99 , 100 in rear transverse end walls 77 , 87 , respectively , of the upper and lower half shells . positive and negative output lead wires 94 , 95 are also connected through a switch 101 to power input terminals of a d . c .- a . c . inverter 102 , which has a pair of high - voltage a . c . output lead wires 103 , 104 which thread through the bore 105 of a diametrically split axle bushing 106 located at a transverse end of a handle pivot axle 107 located at the lower end of handle 22 , and thence to electrodes 108 , 109 of lamp 45 . as shown in fig2 and 12a , bottom half shell 71 of base 21 has a longitudinally disposed battery compartment access door 110 frictionally held within a longitudinally elongated , rectangularly shaped battery compartment access port 111 by a resilient plastic folded leaf - shaped self - spring latch 112 molded integrally with the access door , which is vertically aligned with battery compartment 93 . preferably , base wall 82 of lower half shell 71 also has through its thickness dimension a pair of longitudinally spaced apart , front and rear laterally disposed mounting holes 113 f , 113 b which each have generally circularly shaped center portion 114 and a pair of diametrically opposed radially outwardly protruding , mirror symmetric slots 115 for slidably receiving the shank of mounting screw ( not shown ) screwed into a wall which has a head ( not shown ) insertable into the center portion of the mounting holes , thereby enabling travel mirror 20 to be removably mounted onto a wall by a pair of vertically disposed screws . referring to fig1 a - 14 , it may be seen that handle pivot axle 107 located at a lower end portion of handle 22 has a generally cylindrical shaped major body portion 116 which is disposed transversely between opposite left and right vertical sides 117 l , 117 r of the handle . pivot axle 107 includes at one side of , e . g ., the left side , a bushing 106 of smaller diameter than body 116 of the axle which protrudes axially , i . e ., perpendicularly outwards from left transverse face end 119 of the axle body . also , pivot axle 107 has protruding from an opposite , e . g ., right transverse side thereof , a cylindrically shaped boss section 120 which has a diameter approximating that of main axle body 116 . cylindrical boss section 120 of axle 107 has formed in outer cylindrical wall surface 121 thereof a rectangular cross - section , circumferential annular groove 122 , an inner transverse end wall 123 of which is located adjacent to right vertical side wall 117 r of the handle . boss section 120 also has a cylindrically shaped axially outwardly located end portion 124 which extends from an outer transverse end wall 125 of groove 122 . outer cylindrical end portion 124 of right - hand cylindrical boss section 120 of handle pivot axle 107 has a transversely disposed , outer circular end face 125 , which has protruding perpendicularly outwards therefrom a concentrically located stud 126 which has a generally rectangular transverse cross section . referring still to fig1 a - 14 , it may be seen that upper and lower base half shells 70 , 71 have formed in front portions of inner opposed concave faces 127 , 128 thereof transversely disposed , generally semi - cylindrically shaped upper and lower grooves or channels 129 , 130 , respectively , which , when the half shells are secured together , form a generally cylindrically - shaped cavity 131 for rotatably receiving cylindrically - shaped handle pivot axle 107 . thus , as shown in fig9 – 11 , lower base half shell 71 has protruding upwardly from lower base wall 82 thereof a laterally centrally located , generally semi - cylindrically - shaped pivot axle groove 132 which has a front upper wall 133 adjacent to front transverse end wall 86 of the base shell . pivot axle groove 132 has a rear edge wall comprised of a thin , arcuately curved web 134 which protrudes upwardly from the upper surface 135 of lower base wall 82 , and a lower wall surface 135 comprised of a semi - cylindrically contoured groove formed in the upper surface of the lower base half shell . as shown in fig1 h , lower curved wall surface 135 of semi - cylindrical pivot axle groove 132 preferably has protruding downwardly therefrom a laterally elongated , rectangularly - shaped shallow recess 136 in which is mounted a rectangularly - shaped friction pad 137 that is made of a material such as silicone rubber which has a relatively large surface coefficient of sliding friction . as shown in fig1 h , pivot axle groove 132 has left and right u - shaped , transverse end journals 138 , 139 located at left and right ends thereof , respectively , of the groove . the end journals 138 , 139 are comprised of generally uniform - thickness , transversely disposed u - shaped webs 140 , 141 which protrude perpendicularly upwards from upper surface 135 of lower base wall 82 of lower half shell 71 . left and right end journals 138 , 139 have formed in upper surfaces thereof left and right downwardly concave semi - cylindrically - shaped grooves 142 , 143 which are of a suitable size and lateral spacing from one another to rotatably receive the left - hand bushing 106 and right - had groove 122 of right - hand cylindrical boss section 120 , respectively , of handle pivot axle body 116 . as is also shown in fig1 h , lower base half shell 71 also includes a generally semi - cylindrically shaped , axial friction control groove 144 which is adjacent to the outer , right - hand transverse face 145 of right - hand handle pivot axle body journal 139 . friction control groove 144 is coaxially aligned with lower semi - cylindrical pivot axle groove 132 , and preferably of smaller diameter and length . also , friction control groove 144 has located at a right transverse end thereof a short semi - cylindrically shaped nut holder groove 146 which has a polygonal transverse cross - section and which is adapted to irrotatably hold a hex nut 147 . nut holder groove 146 has an outer , right - hand transverse end journal 148 which has the form of a u - shaped web 149 that has in an upper surface thereof a groove 150 adapted to rotatably receive the shank 151 of a friction adjustment screw 152 which has located at the outer end thereof , a fluted friction - adjustment knob 153 . also , the inner , left - hand transverse end of nut holder groove 146 is bordered by a u - shaped left - hand end journal 154 comprised of u - shaped web 155 which protrudes upwardly from upper surface 135 of lower base wall 82 of lower half shell 71 . left - hand nut groove journal 154 has formed in upper surface 156 of web 155 thereof a downwardly concave semi - cylindrically shaped groove 157 which is of a suitable size to provide clearance for and therefore allow free rotation of screw shank 151 . referring still to fig1 h it may be seen that outer , left - hand transverse face 158 of left - hand nut groove journal 154 has protruding axially outwards therefrom a pair of generally rectangularly - shaped , vertically disposed front and rear end spacer ribs 159 f , 159 b , which are spaced equal distances radially outwards from front and rear sides of journal groove 157 . outer , left - hand face 158 of left - hand nut groove journal 158 also has protruding axially outwards from a lower base portion thereof a low , rectangular cross - section , slider rib 160 which protrudes upwardly from the center of lower semi - cylindrical wall surface 161 of friction control groove 144 . as shown in fig9 and 10 , slider rib 160 protrudes upwardly into a longitudinally disposed lower groove 162 l formed in the outer cylindrical surface 163 of a cylindrically - shaped slider bushing 165 which is longitudinally slidably located in axial friction control groove 144 . as shown in fig1 a – 14 , slider bushing 165 has formed in outer cylindrical surface 163 thereof upper and lower longitudinally disposed , diametrically opposed , rectangular cross - section grooves 162 u , 162 l , respectively . slider bushing 165 has a transversely disposed circular , flat outer or right - hand end face 166 , and a circular left - hand transverse face in which are formed axially inwardly protruding rectangular cross - section vertically disposed transverse grooves 167 u , 167 l which are continuous with upper and lower longitudinal grooves 162 u , 162 l , and a pair of radially disposed front and rear transverse grooves 168 f , 168 b which are perpendicular to the vertically disposed grooves . all of the above - identified end face grooves radiate from a coaxially centrally located blind bore 169 which protrudes inwardly from outer , left - hand transverse face 170 of slider bushing 165 . bore 169 is provided for receiving stud 126 which protrudes outwardly from boss 120 of handle pivot axle 107 . the function of end face grooves 167 u , 167 l , 168 f , 168 b is to facilitate elastic deformation of bushing 165 in response to longitudinal forces exerted on the bushing . as shown in fig1 a – 14 , friction control groove 144 longitudinally slidably holds in axial alignment with slider bushing 165 a circular rubber washer 171 , which is preferably sandwiched between a pair of outer and inner circular plastic washers 172 o , 172 i , all of which have a diameter approximating that of the slider bushing and slightly less than that of the friction control groove . each of the washers is provided with central coaxial through - bore . the inner transverse face 173 i of inner plastic washer 172 i adjacent to outer circular end face 126 of right - hand cylindrical boss section 120 of handle pivot axle 107 is pressed against the right - hand end face of the handle axle boss section with an axial force which is adjustable by turning friction control knob 153 . turning friction control knob 153 in a direction which advances friction adjustment screw shank 151 towards the handle pivot axle increases the axial frictional force exerted on the pivot axle to resist pivotable motion of the handle relative to the base ; turning the control knob in the opposite direction retracts the screw shank to thereby reduce frictional resistance to pivotable motion of the handle . referring to fig1 a – 14 , it may be seen that upper base half shell 70 has formed therein an upwardly concave generally semi - cylindrically shaped , transversely disposed upper half shell channel 129 that has several structural elements which have shapes complementary to those of elements of the lower half shell which were identified and described above . those upper and lower structural elements are mirror symmetrical through a horizontally disposed joint plane between upper and lower base half shells 70 , 71 and cooperate to form generally cylindrically shaped cavities . thus , for example , upper base half shell 70 has left and right transverse end journals 188 , 189 , which mate with lower base half shell journals 138 , 139 , the semi - cylindrically shaped grooves 142 , 143 of the lower journals mating with semi - cylindrically shaped grooves 192 , 193 of the upper half shell journals to form closed , cylindrically shaped pivot axle body end journals 292 , 293 , respectively . similarly , upper base half shell 70 has formed therein an upper semi - cylindrically shaped friction control groove 194 which forms with lower semi - cylindrically shaped friction control groove 144 of lower base half shell 71 a cylindrically shaped friction control cavity 293 . upper base half shell 70 also includes a semi - cylindrically shaped upper nut holder groove 196 which is bordered on right and left ends thereof by right and left upper nut groove journals 198 , 204 , forming with corresponding lower right and left journals 148 , 154 , respectively , a closed , cylindrically shaped nut holder cavity 296 . referring still to fig1 a – 14 , it may be seen that upper base half shell 70 has protruding downwardly from the upper inner surface thereof spacer ribs 209 f , 209 b and a slider rib 210 which are mirror images of ribs 159 f , 159 b , and 160 , respectively , of lower base half shell 71 . as shown in fig1 a – 14 , upper base half shell 70 has protruding rearwardly from front edge wall 221 thereof an elongated , rectangularly - shaped notch 222 which is laterally symmetrically located with respect to the left and right side walls 223 l , 223 r of the upper half shell . with upper and lower base half shells 70 , 71 fastened together , notch 222 is vertically aligned with semi - cylindrically shaped pivot axle groove 132 , and enables handle pivot axle 107 to rotate from an angular orientation in which handle 22 is received in handle groove 87 in the upper surface of the upper half shell , in a compact storage / transit configuration , to an upright use configuration in which the handle is angled upwardly from base 21 , as shown in fig1 and 14 . fig1 a through 21 illustrate structural elements of mirror device 20 which enable telescopic adjustment of dual mirror assembly 24 of mirror device 20 to a desired height relative to base 21 . as shown in those figures , handle 22 of mirror 20 has a vertically elongated , generally rectangular plan - view front portion 224 which has a shape approximating that of rectangular cross - section channel member or shell which includes a front vertically elongated rectangular front base plate member 225 , and rearwardly protruding left and right flange walls 226 l , 226 r . front handle portion 224 has a rearwardly curved , transversely disposed lower end portion 227 which is coextensive with front , upper half 228 of handle pivot axle 107 . also , handle 22 has a rear rectangular plate - shaped panel 229 which is secured within a longitudinally disposed channel 230 in the rear side of front handle shell 224 , and has located at a lower end thereof a transversely disposed , generally semi - cylindrically shaped extension 231 which mates with semi - cylindrically shaped lower end 227 of front handle shell 224 to form cylindrically - shaped handle pivot axle 107 . handle 22 fits telescopically slidably within an elongated rectangular bore 232 within an elongated generally rectangularly - shaped handle boss tube 233 which protrudes rearwardly from rear surface 234 of primary mirror frame 25 , the handle boss extending vertically along a diameter of the mirror frame , centered on a diameter thereof . as shown in fig6 a , 7 a – 7 d and 15 – 19 , bore 232 of handle boss tube 231 has mounted in a front or bottom longitudinally disposed base wall thereof a generally rectangularly - shaped , longitudinally elongated detent plate 235 . detent plate 235 has located in rear surface 236 thereof a plurality of a longitudinally spaced apart , laterally disposed detent grooves 237 . as is also shown in fig1 a and 16 , front base plate member 225 of front handle shell 224 has an upper transversely disposed edge wall 238 which has protruding perpendicularly inwardly therefrom a pair of parallel , longitudinally disposed left and right slots 239 l , 239 r which are spaced equal distances to the left and right , respectively , of a longitudinally center plane of the handle shell . slots 239 l , 239 r form therebetween a rectangularly - shaped tab 240 , which is flexibly and resiliently joined at a rear transverse edge 241 thereof to a longitudinally inwardly located portion of the front base wall plate 225 by an elastically deformable self hinge 242 , resulting from front wall plate 225 being made of an elastically deformable polymer such as polypropylene . tab 240 has protruding downwardly or forwardly from a front edge wall 243 thereof a laterally disposed , radiused detent rib 244 . detent rib 244 is of the proper size and shape to snap resiliently into a particular one of detent grooves 237 that it becomes aligned with as primary mirror frame 25 is moved longitudinally with respect to handle 22 . with rib 244 resiliently engaged within a detent groove 237 , a relatively large longitudinal force must be exerted on handle 22 relative to primary mirror frame 25 to disengage the rib from the groove . thus constructed , primary mirror frame 25 is telescopically extendible and retractable with respect to handle 22 , to an adjustable length or height relative to base 22 , the adjusted height being maintained by cooperative action of the detent rib and a detent groove . | 0 |
fig1 is an example of a circuit , 10 , which utilizes the principles of the invention . an input electrical signal is received on conductor , 11 , and applied to conductor , 12 , through a summing circuit , 13 . the electrical signal is applied to a standard laser module , 14 , which includes a semiconductor laser and necessary electrodes for applying the electrical signal to the laser to produce an optical output . the optical output is coupled to an optical fiber , 15 , for transmission . a portion of the optical output is coupled by means of a tap , 16 , to a photodetector , 17 , so that this portion of the optical signal is converted to an electrical signal . alternatively , the light from a backface of the laser could be incident on the photodetector in accordance with known techniques . the output of the photodetector , 17 , is connected to a filter , 18 , which could be a high pass , low pass or band pass filter . the filter output is connected to an amplifier , 19 . the amplifier output is connected to an attenuator , 20 whose output is connected to a phase shifter , 21 . the photodetector , 17 , filter , 18 , amplifier , 19 , attenuator , 20 , and phase shifter , 21 , can all be considered part of a feedback circuit in accordance with the invention . the output of the phase shifter , 21 , is connected to the summing circuit , 13 . the operation of the circuit will now be described assuming an input signal having the form : where a 1 and a 2 are constants , f 1 and f 2 are the input frequencies , and t is time . ( it is understood that the invention operates over a band of frequencies , but assuming a two tone input within the operating band is a common method of characterizing the linearity of operation .) further , nonlinearity in the output signal , v 0 ( t ) is represented by the series : v . sub . 0 ( t )= g . sub . 0 + g . sub . 1 v . sub . i ( t )+ g . sub . 2 v . sub . i . sup . 2 ( t )+ g . sub . 3 v . sub . i . sup . 3 ( t )+ ( 2 ) where g 0 , g 1 , g 2 , and g 3 are constants . it will be recognized that the term g 1 v i ( t ) is the linear term , while g 2 v i 2 ( t ) and g 3 v i 3 ( t ) yield the second and third order terms , respectively , of the output signal . for convenience , it is assumed that higher order terms can be neglected . for wireless applications , which are narrow band , only the third order terms fall within the band of interest and need to be removed . substituting equation ( 1 ) into equation ( 2 ) yields the following third order products which fall within the operating band : where term ( 3 ) is the upper third order sideband and term ( 4 ) is the lower third order sideband . these terms are also illustrated in the spectrum of fig2 . now considering the second order term ( g 2 v i 2 ( t )) of equation ( 2 ) and substituting therein the signal of equation ( 1 ), the following terms , among others , will result : where terms 5 and 6 are the second harmonic signals included within the second harmonic band , term 7 is the difference signal which is part of the difference frequency band , and term 8 is the sum term also included in the second harmonic band ( see fig2 ). in accordance with a key feature of the invention , the filter , 18 , may be chosen to pass only the second harmonic band ( terms 5 and 6 along with the sum signal ( term 8 )) or only the difference band ( term 7 ). as shown below , the amplitude or phase of such feedback signals can be adjusted by components 19 or 20 and / or 21 so that these terms , which are out of the output band of interest , can nevertheless be used to cancel or reduce the third order terms which are in - band when added to the input signal by summing circuit 13 , thereby improving the linearity of the optical device . specifically , for the case of feeding back the second harmonic signals , the input signal becomes : v . sub . i ( t )= a . sub . 1 cos 2πf . sub . 1 t + a . sub . 2 cos 2πf . sub . 2 t +( ka . sub . 1 . sup . 2 g . sub . 2 / 2 ) cos 4πf . sub . 1 t +( ka . sub . 2 . sup . 2 g . sub . 2 / 2 ) cos 4πf . sub . 2 t ( 9 ) where k is the amount by which the feedback signals are increased or decreased by the components 18 - 20 . when this input is substituted in the second order term of equation ( 2 ), among the terms produced are : thus , term ( 10 ) can cancel out the unwanted third order term ( 3 ) and term ( 11 ) can be used to cancel out the unwanted third order term ( 4 ) if : in the example of feeding back the difference signal ( equation 7 ), a similar analysis reveals : thus , it will be noted that , by passing either the second harmonic frequency band or the difference frequency band in filter , 18 , and providing gain or attenuation by components 19 and 20 in accordance with equations ( 12 ) or ( 13 ), the third order terms can be eliminated from the output signal . for mathematical simplicity , k was assumed to be real and phase was not taken into consideration . however , a means to adjust the phase of the feedback terms may be required in order to satisfy the equations ( 12 ) or ( 13 ). for this reason , the phase shifter , 21 , is included in the feedback path . also note that the sum term , ( 8 ), is included in the second harmonic frequency band but does not contribute to the cancellation effect described on the previous pages . further , while the filter , 18 , has been shown as a separate element , it could be integral with the amplifier , 19 , or other components in the feedback path . | 7 |
with the advent of carrier aggregation , the need arises for a terminal to feedback multiple hybrid - arq acknowledgement bits , one ( or two ) for each dl component carrier on which it receives data . while pf 1 can be used with resource selection to transmit up to four ack / nack bits , this is not an efficient solution for more than four bits . pucch format 3 is based on dft - precoded ofdm . ack / nack bits and an optional scheduling request bit are concatenated and block coded using one or two reed - muller codes . the coded bits are scrambled using a cell - specific scrambling sequence to randomize inter - cell interference . the resulting 48 bits are qpsk modulated and dft - precoded , and 12 qpsk symbols are transmitted in each pucch slot . five of seven ofdm symbols per slot are available for control information bits ( two transmit reference signals ). a cyclic shift of the 12 inputs to the dft , varying between ofdm symbols in a cell - specific manner , is applied to the block of 12 qpsk symbols prior to dft precoding , to further randomize inter - cell interference . each of the five ofdm symbols per slot is multiplied by one element of a length - 5 orthogonal cover code sequence . this allows up to five terminals to share the same resource - block pair for pf 3 . different length - 5 sequences are used in the two pucch slots . a pf 3 resource can be represented by a single index , from which the orthogonal sequence and the resource - block number can be derived . a terminal can be configured with four different pf 3 resources ; these are assigned in a scheduling assignment , allowing the scheduler to avoid pucch collisions by assigning different resources to different terminals . resources cannot be shared between pf 3 and pf 1 / 2 . according to embodiments of the present invention , pucch format 3 resources are defined to report ack / nack and / or csi according to table 1 . the pucch resource labelled “ csi ” is semi - statically configured . it can be a resource on its own or it can coincide with one of the four resources already configured for pf 3 ack / nack feedback . it is possible that this resource is always one of the 4 already configured resources — e . g . the first . in this case , no extra signalling is required to configure this resource . the pucch resource labelled “ csi_pcell_an ” is semi - statically configured . it can be a resource on its own or it can coincide with one of the four resources already configured for pf 3 ack / nack feedback or it can coincide with resource “ csi ”. it is possible that this resource is always one of the four already configured resources — e . g . the first . in this case , no extra signalling is required to configure this resource . it is possible that this resource is always the same as the “ csi ” resource ; in this case no extra signalling is required to configure this resource . the “ ari ” resource is the pf 3 resource which is indicated in the scell dl assignment . in the case that the terminal has only single - cell csi or single - cell csi together with pcell ack / nack to report , it could also use pf 2 / 2a / 2b . however , because for the other cases it has to use a pf 3 resource anyway , it would be a waste of resources if a terminal needs to be configured with both pf 2 / 2a / 2b and pf 3 resources . even a terminal that uses pf 1a / 1b with channel selection to report multi - cell ack / nack could be configured with the above outlined reporting mode and resources to enable csi reporting on pf 3 resources . pdcch signalling is not 100 % reliable . it is possible that a terminal is scheduled on a cell but does not receive the assignment . for example , a terminal could be scheduled on the pcell and an scell and is expected to report csi and ack / nack on the “ ari ” resource . however , since the terminal did not receive the scell assignment it reports csi and ack / nack on the “ csi_pcell_an ” resource . if the terminal receives the pcell assignment it should report csi on the “ csi_pcell_an ” resource using pf 3b . if it misses the pcell assignment it will use the “ csi ” resource instead with pf 3c . if the “ csi ” resource and the “ csi_pcell_an ” resource are different , the base station has to attempt to decode both resources and choose the resource which delivers the better decoding metric . based on that , the base station also knows if pcell assignment has been missed or not . on the “ csi ” resource the base station uses pf 3c , whereas on the “ csi_pcell_an ” resource the base station uses pf 3b . if “ csi ” and “ csi_pcell_an ” resource are the same , the base station does not know whether to use pf 3b or pf 3c . resolution of this ambiguity is discussed below . if the terminal receives all assignments — e . g ., pcell and one or more scells — it will use pf 3b on the “ ari ” resource . if the terminal has also been scheduled on the pcell but misses the pcell assignment , it will still use the same resource and format . it will set the ack / nack bits for the non - received assignment to nack ( as in rel - 10 ). if the terminal misses some scell assignments but at least receives one scell assignment , it will still use the same resource and format . it will set the ack / nack bits for the non - received assignment to nack ( as in rel - 10 ). if the terminal misses all scell assignments but receives a pcell assignment , it will use pf 3b on the “ csi_pcell_an ” resource . the terminal will set the ack / nack bits for the non - received assignment to nack ( as in rel - 10 ). if the terminal misses all scell assignments and also receives no pcell assignment ( not scheduled or missed ), it will use pf 3c on the “ csi ” resource . the base station must monitor the “ ari ” resource ( at least one scell is received ), the “ csi_pcell_an ” resource ( only if pcell is scheduled , this resource would be used if all scells assignments are missed but pcell assignment is received ), and the “ csi ” resource ( no assignment is received ). the base station assumes , for decoding , the pf 3c on the “ csi ” resource and the pf 3b on “ csi_pcell_an ” and “ ari ” resource . if the csi resource coincides with any or both of the “ csi_pcell_an ” and “ ari ” resource , the base station does not know which format to use for decoding . resolution of this ambiguity is discussed below . fig6 a depicts the processing for pucch format 3b , and fig6 b depicts the same for pf 3c . both formats are based on pf 3 and use the same spreading sequences for reference signal modulation , e . g . [ 1 1 ]. the payload processing is different . if the base station does not know which format has been used , it has to test both formats . however , in many circumstances the decoding of both formats will deliver “ valid ” bit sequences for ack / nack and / or csi , and the base station cannot tell which format has been used , and therefore also cannot tell if the bit represents an ack / nack and / or a csi . fig7 a and 7 b depict modifications to fig6 a and 6 b , respectively , where different spreading codes are used to modulate reference signals . pf 3b , depicted in fig7 a , uses the sequence a to modulate ( spread ) the reference signals , and pf 3c , depicted in fig7 b , uses sequence b . here , the reference signals are modulated differently . instead of using [ 1 1 ] to modulate reference signals of both pucch formats , the sequences a =[ a 0 a 1 ] and b =[ b 0 b 1 ] are used to modulate the reference signals for pf 3b and pf 3c , respectively , with a ≠ b . for example , a =[ 1 1 ] could be used for pf 3b , while b =[ 1 − 1 ] could be used for pf 3c . if the terminal transmits pf 3b , it uses sequence a to modulate its reference signals , and if the terminal transmits pf 3c , it uses sequence b to modulate its reference signals . when decoding pf 3b , the base station uses a to de - spread the reference signals , and uses b in the case of pf 3c . the base station hypothesis that matches the transmission will result in a reasonable channel estimate and a good decoding metric . the hypothesis on the de - spreading sequence that does not match the transmission will result in a completely wrong channel estimate and in a very bad decoding metric . by comparing the decoding metrics , the base station can therefore decide which format has been used , and thus also identify if the decoded bits are ack / nack and / or csi . fig8 depicts an exemplary method 100 implemented by the terminal ( also referred to herein as the ue ). after the ue checks its assignments ( block 110 ), the ue determines if there is an ack / nack to report ( block 120 ). if there is no ack / nack to report , the ue uses pf 3c on the csi resource ( block 130 ). if there is an ack / nack to report , the ue determines if the ack / nack is a pcell only ack / nack ( block 140 ). if the ack / nack is a pcell only ack / nack , the ue uses pf 3b on the csi_pcell_an resource ( block 150 ). otherwise , the ue uses pf 3b on the ari resource ( block 160 ). fig9 depicts an exemplary method 200 implemented by the base station ( also referred to herein as the enb ). after the enb checks the ue assignments ( block 210 ), the enb determines if the ue has an ack / nack to report ( block 220 ). if there is no ack / nack to report , the enb uses pf 3c on the csi resource ( block 230 ). if there is an ack / nack to report , the enb determines if the ack / nack is a pcell only ack / nack ( block 240 ). if the ack / nack is a pcell only ack / nack , the enb uses pf 3b on the csi_pcell_an resource , and pf 3c on the csi resource ( block 250 ). otherwise , the enb uses pf 3b on the csi_pcell_an resource ( if a pcell has been scheduled ) and on the ari resource , and pf 3c on the csi resource ( block 280 ). fig1 is a functional block diagram of circuits 400 that may be implemented in a terminal and / or a base station . the diagram 400 includes an ack / nack circuit 410 , a pcell check circuit 420 , and a controller 430 . ack / nack circuit 410 checks the assignments and forwards whether the terminal has an ack / nack to report to the pcell check circuit 420 and / or the controller 430 . if there is no ack / nack to report , the controller 430 indicates pf 3c should be used on the csi resource . if there is an ack / nack to report , the pcell check circuit 420 determines if the ack / nack is a pcell only ack / nack . if the pcell check unit 420 determines ack / nack is a pcell only ack / nack , the controller 430 indicates pf 3b should be used on the csi_pcell_an resource ( and if the circuit 400 is implemented in a base station controller 430 also indicates pf 3c should be used on the csi resource ). otherwise , controller 430 indicates pf 3b should be used on the ari resource ( and if the circuit 400 is implemented in a base station controller 430 also indicates to use pf3b on csi_pcell an resource ( if pcell has been scheduled ) and pf 3c on the csi resource ). as used herein , a “ circuit ” may comprise a dedicated digital , analog , or mixed electronic circuit , or may comprise a software module executing on a processing circuit , such as a microprocessor or digital signal processor ( dsp ). fig1 depicts an exemplary method 300 implemented by the enb for ambiguity avoidance . when the enb has to decode the pf 3b and pf 3c on the same resource ( block 310 ). it forms two hypotheses . in hypothesis 1 , pf 3b is assumed , and a sequence a is used for rs demodulation ( block 320 ). in hypothesis 2 , pf 3c is assumed , and a sequence b is used for rs demodulation ( block 330 ). the enb compares the decoding metrics obtained with both hypotheses ( block 340 ), and determines whether hypothesis 1 has a better metric ( block 350 ). if hypothesis 1 has a better decoding metric , the enb concludes that pf 3b has been used , and that the decoded bits are ack / nack and csi ( block 360 ). otherwise , the enb assumes pf 3c has been used , and that the decoded bits are csi ( block 370 ). fig1 is a functional block diagram of circuits 500 configured to avoid ambiguity in a base station by determining which pucch format was used . the diagram 500 comprises a hypothesis circuit 510 , a decoding metric circuit 520 , and a comparator 630 . the hypothesis circuit 510 forms two hypotheses . in hypothesis 1 , pf 3b is assumed , and a sequence a is used for rs demodulation . in hypothesis 2 , pf 3c is assumed , and a sequence b is used for rs demodulation . the decoding metric circuit 520 demodulates the reference signals using the assumed sequences for each hypothesis , and outputs a decoding metric for each hypothesis . the comparator 530 compares the decoding metrics obtained with both hypotheses , and determines whether hypothesis 1 has a better metric . if hypothesis 1 has a better metric , the enb assumes pf 3b has been used , and that the decoded bits are ack / nack and csi . otherwise , the enb assumes pf 3c has been used , and that the decoded bits are csi . as used herein , a “ circuit ” may comprise a dedicated digital , analog , or mixed electronic circuit , or may comprise a software module executing on a processing circuit , such as a microprocessor or digital signal processor ( dsp ). fig1 depicts a base station 600 operative in embodiments of the present invention . as those of skill in the art are aware , a base station 600 is a network node providing wireless communication services to one or more ue in a geographic region ( known as a cell or sector , not to be confused with the term cell used herein to refer to component carriers in carrier aggregation , such as pcell or scell ). the base station 600 in lte is called an e - nodeb or enb ; however the present invention is not limited to lte or enbs . a base station 600 includes communication circuitry 610 operative to exchange data with other network nodes ; a controller 620 ; memory 630 ; and radio circuitry , such as a transceiver 640 , one or more antennas 650 , and the like , to effect wireless communication across an air interface to one or more ue . according to embodiments of the present invention , the memory 630 is operative to store , and the controller 620 operative to execute , software 635 which when executed is operative to cause the base station 600 to perform methods and functions described herein . in particular , the software 635 may implement a hypothesis circuit 510 , decoding metric circuit 520 , and / or comparator 530 , as described herein with reference to fig1 . fig1 depicts a ue 700 operative in embodiments of the present invention . as those of skill in the art are aware , a ue 700 is a device , which may be battery - powered and hence mobile , operative within a wireless communication network . ue 700 are also known in the art as mobile stations or mobile terminals , and may include laptop computers , pad computers , cellular radiotelephones ( including “ smartphones ”), and the like . the ue 700 includes a user interface 710 ( display , touchscreen , keyboard or keypad , microphone , speaker , and the like ); a controller 720 ; memory 730 ; and a radio circuitry , such as one or more transceivers 740 , antennas 760 , and the like , to effect wireless communication across an air interface to one or more base stations 600 . the ue 700 may additionally include features such as a camera , removable memory interface , short - range communication interface ( wi - fi , bluetooth , and the like ), wired interface ( usb ), and the like ( not shown in fig1 ). according to embodiments of the present invention , the memory 730 is operative to store , and the controller 720 operative to execute , software 735 which when executed is operative to cause the ue 700 to perform methods and functions described herein . in particular , the software 735 may implement an ack / nack circuit 410 , pcell check circuit 420 , and / or controller 430 , as described herein with reference to fig1 . in all embodiments , the controller 620 , 720 may comprise any sequential state machine operative to execute machine instructions stored as machine - readable computer programs in the memory , such as one or more hardware - implemented state machines ( e . g ., in discrete logic , fpga , asic , etc . ); programmable logic together with appropriate firmware ; one or more stored - program , general - purpose processors , such as a microprocessor or digital signal processor ( dsp ), together with appropriate software ; or any combination of the above . in all embodiments , the memory 630 , 730 may comprise any non - transient machine - readable media known in the art or that may be developed . including but not limited to magnetic media ( e . g ., floppy disc , hard disc drive , etc . ), optical media ( e . g ., cd - rom , dvd - rom , etc . ), solid state media ( e . g ., sram , dram , ddram , rom , prom , eprom , flash memory , solid state disc , etc . ), or the like . in all embodiments , the radio circuitry may comprise one or more transceivers 640 , 740 used to communicate with one or more other transceivers 640 , 740 via a radio access network according to one or more communication protocols known in the art or that may be developed , such as ieee 802 . xx , cdma , wcdma , gsm , lte , utran , wimax , or the like . the transceiver 640 , 740 implements transmitter and receiver functionality appropriate to the radio access network links ( e . g ., frequency allocations and the like ). the transmitter and receiver functions may share circuit components and / or software , or alternatively may be implemented separately . in particular , a ue 700 according to embodiments of the present invention may include a transceiver 740 having two or more sets of receiver circuits and / or two or more sets of transmitter circuits , each independently tunable to a different component carrier frequency ( e . g ., pcell and scell ). in all embodiments , the communication circuitry 610 may comprise a receiver and transmitter interface used to communicate with one or more other nodes over a communication network according to one or more communication protocols known in the art or that may be developed , such as ethernet , tcp / ip , sonet , atm , or the like . the communication circuitry 610 implements receiver and transmitter functionality appropriate to the communication network links ( e . g ., optical , electrical , and the like ). the transmitter and receiver functions may share circuit components and / or software , or alternatively may be implemented separately . the embodiments disclosed herein enable simultaneous reporting of channel state information from multiple cells . the base station always has up - to - date csi from multiple cells , which improves dl throughput . the embodiments furthermore avoid the need to configure a terminal with both pf 2 / 2a / 2b and pf 3 resources . because it very difficult to reuse currently unused resources , such an avoidance is beneficial because it reduces recourse waste on the pucch . the present invention may , of course , be carried out in other ways than those specifically set forth herein without departing from essential characteristics of the invention . the present embodiments are to be considered in all respects as illustrative and not restrictive , and all changes coming within the meaning and equivalency range of the appended claims are intended to be embraced therein . | 7 |
an embodiment of a kinetofrictional force testing apparatus according to this invention will be described with reference to fig1 thru 8 . fig1 is a partly cross - sectional elevation of this embodiment . in fig1 numeral 1 designates a sliding member such as a magnetic disk serving as a storage medium . numeral 2 designates a magnetic head which serves as a test head and which is made of a material based on , for example , mn - zn ferrite . kinetofrictional force in the direction of rotation of the disk 1 during contact of the test head 2 with the disk is transmitted to an arm and is detected by a load cell 3 . a spindle 4 and ball bearings 5 are the principal components of a mechanism for rotating the disk 1 . in order to enhance the measurement accuracy of the kinetofrictional force , the rotating mechanism suppresses the vertical movements and radial movements of the disk 1 during the rotation thereof to 1 m or less and also suppresses the rotational jitters of the disk 1 to 0 . 1 % or less . a rotating drive force for the spindle 4 is generated by a spindle motor in the form of a d . c . brushless servomotor 6 and is transmitted to the spindle 4 through a belt 7 . an x - axial stage 8 and a micrometer 9 constitute a positioning mechanism for positioning the magnetic head 2 . fig2 a and 2b are a side view and a plan view , respectively of the load cell of the embodiment of fig1 . the kinetofrictional force between a magnetic head 20 and a magnetic disk 1 ( not shown ) as received by the former is transmitted to magnetic head gimbals 21 connected to the magnetic head 20 . a leaf spring 23 made of stainless steel and having adequately adjusted properties is vibrated according to the kinetofrictional force through a magnetic head gimbals fixture 22 to which the magnetic head gimbals 21 are attached . the leaf spring 23 has first and second lateral surfaces that extend substantially transversly , i . e ., perpendicularly with respect to the plane of a magnetic disk 1 mounted on the spindle 4 . the kinetofrictional force in terms of the vibrations is detected by strain gauge sensors 24 which are attached to both lateral surfaces of the leaf spring 23 . output signals corresponding to the detected kinetofrictional force are transmitted to suitable amplifiers ( not shown ) through an output cord 25 . a three - point leveling mechanism 26 serves to set the spacing and parallelism between the magnetic disk 1 and the magnetic head gimbals fixture 22 with an accuracy within 0 . 01 mm . a leaf spring supporter 27 and a leaf spring fixture 28 hold the zero point of the leaf spring 23 stable for a long term . set screws for a limiter 29 prevent the strain gauge sensors 24 from damage , and they limit the range of movement of the strain gauge sensors 24 lest predetermined detecting ranges should be exceeded . the various elements mentioned above are mounted on a frame 20a . fig3 is a block diagram of a control circuit for this embodiment . in general , the embodiment is controlled in such a way that instructions and commands transmitted over a data bus 33 are executed on the basis of programs which are set in a personal computer 34 . in the arrangement of fig3 the kinetofrictional force detected by a load cell sensor 30 is amplified by a succeeding load cell amplifier 31 and is converted into a corresponding digital value by an a / d converter 32 . thereafter , the digital value is sent through the data bus 33 and is read by the personal computer 34 . the sensitivity of the load cell sensor 30 is symmetric in both the normal and reverse directions in which the kinetofrictional force acts . more specifically , a voltage which corresponds to the output from the load cell sensor 30 is positive during the rotation of the magnetic disk 1 in the counterclockwise ( ccw ) direction , and it is negative during the rotation thereof in the clockwise ( cw ) direction . the rotational direction of the magnetic disk 1 is designated by a rotational direction control switch 36a . the rotation of a motor 37 in the form of a d . c . brushless servomotor is digitally controlled by executing a program set in the personal computer 34 . the control of rotation and stopping of the motor 37 is performed by a motor control circuit 36 on the basis of a motor clock signal output from a rotational frequency controlling synthesizer 35 and a motor on / off signal output from a parallel interface 39 , these units 35 and 39 being operated by instructions or commands from the personal computer 34 . the rotational frequency of the motor 37 is controlled under the management of the rotational frequency controlling synthesizer 35 in a loop comprising the motor control circuit 36 , the motor 37 , and a rotary encoder 38 . fig4 is a diagram of an example of the rotational frequency controlling synthesizer 35 of the embodiment of fig1 . reference pulses of frequency f 0 from a reference crystal oscillator 40 are input to a phase comparator 41 in which the phase of the reference pulses is compared with that of a signal obtained by dividing the frequency of an output from a voltage - controlled oscillator 43 by means of a # 1 preset counter 44 . a signal which corresponds to the component of the resulting phase difference is applied to the voltage control terminal of the voltage - controlled oscillator 43 through a low - pass filter 42 . a closed loop comprising the phase comparator 41 , low - pass filter 42 , voltage - controlled oscillator 43 , and # 1 preset counter 44 forms a negative feedback loop , whereby the output signal of the voltage - controlled oscillator 43 oscillates with the following predetermined set value : by employing such a so - called &# 34 ; pll synthesizer system &# 34 ;, the rotational frequency of the motor 37 , which is a d . c . brushless servomotor , is determined by the frequency of motor clock pulses impressed from the motor control circuit 36 . by jointly employing a # 2 preset counter 45 , the rotational frequency of the motor 37 can be designated with a resolution of 1 rpm for 10 - 4000 rpm , and a resolution of 0 . 1 rpm for 0 . 1 - 10 rpm . fig5 through 8 are graphs for explaining the operation of the embodiment of fig1 . first , fig5 illustrates the characteristic curves of the rise and fall of the rotational speed of a disk in the case where the embodiment is applied to a commercially available magnetic disk device . in this figure , the abscissa is time while the ordinate is rotational frequency . fig6 exemplifies measurements of the relative kinetofrictional forces between a magnetic disk and a magnetic head during the fall of rotational speed in fig5 . in the example of fig6 pulses per revolution are generated as the encoder pulses of a spindle . the magnetic head which floats above the magnetic disk at 3600 rpm begins its contact with the magnetic disk at 200 rpm and comes to a standstill after the lapse of about 0 . 3 seconds . the maximum frictional force on that occasion is 2 gf . fig7 illustrates the frictional force of the magnetic disk , while fig8 illustrates the frictional force at the attraction of the magnetic disk to the magnetic head . in each of fig7 and 8 , the abscissa is time and the ordinate is frictional force . as thus far described , in the embodiment of fig1 the motor clock pulses for determining the rotational frequency of the motor are digitally controlled on the basis of the pll system . it is therefore possible , by employing an inexpensive personal computer , to readily set the rotational frequency at intervals on the order of milliseconds and to establish the same degrees of rotational rise / fall characteristics as those of magnetic disk devices which are commercially available . as expedients for heightening the resonant frequency of the load cell sensor , the sensor system in the load cell sensor , including the magnetic head fixture , leaf spring , leaf spring fixture , etc ., is reduced in size as a whole , a single leaf spring of high rigidity , the properties of which have been adjusted , is used and the mechanism for supporting the leaf spring is formed of a cantilever . in addition , high sensitivity strain gauge sensors are mounted on both lateral surfaces of the leaf spring , whereby the sensitivity of the apparatus is doubled . the magnitudes of strains responsive to the stress of the leaf spring are equalized in both the sideward directions , thereby making it possible to obtain similar measured results even when the rotating direction of the spindle is changed . further , when zero adjustments for the kinetofrictional force are performed with the magnetic disk and the magnetic head lying in contact , ordinarily the zero point becomes unstable on account of stresses remaining in the part of the contact . in contrast , the embodiment of this invention is endowed with the function of resetting the zero points of the strain gauge sensors in programmed fashion after the magnetic head has completely risen above the magnetic disk , and it therefore holds the zero points stable for a long term . as described above , according to this invention , it is possible to measure with a high sensitivity and with a quick response a kinetic relative frictional force which arises when a magnetic disk is rotated in contact with a magnetic head . | 6 |
the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventors of carrying out their invention . various modifications , however , will remain readily apparent to those skilled in the art , since the general principles of the present invention have been defined herein specifically to provide improved embodiments of modified hermes transposases . transposons are mobile genetic elements that are an important source of genetic variation and are useful tools for genome engineering , mutagenesis screens , and vectors for transgenesis including gene therapy . for example , cell free systems for inter - molecular transposition for dna sequencing , to create deletions or insertions into genes , and for studying protein domain functions have been developed for tn7 ( 1 ), for tn5 ( 2 ), and for mu ( 3 ). hermes is a 2479 by long hat family dna transposon element derived from the maryland strain of the common housefly musca domestica . its use in creating transgenic insects was disclosed both in a research publication ( 4 ), and in u . s . pat . no . 5 , 614 , 398 , which is incorporated herein by reference to the extent permissible under applicable statute and regulation . the hermes transposase gene has since been cloned ( seq id no : 2 ) and encodes a 612 amino acid polypeptide chain ( fig1 , seq id no : 1 ) similar to other members of the hat family of transposases , e . g . hobo , ac and tam3 . the transposon is flanked by 17 by imperfect left ( l - end ) and right ( r - end ) terminal inverted repeat sequences that are substrates for the transposition reaction ( l - end = seq id no : 3 and r - end = seq id no : 4 ) and are similar to other members of the hat family . mechanisms involved in hermes transpositions have been carefully characterized by the inventor n . l . craig and colleagues . the hermes protein facilitates movement of the entire transposon element by binding initially to each of the two 17 by terminal binding sequences followed by cleavage at both ends of donor dna association with target dna , then , strand transfer and the generation of 8 - base - pair ( bp ) target - site duplications in target dna upon transposition ( 5 ). this scheme is illustrated in fig2 where initial cleavage at the left ends ( le ) and right ends ( re ) of the hermes element occurs one nucleotide into the flanking strand of the 5 ′ ends of the transposon , thereby generating a flanking 3 ′- oh group . subsequent nucleophilic attack by this 3 ′- oh group on the opposite strand results in flanking hairpins and 3 ′- oh groups at either end of the transposon . these two new 3 ′- oh groups act as nucleophiles for a coordinated attack on target dna , in which two insertion events , separated by 8 bp , occur on opposite strands of the target dna . this results in addition of lengths of the target dna onto the transposon effectively inserting the transposon . the full - length native hermes transposase ( hermes ; residues 1 - 612 ) was subcloned into pet - 15b ( novagen ) for expression in escherichia coli as an n - terminal his - tag fusion protein and purified . the full - length hermes transposase ( residues 1 - 612 ) is soluble , but not readily amenable to crystallization for structural studies because it forms large aggregates in solution when expressed as an n - terminally histidine ( his )- tagged fusion protein in e . coli . however , removal of the n - terminal 78 residues results in a version of hermes that is readily crystallized . the structure of hermes79 - 612 was solved using x - ray crystallography ( 6 ). size - exclusion chromatography and sedimentation equilibrium experiments revealed that hermes forms multimers in solution and examination of the structure revealed an explanation for the multimerization of hermes253 - 612 is provided by the presence of a second interface ( interface 2 ) through which heterodimers can form heterotetramers . this interface arises by domain swapping of two helices between residues 497 and 516 that project away from each hermes79 - 612 molecule . the crystal structure of hermes79 - 612 as well as a more recent unpublished structure solved by alison hickman and others that reveals the configuration of transposon ends within this structure , see fig3 , which made it possible to determine residues in the protein that if mutated or deleted could alter the structure of the multimeric protein complex and its activity ( 7 ). therefore , several residues were mutated along the polypeptide chain and each mutant tested for its transposition activity . two mutants ( fig1 ), the “ triple mutant ” with a combination of three mutations of residues arginine to alanine at position 369 , phenylalanine to alanine at position 503 and phenylalanine to alanine at position 504 in the polypeptide chain ( seq id no : 5 ( protein ), seq id no : 6 ( nucleic acid )), and the “ delta497 - 516 ” mutant with a deletion of residues from positions 497 through to position 516 on the polypeptide chain ( seq id no : 7 ( protein ), seq id no : 8 ( nucleic acid )) formed dimeric complexes in solution and were more active than the native enzyme in in vitro transposition reactions at both 30 ° c . and at 23 ° c ., using an dsdna oligonucleotide with the hermes terminal inverted repeat sequences , a target plasmid , usually puc19 or pbr322 , the purified hermes transposase and divalent cations such as mg 2 + or mn 2 + . fig4 diagrammatically shows that wild type ( wt ) hermes transposase forms heterodimers which assemble into octamers through the mediation of interface 2 . both the delta497 - 516 mutant and the triple mutant lack effective interface 2s so they form only dimers in solution . the polypeptide sequences and method of production of the “ triple mutant ” and the “ delta497 - 516 ” mutants of hermes transposase for in vitro transposition and 5 ′ tagging of nucleic acids are disclosed herein . methods of using the above hyperactive forms of the hermes transposase in generating genomic 5 ′ transposon tagged libraries for whole genome amplification and dna sequencing are also disclosed . the wild type hermes transposase showed minimal insertional bias when a very large dataset of in vitro target sites were analyzed by using a standard method ( 8 ). using this approach , in one example where half of a sequencing lane of an illumina sequencing slide ( illumina , inc ., san diego , calif .) was used , 6 . 5 × coverage of the yeast genome was obtained , i . e ., on average , each base is contained in 6 . 5 reads , with only 7 . 02 % of the genome not covered . it was confirmed that the triple mutant did not display any difference in insertional bias . fig5 shows sequence logos of both the wild type ( wt ) and the triple mutant produced by overlaying the insertion sites of the transposases . the strong thymine and adenine consensus signals indicate essentially no difference in target site selection between the two different transposases . methods of purification of hyperactive hermes transposase : method 1 . the hermes transposase ( tnsp ) orf ( 612 amino acids ) was amplified by polymerase chain reaction ( pcr ) from plasmid pbchshh1 . 9v and cloned between the ncol and pvull sites of plasmid pbad / myc - hisb ( invitrogen ) to generate a hermes - myc - his fusion construct , plq4 . e . coli strain top10 ( invitrogen ) transformed with the hermes - myc - his plasmid was grown overnight with shaking at 30 ° c . in lb medium containing 100 mg / ml carbenicillin . the following day the overnight culture was diluted 1 : 100 with fresh lb + carbenicillin , and cells were then grown to an absorbance at 600 nm of 0 . 6 at 30 ° c . the culture was then shifted to 16 ° c . and induced with 0 . 1 % l - arabinose for 16 h . after induction , cells were washed by centrifugation at 4 ° c . with tsg ( 20 mm tris - hcl , ph 7 . 9 , 500 mm nacl , 10 % v / v glycerol ), and frozen in liquid nitrogen ; all subsequent steps were performed at 4 ° c . frozen cells were resuspended in 10 ml tsg and lysed by sonication . the cleared lysate was loaded onto a pre - equilibrated ni 2 + sepharose column ( amersham ) and washed with ten column volumes of tsg , six column volumes of tsg + 50 mm imidazole and six column volumes of tsg + 100 mm imidazole . the hermes - myc - his fusion protein was eluted with six column volumes of tsg + 200 mm imidazole , dialyzed against tsg , and stored at − 80 ° c . method 2 . soluble hermes transposase ( both wild - type and mutants ) was obtained by expression in e . coli bl21 ( de3 ) cells which were grown at 310 k until od600 = 0 . 6 . cells were then rapidly cooled on ice to 19 ° c . and protein expression was induced by addition of iptg to a final concentration of 0 . 5 mm . cells collected from an 8 liter culture were harvested 16 - 20 h post - induction . the pellet was resuspended in 300 mm nacl , 12 mm phosphate ph 7 . 4 , flash - frozen in liquid nitrogen and then stored at 193 k . unless noted otherwise , all purification steps were performed at 4 ° c . after thawing , cells were lysed by sonication in the presence of 500 mm nacl , 5 mm imidazole ( im ), 25 mm tris ph 7 . 5 and 2 mm β - mercaptoethanol ( bme ). following centrifugation of the cell lysate at 100 , 000g for 45 min , the supernatant was loaded onto a hi - trap metal - chelation column ( amersham biosciences ) previously equilibrated with niso 4 . the column was washed extensively with 20 mm tris ph 7 . 5 , 2 mm im and 500 mm nacl followed by the same buffer containing 22 mm im . hermes was eluted from the column using a gradient of 22 - 400 mm im . after visualization on an sds - page gel , fractions containing hermes 79 - 612 were combined and dialyzed against 20 mm tris ph 7 . 5 , 1 mm edta , 500 mm nacl , 4 mm bme and 10 %( w / v ) glycerol . this was followed by dialysis against a single change of the same buffer containing 5 mm dithiothreitol ( dtt ) in place of bme ( tsk buffer ). to remove the polyhistidine tag , 10 units of thrombin ( sigma ) were added per milligram of protein and incubated overnight . thrombin was removed by passage over a 1 ml benzamidine sepharose 4b ( pharmacia ) column . method 3 . purification of transposase without an affinity tag : it is also possible to purify hermes transposases in sufficient quantities by expressing a version of the protein that lacks an affinity purification tag . this was done by introducing a stop codon at the position where the sequence corresponding to the tag begins in the hermes transposase coding region of plq4 of method 1 . protein was expressed in top10 cells by growth at 37 ° c . until od600 nm ˜ 0 . 6 , followed by cooling to 19 ° c . and then induction by addition of arabinose to a final concentration of 0 . 012 %; cells were harvested after 16 - 18 hrs . cells were lysed by sonication in lysis buffer ( 25 mm tris ph 7 . 5 , 0 . 5 m nacl , 0 . 2 mm tcep ), centrifuged to remove cell debris , and the soluble material loaded onto heparin sepharose columns ( ge healthcare ) previously equilibrated in 25 mm tris ph 7 . 5 , 0 . 1 m nacl , 0 . 2 mm tcep . after washing with the same buffer containing 0 . 5 m nacl , protein was eluted using a linear gradient from 0 . 5 m to 1 . 0 m nacl . for gel filtration , fractions containing hermes were combined , concentrated , and loaded onto a preparative scale biosep - sec - s 3000 column ( phenomenex ) equilibrated in 25 mm hepes ph 7 . 3 , 1 . 5 m nacl , and 0 . 2 mm tcep . strand transfer assay : pre - cleaved hermes - l end for strand - transfer reactions to measure transposition activity was made by annealing the following oligonucleotides : in some experiments , the oligonucleotide was radiolabeled at its 5 ′ end with y - p 32 - datp ( to demonstrate covalent attachment to target ) ( 9 and 10 ) or , as in the example shown in fig6 , unlabeled and used directly as a substrate at 22 . 9 nm or 60 nm or anywhere from 5 nm to 100 nm for strand - transfer reactions with 3 . 4 nm or 4 nm puc19 / pbr322 target dnas and 5 nm to 10 . 7 nm of hermes transposase . in the experiment illustrated in fig6 reactions were incubated for 0 to up to 120 minutes ( times of 0 , 4 , 15 , and 45 minutes are shown ), at 23 ° c . or 30 ° c ., preferably 30 ° c . the reactions were stopped by addition of sds and edta to a concentration of 0 . 5 % - 1 % sds and 20 - 25 mm edta , incubated at 65 ° c . for 20 minutes at room temperature ( rt ), and in some cases treated with 40 μg of proteinase k and incubated for 30 minutes at 37 ° c . for analysis . dna was extracted with phenol / chloroform , precipitated with ethanol and loaded onto 1 % tae agarose gels and / or gel dried and phosphor imaged and the various end products of the reaction analyzed by their distinct electrophoretic mobility . in fig6 the gels were stained with ethidium bromide to visualize the nucleic acid bands . sej and dej represent the product of one and two insertions , respectively , per plasmid target molecule . the smear represents the products of fragmentation resulting from more than three insertions per target molecule . fig7 diagrammatically illustrates the insertion process leading to these results . transposon left - end ( le ) inserts into supercoiled ( sc ) plasmid ( puc19 ) dna converting it to the nicked circular single end joined ( sej ) configuration and with an additional insertion into the linear double end joined ( dej ) form and with still more insertions into the linear fragments ( lfs ) that make up the smear . the dimeric forms of hermes transposase are efficient in strand transfer / covalent attachment to target dna and fragment the target dna as the reaction proceeds as shown in fig7 and 6 . a ) strand transfer reaction : the strand transfer reaction is diagrammatically illustrated in fig8 where insertion of tagged transposon ends into target dna results in 8 - bp single stranded gaps which are filled in by strand displacing dna polymerases such as t4 dna polymerase . this allows next gen sequencing platform specific sequences to be attached to fragments of target dna . strand transfer reaction was carried out by mixing 285 . 7 nm ( 2 ug in 100 ul ) purified hermes transposase , 1 mm ( 100 pmoles in 100 ul ) biotinylated double - stranded hermes lend oligonucleotide ( le ) containing the 17 bp terminal inverted repeat , prepared by annealing oligonucleotides such as the following : 5 ′ biotinylated oligo - hermes le top strand , ( seq id no : 11 ) 5 ′ biotin - ataagtagcaagtggcgcataagtatcaaaataagccacttgttgttgttctctg and 5 ′ phosphorylated oligo ,- hermes le bottom strand , ( seq id no : 12 ) 5 ′ p - ccagagaacaacaacaagtggcttattttgatacttatgcgccacttgctacttat ( synthesized by idt ) with the addition to 2 . 53 pm ( 2 μg in 100 μl ) of proteinase k treated - phenol - chloroform purified schizosaccharomyces pombe or saccharomyces cerevisae genomic dna in a buffer containing 25 mm mops ph 7 . 5 , 100 mm nacl , 10 mm mgcl 2 , 4 % glycerol , 2 mm dtt , 0 . 1 mg / ml bsa for 2 - 3 h at 30 ° c . the reaction was quenched by adding edta and sds to a final concentration of 20mm and 0 . 1 % respectively and inactivating the enzyme at 65 ° c . for 20 min . note that for seq id no : 11 the uppercase nucleotides represent the 17 bp terminal inverted repeat while the lowercase nucleotides represent the biotin sequencing priming region . for seq id no : 12 the uppercase nucleotides represent the 17 bp terminal inverted repeat while the lowercase nucleotides represent the sequencing priming region . at this stage as shown in fig9 , the 3 ′ end of the top strand of the biotinylated double stranded transposon le is covalently attached to the 5 ′ of the target dna fragment on two ends and fragmentation of the target dna has occurred along its length . streptavidin ( sa ) beads or other affinity systems can be used to purify the tagged fragments . after which the fragments can be cut with a four base cutter such as mse1 . there are several well - known methods for modifying these fragments so that they are prepared as suitable templates for dna sequencing . for example , specific next gen sequencing tags such as illumina sequences can be introduced via specific pcr of the insertion sites . well - known methods are used to fill in the 8 by gaps in the fragments . b ) methods of preparing the transposase mediated fragmented and 5 ′ tamed dna for sequencing : the fragments can , at this stage , be subjected to an extension and strand displacement reaction using dna polymerase . arbitrary tags or specific next gen sequencing platform specific tags ( e . g . seq id nos : 17 - 20 ) can be added onto the target dna fragments by this method ( see fig9 ). this method also requires designing primers complementary to the transposon ends in such way that a “ suppression pcr ” can produce the 5 ′ ( arbitrary tag a -( le )) and 3 ′ ( arbitrary tag b - le )) next gen sequencing tags ( as in the nextera kit , illumina ) on either end of each of the fragments . hermes l - end oligo ( tag a - le ) with illumina / arbitrary tag a sequencing priming region , 4 by barcode and a 30 by hermes transposon end is prepared by annealing : taga - le top strand ( seq id no : 17 ): 5 ′ biotin aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctgcgt tcaaaataagccacttgttgttgttctctg and a taga - le bottom strand ( seq id no : 18 ): 5 ′ phospho ccagagaacaacaacaagtggcttattttgaacgcagatcggaagagcgt cgtgtagggaaagagtgtagatctcggtggtcgccgtatcatt . for seq id no : 17 the illumina / arbitrary tag a is shown in uppercase while the sequencing priming region is shown in lower case with the 4 by barcode in uppercase followed by a 30 by hermes transposon end with the minimal 17 bp end shown in lower and uppercase . for seq id no : 18 the 30 by hermes transposon end with the minimal 17 bp end is shown in uppercase and lowercase with the 4 by barcode in uppercase followed by the sequencing priming region in lowercase and the illumina / arbitrary tag a in uppercase . a hermes l - end oligo ( tagb - le ) with illumina / arbitrary tag a sequencing priming region , 4 by barcode and 30 by hermes transposon end is prepared by annealing tagb - le top strand ( seq id no : 19 ): ccagagaacaacaacaagtggcttattttgaacgcagatcggaagagcgtcgtgtagggaaagagtgtgag ctcgtatgccgtcttctgcttg . for seq id no : 19 the illumina / arbitrary tag b is shown in uppercase , the sequencing priming region is shown in lower case followed by a 4 by barcode in uppercase and a 30 by hermes transposon end with the minimal 17 bp end shown in lowercase and uppercase . for seq id no : 20 the 30 by hermes transposon end with the minimal 17 bp end is shown in lowercase and uppercase followed by a 4 by barcode in uppercase and a sequencing priming region and illumina / arbitrary tag b in uppercase . arbitrary tags or specific next gen sequencing platform specific tags can also be added onto the target dna fragments by a modified method that does not need “ suppression pcr ” but provides a second distinct priming site using any “ 4 - bp cutter ”- restriction enzyme and a linker ligation mediated pcr approach . in this method as shown in fig9 , the fragments attached to the biotinylated transferred strand are bound to magnetic streptavidin coupled dynal beads ( invitrogen ) in binding and washing buffer ( b & amp ; w buffer : 100 mm tris - hcl , ph 8 . 0 , 1 mm edta , and 1 m nacl ). the b & amp ; w buffer is removed after magnetic separation and the beads resuspended in a digestion mix that contains a restriction enzyme e . g . msel that cuts at ttaa ( neb ). basically , a variety of affinity purification systems are adaptable to this and related methods . various types of ligand - binding molecule systems are usable as well . most often the small ligand is attached to the transposon and the binding molecule ( receptor ) is attached to a solid phase . in the illustrated examples the solid phase is composed of magnetic beads , but the solid phase can also be beads or solids in a chromatographic column or solid surfaces on a chip , etc . biotin - streptavidin and polyhistidine ( more than six histidine residues )- nickel / cobalt binding moieties are illustrated . lectin - sugar and hapten - antibody systems as well as other affinity systems can be used . the bound dna is digested at 37 ° c . overnight . the beads are washed and mse1 - specific linkers ( obtained by annealing linker / adapter top strand ( seq id no : 13 ) and linker / adapter bottom strand ( seq id no : 14 ) are ligated to the mse1 - digested ends of the hermes l - end attached dna . the beads are washed to remove non - ligated linkers . the dna bound to the beads are used as a template for the pcr amplification of the hermes l - end insertion site junctions using the 5 ′ transposon end specific primer , that has i ) 5 ′ illumina tag sequence fused to ii ) an illumina proprietary sequence ( sequencing primer ), 4 - bp barcode and the hermes lend complementary sequence ( seq id no : 15 ) and the 3 ′ linker / adapter specific primer , that has the 3 ′ illumina tag ( seq id no : 16 ). the pcr mix is separated from the dynal beads , concentrated , the amplicons size - selected on an agarose gel and purified by gel extraction . massively parallel sequencing is then carried out on the illumina hi - seq hts platform . the linker / adapter top strand is seq id no : 13 : tagtcccttaagcggagccctatagtgagtcgtattac . the linker / adapter bottom strand is seq id no : 14 : gtaatacgactcactatagggctccgcttaagggac . the 5 ′ transposon end specific primer is seq id no : 15 : aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctgcgtcgcataag tatcaaaataagccac . the 3 ′ linker / adapter specific primer is seq id no : 16 : caag cagaagacggcatacgagctcttccgatctgtaatacgactcactatagggc . for seq id no : 15 the illumina tag a and the 4 by barcode are in uppercase while the sequencing priming region and inverted repeat are in lowercase . for seq id no : 15 the illumina tag b is in uppercase while the linker adapter pcr priming region is in lower case . in another variation of the above embodiment ( shown in fig1 ), after tagging the 5 ′ ends of the target genomic dna by strand transfer with biotinylated hermes transposon end , instead of restriction digestion and linker ligation , a second transposase is used to provide the second tag ( with a priming site distinct from the priming site provided by the hermes transposon end ) after capturing the fragments on magnetic beads . the second transposon may preferably be the piggy bac transposase that is disclosed in and covered by published patent applications us 2010 / 0287633 , us 2010 / 0154070 , and us 2007 / 0204356 ( which are incorporated herein by reference to the extent allowed by applicable statute or regulation ). however , any other transposase that has target dna recognition characteristics distinct from hermes such as spin , aebuster , or even mu and tn5 ( nextera ) can be used . this step is followed by dna polymerase mediated extension and strand displacement using t4 dna polymerase or dna ligation using t4 ligase followed by pcr using primers carrying next gen sequencing primers . yet another variation ( shown in fig1 ) of the above methods involves using an affinity tag , for example his6 ( polyhistidine ) peptide , covalently linked to the top strand of the transferred transposon end so that pcr amplified dna is to be avoided prior to sequencing . in this method the dna fragments with 8 bp single strand gaps after being immobilized on an ni - nta coated magnetic bead can be filled by extension and strand displacement using t4 dna polymerase and eluted from the column using imidazole . the following claims are thus to be understood to include what is specifically illustrated and described above , what is conceptually equivalent , what can be obviously substituted and also what essentially incorporates the essential idea of the invention . those skilled in the art will appreciate that various adaptations and modifications of the just - described preferred embodiment can be configured without departing from the scope of the invention . the illustrated embodiment has been set forth only for the purposes of example and that should not be taken as limiting the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein . references . the following references are provided to aid in understanding the invention and are incorporated herein by reference to the extent permitted by applicable statute and regulation 1 . biery m . c ., stewart f . j ., stellwagen a . e ., raleigh e . a ., craig n . l ., “ a simple in vitro tn7 - based transposition system with low target site selectivity for genome and gene analysis ”. nucleic acids res . 2000 mar 1 , 28 ( 5 ): 1067 - 77 . 2 . goryshin i . y ., reznikoff w . s ., “ tn5 in vitro transposition ”. , j biol chem . 1998 mar 27 ; 273 ( 13 ): 7367 - 74 3 . haapa s , suomalainen s , eerikäinen s , airaksinen m , paulin l , savilahti h . “ an efficient dna sequencing strategy based on the bacteriophage mu in vitro dna transposition reaction .” genome res . 1999 mar , 9 ( 3 ): 308 - 15 4 . o &# 39 ; brochta d . a ., warren w . d ., saville k . j ., atkinson p . w ., “ hermes , a functional non - drosophilid insect gene vector from musca domestica ”. genetics . 1996 mar ; 142 ( 3 ): 907 - 14 5 . zhou l , mitra r , atkinson p . w ., hickman a . b ., dyda f , craig n . l ., “ transposition of hat elements links transposable elements and v ( d ) j recombination ”. nature . 2004 dec 23 ; 432 ( 7020 ): 995 - 1001 . 6 . perez z . n ., musingarimi p , craig n . l ., dyda f , hickman a . b ., “ purification , crystallization and preliminary crystallographic analysis of the hermes transposase .” acta crystallogr sect f struct biol cryst commun . 2005 jun 1 ; 61 ( pt 6 ): 587 - 90 7 . hickman a . b ., perez z . n ., zhou l ., musingarimi p ., ghirlando r ., hinshaw j . e ., craig n . l ., dyda f ., “ molecular architecture of a eukaryotic dna transposase .” nat struct mol biol . 2005 aug ; 12 ( 8 ): 715 - 21 8 . gangadharan s ., mularoni l ., fain - thornton j ., wheelan s . j ., craig n . l ., “ dna transposon hermes inserts into dna in nucleosome - free regions in vivo ”. proc natl acad sci u s a . 2010 dec 21 ; 107 ( 51 ): 21966 - 72 . 9 . zhou l , mitra r , atkinson p . w ., hickman a . b ., dyda f , craig n . l . “ transposition of hat elements links transposable elements and v ( d ) j recombination ”. nature 2004 dec 23 ; 432 ( 7020 ): 995 - 1001 . 10 . hickman a . b ., perez z . n ., zhou l ., musingarimi p ., ghirlando r ., hinshaw j . e ., craig n . l ., dyda f . “ molecular architecture of a eukaryotic dna transposase ”. nat struct mol biol . 2005 aug ; 12 ( 8 ): 715 - 21 . | 2 |
the invention employs an economical enhancement to the efficiency of a rankine cycle - type heat engine for waste heat recovery . it is known in the art that an internal heat exchanger or regenerator ( hereinafter , regenerator ) can improve the efficiency of a thermodynamic cycle . however , in a rankine cycle , the working fluid is often expanded to a temperature which is too low for effective regeneration . in order to make use of the regeneration concept in a rankine cycle , the present invention provides a rankine cycle - type heat engine modified to introduce , along with the working fluid , a second liquid into an expansion device . this liquid , referred to below as a flooding media ) can act as a buffer against the temperature drop which normally occurs in the working fluid during the expansion process . with the working fluid now exiting the expansion device at a higher temperature , an internal heat exchanger can be employed to increase the efficiency of the cycle . the liquid - flooded expansion process described is possible using a variety of expansion devices . for example , scroll and screw - type expansion devices are particularly tolerant of liquid in the expansion process . the concept of flooded expansion ( and compression ) has been employed in other thermodynamic cycles . for example , u . s . pat . no . 7 , 401 , 475 discloses the concept of both flooded compression and expansion in an ericsson cycle , and u . s . pat . no . 7 , 647 , 790 discloses the use of flooded compression via injection in a vapor compression cycle . however , the application of flooded expansion to a rankine cycle is believed to be unknown . according to a further aspect of the invention , a practical method is provided for approximating an isothermal expansion process for a rankine cycle heat engine . the rankine cycle is known as comprising four thermodynamic processes . in an ideal rankine cycle , the processes are constant entropy pumping of a saturated liquid to a relative high pressure , constant pressure heat addition until the working fluid is at least fully evaporated , constant entropy expansion to a relative low pressure , through which process work is extracted from the energy in the working fluid , and constant pressure heat rejection until the working fluid is fully condensed . as noted above , a first significant difference between the present invention and traditional rankine cycle is that the working fluid is mixed with a liquid flooding media . the flooding media is chosen to have a relatively higher heat capacity than the working fluid . the working fluid and the flooding media are expanded together with an expansion device , with the result that the working fluid exits the expansion device at a significantly higher temperature than in an otherwise equivalent expansion process performed in a traditional rankine cycle . with the working fluid at a sufficiently high temperature , it may be passed through an internal heat regenerator to preheat the working fluid after the pump exit and before it is heated by the heat source . this reduces the required heat input to the working fluid and increases the thermal efficiency of the cycle . for purposes of further describing the invention , fig2 schematically represents a rankine cycle - type heat engine for waste heat recovery , in which the heat engine has been modified in incorporate certain features of the present invention . the system represented in fig2 comprises the following components : a working fluid pump 12 , an internal regenerator ( heat exchanger ) 14 , an evaporator 16 , a flooding media pump 18 , a liquid heater 20 , a mixer 22 for mixing the working fluid and flooding media , an expansion device 24 , a separator 26 for separating the working fluid and flooding liquid , and a condenser 28 . particularly notable working fluids for use with the invention include the hydrocarbon refrigerants r600a , n - pentane and r245fa , though the use of other types of refrigerants is also foreseeable , including but not limited to r245fa and r717 . as previously noted , the flooding media is selected to have a higher heat capacity than the working fluid used . notable fluids for use as the flooding media include water and oils , a notable example of the latter being refrigeration oils , a commercial example of which is zerol 60 , an alkylbenzene refrigeration oil available from nu - calgon . in the example of fig2 , the working fluid enters the pump 12 in a liquid state and at a low pressure . the pump 12 brings the working fluid to a relatively higher pressure and causes the fluid to pass through the regenerator 14 , where it is preheated by a quantity of the working fluid entering the regenerator 14 at a higher temperature ( explained below ) from the separator 26 . the heated working fluid then passes through the evaporator 16 , where it is further heated by an external heat source 30 up to a maximum temperature ( t h ) approaching that of the temperature of the heat source 30 . at the same time , the flooding media enters the pump 18 in a liquid state and at a low pressure , and the pump 18 brings the flooding media to a pressure approximately equal to the pressure of the working fluid that exited the pump 12 . the flooding media is then heated by the heater 20 to a temperature approximately equal to the temperature of the working fluid that exited the evaporator 15 . at this point , both fluid streams are shown as being combined in the mixer 22 before the resulting liquid mixture is expanded through the expansion device 24 , identified in fig2 as a turbine . because of the close thermal contact between the working fluid and flooding media within the liquid mixture , the flooding media ( which does not significantly drop in temperature during expansion ) exchanges heat with the working fluid ( which would otherwise tend to drop in temperature as it expands ). as a result , the working fluid exits the expansion device 24 with a much higher temperature than that with which it would have exited through a normal expansion process in the absence of the flooding media . the liquid mixture containing the working fluid and flooding media then enters the separator 26 , where the working fluid and flooding media are separated into different streams again . the stream of flooding media is returned by the separator 26 to the pump 18 , completing the cycle of the flooding media within the engine 10 . the stream of working fluid is routed by the separator 26 to the regenerator 14 , where its relatively high elevated temperature is used to preheat the working fluid entering the regenerator 14 from the pump 12 . the working fluid then passes through the condenser 28 associated with an external heat sink 32 at a lower temperature ( t l ), with which additional heat is removed so that the working fluid is at the same state as when it entered the pump 12 , where it completes its cycle within the engine 10 . from the above , it should be appreciated that the thermodynamic cycle followed by the working fluid stream of the heat engine 10 is a rankine cycle . it should also be appreciated that , as a turbine , the expansion device 24 is adapted to recover work and that other types of expansion devices could be used for this purpose . some of the work recovered with the expansion device 24 can be used to drive either or both of the pumps 12 and 18 . fig2 represents a particular but nonlimiting embodiment of the invention . as such , various modifications to the heat engine 10 are possible . for example , the regenerator 14 could be eliminated such that the pump 12 delivers the working fluid directly to the evaporator 16 and heat source 30 , and the outlet of the separator 26 delivers the working fluid directly to the condenser 28 and heat sink 32 . other or additional modifications include eliminating the mixer 22 and instead directly injecting both the working fluid and flooding media injected into the expander 24 . furthermore , the liquid mixture containing the working fluid and flooding media could be passed through the regenerator 14 prior to being separated by the separator 26 . it is also possible that a mixture of the flooding media and working fluid could flow through the entire cycle , eliminating the need for the mixer 22 and separator 26 , as well as the pump 18 and heater 20 in the flooding media loop ( though at a loss in cycle efficiency ). other aspects and advantages of this invention will be further appreciated from a paper authored by woodland et al . and entitled “ performance benefits for organic rankine cycles with flooded expansion and internal regeneration ,” international refrigeration and air conditioning conference at purdue , 2462 ( jul . 12 - 15 , 2010 ). the contents of this paper are incorporated herein by reference . while the invention has been described in terms of a particular embodiment , it is apparent that other forms could be adopted by one skilled in the art . therefore , the scope of the invention is to be limited only by the following claims . | 5 |
referring to fig1 there is shown a bias control circuit according to the present invention for selectively providing forward bias current and reverse bias voltage to switching diode 46 for respectively enabling and disabling rf signals therethrough . in the present example , diode 46 is a pin diode , whose switching characteristics are well known and which have been briefly described in an earlier paragraph . pin diode 46 will pass rf signals with virtually no resistance between rf input terminal 44 and rf output terminal 48 when a forward dc bias current flows through diode 46 , that is , from its anode 46a to its cathode 46c . furthermore , pin diode 46 will exhibit a very high resistance , effectively blocking rf signal transmission between terminals 44 and 48 , when the dc voltage level at anode 46a is sufficiently negative with respect to the voltage level at cathode 46c . the reverse bias voltage across diode 46 must be roughly equivalent to the peak rf voltage excursion for effective blockage . the dc path through pin diode 46 includes current - limiting resistor 50 , inductors 52 and 54 and diode 46 . for the parameter values to be used in the present example , resistor 50 may have a value of 20 ohms . inductor 54 is coupled at one end to ground potential , thereby providing a sink for the forward dc bias current through diode 46 and a reference potential for the reverse dc bias voltage . inductors 52 and 54 effectively block the rf signals from the dc path while passing the dc signals with virtually no impedance . the rf path between terminals 44 and 48 includes pin diode 46 and blocking capacitors 56 and 58 . capacitor 56 effectively blocks the dc signals from the rf circuits ( not shown ) coupled at terminal 44 , and capacitor 58 effectively blocks the dc signals from the rf circuits ( not shown ) coupled at terminal 48 , while both capacitors 56 and 58 pass the rf signals with virtually no impedance . the control circuitry of the fig1 embodiment includes switch control 10 , inverter 12 and gate 14 , and is responsive to a diode alarm signal generated by phototransistor 32b and resistor 38 in the status circuitry . inverter 12 and gate 14 may typically be chosen from the 7400 series of ttl digital logic elements , and switch control 10 may be a process controller , such as a microprocessor , which generates a ttl - compatible signal on lead 11 . in the present example , switch control 10 generates a logic low signal , typically 0 volts , to produce forward biasing of pin diode 46 so as to conduct rf signals , and generates a logic high signal , typically + 5 volts , to produce reverse biasing of pin diode 46 so as to block rf signals . the status circuitry of the fig1 embodiment includes resistors 26 and 38 and part of optical couplers 22 and 32 . optical couplers 22 and 32 may be of a type similar to type 4n33 , sold by motorola semiconductor products , inc ., phoenix , ariz . when current flows through light - emitting diode ( led ) 22a , it emits light which is optically coupled to photosensitive transistor 22b , which saturates in the presence of the detected light . this has the effect of applying a voltage of nearly + v l , typically + 5 volts , across resistor 26 , producing the equivalent of a logic high level at status terminal 24 . when no current flows through led 22a , phototransistor 22b is fully off , and terminal 24 sees a virtual ground , which is the equivalent of a logic low level . in the present example , resistor 26 is typically 1 kilohm to be compatible with ttl logic . when current flows through led 32a , it emits light which is optically coupled to phototransistor 32b , which saturates in the presence of the detected light . this has the effect of dropping the full voltage + v l applied at terminal 36 , typically + 5 volts , across resistor 38 , resulting in a virtual ground at status terminal 34 , producing the equivalent of a logic low level . when no current flows through led 32a , phototransistor 32b is fully off , and terminal 34 sees essentially the entire + v l , which is the equivalent of a logic high level . in the present example , resistor 38 is typically 1 kilohm . a first bias circuit provides forward dc bias current to pin diode 46 , and includes optical coupler 16 , transistor 20 and optical coupler 22 . optical coupler 16 , which may be of a type similar to optical couplers 22 and 32 , includes led 16a optically coupled to phototransistor 16b , such that when light is emitted from led 16a , phototransistor 16b saturates and its collector is pulled down close to the ground potential at its emitter . in the present example , transistor 20 is a high - voltage , pnp bipolar device , which may be of a type similar to type mj4647 , sold by motorola semiconductor products , inc ., operated between full - off and full - on , and capable of switching at least 150 milliamps across its emitter - collector junction . the collector - emitter junction of transistor 20 must be capable of withstanding a potential in excess of the large negative voltage applied at power input terminal 42 which , in the present example , is typically - 400 volts . a first voltage source ( not shown ) couples a small positive potential + v l , typically + 5 volts , to power input terminal 18 . with the potential at the cathode of led 16a at zero volts , current passes through led 16a causing it emit light onto phototransistor 16b which saturates , and transistor 20 is driven into full conduction , enabling current flow through optical coupler 22 to node 28 , from which it flows through pin diode 46 . a second bias circuit provides reverse dc bias voltage to pin diode 46 , and includes optical thyristor 30 , optical coupler 32 and resistor 40 . optical thyristor 30 includes led 30a optically coupled to photosensitive thyristor 30b , such that when light is emitted by led 30a , photothyristor 30b provides electrical conductivity . resistor 40 functions as a current limiter for the short - circuit failure mode of pin diode 46 , and may typically have a resistance value of 100 kilohms . element 30b has been described thus far as a thyristor , which is a generic term for the family of controllable bistable semiconductor switching devices having self - latching capability in the presence of current flow therethrough . another such device is a silicon controlled rectifier . in the actual implementation of the invention , however , device 30 may preferably be an optical triac , of a type similar to type moc3021 , sold by , for example , motorola semiconductor products , inc ., as it is the only such currently - available semiconductor switching device with self - latching capability in an optical configuration capable of withstanding the high potential required to reverse bias pin diode 46 . a second voltage source ( not shown ) couples a large negative potential - v h , typically - 400 volts , to power input terminal 42 . with the potential at the anode of led 30a at some positive level , illustratively + 5 volts , current passes through led 30a , causing it to emit light which is coupled to photothyristor 30b , thereby enabling an electrical path between node 28 and power input terminal 42 . thus , the large negative voltage coupled at power input terminal 42 may be selectively applied across pin diode 46 as a reverse bias . with an effectively open circuit from ground to node 28 through diode 46 , there is virtually no current passing through led 32a and photothyristor 30b . the only current flowing through these devices is the diode leakage current , which is of the order of 10 nanoamps . this is not a sufficient amount of current to cause light emission from led 32a . thus , phototransistor 32b does not turn on , and a high level logic signal is coupled back to one input terminal of and gate 14 in the control circuitry for enabling selection of the first bias circuit . the leakage current flow through photothyristor 30b is also insufficient to latch that device when led 30a is extinguished . therefore , repetitive forward and reverse biasing of pin diode 46 can be achieved . if , however , pin diode 46 should fail in the short circuit mode , significantly greater current ( approximately four milliamps ) would flow through photothyristor 30b , latching that device on until the current flow is interrupted by disablement of the power applied to terminal 42 or replacement of the faulty pin diode 46 . summarizing the responses of the first and second bias circuits to the output signals from switch control 10 , and their effects on pin diode 46 and the status circuitry , it is seen that when the signal on lead 11 is a logic low , dc current is enabled from terminal 18 , through node 28 and pin diode 46 to ground . in this circumstance , the logic level at status terminal 24 is high , and thus the diode open - n signal is false . should diode 46 fail in an open circuit mode , there would be no current flow through the first bias circuit and the logc level at terminal 24 would be a low , and thus the diode open - n signal would be true . when the signal on lead 11 is a logic high , a dc electrical path is completed between terminal 42 and pin diode 46 and , because diode 46 appears as a virtual open circuit to the polarity of the voltage applied at terminal 42 , virtually no current flows through the second circuit . in this circumstance , the logic level at status terminal 34 is high , and thus the diode short - n signal is false . should diode 46 fail in a short circuit mode , there would be substantial current flow through the second bias circuit , which current flow would be latched by photothyristor 30b , the logic level at terminal 34 would be a low , and thus the diode short - n signal would be true . it will be recalled that when a short circuit failure of pin diode 46 is detected , the logic low alarm status signal appearing at terminal 34 is also coupled back into the control circuitry at gate 14 to inhibit subsequent selection of forward dc current flow through diode 46 via the first bias circuit . it will be noticed that the elements in the bias paths , between terminals 18 and 42 , are all electrically isolated from the elements of the control and status circuitry . in particular , optical coupler 16 provides electrical isolation between led 16a in the control circuitry and phototransistor 16b in the first bias circuit . optical coupler 22 provides electrical isolation between led 22a in the first bias circuit and phototransistor 22b in the status circuitry . optical thyristor 30 provides electrical isolation between led 30a in the control circuitry and photothyristor 30b in the second bias circuit . finally , optical coupler 32 provides electrical isolation between led 32a in the second bias circuit and phototransistor 32b in the status circuitry . it will further be noticed that the rf switch of the present invention depicted in fig1 provides very fast switching times , as none of the elements in the switching paths injects any significant delay . the logic elements of the control circuitry operate at nanosecond rates . in the first bias circuit , transistor 20 can switch between full - off and full - on within a few microseconds . the limiting factor to the switching speed of the rf switch lies in the second bias circuit , which charges diode 46 to - 400 volts . however , unlike conventional bias circuitry , in which the stray capacitances of the circuit elements charge slowly through relatively high resistance , the path between photothyristor 30b and diode 46 is of very low resistance , typically 20 ohms , as noted earlier . thus , switching times of 50 microseconds may be achieved by the rf switch of the present invention . referring now to fig2 there is shown a cascade arrangement of optical triacs 60a , 60b , . . ., 60i , referred to collectively as optical triacs 60 , which may be used in place of the single optical thyristor 30 of the fig1 embodiment , for extremely high voltage rf applications . if each single optical triac 60 is capable of withstanding a reverse bias voltage in excess of 400 volts , then by cascading , for example , twenty - five optical triacs 60 , in the manner shown in fig2 an off bias voltage in excess of 10 , 000 volts can be maintained across pin diode 46 when it is required to switch extremely high voltage rf signals between input terminal 44 and output terminal 48 . it should be recognized , however , that transistor 20 must also withstand the reverse voltage applied at terminal 42 , and that a higher - voltage transistor or an alternative arrangement of first bias circuit current driver , not disclosed herein , would be necessitated . while the principles of the present invention have been demonstrated with particular regard to the illustrated structure of the figures , it will be recognized that various departures from such illustrative structure may be undertaken in the practice of the invention . the scope of this invention is therefore not intended to be limited to the structure disclosed herein but should instead be gauged by the breadth of the claims which follow . | 7 |
in the drawings , reference numeral 120 ( fig1 ) indicates a universal joint connecting rod in a first embodiment of the invention . the universal joint connecting rod 120 includes a universal joint upper link 121 which is pierced by an upper pin hole 121a so as to be pivotally coupled to the piston 1 in a cylinder head 10 by a piston pin 9 , and a lower pin hole 121b of the universal joint upper link 121 and an upper pin hole 122a of a spider 122 are pivotally coupled by a universal joint upper pin 123 . further , a lower pin hole 122b of the spider 122 is united with an upper pin hole 124a of a universal joint lower link 124 by a universal joint lower pin 125 . and then the universal joint lower link 124 and the connecting rod cap 6 of the universal joint connecting rod 120 are pivotally fitted around a crank pin 7 of the crank shaft 2 and are clamped together by a connecting rod cap bolt 5 . accordingly , the relative position error between the piston 1 and the crank shaft 2 is compensated . now , a second embodiment of the present invention will be described in detail with reference to fig4 and 5 . reference numeral 220 designates a ball joint connecting rod . the piston 1 in cylinder 11 includes upper and lower receptacles 221 and 221a , and the ball joint connecting rod 220 includes a ball body 224 which is movable in a groove or socket 223 of the receptacles 221 and 221a , and which is fixed on a spider 225 with a fixed bolt 222a . a lower hole 225a of the spider 225 is united with an upper pin hole 226a of a lower link 226 by a lower pin 227 . the lower link 226 and the connecting rod cap 6 are pivotally fitted around the crank pin 7 of the crank shaft 2 , and a connecting rod cap bolt 5 fixedly clamps them together . accordingly , the relative position error between the piston 1 and the crank shaft 2 is compensated . a third embodiment of the present invention will be described in detail with reference to fig6 to 12 . reference numeral 301 designates a piston , and the piston 301 has a crown part 302 , a skirt part 303 and a riveting disk 304 which is united with the crown part 302 and the skirt part 303 . two or three grooves 305 are formed on the outer circumference of the upper end on the crown part 302 of the piston 301 and a piston ring 306 is inserted in each groove 305 . on the bottom , a pin hole 308 pierces each of two downwardly projecting arms 307 which together define a clevis , and through the upper end of crown part 302 are vertical rivet holes 309 . in addition , a plurality of flexible tension blades 310 are formed longitudinally on the outer circumference of the skirt part 303 , and along the leading end of each tension blade 310 a contactor -- ridge 311 is formed . on the inner circumference of the piston a groove 313 is formed so as to receive a stop ring 312 . the riveting disk 304 is centrally pierced by a square hole 314 . riveting holes 315 , corresponding to respective riveting holes 309 , extend through the crown part 302 near the outer circumference , and the parts 302 and 304 are united with rivets 316 . next , a fourth embodiment of the present invention will be described in detail with reference to fig1 to 17 . the piston 301 of the fourth embodiment includes a crown part 302 , a skirt part 303 and a riveting disk 304 which is used to unite the crown part 302 with the skirt part 303 , and the crown part 302 and the riveting disk 304 have same structures and same reference numerals as in the fourth embodiment , so the description for them is omitted . a plurality of blade fit grooves 331 are formed longitudinally in the outer circumference of the skirt part 303 , and two grooves 333 are formed to be circumferentially fitted with blade holder rings 332 on the outer circumferences of the upper and lower ends . a contactor blade 334 to be fitted in the blade fit groove 331 of the skirt part 303 is formed with a shape of substantially a &# 34 ; dish &# 34 ;. more specifically , each contactor blade 334 is made from a piece of bent sheet metal having a slightly curved web 334a and two generally parallel legs 334b and 334c which project outwardly from opposite sides of the web . each leg has at each end at tab 334d , which projects outwardly beyond an edge 334e of the web . the outer edge of each leg 334b and 334c is received in a respective blade fit groove 331 , so that each blade fit groove 331 receives the edges of two legs on respective adjacent contactor blades 334 . the tabs 334d at opposite ends of the blades 334 each project under a respective one of the blade holder rings 332 , and the blade holder rings 332 thus hold all of the contactor blades 334 in place on the piston . next , a fifth embodiment of the present invention will be described in detail with reference to fig1 to 21 . the piston 301 of the fourth embodiment includes a crown part 302 , the skirt part 303 and the riveting disk 304 which unites the crown part 302 with the skirt part 303 , and has same structures and same reference numerals as the third embodiment , so the description for them is omitted . a number of blade fit grooves 331a are closely and longitudinally formed on the outer circumference of the skirt part 303 , and ring two circumferential grooves 333a are formed near the upper and lower ends of the skirt so as to be circumferentially fitted with the blade fit rings 332a . each blade fit groove 331a of the skirt portion 303 is fitted with a contactor - spring 340 of wire . referring to fig2 , each contactor spring 340 is a piece of wire bent to have end portions 340a and 340b and a center portion 340c which are disposed in a respective blade fit groove 331a , and to have between the center portion 340c and each end portion 340a an engaging portion 340d or 340e which projects outwardly away from the piston . the end portions 340a and 340b are each disposed beneath a respective one of the blade fit rings 332a , in order to hold the contactor spring 340 on the piston . next , a sixth embodiment of the present invention will be described in detail with reference to fig2 to 27 . the piston 301 of the sixth embodiment includes the crown part 302 , the skirt part 303 and a roll mount disk 350 which is used to unite the crown part 302 with the skirt part 303 , and the same structures as in the second embodiment have the same reference numerals , so the description for them is omitted . the skirt part 303 includes four roll train brackets 363 each pierced by two pin holes 362 to support contactor -- rollers 360 rotatably on roll pivot pins 361 , and a substantially &# 34 ; c &# 34 ; shaped fitting portion 364 is formed in each roll train bracket 363 . the roll mount disk 350 is insertedly and fixedly disposed in the &# 34 ; c &# 34 ; shaped fitting portions 364 of the roll train brackets 363 , and has in the middle a hole 351 . four rivet holes 352 pierce the disk 350 in alignment with the rivet holes 309 of the crown part 302 . reference numeral 370 denotes a rivet having a center portion and having at each end an end projection 371 of smaller diameter , four of which are used to fix the crown part 302 to the roll mount disk 350 ( fig2 ) at regular intervals . more specifically , with reference to fig2 , the four rivets 370 fixedly secure the roll mount disk 350 to the crown 302 , so that the disk 350 is spaced below the crown 302 . four of the roll train brackets 363 are supported on the disk at equally angularly spaced intervals , each roll train bracket 363 having the &# 34 ; c &# 34 ; shaped fitting portion 364 gripping around an edge portion of the disk 350 . each roll train bracket 363 has above and below the disk 350 a portion bent to form a clevis , the clevis having pin holes 362 in each arm and having a horizontal roll pivot pin 361 extending between and disposed in the pin holes 362 , a roller 360 being rotatably supported on each pivot pin 361 . the upper and lower portions of each roll train bracket 363 have a small degree of flexibility , so that each clevis and the roller 360 supported by it can move approximately radially with respect to the piston 301 . the arms 307 projecting downwardly from the crown 302 extend through the hole 351 in the disk 350 . next , a seventh embodiment of the present invention will be described in detail with reference to fig2 . reference numeral 401 denotes a piston . the piston 401 comprises a crown part 402 , and a skirt part 403 which is integrally and fixedly threaded to the crown part . thread parts 404 and 404a are formed on the outer circumference and the inner circumference of the lower end on the crown part 402 of the piston 401 . upper and lower receptacles 406 and 406a are fitted in a gap 405 within the inner circumference of the piston , and a thread part 404b is formed on the outer circumference of the lower receptacle 406a to be cooperatively threaded with the thread part 404a . a spider 225 has at one end a ball body 224 received movably within a groove or socket 223 between the upper and lower receptacles 406 and 406a . the skirt part 403 is formed as in the skirt parts of the third , fourth and sixth embodiments . however , a thread part 404c on the inner circumference is formed to be threadedly engaged with the thread part 404 formed on the outer circumference on the lower end of the crown part 402 . operation of the foregoing structures according to the present invention are described in detail below . referring to fig1 - 3 , the upper pin hole 121a in the universal joint upper link 121 of the universal joint connecting rod 120 axially receives the piston pin 9 in the piston . 1 reciprocating within the cylinder 11 of the cylinder head 10 , and the lower pin hole 121b of the universal joint upper link 121 and the upper pin hole 122a of the spider 122 axially receive the universal joint upper pin 123 , and the lower pin hole 122b of the spider 122 and the upper pin hole 124a of the universal joint lower link 124 axially receive the universal joint lower pin 125 . the universal joint lower link 124 and the connecting rod cap 6 are pivotally fitted around the crank pin 7 of the crank shaft 2 , and are fixedly clamped together with the connecting rod cap bolt 5 . accordingly , the relative position error , which is not united with the relationships for the angle , the perpendicular and the horizontal between the piston 1 and the crank shaft 2 , is compensated automatically . as shown in fig3 the cylinder head 10 and the crank shaft 2 as basic structures of the engine are completely assembled . however , the relative gaps ( clearances ) of four pistons 1 are not constant and the angles are shown for states in which the perpendicular relationships are not identical . by use of the universal joint connecting rod 120 , all of the relative positions which erroneously take place in the internal combustion engine , such as abnormal gaps for the cylinder head 10 , an abnormal position for the crank pin 7 , torsion for the crank shaft 2 , torsion for the universal joint connecting rod 120 , abnormal angles for the crank pin 7 , or abnormal angles for the main bearing journal , are completely compensated automatically , and all the components are smoothly operated . therefore , the gap between the cylinder 11 and the piston 1 can be minimized , and the noises and vibration due to strikes between the cylinder wall and the piston 1 are minimized . although the pressure of the piston rings can be reduced enough by the minimum gap between the cylinder 11 and the piston 1 , fuel leakage and penetration into the combustion chamber of the engine oil can be minimized , and fuel losses due to the friction of the piston rings is reduced . in addition , not only does the minimum pressure of the piston rings produce minimum abrasion of the machines , but also wastes of the pollutions such as exhaust gases can be minimized . further , as to the procedures for machining the inner diameter of the cylinder 11 in the cylinder head 10 , which should be aligned very precisely for the central gaps of the four ( or a plurality of ) cylinders , problems are avoided . also , all charging costs are reduced in order to maintain the straightness and the true angles in the mutual positions for the central shaft of the cylinder 11 and the crank shaft 2 . the noises and wastes of fuel which normally take place due to the sliding gap or clearances are avoided between the connecting rod 120 and the piston 1 on the piston pin 9 ( also in an extremely accessible case ). also , owing to the significant reduction in the necessity to maintain a precise gap or clearance and mutually true parallelism for each crank pin 7 and the main bearing journal , which affects the machining procedures for the crank shaft 2 when only the crank pin 7 and the main bearing journal on their diameters are precisely machined , passed products can be provided and the yield of product is able to increase . two main bearings on both ends of four or five main bearings are able to exchange with the needle roll bearing instead of the both sides -- aligning -- united method as in the existing way , and a maximum load of the crank shaft 2 is replaced with the rolling bearing which is not provided with the siding friction . accordingly , fuel saving , noise reduction and significant improvement for the life of the machine can be accomplished . moreover , when the cylinder head is mounted , by the tension change of the clamped bolt and modifications of the cylinder block according to the aging of the gasket , impact , noise , smoke , and fuel waste are removed by the modifications of the connecting rod . next , the second embodiment ( fig4 - 5 ) will be described in detail . the ball body 224 of the spider 225 for the ball joint connecting rod 220 is fixed with the fixed bolt 222a or a rivet , the piston 1 reciprocates within the cylinder 11 of the cylinder head 10 , and the ball body 224 of the spider 225 swivels in the groove or socket 223 between the upper and lower receptacles 221 and 221a . after ball body 224 is inserted in the groove , the upper and lower receptacles 221 and 221a are secured with the fixing bolt 222 . the lower pin hole 225a of the spider 225 is then aligned with the upper pin hole 226a of lower link 226 , and then the lower pin 227 is axially inserted . thereafter , the lower link 226 and the connecting rod cap 6 are pivotally arranged around the crank pin 7 of the crank shaft 2 and are then clamped with the connecting rod cap bolt 5 . accordingly , the relative position error , which is not suitable for the relationships between the angles , perpendicular and horizontal , is automatically compensated . fig5 shows the complete assembly of the cylinder head 10 and the crank shaft 2 as a basic structure of the internal combustion engine . however , four pistons 1 are not constant in the relative gaps or clearances for them , and the state which is not suitable for the relationships between the angle , perpendicular and horizontal , is shown . by use of the ball joint connecting rod 220 , all of the relative positions which erroneously take place within the internal combustion engine , such as an abnormal gap of the cylinder head 10 , abnormal position of the crank pin 7 , torsion of the crank shaft 2 , torsion of the ball joint connecting rod 220 , abnormal angle of the crank pin 7 , or abnormal angle of the main bearing journal , are completely compensated automatically , and at the same time all components are smoothly operated . therefore , the gap or the clearance between the inner diameter of the cylinder 11 and the outer diameter of the piston 1 can be minimized , and noises and vibrations due to striking between the piston 1 and the cylinder wall are minimized . although the pressure of the piston rings is sufficiently reduced by minimization of the gap between the cylinder 11 and the piston 1 , fuel leakage and penetration into the combustion chamber of the engine oil can be minimized , and fuel losses due to the friction of the piston rings can be reduced . by the minimization of pressure on the piston rings , not only the abrasion of the parts is minimized , but also wastes of the pollutions are minimized . further , on the procedures by which the inner diameter of the cylinder 11 is machined in the cylinder head 10 , the problems associated with precisely positioning the central gaps of the four ( or a plurality of ) cylinders 11 are removed . also , all charging costs are reduced in order to maintain the straightness and the true angles for the mutual position between the crank shaft 2 and the central shaft of the cylinder 11 . in addition , the noises and wastes of fuels which take place due to sliding friction are completely removed , because the allowable gap or clearance is removed between the connecting rod 220 and piston 1 on the piston pin 9 ( also in an extremely accessible case ). owing to a significant reduction of the necessity to maintain a precise gap or clearance and mutual true parallelism for each crank pin 7 and the main bearing journal , which should be maintained in the machining procedures for the crank shaft 2 when only a diameter of the crank shaft 7 and only a diameter of main bearing journal are precisely machined , passed products can be provided and the yield of the products is able to increase . two main bearings on both ends of four or five main bearings are able to exchange with the needle -- roll -- bearing instead of the both sides -- aligning -- united method as in the existing way , and a maximum load of the crank shaft 2 is replaced with the rolling bearing which is not provided with the sliding friction . accordingly , fuel savings , noise reduction and significant improvement for the life of the machines can be accomplished . moreover , when the cylinder head is mounted , by the tension change of the clamped bolt and modifications of the cylinder block according to the aging of the gasket , impact , noise , smoke and fuel wastes are avoided by the modifications of the connecting rod . further , according to the present invention , also in use of the universal joint connecting rod or the ball joint connecting rod , it is natural that change from the rotation motion into straight line motion in the crank shaft or change from the straight line motion into the rotation motion in the piston is within the same range . next , the third embodiment ( fig6 - 12 ) will be described in detail . the clevis defined by arms 307 , which is disposed within the skirt part 302 in the piston 301 , is mounted on the crown part 302 provided on the upper portion in two sections to be divided from the piston 301 . accordingly , when the retractable devices are disposed on the skirt part 302 as the lower portion , the clevis is preferably provided with no obstacle . in addition , on the upper end portion of the crown part 302 , two or three grooves 305 are formed , if necessary , and piston rings 306 which are suitable for these grooves 305 are disposed in the grooves . the clevis defined by arms 307 is integrally molded with the crown part 302 . however , the clevis is pierced by the piston pin hole 308 to receive the piston pin ( not shown ) coupled with the universal joint type connecting rod ( not shown ). further , when the crown part 302 is connected with the skirt part 303 , the size and number of rivet holes 309 is preferably determined according to the practical design and the size of the piston 301 . in addition , the skirt part 303 is preferably molded by extrusion with a metal which is as light as aluminum , is easy to machine , and is high in resistance against abrasion . the inner circumference of the skirt part 303 is formed without any emboss and a thin and broad tension blade 310 is longitudinally formed on the outer circumference . one side edge of the tension blade 310 is integrally formed with the skirt part 303 and is not moved . a contactor ridge 311 on other side edge is formed free , and when the contactor ridge 311 is pressed , it moves toward the body of the skirt part 303 . accordingly , all outer diameters of the skirt part 303 are retractable to be smaller than the free outer diameter . when the piston 301 is assembled with the cylinder ( not shown ), by use of the proper tools , each tension blade 310 on the - skirt part 303 is urged inwardly and can be insertedly assembled into the cylinder , which has a smaller inner diameter than the free outer diameter of the piston . when the tension blades 310 are disposed in the cylinder so the skirt part 303 is smaller than its original free diameter , each contactor ridge 311 is resiliently pushed against the cylinder wall with the externally extending force urging it to reach the free outer diameter of the tension blade 310 . therefore , the force with which the contactor ridge 311 of the tension blade 310 on the skirt part 303 is pushed against the inner wall of the cylinder is enough to inhibit the tilt of the piston 301 , but should be weak enough not to produce an influence on minor inhibition in the reciprocating movement of the piston 301 . in order to meet the above two contrary requirements , when the bending moment curve of the tension blade 310 passes a certain point , the section of the tension blade should be designed to be increased at an acute angle . further , in principle , the inner wall of the skirt part 303 is formed to be smoothly extruded without forming any emboss . the groove 313 is machined all around the inner diameter , and the preparation for assembly is finished by fitting the stop ring 312 in the groove 313 . then , the riveting disk 304 is inserted within the inner circumference of the skirt part 303 , and is to touch the stop ring 312 . the bottom of the crown part 302 is attached to the stop ring 312 , and each hole 315 in disk 302 is mutually aligned with a respective rivet hole 309 . after aligning , the rivets 316 are inserted and the head part of each rivet 316 is upset . with such procedures , the assembling of the piston 1 is completed . next , the fourth and fifth embodiments ( fig1 - 17 and fig1 - 21 ) will be described in detail . the basic concept of the contactor blade 334 in the fourth embodiment and the contactor spring 340 in the fifth embodiment , and the tension structures on the skirt part 303 , are completely the same as the tension blade 310 to be molded by extrusion . however , in case the tension producing device has the tension blade 310 which is molded by extrusion , they have a solid type extruded metal . on the other hand , the contactor blade 334 on the fourth embodiment and the contactor spring 340 on the fifth embodiment are a floating type formed sheet metal and a floating type wire metal . accordingly , they are different points . only spacings of the blade fit grooves 331 and 331a which support the blades or springs for the tension producing are different on the contactor blade type skirt part 303 in fig1 and on the contactor spring type skirt part 303 in fig1 , and other parts have completely the same structures . the spacing between the blade fit grooves 331 to be fitted with the contactor blades 334 is broad , but the spacing between the blade fit grooves 331a to be fitted with the contactor springs 340 is closely formed . further , the contactor blades 334 or the contactor springs 340 are fitted in the blade fit grooves 331 and 331a on the skirt part 303 , and then the blade holding rings 332 and 332a are inserted in the ring grooves 333 and 333a formed on the outer circumference of the skirt part 303 . the contactor blades 334 or the contactor springs 340 are prevented from slipping out of the blade fit grooves 331 and 331a by rings 332 or 332a . the skirt part 303 is united with the crown part 302 , using the rivet 316 as in the third embodiment . accordingly , the assembly of the piston is completely accomplished . next , the sixth embodiment ( fig2 - 27 ) of the present invention will be described in detail . the skirt part 303 of the piston 301 is an aggregate of the contactor rollers 360 , and the aggregate surface on the outer diameter surfaces of the contactor rollers 360 is to form the surface corresponding to the inner diameter of the cylinder . each contactor roller 360 is axially and rotatably disposed on one of the roll pivot pins 361 having ends in the pin holes 362 on the roll train bracket 363 . at this time , the outer diameter of the contactor roller 360 should be provided with the curved surface along the central shaft , and the radius of curvature is preferably the same as the radius of the cylinder inner diameter which contacts the contact roller 360 . further , the plural roll train brackets 363 are manufactured , and are assembled by inserting substantially &# 34 ; c &# 34 ; shaped fixation part 364 of each roll train bracket 363 radially onto the roll mount disk 350 . the outer diameter of the contactor rollers 360 is manufactured so that the aggregate surface defined by all rollers 360 is of larger outside diameter than the inner diameter of the cylinder to be assembled . next , when the skirt part 303 is inserted into the inner diameter of the cylinder , the contactor rollers 360 are preferably maintained by the proper force , with the cylinder holding the contact force . accordingly , the outer diameter parts of the contactor rollers 360 collectively form the outer diameter of the skirt part 303 , and the contactor rollers 360 are carried out to maintain the contact pressure between the cylinder inner diameter and the skirt part 303 . the contact is not a slip engagement , but is rolling engagement . further , after aligning each rivet hole 309 of the crown part 302 with a rivet hole 352 of the roll mount disk 350 , the rivets 370 provided with the end projections 371 are fitted into the rivet holes 309 and 352 so as to maintain constant gaps . and then , when the head part of each rivet 370 is upset , the assembly of the piston 301 is completely accomplished . finally , the seventh embodiment ( fig2 ) of the present invention is described in detail . the crown part 402 of the piston 401 has the same shape as in the third , fourth and fifth embodiments of the present invention . however , it is different to form the thread parts 404 and 404a on the outer circumference and the inner circumference of the lower end part of the crown part 402 . accordingly , into the space 405 of the crown part 402 is inserted the ball body 224 of the spider 225 of the ball joint connecting rod 220 , and after inserting the ball body 224 in the groove or socket 223 of the upper and lower receptacles 406 and 406a , the upper and lower receptacles are inserted . at this time , when the thread 404a disposed on the inner circumference of the space part 405 and the thread part 404b set on the outer circumference of the lower receptacle 406a are mutually engaged , the spider 225 of the ball joint type connecting rod 220 is pivotally fitted on the lower end part of the crown part 402 . then the skirt part 403 is screwed onto the outer circumference of the crown part 402 . the skirt part 403 is similar to the skirt part 303 in the third , fourth and fifth embodiments . however , on the inner circumference , the thread part 404c is formed , and engages the thread 404 of the crown part 402 . accordingly , the piston 401 is completely assembled . as described above , when the connecting rod , which is used in all the internal combustion engine and fluids compressor forming the piston and the crank shaft , includes the universal joint type connecting rod and the ball joint type connecting rod , although the relative position and straightness between the piston and crank shaft are deviated within a given range , the abnormal friction , noise and vibration never take place . accordingly , not only are pollutions such as noise , vibration and wasted gases dramatically reduced , but also the fuels are significantly saved and the life of the machines are doubly increased . with the final assembling using the rivet , welding or other method , the crown part is manufactured by the conventionally existing way and the skirt part is manufactured by the way of forming the solid type blade or a contactor blade or a metal contactor spring or an aggregate roller column on the outer circumference . accordingly , the outer diameter of the piston has expansion and tension , and when operated up and down within the cylinder the rocking motion is completely removed and , as a result of the removal , effects of strikes between the piston and the cylinder are avoided . although particular preferred embodiments of the invention has been disclosed in detail for illustrative purposes , it will be recognized that variations or modifications of the disclosed apparatus , including the rearrangement of parts , lie within the scope of the present invention . | 8 |
the different configurations of the inserts of the invention are generally indicated by the numeral 2 in the accompanying drawings . insert 2 allows a common traffic control device 4 ( such as an open - top traffic safety cone ) to be utilized for additional tasks . insert 2 is simple to use and allows the user to barricade a job site with caution tape to control traffic situations . insert 2 is used with a traffic cone 4 as shown in fig4 to allow cone 4 to be used with safety or caution tape 6 as shown in fig3 . optionally , a sign 8 as shown in fig2 and 3 may be used with insert 2 . insert 2 may be used in construction applications , public service applications , property management applications , and other such venues . inserts 2 may be packaged for sale in groups in stackable containers similar to egg cartons . the groups may include four or eight inserts . heavy users of inserts may purchase boxes or bags of inserts 2 . a sign holder 10 may be packaged with inserts 2 or sold separately . sign holder 10 may include a blank sign or a pre - printed sign . the egg carton - style container may include a compartment for sign holder 10 and sign 8 . a first configuration of insert 2 has a pair of heads 20 and 22 that are each connected to a body 24 with a neck 26 . flanges 28 are disposed between necks 26 and body 24 . the necks have different thicknesses so that insert 2 may be inserted into cones 4 having different upper openings . insert 2 may be configured to function with 18 and 24 inch cones 4 by providing the small neck with a diameter of 0 . 75 inches and the large neck with a diameter of 1 . 125 inches . the bottom surfaces ( flat ring - shaped surfaces disposed opposite flanges ) of heads 20 and 22 overhang or project outwardly from necks 26 so that each head 20 and 22 will snap fit into the top of cone 4 . heads 20 and 22 are tapered so that they may be forced through the opening in the top of cone 4 . in this configuration , each head is frusto - conical in shape . body 24 may have an outwardly curved configuration to define an upper portion and a lower portion . flanges 28 extend beyond the upper and lower portions to define ledges that may be used to stop tape 6 from slipping off body 24 . the upper and lower portions of body 24 may be used to hold two pieces of tape at different levels without the two pieces overlapping . the shape of body 24 also allows the hand is easily grasp insert 2 in a comfortable and secure manner . each head 20 and 22 defines an elongated opening 30 configured to receive the mount 32 of sign holder 10 . openings 30 may be round or non - round in cross section . the non - round cross section functions with a complementary mount 32 so that sign holder 10 does not rotate . sign holder 10 includes a cradle 40 having spaced portions that frictionally receive sign 8 . sign 8 may be slid in between the spaced portions of cradle 40 . a second configuration of insert 2 is depicted in fig5 - 10 . second configuration of insert 2 has a pair of heads 20 and 22 that are each connected to a body 24 with a neck 26 . the longitudinal direction of insert 2 extends between the centers of heads 20 and 22 . in the exemplary configuration , body 24 includes first and second ends that are in the shape of flanges 28 that project outwardly from body 24 and necks 26 . necks 26 have different widths so that insert 2 may be inserted into different cones 4 . each neck 26 has a smaller width than the end of body 24 to define a shelf such that the end of body 24 , the shelf , rests on the top of cone 4 when insert 2 is in use . in this configuration , flanges 28 cooperate with necks 26 to define the shelves . the bottom surface ( flat ring - shaped surface disposed opposite flange ) of each head 20 and 22 overhangs necks 26 so that each head 20 and 22 will snap fit into the top of cone 4 . heads 20 and 22 are tapered so that they may be forced through the opening in the top of cone 4 . in addition to allowing insert 2 to be used with different cones 4 , two heads 20 and 22 are provided so that one head will be disposed up above body 24 when insert 2 is in use . this head may be used as a handle for cone 4 , may be wrapped with a different section of caution tape 6 , may support a sign 8 , may support a light , or may simply increase the visibility of the assembly . the following exemplary dimensions have been found to be functional with eighteen and twenty - four inch cones 4 . in this configuration , heads 20 and 22 are frusto - conical with necks 26 and flanges 28 being disc - shaped . as such , the term “ diameter ” is used to describe the following configurations . in other configurations , heads 20 and 22 are provided in non - conical shapes with necks and flanges also being provided in other shapes . when other shapes are used , widths in the ranges of the following diameters may be used . also , when insert 2 is to be used with a larger cone 4 , the dimensions may be enlarged as needed . in this exemplary configuration , the large head 20 has a height of 1 . 625 to 1 . 875 inches with a large diameter of 1 . 375 to 1 . 625 inches at its inner end and a small diameter of 0 . 750 to 1 . 000 inches at its outer end . small head 22 has a height of 1 . 625 to 1 . 875 inches with a large diameter of 1 . 250 to 1 . 500 inches at its inner end and a small diameter of 0 . 625 to 0 . 875 inches at its outer end . necks 26 have a diameter of 0 . 125 to 0 . 375 inches less than the diameter of the inner ends heads 20 and 22 thus defining about a 0 . 125 inch bottom surface or shoulder between the outer ends heads 20 and 22 and neck 26 . these shoulders extend entirely about the heads . these shoulders are disposed inside cone 4 when insert 2 is in use to prevent insert 2 from being readily pulled out of the top of cone 4 . this should may be sufficient to allow cone 4 to be lifted by insert 2 thus allowing insert 2 to act as a handle for cone 4 . flanges 28 are about 0 . 188 inches thick and have a diameter of 1 . 250 to 1 . 750 inches . these flanges 28 sit on top of cone 4 to prevent insert 2 from falling down inside cone 4 during use . body 24 may have an outwardly curved configuration to define an upper portion and a lower portion as described above or may have a constant - area cross sectional shape such as a square , circle , or polygon . in the exemplary configuration depicted in the drawings , body 24 has a generally rectangular central portion 21 with rounded thin sides 23 that extend between flanges 28 . the sides of end portions 27 of body 24 are tapered from the round shape of flanges 28 to the generally rectangular shape of the central portion 21 . decreasing the cross section of the central portion 21 strengthens body 24 and allows the tapered end portions 27 of body 24 to overhang the slot 25 that receives caution tape 6 . these overhangs help to retain tape 6 that is wrapped at least partially around the exterior of central portion 21 . in addition , flanges 28 overhang end portions 27 to function as backup tape retention devices that stop tape 6 from completely slipping off body 24 when tape 6 is wrapped around the exterior of central portion 21 . central portion 21 of body 24 defines a t - shaped slot 25 that enters body 24 at a slot inlet defined through one of the thin rounded sides 23 of the generally rectangular central body portion 21 . slot 25 is used to receive one or more ( multiple tapes will fit in slot 25 ) sections of tape 6 and has an elongated main portion that has a height ( disposed in the longitudinal direction of insert 2 ) that is just slightly taller than tape 6 such that tape 6 may remain at its full visible width when supported by insert 2 ( see fig6 ). when the size of insert 2 is matched with tape 6 , then tape 6 does not have to be folded over or pinched or crumbled when disposed in slot 25 thus allowing the full width of tape 6 to be viewed while insert 2 is in use . in other configurations , slot 25 is at least l - shaped wherein one slot arm extends up from an entrance slot that extends out of body 24 . slot 25 also may be t - shaped with a pair of oppositely - extending slot arms extend from the inner end of an entrance slot . a pair of small tapes 6 may be used at the upper and lower ends of slot 25 . slot 25 extends through body 24 and may have a width of one - eighth of an inch . when configured for use with a three inch tape 6 , then slot 25 is about three inches tall with the overall height of insert being about 8 . 500 inches . each head 20 and 22 may define an elongated opening configured to receive the mount 32 of sign holder 10 . such openings may be round or non - round in cross section . the non - round cross section functions with a complementary mount 32 so that sign holder 10 does not rotate . sign holder 10 includes a cradle 40 having spaced portions that frictionally receive sign 8 . sign 8 may be slid in between the spaced portions of cradle 40 . insert 2 may be made from a material or coated with a material that reflects light , glows in the dark , or is brightly - colored . powered lights may be carried by insert 2 in a manner similar to the signs described above . also , lights may be disposed inside insert 2 so that inserts 2 glow or flash for increased visibility at night . fig1 - 14 depict inserts 2 used with lift tubes 50 and 52 . lift tube 50 is a fixed - length tube have an opening defined at one end and a head 62 disposed on its other end . the opening is configured to receive either of heads 20 or 22 of insert 2 while head 62 may match the configuration of head 20 or 22 . head 62 is snapped into the top of traffic cone 4 as depicted in fig1 to raise insert 2 higher from the ground and thus raise the level of tape 6 carried by insert 2 . tubes 50 and 52 may be fabricated from a rigid material or a softer material similar to cone 4 . lift tube 52 is an adjustable - length tube have an opening 60 defined at one end and a head 62 disposed on its other end . lift tube 52 includes a plurality of body tube sections that telescope with respect each other to allow the overall length of tube 52 to be adjusted . head 62 of each tube 50 and 52 includes a flange 64 similar to flanges 28 described above . flange 64 engages the top of cone 4 when insert 2 is in use . fig1 depicts a configuration wherein insert 2 includes magnets 70 disposed on the ends of heads 20 and 22 . magnets 70 allow insert 2 to be readily mounted to a metal surface . magnets 70 also allow a sign or a light to be removably mounted to insert 2 . such a sign or light includes a metal stand that is secured to insert 2 by the magnetic force provided by magnet 70 . magnets 70 may be secured to heads 20 and 22 with adhesive , may be snap fit in place , may be overmolded , or secured with fasteners . magnets 70 also may be mounted to the side of body of insert 2 . in the foregoing description , certain terms have been used for brevity , clearness , and understanding . no unnecessary limitations are to be implied therefrom beyond the requirement of the prior art because such terms are used for descriptive purposes and are intended to be broadly construed . moreover , the description and illustration of the invention is an example and the invention is not limited to the exact details shown or described . the dimensional ranges are provided as best embodiments of the insert known at this time . the inventors recognize that other dimensions and shapes may be used that fall with the scope of the claims . throughout the description and claims of this specification the words “ comprise ” and “ include ” as well as variations of those words , such as “ comprises ,” “ includes ,” “ comprising ,” and “ including ” are not intended to exclude additives , components , integers , or steps . | 4 |
fig1 shows a system 10 according to the present invention which has vibratory separator apparatus which , in this case includes a shale shaker sk which receives drilling fluid with solids therein pumped from a wellbore ( not shown ) by a pump system p in a stream a . the shale shaker sk has screen apparatus sa which includes multiple screens saa , sab and sac . as shown , the screens are generally at a similar level ; but , optionally , one or more screens may be at different levels , e . g ., as shown by the screen sm shown in dotted line . vibratory apparatus v vibrates a structure , housing , or basket bt in which the screens are mounted . material separated from the stream ma ( material that does not pass through the screens ) flows off the top of the screens in a stream c to a pit or container r . material flowing through the screens , including drilling fluid , flows down in a stream b to a receptacle or container u . a control system sc controls the operation of the shaker sk ( and it can be any suitable known shaker control system , including , but not limited to , known systems for automatic shaker operation ). the control system sc can also control the pump system p . a control system cs controls the system 10 as described in detail below . optionally , the control system cs also controls a conduit control system cc , described in detail below , and / or the control system sc . detectable material dm is fed in a stream 12 into the stream a . optionally , or instead of the stream 12 , detectable material is fed into the shaker sk in a stream 14 that mixes with the material in the stream a in the shaker before the material is fed onto the screens . optionally , or instead of the stream 12 , detectable material is fed in a stream 16 onto the screens . optionally , a separate stream is fed to each of a plurality of screens ; e . g ., as shown streams 16 a , 16 b , and 16 c are fed to screens saa , sab , and sac , respectively . optionally , such a feed stream is fed to screens at different levels in a separator or shaker ; and , optionally , a different feed stream can be fed to each screen at each level . a detector 18 detects detectable material in the stream b flowing down from the shaker sk . a detector 11 detects detectable material in the stream c flowing from the tops of the screens . optionally , or in addition to the detector 18 , a detector 17 in ( as shown ) or on the shaker sk detects detectable material in the fluid flowing down from the screens . in one aspect , the stream b flows down into the tank u and a detector 15 in the tank u detects detectable material therein . the detector 15 may be used instead of or in conjunction with the detector 18 and / or the detector 17 . in one aspect , the stream c flows down into the pit r and a detector 13 in the pit r detects detectable material therein . the detector 13 may be used instead of or in conjunction with the detector 11 . whether or not detectable material from a stream 12 ( or a stream 14 or a stream 16 ) is in the stream b , additional detectable material is , optionally , added to the stream b in a stream ad . this added detectable material can be the same as , or different from , the detectable material of the stream 12 . any “ detectable material ” herein may be one of or a combination of any of the detectable materials described herein . whether or not detectable material from a stream 12 ( or a stream 14 or a stream 16 ) is in the stream c , additional detectable material is , optionally , added to the stream c in a stream ac . this added detectable material can be the same as , or different from , the detectable material of the stream 12 . whether or not detectable material from a stream 12 ( or a stream 14 or a stream 16 ) is in the stream 19 that conveys material from the tank u , additional detectable material is , optionally , added to the stream 19 in a stream ab . this added detectable material can be the same as , or different from , the detectable material of the stream 12 . added detectable material , e . g ., in a stream ab , ac , or ad , can be any detectable material disclosed herein used for any purpose or function disclosed herein and / or killing material , e . g ., but not limited to a biocide or biocides , ( solids , liquid , solution ) may be added to any of the streams . killing material ( as solids , liquid , solution or a combination of these ), e . g ., but not limited to a biocide or biocides , may be added to any of the streams 12 , 14 , 16 , 16 a , 16 b , 16 c , a , b , c and 19 . a combination of detectable material according to the present invention may be the same form of detectable material or it may be different forms of the same detectale material ( e . g ., and not by way of limitation , materials of different colors which are the same base material ; materials of different size which are the same base material ); or the different detectable materials may be different materials ( e . g ., and not by way of limitation , different chemically ; material of a specific color with another material of a specific electrical conductivity ; light reflective material of multi - micron size and carbon nanotubes ; or pieces of plastic material combined with pieces of magnetically - attractive material ). it is within the scope of the present invention to treat a stream of the system 10 before or after a detector detects detectable material in the stream . for example , if detectable material ( and / or living things ) is detected in one of the streams b , c , or 19 , following such detection the stream is treated by a treatment apparatus ta , tb , or td , respectively , which can provide one or a combination of these functions : heat a stream ; kill living things in a stream , e . g ., with heat , electric current , microwaves , and / or killing material ; remove material from a stream ; add killing material to a stream ; remove magnetically attractive material from a stream ; remove magnetically attractive detectable material from a stream ; cool a stream ; apply light and / or laser beam to a stream ; apply radiation ( e . g ., infrared , microwave , or uv ) to a stream ; and / or mix materials in a stream , e . g . for homogeneity . the control system cs is in communication with the detectors 11 , 13 , 15 , 17 , and 18 ; with the control system sc ; with the conduit control system cc ; with the pump system p ; and with the vibratory apparatus v . via these connections , the control system cs can shut down the system 10 ( e . g ., in response to a signal from a detector that indicates screen damage , faulty screen mounting , or inadequate screen sealing ) e . g ., by stopping the pump system p or by activating the conduit control system cc to stop fluid flow to the system . the conduit control system cc controls all flow lines of the system 10 and includes appropriate and necessary piping , valves , connections , etc . for the various parts and streams of the system . optionally , upon shut down of flow to the shaker sk , the control system cs has the stream a diverted to additional equipment or apparatus , e . g ., to a tank or to a shaker apparatus sl ( as shown by the dotted line from the stream a to the shaker sl ). a treatment apparatus tc can treat the flow stream to the shaker sl . the control system cs can provide an alarm when any detector detects detectable material . optionally , such an alarm is provided by a detector itself . with or without shutting down the system and with or without diverting any flow , the control system cs can activate one or all of the treatment apparatuses to treat a stream with which it is associated . in certain particular embodiments , with a separator or shaker with multiple separating elements or screens , the control system cs can shut down flow to a particular screen or screens so that operation can continue , e . g ., when detection of detectable material indicates a damaged or worn screen , or poor screen mounting or sealing . optionally , the control system cs can determine , from signals from detectors , that , although the shaker is not operating optimally , it is operating within an acceptable range ; but a notification is provided that only a predicted amount of further acceptable operation is possible . a control system cs may be used with any separator or shaker system according to the present invention , including , but not limited to , the systems of fig1 - 4 . fig1 a illustrates a method according to the present invention for testing the efficiency of a separator 61 which separates solids x of a particular size from an input stream 62 that includes solids x . a thing or things 68 is added to the flow 62 . the thing ( s ) are of the same size ( e . g ., of the same largest dimension ) as the solids x so that , if the separator 61 is operating effectively , the thing ( s ) 68 is / are separated from the flow 62 and is / are discharged with the separated solids x in a stream 64 . however , if the separator 61 , for whatever reason , allows the thing ( s ) 68 to pass through and to be discharged in a stream 63 , this provides an indication that the separator is not working as desired ( the indication provided via monitoring electric current level and / or with ultraviolet light ). an apparatus s detects the presence of the things ( s ) 68 in the stream 63 . optionally the things 68 are detectable material . optionally killing material km is added to the stream 62 , the stream 63 , or both . the apparatus s can then communicate with a control system 66 ( on - site and / or remote ) with information about the output stream and , optionally , the control system 66 can activate an alarm 67 and / or can alert and / or inactivate a system 67 which controls the input stream 62 and can alter it or stop it . the separator 61 can be , e . g . and not by way of limitation , any known apparatus , filter , screen , centrifuge , cyclone , solids control apparatus , or hydrocyclone and can include any filter media , screening material , filter , mesh , etc . in one particular aspect , the apparatus s senses the level of electric current across the stream 63 when no thing ( s ) are present , providing and / or remembering this typical current level and then , following the introduction of the thing ( s ) 68 into the stream 62 , the apparatus s continues to monitor the current level . a change in the current level from the typical level ( the level before the introduction of the things 68 ) can indicate something wrong with the separator , the items an / or apparatus used to separate out solids of a particular size and / or wear or damage to such items or apparatuses . a treatment apparatus as any in fig1 may be used with any stream shown in fig1 a ( and also with any stream in any embodiment hereof and in any stream or streams of fig2 - 4 ). the thing or things used in the system of fig1 a may be any detectable material disclosed herein and the apparatus s may be any detector disclosed herein ( and this is true also for any stream of any embodiment hereof and any stream or streams of the systems of fig2 - 4 ). in certain aspects of the present invention , the thing or thing according to the present invention whose size is known and which is used in checking the efficiency and / or operation of an apparatus and / or monitoring and / or inspecting a filter , screen , etc . is a thing that fluoresces , glows or changes color , e . g ., in response to light , to a laser bean , or in response to ultraviolet radiation (“ ultraviolet light ”). any apparatus s in any of the drawing figures may contain a source ( e . g . a “ light ” or “ lamp ”), e . g ., of ultraviolet light , which is directed to a stream of material that includes things ( s ) that respond to light , in some cases providing a visual indication of the presence to the thing ( s ) and / or glowing , fluorescing , and / or changing color that can be sensed by a sensor in or associated with the apparatus ( e . g ., an apparatus s ). sensing of the material responding to the ultraviolet light can , e . g ., provide and indication that thing ( s ) according to the present invention have passed through a screen etc , providing an indication of wear , damage , and / or misalignment or poor sealing . in one particular aspect , the apparatus s of the system and method illustrated in fig1 optionally includes a source g of ultraviolet radiation and a sensor h for sensing a material &# 39 ; s response to the ultraviolet radiation . any apparatus s in any of the other methods disclosed herein according to the present invention can have such a source and such a sensor or such sources and such sensors . methods as described above are referred to as “ ultraviolet methods ” according to the present invention . in certain particular aspects in a method according to the present invention that uses radiation or light , e . g . but not limited to , ultraviolet light , as described herein , the “ thing ” or “ things ” that respond to the light are solids with material that “ lights up ” visually or “ fluoresces ” when subjected to light or ultraviolet light ; e . g ., but not limited to , phosphors , phosphorescent coating , fluorescent dyes , and other materials that convert ultraviolet radiation to visible light . in one particular aspect , an additive for drilling fluid or “ mud ” has added to it and / or coated onto it such ultraviolet - light - responsive material . in one particular aspect , a proppant has such material incorporated therein and / or added thereon and / or coated thereon . in one aspect a sensor h senses a level of fluorescence for a stream into which no thing or things according to the present invention have been added ( i . e ., no thing or thing that responds to ultraviolet light ). a typical level may be zero or there may be something already in the stream that does fluoresces to some degree . the apparatus s stores information ( and / or transmits it ) of this typical level ; and then , following the introduction of the thing ( s ) into the stream , the apparatus s continues to monitor the fluorescence level . a change in the level from the typical level ( before the introduction of the things ) can indicate something wrong with the separator , the items and / or apparatus used to separate out solids of a particular size and / or wear or damage to such items or apparatuses . fig2 illustrates a method 70 according to the present invention for testing the effectiveness of screens used in vibratory separators to screen out solids from an initial flow stream . an initial feed stream 73 is fed to a vibratory separator 71 that has a screen ( or screens ) 72 . the screen ( s ) 72 , when operating correctly and when undamaged , screen out solids z from the stream 73 . the solids z are of a known size ( largest dimension ) and the screen ( s ) is chosen with mesh that will screen out solids of this size . thing ( s ) 78 of the same largest dimension as the solids z is / are added to the stream 73 . if the screen ( s ) 72 are effective , the thing ( s ) 78 will be screened out and will flow with the solids z off the top of the screen ( s ) 72 to a discharge area . if the screen ( s ) 72 are not effective , ( e . g ., the screen material is torn or is of the incorrect mesh size or pattern , or if the screen is not correctly mounted to the vibratory separator or not sealingly mounted thereto ), then the thing ( s ) 78 will pass through or by the screen ( s ) 72 and flow away in a stream 75 ( four down pointing arrows below separator 71 ; things 78 that have passed through screen 72 shown in dotted lines ). an apparatus s detects the presence of the thing ( s ) 78 in the stream 75 . the apparatus s can then communicate with a control system 76 ( on - site and / or remote ) which in turn can activate an alarm 77 and / or can alert and / or inactivate a system 79 which controls the vibratory separator 71 and / or controls the input stream 73 and can alter it or stop it . as is true for the methods shown in fig3 and fig4 , the method shown in fig2 can also include the apparatus of fig1 a with the source ( s ) g and sensor ( s ) h and the method of fig2 ( as can be the methods of fig3 , 4 ) can be light methods , e . g ., but not limited to , “ ultraviolet methods ” according to the present invention . in one particular aspect the stream 73 is a stream of drilling fluid or mud that contains solids ( e . g ., and not by way of limitation debris , drilled cuttings , and / or drilled solids ) which are to be screened out of the fluid by known screen ( s ) often called “ shale shaker screens ” with a vibratory separator often called a “ shale shaker .” the screen ( s ) 72 may be any known shale shaker screen and the separator 71 may be any known shale shaker . using a plurality of apparatuses s ( and this is true for the system and methods of fig6 , 8 and 9 ) the location of a tear in a screen or the location of a poor sealing area for screen mounting can be indicated by the flow in that area containing thing ( s ) ( like the things 68 or 78 ) detected by an apparatus s whose location is known . the things 68 , 78 , 88 and 98 are to be understood , in certain aspects , to include the things described above that fluoresce in response to uv radiation . referring now to fig3 , in a method 80 according to the present invention , solids - laden fluid , drilling fluid , or drilling mud in an initial stream 82 is introduced into a pool 83 in an upflow separator 81 , and the stream 82 is forced up to a vibrating screen 85 that screens out pieces of solids y of a particular known size ( i . e ., the fluid flows up to and through the screen 85 , but the solids y do not flow through the screen 85 ). fluid free of the solids y flow via conduit ( s ), pipe work or channels 84 to containers , e . g ., reservoirs or tanks , for subsequent re - use . the cleaned fluid ( e . g ., but not limited to , drilling mud ) may either exit the separator 81 from the sides or bottom thereof . the solids y fall under gravity to a lower surface 81 s , from which they are conveyed , e . g . by pumping or via a moving belt . the solids y may be wet with fluid and may be sent in a stream 83 s to another system sm , e . g ., a screw press , centrifugal device or shaker to further recover fluid , e . g . drilling fluid or mud . thing ( s ) 88 of the same largest dimension as the solids y is / are added to the stream 82 . if the screen 85 is effective , the thing ( s ) 88 will be screened out and will flow with the solids y from the screen 85 . if the screen 85 is not effective , ( e . g ., the screen material is torn or is of the incorrect mesh size or pattern , or if the screen is not correctly mounted to the vibratory separator or not sealingly mounted thereto ), then the thing ( s ) 88 will pass through or by the screen 85 and flow away in the stream 84 ( things 88 shown in dotted line in stream 84 ). apparatuses s detect the presence of the thing ( s ) 88 in the stream 84 . the apparatus s can then communicate with a control system 86 ( on - site and / or remote ) which in turn can activate an alarm 86 s and / or can alert and / or inactivate a system 89 which controls the separator 81 and / or controls the input stream 82 and can alter it or stop it . fig4 illustrates a method 90 according to the present invention in which an initial stream 91 flows into a container c . the stream 91 contains material r , e . g . material including liquid l and solids s . optionally , the stream 91 is pumped with a pump pm . the material r flows up to a screen apparatus a which is mounted in a basket or box x . part p of the material , e . g . liquid or liquid plus some solids which are of such a size that they pass through the screen apparatus a and flow up through the screen apparatus a . the part p is removed from the system by removal apparatus v ( e . g . vacuum or pump apparatus ). the screen apparatus a is sized to screen out solids of the size of solids z and part of the material r , e . g . solids s and agglomerations or masses of solids . the solids z either settle down in the container c without contacting the screen apparatus a or , upon being prevented from further upward flow by the screen apparatus a and / or by material already adjacent the screen apparatus a , fall downwardly in the container c . it is within the scope of the present invention for the screen apparatus a to be any suitable known screen or screen assembly used for vibratory separators or shale shakers . in one particular aspect the material r is drilling fluid or mud with drilling fluid and drilled solids . thing ( s ) 98 of the same largest dimension as the solids z is / are added to the stream 91 . if the screen apparatus a is effective , the thing ( s ) 98 will not flow therethrough and will flow with the solids z away from the screen apparatus a . if the screen apparatus a is not effective , ( e . g ., the screen material is torn or is of the incorrect mesh size or pattern , or if the screen is not correctly mounted or not sealingly mounted thereto ), then the thing ( s ) 98 will pass through or by the screen apparatus a and flow away with the part p ( things 98 shown in dotted lines ). apparatuses s detect the presence of the thing ( s ) 98 in the part p . the apparatuses s can then communicate with a control system 96 ( on - site and / or remote ) which in turn can activate an alarm 96 s and / or can alert and / or inactivate a system 99 which controls the overall system and each component and / or controls the input stream 91 and can alter it or stop it . sequential detection of detectable thing ( s ) can indicate that a flow path within a separator or shaker is clear . cessation of detection at any particular point can indicate a blockage at that point . fluid flow rate through a separator or shaker can also be determined using the thing ( s ) and the apparatuses s . the apparatuses s are in communication with a control system ( not shown ) like any disclosed herein . also , the method can disclose the location of an amount of fluid within a separator or shaker at any given time ; its temperature ; the flow rate and / or pressure at its location ; and the ph . using any suitable uv source , any ultraviolet system and / or method according to the present invention may be used to sterilize fluid , a stream , and / or drilling fluid . fig5 illustrates a method 770 according to the present invention for testing the effectiveness of screens used in vibratory separators to screen out solids from an initial flow stream . an initial feed stream 773 is fed to a vibratory separator 771 that has a screen ( or screens ) 772 . the screen ( s ) 772 , when operating correctly and when undamaged , screen out solids z from the stream 773 . the solids z are of a known size ( largest dimension ) and the screen ( s ) is chosen with mesh that will screen out solids of this size . mcnano device ( s ) 778 of the same largest dimension as the solids z is / are added to the stream 773 . if the screen ( s ) 772 are effective , the mcnano device ( s ) 778 will be screened out and will flow with the solids z off the top of the screen ( s ) 772 to a discharge area . if the screen ( s ) 772 are not effective , ( e . g ., the screen material is torn or is of the incorrect mesh size or pattern , or if the screen is not correctly mounted to the vibratory separator or not sealingly mounted thereto ), then the mcnano device ( s ) 778 will pass through or by the screen ( s ) 772 and flow away in a stream 775 ( four down pointing arrows below separator 771 ; mcnano devices 778 that have passed through screen 772 shown in dotted lines ). an apparatus s detects the presence of the device ( s ) 778 in the stream 775 . the apparatus s can then communicate with a control system 776 ( on - site and / or remote ) which in turn can activate an alarm 777 and / or can alert and / or inactivate a system 779 which controls the vibratory separator 771 and / or controls the input stream 773 and can alter it or stop it . in one particular aspect the stream 773 is a stream of drilling fluid or mud that contains solids ( e . g ., and not by way of limitation debris , drilled cuttings , and / or drilled solids ) which are to be screened out of the fluid by known screen ( s ) often called “ shale shaker screens ” with a vibratory separator often called a “ shale shaker .” the screen ( s ) 772 may be any known shale shaker screen and the separator 771 may be any known shale shaker . using a plurality of apparatuses s the location of a tear in a screen or the location of a poor sealing area for screen mounting can be indicated by the flow in that area containing mcnano device ( s ) detected by an apparatus s whose location is known . referring now to fig6 , in a method 880 according to the present invention , solids - laden fluid , drilling fluid , or drilling mud in an initial stream 882 is introduced into a pool 883 in a separator 881 , and the stream 882 is forced up to a vibrating screen 885 that screens out pieces of solids y of a particular known size ( i . e ., the fluid flows up to and through the screen 885 , but the solids y do not flow through the screen 885 ). fluid free of the solids y flow via conduit ( s ), pipe work or channels 884 to containers , e . g ., reservoirs or tanks , for subsequent re - use . the cleaned fluid ( e . g ., but not limited to , drilling mud ) may either exit the separator 881 from the sides or bottom thereof . the solids y fall under gravity to a lower surface 881 s , from which they are conveyed , e . g . by pumping or via a moving belt . the solids y may be wet with fluid and may be sent in a stream 83 s to another system sm , e . g ., a screw press , centrifugal device or shaker to further recover fluid , e . g . drilling fluid or mud . mcnano device ( s ) 888 of the same largest dimension as the solids y is / are added to the stream 882 . if the screen 85 is effective , the mcnano device ( s ) 888 will be screened out and will flow with the solids y from the screen 885 . if the screen 885 is not effective , ( e . g ., the screen material is torn or is of the incorrect mesh size or pattern , or if the screen is not correctly mounted to the vibratory separator or not sealingly mounted thereto ), then the mcnano device ( s ) 888 will pass through or by the screen 885 and flow away in the stream 884 ( mcnano device shown in dotted line in stream 884 ). apparatuses s detect the presence of the device ( s ) 888 in the stream 884 . the apparatus s can then communicate with a control system 886 ( on - site and / or remote ) which in turn can activate an alarm 886 s and / or can alert and / or inactivate a system 889 which controls the separator 881 and / or controls the input stream 882 and can alter it or stop it . fig7 illustrates a method 990 according to the present invention for a separator in which an initial stream 991 flows into a container c . the stream 991 contains material r , e . g . material including liquid l and solids sd . optionally , the stream 991 is pumped with a pump pm . the material r flows to a screen apparatus a which is mounted in a basket or box x . part p of the material , e . g . liquid or liquid plus some solids which are of such a size that they pass through the screen apparatus a and flow up through the screen apparatus a . the part p is removed from the system by removal apparatus v ( e . g . vacuum or pump apparatus ). the screen apparatus a is , sized to screen out solids of the size of solids sd and part of the material r , e . g . solids sd and agglomerations or masses of solids . the solids sd either settle down in the container c without contacting the screen apparatus a or , upon being prevented from further upward flow by the screen apparatus a and / or by material already adjacent the screen apparatus a , fall downwardly in the container c . it is within the scope of the present invention for the screen apparatus a to be any suitable known screen or screen assembly used for vibratory separators or shale shakers . in one particular aspect the material r is drilling fluid or mud with drilling fluid and drilled solids . optionally , the screen apparatus a is vibrated . mcnano device ( s ) 998 of the same largest dimension as the solids s is / are added to the stream 991 . if the screen apparatus a is effective , the mcnano device ( s ) 998 will not flow therethrough and will flow with the solids s away from the screen apparatus a . if the screen apparatus a is not effective , ( e . g ., the screen material is torn or is of the incorrect mesh size or pattern , or if the screen is not correctly mounted or not sealingly mounted thereto ), then the mcnano device ( s ) 98 will pass through or by the screen apparatus a and flow away with the part p ( mcnano devices shown in dotted lines ). apparatuses s detect the presence of the device ( s ) 998 in the part p . the apparatuses s can then communicate with a control system 996 ( on - site and / or remote ) which in turn can activate an alarm 996 s and / or can alert and / or inactivate a system 999 which controls the overall system and each component and / or controls the input stream 991 and can alter it or stop it . “ mcnano devices ” or “ mcnanos ” as mentioned above , e . g ., with respect to the systems of fig5 - 7 , include the things described in the paragraphs that follow . the present invention , in certain aspects , discloses systems , equipment , and methods in which very small devices , including microdevices , nanodevices , nanorobots , micro - resonant devices (“ mrds ), nanotransmitters , and / or nano rfid devices ( nano rfids or nanotags )- all such very small devices are referred to herein collectively as mcnano devices or mcnanos . mcnano devices are used , according to the present invention , in a variety of operations and with a variety of equipment . in certain embodiments , at least one , one , or a plurality of such mcnano device are used in equipment , systems , and operations in the oil and gas industries , e . g . in rig operations , well formation , well completion , well production , fluid processing , solids control , and testing methods and with equipment used in these methods . in certain aspects , the mcnano device ( s ) are coated , sheathed , or layered with protective and / or strengthening material , e . g ., but not limited to plastic , metal , polytetrafluoroethylene , and / or ballistic material to cope with a wellbore environment ( e . g . but not limited to , environments of extreme temperature or environments of corrosive or caustic materials or fluids ) in which a mcnano device is used ( and this can be true for an mcnano device disclosed herein and any such device described below on any method according to the present invention ). certain mcnano devices used in equipment and methods according to the present invention are those disclosed in u . s . pub . no . 2009 / 0027280 and are small micro - resonant devices ( mrds ) that can receive an excitation signal and generate and transmit an emission signal , and can be tracked in an oil and gas industry method or environment , e . g ., devices that are on the order of about 5 to 100 microns in diameter or up to about 1000 microns or much smaller , down to about 5 nanometers . mcnano devices can include monolithic mrds that include an antenna component that receives an excitation signal and transmits an emission signal ; and a resonator component that receives an excitation signal and generates a corresponding emission signal ; and , optionally an outer coating that envelopes the device and isolates the device from its environment ; and which coating , in certain aspects according to the present invention , specifically protect a device from fluids and materials encountered in oil and gas operations , within equipment used in such operations , and within oil and gas wells . these devices can have an overall diameter of less than about 1000 microns , e . g ., 100 or 10 microns , and a q value of greater than about 5 , e . g ., greater than 10 , 50 , 100 , or much higher , and the emission signal can be ( i ) a resonant frequency of the device emitted at a delayed time compared to the excitation signal ( or at a time after the excitation signal has stopped ), ( ii ) a frequency different than the excitation signal ; ( iii ) a signal at a different polarization than the excitation signal , or ( iv ) a resonant frequency of the device which upon excitation by an excitation field ( e . g ., a magnetic field ), distorts the applied excitation field . in such mcnano devices , the antenna component and the resonator component can be the same component , i . e ., one component that functions as both an antenna and as a resonator . the devices can also be designed such that the resonant frequency is proportional to an applied magnetic field , e . g ., by fabricating the resonator of a magnetic metal or alloy to induce magnetic field dependence to the resonant frequency . in certain embodiments , the invention features mcnano devices which are mrds as in u . s . pub . no . 2009 / 0027280 in the form of cylindrical or prismatic length extender bars that include a transducer material , e . g ., a piezoelectric or magnetostrictive transducer material , and that have a length of less than about 100 microns and a diameter of less than about 100 microns ; and optionally an outer coating that envelopes the device and isolates the device from its environment in a well or in equipment used in oil and gas operations . in certain aspects , these mcnanos can resonate at a resonant frequency of greater than about 50 mhz after receiving an excitation signal at the reonant frequency . an outer layer for such mcnano devices can include a hydrophilic material encompassing the device or a hydrophobic material encompassing the device and / or a protective sheath , layer , or coating . in other embodiments , the mcnano devices are in the form of devices that include a hermetically - sealed housing having walls forming an internal chamber ; a cantilever arranged within the internal chamber and having a free end and a fixed end connected to a wall of the housing ; and an electrode arranged within the internal chamber in parallel and spaced from the cantilever ; wherein , in certain aspects , the overall size of the device is no larger than about 1000 microns , e . g ., no larger than 100 or 10 microns . in certain aspects , in a well , near a well , and / or in or near equipment used in well operations , mcnano devices are located and / or tracked ( e . g . by an “ apparatus s ) by generating an excitation signal randomly at any location at which they appear or in a target area in which the device might be located ; receiving an emission signal from the one or more mcnanos , if any , e . g ., in a target area ; and processing the emission signal to determine the location of the device ( s ). in various methods , the mcnano devices can have an overall diameter or largest dimension of about 10 microns or less . in embodiments in which the emission signal is a resonant frequency of the device , the device can further include a magnetic material to induce magnetic field dependence to the resonant frequency , and the methods can further include exposing the device or the device in a target area to a magnetic field . mcnano device ( s ) 98 of the same largest dimension as the solids s is / are added to the stream 91 . if the screen apparatus a is effective , the mcnano device ( s ) 98 will not flow therethrough and will flow with the solids s away from the screen apparatus a . if the screen apparatus a is not effective , ( e . g ., the screen material is torn or is of the incorrect mesh size or pattern , or if the screen is not correctly mounted or not sealingly mounted thereto ), then the mcnano device ( s ) 98 will pass through or by the screen apparatus a and flow away with the part p ( mcnano devices shown in dotted lines ). apparatuses s detect the presence of the device ( s ) 98 in the part p . the apparatuses s can then communicate with a control system 96 ( on - site and / or remote ) which in turn can activate an alarm 96 s and / or can alert and / or inactivate a system 99 which controls the overall system and each component and / or controls the input stream 91 and can alter it or stop it . mcnano devices may have an overall outer diameter or largest dimension of less than about 1000 microns , and can be much smaller , e . g ., less than 500 , 250 , 100 , 50 , 20 , 10 , 5 , or 1 micron , or even on the nanometer scale , e . g ., 500 , 250 , 200 , 100 , 50 , 25 , 10 , or 5 nanometers . mcnanos can be individual , standalone , monolithic devices , or can be made of a set of or a plurality of mcnanos , e . g . nano - resonant devices , that are each on the nanoscale , e . g ., in certain aspects , about 500 nanometers or less , e . g ., less than 250 , 100 , 50 , 25 , 10 , or 5 nanometers in size . the mcnano devices can either ( i ) individually produce a resonant signal , e . g . when detected , or when acting in concert in a particular target location , or a set of mcnano devices can produce a collective signal of sufficient power to be detected in the same way that a signal from one device is detected , or ( ii ) individually do not produce a signal , but assemble , e . g ., self - assemble , at a location or at a target location to form a mcnano device , e . g . micro - resonant device , to produce a detectable signal or collectively act to produce a detectable signal . once congregated or self - assembled at a location or at a target location , a set of mcnano devices can act like a single device . alternatively , the mcnano devices can each individually produce a detectable signal . the mcnano devices can be designed and fabricated so that their resonant frequency is sensitive to their surrounding temperature , chemistry , ph , thus making them useful as local sensors with detectable readout ( e . g . rf readout ). mcnano devices with metal or with metallic layers can be detected by conventional metal detection devices and apparatuses . the mcnano device ( s ) can be micron - sized devices that can generate and emit signals at resonant frequencies not present ( or at very low levels ) in a location , a target location , or in and oil and gas well environment . in certain aspects , these individual devices , e . g ., located in a target environment , can be located in three - dimensional space and tracked anywhere in the target environment using conventional methods and apparatuses . if an rf device is used , one or more can be used to locate the presence of the mcnano devices and can also determine the 3 - d location , e . g ., by using three separate rf devices . alternatively , one can use even a single antenna ( rf device ) if it is focused and rotated around the target . in certain aspects , mcnano devices are monolithic devices , i . e ., they are fabricated entirely on a single silicon chip or substrate . they can also be standalone devices , in that they can operate without the need for any connection to another circuit or device . their power requirements can be provided from an on - board power source or from detectors used to detect , track and image them . they can be detected individually , or e . g . when they are composed of a set of nano - scale mcnano devices , they can be detected when congregated at a location or at a target location within a target environment or area . in certain embodiments , mcnano devices can have a coating , sheath , or layer that insulates them from a fluid , a material , or an environment . the coating can be hermetically sealed to keep its interior free from fluids , e . g ., liquids and / or gases in an environment . certain mcnano devices convert mechanical motion into an electrical signal ( as in u . s . pub . no . 2009 / 0027280 ). a simple tracking device ( e . g . an “ apparatus s ”) for tracking mcnano devices can have a single send / receive antenna that is focused to a precise point in 3 - d space . to create an image of a large object , the antenna is scanned in three dimensions , e . g ., in a circular , up / down , and in / out , thus probing the entire 3 - d space occupied by the large object . another device has a ring of antennae , or multiple rings of different diameter , that are scanned in one direction , e . g ., up and down , to reconstruct a 3 - d location of a mcnano . another device includes a large , but finite , number of antennae that reconstruct the position of mcnano devices in 3 - d space without moving . mcnanos can also sense for ph , specific chemicals , etc . encountered in an oil and gas well . in one aspect of the invention , a mcnano device is a nano radio frequency identification ( rfid ) device that includes a radio frequency ( rf ) section configured to send an rf signal and at least one antenna operatively coupled to the rf section for emitting the rf signal , and the nano rfid device is configured to be less than about 150 nanometers in each of width , length and thickness . in another aspect , a method for using a mcnano device that is nano radio frequency identification ( rfid ) device , the nano rfid device includes a radio frequency ( rf ) section configured to emit an rf signal and at least one antenna operatively coupled to the rf section to emit the signal , wherein the nano rfid device is configured to be less than about 150 nanometers in each of width , length and thickness , the method including configuring identification data within the nano rfid device that identifies the rfid device and embedding the nano rfid device within an item or composition for tracking the item or composition . identification data can similarly be configured in other mcnanos . a mcnano device can be energized and / or interrogated with an rf signal . the method and device of the invention includes , in certain aspects , providing a nano radio frequency identification ( rfid ) device ( rfid tag ) of about 150 nanometers or smaller in dimension . in some embodiments , the rfid device may include semiconductors as small as is 90 nanometers , perhaps with some chips configured and provided at the 65 nanometer , 45 nanometer and / or 30 nanometer size level . the technology for included electrical circuitry in such a mcnano or in any other suitable mcnano may include cmos or related technology for low power consumption . a mcnano device for use in methods according to the present invention may include a nano rfid device with a radio frequency circuit ( rf ) that may be configured to respond to a received rf signal and to provide identifying information of the nano rfid device which may be associated with a composition , item , product , person , or similar object . optionally , and as is true for any mcnano device , in some applications , the nano rf circuit may provide identifying information of the device when not triggered by a received rf signal ; and identifying information may be electronically encoded alphanumeric data to uniquely identify the nano - rfid device . the rf circuit may also be configured with a memory , such as , but not limited to , eerom or eeprom , for example , to store other information that may be transmitted along with the identifying information . the nano rfid device may also include antennae that may receive an rf signal and also emit a response signal as generated by an rf circuit . the antennae may be at least one , or two , carbon nano tubes or other nano materials suitable for rf reception and emission such as transmitting an outbound backscatter signal . as is true of any mcnano device , a nano rfid device may have a protective layer , sheath , or coating such as a plastic coating , polytetrafluoroethylene coating , or other suitable composition that provides environmental protection for the nano - rfid device . the nano - rfid device may have a size of about 150 nanometers , or smaller , in all dimensions ( length , width and thickness ). a mcnano device that has an active nano rfid component may include an active nano rfid device and may include a radio frequency circuit ( rf ) that is configured to receive a rf signal and configured to emit data as initiated by the rf circuit or as initiated by a micro - circuit ( e . g ., a micro - processor , or the like ) that provides additional processing and control capability . the emitted data may include identifying information of the active nano rfid device , which may be associated with a composition , item , product , object , person , or similar object . the identifying information may be electronically encoded alphanumeric data to uniquely identify the nano - rfid device . the active nano device may also be configured with a memory , such as eerom or eeprom , for example , to store the identifying data , and / or other information that may be transmitted along with the identifying information . the mcnano device may include ( as is true for any mcnano device ) an active nano device and a nano power source such as a nano battery or a power generator , for example . the power source may be fabricated as a nano chemical - battery as is known in the art . the power source may be configured to provide power to an rf circuit of the device , a micro - circuit , and / or memory . the power source may provide sufficient power to cause a stronger response signal , hence greater transmission distances , as compared with a passive nano rfid . antennae may receive an rf signal and also emit a response signal as generated by the rf circuit that may be initiated by the micro - circuit . the antennae may be at least one , or two or more , carbon nano tubes or other nano materials suitable for rf reception and emission such as transmitting outbound backscatter signal . the rf circuit and the micro - circuit may be combined in some embodiments . in one method a mcnano device in a well operation is a nano - rfid which may be provided , and initialized or configured with identifying data unique to the particular device , and / or unique to an item , composition , person or object associated with the device . this may be ( as is true for any mcnano device ), for example , a serial number , a product code , a name , an encoded identifier , or the like . the device may be embedded in , connected to , or attached to , a composition or material , item , or product or introduced into a fluid or a flow stream . the composition etc . may be tracked and the resulting identification information received by a reception apparatus or system ( e . g . an apparatus s ) and processed according to an application or system using the device . in some applications , the identification information within a mcnano device ( including , but not limited to a nano rfid device ) may be duplicated among more than one device , so that more than one device may have the same identification information , or at least a subset of the same information . this capability may be useful in those applications where an associated item might have multiple devices . in such a case , the identification data may be the same identifying data in all the devices in an item or object . in certain embodiments , a mcnano device may contain temperature , pressure , mechanical ( e . g ., harmonic ) electrical , and / or chemical sensors . in one embodiment , the device may also contain a radio transmitter capable of transmitting continuous , interval , or on - demand signals . the transmitter may contain a power supply , such as a battery . both the transmitter and power supply may be incorporated on a body or on a single chip . the apparatus may contain remotely programmable subdevices or units capable of detecting and analyzing operations and fluid parameters , e . g ., but not limited to , temperature , ph , pressure , and electrical and chemical sensors according to time and location . an apparatuses s in any drawing figure herein may be any detector described herein and may be controlled by a control system as in any figure herein and also can include any known apparatus used to energize , interrogate , control , and / or identify a mcnano device . an apparatus s may also be an apparatus s as disclosed in u . s . application ser . no . 13 / 373 , 283 . optionally , and as is true for any piezoelectric apparatus or piezoelectric combination herein in any embodiment of the invention , the piezoelectric apparatus ( and / or such an apparatus with a conductor ) may be any suitable known piezoelectric generator , piezoelectric electric microgenerator , or any suitable known piezoelectric energy harvesting device or apparatus ; including , but not limited to , those disclosed in u . s . pat . nos . 6 , 655 , 035 ; 6 , 771 , 007 ; 7 , 687 , 977 ; 7 , 880 , 370 and in any of the references cited in these patents . optionally , the conductor provides electric power to an electrically powered item ( e . g ., but not limited to , device , machine , electronic device , circuit , chip , or apparatus ). optionally , an electric control apparatus controls and / or limits and / or adjusts and / or regulates the electric power provided by the piezoelectric apparatus to the conductor . it is within the scope of this invention for the apparatus to be any known control system , transformer , voltage regulator , computerized apparatus , chip or tag . optionally , an electric control apparatus controls and / or limits and / or adjusts and / or regulates the electric power provided by the piezoelectric apparatus through the conductor to an optional item . it is within the scope of the present invention for the item to be , by way of example and not by way of limitation : a heater ; light ; alarm ; transmitter ; sensor ; cooler ; fan ; and electromagnet . any system or method herein may include such an item and may include any control system or control apparatus disclosed or referred to herein for use therewith . any system or method disclosed herein may have : an item or items ; and / or an apparatus . optionally , a control system controls the apparatus wirelessly or via a line , with the apparatus including a device for interfacing with and communicating with the control system . it is within the scope of the present invention for the conductor to be , by way of example and not by way of limitation , any known electrically conductive material , including , but not limited to : wire ; adhesive , epoxy , plastic , thermoplastic material , thermosetting material , and glue with conductive material therein ; foil ; deposited metal ; electrically conductive metal ; and cable . in one aspect the electrically conductive material is electrically conductive nanomaterial . in certain particular aspects , the conductor is a line , grid , or pattern of adhesive , glue , plastic , thermoplastic material , thermosetting material , or epoxy with sufficient electrically conductive material or conductive nanomaterial therein that a current is conveyed through the conductor either for resistive heating or for powering an electrically powered device or apparatus , including , but not limited to , an electromagnetic apparatus . any system or method herein may include such a conductor . it is within the scope of the present invention for the body of a screen to be , by way of example and not by way of limitation , made of metal , plastic , composite , wood , ceramic , cermet , and fiberglass . in certain aspects , these materials are the nonconducting form of these materials . any system or method herein may include such a body . fig8 a shows a screen 20 which has a base 22 and a screening member 21 . the base 22 may be any known screen base or frame including , but not limited to , any base or frame for any known shale shaker screen . the screening member 21 may be any known screening member or screen , including , but not limited to , any screen , screen layer ( s ), or mesh for any known shale shaker screen , including , but not limited to , flat screening mesh or layer ( s ) and non - flat or “ 3 - d ” screening layer ( s ). the screening member 21 may be connected to the base in any known way or manner with any known connector or connective material or adhesive material and / or welding . arrows ar indicate the flow of material to the screen 20 . arrows as indicate material that does not pass through the screen member 21 . arrows aw indicate a component or components of the material that do pass through the screening member 21 . in one particular aspect ( and as may be the case for any screen herein ), the material is solids laden drilling fluid and the material that passes through the screening member 21 is drilling fluid with some or substantially all solids removed from it . a piezoelectric apparatus 24 in the base 22 provides electric power to a conductor 26 and , optionally , electric power is supplied to an item 28 ( like any electrically - powered item disclosed herein ; in one aspect an electromagnet device ). fig8 b shows a screen 20 b according to the present invention with a base 22 b to whose top 20 t a screen member 21 b is connected with adhesive material 20 m . the adhesive material 20 m has electrically conductive material ec therein to which electric current is applied by a piezoelectric apparatus 20 p . in one particular aspect , the material ec is electrically conductive nanomaterial . in one particular aspect , the material ec is carbon nanotubes . by this application of electric current , in one aspect , the screen member 21 b ( in whole or in part ) is resistively heated by the current from the apparatus 20 p flowing through the adhesive material 20 m . in one aspect , the screen member itself is made with electrically conductive material and it too is resistively heated by the current from the apparatus 20 p . optionally there are multiple piezoelectric apparatuses in or on a thing or in or on a base or frame of a screen according to the present invention . for example , the screen 20 b may have a second piezoelectric apparatus 20 r or three , four , five , or any desired plurality of such apparatuses . fig8 c illustrates a screen 20 c that has a base or frame 22 c on which is a screen member 20 v . on top of all or of a portion of the screen member 20 v is electrically conductive material 20 × to which electric current is applied from a piezoelectric apparatus 24 c . fig8 d shows a screen 20 d with a base 22 d and a screen member 21 d . a piezoelectric apparatus 24 d applies electric current to an electromagnet apparatus 24 e for attracting to the screen member 21 d magnetically attractive material in material fed to the screen 20 d so that such magnetically attractive material does not pass through the screen member 21 d and is held thereon or therein . it is within the scope of the present invention , as is true for any other embodiment herein , for there to be multiple piezoelectric apparatuses 24 d and / or multiple electromagnetic apparatuses 24 e . the electromagnetic apparatus or apparatuses may be located in or on a base or frame and / or in or on the screen member . fig9 a shows a screen 30 ( viewed from the bottom ) according to the present invention that has a frame 32 to which is connected a layer 378 ( or layers ) of screening material or mesh . the frame 32 has a plurality of crossmembers 33 . to heat substantially all of the layer ( s ) 38 , a plurality of piezoelectric apparatuses 34 are provided within the frame 32 and the crossmembers 33 . each of the apparatuses 34 is connected to an electrical conductor 36 which is resistively heated by the application of electric current from the apparatuses 34 . optionally , some or all of the apparatuses 34 provide electric current to an electromagnetic apparatus 37 so that magnetically attractive material in material being processed by the screen 30 is held to the frame and / or to the crossmembers . optionally , not all the frame and / or not all the crossmembers have an electromagnetic apparatus or electromagnetic apparatuses therein or thereon . in one particular aspect , only one side or one end of the frame 32 has an electromagnetic apparatus or apparatuses therein or thereon that is powered by a piezoelectric apparatus or apparatuses . optionally such a screen may have any desired number of crossmembers . optionally , one crossmember , the crossmembers , or any number of them as shown in fig9 a are deleted . fig9 b shows a screen 30 b according to the present invention which has a frame 32 b with a screen layer or layers 38 b thereon or connected thereto . an arrow ra indicates material that is fed onto the screen 30 b and which contains magnetically attractive material 30 m . electromagnetic apparatuses 30 p within the frame 32 b are powered by electric current from piezoelectric apparatuses 34 b that are within the frame 32 b . thus some , a portion , a large portion , or substantially all of the magnetically attractive material 30 m within the material 30 t fed to the screen 30 b is removed by being held to the frame 32 b before it can move onto and impact or injure the screen layers 38 b . fig1 shows a cross - section view of a screen 40 that has a base 42 to which is connected a layer 48 ( or layers ) of non - flat screening material or mesh . the material 48 has alternating tops 48 b and valleys 48 v with walls 48 t . the material 48 is over an opening or openings in the base 42 so that material fed to the screen is screened by the material 48 and certain component ( s ) of the material pass through the material 48 ( and through the base 42 ) and certain component ( s ) do not and flow off the top of the material 48 . as is true for any screen herein , the base 42 and / or the layer ( s ) 48 may be a base or layer ( s ) as used in any known flat , non - flat , or 3 - d screen or screen assembly ; including , but not limited to , any base or layer disclosed in u . s . pat . nos . 7 , 484 , 625 ; 7 , 264 , 125 ; 7 , 011 , 218 ; 5 , 720 , 881 ; 5 , 783 , 077 ; 5 , 958 , 236 ; 5 , 417 , 859 ; 5 , 417 , 793 ; 7 , 175 , 027 ; 6 , 769 , 550 ; 6 , 662 , 952 and those disclosed in the references cited in these patents . one or more piezoelectric apparatuses 44 may be used in or on the base 42 and / or in or on the material 48 to provide electric current : to a conductor or conductors for heating of the material 48 and thus of the material fed to and / or passing through the material 48 ; and / or to provide electric current to an electrically powered apparatus or apparatuses , which in one aspect , is an electromagnetic apparatus or apparatuses . in one aspect , piezoelectric apparatuses are provided within the base 42 and / or under tops of the material 48 . as is true for any piezoelectric apparatus disclosed herein , an apparatus 44 under material 48 may be encased in insulating material 49 as may be a conductor and / or electromagnetic apparatus which is not located within a frame or base . fig1 a and 11b show a shale shaker 50 according to the present invention which has a basket 51 with side walls 51 s and an end 51 b . the basket 51 supports screens 54 . material to be treated by the screens is fed from a feed tank 52 and an arrow 52 a indicates the direction of feed to the screens . vibratory apparatuses 53 vibrate the basket 51 which in turn results in vibrating of the screens 54 . optionally , vibrators 53 a ( fig5 b ) vibrate the screens 54 . in one particular aspect , the present invention provides improvements to the shaker and screens of u . s . pat . no . 7 , 578 , 394 , including and improvements herein and / or the improvements of fig1 a and 11b . piezoelectric combinations 56 b are in or on the end 51 b . piezoelectric combinations 56 a are on or mounted beneath the screens 54 . piezoelectric combinations 56 c are in or on the basket walls 51 s . any of these piezoelectric combinations may be used for heating or for magnetic removal of material for the feed material . any of these combinations may be used with a sensor that may be any known sensor used with a shaker or with a shaker screen . as is true for any embodiment herein , any generating apparatus , electrical current producer , or piezoelectric combination disclosed herein may be controlled by a control system ( wired or wirelessly ) like any control system disclosed or referred to herein . similarly any piezoelectric apparatus or systems in any embodiment of the present invention may be used to produce current to kill living things in material , either by the application of current to living things , by the heating of living things , or both . fig1 shows a shaker 70 according to the present invention which has a basket 71 vibrated by vibrating apparatus 77 . the basket 71 supports three screens 72 a , 72 b , 72 c for treating material 74 introduced onto the screen 72 c from a tank 70 t on a base 70 b . the shaker 70 and the screens have at least one or a plurality of piezoelectric combinations 76 . optional temperature sensors 73 a , 73 b , 73 c connected to the basket controllably and selectively sense the temperature of material 74 . the material 74 may be any material that is screened or is treated by a shaker , including , but not limited to , drilling fluid with solids therein . a sensor or sensors like the sensor 73 a may be used above , near , or in the material being treated at any location in the shaker , e . g ., in the material 74 . the sensor ( s ) are in communication with a control system 75 which may be any suitable control system or computer ( s ). the system 75 controls the sensor ( s ), receives and processes signals from the sensor ( s ), and controls the piezoelectric combination ( s ) 76 in or on the shaker and / or in or on a screen or screens used with the shaker . the control system 75 , among other things , turns the piezoelectric combinations 76 on and off ; e . g ., when a piezoelectric combination 76 includes a conductor which is resistively heated , in order to heat material 74 by heating the screen ( s ); and / or when a piezoelectric combination 76 includes selectively actuatable electromagnetic apparatus , in order to remove magnetically attractive material from the material 74 . a control system like the system 75 has the components , hardware , media , programming , devices , apparatus , circuits , chip ( s ), lines , connections , software , and / or electronics to accomplish the stated functions ( as is true for any control system for any embodiment herein ). such a control system and / or such piezoelectric combination ( s ) may be used with any embodiment herein , and , in certain aspects with any shaker and / or any screen herein . the control system 75 may also control the vibratory apparatus 77 and / or the angle of the basket 71 ; and , in one particular aspect , controls the vibratory apparatus 77 to control the vibration of the piezoelectric apparatuses in each combination to control their current output . fluid and / or solid material flowing through the screens flows down into a receptacle 70 r . separated material 78 and / or separated component ( s ) of the originally - introduced material flows off an exit end of the last screen 72 a . it is within the scope of the present invention to use one or a plurality of piezoelectric combinations or apparatuses at any location on or in a shaker and / or at any location on or in a screen ; and , in one aspect , to heat only a partial area of a screen , an initial material input end of a screen , or to heat substantially all of the screening area of a screen and / or screen frame . fig1 shows a piezoelectric device 80 according to the present invention which has a piezoelectric apparatus 84 optionally in material 87 . the combination 84 produces current , when vibrated , that flows via a conductor 82 to an electrically - powered item 86 . optionally , a control system 85 in communication with an apparatus 84 a , communicates with and / or controls the apparatus 84 . optionally , the system 85 may also control the item 86 ( wired , wr ; or wirelessly , ws ). communication between the apparatus 84 and the system 85 is wired ( wr ) or is done wirelessly ( wl ). optionally , the apparatus 84 may be used with a device 83 which may be any device for transmitting , controlling , changing , or switching the current from the apparatus 84 ( e . g ., but not limited to , a transformer , transmitter , switch , voltage regulator ). optionally , when the item 86 is an electromagnetic apparatus , the attraction of magnetically attractive material by the item 86 may be indicated by the closing of a circuit 88 when magnetically attractive material 89 is accumulated and the circuit is closed so that an electrical current flow occurs in the circuit 88 . this flow may be indicated by a device 81 , e . g ., an alarm , light , or indicator in the circuit and / or by a signal sent by the device 81 . in certain aspects , the item 86 is a cooler , heater , fan , switch , light , alarm , sensor , transmitter , electromagnet , or electronic tag or identifier . vibration of the apparatus 84 ( and of any piezoelectric system herein ) may be effected by a vibratory apparatus ( e . g ., one which is powered electrically , powered hydraulically , wind powered , solar powered ). in one aspect it is vibrated by the vibratory motor or motors of a shale shaker . vibration of the apparatus 84 ( and of any piezoelectric system herein ) may also be effected by a part that becomes unbalanced , including , but not limited to a part that becomes unbalanced or whose weight distribution changes , e . g ., due to wear or misalignment . it is within the scope of the present invention to position or mount a piezoelectric apparatus or apparatuses , or a piezoelectric combination or combinations on or within any part of a screen or screen assembly for a vibratory separator or shaker , including , but not limited to , in or on a part of a screen frame , in or on a frame end or side , or in or on a frame crossmember . it is within the scope of the present invention to position or mount a piezoelectric apparatus or apparatuses , or a piezoelectric combination or combinations on or within any part of a mounting structure or basket of a vibratory separator or shaker . any piezoelectric apparatus or combination in any embodiment herein may be wrapped in , painted with , covered with , surrounded by , and / or encased in protective material , insulating material , or both , partially or entirely . also , any piezoelectric device or apparatus alone which is associated with an electrical conductor may be insulated , with or without insulating the electrical conductor . the insulating material may be temperature insulating material or electrical insulating material , or both . for example , a piezoelectric combination used with a vibratory separator &# 39 ; s screen assembly is surrounded by insulating material ; e . g ., when a screen body or screen frame is made of electrically conductive metal , the insulating material may be electrically insulating material . for example , a piezoelectric combination in a frame crossmember may be encased in insulating material which may be temperature insulating material to insulate the piezoelectric combination from heat of material being treated and / or if the crossmember is electrically conductive metal , the insulating material may be electrically insulating material . in one aspect , a screen assembly according to the present invention has a lower support plate and one , two , three , four or more screening layers . optional side hookstrips on sides of the plate facilitate mounting of the screen assembly to certain separators and shakers to a deck or to a mounting structure . on or within the plate is one or are a plurality of piezoelectric devices , apparatuses , combinations . any entire side area or end area may have a plurality of spaced - apart piezoelectric devices etc . for either heating of that area , removal of magnetically attractive material at that area , or both . in certain particular aspects , the screen assembly is like those of u . s . pat . no . 4 , 575 , 421 or of u . s . pat . no . 7 , 571 , 817 ; but with one , at least one piezoelectric system ( piezoelectric device , piezoelectric apparatus , piezoelectric generator , piezoelectric combination , piezoelectric microgenerator , piezoelectric energy harvesting device or apparatus ) or a plurality of them according to the present invention it is within the scope of the present invention to insert into , apply , adhere , or connect a piezoelectric system , to a screen , to a shaker , or to a separator , using a mass , rigid or flexible , which has on it or contains within it the piezoelectric system or systems , with or without insulating material . for example , fig1 a shows a mass 90 of material within which is a piezoelectric system 96 a and / or within which is a piezoelectric system 96 b . in one aspect , the mass 90 is rigid . alternatively the system 96 a is on the mass 90 . in another aspect , the mass 90 is flexible . the mass 90 may be made of flexible material such as , but not limited to , flexible plastic , composite , metal , cloth , fabric , bandage material , elastic material , and tape . the mass 90 can be held in place by wrapping , with connectors , with pins , with hooks , with releasably cooperating fastener material , and with adhesive or glue . the mass 90 may be any suitable material , including , but not limited to , fiberglass , metal , plastic , composite , wood , ceramic , cermet , and polytetrafluoroethylene . any insulating material described herein may be used with such a mass with a piezoelectric system . fig1 b shows a mass 92 according to the present invention , made , e . g ., with the material described above for the mass 90 with or without insulation , with a piezoelectric system 98 a thereon and / or with a piezoelectric system 98 b therein . the mass 92 has a recess 97 sized , located , and configured for receipt therein of a part or portion of a thing for releasable emplacement of the mass 92 on the thing . optionally , such a mass , with or without a recess , is placed within a thing , a friction fit can hold the mass 92 in place and / or connectors , welding , fasteners , and / or adhesive may be used to secure the mass in place on a thing . any tag or energizable identification apparatus in u . s . pat . no . 7 , 484 , 625 may be replaced or used in combination with a piezoelectric system according to the present invention for any purpose or function disclosed herein or in said patent . fig1 c shows a mass 99 according to the present invention which has a body 99 b which is generally doughnut - shaped with a central hole 99 h . a piezoelectric system 99 s is within the body 99 b . such a mass 99 can be placed in or on another thing ; and / or the hole 99 h can receive part of a thing to facilitate application of the mass 99 to the thing and / or maintenance of the position of the mass 99 . parts of a vibratory separator or shale shaker may be mommitored using piezoelectric apparatuses as disclosed herein . fig1 a and 15b represent schematically , in cross - section , parts of a separator or shaker ; e . g ., a rotating shaft 100 rotating within a housing 102 with optional bearings 107 . the shaft 100 has piezoelectric system 104 therein ( or , optionally thereon ) and / or the housing 102 has piezoelectric system 106 therein ( or , optionally , thereon ). these piezoelectric systems may be used for any function or purpose disclosed herein ; including , but not limited to , for indicating vibration of the housing and / or shaft , indicating vibration of the shaft , or both ; wear or damage to the housing ; wear or damage to a bearing ; and / or for heating and / or cooling the housing and / or the shaft . any control system or control apparatus disclosed or referred to herein may be used with the shaft 100 , its piezoelectric systems , the housing 102 , and / or its piezoelectric systems . fig1 shows a screen 110 according to the present invention which has a body 112 with multiple apertures 113 . each aperture 113 has screening material 118 mounted therein or thereover . the screening material may be a single layer or multiple layers of screening material and / or mesh . within the body 112 is a grid 116 of electrically conductive material which is connected to piezoelectric generators 114 which provide electric current to the grid 116 . vibration of the body 112 results in electric current produced by the piezoelectric generators 114 being applied to the grid 116 , resistively heating the grid 116 and thus heating material on and / or passing through the screen 110 . any one or two of the generators 114 may be deleted or more than four such generators may be used . it is within the scope of the present invention for the body 112 to be a single integral layer ; for it to be any of the multi - layer structures disclosed in u . s . pat . no . 4 , 728 , 422 ; or any layer , base or frame or part thereof of any known vibratory separator screen or shale shaker screen . in one aspect , the body 112 is made of nonconducting material so that the grid 116 and the piezoelectric generators are encased within and insulated entirely by the body 112 . referring to an embodiment which employs one or more of the layers disclosed in u . s . pat . no . 4 , 728 , 422 , a grid like the grid 116 may be present in any layer , in any two layers , in any combination of layers , or in all layers . also , a single piezoelectric generator 114 may be used for any and all grids ; or multiple piezoelectric generators may be used in a single layer or in multiple layers . in one particular aspect , the grid 116 is made of electrically conductive ink , fluid , adhesive material ( e . g ., cement , glue , epoxy ) which has electrical conductive material therein . in one particualr aspect , the electrically conductvie material is elecrtrically conductive nanomaterial . in one particular aspect , the electrically conductive nanomaterial is carbon nanomaterial . in one particular embodiment , the electrically conductive nanomaterial is carbon nanotubes . in one aspect the screen 110 is a shale shaker screen and vibration of the shale shaker vibrates the screen 110 which in turn vibrates the piezoelectric generators 114 producing electric current . when this current flows to the grid 116 , it is heated and this heat heats the body 112 so that drilling fluid flowing to the screen 110 is heated . any of the associated items , materials , devices , apparatuses , controllers , and control systems disclosed or referred to herein for use with piezoelectric apparatuses and combinations may be used with the piezoelectric generators 114 , as well as any controller or control system for a shale shaker . it is also within the scope of the present invention to use any piezoelectric system or a plurality thereof . with an item such as a vibratory separator , shale shaker , basket , screen support , screen , screens , screen assembly , and / or screen assemblies to apply electric current to one or more of these items during the processing of fluid to kill living things in the fluid ; including , but not limited to , killing living things in drilling fluid . suitable materials are used for these items so that the applied electricity kills the living things but does not flow from the item , short circuit , or cause a shock , damage or fire . for example , a basket and / or other parts of a shaker are made of nonconducting material ; or a screen support is made of nonconducting material . also screens can be mounted with insulators ; and / or barriers and structures can be used which electrically isolate fluid into which a current is being applied . optionally , the body 112 is made of electrically conductive material and the grid 116 and the piezoelectric generators 114 are insulated within the body 112 so that there is no short circuit with the body 112 . the grid 116 may be applied by any suitable known method . in certain aspects , the grid 114 is applied by any suitable known glue application method including , but not limited to , spraying , pouring , and those disclosed in u . s . pat . no . 6 , 736 , 270 and in the references cited in this patent . in other embodiments , the grid 114 is injected into the body 112 . with a body 112 that includes hollow members ( e . g ., but not limited to , a screen frame or base with hollow ends , hollow sides , and / or hollow crossmembers ), the material for the grid 114 may be pumped into the hollow member , poured into them , or injected into them . fig1 shows a screen 120 according to the present invention which has a frame 122 with multiple apertures 123 . the apertures 123 have screening material 128 mounted over them . the screening material may be ( as is true for any embodiment of the present invention ) a single layer or multiple layers of screening material and / or mesh , flat or non - flat , with layers connected together or not . within the frame 122 is a pattern 126 of electrically conductive material which is connected to a piezoelectric generator 124 which provides electric current to the pattern 126 . vibration of the frame 122 ( e . g ., by a shale shaker or vibratory separator ) results in electric current produced by the piezoelectric generator 124 being applied to the pattern 126 , resistively heating the pattern 126 and thus heating material on and / or passing through the screen 120 . all of the options described above for the screen 110 are available for and may be used with the screen 120 . any screen base , support , or frame or layer disclosed herein ( or part thereof ) for any embodiment hereof which has one or at least one piezoelectric system apparatus , combination , generator , or energy harvester may be salvaged and re - used after screening material thereon is worn or damaged . in one particular aspect the frame 122 is like the frames disclosed in u . s . pat . no . 7 , 753 , 213 and is made with any of the materials disclosed in this patent . for any screen or screen assembly according to the present invention which has a piezoelectric device , apparatus , combination or generator , piezoelectric microgenerator , piezoelectric energy harvesting device or apparatus ( all collectively referred to as “ piezoelectric systems ”) or a plurality thereof , the level of the electrical current output from such system or systems due to vibration of the screen or screen assembly can be sensed and provided to appropriate analysis apparatuses and / or systems to indicate the level of vibration . this level of vibration can also then be used to indicate : whether or not a vibratory apparatus is operating properly ; whether or not there is wear or damage to a vibratory motor , shaft , gear , or associated parts ; whether or not there is wear of damage to screening material ; whether or not there is wear or damage to a screen support , base , or frame ; and / or whether or not a screen or screen assembly is properly mounted and secured in place . vibration levels for the following can be determined and stored in appropriate storage media , including but not limited to computer and digital storage media : normal vibratory motor operation and such operation using different motor parameters ; using a vibratory separator or shaker with undamaged shafts , parts , bearing , etc ; processing fluid or material using a screen or screen assembly with undamaged screening material ; using a screen or screen assembly with undamaged support , frame or base ; and / or using a screen or screen assembly that is properly mounted and sealed in place . with such baseline data , data obtained during actual operation over time and in real time can be compared to the normal baseline data and any difference can be studied , can be the basis for an alarm or warning , and / or can result in the shut down of the vibratory separator , parts inspection and / or replacement , and / or the changing of operating parameters of the vibratory separator — and these things can be done in real time . such comparisons can also be the basis for in factory testing of new screens , new parts , new vibratory separators and shale shakers , new motors , and the processing of a variety of materials and fluids . over time data can be obtained and maintained for each type of separator or shaker , motor , screen and screen assembly , each type of screening material , and each type of material ( e . g ., but not limited to drilling fluid ) that is processed . such a database can then be used in testing ; in design of new systems , motors , separators , shakers and screens ; and in monitoring actual operations . it is within the scope of the present invention to provide a shale shaker ( or vibratory separator ) in which living things in drilling fluid can be killed in one or in multiple locations in or adjacent the shale shaker . such a shale shaker may be used with or without screen ( s ) that also provide electric current to kill living things ; and with multiple screens in one shaker , the screens may all be at substantially the same level or the shaker may have one , two , three , four or more levels or tiers of screen ( s ). it is also within the scope of the present invention for a shaker ( or vibratory separator ) to have a tank , hopper , possum belly , or fluid introduction structure from which material to be treated ( e . g ., but not limited to , drilling fluid with solids therein and / or living things therein ) to be made of electrically insulating material and / or for such tank , etc . to have an interior liner or container that is made from electrically insulating material . it is within the scope of the present invention for s shaker ( or vibratory separator ) to have a basket or other screen support made from electrically insulating material and / or for such a basket or support to have a liner , interior basket , or interior container made of electrically insulating material . one object of such shakers and parts thereof is to provide a space in which or an area in which living things can be killed by electric current without a short circuit of the current and without current flowing from the shaker or from its screen ( s ). electric current can be supplied to a shaker ( or vibratory separator ) and / or to screen ( s ) in any way disclosed herein and also can be supplied by an independent electric current source in , on , or adjacent to the shaker ( or vibratory separator ), including , but not limited to , known electric current sources and also piezoelectric current sources . in certain aspects according to the present invention , a container , receptacle , tank or reservoir not in contact with the shaker ( or vibratory separator ) receives drilling fluid processed through the screen ( s ) of a shaker ( or vibratory separator ). the container etc . has a source or sources of electric current therein , thereon , or adjacent thereto ( any source of current disclosed herein ) to subject the living things to an electric current to kill the living things within the container , etc . in certain aspects , the source of electric current for a shale shaker ( or vibratory separator ), part thereof , a screen , or part thereof , is a piezoelectric system or systems . this system or these systems are vibrated by the vibratory apparatus or apparatuses of the shaker ( or separator ) producing electric current . the system or systems are designed , chosen , controlled , and / or configured so that sufficient electric current is produced to kill living things in the material processed by the shaker or separator . one killing zone , space or area can be provided , e . g ., but not limited to , only in the material introduction structure or only in a receptacle that receives processed material , e . g ., but not limited to , processed drilling fluid with living things therein . alternatively , multiple killing zones , spaces , or areas can be provided . fig1 a and 18b show a shale shaker 130 that has a base 132 , material introduction structure 134 , and an exit end 131 for separated material . material 139 with living things therein is fed to the structure 134 and from there onto screen assemblies 136 . in one particular aspect , this material is drilling fluid from a drilled wellbore that has solids therein and living things therein . the living things ( as is true for any embodiment herein ) may include , but are not limited to , microorganisms , bacteria , viruses , fungi , protests , microbes , aerobic living things , anaerobic living things , algae , and / or spores ( and such living things may be in any fluid treated by any method or system herein according to the present invention ; and they may be in any fluid treatable with any system or any method according to the present invention , including , but not limited to , drilling fluid , fracturing fluid , fuels , shipboard fuels , ballast liquid , ballast water , metal cutting fluids , milk , water , blood , liquid mediums , and / or plasma ). optionally , the material 139 is also processed with additional screen assemblies ( not shown ) which may be at different levels . the shaker 130 and the screens 136 are vibrated by vibration apparatuses 130 v . material that does not pass through the screen assemblies 136 moves off the screens at the exit end 131 ( e . g ., but not limited to , drilled solids , debris , and / or cuttings that are too large to pass through any of the screens ). this material may be sent to storage ( not shown ) or to additional processing equipment ape . material that passes through the screens ( e . g ., fluid with living things therein ) flows down to a receptacle 135 . from the receptacle the material is transmitted ( e . g . by gravity flow and / or by pumping ) to storage ( not shown ) or to further processing equipment fpe . as is true for any stream to or from any separator or shaker herein , killing materil kl may be added to the input to the shaker 130 and to either or both of its outputs . in one aspect , a piezoelectric system 138 i or a plurality of the systems 138 i are provided within or on the introduction structure 134 . when the shaker 130 is vibrated by the vibratory apparatuses 130 v , and the introduction structure is vibrated directly or indirectly the system ( s ) 138 i produce electric current that kills living things in the material in the structure 134 ( this includes material flowing through the structure 134 ). in one aspect , a piezoelectric system 138 s or a plurality of the systems 138 s are provided within , under and / or on the screens 136 a - 136 c . when the shaker 130 is vibrated by the vibratory apparatuses 130 v , the system ( s ) 138 s produce electric current that kills living things in the material on or in the screens ( this includes material flowing through the screens ). in one aspect , a piezoelectric system 138 e or a plurality of the systems 138 e are provided within or on the exit end 131 . when the shaker 130 is vibrated by the vibratory apparatuses 130 v , the system ( s ) 138 e produce electric current that kills living things in the material on the exit end 131 ( this includes material flowing on the exit end ). in one aspect , a piezoelectric system 138 r or a plurality of the systems 138 r are provided within or on the receptacle 135 . when the shaker 130 is vibrated by the vibratory apparatuses 130 v , the system ( s ) 138 r produce electric current that kills living things in the receptacle 135 ( this includes material flowing through the receptacle ). in one aspect , a piezoelectric system 138 w or a plurality of the systems 138 w are provided within or on walls of the base 132 ( which , in one aspect , may be walls of a basket mounted in or on the base ). when the shaker 130 is vibrated by the vibratory apparatuses 130 v , the system ( s ) 138 r produce electric current that kills living things in the receptacle 135 ( this includes material flowing through the receptacle ). in certain particular aspects , there is only one vibratory apparatus 130 v . in one aspect , as shown in fig1 c , in a shaker 130 a ( like the shaker 130 ) a receptacle 135 a ( like the receptacle 135 , fig1 a ) is not in contact with the base 132 and is vibrated by apparatus 139 v ; or , if there is contact , it is via structure 139 s made of material that does not conduct electricity . optionally , as shown in fig1 c , a base or basket of a shaker may have a liner or container 132 b therein that is made of material that does not conduct electricity and the liner or container 132 b may have a piezoelectric system 1381 or piezoelectric systems 1381 which produce electric current when vibrated to kill living things in the liner or container 132 b . as shown in fig1 d , the introduction structure 134 may have an internal container 134 t , liner or lining which contains material fed into the introduction structure . the container 134 t is made of material that does not conduct electricity and it may have one or more piezoelectric systems therein like any disclosed herein . it is within the scope of the present invention for the additional processing equipment ape and / or the further processing equipment fpe to include any structure or system herein for applying electric current to living things in such equipment . optionally , it is within the scope of the present invention to provide a source of electric current es , with appropriate connections , electrodes , wires , insulators , and / or insulating material to supply electric current to a shaker ( or vibratory separator ) and / or to screen ( s ) used therewith from a conventional current source es ( and this is true for any structure or system according to the present invention . a control system cn ( like any control system or apparatus disclosed or referred to herein ; including control apparatuses and / or devices for controlling piezoelectric systems and / or for controlling a shale shaker and any motor , motors , or drive system used with shakers ; which may be any suitable known control system for a shale shaker or vibratory separator ), or multiple control systems , controls each item and piece of equipment and system in fig1 a . fig1 a shows a system 140 according to the present invention for applying an electric current to material 146 within a vessel or container 142 that is vibrated by a vibratory apparatus 144 . within the vessel 142 are one or , as shown , a plurality of piezoelectric systems 148 which , when vibrated , produce electric current that flows to the material 146 . as is true for any such system herein that is used to apply an electric current to material being processed , any suitable wires , electrodes , conductor arrangement , connections , and / or circuits are part of the piezoelectric systems 148 so that the current produced by the systems flows through the material 146 . in one particular aspect , the material 146 is drilling fluid with living things therein and the applied electric current is sufficient to kill the living things . the systems 148 may be any suitable system herein according to the present invention . a control system co ( like any control system of apparatus disclosed or referred to herein ; including control apparatuses and / or devices for controlling piezoelectric systems and / or for controlling a shale shaker and any motor , motors , or drive system used with shakers ; which may be any suitable known control system for a shale shaker or vibratory separator ), or multiple control systems , controls each item and piece of equipment and system in fig1 a . fig1 b shows a system 140 a according to the present invention for applying an electric current to material 146 a within a vessel or container 142 a that is vibrated by a vibratory apparatus 144 a . within the vessel 142 a are one or , as shown , a plurality of piezoelectric systems 148 a which are floating in the material 146 a and which , when vibrated , produce electric current that flows to the material 146 a ; and / or within the vessel 142 a are one or , as shown , a plurality of piezoelectric systems 148 b which are in the material 146 a and sitting on , but not connected to , the bottom of the vessel 142 a and which , when vibrated , produce electric current that flows to the material 146 a as is true for any such system herein that is used to apply an electric current to material being processed , any suitable wires , electrodes , conductor arrangement , connections , and / or circuits are part of the piezoelectric systems 148 a and / or 148 b so that the current produced by the systems flows through the material 146 a . in one particular aspect , the material 146 a is drilling fluid with living things therein and the applied electric current is sufficient to kill the living things . a control system cn ( like any control system or apparatus disclosed or referred to herein ; including control apparatuses and / or devices for controlling piezoelectric systems and / or for controlling a shale shaker and any motor , motors , or drive system used with shakers ; which may be any suitable known control system for a shale shaker or vibratory separator ), or multiple control systems , controls each item , system and piece of equipment and system in fig1 b . the systems 148 a , as shown in fig1 c have a body 148 m within which is a piezoelectric system 148 s which may be any suitable system herein according to the present invention . the body 148 m is made of material of such a density that it floats in the material 146 a . the systems 148 b , as shown in fig1 d have a body 148 p within which is a piezoelectric system 148 t which may be any suitable system herein according to the present invention . the body 148 p is made of material of such a density that it will not float in the material 146 a . in certain particular aspects , the body 142 is the material introduction structure and / or the basket of a vibratory separator or shale shaker . in certain particular aspects , the body 142 is made of material that does not conduct electricity . in certain particular aspects , the body 142 a is the material introduction structure and / or the basket of a vibratory separator or shale shaker . in certain particular aspects , the body 142 a is made of material that does not conduct electricity . in the aspects described in this paragraph , the tops of the containers 142 and 142 a are optional and may be deleted if desired . fig2 illustrates a system 150 according to the present invention that applies a biocidal electric current to material 152 flowing over a conductive screening grid 154 of a screen 156 which has a frame 158 to which the screening material grid 154 is connected . electric current is applied to the grid 154 by an electric supply 151 . optionally , the frame 156 is made of material that does not conduct electricity . in certain aspects the material 152 itself conducts electricity between the connections of the supply 151 . in one particular aspect , the supply 151 applies a certain voltage across the connections to the screening material grid 154 and an optional voltage regulator system 153 operates in feed back with the circuit and the supply 151 so as to change the voltage as desired . the system 153 can include circuitry and a microprocessor 153 a to measure data from the circuit and to determine the conductivity of the material 152 ( and / or temperature ) and these measurements can be used by the system 153 , e . g ., to effectively change the voltage applied to the circuit . values of voltages can be stored in memory 153 b . in one particular aspect , the screen 156 is a screen for a shale shaker and the material 152 is drilling fluid . in one aspect , the drilling fluid has solids therein and the system 150 is used to heat the drilling fluid . in another aspect , the drilling fluid has living things in it and the system 150 is used to kill the living things . the supply 151 can be connected to or mounted on the shale shaker ; or it can be separate therefrom , adjacent thereto or remote therefrom , with appropriate connections . the piezoelectric systems of fig2 may be used with any control system or control apparatus referred to or described herein . in one aspect , the supply 151 is a piezoelectric system or systems . fig2 illustrates a system 160 according to the present invention that applies biocidal electric current to material 162 flowing over a conductive screening material grid 164 of a screen 166 which has a frame 168 to which the screening material grid 164 is connected . the screen 166 has a crossmember 167 . pairs of points on the screening material grid are connected to a piezoelectric system . material between each pair of points completes an electrical circuit and then current from a piezoelectric system flows between the two points through the material being processed . by way of illustration , pairs of points a - b , c - d , and e - f are each connected to a corresponding piezoelectric system 169 a in or on the crossmember 167 which supplies electric current that flows between the points of the corresponding pair when the material 162 completes the circuit . by way of illustration , each pair of points g - h and i - j are connected to a corresponding piezoelectric system 169 b which , when vibrated , produces electricity that flows between the points of the pair when the material 162 completes the circuit . any desired number of pair points may be used and any desired number of systems 169 a , 169 b and / or 169 c may be used . it is within the scope of the present invention to use a piezoelectric system or systems 169 c in the frame 168 . any piezoelectric system ( s ) in fig1 may be used with the supply and / or controls of fig1 and / or with any control system or apparatus disclosed or referred to herein . a control system cn ( like any control system or apparatus disclosed or referred to herein ; including control apparatuses and / or devices for controlling piezoelectric systems ) controls the piezoelectric systems in fig2 . fig2 shows a shale shaker 190 ( or vibratory separator ) with electrical apparatus for applying an electric current to material being processed by the shaker to kill living things in the material , e . g ., living things in drilling fluid . any structure or member to which or in which electric current is applied in made of material that does not conduct electricity , including , but not limited to , nonconducting plastics ; nonconducting fiberglass ; and known composite materials used for shakers , components thereof , and shaker screens which materials do not conduct electricity . any single point or area may be used for treating the material , e . g ., but not limited to , in a supply tank 191 ; on a screen 192 ( or screens if present ); within a main basket 193 ; within an optional secondary basket 194 ( e . g ., a “ scalping ” basket ); or in a receptacle 195 which receives material that passes through the screen ( s ) 192 . optionally the receptacle 195 is on a skid 197 and mounts 199 support the basket 193 above the skid 197 . optionally a system as in fig1 has all systems 198 a - 198 e or only some of them . a drive system 190 s vibrates the basket 193 ( and the basket 194 , if present ). in one aspect , only a system 198 e is used . a system 198 a provides electric current to the contents of the tank 191 . a system 198 b provides electric current to the material in the basket 194 . a system 198 c provides electric current to material on and / or flowing through the screen ( s ) 192 . a system 198 d provides electric current to material in the basket 193 hat has flowed through the screen ( s ) 192 . the system 198 e provides electric current to material in the receptacle 195 . each system 198 a - 198 e has appropriate electrodes or wires or grids or conductors to apply the electric current produced by the systems ; e . g ., electrodes e ( only two labeled ). the systems 198 a - 198 e may be outside of , adjacent , on or within the structures to which they correspond . optionally , a single system is used to supply current to all the structures of the system 190 . a control system cl ( like any control system or apparatus disclosed or referred to herein ; including control apparatuses and / or devices for controlling piezoelectric systems and / or for controlling a shale shaker and any motor , motors , or drive system used with shakers ; which may be any suitable known control system for a shale shaker or vibratory separator ), or multiple control systems , controls each item , system , and piece of equipment and system in fig2 . fig2 shows a shale shaker ( or vibratory separator ) 200 according to the present invention which has the parts and structures that are labeled ( similar to some of the parts and structures of the system 190 , fig2 ). input stream 201 of material ( e . g ., drilling fluid with living things 202 therein ), is introduced to the tank and from there it is sent to and ( partially ) through the screen ( s ), then the part of the material that passes through the screen ( s ) flows to the receptacle . from the receptacle output drilling fluid with living things 202 therein flows in a stream 207 to a vessel 204 . optionally , an electric apparatus 205 is provided which applies an electric current to the stream 201 , killing some or all of the living things 202 therein . the stream 201 can be fed into a vessel and the apparatus 205 can be on or in the vessel . alternatively , as shown , the stream 201 flows between parts 205 a and 205 b ( which are part of a circuit ) of the apparatus 205 and current flows between these two parts through the stream 201 , the completed circuit indicated by the dotted lines , and including as part of the circuit the material in the stream . optionally , an electric apparatus 206 is provided which applies an electric current to the stream 207 , killing some or all of the living things 202 therein . the stream 207 flows between parts 206 a and 265 b of the apparatus 206 and current flows between these two parts and through the stream 201 . optionally or alternatively , the stream 207 can be fed into a vessel 209 in which with electric current some or all of the living things 202 are killed . this killing can be accomplished by one or more piezoelectric systems 208 b and / or by a system 208 a ( like any system in fig2 for applying a current to material ). a control system 204 ( like any control system or apparatus disclosed or referred to herein ) including control apparatuses and / or devices for controlling piezoelectric systems and / or for controlling a shale shaker and any motor , motors , or drive system used with shakers ; which may be any suitable known control system for a shale shaker or vibratory separator , or multiple control systems , controls each item , system , and piece of equipment and system in fig2 . it is within the scope of the present invention to use any known system for applying an electric current to the stream 201 and / or to the stream 207 and for applying a current to any stream of any embodiment herein ; including , but not limited to , the systems disclosed in “ high speed water sterilization using one - dimensional nanostructures ” by schoen et al , american chemical society , 2010 , and any suitable system described or referred to in u . s . patent application ser . no . 61 / 462 , 478 filed feb . 3 , 2011 . it is also within the scope of the present invention to add any suitable known material to the stream 201 and / or to the stream 207 to increase or affect the conductivity of the stream ( s ) to enhance the conductivity thereof and / or to facilitate circuit completion by the material . it is within the scope of the present invention for the features of any shale shaker or vibratory separator described above to be used with a shaker or separator that has a screen or screens at different levels or tiers , one above the other , or a part of one above all or above part of another . any feature or aspect described above for heating material , heating a screen , heating a basket or any part of a shaker or separator , killing living things at any point or area of a shaker or separator , or killing living things in an initial feed stream or in an output stream can , according to the present invention , be used with a shaker or separator that has a screen or screens at different levels or tiers . fig2 a and 24b show a multi - level or multi - tier vibratory separator 210 according to the present invention which has four screening levels with screen supports 211 , 212 , 213 , and 214 with a screen or screens 215 with screening material ( shown schematically by lines labeled 215 ; any known shaker screen or screen and / or vibratory separator screen or screens may be used depending on the material to be processed ). at any single level , any two levels , any three levels , or at all levels , the systems of the present invention described above may be used . in one aspect , the material processed by the separator 210 is drilling fluid with solids and / or living things therein . shown schematically , basket interior systems 218 a ( one or any desired number of them may be used ) represent any apparatus , device or system disclosed herein for applying an electric current to material within a basket 210 b ( e . g ., to kill living things in the material and / or to heat the material ). shown schematically , basket exterior systems 218 b ( of which at least part is outside the basket ; one or any desired number of them may be used ) represent any apparatus , device or system disclosed herein for applying an electric current to material within the basket 210 b ( e . g ., to kill living things in the material and / or to heat the material ). material which has flowed through or past all the screens flows into a receptacle 216 . shown schematically , receptacle interior systems 218 d ( one or any desired number of them may be used ) represent any apparatus , device or system disclosed herein for applying an electric current to material within the receptacle 216 ( e . g ., to kill living things in the material and / or to heat the material ). shown schematically , basket exterior systems 218 c ( of which at least part is outside the basket ; one or any desired number of them may be used ) represent any apparatus , device or system disclosed herein for applying an electric current to material within the receptacle 216 ( e . g ., to kill living things in the material and / or to heat the material ). any screen or screen support of the separator 210 may have any or some of the systems described above for heating material on or adjacent the screen ( s ) and / or for killing living things in material ( e . g ., fluid ) being processed with the screen ( s ). for example , shown schematically , screen systems 218 e ( one or any desired number of them may be used on one , some , or on all screens ) represent any apparatus , device or system disclosed herein for applying an electric current to material being processed by the screen ( s ) ( e . g ., to kill living things in the material and / or to heat the material ). an input stream 217 of material to be treated flowing in a conduit 217 a can be treated with an exterior system 218 f , an exterior system 218 g , and / or interior systems 218 h ( systems 218 f and 218 g have at least a portion thereof outside the conduit 217 ) ( systems shown schematically ) to heat and / or kill living things in the stream 217 and these systems can be any disclosed herein for these purposes . an output stream 219 of material to be treated flowing in a conduit 219 a can be treated with an exterior system 218 k , an exterior system 218 j , and / or interior system 218 i ( systems 218 k and 218 j have at least a portion thereof outside the conduit 219 ) ( systems shown schematically ) to heat and / or kill living things in the stream 219 and these systems can be any disclosed herein for these purposes . similarly , flow directors 211 a , 212 a , and / or 213 a may have any system disclosed herein to heat material and / or to kill living things in material flowing on them . the basket 215 of the separator 210 is on a skid 210 s and has a control system 210 c . in one particular aspect , the present invention provides improvements as described above to the subject matter of u . s . pat . no . 7 , 703 , 612 which is incorporated fully herein for all purposes . as can be easily understood from the foregoing , the basic concepts of the present invention may be embodied in a variety of ways . it involves both structures , method steps , and techniques as well as devices to accomplish the appropriate ends . in addition , while some devices and structures are disclosed , it should be understood that these not only accomplish certain methods but also can be varied in a number of ways . the discussion herein is intended to serve as a basic description . the reader should be aware that the specific discussion may not explicitly describe all embodiments possible ; many alternatives are implicit . it also may not fully explain the generic nature of the invention and may not explicitly show how each feature or element can actually be representative of a broader function or of a great variety of alternative or equivalent elements . again , these are implicitly included in this disclosure . where the invention is described in device - oriented or apparatus - oriented terminology , each element of the device or apparatus implicitly performs a function . apparatus claims may not only be included for the device or apparatus described , but also method or process claims may be included to address the functions the invention and each element performs it should also be understood that a variety of changes may be made without departing from the essence of the invention . such changes are also implicitly included in the description . they still fall within the scope of this invention . it should be understood that such language changes and broader or more detailed claiming may be accomplished at a later date ( such as by any required deadline ) or in the event the applicant subsequently seeks a patent filing based on this filing . with this understanding , the reader should be aware that this disclosure is to be understood to support any subsequently filed patent application that may seek examination of as broad a base of claims as deemed within the applicant &# 39 ; s right and may be designed to yield a patent covering numerous aspects of the invention both independently and as an overall system . further , each of the various elements of the invention and claims may also be achieved in a variety of manners . each physical element disclosed should be understood to encompass a disclosure of the action which that physical element facilitates . thus , the applicants for this patent should be understood to have support to claim and make a statement of invention to at least : i ) each of any described systems and new parts thereof as herein disclosed and described , ii ) the related methods disclosed and described , iii ) similar , equivalent , and even implicit variations of each of these systems , parts , and methods , iv ) those alternative designs which accomplish each of the functions shown as are disclosed and described , v ) those alternative designs and methods which accomplish each of the functions shown as are implicit to accomplish that which is disclosed and described , vi ) each aspect , feature , component , and step shown as separate and independent inventions , vii ) the applications enhanced by the various systems or components disclosed , viii ) the resulting products produced by such systems or components , ix ) each system , method , and element shown or described as now applied to any specific field or devices mentioned , x ) methods and apparatuses substantially as described hereinbefore and with reference to any of the accompanying examples , xi ) the various combinations and permutations of each of the elements disclosed , and xii ) each potentially dependent claim or concept as a dependency on each and every one of the independent claims or concepts presented . with regard to claims whether now or later presented for examination , it should be understood that for practical reasons and so as to avoid great expansion of the examination burden , the inventors may at any time present only initial claims or perhaps only initial claims with only initial dependencies . support should be understood to exist to the degree required under new matter laws — including but not limited to european patent convention article 123 ( 2 ) and united states patent law 35 usc 132 or other such laws — to permit the addition of any of the various dependencies or other elements presented under one independent claim or concept as dependencies or elements under any other independent claim or concept . to the extent that insubstantial substitutes are made , to the extent that the applicant did not in fact draft any claim so as to literally encompass any particular embodiment , and to the extent otherwise applicable , the applicant should not be understood to have in any way intended to or actually waived or relinquished such coverage as the applicant simply may not have been able to anticipate all eventualities ; one skilled in the art , should not be reasonably expected to have drafted a claim that would have literally encompassed such alternative embodiments . further , if or when used , the use of the transitional phrase “ comprising ” is used to maintain the “ open - end ” claims herein , according to traditional claim interpretation . thus , unless the context requires otherwise , it should be understood that the term “ comprise ” or variations such as “ comprises ” or “ comprising ”, are intended to imply the inclusion of a stated element or step or group of elements or steps but not the exclusion of any other element or step or group of elements or steps . any claims set forth at any time during the pendency of the application for this patent or offspring of it are hereby incorporated by reference as part of this description of the invention , and the applicant expressly reserves the right to use all of or a portion of such incorporated content of such claims as additional description to support any of or all of the claims or any element or component thereof , and the applicant further expressly reserves the right to move any portion of or all of the incorporated content of such claims or any element or component thereof from the description into the claims or vice - versa as necessary to define the matter for which protection is sought by this application or by any subsequent continuation , division , or continuation - in - part application thereof , or to obtain any benefit of , reduction in fees pursuant to , or to comply with the patent laws , rules , or regulations of any country or treaty , and such content incorporated by reference shall survive during the entire pendency of this application including any subsequent continuation , division , or continuation - in - part application thereof or any reissue or extension thereon . in conclusion , therefore , it is seen that the present invention and the embodiments disclosed herein and those covered by the appended claims are well adapted to carry out the objectives and obtain the ends set forth . certain changes can be made in the subject matter without departing from the spirit and the scope of this invention . it is realized that changes are possible within the scope of this invention and it is further intended that each element or step recited herein is to be understood as referring to the step literally and / or to all equivalent elements or steps . it is intended to cover the invention as broadly as legally possible in whatever form it may be utilized . the invention described herein is new and novel in accordance with 35 u . s . c . § 102 and satisfies the conditions for patentability in § 102 . the invention described herein is not obvious in accordance with 35 u . s . c . § 103 and satisfies the conditions for patentability in § 103 . the inventor may rely on the doctrine of equivalents to determine and assess the scope of the invention . all patents and applications identified herein are incorporated fully herein for all purposes . the word “ comprising ” is used in its non - limiting sense . | 7 |
the invention is described hereafter in the context of a umts type system using the “ fdd enhanced uplink ” functionality for transmitting data at high - throughput in the uplink direction . this is but an example , the invention being implementable also in other communication systems . fig1 shows a simplified exemplary architecture of the radio part of a communication system comprising three nodes b 2 a , 2 b and 2 c respectively , linked to an rnc 3 . a ue 1 is able to communicate with some at least of the nodes b represented . for this purpose , dedicated transport channels can be used in a conventional manner to transmit the information from the ue 1 to one or more of the nodes b ( uplink direction ), or else to transmit the information from one or more of the nodes b to the ue 1 ( downlink direction ). these dedicated transport channels , denoted dch (“ dedicated channel ”) decompose into logical traffic channels dtch (“ dedicated traffic channel ”), for the transmission of user data , and control channels dcch (“ dedicated control channel ”) for the transmission of signalling messages . furthermore , common channels of ccch type (“ common control channel ”) can be used to transmit signalling messages in relation to a ue set situated under the radio coverage of a node b . moreover , the ue 1 and the communication system illustrated in fig1 support the “ fdd enhanced uplink ” functionality . thus , the communication resources of the ue 1 are controlled directly by the node or nodes b with which it communicates on a dedicated high - throughput uplink channel of e - dch type . fig2 gives a representation as layers of communication protocols implemented in a system such as that of fig1 , in accordance with the aforesaid technical specification ts 25 . 309 . in a conventional manner , the ue represented possesses a medium access layer ( mac - d , “ medium access control ”) which fulfills a function of multiplexing the data on the dtch and dcch transport channels , as well as a physical layer (“ phy ”) of the radio interface on which it transmits the streams emanating from the mac - d layer to the node b concerned . a corresponding mac - d layer is situated in the srnc (“ serving rnc ”), that is to say the rnc controlling the connection with the ue considered , and a corresponding phy layer is situated in the node b with which the ue is in communication . a mac - e layer is furthermore used within the framework of the “ fdd enhanced uplink ” functionality . this layer , which controls the transmissions on the e - dch channel , is situated in the ue and , in a corresponding manner , in the node b . it ensures in particular the following functions : hybrid processes for requesting retransmission of the data of harq type (“ hybrid automatic repeat request ”), control of the resources relating to the e - dch channel (“ scheduling ”) and multiplexing / demultiplexing of the data on the e - dch . in particular , the mac - e layer allows the selection of a transport format for the data blocks transmitted on the e - dch channel . the transmission time interval ( tti ) for the e - dch channel is 2 ms or 10 ms . when the ue is in a macrodiversity situation , as regards the e - dch high - throughput channel , the srnc ensures a reordering and a recombining of the data received from the various nodes b of the active set . it is considered henceforth that the ue 1 of fig1 desires to transmit data at high - throughput on an e - dch channel bound for the node b 2 b . for this purpose , the ue 1 receives communication resources , such as codes , from the rnc 3 , that are configured to be able to pass a variable throughput that can attain a theoretical maximum value . as has been explained in the introduction , it is then desirable that this node b 2 b indicate to the ue 1 what maximum throughput it is assigning to it , so as to be certain that the overall uplink interference level measured at the node b will not exceed a certain threshold and / or that the reception capacity of the node b will not be surpassed . the ue 1 will thus be able to be induced to use the resources which have been allocated to it by the rnc 3 only within the limits fixed by the node b 2 b . it will be noted that the available bandwidth can be determined in conjunction with a maximum reception capacity and / or an estimated uplink interference level , without however being absolutely clamped to these values . in particular , it is possible to define margins with respect to these values , so as to be certain , for example , that the uplink traffic will not have an aggregated throughput surpassing the maximum reception capacity less a predefined margin . conversely , it is possible to define an available bandwidth beyond values mentioned above , for example when it is detected that ues desiring to communicate on e - dch channels have only little impact on the uplink interference level . according to the invention , one proceeds in two stages . first of all , the node b 2 b determines an available bandwidth , that is to say a maximum throughput that it can still absorb , having regard to the information exchanges already under way on the dedicated and common channels involving this node b . if we return to the example mentioned in the introduction , the node b 2 b possesses a reception capacity of 6 mbit / s , that is to say it is capable of performing a correct processing ( despreading and decoding in particular ) of the radio signals that it receives within the limit of an aggregate transmission throughput of 6 mbit / s . now , dtch , dcch and ccch uplink channels controlled by the rnc 3 already use a certain bandwidth of this node b . this use varies over time and it attains for example an overall throughput of 2 mbit / s at a given instant considered . the bandwidth available to the node b 2 b for receiving data on e - dch channels is therefore 4 mbit / s (= 6 − 2 mbit / s ) at the instant considered . once determined at the node b 2 b , this available bandwidth is communicated to the whole set of ues which are situated in its radio coverage , in particular to the ue 1 . this communication is carried out on a common channel , such as an s - ccpch (“ secondary common control physical channel ”). the indication of the available bandwidth can use any type of coding , like an absolute value for example . the calculation and the transmission on a common downlink channel of the indication relating to the available bandwidth for the node b 2 b can be performed repeatedly , for example with a period of 10 ms , as will be described in greater detail subsequently . thus , the ue 1 , like the set of the ues under the radio coverage of the node b 2 b , obtains the information of the available bandwidth relating to the node b 2 b , on the basis of the indications received on the common downlink channel . it will be noted that each node b , like the node b 2 b for example , can cover several radio cells with which ues are in communication . in this particular case , the available bandwidth can be defined at the cell level rather than at the node b level , in particular when this bandwidth is determined with reference to an uplink interference level . the corresponding information , which can be different according to the cells under the responsibility of the node b in question , will then be dispatched on a common s - ccpch type channel by each cell . subsequently , the node b 2 b transmits a second indication to the ue 1 . the latter consists substantially of a percentage . it corresponds to a fraction of the previously transmitted available bandwidth that the ue 1 must use as upper bound to its transmission throughput . the coding used to transmit the percentage information can be of any type . it is understood nevertheless that such information is of small size and can be coded on a restricted number of bits . returning to the preceding example , the ue 1 has first of all been informed that the bandwidth available at a given instant for the node b 2 b was 4 mbit / s . a percentage of 50 % for example is indicated to it henceforth . this signifies that the node b 2 b requests the ue 1 to send on its e - dch channel with a transmission throughput of less than or equal to 2 mbit / s (= 50 %× 4 mbit / s ). at the same time , the node b 2 b indicates to other ues , if any , situated in its zone of radio coverage and supporting the “ fdd enhanced uplink ” functionality , what percentage of the previously communicated available bandwidth each of them can use . of course , a different percentage can be indicated to each ue . for this purpose , the node b 2 b can take into account any criterion for the determination of the percentages to be allocated to the various ues , like for example the number of ues having or requiring an e - dch channel , the type of service required by each ue , etc . the transmission of the percentages is performed in an individual manner for each of the ues concerned . for example , the percentage to be applied by each ue can be transmitted to it on a corresponding dedicated downlink channel . for this purpose , the node b 2 b can perform a puncturing on a dtch downlink channel for example , so as to incorporate the percentage information thereinto . in this case , only a few information bits need to be punctured to transmit the percentage indication , thereby avoiding a loss of information and therefore a degradation of the quality of reception of the information transmitted on the dtch having been the subject of the puncturing . it will be noted that the percentage information is defined at the level of the node b , even in the case where the node b 2 b covers several distinct radio cells . thus , a single item of percentage information is transmitted to each ue in communication with a node b on a respective dedicated channel . the transmission of the percentage indication for a given ue , for example the ue 1 , can be performed at a different rhythm from the transmission of the available bandwidth mentioned above . in particular , the percentage indication can be transmitted solely on the request of the ue concerned . updates can also be dispatched by the node b 2 b when the criteria for determining such percentages undergo a change ( for example a change of the number of e - dch channels bound for the node b ). when it has received a percentage indication , the ue 1 is then able to apply it to the indication of the available bandwidth that it has previously received , then to calculate the maximum throughput that it can use on its e - dch channel . in the example mentioned above , where the available bandwidth transmitted by the node b 2 b is 4 mbit / s and where the percentage returning to the ue 1 is 50 %, the ue 1 deduces therefrom that it can transmit a maximum throughput of 2 mbit / s (= 50 %× 4 mbit / s ) on its e - dch channel . it thereafter organizes its transmissions on its e - dch channel so as to comply with the throughput upper bound thus calculated . such a two - stage transmission of the maximum throughput to be used , such as described above , presents a certain number of advantages . it makes it possible specifically to avoid transmitting very regular updates of absolute throughput values to each ue independently , which would represent a significant amount of signalling , furthermore capable of degrading the quality of reception of the useful information in particular when the throughputs are transmitted by puncturing of downlink traffic channels . by way of illustration , if the available bandwidth of the node b 2 b evolves , following a modification of the resources used on dtch type channels for example , it will then suffice to transmit an update of this information on a common downlink channel , without having to retransmit to each ue concerned a throughput indication modified accordingly . in an advantageous embodiment of the invention , several available bandwidths are determined by the node b considered ( or each of the cells covered by this node b ) then transmitted on a common downlink channel . these various bandwidths are chosen so as to be associated with respective service levels to be implemented by ues . by way of example , a significant bandwidth can be reserved for the usage of the ues having a subscription requiring a high service level , while a lower bandwidth can be used by ues requiring a lower service level . likewise , a significant bandwidth can be reserved for the usage of the communications having a high priority level , while a lower bandwidth can be used for communications with a lower priority level . moreover , the percentage values transmitted to the ues can depend on the level of service to be implemented by these ue . thus , a ue employing a subscription requiring a high quality of service may be assigned a significant percentage of the bandwidth , to the detriment of other ues employing a subscription requiring a lower quality of service . another advantage of such a mechanism will be highlighted hereafter in an exemplary embodiment of the invention where the ue 1 is in a macrodiversity situation in relation to its e - dch channel . it is considered therefore hereafter that the ue 1 of fig1 desires to transmit data at high - throughput on an e - dch channel bound for the three nodes b 2 a , 2 b and 2 c simultaneously . such a macrodiversity situation makes it possible specifically to improve the reliability and the quality of the reception by combining the information received by each node b of the active set . in such a case , each node b possesses its own inherent criteria . by way of example , the interference level in the uplink direction measured by each of the nodes b can be different since it depends in particular on the communications under way with the corresponding node b . likewise , each node b can use a receiver having an inherent reception capacity , possibly different from the other nodes b . furthermore , the use of the channels also varies according to the nodes b , so that the available bandwidth can be different for each node b at a given instant . in the example described hereafter , it is considered that at an instant of observation , the node b 2 a has an available bandwidth of 3 mbit / s , while the node b 2 b has an available bandwidth of 4 mbit / s and the node b 2 c has an available bandwidth of 2 mbit / s . the available bandwidths for each node b of the active set with which the ue 1 is in communication must be transmitted to this ue so as to allow it to adapt its transmission throughput on the e - dch channel accordingly , as indicated above . for this purpose , each node b can advantageously transmit the available bandwidth that it has determined , on a common channel , repeatedly . for example , each node b transmits this information in eight successive time slots of an s - ccpch . the ue 1 , on its side , alternately listens to the time slots of the various s - ccpch channels that it receives from each of the nodes b 2 a , 2 b and 2 c . by virtue of these repetitions , one ensures that the ue 1 will indeed obtain the available bandwidths relating to each of the nodes b , even if it possesses only one receiver . of course , the repetition of the transmission of the bandwidth available by each node b can be performed in all cases , that is to say there is or is not a ue in a macrodiversity situation . the ue 1 can then detect and store some at least of the values received of available bandwidth , in conjunction with the corresponding node b . subsequently , percentages of available bandwidth are dispatched to the ue 1 by each of the nodes b . this information is advantageously transmitted on a downlink dedicated channel . no combining of this information is however carried out at the level of the ue 1 so that the latter can receive and determine the smallest throughput value from among the products of the percentage and of the available bandwidth that emanate from each node b . the ue 1 thus calculates the maximum throughput that it is permitted to use on its e - dch channel so as not to surpass the reception capacity of each of the nodes b . for this purpose , it can for example calculate a maximum throughput relating to each of the nodes b and select the lowest throughput calculated . by way of example , if the percentages received respectively from the nodes b 2 a , 2 b and 2 c are 40 %, 10 % and 50 %, the ue 1 then determines that the maximum throughput to be used in relation to the nodes b 2 a , 2 b and 2 c respectively is 1 . 2 mbit / s (= 40 %× 3 mbit / s ), 0 . 4 mbit / s (= 10 %× 4 mbit / s ) and 1 mbit / s (= 50 %× 2 mbit / s ). in this example , the ue 1 can then choose to use a transmission throughput of less than or equal to 0 . 4 mbit / s on its e - dch channel , so as not to surpass the reception capacity of the node b 2 b . | 7 |
fig1 shows a graphical representation of an orifice plate with a non - wetting region near the edge of the orifice , as known from the prior art . orifices ( 22 ), also referred to as a nozzle having edges ( 30 ) arranged in the outer surface ( 20 ) of the orifice plate . an edge of an orifice defines a transition boundary between an orifice and the outer surface . in an annular region around each nozzle the outer surface of the orifice plate is substantially non - wetting with the ink that is ejected through the orifices ; these regions are referred to as the non - wetting regions ( 36 ′). outside the non - wetting regions , the outer surface ( 32 ) of the orifice plate is substantially wettable with the ink . during printing , ink drops may be ejected through the nozzles . the ejected ink drops follow a trajectory in a direction substantially perpendicular to the outer surface of the orifice plate . due to break - tip of a drop , before or after detaching from a nozzle , residual ink drops may — unintentionally — land on the outer surface of the orifice plate ( 31 , 33 , 34 ). if a residual ink drop ends up on a non - wetting region near an edge of a nozzle , the contact angle between an ink drop and a non - wetting region of outer surface may be relatively high due to the low surface tension of the non - wetting region . in case a residual ink drop ends up on the wetting region ( 32 ) it tends to spread more ( i . e ., the contact angle will be lower ), because the surface tension of the outer surface is higher than that of the non - wetting region . the non - wetting regions prevent residual ink drops from flowing towards an edge of a nozzle and ultimately back into the nozzle . a residual ink drop that has landed on a non - wetting region , and which drop is larger than the widths of the non - wetting region ( 34 ), is partly situated on a wettable portion of the outer surface ( 32 ). a difference in surface energy between a first portion of an edge of an ink drop and a second portion of the edge of the same ink drop may result in contact angle difference across the ink drop . this in turn may provide a driving force for movement of the ink drop from surface regions having a lower surface energy to regions having a higher surface energy . in other words : a larger affinity of a residual ink drop with a wettable portion of the outer surface , induces the residual ink drop to move or flow away from the non - wetting regions , away from the nozzle . the difference in wettability is a driving force for movement of such an ink drop . thus , the risk of disturbing the trajectories of subsequent ejected drops is reduced . however , a residual ink drop that has landed on a non - wetting region and which ink drop is smaller than the width of the non - wetting region ( e . g ., the ink drops indicated by 31 and 33 ) does not move , because the previously described driving force for causing the movement is lacking . small ink drops ( 31 and 33 ) stay in the vicinity of the edges of the nozzles , until otherwise removed , for example by gravity , a wiping procedure or the like . a residual ink drop caused by the ejection of a subsequent ink drop may also land on the same non - wetting region near the edge of the nozzle , possibly causing accumulation of multiple residual ink drops near the edge of the nozzle . in the event that small drops coagulate to form a larger drop like 34 , the large drop tends to move or flow away from the edge of the nozzle . during coagulation of multiple small drops to form a larger drop , the trajectories of subsequent ejected ink drops may be influenced by the growing drop and hence may lead to an inferior print quality . fig2 a shows an outer surface ( 20 ) of an orifice plate comprising at least one orifice ( 22 ) with an edge ( 30 ). near the edges of the orifices , regions ( 36 ′) with a gradually increasing wettability are provided . the gradient starts with a substantially non - wetting behaviour near the edges ( 30 ) of the nozzles ( 22 ) which gradually changes into a substantially wetting behavior with increasing distance from the edges of the nozzles , with such a gradient that the widths ( 10 ) of the gradient regions ( 36 ′) are smaller than half the distance ( 11 ) between the closest edges of two adjacent nozzles ( i . e ., there is no overlap of gradient regions of adjacent nozzles ). in this example , the wettability gradient is applied in a dot - pattern , the dots being zones that are provided with a gold layer . on top of the gold layer an anti - wetting agent is provided , the anti - wetting agent being a thiol compound , for example a perfluoro - thiol compound . the thiol compound may for example be provided as a self - assembled monolayer . in the embodiment shown in fig2 a and fig2 b , a size of each dot in the pattern is selected such that each dot is smaller than a smallest expected residual ink drop , for reasons explained below . on a microscopic scale only two types of regions are present : wettable ( i . e ., regions without anti - wetting agent ) and non - wettable regions ( i . e ., dots provided with anti - wetting agent ). on a macroscopic scale ( i . e ., as experienced by a residual ink drop ) the dotted pattern results in a wettability gradient . during printing , residual ink drops may land on the outer surface of the orifice plate . fig2 b shows that if a residual ink drop ends up in the region ( 36 ′) provided with a wettability gradient ( e . g ., ink drop 33 ), the front end ( 33 ′) of a residual ink drop experiences a higher wettability of the outer surface than the tail end ( 33 ″), regardless of the position of the residual ink drop within the gradient region ( 36 ′). the difference in wettability of the outer surface underneath the residual ink drop is a driving force for movement of the residual drop towards a region with a higher wettability , which is towards the front end of the residual ink drop . the residual ink drop therefore moves away from the edge of the orifice towards region 32 ( see fig2 a ), as indicated by arrows 12 and 13 . an essential feature for the above described mechanism to work , is the presence of a macroscopic ( i . e ., at the scale corresponding to the size of the residual ink drops ) wettability gradient . fig3 shows a graph . the horizontal axis of the graph represents the distance from an edge of a nozzle . the vertical axis of the graph represents the wettability of the outer surface of an orifice plate . the units of both distance and wettability are arbitrary units . a first solid line ( 1 ) represents a first embodiment in which a linear wettability gradient is present around an orifice on the outer surface of an orifice plate ; a second solid line 2 represents a second embodiment in which a non - linear wettability gradient is present ; the wettability gradient has the same magnitude as the wettability gradient represented by solid line 1 ( i . e ., the same total wettability increase over the same total distance ); and the wettability has a higher initial slope , which slope decreases towards the end of the gradient . the wettability gradient represented by solid line ( 2 ) offers a larger driving force for movement of a residual ink drop away from the edge of an orifice , in a region near the edge . a residual ink drop that lands near an edge of an orifice tends to move more quickly away from the edge of an orifice , than a residual ink drop that lands at a larger distance from the edge of an orifice . in other words : a residual ink drop that lands on a more critical region of the outer surface of an orifice plate ( i . e ., near an edge of an orifice where the risk of disturbing a subsequent ejected ink drop is largest ) is quickly removed from that area . the third , fourth and fifth dotted lines ( 3 , 4 and 5 , respectively ) each represent a discrete step - wise increasing wettability with increasing distance from the edge of an orifice . in practice these schemes may be applied on the outer surface as annular regions ( i . e ., rings ) around the orifices with increasing wettability with increasing distance from the edges of the orifices . the third line ( 3 ) shows a third embodiment , in which the linear wettability gradient ( 1 ) is represented by a discrete step - wise variation . the fourth line ( 4 ) shows a fourth embodiment in which the non - linear wettability gradient ( 2 ) is represented by a first discrete step - wise variation , wherein the width of the annular regions is constant and the step - size in wettability decreases with increasing distance from the edge of an orifice . the fifth line ( 5 ) shows a fifth embodiment in which the non - linear wettability gradient ( 2 ) is represented by a second discrete step - wise variation , wherein the step - size in wettability is constant and the width of the annular regions increases with increasing distance from the edge of the orifice . the discrete step - wise variations of the gradients represented by the third , fourth and fifth line ( 3 , 4 and 5 , respectively ) may be applied on a microscopic or a macroscopic scale . in the first case , the spatial step - size ( i . e ., step - size in distance from the edge of an orifice ) is small compared to the expected size of residual ink drops . in the latter case , the spatial step - size may be relatively large compared to the expected size of a residual ink drop . considering the embodiments shown in fig2 , it is clear to the skilled person that many variations of a wettability are possible and fall within the scope of the present invention . fig4 shows yet another embodiment of the orifice plate according to the present invention . for clarity reasons , the wettability gradient is represented by a limited number of iso - wettability lines ( i . e ., lines with constant average wettability ). the pattern required to obtain such a wettability gradient may be based on the profiles shown in fig2 and / or any variation falling within the scope of the present invention . in this embodiment there is provided a first wettability gradient around and near the nozzle edges ( 30 ), defined by iso - wettability lines 40 , 41 and 42 , and a second wettability gradient in an area ( 70 ) between two adjacent nozzles ( 22 - 1 and 22 - 2 ), represented by the horizontal iso - wettability lines on either side of a diametric line ( 60 ) between two adjacent nozzles . the wettability with an ink in the second wettability gradient area ( 70 ) decreases with increasing distance from the diametric line ( 60 ), as indicated by double arrow ( 50 ). the wettability at the location of the diametric line ( 60 ) is preferably substantially equal or substantially lower than the wettability of a region between the iso - wettability lines 41 and 42 . this combination of the first and the second wettability gradient provides an overall wettability gradient that prevents accumulation of ink drops in the area between two adjacent nozzles . if for example an ink drop ( 33 ) lands on the nozzle plate near the edge of a nozzle ( 30 ) on or near the diametric line ( 60 ), the ink drop will experience a driving force to move away from the nozzle edge , towards the second wettability gradient . the second wettability gradient will direct the ink drop away from the diametric line ( 60 ). an exemplary overall ink drop trajectory is indicated by the arrows 13 a or 13 b , dependent on the exact starting location of the ink drop . in any case , an ink drop will move away from a nozzle edge , without ending up in the area ( 70 ) between two adjacent nozzles . it is noted that the iso - wettability lines may have a different shape , for example elliptical , parabolic or curved . other shapes may be of use when specific ink drop trajectories of ink drops that have landed on the outer surface of the orifice plate are desired . hereinafter , an embodiment of a method for applying a wettability gradient on the outer surface of an orifice plate is demonstrated . an orifice plate may be produced by electro - formation , which is a technique well known in the industry . after the orifice plate has been produced , the outer surface ( 32 in fig1 , fig2 a and fig2 b ) is generally non - wetting ( e . g ., it possesses a nickel or gold - plated nickel outer surface ). to achieve the desired wetting and anti - wetting properties according to the present invention , the orifice plate is first coated with a photoresist material , the photoresist material covering the entire outer surface of the orifice plate . the second step is providing and positioning a mask with a pattern according to the desired pattern of wettable and non - wettable regions on the outer surface of the orifice plate ( e . g ., the dot - pattern shown in fig2 a and fig2 b ), on top of the outer surface of the orifice plate . the assembly is then exposed to radiation , which causes the photoresist to react . two types of reaction are possible : 1 ) degradation of the photoresist , and 2 ) curing of the photoresist . photoresists that react according to the first reaction require a negative mask ( i . e ., radiation transparent where wetting regions are required and the non - wetting surface has to be removed ). photoresists which react according to the second reaction require a positive mask ( i . e ., radiation transparent where non - wetting regions are required and the non - wetting surface should be maintained ). the next step is removing the photoresist with a solvent from those parts of the outer surface that are intended to become wetting . the underlying non - wetting surface is subsequently removed by e . g ., wet etching or reactive plasma etching . finally the remaining photoresist is removed with the aid of a solvent . the outer surface of the orifice plate then comprises a pattern e . g ., as shown in fig2 a and fig2 b . various patterns are possible and relatively easy to create by selecting different masks . the above - described method for producing a pattern on the outer surface of the orifice plate is similar to photolithographic techniques known in the semi - conductor industry . the final step is providing an anti - wetting agent on the outer surface of the orifice plate , which can be done in various ways : e . g ., dipping the orifice plate in a liquid anti - wetting agent or applying the anti - wetting agent by one of the numerous coating techniques known in the art . the anti - wetting compound preferably adheres to those portions of the outer surface that are not removed by etching and preferably forms a self - assembled monolayer on those portions of the outer surface . optionally the ink may comprise the anti - wetting compound to be able to restore the self - assembled monolayer if the layer is disturbed or destroyed due to events like a paper crash , a wiping procedure or other incidents that may cause mechanical damage to the orifice plate . the following are some examples of anti - wetting coatings known in the art . perfluoroalkanethiol may be applied on gold . for example , a nickel ( ni ) or silicon ( si ) orifice plate may be provided with a gold layer as a transition layer ; perfluoroalkanetrichlorosilane may be applied on an orifice plate provided with a transition layer comprising a first layer consisting of approximately 50 nm of chrome ( cr ) and a second layer consisting of approximately 300 nm of sio x in which x is about 1 . 5 ; and perfluoroalkanetrichlorosiliane may be applied on an orifice plate provided with a transition layer comprising a natural or artificial sio 2 layer . other known anti - wetting agents may be : teflon - like compounds , for example applied by chemical vapour deposition ( cvd ) techniques , alkanes and silicones . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . | 1 |
referring to fig1 therein is shown a portion of a seeding device 10 adapted for movement over the soil for depositing seed in a furrow and closing the furrow over the seed . as shown , the seeding device 10 is a planter including a row unit 12 having a forward , end 14 connected by a four - bar linkage 18 to a toolbar ( not shown ). conventional furrow opening structure 18 with depth gauging is connected to an opener frame 20 and opens a furrow in the ground and deposits material such as seed and fertilizer in the furrow . trailing press wheel structure 22 supported from the frame 20 at a pivot location 24 firms the soil over the deposited material . the opener frame 20 includes a frame casting 30 connected by holts 32 and 34 ( fig2 ) to an underside of the frame 20 immediately rearwardly of the opening structure 18 . the casting 30 includes an upper apertured portion 38 receiving , the bolts 32 and 34 and a chemical supply line 38 . the casting 30 extends rearwardly and downwardly from the apertured portion 36 to a downwardly and forwardly extending mounting portion 40 that terminates at a lowermost end in an apertured mounting member 42 for receiving one end of a firming wheel down pressure spring 44 . the casting 30 defines a downwardly and forwardly opening cavity indicated generally at 48 . as best seen in fig2 , access to the cavity area is relatively limited . a nozzle and bracket assembly 50 is secured generally within the cavity 48 by the bolt 34 . the supply line 38 feeds a chemical solution to the top of the assembly 50 , and a chemical spray 52 ( fig3 ) is emitted from the bottom of the assembly onto the area of the furrow near the rear of the opener assembly 18 . the assembly 50 includes a formed sheet metal bracket 60 having a generally horizontal top portion 82 with a slot 84 opening ail the way through the rearmost edge of the portion ( fig4 and 5 ). a forward and generally planar slotted wall 66 with spaced upright slots 66 a extends downwardly and slopes slightly forwardly from the top portion 62 . two identical legs 68 are bent rearwardly from the bottom and extend generally horizontally to upturned ends 70 . the bolt 34 secures the top portion 62 against the bottom surface of the portion 36 . the ends 70 of the legs 68 conform to and are resiliency supported against the inside wall of the mounting portion 40 . as can be best appreciated from fig3 , the bracket 60 is secured firmly in place in the cavity 48 using only the single bolt 34 and contact between the ends 70 and the casting 30 . therefore , although the space in the area of the cavity 48 is limited , attachment and removal of the assembly 50 is facilitated . the assembly 50 also includes a nozzle body 80 having an upper inlet 82 connected to the supply line 38 and a nozzle cap 84 releasably mounted on the lower end of the body 80 and defining the spray pattern for the spray 52 . the body 80 as shown is molded from plastic material and includes rearwardly projecting spaced upper and lower mounting tabs 86 a and 86 b received by the slots 66 a in the wall 66 . the tabs 86 a and 86 b extend through the slots 66 a and embrace opposite edges of the slots for firm support by the slotted wall 66 . the ends of the tabs 86 have laterally directed protrusions ( fig7 ) to help secure the body 80 in the slots 66 a . also , the slots 66 a have centrally located offsets 66 b that contact the upper tabs 88 a as the body 80 is slid downwardly into the final assembled position on the bracket 60 . the offsets 68 b help resist upward movement of the body 80 in the slots 86 a and maintain the body 80 in the desired position . for added assembly integrity and body impact protection , the nozzle cap 84 , which is connected to the lower end of the body 80 after the body is slid into position on the bracket 80 by a conventional attachment structure such as a bayonet mount , overlaps the plane of the slotted wall 86 and contacts the wall 86 if for any reason the body 80 is pushed upwardly . as shown in fig4 , the wall 66 includes a downwardly opening aperture or slot 66 c between the bend locations of the legs 88 , and the upper planar surface of the cap 84 ( see 84 c of fig4 ) will contact the lower edge of the slot 66 c if the body 80 is forced upwardly a fraction of a millimeter . this interference between the nozzle cap 84 and the bracket 80 provides added nozzle body retention and makes the assembly 50 more robust and resistant to damage . the attached nozzle cap 84 closely adjacent the lower edge contacts the edge of 68 c at 84 c as the nozzle body 80 is urged upwardly and thereby transfers impact loading from the nozzle cap to the frame through the bracket 80 to prevent nozzle body damage . the relatively inexpensive cap 84 can be easily replaced if damaged and prevents damage to the more expensive nozzle body 80 . during assembly , the tabs 86 a and 86 b of the nozzle body 80 are inserted into the slots and slid downwardly into a final mounting position past the slot offsets 66 b ( fig7 ), and the nozzle cap 84 is attached . the casting 30 is secured to the opener frame 20 with the bolts 32 and 34 . before the bolt 34 is completely tightened , the bracket 60 is attached by sliding the slot 64 under the head of the bolt 34 and positioning the leg ends 70 against the mounting portion 40 ( fig2 ). the bolt 34 is then fully tightened to secure the assembly 50 in the casting 30 . assembly and disassembly of the sprayer assembly on the opener frame is therefore very simple and convenient . the above - described assembly facilitates manufacture and servicing and requires only several parts . having described the preferred embodiment , it will become apparent that various modifications can be made without departing from the scope of the invention as defined in the accompanying claims . | 0 |
the aminoanilino triazines which can be prepared according to the method of the present invention have the structure shown below as molecular formula ( i ): ## str1 ## wherein x is a halogen selected from cl , f , b , or i ; a , b , and c are individually selected from either 0 or 1 ; and r is an aminoanilino group having the structure : ## str2 ## such that the amino groups are either in ortho , meta or para positions with respect to each other . the benzene ring of the aminoanilino group can be substituted with halogen ( cl , f , br , i ), hydroxy , nitro , or a lower alkyl group having from about 1 to about 5 carbon atoms . the para position is preferred so as to define a 4 - aminoanilino group . the preferred values for a , b and c are 0 , so as to define a 2 , 4 , 6 - tris -[ 4 - aminoanilino ]- 1 , 3 , 5 - triazine structure as follows : ## str3 ## the substituted triazine of formula ( i ) is made in accordance with the following procedure : in a first step a phenylazoaniline ( i . e ., an aminoazobenzene ) is reacted with a cyanuric halide to produce a [( phenylazo ) phenylamino ]- triazine . the phenylazoaniline can be 3 - or 4 - phenylazolaniline . however , since the para position for the relative position of amino groups is preferred , the procedure will hereafter be exemplified with 4 - phenylazoaniline ( formula iii ) as the starting material : ## str4 ## the benzene rings of the 4 - phenylazoaniline can optionally have substituents such as halo ( cl , f , br , i ), nitro , hydroxy , or lower alkyl group . the cyanuric halide can be cyanuric chloride , fluoride , bromide , or iodide . since chloride is preferred , the procedure will hereafter be exemplified with cyanuric chloride having formula ( iv ): ## str5 ## the 4 - phenylazoaniline can be prepared by methods commonly known in the art . the molar proportion of 4 - phenylazoaniline to cyanuric chloride can be varied in accordance with the degree of substitution desired on the triazine ring . the 4 - phenyazoaniline is preferably dissolved in a solvent ( e . g ., toluene , benzene or xylene ) to which cyanuric chloride is added with stirring . the temperature is preferably about 25 ° c . at the start . the mixture is gradually heated to a temperature of from about 90 ° c . to about 120 ° c . and held at that temperature for several hours , while triethylamine ( or other bases ) and additional 4 - phenylazoaniline are added . the reaction can be monitored by chromatographic techniques to determine the degree of conversion to the tri substituted 4 -( phenylazo ) phenylamino - 1 , 3 , 5 - triazine . this compound can be filtered out and washed with toluene and with water , then dried . in a second step , the 2 , 4 , 6 - tris -[ 4 -( phenylazo ) phenylamino ]- 1 , 3 , 5 - triazine obtained from the first step is reduced by a reducing agent to form 2 , 4 , 6 - tris -[ aminoanilino ]- 1 , 3 , 5 - triazine . the reduction is preferably performed in the presence of a catalyst . the catalyst is preferably a metal of group viii of the periodic table of the elements ( cas version ), and more preferably , a noble metal such as platinum or palladium on a particulate support ( e . g ., carbon , alumina , silica , aluminosilicates , and the like ). the preferred reducing agent can be selected from , for example , hydrazine hydrate , and hydrogen . the reduction can be performed by dissolving the 2 , 4 , 6 - tris -[ 4 - phenylazo ) phenylamino ]- 1 , 3 , 5 - triazine in a solvent such as isobutanol , and adding thereto the catalyst and the reducing agent . hydrazine hydrate can be added directly to the solution at atmospheric pressure , or the solution can be sealed under pressure ( about 100 - 1 , 000 psi , preferably about 200 - 800 psi , more preferably bout 400 - 700 psi ) with hydrogen , while heating to a temperature of from 50 ° c . to about 110 ° c ., more preferably 70 ° c . to about 100 ° c . the reactor in which the reduction reaction is performed is held at reaction conditions for a period of time sufficient to achieve desired conversion while the reaction is periodically monitored by , e . g ., liquid chromatography . generally , the reaction is conducted for 5 to 15 hours . the resulting 2 , 4 , 6 - tris -[ 4 - aminoanilino ]- 1 , 3 , 5 - triazine is separated out by filtration and recovered . this compound can be used as an intermediate for various other chemicals or as an end product . optionally , the 2 , 4 , 6 - tris -[ 4 - aminoanilino ]- 1 , 3 , 5 - triazine can be used to synthesize n - alkyl - p - phenylene diamino - 1 , 3 , 5 - triazines , which are useful as antiozonants , as mentioned above . the tris substituted compound is preferred . thus , the 2 , 4 , 6 ,- tris -[ 4 - aminoanilino ]- 1 , 3 , 5 - triazine can be reacted with an alkylating agent in a reductive alkylation reaction , preferably in the presence of a catalyst ( e . g ., pt or pd on carbon , alumina , silica or other support ) under a hydrogen atmosphere at from about 200 - 1500 psi ( preferably 500 - 1200 psi , more preferable 600 - 1000 psi ), and a temperature of from about 100 ° c . to about 200 ° c . ( preferably 150 ° c . to 190 ° c ., more preferably 160 ° c . to about 180 ° c ). the alkylating agent can be , for example , a ketone or an aldehyde having from about 3 to about 20 carbon atoms , more preferably from about 5 to about 15 carbon atoms , and most preferably from about 6 to about 10 carbon atoms . the alkylating agent can be a saturated straight chain , branched chain or cycloalkyl structure . the reaction is conducted for a period of time sufficient to obtain the desired degree of alkylation . the 2 , 4 , 6 - tris -[ n - alkyl - p - phenylenediamino ]- 1 , 3 , 5 - triazines prepared in accordance with the method described herein are characterized by the formula ( v ): ## str6 ## wherein r 1 is an alkyl group selected from straight , chain , branched or cycloalkyl saturated structures having from about 3 to 20 carbon atoms , preferably about 6 to about 10 carbon atoms . in a two - liter , five - necked , round - bottom flask equipped with a thermocouple , a condenser , a mechanical stirrer , an addition funnel , and a nitrogen sweep were placed 40 grams ( 0 . 2 mole ) of 98 percent 4 - phenyl - azoaniline and 500 grams of toluene . finely ground 99 percent cyanuric chloride ( 0 . 05 mole , 9 . 3 parts ) was added with good stirring at 25 ° c . over a period of one hour the reaction mixture was heated to 110 ° c ., and held an additional seven hours at 110 ° c . during the hold time , triethylamine ( 0 . 15 mole , 15 . 3 parts ) was gradually added , and an additional 20 grams ( 0 . 1 mole ) of 4 - phenylazoaniline was added . the reaction was followed by high performance liquid chromatography by observing the disappearance of the starting cyanuric chloride and the conversion of the intermediate , dichloro , and monochlorotriazines to the trisubstituted compound . the title compound was isolated by filtration at 90 ° c . the filter cake was washed with 300 milliliters of 80 ° c . toluene , then with 300 milliners of 80 c . water to remove triethylamine hydrochloride , dried to a constant weight to give 78 . 7 percent yield ( 26 . 2 grams ) of 2 , 4 , 6 - tris [ 4 - phenylazo ) phenylamino ]- 1 , 3 , 5 - triazine . the melt point was 254 °- 257 ° c . the infrared spectrum was consistent with the structure . relative hplc analysis of the product showed it to be 95 . 8 percent pure . the toluene filtrate from example i was extracted with 250 milliters of water at 90 ° c ., then placed in the apparatus used in example i . ninety ( 90 ) parts ( 0 . 45 mole ) of 98 percent 4 - phenylazoaniline and 18 . 5 parts ( 0 . 1 mole ) of cyanuric chloride were added . over a period of 1 . 5 hours , the reaction mixture was heated to 110 ° c . and held at 110 ° c . for an additional three hours with the gradual addition of 30 . 6 parts ( 0 . 3 mole ) of triethylamine . the title compound was isolated at 90 ° c . by filtration , washed with 300 milliliters of 80 ° c . toluene and 300 milliliters of 80 ° c . water . the yield was 83 . 5 percent ( 55 . 6 grams ), and the hplc relative area analysis showed it to be 97 . 1 percent pure . the toluene filtrate from example ii , 120 parts ( 0 . 6 mole ) of 98 percent 4 - phenylazoaniline , 27 . 8 parts ( 0 . 15 mole ) of cyanuric chloride , 45 . 9 parts ( 0 . 45 mole ) of triethylamine were used to produce 100 . 9 parts ( 101 percent yield of the title compound by following the procedure of example ii . the hplc area percent assay was 96 . 9 percent . the toluene filtrate from example iii was extracted at 90 ° c . with 250 milliliters of water , then placed in the apparatus used in example i . then 300 milliners of toluene was distilled off , and 90 parts ( 0 . 45 mole ) of 98 percent 4 - phenylazoaniline , 27 . 8 parts ( 0 . 15 mole ) of cyanuric chloride , 45 . 9 parts ( 0 . 45 mole ) of triethylamine were used to produce 95 . 1 parts ( 95 . 2 ) percent yield ) of the title compound by following the procedure of example ii . the hplc are percent assay was 95 . 7 percent . the overall yield for the four reactions based on cyanuric chloride was 92 . 7 percent . this example illustrates alcohols which can be used to prepare the title compound . in a two - liter , four - neck , round - bottom flask equipped with a thermocouple , a mechanical stirrer , a condenser , and a nitrogen sweep were placed 80 grams ( 0 . 4 mole ) of 98 percent 4 - phenylazoaniline and 500 milliliters of isopropanol . the temperature was adjusted to 10 ° c ., and 9 . 3 grams ( 0 . 5 mole ) of finely ground cyanuric chloride was added . over a period of one hour the reaction mixture was heated to 80 ° c ., and held an additional four hours at 80 ° c . during the hold time , 6 grams ( 0 . 15 mole ) of finely ground sodium hydroxide was added . an additional 500 milliliters of isopropanol was added , and the title compound was isolated by filtration at 70 ° c . the filter cake was washed with 250 milliliters of 70 ° c . isopropanol , then with warm water to remove the sodium chloride , dried to a constant weight to give 87 . 9 percent yield ( 29 . 2 grams ) of 2 , 4 , 6 - tris -[ 4 -( phenylazo ) phenylamino ]- 1 , 3 , 5 - triazine . relative area hplc analysis showed it to be 91 . 4 percent pure . using the above procedure , the isopropanol portion of the filtrate was recycled four times . the results are shown in table 1 : table i______________________________________ grams rela - of tive grams of grams of 4 - sodium area , recycle cyanuric phenylazo - bicar - yield , yield % run chloride aniline bonate grams % assay______________________________________1 9 . 3 30 . 2 12 . 6 35 . 6 106 . 9 93 . 92 9 . 3 30 . 2 12 . 6 33 . 3 100 . 0 93 . 53 9 . 3 30 . 2 12 . 6 30 . 8 92 . 5 91 . 34 9 . 3 30 . 2 12 . 6 32 . 9 98 . 8 93 . 0______________________________________ the average yield based on cyanuric chloride was 97 . 2 percent with an average purity of 92 . 6 percent . in one 100 milliliter , four - neck , round - bottom flask equipped with a thermo - couple , a condenser , a mechanical stirrer , and a nitrogen sweep were placed 3 . 34 grams ( 0 . 005 mole ) of 2 , 4 , 6 - tris -[ 4 -( phenylazo ) phenylamino ]- 1 , 3 , 5 - triazine , 50 grams of isobutanol , 1 . 66 grams ( 0 . 033 mole ) of hydrazine hydrate and 0 . 15 gram of 5 percent palladium on carbon ( approximately 60 percent wet ). over a period of two hours , the mixture was heated to 70 ° c ., and held an additional ten hours at 70 ° c . the reduction was followed by high performance liquid chromatography by observing the disappearance of the starting tris - azo compound and the conversion of the intermediate di - and mono - azo compounds to the tris - amino compound and the formation of the by - product aniline . the title compound was isolated by filtration at 60 ° c . the filter cake was washed with 10 milliliters of isobutanol , dried to a constant weight to give 100 percent yield ( 2 grams ) of 2 , 4 , 6 - tris -[ 4 - aminoanilino ]- 1 , 3 , 5 - triazine . the melt point was 297 °- 299 ° c . the infrared spectrum was consistent with the structure . relative area hplc analysis showed it to be 97 . 8 percent pure . the filtrate was distilled to recover 1 . 1 grams of aniline , 78 . 6 percent of theory . a one - liter autoclave was charged with 18 . 7 grams ( 0 . 0281 mole ) of 2 , 4 , 6 - tris [ 4 -( phenylamino ] 1 , 3 , 5 triazine , 198 . 2 grams of isobutanol and 4 grams of 5 percent pd / c , 50 percent wet catalyst . the autoclave was sealed and pressure checked , purged two times with nitrogen , one time with hydrogen , and pressured to about 600 psi with hydrogen . the contents of the autoclave were heated to 100 ° c ., and held for three hours at 100 ° c . while maintaining the hydrogen pressure between 601 - 651 psi . the hydrogen take up was 96 percent of theory . the product was isolated by filtration , and weighed 11 . 1 grams ( 99 . 1 percent of theory ), and the hplc relative area analysis of the product showed to be 82 . 2 percent pure . a one - liter autoclave was charged with 50 grams ( 0 . 125 mole ) of 2 , 4 , 5 - tris -[ 4 - aminoanilino ]- 1 , 3 , 5 - triazine , 250 grams ( 2 . 19 moles ) of 5 - methyl - 2 - hexanone , and 4 . 78 grams ( dry weight ) of 3 percent pd / c catalyst . the autoclave was sealed and pressure checked , purged two times with nitrogen , two times with hydrogen , and pressured to about 900 psi with hydrogen . the contents of the autoclave were heated to 165 ° c ., and held for 3 . 5 hours at 164 ° c . while maintaining the hydrogen pressure between 604 - 904 psi . the hydrogen take up was 94 percent of theory . the catalyst was removed by filtration with the aid of celite . the excess methyl isoamyl ketone was removed by vacuum distillation . the residue was 76 grams ( 87 . 6 percent of theory ), and the hplc assay was 84 . 4 percent . | 2 |
hereinafter , an embodiment of an airbag module removal structure according to the present invention will be described with accompanying drawings . fig1 to 5 are explanation views respectively illustrating an airbag module removal structure according to the present invention . in fig1 to 5 , a reference numeral 1 denotes a steering member , a reference numeral 2 denotes a resin lid portion of an instrument panel , a reference numeral 2 a denotes a fragile groove formed inside the resin lid portion 2 , a reference numeral 3 denotes an airbag module , and a reference numeral 4 denotes an inflator of the airbag module 3 . the resin lid portion 2 is provided with a pair of locking brackets 5 , 6 spacing in the front and back direction of the vehicle . the locking brackets 5 , 6 are provided with engagement holes 5 a , 6 a . a mounting bracket 7 is welded and secured to the steering member 1 . a case body 3 a of the lower portion side of the airbag module 3 is provided with a mounted bracket 8 . the mounted bracket 8 is secured to the mounting bracket 7 by a fixing bolt 9 . a case body 3 b of the upper portion side of the airbag module 3 is provided with side walls 3 c , 3 d in the front and back direction of the vehicle . a pair of the hook members 10 , 11 is disposed in the side walls 3 c , 3 d . the hook member 10 is engageable with an engagement hole 5 a , and the hook member 11 is engageable with an engagement hole 6 a . the distance in the front and back direction of the vehicle between a pair of the locking brackets 5 , 6 is formed slightly larger than a size in the front and back direction of the vehicle of the case body 3 b of the airbag module 3 , and the case body 3 b is located between a pair of the locking brackets 5 , 6 . the hook member 10 comprises a fixed part 10 a secured to the case body 3 , a penetrating direction bending part 10 b which is bended with respect to the fixed part 10 a and extends in the direction penetrating the engagement hole 5 a , and an engagement bending part 10 c which is bended downwardly with respect to the penetrating direction bending part 10 b and engages with the lower portion wall 5 b of the locking bracket 5 . the hook member 11 comprises a fixed part 11 a secured to the case body 3 b , a penetrating direction bending part 11 b which is bended with respect to the fixed part 11 a and extends in the direction penetrating the engagement hole 6 a , and an engagement bending part 11 c which is bended downwardly with respect to the penetrating direction bending part 1 b and engages with the lower portion wall 6 b of the engagement bracket 6 . as illustrated in an enlarged view of fig6 , a size l 1 in the up and down direction of the engagement hole 5 a is about a size capable of removing the engagement bending part 10 c from the engagement hole 5 a when the airbag module 3 is lifted obliquely upward as shown by an arrow a 1 . a size l 2 in the up and down direction of the engagement hole 6 a is about a size capable of removing the engagement bending part 11 c from the engagement hole 6 a when turning the airbag module 3 as described below . the airbag module 3 is secured by the steering member 1 and a pair of locking brackets 5 , 6 such that the side wall 3 c of the vehicle front side of the case body 3 b becomes the upside and the side wall 3 c of the vehicle back side of the case body 3 b becomes the downside . a size l 3 of the penetrating direction bending part 11 b is made to be larger than a size l 4 of the penetrating direction bending part 10 b , and a clearance h 1 between the fixed part 11 a and the locking bracket 6 is structured to be larger than a clearance h 2 between the fixed part 10 b and the locking bracket 5 with a state that the airbag module 3 is secured to the resin lid portion 2 of the instrument panel . as shown in the partially enlarged view of fig7 , in the inner wall shape of the locking hole 5 a of the locking bracket 5 , the lower portion side of the inner wall of the locking hole 5 a is formed with a taper face 5 c in the pulling out direction such that the engagement bending part 10 c does not hook into the inner wall of the locking hole 5 a when the airbag module 3 is lifted obliquely upward to pull out the engagement bending part 10 c from the locking hole 5 a . in addition , the taper face 5 c may be not only a liner inclined plane but also a curvature surface . according to the airbag module removal structure , the fixing bolt 9 shown in fig1 is removed , the airbag module 3 is lifted in the direction shown by the arrow a 1 in fig1 , the airbag module 3 is shifted as shown by the arrow a 2 in fig2 such that the clearance h 1 between the airbag module 3 and the locking bracket 6 becomes small to release the engagement between the locking bracket 5 and the hook member 10 , the airbag module 3 is turned in the direction shown by the arrow a 3 while maintaining the engagement between the locking bracket 6 and the hook member 11 as shown in fig3 , and the hook member 11 is pulled out from the engagement hole 6 a as shown by the arrow a 4 in fig4 . ultimately , as illustrated in fig5 , the airbag module 3 can be easily removed from the vehicle by pulling out the airbag module 3 downwardly in the direction shown by the arrow a 5 from the clearance between the steering member 1 and the locking bracket 6 . according to the above airbag module removal structure , the size of the penetrating direction bending part 11 b of the hook member 11 of the vehicle back side is formed larger than the size of the penetrating direction bending part 10 b of the hook member 10 of the vehicle front side , and the clearance h 1 between the fixed part 11 a of the hook member 11 of the vehicle back side and the locking bracket 6 for locking the hook member 11 of the vehicle back side is structured to be larger than the clearance h 2 between the fixed part 10 a of the hook member 10 of the vehicle front side and the locking bracket 5 for locking the hook member 10 of the vehicle front side , with a state that the airbag module 3 is secured to a pair of the locking brackets 5 , 6 . therefore , the airbag module 3 can be shifted to the side of the locking bracket 6 , which is the locking bracket 6 of the vehicle back side and is positioned lower than the locking bracket 5 of the vehicle front side , when releasing the engagement between the hook member 10 of the vehicle front side and the locking bracket 5 of the vehicle front side . accordingly , the locking bracket 6 of the vehicle back side can receive the own weight of the airbag module 3 when releasing the engagement between the hook member 10 of the vehicle front side and the locking bracket 5 of the vehicle front side , so that an effort for removing the airbag module 3 can be reduced , and a facility of removing an airbag module can be further improved . moreover , in the above airbag module removal structure , when the airbag module 3 is shifted obliquely upward to pull out the hook member 10 of the vehicle front side from the locking hole 5 a of the locking bracket 5 of the vehicle front side , the hook member 10 can be smoothly pulled out because the inner wall surface of the lower portion wall 5 b constructing the engagement hole 5 a is formed with the taper face 5 c , in order to prevent the engagement bending portion 10 c of the hook member 10 from hooking into the inner wall surface constructing the locking hole 5 a of the locking bracket 5 of the vehicle front side . according to the above airbag module removal structure in one embodiment of the present invention , the airbag module can be easily removed from the instrument panel ; thus , the airbag module can be easily disassembled . the patent disclosure relates to subject matter contained in previous japanese patent application no . 2004 - 152679 , filed on may 24 , 2004 , the content of which is herein expressly incorporated by reference in its entirety . fig1 is an explanation view illustrating one embodiment of an airbag module removal structure according to the present invention , and an explanation view showing a state that an airbag module is secured to a steering member and a locking bracket of a resin lid portion . fig2 is an explanation view illustrating a state that an engagement between a hook member of vehicle front side and an locking bracket of vehicle front side is released . fig3 is a view showing a state that an airbag module is downwardly turned while maintaining an engagement between a hook member of vehicle back side and a locking bracket of vehicle back side . fig4 is an explanation view showing a state just after the engagement between the hook portion of the vehicle back side and the locking bracket of the vehicle back side has released . fig5 is an explanation view illustrating a state that the airbag module is pulled out downwardly . fig6 is an enlarged explanation view showing a state that the airbag module shown in fig1 is secured to the steering member and the locking bracket of the resin lid portion . fig7 is a partially enlarged view of the lid portion shown in fig1 . | 1 |
as shown in fig1 - 6 , a flexible vertical grinder is illustrated . a casing 2 is fixed on a grinder frame 1 , a main shaft mounting frame 4 is located on the grinder frame 1 , a main shaft 3 is mounted on the main shaft mounting frame 4 , a large pulley 5 is mounted to a lower end of the main shaft 3 , a spoke 6 of the large pulley 5 is downwardly spiral ; a material unloading bucket 8 is mounted to a lower end of the casing 2 within the grinder frame 1 , a material receiving bucket 7 is located at an upper side face of an outer edge of an inner ring of the large pulley 5 , the material receiving bucket 7 is sleevedly mounted on an outer side face of a lower end of the material unloading bucket 8 ; an arched material feeding bucket 11 is mounted on an upper end of the casing 2 ; a stelliform bracket 9 is mounted on the main shaft 3 within the casing 2 , an upper end of the stelliform bracket 9 is fixed on the main shaft 3 by a pressure plate 10 , a hammer wheel grinding device and a material - sorting balance wheel device are mounted on the stelliform bracket 9 ; the hammer wheel grinding device comprises a swing arm 18 , the swing arm 18 is mounted on the stelliform bracket 9 by a swing arm shaft 15 , a balance hammer 23 is mounted to one end of the swing arm 18 , a hammer wheel shaft 16 is mounted to the other end of the swing arm 18 , a hammer wheel 17 is mounted on the hammer wheel shaft 16 , a grind ring 12 is mounted to an inner wall of the casing 2 corresponding to the hammer wheel 17 , a reducing flow ring 19 is mounted below the grind ring 12 ; the material - sorting balance wheel device comprises a material - sorting balance wheel 14 , the material - sorting balance wheel 14 and the hammer wheel 17 are on a same horizontal plane , the material - sorting balance wheel 14 is mounted to one end of a swing rod 13 by a material - sorting balance wheel shaft 34 , the other end of the swing rod 13 is mounted on the stelliform bracket 9 by a swing rod shaft 38 ; a cross section of the arched material feeding bucket 11 is trapezoidal , the arched material feeding bucket 11 is mounted on an inner wall of a circular ring pressure plate 22 , the circular ring pressure plate 22 is fixed to the upper end of the casing 2 ; at least two layers of hammer wheel grinding devices and material - sorting balance wheel devices are mounted on the stelliform bracket 9 ; a material scraping plate 21 is mounted to a lower end of the hammer wheel shaft 16 ; the swing arm shaft 15 is mounted on the stelliform bracket 9 by a swing arm bearing 32 , two bearing dustproof caps 31 are respectively mounted at an upper side and a lower side of the swing arm bearing 32 , the swing arm 18 is mounted on the swing arm shaft 15 by a locking screw 33 ; a hammer wheel seat 26 is mounted on the hammer wheel shaft 16 , the hammer wheel seat 26 is mounted on the hammer wheel shaft 16 by a hammer wheel seat locking screw 29 , a hammer wheel bearing 27 is mounted between the hammer wheel shaft 16 and the hammer wheel seat 26 , two hammer wheel bearing dustproof caps 25 are respectively mounted at an upper end and a lower end of the hammer wheel bearing 27 , a ring gasket 28 is mounted on the hammer wheel shaft 16 between the hammer wheel bearing 27 and the swing arm 18 , the hammer wheel 17 is mounted on the hammer wheel seat 26 by a hammer wheel pressure ring 24 ; a material - sorting balance wheel seat 35 is mounted on the material - sorting balance wheel shaft 34 , a balance wheel seat bearing 36 is mounted between the material - sorting balance wheel shaft 34 and the material - sorting balance wheel seat 35 , two balance wheel seat bearing dustproof caps 37 are respectively mounted at an upper end and a lower end of the material - sorting balance wheel seat 35 , the material - sorting balance wheel 14 is mounted on the material - sorting balance wheel seat 35 ; a material - sorting balance wheel shaft sliding sleeve 40 is mounted between the two balance wheel seat bearing dustproof caps 37 and the material - sorting balance wheel shaft 34 , a sealing ring 41 is mounted between a contacting surface of the material - sorting balance wheel shaft sliding sleeve 40 and a contacting surface of the material - sorting balance wheel shaft 34 , a sliding sleeve 39 is mounted between a contacting surface of the swing rod 13 and a contacting surface of the swing rod shaft 38 ; the material - sorting balance wheel 14 is made of rubber ; a plurality of material screening holes 42 are provided on a horizontal ring surface of the reducing flow ring 19 . while starting , the main shaft 3 drives three sets of hammer wheel grinding devices to operate , the hammer wheel 17 gradually closes to the inner wall of the grind ring 12 , produces a linear pressure to the inner wall of the grind ring 12 under the effect of the inertial centrifugal force and rotates relying on the friction ; while materials falling , the hammer wheel 17 grinds the materials , an inertial centrifugal force is simultaneously produced at the other end of the swing arm 18 , the swing arm shaft 15 of the swing arm 18 is taken as a fulcrum , based on the principle of planar force system , a balancing moment is produced on the fulcrum , a ground pressure of the hammer wheel 17 can be adjusted by adjusting a corresponding position of the balance hammer 23 or changing a weight thereof according to material grinding levels , the ground pressure of every layer can be set , the ground pressure of the grinding layer without meeting the level requirements is correspondingly adjusted to achieve the best effect . the rubber material - sorting balance wheel 14 of the material - sorting balance wheel device and the hammer wheel 17 are evenly dislocated and distributed at the same rotary plane . while operating the main shaft 3 , the three sets of material - sorting balance wheel devices are driven , the rubber material - sorting balance wheel 14 runs along the inner wall of the grind ring 12 under the effect of the inertial centrifugal force and flexibly contacts with the inner wall of the grind ring 12 . under the loop wall friction , the rubber material - sorting balance wheel 14 also can revolve on its own axis . while materials falling , the rubber material - sorting balance wheel 14 presses the materials to the inner wall of the grind ring 12 . after the rubber material - sorting balance wheel 14 leaves , the materials are transiently stagnated and ground by the subsequent hammer wheel 17 . if the material bed of the falling materials is uneven , the rubber material - sorting balance wheel 14 is capable of flexibly crushing the materials on the loop wall to the vacancy of the inner wall of the grind ring 12 for stabilizing the material bed so as to allow the hammer wheel 17 to continuously evenly grind the materials . the material scraping plate 21 is capable of being mounted to the lower portion of every hammer wheel shaft 16 , and the shape of the material scraping plate 21 can be a straight line or a curve . while the hammer wheel 17 grinding the materials , the radial micro swing is produced to drive the material scraping plate 21 to vibrate for scraping the materials accumulated on the inner wall of the casing 2 . | 1 |
as used herein , “ tobacco ” refers to any part , e . g ., leaves or lamina and stems , of burley , dark air - cured , dark - fired , flue cured , oriental , cigar filler or wrapper , and rare and / or specialty tobaccos . tobacco suitable for use in the invention can be whole leaves or stems , or the tobacco may be shredded , cut , or otherwise processed . tobacco useful in the invention may be in the form of a finished smokeless tobacco product , including but not limited to , moist snuff , dry snuff , or chewing tobacco . for example , tobacco suitable for use in the invention can be fermented or unfermented tobaccos , cured ( e . g ., air cured ), burley , dark , dark - fired , flue cured , oriental , and cigar filler or wrapper . the tobacco used in the invention can be mixed with other additives or flavors as known in the smokeless tobacco art . hence , the percentages used herein with respect to tobacco may be with respect to tobacco alone or to tobacco in combination with various known additives . chewing tobacco and snuffs are often treated with any of a number of flavors to diminish some of the less desirable taste characteristics sometimes associated with the tobacco . the addition of flavors requires solvent systems for spraying , which are generally added during the preparation process of tobacco products . the method of spraying can be costly and the flavor can sometimes deteriorate during product preparation and upon storage . further , this method has not been very successful in transferring certain flavors to smokeless tobacco . the invention therefore provides a novel method to impart flavors into a smokeless tobacco product without the traditional flavor application systems . after choosing an appropriate tobacco type , the tobacco can be chopped or ground to an appropriate size depending on the type of smokeless tobacco product being made . the material can be further separated based on size by passing the cut tobacco over a screen for sizing . the methods of chopping or grinding of the tobacco may be accomplished using the methods known in the art for that purpose . as described herein , the moisture content , the ph , and the salt concentration of tobacco is critical in preparing palatable flavored smokeless tobacco . moisture content , ph , and salt concentration of tobacco can be measured using methods known to those of skill in the art . tobacco suitable for use in the invention typically has a moisture content of between 25 % and 60 %, e . g ., at least 25 %, 30 %, 35 %, 40 %, 45 %, 50 %, 55 %, or 60 %; a ph of between 7 . 0 and 8 . 5 , e . g ., at least 7 , or 8 ; and a salt concentration of between 1 % and 10 %, e . g ., at least 1 %, 2 %, 3 %, 4 %, 5 %, 6 %, 7 %, 8 %, 9 %, or 10 %. the invention provides for a flavored smokeless tobacco . a flavored smokeless tobacco refers to any smokeless tobacco that has been imparted with a flavor from a solid flavor agent . as used herein with respect to flavors , the term “ impart ” means to transfer or convey the desired flavor characteristic or note from one or more solid flavor agents to the tobacco . a solid flavor agent refers to any type of solid substrate ( e . g ., beans , nibs , nuts , and sticks ) having the ability to impart a flavor . representative flavor beans include , but are not limited to , coffee beans , vanilla beans , and cocoa nibs . representative flavor nuts include , but are not limited to , almonds , peanuts , cashews , walnuts , pecans , and pistachios . solid flavor agents for use in the invention can be whole beans , nuts , or sticks . alternatively , solid flavor agents such as beans , nuts , or sticks can be ground using known methods . generally , the amount of a solid flavor agent present in a flavored smokeless tobacco composition is from about 1 % to about 30 % by weight . the mixture of tobacco and flavor beans or nuts is combined by any number of methods known in the art including mixing , stirring , rotating , vibration , shaking , and the like . the mixture is stored for a period of at least 2 days ( e . g ., at least 7 days , at least 10 days , at least 2 weeks ) prior to use , which may vary depending upon the temperature and the solid flavor agent used . while the transference of flavor can be detected in about 2 days , leaving the mixture for longer periods of time allows for greater levels of flavor to develop . the solid flavor agent can be removed from the tobacco by conventional separation techniques or can remain in the final product . separation techniques include a variety of methods known in the art such as sifting based on particle size . flavor beans or nuts may differ in taste and / or flavor depending upon the variety of bean or nut and the environment in which the bean or nut is grown . for example , there are numerous types of coffee beans with distinctive flavors , including arabica , brazillian santos , columbian supremo , costa rican , ethiopian harrar , hawaiian kona , kenya aa , jamaica , sumatra , tanzanian peaberry , and zimbabwe . in addition , coffee beans used as a solid flavor agent of the invention can be roasted or not , and can be natural or decaffeinated . a flavored smokeless tobacco of the invention may possess one or more flavoring components in addition to a solid flavor agent . for example , coffee beans can further include one or more flavoring components commonly used in the coffee industry ( e . g ., hazelnut and french vanilla , as exemplified herein ). combinations of beans and / or nuts and / or sticks ( e . g ., cinnamon sticks ) can be mixed together with the smokeless tobacco to provide new and distinct flavors . the invention will be further described in the following examples , which do not limit the scope of the invention described in the claims . a method for the production of a coffee flavored smokeless tobacco product was performed using smokeless tobacco and french roast arabica beans . tobacco leaves were selected that had a moisture content of 24 - 26 %. the tobacco leaves were processed through a cutter into strips . the moisture content was increased to approximately 60 % by the addition of water and the ph was raised to 7 . 9 . the final salt concentration was approximately 7 . 5 %. about 3 % ( by weight ) whole french roast coffee beans were combined with processed tobacco and stored at room temperature for up to two weeks . smokeless tobacco samples were found to have distinct flavor characteristics of french roast coffee upon chewing after 2 days of storage , and the flavor increased in intensity with longer storage times . a method for the production of a hazelnut flavored smokeless tobacco product was performed using smokeless tobacco and hazelnut flavored arabica beans . tobacco leaves were selected that had a moisture content of 24 - 26 %. the tobacco leaves were processed through a cutter into strips . the moisture content was further increased to approximately 60 % by the addition of water , and the ph was raised to 7 . 9 . the final salt concentration was approximately 7 . 5 % salt . about 3 % ( by weight ) whole hazelnut coffee beans were combined with processed tobacco and stored at room temperature for up to two weeks . smokeless tobacco samples were found to have distinct flavor characteristics of hazelnut coffee upon chewing after 2 days of storage , and the flavor increased in intensity with longer storage times . a method for the production of a french vanilla flavored smokeless tobacco product was performed using smokeless tobacco and french vanilla arabica beans . tobacco leaves were selected that had a moisture content of 24 - 26 %. the tobacco leaves were processed through a cutter into strips . the moisture content was further increased to approximately 60 % by the addition of water , and the ph was raised to 7 . 9 . the final salt concentration was approximately 7 . 5 % salt . about 3 % ( by weight ) whole french vanilla coffee beans were combined with processed tobacco and stored at room temperature for up to two weeks . smokeless tobacco samples were found to have distinct flavor characteristics of french vanilla coffee upon chewing after 2 days of storage , and the flavor increased in intensity with longer storage times . it is to be understood that while the invention has been described in conjunction with the detailed description thereof , the foregoing description is intended to illustrate and not limit the scope of the invention , which is defined by the scope of the appended claims . other aspects , advantages , and modifications are within the scope of the following claims . | 0 |
fig1 and 2 show a first example of a planetary screw drive that was produced according to the method according to the invention from a kit according to the invention . a lead screw nut 1 is arranged according to fig1 on a single - thread threaded lead screw 2 . in a ring gap 3 formed by the lead screw nut 1 and the threaded lead screw 2 there is a planetary roller set 4 that is formed from several different planetary rollers 5 . the planetary rollers 5 are shown in fig2 . a total of six planetary rollers 5 are used , of which three have different shapes relative to each other ; these different types are designated below with type a , type b , and type c . all of the planetary rollers 5 are provided with a planetary roller - side groove profile 6 that has a middle groove profile 6 a and outer groove profiles 6 b and 6 c placed on the two axial sides of the groove profile 6 a . this groove profile 6 consists of endless grooves 7 that are arranged around the planetary rollers and parallel to a plane arranged perpendicular to the rotational axis of the planetary rollers 5 . these grooves 7 are limited by endlessly circulating teeth 8 that have tooth flanks , wherein these tooth flanks end in a tooth tip . the planetary rollers 5 shown here each have two middle groove profiles 6 a that are arranged at an axial distance to each other and are provided with outer groove profiles 6 b and 6 c on its two axial sides . the middle groove profile 6 a is provided for engagement in a thread profile of the threaded lead screw 2 not shown in more detail . the outer groove profile 6 b , 6 c is provided for engagement in a nut - side groove profile of the lead screw nut 1 not shown in more detail . three different types of planetary rollers 5 are provided ; two planetary rollers 5 of type a , two planetary rollers 5 of type b , and two planetary rollers 5 of type c . the types a , b , c differ in that the middle groove profiles 6 a are axially offset relative to each other by a pitch offset delta t . this pitch offset is specified by the lead of the thread profile of the threaded lead screw 2 : if all of the planetary rollers 5 arranged distributed around the circumference are arranged axially aligned — as shown in fig2 — circumferentially successive planetary rollers 5 must have an axially offset middle groove profile 6 a based on the lead ; this pitch offset is dependent on the circumferential distance of adjacent planetary rollers 5 . none of the three types of planetary rollers 5 is mirror - symmetric to an axis that coincides with a middle vertical line that is set up on the rotational axis of the planetary rollers 5 in the axial middle of the planetary rollers . this means the sequence and orientation of the planetary rollers 5 in the planetary screw drive is specified . in fig2 , the types a , b , c are arranged in one orientation and the types a , b , c are arranged in the opposite orientation . the shown sequence is provided for the single - thread planetary screw drive according to fig1 . fig3 shows , in a schematic view , another double - thread planetary screw drive that differs from the planetary screw drive according to fig1 essentially by a double - thread threaded lead screw 11 and by a changed planetary roller set 12 formed from planetary rollers 9 . fig4 shows a section of a winding uncoiled in the plane in a double - thread planetary screw drive according to the invention according to fig3 , but with modified planetary rollers 9 that have only one middle groove profile 9 a and outer groove profiles 9 b , 9 c located at its axial sides . in the double - thread planetary screw drive according to fig3 and 4 , three different types a , b , c — as in the first embodiment — are provided with a pitch offset delta t of the middle groove profile 9 a . these planetary rollers 9 are distributed in the shown sequence across the circumference arranged around the threaded lead screw 2 . this arrangement corresponds to the image in fig3 . the thread profile 10 uncoiled in the plane is to be clearly taken with the schematically indicated two threads . a continuous line shows one thread of the double - thread thread profile 10 and a dashed line shows the other thread . the lead p of the thread profile 10 indicates the axial distance between a start and an end of one full winding of the thread profile 10 . the pitch t indicates the axial distance between the grooves of the adjacent threads . according to the method according to the invention , the planetary roller set 12 shown in fig3 and 4 were derived from basic planetary rollers of a basic planetary roller set in which all of the basic planetary rollers were each selected twice , wherein the orientation of the planetary rollers 9 of type b were arranged opposite the orientation of the planetary rollers 9 of types b and c . fig5 shows a section of a winding uncoiled in the plane in another double - thread planetary screw drive according to the invention with the same planetary rollers 9 as in fig4 . the difference with the embodiment according to fig4 consists in that the lead screw diameter of the threaded lead screw was increased considerably and instead of six planetary rollers 9 of types a , b , c , a total of 12 planetary rollers 9 of types a , b , c were used . these 12 planetary rollers 9 form a complete planetary roller set 13 . in this embodiment , all of the types are arranged in both , that is opposite , orientations around the lead screw axis . in these three described embodiments , the three planetary roller sets 4 , 12 , 13 are assembled from two basic planetary roller sets . the planetary roller set 4 is assembled from a first basic planetary roller set that is formed by the three basic planetary rollers 5 , one of type a , one of type b , one of type c . each basic planetary roller 5 is provided twice in the planetary roller set 4 . the planetary roller set 12 is assembled from a second basic planetary roller set that is formed by the three basic planetary rollers 9 , one of type a , one of type b , one of type c . each basic planetary roller 9 is provided twice in the planetary roller set 12 . the planetary roller set 13 is assembled just like the planetary roller set 12 from the second basic planetary roller set that is formed by the three basic planetary rollers 9 , one of type a , one of type b , one of type c . each basic planetary roller 9 is provided four times in the planetary roller set 13 . the kit according to the invention provides for threaded lead screws of the same number of threads and different diameters of a common basic planetary roller set from which the planetary rollers of each planetary roller set are assembled . the selection and assembly of the planetary rollers from the kit allows the production of planetary screw drives that allow a problem - free rolling contact between the planetary roller and threaded lead screw . the sequence and orientation of the planetary rollers within a planetary roller set is given from the geometry of the threaded lead screw . in all of the embodiments described here , the planetary rollers are arranged distributed uniformly across the circumference of the threaded lead screw . | 5 |
the tool generally designated by 1 has an elongated structural shape and consists of a rod - shaped tool shank 2 and a processing section 3 which adjoins one end of said tool shank and is thickened at least in a cross - sectional dimension in the form of a head , as a result of which a front broad side 4 a , a rear broad side 4 b and two narrow sides 4 c , 4 d extending transverse thereto are present which extend substantially along the centre axis 5 of the tool 1 . the lateral face of the processing section 3 disposed on the front broad side 4 a is a broad lateral face 7 , extending upwards in substantially straight manner and optionally flat , which extends parallel to the centre axis of the tool shank 2 or of the processing section 3 or may include with said centre axis an acute angle w of about 3 to 80 , in particular about 5 °, which is closed towards the free front end . in this connection the broad lateral face 7 and the associated circumferential surface of the tool shank 2 may pass into one another at an obtuse angle , or the broad lateral face 7 may be offset laterally outwards , so that a stepped face 8 is present in between . the narrow - side lateral faces 4 c , 4 d extend substantially parallel to the centre axis 5 , whereby in the transverse direction they may likewise be arranged parallel to one another or may include an acute angle w1 which may amount to about 10 to 200 and is open in the radially outward direction . on the front face 6 the processing section 3 comprises a first front - face section 9 which extends transverse to the centre axis 5 , preferably passes in rounded manner into the broad lateral face 7 and includes with the centre axis 5 an angle w2 of about 90 ° to 100 °, preferably a slightly obtuse angle of about 95 ° which is open towards the tool shank 2 . the front - face section 9 is adjoined laterally by a chamfered processing face 11 which includes with the centre axis 5 an obtuse angle w3 that is greater than the angle w 2 and amounts to about 120 ° to 135 °. the rear broad lateral face 12 may — seen in the side view according to fig1 and 2 — be convex or straight , intersecting the chamfered processing face 11 at an acute angle . this apex edge is preferably broken or rounded . the width a of the front - face section 9 amounts to about 0 . 4 to 0 . 6 mm , preferably about 0 . 5 mm , and corresponds approximately to one half of a conventional wall thickness b of a crown of about 0 . 8 to 1 . 2 mm . the width c of the front side 6 is the same or somewhat greater than the wall thickness b . the width d of the processing section 3 extending transverse thereto is approximately the same as or gr eater than the cross - sectional dimension of the circular tool shank 2 and amounts to about 2 mm to 2 . 5 or up to 3 mm , preferably about 2 . 2 mm . the chamfered processing face 11 is studded with a plurality of cutting edges which , given an oscillating movement proceeding parallel to the apex line 13 between the chamfered processing face 11 and the front - face section 9 , are suitable to remove material from the tooth z by machining . in particular when the amplitudes of an oscillating movement are relatively small , the amplitudes may also be directed transverse to the apex line 13 or in different directions — ie , three - dimensionally . suitable for an abrasive working face 10 are a plurality of hard grains which are preferably fixed closely alongside one another on the chamfered processing face 11 . to this end the chamfered processing face 11 may be diamond - coated in grainy form in a manner known as such . since the abrasive grains on the chamfered processing face 11 form a layer having a certain thickness which at its margin bordering the front - face section 9 forms a small step in the front side 6 , it is advantageous either to make the working face 10 deeper in stepped manner by a thickness e corresponding to the thickness of the grains or to cause the grains in the region of the apex line 13 to taper towards the front - face section 9 , as a result of which a step at the margin of the abrasive coating is prevented . in the course of the manufacture of the tool 1 the depression v produced beforehand is filled out with an abrasive layer . for the retention and guidance of the tool 1 and also for the drive thereof , the handpiece 14 is provided which comprises an elongated round gripping sleeve 15 in the form of a casing in which a vibration generator 16 , operated electrically or pneumatically for example , is arranged which transmits its vibrational energy to a handpiece shank 17 supported in the handpiece 14 and protruding beyond its front end , in the front end region of which an attachment device 18 with a plug - in hole 19 for the tool shank 2 is disposed , the centre axis 21 of which extends transverse to , in particular approximately at a right angle to , the centre axis 22 of the handpiece shank 17 , so that the tool 5 juts out laterally from the handpiece shank 17 . a releasable securing element , a screw for example , is indicated in fig1 by an arrow . taking the confined spatial conditions in the oral cavity of a patient into account it is advantageous if the front end region of the handpiece shank 17 is somewhat bent or angled towards the side facing away from the tool 1 , preferably by an angle w4 of about 5 to 15 °, in particular about 100 , so that the centre axis 5 of the tool 1 includes with the centre axis of the handpiece 14 an obtuse angle w 5 of about 1000 . for the preparation of the tooth z indicated in fig1 said tooth is prepared on its circumferential surface by machining preferably with a rotating processing tool so as to form a tooth stump 25 , the circumferential surface of which is designated by 25 a and the stepped face of which is designated by 25 b . the angle included between the two last - named faces corresponds roughly to the angle w2 between the broad lateral face 7 and the front - face section 9 . with a view to working the chamfered face 25 c in by machining , the tool 1 is inserted with the handpiece 14 into the free space f pertaining to the preparation for the crown in such a way that the broad lateral face 7 abuts the circumferential surface 25 a , and then after activation of the vibration generator 16 and abutment of the chamfered processing face 11 on the outer margin of the stepped face 25 b the tool 1 is moved in the peripheral direction of the tooth stump 25 , whereby the chamfered processing face 11 or working face 10 removes the marginal region of the stepped face 25 b by machining and works in the chamfered face 25 c on the tooth z . in the course of the movement in the peripheral direction the tool 1 receives good guidance by virtue of the abutment of the broad lateral face 7 on the circumferential surface 25 a and of the front - face section 9 on the stepped face 25 b , which are consequently guide faces . however , within the scope of the invention good guidance is also already guaranteed when only the broad lateral face 7 abuts the circumferential surface 25 a . within the scope of the invention it is therefore possible for the abrasive working face 10 to extend not only in the region of the chamfered processing face 11 but also at least over a part of the front - face section 9 or as far as the base region of the broad lateral face 7 . with such a design the tool 1 is also suitable to process the stepped face 25 b by machining and consequently to achieve a well - fitting shape also on the stepped face 25 b . as can best be discerned from fig3 the tool 1 should be rotated about its centre axis 5 in the course of its advance in the peripheral direction of the tooth z , in order that the abutment of the broad lateral face 7 on the circumferential surface 25 a remains guaranteed . this is associated with a considerable ergonomic effort , since a rotation of the tool 1 about its centre axis 5 is only possible to a limited extent , particularly when the cramped spatial conditions in the oral cavity are taken into account . handling is significantly alleviated when , corresponding to the design according to the right side of fig1 the processing section 3 is supported with respect to the handpiece 2 so as to be rotatable about the centre axis 5 . with such a design an automatic rotary adjustment of the processing section 3 takes place in such a way that its broad lateral face 7 always abuts the circumferential surface 25 a and in the process of advancing the tool 1 in the peripheral direction the processing section 3 is rotated automatically as a result of the abutment pressure on the circumferential surface 25 a . with the design according to fig1 such a rotary joint 27 is disposed either between the processing section 3 and the tool shank 2 or in the region of the tool shank 2 . the rotary joint 27 may be constituted by a circular articular tenon 28 and an articular hole 29 receiving it with slight clearance which in the mated position are secured against being pulled apart axially by means of an interlocking device 20 , for example by means of an elastically engageable and releasable securing ring 31 which is seated in an annular groove in the tenon 28 or in the articular hole 29 and is capable of elastically engaging a corresponding mating groove on the respective other part . instead of a securing ring , a securing tenon that is capable of radially inward and outward spring deflection may also be provided which at its free end exhibits a constructional bevel or is rounded in the form of a sphere . with the design according to fig1 the articular tenon 28 is disposed on the processing section 3 and the articular hole 29 is disposed in the tool shank 2 . however , the rotary joint 27 may also be formed by the tool 1 being rotatably supported in a rotary joint 27 in the handpiece 14 or in the handpiece shank 17 . it is possible to construct such a rotary joint 27 by the tool shank 2 being supported by at least one bearing , in the seating hole 19 for example , so as to be rotatable about the centre axis 5 but being axially fixed , for example with the screw ( arrow ) which is set into an annular groove 27 a in the tool shank 2 or with an interlocking device ( not represented ). if a rotary joint 27 is present , the tool 1 can be held during its advance in the peripheral direction of the tooth stump 25 with its broad side 7 constantly in abutment with the circumferential surface 25 a , whereby the processing section 3 or the tool 1 overall constantly follows the circular contour of the circumferential surface 25 a and is thereby rotated . in this connection the handpiece 14 may remain in its normal position projecting into the oral cavity of the patient . the broad abutment face or lateral face 7 is preferably rounded in the shape of a cylinder or circular segment so as to conform to the circumferential surface 25 a , as a result of which the abutment is improved and stabilised . the radius of curvature r may amount to about 5 to 10 mm . the rear broad lateral face 12 may also be correspondingly rounded . with respect to the centre axis 35 of the tooth z the stepped face 25 b does not extend in rotationally symmetrical manner but in the form of a curve so as to conform to the gum z1 in the lateral region of the tooth z and in the approximal region , as fig1 and fig5 to 7 show . the front side 6 — ie , the front - face section 9 and the chamfered processing face 11 or working face 10 — are therefore , viewed in the oblique section iv — iv in fig1 formed in convex manner , in particular are rounded , the rounding being preferably adapted to the maximal curvature of the stepped face 25 b according to fig1 so that the shape of the curve of the stepped face 25 b according to fig1 can be worked out preferably in the normal position of the tool with respect to the centre axis 35 . however , the convex shape designated by 36 may also be constructed so as to be somewhat flatter than the curvature of the contour of the curve , since the tool 1 is also able to perform machining operations in somewhat oblique working positions , as represented on the left side of fig5 by way of example . with a shape that is rounded according to fig4 the radius r1 amounts to about 0 . 4 to 5 , in particular 3 mm . in this connection the processing section 3 , with direction of view towards its rear broad lateral face 12 , may be shaped in the sense of a spatula extending parallel or in the sense of a spatula that is convergent towards its free end , the corners at the free end being rounded ( see fig5 ) or the convergently tapering end being rounded ( fig6 ). the design according to fig5 is suitable for a slight concave curvature of the curved shape of the gum z1 , whereas the end shape according to fig6 with angular flanks or the end shape that is convergent in rounded manner is suitable for strong concave curvatures . this applies also to concave curvatures of the gum z1 according to fig7 . as fig8 and 9 show , the front - face section 9 and the chamfered processing face 11 may also extend in a straight line , whereby the angles w2 and w3 included respectively between them and the centre axis 5 of the tool 1 may amount to about 90 ° to 135 °. in this connection the abrasive working face 10 corresponding to the design according to fig2 may extend only as far as the front - face section 9 or alternatively over a partial region or the entire region of the front - face section 9 or alternatively as far as the associated end region of the broad lateral face 7 . in these designs the depression may extend a corresponding distance in the direction of the broad lateral face 7 , it being possible for it to extend beyond a facing part of the broad lateral face 7 , as is shown . on the rear it is advantageous to cause the depression v to terminate a short distance before the rear broad lateral face 12 . as a result , there is no longer a problematic sharp edge at the associated corner of the processing section 3 , which would be problematic with regard to possibilities of injury . the embodiment example according to fig1 differs from the two embodiment examples described above according to fig8 and 9 in that the step of the processing section 3 which is formed by the front - face section 9 and the chamfered processing face 11 is substantially continuously rounded , preferably in the sense of a uniform curvature , seen in the side view according to fig1 . with such a processing section 3 a rounded stepped face 25 b in the sense of a fillet is generated . also with this design the depression v may extend only in the exterior free end region of the fillet or alternatively over a partial region under the entire region of the front - face section 9 or alternatively over a facing part of the broad lateral face 7 . in this connection the entire front face 6 or its outer part may be an abrasive working face 10 . within the scope of the invention it is also possible for the abrasive working face 10 to extend over the entire region of the broad lateral face 7 , so that the circumferential surface 25 a can also be processed abrasively . in this connection it is furthermore possible for the broad lateral face 7 to extend over the entire height of the tooth stump 25 . with respect to its support and guidance and its abrasive action the functional region b of the processing head 3 consequently extends over a part of the lateral face 7 or over the entire lateral face 7 and over a part of the front face 6 or over the entire front face 6 . with all designs it is possible for a fine preparation of the free space f for the crown to be achieved partially or totally with the tool 1 according to the invention so as to conform to requirements with a high degree of precision . the remaining faces of the processing section 3 , for example the lateral faces 4 c , 4 d outside the convex shape 36 and in particular the rear lateral face 12 , are of smooth construction . by virtue of this , damage to the adjacent tooth z2 in the case of a position of the tool 1 in the approximal region is avoided . for the tool 1 there is a risk that when the tool 1 is prevented from executing an oscillating movement it can be overloaded and damaged by reason of an impulse effect resulting from the oscillating movement . with all designs of the tool 1 it is therefore advantageous to provide a damping means 41 in the region of the tool shank 2 . with the design according to fig1 the damping means 41 is located in the region of the tool shank 2 , preferably close to or on the processing section 3 or in the transitional region between the tool shank 2 and the processing section 3 . the damping means 41 damps the loading peaks resulting from the oscillating drive and acting on the tool 1 , as a result of which the tool is protected against overloads and the risk of damage to or breakage of the tool 1 is avoided or significantly reduced . in this connection the damping means 41 may be effective with respect to forces or impulses directed laterally and / or axially . the damping means 41 enables a relative movement between the sections of the tool 1 between which it is disposed , as a result of which the processing section 3 is kept supple by reason of the flexibility of the damping means 41 . although the damping means 41 transmits the motive force unchanged , the force is transmitted in yielding manner , so that when the tool 1 is prevented from executing its oscillating movement the motive - force peaks are attenuated . this is the case when the amplitudes of the oscillating movement are directed transverse to the working face 10 . with the design according to fig1 the damping element 41 is constituted by an intermediate member 42 made of elastically deformable material , for example plastic or rubber , which is disposed between two tool - shank parts or between the tool shank 2 and the processing section 3 and is firmly connected to these parts , for example by adhesion . such a damping element 41 is also effective in the peripheral direction . within the scope of the invention it is also possible to form the damping element 41 by means of another spring , for example a compression spring with coils or by means of a gas spring , instead of by means of an elastically deformable disc . the damping means 41 consequently enables both an axial relative movement of the processing section 3 and / or a flexure , the elasticity of the damping means 41 being so great that a minimal compressive force or a minimal flexural moment that is required for the abrasive processing is not fallen short of . by reason of the flexibility in the region of the damping means 41 a universally effective joint 45 is created that enables a lateral flexure of the processing section 3 relative to the tool shank 2 , as fig1 indicates . even in the case of such a flexure the aforementioned minimal torque is not fallen short of , so that the requisite pressure force for the abrasive processing can be transmitted despite flexure . the joint 45 consequently constitutes an oscillating joint in which the processing section 3 is centred by reason of the elastic flexibility . by reason of the flexibility , the handling during preparation is alleviated , since the processing section 3 can remain in its position in close contact with the tooth stump 25 and guided thereon , although the tool shank 2 is capable of bending outwards in the course of handling . with the design according to fig1 , in which like or comparable parts are provided with like reference symbols , the damping means 41 is integrated into the rotary joint 27 . in this case the damping means 41 may also be constructed in such a way that it is capable of damping lateral and / or axial impulses or loading forces and at the same time also permits a lateral bending or buckling movement of the processing section 3 . an essential part of the damping means 41 is a sleeve 42 and / or disc 43 , each made of elastic material such as , for example , plastic or rubber . the sleeve 42 is disposed between the circumferential surface of the articular tenon 28 and the circumferential surface of the articular hole 29 , whereby it may be secured firmly on the articular tenon 28 or firmly against the wall of the articular hole 29 , for example it may be fastened with adhesive . the disc 43 is disposed between the articular tenon 28 and the bottom of the articular hole 29 , whereby the disc 43 may also be secured on the front side of the articular tenon 28 or on the basal surface of the articular hole 29 , for example fastened with adhesive . in the case where the sleeve 42 is present , the damping means 41 is capable of damping lateral loading forces or impulses , whereby the processing section 3 is capable of backing away laterally . in the case where a disc 43 is present , the damping means 41 is capable of damping axial loading forces or impulses , whereby the processing section 3 is capable of backing away axially . if the sleeve 42 is part of the articular tenon 28 , the interlocking device 20 is disposed in the region of the wall of the articular hole 29 and in the region of the outer circumferential surface of the sleeve 42 . if the sleeve 42 is secured in the articular hole 29 , the interlocking device 20 is disposed in the region of the inner circumferential surface of the sleeve 42 and in the region of the circumferential surface of the articular tenon 28 . if the disc 43 is present , the interlocking device 20 should be constructed in such a way that it permits the possible axial contracting and stretching movements of the tool 1 . with the present design this is achieved in that the inner recess or outer recess for the interlocking element is greater by a measurement m than the associated cross - sectional measurement of the interlocking element , so that a relative displacement is possible between the two parts that are capable of interlocking . preferably both a sleeve 42 and a disc 43 are present , the damping means 41 preferably being constituted by a cap , as fig1 shows , which may be firmly disposed in the articular hole 29 or on the articular tenon 28 . with the design according to fig1 a locking device 51 is assigned to the rotary joint 27 , said locking device nullifying the free rotary capacity if the lateral loading on the tool 1 exceeds a predetermined force . this design is particularly advantageous in the case of a crown preparation . if the tool 1 is not to back away as a result of rotation in the course of a preparation , then the rotary joint 27 can be made rigid by activating the locking device 51 , so that the processing section 3 cannot back away and is able to perform machining operations in the particular rotary position . this is achieved by virtue of the fact that , in the region of the rotary joint 27 at a radial distance f around the processing section 3 , a locking ring 52 is disposed on the tool shank 2 or tool - shank part , here at the margin of the articular hole 29 , which in the event of a lateral movement or swivelling of the processing section 3 comes into engagement in non - positive manner with an opposite , second locking ring 53 on the processing section 3 by reason of friction or in positive manner by reason of an engagement with the tooth and thereby prevents the processing section 3 from rotating . the teeth , which are not represented , preferably extend parallel to the centre axis 5 , so that given the existence also of an axially effective damping means , here the disc 43 or the cap , the processing section 3 is able to execute an axial movement while it is in engagement with the tooth . if , for example , the processing section 3 is to be employed for a definite purpose and is to be effective by force at a particular processing site on the tooth , then during processing the lateral pressure on the processing section 3 is increased so intensely that the locking rings 51 , 52 , which are preferably moulded on in one piece , come into engagement and nullify the rotary capacity of the processing section 3 . after a diminution of the lateral loading the processing section 3 returns automatically , by reason of the restoring force of the sleeve 42 , to its centred position in which it can be used for abrasive processing by utilising its free rotary capacity . in those cases in which the damping element 41 is only effective axially , two locking rings 52 , 53 should be arranged at an axial distance e from one another in such a way that they come into engagement in the event of an axial movement of the processing section 3 . with the design according to fig1 two pairs of locking rings 52 , 53 and 52 a , 53 a are of appropriately angular construction so that the pair of rings 52 , 53 come into engagement in the event of a lateral movement and the pair of rings 52 a , 53 a come into engagement in the event of an axial movement . the interlocking device 20 makes it possible to equip an associated handpiece with a tool 1 or to exchange a tool 1 in easy - to - handle manner and quickly . it is therefore advantageous to provide , in the form of a set , several tools 1 that differ from one another , that are suitable for different preparatory operations and that can be inserted at will . in this connection it is preferably a question of tools 1 that differ with respect to their preparation shape and / or their capacity to remove material . it is advantageous to provide several tools 1 that have coarse and fine — or coarse , medium and fine — abrasive working faces and consequently enable coarse and fine processing operations and that may differ from one another with respect to their size and / or shape . all embodiments are suitable for short - stroke oscillations transmitted from the oscillation generator to the processing section 3 in the sense of a vibration at a frequency lying preferably in the sonic or ultrasonic range , it being possible for the oscillations or amplitudes to be directed transversely or lengthwise in linear manner or alternatively three - dimensionally . in the case of the present embodiment example the oscillating drive has a frequency of movement of about 4 to 8 khz , in particular about 6 khz , resulting in an amplitude of the three - dimensional movements of about 0 . 05 mm to 0 . 25 mm or up to 0 . 5 mm , in particular of about 0 . 1 mm , in the region of the processing section 3 . | 0 |
fig1 depicts a first steering column 3 with a steering shaft bearing unit 1 according to the invention . by a bracket part 7 , it can be secured on a body of a motor vehicle not shown here . fig2 shows a vertical section through this steering column 3 along a clamp bolt 13 . in particular , fig2 shows especially clearly that the bracket part 7 comprises two side jaws 15 between which the steering shaft bearing unit 1 is retained . in the steering shaft bearing unit 1 , the steering shaft 2 is supported such that it is rotatable about its longitudinal axis 35 . the steering wheel adapter 20 of the steering shaft 2 is provided for the securement of a steering wheel , not shown here , on the steering shaft 2 . between the side jaws 15 and the steering shaft bearing unit 1 is located the bearing part 17 . at the end , facing away from the clamp bolt 13 , the bearing part 17 is securable by means of the bearing part securement 18 in the depicted embodiment on the body , not depicted here , of the motor vehicle . implementations are also conceivable in which the bearing part securement 18 is secured on the bracket part 7 . in the first embodiment the bearing part securement 18 is implemented rigidly in any case . the length of the bearing part 17 is provided with the reference number 30 in the drawing . as explained in the introduction , it is advantageous for the bearing part securement 18 to be as far removed from the clamp bolt 13 as is possible . as already explained , for this purpose the distance between clamp bolt 13 and bearing part securement 18 should be at least half , preferably at least three - fourths , of the length 30 of the bearing part 17 . in the joint region 4 the two half shells or subshells 39 , 40 , from which the steering shaft bearing unit is formed , are connected with one another by , for example , laser welding . in the depicted embodiment the joint region 4 extends within the plane of symmetry 16 which extends approximately parallel to the securement webs 8 and which intersects the longitudinal axis 35 about which the steering shaft 2 is rotatably supported . it is conceivable and feasible to form the joint region 4 at another circumferential region of the steering shaft bearing unit 1 . this can be expedient for being able to implement the two half shells or subshells 39 , 40 more advantageously in terms of fabrication techniques . the depicted embodiment according to fig1 and 2 involves a length - adjustable steering column 3 . the displacement directions are denoted by the double arrow 31 . this corresponds to the longitudinal directions of the steering shaft 2 . in order to enable , on the one hand , the displacement in the longitudinal directions 31 , however , on the other hand , to ensure sufficiently strong securement during operation of the steering shaft bearing unit 1 on the bracket part 7 , in the case of this steering column , as is known per se , a securement device is provided which , inter alia , encompasses the clamp bolt 13 and the actuation lever 19 . it is understood that motor actuations of the securement device are also conceivable . in such cases the actuation lever 19 can be omitted . securement devices with clamp bolts 13 for adjustable steering columns 3 are known within prior art in a multiplicity of implementations . the embodiments depicted here serve only as illustration of one of many different possible variants of the manner in which the clamping and release of the securement device can proceed . in the depicted embodiment , a cam plate 23 is connected torque - proof with the actuation lever 19 . the cams of this cam plate 23 cooperate with corresponding countercams of the tightening piece 24 . the tightening piece 24 is connected torque - proof with the bracket part 7 . on the opposite side the clamp bolt 13 is fixed with a clamping nut 25 . here is also located a tightening piece 24 or an axial bearing which is disposed between the clamping nut 25 and the corresponding side jaw 15 of the bracket part 7 . by turning the actuation lever 19 about the center longitudinal axis 32 of the clamp bolt 13 , the cam plate 23 is turned against the adjacently disposed tightening piece 24 . depending on the position of the involved cams with respect to one another , the securement device is subsequently in the closed state in which the steering shaft bearing unit 1 is fixed on the bracket part 7 at least under the forces occurring in normal operation . through the appropriate rotation of the actuation lever 19 the securement device can subsequently be brought into the open state in which a displacement in the longitudinal directions 31 of the steering shaft bearing unit 1 relative to the bracket part 7 , and therewith a setting of the position of the steering wheel , is enabled . such securement devices are known per se and do not need to be further explained here . as is especially clearly evident in the sectional representation according to fig2 , the bearing part 17 as well as also the steering shaft bearing unit 1 each have beads with which they are supported one in the other . in the first embodiment , the particular bearing part bead 21 is guided in one of the steering shaft bearing unit beads 14 . in the depicted first embodiment according to fig1 and 2 , the bracket part 7 additionally also comprises at both side jaws 15 one bracket part bead 22 which , in the depicted embodiment , engages into one of the bearing part beads 21 . the clamp bolt 13 is guided through the bearing part beads 21 and the steering shaft bearing unit beads 14 . in the depicted embodiment it is additionally also guided through the bracket part beads 22 . it is conceivable and feasible , even in steering columns 3 which are only adjustable in length to omit a bracket part bead 22 . the side jaws 15 are in that case preferably implemented planarly in the proximity of the tightening and displacement , at least in the surface directed toward the steering shaft bearing unit . as can be seen especially well in fig2 , it is advantageous if , as in this embodiment also realized , the beads are implemented as so - called inner beads . this is the case if they are implemented such that they are recessed in the direction into the region 33 between the side jaws 15 of the bracket part 7 or in the direction into the interior volume of the securement region 6 forming the region 33 . region a from fig2 is once again depicted in fig2 at an enlargement . it can here be seen especially well that each of the beads 14 , 21 and 22 comprises two side jaws 28 which are each connected with one another by a bead base 29 . the clamp bolt 13 penetrates in each instance the bead base 29 of said beads 14 , 21 and 22 . the cutout or opening necessary for this purpose is advantageously only large enough for there still lateral margins to be of the bead base 29 . this enables greater rigidity in the contact of the bearing part bead 21 on the particular steering shaft bearing unit bead 14 since thereby , in the direction of the center longitudinal axis 32 of the clamp bolt 13 , forces can be transmitted especially well . the side walls 28 , and here also the bead bases 29 of the beads 14 , 21 and 22 located adjacently , are fully in areal contact on one another . they are symmetric with respect to the center longitudinal axis 32 of clamp bolt 13 and , in terms of optimal contact on one another , have a geometrically similar form . in the first embodiment according to fig1 and 2 , the tightening pieces 24 , engaging from the outside into the bracket part beads 22 , comprise projections formed out corresponding to the bead indentation , with which they engage into the bracket part beads 22 . by guiding the clamp bolt 13 directly through the beads 14 , 21 and here also 22 , the clamping forces of the clamp bolt 13 act directly onto the beads whereby a simple as well as also effective construction method and force transmission is realized . the through - opening 12 , or the elongated hole forming it , is advantageously wider in the steering shaft bearing unit 1 than the diameter of hole 36 in the bearing part 17 . the diameter of hole 37 in the bracket part 7 is advantageously smaller than the diameter of hole 36 in the bearing part 17 . in this way the abrasion can be reduced . it is also conceivable and feasible for the production of a greater displacement length to implement the hole 36 as an elongated hole . in that case , instead of the diameter of hole 36 , the width of the elongated hole , would have to be assessed as the measure of the above comparisons . in general , reference should be made to the fact that through the construction according to the invention , a highly compact construction method is made possible thereby that the spacing between the clamp bolt 13 and the steering shaft 2 can be kept very low . this is preferably made possible through a single - wall implementation in which the steering shaft bearing unit 1 is formed by only a single circumferential wall , apart from potentially possible attachment parts , which may be attached for additional functions . in this way , between the clamp bolt 13 and the steering shaft 2 no walls are located with corresponding wall thicknesses and require increased minimum spacing between steering shaft 2 and clamp bolt 13 . the steering shaft bearing unit 1 according to the invention and the fabrication technology in half shell technology enable this construction method in simple manner . in the first embodiment , each steering shaft bearing unit bead 14 comprises as the through - openings 12 an elongated hole through which the clamp bolt 13 is guided . through these elongated holes extending longitudinally in the longitudinal direction 31 of the steering shaft 2 , it becomes feasible to displace the steering shaft bearing unit 1 in the longitudinal directions 31 relative to the bracket part 7 . the bearing part beads 21 and the bracket part beads 22 do not need to be implemented such that they extend longitudinally . through the longitudinal extent of the bearing part 17 over its length 30 and the disposition of the bearing part securement 18 , remote from the clamp bolt 13 in the longitudinal direction 31 , a highly torsion - resistant and low - play bearing of the steering shaft bearing unit 1 is attained . yet the torsion resistance of the construction can be still further increased thereby that , as realized in the first embodiment , the bearing part beads 21 also are longitudinally extended . the engagement of the bearing part beads 21 into the steering shaft bearing unit beads 14 is thereby , as realized in the first embodiment , markedly extended in the longitudinal direction 31 which further increases the torsion resistance of the overall construction . before discussing the embodiment according to fig3 and 4 , reference should be made to the fact that in all of the embodiments shown the particular bead configurations are realized bilaterally , thus on both side jaws 15 of the bracket part 7 . this is advantageous in terms of a low - play rigid structure . however , it is not absolutely necessary . it would also be conceivable to realize the corresponding bead configurations in the region of only one of the side jaws 15 . in the embodiment according to fig3 and 4 , in addition to the length adjustability of the steering column 3 in the longitudinal direction 31 , a height adjustability of this steering column 3 or its steering shaft 2 in the height directions 34 is provided . for this purpose , in each of the two side jaws 15 of the bracket part 7 in this embodiment , a vertically extending elongated hole 26 is disposed in which the clamp bolt 13 is disposed such that it is longitudinally displaceable . height as well as also length adjustment , however , are only possible when the securement device is in its open state . in the closed state of the securement device , these adjustment capabilities are not given at least not under the forces occurring during normal operation . in order to be able to realize the height adjustability in the height directions 34 also , in the embodiment according to fig3 and 4 , the bearing part securement 18 of bearing part 17 comprises a swivel joint . the bearing part 17 , together with the steering shaft bearing unit 1 , can be swivelled about this swivel joint of the bearing part securement 18 about a swivel axis 38 when a height adjustment is carried out . a further difference from the first embodiment comprises that in this variant a bracket part bead is omitted on both side jaws 15 . the elongated holes 26 are provided in the side jaws 15 on both sides . the tightening pieces 24 in this embodiment also do not comprise noses with which they would engage into the beads . it is nevertheless provided that the bearing part beads 21 are in contact in the steering shaft bearing unit beads 14 and that the clamp bolt 13 penetrates through these beads . all of this is once again shown in fig7 at an enlargement by depicting in this figure the detail b from fig4 . as far as applicable , the description provided in conjunction with fig6 applies to this figure also with the exception of the differences already stated . apart from these differences , the embodiment according to fig3 and 4 is substantially implemented like the first embodiment such that additional explanations in this regard are not necessary . in general , reference is to be made to the fact that the steering shaft 2 is preferably rotatably bearing supported at two sites , spaced apart from each other , of the steering shaft bearing unit 1 , by bearings , located here in circumferentially closed regions 5 of the steering shaft bearing unit 1 . although the bearings are not explicitly drawn here , they are known per se . in the modified variant of the embodiment according to fig3 and 4 depicted in fig5 , a steering shaft bearing 27 is provided at the motor - side end of the bearing part 17 . in all other regards , this embodiment according to fig5 corresponds to the variant according to fig3 and 4 . it is also conceivable and feasible to secure this additional steering shaft bearing 27 directly on the motor vehicle body , not shown here , or to integrate it into a gearing , not shown here , for a power assistance of the steering movement . it is in particular for these cases conceivable and feasible to rotatably support the steering shaft at one single bearing in the steering shaft bearing unit 1 . fig9 and 10 show separately , thus detached from the remaining steering column 3 , the steering shaft bearing unit 1 according to the invention such as can be installed in the embodiments of steering column 3 according to fig1 to 5 , however also in other variants according to the invention . the steering shaft bearing unit is formed in the example by two mirror - symmetric half shells or subshells 39 , 40 which are connected with one another along the joint region 4 . as already explained , it is a fundamental concept of the invention to fabricate initially the individual half shells or subshells 39 , 40 of the steering shaft bearing unit separately and subsequently to connect them with one another . it is hereby very simple to provide an especially stable and torque - proof steering shaft bearing unit 1 . in fig8 is depicted a half shell or subshell 39 which comprises a section 41 of a first circumferentially closed region 5 and a section 42 of a second circumferentially closed region 5 as well as a section 43 of a securement region 6 . in section 43 of the securement region 6 a securement web 8 is developed . in the end region 10 of the securement web 8 a through - opening 12 is located , which here — as is preferred — is implemented as an elongated hole . the end region 10 is adjoined by a section 44 of the connection section 11 , which section 44 is already comprised , in the form of a leg of the v - shape of the connection section 11 of steering shaft bearing unit 1 . however , it is also conceivable and feasible to implement the connection section in the form of a w . the faces forming the v or the w can herein also be implemented in the form of an arc . to facilitate the connection between the half shells or subshells 39 , 40 , additional shaped elements can be provided with which the structural parts can be positioned in orientation to each other before they are joined . along these shaped elements the structural parts can be prepositioned in a type of play fitting or a minimal press fitting . in the following method step the structural parts are subsequently connected with one another for example by welding , preferably by laser welding . in terms of an implementation as cost - effective as possible , it is preferably provided that , as also realized in the depicted embodiment according to fig8 to 10 , the steering shaft bearing unit 1 is implemented at all sites entirely as a single wall . to weld the individual structural parts 5 and 6 together , classic welding methods can be utilized , just as in the corresponding shaping can be utilized the orbital friction welding or the laser welding . it is , in particular , especially simply possible using half shell technology to implement the circumferentially closed region 5 such that the bearing for bearing supporting the steering shaft 2 can be directly pressed in for producing the steering column 1 . in fig1 a further embodiment of the steering shaft bearing unit is illustrated . the steering shaft bearing unit 1 is here produced from two half shells or subshells 39 , 40 . the steering shaft bearing unit 1 is formed by joining the half shells or subshells 39 , 40 along the longitudinal axis 35 of the steering shaft bearing unit 1 , along which the steering shaft 2 is rotatably supportable . each of the half shells or subshells 39 , 40 is fabricated in the explained half shell technology from the subhalf shells 45 and 46 . the half shells or subshells 39 , 40 are oriented along the longitudinal axis 35 and connected in the joint regions 4 with one another . the connection of the half shells or subshells 39 , 40 can here also be completed by welding . however , the sequence of the joining operations is in principle insignificant . it is conceivable and feasible to connect first the subhalf shells 45 , 46 to form half shells or subshells 39 , 40 . however , alternatively , it is also feasible to connect first the subhalf shells 45 and 45 or the subhalf shells 46 and 46 , which are disposed each on one side of the plane of symmetry , and subsequently to connect the two structural parts thus formed as half shells or subshells 39 , 40 with one another . when in the preceding description , sheet metal has been listed as the material , it should be noted that the structural parts or the intermediate forms can be fabricated for example of sheet steel , sheet aluminum , sheet magnesium and also of carbon fiber compound materials or other compound materials . instead of sheet metal , cast parts can be utilized as preshapes or prefabricated parts . it is also conceivable and feasible to utilize a mixture of different materials and different production methods for the preshaped parts for producing the steering shaft bearing unit . the term sheet metal is thus to be interpreted correspondingly broadly in terms of a wall or a jacket and is not to be restricted to metallic or pure sheet metal . in the embodiment according to fig1 and 13 , an embodiment with a steering shaft bearing unit 1 is depicted which is structured of overall three half shells or subshells 39 , 40 and 47 . these three half shells or subshells 39 , 40 and 47 are also joined together in this embodiment by welding and each comprises at least one section of the securement region 6 and at least one section of the at least one circumferentially closed region 5 . this embodiment also serves the purpose of once again clarifying that the term “ half shell ” does not mean that precisely two half shells or subshells 39 , 40 , 47 must be involved . the term “ half shell ” also does not absolutely define that the half shells or subshells 39 , 40 , 47 must be of equal size or axisymmetric or mirror symmetric . the half shells or subshells 39 , 40 and 47 can be of different sizes and nonsymmetric with respect to one another . their number is not limited to two . if applicable , all features depicted in the individual embodiments can be freely combined with one another without leaving the scope of the invention . | 1 |
in the general formula [ i ] or [ ii ], the transition metal atom represented by m 1 indicates a transition metal element of the group iv of the periodic table of the elements ( revised edition of iupac inorganic chemistry nomenclature 1989 ), and examples thereof include a titanium atom , a zirconium atom , a hafnium atom and the like . a titanium atom or a zirconium atom is preferable . examples of the atom of the group xvi of the periodic table of the elements indicated as a in the general formula [ i ] or [ ii ] include an oxygen atom , a sulfur atom , a selenium atom and the like , and an oxygen atom is preferable . examples of the atom of the group xiv of the periodic table of the elements indicated as j in the general formula [ i ] or [ ii ] include a carbon atom , a silicon atom , a germanium atom and the like , and a carbon atom or a silicon atom is preferable . examples of the group having a cyclopentadiene type anion skeleton indicated as the substituent group , cp 1 , include an η 5 -( substituted ) cyclopentadienyl group , an η 5 -( substituted ) indenyl group , an η 5 ( substituted ) fluorenyl group and the like . specific examples include an η 5 - cyclopentadienyl group , an η 5 - methylcyclopentadienyl group , an η 5 - dimethylcyclopentadienyl group , an η 5 - trimethylcyclopentadienyl group , an η 5 - tetramethylcyclopentadienyl group , an η 5 - n - ethylcyclopentadienyl group , an η 5 - propylcyclopentadienyl group , an η 5 - isopropylcyclopentadienyl group , an η 5 - n - butylcyclopentadienyl group , an η 5 - sec - butylcyclopentadienyl group , an η 5 - tert - butylcyclopentadienyl group , an η 5 - n - pentylcyolopentadienyl group , an η 5 - neopentylcyclopentadienyl group , an η 5 - n - hexylcyclopentadienyl group , an η 5 - n - octylcyclopentadienyl group an η 5 - phenylcyclopentadienyl group , an η 5 - naphthylcyclopentadienyl group , an η 5 - trimethylsilylcyclopentadienyl group , an η 5 - triethylsilylcyclopentadienyl group , an η 5 - tert - butyldimethylsilylcyclopentadienyl group , an η 5 - indenyl group , an η 5 - methylindenyl group , an η 5 - dimethylindenyl group , an η 5 - ethylindenyl group , an η 5 - n - propylindenyl group , an η 3 - isopropylindenyl group , an η 5 - n - butylindenyl group , an η 5 - sec butylindenyl group , an η 5 - tert - butylindenyl group , an η 5 - n - pentylindenyl group , an η 5 - neopentylindenyl group , an η 5 - n hexylindenyl group , an η 5 - n - octylindenyl group , an η 5 - n - decylindenyl group , an η 5 - phenylindenyl group , an 72 5 - methylphenylindenyl group , an η 5 - naphthylindenyl group , an η 5 - trimethylsilylindenyl group , an η 5 - triethylsilylindenyl group , an η 5 - tert - butyldimethylsilylindenyl group , an η 5 - tetrahydroindenyl group , an η 5 - fluorenyl group , an η 5 - methylfluorenyl group , an η 5 - dimethylfluorenyl group , an η 5 - ethylfluorenyl group , an η 5 - diethylfluorenyl group , an η 5 n - propylfluorenyl group , an η 5 - di - n - propylfluorenyl group , an η 5 - isopropylfluorenyl group , an η 5 - diisopropylfluorenyl group , an η 5 - n - butylfluorenyl group , η 5 - sec - butylfluorenyl group , an η 5 - tert - butylfluorenyl group , an η 5 - di - n - butylfluorenyl group , an η 5 - di - sec - butylfluorenyl group , an η 5 - di - tert - butylfluorenyl group , η 5 - n - pentylfluorenyl group , an η 5 - neopentylfluorenyl group , an η 5 n - hexylfluorenyl group , an η 5 - n - octylfluorenyl group , an η 5 - n - decylfluorenyl group , an η 5 - n - dodecylfluorenyl group , an η 5 - plenylfluorenyl group , an η 5 - diphenylfluorenyl group , an η 5 - methylphenylfluorenyl group , an η 5 - naphthylfluorenyl group , an η 5 - trimethylsilylfluorenyl group , an η 5 - bis - trimethylsilylfluorenyl group , an η 5 - triethylsilylfluorenyl group , an η 5 - tert - butyldimethylsilylfluorenyl group and the like . an η 5 - cyclopentadienyl group , an η 5 - methylcyclopentadienyl group , an η 5 - tert - butyloyclopentadienyl group , an η 5 - tetramethylcyclopentadienyl group , an η 5 - indenyl group or an η 5 - fluorenyl group is preferable . as the halogen atom in the substituent , x 1 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 , a fluorine atom , a chlorine atom , a bromine atom , and an iodine atom are illustrated . a chlorine atom or a bromine atom is preferable and a chlorine atom is more preferable . as the alkyl group in the substituent , x 1 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 , an alkyl group having 1 to 20 carbon atoms is preferred , and examples include a methyl group , an ethyl group , a n - propyl group , an isopropyl group , a n - butyl group , a sec - butyl group , a tert - butyl group , a n - pentyl group , a neopentyl group , a sec - amyl group , a n - hexyl group , a n - octyl group , a n - decyl group , a n - dodecyl group , a n - pentadecyl group , a n - eicosyl group and the like , and a methyl group , an ethyl group , an isopropyl group , a tert - butyl group or a sec - amyl group is more preferable . all of these alkyl groups may be substituted with a halogen atom such as a fluorine atom , a chlorine atom , a bromine atom or an iodine atom . examples of the alkyl group having 1 to 20 carbon atoms which is substituted with the halogen atom , include a fluoromethyl group , a difluoromethyl group , a trifluoromethyl group , a chloromethyl group , a dichloromethyl group , a trichloromethyl group , a bromomethyl group , a dibromomethyl group , a tribromomethyl group , an iodomethyl group , a tribromomethyl group , a triiodomethyl group , a fluoroethyl group , a difluoroethyl group , a trifluoroethyl group , a tetrafluoroethyl group , a pentafluoroethyl group , a chloroethyl group , a dichloroethyl group , a trichloroethyl group , a tetrachloroethyl group , pentachloroethyl group , a bromoethyl group , a dibromoethyl group , a tribromoethyl group , a tetrabromoethyl group , pentabromoethyl group , a perfluoropropyl group , a perfluorobutyl group , a perfluoropentyl group , a perfluorohexyl group , a perfluorooctyl group , a perfluorododecyl group , a perfluoropentadecyl group , a perfluorceicosyl group , a perchloropentyl group , a perchlorobutyl group , a perchloropentyl group , a perchlorohexyl group , a perchlorooctyl group , a perchlorododecyl group , a perchloropentadecyl group , a perchloroeicosyl group , a perbromopropyl group , a perbromobutyl group , a perbromopentyl group , a perbromohexyl group , a perbromooctyl group , a perbromododecyl group , a perbromopentadecyl group , a perbromoeicosyl group and the like . further , all of these alkyl groups may be partially substituted with an alkoxy group such as a methoxy group , an ethoxy group or the like , an aryloxy group such as a phenoxy group or the like or an aralkyloxy group such as a benzyloxy group or the like , etc . as the aralkyl group in the substituent , x 1 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 , an aralkyl group having 7 to 20 carbon atoms is preferable , and examples thereof include a benzyl group , a ( 2 - methylphenyl ) methyl group , a ( 3 - methylphenyl ) methyl group , a ( 4 - methylphenyl ) methyl group , a ( 2 , 3 - dimethylphenyl ) methyl group , a ( 2 , 4 - dimethylphenyl ) methyl group , a ( 2 , 5 - dimethylphenyl ) methyl group , a ( 2 , 6 - dimethylphenyl ) methyl group , a ( 3 , 4 - dimethylphenyl ) methyl group , a ( 3 , 5 - dimethylphenyl ) methyl group , a ( 2 , 3 , 4 - timethylphenyl ) methyl group , a ( 2 , 3 , 5 - timethylphenyl ) methyl group , a ( 2 , 3 , 6 - timethylphenyl ) methyl group , a ( 3 , 4 , 5 - timethylphenyl ) methyl group , a ( 2 , 4 , 6 - timethylphenyl ) methyl group , a ( 2 , 3 , 4 , 5 - tetramethylphenyl ) methyl group , a ( 2 , 3 , 4 , 6 - tetramethylphenyl ) methyl group , a ( 2 , 3 , 5 , 6 - tetramethylphenyl ) methyl group , a ( pentamethylphenylnmethyl group , an ( ethylphenyl ) methyl group , a ( n - propylphenyl ) methyl group , an ( isopropylphanyl ) methyl group , a ( n - butylphenyl ) methyl group , a ( sec - butylphenyl ) methyl group , a ( tert - butylphenyl ) methyl group , a ( n - pentylphenyl ) methyl group , a ( neopentylphenyl ) methyl group , a ( n - hexylphenyl ) methyl group , a ( n - octylphenyl ) methyl group , a ( n - decylphenyl ) methyl group , a ( n - dodecylphenyl ) methyl group , a naphthylmethyl group , an anthracenylmethyl group and the like , and a benzyl group is more preferable . all of these aralkyl groups may be partially substituted with a halogen atom such as a fluorine atom , a chlorine atom , a bromine atom or an iodine atom , an alkoxy group such as a methoxy group , an ethoxy group or the like , an aryloxy group such as a phenoxy group or the like or an aralkyloxy group such as a benzyloxy group or the like , etc . as the aryl group in the substituent , x 1 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 , an aryl group having 4 to 20 carbon atoms is preferable , and examples thereof include a phenyl group , a 2 - tolyl group , a 3 - tolyl group , a 4 - tolyl group , a 2 , 3 - xylyl group , a 2 , 4 - xylyl group , a 2 , 5 - xylyl group , a 2 , 6 - xylyl group , a 3 , 4 - xylyl group , a 3 , 5 - xylyl group , a 2 , 3 , 4 - trimethylphenyl group , a 2 , 3 , 5 - trimethylphenyl group , a 2 , 3 , 6 - trimethylphenyl group , a 2 , 4 , 6 - trimethylphenyl group , a 3 , 4 , 5 - trimethylphenyl group , a 2 , 3 , 4 , 5 - tetramethylphenyl group , a 2 , 3 , 4 , 6 - tetramethylphenyl group , a 2 , 3 , 5 , 6 - tetramethylphenyl group , a pentamethylphenyl group , an ethylphenyl group , a n - propylphenyl group , an isopropylphenyl group , a n - butylphenyl group , a sec - butylphenyl group , a tert - butylphenyl group , a n - pentylphenyl group , a neopentylphenyl group , a n - hexylphenyl group , a n - octylphenyl group , a n - decylphenyl group , a n - dodecylphenyl group , a n - tetradecylphenyl group , a naphthyl group , an anthracenyl group and the like , and a phenyl group is more preferable . all of these aryl groups may be partially substituted with a halogen atom such as a fluorine atom , a chlorine atom , a bromine atom , an iodine atom or the like , an alkoxy group such as a methoxy group , an ethoxy group or the like , an aryloxy group such as a phenoxy group or the like or an aralkyloxy group such as a benzyloxy group or tho like , etc . the substituted silyl group in the substituent , x 1 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 is a silyl group substituted with a hydrocarbon group , and examples of the hydrocarbon group include alkyl groups having 1 to 10 carbon atoms such as a methyl group , an ethyl group , a n - propyl group , an isopropyl group , a n - butyl group , a sec - butyl group , a tert - butyl group , an isobutyl group , a n - pentyl group , a n - hexyl group , a cyclohexyl group and the like , and aryl groups such as a phenyl group and the like , etc . examples of such substituted silyl group having 1 to 20 carbon atoms include mono - substituted silyl groups having 1 to 20 carbon atoms such as a methylsilyl group , an ethylsilyl group , a phenylsilyl group and the like ; di - substituted silyl groups having 2 to 20 carbon atoms such as a dimethylsilyl group , a diethylsilyl group , a diphenylsilyl group and the like ; and tri - substituted silyl groups having 3 to 20 carbon atoms such as a trimethylsilyl group , a triethylsilyl group , a tri - n - propylsilyl - group , a triisopropylsilyl group , a tri - n - butylsilyl group , a tri - sec - butylsilyl group , a tri - tert - butylsilyl group , a tri - isobutylilyl group , a tert - butyl - dimethylsilyl group , a tri - n - pentylsilyl group , a tri - n - hexylsilyl group , a tricyclohexylsilyl group , a triphenylsilyl group and the like , and a trimethylsilyl group , a tert - butyldimethylsilyl group or a triphenylsilyl group is preferable . all of the hydrocarbon groups of these substituted silyl groups may be partially substituted with a halogen atom such as a fluorine atom , a chlorine atom , a bromine atom or an iodine atom , an alkoxy group such as a methoxy group , an ethoxy group or the like , an aryloxy group such as a phenoxy group or the like or an aralkyloxy group such as a benzyloxy group or the like , etc . as the alkoxy group in the substituent x 1 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 , an alkoxy group having 1 to 20 carbon atoms is preferable , and examples thereof include a methoxy group , an ethoxy group , a n - propoxy group , an isopropoxy group , a n - butoxy group , a sec - butoxy group , a tert - butoxy group , a n - pentoxy group , a neopentoxy group , a n - hexoxy group , a n - octoxy group , a n - dodecoxy group , a n - pentadecoxy group , a n - eicosoxy group and the like , and a methoxy group , an ethoxy group or a tert - butoxy group is preferable . all of these alkoxy groups may be partially substituted with a halogen atom such as , a fluorine atom , a chlorine atom , a bromine atom , an iodine atom or the like , an alkoxy group such as a methoxy group , an ethoxy group or the like , an aryloxy group such as a phenoxy group or the like or an aralkyloxy group such as a benzyloxy group or the like , etc . as the aralkyloxy group in the substituent , x 1 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 , an aralkyloxy group having 7 to 20 carbon atoms is preferable , and examples thereof include a benzyloxy group , a ( 2 - methylphenyl ) methoxy group , a ( 3 - methylphenyl ) methoxy group , a ( 4 - methylphenyl ) methoxy group , a ( 2 , 3 - dimethylphenyl ) methoxy group , a ( 2 , 4 - dimethylphenyl ) methoxy group , a ( 2 , 5 - dimethylphenyl ) methoxy group , a ( 2 , 6 - dimethylphenyl ) methoxy group , a ( 3 , 4 - dimethylphenyl ) methoxy group , a ( 3 , 5 - dimethylphenyl methoxy group , a ( 2 , 3 , 4 - trimethylphenyl ) methoxy group , a ( 2 , 3 , 5 - trimethylphenyl ) methoxy group , a ( 2 , 3 , 6 - trimethylphenyl ) methoxy group , a ( 2 , 4 , 5 - trimethylphenyl ) methoxy group , a ( 2 , 4 , 6 - trimethylphenyl ) methoxy group , a ( 3 , 4 , 5 - trimethylphenyl ) methoxy group , a ( 2 , 3 , 4 , 5 - tetramethylphenyl ) methoxy group , a ( 2 , 3 , 4 , 6 - tetramethylphenyl ) methoxy group , a ( 2 , 3 , 5 , 6 - tetramethylphenyl ) methoxy group , a ( pentamethylphenyl ) methoxy group , an ( ethylphenyl ) methoxy group , a ( n - propylphenyl ) methoxy group , an ( isopropylphenyl ) methoxy group , ( n - butylphenyl ) methoxy group , a ( sec - butylphenyl ) methoxy group , a ( tert - butylphenyl ) methoxy group , a ( n - hexylphenyl ) methoxy group , a ( n - octylphenyl ) methoxy group , a ( n - decylphenyl ) methoxy group , a naphthylmethoxy group , an anthracenylmethoxy group and the like , and a benzyloxy group is more preferable . all of these aralkyloxy groups may be partially substituted with a halogen atom such as a fluorine atom , a chlorine atom , a bromine atom or an iodine atom , an alkoxy group such as a methoxy group , an ethoxy group or the like , at aryloxy group such as a phenoxy group or the like or an aralkyloxy group such as a benzyloxy group or the like , etc . as the aryloxy group in the substituent , x 1 , x 2 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 , an aryloxy group having 6 to 20 carbon atoms is preferable , and examples thereof include a phenoxy group , a 2 - methylphenoxy group , a 3 - methylphenoxy group , a 4 - methylphenoxy group , a 2 , 3 - dimethylphenoxy group , a 2 , 4 - dimethylphenoxy group , a 2 , 5 - dimethylphenoxy group , a 2 , 6 - dimethylphenoxy group , a 3 , 4 - dimethylphenoxy group , a 3 , 5 - dimethylphenoxy group , a 2 , 3 , 4 - trimethylphenoxy group , a 2 , 3 , 5 - trimethylphenoxy group , a 2 , 3 , 6 - trimethylphenoxy group , a 2 , 4 , 5 - trimethylphenoxy group , a 2 , 4 , 6 - trimethylphenoxy group , a 3 , 4 , 5 - trimethylphenoxy group , a 2 , 3 , 4 , 5 - tetramethylphenoxy group , a 2 , 3 , 4 , 6 - tetramethylphenoxy group , a 2 , 3 , 5 , 6 - tetramethylphenoxy group , a pentamethylphenoxy group , an ethylphenoxy group , a n - propylphenoxy group , an isopropylphenyl group , a n - butylphenoxy group , a sec - butylphenoxy group , a tert butylphenoxy group , a n - hexylphenoxy group , a n - octylphenoxy group , a n - decylphenoxy group , a n - tetradecylphenoxy group , a naphthoxy group , an anthracenoxy group and the like . all of these aryloxy groups may be partially substituted with a halogen atom such as a fluorine atom , a chlorine atom , a bromine atom or an iodine atom , an alkoxy group such as a methoxy group , an ethoxy group or the like , an aryloxy group such as a phenoxy group or the like or an aralkyl oxy group such as a benzyloxy group or the like , etc . the di - substituted amino group in the substituent , x 1 , r 1 , r 2 , r 3 , r 4 , r 5 or r 6 is an amino group substituted with two hydrocarbon groups and examples of the hydrocarbon group include alkyl groups having 1 to 10 carbon atoms such as a methyl group , an ethyl group , a n - propyl group , an isopropyl group , a n - butyl group , a sec - butyl group , a tert - butyl group , an isobutyl group , a n - pentyl group , a n - hexyl group , a cyclohexyl group and the like ; aryl groups having 1 to 10 carbon atoms such as a phenyl group and the like ; aralkyl groups having 7 to 10 carbon atoms , etc . examples of such di - substituted amino group substituted with the hydrocarbon group having 1 to 10 carbon atoms include a dimethylamino group , a diethylamino group , a di - n - propylamino group , a diisopropylamino group , a di - n - butylamino group , a di - sec - butylamino group , a di - tert - butylamino group , a di - isobutylamino group , a tert - butylisopropylamino group , a di - n - hexylamino group , a di - n - octylamino group , a di - n - decylamino group , a diphenylamino group , a bistrimethylsilylamino group , a bis - tert - butyldimethylsilylamino group and the like , and a dimethylamino group or an diethylamino group is preferable . all of these di - substituted amino groups may be partially substituted with a halogen atom such as a fluorine atom , a chlorine atom , a bromine atom or an iodine atom , an alkoxy group such as a methoxy group , an ethoxy group or the like , an aryloxy group such as a phenoxy group or the like or an aralkyloxy group such as a benzyloxy group or the like , etc . the substituent , r 1 , r 2 , r 3 , r 4 , r 5 and r 6 may be optionally combined with each other to form a ring . each of r 1 is preferably an alkyl group , an aralkyl group , an aryl group or a substituted silyl group , independently . each of x 1 is preferably a halogen atom , an alkyl group , an aralkyl group , an alkoxy group , an aryloxy group or a di - substituted amino group , independently . an alkoxy group is more preferable . examples of the atom of group xvi of the periodic table of the elements indicated as x 2 in the general formula [ i ] or [ ii ] include an oxygen atom , a sulfur atom , a selenium atom and the like , and an oxygen atom is preferable . examples of such transition metal compound [ i ] include μ - oxobis { isopropylidene ( η 5 - cyclopentadienyl )( 2 - phenoxy ) titanium chloride }, μ - oxobis { isopropylidene ( η 5 - cyclopentadienyl )( 2 - phenoxy ) titanium methoxide }, μ - oxobis { isopropylidene ( η 5 - cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium chloride }, μ - oxobis { isopropylidene ( η 5 - cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide }, μ - oxobis { isopropylidene ( η 5 - methylcyclopentadienyl ) ( 2 - phenoxy ) titanium chloride }, μ - oxobis { isopropylidene ( η 5 - methylcyclopentadienyl ) ( 2 - phenoxy ) titanium methoxide }, oxobis { isopropylidene ( η 5 - methylcyclopentadienyl ) ( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium chloride ), μ - oxobis { isopropylidene ( η 5 - methylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide }, μ - oxobis { isopropylidene ( η 5 - tetramethylcyclopentadienyl )( 2 - phenoxy ) titanium chloride }, μ - oxobis { isopropylidene ( η 5 - tetramethylcyclopentadienyl )( 2 - phenoxy ) titanium methoxide }, μ - oxobis { isopropylidene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl 2 - phenoxy ) titanium chloride }, μ - oxobis { isopropylidene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide }, μ - oxobis { dimethylsilylene ( η 5 - cyclopentadienyl )( 2 - phenoxy ) titanium chloride }, μoxobis { dimethylsilylene ( η 5 - cyclopentadienyl )( 2 - phenoxy ) titanium methoxide }, μ - oxobis { dimethylsilylene ( η 5 - cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium chloride }, μ - oxobis { dimethylsilylene ( η 5 - cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide }, μ - oxobis { dimethylsilylene -( η 5 - methylcyclopentadienyl )( 2 - phenoxy ) titanium chloride }, μ - oxobis { dimethylsilylene ( η 5 - methylcyclopentadienyl )( 2 - phenoxy ) titanium methoxide }, μ - oxobis { dimethylsilylene ( η 5 - methylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium chloride }, μ - oxobis { dimethylsilylene ( η 5 - methylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide }, μ - oxobis [ dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 2 - phenoxy ) titanium chloride }, μ - oxobis { dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 2 - phenoxy ) titanium methoxide }, μ - oxobis { dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium chloride }, μ - oxobis { dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide } and the like . examples of such transition metal compound [ ii ] include di - μ - oxobis { isopropylidene ( η 5 - cyclopentadienyl )( 2 - phenoxy ) titanium }, di - μ - oxobis { isopropylidene ( η 5 - cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium }, di - μ - oxobis { isopropylidene ( η 5 - methylcyclopentadienyl )( 2 - phenoxy ) titanium }, di - μ - oxobis { isopropylidene ( η 5 - methylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium , di - μ - oxobis { isopropylidene ( η 5 - tetramethylcyclopentadienyl )( 2 - phenoxy ) titanium }, di - μ - oxobis { isopropylidene ( η 5 - tetramethyl cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium }, di - μoxobis { dimethylsilylene ( η 5 - cyclopentadienyl )( 2 - phenoxy ) titanium }, di - μ - oxobis { dimethylsilylene ( η 5 - cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium }, di - μ - oxobis { dimethylsilylene ( η 5 - methylcyclopentadienyl ) ( 2 - phenoxy ) titanium )}, di - μ - oxobis { dimethylsilylene ( η 5 - methylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium }, di - μ - oxobis { dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 2 - phenoxy ) titanium }, di - μ - oxobis { dimethylsilylene ( η 5 - tetramethyl cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium } and the like . the transition metal compound represented by the general formula [ i ] or [ ii ] can be produced , for example , by reacting a transition metal compound obtained according to the method described in the wo 97 / 03992 with 0 . 5 - fold by mole or 1 - fold by mole of water . wherein a method of directly reacting a transition metal compound with a required amount of water , a method of charging a transition metal compound in a solvent such as a hydrocarbon containing a required amount of water , or the like , a method of charging a transition metal compound in a solvent such as a dry hydrocarbon or the like and further flowing an inert gas containing a required amount of water , or the like , etc . can be adopted . the aluminum compound ( b used in the present invention is at least one organoaluminum compound rejected from ( b1 ) to ( b3 ) described below ; ( b1 ) an organoaluminum compound indicated by the general formula e 1 a alz 3 - n ; ( b2 ) a cyclic aluminoxane having a structure indicated by the general formula {— al ( e 2 )— o —} b ; and ( b3 ) a linear aluminoxane having a structure indicated by the general formula e 3 {— al ( e 3 )— o —} c ale 3 2 ( wherein each of e 1 , e 2 and e 3 is a hydrocarbon group ; all of e 1 , all of e 2 and all of e 3 may be the same or different ; z represents a hydrogen atom or a halogen atom ; all of z may be the same or different ; a represents a number satisfying an expression of 0 & lt ; a ≦ 3 ; b represents an integer of 2 or more ; and c represents an integer of 1 or more ). as the hydrocarbon group in e 1 , e 2 or e 3 , a hydrocarbon group having 1 to 8 carbon atoms is preferable and an alkyl group is more preferable . specific examples of the organoaluminum compound ( b1 ), indicated by the general formula e 1 a alz 3 - a include trialkylaluminums such as trimethylaluminum , triethylaluminum , tri - n - propylaluminum , triisopropylaluminum , triisobutylaluminum , tri - n - hexylaluminum and the like ; dialkylaluminum chlorides such as dimethylaluminum chloride , diethylaluminum chloride , di - n - propylaluminum chloride , diisopropylaluminum chloride , diisobutylaluminum chloride , di - n - hexylaluminum chloride and the like ; alkylaluminum dichlorides such as methylaluminum dichloride , ethylaluminum dichloride , n - propylaluminum dichloride , isopropylaluminum dichloride , isobutylaluminum dichloride , n - hexylaluminum dichloride and the like ; and dialkylaluminum hydrides such as dimethylaluminum hydride , diethylaluminum hydride , di - n - propylaluminum hydride , diisopropylaluminum hydride , diisobutylaluminum hydride , di - n - hexylaluminum hydride and the like , etc . specific examples of e 2 and e 3 in the cyclic aluminoxane ( b2 ) having a structure indicated by the general formula {— al ( e 2 )— o —} b and the linear aluminoxane ( b3 ) having a structure indicated by the general formula e 3 {— al ( e 3 )— o —} c ale 3 2 include alkyl groups such as a methyl group , an ethyl group , a n - propyl group , an isopropyl group , a n - butyl group , an isobutyl group , a n - pentyl group , a neopentyl group and the like . b is an integer of 2 or more , and c is an integer of 1 or more . preferably , each of e 2 and e 4 is a methyl group or an isobutyl group , b is 2 to 40 and c is 1 to 40 . the above - mentioned aluminoxane is prepared by various methods . the method is not specifically limited , and the aluminoxane may be prepared according to publicly known processes . for example , the aluminoxane is prepared by contacting a solution of a trialkylaluminum ( e . g . trimethylaluminum or the like ) dissolved in a suitable organic solvent ( e . g . benzene , an aliphatic hydrocarbon or the like ) with water . further , there is exemplified a process for preparing the aluminoxane by contacting a trialkylaluminum ( e . g . trimethylaluminum , etc .) with a metal salt containing crystal water ( e . g . copper sulfate hydrate , etc .]. as the boron compound ( c ) in the present invention , any one of the boron compound ( c1 ) represented by the general formula bq 1 q 2 q 3 , the boron compound ( c2 ) represented by the general formula g + ( bq 1 q 2 q 3 q 4 } − and the boron compound ( c3 ) represented by the general formula ( l - h ) + ( bq 1 q 2 q 3 q 4 ) − can be used . in the boron compound ( c1 ) represented by the general formula bq 1 q 2 q 3 , b represents a boron atom in the trivalent valence state ; q 1 to q 3 are respectively a halogen atom , a hydrocarbon group , a halogenated hydrocarbon group , a substituted silyl group , an alkoxy group or a di - substituted amino group and they may be the same or different . each of q 1 to q 3 is preferably a halogen atom , a hydrocarbon group having 1 to 20 carbon atoms , a halogenated hydrocarbon group having 1 to 20 carbon atoms , a substituted silyl group having 1 to 20 carbon atoms , an alkoxy group having 1 to 20 carbon atoms or a di - substituted amino group having 2 to 20 carbon atoms , and each of more preferable q 1 to q 3 is a halogen atom , a hydrocarbon group having 1 to 20 carbon atoms or a halogenated hydrocarbon group having 1 to 20 carbon atoms . each of the more preferable q 1 to q 2 is a fluorinated hydrocarbon group having 1 to 20 carbon atoms which contains at least one fluorine atom , and in particular , each of q 2 to q 4 is preferably a fluorinated aryl group having 6 to 20 carbon atoms which contains at least one fluorine atom . specific examples of the compound ( c1 ) include tris ( pentafluorophenyl ) borane , tris ( 2 , 3 , 5 , 6 - tetrafluorophenyl ) borane , tris ( 2 , 3 , 4 , 5 - tetrafluorophenyl ) borane , tris ( 3 , 4 , 5 - trifluorophenyl ) borane , tris ( 2 , 3 , 4 - trifluorophenyl ) borane , phenylbis ( pentafluorophenyl ) borane and the like , and tris ( pentafluorophenyl ) borane is most preferable . in the boron compound ( c2 ) represented by the general formula g + ( bq 1 q 2 q 3 q 4 ) − , g + is an inorganic or organic cation ; b is a boron atom in the trivalent valence state , and q 2 to q 4 are the same as defined in q 1 to q 3 in the above - mentioned ( c1 ). specific examples of g + as the inorganic cation in the compound represented by the general formula g + ( bq 1 q 2 q 3 q 4 ) − include a ferrocenium cation , an alkyl - substituted ferrocenium cation , a silver cation and the like , and the g + as the organic cation includes a triphenylmethyl cation and the like . g + is preferably a carbenium cation , and a triphenylmethyl cation is particularly preferred . as the ( bq 1 q 2 q 3 q 4 ), tetrakis ( pentafluorophenyl ) borate , tetrakis ( 2 , 3 , 5 , 6 - tetrafluorophenyl ) borate , tetrakis ( 2 , 3 , 4 , 5 - tetrafluorophenyl ) borate , tetrakis ( 3 , 4 , 5 - trifluorophenyl ) borate , tetrakis ( 2 , 3 , 4 - trifluorophenyl ) borate , phenyltris ( pentafluoroplenyl ) borate , tetrakis ( 3 , 5 - bistrifluoromethylphenyl ) borate and the like are mentioned . these specific combinations include ferrocenium tetrakis ( pentafluorophenyl ) borate , 1 , 1 ′- dimethylferrocenium tetrakis ( pentafluorophenyl ) borate , silver tetrakis ( pentafluorophenyl ) borate , triphenylmethyl tetrakis ( pentafluorophenyl ) borate , triphenylmethyl tetrakis ( 3 , 5 - bistrifluoro methylphenyl ) borate and the like , and triphenylmethyl tetrakis ( pentafluorophenyl ) borate is most preferable , further , in the boron compound ( c3 ) represented by the formula ( l - h ) + ( b ) q 1 q 2 q 3 q 4 ) − , l is a neutral lewis base ; ( l - h ) + is a brnsted acid ; b is a boron atom in the trivalent valence state ; and q 1 to q 4 are the same as q 1 to q 2 in the above - mentioned lewis acid ( c1 ). specific examples of ( l - h ) + as the brnsted acid in the compound represented by the formula ( l - h ) + ( bq 1 q 2 q 3 q 4 ) include a trialkyl - substituted ammonium , an n , n - dialkylanilinium , a dialkylammonium , a triarylphosphonium and the like , and examples of ( bq 1 q 2 q 3 q 4 ) − include those as previously described . these specific combinations include triethylammonium tetrakis ( pentafluorophenyl ) borate , tripropylammonium tetrakis ( pentafluorophenyl ) borate , tri ( n - butyl ) ammonium tetrakis ( pentafluorophenyl ) borate , tri ( n - butyl ) ammonium tetrakis ( 3 , 5 - bistrifluoromethylphenyl ) borate , n , n - dimethylanilinium tetrakis ( pentafluorophenyl ) borate , n , n - diethylanilinium tetrakis ( pentafluorophenyl ) borate , n , n - 2 , 4 , 6 - pentamethylanilinium tetrakis ( pentafluorophenyl ) borate , n , n - dimethylanilinium tetrakis ( 3 , 5 - bistrifluoromethylphenyl ) borate , diisopropylammonium tetrakis ( pentafluorephenyl ) borate , dicyclohexylammonium tetrakis ( pentafluorophenyl ) borate , triphenylphosphonium tetrakis ( pentafluorophenyl ) borate , tri ( methylphenyl ) phosphonium tetrakis ( pentafluorophenyl ) borate , tri ( dimethylphenyl ) phosphonium tetrakis ( pentafluorophenyl ) borate and the like , and tri ( n - butyl ) ammonium tetrakis ( pentafluorophenyl ) borate or n , n - dimethylanilinum tetrakis ( pentafluorophenyl ) borate is most preferable . in the present invention , the olefin polymerization catalyst is prepared by a process comprising contacting the transition metal compound ( a ) represented by the general formula [ i ] and / or [ ii ] and [ the above - mentioned ( b ) and / or the above - mentioned ( c )]. in case of an olefin polymerization catalyst prepared by using the transition metal compound ( a ) and the above - mentioned ( b ), the fore - mentioned cyclic aluminoxane ( b2 ) and / or the linear aluminoxane ( b3 ) is preferable as ( b ). further , as another preferable mode of an olefin polymerization catalyst , an olefin polymerization catalyst prepared by using the transition metal compound , ( a ), the above - mentioned ( b ) and the above - mentioned ( c ) is illustrated , and the fore - mentioned ( b1 ) is also easily used as said ( b ). in the present invention , the transition metal compound ( a ) represented by the general formula [ i ] and / or [ ii ] and the above - mentioned ( b ), or further the above - mentioned ( c ) can he charged in an arbitrary order during polymerization to be used , but a reaction product obtained by previously contacting an arbitrary combination of those compounds may be also used . the used amount of respective components is not specifically limited , and it is desirable to usually use the respective components so that the molar ratio of the ( b )/ transition metal compound ( a ) is 0 . 1 to 10000 and preferably 5 to 2000 , and the molar ratio of the ( c )/ transition metal compound ( a ) is 0 . 01 to 100 and preferably 0 . 5 to 10 . when the respective components are used in a solution condition or a condition in which they are suspended or slurried in a solvent , the concentration of the respective components is appropriately selected according to the conditions such as the ability of all apparatus for feeding the respective components in a polymerization reactor . the respective components are desirably used so that the concentration of the transition metal compound ( a ) is usually 0 . 001 to 200 mmol / l , more preferably 0 . 001 to 100 mmol / l and most preferably 0 . 05 to 50 mmol / l ; the concentration of ( b ) usually 0 . 01 to 5000 mmol / l converted to al atom , more preferably 0 . 1 to 2500 mmol / l and most preferably 0 . 1 to 2000 mmol / l ; and the concentration of ( c ) is usually 0 . 0001 to 500 mmol / l , more preferably 0 . 01 to 250 mmol / l and most preferably 0 . 05 to 100 mmol / l . as olefins which can be applied to the polymerization in the present invention , olefins having 2 to 20 carbon atoms such as , particularly , ethylene and an α - olefin having 3 to 20 carbon atoms , diolefins having 4 to 20 carbon atoms and the like can be used , and two or more monomers can also be used , simultaneously . specific examples of the olefin include straight - chain olefins such as ethylene , propylene , butene - 1 , pentane - 1 , hexene - 1 , heptene - 1 , octene - 1 , nonene - 1 , decene - 1 and the like ; branched olefins such as 3 - methylbutene - 1 , 3 - methylpenten - 1 , 4 - methylpentene - 1 , 5 - methylhexene - 1 and the like : vinylcyclohexane , etc ., but the present invention should not be limited to the above - mentioned compounds . specific examples of the combination of monomers in case of conducting copolymerization include ethylene and propylene , ethylene and butene - 1 , ethylene and hexene - 1 , ethylene and octene - 1 , propylene and butene - 1 and the like , but the present invention should not be limited thereto . the present invention can be effectively applied to the particular preparation of the copolymer of ethylene and an α - olefin such as in particular , propylene , butene - 1 , 4 - methylpentene - 1 , hexene - 1 , octene - 1 or the like . polymerization processes should not be also specifically limited , and there can be a solvent polymerization or slurry polymerization in which an aliphatic hydrocarbon such as butane , pentane , hexane , heptane , octane or the like ; an aromatic hydrocarbon such as benzene , toluene or the like ; or a halogenated hydrocarbon such as methylene dichloride or the like used as a polymerization medium . further , high pressure ionic polymerization in which the polymerization of an olefin is conducted without a solvent under which an olefin polymer is melt in a high temperature and high pressure olefin in a supercritical liquid condition , and further , a gas phase polymerization in a gaseous monomer and the like are possible . further , either of a continuous polymerization and a batch - wise polymerization are possible . the polymerization temperature can be usually adopted at a range of − 50 ° c . to 350 ° c . and preferably 0 ° c . to 300 ° c ., and in particular , a range of 50 ° c . to 300 ° c . is preferable . the polymerization pressure can be adopted at a range of atmospheric pressure to 350 mpa and preferably atmospheric pressure to 300 mpa , and in particular , a range of atmospheric pressure to 200 mpa is preferable . in general , the polymerization time is appropriately determined according to the kind of a desired polymer and a reaction apparatus , and the conditions are not specifically limited and a range of 1 minute to 20 hours can be adopted . further , a chain transfer agent such as hydrogen or the like can also be added to adjust the molecular weight of a copolymer in the present invention . the process for polymerizing the olefin polymer of the present invention is suitably carried out by a high - pressure ionic polymerization process , in particular . specifically , it is preferably carried out under a pressure of 30 mpa or more and at a temperature of 300 ° c . or more . it is more preferably carried out under a pressure of 35 to 350 mpa and at a temperature of 135 to 350 ° c . the polymerization form can be carried out in either a batch - wise manner or a continuous manner , but the continuous manner is preferable . as a reactor , a stirring vessel type reactor or a tubular reactor can be used . the polymerization can be performed in a single reaction zone . alternatively , the polymerization can also be performed by partitioning one reactor into a plurality of reaction zones or connecting a plurality of reactors in series or parallel . in case of using a plurality of reactors , a combination of a vessel reactor and a vessel reactor or a combination of a vessel reactor and a tubular reactor may be used . in a polymerization process using a plurality of reaction zones or a plurality of reactors , polymers having different characteristics can also be produced by changing the temperature , pressure and gas composition of respective reaction zones or reactors . the present invention is further illustrated in detail according to examples and comparative examples below , but the present invention is not limited thereto . properties of the polymers in examples were measured according to methods described below . ( 1 ) melt index ( mfr ) was measured at 190 ° c . according to the method defined in jis k - 6760 . ( unit : g / 10 min .) wherein the value of density described as density ( without annealing ) is a value obtained by measuring without an annealing treatment in jis k - 6760 . ( unit ; g / cm 3 ) it was measured under the following conditions using dsc7 manufactured by perkin - elmer co . heating : heating to 150 ° c . and maintaining until the change of calorie is stabilized cooling : 150 to 10 ° c . ( 5 ° c ./ min .) and maintaining for 10 minutes it was determined from the characteristic absorption of ethylene and α - olefin using an infrared spectrometer ( ft - tr7300 , manufactured by nippon bunko inc .) and was represented as a short - chain branch ( scb ) number per 1000 carbon atoms . ( 5 ) weight average molecular weight ( mw ), number average molecular weight ( mn ) and molecular weight distribution ( mw / mn ): they were determined under the following conditions using gel permeation chromatograph ( 150 , c , manufactured by waters co .). 100 mg of a copolymer obtained was dissolved in 50 ml of tetralin at 135 ° c . and the solution was set in an oil bath maintained at 135 ° c . using an ubbelohde viscometer , the intrinsic viscosity was determined by the falling speed of the tetralin solution in which said sample was dissolved . ( unit : dl / g ) in a schlenk tube , 0 . 131 g ( 4 . 1 mmol ) of methanol was dissolved in 10 ml of anhydrous diethyl ether and a diethyl ether solution ( 3 . 9 ml , 4 . 1 mmol ) of methyllithium having a concentration of 1 . 05 mol / l was added dropwise at − 78 ° c . thereto . the resulting mixture was heated to 20 ° c ., the formation of lithium methoxide was confirmed by gas generation , and the resulting reaction solution was again cooled to − 78 ° c . into the reaction solution , 20 ml of an anhydrous diethyl ether suspension liquid of 0 . 919 g ( 2 . 0 mmol ) of dimethylsilylene ( η 5 - tetramethylcyclopentadienyl ) ( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium dichloride which was previously prepared in another schlenk tube was transferred , and then , the resulting reaction mixture was gradually heated to room temperature to obtain a reaction solution , after concentrating the reaction solution , 20 ml of toluene was added and an insoluble product was separated by filtration . the filtrate was concentrated to obtain dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - b - methyl - 2 - phenoxy ) titanium dimethoxide of yellow crystals ( 0 . 86 g , 95 %). [ 0107 ] 1 h nmr ( 270 mhz , c 6 d 6 ); δ7 . 26 ( m , 2h ), 4 . 13 ( s , 6m ), 2 . 33 ( s , 3h ), 1 . 97 ( s , 6h ), 1 . 89 ( s , 6h ), 1 . 59 ( s , 9h ), 0 . 55 ( s , 6h ) [ synthesis example of transition metal compound : μ - oxobis { dimethylsilylene ( η 5 - tetramethyl cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide ( compound 1 )] under a nitrogen atmosphere , 10 . 00 g of dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy titanium dimethoxide ( the compound obtained by the same method as in reference example 1 ) was dissolved in 50 ml of heptane , 0 . 30 g of distilled water was added thereto , and the mixture was stirred at the same temperature for 12 hours . the solid produced was separated by filtration , rinsed with 5 . 0 ml of heptane , and then dried under vacuum to obtain μ - oxobis { dimethylsilylene ( η 5 - tetramethyl cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide } of a yellow solid ( 5 . 51 g , 56 %). [ 0110 ] 1 h - nmr ( c 6 d 6 ); δ7 . 25 ( d , j = 2 . 0 hz , 2h ), 7 . 16 ( d , j = 2 . 0 hz , 2h ), 3 . 99 ( s , 6h ), 2 . 37 ( s , 6h ), 2 . 30 ( s , 6h ), 2 . 06 ( s , 6h ), 1 . 86 ( s , 6h ), 1 . 71 ( s , 6h ), 1 . 27 ( s , 18h ), 0 . 83 ( s , 6h ), 0 . 63 ( s , 6h ) [ synthesis example of transition metal compound : di - μ - oxobis { dimethylsilylene ( η 5 - tetramethyl cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium } ( compound 2 )] in a schlenk tube , 1 . 50 g ( 3 . 3 mmol ) of dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium dimethoxide was dissolved in 20 ml of toluene , 1 ml of water was added thereto , and the resulting liquid mixture was stirred at 70 ° c . for 1 hour . after concentrating the organic layer which was obtained by phase separation , the concentrate was recrystallized from 10 ml of heptane to obtain di - μ - oxobis { dimethylsilylene ( η 5 - tetramethyl cyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium } of yellow crystals ( 0 . 40 g , 33 %). mass spectrum ( m / e ) 808 . calculated value : 808 [ 0112 ] 1 h - nmr ( 270 mhz , c 6 d 6 ); δ7 . 28 ( m , 4h ), 2 . 32 ( s , 12h ), 1 . 97 ( s , 6h ), 1 . 78 ( s , 6h ), 1 . 59 ( s , 6h ), 1 . 53 ( s , 18h ), 0 . 78 ( s , 6e ), 0 . 58 ( s , 6h ) using an autoclave type reactor having an inner volume of 1 liter equipped with a stirrer , polymerization was carried out by continuously feeding ethylene and hexene - 1 into the reactor . regarding the polymerization conditions , the total pressure was set to 80 mpa and the concentration of hexene - 1 based on the total of ethylene and hexene - 1 was set to 28 . 8 % by mole . a heptane solution ( which was adjusted to be the concentration of compound 1 of 0 . 185 μmol / g , the concentration of triisobutylaluminum of 18 . 5 μmol / g and a molar ratio of al atom to ti atom of 50 .) in which μ - oxobis { diethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide } ( compound 1 ) and triiosobutylaluminum were mixed and a toluene solution ( 0 . 90 μmol / g ) of n , n - dimethylaniliniumtetrakis ( pentafluorophenyl ) borate were respectively prepared in separate vessels . each of the solutions was continuously fed in the reactor at a feeding rate of 100 g / hour and 140 g / hour . the polymerization reaction temperature was at 222 ° c ., and a molar ratio of boron atom to ti atom was set to 3 . 4 . as a result , an ethylene - hexene - 1 copolymer having mfr of 8 . 39 , a density ( without annealing ) of 0 . 883 g / cm 3 , scb of 36 . 0 , a weight average molecular weight ( mw ) of 62000 and a molecular weight distribution ( mw / mn ) of 1 . 9 was produced at a rate of 74 ton per 1 mole of ti atom . using an autoclave type reactor having an inner volume of 1 liter equipped with a stirrer , polymerization was carried out by continuously feeding ethylene and hexene - 1 into the reactor . the total pressure was set to 80 mpa and the concentration of hexene - 1 based on the total of ethylene and hexene - 1 was set to 34 % by mole . a hexane solution ( 0 . 7 μmol / g ) of dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium dichloride , a heptane solution of triisobutylaluminum ( 33 μmol / g ) and further a toluene solution ( 1 . 2 μmol / g ) of n , n - dimethylaniliniumtetrakis ( pentafluoroplenyl ) borate were respectively prepared in separate vessels and continuously fed into the reactor at feeding rates of 290 g / hour , 350 g / hour and 580 g / hour , respectively . the polymerization reaction temperature was set at − 215 ° c ., and a molar ratio of boron atom to ti atom was set to 3 . 3 . as a result , an ethylene - hexene - 1 copolymer having mfr of 4 . 2 , a density ( without annealing ) of 0 . 881 g / cm 3 , a melting point of 67 . 3 ° c ., scb of 40 . 4 , mw of 66000 and mw / mn of 1 . 8 was produced in a rate of 14 ton per 1 mole of ti atom . after replacing the atmosphere of an autoclave type reactor having an inner volume of 0 . 4 liter equipped with a stirrer with argon , 185 ml of cyclohexane as a solvent and 15 ml of hexene - 1 as an α - olefin were charged and the reactor was heated to 18 ° c . after the elevation of temperature , ethylene was fed while adjusting at an ethylene pressure of 2 . 5 mpa . after the system was stabilized , 0 . 2 mmol of triisobutylaluminum , 0 . 5 ml ( namely , 0 . 5 μmol of compound 1 and 25 μmol of triisobutylaluminum ) of a heptane solution ( which was adjusted to be the concentration of compound 1 of 1 μmol / ml , the concentration of triisobutylaluminum of 50 μmol / ml and a molar ratio of al atom to ti atom of 25 .) in which μ - oxobis { dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide } ( compound 1 ) and triisobutylaluminum were mixed , were charged and successively , 1 . 5 μmol of n , n - dimethylaniliniumtetrakispentafluorophenyl ) borate was charged as a slurry in heptane . polymerization was carried out for 2 minutes . as a result of the polymerization , 2 . 53 g of an ethylene - hexene - 1 copolymer having [ η ] of 0 . 85 dl / g , scb of 31 . 4 and melting points of 78 . 6 ° c . and 90 . 8 ° c . was obtained . polymerization activity per 1 mole of ti atom was 2 . 53 × 10 4 g polymer / mol - ti atom per 2 minutes . after replacing the atmosphere of an autoclave type reactor having an inner volume of 0 . 4 liter equipped with a stirrer with argon , 185 ml of cyclohexane as a solvent and 15 ml of hexene - 1 as an α - olefin were charged and the reactor was heated to 180 ° c . after the elevation of temperature , ethylene was fed while adjusting at an ethylene pressure of 2 . 5 mpa . after the inner of system was stabilized , 0 . 2 mmol of triisobutylaluminum , 0 . 5 ml ( namely , 0 . 5 μmol of compound 1 and 25 μmol of triisobutylaluminum ) of a heptane solution ( which was adjusted to be the concentration of compound 1 of 1 μmol / ml , the concentration of triisobutylaluminum of 50 μmol / ml and a molar ratio of al atom to ti atom of 25 .) in which μ - oxobis { dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium methoxide } ( compound 1 ) and triisobutylaluminum were mixed , were charged and successively . 3 μmol of n , n - dimethylanilinium tetrakis ( pentafluorophenyl ) borate was charged as a slurry in heptane ( a slurry concentration of 1 μmol / ml ). polymerization was carried out for 2 minutes . as a result of the polymerization , 5 . 33 g of an ethylene - hexene - 1 copolymer having [ η ] of 0 . 67 dl / g , scb of 35 . 0 , melting points of 74 . 2 ° c . and 88 . 6 ° c ., mw of 43000 and mw / mn of 2 . 7 was obtained . polymerization activity per 1 mole of ti atom was 5 . 33 × 10 6 g - polymer / mol - ti atom per 2 minutes . after replacing the atmosphere of an autoclave type reactor having an inner volume of 0 . 4 liter equipped with a stirrer with argon , 185 ml of cyclohexane as a solvent and 15 ml of hexene - 1 as an α - olefin were charged and the reactor was heated to 180 ° c . after the elevations of temperature , ethylene was fed while adjusting at an ethylene pressure of 2 . 5 mpa . after the system was stabilized , 0 . 2 mmol of triisobutylaluminum , 0 . 5 ml ( namely , 0 . 5 μmol of compound 2 and 25 μl mol of triisobutylaluminum ) of a heptane solution ( which was adjusted to be the concentration of compound 2 of 1 μmol / ml , the concentration of triisobutylaluminum of 50 μmol / ml and a molar ratio of al atom to ti atom of 25 .) in which di - μ - oxobis { dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium } ( compound 2 ) and triisobutylaluminum were mixed , were charged and successively , 1 . 5 μmol of n , n - dimethylanilinium tetrakis ( pentafluorophenyl ) borate was charged as a slurry in heptane ( a slurry concentration of 1 μmol / ml ). polymerization was carried out for 2 minutes . as a result of the polymerization , 2 . 55 g of an ethylene - hexene - 1 copolymer having [ η ] of 0 . 84 dl / g , scb of 30 . 7 and melting points of 80 . 2 ° c . and 93 . 0 ° c . was obtained . polymerization activity per 1 mole of ti atom was 2 . 55 × 10 6 g - polymer / mol - ti atom per 2 minutes after replacing the atmosphere of an autoclave type reactor having an inner volume of 0 . 4 liter equipped with a stirrer with argon , 195 ml of cyclohexane as a solvent and 15 ml of hexene - 1 as an α - olefin were charged and the reactor was heated to 180 ° c . after the elevation of temperature , ethylene was fed while adjusting at an ethylene pressure 2 . 5 mpa . after the system was stabilized , 0 . 2 mmol of triisobutylaluminum , 0 . 5 ml ( namely , 0 . 5 μmol of compound 2 and 25 μmol of triisobutylaluminum ) of a heptane solution ( which was adjusted to be the concentration of compound 2 of 1 μmol / ml , the concentration of triisobutylaluminum of 50 μg mol / ml and a molar ratio of al atom to ti atom of 25 .) in which di - μ - oxobis { dimethylsilylene ( η 5 - tetramethylcyclopentadienyl )( 3 - tert - butyl - 5 - methyl - 2 - phenoxy ) titanium } ( compound 2 ) and triisobutylaluminum were mixed , were charged and successively , 3 μmol of n , n - dimethylanilinium tetrakis ( pentafluorophenyl ) borate was charged as a slurry in heptane ( a slurry concentration of 1 μmol / ml ). polymerization was carried out for 2 minutes . as a result of the polymerization , 3 . 92 g of an ethylene - hexene - 1 copolymer having [ η ] of 0 . 73 dl / g , scb of 33 . 0 , melting points of 78 . 9 ° c . and 91 . 5 ° c . mw of 48000 and mw / mn of 2 . 5 was obtained . polymerization activity per 1 mole of ti atom was 3 . 92 × 10 6 g - polymer / mol - ti atom per 2 minutes . as described above in detail , according to the present invention , a transition metal compound useful an a highly active olefin polymerization catalyst component at an efficient reaction temperature in the industrial process of an olefin polymerization , and a highly active olefin polymerization catalyst using said transition metal compound and a process for producing an olefin polymer using said olefin polymerization catalyst are provided . further , the transition metal compound of the present invention is also effective as an olefin polymerization catalyst component having a high comonomer reaction rate in compolymerization and providing an olefin polymer with a high molecular weight , and has a remarkable value for utilization . | 8 |
fig1 is a simplified circuit diagram of a multiplier 2 having a carry save adder csa , a temporary sum register 4 , a temporary result register 6 , a temporary carry register 8 and an accumulating result shift register 10 . each register 4 , 6 , 8 , 10 has a plurality of flip - flops ff . the carry save adder csa has a plurality of full adders fa in two rows for two bits x i and x i + 1 of a second operand . a further carry save adder comprising four rows is shown in fig7 will be described later . the two row carry save adder csa in fig1 and the four row carry save adder csa in fig7 are comparable in layout . consider the example of a first operand of 4 bit depth with bits a 0 to a 3 . the bit values a 0 to a 3 are input to the respective and - gates together with respective two bit values x i and x i + 1 . the output of the and - gates supply the a input of the full adders fa . the lower bit parts of the full adder fa sums are stored in temporary result register 6 . the higher bit parts of the full adder fa sums are stored in temporary sum register 4 . the carry values from the full adders fa of the last row of carry save adder csa are stored in temporary carry register 8 . to multiply operands having more than four bits , this operation of the carry save adder csa is repeated iteratively . the accumulating result shift register 10 incorporates the lower bit results . this is indicated by the arrow pointing from the temporary result register 6 to the accumulating result shift register 10 . further details for the carry save adder csa and its operation are exemplarily known from german patent application no . 10 2007 014 808 filed on mar . 28 , 2007 and german patent application no . 10 2007 056 104 filed on nov . 15 , 2007 by the same applicant . according to an exemplary embodiment , the registers 4 , 6 , 8 , 10 are clocked by clock signal clk that is preferably generated by an oscillator according to an embodiment shown in one of fig2 to 4 , 6 or 8 . the respective oscillators are exemplarily dedicated to the two row type multiplier 2 shown in fig1 . fig2 is an oscillator 12 comprising a full adder fa , a first flip - flop ff 1 , a second flip - flop ff 2 , an xor - gate xor and a delay element del . oscillator 12 is enabled by setting input a of full adder fa to high . the second input b of full adder fa is constantly set to “ 0 ”. fig3 illustrates time dependent signals of selected terminals of the logic gates of the oscillator 12 illustrated in fig2 . when switching input a of full adder fa from low to high a delay time t fa - s elapses before sum output s of full adder fa follows and also switches from low to high . sum output s of full adder fa supplies input c 1 of flip - flop ff 1 which also changes from low to high . after expiration of a delay time t ffq , which is the clock to q delay time of flip - flop ff 1 , output q 1 of flip - flop f 1 switches to high . the inverted output of flip - flop ff 1 q 1 is coupled to data input d 1 of flip - flop ff 1 . output q 1 is coupled to one terminal of xor - gate xor . the other terminal of xor - gate xor is coupled to output q 2 of second flip - flop ff 2 . after expiration of the delay time t xor of xor - gate xor , xor - gate xor switches clock signal clk to high ( see fig3 ). if the delay time the delay element del is zero , the clock signal clk is equal to signal cin . signal cin is coupled to carry in terminal cin of full adder fa . following a further delay time t fa - co , the input to carry output delay of full adder fa , carry output cout of full adder fa switches to high . carry output cout of full adder fa is coupled to clock input c 2 of second flip - flop f 2 . clock input c 2 of second flip - flop ff 2 thus follows signal cout . after expiration of the delay time t ffq , the clock to q delay time of the second flip - flop which is preferably equal to the clock to q delay time of first flip - flop ff 1 , output q 2 of second flip - flop ff 2 switches from low to high . inverted output q 2 of second flip - flop ff 2 is coupled to the data input d 2 of second flip - flop ff 2 . output q 2 of second flip - flop ff 2 is coupled to the second terminal of xor - gate xor . since the value at output q 1 of first flip - flop ff 1 is still high , the output of xor - gate xor switches from high to low after expiration of delay time t xor . thus clock signal clk switches from high to low and a first clock period clkp has expired ( see fig3 ). this signal routing is repeated for each clock cycle . at the beginning of a new clock cycle , clock signal clk is coupled to carry input cin of full adder fa via delay element del . upon expiration of delay time t fa - s sum output s of full adder fa switches from low to high . the signal routing proceeds as already explained . at the end , clock signal clk again switches to high . clkp = 2 t ffq + t fa - s + t fa - co + 2 t xor + 2 t delay where : t delay is the delay time of delay element del . the propagation delay time of the critical path cpom of a multiplier may be estimated by help of the formula : where : t ffq is the delay time at a flip - flop for a signal that is routed from a clock input to the q output ; t ff - setup is the setup time for a flip - flop ; t fa - s is the delay time in the full adder for a signal that is routed from the carry input cin to the sum output s ; and t fa - co is the delay time in a full adder for a signal that is coupled to carry input cin and is routed to carry output cout . for a typical flip - flop , 2t ffq is nearly equal to t ffq plus t fe - setup . this is because setup time t ff - setup is nearly equal to the clock to q delay t ffq . the setup time is approximately the clock to q delay t ffq . accordingly , the first summand 2t ffq of the formula for clkp and the sum of the first two delay times t ffq and t ff - setup in the formula for cpom are nearly equal . further , the second and third delay time in the formula for clkp and the third and fourth delay time inside the formula for cpom ( t fa - s , t fa - co ) are identical . consequently , the clock period clkp is greater than the critical path of the multiplier cpom by the following delay time t sm which is referred to as a safety margin . consequently , the oscillator 12 giving the clock signal clk for the registers 4 , 6 , 8 and 10 of the multiplier 2 according to fig1 is slower than the signal delay time of the critical path of the multiplier 2 . the propagation delay of the critical path of the carry save adder csa is lower or equal to the clock period of the oscillator 12 plus the delay time t sm defining a safety margin . the logical gates of the oscillator 12 and the logical gates of the multiplier 2 are preferably manufactured with the same standard cell or have the same semiconductor layout . thus the safety margin t sm is preserved even if the pvt parameters change . fig4 and 5 are further embodiments of oscillator 12 . in fig4 sum output s of full adder fa supplies the clock inputs of flip - flops ff 1 and ff 2 . in fig5 carry output cout of full adder fa supplies the clock inputs of flip - flops ff 1 and ff 2 . in both embodiments , one channel is inverted . fig4 illustrates inverter inv coupled to clock input c 2 of second flip - flop ff 2 . fig5 illustrates inverter inv coupled to clock input c 1 of first flip - flop ff 1 . the operation of the embodiments of fig4 and 5 is very similar . in fig4 , inverter inv inverts the signal sum output s of full adder fa to clock input c 2 of second flip - flop ff 2 . the signal from sum output s of full adder fa to clock input c 1 of first flip - flop ff 1 is not inverted . thus just one of flip - flops ff 1 and ff 2 receives a clock signal . sum s and carry cout output of full adder fa are opposite to each other and accordingly only one of the clock inputs of the flip - flops receives a clock signal . thus if a first clock input is high the other clock input will be low . the embodiment is advantageous if the delay times between the carry input cin an the sum output s designated t fa - s and the delay time between the carry input cin and the carry output cout of the full adder fa designated t fa - co are significantly different . a suitable delay time should be selected . the additional inverter inv provides an extra delay time adding a further delay to the clock period . according to a further embodiment shown in fig6 , the oscillator 12 has a further full adder this including first full adder fa 1 and second full adder fa 2 . oscillator 12 further includes a first and gate and 1 and a second and gate and 2 . as already shown in fig2 , data output q 1 of first flip - flop ff 1 is coupled to the first terminal of the xor - gate xor and data output q 2 of second flip - flop ff 2 is coupled to the second terminal of the xor - gate xor . inverted output q 1 of first flip - flop ff 1 is coupled to data input d 1 of first flip - flop ff 1 and inverted output q 2 of second flip - flop ff 2 is coupled to data input d 2 of second flip - flop ff 2 . the output of the xor - gate outputs clock signal clk and is further coupled via the delay element del to carry inputs cin of both first full adder fa 1 and second full adder fa 2 . oscillator 12 is enabled by switching input a of first adder fa 1 and input a of second full adder fa 2 from low to high . second input b of first full adder fa 1 and second full adder fa 2 remain at “ 0 ”, as illustrated in fig2 . sum output s 1 of first full adder fa 1 is coupled to one terminal of first and element and 1 . sum output s 2 of second full adder fa 2 is coupled to the other terminal of first and element and 1 . the output of first and element and 1 is coupled to clock input c 1 of first flip - flop ff 1 . carry output cout 1 of first full adder fa 1 is coupled to one terminal of second and - gate and 2 . carry output cout 2 of second full adder fa 2 is coupled to the other terminal of second and - gate and 2 . the output of second and gate and 2 is coupled to clock input c 2 of second flip - flop ff 2 . first and second and - gates and 1 and and 2 are high if both inputs are high . the output of first and gate and 1 is high if both sum output s 1 of first full adder fa 1 and sum output s 2 of second full adder fa 2 are high . the same applies with respect to carry outputs cout 1 and cout 2 of first full adder fa 1 and second full adder fa 2 . first full adder fa 1 and second full adder fa 2 work synchronously . if the first full adder fa 1 and second full adder fa 2 are exactly identical and have the same internal delay times ( t fa - s , t fa - co ), the clock period is the clock period of the embodiment in fig2 with an added delay time due to the and gates and 1 and and 2 . however , if the full - adders fa 1 and fa 2 having differing delay times , due to production spread or slight variations in the semiconductor production process , clock period clk is dominated by the slower full - adder . this leads to a further safety margin with respect to the necessity that clock period clk shall be slower than the critical path of the multiplier . fig7 is a simplified circuit diagram of a multiplier 2 including a carry save adder csa , a temporary sum register 4 , a temporary result register 6 , a temporary carry register 8 and an accumulating result shift register 10 . each register 4 , 6 , 8 , 10 has a plurality of flip - flops ff . carry save adder csa has a plurality of full adders fa in four rows for four bits x i , x i + 1 , x i + 2 , and x i + 3 of a second operand . the first operand has a 4 bit depth with bits ranging from a 0 to a 3 . for operands having a higher bit depth , the operation is repeated iteratively . the operation of the registers 4 , 6 , 8 , 10 is the same mentioned for the multiplier 2 illustrated in fig1 . fig8 is further embodiment of an oscillator 12 corresponding to the embodiment of fig4 including two full adders fa 1 and fa 2 . carry output cout of first full adder ff 1 is coupled to carry input cin of second full adder fa 2 . the clock period clkp for the oscillator according to fig8 is given by the following formula : this includes an extra time of 2t fa - co in comparison to the embodiment of fig2 . this extra time may be necessary since the critical path cpom of a multiplier having four rows may be estimated by the formula : assume the delay time for a signal from the carry input to the sum output t fa - s of a full adder is comparable to the delay time of a signal from the carry input cin to the sum output s t fa - co in a full adder . this includes an extra time of 2 t fa - co compared to the embodiment of fig2 . thus the safety margin between the clock of the oscillator and the carry save adder remains constant at : this principle permits the design of a suitable oscillator for a multiply unit having a carry save adder with an arbitrary number of rows . the number of rows of the multiply may be twice as high as the number of full adders . fig9 is a simplified floor plan for a carry save adder and an oscillator . the oscillator has first and second flip - flops ff 1 and ff 2 , first and second full adders fa 1 and fa 2 , first and second and gates and 1 and and 2 and xor - gate xor . as an example according to fig6 the oscillator may have no delay element del . further flip - flops ff , full adders fa and and gates and are component parts of the carry save adder . this embodiment permits the signal routing delay times inside the oscillator and inside the carry save adder to be matched . to switch clock signal clk ( see also fig6 ) the signal from data output q 1 of first flip flop ff 1 must be routed to one input of xor - gate xor . the same applies for signal routing between data output q 2 of second flip flop ff 2 and the other input of xor - gate xor . by placing the two flip - flops ff 1 and ff 2 in the periphery of the carry save adder , the critical path of the oscillator including the signal routing delay times is longer than the delay time of the critical path in the carry save adder . the wiring length and therefore the signal delay due to signal propagation in the oscillator is always at least slightly greater than the maximum routing delay time of the multiply unit . xor - gate xor is disposed in a center area that is more or less in the middle between the two flip - flops ff 1 and ff 2 . this provides a uniform duty cycle of the oscillator . in the floor plan of fig9 , the length of the conductive path between data output q 1 of first flip flop ff 1 and the input of xor - gate xor is more or less the same as the length of the conductive path between data output q 2 of second flip flop ff 2 and the other input of xor - gate xor . the signal routing delay time will be comparable for the two conductive paths . during a first part of the clock cycle of the oscillator , if the output signal of the oscillator is “ high ”, the clock signal is routed from first flip - flop ff 1 to xor - gate xor . during a second part of the clock cycle of the oscillator , if the output signal is “ low ”, the clock signal is routed from the second flip - flop ff 2 to the xor - gate xor . due to the arrangement of the xor - gate in a center region of the carry save adder , the signal path delay for the clock signal that is routed from first flip - flop ff 1 to xor - gate xor is comparable to the signal path delay for the clock signal that is routed from second flip - flop ff 2 to xor - gate xor . accordingly , the duty cycle of the clock signal is advantageously uniform . fig1 and 11 are exemplarily simulations of the energy consumption of a 32 bit multiplier according to the prior art and in comparison a 32 bit multiplier according to an embodiment of this invention . the potential for energy savings is visualized . the graphs show the power consumption in mw over time in μs . the respective areas illustrate the energy consumption . in the upper part of fig1 shows the energy consumption of a multiplier according to the prior art . in comparison , the lower part of fig1 illustrates the energy consumption of a multiplier according to an embodiment of this invention . as an example fig1 assumes a system frequency of 10 mhz . fig1 is a further example comparing the energy consumption of multiplier according to the prior art with a multiplier according to an embodiment of the invention . fig1 assumes a system frequency of 25 mhz . the upper part of fig1 shows the energy consumption of a multiplier according to the prior art , while the lower part of fig1 illustrates the energy consumption of a multiplier according to an embodiment of this invention . at a system speed of 10 mhz , the multiplier according to the prior art consumes 12 cpu cycles having a duration of 1 . 2 μs for the exemplary multiplication operation . the multiplier itself consumes 0 . 59 nws during this operation . further parts of the system consume 1 . 25 nws . after the calculation , a quiescent energy consumption of 0 . 08 nws is consumed until the end of 2 μs . this leads to a total energy consumption of 1 . 92 nws . in contrast , a multiplier according to an embodiment of the invention consumes 1 . 06 nws for the exemplary multiplication operation . this specific energy consumption is higher than for the multiplier according to the prior art . however , the multiplication operation is finished after 2 cpu cycles . the power consumption of the further parts of the system is accordingly only 2 / 12 of the aforementioned 1 . 25 nws which is about 0 . 21 nws . after the calculation , a quiescent energy consumption of 0 . 18 nws is consumed until the end of 2 μs . this leads to a total energy consumption of 1 . 45 nws . this is a total energy savings of about 24 . 5 %. the multiplier according to an embodiment of this invention needs about 24 . 5 % less energy for the same exemplary calculation operation in comparison to an multiplier according to the prior art . fig1 illustrates the exemplary calculation at a system speed of 25 mhz . fig1 shows a total power savings of about 11 . 6 %. a 32 bit multiplier according to the prior art consumes about 1 . 99 nws during 2 μs . since the overall system frequency is higher , the multiplier according to an embodiment of this invention requires 5 cpu cycles instead of 2 cpu cycles at a system frequency of 10 mhz . this leads to an energy consumption of 1 . 06 nws for the multiplier and 0 . 52 nws for the further part of the system . the energy consumption of the further parts of the system is significantly reduced because this embodiment of the invention requires 5 cpu cycles instead of 12 cpu cycles required by the multiplier of the prior art . the total energy consumption of the multiply operation according to this embodiment of the invention is 1 . 76 nws during 2 μs . fig1 shows a simplified diagram of a multiplier with two adder stages . this is a typical configuration of a multiplier 2 . the first stage is a carry save adder csa 1 in accordance with the previously discussed embodiments of the invention . the second stage is a carry propagate stage cpa configured to sum the final temporary sum vector and the final temporary carry vector provided in registers 4 and 8 by carry save adder csa 1 . since carry propagate adder cpa has an entirely different architecture than carry save adder csa 1 , the optimized clocking principles and oscillators shown fig2 , 4 , 5 , 6 and 8 according to the invention cannot be applied . the final summing performed in carry propagate adder cpa requires a different clock period . this disadvantage can be overcome if carry save adder csa 1 is used for the last summing instead of carry propagate adder cpa . fig1 illustrates how a carry save adder used for the normal operation can be reused for the final summing . fig1 shows two carry save adder stages csa 1 and csa 2 . carry save adder stage csa 2 is only illustrated to show the way in which carry save adder stage csa 1 is be modified to perform the final summing step . the same hardware is used for carry save adder stage csa 1 and csa 2 . f carry save adder stage csa 1 has the carry save adder configuration described with respect to the other embodiments of the invention . an optimized oscillator according to the aspects of the invention can be used . the second carry save adder stage csa 2 sums the last temporary sum vector and the last temporary carry vector . the hardware for both configurations csa 1 and csa 2 is the same . it is a 16 by 16 bit carry save array . since the same hardware is used for both operations , the critical paths are identical . the maximum propagation delays of the two carry save adder configurations csa 1 and csa 2 are therefore exactly equal . this means that the same optimized clock period can be used . fig1 shows a simplified circuit diagram of modification of the multiplier shown in fig1 . the modifications reuse the same carry save array for all summing steps as illustrated in fig1 . there is an additional and gate coupled to each full adder for the highest bit of each row . the other and gates of each row have an additional input for a partial product enable signal en_pp . this signal is high during normal operation while the partial products are calculated . the oscillator and optimal clock period according to this invention is used for each cycle . there is an additional enable signal referred to as accumulator enable signal en_acc . this signal is always active when en_pp is active and additionally during the first cycle during which the final product ( illustrated by csa 2 in fig1 ) is formed . signals en_acc and en_pp allow adding the two highest significant bits of the value held in accumulating result shift register 10 . the lower significant bits other than two highest significant bits of the accumulating result shift register 10 are loaded into the temporary sum register 4 before the carry save adder operation starts . this principle is applied to other embodiments using carry save adders with a different number of rows and columns . the carry save array shown in fig1 can be used for all summing operations required for determining the product of two operands and it allows to add a third operand from the accumulation register . since the same hardware is used for all operations , the critical path is the same and the same optimized clock signal generated by the oscillators according to the invention can be used . in order to ensure the critical path as defined herein above , there are flip - flops ff added between the outputs of the and gates and the inputs of the full adder cells fa . the flip - flops allow the partial products in the and gates to be determined one cycle before the summing in the full adders fa is performed . this ensures that the critical path becomes independent of the partial product generation and corresponds always to a path comprising a flip - flop ff , a full adder fa another full adder fa and another flip - flip ff . this also applies to the and gates used for gating the accumulator signals with enable signal en_acc and with partial product enable signal en_pp . the same modifications as shown in fig1 with respect to fig1 can be made for the embodiment shown in fig7 . although the invention has been described hereinabove with reference to specific embodiments , it is not limited to these embodiments and no doubt further alternatives will occur to the skilled person that lie within the scope of the invention as claimed . | 6 |
the techniques of the present invention are designed to treat atherosclerosis without damaging the important endothelial layer . once the catheter is positioned , the heating of the atherosclerotic lesion takes little time , in some cases less than one - half second . the power levels are low — in the range of about 1 watt . the catheter is designed to operate while blood continues to flow through the artery . a temperature profile is produced in the arterial wall that necroses or ablates connective tissue , softens waxes and fats , and allows the arterial pressure to more gently act to dilate the artery . frequency of the radiation has a significant affect on the depth of maximum energy deposition . the beamwidth can be selected to be in accord with the size of the lesion . where the lesion ( s ) are asymmetrically disposed in a specific arc of the arterial wall , the energy is directed toward the arc and the angle of focus for the radiator can be adjusted accordingly . this provides much more efficient use of the energy , making the procedure quicker . it also protects the remainder of the healthy tissue from being overheated . therefore , radiation is preferably more specifically tailored to concentrate energy within the atherosclerotic lesion based on the position and depth thereof , as well as the size and shape of the lesion . as more improved information becomes available by ever improving technology about the more precise structure of the lesion , such as with mri and cat scans , the information can be used to further refine predictions when computing temperature profiles through the computerized modeling techniques disclosed , as discussed further in regard to the computer simulation program . furthermore , the test assembly of the parent of this application may be used to quite realistically test the instrument using damaged arterial segments so that extensive experience and training can be obtained prior to use . as a general background . fig1 discloses the progressive nature of atherosclerosis with a variable time line in terms of age . artery 1110 is initially free of lesions or fatty tissue so that lumen 1114 is completely open . between very roughly the age of 15 to 30 , fatty streaks 1115 begin to develop as shown by artery 1120 . these fatty streaks may disappear as indicated by the double arrows between artery 1110 and 1120 . thus , the body has the ability to reabsorb fatty streaks , to some extent . over age 30 , waxy and fibrous tissue or atheroma 1118 forms as indicated in artery 1130 . the atheroma 1118 , or atherosclerotic lesion , shown in artery 1130 , is in the uncomplicated state , or non - thrombotic state , that leaves some lumen , however narrow . the waxy , and especially the fibrous tissue does not normally disappear as frequently as did fatty streaks 1115 . without assistance of some type , the body has less ability to reabsorb such tissue . at some time , very roughly in the age range of 40 to 80 , a complicated lesion 1124 , with plaque that typically also includes calcification , as indicated in artery 1140 may occur . the body tends to have little ability to reabsorb the calcification although some pharmacological treatments exist wherein the goal is to assist the body to effect reabsorption of calcified plaque . complicated lesion 1124 is considered complicated because it may be hemorrhaged , ulcered , calcified , or thrombogenic , and may produce a heart attack , or myocardial infarction , due to blockage of blood flow . in this case , thrombus or blood clot 1122 has formed to block artery 1140 . therefore , as the disease slowly progresses , trauma to the endothelial layer may occur that results in a complication . for instance , if blood is then exposed to collagen tissue that typically encapsulates the plaque , and / or for the numerous other reasons discussed hereinabove , blood clot such as thrombus 1122 may develop that closes the artery lumen and results in a heart attack due to the heart muscle not receiving sufficient , or any , blood flow . obviously , it is preferable that treatment begin prior to the complicated or occlusive stage of artery 1140 . such treatment may be directed to slowing down the atherosclerotic processes involved and may involve dieting , monitored exercising , lowering cholesterol , decreasing blood pressure , and the like . if the lumen needs to be dilated to obtain sufficient blood flow to the heart muscles , and pharmacological means are unable to provide suitable relief , means as discussed hereinafter may be used to dilate the lumen while attempting to maintain the important healthy aspects of the artery . it will be observed that often , as shown , atherosclerotic lesions are asymmetrical , as indicated in artery 1130 . in accord with the present invention , the healthy tissue not affected by atherosclerosis should be protected and not be placed under stress . any healthy tissues that are damaged in the process of dilating the lumen may become involved in processes of restenosis wherein a relatively rapid reclosure of the artery may occur within one year or so after the dilation procedure . according to the present invention , plaque is preferably heated so as to soften and melt it . after heating , the plaque volume or volume of the lesion may be somewhat reduced and some plaque components , such as the fatty elements , may perhaps be reabsorbed to a certain degree . the heating also necroses or ablates connective tissue so that the arterial lumen can dilate due to natural arterial pressure . without the aid of connective tissue , flesh loses connective strength and may be similar to a paste or gel in overall tensile strength . care also needs to be taken to not ablate too much tissue surrounding the artery . if the artery has insufficient strength , it may become subject to problems of aneurysms . as noted previously , the possibility of aneurysms can also be a long term problem associated with balloon angioplasty treatment . apparently , simply opening the diameter of the lumen is not , in itself , necessarily the cause of restenosis . by avoiding damage to healthy tissue including the endothelium , it is expected that this technique will alleviate some , and perhaps many , of the processes of restenosis . however , it will be recognized that essentially dilation procedures are simply delay procedures that permit improved blood circulation while , hopefully , the underlying causes of the atherosclerosis , which may be many causes , are alleviated . however , because restenosis tends to proceed at a much faster pace than the underlying problem of atherosclerosis , restenosis remains a very significant barrier to successful long term treatment of atherosclerosis . it is therefore a basic goal of the present invention to alleviate problems of restenosis while dilating the artery . fig1 discloses the general make up of a healthy arterial vessel wall in greater detail disclosing the cellular layers of tissues and provides , very approximately , the width in microns of the cellular layers in an average healthy vessel wall . the values of the width of the vessel wall may change significantly for a vessel wall having an atherosclerotic lesion in it . plaque tends to somehow make its way into and to build up within the intimal and / or medial layers , apparently due to numerous processes that may underlie the atherosclerosis . the intimal layer includes the endothelium layer wherein endothelial cell 1212 is indicated and an additional layer of cellular tissue 1214 . as discussed previously , blood does not clot when in contact with the endothelial layer but has a tendency to do so when it comes into contact with many other types of tissues such as those found within plaque , e . g ., collagen or connective tissue . such tissues are highly thrombotic . protection of the endothelial layer is therefore very important and , if it remains healthy , will probably aid in preventing or slowing of numerous of the processes of restenosis , as well as the processes involved in atherosclerosis . internal elastic membrane 1216 separates the intimal layer from medial layer that includes smooth muscle cells 1222 . adventitial layer 1224 provides for lymph drainage and blood flow within the arterial wall . the lumen is located adjacent intimal layer and defined by the endothelium , in the health artery . atherosclerotic lesions are found within the vessel wall , generally in the intimal or medial layers . it is desirable to apply heat to the lesion without traumatizing the surrounding tissues , including the endothelium and adventitial layers . where possible , it is desirable to protect the healthy intimal layer and / or medial layers when the lesion has not formed therein . therefore , a system is necessary for developing a controllable temperature profile that maximizes heat within the lesion and wherein the temperature drops off quickly outside the lesion to avoid damage to healthy tissue . referring now to fig1 the major components of system 10 disclose a preferred embodiment of the present invention for treating atherosclerosis . generally , system 10 includes a millimeter wave / microwave power source , a catheter transmission line in the form of a waveguide , coaxial cable or combination of the two , and an antenna / radiator located at the end of the catheter . another type of catheter without a microwave transmission line is also shown as an alternative embodiment in fig1 and is discussed hereinafter . power source 12 is capable of producing up to 10 watts at a controlled power level . however , generally the power required may be considerably less if the atherosclerotic lesion is asymmetrically oriented and depending on the size thereof . it is presently anticipated that heating will generally be sufficiently effected at levels closer to about one watt , depending on the volume of the lesion . the subsequently shown test results are normally based on an antenna power of one watt or less . power level control 14 is used to adjust the antenna power to the desired level . power source 12 supplies power at the desired frequency , which as shown hereinafter , can be used to control the temperature profile . selected frequencies for the present invention , depending on the application as discussed hereinafter , are in a range from 2 ghz to 300 ghz . it is presently anticipated that a separate power source would preferably be used or required for each frequency selected . pulse duration control 15 provides a pulse that controls the time that antenna power is applied . in the present embodiment , pulse duration control 15 is arranged to be pulsed with a desired pulse duration of from 0 . 1 to 10 seconds , with the accuracy of the pulse duration controlled within 2 %. as will be seen subsequently , the pulse duration was less than about 0 . 5 seconds during the tests for anticipated volumes of lesion size which were for asymmetrically spaced atheromas . as discussed subsequently , the necessary power can be applied more quickly , or efficiently , if the asymmetrical nature of the typical atherosclerotic lesion is taken into consideration . not only is heating time reduced thereby limiting treatment time to a desirable minimum , but also healthy tissue is spared . the pulse duration may be increased or decreased as necessary and precision of the pulse length could be narrowed , if desired although the small 2 % variation in pulse duration is not anticipated to significantly affect the thermal profile produced . directional coupler 16 is used to match impedances for more efficient application of power to the antenna . forward / reflected power monitor 18 detects if a mismatch has occurred such that power is not being radiated from the antenna with sufficient efficiency . in that case , power will not be radiated efficiently and therefore power source 12 may be shut down automatically . catheter 20 provides a means of directing energy from power source 12 to antenna 22 . at the higher range of frequencies from approximately 25 - 30 ghz to300 ghz , it is likely that a flexible waveguide would provide the most efficient means of power delivery . at the lower frequencies , from approximately 2 ghz to 25 - 30 ghz , a coaxial cable will probably be preferable for efficiency of power delivery . in some cases , it may be desirable to have a coaxial cable for a portion of catheter 20 formed of coaxial cable and a portion formed of waveguide . if that proves to be desirable as may occur for flexibility purposes , cost , convenience or other reasons , then an impedance matching transition member , such as transition member 24 , may be used to connect between the coaxial cable portion and the waveguide portion . in yet another embodiment , such as that discussed in the embodiment of fig1 , it may be preferable to locate the millimeter wave source directly behind the antenna , thereby reducing transmission line losses . antenna design is also preferably made dependent of the selected frequency of operation . for operation in the higher range of frequencies , the presently preferred embodiment of the invention would use a radically beveled open ended waveguide antenna , as shown in fig2 and discussed hereinafter . the radically beveled antenna produces a radiation beam that is directed to a selected arc of the lumen . for frequencies at the lower end of the frequency range , disk loaded monopole antennas , as shown in fig3 have proven to be effective . disk loaded monopole antennas are discussed in some detail in the parent to this application , which application is incorporated by reference herein . at the low end of the frequency range , antennas tend to radiate much more broadly . therefore , such antennas may be more suitable when the cross - sectional distribution of lesion ( s ) is of the type sometimes referred to as a circumferential lesion that yield a central lumen completely surrounded by a circumferentially distributed lesion . more commonly , an eccentric atheroma is found that yields an eccentric lumen . for this reason , the radically beveled open ended antenna that operates in the higher range of frequencies may be preferable . for this and other reasons discussed hereinafter , a choice of 95 ghz was made for the initial test program in which selected arteries , in vitro , will be heated via a transcatheter antenna . it will be noted that the eccentric lumen may be subdivided further into categories including a slitlike or circular lumen with the circular lumen being positioned eccentrically within the cross - section of the artery . there are numerous variations in between , depending largely on the size of the arc of the lesion . the slitlike lumen may have a lengthwise diameter almost as wide and the original lumen . therefore , adjustment of the beamwidth of the antenna may be used , as discussed subsequently , or some additional rotation of the antenna may be used , to heat the desired portion or all of the atheroma . fig2 discloses a presently preferred radiator for the higher frequency range of from about 25 - 30 ghz to 300 ghz in the form of a radically beveled circular waveguide antenna 200 . waveguide material 210 is preferably a low loss ceramic material that is suitably flexible for use in a catheter . the waveguide antenna and waveguide preferably have a diameter 224 of about two millimeters and is circular . metallic sheath 214 is cut and removed to provide for a radical bevel 212 . metallic sheath 214 conforms and surrounds waveguide material 210 . the angle of bevel 212 affects the width of the directional beam 218 , indicated in dash , produced by antenna 200 so that a smaller angle with respect to the longitudinal axis of the antenna produces a wider beam . a minimum and maximum angle may be used depending on variables related to the losses at beveled interface 220 . as indicated , directional beam 218 is directed radially outwardly from beveled interface 220 . as discussed hereinafter in regards to the computational simulation , beam 218 , depending on the type of antenna , may be a focused beam , a spreading beam in one direction , or a spherically spreading beam . the beam of the waveguide antenna may be a focussed beam without significant spreading although , for illustrative purposes only , some spreading is indicated as may be possible to produce depending on the angled cut of the bevel . a selected beamwidth with appropriate spreading tendencies is desirable and necessarily depends on the size and location of the lesion in the wall . tip 216 may be formed of waveguide material 210 and preferably extends past radical bevel 212 in metallic circular cross - sectioned sheath 214 . tip 216 may also be formed of a different dielectric material selected for loading purposes . however , construction of antenna 200 may be simplified somewhat if the same waveguide material 210 is used . a medically acceptable nonthrombogenic material is used to form sheath 222 of the catheter . federal regulations presently require use of a new catheter for each procedure rather than allowing sterilization and reuse of the same catheters . this factor may make it possible to provide for variations in the catheters and the catheter antennas to match the particular usage of size and shape of the lesion without any substantial increase in cost . fig3 discloses a double disk loaded monopole antenna 300 in accord with the present invention . the general construction features of such an antenna are covered in some detail in the parent of this application so that only the basic features are covered herein . antenna 300 is essentially simply a smaller antenna than the antenna disclosed in the parent , and reference is made to the earlier patent that is incorporated herein by reference . antenna 300 is connected to coaxial cable portion 310 . coaxial cable 310 comprises an outer metallic conductor 312 and a centrally located conductor 314 . insulator material such as teflon ® or other suitable material forms the core 316 of coaxial cable 310 and also preferably extends into antenna 300 . to limit current flow along the catheter , metal choke 318 is employed . insulative jacket 320 is provided on the catheter but is cut off at the beginning of metal choke 318 so that radiation may occur , mainly from the discontinuities of antenna 300 starting at the beginning of gap 322 . gap 322 is related to the frequency of operation . the second and third discontinuities include tuning disk 324 and disk 326 . tuning disk 324 may be used to adjust the center frequency of operation of the antenna so as to flatten the response over the bandwidth of operation , which tends to be fairly broad . antenna 300 is preferably used for lower frequencies such as the range from 2 ghz to 25 or 30 ghz radiation proceeds outwardly in all directions from antenna 300 and therefore antenna 300 is preferably used for treatment of circumferentially disposed atherosclerotic lesions . referring to fig4 in operation at frequencies above 40 ghz , most energy is deposited within the atherosclerotic lesion and little energy will pass into and beyond the adventitial layer because of rapid decay of the electromagnetic wave . the frequency used in the chart of fig4 is 95 ghz . the maximum temperature rise for the example of fig4 occurs at about 132 microns as indicated by heavy line 410 which represents the temperature profile as a function of depth . the heating time is 0 . 5 seconds and the volume heated is 5 cubic millimeters . the antenna power is 1 watt . a focused beam is used and the maximum temperature increase is approximately 12 degrees for the example of fig4 . the material used for testing is beef heart muscle . keeping all variables the same except frequency , the maximum temperature rise for the situation of fig5 occurs at 246 microns , therefore indicating the significant effect that changing only frequency has on the temperature profile . for a focused beam antenna , power absorption decreases as exp (− 2αr ) where α is the attenuation constant , and r is the distance from the antenna . this exponential decay is indicated by the thin line 412 in fig4 that indicates the relative deposition rate of energy as a percentage . for a very broadly radiating antenna , power absorption decays as exp (− 2αr )/ r 2 . the decay is more rapid because of spherical beam spreading resulting in the r 2 term in the denominator . therefore , when a broad beam radiator is used for radiating an asymmetrically disposed lesion , only a portion of the radiated energy is used so that generally only a portion of the lesion is illuminated . the extraneous energy is wasted or produces heating of non - diseased tissue or proximal blood . except for circumferentially diffused lesions , a focused beam is therefore preferred . in addition to electromagnetic heat deposition , thermal conduction plays a critical role in obtaining the desired temperature profile within the arterial wall . at any depth within the wall , thermal equilibrium is reached when the heat gained by electromagnetic deposition is equal to the heat lost by the heat loss mechanisms . at the internal surface of the artery . i . e ., the endothelial layer , heat lost by conduction and convection to the flowing blood as well as heat lost by conduction to the outer layer of the transcatheter antenna , will prevent any significant temperature rise . as indicated in fig4 heat rise for the first 20 microns is zero . the maximum heat rise over the endothelial layer , of approximately 30 microns , is only about 2 degrees centigrade . at shallow depths within the intimal layer , temperatures are depressed by strong thermal conduction to the blood due to the relatively short distance thereto . at deeper depths , temperatures rise until a depth of maximum temperature is reached . in the chart of fig4 the maximum temperature is reached at 132 microns from the surface of the vessel . by adjusting the frequency , beam width , pulse time , and power , the maximum temperature can be placed at the center of the atherosclerotic lesion . at depths beyond the lesion , temperatures drop because electromagnetic deposition , as indicated by thin line 412 , is significantly diminished . therefore , in the example of fig4 the adventitial layer and much of the muscle tissue of the medial layer is well preserved . in the example of fig5 where all the controlled variables are the same , i . e ., power delivered , pulse duration , and antenna bandwidth , the maximum temperature occurs at 246 microns as indicated by temperature profile thick line 510 , which is typically well beyond the intima and into the media where many lesions occur . thin curve 512 discloses a more flattened energy deposition curve . in both cases , the important endothelial layer is well preserved . temperature profiles can be customized to the size , shape , and type of the lesion . the controllable factors that determine the temperature profile are the following : ( 1 ) antenna power delivered , ( 2 ) pulse length , ( 3 ) frequency , and ( 4 ) antenna design / beamwidth control . a computer program simulation has been written that calculates the three dimensional isothermal contours for a given frequency , power level , pulse duration , antenna type , tissue complex permittivity and tissue constants . examples are shown in the isothermal type printouts of fig6 - fig8 . it will be noted that the program can be used with heterogenous tissues that are typical with atherosclerotic lesions , although in the present examples the tissue is assumed to be homogenous . it is anticipated that testing with actual atherosclerotic tissue in the test unit will refine the values used . e . g ., for thermal conductivity and conductivity . as well , test information about the particular situation available or that may become available in the future due to advances such as refined mri photos may be of value in refining the data for particular cases . in fig6 , and 8 all variables are kept constant except frequency , although the isothermal regions viewed in fig8 are twice as large . the type of printout shown is a sectionalized isothermal profile although other types of printouts could be used or different views could be projected . these particular views are shown for example only . in fig6 the computer simulation uses a frequency of 95 ghz . in fig7 the selected frequency is 40 ghz and in fig8 the selected frequency is 15 ghz . the large plot on the left in each figure shows the heating of a cube of myocardium with half of the cube cut away in the z direction to show the isothermal profiles in the x - y plane . the eight individual cross - sections shown on the right are artificially expanded in the y direction so that the isothermal profiles in the x - y plane can be observed . it will be seen that the results from the computer simulation are similar to that shown in the physical testing as per the charts of fig4 and fig5 . an increase in frequency , keeping all other variables constant , tends to move the center of the position of maximum temperature closer to the antenna . this is seen by reviewing regions 616 , 716 , and 816 that of the respective fig6 , and 8 that indicate regions having temperature increases between 15 and 20 degrees kelvin . the regions of relatively moderate increases , i . e . 612 , 712 , and 812 for temperature increases between 5 and 10 degrees kelvin , and 614 , 714 , and 814 for temperature increases between 10 and 15 show a somewhat similar shift in the same direction . the coolest regions are those of 610 , 710 , and 810 that reflect regions having a temperature increase less than 5 degrees kelvin . the individual cell size selected for this particular display is 100 microns on a side ( 200 microns on a side in fig8 ) and therefore provides an overview of a relatively large area for easy viewing of the overall effects throughout the simulated lesion volume . the entire field size is about 1800 microns on a side for fig6 and fig7 and 3600 microns for fig8 . in the isothermal segments of fig6 and fig7 the side in the x direction is 1800 microns wide and the side in the y direction is 900 microns . if desired , much smaller regions , such as the approximately 30 micron depth of the endothelium , could be emphasized in greater detail to provide a picture of heating in the endothelial , intimal , medial , or any other portion of the arterial wall . however , it will be noted that the larger scales are quite useful when an overview is desired . fig9 is a printout that provide some relatively detailed feedback from the computer simulation regarding this region and any of about 50 different sections , as discussed hereinafter , although the focus of the simulation printout can be varied as desired . other graphs such as the temperature profile versus depth for various times during the heating period may be printed out . the plots may be in color . additional information may be printed on each plot including values such as cell size , final temperature profile , type of antenna radiation , number of cubic millimeters at various selected temperature ranges , total energy in the cube after the power pulse , antenna radiated power , the number of computational cells illuminated , and so forth . comparing information regarding fig6 , and 8 , the volume of material having a 10 ° c .- 15 ° c . rise is greater for 40 ghz and less at both 95 ghz and 15 ghz . the time of the pulse in each case was 299 milliseconds . for short duration times of power application , the blood temperature at the surface of the lesion near the antenna rises with increasing frequency . the maximum temperature in the lesion moves to shallower depths with increasing frequency . also the maximum temperature in the lesion increases with increasing frequency . one basic premise shown from fig6 , and 8 is that heat contours can be significantly customized by frequency selection alone . further customization is accomplished by selection of power level , duration of power delivery , and antenna type . the computer simulation can readily show the effects of such changes . the simulation results can be compared with information obtained from the test setup as discussed in the parent wherein temperature profiles , blood flow , type of vein , and so forth can be realistically determined , even prior to in vivo testing . in a presently preferred embodiment of the simulation , a computational “ myocardium ” or heart tissue cube having a size that correlates to a region of tissue to be ablated is given the electrical and thermal characteristics of in - vivo myocardium . this selection is made for convenience and could be given the characteristics of plaque and encapsulating tissue . the characteristics can be specifically tailored for different areas of the cube or can be given average values . the cube or region or other shape selected as desired to be analyzed is subdivided into computational cells . in this simulation a cube of simulated myocardium is divided into 8000 small cubes with each cube being a computational cell . the instantaneous heat of one arbitrary computational cell in the cube is given by : δq rf is the heat added due to absorption of microwave energy ; ∫ δq hc is the net heat added or lost by the cell from heat conduction ; and t c is the new cell temperature in ° c . ; each cell is assumed to be a cube with six faces . the heat energy transferred through each face for one time increment is given by : ∂ t /∂ r is the temperature gradient from the center of one cube to the next ; and the electric field intensity in a cell is given by : e ^ l = e ^ nl e - γrl r l a 10 ê 1 is the electric field intensity resulting from the the radiation at the feed point of the antenna ; ê 01 is related to the relative magnitude and phase of radiation from the phase center of the antenna ; and r 1 is the distance from the antenna phase center to the center of a cell . a = 0 for a focused beam , 1 for a spreading beam in one dimension , and 2 for a spherically spreading beam . as discussed previously , the results from the simulation can be plotted in many ways to show the size and shape of the projected isothermal volumes . fig9 shows a different presentation wherein the temperature vs . time is given for each of 50 layers of 20 micron thickness with each layer being represented by a separate line . although any of the lines could be displayed individually , only lines 1 - 4 , the top layers , and line 16 , the hottest layer are clearly visible and are marked . each line represents a thickness of 20 microns . the heating time is one second . the frequency is 15 ghz . the volume heated is 9 . 4 cubic millimeters . as can be seen from this graph , layer 16 would have been heated by about 16 degrees centigrade and is about 320 microns into the arterial wall which would probably typically be in the medial layer of the artery . it will be noted that the first one or two layers that would be the endothelium would remain less than about 5 degrees centigrade , in this projection . the program may also be altered to accept the desired heat contours as the input . by working backwards from a desired thermogenic profile , the program could be used to select the most appropriate choice of frequency , power level , duration of power delivery , antenna beamwidth from a particular selection of antennas , and other factors as discussed herein . fig1 discloses oscillator chip catheter 1000 as another embodiment of the present invention . in this embodiment , a direct current power supply 1010 is used to supply power through catheter 1020 to one or more mmic chips 1030 that may use a radiating antenna 1040 such as a waveguide antenna , disk - loaded monopole antenna , or other antenna . the mmic chips preferably reside in the catheter &# 39 ; s distal end adjacent to the radiating element . currently , mmic technology allows for cylindrical diameter dimensions of about 2 . 76 millimeters plus a thin sheath , which an excellent size that allows for convenient positioning of catheter 1020 . the presently available chips cover the preferred range of frequencies , i . e ., 2 ghz to 300 ghz , over a range from about 50 ghz to about 110 ghz . chips operating in the lower frequencies of about 50 ghz presently offer more power per chip . to achieve greater than one watt of power delivered to radiating element 1040 , if necessary , two or more mmic chips may be sequentially connect together . the chips may be physically connected with microstrip 1050 . numerous variations and methods of operation may be used with the present invention . for instance , the catheter of the present invention may be used with other catheters and / or means to orient the catheter or may be built into other types of catheters . the present catheter may be modified to include simple orientation means . for instance , on the sheath side of the waveguide antenna , a simple resistivity sensor might be added that operates at a much lower frequency and with very low current but is directive and will sense the difference in resistivity of the arterial wall with or without an atheroma so as to quickly detect position and orient the device . although the present device is preferable used instead of an angioplasty balloon , it has advantages that may also make it useful in combination with an angioplasty balloon , if desired , e . g ., the ability to direct heat towards an asymmetrically positioned lesion . while the preferred embodiment antennas are disclosed in accord with the law requiring disclosure of the presently preferred embodiment of the invention , other types of antennas may also be used . therefore , the foregoing disclosure and description of the invention are illustrative and explanatory thereof , and various changes in the method steps and also the details of the apparatus may be made within the scope of the appended claims without departing from the spirit of the invention . | 0 |
directional phrases used herein , such as , for example , left , right , front , back , top , bottom and derivatives thereof , relate to the orientation of the elements shown in the drawings and are not limiting upon the claims unless expressly recited therein . as employed herein , the term “ fastener ” refers to any suitable connecting or tightening mechanism expressly including , but not limited to , screws , bolts and the combinations of bolts and nuts ( e . g ., without limitation , lock nuts ) and bolts , washers and nuts . as employed herein , the statement that two or more parts are “ coupled ” together shall mean that the parts are joined together either directly or joined through one or more intermediate parts . as employed herein , the term “ number ” shall mean one or an integer greater than one ( i . e ., a plurality ). fig1 is a schematic diagram of an electrical system 2 according to an exemplary embodiment of the disclosed concept . as seen in fig1 , electrical system 2 includes a power source 4 , which may be , for example and without limitation , a single phase or three phase ac electrical distribution system . electrical system 2 further includes a load 6 , such as an electronic device or other hardware . in addition , to protect load 6 from over - voltages that might otherwise damage load 6 , electrical system 2 includes a dual surge protection device 8 . dual surge protection device 8 is described in greater detail herein and provides such protection by coupling a number of transient - suppressing elements in parallel with load 6 between power source 4 and the neutral and / or ground ( the illustrated embodiment ) conductors of power source 4 . according to one aspect of the disclosed concept , dual surge protection device 8 enhances performance by providing a higher current rating than would normally be possible . dual surge protection device 8 provides this enhanced performance by including two surge protection devices therein that are connected in parallel with one another . as a result , dual surge protection device 8 is able to provide increased current protection as compared to a single surge protection device ( e . g ., two times the rating ; 800 , 000 amps as opposed to 400 , 000 amps ). fig2 is a schematic diagram of dual surge protection device 8 according to one exemplary embodiment of the disclosed concept . as seen in fig2 , dual surge protection device 8 includes a first surge protection device 10 and a second surge protection device 12 . first surge protection device 10 and second surge protection device 12 each include a number of transient - suppressing elements that are provided in parallel with load 6 between power source 4 and ground . in the exemplary embodiment , first surge protection device 10 and second surge protection device 12 each include a number of movs as the transient - suppressing elements . it will be understood , however , that alternative transient - suppressing elements , such as silicon avalanche diodes ( sads ) or gas tubes , may also be used . in the illustrated exemplary embodiment ( wherein power source 4 is a three - phase ac source ), surge protection device 10 and second surge protection device 12 each include four groups of movs 14 , with each group 14 including one or more ( e . g ., four ) movs and being associated with a particular phase / line of power source 4 ( e . g ., phase a , phase b , phase c and neutral ). the mov groups 14 are shown schematically in fig2 and labeled with reference numbers 14 a - 14 h . in addition , surge protection device 10 includes a number of outputs 16 , labeled 16 a - 16 d , with each output 16 being associated with a respective one of the mov groups 14 a - 14 d . surge protection device 10 is structured , using , for example , a number of transistor devices ( e . g ., fets ), such that , when configured as shown in fig2 , each output 16 will have one of the following two states : ( i ) 0 . 5v if all of the movs in the associated mov group 14 are fully operational , and ( ii ) 0 . 0v if any ( i . e ., one or more ) of the movs in the associated mov group 14 has failed ( e . g ., due to the occurrence of a surge condition ). similarly , surge protection device 12 also includes a number of outputs 16 , with each output 16 being associated with a respective one of the mov groups 14 e - 14 h . like surge protection device 10 , surge protection device 12 is structured such that , when configured as shown in fig2 , each output 16 will have one of the following two states : ( i ) 0 . 5v if all of the movs in the associated mov group 14 are fully operational , and ( ii ) 0 . 0v if any ( i . e ., one or more ) of the movs in the associated mov group 14 has failed ( e . g ., due to the occurrence of a surge condition ). the significance of this feature is described in detail below . as seen in fig2 , dual surge protection device 8 further includes an i / o circuit 18 . as described below , i / o circuit 18 is configured to indicate which one of the surge protections devices 10 or 12 , if any , has experienced an mov failure . i / o circuit 18 in the exemplary embodiment includes eight comparators 20 , labeled 20 a - 20 h . the output of each of the comparators 20 a - 20 d is coupled to a first led 22 for driving led 22 described herein , and the output of each of the comparators 20 e - 20 h is coupled to a second led 24 for driving led 24 as described herein . i / o circuit 18 also includes four first voltage dividers 26 , labeled 26 a - 26 d , and four second voltage dividers 28 , labeled 28 a - 28 d . in one non - limiting embodiment , each of the first voltage dividers 26 is a resistor . as seen in fig2 , outputs 16 a and 16 e are input into voltage divider 26 a , outputs 16 b and 16 f are input into voltage divider 26 b , outputs 16 c and 16 g are input into voltage divider 26 c , and outputs 16 d and 16 h are input into voltage divider 26 d . voltage divider 26 a is coupled to the negative input of comparator 20 a and the negative input of comparator 20 e , voltage divider 26 b is coupled to the negative input of comparator 20 b and the negative input of comparator 20 f , voltage divider 26 c is coupled to the negative input of comparator 20 c and the negative input of comparator 20 g , and voltage divider 26 d is coupled to the negative input of comparator 20 d and the negative input of comparator 20 h . as shown in fig2 , each voltage divider 28 has a 14 v input . voltage divider 28 a is coupled to the positive input of comparator 20 a and the positive input of comparator 20 e , voltage divider 28 b is coupled to the positive input of comparator 20 b and the positive input of comparator 20 f , voltage divider 28 c is coupled to the positive input of comparator 20 c and the positive input of comparator 20 g , and voltage divider 28 d is coupled to the positive input of comparator 20 d and the positive input of comparator 20 h . as a result of the above described configuration , the negative input of each comparator 20 will receive either 0 . 5v or 0 . 0v depending on the state of the associated output 16 and the associated mov group 14 . in particular , if all of the movs in an mov group 14 are fully operational , the state of the associated output 16 will be 0 . 5v and the negative input of the associated comparator 20 will receive 0 . 5v . if , however , any mov in an mov group 14 has failed , the state of the associated output 16 will be 0 . 0v and the negative input of the associated comparator 20 will receive 0 . 0v . furthermore , the positive input of each comparator 20 will receive a constant 0 . 1 v ( via the 14 v input and the associated voltage divider 28 ). moreover , the output of each comparator 20 will depend on the current state of the negative input thereof ( as noted above , the positive input of each comparator 20 is at a constant 0 . 1v ). in particular , if the negative input is 0 . 5v , the output of the comparator 20 will be low . if the negative input is 0 . 0v , the output of the comparator 20 will be high . furthermore , if the output of any one of the comparators 20 a , 20 b , 20 c or 20 d is high , led 22 will be lit ( otherwise led 22 will not be lit ). similarly , if the output of any one of the comparators 20 e , 20 f , 20 g or 20 h is high , led 24 will be lit ( otherwise led 24 will not be lit ). thus , in operation , if all movs in a surge protection devices 10 and 12 are operational , all of the outputs 16 of the surge protection device 10 , 12 will be 0 . 5v and all of the negative inputs of the associated comparators 20 will be 0 . 5v . in this condition , both led 22 and led 24 will be off ( unlit ). if any of the movs in mov groups 14 a , 14 b , 14 c or 14 d of surge protection device 10 fails , led 22 will be turned on ( lit ), and if any of the movs in mov groups 14 e , 14 f , 14 g or 14 h of surge protection device 12 fails , led 24 will be will be turned on ( lit ). a lit led 22 or 24 will indicate to an observer that the associated surge protection device 10 or 12 has had an mov failure and therefore needs to be replaced . while specific embodiments of the disclosed concept have been described in detail , it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure . accordingly , the particular arrangements disclosed are meant to be illustrative only and not limiting as to the scope of the disclosed concept which is to be given the full breadth of the claims appended and any and all equivalents thereof . | 7 |
the present invention will now be described more specifically with reference to the following embodiments . it is to be noted that the following descriptions of embodiments of this invention are presented herein for the purposes of illustration and description only ; it is not intended to be exhaustive or to be limited to the precise form disclosed . an embodiment of the fir emitter according to the present invention is fir ceramic powder ( e . g . 20 g ) including al 2 o 3 , fe 3 o 4 , mgo , zno and caco 3 , which have a weight ratio of 90 : 2 : 5 : 2 : 1 . for example , the amount of al 2 o 3 is about 90 % of the total weight of the fir emitter ( i . e . wt %). the mentioned fir ceramic powder is enclosed in plastic bags as the fir irradiation source , and the following activity testing assays are performed to analyze the use of antioxidation of the fir emitter in the present invention . reactive oxygen radicals of h 2 o 2 are important factors of oxidative stress related to the pathogenesis of many important diseases in organisms . cumulative increases in h 2 o 2 and superoxide radicals can potentially damage cells including proteins , lipids , and dna leading to proven augmented mutation rates . accordingly , h 2 o 2 is utilized to simulate an environment having oxidative stress in the present invention . in pathophysiological conditions , h 2 o 2 is continuously generated , and its level remains higher than normal . exposure of cells to h 2 o 2 for a certain period may lead to cell death by apoptosis and necrosis . cell death or cytotoxicity is classically evaluated by quantifying cytoplasm or plasma membrane damage . in the other hand , because h 2 o 2 is highly membrane - permeable , the equilibrium between extra - and intracellular levels of h 2 o 2 can be reached extremely rapidly when h 2 o 2 gradients form since the h 2 o 2 production site and h 2 o 2 degradation site are separated by membranes , such that the measurement of intracellular levels of h 2 o 2 also reflects extracellular levels thereof . it has been reported that the oxidative stress induced by h 2 o 2 is one of the main factors in causing osteoblastic cells death . the reducing of the osteoblastic cells will result in significant decreasing of bone formation and cause bone loss . under the influence of aging , osteoblastic cells will be more easily to be damaged by the oxidative stress . this also explains the reason why postmenopausal women and aged person are easy to suffer a fracture . therefore , the analysis of the viability of osteoblastic cells is used as an indication that the fir emitter can promote a bone formation . it has been reported that peroxidative ions produced by ultraviolet ( uv ) rays would be converted to h 2 o 2 , which inhibits the viability of epidermal fibroblastic cells . fibroblastic cells are necessary for wound healing due to the capability of resisting the oxidation damage induced by h 2 o 2 . in the treatment for a burned wound or an epidermal injury , anti - oxidation agent or radical scavenger is helpful to healing process . therefore , the analysis of the viability of fibroblastic cells is used as an indication that the fir emitter can promote a healing of a wound . the analyses of cell viabilities of osteoblast and fibroblast under oxidative stress induced by h 2 o 2 are performed by mtt assay , respectively . please refer to fig1 and 2 , which respectively shows the effect of fir on viabilities of osteoblastic cells and fibroblastic cells in h 2 o 2 - induced cytotoxicity . as the results shown in fig1 and 2 , the viabilities of cells treated with fir under h 2 o 2 - mediated oxidative stress is higher than the control counterparts which receive h 2 o 2 treatment without fir . in fact , additional fir treatment for the osteoblastic cells in h 2 o 2 - induced cytotoxicity results in about 23 . 02 % cell viability increases in the 200 μm h 2 o 2 concentration group , and results in about 18 . 77 % cell viability increases in the 800 μm h 2 o 2 concentration group . furthermore , additional fir treatment for the fibroblastic cells in h 2 o 2 - induced cytotoxicity results in about 25 . 67 % cell viability increases in the 25 μm h 2 o 2 concentration group , and results in about 47 . 16 % cell viability increases in the 50 μm h 2 o 2 concentration group . the t - test ( n = 28 ) further confirms that the cells with fir treatment may suffer higher h 2 o 2 - induced oxidative stress . macrophages play a significant role in innate immunity and inflammation . when macrophages are activated by pathogens and / or cytokines , they produce large amounts of h 2 o 2 and ros to exert strong cytotoxicity against microorganisms and many cells , including killing macrophages themselves . therefore , increasing the survival rate of macrophages would enhance cell - mediated immunity . because macrophages are vital for the recognition and elimination of microbial pathogens , and the survival of macrophages may directly contribute to a host &# 39 ; s defense system . accordingly , raw264 . 7 murine macrophages are used as a cell target to analysis the effect of the fir emitter of the present invention on the bio - activity under oxidative stress . please refer to fig3 ( a ) and 3 ( b ) , which are diagrams showing extracellular h 2 o 2 level of raw264 . 7 cells without lipopolysaccharide ( lps ) induction , after being effected by fir in 1 day and 2 days , respectively , wherein the peroxide level is significantly reduced (* p & lt ; 0 . 05 ). please refer to fig4 , which is a diagram showing extracellular h 2 o 2 level of raw264 . 7 cells with lps induction ( a simulation of an inflammatory condition in an animal subject ). after being effected by fir in 1 day , the peroxide level is significantly decreased (* p & lt ; 0 . 05 ). please refer to fig5 , which is a diagram showing cell viability of raw264 . 7 cells treated with fir under oxidative stress , wherein different concentration of h 2 o 2 is used as the source of oxidative toxicity , and the cell proliferation (%) of raw264 . 7 cells against h 2 o 2 is determined via xtt assay . as shown in fig5 , fir possesses ability to decrease the death of raw264 . 7 cells under h 2 o 2 (* p & lt ; 0 . 05 ). raw264 . 7 cells are seeded in 6 - well tissue culture plates at a density of 4 × 10 5 cells per well . after 24 hours of culturing , the medium is changed and various concentrations of h 2 o 2 ( 400 μm and 600 μm ) are added . for fir groups , enclosed fir ceramic powder is distributed uniformly in plastic bags , which has been inserted beneath the tissue culture plates . cells are treated with fir for a further 24 hours . cells are washed with pbs and stained with 3 μm propidium iodide ( pi ; molecular probes ) for 30 min . the fluorescence emitted from the pi - dna complex is quantitated after excitation of the fluorescent dye by facscan flow cytometry ( becton dickinson co .). please refer to fig6 ( a ) , which is a diagram showing result of the effect of fir on apoptosis of raw264 . 7 cells induced by h 2 o 2 . as shown in fig6 ( a ) , the ratio of hypodiploid cells increases in h 2 o 2 - treated cells , and that is significantly reduced after being treated with fir (* p & lt ; 0 . 05 ), which indicates that fir can reduce the apoptosis of cells induced by h 2 o 2 . please refer to fig6 ( b ) , which is a diagram showing result of the effect of fir on ldh release of cells . as shown in fig6 ( b ) , under the induction of h 2 o 2 ( 400 μm and 600 μm ), ldh release increases in h 2 o 2 - treated cells , and that is significantly reduced in fir group . the effect of fir on ldh release assays indicates a significant difference between the control and fir groups for h 2 o 2 - treated cells (* p & lt ; 0 . 05 ; ** p & lt ; 0 . 01 ). according to fig6 ( b ) of the present application , ldh is utilized to prove the antioxidant ability of cells treated with fir in the circumstance of h 2 o 2 toxicity . ldh is a stable enzyme presenting in all cell types , which is rapidly released into the cell culture medium upon damage to plasma membranes . therefore , ldh is the most widely used marker in cytotoxicity studies . fig6 ( b ) shows significant reduce of ldh release in cells treated with fir , which means that the damage to the cells is decreased . please refer to fig7 , which is a diagram showing the effect of fir on intracellular h 2 o 2 level of raw264 . 7 cells . fig7 shows that level of intracellular h 2 o 2 is significantly reduced by fir ( compared with the control group , * p & lt ; 0 . 05 ) via flow cytometry analysis using dchf - da as a peroxide - sensitive fluorescent dye . excessive ros causes degenerative diseases of aging , particularly cancer and atherosclerosis as consequences of oxidative damage by ros . protection of cells from such intracellular oxygen radicals appears to be due to the presence of a variety of intracellular enzymes and naturally occurring radical scavengers , such as cytochrome c . under normal conditions , these protective mechanisms are adequate to prevent extensive damage to vital cellular constituents . in many aerobic mammalian cells , the generation of oxygen radicals and h 2 o 2 in the respiratory chain is a result of electron leakage . mitochondria represent a primary source of ros in the cells . cytochrome c is an ideal antioxidant , which attacks superoxide and oxygen radical . accordingly , cytochrome c is essential in the respiratory chain for keeping a lower physiological h 2 o 2 concentration in mitochondria . lack of cytochrome c within the respiratory chain causes the higher level of oxygen radicals and associate h 2 o 2 accumulation . the level of oxygen radicals and h 2 o 2 is in a balanced state between the generation of respiratory chain and the elimination of cytochrome c . please refer to fig8 , which is a diagram showing the effect of fir on intracellular cytochrome c level of raw264 . 7 cells . as shown in fig8 , by immunoblotting analysis , the level of cytochrome c in fir irradiated groups of cells is significantly decreased (** p & lt ; 0 . 01 ), which demonstrates that fir enhances the antioxidant effect for h 2 o 2 by consuming more of intracellular cytochrome c . please refer to fig9 , which is a diagram showing the effect of fir on nadp + / nadph of raw264 . 7 cells . the ratio of nadp + / nadph is measured according to the absorbance of the reduced coenzyme at 340 nm assayed by spectrophotometer . as shown in fig9 , the ratio is increased in fir group . by the effect of fir , more nadph is consumed and associate increase of nadp + , and thus the ratio of nadp + / nadph is increased in fir group . this is the first invention disclosing that fir may exhibit antioxidant characteristics in a mammalian cell via the effects on intracellular level of h 2 o 2 , cytochrome c and the nadp + / nadph levels . based on the aforementioned embodiments , a possible pathway that fir has the antioxidant effect may include the oxidation and electron transfer of nadph triggered by fir , decomposition of h 2 o 2 into water , and reducing the level of cytochrome c . according to the aforementioned embodiments , the methods and the medical device provided in the present invention are easy to be applied and configurable in various forms , and can continuously generate desired effect without need of specific or complicate operations . the methods and the medical device provided in the present invention can achieve various effects relating to antioxidation , such as promoting a healing of a wound , promoting a bone formation and enhancing an immunity . accordingly , the medical device can be configured in any form of a health care product , which includes , but is not limited to , a patch , a clothes , a wrist support , a waist support , a knee support , a mattress and a pillow . while the invention has been described in terms of what is presently considered to be the most practical and preferred embodiments , it is to be understood that the invention needs not be limited to the disclosed embodiments . on the contrary , it is intended to cover various modifications and similar arrangements included within the spirit and scope of the appended claims which are to be accorded with the broadest interpretation so as to encompass all such modifications and similar structures . | 0 |
an embodiment of the invention will be described below with reference to fig1 to 3 . the terms “ up ”, “ down ”, “ left ”, “ right ”, “ horizontal ” and “ vertical ( perpendicular )” with reference to the following drawings mean up , down , left , right , horizontal and vertical ( perpendicular ) shown in the paper of the drawings if there is no special notice . in the following description , the same or similar components will be denoted by the same reference numerals , and the duplicate description thereof will be omitted . fig1 is a view showing the external appearance of a foldable portable communication terminal 1 , which is a wireless communication device according to an embodiment of the invention . the portable communication terminal 1 has a first case 11 and a second case 12 which are connected to each other so that they can be opened and closed to each other . fig1 shows a state where the first case 11 and the second case 12 are opened to each other , in view from a user side . however , the casing configuration of the portable communication terminal 1 is not limited to the foldable type as shown in fig1 . a display device 14 , for example , having a liquid crystal display panel , is mounted in the first case 11 . the display device 14 is configured to display texts and images , so that the portable communication terminal 1 can run an application ( such as a mailer application , a web browser application , and an address book application ) with screen display by using the display device 14 . a microphone 15 is mounted in the first case 11 . a speaker 16 is mounted in the second case 12 . the portable communication terminal 1 can be used for voice communication since the microphone 15 and the speaker 16 are provided in the portable communication terminal 1 . a user interface 17 ( indicated in fig1 by broken - line frame ) including a plurality of operation keys is mounted in the second case 12 . the user interface 17 may include operation keys not shown but provided in a side surface or a back surface of the first case 11 or the second case 12 . when operation keys belonging to the user interface 17 are operated , start / stop operation of the portable communication terminal 1 or input of texts or operation commands is performed . each of the display device 14 , the microphone 15 , the speaker 16 and the user interface 17 serves as a user interface unit in the portable communication terminal 1 . fig2 is a block diagram of the portable communication terminal 1 . the portable communication terminal 1 includes an antenna 19 and a communication unit 20 , so that the portable communication terminal 1 can transmit / receive radio waves to / from a mobile communication base station not shown . the portable communication terminal 1 further includes an audio interface 21 , a processor 22 , a random access memory ( ram ) and a read - only memory ( rom ) 24 . the processor 22 is configured lay a single processing device such as a micro - processor or by a combination of a plurality of such chips . the ram 23 is a memory used by the processor 22 which reads or writes necessary programs or data at any time to achieve the function of the portable communication terminal 1 . the rom 24 is a memory in which programs or data are written in advance . the communication unit 20 , the audio interface 21 , the ram 23 and the rom 24 are connected to the processor 22 , for example , through a common bus and monitored and controlled by the processor 22 . the user interface 17 described above with reference to fig1 is connected to the processor 22 , for example , likewise through the common bus so that the user interface 17 can send a signal corresponding to an operation input to the processor 22 . the display device 14 described above with reference to fig1 is connected , for example , to the common bus so that the display device 14 can perform screen display under the control of the processor 22 . in the portable communication terminal 1 , the processor 22 serves as a controller that controls respective components provided in the portable communication terminal 1 . the portable communication terminal 1 further includes a non - contact ic card chip 26 , a ( coil ) antenna 27 having a coil - shaped element , and an accelerometer 28 . the portable communication terminal 1 further includes a battery chamber 29 , and a battery 30 placed in the battery chamber 29 supplies dc power to respective components of the portable communication terminal 1 including the non - contact ic card chip 26 . when the portable communication terminal 1 is positioned to be close to a reader - writer , which is not shown in the drawings , so that the coil antenna 27 is faced to an antenna of the reader - writer , the reader - writer performs writing or reading of information in / from the non - contact ic card chip 26 . the non - contact ic card chip 26 has built - in transmitter and receiver and is connected to the processor 22 , for example , through the common bus . the non - contact ic card chip 26 can notify the processor 22 of reception of a signal which is transmitted from the reader - writer . since the non - contact ic card chip 26 is supplied with electric power from the battery 30 , the non - contact ic card chip 26 is capable of setting transmission power of the transmitter variably in accordance with control made by the processor 22 , while a stand - alone non - contact ic card which has no battery and which derives a power from a signal transmitted from the reader - writer . in the portable communication terminal 1 according to the embodiment , the non - contact ic card chip 26 serves as a close proximity communication unit , configured to perform close proximity wireless communication with the counterpart device . the accelerometer 28 is manufactured , for example , by using a micro electro mechanical systems ( mems ) technique and provided for detecting an applied acceleration . the accelerometer 28 is connected to the processor 22 , for example , through the common bus so that the processor 22 can determine the portable communication terminal 1 as “ moving ” from the amount of spatial movement of the portable communication terminal 1 when the output of the accelerometer 28 exceeds a given threshold value . fig3 is a flow chart showing the operation concerned with non - contact communication of the portable communication terminal 1 with the reader - writer . after the operation is started ( start ), the processor 22 waits for reception of a signal which is transmitted from the reader - writer (“ no ” in step s 1 ). when a signal transmitted from the reader - writer is received by the non - contact ic card chip 26 (“ yes ” in step s 1 ), the processor 22 confirms the output of the accelerometer 28 and compares the output of the accelerometer 28 with the aforementioned threshold value to thereby determine whether the portable communication terminal 1 is moving or not . when the processor 22 determines that the portable communication terminal 1 is not moving (“ no ” in step s 3 ), the processor 22 sets transmission power of the transmitter of the non - contact ic card chip 26 at a default value ( step 54 ) and makes the non - contact ic card chip 26 communicate with the reader - writer . thus , the operation is terminated ( end ). when the processor 22 determines that the portable communication terminal 1 is moving (“ yes ” in step s 3 ), the processor 22 sets transmission power of the transmitter of the non - contact ic card chip 26 at a higher value than a default value ( step s 5 ) and makes the non - contact ic card chip 26 communicate with the reader - writer . thus , the operation is terminated ( end ). since transmission power of the transmitter of the non - contact ic card chip 26 is controlled to be increased when determination is made that the portable communication terminal 1 is moving described above , the portable communication terminal 1 can increase the probability that communication with the reader - writer will be allowed , even if there arises a situation that the portable communication terminal 1 cannot be brought sufficiently close to the reader - writer . since there is provided a flow in which the processor 22 confirms the output of the accelerometer 28 only when a signal transmitted from the reader - writer is received , it is possible to suppress the possibility that detection of acceleration will be caused by an operation per se of putting the portable communication terminal 1 over the reader - writer although the portable communication terminal 1 is not moving . although communication between the portable communication terminal 1 and the reader - writer is based on a near electromagnetic field wireless communication , for example , using a nominal frequency of 13 . 56 mhz , the communication method is not limited to this method . any mounting form may be applied to the reader - writer . for example another portable communication terminal having a built - in reader - writer function may be used as the reader - writer . according to the embodiment of the invention , it is possible to reduce the probability that communication will it fail when the portable communication terminal having the built - in non - contact ic card chip is put over the reader - writer while the portable communication terminal is moving . in the above description , the external appearance , shape , configuration and non - contact communication type of the wireless communication device are only described by way of example and can be changed variously without departing from the gist of the invention . in the portable communication terminal 1 according to the embodiment , the accelerometer 28 is provided for detecting applied acceleration as an amount of spatial movement of the communication unit 20 ( i . e . the portable communication terminal 1 ). in other words , the accelerometer 28 serves as a detector configured to detect an amount of spatial movement of the communication unit 20 . however , the portable communication terminal 1 may alternatively be provided with a proximity sensor configured to detect a variation in positional relationship between the communication unit 20 and the counterpart device as the amount of the spatial movement . the proximity sensor , which may be used as the detector for detecting the amount of the spatial movement , may be any type of sensor such as an inductive sensor , a capacitive sensor , eddy - current sensor , a magnetic sensor , a photoelectric sensor , a laser rangefinder , a sonar , a radar , a thermal infrared sensor , and an optical sensor . although the embodiment according to the present invention has been described above , the present invention is not limited to the above - mentioned embodiment but can be variously modified . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents . | 7 |
fig6 illustrates a bolt 20 including a head 21 , a shank 22 and a threaded portion 30 . the shank 22 constitutes a strainable portion . when the bolt is tightened , and thus under load , the shank 22 will strain appreciably whereas there will be much less deformation within the head 21 and any deformation within the head 21 will be more complex . the bolt 20 is a single integral body of material machined from a single block of steel . a bore 23 opens from the end face of the head 21 and is coaxial with the head 21 and shank 22 . the bore 23 has a stepped profile . the outer end of the bore is internally threaded , forming a retaining region 24 . from this outer end the bore steps down to a reduced diameter before terminating at its inner end 25 . the inner end 25 is a planar face perpendicular to the axis of the bolt and , as will be described , constitutes a datum , specifically the strainable portion datum 25 . a pin 26 sits within the shank 22 , the pin typically being referred to as a gauge pin or reference pin 26 . the reference pin 26 extends upwardly ( as drawn ) from its root 28 to its free end 27 . the free end 27 is a planar face perpendicular to the axis of the bolt . the free end 27 constitutes a datum , specifically the reference datum 27 . in this example , when the bolt is unloaded the datums 25 , 27 are in co - planar alignment . advantageously this alignment leads to the elongation of the relevant portion ( i . e . the datum to the root portion ) of the strainable portion being the difference between the position of the strainable portion datum 25 relative to the reference datum 27 , and is typically directly proportional to the load in the bolt . other examples of the invention may take the form of a stud bolt akin to the bolt of fig1 in which the head 21 of the bolt of fig6 is replaced by an externally threaded portion , forming the first load receiving portion , as shown in fig1 , co - operable with a nut ( not shown ). in these examples , by locating the datum 25 within the strainable portion , rather than within or beyond the load receiving portion underlying the nut as in fig1 to 3 , complexities related to the location of the nut and the complex strain field in the region underlying the nut are avoided . this region is sometimes referred to as “ dead length ”. the bore 23 and pin 26 are preferably formed by a series of machining operations including drilling , reaming , tapping and edm . firstly , most of the bore 23 is drilled . the bore is then reamed to size . reaming typically produces about an h6 tolerance and a surface finish up to a maximum of ra 2 μm aarh . a maximum of ra 2 μm aarh is the preferred surface finish regardless of how the bore is formed . whilst reaming is the preferred secondary bore forming operation , other processes such as honing , boring and / or grinding may also be suitable . the retaining region 24 is formed in the end portion by tapping to define a female thread about its cylindrical wall . following those operations , a portion 29 of material that is itself tubular is machined out to define the reference pin 26 . the datums 25 , 27 are then formed in a single machining set up , by edm in this example . whilst edm is employed in this example of the invention , other forms of contactless machining may be employed in place of one or more of the described machining operations . the removed material 29 is an annulus of removed material such that the pin 26 is cylindrical , although other shapes are possible . the annulus of material is preferably removed ( to define the pin 26 ) using a variant of fast - hole edm . an electrode that is cylindrical and tubular is axially advanced towards the workpiece . in contrast to conventional thought in the field of edm , the inventor has found this method to be commercially feasible . by using a relatively thin - walled electrode , holding that electrode at a relatively lower voltage and reducing the rate at which the electrode is advanced , commercially satisfactory results have been achieved . once supplied with this knowledge , persons of skill in the art have no difficulty implementing this process . indeed , the inventor confidentially reverted to a number of the machinists who suggested that edm was not suitable , and once supplied with this knowledge those machinists were in fact able to produce a sample pin in a commercially acceptable timeframe . the pin and exterior of the shank are preferably aligned within the one or more ( and preferably all ) of the following tolerances : bolt alignment bore tolerance = total radial run - out relative to the reference pin to be within 1 / 200 th of reference pin length or more preferably within 1 / 600 th of reference pin length ; pin alignment tolerance = coaxial to the bolt to within 1 / 60th of reference pin length ; and end of pin alignment = concentric to the bolt alignment bore to within half the gap between the pin and outer datum ( this in conjunction with a similar tolerance applied to the measuring tool ensures that of a bolt &# 39 ; s two datums , each of the tool &# 39 ; s datum two contacting portions contacts only its respective target datum ). experimentation has shown that these tolerances are not only achievable , but are practical , using the described variant of fast - hole edm . in one example , the annular material could be removed ( to define the pin ) during the same edm operation during which the datums 25 , 27 are formed . to form this shape , the electrode would have planar faces corresponding to the faces 25 , 27 and a tubular extension corresponding to the removed material 29 . more preferably , a tubular electrode is used to form the void 29 ( as described above ) and a separate cylindrical electrode having a planar end face brought in to define the datums 25 , 27 . the datums could be formed using sinker edm , that is the separate cylindrical electrode could correspond in diameter to the datum 25 so that a central portion of its end face is for the reference datum 27 and an outer annular portion of that face is for the strainable portion datum 25 . of course the surfaces of the electrode ( s ) would be offset from the surfaces of the bolt 20 by a distance corresponding to the arc distance . whilst conventional sinker edm could be so employed and would be advantageous over many other methods , the inventor has recognized the potential for relevant error in that the end face of the electrode may well wear to some non - planar shape . in particular the electrode &# 39 ; s central portion may erode at a different rate to its outer annular portion . such erosion would result in a change in the relative disposition of the datums 25 , 27 which ( if left unchecked ) would impact upon load measurement accuracy . the inventor &# 39 ; s experiments suggest that conventional sinker edm could be expected to maintain the axial disposition of the high point of one datum to the high point of the other datum within a tolerance of about 0 . 13 mm at best . 0 . 13 mm corresponds to about 1 / 200 th of a 25 mm reference length . the inventor has recognized that this wear problem can be addressed , and very accurately aligned datums can be achieved , by relatively moving at least a portion of the functional area of the electrode over , to act on , both of the datums 25 , 27 . one implementation of this concept is illustrated in fig7 and 9 . a cylindrical electrode 35 is placed parallel to but offset from the centerline 34 of datums 25 and 27 . the diameter of the electrode 35 is preferably smaller than the bore diameter but larger than half of the bore diameter . the centerline 34 corresponds to the axis of pin 26 , which also corresponds to the axis of the bolt in this example . the electrode 35 could be a solid cylindrical electrode , the end portion of which is bathed in a suitable dielectric . alternatively , as suggested in fig9 , a hollow electrode may be used . fig9 shows an alternative form of electrode , being fluid cooled by galleries 37 running inside the electrode 35 . by passing fluid through the galleries the edm can be performed without a bath , since the fluid passes from the galleries to flush between the electrode and the surfaces being machined . the advantageous relative movement is suggested by the arrows in fig7 and 8 and is the combination of two or three distinct movements : the electrode 35 is rotated about its axis in one direction ( clockwise as drawn in this example ); the bolt 20 is rotated about its axis in the opposite direction ( anti - clockwise as drawn in this example ); and the electrode 35 is optionally laterally stroked ( i . e . moved in a direction perpendicular to the axis of the bolt ) or more specifically ( in this example ) stroked radially relative to the axis of the bolt . as part of this movement , respective portions of the functional area repetitively pass over one of the datums and then the other . relative to other simpler movements , each of these respective portions traverses a greater area of the datum surfaces . this relative movement limits , or in preferred implementations substantially avoids , the adverse consequences of machining tool wear . by way of example , if the end face of the machining tool were to wear to a concave shape , the remaining circular rim would continue to act on the workpiece to accurately produce flat co - planar datums . on the other hand , if the end face were to wear to a convex shape , the stroke and diameter of the electrode can be adjusted so that substantially the same outer annular region defines the outer datum 25 and a central portion of the inner datum 27 , whereby the axial relative disposition of the highest points of the datums can be very tightly controlled . for the avoidance of doubt , “ high point ” and “ highest point ” and variants of those terms are used herein in their ordinary sense in the context of machined components to refer to the points that would be picked up by a contact measuring tool . these points are independent of the orientation of the workpiece . experimentation has shown that electrodes and bolts mutually wear each other , such that in practice the electrode wears more uniformly than in conventional edm processes , such that functional area remains relatively planar . it is contemplated that some rounding would occur about the circular perimeter of the functional area , although this has not be noticeable in the experimental results and is adequately accounted for by routine corner treatment ( e . g . chamfering or rounding ) of the leading circular edge of the measurement tool to clear any corresponding rounding of the corner connecting the outer datum 25 to the cylindrical wall of the bore portion 23 . each of the datum surfaces preferably has a maximum axial run - out of 1 / 100 th of the distance from the datum of the member to the root of the pin , regardless of how it is formed . this limits variations in measurement associated with rotatable measurement tools . the described edm process has been found to produce a satisfactory axial run - out . beyond limiting the adverse effects of machining tool wear , the described relative motion offers the further benefit in that the dielectric fluid is in continual motion . this improves the quality of the fluid in the critical region in which arcing occurs , by more effectively flushing away eroded material and limiting the formation of bubbles and other localized effects . in turn , a better surface finish is achieved which further contributes to the accuracy of the initial disposition of the datums . in particular , rotation of the bolt is thought to aid in the removal of the machined waste due to the centrifugal forces associated with this rotation . to emphasize , it is motion of the machining tool relative to the bolt that is most important . aside from the mentioned centrifugal forces , similar benefits could be obtained by holding one of the tool and the bolt stationary and suitably modifying the motion of the other of the tool and the bolt . by combining aspects of sinker edm and fast - hole edm methods as described , maintaining suitable machine settings , selecting appropriate electrode dimensions , selecting suitable dielectric fluids and the incorporation of an offset electrode with counter - rotation of the work - piece and the electrode for machining the datum surfaces , it is possible to use edm to produce a load - indicating bolt in a commercially viable mass - production process ( i . e . within 2 to 3 minutes per bolt for the entire edm process ). once supplied with the knowledge in this patent specification , persons of skill in the art will have no difficulty selecting and controlling these parameters . the separate annulus - forming and datum - forming machining operations can be completed using the same edm power supply and control system . by forming both datums in a single machining set up the initial relative disposition of the datums 25 , 27 is very tightly controlled . the manufacturing process can include checking the relative disposition of the datums and re - machining if that disposition is outside of a predetermined tolerance , although often re - machining is not required . for practical purposes , process variation is eliminated . the initial relative disposition can be controlled tightly enough that , for most purposes , there is no need to know the history of the bolt , e . g . no need to measure the initial relative disposition or to track this information . thus the labour and potential for error associated with measuring , tracking and calculating the unloaded relative disposition of the datums is eliminated . this is particularly advantageous in the context of quality assurance activities entailing random inspection . the described process can be automated and relatively straightforward , meaning that bolts may be produced by a standard machine shop . there is no need for specialist calibration or a specialist fabricator . in the finished member , both datums are defined by the same integral body of material . thus the errors inherent in multi component constructions are avoided . these avoided errors include both initial production variations and longer term variations . in the longer term , connections such as threaded connections and force fitted pins can work loose when subject to vibration and / or thermal cycling . for example , with reference to fig1 , if the threaded connection at the root of the pin were to work loose , the measured degree of recession would be reduced which may lead to a false measurement and over tightening of the bolt and in turn failure of the bolt . also the labour costs of the assembly steps have been avoided . for example , with reference to fig1 to 3 , the costs and errors associated with threadingly engaging a pin and inserting a sleeve are avoided . formation of the pin 26 and the strainable portion 22 by the same machining process and as part of the same integral body also reduces errors associated with differential thermal expansion . for example , even if the pin of fig1 were formed of nominally the same material as the shank , differences in the fabrication techniques used to make these components can lead to different coefficients of expansion . such formation also ensures that the pin and the strainable portion have a similar tolerance for operating conditions such as temperature and other environmental factors . moreover , in at least preferred forms of the member , the datums 25 , 27 and the root 28 of the pin 26 are all within the strainable portion of the member so as to most likely be at substantially the same temperature . this reduces the errors associated with temperature differences . the use of edm allows the construction of finer features than other machining methods , e . g . the pin 26 , annulus 29 and shank 22 may have outer diameters of 2 . 5 mm , 3 . 2 mm and 19 mm respectively . the bolt may be pre - relaxed ( by tightening on a solid steel cylinder and placing it in an oven ) prior to machining the gauge pin , such that the bolt has already had primary creep / relaxation prior to being placed in service . the device will then still measure actual elastic elongation ( since plastic elongation due to creep / relaxation will be minimal ). this is useful for high temperature joints . the process of pre - relaxing the bolt can be used on any bolt , particularly those used in high temperature environments and the bolts do not need to be load indicating bolts . tightening the bolt onto an item is one method of applying a load to the strainable portion in the same direction as an in use loading of that portion . other means of applying load in that direction are possible . preferably the process for pre - relaxing the bolt is controlled based on the bolt material and the intended application temperature and bolt stress level . an exemplary pre - relaxation process involves stressing the bolt to a given bolt stress level which is in excess of the intended operating bolt stress but sufficiently low so as to avoid excessive yield at temperature , and placing it in an oven at a temperature that is hotter than the intended operating temperature , but lower than a temperature that will modify the material properties . the oven temperature is then maintained for a period of time , determined by previous testing of similar bolt materials under similar conditions , such that the primary rate of creep / relaxation has been exhausted and the bolt is now at a suitable secondary creep / relaxation rate such that a rate of secondary creep / relaxation is negligible compared to an elastic strain of the strainable portion . whilst the oven might be held at a constant temperature , the characteristics of the heating might be varied to produce other temperature profiles . controlling the process parameters such that at the end of the pre - relaxation period the creep / relaxation rate is less than 4 × 10 − 7 m / m / hr has been found to be highly desirable . this rate of creep / relaxation often corresponds to a nominal in service relaxation not more than 10 % ( based on a nominal service of 5 years at 80 % of a creep temperature and an initial stress of 50 % of a yield stress ). this nominal service relaxation is sufficient for most purposes . achieving adequate pre - relaxation may require the bolt to be removed and retightened periodically , depending on the material , the bolt stress , the oven temperature and the intended operating conditions . for the avoidance of doubt , “ heating for a period ” and similar words as used herein take in the possibility of heating for two or more separate sub - periods . preferred forms of the described process result in a selected secondary creep / relaxation rate that is minimal by comparison to the expected bolt elastic elongation , ensuring that the load measurement corresponds substantially to the elastic elongation , rather than the combined elastic - plastic elongation of the bolt . creep is the elongation of the material under constant stress , relaxation is the loss of load under constant deflection . relaxation occurs at a much lower temperature than creep and is due to micro - plasticity of the material . the microstructures of some materials will undergo more relaxation than others . for example , alloys intended for very high temperature uses will likely be less responsive to the pre - relaxation treatment disclosed herein , whereas cheaper more popular alloys can be pre - relaxed to a point where in - use relaxation is at the secondary creep / relaxation strain rate . for such lower alloy materials , imparting an initial creep strain into the bolt during the pre - relaxation treatment ensures that the strain rate once it is placed into service will be significantly lower . this is particularly the case in services where the creep rate will not be very high and relaxation is the primary cause of bolt load loss . so the pre - relaxation process enables the use of low alloy and less expensive higher alloys in place of expensive high temperature alloys for bolted joints that are operating at a temperature where creep is not significant but relaxation causes loss of bolt load to the point where joint integrity is compromised . bolt relaxation can compromise joint integrity so that in a pressure boundary bolted joint there is leakage and , in a structural type joint such as a compressor casing or similar , the bolt load loss is to the point that the bolt will be at risk of fatigue and / or other parts of the structure will become over - stressed . while in most cases the heating of the bolt would exceed a nominal creep temperature of the bolt material and would be less than a maximum temperature limit set as the lower of the annealing temperature for the material or the temperature that causes detrimental microstructural changes ( such as the precipitation of carbides to the grain boundaries in some material for example , i . e . adversely affecting microstructural changes of the strainable portion of the bolt ), the heating temperature may be in as broad a range as from 80 % of the creep temperature up to the maximum temperature limit . preferably the heating temperature is within 30 % to 90 % of a range defined from the creep temperature to the maximum temperature that causes detrimental changes to the bolt material . similarly while the load applied to the bolt during the pre - relaxation process is preferably equivalent to between 50 % of the yield stress in the strainable portion of the bolt at ambient temperature and 100 % of the yield stress at an operating temperature of the bolt , it is more preferably equivalent to at least 75 % of the yield stress at ambient and less than the yield at an operating temperature of the bolt . heating close to the maximum temperature , applying a load of at least 75 % of yield at ambient temperature and reapplying the load as the bolt relaxes all accelerate the pre - relaxation process . therefore it is also desirable to remove and retighten periodically to accelerate the accumulation of strain during the pre - relaxation treatment . it would be advantageous to use a long oven to accommodate a full length of threaded bar used for stud bolts . fig2 shows a graph of bolt stress vs time for a bolt that is assembled on a solid steel cylinder and heated . the slope of the curve 100 is the creep / relaxation rate . the region 101 from zero time up to the time indicated by the line 103 the relaxation rate is a primary creep / relaxation rate . after that time , the creep / relaxation rate begins to approach a low rate , through which time the process is known as secondary creep / relaxation , region 102 . in some cases the pre - relaxation treatment is carried out to exhaust the primary creep / relaxation , so the bolt is loaded and heated for the time indicated by the line 103 . however it can be advantageous to use a slightly longer time pre - relaxation treatment time as indicated by the line 104 , going past what would be traditionally called the point of transition between primary and secondary . the benefit of using the slightly longer pre - relaxation treatment time is that the bolt material is to ensure that , for most purposes , the rate of secondary creep / relaxation will be negligible compared to the bolt assembly elastic strain . the datum 25 is defined by the strainable portion 22 , i . e . it does not sit higher up within or above the head 21 of the bolt or in the load receiving portion of the thread . locating this datum in this region removes the influence on the relative displacement of the datums 25 , 27 , of the complex stress and deformation patterns within the head 21 . fig1 shows the stud bolt of fig8 assembled with a first nut 42 engaging the first load receiving portion 36 of the external thread 43 near the measuring access end 44 of the bolt . a second nut 45 is shown towards the opposite end of the bolt 20 in the stud bolt assembly 41 to enable load to be applied and reacted by the first and second nuts . the second nut engages the thread 43 over a second load receiving portion 46 . the strainable portion 47 is the region of the bolt between the first and second load receiving portions 36 and 46 . the hole 48 from the measuring access end of the bolt includes the bore portion 23 ending in a datum step 49 at its inner end . the threads of the end portion 24 of the hole 48 are multi - purpose . during ordinary use of the bolt in typical operating environments the threads co - operate with a plug 50 which blocks access to the datums 25 , 27 to shield them from debris that might otherwise settle on the datums ( and thus make accurate measurement impossible ) or bind within the gap 29 to give a false reading . the plug 50 also protects the datums from corrosion and other environmental degradation . potentially a desiccant or an inert gas may be sealed in by the plug as a further means of protection . the plug 50 sits within the hole 48 , as opposed to a cap that might sit over an external feature on the measuring access end 44 of the bolt to cover and protect the bore 23 . other closures are possible . in typical operating environments , to measure the load on a bolt the plug is removed and a measuring tool screwed in its place . in more aggressive / hazardous environments , such as underwater , a measurement tool may remain permanently engaged with the threads to protect the interior of the bolt , e . g . to prevent the ingress of seawater , corrosion of the datum and reduced operational lifespan of the bolt load measurement device . fig1 illustrates the principal components of a measuring tool 60 which in and of themselves constitute a tool . these principal components include an outer tubular datum contacting portion 61 for making contact with the strain portion datum of the bolt , and another datum contacting portion 62 in the form of a pin internally carried within the portion 61 for making contact with the reference datum on the end of the reference pin of a bolt . the pin or measuring rod 62 is mounted to axially slide within the sleeve 61 and a strain gauge 63 carrying diaphragm 64 is mounted to detect this movement . the sleeve 61 is dimensioned to align and support the pin 62 to substantially eliminate error inducing lateral movement at the pin 62 . as previously noted there is preferably an axial distance from the highest point of the reference datum to the highest point of the strain portion datum of less than 1 / 1000th of an axial distance from the reference datum to the root of pin . preferably however , each of the datum contacting portions preferably has a maximum axial run - out of 1 / 1000 th of the distance from the reference datum of the member to the root of the pin , regardless of how it is formed . this limits variations in measurement associated with rotatable measuring tools . the portion 61 has a disc - like head 65 from which a circular rim 66 axially projects . that rim is spanned by the diaphragm 64 such that the diaphragm resists the pin 62 retracting into the tool . in doing so the diaphragm 64 deforms so as to have a bell curve - like transverse cross - section . strain gauges 63 mounted on the diaphragm detect this deformation . the diaphragm offers some resistance to this deformation whereby the reference datum contacting portion or pin 62 is urged to remain in contact with the reference datum 27 of a bolt being measured . similar diaphragms and strain gauges are known in the context of pressure measurement . by drawing on technology from this non - analogous art , the present inventor has realised significant efficiencies and increased accuracy of measurement . desirably the strain gauge may operate on a voltage low enough to suit explosive environments . desirably the tubular portion or sleeve 61 is dimensioned for a close sliding fit within the bore 23 of a bolt and so as to seat against the reference datum 25 of the bolt without contacting the strain portion datum 27 of the bolt . the pin or measuring rod 62 is dimensioned to seat on the reference datum 27 without contacting the strain portion datum 25 . this close sliding fit means that the tubular probe is aligned precisely by the tight tolerances between its outer shaft and hole in the bolt . this alignment leads to better measurement accuracy over existing devices in which the alignment is made only using the contact surfaces on the bolt head . the inventor has observed that when using such existing devices the read out value changes by about 10 % if you rotate the device or remove and replace the device . this is due to the relatively small contact area used to align the device to the bolt . the described close sliding fit substantially eliminates this variation ( i . e . error ). the engagement between the cylindrical exterior of the portion or sleeve 61 and the cylindrical interior of the bore of a bolt to be measured is a translational sliding engagement ( as opposed to , say , a helical sliding engagement in a threaded connection ). of course cylindricity is not essential . profiles other than circular are possible . fig1 shows a measuring tool 30 comprising the principal components shown in fig1 and a retaining cap arrangement 80 to locate the measuring tool to the thread in the end of the hole of a bolt . as in fig1 , the measuring tool includes a pin or measuring rod 62 within a sleeve 61 , the inner end of the measuring rod 62 having a diaphragm contacting surface 71 . the sleeve 61 has a probe portion 72 and , at one end , a flange portion 65 . a diaphragm 64 is arranged across the flange portion 65 . in use , the diaphragm contacting surface 71 of the measuring rod pushes on the diaphragm 64 . the other end , being the external end , of the measuring rod 62 has a reference datum engaging surface 73 to engage the reference datum of a bolt . the measuring rod also includes a ridge 74 co - operable with a complementary formation within the sleeve 61 to prevent the rod 62 from extending too far relative to the sleeve 61 so as to retain the rod 62 at least partly within the sleeve 61 . the sleeve 61 is held in a two piece housing ( the retaining cap arrangement 80 ) comprising a body 81 and a cap 82 . the outer surface 75 of the probe portion 72 of the sleeve is preferably a sliding fit inside the bore 23 of the bolt to be measured . a thread or other form of retaining region 83 on the housing is provided to enable the measuring tool 60 to be anchored to the bolt during measurement . a spring or other resilient member 84 between the housing cap 82 and a cap 76 on the flange ensures that when the measurement tool is engaged with a bolt , a strain portion datum engaging end 77 of the sleeve is pushed with a controlled force onto the strain portion datum . deformation of the diaphragm 64 by the measuring rod 62 is measured by strain gauges 63 connected by wires 78 to a measurement display unit ( not shown ). other arrangements are possible , such as locating the signal conditioning components in the measurement tool and using a wireless link to a measurement display unit . a non - circular bore profile can be engaged by a measuring tool having a complementary non - circular profile to substantially prevent rotation of the tool about the axis of the gauge pin , e . g . the tool may have a keyway in which a key of the bore is received or vice - versa . the inclusion of features co - operable to limit rotation of the tool relative to the member is another means of improving accuracy . the measuring tool 60 is but one example of a mechanical load checking tool that may be advantageously used in conjunction with the described members . in contrast to non - contact tools mechanical load checking tools are characterised by having at least one dedicated datum contacting portion for each of the datums . mechanical load checking tools are often simpler , more robust , less sensitive to temperature and of lower cost than other options . the inventor has recognised that the tool taking its alignment from the bore is a significant advance over existing arrangements in which alignment is taken from a surface transverse to the gauge pin , e . g . over the variant of fig4 of uk patent application no . gb 2 372 826 a ( herein fig5 ) in which the probe is biased against the step to fixedly locate the probe relative to the step . the significant advance arises because despite all reasonable manufacturing precautions being taken , no surfaces are truly planar . rather , nominally planar surfaces are in fact irregular albeit if only at a microscopic level . these irregularities can result in misalignment of the tool and in turn to measurement error . the larger a surface is , the more difficult it is to keep within a given flatness tolerance . fig1 schematically illustrates an interface between a variant of the system incorporating a sleeve portion 61 of reduced diameter or insufficient bore length so that the measuring tool does not take its alignment from the wall of the bore 23 , but rather from one of the datum surfaces , in this case from surface 25 . surface irregularities are greatly exaggerated in the figures . as suggested by the line l , despite these irregularities the surfaces 25 , 27 are nominally co - planar . nonetheless , as will be apparent , these irregularities result in the tool being cocked and in an erroneous measurement suggesting that the datum 27 is proud of the datum 25 . fig1 is a schematic similar to the schematic of fig1 but for an engagement e between the wall of the bore 23 and the tool . the engagement e , a radial clearance toleranced for a running or sliding fit , ensures that the axis of the tool is parallel to the axis of the gauge or reference pin 26 and in turn a respective high point of the each of the datums 25 , 27 is picked up , leading to a more repeatable measurement . the axis of the tool is thus held perpendicular to the ( nominally ) planar datums using a repeatable method . moreover , the engagement e means that the datums 25 , 27 are released from the tool - aligning function that they might otherwise serve and therefore may be smaller than would otherwise be required . because the datums are smaller , surface irregularities can be minimised or , put another way , a tighter flatness tolerance can be maintained . this contributes to the accuracy of the measurement . by checking the relative disposition of the high points during manufacturing and if necessary re - machining , the initial alignment of datums can be very tightly controlled using relatively low cost manufacturing techniques . the initial alignment is controlled to within suitable tolerances so that tools can be calibrated with standard calibration blocks . by way of example , satisfactory accuracy for many applications can be achieved using a 25 mm root - to - datum dimension and an initial alignment tolerance between the datums ( or more specifically the high point of the datum 25 and the high point of the datum 27 as discussed above ) within 12 . 5 μm . more accurate applications may require a tolerance of half this value . preferably the axial distance between the high points of the datums 25 , 27 is less than 1 / 1000 th of the length of the reference pin , preferably less than 1 / 2000 th ( i . e . 12 . 5 μm for a 25 mm long reference pin ) and in more accurate applications , less than 1 / 4000 th of the length of the reference pin . these tolerances are readily achievable using the described low cost manufacturing techniques . in contrast , achieving similar results would be much more difficult ( i . e . much more expensive ) using arrangements as in fig4 of uk patent application no . gb 2372 826 a ( herein fig5 ) and fig1 . it would be much more difficult because achieving the same accuracy would require the cumulative errors across the entire datum surface under the measurement probe and relating to flatness , parallelism , perpendicular and co - planar to be held all within the same overall tolerance , which is much more difficult due to the possible combinations of error accumulation . in addition , the non - contact method of measurement of gb 2 372 826 is inherently more sensitive to surface condition than the present contact measurement method . similar comments apply in respect of the arrangement of fig2 of uk patent application no . gb 2 372 826 a ( herein fig4 ). whist that arrangement includes a close sliding fit within a bore that would assist with concentrically aligning the end of the tool with the datum , that bore is much too short to limit angular misalignment , i . e . to limit misalignment of the type illustrated in fig1 . the advantageous engagement e arises from a combination of the fit ( relating to the radial clearance ) and the length of the engagement . fig1 is an exaggerated schematic of misalignment of a measuring tool 60 resulting from a loose fit . measurements would vary as the tool is rotated or otherwise manipulated . likewise , even a very tight fit in a short bore such as the bore of fig2 of uk patent application no . gb 2 372 826 a ( herein fig4 ) would allow for tool misalignment and in turn to appreciable variations in measurement as the tool 60 is rotated or otherwise manipulated within the hole 48 . if a sliding fit is used , accuracy sufficient for most purposes can be achieved whilst the length of the bore portion is reduced to 1 . 5 times or even equal to the bore diameter , particularly if a short bushing is also provided in the hole axially spaced from the bore portion to assist with alignment of the probe portion of the measurement tool . so the ratio of bore portion length to diameter is preferably at least 1 : 1 , more preferably at least 1 . 5 : 1 , at least 2 : 1 or at least 3 : 1 . where a ratio of 1 . 5 : 1 or less is used , preferably the fit between the bore of the bolt and a probe portion of a measuring tool is a sliding fit to ensure misalignment is minimised . the fit between the bore of the bolt and a probe portion of a measuring tool is preferably at loosest substantially an rc 6 , i . e . at loosest a medium running fit . the ( ansi ) rc 6 fit falls between the iso free running and easy running fits , all three of which require an h9 hole tolerance at loosest . an h9 bore will form a suitable fit with tools of nominally the same diameter and formed to iso e8 or better ( e . g . f8 , f7 , e7 , g6 or g7 , the tolerances for ansi rc 5 and rc4 and iso easy running or sliding fits ). the h9 tolerance is preferably applied as an h9 { circle around ( e )} tolerance , i . e . h9 with the envelope specification to simultaneously limit wavy or otherwise bent bores as well as the bore diameter . to account for non - cylindrical bores ( such as a cylindrical bore extended by a keyway ), the square root of the bore &# 39 ; s cross - sectional area is a suitable substitute for the diameter in the above calculations . for the avoidance of doubt , in this context and in similar contexts herein , references to a bore &# 39 ; s diameter and / or cross - sectional area are in respect of the bore &# 39 ; s relevant measuring tool engaging portion ( s ). fig1 shows a system 90 including a stud bolt 20 and a tool 60 . the measuring tool 60 includes a key 91 , and the bolt 20 includes a complementary keyway 92 , to rotationally orient the tool relative to the bolt . fig1 is a perpendicular cross - section as indicated by the arrows 16 - 16 in fig1 . no retaining region is shown in fig1 and the measuring tool 30 can be manually held in place , although use of a retaining region able to hold the measuring tool in place and / or to retain a plug or cap is preferable . in this example , the key 91 and keyway 92 are axially spaced from the engaging portions of the bore 23 and tool ( sleeve 61 of the probe portion ). whilst the tool - engaging portion of the bore preferably has a substantially uniform profile , it is also contemplated that the bore may vary in profile along its axial length . by way of example a bore may be formed with a pair of guide rings axially spaced from each other by a relieved portion of greater diameter . likewise , the engaging tool could be formed with a pair of guide rings axially spaced from each other along the sleeve portion to engage the bore whereby the engagement is a discontinuous engagement . in either case the lengthwise axial separation of the outer most portions of the rings can be substituted for the length in the above calculations . of course the ends of a single cylindrical engagement region are two locations spaced by an axial length . likewise , whilst a substantially conformal fit between the tool and the bore is preferred , other forms of engagement are possible . by way of the example , the wall of the bore may include inwardly directed splines defining separate lines of contact with a cylindrical tool exterior . the components of fig1 when coupled to suitable data acquisition equipment to read the strain gauge could be used as a load monitoring tool by simply handling the head of the portion 61 to insert it into the bore 23 . the data acquisition equipment may include a standard instrument ( gauge meter ) for measurement of the bolt load ( single channel hand - held device or , in the case of multiple bolts being measured simultaneously , a multi - channel data - logger ). the data acquisition equipment may simply record the read out value from the strain gauge , but preferably includes ( or is linked to ) a display to display that value . simply handling the head of the portion 61 may entail some error depending on how hard the operator pushes the tool in place . accordingly the tool 60 preferably includes a housing 80 and a spring arrangement 84 as shown in fig1 which serve to control the force by which the key components 61 , 62 are inwardly urged . the housing 80 encloses the head of the portion 61 and the diaphragm 64 . in some variants the enclosure may be a sealing enclosure to suit operation in aggressive ( e . g . underwater ) and / or hazardous ( e . g . explosive ) environments . the housing includes an externally threaded tubular boss 83 through which the portions 61 , 62 project from the housing 80 . the externally threaded tubular boss threadingly engages the threads of the retaining region 24 at the end of the hole in the bolt to mount the measuring tool 60 . the housing 80 is configured for simple hand manipulation to screw the tool in and out . the tool 60 is easily removable and can be easily moved from bolt to bolt rather than being an integrated part of a bolt . the tool 60 is also convenient in that it can easily be calibrated in the field using a calibration block . the spring arrangement 84 is a compression spring arrangement acting between a roof of the housing 80 and the annular rim of the portion 61 to downwardly drive that portion relative to the housing . when the housing 80 is screwed into the bolt 20 , the portion 61 abuts the datum 25 , so that it cannot move inwardly . as the housing is further screwed in , the head 65 of the portion 61 relatively moves within the housing 80 to compress the spring arrangement 84 . the housing 80 is screwed in until it abuts a stop ( the end face of the bolt 20 in this case ). the spring arrangement may be a helical compression spring . alternatively it may be a series of wave springs to provide a more uniform distribution of pressure on the portion 61 . the measuring tool 60 may also be left in place as part of an automatic load maintaining system including a mechanism for varying load ( e . g . for turning a nut or bolt head ) responsive to the strain gauge . of course sensors other than strain gauges are also possible . a linear variable differential transformer is another example of a sensor that may be employed . the materials of construction for the measurement device can be non - conductive ( thermally ) and external cooling / heating may be applied , making it capable of measuring bolt load at a wide range of temperatures either intermittently or continuously . the portions 61 , 62 can be constructed from steel or , in the case of a high temperature gauge , a thermally insulating ceramic material . when the bolt is tightened , the pin 26 remains unstressed whereas the strainable portion 47 is loaded and stretches . the relative displacement of the datums 25 , 27 when the bolt is so loaded corresponds to the amount by which the material between the strain portion datum 25 and the root 28 has extended . thus the lengthwise dimension from the datum 25 to the root 28 is an important dimension . by knowing this length and the elastic properties ( e . g . young &# 39 ; s modulus ) of the bolt material , the load can be determined based on the measured relative displacement and in turn data processing equipment associated with the measuring tool 60 can be calibrated to provide an output indicative of the load . if the datums of an unloaded bolt are co - planar ( or preferably the planes passing through the high points on the datums are separated by less than 1 / 2000 th of the axial length of the pin , each plane being perpendicular to the major axis of the bore ), this important dimension ( between the strain portion datum 25 and the root 28 ) corresponds to the length of the gauge ( reference ) pin 26 . longer datum to root dimensions produce a proportionately larger relative displacement between the datums 25 , 27 for a given strain . thus , when a bolt is to be subject to pure tension , a longer datum to root dimension will produce more accurate results . 12 mm is considered a practical minimum for many applications . on the other hand , longer datum to root dimensions are more difficult to manufacture and can lead to inaccuracy if a bolt is subject to bending . 75 mm is considered a practical maximum required for many applications . fig1 is an exaggerated schematic view illustrating how bending can lead to misalignment of the datums of similar effect to the misalignment contemplated in fig1 . the transfer function that gives load as a function of the relative displacement of the datums varies based on the important root to datum length , the cross - sectional area of the strainable portion , and the material properties . thus a set of bolts that were formed of differing materials but otherwise identical would require differently calibrated measuring tools to measure their output . accordingly it is proposed that bolts of differing material be shaped differently to permit checking with a common tool ( i . e . without modification of , recalibration of , or changing settings on , the tool ). in a simple form , the initial relative disposition of the datums 25 , 27 could be varied , e . g . by lengthening the pin 26 , so that the datums of differing bolts move to a common relative disposition when a critical load is reached . this would permit a simple check of whether the critical load has been reached with a common tool . more preferably the critical length from the datum 25 to the datum 27 is varied so that the transfer function that gives load as a function of relative displacement is consistent across a set of bolts formed of dissimilar materials . this configuration allows a common tool to measure ( i . e . to provide an accurate numerical output of ) the load on each of the bolts . the pin 26 is relatively thin so as to minimise the reduction in the functional cross - sectional area of the strainable portion 47 . since it is inextensible , workable variants of the bolt 20 may have longer or shorter pins 26 , although it is preferred that the end of the pin 27 is within the strainable portion , and most preferably that datum 27 is co - planar with a datum 25 ( or at least that a measuring tool measures the relative disposition as less than a maximum tolerance value ) when the bolt is not loaded . as discussed above , that maximum tolerance value is preferably 12 . 5 μm for a 25 mm long pin 26 . the thin pin 26 is safely housed within the bolt 20 and thus shielded from damage . of course the shape of the tool 60 is complementary to the shape of the bolt 20 . the described geometry of the datums 25 , 27 results in the measuring rod portion 62 likewise being safely housed within the sleeve portion 61 along at least most of its length . thus it too is shielded from damage . fig1 shows a system 90 including a bolt type of fastener 20 having a head 21 and a shank 22 , with the measurement tool 60 engaged , ready for measurement of the elongation and therefore the load . the first load engaging region 36 is now the bolt head 21 . the gauge length , the reference pin 26 , the root 28 , reference datum 27 and strain portion datum 25 are again all located within the shank 22 and therefore within the strainable portion 47 of the fastener . fig2 is a partial section of the system of fig1 around the shank 22 and strainable portion of the fastener , showing the engagement of the outer surface 75 of the probe portion of sleeve 61 of the measuring tool inside the bore 23 of the fastener or bolt 20 , with the strain portion engaging end 77 of the sleeve 61 contacting the strain portion datum 25 and the reference datum engaging surface 73 of the measuring rod 62 contacting the reference datum 27 on the end of the gauge or reference pin 26 . fig2 shows a system 90 including a headed bolt 20 in which the retaining region 24 takes the form of an externally threaded tubular boss . as in various other members disclosed herein , the region 24 co - operates with , to retain , a protective cap and / or the measuring tool 60 . threads of the region are external to the hole 48 . the retaining region 24 on the bolt 20 in this example is now a male thread and a female thread is now provided inside the housing body 81 of the measuring tool 60 . this arrangement can be preferable for example on smaller diameter bolts or on bolts utilising a keyway as in fig1 and 17 . preferred forms of the system made up of fastener 20 and measurement tool 60 are capable of sustained measurement at elevated temperatures , due to the combination of an integral pin that is identical to the bolt , minimal measurement contact surfaces and the ability to build the measurement device out of non - conductive materials ( such as ceramic ). the bolt material properties may be modified by pre - conditioning prior to installation of the measurement device in order to eliminate measurement drift associated with creep or relaxation of the components , which is an inherent problem with the load indicating bolts currently in use . due to the improved accuracy arising from the elimination of multiple components in the measurement system ( e . g . relative to the bolt of fig2 the elimination of a separable pin and sleeve ) and improvements to the measurement device misalignment , a more sensitive gauge can be employed . this allows the use of a shorter dimension from the datum 25 to the root 28 , which is advantageous in reducing temperature and bolt bending effects on the measurement . by way of example , a root to datum measurement of about 25 mm is contemplated , whereas about 50 mm is thought to be a practical minimum for the corresponding dimension in the bolt of fig1 . bolts in the vicinity of φ12 mm up to φ200 mm or so are contemplated . in the preceding discussion various examples of the invention are disclosed . the invention is not limited to these examples . rather the invention is defined by the following claims . | 1 |
referring now to the drawings , wherein like reference numbers are used to designate like elements throughout the various views , several embodiments of the present invention are further described . the figures are not necessarily drawn to scale , and in some instances the drawings have been exaggerated or simplified for illustrative purposes only . one of ordinary skill in the art will appreciate the many possible applications and variations of the present invention based on the following examples of possible embodiments of the present invention . with reference to fig1 , a functional depiction of a broadband information appliance 100 is shown . the broadband information appliance 100 includes a base unit 101 . the base unit 101 typically houses the processing circuits , memory storage , interfaces 105 , manual inputs 102 and power connections . the base unit 101 may be attached to a display 103 . the display 103 may be integral with the base unit 101 . the display 103 may be an independent unit fixedly attached to the base unit 101 . the display 103 may be interchangeably attached to the base unit 101 such that the display 103 may be easily exchanged for a different display 103 . base unit 101 may include manual inputs 102 . typically the manual inputs 102 may include a standard telephone keypad with ten numeric buttons plus “#” and “*” buttons . the manual inputs 102 may further include any number of other buttons , switches , thumbwheels or other appropriate manual input devices . a wide variety of functions and features may be controlled using the manual inputs 102 . manual inputs 102 may include navigation keys or a joystick for up , down , right and left selections , programmable soft keys . power and status leds may also be provided . base unit 101 may be connected to a handset 104 . handset 104 may be substantially a standard telephone handset including a microphone and speaker . handset 104 may be directly connected to the base unit 101 . a handset 104 directly connected to the base unit 101 may be called a “ tethered ” or “ wired ” handset . handset 104 may also include a wireless transceiver for wireless connection to a base unit including ( or connected to ) a wireless transceiver . the wireless transceivers may be a 2 . 4 gigahertz transceivers or may use any other suitable wireless transceiver frequency . the wireless transceivers may be spread spectrum transceivers . a handset 104 wirelessly connected to the base unit may be called a “ wireless ” handset . base unit 101 may be connected to an interface 105 . typically , interface 105 will be integral with base unit 101 . interface 105 includes an interface for connection to network 106 . network 106 may be an open network such as the internet . interface 105 includes interface connections 107 for connecting the base unit 101 to a variety of peripherals or networks . typically , the interface 105 will provide ethernet ports , telephone handset and keypad support , video capture and display ports including ntsc composite input and output ports , s - video ports , ntsc camera ports and lcd display ports . the interface 105 may include audio capture and reproduction ports , an external microphone port , an external speaker port , two audio line level inputs , a handsfree speakerphone , a digital video camera 115 may be connected to base unit 101 . typically digital video camera 1105 is a ccd camera device . the digital video camera 115 may be integral with the base unit 101 or the display 103 . an additional digital video camera 137 may be integral with the handset 104 . a privacy shield 141 may be a cover provided to disable the digital video camera 137 by covering the lens of the digital video camera 137 . with reference to fig1 a , a more detailed depiction of the features that may be incorporated into handset 104 is shown . the handset 104 typically includes a speaker 135 and a microphone 136 to provide standard audio communication . handset 104 may include a digital video camera 137 , typically at one end of the handset 104 . a scanner 138 may be provided on the handset 104 to read machine readable codes or to scan image data . an lcd display 139 may be provided on the handset 104 - to allow the user to see the input from digital video camera 137 , show video data being shown on display 103 when the handset 104 is being used remotely from the base 101 . the handset display 139 may also show alternate visual data . the handset 104 may include further manual inputs 140 to control the video camera 137 , handset display 139 , scanner 138 . with reference to fig2 , a functional block diagram of a basic broadband information appliance 100 is shown . a gateway 110 provides an interface to network 106 . the gateway communicates with voice - over - internet - protocol ( voip ) hardware 111 and video hardware 114 . the voip hardware 114 may be directly connected to wired handset 104 or may be connected to a cordless base unit 112 which provides wireless communication with a cordless handset 113 . the video hardware 114 may be connected to a video camera 115 and a display 103 . with reference to fig3 , a more detailed functional block diagram of a broadband information appliance 100 is shown . a gateway 111 provides communication with one or more networks 106 . gateway 110 may be a micrel ks8695p processor . the gateway 110 typically - acts as the master boot processor for the broadband information appliance 100 . the gateway 110 is typically an integrated , multi - port pci bridge system on a chip . the ks8695p integrates an arm922t cpu , a pci bridge that can support up to 3 external pci , masters and a 5 - port switch with integrated media access controllers and low power ethernet phys . the pci interface can be connected gluelessly to minipci or cardbus wireless lan cards that support 802 . 11a / g / b . those skilled in the art will recognize that other processors , chips or configurations could be used for the gateway 110 . the ks8695p gateway processor includes five ethernet mac and phy , 10 / 100 base - transceivers . it includes a pci bridge and master arbiter of up to 3 external pci 2 . 1 compliant controllers , supporting a 32 bit data bus as 33 mhz clock speed . the processor includes a memory controller for glueless synchronous dram support at 133 mhz access of up to 32 mb . the processor has a standard memory bus for sram and flash rom , 32 bit address , 32 bit data up to 32 mb , with general purpose i / o pins and a jtag port . gateway 110 provides one or more external ethernet ports . gateway 110 includes ethernet ports for both uplink 116 and downlink 117 connections . typically , uplink 116 and downlink 117 are integrated , however according to some embodiments , separate communication links may be provided for the uplink 116 and downlink 117 , particularly where bandwidth limitations make it advisable to provide greater bandwidth for the downlink 117 than the uplink 11 6 . gateway 119 may be connected to a link controller 119 , a usb host controller 120 , a mini - pci slot 121 or other interfaces . gateway 119 may be connected to gateway memory 118 . gateway memory 118 may be flash memory , sdram or other suitable memory device . gateway 119 may be connected to a voip processor 111 . a voip processor 111 is a communication processor for audio codec and telephone management . the voip processor 111 may be a telogy tnetv1050 dsp . the voip processor may include a mips32 reduced instruction set computer processor and a c55 dsp . the risc processor software supplies overall system services and performs user interface , network management , protocol stack management , call processing and task scheduling functions . the dsp software provides real - time voice processing functions such as echo cancellation , compression , pulse - code modulation data processing and tone generation and detection . two 10 / 100 base - t ethernet mac and phy are included with integrated layer - 2 three - port ethernet switches . on - chip peripherals include an 8 × 8 keypad interface , usb controller host , universal asynchronous receiver / transmitter serial interface , a programmable serial port , several general - purpose input / outputs and integrated voltage regulator . the integrated dual channel 16 - bit voice coder / decoder integrates the critical functions needed for ip phone applications , including two analog - to - digital converters and two digital to analog converters . other features include analog and digital sidetone control , filter , programmable gain options , a programmable sampling rate , 8 - speaker driver , microphone , handset and headset interfaces . the voip processor 111 may include dual - ethemet mac and phy , 10 / 100 base transceivers . the voip processor 111 may include a speaker and microphone for handset , headset , and optional input and output sources . the voip processor 111 may include a pc and palm compatible irda transceiver , a rs - 232 serial port , a usb host port , general purpose i / o pins for led and configuration options . the voip processor 111 may include synchronous dram , 133 mhz up to 128 mb , a standard memory bus , a jtag port and hp logic analyzer connectors . those skilled in the art will recognize that other voip processors may be used as suitable . voip processor 111 may be connected to a voip memory 112 . voip memory 112 may be a flash memory , sdram or other suitable memory devices . the voip hardware 111 may be connected to a handset 104 or a cordless base 112 which provides wireless communication with a cordless handset 113 . the voip hardware 111 may be connected to manual input devices 102 , a microphone 124 , a speaker 123 . voip hardware 111 may be connected to an alpha - numeric keyboard 125 . gateway 110 may be connected to video processor 114 . the video processor 114 is a video codec and lcd panel controller . the voip processor 111 may be a ti tms320dm642 digital signal processor . the digital signal processor may be based on the second - generation high - performance advanced velociti very - long - word - instruction ( vliw ) architecture . the digital signal processor may provide 4800 million instructions per second at a clock rate of 600 mhz . the dsp offers operational flexibility of high speed controllers and the numerical capability of array processors . a dsp core processor has 64 general purpose registers of 32 - bit word length and eight independent functional units including two multipliers for 32 bit word length and six arithmetic logic units . the dsp provides extensions in the eight functional units including new instructions to accelerate performance in video and imaging applications to extend parallelism . the dsp can produce four 32 - bit multiply accumulates per cycle for a total of 2400 million macs per second or eight 8 - bit macs per cycle for a total of 4800 million macs . the dsp may have application specific hardware logic , on - chip memory and additional on - chip peripherals . the dsp typically uses a two - level cache - based architecture . a level i program cache is a 128 - kbit direct mapped cache and a level 1 data cache is a 128 - kbit 2 - way set - associative cache . a level 2 memory cache consists of a 2 - mbit - memory space that is shared between program and data space . level 2 memory can be configured as mapped memory . the peripheral set may include configurable video ports ; a 10 / 100 mb / s ethernet mac ; a management data input / output ; a vcxo interpolated control port ; a multichannel buffered audio serial port ; an inter - integrated circuit bus module ; two multichannel buffered serial ports ; three 32 - bit general purpose timers ; a user - configurable 16 - bit or 32 - bit host port interface ; a peripheral component interconnect ; a 16 - ping general - purpose input / output port with programmable interrupt / even generation modes ; and a 64 - bit glueless external memory interface which is capable of interfacing to synchronous and asynchronous memories and peripherals . the dsp may have three configurable video port peripherals . these video port peripherals provide a glueless interface to common video decoder and encoder devices . the dsp video port peripherals support multiple resolutions and video standards . the video ports peripherals are configurable and can support video capture and video display modes . each video port may include two channels with a 5120 byte capture / display buffer that is split - able between the two channels . the dsp may include three video ports including a capture port interfaced with a philips saa7115 decoder with integrated multiplexer for ntsc , s - video sources ; display port interfaced with philips saa7105 ntsc and s - video encoder and a third port dedicated to an lcd panel . the dsp may - include ethernet mac 10 / 100 base - transceivers . the dsp may include general purpose i / o pins and a jtag port . the dsp may be a synchronous dram 64 - bit wide , 133 mhz up to 1 gb support . the dsp may include a standard asynchronous memory bus 32 bit . the dsp may include bp logic analyzer connectors for memory bus address , data and control signals . those skilled in the art will recognize that other dsp processors may be implemented . the video processor 114 may be connected to a video memory 128 . video memory 128 may be - a flash memory , sdram or other suitable memory device . the video processor 114 may be connected to an video decoder 126 . video decoder 126 may be a ntsc decoder . video decoder 126 may receive video signals from an external source 127 or a video camera 115 . the video processor 114 may be connected to a video encoder 129 . the video encoder 129 may be an ntsc encoder . the video encoder 129 may be integral with a csc 133 to provide video signals to an rgb / lcd panel 132 . the video encoder 129 may provide video signals to an lcd panel 130 and a cv / s / rgb output . the gateway 110 , voip processor 111 and video processor 114 may be mutually connected to a cpld decoder 134 . the broadband information appliance 100 may include smart media access , an infrared transceiver , an unpowered firewire port , fast peripheral ports , a wireless interface , bluetooth support and a homeplug interface . the broadband information appliance 100 may be an ac powered device , using residential power distribution of 120 vac at 60 hz or 230 vac at 50 hz . a power adapter may conver the ac power to 12 volts dc . the broadband information appliance typically includes three memory module , particularly the gateway memory 118 , the voip memory 122 and the video memory 128 . sdram memory may be connected through each of the direct sdram interfaces in the dsp and gateway processors . sdram may be rated to operate at 133 mhz and terminated with discrete components . dedicated sdram for each processor may be used . with reference to fig4 , a system for providing promotional content to an anv telecommunication device 100 is shown . in this embodiment , a content provider generates media content including audio or video programming such as advertisements , informational or educational content , entertainment content , interactive communication content or other an content . in response to a consumer request from the an telecommunication device 100 or as determined by the host server 202 , the content provider 204 provides the media content to the an telecommunication device . it will be appreciated by those skilled in the art having the benefit of this disclosure that this invention provides a broadband information appliance . it should be understood that the drawings and detailed description herein are to be regarded in an illustrative rather than a restrictive manner , and are not intended to limit the invention to the particular forms and examples disclosed . on the contrary , the invention includes any further modifications , changes , rearrangements , substitutions , alternatives , design choices , and embodiments apparent to those of ordinary skill in the art ; without departing from the spirit and scope of this invention , as defined by the following claims . thus , it is intended that the following claims be interpreted to embrace all such further modifications , changes , rearrangements , substitutions , alternatives , design choices , and embodiments . | 7 |
the mold 1 of which an exploded perspective view is shown in fig1 comprises two shells 2 and 3 and an annular seal 4 provided with a removable plug 5 . the shells 2 and 3 are conventionally made from relatively thick glass with one concave face , one convex face and a circular contour edge . the active face 6 of the shell 2 , situated on the side facing the seal 4 , is concave and has a conformation corresponding to the anterior face of the lens to be obtained . the active face 7 of the shell 3 , also situated on the side facing the seal 4 , is convex and corresponds to the posterior face of the lens to be obtained . the seal 4 is molded from a synthetic elastomer material . it has a globally annular conformation with an external belt 8 to the inside of which is attached a bead 9 that is narrower than the belt 8 and has a dovetail - shaped cross section whose narrower side is that by which the bead is attached to the belt 8 . thus there exists on either side of the bead 9 a recess adapted to receive one of the shells 2 and 3 , the peripheral surface of this recess being the internal surface 10 of the belt 8 , whose diameter corresponds to that of the shells 2 and 3 , while the shoulder surface of the recess is the flank surface 11 of the bead 9 , which is inclined outward and toward the center of the seal . each edge 12 at the junction between a surface 11 and the inside peripheral surface 13 of the bead 9 thus forms the edge of a lip 14 adapted to cooperate sealing fashion with one of the shells 2 and 3 , as seen in fig7 and 8 . the external surface 15 of the seal 4 has a slight relief on either side of a central edge 16 that corresponds to the plane of the seal of the mold used to fabricate the seal 4 . as seen in fig4 to 6 , there projects from the lateral surface 15 a relatively narrow lug 17 that extends to only one side of the edge 16 , the lug 17 having a transverse end surface 18 in the same plane as the edge 16 . the angular offset between the lug 17 and the hole 19 that is plugged by the plug 5 is such that , when the hole 19 is at the top of the seal 4 , as shown in the drawings , the lug 17 is visible above the seal 14 . this is used to position the mold 1 and thus the hole 19 in the axial direction , as explained later . the hole 19 is oriented in a radial direction and is centered in the plane that contains the edge 16 , half way or substantially half way between the two opposite recesses each delimited by the surfaces 10 and 11 of the seal 4 that cooperate with the shells 2 and 3 . around the hole 19 the seal 4 has a boss 20 projecting relative to the surface 15 . between its two outlets , onto the external surface of the boss 20 and onto the internal surface 13 of the bead 9 , respectively , the hole 19 has three sections 21 , 22 and 23 with different diameters . the section 21 , which is the narrowest , extends between a first end , at the surface 13 , and a second end at which it is joined to a first end of the section 22 , which has a larger diameter than the section 21 ; a slight chamfer is formed at the junction between the sections 21 and 22 , the latter extending as far as a second end at which it is joined to the section 23 , which has a greater diameter , the section 23 extending as far as the upper surface of the boss 20 . thus the sections 21 , 22 and 23 of the hole 19 have a generally stepped arrangement . the plug 5 is made from the same material as the seal 4 . it has a head 24 and a body 25 . the diameter of the head 24 corresponds to the diameter of the section 23 , the diameter of the body 25 corresponds to the diameter of the section 21 , and the length of the body 25 corresponds to the sum of the lengths of the section 21 and the section 22 . accordingly , when the plug 5 is fitted into the hole 19 , as shown in fig3 in particular , the free end of the body 25 is flush with the surface 13 and the transverse surface of the head 24 flanking the body 25 bears on the shoulder surface of the section 23 . the fit between the section 21 and the body 25 is moderately tight so that when the body 25 is in place in the section 21 the latter is plugged and sealed . similarly , the fit between the head 24 and the section 23 is moderately tight , so that fitting of the head 24 into the section 23 plugs and seals the latter . in the example shown , the diameter of the section 21 is of the order of 7 . 8 mm , that of the section 22 is of the order of 16 . 6 mm , and that of the section 23 is of the order of 17 . 8 mm , the length of the section 21 is of the order of 3 mm , that of the section 22 is of the order 3 . 7 mm , and that of the section 23 is of the order of 2 . 4 mm . it will be noted when the plug 5 is in place in the hole 19 , there exists within the section 22 , around the body 25 , a sealed chamber 26 plugged on one side by the cooperation between the body 25 and the section 21 and on the other side by the cooperation between the head 24 and the section 23 . given the dimensions specified above , it should also be noted that the volume of the chamber 26 is greater than the volume of the section 21 . as shown in fig1 to 13 , which , like fig6 to 9 , are highly diagrammatic , unlike fig1 to 5 , the result of this is that if the molding cavity delimited by the shells 2 and 3 fitted into the seal 4 is filled until the polymerizable material reaches the junction between the sections 21 and 22 and the plug 5 is then fitted , the material contained in the section 21 may be accommodated in the chamber 26 and retained therein in a sealed manner when the plug 5 has been pushed all the way in , which prevents overflow of polymerizable material out of the mold . to obtain an optical lens using the mold 1 , the shells 2 and 3 are fitted into the seal 4 , as shown in fig7 in particular , after which the mold 1 obtained in this way is placed in the filling device 30 shown in fig6 , to be more precise in a receiving unit 31 of the mold of the device . to receive the mold 1 , the unit 31 comprises two fingers 32 and a fork 33 , all of which are oriented longitudinally . as seen in fig4 and 5 in particular , the mold 1 is disposed vertically in the unit 31 with the filling hole at the top of the seal 4 , the fingers 32 and the fork 33 being at angular positions substantially corresponding to 4 o &# 39 ; clock , 8 o &# 39 ; clock and 12 o &# 39 ; clock on a clock face . the seal 4 simply rests on the fingers 32 , which center the seal 4 with respect to the unit 31 , while the boss 20 is engaged in the fork 33 , which positions the seal 4 angularly relative to the unit 31 and in particular ensures that the hole 19 is at the top of the seal 4 . on each side of the location for the mold 1 the unit 31 comprises a respective sleeve 34 and 35 , seen in more detail in fig8 ( in which the fingers 32 and the fork 33 are not shown ). the sleeve 34 is fixed directly to the frame 36 of the unit 31 whereas a hydraulic actuator 37 is provided between the sleeve 35 and the frame 36 whose body is fixed to the frame 36 and whose piston rod is fixed to the sleeve 35 . the chambers of the actuator 37 are connected by respective pipes 38 and 39 to a control center 40 which conventionally comprises a hydraulic pump and distribution and regulation means . the unit 31 has a configuration for fitting and removing the mold 1 in which the piston rod 37 is retracted , i . e . a position in which the sleeve 35 is offset to the right relative to the position shown in fig8 . with the unit 31 in this configuration the mold 1 is put into position by sliding it along the fingers 32 until the shell 2 comes into contact with the sleeve 34 and engaging the boss 20 in the fork 33 . at the control center 40 , the operator then starts the automatic control means provided therein to deploy the piston rod 37 until the pressure in the pressurized chamber of the actuator , in this example the chamber on the right as seen in fig8 , reaches a predetermined pressure threshold , the control means provided in the control center 40 then holding the piston rod 37 in this position . during the deployment of the piston rod 37 , the sleeve 35 comes into contact with the shell 3 , after which further movement of the piston rod applies a force moving the shells 2 and 3 toward each other , the effect of which is that the seal 4 is compressed elastically in the axial direction , in particular at the location of the lips 14 , as may be seen by comparing fig7 and 8 . this compression of the seal 4 by an external mechanical force provides an excellent seal between the seal 4 and the shells 2 and 3 . in the example shown , the synthetic elastomer from which the seal 4 is made has , as measured by the test method nf t 46 - 002 , a modulus of elasticity at 100 % of the order of 0 . 8 to 1 . 3 mpa , a yield strength of the order of 3 to 7 mpa , and an elongation at the yield point of the order of 500 to 750 %; its shore a ( 30 s ) hardness , using the nf iso 868 test method , is of the order of 30 to 49 ; the diameter of the actuator 37 is 40 mm and the predetermined pressure threshold at which the control means in the control center 40 deploy the piston rod 37 is of the order of 0 . 3 mpa . the external mechanical force applied by the actuator 37 to the mold 1 via the sleeves 34 and 35 is therefore relatively high , of the order of 37 . 7 dan . it will be noted that the contact surface between the sleeve 34 and the shell 2 is opposite the contact surface between the annular lip 14 and the shell 2 and likewise the contact surface between the sleeve 35 and the shell 3 is opposite the contact surface between the annular lip 14 and the shell 3 , which minimizes the risk of deformation of the shells 2 and 3 . the structure and operation of the device 30 are described in more detail next . the device 30 comprises , in addition to the unit 31 , a station 41 for introducing polymerizable liquid material and a plugging station 42 . each of the stations 41 and 42 is mobile in the vertical direction and adapted to be driven upward and downward , as shown by the double - headed arrows 43 and 44 , whereas the receiving unit 31 is mobile in the horizontal direction and is adapted to be driven toward the right and toward the left , as shown by the double - headed arrow 45 . at each of the stations 41 and 42 there is a respective optical cell 46 and 47 for detecting the position of the mold 1 in the axial direction , each of the cells 46 and 47 comprising an emitter and a receiver of light beams such as the incident beam and reflected beams 47 ′ shown in part in fig5 . the incident beam 47 ′ is oriented vertically and when the mold 1 is under the cell emitting the beam , the latter is at the level of the surface 15 , and always at a distance from the latter less than the thickness of the lug 17 . when the mold is in a position such that the lug 17 is vertically in line with the incident beam 47 ′, the beam is reflected by the lug 17 and the cell that emitted the beam receives and detects a reflected beam . on the other hand , when the mold 1 is in a position in which the lug 17 is not vertically aligned with the incident beam 47 ′, no reflection of the beam occurs at the lug 17 , and there is therefore no reflected beam . it is therefore possible , based on the information as to whether the respective cells 46 and 47 receive a reflected beam or not , to position the mold 1 very accurately with the surface 18 of the lug 17 that is aligned with the emitted beam , i . e . the surface 18 situated in the plane in which the hole 19 is centered , in a position in which the hole is centered with respect to the polymerizable liquid material introduction station 41 and the plugging station 42 , respectively . the polymerizable liquid material introduction station 41 comprises two nozzles projecting downward , respectively a nozzle 48 for introducing the polymerizable material into the cavity of the mold 1 and a nozzle 49 for aspirating surplus material in the hole 19 . the nozzle 49 is in the transverse plane containing the beam emitted by the cell 46 and is centered with respect to the unit 31 . the plugging station 42 comprises a canula 50 for receiving the plug 5 projecting downward , situated in the transverse plane that contains the beam emitted by the cell 47 and centered with respect to the unit 31 . to cooperate with the canula 50 , the plug 5 comprises a blind hole 51 that is open at the end adjoining the head 24 and closed at the end adjoining the body 25 , the hole 51 having a diameter corresponding to the external diameter of the canula 50 , which is connected to a vacuum system and surrounded , at the end opposite its free end , by an abutment 52 forming a shoulder around the canula 50 . when the unit 31 is in its configuration for fitting and removing the mold 1 its axial position is such that the mold is vertically aligned with the plugging station 42 , as shown in fig6 . the operator places the mold 1 by hand onto the fingers 32 and the fork 33 , in the manner previously explained , and , for example using his other hand , threads the plug onto the canula 50 , the latter penetrating into the blind hole 51 until the face of the head 24 opposite the body 25 comes up against the abutment 52 , the plug being retained by aspiration by virtue of the fact that the canula 50 is at this time connected to a vacuum system . as previously explained , using the control center 40 , the operator commands the deployment of the piston rod 37 until an external force of predetermined intensity is exerted that moves the shells 2 and 3 toward each other . the unit 31 is then driven toward the polymerizable liquid material introduction station 41 , i . e . toward the left in fig6 , the drive means being controlled in conjunction with the cell 46 so that the mold 1 is positioned with the nozzle 49 centered relative to the hole 19 , in the manner explained above . the polymerizable liquid material introduction station 41 is then driven downward until the distal ends of the nozzles 48 and 49 are inside the hole 19 , as shown in fig9 . in the example shown , the distal end of the polymerizable material introduction nozzle 48 and the distal end of the surplus material aspiration nozzle 49 are in the section 22 of the hole 19 and in any event above and facing the section 21 , the distal end of the nozzle 49 being above that of the nozzle 48 . although the nozzle 49 is vertical , the nozzle 48 is slightly inclined so that the jet of polymerizable material that this nozzle emits is oriented obliquely to the section 21 , the jet in question passing across this section and then encountering the shell 3 , along which the polymerizable material flows as the cavity of the mold 1 is filled . it will be noted that , in practice , to enable the jet of material to cross the section 21 in the manner just indicated the nozzle 48 is less inclined than in the highly diagrammatic fig9 . the fact that the material introduced into the molding cavity runs along the wall of the shell 3 helps to produce a homogeneous lens and in particular avoids the formation of bubbles . introduction of the polymerizable material continues until the section 21 and a portion of the section 22 are filled with polymerizable material . given that the section 21 is at the top of the molding cavity , when this section is itself filled with polymerizable material it is certain that no air remains in the molding cavity . the nozzle 49 then aspirates the overflowing polymerizable material . its distal end is positioned relative to the top of the section 21 so that when aspiration ceases the level of polymerizable material is level with the top of the section 21 , as shown in fig1 . the height difference between the distal end of the nozzle 49 and the top of the section 21 corresponds to the height of the column of polymerizable liquid material that remains between the time at which the polymerizable material level falls below that of the distal end of the nozzle 49 and the time at which aspiration stops . it will be noted that the surface of the polymerizable liquid material is shown perfectly horizontal in the diagrams of fig1 and 11 , whereas in practice this surface is domed . once introduction of the polymerizable material has finished , i . e . when aspiration of the material by the nozzle 49 ceases , the station 41 is driven upward to return to its position as shown in fig6 , after which the receiving unit 31 of the mold 1 is driven horizontally toward the plugging station 42 until the hole 19 is positioned by the cell 47 and the lug 17 , in the manner previously explained , in a position in which the canula 50 , fitted with the plug 5 , is centered relative to the hole 19 . the station 42 is then driven downward , so that the plug 5 progressively penetrates into the hole 19 , as shown in fig1 to 13 . when the body 25 of the plug penetrates into the section 21 , the polymerizable liquid material that was contained in this section progressively passes into the chamber 26 in which , as explained above , it is trapped in a sealed manner because of the plugging of the section 21 by the body 25 of the plug and the plugging of the section 23 by the head 24 . it will be noted that expelling the polymerizable liquid material that was contained in the section 21 toward the chamber 26 , i . e . away from the molding cavity , makes certain that no air is introduced into the molding cavity on the occasion of fitting the plug . while the body 25 is being pressed into the section 21 , the small section of the polymerizable liquid material between the body 25 and the perimeter of the section 21 causes a certain pressure rise in the molding cavity , but this dynamic pressure rise does not cause any leaks between the seal 4 and the shells 2 and 3 because of the external force applied by the sleeves 34 and 35 , which external force has been maintained throughout the filling step , as shown by arrows in fig9 to 13 . once the fitting of the plug 5 into the hole 19 has finished , i . e . once the station 42 is at the end of its downward travel , the connection between the canula 50 and the vacuum system is broken and the canula 50 is vented to the atmosphere , or even subjected to a slightly increased pressure , which releases the plug 5 from the station 42 , which is then returned to its uppermost position shown in fig6 . using the control center 40 , the operator then causes the hydraulic fluid to flow in the pipes 38 and 39 in the direction that retracts the piston rod 37 into the body of the actuator , to retract the sleeve 35 , i . e . to move it toward the right in fig8 . the releasing of the external force moving the shells 2 and 3 toward each other that occurs at the start of the retraction of the sleeve 35 has no effect on the positions of the shells 2 and 3 relative to the seal 4 , each of the shells 2 and 3 being held in place by a suction effect . the mold 1 , filled with polymerizable material , therefore remains in the assembled configuration of its own accord , as shown in fig1 . the operator then removes the filled mold 1 from the unit 31 , or more generally from the device 30 , and it is then transported to a water bath in which it remains for the time required to polymerize the material in the molding cavity . once polymerization has been completed , the lens is removed from the mold by removing the seal 4 and then the shells 2 and 3 . it will be noted that the lack of leaks between the shells 2 and 3 and the lips 14 means that there is no polymerized material between the surfaces 10 and 11 of the seal 4 and no intervention is required on the lens after removal from the mold to eliminate flash , and this also facilitates cleaning the seal to eliminate polymerized material before recycling . in fact , the only portion of the seal 4 in which polymerized material remains is the chamber 26 , which is a very localized area that is relatively easy to deal with . in a variant , not shown , only the cell 46 is provided : the position of the mold 1 in vertical alignment with the station 42 before the plugging operation is obtained by moving the unit 31 from the position in which the mold 1 is vertically aligned with the station 41 by the exact distance between the stations 41 and 42 , using a stepper motor . in this variant , the mold 1 is placed on the unit 31 in a position between the positions in which the unit 31 is respectively vertically aligned with the station 41 and vertically aligned with the station 42 : this provides the operator with more space for threading the plug 5 onto the canula 50 . in the example shown , the cells 46 and 47 are above the station 41 and the station 42 , respectively , but they may be located at any other location from where the lug 17 is visible . in other variants , not shown , the filling hole comprises only the sections 21 and 22 , the head of the plug bearing directly on the outside lateral surface of the seal ; there is no hole in the seal away from the means for cooperating with the molding shells , such as the shoulder delimited by the surfaces 10 and 11 , the double - acting hydraulic actuator 37 is replaced by some other type of actuator , for example a single - acting pneumatic actuator , and / or , more generally , a type of mechanism other than that shown in fig8 is provided for producing an external mechanical force for moving the shells toward each other , this mechanism possibly being hand operated , like a vice or a chuck . numerous variants are also possible in respect of the dimensions and the mechanical characteristics of the components shown . more generally , it is pointed out that the invention is not limited to the examples described and shown . | 8 |
while the present teachings are described in conjunction with various embodiments and examples , it is not intended that the present teachings be limited to such embodiments . on the contrary , the present teachings encompass various alternatives , modifications and equivalents , as will be appreciated by those of skill in the art . referring now to fig1 , an optical beam 12 having a spatial intensity distribution 11 impinges on a conventional flat mems mirror 10 having a substrate 18 supporting a reflective coating 13 . the optical beam 12 reflects from the reflective coating 13 , as shown at 14 . the mems mirror 10 has a torsional hinge 15 for tilting the mems mirror 10 as shown by arrows 16 , thus steering the reflected optical beam 14 . the mems mirror 10 has a uniform thickness . the reflective coating 13 of the mems mirror 10 typically has a non - zero curvature due to residual stresses , or thermally induced stresses in the reflective coating 13 due to thermal mismatch with the substrate 18 . when the mems mirror 10 is used in an optical switch , the curvature of the reflective coating 13 of the mems mirror 10 has an adverse effect on the optical insertion loss and the extinction ratio of the optical switch . the magnitude of these adverse effects is approximately proportional to the fourth power of the mirror size or optical beam size . high port count wavelength selective switch ( wss ) devices require relatively large optical beams . thus , the flatness of the mems mirror 10 is of a considerable concern , especially for high port count wss devices . as noted above , one traditional solution to ensuring flatness of the mems mirror 10 is to increase the thickness of the substrate 18 . however , increased thickness of the substrate 18 worsens dynamic performance of the mems mirror 10 . due to a requirement for the mems mirror 10 to withstand shock and vibration , the mems mirror 10 should have a resonance frequency of rotational oscillations above a certain threshold . the resonance frequency is proportional to a ratio of the spring constant of the torsional hinge 15 to the moment of inertia of the mems mirror 10 , which depends on the thickness of the substrate 18 . the spring constant of the torsional hinge 15 is limited by a maximum torque created by an actuator , not shown , which depends on a maximum voltage applied to the actuator . therefore , the moment of inertia and the maximum thickness of the substrate 18 are limited in case of the mems mirror 10 by the maximum driving voltage available , and by the resonance frequency requirement . the present invention overcomes this limitation by providing a mems mirror having a laterally varying thickness , which preferably matches laterally varying optical beam intensity . referring now to fig2 , a mems mirror 20 has a top reflective surface 23 and a bottom surface 29 . the bottom surface 29 is profiled ( non - flat ), so that the mems mirror 20 has a laterally varying thickness . to simplify the mirror structure , no voids or ribs are present in the mems mirror 20 . the mems mirror 20 has a hinge 25 defining a tilt axis 25 ′ of the mems mirror 20 for tilting as shown with arrows 26 . a longitudinal axis 21 is perpendicular to the tilt axis 25 ′ and is crossing the tilt axis 25 ′ at a point 1 . the thickness of the mems mirror 20 decreases in going from the point 1 towards ends 2 and 3 of the mems mirror 20 . the ends 2 and 3 are disposed on the longitudinal axis 21 . as noted above , thinning down the mems mirror 20 at its ends 2 and 3 , where the optical beam intensity is reduced , facilitates reducing the moment of inertia without a significant reduction of the quality of the reflected optical beam 14 . preferably , the lateral profile of the thickness variation of the mems mirror 20 correlates with the optical intensity profile 11 of the incoming optical beam 12 . in this way , the moment of inertia of the mems mirror 20 can be lessened while keeping a pre - defined quality of the reflected optical beam 14 . note that the moment of inertia is proportional to square of a distance to the pivot axis ; therefore the moment of inertia can be reduced dramatically by having less mass farther from the pivot , as is the case in the present invention . the mems mirror 20 is the thickest at the point 1 , where the intensity profile 11 of the impinging optical beam 12 is at maximum . at or near the point 1 , the undesired curvature of the reflective layer 23 of the mems mirror 20 is at minimum , which lessens the optical losses upon subsequent fiber coupling , and also improves switching ratio ( extinction ratio ) of a mems optical switch the mems mirror 20 is used in . preferably , the thickness profile t ( x , y ) of the mems mirror 20 varies as wherein i ( x , y ) is the intensity profile 11 of the impinging optical beam 12 , the plane ( x , y ) is a plane of the reflective layer 23 , n & gt ;= 0 . 5 , and c is a constant . it follows from eq . ( 1 ) that when the function i ( x , y ) is exponential , as is commonly the case , the function t ( x , y ) is also exponential . the thickness of the mems mirror 20 decreases smoothly and monotonically in going from the point 1 toward the ends 2 and 3 . however , it may be difficult to realize such a smoothly varying thickness profile using existing mems fabrication methods . other , simpler forms of the thickness profile can be more practical . referring now to fig3 , a bottom surface 39 of a mems mirror 30 is profiled so that the mems mirror 30 has a linearly varying thickness profile . this thickness profile is an approximation of a “ desired ” gaussian thickness profile , corresponding to the bottom surface 29 shown in fig3 in a dashed line for comparison purposes . the linearly varying thickness profile due to the bottom surface 39 can be obtained using a linearly graded etching mask . another practical form of a thickness profile is a stepped profile . turning to fig4 , a mems mirror 40 has a bottom surface 49 having a stepped profile . the total number of steps is four , two for each end of the mems mirror 40 . this “ stepped ” profile is also an approximation of the “ desired ” gaussian thickness profile 29 shown in fig4 in a dashed line . more steps can be used if desired , for a better approximation of the gaussian profile 29 . the step location is preferably correlated with a location where a local beam intensity decreases to a pre - determined percentage of a peak beam intensity . referring now to fig5 , a mems mirror 50 has a bottom surface 59 having only one step . one advantage of the mems mirror 50 is manufacturability . only two masks are required to manufacture a step in the mems mirror 50 . by way of example , the silicon mems mirror 50 having a length of 1300 um , thickness of 30 um in the middle and 15 um at the ends , a step location half - way to the mirror center , that is 750 um from each edge , has an optical performance comparable to that of the mirror 10 of fig1 of the same length and uniform thickness of 30 um , while having only 33 % of the moment of inertia of the mems mirror 10 of fig1 . when a “ polarization diversity ” arrangement is used in an optical switch to achieve a polarization independent functionality , two beams of light , corresponding to two orthogonal polarization components of the original optical beam , co - propagate in an optical switch . to ensure low polarization sensitivity , a mems mirror must be able to steer the two beams in a nearly identical fashion . turning to fig6 , a mems mirror 60 is shown having two rigidly connected halves 68 a and 68 b and a torsional hinge structure 65 for tilting the mems mirror 60 about a tilt axis 65 ′. the two halves 68 a and 68 b are coated with a reflective coating 63 . in operation , two optical beams 62 a and 62 b , having intensity profiles 61 a and 61 b , impinge on the reflective coating of the two halves 68 a and 68 b , forming reflected optical beams 64 a and 64 b , respectively . although in this case the mirror thickness of the mirror halves 68 a and 68 b does not correspond directly to the local intensity of the impinging optical beams 64 and 65 , nonetheless , spatially varying the thickness of the mems mirror 60 also helps reduce the mirror &# 39 ; s moment of inertia . furthermore , it is possible to customize the mirror 60 for the two - beam application ( that is , for steering the two beams 62 a and 62 b ) by thinning down sections 67 a and 67 b of the two halves 68 a and 68 b , respectively , because the sections 67 a and 67 b correspond to low power density of the optical beams 62 a and 62 b . turning now to fig7 , a mems mirror 70 having a “ hidden - hinge ” configuration is shown . in the mems mirror 70 , the hinge structure 65 is “ hidden ” beneath a mirror layer 77 disposed over the mirror halves 68 a and 68 b . in this case , the thickness of the mems mirror 70 can also be correlated to an intensity profile 71 of an impinging optical beam 72 , so that optical quality of a reflected optical beam 74 can be preserved . referring to fig8 a and 8b , a mems mirror 80 has a tilt axis 85 ′, a longitudinal , e . g . central , axis 81 perpendicular to the tilt axis 85 ′ and crossing the tilt axis 85 ′ at the point 1 . the mems mirror 80 has the two ends 2 and 3 disposed on the longitudinal axis 81 , and two more ends 4 and 5 disposed on the tilt axis 85 ′. the thickness of the mems mirror 80 decreases in going from the point 1 towards the points 2 and 3 ; and towards the points 4 and 5 . in the mems mirror 80 , the thickness decreases in stepwise fashion . the location and the magnitude of steps are correlated with the intensity distribution of an impinging optical beam , not shown in fig8 a and 8b . the steps are formed by three rectangular layers 87 , 88 , and 89 , and a pair of torsional hinges 85 for tilting the mems mirror 80 about the tilt axis 85 ′. a reflective layer 83 is disposed on the top rectangular layer 87 . preferably , the torsional hinges 85 are associated with the thinnest top layer 87 . the stepped mems mirror 80 can be formed using etching through a succession of generally rectangular etch masks ; the mask for the layer 87 can include hinge structures . during etching the layer 87 , the torsional hinges 85 can also be formed . instead of stepped shape as shown in fig8 a and 8b , the mems mirror 80 can have a shape of a cone or a pyramid , or a stepped cone or a pyramid . referring to fig9 a and 9b , the pyramid - shaped and cone - shaped mems mirrors 90 a and 90 b are shown , respectively . in fig1 a and 10b , truncated ( frusto - conical ) pyramid - shaped and cone - shaped mems mirrors 90 a and 90 b are presented , respectively . in the mems mirrors 90 a and 90 b , the thickness decreases in going from a centrally located generally flat section 102 a and 102 b , respectively , to the ends of the mems mirror . in fig9 a , 9 b , 10 a , and 10 b , the vertical scale is exaggerated for clarity of presentation . the mems mirrors 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 a , 90 b , 100 a , and 100 b can be manufactured using micromachining methods known to one of skill in the art . generally , at a first step , a continuous mirror wafer , having no voids or ribs therein , is provided . at a second step , the bottom surface is profiled , so as to have its thickness decrease in going from the middle of the mirror towards its edges . the bottom surface profiling is preferably achieved by etching . a graded etch mask can be used to manufacture the mems mirrors 20 , 30 , 90 a , 90 b , 100 a , and 100 b ; or a plurality of uniform etch masks can be used to manufacture the mems mirrors 40 , 50 , 60 , 70 , and 80 . the thickness of the mems mirrors 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 a , 90 b , 100 a , and 100 b is preferably correlated with the beam intensity variation , so that the moment of inertia of the manufactured mems mirrors can be lessened while keeping a pre - defined quality of the optical beam , which is important in ensuring a good extinction ratio and insertion loss of the mems optical switch the mems mirrors 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 a , 90 b , 100 a , or 100 b are used in . for the stepped mems mirrors 40 , 50 , 60 , 70 , and 80 , height and position of the steps are correlated with the beam intensity variation to achieve the effect of reducing moment of inertia of the mems mirrors 40 , 50 , 60 , 70 , and 80 , while keeping a pre - defined optical quality of the reflected optical beam . the reduced moment of inertia helps increase a frequency of a mechanical resonance of the mems mirrors 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 a , 90 b , 100 a , and 100 b . the foregoing description of one or more embodiments of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto . | 6 |
fig2 illustrates the slip area of a downhole tool which in the preferred embodiments shown in fig5 - 7 is a packer . fig2 illustrates the mandrel 18 which can also be seen in fig5 b . the exploded view of fig2 aids in understanding of how the assembly is put together and further aids in understanding of its operation . the cage 20 has a closed end 22 from which extend a series of longitudinal members 24 defining openings or windows 25 . at their lower end 26 , each of the longitudinal members 24 are threaded so as to accept a ring 28 in order to complete the assembly . other mechanisms for attaching the ring 28 to the longitudinal members 24 are within the purview of the invention . to begin the assembly , cone 30 is initially inserted through lower end so that the shoulder 32 is retained by member 34 which forms a part of the closed end 22 . as shown in fig2 there are four discrete ramps 36 , each having an outer dimension 38 with shoulder 32 defined adjacent thereto . the outer dimension 38 of the cone 30 is , at most , equal to , but can be smaller than , the outer dimension of the members 34 which define the closed end 22 of the cage 20 . with cone 30 inserted through the open end of cage 20 until shoulders 32 connect with members 34 , the slips 48 are pushed into place and the mandrel 18 can now be installed through cones 30 and 40 which are already in place with respect to cage 20 . cone 40 , which is preferably identical to cone 30 but in opposed orientation , slides over the mandrel 18 past lower end 26 . again , the tapers 42 extend in the gap between the longitudinal members 24 as shown in fig3 . the outer dimension 44 of the cone 40 is equal to the outer dimension of the members 24 . fig3 shows more clearly the extent of the outer dimension of cone 30 as being eqidistant with the outer surface 46 of the members 24 which define the cage 20 . it could be shorter if desired . once cone 40 is installed over mandrel 18 , ring 28 is threaded through lower end 26 and the assembly is complete as shown as fig3 . as part of the assembly after installation of cone 30 , the slips 48 ( there being four shown in fig2 ) are installed into the cage 20 prior to insertion of the mandrel 18 . in the preferred embodiment , the slips 48 are all identical and , therefore , only one will be described with the understanding that the description is equally applicable to the remaining slips . however , it should be noted that it is within the purview of the invention to use slips of differing design and that only the preferred embodiment is intended to include identical slips laid out at 90 ° spacing about the longitudinal axis of the tool with opposed wickers . the slip 48 has opposed wickers 50 and 52 extending from opposed t - shaped bodies 54 and 56 , respectively . a recess 58 is located on each side of each of the members 24 such that the extending tab sections 60 and 62 extend into recess 58 symmetrically on both sides of bodies 54 and 56 . the recesses 58 clearly do not retain the bodies 54 and 56 against outward movement . instead , the function of recesses 58 is in the retrieval of the downhole tool for effecting release of the slips 20 . in essence , tabbed section 62 defines a pickup shoulder 64 which is engaged by a shoulder 66 ( formed as part of recess 58 ) for release of the slips 20 , as will be described below . referring again to fig2 the members 24 each have an undercut 68 extending from opposed edges thereof . &# 34 ; undercut &# 34 ; is a term meant to include open slots as shown or closed slots such as a grove disposed completely in the middle of the edge of members 24 . this undercut engages a pair of opposed tabs 70 and this is the mechanism which limits the radial outward travel of the slips 48 as the tabs 70 come into contact with the end of the undercut 68 . the assembled view of fig3 does not show the tabs 70 and undercut 68 but they can be more readily seen in fig2 . thus , after cone 30 is inserted through the open end of cage 20 and all the slips 48 are inserted such that their tabs 70 are in undercut 68 and tabbed section 60 and 62 are within recess 58 , the mandrel 18 is pushed through the cone 30 as the cone 40 is installed over the mandrel and the entire assembly is secured by ring 28 . the slips 48 are biased radially inwardly by band springs 72 which are more clearly shown in fig4 . it should be noted that the band springs have been deliberately omitted from fig2 and 3 for clarity of the drawings but are shown in the section view of fig4 . the band springs 72 span over a slip 48 generally in the area of recess 74 shown in fig3 . the springs 72 extend below the members 24 through apertures 76 which even at full extension of the slips 48 still leaves clearance so that the spring 72 is not cut as the slips 48 are forced out by the cones 30 and 40 . the operation of the caged slip assembly as depicted in fig2 and 3 is also shown in section in fig5 and 7 . fig5 is the run - in position which shows the slips 48 in a retracted position so that the wickers 50 do not extend beyond the outer dimension 46 of the cage 20 . fig6 b illustrates the slips 48 in the extended position which is also shown in the perspective view of fig3 . both cones move with respect to the slips . in order to accomplish this , in the known manner , by differential movement , the cone 40 is held stationary while the cone 30 is advanced toward it . this results in ramp 36 pushing out the slips 48 against tapers 42 of cone 40 . as a result , the slips 48 move radially outwardly until they engage the casing ( not shown ) or until the tabs 70 engage their travel limits within undercut 68 . the released position is shown in fig7 ( b ). this is accomplished by an upward force directed to cone 30 which forces shoulder 32 against member 34 . the upward force applied to cone 30 pulls the tapered surface 36 out from under the slips 48 plus engages shoulder 32 to the cage 20 to impart an upward force on the cage 20 . this in turn is transmitted to the slip assembly by virtue of shoulder 66 contacting pickup shoulder 64 , which in turn pulls the slips 48 away from tapered surfaces 42 of cone 40 . those skilled in the art will appreciate the advantageous features of the disclosed design . the cones 30 and 40 have tapers 36 and 42 which extend to outer dimensions such as 38 which are at least equal to the outer dimension 46 of the cage 20 . what this means is that the ramp surfaces 36 and 42 can bear over a greater area on the slips 48 and the amount of bearing area is not limited as in the prior art where the cone assembly in its entirety , including the ramp surfaces , was behind the openings 14 of the longitudinal members 12 which define the cage as shown in the prior art fig1 . additionally , the use of the tabs 70 regulates the radial outward movement of the slips 48 in case they are extended to their maximum limit without encountering a segment of the casing . with the design shown in fig2 and 3 , the thickness of members 24 can vary to allow the appropriate structural strength to the cage assembly 20 . however , varying the thickness of members 24 does not limit the outer travel available to the slips 48 . the definition of the outer travel of the slips 48 is given by the depth and / or location of the undercut 68 and the position of the tabs 70 on the slips 48 in relation with the wickers 50 . since the members 24 already have larger recesses such as 58 to accommodate the slips 48 , the undercut 68 can be varied so that a relatively thick cross - section of the members 24 can be employed while in discrete small areas an undercut 68 can be provided to allow significant radial movement of the slips 48 . this versatility allows a single tool to be used in situations involving casings of different wall thicknesses as opposed to having on tap a variety of tools to be used depending on the particular casing size in which the slips 48 are to be set . finally , the full advantages of protecting the slips 48 used in a caged design is retained while these other additional advantages are obtained . to further protect the slips 48 during run - in , the springs 72 hold them in a retracted position between the members 24 . thus , with the cones in effect being disposed in the windows defined between members 24 , a greater load capacity of the slips 48 is achieved as the compact area on the slips 48 is increased . the cage 20 also serves as a transmission conduit for a pickup force which pulls the slips 48 off of tapers 42 on cone 40 . the foregoing disclosure and description of the invention are illustrative and explanatory thereof , and various changes in the size , shape and materials , as well as in the details of the illustrated construction , may be made without departing from the spirit of the invention . | 4 |
as shown in the isometric view of fig1 the practice and training device of the instant invention comprises a plurality of attachment devices 1 configured for attaching the top ends of a backstop 3 to a ceiling or similar structure . attachment devices 1 are preferably formed of metal or other high strength material , and are connectable to the ceiling of a room or similar structure 17 by helical screw friction , expansion connectors , or high strength straps . adjustable shock absorbing connectors 2 connect the backstop 3 to attachment devices 1 . connectors 2 can be adjusted from approximately 50 mm to 2 meters in length , and are made of elastic material similar to rubber or expandable woven fabric . the backstop 3 is typically made of thin flexible cloth material , mesh netting , or any other material that is flexible , that can have alignment marks applied to it , and that can withstand repeated impacts of the golf ball 16 . the backstop is preferably provided with overall dimensions of approximately 180 mm wide by 240 mm high , and the top and bottom corners of the backstop 3 form angles with the horizontal of approximately 85 and 75 degrees , respectively . backstop 3 is provided with alignment marks permanently marked or sewn onto backstop 3 such as with thread , die , ink , paint , epoxy or other suitable marking product . a vertical alignment mark 4 is located on the longitudinal centerline of the backstop 3 and is approximately 220 mm long and 1 . 5 mm wide . approximately seven large graduated horizontal alignment marks 6 are each located along backstop 3 at approximately 24 mm increments from the bottom to the top of backstop 3 . horizontal alignment marks 6 define consecutive angular trajectories at 10 degree angles 21 from the forward straight alignment mark 8 of base 15 , with their origins at the point of contact between the golf ball 18 and the base 15 . a small graduated horizontal alignment mark 7 is located halfway between each pair of spaced graduated horizontal alignment marks 6 . the large 6 and small 7 graduated horizontal alignment marks are 60 mm × 1 . 5 mm and 30 mm × 0 . 75 mm , respectively . one additional small graduated horizontal alignment mark 5 is provided , and this is a differentiating horizontal alignment mark . to reach above the differentiating mark 5 typically requires a pitch shot , and below is a chip shot . preferably , a simulated hole 22 is marked on the backstop 3 where it rests on the base 15 . simulated hole 22 is centered on the vertical alignment mark 4 . also provided is a horizontal base 15 attached to backstop 3 via shock absorbing attachment devices 14 . base 15 is provided with base alignment markings 8 , 9 , 10 , 11 , 12 , and 13 . the base 15 has overall dimensions of roughly 180 mm × 213 mm , is approximately 2 mm thick , and consists of tightly woven carpet formed from vertical and horizontal mesh . however , the base can be larger , consist of any material that can withstand repeated impacts of a golf club 23 , and can support a golf ball 18 in similar manner as natural ground coverings such as grass , dirt , rocks , or sand . base 15 is provided with alignment marks 8 , 9 , 10 , 11 , and 12 , and a golf ball strike box 13 ( a . k . a . “ strike zone ”), permanently marked on the base 15 with any marking material such as thread , die , ink , paint , epoxy , or similar marking materials . strike box 13 is rectangular in shape , approximately 30 mm × 10 mm , and located longitudinally 50 mm from the rear end of the base 17 . the lines forming the strike box 13 are approximately 1 . 5 mm wide . the forward straight alignment mark 8 is approximately 110 mm long and 1 . 5 mm wide and is marked on the base 15 in a straight line from the forward side of the golf ball strike box 13 to the forward end of the base 15 along the longitudinal centerline of the base 15 . the backswing straight alignment mark 9 is approximately 50 mm × 10 mm and marked on the base 15 in a straight line from the rear side of the base golf ball strike box 13 to the rear end of the base 15 along the longitudinal centerline of the base 15 . four angled alignment marks 10 are 55 mm × 0 . 75 mm and marked on the base 15 at five degree angles to the forward straight alignment mark 8 and the backswing straight alignment mark 9 with the strike box 13 and the forward two corners of the strike box 13 . the rear latitudinal line of the strike box 13 is 60 mm × 1 . 5 mm forming the golf club edge alignment mark 11 . six distance alignment marks 12 approximately 30 mm × 0 . 75 mm centered on the forward 8 and backswing 9 straight alignment marks and parallel to the golf club edge alignment mark 11 are located 15 mm , 30 mm , and 45 mm in front of and behind the golf club edge alignment mark 11 , respectively . the practice device of the instant invention is easily assembled with conventional hand tools , such as a hammer , a screw driver , and a drill by securing the ceiling or structure attachment devices 1 to a ceiling or structure 17 . the adjustable shock absorbing devices 2 are connected to the attachment devices 1 and the backstop 3 . the base 15 is placed on the ground or floor 18 and the backstop 3 is connected to the base 15 by the base shock absorbing attachment devices 14 . the user adjusts the adjustable shock absorbing devices 2 so that the backstop 3 is aligned with the base 15 based on the height of the ceiling or structure 1 and the invention is then ready for use . a golfer uses the throw , swing , chip , pitch and putt exercise and training device of the instant invention by placing a golf ball 18 inside and at the rear end of the golf ball strike box 13 , standing on the base 15 , aligning parts of their bodies with the backstop 15 and base alignment marks 4 , 8 , 9 , 10 , 11 , and 13 as shown in fig3 aligning the edge of the golf club head 24 with is the golf club edge alignment mark 11 , executing the swing , chip , pitch and putt and observing the affects of their swing , chip , pitch and putt . the user initiates a swing , chip , pitch and putt by moving the golf club head 21 along the backswing straight alignment mark 9 . as the user moves the golf club 21 backwards , he or she sees whether the club 21 moves in or deviates from a straight path by observing any part of the backswing straight alignment mark 9 around the club head . the backswing straight alignment mark 9 is approximately as wide as the club head 24 is long . the appearance of any part of the backswing straight alignment mark 9 around the head 24 as the club 21 moves down the mark 9 indicates a deviation of the club 21 from a straight path during the backswing . the golf ball strike box 13 and the straight and angled alignment marks on the base 8 , 9 , 10 , and 11 cause the user to focus his or her eyes on the golf ball 16 during the execution of the swing , chip , pitch and putt and prior to contact between the golf club head 24 and the golf ball 16 . at impact between the club head 24 and the ball 16 , the user determines if he or she caused the head 24 to strike the ball 16 properly by observing the relationship between the head 24 and the strike box 13 . the user causes improper contact if he or she observes the head 24 passing over the longitudinal lines of the box 13 . immediately after impact between the golf club 21 and the golf ball 16 , the user aligns the movement of the golf club 21 with the forward straight alignment mark 8 and observes the affects of the swing , chip , pitch and putt when the golf ball 16 strikes the backstop 3 . the user observes the backstop 3 , alignment marks 4 , 5 , 6 , and 7 , and golf ball 16 to determine the results of his or her swing , chip , pitch and putt . for example , a golf ball 16 spins as it leaves the face of a golf club 21 . thus , the ball 16 may impact the backstop 3 either to the right , left , or center of the vertical alignment mark 4 . the ball moves to the right or left or stays in the center of the backstop 3 at impact due to its spin . the ball 16 also strikes the backstop 3 at a specific elevation . the horizontal alignment marks help the user determine the angle in which the ball 16 traveled to the backstop 3 . the location of the impact of the ball 16 and the movement of the ball 16 at impact indicates how the user hits the ball 16 with the golf club 21 . because each golfer produces different ball take - off angles than other golfers for the same club , each golfer must establish his or her own optimum angle to achieve a given distance for a particular club 23 . the user may use the practice device of the instant invention to develop a consistent straight shot for a variety of take - off angles , and adjust his or her actual swing during play for the take - off angle that will provide the desired distance of the shot . the adjustable shock absorbing devices 2 and the base shock absorbing attachment devices 14 absorb the impact of the golf ball 16 on the backstop 3 and prevent the golf ball 16 from rebounding . the sloping arrangement of the backstop 3 causes the golf ball 16 to return to the base after it comes in contact with the backstop 3 . the user 22 recovers the golf ball 16 at the bottom and prepares for the next swing , chip , pitch and putt . various modifications of the invention are possible due to the many ways in which golfers swing , chip , pitch and putt objects , the numerous materials that are available in the marketplace to manufacture the device , the variety of alignment marks that can be used , the variety of arrangements of the alignment marks that can be used , and the different techniques golfers use when they swing , chip , pitch and putt . having now fully set forth the preferred embodiments and certain modifications of the concept underlying the present invention , various other embodiments as well as certain variations and modifications of the embodiments herein shown and described will obviously occur to those skilled in the art upon becoming familiar with said underlying concept . it is to be understood , therefore , that the invention may be practiced otherwise than as specifically set forth herein . for example , the versatility of the practice device of the instant invention enables it to be extremely flexible and configured into a large number of uses in which a user seeks to practice swinging , chipping , or pitching movements of any objects . for example , the user may use the device to hit , swing , chip , pitch and putt objects such as baseballs with baseball bats , tennis balls with tennis racquets , racquetballs with racquetball racquets , hockey pucks with hockey sticks , and golf balls with golf clubs . thus , a baseball batter , a tennis player , or a racquetball player can use the device to exercise and train themselves in the use of the sporting equipment used in their sport . variations of the same golf swing , chip , pitch and putt exercise and training device of the instant invention can thus easily be adapted for other applications . | 0 |
referring now to the drawing , in which like numerals refer to like parts throughout the several views , fig1 shows a needle removal apparatus 10 embodying the invention . the needle removal apparatus 10 is normally mounted in the mouth of a container 12 , shown in dotted lines in fig1 and protected by a cover 13 , shown in fig4 and 22 . the container 12 may be a glass or plastic jar , for example . a syringe assembly 14 is shown in a position prior to insertion in the needle removal apparatus 10 , and includes a needle 15 and a needle retainer portion 16 . when the assembly 14 is inserted in the direction of the arrow , the parts of the needle removal apparatus described below automatically disconnect the needle 15 from the retainer 16 . referring to fig1 and 2 , the apparatus 10 includes an actuator housing 20 , which is a cylinder open at both ends . its top end is surrounded by an annular flange 21 which extends radially outwardly from the cylindrical wall . the housing 20 defines three vertical slots 22 which intersect the flange 21 and extend down to a point spaced above the bottom of the housing 20 . the interior of the cylindrical wall defines three arcuate grooves 25 extending at an angle , preferably 40 - 60 degrees from the horizontal , from just under the flange 21 to the bottom of the housing 20 . these grooves 25 form cam tracks or female screw threads to cause rotary motion , as described below . fitted for vertical motion within the actuator housing 20 is a carriage 28 , which is formed having a horizontal annular plate 29 . as shown in fig2 three tabs 30 extend outwardly from the circumference of the annular plate 29 and enter the slots 22 of the actuator housing 20 . the tabs 30 thus prevent the carriage 28 from rotating , but allow vertical movement . slightly below the plane of the plate 29 , a recessed annular shoulder 32 is formed around an insert opening 33 , into which the needle 15 is placed . an annular portion 19 , shown in fig4 surrounding the opening 33 is provided in the cover 13 to help guide needles to the opening . a pair gear shafts 34 and 35 extend vertically downward on opposite sides of the insert opening 33 . the shafts terminate in lock posts 37 and 38 , which are somewhat smaller in diameter than the shafts 34 and 35 . the carriage 28 also defines three spring stop tabs 40 which project downwardly near the periphery of the annular plate 29 . the tabs 40 are spaced evenly around the plate 29 . several other elements shown in fig3 are connected to the carriage 28 and move with it within the actuator housing 20 . a drive gear 45 , also illustrated in fig6 having a circular cross section fits around the gear shafts 34 and 35 and has a diameter slightly smaller than the inside diameter of the actuator housing 20 , as shown in fig4 . the drive gear 45 defines an inner circular gear 47 adjacent the bottom surface 46 of the drive gear 45 . a central bore 48 of diameter less than that of the circular teeth 47 is formed axially through the gear 45 . in the annular space remaining , three arcuate spring tracks 50 are cut into the top surface 49 of the drive gear 45 . these tracks 50 have a semicircular bottom profile which matingly receives the ends of the spring stop tabs 40 extending downwardly from the carriage 28 . narrow walls 51 formed between the spring tracks 50 act as spring compression actuators in the manner described below . coil springs 57 are placed within the tracks 50 between one of the walls 51 and one of the stop tabs 40 , as shown in fig5 . three balls 58 of plastic , teflon , stainless steel , or other material are also placed in each track 50 on the other side of each tab 40 from the spring 57 . the purpose of the balls is to provide spacing and reduce friction between the drive gear 45 and the carriage 28 . those skilled in the art will understand that rounded nibs or projections extending from either element could provide these functions . after the drive gear and springs are fitted under the carriage 28 , a pair of needle disconnect or unscrewing gears 60 and 61 are rotatably journalled on the gear shafts 34 and 35 . the structure of these gears is best shown in fig7 - 10 . the shafts 34 and 35 are received through central bores 63 . an outer series of teeth 65 mesh with the teeth 47 of the drive gear 45 , as shown in fig5 and provide about 115 degrees of rotation of the disconnect gears 60 and 61 about the shafts 34 and 35 . two separate inner series of teeth 67 , one on each of the gears 60 and 61 , face each other across the space below the insert opening 33 . the teeth 67 are formed differently from the teeth 65 for the specific purpose of engaging and unscrewing the needle , as explained below . the series 67 begins with an alignment tooth 68 . a ramp 70 is cut out of the gears 60 and 61 through the arc of the teeth 67 , beginning at about the center of the alignment tooth 68 and sloping downwardly to meet a dropout opening 72 , positioned in the embodiment shown about 115 degrees from the alignment tooth . as explained in more detail below , the ramp 70 accommodates portions of the needle assembly as it is unscrewed , and the dropout opening 72 allows the needle to drop vertically when it is fully unscrewed from the retainer 16 . the dropout opening 72 includes an undercut cam surface 73 . the undercut cam surfaces 73 of the gears 60 , 61 act together to urge the needle into the container with a cam - like squeezing action after unscrewing , in those instances where the rubber sleeve abutting the threads interferes with the complete disengagement of the needle 15 from the syringe 14 . the arcuate travel of the disconnect gears 60 and 61 is limited by rotation limiting cutouts 75 made in the lower portion of the outer series teeth 65 . the ends of the cutouts 75 meet stops to be described below , and thereby stop motion of the gears when the dropout openings 72 are aligned with one another . as shown in fig2 and described in detail below , when the accumulation of needles in the container 12 is such that further needles cannot be safely disposed , one of the cutouts 75 receives a locking tab 104 of a leg 101 , which prevents rotation of the disconnect gears 60 , 61 . the arcuate length of the teeth 67 determines how many turns of the needle are made before the dropout opening is reached , and this arcuate length may be varied in accordance with the number of turns needed to release the needle from the particular locking device being used . for example , a luer lock may require only a portion of a turn , whereas a conventional screw connector may require about 1 . 5 to 2 turns . also affected by the required number of turns is the length of the outer series of teeth 65 , which may be constructed to provide more or less than the 115 degrees of rotation described above . the needle removal apparatus 10 also includes a circular bottom plate 80 , which includes an upwardly extending cylindrical wall 82 at the periphery of the plate 80 . the bottom plate 80 defines a pair of openings 84 which receive the lock posts 37 and 38 at the ends of the shafts 34 and 35 . a pair of flexible lock rings of conventional construction are forced onto the projecting lock posts to hold the bottom plate 80 , and therefore the drive gear 45 and disconnect gears 60 and 61 , in place beneath the carriage 28 . in this configuration , shown in fig4 a pair of v - shaped spacers 83 extend upwardly from the bottom plate to meet and support the housing 28 at the insert opening 33 . these spacers also help to keep the needle in a relatively straight axial orientation as it is being inserted between the gears 60 and 61 . a central opening 85 is formed in the bottom plate 80 below the insert opening 33 , to allow disconnected needles to drop out of the apparatus . a pair of stops 86 extend upwardly from the bottom plate into the rotation limiting cutouts 75 of the gears 60 and 61 . the stops 86 are positioned so that they are engaged by the gears when the dropout openings 72 in the gears are aligned . the cylindrical wall 82 is dimensioned to extend up to engage the bottom of the drive gear 45 , and positions the drive gear under the housing 28 without forcing the parts together so as to cause excess friction during rotation of the drive gear 45 . a pair of spring tabs 78 with rebound blocks 88 attached thereto , both illustrated in fig1 , act to direct the carriage 28 upwardly towards the top of the actuator housing 20 , after a user has released pressure from the retainer 16 . the spring tabs 78 are formed in the flexible plastic material of the bottom plate 80 by cutouts 79 , and the rebound blocks 88 are molded on the inward tip of the tabs . the blocks 88 are positioned to engage the gears 60 and 61 . as the disconnect gears 60 and 61 complete their rotation , the spring tabs 78 , which are cut out of the bottom plate 80 , flex downwardly , and then , when pressure is released , rebound in an upward direction so as to urge the disconnect gears back towards the top of the actuator housing . still referring to fig3 the needle removal apparatus 10 also includes a locking leg 101 , which includes three tabs 102 , 103 , 104 , which extend upwardly from a top 105 of the leg 101 and selectively through the bottom plate 80 . the bottom plate 80 includes three openings 92 , 93 , 94 for receiving the three tabs 102 , 103 , 104 of the leg 101 , as illustrated in fig1 . tab 102 has a split shape which facilitates easy snapping of tab 102 into opening 92 . tab 103 , the centrally located of the three tabs , prevents the leg 101 from twisting . this function could also be accomplished by providing the tab 102 with a non - circular cross section . a foot 106 extends perpendicularly from the bottom of the leg 101 . as the disconnect gears 60 and 61 rotate and the carriage 28 moves downwardly through the actuator housing , the leg 101 and the foot portion 106 also move in a downward direction , towards the pile 200 of needles 15 which have been discarded in the container 12 as shown in detail in fig1 . when the size of the pile 200 of needles 15 in the container 12 is such that no additional needles may be safely discarded in the container 12 without risking escape of the needles through the insert opening 33 or having the point of a needle extend out of the insert opening 33 , the locking tab 104 of the leg is positioned such that further movement of the disconnect gears is prevented , as shown in fig2 and 21 . further details of the assembled configuration may be perceived from fig5 which is a view downwardly into the apparatus with the carriage 28 removed . a vertical space for receiving the needle is bounded by the two disconnect gears 60 and 61 , and the two spacers 83 . the needle removal apparatus is intended to be disposable after a period of use , such as when the container 12 is full . thus , all of the elements described above are preferably made of suitable plastics known to those skilled in the art , although metal can be utilized where appropriate . a permanent lid 150 is attached to one side of the container 12 , as illustrated in fig2 . the lid 150 sits in a recess 160 , seen in part in fig1 , in the container 12 , and is held in place by four tabs 151 , 152 , 153 , 154 . when the container 12 reaches its safe limit of needles 200 and the leg 101 locks the disconnect gears 60 and 61 , the permanent lid 150 may be placed over a raised portion of the cover 155 under which the carriage 28 is positioned , thus safely sealing the insert opening 33 of the container 12 . the entire container 12 may then be safely disposed . the needle removal apparatus 10 is constructed to accommodate needles other than the types attached to syringes . a coat hanger - shaped opening 120 in the raised portion 155 of the cover 13 is large enough to receive numerous varieties of non - syringe needles , including the so - called &# 34 ; butterfly &# 34 ; needle used by hospital personnel , as fig4 shows . a hinged retaining flap 125 is mounted between the cover 13 and the annular plate 29 . a strut 127 , extending downward from the cover 13 and abutting the plate 29 , passes through a hole 126 in the flap , thus positioning the flap 125 . the flap 125 includes a hinged portion 128 , around which the flap is rotatable . the retaining flap 125 is positioned so as to not impede the disposal of non - syringe needles down into the opening 120 when the apparatus 10 is in an upright position on a hospital personnel &# 39 ; s medical cart ( not pictured ). however , if the apparatus 10 is upset from its upright position , the flap 125 pivots around its hinge 128 in the direction of the arrow 130 to cover the opening 120 , thus preventing disposed contaminated needles from spilling out of the apparatus 10 . it should also be noted that the detaching mechanism of each model of the needle removal apparatus 10 can accommodate only one particular brand of needles , due to the various threading mechanisms employed by each manufacturer of syringe - held needles . accordingly , the opening 120 also includes two teeth - like elements 121 , 122 which can be used to unscrew needles not suited to the particular model of the needle removal apparatus which the personnel are currently using . further details of the construction of a typical conventional syringe assembly 14 are shown in fig2 . the needle 15 extends into a collar 95 , which defines a plurality of outwardly extending flanges 96 . the flanges terminate in a circular stop 97 , which separates them from a threaded screw portion 98 . the collar 95 is screwed into a tapped hole in the retainer portion 16 of the syringe 14 , with an inner needle 99 ( shown covered by a protective envelope ) extending into the retainer 16 . the protective envelope often terminates in a raised ring 99 &# 39 ; adjacent to the threads 98 . the ring 99 &# 39 ; may become caught in the disconnect gears even after the threads 98 are separated from the syringe . the flanges 96 are provided to allow the user to get a grip on the needle for screwing and unscrewing the needle . it is the object of the present invention to obviate the need for grasping the collar by hand to unscrew it after the needle is contaminated . the retainer portion 16 includes a leading surface 100 , which engages the annular shoulder 32 within the carriage 28 . operation of the needle removal apparatus is described as follows , with particular reference to fig1 - 17 , which show a sequence of positions of the disconnect gears 60 and 61 during operation . after the syringe assembly 14 has been used and the needle 15 contaminated , the user simply takes the needle retainer 16 in one hand and inserts it into the carriage 28 , until the needle 15 passes into the space between the disconnect gears , and the leading surface 100 of the retainer 16 is in contact with the annular shoulder 32 . at this point , the flanges 96 have engaged the alignment teeth 68 of both gears 60 and 61 , and have been caused to align the syringe so that the flanges are astride the alignment teeth as shown in fig1 and 12 . the position of the syringe at this point in the operation is shown in dotted lines in fig4 . detachment of the needle 15 from the retainer 16 is accomplished when the user asserts downward pressure on the retainer . this pressure causes the carriage 28 to begin to move downwardly along the slots 22 in the actuator housing 20 . as this occurs , the cam followers 55 of the drive gear 45 are forced to follow the path defined by the cam tracks 25 of the actuator housing 20 . thus , the drive gear 45 rotates counterclockwise as it descends with the carriage 28 , and its rotation causes the following other functions to be carried out . the rotating inner teeth 47 cause rotation of the disconnect gears 60 and 61 , in turn causing the inner unscrewing teeth 67 to move relative to the flanges 96 of the needle collar 95 . the teeth 67 engage the flanges 96 and turn the collar in an unscrewing direction ( clockwise looking down as in fig1 and 15 ) as the gears turn . after a portion of the permitted rotation , the needle collar position is shown in fig1 . the threaded portion 98 has begun to emerge from the needle retainer 16 . the ramp 70 provides room for the circular stop 97 to move downwardly past the gears , while the flanges remain engaged with the inner unscrewing teeth 67 . as the drive gear 45 rotates , it causes the spring compression walls 51 to compress the return springs 57 against the spring stops 40 , which do not rotate . in the embodiment shown in fig5 the springs are compressed through about 53 degrees of arc . at the same time , the balls 58 roll between the carriage 28 and the spring tracks 50 , in the space created by the departure of the adjacent wall 51 from its rest position . when the rotation of the disconnect gears 60 and 61 has reached the configuration shown in fig1 and 15 , the threaded portion 98 of the collar 95 has been completely unthreaded from the retainer 16 , and the collar has moved down the ramp 70 into the dropout openings 72 , which are now aligned across from one another . thus , there should be nothing to prevent the needle assembly from falling down through the opening 85 in the bottom plate , into the container 12 . in certain situations , the threaded portion 98 of the collar 95 will be completely unthreaded , as shown in fig1 and 15 , but a portion of the needle assembly 15 , such as the ring 99 &# 39 ; of the protective envelope of fig2 , will obstruct passage of the needle assembly 15 into the container 12 . when such blockage occurs , the cutout cam surfaces 73 are urged against the needle assembly 15 in such a manner so as to force the needle assembly 15 to fall into the container 12 , as fully shown in fig1 and 17 . the cutout cam surfaces 73 thus prevent detached contaminated needles which are &# 34 ; trapped &# 34 ; between the disconnect gears from spilling away from the container and causing a potential health hazard , or from interfering with further operation of the detaching mechanism . the ending position of the gears 60 and 61 is defined by the posts 86 on the bottom plate 80 , which strike the ends of the cutouts 75 in the gears and prevent further rotation . this also prevents further penetration of the carriage , drive gear , and bottom plate into the actuator housing . at this time , the user may terminate downward pressure on the needle retainer 16 and withdraw it from the apparatus 10 . the energy stored in the compressed return springs 57 causes the drive gear 45 to rotate in the opposite direction to its original position . the cam followers 55 climb back up the cam tracks 25 , and the carriage 28 moves up the slots 22 . the apparatus stops rotating , and reaches its original orientation as the balls 58 become trapped between the stops 40 and the walls 51 . the alignment teeth 68 of the gears 60 and 61 are now reset across from one another ready to receive the next needle collar . when a sufficient quantity of needles 200 have been disposed in the container 12 , the apparatus 10 can no longer function safely without creating a risk that needles will protrude through the openings 33 and 85 into which they are placed for disposal . during the downward movement of the carriage 28 and the leg 101 , if the foot portion 106 of the leg 101 encounters the pile 200 of needles 15 , the tabs 102 , 103 , and 104 of the leg 101 are pushed further upward through the openings 92 , 93 , and 94 and closer to the gears 60 and 61 . after the gears 60 and 61 have been sufficiently rotated to unthread the needle 15 from the retainer 16 , as shown in fig1 and 15 , the locking tab 104 , due to the upward movement caused by the foot portion 106 encountering the pile 200 of needles 15 , moves into the cutout 75 of one of the disconnect gears . thereafter , when the gears 60 and 61 strike the posts 86 and begin to return to their initial position , the end of the cutout 75 will encounter the locking tab 104 and the gears 60 and 61 will be unable to move in either direction . the engagement of the tab 104 with the cutout 75 is shown in fig2 , and the relative positions of the post 86 and the tab 104 when locking occurs are shown in fig1 . therefore , further operation of the actuator housing 20 is prevented and the apparatus 10 is rendered inoperative . if the needle collar has not been fully screwed into the retainer , the circular stop 97 may engage the top of the gears 60 and 61 before the leading surface 100 meets the annular shoulder 32 of the carriage . in this case , the spring tabs 78 will allow the gears to yield downwardly , so that the flanges will still engage the teeth 68 and the retainer will transmit pressure to the carriage . it should be understood that the return function provided by the return springs 57 could be performed by compression springs mounted below the bottom plate 80 to urge the assembled parts upwardly when pressure is released . it should also be understood that the needle collar could be engaged for unscrewing by means other than gear teeth . for example , the disconnect gears could be wheels having resilient outer bands for frictionally engaging the needle and / or the interior of the drive gear , which could also be lined with a high friction interface rather than gear teeth . alternately , the needle collar could be rotated by a rack or racks caused to move past the collar . while this invention has been described in detail with particular reference to preferred embodiments thereof , it will be understood that variations and modifications can be effected within the spirit and scope of the invention as described hereinbefore and as defined in the appended claims . | 0 |
the embodiment shown in fig2 illustrates an improvement to an air bag deployment system . in the fig2 embodiment , a portion of an air bag deployment system 200 is shown in which a base substrate 220 supports a foam layer 230 and an outer skin 240 . an air bag deployment chute 250 with an inner side wall 251 and flange 252 is shown with deformable ribs 254 , 256 , 258 and 260 on flange 252 that are preferably ultrasonically welded to the lower surface of substrate 220 . a pre - weakened tear seam 202 is slightly off - set from the opening of air bag deployment chute 250 , and the deployment door 210 is defined by the tear seam path and hinge ( not shown ). although only a small portion of the air bag deployment system is shown , it should be understood that flange 252 extends and weld ribs are provided around the entire door 210 outward from tear seam 202 . air bag deployment chute 250 contains a gusset 257 to stiffen side wall 251 and flange 252 during air bag deployment . deflector rib 253 is formed into the corner between the side wall 251 and flange 252 so as to protrude into a non - bonded area forming an air gap 266 between the flange 252 and lower surface of substrate 220 . although only shown in cross - section , deflector rib 253 extends along the corner edge of air bag deployment chute 250 so as to protect all flange welds adjacent the chute opening . deflector rib 253 is sufficiently high to block the entry of the air bag 270 fabric into gap 266 and prevent damage to weld 254 during air bag deployment . air bag 270 is depicted in fig2 at the moment during deployment activation prior to sufficient force build up that fractures tear seam 202 . as can be seen , deflector rib 253 prevents the air bag 270 fabric from entering gap 266 and from causing damage to weld 254 . fig2 a and 2b illustrate alternate versions of the embodiment shown in fig2 . in fig2 a , the deflector rib 253 is formed to have portions of varying heights 253 i and 253 ii that are spaced apart , but provide a sufficient barrier to air bag fabric entering the gap 266 . in fig2 b , the deflector rib 253 is formed to have a substantially continuous height to block the air bag fabric from entering gap 266 . the embodiment shown in fig3 illustrates another improvement to an air bag deployment system . in the fig3 embodiment , a portion of an air bag deployment system 300 is shown in which a base substrate 320 supports a foam layer 330 and an outer skin 340 . an air bag deployment chute 350 with an inner side wall 351 and flange 352 extending from the corner 353 at the chute opening . flange 352 contains deformable ribs 354 , 356 , 358 and 360 that are preferably ultrasonically welded to the lower surface of substrate 320 . a pre - weakened tear seam 302 is slightly off - set from corner 353 at the opening of air bag deployment chute 350 , and the deployment door 310 is defined by the tear seam path and hinge ( not shown ). air bag deployment chute 350 contains a gusset 357 to provide stiffening to side wall 351 and flange 352 . deflector rib 359 is formed onto flange 352 between weld rib 354 and tear seam 302 so as to protrude into gap 366 that results between the flange 352 and lower surface of substrate 320 . deflector rib 359 is sufficiently high to block the entry of the air bag 370 fabric into gap 366 to a point where it could damage weld 354 during air bag deployment . alternatively , the deflector rib could be formed on the lower surface of base substrate 320 to protrude into gap 366 with equivalent results . air bag 370 is depicted in fig3 at the moment during deployment activation prior to sufficient force build up that fractures tear seam 302 . as can be seen , deflector rib 353 prevents the forces from the air bag fabric from damaging the weld 354 , while applying forces against tear seam 302 and deployment door 310 . fig3 a and 3b illustrate alternate versions of the embodiment shown in fig3 . in fig3 a , the deflector rib 359 is formed to have portions of varying heights 359 i and 359 ii that are spaced apart , but provide a sufficient barrier to prevent air bag fabric from damaging weld 354 . in fig2 b , the deflector rib 359 is formed to have a substantially continuous height to prevent the air bag fabric from damaging weld 354 . as can be seen by the drawings and accompanying explanation , the described embodiments are unique improvements over conventional air bag deployment systems . and while the embodiments shown here are preferred , they shall not be considered to be a restriction on the scope of the claims set forth below . | 1 |
reference will be made in detail to embodiments of the present disclosure . the embodiments described herein with reference to drawings are explanatory , illustrative , and used to generally understand the present disclosure . the embodiments shall not be construed to limit the present disclosure . a cleaning appliance 10 according to embodiments of the present disclosure will be described with reference to drawings . as shown in fig1 - 3 , the cleaning appliance 10 according to embodiments of the present disclosure includes a body 101 , a filtering member 102 and a dust tapping - off device . the body 101 has a clean air outlet 1011 , and the filtering member 102 is disposed at the clean air outlet 1011 . as shown in fig1 - 3 , the dust tapping - off device according to embodiments of the present disclosure includes a sliding rail 103 , a sliding block 104 , an actuating rod 105 and a dust tapping - off member 106 configured for tapping the filtering member 102 . the sliding rail 103 is disposed on an outer surface of the body 101 and opposite to the clean air outlet 1011 . the sliding block 104 is slidably disposed on the sliding rail 103 . the actuating rod 105 is rotatably disposed on the sliding block 104 . the dust tapping - off member 106 is disposed on the actuating rod 105 . a dust tapping - off process of the cleaning appliance 10 according to embodiments of the present disclosure will be briefly described with reference to fig1 - 3 . when the cleaning appliance 10 has been used for a period of time , the filtering member 102 is blocked gradually by dust and dirt , such that a suction of the cleaning appliance 10 is reduced , thereby decreasing a total cleaning efficiency of the cleaning appliance 10 ( for example a vacuum cleaner ). by rotating the actuating rod 105 , the dust tapping - off member 106 mounted to the actuating rod 105 may be driven to rotate , so that the dust tapping - off member 106 may tap the filtering member 102 . furthermore , by driving the sliding block 104 to move along the sliding rail 103 , the actuating rod 105 and the dust tapping - off member 106 are moved , so that the dust tapping - off member 106 may tap different parts of the filtering member 102 , and thereby the whole filtering member 102 may be cleaned . that is to say , by providing the dust tapping - off device , the filtering member 102 does not need to be removed for cleaning . in the dust tapping - off device according to embodiments of the present disclosure , by providing the rotatable actuating rod 105 and mounting the dust tapping - off member 106 to the actuating rod 105 , the dust tapping - off member 106 may be rotated by rotating the actuating rod 105 , so that the dust tapping - off member 106 may tap the filtering member 102 , and thereby the filtering member 102 may be cleaned conveniently and easily . therefore , the dust tapping - off device according to embodiments of the present disclosure has a simple structure and is easy to use . in the cleaning appliance 10 according to embodiments of the present disclosure , by providing the dust tapping - off device , the filtering member 102 may be cleaned conveniently and easily and the filtering member 102 does not need to be removed for cleaning . therefore , the cleaning appliance 10 according to embodiments of the present disclosure has the simple structure , and is easy to clean and use . the body 101 and the filtering member 102 of the cleaning appliance 10 according to embodiments of the present disclosure may be known . for example , the filtering member 102 may be configured to be a high efficiency particulate air filter ( hepa ). as shown in fig1 - 3 , the cleaning appliance 10 according to some embodiments of the present disclosure includes the body 101 , the filtering member 102 and the dust tapping - off device . the dust tapping - off device includes the sliding rail 103 , the sliding block 104 , the actuating rod 105 , a handle 108 and the dust tapping - off member 106 configured to tap the filtering member 102 . the clean air outlet 1011 is provided in an upper surface of the body 101 , i . e . the clean air outlet 1011 is opened upwards . the upper surface of the body 101 is provided with a first engaging lug 1012 and a second engaging lug 1013 . the first engaging lug 1012 is provided with a first engaging groove , and the second engaging lug 1013 is provided with a second engaging groove . the sliding rail 103 includes a rail body 1031 , a first mounting portion 1032 and a second mounting portion 1033 . an upper end of the first mounting portion 1032 is connected to a first end of the rail body 1031 and a lower end of the first mounting portion 1032 is configured as a first fastener engaged in the first engaging groove . an upper end of the second mounting portion 1033 is connected to a second end of the rail body 1031 and a lower end of the second mounting portion 1033 is configured as a second fastener engaged in the second engaging groove . thus , the sliding rail 103 may be mounted to the body 101 easily and steadily . advantageously , the rail body 1031 , the first mounting portion 1032 and the second mounting portion 1033 may be formed integrally . the clean air outlet 1011 may be configured as a round hole , and the rail body 1031 may extend along a radial direction of the clean air outlet 1011 . as shown in fig2 and 3 , in an embodiment of the present disclosure , the sliding block 104 has an accommodating cavity 1041 therein , both two opposite ends of the accommodating cavity 1041 are open , and the sliding rail 103 passes through the accommodating cavity 1041 . in other words , the sliding block 104 may be fitted over the rail body 1031 . thereby , the structure of the dust tapping - off device may be reasonable and steady . advantageously , a groove 1034 may be provided in an upper surface of the rail body 1031 , a protruding block 1042 may be disposed on a top wall surrounding the accommodating cavity 1041 , and the protruding block 1042 is fitted in the groove 1034 , so that the sliding block 104 may slide along the rail body 1031 steadily and easily . as shown in fig3 , in some embodiments of the present disclosure , the dust tapping - off device further includes a rolling element 107 . the rolling element 107 is rotatably disposed in the accommodating cavity 1041 , and also is mounted on the rail body 1031 . the actuating rod 105 passes through walls surrounding the accommodating cavity 1041 and is connected to the rolling element 107 . that is to say , the rolling element 107 may drive the actuating rod 105 to rotate . when the filtering member 102 is cleaned , the sliding block 104 is driven to move along the rail body 1031 , and the sliding block 104 may drive the rolling element 107 to roll . that is to say , during the movement of the sliding block 104 along the rail body 1031 , the rolling element 107 keeps rotating , so that the actuating rod 105 may keep rotating , and thus the dust tapping - off member 106 may be driven to tap the filtering member 102 . thus , a user may complete the cleaning of the filtering member 102 only by operations of moving the sliding block 104 ( without rotating the actuating rod 105 manually ), and thereby the filtering member 102 may be cleaned conveniently and easily . advantageously , a part of the rolling element 107 may be fitted in the groove 1034 , so that the rolling element 107 may roll steadily . the rolling element 107 may be configured as a rolling bearing . as shown in fig2 , in an embodiment of the present disclosure , the actuating rod 105 may be perpendicular to the sliding rail 103 . thus , the structure of the dust tapping - off device may be reasonable . specifically , the actuating rod 105 may extend along the radial direction of the clean air outlet 1011 as well . in a specific embodiment of the present disclosure , as shown in fig2 , a first portion 1051 of the actuating rod 105 extends leftwards out of the sliding block 104 , and a second portion 1052 of the actuating rod 105 extends rightwards out of the sliding block 104 . furthermore , two dust tapping - off members 106 are provided . one dust tapping - off member 106 is disposed on the first portion 1051 of the actuating rod 105 , and the other dust tapping - off member 106 is disposed on the second portion 1052 of the actuating rod 105 , such that a cleaning speed of the dust tapping - off device may be improved , and thereby the filtering member 102 may be cleaned rapidly . advantageously , one dust tapping - off member 106 may be movably fitted over the first portion 1051 of the actuating rod 105 along a left - right direction , and the other dust tapping - off member 106 may be movably fitted over the second portion 1052 of the actuating rod 105 along the left - right direction . the left - right direction is perpendicular to a paper in which fig3 is , i . e . the actuating rod 105 extends along the left - right direction . thus , different parts of the filtering member 102 may be tapped by moving the two dust tapping - off members 106 along the left - right direction . the dust tapping - off member 106 may be configured as a cam , so that the structure of the dust tapping - off device may be reasonable . as shown in fig2 and fig3 , the handle 108 is disposed on the sliding block 104 , and thus the user may drive the sliding block 104 to move conveniently and easily . advantageously , the handle 108 and the sliding block 104 may be formed integrally . in the specification , it is to be understood that terms such as “ central ”, “ longitudinal ”, “ lateral ”, “ length ”, “ width ”, “ thickness ”, “ upper ”, “ lower ”, “ front ”, “ rear ”, “ left ”, “ right ”, “ vertical ”, “ horizontal ”, “ top ”, “ bottom ”, “ inner ”, “ outer ”, “ clockwise ” and “ counterclockwise ” should be construed to refer to the orientation as then described or as shown in the drawings under discussion . these relative terms are for convenience of description and do not require that the present disclosure be constructed or operated in a particular orientation . in addition , terms such as “ first ” and “ second ” are used herein for purposes of description and are not intended to indicate or imply relative importance or significance or to imply the number of indicated technical features . thus , the feature defined with “ first ” and “ second ” may comprise one or more of this feature . in the description of the present disclosure , “ a plurality of ” means two or more than two , unless specified otherwise . in the present disclosure , unless specified or limited otherwise , the terms “ mounted ”, “ connected ”, “ coupled ”, “ fixed ” and the like are used broadly , and may be , for example , fixed connections , detachable connections , or integral connections ; may also be mechanical or electrical connections ; may also be direct connections or indirect connections via intervening structures ; may also be inner communications of two elements , which can be understood by those skilled in the art according to specific situations . in the present disclosure , unless specified or limited otherwise , a structure in which a first feature is “ on ” or “ below ” a second feature may include an embodiment in which the first feature is in direct contact with the second feature , and may also include an embodiment in which the first feature and the second feature are not in direct contact with each other , but are contacted via an additional feature formed therebetween . furthermore , a first feature “ on ”, “ above ” or “ on top of ” a second feature may include an embodiment in which the first feature is right or obliquely “ on ”, “ above ” or “ on top of ” the second feature , or just means that the first feature is at a height higher than that of the second feature ; while a first feature “ below ”, “ under ” or “ on bottom of ” a second feature may include an embodiment in which the first feature is right or obliquely “ below ”, “ under ” or “ on bottom of ” the second feature , or just means that the first feature is at a height lower than that of the second feature . reference throughout this specification to “ an embodiment ”, “ some embodiments ”, “ one embodiment ”, “ another example ”, “ an example ”, “ a specific example ” or “ some examples ” means that a particular feature , structure , material , or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present disclosure . thus , the appearances of the phrases such as “ in some embodiments ”, “ in one embodiment ”, “ in an embodiment ”, “ in another example ”, “ in an example ”, “ in a specific example ” or “ in some examples ” in various places throughout this specification are not necessarily referring to the same embodiment or example of the present disclosure . furthermore , the particular features , structures , materials , or characteristics may be combined in any suitable manner in one or more embodiments or examples . although explanatory embodiments have been shown and described , it would be appreciated by those skilled in the art that the above embodiments cannot be construed to limit the present disclosure , and changes , alternatives , and modifications can be made in the embodiments without departing from spirit , principles and scope of the present disclosure . | 0 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . a method of combining the red phosphorescence compound according to the present invention will now be described . an iridium ( 111 )( 2 -( 3 - methylphenyl )- 7 - methyl - quinolinato - n , c 2 )( 2 , 4 - pentanedionate - 0 , 0 ) compound , which is shown as a - 2 among the red phosphorescene compounds used in the organic el device according to the present invention . 3 - methyl - phenyl - boric acid ( 1 . 3 mmol ), 2 - chloro - 6 - methyl - quinoline ( 1 mmol ), tetrakis ( triphenyl phosphine ) palladium ( 0 ) ( 0 . 05 mmol ), and potassium carbonate ( 3 mmol ) are dissolved in a two - neck round bottom flask containing thf ( 30 ml ) and h 2 o ( 10 ml ). the mixture is then stirred for 24 hours in a bath of 100 degrees celsius ( c ). subsequently , when reaction no longer occurs , the thf and toluene are discarded . the mixture is extracted by using dichloromethane and water , which is then treated with vacuum distillation . then , after filtering the mixture with a silica gel column , a solvent is treated with vacuum distillation . thereafter , by using dichloromethane and petroleum ether , the mixture is re - crystallized and filtered , thereby yielding solid 2 -( 3 - methylphenyl )- 6 - methyl - quinoline . iridium chloride ( 1 mmol ) and 2 -( 3 - methylphenyl )- 6 - methyl - quinoline ( 2 . 5 mmol ) are mixed in a 3 : 1 liquid mixture ( 30 ml ) of 2 - ethoxyethanol and distilled water . then , the mixture is refluxed for 24 hours . thereafter , water is added so as to filter the solid form that is produced . subsequently , the solid form is washed by using methanol and petroleum ether , thereby yielding the chloro - cross - linked dimer complex . a chloro - cross - linked dimer complex ( 1 mmol ), 2 , 4 - pentane dione ( 3 mmol ), and na 2 co 3 ( 6 mmol ) are mixed into 2 - ethoxyethanol ( 30 ml ) and refluxed for 24 hours . the refluxed mixture is then cooled at room temperature . thereafter , distilled water is added to the cooled mixture , which is filtered so as to yield a solid form . subsequently , the solid form is dissolved in dichloromethane , which is then filtered by using silica gel . afterwards , the dichloromethane is treated with vacuum suction , and the solid form is washed by using methanol and petroleum ether , so as to obtain the chemical compound . hereinafter , examples of preferred embodiments will be given to describe the present invention . it will be apparent that the present invention is not limited only to the proposed embodiments . an ito glass substrate is patterned to have a light emitting area of 3 mm × 3 mm . then , the patterned ito glass substrate is washed . subsequently , the substrate is mounted on a vacuum chamber . the standard pressure is set to 1 × 10 − 6 torr . thereafter , layers of organic matter are formed on the ito substrate in the order of cupc ( 200 å ), npb ( 400 å ), balq + a - 2 ( 7 %) ( 200 å ), alq 3 ( 300 å ), lif ( 5 å ), and al ( 1000 å ). at 0 . 9 ma , the brightness is equal to 1066 cd / m 2 ( 6 . 5 v ). at this point , cie x = 0 . 646 , y = 0 . 351 . furthermore , the durability ( half of the initial brightness ) lasts for 5500 hours at 2000 cd / m 2 . an ito glass substrate is patterned to have a light emitting area of 3 mm × 3 mm . then , the patterned ito glass substrate is washed . subsequently , the substrate is mounted on a vacuum chamber . the standard pressure is set to 1 × 10 − 6 torr . thereafter , layers of organic matter are formed on the ito substrate in the order of cupc ( 200 å ), npb ( 400 å ), balq + a - 7 ( 7 %) ( 200 å ), alq 3 ( 300 å ), lif ( 5 å ), and al ( 1000 å ). at 0 . 9 ma , the brightness is equal to 1102 cd / m 2 ( 6 . 1 v ). at this point , cie x = 0 . 645 , y = 0 . 352 . furthermore , the durability ( half of the initial brightness ) lasts for 5800 hours at 2000 cd / m 2 . an ito glass substrate is patterned to have a light emitting area of 3 mm × 3 mm . then , the patterned ito glass substrate is washed . subsequently , the substrate is mounted on a vacuum chamber . the standard pressure is set to 1 × 10 − 6 torr . thereafter , layers of organic matter are formed on the ito substrate in the order of cupc ( 200 å ), npb ( 400 å ), balq + a - 9 ( 7 %) ( 200 å ), alq 3 ( 300 å ), lif ( 5 å ), and al ( 1000 å ). at 0 . 9 ma , the brightness is equal to 949 cd / m 2 ( 5 . 3 v ). at this point , cie x = 0 . 658 , y = 0 . 339 . furthermore , the durability ( half of the initial brightness ) lasts for 5000 hours at 2000 cd / m 2 . an ito glass substrate is patterned to have a light emitting area of 3 mm × 3 mm . then , the patterned ito glass substrate is washed . subsequently , the substrate is mounted on a vacuum chamber . the standard pressure is set to 1 × 10 − 6 torr . thereafter , layers of organic matter are formed on the ito substrate in the order of cupc ( 200 å ), npb ( 400 å ), cbp + a - 2 ( 7 %) ( 200 å ), a hole blocking layer ( 100 å ), alq 3 ( 300 å ), lif ( 5 å ), and al ( 1000 å ). when forming a hole blocking layer using balq , the brightness is equal to 986 cd / m 2 ( 6 . 7 v ) at 0 . 9 ma . at this point , cie x = 0 . 641 , y = 0 . 357 . furthermore , the durability ( half of the initial brightness ) lasts for 4500 hours at 2000 cd / m 2 . an ito glass substrate is patterned to have a light emitting area of 3 mm × 3 mm . then , the patterned ito glass substrate is washed . subsequently , the substrate is mounted on a vacuum chamber . the standard pressure is set to 1 × 10 − 6 torr . thereafter , layers of organic matter are formed on the ito substrate in the order of cupc ( 200 å ), npb ( 400 å ), balq +( btp ) 2 ir ( acac )( 7 %) ( 200 å ), alq 3 ( 300 å ), lif ( 5 å ), and al ( 1000 å ). at 0 . 9 ma , the brightness is equal to 780 cd / m 2 ( 7 . 5 v ). at this point , cie x = 0 . 659 , y = 0 . 329 . furthermore , the durability ( half of the initial brightness ) lasts for 2500 hours at 2000 cd / m 2 . in accordance with the above - described embodiments and comparison example , the characteristics of efficiency , chromacity coordinates , brightness , and durability are shown in table 1 below . as shown in table 1 , the device is operated with high efficiency at a low voltage even when the color purity is high ( cie ( x )≧ 0 . 65 ). furthermore , the current efficiency of the second embodiment has increased by 70 % or more as compared to the comparison example . additionally , the durability of the second embodiment has increased to twice that of the comparison example . table 2 below shows the characteristics of efficiency , chromacity coordinates , and brightness in accordance with the increase in voltage and electric current in the organic electroluminescence device according to the second embodiment of the present invention . as shown in table 2 , the second embodiment provides excellent efficiency , and the chromacity coordinates according to the driving voltage also maintains high color purity . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the inventions . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 8 |
attention is first directed to fig4 and 5 , which illustrate the principles of the invention as applied to a structurally simple vaporizer . in those figures the vaporizer is designated generally as 20 . it includes a lower body member 21 and an upper body member or cap 22 . both body members 21 and 22 are constructed of heat conductive material , such as aluminum . cap 22 has a heating fluid passage 23 running horizontally therethrough , with inlet and outlet lines 24 and 25 connected to it . lower body member 21 , in its lower portion , is also provided with a heating fluid passage 26 , having inlet and outlet lines 27 and 28 fitted thereto . in the upper portion of the lower body member 21 there is formed a working fluid passage 29 , which has several distinct regions or sections , each of which will be discussed . as can best be seen from fig4 the top wall 30 of passage 29 is formed by part of the bottom surface of the cap 22 . working fluid passage 29 has inlet and outlet lines 30 &# 39 ; and 31 fitted thereto . at the upstream ( left ) end of passage 29 is an internal header 32 , where incoming working liquid falls in pressure , is at least partially vaporized , and is distributed across the width of the passage . immediately downstream from header 32 of enlarged area , wherein is the abovementioned vapor film area 33 of passage 29 , and this vapor film area is formed by rib 34 in the bottom wall of the passage which projects toward the top wall farther than any other portion of the bottom wall . the vaporous portion of the working fluid is easily accelerated through the constricted cross section of film area 33 , but the liquid portion is not . it is held in header 32 , wherein heat is added to it until it vaporizes and can pass as vapor through the film area . the next region of the working fluid passage 29 in the downstream direction is escape zone or area 35 of enlarged area . in this area , the vapor which has passed through film area 33 is heated further to provide sufficient superheat to prevent condensation when the vapors encounter other and cooler parts of the fuel system downstream from the vaporizer . to the extent that very fine droplets of liquid have successfully passed through the film area 33 , they are broken up into even finer droplets by the turbulence caused by the change in passage cross section and are vaporized by the heat supplied in the escape zone 35 . at the end of escape zone 35 is a second internal header 36 , similar to the header 32 , which gathers vapor issuing from said escape zone and conducts it to outlet line 31 . ( in the discussion thus far line 30 &# 39 ; has been referred to as an &# 34 ; inlet &# 34 ; line and line 31 as an &# 34 ; outlet &# 34 ; line , in accordance with the flow directional arrows appearing on fig4 . however , as will appear from the discussion hereinbelow , vaporizer 20 is fully operative with the working fluid flow direction reversed , and the functional designations of lines 30 &# 39 ; and 31 should also be regarded as reversible .) table i below presents vaporizer parameters and performance data for a vaporizer which was constructed generally in accordance with fig4 and 5 , and which was modified from test run in the size of the film area 33 . the vaporizer differed from that shown in fig4 and 5 only in that the cap 22 and lower body member 21 each had two parallel one - fourth inch diameter heating passages therethrough instead of the single passage in each member shown in the drawings , and the heating liquid accordingly made two passes through the vaporizer instead of one . the vaporizer employed in the tests reported in table i had a working passage facial area ( defined here as the sum of the size of the film are 33 , if any , and the area of escape zone 35 , if any ) of one - inch square , on both the top and bottom of the passage . the facial area was maintained constant throughout the series of tests , although the proportions devoted to film surface area and escape zone were varied . the height ( vertical dimension ) of the working fluid passage in the escape zone was 0 . 03 inches ; the height of the passage in the film area was 0 . 006 inches . in accordance with the invention , the smallest dimension of the film area ( usually termed its depth or height ) may vary between about 0 . 001 inches and about 0 . 015 inches , depending upon the properties of the working fluid and the allowable pressure drop . the vaporizer employed in the test , since it was designed to serve as a &# 34 ; test - bed &# 34 ; for exploration of the principles and parameters of the invention , operated at a higher pressure drop than would generally be desirable in a fuel system unit . it was intended to vaporize liquefied petroleum gas ( hd5 propane -- 95 % propane and not over 1 % propylene ). the input conditions of the working fluid from storage were 65 ° f at 100 psig . the working fluid was passed through an upstream pressure regulator and entered the vaporizer at about 20 ° f and about 41 psig . the exiting fluid was at a pressure of about 6 psig . as can be seen from the table , with a film area present in the unit , under these conditions 40 - 50 lbs ./ hr . of vapor at a temperature near 55 ° f could be produced , utilizing heating liquid at temperatures typical of those of an engine cooling system -- about 130 ° f to 150 ° f . the calculated mass liquid - to - vapor ratio across the film area is 32 % liquid and 68 % vapor , while the volume liquid - to - vapor ratio is 0 . 181 % liquid and 99 . 82 % vapor . table i______________________________________ heating exit temper - flow ratefilm fluid ature working of work - area , flow temp . fluid ing fluid , run sq . inches direction ° f ° f 1bs ./ hr . ______________________________________1 0 -- 150 ° 28 and falling 47 . 72 1 -- 135 ° 54 45 . 83 0 . 5 film area 138 ° 54 47 . 0 first4 0 . 25 film area 147 ° 54 46 . 9 first5 0 . 125 film area 148 ° 56 47 . 6 first6 0 . 125 film area 150 ° 54 48 . 1 last______________________________________ from table i it can be seen that with no film area , the vaporizer was unable to produce vapor at the desired rate and temperature ( run 1 ). the output temperature fell continuously and was 28 ° f ( unusable for fuel system purposes ) when the run was terminated . a comparison of run 1 with runs 2 through 6 taken together , shows that the film area provided in accordance with the invention converts the device from one inoperative for its intended purpose to one capable of delivering vapor at appropriate temperatures and rates for use in a fuel system for a moderate sized engine . runs 5 and 6 show that the beneficial effects of the film area are obtained whether it is positioned at the upstream end of the passage or the downstream end . runs 2 through 6 show that the area and proportionate area of the film area are not critical to the operation of the invention , but they also show that some improvement in throughput capacity is obtained if an enlarged passage is provided downstream ( runs 3 - 5 ) or upstream ( run 6 ) of the film area . the vaporizer employed in the tests of table i successfully operated in a fuel system for a 162 cubic inch engine . attention is now directed to fig6 which shows in plan view the lower body member 21 &# 39 ; of a vaporizer 20 &# 39 ; which has a basic structure much like that of vaporizer 20 shown in fig4 and 5 . for this reason , some of the parts of lower body member 21 &# 39 ; are given the same reference characters with a &# 34 ; prime &# 34 ; designation . interdigitated grooves 37 , 38 and 39 are cut into the bottom facial area of the working fluid passage . groove 37 is an extension of inlet header 32 &# 39 ;. grooves 38 and 39 are extensions of outlet header 36 &# 39 ;, and when working fluid flow is from left to right as fig6 is drawn , grooves 38 and 39 function as the escape zone or area of the working fluid passage . when flow is from right to left as fig6 is drawn , groove 37 functions as the escape zone or area . the film area 40 occupies the remainder of the facial area of the bottom of the working passage . the frontal area of the film area in the embodiment of fig6 is thus about 3 times greater than the frontal area of the film area 33 in the embodiment of fig4 and 5 . a vaporizer constructed in accordance with fig6 successfully produced vapors at a temperature of 60 ° f and at a rate of 48 . 1 pounds per hour , using a heating liquid temperature of 145 ° f , operating in a system in which the primary pressure drop in the working fluid occurred upstream of the vaporizer . another test run was made with the principal pressure drop in the working fluid occurring downstream of the vaporizer . in this run the vaporizer produced vapor at a temperature of 55 ° f at a rate of 47 pounds per hour , with a heating liquid temperature of 135 ° f . these two test runs , taken together , demonstrate that the vaporizer of the invention functions well at both high and low working fluid pressures . in fig7 and 8 there is shown a circular vaporizer 41 constructed in accordance with the invention . it includes an upper body member or cap 42 , and a lower body member 43 . the upper surface of lower body member 43 has a circumferential heating fluid passage groove 44 formed in it . groove 44 is closed on its top side by cap 42 . heating fluid is introduced to and removed from groove 44 through lines 45 which pass downwardly through cap 42 as indicated by the dotted outlines in fig8 . the lower body member 43 has a central inlet bore 46 passing upwardly therethrough , which forms a portion of the working fluid passage through the unit . a pattern of radial grooves 47 is formed in the upper surface of lower body member 43 so that the inner ends of the grooves are in communication with bore 46 . also formed in the upper surface of lower body member 43 is a circumferential groove 48 which forms part of the working fluid passage . groove 48 is positioned radially inwardly from heating fluid groove 44 , and radially outwardly of bore 46 and the communicating radial grooves 47 ( see fig8 ). a series of wedge - shaped notches 49 is formed in the upper surface of lower body member 43 in the spaces between radial grooves 47 . the outer edges of notches 49 communicate with groove 48 . an internal header 50 is also formed in lower body member 43 in communication with circumferential working fluid passage groove 48 . a bore 51 intercepts header 50 from the side , and an outlet line 52 is fitted in bore 51 . between the radial grooves 47 and notches 49 , the upper surface of lower body member 43 constitutes a film area 53 . an inlet line 54 is fitted into bore 46 and a pressure regulator 55 for dropping the pressure of incoming working fluid is provided in line 54 . from the foregoing description , it can be seen that when cap 42 is placed over lower body member 43 a closed flow path for working fluid is established which includes inlet line 54 , bore 46 , grooves 47 , film area 53 , notches 49 , groove 48 , header 50 , bore 51 , and outlet line 52 . a vaporizer constructed as shown in fig7 and 8 having a facial area ( the area radially inwardly of groove 48 ) of 1 . 5 square inches was capable of producing vapors at 50 ° f at a rate of 65 . 7 pounds per hour using a heating liquid temperature of 128 ° f . fig9 illustrates somewhat diagrammatically the application of the vaporizer of the invention to a gas plant , as contrasted with the fuel system applications of the invention discussed thus far . the gas plant includes a cabinet or housing 60 , having air inlets 61 and an exhaust stack 62 . mounted inside of cabinet 60 is a gas burner 63 having a supply line 64 and a controller 65 . a vaporizer 66 is mounted in the cabinet above burner 63 in position to receive heat therefrom . the vaporizer 66 may be of the general structure of the vaporizers discussed above in connection with fig4 through 8 , or the structures disclosed in fig1 or fig1 discussed below , with the heating fluid passages omitted , since the body of the vaporizer is heated by radiant and convective heat transfer from the burner 63 . working fluid is introduced to the vaporizer through line 67 , and withdrawn therefrom through line 68 . it then is dropped in pressure through regulator 69 and is passed through line 70 back through the cabinet 60 of the gas plant for additional superheating . it is then led through line 70 to a point of use . a portion of the gas or vapor in line 70 is drawn off through burner control 65 for delivery to burner 63 . fig1 illustrates the application of the principles of the invention to a tubular or annular - type heat exchanger configuration . this configuration is in contrast to that of the embodiments of fig4 through 8 where at least a major part of the working fluid passage is arranged to provide for planar flow of the working fluid . the exchanger of fig1 includes a tubular outer body 71 having an axial bore 72 and side bores 73 and 74 intercepting the axial bore 72 , one near one end of the member 71 and the other near the other end . mounted in axial bore 72 , as by welding 75 , is inner tubular body member 76 . member 76 is provided with an axial bore 77 and inlet and outlet lines 78 and 79 are fitted in the ends thereof . the axial bore 77 of inner tubular member 66 constitutes the heating fluid passage of the exchanger , and since flow of the heating fluid may be in either direction through that passage , lines 78 and 79 may each be given alternate functional designations . thus , line 78 is an inlet line or an outlet line depending upon the flow direction of heating fluid . the outer surface of inner tube 76 is developed as shown in fig1 so that an entrance zone or internal header ( annular in shape ) is formed adjacent side bore 73 . the internal header is designated 78 &# 39 ;. also formed in axial passage 72 by the development of the outer surface of tube 76 is an annular film area 79 &# 39 ;, and an escape zone 80 which extends to a point adjacent the other side bore 74 . lines 81 and 82 are fitted into side bore 73 and 74 , respectively . the arrows appearing on fig1 indicate a flow of working fluid into the unit through line 81 and out of it through line 82 . it should be understood , however , that the flow of working fluid may be in the other direction , in which event escape zone 80 becomes an entrance zone . from the foregoing description it can be seen that the embodiment of the invention shown in fig1 employs the same principles and features as the embodiments discussed earlier , including those of a film area and adjacent entrance and escape zones in the working fluid passage . fig1 through 3 illustrate a vaporizer of the invention combined in a unitary device with a pressure actuated control valve . in fig1 through 3 the vaporizer unit is designated generally as 85 . vaporizer 85 is constructed in two main sections , the vaporizer proper 86 , and the regulator or control valve section 87 . the vaporizer proper 86 , as can be seen from fig1 through 3 , is formed of a generally prismatic rectangular block of material . at one side of the block a horizontal bore 88 , closed at its ends by freeze plugs 89 and 90 , is provided . a tubular insert 91 is mounted in bore 88 by means of o rings 92 and 93 . tubular insert 91 has an axial bore therein 94 , and has a developed outer surface much like that of inner tubular member 76 of the embodiment of fig1 . the function of the developed surface is discussed later hereinbelow . two parallel grooves are formed in the top surface of the block of material forming the vaporizer proper 86 , which grooves intercept bore 88 . in fig3 these grooves are designated 95 and 96 . at the ends of the grooves remote from their interceptions of groove 88 , side bores 97 and 98 are provided which intercept grooves 95 and 96 , respectively . lines 99 and 100 are fitted in bores 97 and 98 . the top side of grooves 95 and 96 is closed by lower body member 101 of the control valve portion 87 of the unit . from the foregoing description it can be seen that the heating fluid circuit through vaporizer proper 86 proceeds through line 99 , bore 97 , groove 98 , axial bore 94 of tubular insert 91 , groove 96 , bore 98 , and line 100 . it should be understood that the flow path of heating fluid may be reversed from that just traced , if desired . in the block of material forming vaporizer proper 86 , in the portion thereof beside axial bore 88 , there is formed in the top surface a relatively deep rectangular groove 102 . for convenience in discussion , the four legs of groove 102 are labeled 102a , 102b , 102c , and 102d . in the corner of groove 102 formed by legs 102a and 102c , the floor of the groove is elevated somewhat , this elevated region being designated 102e . a hole 103 is provided in the floor of groove 102 in the region 102e . immediately beneath hole 103 is a valve bore 104 of larger diameter than hole 103 . the upper end of valve bore 104 forms a valve seat 105 surrounding the lower end of hole 103 . a valve assembly designated generally 106 is threadedly mounted in valve bore 104 . valve assembly 106 includes a cap 107 , a valve stem 108 , a valve member 109 , and a valve spring 110 . as can best be seen in fig2 valve stem 108 passes through hole 103 . it is somewhat larger in diameter above valve member 109 than it is below it , and valve spring 110 is positioned to work between valve member 109 and valve cap 107 . valve spring 110 is biased to urge valve member 109 upwardly to a closed position against valve seat 105 . valve stem 108 is of a length sufficient to extend into the control valve section 87 of the vaporizer as is discussed below . a crossbore 111 connects valve bore with axial bore 88 . lower body member 101 of the control valve section 87 closes the top of groove 102 . a hole is provided so that valve stem 108 may project upwardly through lower body member 101 , and a second hole 112 is provided to establish fluid communication between groove 102 and the control valve section 87 . a side bore 113 intercepts groove 102 , and particularly leg 102d , approximately diagonally across the rectangle of groove 102 from hole 103 . output line 114 is fitted in bore 113 . another side bore 115 intercepts axial bore 88 , and an inlet line 116 is fitted in it . the developed outer surface of tubular insert 91 establishes , with inner surface of bore 88 , an annular working fluid passage , including an entrance zone 91a , a film area 91b , and a small escape zone 91c . from the foregoing description , it can be seen that the flow path through vaporizer proper 86 for working fluid is as follows : inlet line 116 , bore 115 , axial bore 88 ( in the annular space outside of the developed surface of tubular member 91 ) bore 111 , valve bore 104 , hole 103 ( assuming valve member 109 to be open ) groove legs 102a and 102b or groove legs 102c and 102d , bore 113 , and outlet line 114 . the working fluid is therefore in single - walled heat exchange contact with heating fluid during its traverse of bore 88 and legs 102b and 102c of groove 102 , and in somewhat more indirect heat exchange contact with the heating fluid in its traverse of legs 102a and 102d of groove 102 . within the perimeter defined by rectangular groove 102 , a hole 117 is provided in vaporizer proper 86 to save weight and material . the control valve section 87 includes beforementioned lower body member 101 , which has a cylindrically shaped hollow interior 118 . the open top of interior 118 is closed by a flexible diaphragm 119 . above diaphragm 119 is a cap 120 , having an opening therein communicating with the atmosphere . a diaphragm biasing spring 121 works between cap 120 and a washer 122 on the upper surface of diaphragm 119 . shaft 123 is mounted to depend from the lower side of the diaphragm , and arm 124 extends laterally from shaft 123 to contact and bear against valve stem 108 . with the foregoing description of the structure of the unit of fig1 - 3 in hand , its operation can now be outlined . heating liquid from the engine cooling system enters through line 99 or 100 and leaves through the other . liquid or partially vaporized working fluid enters through line 116 . its vapor fraction is increased as it passes through entrance zone 91a , and its vaporization is substantially completed as it passes through the film area 91b in the manner explained above . the vapor then passes through the valve 106 and into rectangular groove 102 , where it is superheated before exiting through line 114 . the bias of spring 121 in control valve section is selected so that it , when added to the pressure of the atmosphere above diaphragm 119 , establishes a suitable ( and selected ) positive pressure in the working fluid passage by holding valve member 109 away from seat 105 . if the working fluid pressure exceeds the desired level or range , valve member 109 will close against seat 105 . when the pressure in the vapor system falls , as occurs when an engine increases its demand for fuel , the diaphragm moves downwardly against the decreased pressure under the influence of the atmosphere and its bias spring to increase the gap between valve member 109 and valve seat 105 , thereby increasing the vapor flow rate and ultimately the vapor sytem pressure . at low flow rates , vaporization of the working fluid is completed and some superheating of the vapor is accomplished in , and even upstream of , the film area 91b . as the flow rate of the working fluid increases , less superheating is achieved in the film area , and at very high flow rates , droplets of liquid may even move downstream of the film area . but these are instantly vaporized as they are flashed through hole 103 of the valve , and superheat is added as the vapor traverses groove 102 . fig1 presents a series of curves showing vapor parameters , and their manner of variation as the working fluid moves from upstream to downstream through the vaporizer . also presented is a curve plotting the cross sectional area of the working fluid passage throughout its relevant length . the curves are based upon the maximum design point of a vaporizer having a 100 lb ./ hr . capacity with a delivery temperature of 60 ° f , handling propane . in the bottom curve , the distance between the heavy line at area = 0 . 00 square inches and the curve represents the cross sectional area of the working fluid passage . it can be seen that the vaporizer includes both an entrance zone upstream of the film area , and an escape zone downstream from it . the curve labelled btu content shows that heat is continually pumped into the working fluid as it moves through the vaporizer . this heat is devoted to vaporizing increasing amounts of the working fluid , as is illustrated by the curve labelled % vapor by weight . the curve labelled velocity shows that the mean velocity increases rapidly as the film area is approached and traversed , due both to the decreased cross sectional area of the passage and to the increasing vapor fraction of the material . the vapor can easily be accelerated to the velocities represented on this curve in the neighborhood of the film area , with only a few pounds of pressure drop , but to accelerate the liquid in the same manner , a pressure drop of a few hundred pounds would be required . the liquid is therefore dammed at the entrance of the film area until it is vaporized or at least reduced to fine droplets capable of passing through the film area and readily vaporizable downstream in the system from it . | 5 |
referring now to fig1 , a computer system 10 , which may be , for example , a general purpose computer or a network intrusion detection system ( an ids ), may receive executable files 12 from a network 14 , such as the internet , or from a storage device 16 such as a hard drive of the computer system 10 . the executable files 12 may be programs directly executable under the operating system of the computer system 10 ( e . g ., “ exe ” or “ bin ”) files or may be “ scripts ” or so - called “ application macros ” executed by another application program . the received executable files 12 may be received by a scanner program 18 incorporating a malware normalizer 20 of the present invention which normalizes the code of the executable files 12 and then provides it to a signature detector program 22 that compares the normalized executable files 12 to a set of standard , previously prepared , malware signatures 24 . referring now to fig2 the malware normalizer 20 of the present invention may provide for a prescreening block 26 which makes an optional predetermination of whether the executable file 12 is likely to be malware or not . this pre - screening is accepting of a significant number of false positives and is intended only to provide improved throughput to the malware normalizer 20 and the signature detector program 22 by eliminating the need to analyze programs that are unlikely to be malicious . depending on the determination by the prescreening block 26 the executable file may be passed along to an unpacking program 28 or bypassed , as indicated by bypass path 30 , without unpacking to the reordering program 31 . at the unpacking program 28 , as will be described further below , executable file 12 is allowed to unpack ( decompress ) or decrypt itself ( if the executable file 12 is packed or encrypted ). as used henceforth the terms “ pack ” and “ unpacking ” shall be considered to refer also to “ encrypt ” and “ decrypt ” and similar functions performed by self - generating code , for example , including optimization , that generally alter the signature of the executable file 12 . the unpacking process of unpacking program 28 may be repeated iteratively , as indicated by path 32 , so as to unpack executable files 12 that have been packed multiple times . the unpacking program 28 may produce a detection signal 33 when the detection of self - generating code is desired ( as opposed to the detection of malware ). at the moment the unpacking or decryption is complete , the unpacked executable file 12 is forwarded to a reordering program 31 . if the executable file 12 does not have packing it is passed directly to the reordering program 31 without modification . the reordering program 31 reorders the instructions of the executable file 12 , as received from the unpacking program 28 into a standard form , as will be described , and then passes the reordered executable file 12 to the dead code remover program 34 . the dead code remover program 34 removes “ semantic nops ” being nonfunctional code ( not necessarily limited to nop instructions ) to provide as an output a normalized executable file 12 that is passed to the signature detector program 22 for comparison to normalized malware signatures 24 . referring still to fig2 , the prescreening block 26 is intended to provide a rough determination of whether the executable file 12 has been packed or encrypted . to the extent that packing programs look for repeating patterns that may be abstracted and expressed more simply ( for example long runs of zeros ) a compressed program will have a greater entropy or randomness . thus the prescreening block 26 in one embodiment may compare the entropy of the executable file 12 against a threshold for the determination of likelihood that the executable file 12 is compressed . the threshold is set high enough that nearly all compressed executable files 12 are passed to the unpacking program 28 even at the risk of including some uncompressed executable files 12 . other methods of prescreening can also be employed including those that consider the source of the file or that look for signatures of common unpacking programs and the like . referring now to fig2 , 3 and 4 , the unpacking program 28 receives the executable files 12 suspected of being packed and loads the file into memory 40 to be controllably executed , for example , by an emulator or in a “ sandbox ” environment as indicated by process block 36 . the emulator or sandbox allows the monitoring “ reads ” and “ writes ” to memory by the executable file 12 with the ability to block the writing of data outside of the sandbox and the ability to freeze the execution of the executable file during the monitoring process based on memory reads and writes . as shown in fig3 , a loaded image 42 of the executable file 12 , including program instructions and data , will be bounded by a logical starting address 44 and an ending address 45 and will begin execution at a start instruction 46 moving throughout the instructions of the executable file 12 as indicated by control flow 48 . during execution , data writes 50 may occur both to external data locations 52 for example to “ external ” memory addresses outside of the loaded image , for example the “ heap ” or the stack of the computer system 10 , or to “ internal ” memory addresses within the loaded image 42 . these internal memory addresses will be tracked per process block 58 of the unpacking program 28 to determine an unpack area 56 . at some point in the execution of the executable file 12 , if the executable file 12 is packed , an unpacker program 54 in the executable file 12 will be invoked performing writes 50 to internal memory addresses of code that is being unpacked . these memory addresses are also tracked per process block 58 of the unpacking program 28 to further define the unpack area 56 which will grow , logically bounded by a first instruction 60 and a last instructions 62 although unpack area 56 need not be absolutely continuous within that range . at decision block 64 of the unpacking program 28 , occurring during the execution of each instruction of the executable file 12 , the unpacking program 28 checks to see if there has been a jump in the control flow 48 to the unpack area 56 indicating that previously written data is now being executed as instructed . this jump is assumed to signal the conclusion of the unpacking process and the beginning of execution of the malware . at this time , a signal 33 is produced indicating that compression was detected . at iteration block 66 , the unpacking program 28 checks to see if the executable file 12 has concluded execution such as may be detected by movement of the control flow 48 out of the loaded image 42 or by a steady state looping such as may be detected , for example , by analyzing a fixed number of executed instructions . so long as the executable file 12 appears to be continuing execution , the iteration block 64 repeats process blocks 36 , 58 , and 64 creating a new unpack area 56 within the loaded image and monitoring the control flow 48 for a jump into the new unpack area 56 . this process is continued to accommodate possible multiple packing operations . at the conclusion all the iteration , as indicated by process block 68 of the unpacking program 28 , the unpacked code , being for example the unpack area 56 of the final iteration or the union of all unpack areas 56 of all iterations , is sent to the reordering program 31 . referring now to fig5 , 6 a , 6 b , and 7 , the reordering program 31 builds a control flow graph of the executable file 12 ( as possibly unpacked ) using for example a disassembler ( to recover the source code from the object code of the executable file 12 ) combined with a control flow graph builder . disassemblers for this purpose are well known in the art and may , for example , include the idapro ™ interactive disassembler commercially available from datarescue of liege , belgium ( www . datarescue . com ). the execution ordered control flow graph may be produced using codesurfer ™ by grammatech , inc . of ithaca , n . y . ( www . grammatech . com ). referring specifically to fig5 , an executable file 12 received from the unpacking program 28 may , for example , include an instruction 70 ( a ) followed by a conditional branch instruction 72 ( b ) followed by an arbitrary instruction 74 ( c ) followed by an unconditional jump instruction 75 ( d ) and an arbitrary instruction 76 ( e ). instruction 72 and 75 are a control flow instructions , that is , they direct the control flow of the executable file 12 , while the remaining instructions are non - control flow instructions . as shown in fig6 a each of these instructions 70 - 76 may represent a node in a control flow graph with control flow paths between them representing edges in a control flow graph . the edge 78 connecting instructions 70 and 72 will be termed a “ fall - through edge ” being any edge linking a non - control flow instruction with its unique control flow successor . the edge 80 connecting instructions 72 and 74 will also be termed a “ fall - through edge ” because it represents the false path of the conditional control flow instruction . the edge 82 connecting instructions 72 and 76 is a conditional jump instruction and the edge 84 connecting instructions 72 and 76 is an unconditional jump instruction . per fig7 , and as shown by process block 90 , the reordering program 31 of fig2 tests each node of the control flow graph of fig6 a to see that each node with at least one unconditional jump edge also has exactly one fall - through edge per decision block 92 . in this example , node 76 receives an unconditional jump edge 84 and when the test is applied to node 76 it is apparent that node 76 does not have a fall - through edge . in this case , and as shown by process block 94 , the executable file 12 is edited by the reordering program 31 to remove the unconditional jump instruction 75 and replace it with its target 76 as shown in fig6 b . when there is more than one unconditional jump predecessor for a given node ( and that node has no fall - through edges ) an arbitrary unconditional jump instruction may be eliminated . in a preferred embodiment , the unconditional jump instruction that is eliminated is the last unconditional jump predecessor in the order of the control flow graph . in a more sophisticated embodiment , conditional jump instructions that always jump are detected and treated as unconditional jump instructions . referring now to fig2 , 8 and 9 , after code reordering per the reordering program 31 , the program is received by a dead code remover program 34 . unlike conventional dead code removal tools that collect lists of non - functional code , for example , strings all of nop instructions , or successive incrementing and decrementing of a variable , and their functional synonyms in a predefined table , the present invention employs a semantic analysis approach that may detect nonfunctional code that has not previously been observed and catalogued . referring to fig9 , at a first step of this process indicated by process block 96 , the dead code remover program 34 searches for “ hammocks ” in the executable files 12 . hammocks are sections of the control flow graph having a single entry node and a single exit node , that is , there are no nodes between the entry and exit node that are connected by edges to nodes outside the hammock . for example , as shown in fig8 , hammock 98 may be identified by its single entry node 100 and single exit node 102 . generally hammocks will occur with structured “ if ”, “ while ”, and “ repeat ” statements but may also occur in other contexts . per process block 104 of the dead code remover program 34 , the execution of the instructions within the hammock 98 ( for example using the emulator or sandbox described above ) is monitored keeping track of each write 106 performed by an instruction in the hammock 98 , for example , by enrolling those written values and their addresses in a buffer table 108 to be refreshed at each hammock 98 . if a given address receives a multiple write , the last written value is the one held in the table 108 . the table 108 also preserves the original values 112 for each of the written values 110 . this population of the table 108 may also be performed by a static analysis of the instructions of the hammock 98 . at the conclusion of the execution of the hammock 98 , that is when the hammock 98 is exited from at node 102 , per process block 107 , the original values 112 and written values 110 are compared . if they are identical , then the hammock represents nonfunctional or dead code insofar as there has been no net change in any variable . referring again to fig2 upon completion of the operation of the dead code remover program 34 , the resulting processed and normalized executable file 12 is forwarded to the signature detector program 22 as seen in fig1 . in this case it is important that the signatures 24 also be of normalized malware executable files . it is specifically intended that the present invention not be limited to the embodiments and illustrations contained herein , but include modified forms of those embodiments including portions of the embodiments and combinations of elements of different embodiments as come within the scope of the following claims . | 6 |
fig1 depicts a vehicle according to the present invention . as shown , the tires of the vehicle extend beyond the outer perimeter of the body of the vehicle . in particular , the front wheels 3 extend past the front of the vehicle 2 . in one embodiment of the invention , the front wheels 3 also extend beyond the side of the chassis 6 . the rear wheel 4 also protrudes from the back of the vehicle to providing a rear impact point . the tires provide impact points 1 and 5 . the protruding tires effectively provide front and rear bumpers for the vehicle . in a preferred embodiment , the vehicle is steered using both the front and rear wheels . alternatively , the steering is user selectable , i . e ., the front wheels , the rear wheels , or both sets of wheels can be used for steering . the steering can be accomplished using hydraulics , mechanical linkages , or a combination of both . in one embodiment , the vehicle has a frame that includes a roll cage and a floor pan , for defining a compartment for carrying passengers and a power plant . the frame comprises at least two substantially elliptical roll bars and the floor pan , or alternatively , a plurality of polygon shaped roll bar assemblies and a floor pan . in one embodiment , the roll bars are constructed using a lattice - like construction , thereby increasing the strength of the roll bars . one of the horizontally disposed roll bars is integrally bonded to the floor pan at the perimeter of the floor pan . at least one additional roll bar positioned inboard of the horizontal roll bars and at an inclined angle relative to said floor pan . the horizontal roll bars are connected to the inclined roll bar at each intersection point . the front wheels 3 and the rear wheels 4 are exposed and extend beyond the outer perimeter of the elliptical roll bars to form bumpers . in a preferred embodiment , to reduce drag , approximately 90 % of the air travels over the top of the vehicle . the remaining air is channeled under the vehicle or down the side of the vehicle . in a preferred embodiment , a portion of the air is used for cooling the motor , radiator , brake rotors , and the like . the vehicle is steered by rotating rear assembly 7 . the vehicle can also use front steering . however , the vehicle uses rear steering or jet propulsion in amphibious mode . rear steering with front steering provides a smaller turning radius than conventional front steering vehicles . fig3 is a depiction of the vehicle according to one embodiment of the invention . as shown , the frame includes a roll bar 8 . in a preferred embodiment , the frame has a length appropriate to accommodate three seats , as discussed further below . as shown in fig3 , the frame and roll bar are extendable to accommodate additional seating . without adding additional wheels , the chassis can be extended to accommodate 5 or more seats . the extended chassis can be used as a taxi , bus , or the like . because the frame is preferably constructed from stainless steel or an equivalent , it is strong enough to be extended . in one embodiment , the frame includes at least two essentially d - shaped roll bars and a floor pan . one horizontally disposed roll bar is integrally bonded to said floor pan at the perimeter thereof , and at a second roll bar is positioned inboard of said horizontal roll bars and at an inclined angle relative to said floor pan . the horizontal roll bar is connected to the inclined roll bar at each intersection point forming an exoskeleton around the compartment . the tires extend beyond the perimeter of the exoskeleton . this creates a non - compressible occupant compartment of a rigid , unified structure with additional protection . in another embodiment , the frame is formed using a lattice - like structure as shown in fig3 . in this embodiment , the frame and roll bar are formed to create the occupant compartment . the tires protrude beyond the perimeter of the vehicle to act as bumpers providing additional protection . fig4 is a top view of the vehicle according to one embodiment of the invention . shown is the seating position according to one embodiment of the invention . the driver sits mid - frame in position 9 and passengers sit in the back in seats 10 . additional seats are added behind seats 10 . the disclosed vehicle is drivable in both right - hand drive and left - hand drive countries without modification because the driver sits approximately in the middle of the vehicle . in one embodiment , there is a storage area between the front wheels . additionally , as shown , the tires extend beyond the perimeter of the frame . in one embodiment , the vehicle is designed for dual use , both dry land and marine applications . the vehicle requires a dual propulsion and steering system when used in a marine environment . this system is described as “ hydro jet steering and drive .” as shown in fig5 , the rear wheel is preferably two wheels separated by a short axle . each wheel hub has protruding spokes 12 . these spokes 12 act as paddle wheels when the vehicle is operated in amphibious conditions . between the two wheels are baffles 13 that direct water between the two wheels and direct it backwards . as seen with more detail in fig6 , impeller 14 scoops and forces water in direction 15 . the protruding spokes direct the water medially towards the impeller 14 . the configuration of the wheels creates a vertical propeller to propel the vehicle in water . as shown in fig7 , the baffles 13 direct the water . in one embodiment , a nozzle 17 further directs the water . the nozzle 17 is affixed to the rear wheel assembly so that it moves with the assembly . in other words , the steering wheel that controls the rear wheel also controls the nozzle . alternatively , the nozzle is separate from the wheel assembly but is controlled by the steering wheel . the nozzle increases the force of the water to propel the vehicle . as shown in fig8 , in another embodiment of the amphibious propulsion system , instead of having two paddle wheels on a short axle creating a water jet , the regular broad back wheel or double wheel 4 is retained and two water jets 30 and 31 , one in each rear quarter of the vehicle is used . the water jets provide propulsion when in water . water jets , such as those typically used on jet skis would allow for more rapid propulsion . this double set of water jet engines would also allow for steering the vessel by decreasing the speed of one water jet to turn the vehicle to one side or the other . in one embodiment , two throttles , as used in motor boats , situated in front of the driver on the dashboard control the water jets . in an alternative embodiment , sensors in the steering wheel control the water jets such that turning the steering wheel causes higher or lower output to the water jets . alternatively , rudders are used to steer the vehicle . as shown in fig8 and 9 , dual turbine or impeller type submersible drive units 35 pull in water from the underside of a vehicle 33 and evacuate that material , now energized , via an exhaust passage 32 . water inlet 33 preferably remains closed during normal operation to reduce drag , only opening in amphibious mode . hydraulic or electric motors provide a power source for turbines . in a preferred embodiment , the drivetrain includes a transfer case or transmission adapted to transfer power from the drive wheels to the water propulsion means . the pressurized fluid is forced back to its source which will oppose the pressure and move the vehicle in the opposite direction . the vehicle &# 39 ; s steering system is coupled to a proportional valve ( hydraulic ) or rheostat ( electric ) which controls the speed of individual motors fitted to the rear underside of the vehicle and effects steering by reducing the speed and pressure applied to one side of the vehicle while increasing the speed and pressure to the opposite side . in another embodiment , a mechanical system is used . the mechanical system increases or reduces the inlet aperture . the effect of the fluid speed increase and opposite reduction of fluid speed causes the vehicle to turn while making forward motion . while traveling in the opposite direction , the motors can be reversed and steering can be effected in precisely the same way . a unique feature of the vehicle is shown in fig1 . if one of the rear tires becomes flat , the vehicle rides on the remaining tire without a significant loss of performance . if one of the front tires 3 , 18 becomes flat , one of the inflated rear tires is swapped with the flat front tire . the vehicle can continue until the flat tire is repaired . because there are two tires in the rear of the vehicle in close proximity to one another , one tire can be flat while the vehicle travels on the remaining tire . alternatively , the flat tire can be stored in one of the vehicle &# 39 ; s storage areas 28 , 29 , or mounted on the roof 30 . fig1 is a rear view of the vehicle . in one embodiment , there are leds , bulbs , fiber optics , or other lighting device 20 on the roll bar . in other embodiments , the lighting device is on another rear facing portion of the vehicle . in one embodiment , there is a matching set of lighting devices in the front of the vehicle . preferably , the front facing lighting devices are yellow and the rear facing lighting devices are red . both the front and rear lighting devices get brighter when the driver depresses the brake peddle . the brightening of the lighting devices alerts surrounding drivers of an impending stop . the front lighting devices also alert pedestrians in crosswalks and the like that the vehicle is braking . lifting hooks 27 , as shown in fig1 , are provided on the roll bar . the lifting hooks can be used to lift the vehicle onto a truck or boat for transport or to lift the vehicle to work on it in a shop . the lifting hooks can also be used in air - lift applications to load the vehicles onto planes or large helicopters . additionally a parachute can be attached to the hooks 27 . the vehicle is light - weight enough to drop by parachute and strong enough to survive a drop by parachute . the vehicle has at least one rear mounted camera . the camera can be a ccd camera , a digital or analog camera , or the like . preferably there are at least two cameras one each side of the vehicle , and one in the rear of the vehicle that provide a 180 degree view of the rear of the vehicle . the two side cameras can have wide angle lenses to further eliminate blind spots . as shown in fig1 , three screens 24 , 25 , and 26 are mounted in front of the driver , providing a panoramic view of the rear from cameras 21 and 22 . cameras 21 are mounted on the sides of the vehicle . the third camera 22 is mounted on the midline on the rear of the vehicle . preferably screen 26 is larger and dedicated to display the view from camera 22 . the screens 24 and 25 show the side of the vehicle to assist the driver in determining the location of other cars , pedestrians , or the like . the screen can be one or a plurality of screens . the screens can be led displays , lcd displays , plasma screens , crt displays , touch screen , a heads - up display , or the like . in one embodiment , one of the screens switches from rear display to a gps display and the remaining two screens display the panoramic view of the rear of the vehicle . further , one of the screens can switch to display climate control , radio control , and the like . preferably , the screen used for additional displays is screen 26 . fig1 shows possible storage locations for the vehicle . in one embodiment the vehicle preferably has a front , rear , and roof trunk . the front trunk 28 , the rear trunk 29 , and the roof trunk 30 each have luggage matching the shape of the trunk to maximize storage . the luggage may be only a portion of the respective trunk . for example , there may be three pieces of fitted luggage for the roof trunk , each being a third of the trunk . these smaller pieces of luggage would be more maneuverable than one large piece of luggage . while this invention has been described by reference to preferred embodiments , it should be understood that numerous changes could be made within the spirit and scope of the inventive concepts described . accordingly , it is intended that the invention not be limited to the disclosed embodiment , but that it have the full scope permitted by the language of the following claims . | 1 |
the present invention relates to a holographic direct - view display with at least one controllable spatial light modulator which comprises modulator cells 7 ′, 7 ″ which are arranged in a matrix 7 , and where each modulator cell 7 ′, 7 ″ is assigned to an apodisation mask 6 ′, 6 ″ which has an apodisation function . the light modulator modulates the phase and / or amplitude of sufficiently coherent light . the phase and / or amplitude values which are encoded on the light modulator can for example represent a hologram which serves to reconstruct a three - dimensional object in a holographic direct - view display . various combinations of light modulator and apodisation masks are possible . for example , a light modulator which modulates the phase only can be combined with an apodisation mask which apodises the amplitude only , and vice versa . generally , both light modulator and apodisation mask can be used for a complex - valued modulation . determining the apodisation function for apodisation masks of modulator cells according to this invention is based on the approach that — in addition to the fix initial values — target values are defined for parameters to be set . here , a complex amplitude shall specifically be set in the far field of the slm which corresponds with the fourier plane of the slm . the complex amplitude is realised by way of a fourier transformation from the slm to the far field . specifically , the parameter of luminous intensity in the fourier plane is given . the luminous intensity shall be widely reduced in preferred diffraction orders or just in a selected range of the preferred diffraction orders . the shape of the active region of a modulator cell represents the position of the diffraction orders in the far field and thus in the fourier plane . since for example in a holographic direct - view display the observer eyes are situated there as well , diffraction orders of the hologram which is encoded on the slm and which is intended for the left eye can hit the right eye and interfere with the hologram which is intended for the right eye , and vice versa . thanks to the combination of modulator cells of the light modulator and apodisation mask , an apodisation function in an apodisation mask which is computed with the respective parameters causes the incident light to be modulated such that the intensity values in the fourier plane come very close to the intensity profile which is given there or which are identical to that latter . another parameter for the apodisation function can be a phase function with constant amplitude . other parameters in conjunction with the light modulation which are not specifically mentioned here can also be optimised with the method according to this invention for determining an apodisation function for apodisation masks . the target values can be approximated with the help of an iterative process according to an embodiment of the present invention , thus optimising the intensity profile . the apodisation masks are designed as an array and are disposed ideally as close as possible to the light - modulating optical layer of at least one slm . the array is either disposed directly on at least one slm as an additional front or rear layer or integrated into the cover glass of the at least one slm . further , the division bars between the active regions of a modulator cell can already be designed such that they have the effect of an apodisation array . the apodisation masks are aligned with the given arrangement of modulator cells . according to an embodiment , in addition to the slm on which e . g . hologram values of a 3d scene are encoded , the holographic direct - view display can comprise a prism array which comprises electrowetting cells as a further slm which preferably modulates a wave front in its direction of propagation , but which can also modulate the phase and / or amplitude of that wave front . fig1 a shows schematically a top view of a holographic direct - view display according to the prior art , i . e . without apodisation mask . the numeral 1 denotes a holographic display device , 2 l and 2 r denote the reconstruction beams of an object point 5 of a three - dimensional scene , 3 l and 3 r denote the visibility regions , also referred to as observer windows , for a respective left and right observer eye in the far field of the display device 1 , and 4 denotes the intensity distribution in the visibility region 3 r for the right observer eye . the intensity distribution 4 of the reconstruction beam 2 r also shows the occurring higher diffraction orders , which cause crosstalking , thus adversely affecting the left observer eye . fig1 b shows schematically a top view of a holographic direct - view display according to this invention with an array of apodisation masks 6 on the display device 1 . the reconstruction beam 2 r of the object point 5 generates in the visibility region 3 r for the right observer eye an intensity distribution 4 ′. at the position of the left observer eye the higher diffraction orders of this intensity distribution 4 ′ are reduced such that 20 they do not disturb the other observer eye . fig2 is a graphic representation which shows an apodisation function which can be realised in an apodisation mask for a modulator cell . this apodisation function uniformly reduces diffraction orders starting with the ± 2nd order of diffracted light according to a target . the exemplary computation was only performed for one dimension in this figure . generally , the areal extent of the modulator cell in two dimensions must be considered in the computation . in the example , the modulator cells are assumed to have a rectangular shape and thus to exhibit a rectangular transmittance curve . for computing the apodisation function it is important to know the distance between two adjacent modulator cells of the light modulator . this allows the location of the diffraction orders to be found precisely in a matrix of modulator cells , in particular if only individual higher diffraction orders are to be reduced . knowing the distance is less important if the intensities are to be reduced in contiguous ranges of neighbouring diffraction orders . at a defined position at a distance d from the light modulator , a diffraction order has the extent d · λ / p in one dimension , where λ is the wavelength of the light and p is the distance ( pitch ) between the centres of two adjacent modulator cells of the same given group in that dimension . fig3 shows the diffraction pattern of a single modulator cell with and without apodisation mask in the fourier plane of the light modulator , where the amplitudes are shown on a logarithmic scale . curve k 1 shows the diffraction pattern which is computed without apodisation as a sinc function for a rectangular transmittance which is constant across the aperture of the modulator cell . such a transmittance profile where the amplitude is set to the value 1 at all scan points within the aperture of the modulator cell is also used as the initial value for the iterative process with which curve k 2 was computed . in a modulator cell with an aperture which is as large as the cell distance , the distance between two minima of the sinc function would correspond with the extent of a diffraction order . if the aperture is smaller than the cell distance , the diffraction orders are smaller by the same ratio of aperture and cell distance . the curve k 2 shows an amplitude profile in the fourier plane which was computed with the help of the iterative process , resulting from the apodisation function of fig2 . the iterative process was terminated after five iteration steps and the result was used in the computation of the apodisation function . the relative intensities of the higher diffraction orders of k 2 — in the diagram left and right of the central lobe — are clearly reduced compared to k 1 . because here a symmetrical reduction of the positive and negative diffraction orders was stipulated , the result of the computation is a distribution of real amplitude or intensity values in the apodisation function . this apodisation function can be realised in a first embodiment of an apodisation mask for uniform reduction of higher diffraction orders . the result of the computation is qualitatively similar to the curve which would be obtained with conventional analytical apodisation functions . the example shows that the iterative process can also be applied to a general case . the advantages of using the iterative process for modifying an apodisation function will become even clearer in the second embodiment . the diagrams in fig4 to 6 illustrate a second embodiment of an apodisation mask in which an apodisation function is realised which only reduces negative diffraction orders . an application of such an embodiment would be a holographic direct - view display with a light modulator where one group of modulator cells are used for the generation of a visibility region for the left eye and another group of modulator cells are used for the generation of a visibility region for the right eye . in a light modulator of a holographic display for generating a reconstruction , the fourier plane is at the same time the plane where the visibility region is situated in which the reconstruction is visible . cross - talking of the left visibility region to the right eye is then e . g . only affected by the intensity in preferred positive diffraction orders of the respective group of modulator cells . cross - talking from the right visibility region to the left eye is only affected by negative diffraction orders of the other group of modulator cells , so that only the negative diffraction orders of that other group must be reduced . fig4 shows the amplitude profiles of the diffraction pattern in the fourier plane scaled to 1 for a reduction of diffraction orders with a cosine - shaped curve of the apodisation function ( curve k 3 ) and the result of the iterative computation with a reduction only of negative diffraction orders ( curve k 4 ). the intensity profile of curve k 4 was computed with iteration steps . this reduces the negative higher diffraction orders about as well as with the cosine - shaped apodisation function . the positive higher diffraction orders are about as high as in the diffraction pattern of the rectangular transmittance profile without apodisation , i . e . of the sinc function k 1 in fig3 . as regards the remaining intensity in the higher diffraction orders , using only the negative diffraction orders does not show any advantage in this embodiment . the advantage will only become clear when the apodisation profile in the modulator cell is considered which causes the respective reduction of negative orders . fig5 and 6 are graphic representations of an amplitude profile and of a phase profile of an apodisation function of complex values across a modulator cell according to fig4 . fig5 shows in addition to the curve m 4 of the amplitude profile of complex values the amplitude profile of a cosine - shaped apodisation as curve m 3 . in this cosine 10 shaped apodisation , the phase is constant across the modulator cell . the amplitude profile of the cosine - shaped apodisation function causes light to be absorbed in the marginal areas of the modulator cell . altogether , an apodisation mask which is provided with this apodisation function clearly reduces the total transmittance of a modulator cell . it is 50 % if the apodisation is only carried out in one dimension , and 15 25 % in the case of a two - dimensional cosine apodisation . the 50 % correspond with the mean value of the squared cosine ( intensity = amplitude squared ) between − π / 2 and π / 2 . this reduces the luminous intensity in the higher diffraction orders relative to the zeroth diffraction order , but the absolute intensity will disadvantageously be reduced equally in all diffraction orders , including the zeroth one . this cannot be seen in fig4 . there , the amplitude profiles are normalised to 1 to facilitate the comparison of the reduction of higher orders . in contrast , the transmittance with the apodisation function which is found using the iterative process is much higher . referring to fig5 , the amplitude of the curve m 4 and thus the intensity is almost 1 in the central region of the modulator cell , and it declines slightly towards the edges . the restriction to the reduction of negative higher diffraction orders shows an about equally good result in these diffraction orders , but without the above - mentioned disadvantage of a substantial loss in intensity in the other used diffraction orders . the resulting apodisation function is complex - valued , because the reduction of higher orders is not symmetrical to the zeroth order . due to the symmetrical behaviour of the diffraction orders , an apodisation function for the reduction of all positive higher diffraction orders can be obtained without a new iterative process in that the amplitude profile of the apodisation function is chosen to be the same , but the phase profile is mirrored . in a holographic direct - view display with a light modulator where one group of modulator cells is used for the generation of a visibility region for the left eye and another group for the right eye , the apodisation mask would have the amplitude profile as shown in fig5 , curve m 4 , for all modulator cells . as regards the phase profile , however , one group of modulator cells would have the profile as shown in fig6 , and the other group would have a phase profile which is mirrored to this phase profile . it becomes apparent from what has been said above that the modified profile of the apodisation function cannot be described simply by one equation . the second embodiment shows that the method can be used generally in applications where no analytic apodisation functions are known . a further optimisation of the apodisation function is possible if not all positive or all negative higher diffraction orders are reduced , but only preferred diffraction orders . in the holographic direct - view display discussed here , these are preferably those diffraction orders which hit the neighbouring eye . which orders are embraced by this definition depends on parameters like the cell distance ( pitch ) of the modulator cells and the preferred observer distance to the display . the affected orders can for example be the + 3rd and + 4th or the − 3rd and − 4th diffraction order . in a holographic direct - view display where the modulator cells are not fixedly assigned with the left or right eye , it can make sense to compute the apodisation function such that preferred orders such as the + 3rd and + 4th or the − 3rd and − 4th diffraction order are reduced in the same way for all modulator cells . this applies for example to holograms which are displayed sequentially to the left and right eye . alternatively , it applies to an observer tracking feature in a display which assigns a certain modulator cell to the left eye for one observer position and to the right eye for another observer position . cross - talking to the respective other eye can then be reduced on either side with the same modulator cells . such an apodisation function has advantages over the uniform reduction of all higher diffraction orders . fig7 shows the amplitude profile k 5 normalised to 1 of the diffraction pattern in the fourier plane for a reduction of a region of preferred diffraction orders ( indicated by arrows in the diagram ). here , the reduction is better than with a cosine - shaped apodisation by the curve k 3 in fig4 . fig8 shows the amplitude profile of curve m 5 over a modulator cell according to fig7 . because of the symmetrical profile , the apodisation function is here revalued again . the phase is also constantly zero . with a transmittance of about 62 % relative to a modulator cell without apodisation mask , the transmittance is higher than in the case of a cosine - shaped apodisation , where it would amount to about 50 % only . in other applications , the iterative computation — with an according definition of target values — can also yield an increase in the intensity values of preferred diffraction orders . fig9 shows schematically a detail with regularly arranged modulator cells 7 ′, 7 ″ of a light modulator , each of which being assigned with an apodisation mask 6 ′, 6 ″ with a one dimensionally computed apodisation function . one - dimensional here means that the amplitude and phase values of the apodisation function only change in one direction , here horizontally , and are the identical in the orthogonal direction , here vertically , for different positions in the modulator cell 7 ′, 7 ″. further , in this example there is only one group of modulator cells , this means that all modulator cells 7 ′, 7 ″ have the same apodisation function . the diagram in fig1 shows schematically a detail with regularly arranged modulator cells 7 ′, 7 ″, which form two groups of modulator cells . the apodisation mask 6 ′, 6 ″ comprises for both groups a different apodisation function which is additionally always computed two - dimensionally . these groups of modulator cells can be used for different purposes , and the apodisation function is computed separately for each group . two - dimensional here means that the amplitude and phase values of the apodisation function change in two directions , horizontally and vertically , in the modulator cell . fig1 shows schematically the diffraction pattern of a square modulator cell as a greyscale profile in two dimensions , which is realised by a two - dimensional apodisation function . the relative brightness is shown in a non - linear way . this diagram serves as an example for a reduction of a range of preferred diffraction orders . similar to fig1 , only those diffraction orders are reduced which would fall on the right or left neighbouring eye if the other eye is situated in the zeroth diffraction order in a holographic direct - view display . the range of reduced diffraction orders is also confined vertically , which is shown in the form of the two black rectangles in the drawing . this result is achieved with an apodisation function which has a transmittance of about 77 %. another example of the application of groups of modulator cells with different apodisation functions is the presentation of 3d objects in colour . in many types of light modulators , a coloured representation is achieved by way of spatial interleaving of modulator cells of different primary colours , which are for example obtained with the help of red , green or blue colour filters . with such spatial interleaving of colours , the modulator cells of each primary colour form a given group , where different apodisation functions are found for each of those groups . if a coherent illumination is used , it must be noted when finding the apodisation function that the width of a diffraction order changes in proportion with the wavelength . in a holographic direct - view display with visibility regions for the left / right eye , where the disturbing cross - talking between the two visibility regions is to be prevented with the help of an apodisation mask , the higher diffraction orders for red , green and blue light have different positions in relation to the neighbouring eye . to achieve a substantial reduction of the diffraction orders , the apodisation function must therefore be computed separately with different set - point values in the fourier plane for the groups of modulator cells of each individual colour . the division of the modulator cells of a light modulator in colour groups can be combined with other systems of group divisions . if in a 3d display modulator cells are additionally fixed assigned to the left or right eye , then those modulator cells for red light and left eye can form one group for which an apodisation function is found , for example . it is a further advantage of this invention that for finding an apodisation function for a group of modulator cells or for at least one light modulator in the holographic directview display an iterative process is carried out only once offline in a computing unit . in contrast to other applications of iterative algorithms , the computational load and the required computing time do not play a role then . now , a method for determining an optimised apodisation function for apodisation masks which are assigned to regularly arranged modulator cells of a spatial light modulator will be described , said method including an iterative process . first , intensity values are defined to serve as set - point values in preferred diffraction orders or sections thereof for a defined position in the optical path for carrying out an iterative process . after having defined an apodisation function as an initial apodisation function , with the help of the known shape and size of a modulator cell of the given group of modulator cells the transmittance profile of the modulator cell is represented by a number of scan points in a grid inside and outside the modulator cell . a transmittance profile is generally understood to be an amplitude profile or an amplitude and phase profile in the form of complex values . the grid of these scan points can be matched to the resolution with which a transmittance profile is technologically feasible to be made across a modulator cell if the point resolution of the manufacturing process is limited . ideally , an analogue transmittance profile is generally desired . for example , a modulator cell with a size of 60 × 60 μm where the transmittance profile is to be realised with a resolution of 1 μm can be represented by 60 scan points in each dimension . if it is technologically feasible to manufacture a continuous transmittance profile , the latter can still be approximated in the computation by scan points . the scan points which represent the transmittance profile within the modulator cell are given initial phase and amplitude values . in the most simple case , this can be a rectangular function with the transmittance of 1 within the aperture of the modulator cell , or any other known analytical apodisation function . there is no transmittance outside the aperture of the modulator cell , which is why scan points which are situated there are set to zero . an initial apodisation function is provided with the given initial values , and this function is optimised with the help of an iterative process . it is in particular the distribution of intensity values in the fourier plane of the light modulator which is optimised . the phase and amplitude values are transformed from the plane of the light modulator to its fourier plane , whereby the fourier plane is given a distribution of amplitude values or complex values over multiple diffraction orders . since the computation is performed with the help of a fourier transformation , the number of diffraction orders in the fourier plane which are computed corresponds with the number of scan points within the modulator cell ( aperture and cell margins ), and the number of complex values within a diffraction order in the fourier plane corresponds with the ratio of total number of scan points and scan points within a modulator cell . in the fourier plane , the amplitude values or complex values are replaced by set point values in the given diffraction orders or section thereof , and in the remaining diffraction orders the above - mentioned values are taken from the transformation and back - transformed to the plane of the light modulator . in the plane of the light modulator , the amplitude values or complex values within the aperture of the modulator cells which are computed by way of back - transformation are carried forward to the next iteration step , and the amplitude values or complex values which lie outside the aperture of the modulator cells are set to zero . now , another iteration step with a transformation of the given values to the fourier plane can be started . the iterative process is either terminated after a predefined number of iteration steps , or when another predefined termination criterion is satisfied . it is for example possible to compare the setpoint values in higher diffraction orders with the actual values in the fourier plane before a replacement as a termination criterion . the iteration will be terminated if the deviations of the actual values from the setpoint values falls below a certain threshold . complex values which are the computed result of a fourier transformation between the plane of a light modulator and its fourier plane in one iteration step in one of these two planes are referred to as actual values here . it is possible to introduce further conditions for the cycle of the iterative process . for example , it is possible to specify that the amplitude and phase values are quantized within the modulator cell , and that those quantised values are used for the apodisation function which have the smallest difference to the respective actual value instead of carrying over actual values in each iteration step for the scan points in the modulator cell . for this , the amplitudes of the actual values are preferably normalised such that their range of values matches that of the quantised values . a normalisation to a range of between 0 and 1 can be achieved with the help of a division by the maximum amplitude . such a computation of a quantised apodisation function is particularly sensible if the apodisation function is computed in the context of a certain manufacturing process of the apodisation mask and if only a limited number of different greyscale values or phase values can be realised with that method . a special case of it is a binary apodisation mask which only contains black and fully transparent sections , i . e . two quantisation steps . in another modification of the method , it can be specified that the apodisation function is a phase - only function . a phase function has the advantage that the transmittance of the light modulator is not reduced by the apodisation mask . for a phase function , the phase part of a complex - valued actual value is taken over and its absolute value is set to 1 at the scan points within the aperture of the modulator cell in each iteration step . for reducing only negative or only positive orders , it is for example possible to use a phase - only function . although it delivers remaining intensity values which are somewhat higher in these diffraction orders in contrast to the curve k 4 in fig4 , this result is achieved completely without any reduction in transmittance of the light modulator . another option for the termination criterion is to set the amplitude to a minimum value . according to a certain method for manufacturing an apodisation mask , it makes sense to choose the scan points for the computation depending on the size of the modulator cell such that their distance either corresponds with the spatial resolution of that mask or is slightly larger , so that the apodisation mask can be made by way of interpolation between the scan points . the advantage of an iterative process for determining the apodisation function is that an apodisation function which is optimised to the specific application can be computed and realised in an apodisation mask . in contrast , standard apodisation functions only allow a general reduction of the light intensity uniformly in all higher diffraction orders , where the reduction in intensity typically outweighs the intensity which is optimised for a certain higher diffraction order . moreover , the reduction in transmittance of the light modulator is lower when using the apodisation function which is optimised to a certain application than when using a standard apodisation function . the apodisation masks which are provided with the determined apodisation function realise the desired amplitude transparency in the controllable light modulator and thus a reduction of higher diffraction orders . this light modulator can be used in a holographic direct - view display with visibility regions in the fourier plane which are assigned separately to a left / right eye , or in a stereoscopic display for the presentation of spatial objects to observer eyes . in the latter type of display , an illumination with coherent light would be essential . with the help of the apodisation function it is achieved that cross - talking between the visibility regions of the stereo views between left and right eye is minimised . if in the above - mentioned displays a spatial interleaving of visibility regions is realised which are generated at a defined distance to the observer , and if the modulator cells are fixedly assigned to a left or right observer eye , then groups of modulator cells can be specified such that the diffracted light of each group generates visibility regions in the fourier plane which are assigned to the respective observer eyes . the set luminous intensity of the one group is minimised at a given observer distance at the observer eye of the other group and vice versa . in this case , the modulator cells for the left observer eyes exhibit an apodisation function which differs from that of the modulator cells for the right observer eyes . for modulator cells of a controllable light modulator , apodisation masks are designed with which the light modulator can preferably realise an individually specified intensity distribution in the diffraction orders of diffracted coherent light . for this , an apodisation function for the apodisation masks was determined , where target values of luminous intensities in given higher diffraction orders must be considered of in a simplified manner in the computation . it is technologically feasible that the thus modified apodisation function is realised in an apodisation mask . further , it is possible either to give the apodisation function a continuous profile or to realise an apodisation function with discrete values in single steps across the modulator cell in the apodisation mask . this invention also allows to use such amplitude and / or phase profiles in modulator cells as apodisation functions which cannot be described by an analytical function . the apodisation is here preferably made possible with simple functions ( cosine etc .) or , in the most simple case , with binary steps . further , disturbing margin effects in modulator cells can be weakened by an apodised intensity or phase profile in that for example the margin of the modulator cell is darkened or cut off . this also allows the reconstruction quality to be improved in the visibility region itself . the invention can be applied both in modulators with liquid crystal cells and in modulators with electrowetting cells or other types of cells . the slm and thus the holographic or autostereoscopic displays can either be of a reflective or of a transmissive type . the displays which are described in this invention are direct - view displays . in the case mems - based reflective piston micro - mirror arrays are used as slms , an array of apodisation masks can be realised in that a modulator cell is given a reflectivity gradient . | 6 |
referring to the drawings silicon process wafers 11 to be metallized are disposed on an inert , e . g . silica , boat or carrier 12 and placed in a furnace chamber 13 sealed by a door 14 and gasket 15 . the furnace 13 is evacuated via a side entry tube 16 , heated to the required deposition temperature and purged with an inert gas , e . g . argon , supplied via a valve 17 and flowmeter 18 from a gas supply manifold 19 feeding a tube 20 communicating with the furnace 13 . after purging the gas supply is turned off and the furnace is again evacuated . the process wafers 11 may in some applications be cleaned by admitting e . g . hydrogen chloride vapour via the manifold 19 into the furnace 13 following which the furnace is again evacuated , although in many cases this cleaning step may be omitted . advantageously the process wafers may next be exposed to titanium tetrachloride vapour via manifold 19 , as shown in fig2 following which the furnace is re - evacuated . deposition of a silicon / aluminum alloy on the wafers is effected by admitting an aluminum alkyl vapour for example , tiba , or mixtures of aluminum alkyls , from a temperature controlled reservoir 21 containing the liquid alkyls via a valve 22 into the furnace 13 and simultaneously admitting silane via the manifold 19 into the furnace 13 . the alloy deposits spontaneously on the process wafers 11 by a thermal decomposition process . the process of incorporation of silicon in the deposited alloy film appears to be self limiting according to the solubility limit of the silicon in aluminum at the deposition temperature . thus the concentration of silane is not critical although , of course , if the silane concentration is far in excess of that required to saturate the aluminum the film deposition rate is drastically reduced and poor quality films are obtained . silane partial pressures in the range of 0 . 15 to 2 . 0 torr have been employed . we prefer , however , to employ a partial pressure of silane in the range of 0 . 25 to 0 . 3 torr . when the deposition is complete the silane and aluminum alkyl supplies are switched off , and the furnace is brought up to atmospheric pressure with inert purge gas . the coated process wafers are then ready for patterning and no further annealing or alloying is required . in the alternative sequential deposition process the wafers 11 , preferably surface activated with titanium tetrachloride vapour , are exposed to tiba vapour supplied from the temperature controlled reservoir 21 while maintaining the furnace 13 at a temperature of 200 ° c . to 350 ° c . preferably deposition should be effected in the temperature range 240 ° c . to 300 ° c . after aluminum deposition has been effected the tiba vapour supply is removed and the furnace is re - evacuated and its temperature raised to between 350 ° c . and 500 ° c . silane is admitted during the heat - up cycle via the manifold 19 thus effecting silicon deposition and subsequent alloying of the deposited silicon with the aluminum . after deposition is complete the furnace is re - evacuated , cooled and purged as before . the sequential process permits independent optimization of the film deposition and the alloying conditions while the simultaneous process offers simplicity by way of a compromise of the deposition and alloying requirements . various alkyls may be employed in the process . thus , for example , tri - methyl , tri - ethyl , tri - isopropyl aluminum , tri - isobutyl aluminum ( tiba ) and di - isobutyl aluminum hydride ( dibah ) or mixtures thereof may be employed . for high quality films , tiba , dibah or mixtures thereof should be employed . the temperature at which the alkyl reservoir is maintained is dependent on the evaporation rate of the alkyl or mixture of alkyls . further , the alkyl / silane mixture , or the alkyl and the silane in the sequential process , may in some applications be diluted e . g . with argon and / or hydrogen , the latter enhancing the annealing efficiency of the process . a typical process sequence for metallizing silicon process wafers using the apparatus shown in the accompanying drawings is as follows : 1 . load process wafers 11 on to carrier 12 and insert into heated furnace 13 . 3 . optionally clean process wafers 11 with e . g . hydrogen chloride and re - evacuate . 4 . surface activate with ticl 4 vapour and re - evacuate . ( this step will be omitted when using the apparatus shown in fig1 ). 5 . effect deposition by supplying silane and aluminum alkyl to furnace 13 . 7 . bring furnace up to atmospheric pressure with argon or nitrogen . in such a deposition process in which the furnace was maintained at 350 ° c . and deposition was effected from silane and tiba both supplied at a rate of 200 ml / min . ( npt ) at a pressure of 4 torr it was found that a 4 minute deposition period produced an alloy film 1 micron in thickness . 1 . load process wafers onto carrier 12 and insert into heated furnace 13 . 4 . surface activate wafers with ticl 4 vapour and re - evacuate . 5 . hold furnace temperature at 200 ° c . to 350 ° c . and admit tiba vapour to effect aluminum deposition . 10 . bring furnace up to atmospheric pressure with nitrogen and unload wafers while flushing with nitrogen . 11 . cool furnace to aluminum deposition temperature and reload with next batch of wafers . in such a deposition process , the furnace temperature was first maintained at 270 ° c . during a 4 minute aluminum deposition period with a tiba flow rate of 200 ml / min . ( npt ) at 1 torr . silane was then admitted and the temperature was raised to 390 ° c . to effect gas phase alloying with a silane flow rate of 150 ml / min . ( npt ) at a pressure of 0 . 3 torr . this produced an alloy film 1 micron in thickness and containing 0 . 4 atomic % silicon . no etch pits could be seen in contact windows of ic test wafers treated by this process , whereas it was found that the omission of silane during the heat up stage resulted in severe pitting of the aluminum films in every case . in a modification of the process described herein , an inert gas , e . g . argon or nitrogen is admitted via reservoir 24 and valve 23 into the furnace 13 at regular intervals during the deposition process . the pressure in the furnace 13 is temporarily raised above the vapor pressure of tiba or tiba / dibah mixture contained in the evaporator thus temporarily restricting the alkyl supply . this permits periodic removal of the reaction products from the furnace 13 , which are swept away together with inert gas into the pump . in further embodiments of the process the aluminum alkyl or mixture of alkyl may be injected into the furnace 13 via an atomizing device . alternatively the liquid alkyl or mixture of alkyl may be admitted via a metering device to a flash evaporation or a continuous evaporation arrangement . in a further embodiment a sequential process may be employed wherein the aluminum coating is deposited by techniques other than chemical vapor deposition . for example , vacuum evaporation or sputtering may be employed . the aluminum film is then alloyed with silicon by exposure to silane while raising the temperature to between 350 ° c . and 550 ° c . as previously described herein . the term semiconductor device as employed herein is understood to refer both to discrete devices and integrated circuits . whereas this invention has been described with respect to specific embodiments thereof , it will be understood that various changes and modifications will be suggested to one skilled in the art , and it is intended to encompass such changes and modifications as are within the scope of the appended claims . | 2 |
fig1 illustrates the nodes of a network by way of background to the invention . reference numeral 2 denotes user equipment ue , for example mobile stations . user equipment ue is in communication with a radio network controller 4 via radio network channels 6 which are referred to herein as radio bearers rb . these radio network channels are set up in a mobile telecommunications network in a known manner . each user equipment ue can have one or more radio network channels open at any one time with the radio network controller 4 , and there can of course be a number of user equipments in communication with the radio network controller by way of individual radio network channels as is well known in the art . the radio network controller is in communication with a sgsn 8 via an iu interface 10 . the sgsn 8 communicates with a gateway gprs support node 12 via a g n or g p interface 14 , which is a switched packet data interface . as is well known , the sgsn 8 and the ggsn 12 provide support for gprs services in the network . the ggsn 12 is under the control of a policy decision function 18 . the policy decision function may be stand - alone or may be combined with an application function such as a proxy connection state control function p - cscf 16 of ip multimedia subsystem ( ims ). fig1 a illustrates the relationship between the different functional entities , but with the omission of the network elements which are not involved in service - based local policy ( in particular radio network controller rnc and the serving gateway support node sgsn ). fig1 a indicates that the user equipment 2 includes an sip client 100 , an ip bearer service ( ipbs ) manager 102 , a translation / mapping function 104 and a umts bearer service ( umtsbs ) manager 106 . the umtsbs manager 106 is in connection with the ggsn 12 by way of its own umtsbs manager 108 . the ggsn 12 also includes a translation / mapping function and an ipbs manager 112 with a policy enforcement point . the policy enforcement point is in connection with the policy decision function 18 forming part of the p - cscf node in one embodiment . the communications semantics across the nodes of the network illustrated in fig1 are shown in fig2 . overall communication between user equipment 2 and the ggsn 12 is provided by a pdp context . each pdp context provides a communication pathway between a particular user equipment 2 and the gateway gprs support node 12 and , once established , can carry multiple traffic flows . each traffic flow represents for example a particular service or a media component of a particular service . the pdp context therefore represents a logical communication pathway for one or more traffic flows across the network . to implement the pdp context between user equipment 2 and the sgsn 8 , a radio access bearer rab is established which allows for data transfer across the radio bearer 6 and the iu interface 10 . the physical channels established between the user equipment 2 and the radio network controller 4 are referred to as radio bearers rb . the implementation of these logical and physical channels is known and is therefore not discussed further herein . in existing systems , multiple traffic flows within a pdp context are all treated in the same manner based on pdp context attributes , such as quality of service ( qos ) or charging treatment . the possibility exists to create a secondary pdp context at the user equipment so that certain traffic flows from the user equipment can be treated differently in their transmission across the network . for example , there are a number of quality of service traffic classes applying to traffic flows of differing kinds : conversational , streaming , interactive and background . depending on the nature of the data to be transmitted across the network , the appropriate quality of service is requested by the user equipment 2 and is authorized by the network . by way of background , reference is made to fig2 a which is a schematic diagram illustrating the authorization of qos resources at an originating pdf . for example , at session setup , the pdf 18 obtains information from the sdp parameters defined by the originator and identifies the connection information needed ( for example ip address of the downlink media flow , media ports to be used etc .). the pdf 18 obtains information from the negotiated sdp parameters from the terminating side . the pdf 18 then identifies the connection information needed to define the uplink connection . information from the sdp parameters is used by the pdf 18 , in order to define the qos resource authorization . the pdf 18 authorizes each media component negotiated for the session which is expressed in terms of ip qos parameters . an authorization token is generated by the pdf and sent to the ue via the p - cscf . fig3 is a schematic diagram illustrating an embodiment of the invention which allows the pdf 18 to have more information about the available qos across the network . the user equipment 2 generates ( step s 1 ) a request for activating a pdp context across the network , identifying a requested qos . in case of ims services , the request includes an authorization token and , in this embodiment , two traffic flow identifiers flow 1 and flow 2 . this request is carried from the user equipment ue to the sgsn 8 . the sgsn 8 creates ( step s 2 ) a pdp context request for transmission to the ggsn 12 which itself creates a request ( step s 3 ) to the pdf 18 . the pdf 18 returns a decision ( step s 4 ) to the ggsn 12 defining a packet classifier for each flow to identify the flow in the network with the attributes of each of the flows , flow 1 and flow 2 . at this point , the ggsn 12 reports the negotiated qos attributes of the network to the pdf 18 , at step s 5 . the negotiated qos attributes may contain e . g . the qos class , the guaranteed bitrate and the max bitrate . the guaranteed and max bitrates may be indicated both for uplink and downlink direction . these qos attributes may be considered as ip qos attributes . as another example , the negotiated qos attributes may contain umts specific qos attributes , such as the traffic class , the traffic handling priority , the allocation / retention priority , the guaranteed bitrate and the max bitrate . the guaranteed and max bitrates may be indicated both for uplink and downlink direction . the pdf 18 processes the information on the negotiated qos attributes at step s 5 a before sending them to an application server / proxy 20 to determine the treatment of traffic flows based on the negotiated qos attributes . for example , the pdf 18 may decide to divide the pdp context qos attributes into traffic flow specific qos attributes . the pdf may also decide to drop some of the traffic flows e . g . if the negotiated qos attributes are not sufficient for all the traffic flows . in effect , the decision issued by the pdf 18 can be modified by the qos attribute processing step at s 5 a . the decision which is returned in step s 4 by the pdf 18 causes the ggsn 12 to create the pdp context response at step s 6 . the sgsn 8 then establishes the pdp context for the traffic flows setting up a radio access bearer as indicated in step s 7 . it is possible that the sgsn 8 or rnc 4 modifies the qos attributes due to the network environment . according to the described embodiment of the invention , this is reported by the sgsn 8 to the ggsn 12 at step s 8 in a step to modify the pdp context . the ggsn reports the modified qos parameters to the pdf 18 at step s 9 ( shown with reporting step s 5 in fig3 , because it is similar to the reporting step s 5 ) and the pdf 18 can then take steps to cause different traffic flow treatment , for example to divide the modified qos into traffic flow specific qos attributes . as an example , flow 1 requires 20 kbps as the max bitrate and flow 2 requires 10 kbps as the max bitrate . if the modified qos attributes indicate only support of 15 kbps as the max bitrate , this max bitrate should be divided between the two flows . the pdf could thus allocate 10 kbps ( 20 /( 20 + 10 )= 2 / 3 ) to flow 1 and 5 kbps ( 10 /( 20 + 10 )= 1 / 3 ) to flow 2 . the pdf may also decide to drop some of the traffic flows if the modified qos attributes are not sufficient for all the traffic flows . this step of determining the flow treatment is similar to the step for determining the flow treatment already mentioned above for negotiated qos attributes and thus is illustrated in fig3 as the same step s 5 a . a new decision issued by the pdf 18 causes a modified pdp context response to be created at the ggsn as in step s 10 . if some of the traffic flows were dropped by the pdf 18 , the new decision may contain information about the remaining traffic flows or as an alternative about the dropped traffic flows . in response to the modified pdp context request issued by the ggsn 12 , the sgsn 8 activates a pdp context acceptance to the ue 2 as indicated at step s 11 . fig3 describes how the ggsn can inform the pdf and how the pdf can inform the application server / proxy about the negotiated qos attributes . as an alternative , the ggsn may communicate with the application server / proxy directly . in this case , there is no pdf in between . fig4 shows the sequence described above in more diagrammatic format . furthermore , as described above , the pdf 18 informs the application server / proxy 20 about the negotiated qos attributes for the traffic flows carried by the pdp context . if the pdf 18 sends information to the application proxy , the application proxy transfers the information to the application server . in this way , the application server is aware of what are the negotiated qos attributes of a traffic flow related to the pdp context . the application server may adjust its configuration for sending or receiving traffic flows . this will optimize the qos efficiency , avoiding packet losses in the network and providing better quality for the user . the application server / proxy may receive the negotiated qos attributes also from other sources than the pdf , e . g . from the ue . if the application server / proxy receives the negotiated qos attributes from the multiple sources , the application server / proxy decides which set of negotiated qos attributes to take into account if the sets of negotiated qos attributes differ from each other . if the ue can send the negotiated qos attributes to the application server / proxy , it may indicate this to the ggsn , in which case , there is no need to send the negotiated qos attributes from the ggsn to the pdf and from the pdf to the application server / proxy . as an alternative , the ggsn may send the negotiated qos attributes to the pdf but also indicate that there is no need to send the negotiated qos attributes to the application server / proxy . if the ggsn can send the negotiated qos attributes towards the application server / proxy via the pdf , the ggsn may indicate this to the ue , and thus there is no need to send the negotiated qos attributes from the ue to the application server / proxy . the principles of the invention described herein can be used to enhance multimedia broadcast / multicast services ( mbms ). qos negotiation is applicable for mbms services because the ue cannot ask for the required qos attributes and there is the possibility of dropping the service if all the network nodes don &# 39 ; t negotiate the qos . also multiple qos streams of a media component for a single mbms service have been proposed where the clients can choose the appropriate quality level . the disadvantages of this proposal is that if different media components are separated and provided with different qos profiles , then each component for a single mbms service will require separate pdp contexts and tunnels for transmission . this is not efficient in mbms if all the nodes don &# 39 ; t support qos and the resources cannot be reserved beforehand . also the traffic handling priority cannot be used for background and streaming classes , instead allocation / retention priority is applicable for those qos classes . without qos negotiation the rnc may not be able to provide the required qos ( the bitrate ( s )) and , thus , some branches may not be established . thus , all the ues under that rnc are left without the mbms service . when knowing the negotiated qos attributes , the pdf 18 or the application server / proxy 20 may also decide whether the negotiated qos of pdp context is sufficient to carry a traffic flow . if the negotiated qos of pdp context is not sufficient , the pdf 18 or the application server / proxy 20 may initiate release of the pdp context . this is particularly beneficial in case of multimedia broadcast / multicast services ( mbms ). in case of mbms services , mbms bearers are created in the network to carry an mbms service . mbms bearer creation is initiated by the broadcast / multicast service center bm - sc , an application server / proxy for mbms services . if qos may be negotiated by the network , e . g . by the ggsn , sgsn or rnc , the negotiated qos attributes may differ from the qos attributes requested by the bm - sc . if those differ , the pdf or bm - sc can decide , whether the negotiated qos attributes are sufficient for the mbms service . if the negotiated qos attributes are not sufficient for the mbms service , the pdf or bm - sc may initiate release of the mbms bearer . in case of an mbms service , multiple mbms bearers may be created in the network , in which case , multiple sets of negotiated qos attributes may be indicated to the pdf or bm - sc . if some of those sets is not sufficient for the mbms service , the pdf or bm - sc may initiate release of those particular mbms bearers . the pdf has information for the traffic flows carried by the pdp context in the form of qos attributes . as described above , the pdf can implement intelligent logic for dealing with cases when the requested qos is very different ( for example higher ) than the negotiated qos . as described above , this internal logic may be applied e . g . for pdp contexts and for mbms bearers . for example , in the above case where the negotiated max bitrate of the pdp context is only 15 kbps , the pdf 18 may decide to drop one of the traffic flows , flow 1 or flow 2 , and leave only one of them , based on service and operator information for the traffic flows . the logic in the pdf may be operator configurable . the operator may prefer not to provide a specific service under a specified qos limit ( for example , do not provide streaming news from a news information source if the guaranteed bitrate falls below the limit of 10 kbps ). if the pdf has performed some action due to operator policy on the negotiated qos , then the pdf can inform the application server / proxy 20 about that . the pcf informs also the ggsn 12 about that and the ggsn may indicate the accepted / dropped traffic flows to the ue 2 . there follows a more detailed discussion of the application of negotiated qos to mbms , with two examples of negotiation solutions : ( i ) multiple negotiated qos and ( ii ) one negotiated qos . in the case of multiple negotiated qos , the qos supported in each branch of the mbms service can be different ( have different bitrate value ). otherwise the service is similar to the one negotiated qos . in the case of one negotiated qos , the qos supported by each branch of the mbms distribution tree will be the same . all the nodes can propose a qos value suitable for them , and the dropping of the service is less likely . fig5 illustrates one embodiment for the multiple negotiated qos . considering the network scenario in fig5 , it is possible that sgsns will decide to accept all the qoss requested / negotiated by rncs . in other words , different qos values can be used for one mbms session . as shown in fig5 , mbms bearer establishment for multiple negotiated qos may proceed according to the following discussion . according to a first step of the multiple negotiated qos , the pdf / bm - sc sends the required qos to the nodes ( ggsns , sgsns , rncs ) in the distribution tree . according to a second step of the multiple negotiated qos , the rnc 1 and rnc 2 can support qos 1 and qos 2 , respectively , and send this info to sgsn 1 as mbms bearer establishment request if this has not already been done . if the sgsn 1 can accept qos 1 for rnc 1 and qos 2 to rnc 2 , sgsn 1 sends an mbms bearer request message to the ggsn with those qos value ( s ). however , if the sgsn 1 cannot support qos 1 and / or qos 2 it can send the negotiated qos value ( s ) it is able to support to ggsn . note that the qoss selected by the sgsn 1 are either the same or lower than the requested qoss by rncs under it and the required qos originally requested by the pdf / bm - sc in step 1 of the multiple negotiated qos . according to a third step of the multiple negotiated qos , if the ggsn can accept the qos value ( s ) received from sgsn 1 , it sends the bearer request message to the bm - sc with these qos value ( s ). however , if the ggsn cannot accept the qos received from the sgsn 1 , it can send to the pdf / bm - sc the negotiated qos value ( s ) it is able to support . note that the qos selected by the ggsn is either the same or lower than the requested qoss by sgsn 1 under it and the required qos originally requested by the pdf / bm - sc in step 1 of the multiple negotiated qos . according to a fourth step of the multiple negotiated qos , if the pdf / mb - sc can accept the qos value ( s ) received from ggsn , it responds to the ggsn with negotiated qos value ( s ) to establish tunnel . if bm - sc does not support some of those qos value ( s ), it will not establish the bearer for those qos value ( s ) towards downstream nodes . bm - sc and ggsn will establish separate tunnel for each qos value . according to a fifth step of the multiple negotiated qos , the ggsn responds to the mbms bearer request received from the sgsn 1 in step 2 with qos value ( s ) received from the bm - sc . sgsn 1 and ggsn establish separate tunnel for each qos value . according to a sixth step of the multiple negotiated qos , the sgsn 1 responds to the request received from the rnc 1 and rnc 2 to establish the tunnels with the negotiated qos value ( s ) it is able to support sgsn 2 , rnc 3 and rnc 4 also carry the second , third , fourth , fifth and sixth steps of the multiple negotiated qos described above . one advantage of the invention is that different iu bearers will support different / multiple qoss and hence less possibility to drop services when all the downlink nodes ( rnc , sgsn , ggsn ) already support the qoss . fig6 illustrates an embodiment for the one negotiated qos . in the one negotiated qos , the qos is the same for each branch of the mbms distribution tree . the qos negotiation can be initiated by the rnc , sgsn or ggsn . in this example , the rnc initiated case is described , see fig6 . mbms bearer establishment process for one negotiated qos may proceed according to the following discussion . first , the pdf / bm - sc sends the required qos to the nodes ( ggsns , sgsns , rncs ) through the distribution tree . second , the rnc 1 indicates that it supports qos 1 and rnc 2 indicates that it supports qos 2 ( i . e . different bitrates ) as in fig3 , and sgsn 1 decides what qos value to accept ( i . e . qos 1 , qos 2 ). in the same way , the rnc 3 supports qos 3 , rnc 4 supports qos 4 and sgsn 2 decides what qos value to accept ( i . e . qos 3 , qos 4 ). based on which qos value the nodes accept there can be two different cases . in the first step of the first case , all rncs ( rnc 1 , rnc 2 , rnc 3 , rnc 4 ), sgsns , ggsn and bm - sc can support the qos 1 . in the first case , once the sgsns ( e . g . sgsn 1 , sgsn 2 ) have accepted qos values from rncs under them , it sends the qosx ( e . g . qos 1 ), qosy ( e . g . qos 3 ) or the negotiated qos to the ggsn . note , that the qos selected by the sgsn 1 is either the same or lower than qos 1 , qos 2 and the required qos originally requested by the pdf / bm - sc . similarly qos selected by the sgsn 2 is either the same or lower than qos 3 , qos 4 and the required qos originally requested by the pdf / bm - sc . ( note , this means that 0 kbit / sec is the lowest qos value that the sgsn can accept ). in the second step of the first case , the ggsn decides what qos value to accept ( qosx , qosy or negotiated qos value ) and send it to pdf / bm - sc . if ggsn accepts the qos ( e . g . qos 1 ), it sends to the pdf / bm - sc . note , that the qos selected by the ggsn is either the same or lower than qosx ( e . g . qos 1 ), qosy ( e . g . qos 3 ), and the required qos originally requested by the pdf / bm - sc . ( note , this means that 0 kbit / sec is the lowest qos value that the ggsn can accept ). in the third step of the first case , if the pdf / bm - sc accepts the qos ( e . g . qos 1 ) received from ggsn , it then acknowledges it back to the ggsn . in the fourth step of the first case , the ggsn sends the acknowledgement back to sgsn 1 and sgsn 2 . if both sgsns ( sgsn 1 , sgsn 2 ) can support or negotiate the qos 1 acknowledged by the ggsn and pdf / bm - sc , sgsn 1 and sgsn 2 will acknowledge it back to the rncs under them . in the second case , if the ggsn , sgsns , rncs can accept or negotiate the qos 1 then bearer will be established as in fig7 . in the second case , one rnc ( rnc 1 ) can support the qos 1 , but the other rnc ( rnc 2 ) cannot . in this case the qos 2 is lower than qos 1 . sgsn 1 sends the qos ( qos 1 , qos 2 or negotiated qos ) to ggsn . similarly rnc ( rnc 3 ) can support the qos 1 , but the other rnc ( rnc 4 ) cannot , in this case the qos 4 is lower than qos 1 . sgsn 2 sends the qos ( qos 3 , qos 4 or negotiated qos ) to ggsn . the second case may include a first step wherein , once the sgsns ( e . g . sgsn 1 , sgsn 2 ) have accepted qos values from rncs under them , it sends the qosx ( e . g . qos 1 ), qosy ( e . g . qos 3 ) or the negotiated qos to the ggsn . note , that the qos selected by the sgsn 1 is either the same or lower than qos 1 , qos 2 and the required qos originally requested by the pdf / bm - sc . similarly qos selected by the sgsn 2 is either the same or lower than qos 3 , qos 4 and the required qos originally requested by the pdf / bm - sc . ( note , this means that 0 kbit / sec is the lowest qos value that the sgsn can accept ). the second case may include a second step wherein the ggsn decides what qos value to accept ( qosx , qosy or negotiated qos value ) and send it to pdf / bm - sc . if ggsn accepts the qos ( e . g . qos 1 ), it sends to the pdf / bm - sc . note , that the qos selected by the ggsn is either the same or lower than qosx ( e . g . qos 1 ), qosy ( e . g . qos 3 ), and the required qos originally requested by the pdf / bm - sc . ( note , this means that 0 kbit / sec is the lowest qos value that the ggsn can accept ). the second case may include a third step wherein , if pdf / bm - sc accepts the qos ( e . g . qos 1 ) received from ggsn , it then acknowledges it back to the ggsn . the second case may include a fourth step wherein the ggsn sends the acknowledgement back to sgsn 1 and sgsn 2 . if both sgsns ( sgsn 1 , sgsn 2 ) can support or negotiate the qos 1 acknowledged by the ggsn and pdf / bm - sc , sgsn 1 and sgsn 2 will acknowledge it back to the rncs under them . the second case may include a fifth step wherein rnc 1 already supports the qos 1 acknowledged by the pdf / mb - sc , ggsn and sgsn 1 , but rnc 2 doesn &# 39 ; t . similarly , rnc 3 can negotiate qos 1 but rnc 4 doesn &# 39 ; t . so bearer will not be established between sgsn 1 , rnc 2 and rnc 4 , sgsn 2 . bearer will be established between nodes that support qos 1 as in fig8 . if there are several ggsns involved in the mbms session then a qos negotiation as described above in the second , third and fourth steps of the second case can be applied if the ggsns accept different qos values . note , that in the normal case all the nodes can accept the required qos originally requested by the pdf / bm - sc . so , the negotiation principle described above is only used in the special cases when there is congestion in the network . one advantage of the invention is that there is less of a possibility to drop the service when all the downlink nodes ( rnc , sgsn , ggsn ) already support the negotiated qos . the signalling flow of the qos negotiation describes a general signaling flow of qos negotiation for one negotiated qos and for multiple negotiated qos as shown in fig9 . the session start procedure carries the required qos from bm - sc towards downlink nodes ( ggsn , sgsn and rnc ). in step 21 of fig9 , required qos is carried from rnc to sgsn through mbms bearer establishment request message . if rnc cannot accept the required qos , then rnc can downgrade the qos at this stage and send the downgraded qos to sgsn . sgsn will wait until all rncs join the sgsn with the negotiated qos . in step 22 of fig9 , if sgsn can support the qos received from rncs , the sgsn will send the qos through mbms bearer request message to ggsn . downgrade of qos is possible at sgsn and the sgsn will send the negotiated qos to ggsn . in step 23 of fig9 , after ggsn receives the bearer request from sgsn with the requested qos , it will request for bearer establishment to the pdf / bm - sc or joins an existing one , if available , for this mbms service with the negotiated qos . it is possible to downgrade the qos at the ggsn . in step 24 of fig9 , if qos negotiation is accepted by pdf / bm - sc , it will send the bearer response to the ggsn . if pdf / bm - sc does not support the negotiated qos , then it releases the bearer at that branch . in step 25 of fig9 , if ggsn accepts the qos from pdf / bm - sc , it will send the mbms bearer response to the sgsn with the negotiated qos . in step 26 of fig9 , sgsn will send the mbms bearer establishment response towards rnc if sgsn accepts the qos received from sgsn . | 7 |
in a first embodiment , an example of which is shown in fig1 , an optical element , such as a motheye antireflective pattern , consisting of an array of submicron sized tall conical shapes , is formed directly onto the curved surface of a concave lens using a stretchable elastomeric mold . the mold pattern , which is complementary to the desired pattern , is formed on one surface of an elastomeric film 1 . this can be done by forming the mold pattern directly into the surface of the film , by known thermal or chemical / solvent imprinting means . in another embodiment , the stretchable elastomeric patterning mold is formed as a composite ( multilayer ) film in which the mold pattern is formed as a layer on a stretchable elastomeric support film . the mold layer is formed by the known means of radiation curing , or thermal or chemical molding . the elastomeric mold film 1 is mounted in a tension hoop 3 , such as is used to form drum heads and the like , under approximately uniform tension 2 . the tension hoop with elastomeric film is stretched over the convex lens substrate 5 that has been coated with a thin layer of radiation curable polymer adhesive 4 , at which time radiation 6 of appropriate wavelength to cause the adhesive 4 to solidify is applied through film 1 . radiation 6 can also be applied though lens 6 , or through both , often depending on the optical transmission characteristics of each of said elements . withdrawal of the tension hoop 3 results in the solidified polymer 4 now having a pattern complementary to that of mold film 1 . it is preferable that polymer adhesive 4 is selected so as to have high adhesion to the substrate ( 5 ) and low adhesion to the mold ( 1 ). for example , the mold can be a silicone ( pdms ) or polyurethane material , while the adhesive is a cationic or other radiation curable glass adhesive . it should be noted that the adhesive can be applied using slot - die coating , spin coating , ink jet application , or any other well - known suitable process , and may be applied to the substrate , the mold surface , or both . each of the two types of stretchable elastomeric mold films in this example have certain advantages , and may be used according to the material and pattern requirements . for example , the composite film approach has the advantage of being able to use materials as the mold layer that may not be capable of self - support due to low tear resistance , etc ., where the elastomeric support film provides the required tear resistance . in addition , the patterning layer can also serve to planarize the substrate in cases where the substrate has an intrinsic surface roughness that would interfere with the molded pattern . however , the stretching properties of both the mold layer and the support film must be properly matched in order to eliminate the possibility of delamination fracturing of the composite film during stretching . on the other hand , the integral ( single material ) stretchable elastomer mold film has the advantage of being simpler ( 1 layer ), which allows the patterned surface to stretch uniformly along with the bulk substrate material without the possibility of delamination or fracture . fig2 shows another embodiment in which stretchable film 7 has a desired pattern 8 on one surface of planar surface of an ( of elastomer material such as a polyurethane , silicone / pdms , etc .). as in the previous example , this can be an integral or composite elastomeric substrate , but in this case the pattern 8 is formed on the outer surface of film 7 and has the final pattern rather than the complementary pattern . the film is mounted into circular tension hoop fixture 3 and is pulled over the surface of the convex lens 5 , which has previously been coated with a thin layer of uv - curable adhesive 4 , bringing it into conformal contact with the surface of the substrate . a uv radiation source 6 is used in this example to solidify the adhesive layer , although other types of adhesives may be used . where the substrate is an optical lens , it is desirable that the transparency and index of refraction of the molding adhesive match that of the substrate as close as possible . adhesive application may be carried out by spin coating , ink jet application , or any other well - known suitable process . the adhesive can also be applied to the back side surface of the elastomeric mold film , or both the film and substrate . with the adhesive applied , the tension hoop containing the elastomeric mold is pulled over the substrate . after curing , the mold is withdrawn , leaving the complementary pattern on the surface of the curved substrate . in the above embodiment where the patterned elastomeric film is used as a replication mold , it will be seen that the replicating monomer material itself does not have to be elastomeric material , since when the mold is stretched the replicating polymer is in a liquid state and is not under tension and thus does not require elastomeric properties . this allows for the use of a broader range of replication materials with optimal physical properties ( hardness , scratch resistance , etc .) for use as the pattern layer . the key required properties of the replicating material are that it adheres well to the substrate while not adhering to the elastomeric mold . in yet another embodiment ( not illustrated ), the pattern is formed as a thin layer on a temporary elastomeric mold by any of the previously - mentioned means , including by chemical curing of a 1 - or 2 - part reactive material , where the thin pattern layer and the mold material have weak mutual adhesion ( either by material selection based on intrinsic adhesion properties or use of a mold release ). as in the previous examples , the film structure is stretched over the lens with the thin pattern layer facing the substrate and is then bonded to it using any of the previous described means . the temporary elastomeric carrier / mold is then removed , leaving the thin pattern layer bonded to the substrate with the pattern facing outward . this embodiment is useful when the film containing the pattern is very thin and / or prone to tearing . in addition , it allows use of desirable pattern - forming materials that may not otherwise adhere to the ( lens ) substrate , since the adhesive that bonds the film and substrate will provide the required substrate - to - pattern layer adhesion . the critical dimensions of many patterns , particularly those with nanoscale features , are generally very small relative to the curvature of the surface , thus the small degree of distortion introduced by the elastomeric stretching will generally be insignificant . however , in applications in which this distortion results in undesirable changes to the geometry of the pattern , structural changes resulting from the elastomeric distortion can be compensated for by “ pre - distortion ” in the master pattern : that is , alteration of the original geometry such that the pattern is rendered correctly when applied to the surface . this is shown in fig3 , in which pattern 9 on elastomeric film 7 has been modified in such a way as to form the correct pattern after it has been stretched in hoop 3 over lens 5 coated with bonding adhesive 4 . it is therefore an aspect of the present invention to use this technique with the previously described elastomeric mold process ( fig1 ), the applied film process ( fig2 ), or any other approach described in this invention to compensate for elastic distortion of the pattern . in another embodiment , shown in fig4 , an elastomeric film for molding or direct bonding can be formed by a roll - to - roll process when large quantities ( and with the further benefit of lower costs ) of patterned substrates are required . in this example , a section of a continuously patterned film 11 that has been formed in a roll - to - roll process ( film transport not shown ) is advanced from a supply spool with the patterned surface facing the substrate . a tension hoop 3 b is used to press the film onto substrate 5 coated with replicating polymer adhesive 4 , where the adhesive is then solidified by action of radiation 6 . the hoop 3 b along with mold film 11 is not retracted , leaving a layer complementary to the pattern of film 11 on the outer surface of substrate 5 . the film can now be indexed to an unused section of film 11 to repeat the process on another substrate . this can be done in a step - and - repeat fashion or in a continuous fashion , where the engaged hoop and substrate move ( on a conveyor belt fixturing assembly , for example ) with the film . depending on the durability of the mold film , the films may be used multiple times . in another embodiment of the above example ( not shown ), the approach of fig2 ( direct bonding of patterned film ) can be used in a continuous or step - and - repeat machine operation . in this case , after the patterned film is adhesively bonded to the substrate , the pattern is die - cut from the web . fig5 shows an example of the use of the present invention to form a pattern on a concave surface . here , pressure is applied to a conformal material 13 ( in this case an inflated bladder or balloon ) to put the elastomeric film 1 in tension hoop 3 into conformal contact with the concave surface 15 of substrate 16 . the conformable material 13 can be inflated using gas or hydraulic pressure , or can be a distortable solid ( silicone or sand - filled ball , etc .). elastomeric film 1 can be either a mold or a directly patterned film ( using methods of fig1 and 2 , respectively ). in the case of the elastomeric mold ( fig1 ), the concave lens surface ( or patterned surface , or both ) is coated with a replicating polymer ( not shown ) and the tension - hooped mold is pressed against the substrate by pressure from member 13 , and radiation is used to solidify the replicating polymer , after which the mold film is withdrawn by retraction of member 13 . for the process of fig2 , the adhesive is a permanent adhesive to bond the film to the substrate , after which it is die cut from the tension hoop . in yet another embodiment , shown in fig6 , mold film 1 in hoop 3 is configured to form part of a vacuum enclosure 14 ( e . g ., a bell - jar , bag , frame , etc . ), inside of which substrate 15 is located . after applying the adhesive or replicating polymer adhesive ( not shown ), application of vacuum by exhausting air through port 19 causes the film mounted in the tension hoop to contact the substrate , at which time the adhesive is activated by application of actinic radiation 16 through either the transparent film 1 ( as shown ) or through the bottom side of the substrate ( not shown ). the effectiveness of the vacuum method can be enhanced if the vacuum enclosure is designed such that all frame surfaces other than the tension hoop holding the pattern film are rigid . thus the only member that can move when the frame is evacuated is the pattern film . this can be further enhanced by adding additional pressure to the film surface outside of the vacuum frame , as shown in fig5 . it is another aspect of the present invention that the elastomeric film may be made to initially contact a single point on the concave surface resulting in the formation of a pathway for escape of any trapped to escape as the area of contact is increased . fig7 shows an embodiment of the invention for forming a rigid , reusable mold for patterning curved surfaces . using any of the methods of the prior embodiments , substrate 20 with pattern 22 is formed . transparent mold blank 24 is formed using conventional surface grinding technology . molding adhesive layer 23 is the applied to the pattern ( or to blank 24 , or both , not shown ), the pattern brought onto contact with blank 24 , and radiation 6 is applied through the blank or the curved substrate so that layer 23 is solidified . after exposure and part separation , surface 25 , having a pattern complementary to that of 22 is formed . patterned mold 27 is used to form part 26 , a replica of the original part ( 20 + 22 ) or a durable molding tool for making concave patterned replicas . part 26 can be made as a durable tool by plating , such a ni electroforming or electroless metal deposition , into cavity 27 , where convex mold part 26 is formed after separation from mold 27 . part 26 can also be used to form durable tool 28 , also by plating . concave and convex molds ( 28 and 26 , respectively ), if formed using known ni electroforming techniques , can be used multiple times to form patterned curved substrates using thermal ( including injection molding ), chemical reactive or radiation ( through transparent substrate ) molding techniques . fig8 shows the use of durable concave mold 28 to pattern layer 32 coated on lens 30 . after molding , convex patterned part 36 is extracted from mold 34 . a similar process can be used with convex molds . for opaque ( e . g ., durable ni ) molds , radiation exposure is from the transparent substrate side , or can be accomplished by thermal or injection molding . when the combination of substrate curvature , pattern geometry or rigid mold materials may result in damage to either the mold or the replica during separation , thermal assisted separation may be used to facilitate separation without damage ( fig9 ). here , either mold 34 is heated ( 40 ) or the replica part 35 is chilled ( or both ) in order to utilize differential thermal expansion and / or contraction to allow separation of part 36 . because the height of the patterns are typically very small compared to the substrate , very little dimensional change ( temperature differential ) is required to allow separation by this method . it is another objective of the present invention to describe methods for forming useful patterns of metals , alloys , inorganic / dielectric materials or multi - layer thin films on compound curved surfaces . such patterns may include electrical wires or electric circuits and elements , transparent electrically conductive meshes or grid patterns , wire - grid polarizer patterns , meta material structures , beam splitters , zone plates , touch screen patterns , photomasks , etc . to create metal or dielectric patterns , a polymeric mask is formed on the surface of the substrate , using the previously described methods for forming polymer structures . in this case , the structure is used as a pattern forming mask , similar in function to a photoresist mask used in lithography , to form the desired metal or dielectric pattern by subtractive ( material removal ) or additive ( material deposition ) processing . in the example shown in fig1 , metal layer 42 is deposited by vacuum or other deposition means ( including electroplating or electroless plating ) on the lens or curved surface 30 to be patterned . next , using the imprinting embodiment described earlier ( fig7 ), polymeric pattern 44 , pre - distorted if necessary , is formed over the metal layer . in this example transparent mold 43 is used to solidify layer 32 , but the methods of fig1 ( elastomeric mod patterning ) can also be used to form the mask . as shown in fig1 , imprinted polymer layer 46 acts as a resist etch mask for transfer of the pattern of the mask to the metal layer by first removing any polymer residue layer (“ scum ”, 46 ) that might be in the bottoms of the imprinted mask ( 44 ) by plasma etching ( 48 ), this “ descum ” process being well known in the field of photolithography . this exposes and cleans the surface of the substrate 50 under the imprinted mask . in a subsequent step , the de - scummed polymer mask is used in conjunction with either wet chemical etching or plasma etching ( 52 ) to selectively remove the areas of the metal layer ( 53 ) exposed through the mask openings . the mask may then be removed ( 54 ), by chemical treatment (“ lift off ”), plasma etching or mechanical means , to expose the metal pattern on the surface of the substrate . in some cases , the transparent mask may be left in place as a protective coating over the pattern . patterns thus formed could be , for example , as wire grid polarizers , transparent conductors , clear - field or dark - field photomasks , etc . a photomask formed in this manner can be used to expose a photoresist - coated substrate of matching curvature to form a mask on said substrate . although the example given in fig1 shows the patterning of a convex surface , the analogous process can be used to form an etch mask pattern on a concave substrate , using techniques described earlier . by the above methods , metal layers , inorganic layers , transparent conductors such as indium tin oxide ( ito ), etc ., and multilayer stacks such as anti - reflection layers , etc . can be patterned . in yet another embodiment ( not shown ), a mask formed by the above process is used to additively form a metal or inorganic pattern on a concave or convex curved surface . in this process the polymer mask is formed directly on the substrate and the mask is then de - scummed , after which the material to be patterned ( metal , inorganic ) is deposited over the entire masked area . lift - off of the mask along with excess deposited material produces the desired pattern . it is another aspect of the present invention to combine of any of the techniques of the present invention to pattern both sides of a curved surface or lens , such as a bi - concave , bi - convex , concave - convex , or plano - concave / convex lens . an example of a dual - sided concave - convex lens patterned this way is given in fig1 , where transparent molds 43 and 60 are used to form patterns 56 and 58 , respectively , on substrate 59 . in this case , radiation 6 is used to solidify the molding material . another embodiment of the present invention combines a molded optical pattern ( such as a diffractive , binary or holographic structure , etc .) with a patterned metallic or dielectric pattern to allow surfaces to benefit from both types of patterns . this could include , for example , a motheye or diffractive pattern combined with a transparent conductive grid . one such example is illustrated in fig1 , where a patterned metal ( or dielectric , etc .) layer ( e . g ., 56 in fig1 ) is first formed , then mold 62 with pattern 64 is used to form pattern 66 over previously - formed metal pattern 36 on substrate 32 . again , the tension hoop pattern molding method for fig1 , etc ., can also be used to form the metal pattern 56 and optical pattern 66 . dual - sided patterning , described earlier , can be used in various combinations , such as one side having a molded pattern and the other having a metallic or dielectric pattern , or any useful combination of dual patterns on both sides of a curved substrate or lens . the techniques of the present invention can also be applied in the simpler case of cylindrically curved surfaces , where only one axis of curvature exists . in this case , the film used to form the pattern must be flexible but does not have to also be stretchable ( elastomeric ), thereby allowing the use of films such as polyethylene phthalates ( pet , etc . ), polycarbonates , polyimides , flexible glass or metal foils . fig1 and 15 illustrate this process for replication molds and bonded films , respectively . a further embodiment . shown in fig1 is a schematic of a process in which a patterned film 68 is pulled under tension ( 70 ) against adhesive - coated layer 74 of convex cylindrical surface 72 to provide a pattern layer over the substrate , analogous to the process in fig2 . fig1 illustrates the process analogous to fig1 in which flexible member 78 is pulled under tension ( 70 ) over substrate 74 coated with replication polymer 72 , where the replication polymer is solidified by radiation 6 through transparent film 78 . in another embodiment of the example in fig1 , in fig1 is shown block 80 , with curvature matching that of the cylindrical substrate , which is used to add additional pressure on mold film 78 from that provided by film tension 70 . this allows uniform pressure to be applied to assure uniform monomer thickness . the block may also include an elastomeric surface 82 to allow additional compliance to the mold . block 80 and compliant layer 82 are transparent in this case in order to pass radiation 6 that solidifies layer 76 on substrate 72 . the curvature of block 80 and layers 82 and 78 can be adjusted to closely match that of 7 substrate 72 ( with layer 76 ). fig1 shows a similar process as above , but in this example the surface to be patterned 86 is convex and corresponding block 84 with compliant layer 82 is concave in shape . the thickness of the film and adhesive layer 88 may again need to be taken into account when determining the curvature of the compliant blocks . in this example , an flexible mold film is placed into contact with replica layer 88 , and radiation source 6 used to solidify the pattern . fig1 shows an example of the application of patterned flexible film 68 to concave substrate 85 using adhesive layer 83 . in this case pressure is applied through force 89 to shaft 92 of elastomeric roll 90 . it should be noted that , similar to the examples for compound curved substrates shown in fig7 - 13 , cylindrical molds can be used to replicate patterns on concave and convex cylindrical substrates the methods of forming patterns on compound curved surfaces of the present invention are expected to find use in low cost improved optics , sensors , electronic circuits and displays . the components , steps , features , objects , benefits , and advantages that have been discussed are merely illustrative . none of them , nor the discussions relating to them , are intended to limit the scope of protection in any way . numerous other embodiments are also contemplated . these include embodiments that have fewer , additional , and / or different components , steps , features , objects , benefits , and advantages . these also include embodiments in which the components and / or steps are arranged and / or ordered differently . for example , while certain exemplary assignment protocols are described above , others may be used within the scope of the present disclosure . unless otherwise indicated , the servers , systems , and software modules that have been discussed herein are implemented with a computer system configured to perform the functions that have been described herein for the component . each computer system includes one or more processors , tangible memories ( e . g ., random access memories ( rams ), read - only memories ( roms ), and / or programmable read only memories ( proms )), tangible storage devices ( e . g ., hard disk drives , cd / dvd drives , and / or flash memories ), system buses , video processing components , network communication components , input / output ports , and / or user interface devices ( e . g ., keyboards , pointing devices , displays , microphones , sound reproduction systems , and / or touch screens ). if used , each computer system may be a desktop computer or a portable computer , such as a laptop computer , a notebook computer , a tablet computer , a pda , a smartphone , or part of a larger system , such a vehicle , appliance , and / or telephone system . a single computer system may be shared by various components / steps of the methods described herein . each computer system may include one or more computers at the same or different locations . when at different locations , the computers may be configured to communicate with one another through a wired and / or wireless network communication system . each computer system may include software ( e . g ., one or more operating systems , device drivers , application programs , and / or communication programs ). when software is included , the software includes programming instructions and may include associated data and libraries . when included , the programming instructions are configured to implement one or more algorithms that implement one or more of the functions of the computer system , as recited herein . the description of each function that is performed by each computer system also constitutes a description of the algorithm ( s ) that performs that function . the software may be stored on or in one or more non - transitory , tangible storage devices , such as one or more hard disk drives , cds , dvds , and / or flash memories . the software may be in any suitable programming language and may include source code and / or object code format and / or executable code . associated data may be stored in any type of volatile and / or non - volatile memory . the software may be loaded into a non - transitory memory ( e . g ., computer - readable medium ) and executed by one or more processors . unless otherwise stated , all measurements , values , ratings , positions , magnitudes , sizes , and other specifications that are set forth in this specification , including in the claims that follow , are approximate , not exact . they are intended to have a reasonable range that is consistent with the functions to which they relate and with what is customary in the art to which they pertain . all articles , patents , patent applications , and other publications that have been cited in this disclosure are incorporated herein by reference . the phrase “ means for ” when used in a claim is intended to and should be interpreted to embrace the corresponding structures and materials that have been described and their equivalents . similarly , the phrase “ step for ” when used in a claim is intended to and should be interpreted to embrace the corresponding acts that have been described and their equivalents . the absence of these phrases from a claim means that the claim is not intended to and should not be interpreted to be limited to these corresponding structures , materials , or acts , or to their equivalents . the scope of protection is limited solely by the claims that now follow . that scope is intended and should be interpreted to be as broad as is consistent with the ordinary meaning of the language that is used in the claims when interpreted in light of this specification and the prosecution history that follows , except where specific meanings have been set forth , and to encompass all structural and functional equivalents . relational terms such as “ first ” and “ second ” and the like may be used solely to distinguish one entity or action from another , without necessarily requiring or implying any actual relationship or order between them . the terms “ comprises ,” “ comprising ,” and any other variation thereof when used in connection with a list of elements in the specification or claims are intended to indicate that the list is not exclusive and that other elements may be included . similarly , an element preceded by an “ a ” or an “ an ” does not , without further constraints , preclude the existence of additional elements of the identical type . none of the claims are intended to embrace subject matter that fails to satisfy the requirement of sections 101 , 102 , or 103 of the patent act , nor should they be interpreted in such a way . any unintended coverage of such subject matter is hereby disclaimed . except as just stated in this paragraph , nothing that has been stated or illustrated is intended or should be interpreted to cause a dedication of any component , step , feature , object , benefit , advantage , or equivalent to the public , regardless of whether it is or is not recited in the claims . the abstract is provided to help the reader quickly ascertain the nature of the technical disclosure . it is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims . in addition , various features in the foregoing detailed description are grouped together in various embodiments to streamline the disclosure . this method of disclosure should not be interpreted as requiring claimed embodiments to require more features than are expressly recited in each claim . rather , as the following claims reflect , inventive subject matter lies in less than all features of a single disclosed embodiment . thus , the following claims are hereby incorporated into the detailed description , with each claim standing on its own as separately claimed subject matter . | 1 |
specific embodiments of the invention will now be described in detail with reference to the accompanying figures . like elements in the various figures are denoted by like reference numerals for consistency . in the following detailed description of embodiments of the invention , numerous specific details are set forth in order to provide a more thorough understanding of the invention . however , it will be apparent to one of ordinary skill in the art that the invention may be practiced without these specific details . in other instances , well - known features have not been described in detail to avoid unnecessarily complicating the description . in general , embodiments of the invention provide a method and system for controlling the bandwidth consumed by a virtual machine . more specifically , embodiments of the invention relate to a method and system for controlling bandwidth using software receive rings . fig1 shows a system in accordance with one embodiment of the invention . as shown in fig1 , the system includes a host ( 101 ) operatively connected to a nic ( 102 ). the nic ( 102 ) provides an interface between the host ( 101 ) and a network ( not shown ) ( e . g ., a local area network , a wide area network , a wireless network , etc .). more specifically , the nic ( 102 ) includes a network interface ( ni ) ( i . e ., the hardware on the nic used to interface with the network ) ( not shown ). for example , the ni may correspond to an rj - 45 connector , a wireless antenna , etc . the packets received by the ni are then sent to other components on the nic ( 102 ) for processing . in one embodiment of the invention , the nic ( 102 ) includes a classifier ( 155 ) and one or more hardware receive rings ( 145 , 150 ). in one embodiment of the invention , the hardware receive rings ( 145 , 150 ) correspond to portions of memory within the nic ( 102 ) used to temporarily store the received packets . further , in one embodiment of the invention , a ring element of the receive rings ( 145 , 150 ) may point to host memory . in one embodiment of the invention , the classifier ( 155 ) is configured to analyze the incoming network traffic , typically in the form of packets , received from the network ( not shown ). in one embodiment of the invention , analyzing individual packets includes determining to which of the hardware receive rings ( 145 , 150 ) each packet is sent . in one embodiment of the invention , analyzing the packets by the classifier ( 155 ) includes analyzing one or more fields in each of the packets to determine to which of the hardware receive rings ( 145 , 150 ) the packets are sent . as an alternative , the classifier ( 155 ) may use the contents of one or more fields in each packet as an index into a data structure that includes information necessary to determine to which hardware receive ring ( 145 , 150 ) that packet is sent . the classifier ( 155 ) may be implemented entirely in hardware ( i . e ., the classifier ( 155 ) may be a separate microprocessor embedded on the nic ( 102 )). alternatively , the classifier ( 155 ) may be implemented in software stored in memory ( e . g ., firmware , etc .) on the nic and executed by a microprocessor on the nic ( 102 ). in one embodiment of the invention , the host ( 101 ) may include the following components : a device driver ( 140 ), one or more software receive rings ( 130 , 135 ), one or more virtual nics ( 120 , 125 ), and one or more virtual machines ( 105 , 110 ) containing one or more virtual stacks ( 106 , 111 ). in one embodiment of the invention , the device driver ( 140 ) provides an interface between the hardware receive rings ( 145 , 150 ) and the host ( 101 ). more specifically , the device driver ( 140 ) exposes the hardware receive rings ( 145 , 150 ) to the host ( 101 ). in one embodiment of the invention , each of the software receive rings ( 130 , 135 ) is associated with one or more hardware receive rings ( 145 , 150 ). in one embodiment of the invention , there is a one - to - one mapping of hardware receive rings ( 145 , 150 ) to software receive rings ( 130 , 135 ). in one embodiment of the invention , a packet may flow from a hardware receive ring ( 145 , 150 ) to a virtual nic ( 120 , 125 ) through a software receive ring ( 130 , 135 ). in other words , the software receive ring ( 130 , 135 ) corresponds to a buffer interposed between a hardware receive ring ( 145 , 150 ) and a virtual nic ( 120 , 125 ). alternatively , the software receive ring ( 130 , 135 ) corresponds to a fifo queue interposed between a hardware receive ring ( 145 , 150 ) and a virtual nic ( 120 , 125 ). in one embodiment of the invention , a software receive ring ( 130 , 135 ) may be capable of determining the bandwidth consumed by a virtual machine ( 105 , 110 ) by analyzing the number and / or contents of packets flowing from a hardware receive ring ( 145 , 150 ) to the software receive ring ( 130 , 135 ) ( and , thus , to the virtual machine associated with the software receive ring ). in one embodiment of the invention , each software receive ring ( 130 , 135 ) is capable of adjusting the operating mode of the one or more hardware receive rings ( 145 , 150 ) based on bandwidth consumption ( discussed below ). further , in one embodiment of the invention , each software receive ring ( 130 , 135 ) is configured to regulate the flow of packets from the nic ( 102 ) to the virtual nics ( 120 , 125 ) based on its operating mode ( discussed below ). in one embodiment of the invention , each software receive ring ( 130 , 135 ) is implemented in the media access control ( mac ) layer ( not shown ) of the host ( 101 ). in one or more embodiments of the invention , each of the virtual nics ( 120 , 125 ) is associated with a software receive ring ( 130 , 135 ). the virtual nics ( 120 , 125 ) provide an abstraction layer between the nic ( 102 ) and the various packet destinations ( not shown ) executing on the virtual machines ( 105 , 110 ) of the host ( 101 ). more specifically , each virtual nic ( 120 , 125 ) operates like a nic ( 102 ). for example , in one embodiment of the invention , each virtual nic ( 120 , 125 ) is associated with one or more internet protocol ( ip ) addresses , one or more ports , and configured to handle one or more protocol types . thus , while the host ( 101 ) may be operatively connected to a single nic ( 102 ), packet destinations ( not shown ) executing on the virtual machines ( 105 , 110 ) of the host ( 101 ) operate as if the host ( 101 ) is bound to multiple nics . in one or more embodiments of the invention , each of the virtual nics ( 120 , 125 ) is implemented in the mac layer of the host ( 101 ). in one embodiment of the invention , each of the virtual nics ( 120 , 125 ) is operatively connected to a virtual machine ( 105 , 110 ), where each virtual machine ( 105 , 110 ) includes one or more virtual stacks ( 106 , 111 ). in one embodiment of the invention , each virtual stack ( 106 , 111 ) includes network layer functionality . in one embodiment of the invention , network layer functionality corresponds to functionality to manage packet addressing and delivery on a network ( e . g ., functionality to support ip , address resolution protocol ( arp ), internet control message protocol , etc .). in one embodiment of the invention , each virtual stack ( 106 , 111 ) is configured to send and / or receive packets from one or more associated packet destinations ( not shown ) on the virtual machine ( 105 , 110 ). further , each virtual stack ( 106 , 111 ) is configured to send and / or receive packets from an associated virtual nic ( 120 , 125 ). further still , each virtual stack ( 106 , 111 ) may also include functionality , as needed , to perform additional processing on the incoming and outgoing packets . this additional processing may include , but is not limited to , cryptographic processing , firewall routing , etc . in one embodiment of the invention , each of the virtual machines ( 105 , 110 ) is located outside of the mac layer ( not shown ) of the host ( 101 ). in one embodiment of the invention , each virtual machine ( 105 , 110 ) shares host resources ( e . g ., one or more central processing units ( cpu ), memory , etc .) ( not shown ) with other virtual machines ( 105 , 110 ) on the host ( 101 ). as discussed above , a virtual machine ( 105 , 110 ) on a host ( 101 ) may include one or more packet destinations ( e . g ., containers and / or services ) ( not shown ). in one embodiment of the invention , the packet destination ( s ) ( e . g ., containers and / or services ) corresponds to any process or group of processes executing on the virtual machine of the host that sends and receives network traffic . examples of packet destinations include , but are not limited to containers , services ( e . g ., web server ), etc . fig2 shows a flowchart in accordance with one embodiment of the invention . initially , a virtual stack is created and bound to a packet destination executing on a virtual machine ( step 210 ). those skilled in the art will appreciate that the packet destination may be bound to the virtual stack anytime after the virtual stack has been created . in step 220 , a virtual nic is created and bound to the virtual machine . at this stage , a software receive ring is created ( step 230 ) and bound to both the virtual machine and a hardware receive ring ( step 240 ). the classifier is subsequently programmed such that network traffic for the virtual machine is directed to the hardware ring bounded to the software ring created in step 230 ( step 250 ). the software receive ring is then programmed to enforce bandwidth control ( step 260 ). in one embodiment of the invention , programming the software ring to enforce bandwidth control ( step 260 ) includes specifying a packet arrival rate threshold . in one embodiment of the invention , the packet arrival rate threshold specifies the maximum number of packets that may flow to the software ring over a given time interval ( e . g ., the maximum number of packets that may flow to the virtual nic per second ). alternatively , the packet arrival rate threshold may specify the number of bytes of data that may flow to the software receive ring over a specific time interval . those skilled in the art will appreciate that the steps shown in fig2 may be repeated as required to create any number of virtual stacks . once the virtual network stack ( s ) has been created , as described above , the host may proceed to receive packets from the network . those skilled in the art will also appreciate that the number of virtual stacks created using the steps shown in fig2 may vary based on the available system resources ( e . g ., number of cpus , type of nic , etc .). fig3 shows a flowchart in accordance with one embodiment of the invention . initially , a packet is received by the nic ( step 310 ). the classifier analyses the packet and determines to which of the hardware receive rings the packed should be sent . the packet is subsequently sent to the appropriate hardware receive ring ( step 320 ). at this stage , the process determines the operating mode of the hardware receive ring ( step 330 ). in one embodiment of the invention , a hardware receive ring may operate in polling mode . if the hardware receive ring is operating in polling mode , then the packet remains in the hardware receive ring until the software receive ring requests one or more packets from the hardware receive ring ( step 340 ). in one embodiment of the invention , the software receive ring may request all packets in the hardware receive ring , or may request any number of packets in the hardware receive ring . subsequently , the packet ( s ) is sent to the software receive ring ( step 350 ). in one embodiment of the invention , the software ring may not request any packets if the packet arrival rate exceeds the packet arrival rate threshold . in one embodiment of the invention , the software ring may poll the hardware receive ring to keep the packet arrival rate at or below the packet arrival rate threshold . in one embodiment of the invention , the hardware receive ring may operate in interrupt mode . if the hardware receive ring is operating in interrupt mode , then the hardware receive ring may issue an interrupt when it receives the packet ( step 360 ). the packet ( and any additional packets at the time the interrupt is issued ) on the hardware receive ring is then send to software receive ring ( step 350 ). in step 370 , the packet ( s ) in the software receive ring is sent to virtual stack through the associated virtual nic . in step 375 , it is determined whether the operation mode of the receive ring needs to be changed . in one embodiment of the invention , if the packet arrival rate at the software receive ring exceeds the packet arrival rate threshold , the hardware receive rings may be placed in polling mode ( step 380 ). in one embodiment of the invention , if the packet arrival rate at the software receive ring is below the packet arrival rate threshold , the hardware receive ring may be placed in interrupt mode ( or no action may be taken with respect to changing the operating mode ) ( step 380 ). the invention may be implemented on virtually any type of computer regardless of the platform being used . for example , as shown in fig4 , a computer system ( 400 ) includes a processor ( 402 ), associated memory ( 404 ), a storage device ( 406 ), and numerous other elements and functionalities typical of today &# 39 ; s computers ( not shown ). the computer ( 400 ) may also include input means , such as a keyboard ( 408 ) and a mouse ( 410 ), and output means , such as a monitor ( 412 ). the computer system ( 400 ) is connected to a local area network ( lan ) or a wide area network ( e . g ., the internet ) ( not shown ) via a network interface connection ( not shown ). those skilled in the art will appreciate that these input and output means may take other forms . further , those skilled in the art will appreciate that one or more elements of the aforementioned computer system ( 400 ) may be located at a remote location and connected to the other elements over a network . further , the invention may be implemented on a distributed system having a plurality of nodes , where each portion of the invention ( e . g ., vnic , software receive ring , virtual stack , etc .) may be located on a different node within the distributed system . in one embodiment of the invention , the node corresponds to a computer system . alternatively , the node may correspond to a processor with associated physical memory . the node may alternatively correspond to a processor with shared memory and / or resources . further , software instructions to perform embodiments of the invention may be stored on a computer readable medium such as a compact disc ( cd ), a diskette , a tape , a file , or any other computer readable storage device . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims . | 7 |
although the following detailed description contains many specifics for the purposes of illustration , anyone of ordinary skill in the art will appreciate that many variations and alterations to the following details are within the scope of the invention . the present invention provides a method of classifying , qualifying and relating information . this method is referred to herein as active rank . the method utilizes a network built from semantic , conceptual , numeric , etc ., relations between elements of different sets that are structurally alike , understanding structurally alike as different sets that can be related to the same group of network nodes . the system is based on dynamics that underlie the information network built from the interaction among the different elements mentioned before . for this reason , it is possible to define a ranking system that depends not only on the structure of the links of the network , but also on interest profile of each particular element . a vector is defined to capture both the importance of the structure of the links and the interest profiles of participating subjects . this vector is referenced herein as an active rank index vector or in general as an active rank vector . an information network , formed from subjects ( users ) and registers ( documents or information registers ) as elements of two structurally similar sets that can be related to each other by a common set of network nodes ( categories ), will be used in order to simplify the explanation and comprehension of the method . nevertheless , it should be interpreted as the behavior that n active rank vectors would have , interacting among themselves , every time they interact . what is meant by structurally alike sets is that they can be related to the same type of nodes . in other words , in the examples of information networks we will use , although subjects and registers can be related to different conceptual categories , an active rank vector of two elements belonging to different sets is structurally identical to an external observer , can be observed as an indistinct element of the network consider two structurally alike sets a and u . in this example , each element a of the set a represents a register and each element u of the set u represents a user . each elements a and u of the sets a and u can be related to at least one individual category j of a set of m categories . these two sets a and u are structurally alike because they both can be related to the same set of categories . a ranking vector , or active ranking vector , can be defined for each element a , u of the set a , u based on how close the element relates to each of the m categories . as noted , the same symbols will be used to denote the ranking vectors . thus , a ranking vector for an element a is also denoted as ranking vector a , unless the context requires otherwise . this is expressed as where each ranking vector is an m - dimensional vector , with its components representing the degree to which the element a is related to category j . it should be noted that the degree to which an element relates to a category may have different meanings depending on the nature of the set and the set of categories . for example , a set may be defined to represent people in a community . a ranking vector associated with a member in the community may be defined to represent the member &# 39 ; s interest profile , with categories being different interest categories such as movies , books , hobbies etc . each component of the ranking vector in this case represents how important the category is to the member . we can also define a set of documents . a ranking vector associated with a document may be defined to represent how the document is classified based on a set of subject categories , such as history , science , literature etc . in the graph interpretation , register a is related to category j , j ε [ 0 , m − 1 ], if a j & gt ; 0 ; similarly , u is related to category j , j ε [ 0 , m − 1 ], if u j & gt ; 0 . it is worth pointing out that the belonging of a register to a category is not exclusive . the system permits an interdisciplinary connection and classification of the information . a vector x =( x 0 , λ , x m − 1 ) is normalized if it satisfies conveniently , we can normalize every ranking vector so that each component of the ranking vectors is a positive real value between zero and one . in addition to ranking vectors defined for each of the elements of structurally alike sets , a link between two elements can be established to represent relationship between an element of one set and an element of another set . the relationship can be semantic , conceptual , numeric , etc ., among others . a link weight can be associated with each of such links , to indicate how important the relationship is to these two elements from different sets . a link may also be established to relate two elements of the same set , in which case a link weight measures the similarity of these two elements based on how many common categories they share and to what degree they share the common categories . r 1 is link with n 1 and n 2 , both connections has the same link weight ( 0 . 5 ) r 2 is link with n 2 and n 3 , both connections has the same link weight ( 0 . 5 ) u 1 is link with n 1 and n 3 , both connections has the same link weight ( 0 . 5 ) in fig2 , n 2 is a common node of r 1 and r 2 and we can interpret that r 1 and r 2 are related indirectly by the common relation to n 2 . we create two more links , a link between u 1 and r 1 and another link between u 1 and r 2 , using n 1 and n 3 respectively as a commons nodes of each pair , i . e ., although r 1 and r 2 are not directly linked , they are otherwise unrelated nodes , links with the common nodes who provide secondary connection ( and may be viewed as bridge ) that link r 1 to r 2 . conveniently , r 1 and r 2 may also be viewed as connected to each other directly via a virtual link , shown in a dash - dotted line linking r 1 and r 2 . the magnitude indicated next to each of the new links corresponds to the ranking measure ( or similarity quotient ) between the two corresponding vertexes . one must be cautious not to confuse link weight and ranking . ranking is a property we can measure between elements of the network . the link weights have to be defined in order to generate the network in which ranking measurements will be made . nevertheless , ranking measurements can be interpreted as link weight for virtual links mentioned before . as an example for understanding better the effect of an interactive system , we define the interaction of the user with the system as each incident of download of any register ( i . e ., document ); so , if the user u 1 downloads the register r 1 , or document r 1 , five times , the link between u 1 and r 1 will have an increased ranking measure . this is illustrated in fig3 , which also shows new values of the active rank vectors represented in the network . fig3 shows that the ranking measure of a link between r 1 and u 1 is now larger , indicating that r 1 and u 1 are more similar now . the network shown in fig3 also includes a new real link created by u 1 ( from u 1 to n 2 ), and another new real link from r 1 to n 3 , thus increasing the interconnections inside the network . because of the interactions , the ranking measure associated with u 1 and r 1 has changed , indicating redistribution of relative weight among other links . it will be appreciated that the values of weight and ranking measures shown in fig3 are for illustration only and will be different for different systems . having shown an example of an information network and the evolution of the network as a result of interactions between elements of the network , we next describe a system and method of classifying , qualifying and relating information based on mathematical graphs and networks , referred to herein as “ active rank ”. for explanation purposes only , we are going to explain it using an information network . using active rank , one can classify information into categories . suppose we have m categories , numbered form 0 to m − 1 , in which we want to classify our information . then , we define an active rank vector which is a basic unit of the system . consider active rank vectors a =( a 0 , . . . , a m − 1 ) and u =( u 0 , . . . , u m − 1 ) where each component of the vectors is a positive real value between zero and one . suppose , for the purpose of explanation , that the vectors a and u represent the associated active rank vectors of a user u and a register a respectively . each vertex of the network is associated with an active rank vector . the set of users and the set of registers are considered to be structurally similar in that they can be related to the same group of network nodes . in other words , they both relate to the same set of categories . we therefore will use active rank vector a and register a interchangeably . we will also use active rank vector u and user u interchangeably . further , we will treat a and u as elements of the network . in the graph interpretation , register a is related to category j , j ε [ 0 , m − 1 ], if a j & gt ; 0 ; similarly , u is related to category j , j ε [ 0 , m − 1 ], if u j & gt ; 0 . when initializing an active rank system , ranking vectors a and u will need to be initialized . they may be initialized by assigning an initial value , the same value , to each component of each ranking vectors . alternatively , they may be initialized using statistical information already known about the set of registers and set of users . for example , there may be known , or pre - existing information that one can get from network structure , or existing relationships between one element ( user , documents , etc .) with all other elements or vertexes of the network . for example , the frequency a particular word appearing in a document may be used as statistical information to relate the document to nodes that represent a set of keywords . the frequency in this case represents the degree to which the document is related to the particular word . as another example , consider the total number of hypertext links that a webpage has with other webpages in certain category . the number of hypertext links may be used as pre - existing statistical information when initializing an active rank vector associated with the webpage . in general , using active rank the dynamic of the network is determined by the interaction between different elements of the network itself and is reflected in the evolution of the active rank vectors , i . e ., the change of the vector values . in one embodiment , these vectors represent the interest profiles . when two elements interact , we would expect that the profiles of both elements would be affected according to an existing similarity between them . more particularly , if these two vectors can influence each other through their interactions with each other , we would expect that , after sufficient number of interactions , both vectors would converge toward each other , or even could reach some common convergence point . here is an example to illustrate this convergence . when two different persons interact eventually they will find their common interests , and at the same time they each adopt some of the other &# 39 ; s interests that they did not have . if this interaction was carried out all the time or a great number of times , then both profiles would be very similar eventually . these interests , or weights assigned to interests for each subject , may evolve or redistribute in a number of different manners . the following illustrates two different ways the interests or weights can evolve or redistribute as a result of interaction between two elements . the first one is when a first element affects the latter and does not suffer alterations itself . depending on how strongly the first element can influence the latter element , after a number of interactions , the latter element generally will adopt the pattern of interests of the applicator ( i . e ., the first element ) as its own . the second is when there is feedback ; this is when simultaneously both elements influence each other , where the result will be convergent values in an intermediate profile for both elements . the mono - directional or bi - directional effect depends on the nature of interactions among elements in the system . the method described herein is applicable whether the influence exhibited is mono - directional or bi - directional . next we describe a weight redistribution algorithm to illustrate how to mathematically model the evolution of vectors . it will be appreciated that other mathematical models can be developed to mimic the evolution of vectors or relationships as a result of interaction between elements . let κ ε ( 0 , 1 ] be an arbitrary interaction coefficient that reflects speed of weight redistribution at each interaction . the interaction coefficient is generally selected to model and typically determined by the nature of interactions among the elements in the system and is a parameter of the algorithm described herein . let a and u be the two active rank vectors previously initialized , associated to a ( register ) and u ( subject ) as we explain before , and where u applies over a ( the subject interact with the register modifying the active rank vector values of vector a ). we define an application of the element u over a during an interaction as : a j new = a j + κ ( u i − a j ), where the result of the calculation on the right hand side of the equation is assigned to the variable on the left hand side . the application of vector a over vector u can be similarly defined . if the application is bidirectional , both formulas are applied simultaneously . the redistribution of link weight that happens during the elements interaction is one important aspect of the active rank algorithm . as the vectors are generally normalized , the components of an active rank vector add up to one . when a new register ( or new element ) is added to the system , the active rank vector associated with each element is preferably normalized again , or re - initialized . there are different ways of initializing an active rank vector . selection of a particular method of initialization is generally part of a system &# 39 ; s implementation choice . on the other hand , when a new node ( i . e ., new category ) is generated in the network , we simply need to add a null component to all active rank vectors of the network , all in the same position . this is expressed as : if a new node is added to the network and the active rank vectors of the network have the form a =( a 0 , . . . , a m − 1 ), then a new position m + 1 is added and the value a m = 0 is defined for all existing vectors . as will be appreciated , there can be many different ways of adding a new node ( or a new register ). the methods described above are only some examples , for illustration only . a general ranking or similarity quotient ρ is defined for any pair of elements of the network . the ranking or similarity quotient is determined from the involved active rank vectors ; the set of vectors representing the structure of the network links . conveniently , we can also represent the set of vectors in a matrix form to represent the network . we define the ranking between two elements a and u as : the rankings associated with links between elements are illustrated in fig2 and 3 . the dotted lines between r 1 and u 1 and r 2 and u 1 represent the virtual links between the respective pair of elements . the numbers shown next to the dotted lines are values of ρ ( r 1 , u 1 ) and ρ ( r 2 , u 1 ) respectively . in fig2 , both values are equal to 0 . 5 , and can be interpreted that r 1 and r 2 are equally important to the element u 1 at that time . but in fig3 , after five interactions between u 1 and r 1 , the values of the new ranking measures are ρ ( r 1 , u 1 )= 0 . 705 and ρ ( r 2 , u 1 )= 0 . 5 . the increase of ranking measure between r 1 and u 1 is a consequence of the interaction between them . note that ρ ( a , u )= ρ ( u , a ) and that the larger the value ρ ( a , u ) is , the more close the relation between the elements . a value ρ ( a , u )= 0 indicates that the elements do not share any connection with any node in common , and that all of their relations are non - coincidental , while ρ ( a , u )= 1 expresses that both elements have the same active rank vector . two elements u 1 and u 2 can have the same ranking measure in relation to a third element c , ρ ( c , u 1 )= ρ ( c , u 2 ), and a null value as for themselves , ρ ( u 1 , u 2 )= 0 . this implies that two different elements can have the same relational importance to a third element , without being connected in the same way between themselves , including not sharing nodes in common . this method allows us to quantify the relation between two elements of the network , in this case a and u . therefore , if we obtain the ranking between a set of elements , u ={ u 0 , λ , u m − 1 }, and another element , a , we can rank all elements in set u with reference to element a as the base . this ranking subsequently provides a foundation for sorting results according to relevance to a specific user . for example , this can be used in the case where a user with the active rank vector u submits a search query , and a is the set of active rank vectors associated to the set of network elements where you want to search . ordering the results by ranking provides a list of results of a query where probably the top ranked results are more relevant to the user than the ones ranked last . this can be observed as a personalized search system . we can also do the individual analysis of the active rank vector values of any element ; where we interpret the value of each index as the particular ranking that such element has with certain node , as was explained earlier . the former is possible due to the fact that after a relatively small number of interactions , the specific weight for each element of the vector mentioned before converges . it is evident that said convergence is limited by the nature of the system where the method is applied , as well as its particular dynamic and the sets that interact . as described above , the present invention provides a computer implemented method that generates relations between elements of diverse sets , generates a measure of dynamic weight for each relation and obtains dynamic coefficients of similarity between the elements of the sets . the method includes the steps of generating the relation between the elements of a given data set based on individual relationships of its elements with other elements from other sets ; generating a dynamic measure of link weight for each relation , which can be modified by the interaction between elements of the same or other set ; obtaining and processing coefficients of similarity between elements of the sets , which are dynamic and are utilized to generate subsets of similar elements . the dynamic characteristics mentioned before express that the values and situations can change by the network interaction , and the different steps can be applied all the times that be necessary . clustering algorithms can be applied to different sections of the network structure . these clustering algorithms can be applied to elements and nodes which are both vertexes of the graph . if a and b are connected vertexes , and there is a link between a and another vertex c , then it is probable that b and c are also related . this trend of the vertices to aggregate in highly interconnected piles is known as clustering . for example , members of a society tend to group in small communities where everybody knows almost everyone . in information networks , thanks to the use of active rank one can determine the weight of each link of each element ( subject , register , document , etc . ), and relate them to find out the importance of a determined link and , thanks to this , can build a more efficient clustering algorithm that automatically generates more representative groups . an active rank vector can be interpreted as a point in a space . such a space may be a vector space , but in general , is a space with active rank vectors corresponding to points in the space . when we have a succession of active rank vectors that represents an element of a network that varies with time and we interpret them as points we get a trajectory in this space . if we extrapolate the trajectory we can predict the behavior of the element by its associated new predicted active rank vector . with the trajectory interpretation many aspects of the behavior can be analyzed . in one embodiment , the interaction dynamic between the elements of the sets in each system depends on the nature and objectives of the system itself . a model can be established to describe the interaction . according to a feature of this aspect of the algorithm , the value of an interaction coefficient used in modeling the interaction depends directly on the interaction nature ( frequency , individual importance , etc .) and can vary according to the system , also can be adjusted during the processes of interaction if necessary . this in turn determines the change of active rank vector a at each application of the element u over element a during each interaction . in one implementation , the method divides the network into sets or blocks . these sets or blocks develop some action such as : making use of the dynamic link weights of relation between the elements of the sets to determine similarity coefficients ; self - organizing the elements of the different sets from the similarity coefficients and the analysis of the dynamic link weights of relation between the elements ; processing interaction between the elements of the sets that redistributes the link weight between each relation ; redistributing the link weights of relations of an element based on the values of link weights of relations of the elements which it interacts with . based on the relations generated between the elements of the sets , one can develop , implement or improve search , administration or other kind of analysis or information processing system . in addition , the method can be used to sort the results of a search or query making use of the similarity coefficients between the elements . the dynamic link weight of relations between elements can also be used in the sorting of results of a search or query . the system and method can be implemented on any computer system , platform , architecture and in any programming language , whether distributed systems , parallel computing or other technology . for example , the system and method may be implemented as a software application , stored on a computer readable media , such as magnetic hard disk , optical compact disk or flash memory , and read by a computer and executed on a processor of the computer . there is no restriction as to storing the information generated using any particular database systems or any data storing system . the method can be applied to any set of information which is being read and / or modified simultaneously by any other method , without limiting itself to any particular implementation for the analysis of information sets . in one embodiment , the method includes : providing a measure of dynamic link weight for each relation substantially independent of the type of data set or the type of category information which is being processed ; and computing a dynamic coefficient of similarity independent of the type of elements of either the data set or category information which are being processed ; the interpretation of generated results as interests profiles . in another embodiment , steps include : using statistical information to generate or initialize active rank vectors ; the use of computing optimization method such as number rounding or other types of optimization . the invention also can be used to provide a graphical representation of a computer implemented method and the results generated by the algorithm . the graphical representation provides an easy way to visualize the active rank vectors as a network or a set of points in a defined space ; a representation of the relation weights between elements by characters , icons , figures , colors or size on a network or as points in space ; a representation of the different sets involved as different interrelated networks , and includes development and implementation of graphical navigation systems for networks generated with active rank vectors . the graphical representation of the network can be conveniently shown on a graphical user interface , such as on a graphical computer display . the invention also can be used to provide a textual representation of a computer implemented method and the results generated by the algorithm . the textual representation provides a numeric data of active rank vectors ; a tabular representation of active rank vectors ; a numeric representation of the relation weights ; and includes the development of textual navigation systems for networks generated with active rank vectors . various embodiments of the invention have now been described in detail . those skilled in the art will appreciate that numerous modifications , adaptations and variations may be made to the embodiments without departing from the scope of the invention . since changes in and or additions to the above - described best mode may be made without departing from the nature , spirit or scope of the invention , the invention is not to be limited to those details but only by the appended claims . | 6 |
nadh dehydrogenase subunit 2 ( nd2 ) is a src unique domain - binding protein . a yeast two - hybrid screen of a fetal brain library using bait constructs containing the murine src unique domain was conducted in order to search for proteins that interact with the src unique domain . cdnas encoding amino acids 4 - 82 ( the src unique domain ) and amino acids 4 - 150 ( the src unique and sh3 domains ) of murine n - src were ligated into peg202 ( gyuris et al . cell 75 : 791 - 803 1993 ) to create two expression vectors encoding in frame lexa fusions containing the src unique domain ( the nucleotide sequence encoding src is seq id no : 3 and the amino acid sequence is seq id no : 4 ). the bait constructs were then sequenced . both baits were tested to ensure that the baits did not activate transcription of the reporters in the absence of prey and that both could enter the nucleus and bind to lexa operators . to create the selection strains for screening , each bait plasmid was individually transformed into the yeast strain egy48 . egy48 has an integrated leu2 selectable marker regulated by 6 lexa operator repeats , and carries a reporter plasmid with the lacz gene regulated by 8 lexa operator repeats . bait - prey interactions that occur with low affinity result in activation of the leu2 reporter gene only , whereas high affinity interactions result in activation of both the leu2 and lacz reporter genes , allowing for double selection of prey . the selection strain was transformed with a representative activation - tagged cdna prey fusion library constructed using ˜ 1 kilobase ecori fragmented poly a (+) rna from human fetal brain . yeast transformed with the prey library ( approximately 1 . 1 × 10 6 clones ) were screened by double selection on x - gal leu − medium . prey cdnas encoding proteins that interacted with the bait were isolated and sequenced . src , fyn , and nd2 recombinant proteins were prepared . the cdnas encoding the sh3 and sh2 domains of mouse n - src and fyn were pcr subcloned , ligated in frame into pgex4t - 1 ( amersham pharmacia biotech , baie d &# 39 ; urfé , québec ), and sequenced . these plasmids , as well as plasmids encoding the unique domains of src and fyn in pgex2t ′ 6 , were transformed into bl21 bacteria , and gst fusion proteins were purified by glutathione affinity chromatography . to create the nd2 . 1 , nd2 . 2 , and nd2 . 3 gst fusion proteins , cdnas encoding amino acids 239 - 321 ( nd2 . 1 - gst ; seq id no : 7 ), amino acids 189 - 238 ( nd2 . 2 - gst ; seq id no : 11 ), and amino acids 1 - 188 ( nd2 . 3 - gst ; seq id no : 13 ) of human nd2 were pcr subcloned and ligated into pgex4t - 1 ( the nucleotide sequence encoding nd2 is seq id no : 8 and the amino acid sequence is seq id no : 9 ; the nucleotide sequences encoding nd2 . 1 ; nd2 . 2 and nd2 . 3 are seq id nos : 6 , 10 and 12 , respectively ). using pcr - based single nucleotide mutagenesis , all cdnas encoding nd2 fusion proteins were corrected for differences between mitochondrial and nuclear codons to prevent premature translation termination and protein truncation . all constructs were then confirmed by sequencing . the plasmids were transformed into bacteria , and gst fusion proteins were purified by glutathione affinity chromatography . detailed protocols for in vitro binding assays , pull down assays , immunoblotting , and co - immunoprecipitation techniques can be found in pelkey et al . ( neuron 34 : 127 - 138 2002 ). in two independent screens , cdna fragments encoding overlapping regions within nadh dehydrogenase subunit 2 ( nd2 ) were isolated ( fig1 a ). nd2 is a 347 amino acid protein ( seq id no : 9 ) that is a subunit of the inner mitochondrial membrane enzyme , nadh dehydrogenase ( complex i ). nd2 is one of a group of seven oxidoreductase proteins that are encoded in the mitochondrial genome and which co - assemble with 35 nuclear encoded subunits to form complex i . nd2 on its own lacks enzymatic activity ( j . e . walker quarterly reviews of biophysics 25 ( 3 ): 253 - 324 1992 ; sazanov et al . journal of molecular biology 302 : 455 - 464 2000 ; sazanov et al . biochemistry 39 : 7229 - 7235 2000 ). fig1 a is a schematic diagram illustrating the domain structure of nd2 , clones isolated from the yeast two hybrid screen , and recombinant gst - tagged fusion proteins . the lines point out the beginning of the oxidoreductase domain at amino acid position 23 and the end at amino acid position 197 . each clone and gst - fusion protein represent overlapping regions within nd2 . as yeast two - hybrid screening may reveal false positive protein - protein interactions , the interaction between src and nd2 was observed using an independent methodological approach . direct binding in vitro between nd2 and src was tested using recombinant proteins . a series of gst fusion proteins comprised of portions of nd2 that spanned the overlapping region found with the yeast two - hybrid screen were made ( fig1 a ). importantly , the cdnas encoding each of the nd2 fusion proteins were corrected for differences between mitochondrial and nuclear codons so that the sequence of the nd2 portion of the fusion proteins was that which would have been produced by translation in the mitochondria . for example , fig9 a shows the nucleotide sequence encoding recombinant nd2 . 1 protein ( seq id no : 6 ). codons that are highlighted with bold type were altered by pcr - based single nucleotide mutagenesis . tga was changed to tgg to prevent premature translation termination and protein truncation . gaa was changed to gag to remove a restriction enzyme site . numbers in parenthesis correspond to equivalent positions in the endogenous human nd2 nucleotide sequence . fig9 b shows the amino acid sequence of recombinant nd2 . 1 protein ( seq id no : 7 ). numbers in parenthesis correspond to equivalent positions in the endogenous human nd2 amino acid sequence . each of the series of gst - fusion proteins was tested individually for interaction with the src unique domain (“ pull - down ” assay ). fig1 b shows a blot of nd2 - gst fusion proteins probed with biotinylated src unique domain followed by a streptavidin - hrp conjugate . a gst fusion protein containing amino acids 239 - 321 of nd2 ( nd2 . 1 - gst ; seq id no : 7 ) was found that bound to the unique domain of src ( fig1 b ). in contrast , gst fusion proteins containing amino acids 189 - 238 ( nd2 . 2 - gst ) or 1 - 188 ( nd2 . 3 - gst ) of nd2 ( nd2 protein sequence is seq id no : 9 ) did not bind to the src unique domain . these results , together with those from the yeast two - hybrid screen , indicate that nd2 is a src unique domain - binding protein . the results indicate further that the src - binding portion of nd2 is contained within the region of amino acids 239 - 321 ( seq id no : 7 ). this region of nd2 shows little conservation amongst the mitochondrially encoded oxidoreductase proteins and is outside the so - called “ oxidoreductase domain ”, a signature region identified in all mitochondrially encoded subunits of nadh dehydrogenase ( j . e . walker quarterly reviews of biophysics 25 ( 3 ): 253 - 324 1992 ; sazanov et al . journal of molecular biology 302 : 455 - 464 2000 ; sazanov et al . biochemistry 39 : 7229 - 7235 2000 ) and some antiporters ( fearnley et al . biochim . biophys . acta 1140 : 105 - 143 1992 ). another “ pull - down ” assay was conducted to determine whether the binding of nd2 might generalize to other domains of src or to other src family tyrosine kinases . however , it was found that nd2 . 1 - gst did not bind to either of the prototypic protein - protein interaction domains of src , the sh2 or sh3 domains ( fig1 ). fig1 shows a blot of nd2 . 1 - gst probed with biotinylated domains of src and fyn followed by streptavidin - hrp conjugate . to examine the potential interaction of nd2 with other kinases of the src family recombinant domains of fyn were tested , the protein most closely related to src but which has little primary sequence conservation in the unique domain ( brown et al . biochim . biophys . acta 1287 : 121 - 149 1996 ; t . pawson nature 373 : 573 - 580 1995 ). it was found that nd2 . 1 - gst did not interact in vitro with the fyn unique domain ; nor did nd2 . 1 bind to the sh2 or sh3 domains of fyn . thus , the nd2 . 1 region does not interact with the sh2 or sh3 domains of src or fyn nor does it generally bind to the unique domain of src family tyrosine kinases . to investigate the possibility that src and nd2 may interact in vivo , brain lysates were immunoprecipitated with antibodies directed against nd2 ( anti - nd2 ) or against src ( anti - src ). it was found that immunoprecipitating src led to co - immunoprecipitation of nd2 ( fig1 d ). fig1 d shows immunoblots of co - immunoprecipitates from brain homogenate probed with anti - nd2 , anti - src or anti - fyn as indicated . non - specific igg was used as a negative control for immunoprecipitation . fyn was readily detected in the brain homogenate used as a starting material for the co - immunoprecipitation ( data not illustrated ). conversely , immunoprecipitating with anti - nd2 resulted in co - immunoprecipitation of src . in contrast , anti - nd2 did not co - immunoprecipitate fyn and neither nd2 nor src was immunoprecipitated with a non - specific igg ( fig1 d ). as an independent immunoprecipitation control it was found that nd2 was co - immunoprecipitated by anti - src from src +/+ fibroblasts but not from src −/− fibroblasts ( fig1 e ). fig1 e shows an immunoblot of co - immunoprecipitates from cultured src +/+ and src −/− fibroblasts probed with anti - nd2 . non - specific igg was used as a negative control for immunprecipitation , and immunoblotting of nd2 protein from both cell lines was used as a positive control . thus , in addition to finding the nd2 - src unique domain interaction in two yeast two - hybrid screens and in vitro binding assays with recombinant proteins , it was found that nd2 and src co - immunoprecipitated with each other , which together led to the conclusion that the nd2 is a src unique - domain binding protein that may interact with src in vivo . post - synaptic density proteins ( kennedy et al . proceedings of the national academy of science usa 80 : 7357 - 7361 1983 ) were prepared from rat brain as described in detail ( pelkey et al . neuron 34 : 127 - 138 2002 ). cellular fractionation of rat brain tissue into nuclear , heavy mitochondrial , light mitochondrial , microsomal , and cytosolic fractions was performed by differential centrifugation of tissue homogenate in 0 . 25 m sucrose / 10 mm hepes - naoh , 1 mm edta , ph 7 . 4 with 2 μg each of aprotinin , pepstatin a , and leupeptin ( sigma , st . louis , mo .) at 4 ° c . nuclei were pelleted by centrifugation at 1 000 g for 10 minutes , the supernatant was removed and spun at 3 000 g for 10 minutes to obtain a heavy mitochondrial pellet . the supernatant was removed and spun at 16 000 g for 15 minutes to obtain a light mitochondrial pellet . the supernatant was removed and spun at 100 000 g for 1 hour to obtain a microsomal pellet and the cytosolic fraction . all pellets were then resuspended in ripa buffer ( 50 mm tris ph 7 . 6 , 150 mm nacl , 1 mm edta , 1 % np - 40 , 2 . 5 mg / ml nadoc , 1 mm na 3 vo 4 1 mm pmsf , and 2 μg / ml each of protease inhibitors ). the light mitochondrial fraction was used in subsequent experiments . for western blots , 50 μg of total protein was loaded per lane , resolved by sds - page , transferred to nitrocellulose membranes , and probed with anti - nd2 , anti - cytol and anti - nd4 ( mouse monoclonals , molecular probes inc ., eugene , oreg . ), anti - psd95 ( mouse monoclonal clone 7e3 - 1b8 , oncogene research products , cambridge , mass . ), anti - nr1 ( mouse monoclonal clone 54 . 1 , pharmingen ), anti - src , or anti - synaptophysin ( mouse monoclonal , sigma ). post - embedding immunogold electron microscopy was carried out . sprague dawley rats were anesthetized and perfused with 4 % paraformaldehyde plus 0 . 5 % glutaraldehyde in 0 . 1 m phosphate buffer . parasagittal sections of the hippocampus were cryoprotected in 30 % glycerol and frozen in liquid propane . frozen sections were immersed in 1 . 5 % uranyl acetate in methanol at − 90 ° c ., infiltrated with lowicryl hm - 20 resin at − 45 ° c ., and polymerized with ultraviolet light . sections were incubated in 0 . 1 % sodium borohydride plus 50 mm glycine in tbs and 0 . 1 % triton x - 100 ( tbst ), followed by 10 % normal goat serum ( ngs ) in tbst , primary antibody in 1 % ngs in tbst , and immunogold ( 10 nm ; amersham pharmacia biotech ) in 1 % ngs in tbst plus 0 . 5 % polyethylene glycol . finally , the sections were stained in uranyl acetate and lead citrate prior to analysis . in the cns a prominent subcellular location for src is in the post - synaptic density ( psd ) ( yu et al . science 275 : 674 - 678 1997 ), a subsynaptic specialization at glutamatergic synapses comprised of α - amino - 3 - hydroxy - 5 - methylisoxazolepropionic acid ( ampa -) and nmda - type glutamate receptors together with scaffolding , signaling and regulatory proteins ( walikonis et al . journal of neuroscience 20 : 4069 - 4080 2000 ). because src is known to regulate subsynaptic nmdars ( yu et al . science 275 : 674 - 678 1997 ), if nd2 is the protein mediating the interaction between nmdars and the unique domain of src then nd2 is predicted to be present in the psd . this was tested by preparing psd proteins from rat brain homogenates by sequential fractionation and determining whether nd2 was present in this fraction . characteristic of a bona fide psd fraction , the fraction which was prepared contained post - synaptic proteins including psd - 95 and nmda receptor subunit proteins but lacked the pre - synaptic protein synaptophysin ( fig2 a ). fig2 a shows immunoblots of psd proteins probed with anti - nd2 , anti - cytochrome c oxidase i ( cyto 1 ), anti - nd4 , anti - psd95 , anti - nr1 , anti - src and anti - synaptophysin as indicated . it was found that nd2 was present in the psd fraction and the amount of nd2 estimated in this fraction was approximately 15 % of that in the total brain homogenate . in contrast to nd2 , neither the oxidoreductase protein nd4 , another mitochondrially - encoded component of complex i ( j . e . walker quarterly reviews of biophysics 25 ( 3 ): 253 - 324 1992 ; sazanov et al . journal of molecular biology 302 : 455 - 464 2000 ; sazanov et al . biochemistry 39 : 7229 - 7235 2000 ) nor cytochrome c oxidase subunit 1 ( cyto 1 ), an inner mitochondrial membrane protein that is part of complex iv ( marusich et al . biochim . biophys . acta 1362 : 145 - 159 1997 ), was detectable in the psd fraction . on the other hand , cyto 1 and nd4 , as well as nd2 , were readily detected in proteins from brain mitochondria ( fig2 b ). subsequent investigation indicated that the ndufa9 ( nadh - ubiquinone oxidoreductase 1 alpha subcomplex 9 ) subunit of mitochondrial complex i was detected and not nd4 ( fig1 b ). fig2 b shows immunoblots of mitochondrial proteins prepared by differential centrifugation probed with anti - nd2 , anti - cyto 1 and anti - nd4 . neither nr1 nor nr2a / b was detected in the mitochondrial fraction ( data not shown ). as noted above , subsequent investigations indicated that the antibody initially thought to recognize the mitochondrial protein nd4 , a control in the study , actually recognizes nadh - ubiquinone oxidoreductase 1 alpha subcomplex 9 ( ndufa9 ). like nd4 , ndufa9 protein has a molecular weight of 39 kda and is a subunit of nadh dehydrogenase ( mitochondrial complex i ). however , unlike nd4 , ndufa9 is encoded in the nucleus . because ndufa9 is a subunit of mitochondrial complex i , as is nd4 , ndufa9 is also an appropriate control for the instantly described experiments ( gingrich et al . pnas 103 ( 25 ): 9744 2006 ; published online on jun . 8 , 2006 ). referring now to fig1 a - b , characteristic of a bona fide psd fraction , the fraction which was prepared contained post - synaptic proteins including psd - 95 and nmda receptor subunit proteins but lacked the pre - synaptic protein synaptophysin ( fig1 a ) fig1 a shows immunoblots of psd proteins probed with anti - nd2 , anti - cytochrome c oxidase i ( cyto 1 ), anti - ndufa9 , anti - psd95 , anti - nr1 , anti - src and anti - synaptophysin as indicated . it was found that nd2 was present in the psd fraction . in contrast to nd2 , neither the nadh - ubiquinone oxidoreductase 1 alpha subcomplex 9 ( ndufa9 ), a subunit of mitochondrial complex i , nor the cytochrome c oxidase subunit 1 ( cyto 1 ), an inner mitochondrial membrane protein that is part of complex iv ( marusich et al . biochim . biophys . acta 1362 : 145 - 159 1997 ), were detectable in the psd fraction . on the other hand , cyto 1 and ndufa9 , as well as nd2 , were readily detected in proteins from brain mitochondria ( fig1 b ). fig1 b shows immunoblots of mitochondrial proteins prepared by differential centrifugation probed with anti - nd2 , anti - cyto 1 and anti - ndufa9 . fig1 c - e are identical to fig2 c - e . although the molecular size of the protein detected by anti - nd2 in the psd preparation matched that of nd2 in mitochondria , it is conceivable that the protein detected in the psd preparation was not nd2 but a protein of the same molecular size that was recognized by anti - nd2 . however , it was found that incubating anti - nd2 with the antigen to which the antibody was raised prevented the immunoblotting signal ( fig2 c ). fig2 c shows immunoblots of psd proteins showing the specificity of the n - terminal nd2 antibody by pre - adsorption with the antigenic peptide used to derive the antibody . moreover , it was found that a separate antibody directed towards a distinct epitope in a region of nd2 remote from that of the anti - nd2 epitope also detected nd2 , at the correct molecular size , in the psd preparation , as well as in the mitochondrial preparation ( fig2 d ). fig2 d shows immunoblots of psd and mitochondrial proteins probed with two independent rabbit polyclonal antibodies directed against two disparate regions of nd2 . the n - terminal nd2 antibody was used for all subsequent experiments illustrated . thus , nd2 was found in the psd preparation by two separate antibodies , and this could not be accounted for by a general contamination with mitochondrial proteins because neither cyto 1 nor nd4 were detected in the psd . in addition to examining psd protein preparations , the presence of nd2 in psds was tested for by means of post - embedding immunogold electron microscopy in the ca1 stratum radiatum of rat hippocampus ( petralia et al . nature neuroscience 2 : 31 - 36 1999 ; sans et al . journal of neuroscience 20 : 1260 - 1271 2000 ). with this experimental approach the tissue is fixed immediately after the animal is sacrificed and prior to sectioning so that protein localization is preserved . nd2 labeling was found , as visualized by secondary antibody conjugated to 10 nm gold particles , in the psd and the postsynaptic membrane in dendritic spines of ca1 neurons ( fig2 e ), as well as over mitochondria ( not illustrated ). fig2 e shows three representative post - embedding immunogold electron microscopy images of rat hippocampus ca1 synapses , pre - synaptic . scale bar is 200 nm . nd2 labeling was enriched in the post - synaptic membrane approximately 30 - fold as compared with the plasma membrane in the remainder of the dendritic spine ( 0 . 37 particles per psd / section versus 0 . 012 , p & lt ; 0 . 05 ) and there was no obvious accumulation of nd2 labeling along the plasma membrane of the dendritic shaft . the nd2 labeling observed in the psd and post - synaptic membrane could not have been due to labeling in mitochondria because it is known that mitochondria are excluded from dendritic spines ( shepherd et al . journal of neuroscience 18 ( 20 ): 8300 - 8310 1998 ). thus , these results indicate that nd2 is present in the biochemically defined psd protein fraction and is localized at psds in ca1 neurons . nd2 interacts with src at the nmda receptor complex in post - synaptic densities . since previous results indicate that nd2 is present in psds from brain , it was examined whether nd2 interacts with src in psds . it was found that immunoprecipitating nd2 from the psd fraction led to co - immunoprecipitation of src and vice versa ( fig3 a ), indicating that nd2 and src interact post - synaptically at glutamatergic synapses . fig3 a shows immunoblots of co - immunoprecipitates from psd preparations probed with anti - nd2 or anti - src as indicated . non - specific igg ( either rabbit or mouse ) was used as a negative control for both antibodies . moreover , src was pulled from the psd fraction by the fusion protein nd2 . 1 - gst , but not by either nd2 . 2 - or nd2 . 3 - gst ( fig3 b ). fig3 b shows recombinant nd2 . 1 - gst fusion protein , but not nd2 . 2 - gst , nd2 . 3 - gst , or gst alone , pulls src form psd preparations . thus , as it was found with the src - nd2 binding in vitro , these results indicate that amino acids 239 - 321 of nd2 ( seq id no : 7 ) are both necessary and sufficient for nd2 to interact with src in the psd . the hypothesis that nd2 is the protein mediating the interaction between src and nmdars requires that , in addition to being present in the psd and interacting there with src , nd2 is part of nmdar complex of proteins . to determine whether nd2 is a component of the nmdar protein complex , nmdar complexes were immunoprecipitated from the psd fraction , using an antibody directed against the core nmdar subunit nr1 ( dingledine et al . pharmacology reviews 51 : 7 - 61 1999 ), and the co - immunoprecipitating proteins were probed with anti - nd2 . it was found that nd2 co - immunoprecipitated ( fig4 a ), and conversely , immunoprecipitating with anti - nd2 led to co - immunoprecipitation of nr1 ( fig4 a ). fig4 a shows immunoblots of co - immunoprecipitates from psd preparations probed with anti - nd2 or with anti - nmda receptor subunit 1 ( nr1 ) as indicated . non - specific igg ( either rabbit or mouse ) was used as a negative control for both antibodies . neither nd2 nor nr1 was immunoprecipitated by non - specific igg , and nd2 did not co - immunoprecipitate with the potassium channel kv3 . 1 ( fig4 b ), a negative control for non - specific immunoprecipitation of post - synaptic proteins , therefore it was concluded that nd2 is an nmdar complex protein . fig4 b shows an immunoblot of co - immunoprecipitates from psd preparations using anti - glur2 , anti - gaba a rα , anti - gaba a rβ2 / 3 and anti - kv3 . 1 antibodies to immunoprecipitate . probe was anti - nd2 . importantly , neither nd4 nor cyto 1 was detected in co - immunoprecipitates of nr1 ( not illustrated ) indicating that mitochondrial proteins in general are not components of the nmdar complex . moreover , nd2 did not co - immunoprecipitate with glur2 , gaba a rα or gaba a rβ / 3 ( fig4 b ) indicating that nd2 is not a detectable component of ampa receptor or γ - aminobutyric acid ( gaba ) receptor complexes . thus , while nd2 is a component of nmdar complexes it is not generally a component of neurotransmitter receptor complexes in the brain . src40 - 58 and scrambled src peptides were biotinylated by incubating with sulfo - nhs - biotin ( pierce chemical co ., rockford , ill .) for 30 minutes at room temperature ( seq id no : 4 , src protein ). the biotinylation reaction was then quenched by the addition of tris - hcl ( ph 8 . 0 ) to a final concentration of 20 mm . purified recombinant fusion proteins (˜ 20 μg each ) were dotted onto nitrocellulose and dried overnight . membranes were blocked with 5 % bsa in pbs for 1 hour , after which biotinylated peptides ( 30 μg / ml ) diluted 1 : 1000 in fresh 5 % bsa in pbs were added . the membranes were incubated with the peptides for 1 hour , washed , and probed using a streptavidin - hrp conjugate . bound probe was then detected on film using an ecl kit . nd2 acts as an adapter protein for src . amino acids 40 - 58 ( seq id no : 4 ) within the src unique domain have been implicated in the binding of src to the interacting protein in the nmdar complex ( yu et al . science 275 : 674 - 678 1997 ; lu et al . science 279 : 1363 - 1368 1998 ; yu et al . nature 396 : 469 - 474 1998 ) and thus , nd2 was predicted to bind to this region of src . this prediction was examined in vitro using a peptide with the sequence of amino acids 40 - 58 ( src40 - 58 ; seq id no : 4 ) which was found to bind directly to nd2 . 1 - gst ( fig4 c ) in vitro . in contrast , a peptide with identical amino acid composition , but a scrambled sequence ( scrambled src40 - 58 ), did not bind to nd2 . 1 - gst . neither src40 - 58 nor scrambled src40 - 58 bound to nd2 . 2 - gst , nd2 . 3 - gst or to gst alone ( fig4 c ). fig4 c shows a dot blot of nd2 - gst fusion proteins probed with biotinylated src40 - 58 or scrambled src40 - 58 peptides followed by streptavidin - hrp conjugate . furthermore , the effect of src40 - 58 on the interaction between src and nd2 was examined ( fig4 d and 4e ). it was found that incubating nd2 . 1 - gst with src40 - 58 prevented this fusion protein from pulling down the src unique domain protein in vitro ( fig4 d ). fig4 d shows a blot of nd2 . 1 - gst probed with boptinylated src unique domain in the presence of either src40 - 58 or scrambled src40 - 58 peptides followed by streptavidin - hrp conjugate . on the other hand , scrambled src40 - 58 did not affect the interaction between the nd2 . 1 - gst and src unique domain proteins . incubating psd proteins with src40 - 58 prevented the co - immunoprecipitation of nd2 by anti - src but this was not affected by scrambled src40 - 58 ( fig4 e ). fig4 e shows immunoblots of co - immunoprecipitates obtained from psd proteins in the presence of either src40 - 58 or scrambled src40 - 58 probed with anti - nd2 or stripped and re - probed with anti - src . importantly , src40 - 58 did not affect the immunoprecipitation of src from psds . thus , it was concluded that amino acids 40 - 58 of src interact with the region spanned by nd2 . 1 , thereby mediating the binding between the src unique domain and nd2 . as nd2 alone is not catalytically active ( j . e . walker quarterly reviews of biophysics 25 ( 3 ): 253 - 324 1992 ; sazanov et al . journal of molecular biology 302 : 455 - 464 2000 ; sazanove et al . biochemistry 39 : 7229 - 7235 2000 ), its functional role in the nmdar complex was investigated . nd2 might be a phosphorylation target for src , but it was found that nd2 immunoprecipitated from psd protein fractions was not detectably phosphorylated on tyrosine . moreover , inclusion of nd2 . 1 - gst did not alter the catalytic activity of src in vitro ( not illustrated ) consistent with the binding of nd2 to the unique domain rather than to the regulatory or catalytic domains . thus , it is unlikely that nd2 is a target of src or a regulator of src kinase activity . however , it was found that the co - immunoprecipitation of src with nmdars ( fig4 f , left panel ) was suppressed by src40 - 58 , but not scrambled src40 - 58 , and by nd2 . 1 ( fig4 f , right panel ) indicating that the association of src with the nmdar complexes depends on the interaction with nd2 . fig4 f , left panel shows immunoblots of co - immunoprecipitates obtained from psd proteins in the presence of either src40 - 58 or scrambled src40 - 58 . fig4 f , right panel shows immunoblots of co - immunoprecipitates obtained from psd proteins in the presence of gst - nd2 . 1 fusion protein probed with anti - src or anti - nr1 as indicated . in contrast , the co - immunoprecipitation of nd2 with nmdars was not affected by src40 - 58 ( fig4 g ), implying that binding nd2 to src is not necessary for nd2 to associate with nmdar complexes . fig4 g shows immunoblots of co - immunoprecipitates obtained from psd proteins in the presence of either src40 - 58 or scrambled src40 - 58 peptides preobed with anti - nd2 or stripped and re - probed with anti - nr1 . taking these results together , it was concluded that nd2 may function as an adapter protein that anchors src in the nmdar complex . loss of nd2 in neurons prevents the regulation of nmda receptor activity by src . fetal rat hippocampal neurons were prepared , cultured , and used for electrophysiological recordings 12 - 17 days after plating . methods for whole cell recordings are described in pelkey et al . ( neuron 34 : 127 - 138 2002 ). it was hypothesized that if nd2 is a src adapter protein then loss of nd2 should prevent the upregulation of nmdar activity by endogenous src ( yu et al . science 275 : 674 - 678 1997 ). this was tested by investigating miniature excitatory post - synaptic currents ( mepscs ) recorded from cultured hippocampal neurons ( macdonald et al . journal of physiology ( london ) 414 : 17 - 34 1989 ). in these neurons the nmdar - mediated component of mepscs is increased by activating endogenous src with a high - affinity activating phosphopeptide epq ( py ) eeipia ( liu et al . oncogene 8 : 1119 - 1126 1993 ) and is reduced by applying src40 - 58 ( yu et al . science 275 : 674 - 678 1997 ). it is predicted that each of these effects will be lost by blocking the expression of nd2 , if it acts as an adapter protein for src in the nmdar complex . in order to suppress nd2 expression , the hippocampal cultures were treated with chloramphenicol to selectively inhibit translation of mitochondrially encoded proteins but not translation of proteins encoded in the nucleus ( ibrahim et al . journal of biological chemistry 251 : 108 - 115 1976 ). after 48 hours treatment with chloramphenicol it was found that the level of nd2 in the cultures was reduced by more than 95 % whereas there was no significant change in the levels of the nuclear encoded proteins examined ( fig5 a ). fig5 a shows immunoblots of total soluble protein obtained from cultured rat hippocampal neurons treated with 50 μg / ml chloramphenicol for 48 hours and probed with anti - nd2 , anti - nr1 and anti - src as indicated . importantly , chloramphenicol did not affect the level of src or of the nmdar subunit nr1 but did suppress the co - immunoprecipitation of src with the nmdar complex ( fig5 b ), as predicted if nd2 is an adapter protein linking src to the complex . fig5 b shows an immunoblot of co - immunoprecipitates obtained from cultured hippocampal neurons , either treated or untreated with 50 μg / ml chloramphenicol for 48 hours and probed with anti - nr1 or anti - src . the effect of the 48 hours treatment with chloramphenicol on the atp levels , mitochondrial membrane potential , viability and general functioning of the hippocampal neurons in culture was examined . it was found that chloramphenicol did not significantly affect the level of atp levels in the cultures ( fig5 c ), consistent with the lack of effect of chloramphenicol treatment for up to 55 hours on atp levels in other cell types in culture ( ramachandran et al . proceedings of the national academy of science usa 99 : 6643 - 6648 2002 ). fig5 c shows summary histograms ( left panel ) of atp level or mitochondrial membrane potential ( δψm ), as assessed by tmrm fluorescence dequenching ( right panel ), in cultured hippocampal neurons either untreated or treated 50 μg / ml chloramphenicol for 48 hours . to examine the effect of chloramphenicol on mitochondrial membrane potential ( δψm ) in individual neurons , the dequenching of the potentiometric fluorescent cationic dye tetramethylrhodamine methyl ester ( tmrm ) by the mitochondrial uncoupler carbonyl cyanide p - trifluoromethoxyphenylhydrazone ( fccp ) was monitored ( reers et al . biochemistry 30 : 4480 - 4486 1991 ). the dequenching response evoked by bath - applied fccp ( 2 μm ) in neurons from chloramphenicol - treated or control cultures was assessed . it was found that the dequenching response of chloramphenicol - treated neurons was not different from that of untreated neurons ( fig5 c ), indicating that δψm was not affected by chloramphenicol . moreover , it was found that neurons treated with chloramphenicol were not distinguishable from untreated neurons in terms of cell number , gross morphology , resting membrane potential , resting intracellular calcium concentration , action potential amplitude , or mepsc frequency ( data not illustrated ). thus , from these data together it was concluded that treatment with chloramphenicol for 48 hours did not detectably compromise the functioning of the neurons . nevertheless , it was noted that the intracellular solution used for all whole - cell recordings contained 2 mm mg - atp , so that the level of intracellular atp was equal in all cells throughout the experiments . in neurons treated with chloramphenicol for 48 hours it was found that the nmdar component of the mepscs was not affected by administering either the epq ( py ) eeipia ( seq id no : 5 ) peptide or the src40 - 58 peptide ( fig5 d - f ). in contrast , in control experiments administering epq ( py ) eeipia ( seq id no : 5 ) increased the nmdar component of mepscs by 172 ± 28 % and application of src40 - 58 decreased the nmdar component to 56 ± 4 % ( fig5 d - f ). chloramphenicol was present during the recording periods of the control experiments and therefore the loss of effect of the epq ( py ) eeipia ( seq id no : 5 ) and src40 - 58 peptides cannot be attributed to an acute effect of chloramphenicol . fig5 d shows that the upregulation of nmdar activity in the presence of the src activator peptide epq ( py ) eeipia ( seq id no : 5 ), labeled as ( py ) eei ( amino acid residues 4 - 7 of seq id no : 5 ), is prevented in neurons treated with chloramphenicol for 48 hours . fig5 e shows that the reduction of nmda activity in the presence of the src40 - 58 peptide is also prevented in neurons treated with chloramphenicol for 48 hours . composite traces are shown in black , the nmdar component in dark grey , and the ampar component in light grey . scale bars are 50 ms / 10 pa . fig5 f shows a summary histogram of electrophysiology data . nmda component data were calculated as q 20 ′ / q 2 ′ , and ampa component data were calculated as a 20 ′ / a 2 ′ . a 48 hour chloramphenicol treatment prevents the modulation of nmdar function by the src activator peptide ( seq id no : 5 ) and src40 - 58 peptides , while neither of these reagents affected the ampa receptor component of the mepscs under the recording conditions used . an * indicates a significant difference , student &# 39 ; s t - test , p & lt ; 0 . 05 . taking our results together , it is concluded that src - dependent regulation of the activity of nmdars depends on expression of nd2 through its anchoring of src to the nmdar complex . to detect the binding of nd2 . 1 - gst with src peptides , the nd2 . 1 - gst fusion protein was purified on glutathione sepharose . src40 - 58 , src40 - 49 , src49 - 58 , and scrambled src40 - 58 peptides ( 30 mg / ml ; synthesized by hsc peptide synthesis facility ; all four peptides are schematically depicted in fig6 a ) were biotinylated by incubating with sulfo - nhs - biotin ( pierce chemical co ., rockford , ill .) for 30 minutes at room temperature . the biotinylation reaction was then quenched by the addition of tris - hcl ( ph 8 . 0 ) to a final concentration of 20 mm . biotinylated peptides were incubated with nd2 . 1 - gst on beads for 1 hour at 4 ° c . the beads were washed three times with pbs / 0 . 1 % triton x - 100 , then resuspended in pbs + sds - page sample buffer . after brief centrifugation , samples were resolved by sds - page , transferred to nitrocellulose membranes , and probed using a streptavidin - hrp conjugate ( sigma , st . louis , mo .). bound probe was then detected on film using an ecl kit ( amersham pharmacia biotech , baie d &# 39 ; urfé , québec ). fig6 b shows the blot of the nd2 . 1 - gst fusion protein which was probed with biotinylated src peptides followed by streptavidin - hrp conjugate . src40 - 58 , src40 - 49 , src49 - 58 , scrambled src40 - 58 , tat - src40 - 49 , and scrambled tat - src40 - 49 peptides were biotinylated by incubating with sulfo - nhs - biotin ( pierce chemical co ., rockford , ill .) for 30 minutes at room temperature . the biotinylation reaction was then quenched by the addition of tris - hcl ( ph 8 . 0 ) to a final concentration of 20 mm . purified recombinant fusion proteins (˜ 20 μg each ) were dotted onto nitrocellulose and dried overnight . membranes were blocked with 5 % bsa in pbs ( ph 7 . 5 ) for 1 hour , after which biotinylated peptides ( 30 μg / ml ) diluted 1 : 1000 in fresh 5 % bsa in pbs were added . the membranes were incubated with the peptides for 1 hour , washed , and probed with streptavidin - hrp conjugate . bound probe was then detected on film using an ecl kit . fig6 c shows the dot blots of nd2 . 1 - gst fusion proteins probed with biotinylated src peptides followed by streptavidin - hrp conjugate . male sprague - dawley rats 150 - 200 g were used for all experiments . rats were housed in pairs , maintained on a 12 / 12 hour light / dark cycle , and allowed free access to food and water . all experiments were conducted during 10 am and 5 pm . peptide src40 - 49tat ( tsudapi - 1 ; seq id no : 2 ) or tat alone ( amino acid residues 1 - 11 of seq id no : 2 ) was dissolved in sterilized saline . peptide or saline was injected intravenously at a volume 1 ml / kg into rat &# 39 ; s tail 45 minutes before behavioral testing . injections were done under brief halothane anesthesia and rats were returned to the cages after injections . the formalin test was performed as previously described ( liu et al . european journal of pharmacology 408 ( 2 ): 143 - 152 2000 ). rats were placed in a plexiglass observation chamber for an initial 20 minutes to allow acclimatization to the testing environment . formalin 2 . 5 % was injected subcutaneously in a volume of 50 ml into the plantar aspect of the hind paw . following injections , rats were returned to the observation chamber and monitored for flinching behaviors ( lifting , shaking and overt flinching with a ripple over the haunch ) and biting / licking time . two rats in adjacent chambers were observed at one time , with observations occurring in alternate 2 minute bins . recorded episodes were not corrected , thus values represent about half of the total behaviors expressed . fig7 a - d show the effect of src40 - 49tat ( 0 . 1 pmol ) on 2 . 5 % formalin induced flinching or biting / licking behaviors . peptides or saline controls were injected 45 minutes before behavioral testing . fig7 b shows measurement of flinching behaviors observed within an hour . fig7 a shows the cumulative flinches in different phases observed within the hour . p1 represents a time period of 0 - 8 minutes ; p2a represents a time period of 12 - 28 minutes and p2b represents a time period of 32 - 60 minutes . values depict means ( n = 7 , src40 - 49tat ; n = 20 , saline ). p & lt ; 0 . 05 , p & lt ; 0 . 01 with student t test compared to saline control . fig7 d shows measurement of the time of each biting / licking behavior observed within an hour . fig7 c shows the cumulative biting / licking behaviors in different phases observed within the hour . p1 represents a time period of 0 - 8 minutes ; p2a represents a time period of 12 - 28 minutes and p2b represents a time period of 32 - 60 minutes . values depict means ( n = 7 , src40 - 49tat ; n = 20 , saline ). p & lt ; 0 . 05 , p & lt ; 0 . 01 with student t test compared to saline control . fig8 a - d show the effect of hiv - tat ( 1 pmol / g ) on 2 . 5 % formalin induced flinching or biting / licking behaviors . peptides or saline controls were injected 45 minutes before behavioral testing . fig8 b shows measurement of flinching behaviors observed within an hour . fig8 a shows the cumulative flinches in different phases observed within the hour . p1 represents a time period of 0 - 8 minutes ; p2a represents a time period of 12 - 28 minutes and p2b represents a time period of 32 - 60 minutes . values depict means ( n = 7 , hiv - tat ; n = 20 , saline ). p & lt ; 0 . 05 , p & lt ; 0 . 01 with student t test compared to saline control . fig8 d shows measurement of the time of each biting / licking behavior observed within an hour . fig8 c shows the cumulative biting / licking behaviors in different phases observed within the hour . p1 represents a time period of 0 - 8 minutes ; p2a represents a time period of 12 - 28 minutes and p2b represents a time period of 32 - 60 minutes . values depict means ( n = 7 , hiv - tat ; n = 20 , saline ). p & lt ; 0 . 05 , p & lt ; 0 . 01 with student t test compared to saline control . as compared to hiv - tat alone and the saline control , the src40 - 49tat peptide is shown to reduce pain behaviors over a time period of an hour . it is known that tyrosine phosphorylation of the nr2 subunits plays a key role in nmda receptor activation ( moon et al . pnas usa 91 : 3954 - 3958 1994 ; lau et al . journal of biological chemistry 270 : 20036 - 20041 1995 ; xiong et al . journal of neuroscience 19 : rc37 ( 1 - 6 ) 1999 ). it is also known that inflammatory hyperalgesia is associated with rapid and prolonged enhancement of tyrosine phosphorylation of the nr2b subunits of nmda receptors ( guo et al . the journal of neuroscience 22 ( 14 ): 6208 - 6217 2002 ). thus , considering that protein phosphorylation is a major mechanism for both normal and pathological receptor function , the effect of the formalin test on receptor phosphorylation was examined . fig1 a - d illustrate the increase in tyrosine phosphorylation of the nr2b subunit after formalin injection ( fig1 a - b ) and further illustrate that this increase of nr2b tyrosine phosphorylation is significantly reduced by intrathecal ( i . t .) administration of src40 - 49tat ( seq id no : 2 ) ( fig1 c - d ). fig1 a shows a western blot of an immunoprecipitation using an anti - nr2b antibody and an anti - phosphorylated tyrosine antibody . it can be seen that by 60 minutes post - injection of formalin , tyrosine phosphorylation of the nr2b subunit increases . fig1 b shows a graph quantifying the tyrosine phosphorylation calculated as a percent of the control . this data was calculated prior to formalin injection and at three times post - injection ; at 5 minutes , 30 minutes and 60 minutes . as can be seen , the amount of nr2b subunit that is phosphorylated peaks at around 30 minutes post - injection . fig1 c shows another western blot of an immunoprecipitation using an anti - nr2b antibody and an anti - phosphorylated tyrosine antibody . this blot evidences the reduction of formalin - induced tyrosine phosphorylation resulting from treatment with src40 - 49tat ( seq id no : 2 ) and the absence of reduction resulting from treatment with scrambled src40 - 49tat ( ssrc40 - 49tat ). fig1 d shows a graph quantifying the tyrosine phosphorylation ( after treatment with src40 - 49tat or ssrc40 - 49 ) calculated as a percent of the control . this data was calculated at 60 minutes post - injection of formalin to treated animals . total soluble protein was prepared from pre - weighed rat tissues by homogenization at 4 ° c . in 0 . 25 m sucrose / 10 mm hepes - naoh , 1 mm edta , ph 7 . 4 with 2 μg / ml each of aprotinin , pepstatin a , and leupeptin . following brief configuration of the samples at 4 000 g , np - 40 was added to 1 % ( vol / vol ) to the cleared supernatants . after incubation for 10 minutes , the protein concentration of the samples was determined by detergent compatible protein assay ( biorad laboratories , mississauga , ontario ) and equilibrated . the solubilized proteins were centrifuged briefly at 14 000 g to remove insoluble material and then incubated with 51 g of either anti - nd2 ( rabbit polyclonal from dr . r . f . doolittle , ucsd , ca ; described in mariottini et al . pnas usa 83 : 1563 - 1567 1986 ), anti - src ( mouse monoclonal clone 327 from j . bolen , dnax , palo alto , calif .) or control , non - specific rabbit or mouse igg ( sigma ) overnight at 4 ° c . immune complexes were isolated by the addition of 10 μl of protein g - sepharose beads followed by incubation for 2 hours at 4 ° c . immunoprecipitates were then washed three times with ripa buffer , re - suspended in ripa buffer + sds - page sample buffer and boiled for 5 minutes . the samples were resolved by sds - page , transferred to nitrocellulose membranes and analyzed by immunoblotting with anti - nd2 , anti - src or anti - fyn ( mouse monoclonal clone 25 , pharmingen , mississauga , ontario ). bound antibody was then detected on film using appropriate secondary antibody / hrp conjugates and an ecl kit ( amersham pharmacia biotech ). for control immunoprecipitations under denaturing conditions , sds was added to the initial protein samples to a final concentration of 0 . 4 % and the samples were boiled for 5 minutes and rapidly cooled to 4 ° c . prior to the addition of the antibodies used for immunoprecipitation . in addition , pre - adsorption of the anti - nd2 antibody with antigenic peptide prevented antibody signal detection on immunoblots . non - receptor tyrosine kinase src and nd2 are both expressed in cells of multiple , diverse tissues . illustrative , albeit non - limiting , examples are peripheral nervous system tissue , central nervous system tissue , heart , intestine , kidney , liver , lung , pancreas , skeletal muscle , spleen , testis , bone , skin and brain . the data presented in fig1 a - b shows that nd2 and src interact in multiple , diverse tissues . immunoblots of co - immunoprecipitates from various tissues ( fig1 a ) and tissue homogenates ( fig1 b ) probed with anti - nd2 , anti - src , or anti - fyn as indicated . tissues : b - brain ; h - heart ; 1 - intestine ; k - kidney ; liv - liver ; lu - lung ; p - pancreas ; sk - skeletal muscle ; sp - spleen and t - testis . non - specific igg applied to liver homogenate was used as a negative control for co - immunoprecipitation . immunoblotting of fyn protein from brain was used as a positive control for the anti - fyn antibody . in these experiments the cell lysates were prepared using non - denaturing conditions , but when denaturing conditions were used to prepare the proteins , no co - immunoprecipitation of src by anti - nd2 or of anti - src was found ( data not illustrated ). increased activity of nmda receptors is known to play a major role in pain produced by peripheral nerve injury ( ren et al . journal of orofacial pain 13 : 155 - 163 1999 ). this type of pain is debilitating and treatments remain relatively ineffective . antagonists of the nmda receptor complex have been suggested as potential drugs for neuropathic pain management ( planells - cases et al . mini review of medicinal chemistry 3 ( 7 ): 749 - 756 2003 ). however , non - selective blocking of nmda receptor function is deleterious , since complete blockade of synaptic transmission mediated by nmda receptors is known to hinder neuronal survival ( ikonomidou et al . lancet : neurology 1 : 383 - 386 2002 ; fix et al . experimental neurology 123 : 204 1993 ; davis et al . stroke 31 : 347 2000 ; morris et al . journal of neurosurgery 91 : 737 1999 ). the method of the instant invention selectively blocks nmdar - mediated excitatory post - synaptic current ( epsc ) without effecting the ampa ( glur1 - containing α - amino - 3 - hydroxy - 5 - methyl - 4 - isoxazolepropionic acid ) component . pain induced by cuff implantation , in a laboratory animal such as a rat or mouse , is an art - accepted model of neuropathic pain . generally , in cuff implantation a nerve root in the sciatic nerve leading to a hind paw is tied off by surgical implantation of a “ cuff ”, for example , a polyethylene ring . over a period of time the nerve degenerates and a neuropathic pain pattern develops . a control is created by subjecting another group of animals to “ sham surgery ”, a procedure wherein the animals receive the same type of surgery as cuff implantation without the physical implantation of the cuff . after a period of time , the paw is stimulated by a series of filaments or exposure to a small amount of moderate heat . pain is measured by observation of “ paw withdrawal ”, in general , if the animal lifts the paw and the time it takes to do so . typically , an animal not experiencing neuropathic pain will not respond to the stimuli . when testing using filaments , threshold is defined in terms of force . a reduction in threshold suggests the development of allodynia . this testing method is described in the art ; ren physiological behavior 67 : 711 - 716 1999 and guo et al . the journal of neuroscience 22 ( 14 ): 6208 - 6217 2002 . in this experiment , tactile allodynia was induced in a group of mice by cuff implantation and symptoms were observed as early as day 3 post - surgery . allodynia was allowed to fully develop at 8 - 10 days post - surgery before the “ paw withdrawal ” tests were performed . a group of mice received an intrathecal ( introduced into the space under the arachnoid membrane of the brain or spinal cord ) injection of 0 . 02 pmol of src40 - 49tat ( tsudapi - 1 , seq id no : 2 ), a second group of mice received an intrathecal injection of 0 . 02 pmol scramble src40 - 49tat and a third group of mice received an intrathecal injection of saline . “ scramble src40 - 49tat ” refers to tsudai - 1 ( seq id no : 2 ) having a “ scrambled ” sequence , i . e . having amino acid residues out of order from the normal . the results are presented in fig1 . green represents src40 - 49tat ( tsudapi - 1 , seq id no : 2 ), grey represents scramble src40 - 49tat and red represents saline . src40 - 49tat ( tsudapi - 1 , seq id no : 2 ), but not scramble src40 - 49tat or saline , significantly reversed allodynia . the reversal effect was observed as early as one hour following administration . the reversal was significant at more than 5 hours post injection , with pwt 6 . 03 ± 1 . 45 g ( src40 - 49tat ) versus 1 . 7 ± 0 . 47 g ( scrambled src40 - 49tat ) ( p & lt ; 0 . 05 ). another group of mice received an intravenous injection of 10 pmol / g of src40 - 49tat ( tsudapi - 1 , seq id no : 2 ) and a second group of mice received an intravenous injection of saline . the results are presented in fig1 . green represents src40 - 49tat ( tsudapi - 1 , seq id no : 2 ) and red represents saline . src40 - 49tat ( tsudapi - 1 , seq id no : 2 ), but not saline , significantly reversed allodynia . the reversal effect was observed as early as one hour following administration . the anti - allodynic effect of the peptide ( seq id no : 2 ) peaked at 2 hours following injection , with pwt 9 . 28 ± 2 . 55 g ( src40 - 49tat ) versus 1 . 95 ± 0 . 617 g ( saline ) ( p & lt ; 0 . 05 ). protein phosphorylation is a major mechanism for receptor function . it is known that tyrosine phosphorylation of the nr2 subunits plays a key role in nmda receptor activation ( moon et al . pnas usa 91 : 3954 - 3958 1994 ; lau et al . journal of biological chemistry 270 : 20036 - 20041 1995 ; xiong et al . journal of neuroscience 19 : rc37 ( 1 - 6 ) 1999 ). it is also known that inflammatory hyperalgesia is associated with rapid and prolonged enhancement of tyrosine phosphorylation of the nr2b subunits of nmda receptors ( guo et al . the journal of neuroscience 22 ( 14 ): 6208 - 6217 2002 ). in this experiment , a significant increase of tyrosine phosphorylation of nmda receptor nr2b subunits in spinal cord dorsal horn tissue was observed in cuffed rats but not in sham - operated rats ( fig1 a ). intrathecal injection of 0 . 02 pmol src40 - 49tat ( tsudapi - 1 , seq id no : 2 ) significantly reversed the increase in tyrosine phosphorylation ( fig1 b ). fig1 a shows a western blot of an immunoprecipitation using an anti - nr2b antibody and anti - phosphorylated tyrosine antibody . fig1 b shows a graph quantifying the tyrosine phosphorylation calculated as a percent of the control . this graph represents quantification of band ( from western blots ) density in three experiments . another experiment was performed to compare cuff - induced allodynia in wild - type mice to src kinase null mice ( src kinase knock - out mice ). the results are shown in fig1 . the pwt was tested in the mice prior to surgery . the basal pwt in src kinase null mice was not different from that of wild - type mice ; see black bars in graphs in center and right hand side in fig1 , src −/− and src +/+. both groups of mice received an intravenous injection of 100 pmol of src40 - 49tat ( tsudapi - 1 , seq id no : 2 ). allodynia was depressed in src kinase null mice throughout the testing time course , with pwt 0 . 01 ± 1 . 53 g ( wild ) versus 0 . 21 ± 0 . 04 g ( null ) ( p & lt ; 0 . 05 ) at 22 days post surgery ( left graph in fig1 ). treatment with src40 - 49tat ( 100 pmol , intravenous injection ) significantly reversed allodynia in wild - type mice from 0 . 008 ± 0 . 0 g to 0 . 23 ± 0 . 05 g ( p & lt ; 0 . 05 ), but did not further increase pwt in null mice . nerve - injury induced increase in phosphorylation of the nr2b subunit was found to be depressed in both wild - type and src kinase null mice . treatment with src40 - 49tat did not further decrease phosphorylation of nr2b subunits in src kinase null mice . thus , the instant inventors concluded that loss of src or depressed action of src through treatment with src40 - 49tat ( tsudapi - 1 , seq id no : 2 ) inhibits src - mediated nmdar up - regulation dependent neuropathic pain . the main criteria for identifying nd2 as the protein mediating the interaction between nmdars and the unique domain of src , as inferred from previous work ( ali et al . current opinion in neurobiology 11 : 336 - 342 2001 ; yu et al . science 275 : 674 - 678 1997 ) are as follows : nd2 must bind directly to the unique domain of src through amino acids 40 - 58 ( specifically 40 - 49 ; seq id no : 1 ); this binding must be prevented by the src40 - 58 ( specifically 40 - 49 ) peptide ; nd2 must be present at excitatory synapses and must be a component of the nmdar complex ; and lack of nd2 must prevent the upregulation of nmdar activity by endogenous src . nd2 was first considered as a potential src unique domain - binding protein when overlapping clones of nd2 in two separate yeast two - hybrid experiments were isolated . subsequently , the direct interaction of the src unique domain and nd2 was confirmed through in vitro binding assays using recombinant proteins . through these experiments the nd2 . 1 region was identified as necessary and sufficient for interacting with the src unique domain . nd2 . 1 bound directly to the src40 - 58 ( specifically 40 - 49 ) peptide and the in vitro binding of the src unique domain to nd2 . 1 was prevented by src40 - 58 ( specifically 40 - 49 ). src and nd2 co - immunoprecipitated with each other in brain homogenates and psd protein preparations . the co - immunoprecipitation was prevented by src40 - 58 ( specifically 40 - 49 ), implying that the src - nd2 interaction identified in vitro may occur in vivo . in addition to finding nd2 in psd protein preparations , nd2 - immunoreactivity was found by immunogold electron microscopy in psds in the ca1 hippocampus . moreover , co - immunoprecipitation experiments indicated that nd2 is a component of the nmdar complex and that the src - nd2 interaction is required for the association of src , but not nd2 , with nmdars . it was found that depleting nd2 suppresses src association with the nmdar complex and prevents the upregulation of nmdar function by activating endogenous src at excitatory synapses . src40 - 49 ( sudapi - 1 ; seq id no : 1 ) was identified as the specific peptide that interacts with nd2 as src50 - 58 alone did not interact with nd2 . finally , it was found that tat - src40 - 49 ( tsudapi - 1 ; seq id no : 2 ) as administered to rats reduced pain behavior in the formalin test . these multiple , converging lines of evidence lead to the conclusion that nd2 is the protein mediating the interaction between nmdars and the unique domain of src . nd2 is mitochondrially encoded and translated , and yet it is found within the psds of glutamatergic synapses in the brain . the other mitochondrial proteins examined , nd4 and cyto 1 , were not detected in the psd fraction implying that this fraction is not contaminated non - specifically by mitochondrial proteins . further , nd2 - immunoreactivity by immunogold electron microscopy was found within structurally - identified psds in dendritic spines of ca1 neurons . in this preparation , proteins are immobilized by tissue fixation precluding the possibility that nd2 could have relocated from the mitochondria to the psd during processing . moreover , because dendritic spines are devoid of mitochondria ( shepherd et al . journal of neuroscience 18 ( 20 ): 8300 - 8310 1998 ) the nd2 immunoreactivity cannot be accounted for by mitochondria abutting the psd . taken together these findings indicate that nd2 , but not the entire complex i , is normally present within the psd . the psd contains many enzymes that may be involved in regulating synaptic functioning ( p . siekevitz proceedings of the national academy of science usa 82 : 3494 - 3498 1985 ) including glycolytic enzymes capable of generating atp ( wu et al . proceedings of the national academy of science usa 94 : 13273 - 13278 1997 ). however , without other components of complex i it is unlikely that nd2 functions catalytically within the psd . thus , in addition to its localization in mitochondria and function as a component of complex i , the present results indicate that nd2 has a second location and function in outside the mitochondria . mitochondria are intimately linked to overall cellular functioning through generation of atp by oxidative phosphorylation . mitochondria are also known to be key for sequestration of intracellular calcium ( d . d . friel cell calcium 28 : 307 - 316 2000 ; r . rizzuto current opinion in neurobiology 11 : 306 - 311 ) and to participate in programmed cell death ( gorman et al . developmental neuroscience 22 : 348 - 358 2000 ; m . p . mattson national review of molecular and cellular biology 1 : 120 - 129 2000 ). some mitochondrial proteins are known to be present at extra - mitochondrial sites ( soltys et al . trends in biochemical science 24 : 174 - 177 1999 ; soltys et al . international review of cytology 194 : 133 - 196 1999 ). but , the experiments described herein indicate a new type of function for a mitochondrial protein outside this organelle , that is nd2 acts as an adapter protein that anchors src within the nmdar complex , where it thereby allows src to upregulate nmdar activity . upregulating the activity of nmdars is a major function of src in neurons in the adult cns ( lu et al . science 279 : 1363 - 1368 1998 ; pelkey et al . neuron 34 : 127 - 138 2002 ; huang et al . neuron 29 : 485 - 496 2001 ) and this mediates the induction of long - term potentiation ( ltp ) of excitatory synaptic transmission in ca1 neurons in the hippocampus ( ali et al . current opinion in neurobiology 11 : 336 - 342 2001 ). the findings described herein imply that the nd2 - src interaction is essential for ltp induction as ltp in ca1 neurons is prevented by src40 - 58 and by anti - src1 , an antibody that recognizes this amino acid sequence within the src unique domain and which prevents the src unique domain interaction with nd2 . 1 in vitro ( j . r . g ., m . w . s . unpublished observations ). ltp at schaffer collateral - ca1 synapses is the prototypic example of nmdar - dependent enhancement of excitatory synaptic transmission , which is observed at numerous types of glutamatergic synapses throughout the cns ( malenka et al . science 285 : 1870 - 1874 1999 ). in addition , src has been implicated in nmdar - dependent seizures ( sanna et al . proceedings of the national academy of science 97 : 8653 - 8657 2000 ), chronic pain ( guo et al . journal of neuroscience 22 : 6208 - 6217 2002 ) and neurotoxicity ( pei et al . journal of cerebral blood flow metabolism 21 : 955 - 963 2001 ). thus , the discovery of the src - nd2 interaction at nmdars , which is disclosed herein , defines a protein - protein interaction of general relevance to regulation of neuronal function , synaptic plasticity , and pathophysiology in the cns . additionally , by showing an extramitochondrial action for a protein encoded in the mitochondrial genome a previously unsuspected means by which mitochondria regulate cellular function has been identified . because nd2 and src are broadly expressed , the interaction of nd2 with the src unique domain may be of general relevance for control of src signaling ( example 8 and fig1 a - b ). all patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . all patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . it is to be understood that while a certain form of the invention is illustrated , it is not to be limited to the specific form or arrangement herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned , as well as those inherent therein . the oligonucleotides , peptides , polypeptides , biologically related compounds , methods , procedures and techniques described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims . | 2 |
the laser unit illustrated in the drawings comprises essentially a laser 1 proper having a substantially vertical axis , an afocal system ( shown in fig2 but non otherwise designated , an optical device 2 for automatically correcting the verticality of the laser beam , which is located after the afocal system on the substantially vertical path of the laser beam produced by said laser 1 , and a base structure 3 provided with means 4 for supporting the laser 1 and the optical device 2 in a position such that the laser axis be substantially vertical . in the two embodiments illustrated in the drawings the support means 4 comprise a mounting permitting the pivotal movements of the laser 1 about its substantially vertical axis . to this end , the support means 4 comprise more particularly a cylindrical socket 5 having a substantially vertical axis and , at its upper portion , a gauged bore 5a . on the other hand , the laser 1 ( comprising optical and electronic components known per se ) is enclosed in a housing of which the lower portion comprises a gauged cylindrical bearing section 6 coaxial to the laser beam and an axial bearing surface 7 facing downwards , as shown . the lower portion of the laser 1 is fitted in the socket 5 in such a manner that the axial bearing surface 7 of the laser housing bears on the top edge of said socket 5 , and that the cylindrical bearing section 6 is rotatably engaged without any undue play in the gauged bore 5a of socket 4 , due to a proper selection of the diameters of said bore 5a and cylindrical bearing section 6 , respectively . blocking means are provided for preventing , when desired , the laser 1 from rotating in the socket 5 . in the embodiment shown in fig1 these blocking means comprise a screw 8 having a knurled head 9 constituting a control knob , said screw 8 engaging a tapped radial hole formed in a ring 9 secured for example by means of screws ( not shown ) to said socket 5 , at the upper end thereof . this screw 8 is adapted to exert a radial pressure against a tongue or strip 5b cut out in the wall of socket 5 so as to press firmly this tongue against the bearing section 6 . in the modified construction illustrated in fig4 and 5 , the screw 8 is engaged in a tapped hole formed through the wall of socket 5 and reacts against a crescent - shaped clamping member 11 so as to press same firmly against the cylindrical bearing portion 6 . in both embodiments illustrated in the drawings the base structure 3 comprises essentially a substantially horizontal main platform 12 in which a relatively large aperture 13 is formed ; this main platform 12 is supported by a tripod structure comprising vertically adjustable legs 14 ( of which only two are visible in fig1 and 4 ). thus , a rough adjustment of the horizontality of platform 12 and consequently of the verticality of the axis of socket 5 ( connected to said platform 12 by means to be described presently can be made by means of said adjustable legs 14 in combination with a spherical bubble level ( not shown ). in the embodiment shown in fig1 the aperture 13 is substantially centered to the platform 12 and in the modified embodiment of fig4 and 5 this aperture 13 is formed in a lateral extension 12a of platform 12 which is disposed externally of the triangle having its apices coincident with the axes of the platform legs 14 . in both embodiments illustrated in the drawings the socket 5 is movable in , or in front of , the aperture 13 of platform 12 due to the provision of guide means whereby the socket 5 can be moved in any desired horizontal direction , means being also provided for blocking the socket 5 in relation to said platform 12 when the former has been brought to the desired position . in the specific embodiment shown in fig1 the above - mentioned guide means consist of a pair of parallel , horizontal plates 15 and 16 adapted to slide on the opposite faces of platform 12 and comprising coaxial circular openings through which said socket 5 can project . the socket 5 further comprises intermediate its ends a flange 17 rigid or formed integrally therewith , which is used for securing the socket 5 to the horizontal plate 15 by means of screws . on the other hand , the socket 5 can slide freely through the circular opening formed in plate 16 . moreover , the above - mentioned blocking means comprise clamping or tightening means which , according to the direction in which they are actuated , engage the plate 16 to either move same towards the plate 15 and thus clamp the platform 12 therebetween , so that the socket 5 is blocked in relation to said platform , or move said plate 16 away from plate 15 and thus enable said plates 15 and 16 to slide freely on platform 12 . the above - described clamping means comprise a first ring 18 surrounding the socket 5 and adapted to slide axially therealong . this ring 18 has external screw - threads formed thereon and is held against rotation about the socket 5 by a set of three screws 19 ( of which only one is visible in fig1 ) extending parallel to the axis of socket 5 through radial slots formed in flange 17 and also through holes formed in plates 15 and 16 . furthermore , said clamping means comprise another ring 21 formed with inner threads engaging the outer threads of ring 18 . the ring 21 is adapted to rotate but is held against axial movement on the external cylindrical surfaces of flange 17 and of another ring 22 screwed on said socket 5 at a certain axial distance from said flange 17 . thus , when the operator rotates the ring 21 in a first direction , the ring 18 is moved for instance upwards so that the screws 19 draw the plate 16 towards plate 15 and thus clamp the platform 12 therebetween . on the other hand , when ring 21 is rotated in a direction opposite said first direction , ring 18 is moved downwards and plate 16 is moved away from plate 15 by gravity , whereby these plates 16 and 15 can slide on the opposite surfaces of platform 12 . in the modified construction illustrated in fig4 and 5 the above - mentioned guide means consist essentially of a pair or slideway disposed horizontally at right angles to each other . socket 5 is secured by means of screws 23 to the movable member or slide 24 of the first one of said pair of slideways . slide 24 is guided horizontally in a guide carried by the movable member or slide 25 of the second slideway . the guide for slide 24 may consist for example of a dovetail - sectioned groove 26 formed in slide 25 and extending substantially horizontally at right angles to the horizontal direction of movement of said slide 25 . the slide 25 is guided by guide means carried by the extension 12a of platform 12 and consisting for example of a dovetail groove 27 formed in said extension 12a of platform 12 . in addition and as shown in fig5 secured to said slide 24 is a rack 28 meshing with a pinion 29 secured to one end of a shaft 31 rotatably mounted in a block 32 secured to the slide 25 . a control handwheel 33 is secured to the opposite end of shaft 31 , and when this handwheel 33 is rotated manually in one or the other direction the pinion 29 is caused to rotate in the same direction so as to drive the rack 28 and thus move the slide 24 in dovetail groove 26 . likewise , as illustrated in fig4 a rack 34 is secured to slide 25 and meshes with a pinion 35 secured to one end of a shaft 36 rotatably mounted in a block 37 secured to platform 12 . a control handwheel 38 secured to the opposite end of shaft 36 is provided for rotating the pinion 35 and thus drive the slide 25 in dovetail groove 27 . if the laser 1 is arranged for directing the beam issuing therefrom vertically downwards , as disclosed hereinafter said slides 24 and 25 comprise openings 39 and 41 , respectively , to permit the passage of the laser beam therethrough . moreover , as illustrated in fig6 the slide 25 may be blocked in any desired position in the dovetail groove 27 by means of a blocking wedge 42 which is adapted to be pressed firmly against the inclined edge of slide 25 by means of a screw 43 formed with a manually operable head and engaging a tapped hole in a block 44 secured to said platform 12 . in a similar fashion and as shown in fig7 the slide 24 may be blocked in any desired position in dovetail groove 26 by means of a blocking wedge 45 adapted to be tightly pressed against the inclined edge of slide 24 by means of another screw 46 having a manually operable head and screwed in a block 47 secured to slide 25 . in both embodiments of the device illustrated in the drawings the laser is so disposed that its outlet window lies at the bottom or lower end of the laser and that the laser beam is directed vertically downwards . moreover , the optical device for automatically correcting the verticality of this beam is secured coaxially to the laser 1 at the lower end thereof . a typical example of an optical device 2 will now be described with reference to fig1 and 2 ; of course , the optical device shown in dash and dot lines in fig4 may be similar to the device described hereinafter . as shown in fig1 the optical device 2 comprises a pair of cylindrical cups 48 and 49 disposed coaxially one above the other and containing a liquid having an index of refraction of 1 . 5 . the first or upper cup 48 is closed by a cover fitted or screwed thereon , and the other cup 49 is closed partly by another cover fitted or screwed thereon , and partly by the bottom of the upper cup 48 fitted or screwed in the cover of cup 49 . both cups 48 and 49 and the cover of cup 48 comprise windows aligned with the cup axis to permit the passage of the laser beam . each of said windows consists of a parallel - faced transparent blade , and all these transparent blades are parallel to each other . the assembly comprising the two cups 48 and 49 is resiliently mounted between a pair of flexible o - rings 51 and 52 in a cylindrical case 53 secured at its upper end , for example by screwing , to the lower end of the case of laser 1 and coaxially thereto . the top and bottom of the case 53 are each provided with a coaxial aperture permitting the passage of the laser beam . moreover , adjustment means adapted to be actuated from the outside for adjusting the orthogonality of the parallel - faced transparent blades of both cups 48 and 49 and of the cover of cup 48 with respect to the incident laser beam within the case 53 are provided . these adjustment means may consist for example of four screws 54 ( of which only two are shown in fig1 ). these screws are spaced 90 ° apart , engage tapped holes formed in the cylindrical wall of case 53 , and project inside ease 53 so as to act against the cylindrical wall of cup 49 . four holes 55 are drilled through the socket 5 in alignment with said screws 54 , so that the latter can be turned by means of a screwdriver . now reference will be made to fig2 to illustrate the principle of operation of the optical device 2 for automatically correcting the verticality of the laser 1 . firstly , it will be assumed that the orthogonality of the parallel - faced transparent blades of cups 48 and 49 and of the cover of cup 48 with respect to the incident laser has been adjusted from the onset by means of said screws 54 in a manner to be explained presently . now if for any reason the laser unit assumed a position such that the axis of the beam emitted by the laser 1 formed a relatively small angle α with respect to the true vertical , the bottom of both cups 48 and 49 would be inclined as shown in fig2 so that two liquid prisms having a vertex angle α would result . the combination of these two liquid prisms would deflect the laser beam by an angle d given by the following formula : since the index of refraction n of the two liquids is 1 . 5 , it is clear that d = α , so that after having passed through the two liquid prisms the laser beam emerges vertically therefrom . the laser assembly or unit according to any of the two examplary embodiments described hereinabove operates as follows : when the laser unit is brought to the site where the projected operation or observation is to be accomplished , the operator firstly adjusts the horizontality of platform 12 by adjusting the height of legs 14 by means of the relevant screws 56 , until the bubble of the spherical level carried by said platform 12 is exactly at the center of said level . then , the operator releases the screw 8 so that the laser 1 can rotate in its socket 5 . thus , if when rotating the laser 1 in socket 5 the laser beam traces or draws a small circle on a target , this proves that the laser beam emerging from the optical device 2 is not perfectly vertical , because the parallel - faced transparent blades of cups 48 and 49 and of the cover of cup 48 are not orthogonal to the incident laser beam . therefore , the orthogonality of these parallel - faced transparent blades must be adjusted by means of the set screws 54 until the beam forms only a pin - point mark on the target when the laser 1 is rotated about its geometrical axis . under these conditions , the laser beam emitted by the laser 1 is perfectly vertical . if later on and for any reason the laser unit assumed any position such that the geometrical axis of the laser diverges slightly , by an angle α , from the vertical , the optical device 2 would automatically correct the path of the laser beam and restore its verticality . upon completion of the above - described adjustments the screw 8 can again be tightened to block the laser 1 in relation to its supporting socket 5 . the impact point of the laser beam on the target may be modified within certain limits by either causing the plates 15 and 16 to slide with respect to the platform 12 , as already described in the foregoing with reference to fig1 or utilizing the pair of orthogonal slideways , as also described hereinabove with reference to fig4 and 5 . in the arrangements described , the laser unit is adapted to direct the laser beam vertically downwards . however , the laser unit may also be operated if desired in combination with a device 57 ( fig1 ) for reversing the direction of the laser beam , or alternatively with a device 58 ( fig3 ) for reflecting said laser beam in a direction set at 90 ° to its original direction . to this end , as shown in fig1 a plate 59 is secured to the lower portion of socket 5 and projects on one side of the socket . this plate 59 comprises a first aperture 61 coaxial to socket 5 and a second eccentric aperture 62 located externally of socket 5 . the reversing device 57 consists essentially of a tetrahedral prism 63 of the so - called &# 34 ; cube corner &# 34 ; type , housed in a case 64 detachably secured to the plate 59 and adapted to reflect vertically upwards through the aperture 62 the laser beam entering vertically downwards the prism through the aperture 61 . the device 58 illustrated in fig3 consists essentially of a pentahedral prism 65 adapted to direct horizontally , after a double bond , the vertical downward laser beam received through the aperture 61 . this pentahedral prism 65 is housed in a case 66 rotatably mounted in a support 67 detachably secured to the aforesaid plate 59 whereby the axis of rotation of case 66 merges with the geometric axis of socket 5 . the case 66 further comprises an aperture 68 for the incoming laser beam and another aperture 69 for the outgoing laser beam , a set screw 71 engaging a tapped hole formed in support 67 being provided for blocking the case 66 in any desired angular position . of course , the various embodiments described hereinabove with reference to the accompanying drawings should not be construed as limiting the present invention , since many modifications and changes may be brought thereto without departing from the basic principles of the invention as set forth in the appended claims . | 7 |
the following detailed description is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . this invention establishes methods for fabricating an integrated circuit wherein the si material that forms a pfet is recessed to a depth such that upon epitaxial growth of a sige channel on the pfet , there is a reduced or negligible step - height difference between the active surface of the pfet and nfet portions of the circuit , and further there is reduced or negligible divot formation at the sti feature . in accordance with one embodiment , si recessing at the pfet is accomplished using an ammonia - hydrogen peroxide - water ( apm ) solution at concentrations and for times as will be discussed in greater detail below . in accordance with another embodiment , si recessing at the pfet is accomplished using a solution including one or more of choline hydroxide , ammonium hydroxide , tetraethylammonium hydroxide , clκ888 ™, ekc162 ™, and apm . fig4 - 7 illustrate , in cross section , an exemplary method in accordance with one embodiment of the present invention . as shown therein , at fig4 , a complementary metal - oxide semiconductor ( cmos ) circuit is provided that includes a pfet 30 , an nfet 35 , and a shallow trench isolation ( sti ) feature 15 between the pfet 30 and the nfet 35 . an sti 15 is provided between the pfet 30 and the nfet 35 to prevent electrical current leakage between the adjacent semiconductor device components . the nfet 35 includes a hard - mask material 10 , such as a hard - mask oxide , to protect the nfet 35 during the deposition of channel material on the neighboring pfet 30 . at fig5 , the native oxide 20 , which is a product of previous processing steps or exposure to an oxygen containing environment , is removed with an oxide etchant , such as about 1 : 300 dhf ( dilute hydrogen fluoride ), in a pre - clean step . the oxide etchant also etches a portion of the sti 15 and the hard - mask material 10 . as shown , the sti 15 also typically will include a feature 16 including a change in height between the portion of the sti directly adjacent to the pfet and the portion directly adjacent to the nfet , which is formed in part as a result of processing subsequent to forming the hard - mask on the nfet . at fig6 , an apm solution is applied to the si of the pfet 30 for recessing the active surface 31 of the pfet region 30 to a desired depth . the apm solution reacts chemically with the si , and dissolves the si to provide the recess depth 50 . apm solutions are provided in concentrations with reference to the ammonia component thereof . for example , an apm solution may be given as 1 : x : y , wherein “ 1 ” represents the ratio by mole fraction of ammonia present in the solution , “ x ” represents the ratio of hydrogen peroxide present in the solution with reference to the ammonia , and “ y ” represents the ratio of water present in the solution with reference to the ammonia . in one embodiment , it has been discovered that the si recessing process achieves desirable controllability , consistency , and uniformity when the apm is applied in a concentration wherein “ x ” is between about 1 to about 10 , and wherein “ y ” is between about 2 to about 20 . more preferably , “ x ” is between about 1 to about 5 , and “ y ” is between about 5 to about 20 . an exemplary concentration is about 1 : 1 : 5 . a further exemplary concentration is about 1 : 4 : 20 . it has further been discovered that the si recessing process achieves desirable controllability , consistency , and uniformity when the apm solution is applied at a temperature between about 40 ° c . and about 80 ° c ., such as between about 60 ° c . and about 65 ° c . an exemplary temperature is about 60 ° c . a further exemplary temperature is about 65 ° c . in another embodiment , it has been discovered that the si recessing process achieves desirably controllability , consistency , and uniformity when the apm is applied in a concentration wherein “ x ” is between about 1 to about 0 . 001 , and wherein “ y ” is between about 1 to about 20 . exemplary concentrations of “ x ” include 0 . 001 , 0 . 01 , 0 . 1 , or 1 . exemplary concentrations of “ y ” include 1 , 5 , 10 and 20 . it has further been discovered that the si recessing process achieves desirable controllability , consistency , and uniformity when the apm solution in this embodiment is applied at a temperature between about 20 ° c . and about 100 ° c . exemplary temperatures include 60 ° c ., 65 ° c ., and 80 ° c . in still other embodiments , other chemicals may be used in place of or in addition to the apm solutions described above . these alternative chemicals include , but are not limited to , choline hydroxide , ammonium hydroxide , tetraethylammonium hydroxide , clκ888 ™ ( manufactured by avantor performance materials , inc . of center valley , pa ., usa ), and ekc162 ™ ( manufactured by dupont electronic technologies of hayward , calif ., usa ). as used herein , choline hydroxide , ammonium hydroxide , tetraethylammonium hydroxide are provided in aqueous solution , and can range in concentration between about 1 molar and about 10 molar , for example , although higher and lower concentrations are possible . in yet another embodiment , the process steps described above with regard to fig5 and fig6 can be combined into a single step to reduce the tooling capacity required to perform the fabrication of the integrated circuits and to reduce the amount of chemicals consumed in the process , thereby reducing the overall cost of the ic fabrication . in order to combine the pre - clean step of fig5 and the recessing step of fig6 , the apm solution ( and / or other chemical solution as noted above ) is combined with the dhf oxide etchant into a single solution . it has been discovered that the combined pre - clean / recessing step is preferable , and can be performed using a dhf concentration that is about 1 : 300 . in order to avoid the detrimental formation of step - height differences and divots , the si of the pfet 30 is recessed to a depth sufficient to allow a subsequently - grown silicon - based material channel , for example a sige channel , to achieve a height approximately equal to the height of the active nfet surface 36 ( i . e ., the resulting active pfet surface 31 and the active nfet surface 36 will be approximately equal or co - planar with respect to one another ). as such , the pfet 30 is preferably recessed to a depth between about 2 nm to about 20 nm , and more preferably between about 4 nm and 8 nm . exemplary recess depths 50 include depths of 6 nm and 8 nm . the time period required to achieve such a recess depth 50 will depend upon the concentration of apm solution used and the desired recess depth . however , it has been found that , using the ranges of concentrations and temperatures described above , times ranging between about 5 minutes and about 60 minutes , or more preferably between about 15 minutes and 50 minutes , are desirable for achieving a sufficient pfet si recess 50 . exemplary time periods include about 15 minutes , about 25 minutes , and about 50 minutes . after recessing the pfet 30 , the pfet 30 may optionally be cleaned using another hf solution to remove an impurities or imperfections on the surface thereof and to terminate the si surface with hydrogen . at fig7 , sige is epitaxially grown on the pfet 30 to form a sige channel 40 . as shown , due to the recess 50 in the pfet 30 , the deposited sige channel 40 ( i . e ., the pfet active surface 31 ) reaches a height roughly equivalent to that of the active nfet surface 36 , desirably resulting in a minimal or negligible step - height difference . further , the deposited sige channel 40 reaches a height roughly equivalent to that of the adjacent sti 15 , desirably resulting in minimal or negligible divot formation ( a divot 45 a is shown , greatly reduced in size as compared to fig3 divot 45 ). further processing steps , as will be known to those having ordinary skill in the art , can thereafter be used to remove the hard - mask covering the nfet 35 and the portion of the sti 15 extending to the height of the hard - mask 10 . although not illustrated , the integrated circuit is completed in conventional manner by , for example , forming one or more gate electrodes , forming one or more source / drain regions , providing electrical contacts to the source / drain regions and to the gate electrodes , etc . the conventional processing may further include , for example , depositing interlayer dielectrics , etching contact vias , filling the contact vias with conductive plugs , and the like as are well known to those of skill in the art of fabricating semiconductor circuits . the subject matter disclosed herein is not intended to exclude any subsequent processing steps to form and test the completed integrated circuit as are known in the art . while at least one exemplary embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing the exemplary embodiments . it should be understood that various changes can be made in the function and arrangement of elements without departing from the scope of the invention as set forth in the appended claims and the legal equivalents thereof . | 7 |
reference is now made to fig1 , which is a simplified illustration of a hemostasis device 100 for producing hemostasis following arterial catheterization , in accordance with a preferred embodiment of the present invention . the hemostasis device 100 is suitable for insertion via a conventional catheter introducer ( not shown ) following completion of catheterization and removal of the catheter from the catheter introducer . in accordance with a preferred embodiment of the present invention , hemostasis device 100 comprises a main shaft 102 , which has an outer wall 104 and preferably includes at least three bores . a first bore , designated generally by reference numeral 110 , extends along the main shaft 102 to an anchor balloon inflation location 112 . a second bore 120 extends along the shaft 102 to a peripheral balloon inflation location 122 . a third bore , designated generally by reference number 130 , contains an electrocoagulation heating device 132 connected to an electrical power source and control module 134 by a connector 136 . disposed at an end of main shaft 102 at anchor balloon inflation location 112 is an anchor balloon 140 . anchor balloon 140 is selectably inflated , as shown in fig2 c , via a stopcock 142 and associated conduit 144 in fluid communication with main shaft 102 via a head element 150 . head element 150 is fixed to main shaft 102 at an end thereof opposite the end at which anchor balloon 140 is located . the interior of head element 150 is in fluid communication with first bore 110 in main shaft 102 , which in turn is in fluid communication with the interior of the anchor balloon 140 at anchor balloon inflation location 112 . disposed adjacent the end of second bore 120 in fluid communication with peripheral balloon inflation location 122 , exterior of wall 104 , is a peripheral balloon 160 . peripheral balloon 160 is selectably inflated , as shown in fig2 e , via second bore 120 , via a stopcock 162 and associated conduit 164 that communicate with second bore 120 via head element 150 . in accordance with a preferred embodiment of the present invention , electrocoagulation heating device 132 comprises an electrical conductor 170 connected to an electrocoagulation electrode 176 at an extreme end 178 of third bore 130 . a pair of electrical cables 180 and 182 extend from electrical power source and control module 134 . in the illustrated embodiment , electrical cable 180 serves as a power supply cable and is connected to electrocoagulation heating device 132 by connector 136 . electrical cable 182 serves as a return current cable and is preferably connected to an electrode 184 attached to a body of a patient . electrical power source and control module 134 preferably comprises a power supply , preferably an rf power supply source 186 , including a feedback measurement circuit 188 . the feedback measurement circuit 188 is preferably operative to measure current , blood resistance or blood temperature and thereby determine progress of hemostasis . the electrical power source and control module 134 also preferably includes a microprocessor 190 , operative to adjust the power supplied to hemostasis device 100 according to the blood temperature or other feedback measurement received from feedback measurement circuit 188 , in order to achieve optimal coagulation of the blood . in accordance with a preferred embodiment of the present invention an operator actuation switch 192 is connected along electrical cable 180 . in accordance with another preferred embodiment , switch 192 may be obviated and electrical cable 180 connected directly to connector 136 . reference is now made to fig2 a - 2i , which illustrate various steps in a preferred mode of operation of the apparatus of fig1 . fig2 a illustrates the hemostasis device 100 about to be inserted into an artery 200 via a conventional catheter introducer assembly 202 , following completion of a catheterization procedure and withdrawal of a catheter ( not shown ) from the catheter introducer assembly 202 . the catheter introducer assembly 202 conventionally includes a catheter introducer sheath 204 . fig2 shows the hemostasis device 100 inserted into the catheter introducer assembly 202 such that the outer end of the main shaft 102 extends into the artery 200 well beyond the end of catheter introducer sheath 204 . as shown with particularity in fig2 b , at this stage both anchor balloon 140 and peripheral balloon 160 are deflated . reference is now made to fig2 c , which shows initial inflation of the anchor balloon 140 , preferably by use of a syringe 220 communicating with first bore 110 via the interior of head element 150 , stopcock 142 and associated conduit 144 . the inflated anchor balloon 140 preferably has a cusp - type configuration as seen with particularity in fig2 c . following inflation of the anchor balloon 140 , the catheter introducer assembly 202 and the hemostasis device 100 are both withdrawn , such that the catheter introducer sheath 204 is removed from artery 200 only when the anchor balloon 140 already engages the interior wall of artery 200 in sealing engagement with the aperture in the artery 200 through which the catheter introducer sheath 204 is drawn and through which the main shaft 102 presently extends . this stage is shown in fig2 d . as seen in fig2 e , initial inflation of the peripheral balloon 160 is effected , preferably by use of a syringe 240 communicating with second bore 120 via head element 150 , stopcock 162 and associated conduit 164 . thereafter , as seen in fig2 f , the anchor balloon 140 is deflated and the peripheral balloon 160 is more fully inflated , which preferably causes the extreme end of the main shaft 102 to be withdrawn from the artery 200 to a location lying just outside the artery wall . as seen in fig2 f , peripheral balloon 160 is preferably designed to allow a limited volume of blood to collect outside of the artery wall after the anchor balloon 140 is deflated . this volume of blood is located in a region , indicated by reference numeral 250 , delimited by the engagement of peripheral balloon 160 with the artery wall . at this stage , electric power is supplied to the electrode 176 to provide heating of the blood in region 250 , causing coagulation thereof , as seen in fig2 g . in accordance with the illustrated embodiment of fig1 and as shown in fig2 g , the electric power is provided by actuation of switch 192 . in accordance with another preferred embodiment , switch 192 is obviated , and the electric power is provided by connecting electrical cable 180 ( fig1 ) directly to connector 136 . preferably , the amount of electrical power supplied along electrical cable 180 ( fig1 ) from electrical power source and control module 134 to the electrocoagulation electrode 176 is between 0 . 1 - 10 watts at up to 25 volts at rf frequencies . once acceptable hemostasis has occurred in region 250 , the peripheral balloon 160 is deflated , as shown in fig2 h , preferably by operation of syringe 240 communicating with second bore 120 via head element 150 , stopcock 162 and associated conduit 164 . thereafter , the hemostasis device 100 is entirely withdrawn from the patient , leaving a region 260 of hemostasis outside of artery 200 , as shown in fig2 i . reference is now made to fig3 , which is a simplified illustration of a hemostasis device constructed and operative in accordance with another preferred embodiment of the present invention . the embodiment of fig3 is similar to that of fig1 , except as described hereinbelow . elements that occur in both embodiments are identified by the same reference numerals . in the embodiment of fig3 , electrocoagulation heating device 132 comprises a pair of separate electrical conductors 300 extending along third bore 130 connecting electrical power source and control module 134 to a pair of electrocoagulation electrodes 302 at end 178 of third bore 130 . electrical cables 180 and 182 are both connected to electrocoagulation heating device 132 by connector 136 . the illustrated embodiment shows connector 136 directly connected to electrical cables 180 and 182 . in the embodiment of fig3 , the electrodes 302 may be arranged in mutual coaxial arrangement or in mutual side - by - side arrangement or any other suitable arrangement . it will be appreciated by persons skilled in the art that the present invention is not limited by what has been particularly shown and described hereinabove . rather the scope of the present invention includes both combinations and subcombinations of the various features described hereinabove and shown in the drawings as well as modifications and further developments thereof which would occur to a person of ordinary skill in the art upon reading the foregoing description and which are not in the prior art . | 0 |
fig1 of the accompanying drawings shows a heating acupuncture needle 1 provided with an external energy source 2 which co - acts with a heating means 3 forming an integral part of needle 1 and extending over all the length of this latter . according to the invention , the heating means 3 is present in the form of a thin resistive envelope surrounding the body of the needle 1 over all of its surface except the upper end of its head 1 ′, which remains uncovered . according to one characteristic of the invention , this resistive envelope is preferably constituted by a thin insulating layer 13 entirely surrounding the body of the needle 1 except the upper end of the head 1 ′ and of the end of the point and itself covered , over all of its surface , with a very thin layer 14 that is conductive of the electricity , this conductive layer 14 also covering the end of the point which is not provided with the thin insulating layer 13 . this characteristic appears in the cross - sectional detailed view greatly enlarged of one end of a needle according to fig2 of the accompanying drawings , in which the means 3 is shown by two lines extending on opposite sides of the body of needle 1 , whilst the very thin electrically conductive layer 14 also surrounding the point is shown by a single line parallel to this point . to this end , the thin insulating layer 13 can preferably be constituted by an epoxy , polyurethane or fluorinated resin , of the tetrafluoroethylene type , and the electrically conductive layer 14 can be a film of metal , particularly biocompatible metal . so as to obtain good flexibility of the needle , the thickness of the composite layer forming the heating means 3 is preferably low relative to the diameter of the body of the needle and is preferably less than 0 . 1 of the diameter . thus , the needle according to the invention will have a flexibility substantially comparable to that of a conventional acupuncture needle . the resins used are preferably flexible and adhere well to the steel constituting the body of the needle 1 . preferably , these resins are biocompatible . moreover , these resins have a viscosity permitting their deposition in the form of very thin layers and they are metallizable . the covering of the body of needle 1 with a layer of resin is carried out by quenching or any other technique of coating and the ultimate deposition of the conductive layer 14 is carried out by chemical means or by physical means . by way of example , the insulating layer 13 is preferably a polyurethane resin of the type of that known by the commercial name esthane 5715p of the bf goodrich company . this resin permits obtaining adherent , smooth and insulating deposits . it is also possible , according to a modified embodiment of the invention , as shown in fig3 of the accompanying drawing , to constitute the heating means 3 in the form of a thin composite layer 13 ′ of a resistive material covering integrally the body of the needle except for the upper end of its head , this composite layer being itself covered by an electrically conductive layer 14 . such a material can preferably be either a resin of the loaded polytetrafluoroethylene type , loaded for example with black carbon powder or a metallic powder , or a conductive epoxyde resin of the type known by the commercial name epo - tek h20e or epo - tek 417 of the epotecny company . in such an embodiment , the external conductive layer 14 remains totally separated from the body of the needle 1 by the resin constituting the layer 13 ′, and this layer 14 also covers the end of the point of the needle 1 . moreover , the external conductive layer 14 can then have an almost zero resistance , because it is not used . as a result , an electric current , passing between the body of the needle 1 and the external layer 14 , will pass through the resistive layer 13 ′ over all the extent of its mass . according to another modified embodiment of the invention , the heating means 3 is present in the form of a thin resistive envelope , whose resistance diminishes progressively from the head of the needle 1 to its point . as a result , it is possible to provide a progressive falloff of thermal energy , which corresponds to a progressive decrease of the temperature , from the head toward the point of the needle , contrary to the embodiment described above , in which the loss is uniform . thus , the needle will behave in a manner identical to a conventional acupuncture needle heated by any traditional external means . the resistance of the resistive envelope can for example be comprised between 10 ohms in the case of a construction in the form of an external metallic layer , and 100 ohms in the case of an embodiment of the means 3 in the form of a thin composite layer 13 ′ of a resistive material , this composite layer being itself covered with an electrically conductive layer 14 . a needle covered with such a complex has a mechanically stable surface and a thermally stable sub - layer and permits radiation into the air of variable energy , by modulation of the intensity within a bracket comprised between 20 ma and 200 ma for a resistance comprised between 10 ohms and 100 ohms , for one hour , without change of said covering . the external energy source 2 is preferably present in the form of a receptacle provided at its lower portion with a recess 4 for reception and for electrical connection of head 1 ′ at the end of the needle 1 and receiving in a chamber 5 a device 6 , removable or fixed , for production of electric current , said chamber 5 being closed in a sealed manner by a cover 7 , an electrically conductive wall 8 being provided between the recess 4 for the reception of the head 1 ′, from which it is electrically insulated , and the chamber 5 . this receptacle can be provided at its end that receives the head 1 ′ of the end of needle 1 , with a means 9 for holding the head 1 of said needle 1 in its recess 4 . this holding means 9 can be present in the form a disk sectors 10 mounted slidably at the base of the receptacle forming the energy source 2 , against the action of return springs . preferably , the recess 5 has a depth such that , in case of closing the sectors of the disk 10 about the head 1 ′ of the needle 1 , the upper end of said head 1 ′ of the needle 1 is applied against the electrically conductive wall 8 provided between the chamber 5 for reception of the device 6 for electrical production , and the recess 4 . the conductive wall 8 is mounted on the bottom of the receptacle forming the energy source 2 by means of an insulating cylinder 11 and is insulated from the recess 4 by an insulating plate 12 . thus , the electricity produced by the device 6 is transmitted , on the one hand , to the walls 8 and , on the other hand , to the recess 4 which is in contact with the conductive envelope of the heating means 3 . there results from the closure of the electrical circuit a heating of the resistive covering , over all its length , and a transfer of heat from the needle to the surrounding tissues . the device 6 is constituted for example by an electric battery of the wafer battery type or else by an electrical accumulator . in such a case , it suffices , after emplacing the needle 1 , to secure the energy source 2 on the head 1 ′ of the needle 1 , such that the means 3 of needle 1 is in electrical contact with the battery forming the device 6 by means of the conductive wall 8 and of the recess 4 and can heat itself . there results a temperature increase of the assembly of the needle , such that the tissue in which the needle is implanted is subjected , over all the depth of penetration of the needle 1 , to a corresponding constant heating over all the length or modulated over the latter . this has the effect of stimulating the deep layers of the organism and of the neurovascular complexes according to a temperature balancing principle similar to the operation of a cooling circuit . in particular , in the field of action of the needle , the micro - circulation of the blood is increased . the needle according to the invention can be subjected , for treatment , to a temperature increase permitting dissipation in the tissues of sufficient energy , equivalent to that dissipated by a conventionally heated needle . this temperature increase can be obtained , in a known manner , by a choice of the optimum resistance of the heating means 3 and of the voltage delivered by the battery or the electrical accumulator . as a result , the modulation of the degree of heat to be obtained can be completely delimited . thanks to the invention , it is possible to provide heating , subcutaneously , at the point of acupuncture or of reflexotherapy , by means of an acupuncture needle having a flexibility comparable to that of conventional acupuncture needles and over all the length of the needle . moreover , the quantity of thermal energy dissipated is constant over the punctured neurovascular complex . one can thus carry out a non - exclusive single point stimulation , of variable depth and extent , by means of a portable and self - contained assembly not requiring an external connection by means of wires or other connections . the duration of treatment with heat can be completely controlled by interruption of the production of heat directly by action on the external energy source or by separation of this source from the head 1 ′ of the needle 1 . the needle 1 can have a straight shape or a curved shape as a function of the points of implantation and can have an end in the form of “ seven stars ” or “ plum flower ”, which is to say ending in several points . moreover , the invention permits better carrying out of the technique of moxibustion , on the one hand , in terms of comfort for the patient and , on the other hand , in technical terms for the practitioner . thus , the invention permits treatment permitting ambulatory treatment , as well as accessibility to several cutaneous regions simultaneously . moreover , the practitioner is no longer required to be constantly present , because the risk from burning is eliminated and the sources of energy used have sufficient autonomy for overall duration of treatment . the puncture depth can also be selected completely freely because of the fact that the external energy source 2 gives rise to no risk of burning and an inclination of the needle , if desired , with said external energy source 2 toward the skin remains harmless . the treatment of the hairy regions can also be carried out without preliminary preparation by shaving . this advantage permits particularly the use of acupuncture with moxa in veterinary treatments . finally , the needle according to the invention , with its source of energy , is completely clean in use , namely it gives off no pollution and can be coupled , contrary to the traditional technique , with the use of suction . the heating acupuncture needle according to the invention has uses in other fields and , in a particularly interesting manner , in obstetrics and rheumatology . thus , in the field of obstetrics , the invention could permit the use of a heating myorelaxant before enduring labor . in rheumatology , the invention is applicable for pathologies connected to cold , such as torticollis and lumbago , and even arthritis . the same is true as to gastro - enterology and pneumology . of course , the invention is not limited to the embodiment described and shown in the accompanying drawings . modifications remain possible , particularly as to the construction of the various elements or by the substitution of technical equivalents , without thereby departing from the scope of protection of the invention . | 8 |
we describe a method for hosting versioned web services . our approach separates the interface and implementation versions of a service . the interface version of a service is the ( published ) version of the service which describes the service interface characteristics ( operations , parameters , results , behavior , and so on ). the implementation version is the version of the deployed component which supports a particular interface . each implementation version is accompanied by new version metadata which explicitly describes the interface version supported and ( if any ) set of other compatible interface versions supported . this metadata forms a version configuration model which is then used to dynamically link interface version requests to implementation versions at runtime . the advantage of this approach is that it gives the service provider the flexibility to manage the transition between compatible versions , allowing concurrent deployment of multiple versions in a way that is transparent to the service consumer . an interface change can be picked up by new service consumers at development time , while existing service consumers which are bound to a previous version are identified by the service request version . the dynamic mapping at runtime allows the service provider to flexibly deploy and manage multiple versions of a service in a way that is transparent to a service consumer . we draw a distinction between a service &# 39 ; s interface and implementation version . we borrow the terminology of the software contract to describe the interface version , because it effectively defines a software contract between the client and the service provider . a client necessarily binds to a particular version of a service , with that particular version &# 39 ; s set of operations , parameters , results , and so forth . when that client later invokes the service , it has an expectation of consistency of behavior . for example , the client expects that the service provider will adhere to the terms of the software contract in effect when the service was built . the service provider has a responsibility to assure that whichever implementation version handles this request , it will meet its contractual expectations . we call this the contract version or interface version , and it is this metadata which identifies a versioned service request . any discussion of the evolution of services and change is necessarily hinge on the question of compatibility . if change is inevitable , it is up to the service developer to decide how to introduce that change . the impact of a change can range from seamlessly backward compatible to incompatible requiring a whole new programming model . however , because of its inherent disruptive effects , incompatible change is relatively rare . the more typical pattern introduces change with some level of compatibility . for example , a bug - fix release would likely have the same ( therefore compatible ) interface . or a version may introduce new operations or parameters while maintaining backward compatibility with the previous version . knowing the explicit compatibility relationship between two versions can be leveraged in the hosting environment . if version 2 is backward compatible with version 1 , then it is eligible to have version 1 requests routed to it and can in fact replace version 1 . however , if version 3 drops compatibility with the older version 1 , the service provider may choose to keep both versions 2 and 3 deployed in order to not break clients using the old version 1 interface . therefore , in addition to the contract version and the implementation version , we also add a compatibility assertion to our version metadata model . this version metadata ( service contract version , implementation version , and associated version compatibility assertions ) is added to the system configuration and is used in controlling the version matching behavior of the service provider . table 1 illustrates the version metadata of an exemplary service with three contract versions . each implementation version supports a particular contract version , and has a set of other contract versions with which it is compatible . note that while contract version 1 . 1 is backward compatible with version 1 . 0 , contract version 1 . 2 has dropped compatibility with the older 1 . 0 version . using a layered hosting approach , with a version routing point , or gateway , which maps interface versioned requests to deployed implementation versions , provides the service provider the flexibility to manage phased version transitions while insulating service consumers from backend changes . three of the key aspects of this service are : 1 ) distinguishing between a public interface version and a private implementation version ; 2 ) creating a metadata version model to link implementation versions to supported interface versions ; and 3 ) creating a metadata - driven selection algorithm to dynamically map interface versioned requests onto implementation versioned services . fig1 illustrates our approach , with version aware service consumers 150 submitting versioned service requests 190 to a version group gateway 120 . the gateway &# 39 ; s functions are broken down into three steps as follows : 1 ) extract any version metadata from the request ; 2 ) version selection ( calling the version selection algorithm 130 ); and 3 ) route the request to the selected endpoint . to extract the metadata , the gateway 120 parses the request message 190 to extract any version metadata ( e . g . the contract version ). depending on the messaging protocol , the version metadata will need to be encoded differently , so this step must be protocol aware . once the version metadata is retrieved , the gateway 120 invokes the version selection algorithm 130 to determine the correct implementation target version 160 or 165 for a particular request 190 . the gateway 120 then dynamically re - routes the request to the selected implementation version . it should be noted that the example of fig1 shows only two target versions , for clarity . any number of target versions and consumers may benefit from the hosting service as described herein . in this design , one or more versions of a particular service deployed side - by - side form a version group . the aggregate of the individual service &# 39 ; s versioning metadata forms the version group configuration which controls the request routing behavior of the system 100 . the service proxy 175 is logically positioned between service implementation versions 160 and 165 and the version aware clients 150 . the service proxy 175 is the endpoint to which client applications bind . this structure insulates the client applications from the details of the implementation versioning changes and effectively puts the service provider in control of version routing selection . referring to fig2 there is shown an exemplary implementation of the embodiment of fig1 . the three main logical components of the gateway 120 are shown in fig2 : version metadata extractor 210 , dynamic endpoint selector 220 , and version selector 230 . referring to fig3 there is shown a flow chart of the process steps for hosting versioned web services according to an embodiment of the present invention . in step 310 the service gateway 120 receives the versioned requests 190 . in step 320 the version metadata extractor 210 parses the request message 190 to extract any version metadata ( that is , the contract version ). once the version metadata is extracted , in step 330 the gateway 120 invokes the version management controller ( vmc ) 135 , possibly through its version mapping api , to determine the correct target . in step 340 the endpoint selector 220 parses the service context and the contract version metadata extracted in step 320 to the vmc 135 which determines the correct endpoint in the service group 162 . it should be noted that the separation of functionality between the vmc 135 and the gateway 120 as depicted in fig2 is just one example of how the roles can be assigned . in an alternate embodiment , the gateway 120 is configured to perform the role of the vmc 135 as well . on the other hand , the vmc 135 may also be configured to take on some of the roles shown as performed by the gateway 120 . in step 350 the gateway 120 then dynamically re - routes the request 190 through a service bus to the endpoint of the target implementation version ( 160 or 165 in this example ). when a new implementation version of a service is installed , a version group member is created and its versioning metadata is added to the existing hosting configuration . the metadata contains the contract version , implementation version ( and associated implementation endpoint or address ) and compatibility assertions . in addition to these fixed attributes , we add three tunable parameters ( active interface set , the version state , and the default indicator ) which are used to control how the gateway 120 routes requests . referring now to fig5 , there is shown a list summarizing the version configuration metadata 500 : service interface version — this is the published interface version which is used by the client ; compatible interface versions — this is the set of interface versions this implementation can support ; currently active interface versions — this is the subset of the compatible interface versions this implementation is currently actively supporting ; default version flag ( true / false )— one member of each version group can be tagged as the default version which is designated as the default target to route unversioned requests or in certain cases , versioned requests that cannot be matched with any of the deployed versions in the group ; and state ( active / inactive )— this is the state ( active / inactive ) flag indicates whether this implementation is able to handle requests the default version is also useful in dealing with the transition from unversioned legacy services ; an implementation which has been marked as inactive is not eligible to receive requests . multiple implementation versions supporting the same interface version would not be activated concurrently . the endpoint is the unique target for this implementation version which the gateway uses as the routing destination . table 2 shows an example of the configurable metadata of four deployed versions of a service with their deployed endpoints purposely omitted for simplicity . in this version group , version 1 . 0 . 3 can support service contract 1 . 0 , version 1 . 1 . 2 can support both contract versions 1 . 0 and 1 . 1 and version 1 . 2 . 1 can support only contract version 1 . 2 . currently , three deployed versions are serving requests side - by - side , and version 1 . 0 . 3 is designated as the default version of the group for unversioned requests . note that while there are two deployed versions which support the 1 . 1 contract , only one of them ( 1 . 1 . 2 ) is active . since an interface version can be supported by multiple implementation versions in a version group , care must be exercised when configuring the metadata to avoid routing conflicts . for example , if the service administrator decides to retire version 1 . 0 . 3 and to forward all the traffic for service contract 1 . 0 to version 1 . 1 . 2 , the version metadata of version 1 . 0 . 3 is configured to turn the active flag to be false and contract version 1 . 0 needs to be added to the active contracts that version 1 . 1 . 2 currently supports . this is represented in the configuration shown in table 3 . therefore , configuration validation is necessary to assure a consistent configuration . the version metadata discussed so far are sufficient to handle basic version management . they can be extended to include other attributes for more complex scenarios . for example one could add time - based version routing with the addition of a valid - from / valid - to time window . the version selection algorithm 130 takes the requested interface version 190 as input and searches the version group configuration to find the appropriate implementation version to handle this request . this matching algorithm is described in the pseudo - code of fig4 . if a match is found , the algorithm 130 returns the matching implementation address to the gateway 120 . if no match is found , the algorithm 130 returns an error and the gateway 120 can return an appropriate error result to the service requester 150 . fig6 is a simplified block diagram of a programmable computer that can be configured to operate according to an embodiment of the invention . according to an embodiment of the invention , a computer readable medium , such as a cdrom 601 can include program instructions for operating the programmable computer 600 according to the invention . the processing apparatus of the programmable computer 600 comprises : random access memory 602 , read - only memory 604 , a processor 606 and input / output controller 608 . these are linked by a cpu bus 609 . additionally , there is an input / output bus 629 , and input / output interface 610 , a disk drive controller 612 , a mass storage device 620 , a mass storage interface 614 , and a removable cdrom drive 616 . it is important to note that the present invention as shown in fig6 has been described in the context of a fully functioning data processing system , those of ordinary skill in the art will appreciate that the processes of the present invention are capable of being distributed in the form of a computer readable medium of instructions and a variety of forms and that the present invention applies equally regardless of the particular type of signal bearing media actually used to carry out the distribution . examples of signal bearing media include cd - roms , dvd - roms , and transmission - type media , such as digital and analog communication links , wired or wireless communications links using transmission forms , such as , for example , radio frequency and light wave transmissions . the signal bearing media make take the form of coded formats that are decoded for use in a particular data processing system . according to another embodiment of the invention , a computer readable medium , such as the cd - rom 601 can include program instructions for operating the programmable computer 600 according to the invention . what has been shown and discussed is a highly - simplified depiction of a programmable computer apparatus 600 . those skilled in the art will appreciate that a variety of alternatives are possible for the individual elements , and their arrangement , described above , while still falling within the scope of the invention . this method as described can be performed as a service for a second party . in a service embodiment , the gateway 120 , the vmc 135 , or both , can perform their respective functions for a fee . the fee can be a per - usage fee or a monthly subscription fee . an interface to dynamically modify the version configuration has been described . this version configuration interface gives the service provider control over the routing behavior through functions to view , modify and verify the version group configuration . to guard against an inconsistent configuration , the controller validates and rejects the configuration before committing any changes which create routing conflicts . through this interface the service provider can modify the active interface version set , the version state ( active / inactive ) and the default indicator . these controls allow the system provider the flexibility to dynamically control the version selection behavior of the system . therefore , while there has been described what is presently considered to be the preferred embodiment , it will understood by those skilled in the art that other modifications can be made within the spirit of the invention . the above descriptions of embodiments are not intended to be exhaustive or limiting in scope . the embodiments , as described , were chosen in order to explain the principles of the invention , show its practical application , and enable those with ordinary skill in the art to understand how to make and use the invention . it should be understood that the invention is not limited to the embodiments described above , but rather should be interpreted within the full meaning and scope of the appended claims . | 7 |
referring now to the drawing , fig1 through 4b depict features of a first embodiment of the present invention , and fig5 through 10c depict features of a second embodiment of the present invention , wherein it is to be understood that these embodiments are merely preferred and that other embodiments of the present invention are contemplated by the present invention in which the wiper arm of a wiper system is enabled to be raised and drop onto the glass surface as a shake , preferably repeatedly as a series of shakes , such as to shakingly remove soluble and insoluble debris as may be trapped between the wiper blade and the glass surface . fig1 through 3a , 5 through 7 b , 9 a and 9 b depict features of a conventional wiper system 100 . at each wiper 104 of the wiper system 100 , there is included an electric wiper motor 106 connected by its shaft 106 s to the proximal end portion 108 a of a wiper arm 108 and a wiper blade assembly 110 connected to a distal end portion 108 b of the wiper arm , wherein the wiper blade assembly carries an elastomeric wiper blade 112 which wipes across the glass surface 114 in squeegee - like fashion to wipingly remove debris and precipitation laying thereon , and wherein an arm pivot 108 p defines a fixed arm portion 108 c ( in this example being identical with the proximal end portion 108 a ) of the wiper arm and a pivotal arm portion 108 d of the wiper arm , whereby the arm pivot provides vertical movement of the wiper blade assembly toward and away from the glass surface , whereby a biasing spring 116 associated with the wiper arm biases of the wiper blade pressably toward ( onto ) the glass surface 114 . in operation , when the wiper motors are actuated , the respective wiper arms reciprocate across the surface to be wiped , the speed of reciprocation being determined by an electronic circuit . referring now to the first embodiment of the present invention , an automatic debris removal apparatus 102 is preferably interfaced with each wiper 104 ( alternatively for example , there may only be one actuator located at the driver &# 39 ; s side wiper , being absent at the passenger &# 39 ; s side wiper ). the automatic debris removal apparatus 102 includes , at each wiper so equipped , an actuator 120 ( as for example a piston - cylinder combination ) which is preferably electrically actuated , but may be operated otherwise as for example hydraulically , wherein the actuator is operably extensible / retractable along an actutation axis a a between a retracted state ( as shown at fig2 ) and a deployed state ( as shown at fig3 ). the preferred disposition of the actuator 120 is generally adjacent the arm pivot 108 p beneath the pivotal arm portion 108 d of the wiper arm 108 . the actuator 120 is secured to a structural member 122 in a manner known in the art and is further connected to a source of electricity or pressurizable fluid in a manner also known in the art . the actuator 120 has an actuator rod 124 a having an actuator rod terminus 124 adapted to abutably engage the wiper arm 108 directly thereabove when in the deployed state . in normal operation of the wiper system 100 , the wipers are actuated , as for example automatically by a moisture sensor 126 or manually by a switch 128 through an electronic control module 130 which has programmed wipe modes for the electric motors . the actuators 120 of the automatic debris removal system 102 are in the retracted state of fig2 , whereby the wiper arms 108 are free of contact with the actuator rod terminus 124 of their respective actuator as they wipe across the glass surface 114 . in the event debris 132 ( see fig2 ) is / are trapped between a wiper blade 112 and the glass surface 114 , the operator of the vehicle initiates a wiper clean routine ( see fig4 b ), as for example by pressing a switch 134 in which the wiper arms 108 assume a horizontally stationary position above their respective actuators 120 as for example determined by a wiper arm position sensor 136 , whereupon the actuators are actuated to cycle between the retracted state of fig2 and the deployed state of fig3 , such that the actuator rod terminus 124 pushes up upon the pivotal arm portion 108 d of the wiper arm , thereby causing the pivotal arm portion to pivot ( see arrows p ) and the wiper blade to become spaced from the glass surface , as shown at fig3 . it is preferred that during the actuation cycle , the actuator rod terminus retract quickly so that the biasing spring 116 will cause the wiper blade to drop strikingly upon the glass surface as a shake ( analogous to the manual manner of shaking described hereinabove ) in order to shake off ( i . e ., knock loose or break up ) any debris stuck to the wiper blade or stuck to the glass surface ( as indicated at fig3 ), whereupon any trapped debris is dislodged from the wiper blade , as shown at fig3 a . in this regard it is preferred for a predetermined number of shake cycles to be performed , as for example 3 to 5 cycles . fig4 b depicts an example of an actuation algorithm 150 for implementing the first preferred embodiment of the present invention . the algorithm may be contained in any electronic control module of the vehicle ( i . e ., ecm 130 ) and is electronically interfaced with the wiper system electronics of the vehicle ( i . e ., fig4 a ). at block 152 command is received from the driver that automatic debris removal is requested . at block 154 , the program interrupts the wiper system electronics control of the wiper system . at block 156 the program directs the wiper motors to position the wiper arms directly above their respective actuators and remain there , wherein at decision block 158 , the wiper arm position sensor assures correct placement of the wiper arms . at block 160 , the actuators are sent a command to actuate through a predetermined number of shake cycles ( i . e ., between 3 and 5 cycles , for example ). at block 162 , with the actuators at the retracted state , control is passed back to the wiper system electronics . referring next to fig5 though 10 b , the second embodiment of the automatic debris removal system 102 ′ according to the present invention will be detailed , wherein the above described conventional wiper system 100 is utilized , and wherein like functioning parts have identical numbering and similar but modified parts have identical numbering with a prime . the automatic debris removal apparatus 102 ′ is preferably interfaced with each wiper 104 ( alternatively for example , there may only be one actuator located at the driver &# 39 ; s side wiper , being absent at the passenger &# 39 ; s side wiper ). the automatic debris removal apparatus 102 ′, at each wiper , includes an actuator 120 ′ ( as for example a piston - cylinder combination ) which is preferably electrically actuated , but may be operated otherwise as for example hydraulically , wherein the actuator is operably extensible / retractable along an actutation axis a a ′ between a retracted state ( shown at fig6 ) and a deployed state ( as shown at fig7 a and 7b ). as in the first embodiment , the preferred disposition of the actuators 120 ′ is generally adjacent the pivot 108 p beneath the pivotal arm portion 108 d of the respective wiper arm 108 . the actuators 120 ′ are secured to a structural member 122 in a manner known in the art and is further connected to a source of electricity or pressurizable fluid in a manner also known in the art . differing from the first embodiment , each actuator 120 ′ has a cam 170 connected to the actuator rod 124 a adjacent the actuator rod terminus 124 ′ which is unidirectionally pivoting on a cam pivot 172 , wherein the cam has a ramp portion 170 a and a drop portion 170 b . a cam spring 174 biases the cam to its unpivoted state ( see fig8 a ) from its pivoted state ( see fig8 b ). a boss 176 on the actuator rod adjacent the actuator rod terminus interferes selectively with the cam 170 , resulting in the unidirectional pivoting of the cam . in normal operation of the wiper system 100 , the actuators 120 ′ of the automatic debris removal system 102 ′ are in the retracted state of fig6 , whereby the wiper arms 108 are free of contact with the cams 170 of the respective actuators 120 ′. in the event debris 132 ( see fig6 ) is / are trapped between a wiper blade 112 and the glass surface 114 , the operator of the vehicle initiates a wiper clean routine , which routine , according to a first aspect of the second embodiment , may be independent of the wiper system electronics in that the wiper system reciprocates normally during cleaning , or may be interfaced with the wiper system electronics according to a second aspect of the second embodiment ( see fig1 a and 10b ). the wiper clean routine actuates the actuators 120 ′ so that they assume the deployed state , whereupon the cams 170 now interact with their respective wiper arm 108 as the wiper arms move reciprocally ( in first and oppositely second directions ) across the glass surface in response to operation of the wiper motors . since each cam 170 cannot pivot as the wiper arm moves in the first direction and up the ramp portion 170 a from position a to position b in fig8 a because of interference by the boss 176 , the pivotable arm portion 108 d of the wiper arm pivots ( see arrows p ′) and the wiper blade becomes spaced from the glass surface until a maximum height ramp location is attained at position b and the wiper blade is maximally spaced from the glass surface , as shown at fig9 b . with further movement in the first direction of the reciprocation of the wiper arm by the wiper motor , the wiper arm encounters the drop portion 170 b , whereupon the biasing spring 116 causes the wiper blade to drop shakingly ( strikingly ) upon the glass surface to shake off ( i . e ., knock loose or break up ) any debris stuck to the wiper blade or stuck to the glass surface ( as indicated at fig7 a ), whereby any trapped debris is dislodged from the wiper blade . in the return second direction of the reciprocation of the wiper arms in which the wiper arms move opposite to the first direction , the wiper arms encounter the drop portion of each respective cam 170 , but the cam is able to pivot ( see arrows p ″) due to a force from this direction overcoming the biasing of the cam spring 174 , such that the cam will now pivot to allow the wiper arm to pass thereover without interference , as shown at fig8 b . fig1 a depicts an example of an algorithm for implementing the first aspect of the second embodiment of the present invention , wherein the wiper system electronics are independent of the debris removal system 102 ′. at block 182 , the driver inputs a command ( i . e ., presses a switch ), which at block 184 causes the actuators 120 ′ to assume their deployed state . after a predetermined time ( sufficient to allow , for example 3 to 5 passes ( providing 3 to 5 shake cycles ) of the wiper arm thereover ), at block 186 the actuators are returned to the retracted state . fig1 b and 10c depict an example of an implementation of the second aspect of the second preferred embodiment of the present invention . the algorithm 190 of fig1 c may be contained in any electronic control module ( i . e ., ecm 130 ′) of the vehicle and is electronically interfaced with the wiper system electronics ( see fig1 b ) of the vehicle . at block 192 , command is received from the driver that automatic debris removal is requested ( i . e ., via pressing of switch 134 ′). at block 194 , the program interrupts the wiper system electronics control of the wiper system . at block 196 , the actuators are sent a command to actuate to the deployed state . at block 198 , the program directs the wiper motors to move the wiper arms reciprocally in the first and second directions of movement ( i . e ., back and forth ) across the cams a predetermined number of times ( for example , 3 to 5 passes providing 3 to 5 shake cycles ), wherein each direction of movement of the reciprocation is localized with respect to the cams , being just a little distance on either side of the respective cams , much smaller than the full reciprocation of the wiper arms , thereby rendering a quick succession of wiper blade shakes . at block 200 , with the actuators at the retracted state , control is passed back to the wiper system electronics . to those skilled in the art to which this invention appertains , the above described preferred embodiment may be subject to change or modification . such change or modification can be carried out without departing from the scope of the invention , which is intended to be limited only by the scope of the appended claims . | 1 |
fig1 - 4 illustrate a book sling 20 constructed in accordance with the invention that is of open side construction advantageously permitting quick , easy and convenient loading and unloading of at least one of a plurality of books 22 capable of being removably carried by the sling 20 . the book sling 20 quickly and easily adjusts to conform to the number , shape and orientation of the books 22 loaded into it , facilitating easy and stable lifting onto the back or shoulder of a person wearing the book sling 20 . such an adjustably conformable construction advantageously provides excellent comfort when worn while making it quick and easy to put on , take off , load and unload during use and operation of a book sling configured in accordance with the present invention . the book sling 20 includes a body 24 made preferably of a flexible webbing 26 configured to provide a front wall 28 that lies against the backside of a person 30 ( in phantom in fig1 ) wearing the sling 20 and a rear wall 32 spaced from the front wall 28 by a bottom 34 arranged to form a generally u - shaped cradle 36 in which the books 22 are placed to transport them . the flexible webbing 26 is preferably composed of a flexible material , such as a flexible fabric , a flexible woven material , a flexible non - woven material , or another suitable flexible material . examples of suitable commercially available materials include nylon , vinyl , gore - tex , and leather . in a preferred embodiment , a plurality of pieces are joined , such as by stitching , bonding , riveting or the like to form the webbing 26 . in another preferred embodiment , the webbing 26 is made of a single piece of flexible material such that the front wall 28 , the rear wall 32 and the bottom 34 are also made from the same single piece of material . the sides between the front wall 28 and the rear wall 32 are generally open . preferably , adjustable side restraints 38 and 40 extend along each side of the cradle 36 and between the sling walls 28 and 32 keeping books 22 in the cradle 36 while also enabling wall spacing adjustment , which advantageously permits the book - carrying capacity of the sling 20 to be correspondingly varied as needed . more preferably , a top restraint 42 overlies at least a portion of the cradle 36 and extends between the sling walls 28 and 32 . preferably , the top restraint 42 is adjustable and reclosable , permitting convenient and efficient loading or unloading of the books 22 . the top restraint 42 attaches preferably to the front sling wall 28 adjacent where one end of a flexible and adjustable shoulder strap 44 is attached . as is depicted in the preferred embodiment of fig1 , the strap 44 goes over and around the backside of the shoulder and part of the back of a person 30 ( shown in phantom in fig1 ) wearing the sling 20 . the strap 44 carries a position - adjustable , comfort - enhancing shoulder pad 46 and a reclosable pouch 48 preferably configured as an electronic device storage that is also capable of being moved along the strap 44 . the pouch 48 preferably is also configured so it can be removed and reattached to the strap 44 in a quick and easy manner enabling the person 30 to take the pouch 48 with them independent of where they leave the sling 20 . fig2 illustrates the rear sling wall 32 of the preferred embodiment in more detail . the rear wall 32 is preferably of elongate construction having a bottom edge 50 , a pair of sides 52 and 54 and a top edge 56 defining a rear wall panel 58 . the rear wall panel 58 is made of a flexible material , such as a fabric , a cloth , a woven material , a non - woven material or the like . examples of suitable flexible wall materials include nylon , vinyl , gore - tex , or leather . in the preferred embodiment depicted in fig2 , the wall panel 58 may be of any configuration , but preferably is of a generally trapezoidal construction , preferably having its base angle at each bottom corner 60 and 62 of the panel 58 being substantially the same such that they are within about 5 ° of one another . in the preferred embodiment of the wall panel 58 depicted in fig2 , the bottom left corner angle is defined as an angle formed by an intersection between an imaginary line running substantially coincident with and generally parallel to the left side 52 and the bottom 50 and the bottom right corner angle is defined as an angle formed by an intersection between a line substantially coincident with the right side 54 and the bottom 50 . in combination with the side restraints 38 and 40 , the aforementioned wall panel shape of the preferred embodiment advantageously helps encourage books 22 received in the sling 20 to self - center themselves , including while the sling 20 is being carried by a person 30 who is walking . this advantageously helps increase load stability by preventing load shifting during use and operation . for example , while being carried by a walking person , the resultant up and down motion imparted on the sling 20 in combination with the force of gravity acting on the books 22 in the sling 20 can cause book movement helping self - center each book 22 relative to the center of the sling bottom 34 . the top edge 56 can deviate from being generally straight , as one would ordinarily expect it to be where the wall panel 58 is of trapezoidal construction , such that it is generally triangular , curved , and / or includes an apex at its very highest point as a result of convergence between the panel sides 52 and 54 , such as is depicted in fig2 . as is shown in fig2 , panel sides 52 and 54 preferably converge by being angled toward one another . in the preferred embodiment of fig2 , the apex produced from this panel side edge convergence is obstructed by part of the top restraint 42 . preferably , the rear wall 32 includes at least one or a pair of book retaining side flaps 64 and 66 , which extend outwardly from corresponding panel side edges 52 and 54 to help keep books 22 from falling out of the sling 20 , particularly when a person 30 is carrying the sling 20 on their shoulder . one or more side flaps 64 and 66 may be formed to extend from the front wall 28 . in a preferred arrangement , each one of the side flaps 64 and 66 cooperates with a corresponding side restraint 38 and 40 to help prevent the books 22 in the sling 20 from falling out of a respective open side 68 and 70 of the sling 20 . in doing so , each side flap 64 and 66 constrains side - to - side movement of the books 22 received in the sling cradle 36 . the side flaps 64 and 66 preferably cooperate with the side restraints 38 and 40 such that the restraints 38 and 40 overlie parts of the respective flaps 64 and 66 along a lengthwise extending section of the flap , preferably along its maximum lengthwise extent . in the preferred side flap embodiment shown in fig1 - 4 , each side flap 64 and 66 is generally triangular with part of the flap underlying its corresponding restraint 38 or 40 such that at least part of the flap adjacent its apex 72 ( fig1 ) underlies at least a portion of the restraint . in the preferred flap embodiment shown in fig1 each flap 64 and 66 is connected to the front wall 28 . where connected to the front wall 28 , each flap 64 and 66 preferably is connected by a fixed length of belt or strap 74 . as is also shown in fig1 , the flap connector strap 74 preferably connects to the front wall 28 adjacent where corresponding side restraint 38 connects to the front wall 28 . where the front wall connection of these two sling components is adjacent each other , the strap 74 preferably underlies part of corresponding side restraint 38 . the rear wall 32 preferably also includes a top cover flap 76 that extends upwardly towards a top part of the front wall 28 , such as in the manner shown in fig1 and 4 . the cover flap 76 also is generally triangular with one end of the top restraint 42 preferably being attached to it at or adjacent its apex 56 . a gusset 79 may be fixed to the cover flap 76 and to part of the top restraint 42 to securely anchor the restraint 42 to the rear wall 32 . in the preferred embodiment shown in fig1 - 4 , the top restraint 42 is fixed to the cover flap 76 adjacent apex 56 but spaced a distance from its outer or top edge leaving a lip 78 that can overlap with the top part of the front wall 28 , if desired . for example , where the top restraint 42 is length adjustable , the cover flap lip 78 can overlap with part of the top part of the front wall 28 when the length of the top restraint 42 is sufficiently shortened . this can help optimize the ability of the book sling 20 to be expanded or contracted as needed to vary its storage capacity to accommodate the particular volume of books 22 being carried at the time . the rear wall 32 can include an overlay 80 made a panel of flexible material that preferably is the same as or like the material of the rear wall 32 . the overlay panel 80 preferably has a shape substantially complementary to that of at least a portion of the rear wall 32 . for example , as is best shown in fig1 and 2 , the overlay panel 80 preferably has a quadrilateral shape that can also be of generally trapezoidal construction . no matter what its shape , the overlay panel 80 preferably may have a bottom edge 82 that is adjacent and which can be substantially coincident with the bottom edge 50 of the rear wall 32 . the bottom edge 82 preferably is longer than the overlay panel top edge 84 , which can be curved as shown in fig2 . for example , the bottom edge 82 of the overlay panel 80 preferably is fixed to the rear wall 32 via an elongate stitched seam 86 that extends along the bottom 34 of the rear wall 32 . where the rear wall 32 has tapering or converging sides 52 and 54 , the overlay panel 80 can also have same or similar converging side edges 88 and 90 . for example , as is shown in fig2 , each overlay panel side edge 88 and 90 preferably is generally parallel to a corresponding rear wall side 52 and 54 . the overlay panel 80 can be configured as an open top pocket capable of receiving objects , preferably flat in shape , inserted into the pocket along the top edge . in one preferred embodiment , stitching 92 extends along both panel side edges 88 and 90 , fixing the panel 80 along its side edges 88 and 90 to the rear wall 32 . a seam 94 preferably extends along the curved top edge 84 of the panel 80 in the manner illustrated in fig2 . where it is desired to attach the panel 80 to the rear wall 32 along the top edge 84 , the stitching 92 along the side edges can also be extended along the panel top edge 84 . the rear wall 32 can also carry a reclosable compartment 96 , such as is depicted in fig2 on either or both sides of the rear wall 32 . the compartment 96 may preferably include an elongate reclosable fastener arrangement 98 that defines a mouth or opening through which articles ( not shown ) can be inserted into the compartment 96 . the fastener arrangement 98 preferably is a zipper 100 that extends along part of the periphery of an outer compartment wall panel 102 . in the preferred embodiment , the zipper 100 extends along a top edge and at least a portion of both side edges of the outer wall panel 102 . if desired , the zipper 100 can be further configured to attach the outer panel 102 to the overlay panel 80 and / or the rear wall 32 . in the preferred compartment embodiment shown in fig2 , a mesh article retaining pocket 104 can be provided inside the compartment . the compartment 96 can also include one or more pen or pencil holding loops 106 , which can be attached to the inner surface of the outer panel 102 . an article tie down arrangement 108 can be carried by the compartment 96 , preferably mounted to or otherwise defined in part by outer wall panel 102 . the tie down arrangement 108 may preferably include an elastic hold down cord 110 , e . g ., bungee cord , arranged in a criss - cross manner , as is shown in fig2 , by threading the cord 110 appropriately through four guide loop tabs 112 spaced about the periphery of the outer panel 102 . while all of the tabs 112 can be anchored to the outer panel 102 , the tabs 112 are each preferably attached to a respective one of a plurality of corner gussets 114 and 116 located at or along each bottom compartment corner . the ends of the cord 110 are preferably held captive in a thumb operated slide cinch adjuster 118 that enables cord tension adjustment . this can advantageously enable the cord 110 to be loosened or tightened as needed to hold an article ( not shown ) manually placed between the cord 110 and the outer surface of the outer compartment wall panel 102 . the corner gussets 114 and 116 preferably also help reinforce the corresponding bottom corner 60 and 62 of the rear wall 32 , such as is depicted in fig2 . each gusset 114 and 116 preferably helps stress risers from concentrating at corresponding rear wall bottom corners 60 and 62 when the book sling 20 is carrying a heavy load . each gusset 114 and 116 may help prevent this from happening by spreading out forces from the load along the portions of the real wall bottom and side edge extending adjacent where the gusset is attached . this can advantageously help enable a book sling 20 constructed in accordance with the invention to lack any kind of rigid or substantially rigid framework or support structure and permit its walls 28 , 32 and 34 and flaps 64 , 66 and 76 to be made of a flexible material , such as the flexible materials disclosed above . fig3 illustrates the front sling wall 28 of the preferred embodiment in more detail . the front wall 28 also is preferably of elongate construction having a bottom edge 120 , a pair of sides 122 and 124 and a top edge 126 defining a front wall panel 128 of generally quadrilateral construction . in the preferred wall panel embodiment show in fig3 , the front wall panel 128 preferably is substantially rectangular . the wall panel 128 preferably is also made of a flexible material , such as a fabric , a cloth , a woven material , a non - woven material or the like . the front wall 28 preferably includes an outer surface 130 that faces toward and typically bears against the back of a person 30 carrying the book sling 20 . the front wall 28 preferably includes a generally top cover flap 132 that preferably also is generally triangular like the rear wall cover flap 76 . likewise , the other end of the top restraint 42 is attached to the cover flap 132 , preferably adjacent its apex 134 . a reinforcement gusset 136 preferably is provided to more securely anchor the top restraint 42 to the front wall 28 helping reinforce where it attaches . the front wall 28 can also include an outer overlay panel 138 that is elongate and which preferably is fixed substantially about its periphery to the front wall panel 128 . in the preferred embodiment shown in fig3 , a seam 140 extends about its entire periphery with stitching preferably used in attaching the overlay panel 138 to the wall panel 128 . the overlay panel 138 preferably sandwiches comfort - increasing padding ( net shown ) between it and wall panel 128 . to enable the book sling 20 to be hung up , such as on a wall mounted hook or peg ( not shown ), the front wall 28 can be equipped with a hanger loop 142 that is anchored by a gusset 144 to the front wall 28 . in the preferred embodiment shown , the gusset 144 is generally centrally located , disposed so it overlaps a top portion of the overlay panel 138 and seam 140 , and can have a portion folded underneath the overlay panel 138 . the hanger loop 142 is preferably attached to the gusset 144 at or adjacent each loop end . located adjacent and preferably above the hanger loop gusset 144 is a transversely extending reclosable opening 146 of an article holding pocket or compartment disposed on either or both sides of the front wall 28 . it may preferably include a reclosable fastening arrangement 148 that preferably is a zipper 150 or the like that can be opened to enable compartment access and that can be closed to prevent compartment access . in one preferred embodiment , the integral wall formed compartment holds a rain shield ( not shown ) made of a water - resistant or water impervious material such as plastic , e . g ., plastic film , or the like , which is packed in the compartment during book sling manufacturing . such a rain shield can be configured to serve as a hood that can be pulled at least partially out of the compartment in the wall 28 when the zipper 150 is open , manually rearranged , such as by unfolding it and / or spreading it out , and placed relative to the exposed parts along the top and sides of the book sling 20 so as to keep the rain away from any books 22 being carried by the book sling 20 . in one preferred rain hood configuration ( not shown ), the hood is made of a plastic film or thin sheet material that can be unfolded and arranged so it overlies , not just the book sling 20 , but the person 30 wearing the book sling 20 as well . located adjacent and above the front wall bottom 120 preferably are a pair of generally triangular shoulder strap mounting ears 152 and 154 enabling the shoulder strap 44 to be attached so the book sling 20 can be worn over either shoulder . each shoulder strap mounting ear 152 and 154 preferably includes a d - ring 156 carried by a loop 158 that is fixed to the respective ear . the shoulder strap 44 preferably has a manually operated snap 160 that releasably engages the d - rings 156 of one of the mounting ears 152 or 154 , depending on user preference , e . g . comfort , left - handed , etc . the shoulder strap 44 preferably includes a strap adjuster 162 for enabling shoulder strap length to be changed by the user 30 . one preferred type of adjuster 162 suitable for use is a tape adjuster , or the like , that is configured to function or operate the same as or similar to that of a slide adjuster . as is shown in fig1 , the shoulder strap 44 preferably is threaded through the adjuster 162 such that a handle strap segment 164 extends outwardly from the adjuster 162 toward a user 30 wearing the book sling 20 permitting it to be grasped and manipulated , e . g ., pulled , to adjust strap length while the sling 20 is being worn . capping the free end of the handle strap segment 164 preferably is selvage , welting or the like forming a grasp tab 166 that can be felt by touch , grasped and pulled while the book sling 20 is being worn . because of its unique size , shape , texture , etc ., it can advantageously enable a person 30 to more easily blindly find the strap segment 164 by feel when reaching back while wearing the book sling 20 . such a grasp tab 166 may also help prevent the handle strap segment 164 from being inadvertently pulled completely free of the cinching strap adjuster 162 . while the strap 44 can be constructed without such a grasp tab 166 , it preferably is equipped with such a grasp tab 166 fixed to it at or adjacent its free end having a configuration like that shown in fig1 . as best shown in fig1 , 2 and 4 , each side restraint 38 and 40 preferably includes a cinching arrangement 168 that cooperates with an adjuster strap 170 and an anchor strap 172 to enable it to be tightened as needed to help three dimensionally conform it and its corresponding adjacent retainer flap 64 and 66 around books 22 in the sling 20 . when each restraint 38 and 40 preferably is suitably tightened around the books 22 in the sling 20 , the sling 20 and books 22 behave substantially as a single object , which advantageously prevents load shifting during transport thereby reducing user fatigue while also preventing books from inadvertently falling out during book sling loading , lifting , and transport . part of each side restraint 38 and 40 , including the cinching arrangement 168 , preferably is spaced from the adjacent side retainer flap 64 and 66 sufficiently so as to permit relative movement therebetween during tightening or loosening of each restraint 38 and 40 . as a result of permitting such relative movement to occur , the book sling 20 advantageously can be capable of varying its book - carrying capacity greatly . for example , when fewer books 22 are in the book sling 20 , relative movement between each restraint 38 and 40 and its corresponding retainer flap 64 and 66 permit the adjacent flap to fold , bend or otherwise deform to accommodate the smaller load volume when each restraint 38 and 40 is tightened . as a result of being wider than the adjacent restraint supporting it , each retainer flap 64 and 66 can help to more evenly spread forces from the corresponding adjacent restraints 38 and 40 to the books 22 in the sling 20 over a greater surface area of the books 22 preventing the books 22 from being damaged by the restraints 38 and 40 , no matter how hard each restraint 38 and 40 is tightened . the anchor strap 172 of each side restraint 38 and 40 is preferably fixed at one end to the cinching arrangement 168 and at its other end to a generally triangular flexible mounting tab 174 that extends outwardly from one of the sling walls , preferably rear wall 32 . the adjuster strap 170 is fixed at one end to the other one of the sling walls , preferably wall 28 , and adjustably threaded through a strap adjuster 176 of the cinching arrangement 168 . as is shown in fig1 and 4 , the fixed end of the adjuster strap 170 preferably directly overlies the flap connector strap 74 of the adjacent retainer flap 64 or 66 . in a preferred embodiment , the adjuster strap 170 is attached directly to the flap connector strap 74 adjacent sling wall 28 , such as in the manner depicted in fig4 . it preferably also is attached directly to sling wall 28 . a portion of the adjuster strap 170 threaded through the cinching adjuster 176 preferably extends beyond the adjuster 176 defining a handle strap segment 178 that preferably also includes a grasp tab 180 at its free end . such a construction advantageously can provide quick , easy and convenient cinching adjustment of each side restraint 38 and 40 , even while the book sling 20 is being worn . the adjuster strap 170 also is preferably fixed to a sling wall , in this case 28 , that enables it to be threaded through adjuster 176 in a manner ensuring the strap handle segment 178 that extends outwardly from the adjuster 176 extends generally toward the back of a user 30 wearing the book sling 20 so the user can reach back and grasp the handle segment 178 while wearing the sling 20 to perform a cinching adjustment to either side restraint 38 and 40 . the top restraint 42 also can include a cinching arrangement 182 that not only facilitates length and for tension adjustment but which also is of releasably latching construction for enabling the restraint 42 to be opened permitting unobstructed access to books 22 in the book sling 20 . for example , when the restraint 42 is open , books 22 can be loaded into the sling 20 and / or books 22 can be removed from the sling 20 . the releasable latching cinch arrangement 182 preferably includes a strap adjuster 184 that is integrated with a buckle and socket type releasable latch assembly 186 that preferably is of side release cinch buckle construction or the like . an adjuster strap 188 ( fig1 ) is preferably fixed at or adjacent one end to one of the sling walls , preferably wall 28 , and threaded through the strap adjuster 184 such that a handle strap segment 190 can extend outwardly from the adjuster 184 towards a person 30 wearing the book sling 20 . the free end of the handle strap segment 190 preferably has a grasp tab 192 attached to it . by this component arrangement causing the handle segment 190 to extend generally toward the back of a person 30 wearing the sling 20 , it advantageously enables the handle segment 190 to be easily grasped and manipulated by the user 30 to cinch or un - cinch the top restraint 42 . for example , handle segment 190 can easily be reached by a person 30 wearing the sling 20 to pull it to cinch the top restraint 42 tighter so the sling walls 28 and 32 more securely clamp against or otherwise engage books 22 in the sling 20 . the latch assembly 186 preferably includes a buckle 194 that is releasably interlocks with a buckle socket 196 when the tongue or tongues 202 ( fig2 ) of the buckle 194 are inserted into the socket 196 . the buckle 194 preferably includes an integrally formed slide adjuster 198 disposed on its side opposite its socket engaging tongue or tongues 202 through which part of the adjuster strap 188 extends . an anchor strap 200 is preferably fixed at or adjacent one end to the other one of the sling walls , preferably wall 32 , and is attached to the buckle socket 196 at or adjacent its other end . in the preferred embodiment shown in fig2 and 4 , the part of the anchor strap 200 that attaches to sling wall 32 preferably includes a plurality of upraised loops 204 formed via attachment to the wall 32 with each loop 204 preferably configured to retain an article , such as a pen , pencil or the like ( not shown ). with reference to fig5 and 6 , the reclosable pouch 48 can be carried by the shoulder strap 44 , such as is in the manner shown in fig1 . the pouch 48 shown in fig5 and 6 has an outer wall 206 defining an elongate and oblong , e . g . egg - shaped pouch construction having a generally u - shaped reclosable opening 208 that can be opened to insert a cell phone , a pda , a data storage device , or a music player , preferably an mp3 player or the like into the pouch 48 . likewise , the reclosable opening 208 can be opened to remove any such article being held inside the pouch 48 . in the preferred embodiment shown in fig5 and 6 , the reclosable opening 208 employs a reclosable fastening arrangement 210 , such as preferably a zipper 212 or the like , to enable the pouch 48 to be selectively opened or closed . the pouch 48 preferably can be adjustably positioned along the shoulder strap 44 such that it can be oriented to enable pouch access by a user 30 while carrying the book sling 20 . to enable the pouch 48 to be completely removed from the strap 44 , it may include a pair of outwardly extending mounting wings 214 and 216 that wrap around the strap 44 and engage one another to releasably mount the pouch 48 to the strap 44 . a releasably engaging fastening arrangement 218 that preferably is a hook and loop fastening arrangement 220 , such as velcro , is used to releasably engage the wings 214 and 216 and keep them engaged with one another when wrapped around the strap 44 . as is shown in fig6 , one of the wings 214 preferably has a hook containing fastener strip 222 attached to it and the other one of the wings 216 preferably has a loop containing fastener strip 224 attach to it . when the wings 214 and 216 are wrapped around the shoulder strap 44 enough so the fastener strips 222 and 224 come into contact , they releasably engage one another preventing disengagement without significant intentional manual effort being applied to pull the wings 214 and 216 apart . preferably , this mounting arrangement advantageously not only allow the pouch 48 to be positioned just about anywhere along the shoulder strap 44 , it also permits the pouch 48 to be removed and used independently from the book sling 20 as it can be transported independently of the sling 20 . another preferred embodiment is shown by fig7 through 13 . according to fig7 , a book sling 300 preferably includes a rear wall 314 and a front wall 316 spaced apart from the rear wall by a bottom 318 and two mesh side walls 319 on either side of the book sling 300 . the book sling 300 may be formed in accordance with any of the aspects described above . the book sling 300 may preferably be provided with a sling strap 317 rigidly attached to the top of front wall and a bottom corner of front wall to enable user to carry the bag over a shoulder to transport books . also seen in the preferred embodiment of fig7 is the auto cinching handle 315 which , as will be further described hereinafter , preferably is attached to adjustable side restraints 313 . as will be further described hereinafter , when a user pulls on auto cinching handle 315 , adjustable side restraints 313 are retracted , thereby moving rear wall 314 closer to front wall 316 and securely holding the contents within the book sling . fig8 is shown as a front , perspective view of the preferred embodiment of book sling according to the present invention , clearly showing side restraints 313 which can be securely affixed to rear wall 314 and pass through grommets 320 on front wall 316 into the interior of front wall where they are connected to auto cinching handle , as will be further described hereinafter . also show in fig8 preferably is an adjustable strap with a buckle 322 attached to the too of rear wall 314 and the inside top of front wall 316 for securely closing the top of book sling once objects are loaded into the interior space of book sling 300 . strap 322 can have a releasable buckle 324 for releasably attaching strap 322 from the front wall to the rear wall to facilitate loading and unloading of the book sling . furthermore strap 322 preferably is adjustable such that it can be lengthened or shortened to conform to the size load that preferably is contained within the book sling . fig9 is a side perspective view of the preferred embodiment of book sling whereby restraints 313 are visible , extending from rear wall 314 to front wall 316 through grommets 320 . the adjustable side restraints are preferably securely affixed to front wall 316 at points of varying heights 330 along rear wall 314 . in this way , the adjustable side restraints can pull equally from front wall to back wall at varying heights in order to provide a secure and uniform tightening effect for any size or shape load carried within the book sling . fig1 is a front view of the auto cinch handle of a book sling showing a view of the top of front wall 316 with the auto cinch handle 315 preferably extending beyond the top of front wall 316 and entering into the interior of front wall 316 through grommets 340 . in addition , there preferably is provided and depicted in fig4 a locking mechanism 342 for releasably securing auto cinch handle in a tightened position once a user fully tightens adjustable restraints 313 by pulling on handle 315 . the cord 344 of auto cinching handle 315 preferably passes through the locking mechanism 342 before entering the interior of front wall 316 . when the handle preferably is pulled into a tightened position , the locking mechanism prevents the cord from reversing its direction and thereby loosening adjustable restraints 313 . locking mechanism 342 preferably is released by pressing button 346 in a downward direction as depicted , thereby releasing the locking mechanism and allowing cord 344 to pass through the locking mechanism , thereby allowing adjustable restraints 313 to be loosened up and expanding book sling 300 . fig1 preferably shows a front view of front wall 316 showing cushioned material placed on the outside of front wall thereby providing a soft surface for a user that would carry the book sling across a shoulder and leaning against the user &# 39 ; s back . also visible is shoulder strap 317 preferably attached to the top of front wall 316 and also to d - ring 350 at the left front , as depicted , bottom of front wall 316 . it should be noted that an additional d - ring 350 appears on the right bottom corner of front wall 316 . similar to the above embodiment , a user can switch strap 317 from the right to the left - hand side , thereby facilitating carrying it on a right or left shoulder , in accordance with the user &# 39 ; s preferences . as further depicted , there preferably is both a zippered pocket as well as a pouch on the front of front wall 316 although the configuration depicted preferably is only representative of one particular embodiment and front pocket and / or pouches maybe included on the front wall in any number of configurations . fig1 preferably is showing an interior cut - away view of the preferred embodiment of the auto cinching mechanism for the book sling in accordance with the present invention . there preferably is shown cord 344 extending from handle 315 which , as previously described , passes through grommets 340 on the front of front wall 316 and into the interior portion of front wall 316 , as shown . cord 344 may extend downward along the back of front wall 316 and preferably is attached by way of a loop 360 through which adjustable restraints 313 pass . the loop permits the free movement of adjustable restraints 313 through the loop such that when auto cinching handle preferably is pulled and thereby shortened , the adjustable restraints can pass through the loop freely . in addition , as previously described , adjustable restraints 313 can pass through grommets 320 in front wall 316 which are visible on the interior cut - away portion of front wall 316 . adjustable restraints 313 can pass through the grommets and extending through a d - ring which preferably is affixed to the bottom of the interior portion of front wall 316 , then , continuously extend through the d - ring and loop 360 and preferably further extend back out through the opposite side of front wall 316 , through grommets 320 . in this way , it can be seen that the adjustable restraints 313 can be each , one continuous cord which preferably is securely affixed to one side of rear wall 314 extending through grommets 320 , and through d - ring 362 , and loop 360 , and extending back out of the opposite side of front wall 316 through grommets 320 and are securely affixed to the opposite side of front wall . in this way , it can be seen that by pulling on auto cinching handle 315 and shortening cord 344 , adjustable restraints 313 can also be thereby pulled upwards by loop 360 , and thus decrease the distance between front wall 314 and front wall 316 to decrease the space within u - shaped sling 310 to securely carry the load therein . both adjustable restrains 313 and cord 344 can be formed from non - elastic cords , such as nylon of varying diameter . the cords shown can be approximately 4 mm in diameter . however , as stated , they may be of varying diameter and / or composition as needed in accordance with the anticipated use and load bearing capabilities . fig1 preferably is shown as a side cut - away view of the book sling in accordance with the present invention depicting adjustable restraints 313 extending from front wall wherein they are securely affixed at various points along front wall as previously described , extending through grommets 320 of back wall , and then further continuously through d - ring 362 and loop 360 , then returning through d - ring 362 and out to the opposite side of front wall 316 . the book slings described above may be provided with more than one shoulder strap , e . g ., to provide a back pack configuration . with reference to fig1 , a book sling or backpack 400 with a person wearing it over his shoulders in an operational position is shown . two shoulder straps 417 and 418 are preferably connected adjacent to the top part as well as the bottom part of the front wall 416 facing the user . in addition , the book sling 20 and / or 300 of the present invention can be adapted to incorporate various features from commonly owned , commonly invented , u . s . application ser . no . 11 / 700 , 453 , filed jan . 31 , 2007 , titled cinching shoulder or back carried bag and method , the entirety of which is hereby incorporated by reference herein . for example , the book sling 20 and / or 300 of the present invention can be adapted to incorporate other features disclosed in the &# 39 ; 453 application and / or which are identified in the &# 39 ; 453 application drawings . it may be desired to modify the side restraints 38 and 40 of the book sling 20 and / or 300 of the present invention to incorporate corresponding features of the shoulder back carried bag disclosed in the &# 39 ; 453 application . for example , it may be desired to remove or otherwise further restricting the length adjustability of the side restraints 38 and 40 where the automatic cinching arrangement disclosed in the &# 39 ; 453 application is employed in the book sling 20 and / or 300 of the present invention . various alternatives are contemplated as being within the scope of the one or more inventions disclosed herein . therefore , it is to be understood that , although the foregoing description and drawings describe and illustrate in detail one or more preferred embodiments of the present invention , to those skilled in the art to which the present invention relates , the present disclosure will suggest many modifications and constructions as well as widely differing embodiments and applications without thereby departing from the spirit and scope of each such invention including any and all such inventions claimed herein . accordingly , the particularly disclosed scope of the invention is set forth in the following claims . | 0 |
referring now to fig1 there is shown a two - pass fault diagnostic method comprising one embodiment of the present invention . a first pass comprises testing an original circuit according to test patterns generated by an atpg tool and collecting output data and a second pass comprises testing a critical subset extracted from the original circuit according to an extraction algorithm comprising one aspect of the present invention . first , the original circuit is tested and output data is collected . once the output data is collected fault diagnosis is performed on the original circuit utilizing the atpg tool . the fault diagnosis generates a list of likely faulty nets . the likely faulty nets are then used as the interested nets for extraction of the critical circuit subset . extraction of a critical subset of the original circuit is thereafter performed according to an extraction algorithm comprising one aspect of the present invention . for any digital vlsi circuit with full scan chain implementation , a critical circuit subset can be extracted using the extraction algorithm comprising one aspect of the invention . the extracted critical circuit subset has three characteristics . ( 1 ) the extracted subset contains all interested nets and assumes that all likely faulty nets are included among the interested nets so that all other nets can be assumed to be functional . ( 2 ) the extracted circuit subset maintains the accessibility to the interested nets , that is , it maintains the capability of asserting and observing the logic states of the interested nets . there is at least one unique input path and one unique output path for each interested net in order to maintain the accessibility . ( 3 ) the extracted critical circuit subset significantly reduces the circuit size , enabling minimization of circuit size while maintaining accessibility of the interested nets . when the faulty nets are identified , the critical subset may thereafter be extracted according to the extraction algorithm , which assigns net types to all nets in the circuit . nets of interest are assigned type “ c .” nets that extend the interested nets to inputs and outputs for their accessibility are assigned types “ e .” nets that allow c and e nets passing gates without interfering other input nets of the gates are called p nets . each p net has a fixed logic state assigned . all other nets in the circuit besides c , e , and p nets are assigned type x nets , meaning “ do not care nets ,” which can be ignored during subsequent diagnostics and testing . the critical circuit subset therefore contains only c , e , and p nets . atpg test patterns can thereafter be generated for the critical circuit subset and then mapped back to the original circuit . during a test operation , only c and e net logic states are purposely toggled . the p nets are fixed with their assigned logic values . after running the test operation , output data can be collected and the fault diagnosis can be performed . if the diagnostic resolution is not satisfied , the method presented in the invention can be used repeatedly . the likely faulty nets generated in the previous pass can be used as the interested nets for the subsequent circuit extraction and diagnosis . the pseudo primary inputs and outputs are referred to as outputs and inputs of scan cells . scan chain technique is frequently and commonly used in the advanced digital vlsi circuit designs . scan chain technique comprises chaining the registers and latches within the circuitry together in series . each register / latch becomes a scan cell in a scan chain . the scan cell logic states can be set and observed through an appropriate procedure via the three special ports : scan in , scan out , and scan enable . with the help of full scan chain technique , a sequential circuitry can become a pure combinational circuitry . the registers or latches become scan cells whose inputs and outputs become the pseudo primary outputs and inputs for the combinational circuitry . all circuits have only two types of entities : gates and nets . accordingly , each circuit can be considered as a large data structure which is nothing but a collection of nodes and nets . a node can be a gate node , a stern node , or an input / output node . a gate node generally consists of inputs coming into the node and one output generated out of the node . a stem node has one input but multiple outputs or branches . there are two types of input / output nodes : primary input / output nodes and pseudo primary input / output nodes . the primary input / output nodes are the regular circuitry input / output ports . the pseudo primary inputs / outputs are referred to as the scan cell outputs and inputs . upstream and downstream nets are referred to as the adjacent nets along the signal flow direction . upstream nets are the nets from the input side and downstream nets are the nets from the output side . when extracting the critical circuit subset , each net in the original circuit is assigned one of the following net types : a . c — stands for “ core ” net . each c net is a net of interest . b . e — stands for “ extended ” net . e nets are the nets necessary to extend the c nets into primary or pseudo primary inputs / outputs in order to maintain the capability of asserting and observing the c nets . c . p — stands for “ passivating ” nets . when c , e , or d nets pass a gate sharing with other inputs , the other inputs are assigned a fix logic value so that the output of the gate is solely determined by the c , e or d nets . these other inputs are called p nets , the passivating nets . d . x — stands for “ not care ” nets , meaning all x nets can be ignored during subsequent testing and failure analysis . e . d — stands for “ to be decided ”. when a net of the type ‘ c ’ or ‘ e ’ hits a stem that branches out , there are multiple paths from this net to reach the primary outputs . initially , a best path is not known so each branch of the stein is assigned a ‘ d ’ net type . eventually , one or more of these paths will be chosen and all nets therein assigned as either e nets or converted to x nets . p and d nets each have additional special attributes . the attributes for a p net comprise source , value , and possibility . the attribute for a d nets is difficulty . each p net source attribute has two values : ‘ e ’— the p net path passivates an e net ; and ‘ d ’— the p net path passivates a d net . ‘ 0 ’— the p net should be set at logic 0 ; ‘ 1 ’— the p net should be set at logic 1 ; and ‘ 0 & amp ; 1 ’— the p net has conflicting logic states . ‘ y ’— the p net path logic state can be set without conflicts ; ‘ n ’— the p net path intersects with e net at a stem output ; ‘ ce ’— the p net path logic state has conflicts with p net paths that passivate e nets ; ‘ cd ’— the p net path logic state has conflicts with p net paths that passivate d nets ; and ‘ c ’— the p net has value attribute ‘ 0 & amp ; 1 ’. ‘ 0 ’— the d net path has no intersection with , other c , e , or d net paths and all passivated p nets have possibility attribute ‘ y ’; ‘ 1 ’— the d net path has no intersection with other c , e , or d net paths and at least one of the passivated p nets has possibility attribute ‘ cd ’ but none have possibility attribute ‘ ce ’ or ‘ n ’; ‘ 2 ’— the d net path has no intersection with other c , e , or d net paths and at least one of the passivated p nets has possibility attribute ‘ ce ’ but none have possibility attribute ‘ n ’; ‘ 3 ’— the d net path has no intersection with other c , e , or d net paths and at least one of the passivated p nets has possibility attribute ‘ n ’; ‘ 4 ’— the d net path has intersections with other d net paths and have no intersections with other c or e net paths ; and ‘ 5 ’— the d net path has intersections with other c or e net paths . a path is defined as a sequence of nets of the same type connecting each other in the order following the direction of signal flows . for a given set of interested nets , the critical circuit extraction is as illustrated in fig2 . a first step comprises assigning a net type for each net . there are 5 net types : c , e , x , d , and p . c nets are for the interested nets . e nets are the extension of c nets to the inputs and outputs . c and e nets &# 39 ; logic states can be purposely toggled during test operation . x nets are “ don &# 39 ; t care ” nets , which can thereafter be ignored in subsequent testing operations . d nets are the temporary nets which will eventually be converted to either e nets or x nets . p nets will have fixed logic states during test operation . once the logic values are assigned to each p net , the p nets thereafter allow c or e net passing gates without interfering with nets other than c or f nets . once the net type is assigned , a second step comprises assigning net attributes to all d and p nets . each d net is assigned a “ difficulty ” attribute which is used to determine which d nets to convert to e nets and which d nets to convert to x nets . each p net has three attributes : “ source ”, “ possibility ”, and “ value ”. source and possibility attributes help determine which p nets to convert to e nets and value attributes indicate which logic value to be set for each p nets . after assigning net attributes , a net type conversion process begins to convert p and d nets to either e or x nets in order to maintain accessibility to the interested nets while minimizing the circuit size of the critical subset . the net type conversion process comprises a repeat process of converting net types and assigning net attributes . when some nets are converted , other net attributes need to be reassigned accordingly . more nets can thereafter be converted based on the newly assigned attributes . the net type conversion process is repeated until all d nets are converted to either e or x nets and all remaining p nets have possibility attribute “ y ”. the procedures and criteria for assigning net types , net attributes , and converting net types are detailed according to the following rules : a ) all interested nets are assigned as type c nets ; b ) any unassigned nets that are the output nets of gates whose input nets contain c or e nets are assigned as type e nets as illustrated in fig3 ; c ) any unassigned nets that are multiple output nets of a stem whose input net is c or e net are assigned as type d nets as illustrated in fig4 ; d ) any unassigned nets for which the upstream nets contain d nets are assigned as type d nets as illustrated in fig5 ; e ) any unassigned net that is the sole input of a stem or a gate whose outputs contain c or e nets are assigned as type e nets as illustrated in fig6 ; f ) any unassigned nets that are input nets of gates whose outputs are c , e , or d nets are assigned as type p nets as illustrated in fig7 ; g ) any unassigned nets whose downstream nets contain p nets are assigned as type p nets as illustrated fig8 ; h ) any remaining unassigned nets are assigned as type x nets . a ) attributes for p nets are assigned according to the following procedure : i ) assign source attribute ‘ e ’ to any p nets which are inputs of gates whose outputs are either c or e nets ; ii ) assign source attribute ‘ d ’ to any p nets which are inputs of gates whose outputs are d nets ; iii ) assign source attribute ‘ e ’ to any p nets with downstream p nets having source attribute ‘ e ’; iv ) assign source attribute ‘ d ’ to any p nets with downstream p nets having source attribute ‘ d ’; v ) assign value attribute ‘ 1 ’ to p nets which are inputs of and or nand gates whose outputs are c , e , or d nets ; vi ) assign value attribute ‘ 0 ’ to p nets which are inputs of or or nor gates whose outputs are c , f , or d nets ; vii ) for p nets that are inputs of gates whose outputs are p nets , assign value attributes so that when the input p nets &# 39 ; logic states are set as the input p net value attributes , the output p nets are at the logic states as indicated by the output p net value attributes ; viii ) for any p net that is an input of a stem , assign the same value attribute as that of the output p nets if all output p nets have the same value attribute ; if output p nets have different value attributes , assign the stem input p net value attribute ‘ 0 & amp ; 1 ’; ix ) assign value attribute ‘ 0 & amp ; 1 ’ to any p nets with downstream p net value attributes of ‘ 0 & amp ; 1 ’; x ) assign possibility attribute ‘ n ’ to p nets which are stem outputs and the corresponding stem inputs are e nets ; xi ) assign possibility attribute ‘ ce ’ to any p net which ( 1 ) is an output of a stem whose input p net has a value attribute of ‘ 0 & amp ; 1 ’ and ( 2 ) at least one of the stem output p nets with source attribute ‘ e ’ has a value attribute different from its own value attribute ; xii ) assign possibility attribute ‘ cd ’ to any p net which ( 1 ) is an outputs of a stem whose input p nets have value attribute ‘ 0 & amp ; 1 ’ and ( 2 ) all stem output p nets that have different value attributes have source attribute ‘ d ’; xiii ) assign possibility attribute ‘ n ’ to p nets with upstream p nets having possibility attribute ‘ n ’; xiv ) assign possibility attribute ‘ ce ’ to p nets with upstream p nets having possibility attribute ‘ ce ’ and with possibility attributes which have not been assigned in any of the previous steps ( i ) through ( xii ); xv ) assign possibility attribute ‘ cd ’ to p nets with upstream p nets having possibility attribute ‘ cd ’ and with possibility attributes which have not been assigned in any of the previous steps ( i ) through ( xiv ); xvi ) assign possibility attribute ‘ c ’ to p nets having a value attribute of ‘ 0 & amp ; 1 ’ and with possibility attributes which have not been assigned in any of the previous steps ( i ) through ( xv ); xvii ) assign possibility attribute ‘ y ’ to any p nets whose possibility attributes have not been assigned in any of the previous steps ( i ) through ( xvi ). b ) net attributes of d nets are assigned according to the following procedure ; i ) assign difficulty attribute ‘ 0 ’ to any d nets having paths which can reach primary or pseudo primary outputs without intersecting any other c / e / d net paths at gates and if all passivating p nets if any , along the paths have possibility attribute “ y ”; ii ) assign difficulty attribute to any d nets having paths which can reach primary or pseudo primary outputs without intersecting any other c / e / d paths at gates and at least one of said d net &# 39 ; s passivated p nets has possibility attribute ‘ cd ’ but none having possibility attribute ‘ ce ’; iii ) assign difficulty attribute ‘ 2 ’ to any d nets having paths which can reach primary or pseudo primary outputs without intersecting any c / e / d paths at gates and at least one of said d net &# 39 ; s passivated p nets has possibility attribute ‘ ce ’; iv ) assign difficulty attribute ‘ 3 ’ to any d nets having paths which can reach primary or pseudo primary outputs without intersecting any c / e / d paths at gates and at least one of said d net &# 39 ; s passivated p nets has possibility attribute ‘ n ’; v ) assign difficulty attribute ‘ 4 ’ to any d nets having paths which intersect with other d net paths at gates , but do not intersect with c or e nets at gates ; vi ) assign difficulty attribute ‘ 5 ’ to any d nets having paths which intersect with other c ′ or e net paths at gates . a ) convert d nets with difficulty attribute of ‘ 5 ’ into e nets ; b ) re - assign net attributes according to the procedures for assigning net attributes ; c ) repeat steps a ) and b ) until there are no remaining d nets with difficulty attribute of ‘ 5 ’; d ) for any stem at which the input is a c or e net and some outputs are d nets , among which there is at least one d net path with difficulty attribute ‘ 0 ’, do the following conversion : i . convert the d net path that least intersects with p nets among , the paths of d nets having a difficulty attribute of ‘ 0 ’ into e net path ; ii . convert all d net paths at the stem output with a difficulty attribute of ‘ 4 ’ into p nets ; iii . convert all other d net paths at the stem output along with said d nets &# 39 ; passivated p net paths into x net paths ; e ) re - assign net attributes as described in the procedures for assigning net attributes ; f ) repeat steps d ) and e ) until there are no remaining d net paths with a difficulty attribute of ‘ 0 ’; g ) for any stem at which the input is a c or e net and some outputs are d nets among which at least one d net path has difficulty attribute value of ‘ 1 ’, do the following conversion : i . convert the d net path that least intersects with p nets among the difficulty attribute ‘ 1 ’ d net paths into an e net path ; ii . convert all d net paths at the stem output with a difficulty attribute of ‘ 4 ’ into p nets , iii . convert all other d net paths at the stem output along with said d nets &# 39 ; passivated p net paths into x net paths ; h ) re - assign net attributes as described in the procedures for assigning net attributes ; i ) repeat steps d ) through h ) until all d net paths have difficulty attributes larger than 1 ; j ) for any stem at which the input is a c or e net and some outputs are d nets among which there are at least one d net path with a difficulty attribute of ‘ 2 ’, do the following conversion : i . convert the d net path that least intersects with p nets among the paths of d nets having a difficulty attribute of ‘ 2 ’ into an e net path ; ii . convert all d net paths at the stem output having a difficulty attribute of ‘ 4 ’ into p nets ; iii . convert all other d net paths at the stem output along with said d nets &# 39 ; passivated p net paths into x net paths ; k ) re - assign net attributes as described in the procedures for assigning net attributes ; l ) repeat steps d ) through k ) until all d net paths have difficulty attributes larger than 2 ; m ) for any stem at which the input is a c or e net and some outputs are d nets among which at least one d net path has a difficulty attribute value of ‘ 3 ’, do the following conversion : i . convert the d net path that least intersects with p nets among the paths of d nets having difficulty attribute ‘ 3 ’ into an e net path ; ii . convert all difficulty attribute ‘ 4 ’ d net paths at the stem output into p nets ; iii . convert all other d net paths at the stem output along with said d nets &# 39 ; passivated p net paths into x net paths ; n ) re - assign net attributes as described in the procedures of assigning net attributes ; o ) repeat steps d ) through n ) until all d net paths have difficulty attributes larger than 3 ; p ) convert all remaining d nets into e nets ; q ) re - assign net attributes as described in the procedures for assigning net attributes ; r ) for any gate at which all inputs are p nets and the output is c or e net , if there is at least one input p net having possibility attribute ‘ y ’, choose the p net path that intersects the least number of other p net paths among the possibility attribute ‘ y ’ p net paths and convert it into e net path ; s ) re - assign net attributes as described in the procedures for assigning net attributes ; t ) convert all p nets that have possibility attribute other than ‘ y ’ into e nets . performance of the above extraction algorithm results in extracting a reduced - size combinational “ subset ” circuit from the original circuit comprising only core and extended nets . fault diagnosis can thereafter be performed on the extracted “ subset ” circuit in a more timely and accurate manner than diagnosing the entire original circuit . a development or production engineer can therefore analyze results of said fault diagnosis and determine corrective actions needed , if any , to either the design of the circuit and / or a production process utilized in fabricating the circuit . although preferred embodiments of the invention have been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the embodiments disclosed , but is capable of numerous rearrangements , modifications , and substitutions of parts and elements without departing from the spirit of the invention . | 6 |
with reference first to fig1 a fastener system 9 secures an object 24 such as a railroad rail fastener ( known as a &# 34 ; direct fixation &# 34 ; or &# 34 ; d . f .&# 34 ; fastener ) to concrete structure 14 such as a cast concrete railroad tie . the fastener system includes a shaft 10 having a first end 16 provided with left - hand cut threads 16a . a second end 18 of the shaft has right - hand rolled threads 18a , and forms an external portion of the fastener that receives a nut 20 . the nut 20 is a cap nut having a blind hole 21 terminating at an interior end surface 21a . a collapsible pellet 22 , made , for example , of neoprene , is interposed between the top of the shaft end 18 and the nut interior end surface 21a . this fastener system also includes a metal washer 26 and a die - cut washer 28 ( which may be e . g ., polyurethane ), both of which are interposed between the nut 20 and the d . f . rail fastener 24 . a sleeve 34 has a deformable head or collar 34 &# 39 ; adjacent to the nut 20 and a cylindrical body 34 &# 34 ; that extends down far enough into a hole 12 to embed in a hardening securing agent 32 filling the hole . deformable headed sleeves suitable for this use are available under the trademark nyltite . the fastener system also includes a polyethylene end cap 36 which serves to electrically insulate the shaft 10 from the hole interior if the shaft is inserted at an angle from the vertical that would ordinarily bring the end of the shaft into contact with the side of the hole or if the hole is short enough to bring the bottom of the shaft 11 into contact with the hole bottom . in this event , the end cap also serves as a moisture barrier between the shaft and the hole wall . the hole 12 may be one of a number of holes in the concrete railroad tie 14 or other concrete structure . the holes can be drilled at the site , using the d . f . fastener 24 as a template . alternatively , the holes can be provided in the tie 14 at the time of its manufacture . the securing agent 32 contemplated is a two - part cement consisting of a viscous , liquid , peroxide - cured resinous material and a peroxide curing agent formed as a flowable powder , easily measured to the appropriate predetermined amount to permit simplified mixing in the field of the correct proportions of the curing agent and the liquid hardenable resinous cement . suitable two - part resinous cements commercially available are &# 34 ; mastico adhesive &# 34 ; from a & amp ; p foglia , 14 hickory dr ., east brunswick , n . j . and &# 34 ; kelibond &# 34 ; from kelken - gold inc ., p . 0 . box 336t , hazlet , n . j . a release agent 30 , not apparent in fig1 coats the threads 16a of the lower end of the shaft 10 . the release agent 30 may include any of a wide range of commercially available waxes or greases . preferably , the release agent 30 includes teflon dispersed throughout any suitable grease or grease - like lubricant that is of suitable consistency to coat the cut threads 16a . in use in the field , the first end 16 of the shaft 10 is dipped into the release agent 30 to coat the threads 16a . the cement and powdered curing agent are stirred together in the correct proportions , and poured into the hole 12 . the first end 16 and the sleeve 34 are then inserted through the washers and the d . f . fastener 24 into the hole 12 filled with the securing agent 32 and the securing agent hardens . by hardening about the cut threads 16a of the first end 16 , the securing agent 32 forms female threads conforming to the cut threads 16a of the first end 16 . the sleeve 34 and the hardened agent 32 keep surface water and moisture from reaching the threaded member . the nut 20 is hand - wrench tightened , causing the collapsible pellet 22 to collapse to a predetermined thickness , and the collar 34 &# 39 ; of the nylon sleeve 34 to deform and flow tightly around the shaft and into the washer hole , effecting a water tight seal at that location . the die cut washer also compresses by about 50 %, further enhancing the water tight seal . because it is thus made water tight , the fastener system is highly resistant to corrosion . resistance of the pellet 22 to further collapse gives the workman sufficient resistance to further tightening to cause him to cease turning down the nut . if the shaft 10 must be removed from the hole 12 , the nut 20 need simply be turned , albeit with considerably more force , in the same direction as caused the tightening of the nut 20 . a standard rotation impact wrench may be used to this end . this further turning causes the cap nut 20 , the pellet 22 , and the upper end 18 of the threaded member to bind together . the left - hand cut threads 16a unscrew from the hardened securing agent 32 owing to the release properties of the release agent 30 . as shown in fig1 a , instead of coating the cut threads 16a with a release agent 30 and providing a separate polyethylene insulating end cap 36 , the present invention also contemplates dipping the cut threaded shaft end 16 in an insulating plastic or vinyl based dip , such as is used to coat the handles of pliers , wire cutters , etc . one such product is commercially available under the trade name plasti - dip . to the commercially available dip is added teflon to impart the same release properties as described above , while at the same time providing an insulating covering 30a . in this case , when the elongate threaded member 10 is removed , the covering 30a remains . enlarging the diameter of the bottom of a hole in which the fastener shaft is to be embedded greatly increases the holding strength of the resin - bonded fasteners of the present invention . the enlarged diameter areas may be formed at the time concrete is cast or , alternatively , may be opened up in an already drilled hole . fig2 illustrates a method of forming such enlarged holes when casting the structure that forms the surface to which an object is to be secured . a concrete railroad tie 114 has cast in place therein elongate mold parts 140 ( one of which is shown ). in this case , the part 140 is a teflon sleeve of a predetermined diameter , which is inserted into a frusto - conically shaped hollow cup or foot 142 of , for example , polyethylene . the mold parts 140 may be of another material that will enable them to be released from the hardened concrete or they too can be coated with a suitable release agent . the diameter of the parts 140 should be slightly greater than the diameter of the fastener shaft later to be inserted . concrete is poured into a mold and around the parts 140 . once the cast concrete has hardened , the parts 140 are removed from the tie 114 , leaving the polyethylene feet 142 behind . the result is a cast tie having preformed holes with enlarged diameters at their base . a fastener shaft , such as that illustrated in fig1 may thereafter be inserted into the hole along with the securing agent , as has been described above . instead of molding holes in new cast structure according to the foregoing method illustrated in fig2 the base of an already existing or freshly drilled hole may be enlarged , as illustrated in fig3 by a long , narrow , bit 146 with a carbide tip 147 using a conventional drill 150 having a hammer mode . angled into the hole and worked around the bottom of its side walls , the bit 146 will break out a large diameter hole at the bottom of a preexisting hole 112 . the bit 146 is narrow in comparison to the diameter of the hole 112 , less than one half of the width of the hole . this enables the bit to be inclined sufficiently to work on and chip away the sides of the hole at the hole bottom . an adapter 148 may be required where the bit 146 has an end tapered or otherwise unacceptable to the jaws of the chuck of the drill . preferably , the hole is blown free of debris . whether molded initially or subsequently enlarged . this undercutting of the hole bottom side walls permits the hardening agent described above to fill in below hole side walls that are above and radially inward of the enlarged hole portion . the formed in situ anchor that the hardening agent forms is virtually impossible to withdraw without destroying the concrete structure above . the hardness and strength of the hardening agents specifically mentioned above are such that fastening systems used with holes formed in this manner consistently exceeded all expectations in resisting pull out . fig4 a - 4e , shows another method for forming a fastener system in which the holes to receive the threaded fastener shafts are formed during casting . in fig4 a , a concrete form 150 or a mold for a particular cast item supports one or more bolts 152 having a fixed head 154 and cut or rolled threads 155 on its shaft 156 . each bolt 152 has a diameter slightly larger than the threaded shaft of a fastener that will ultimately be used to secure an object to the structure being cast . the lower end of the bolt 152 has press fit thereon a wide bottomed polyethylene ( or other suitable material ) cup 158 . the bolt also has been coated with a release agent , such as described above . after the concrete has been poured into the form 50 and has hardened , the bolt 152 is backed out , leaving a hole 162 ( fig4 b ). the bolt leaves behind the cup 158 . this serves as an enlarged bottom for the hole . a secured object 163 is correctly located . the hole 162 is filled with a hardening mixture 165 ( fig4 c ), such as the two - part securing agent described above , and a slightly smaller bolt 170 is inserted into the hole and embedded in the securing agent ( fig4 d ). once the securing agent has hardened , the bolt 170 may be removed if it has been coated with release agent as described above . the bolt 170 has a fixed head 171 . to permit further tightening , the end of a threaded shaft 173 of the bolt has an end cap 174 , e . g ., a press - fit polyethylene cup . this defines a void under the bolt . the cup 174 may contain a compressible form or pellet 177 , of , e . g ., neoprene , foam , or the like . the bolt 170 is inserted into the hardening agent filled hole until the cup 174 hits bottom . the form or pellet 177 prevents collapse of the cup . referring to fig4 e , once the securing agent has hardened , the bolt may be turned and threaded deeper into the hole for further tightening . the void formed by the cup 174 below the bolt permits this . the cup 174 and the compressible pellet 177 collapse as the head 171 of the bolt tighten down to secure the object 163 . in other words , the cup 174 has prevented the hardening agent from filling in under the bolt to prevent its being further threaded downwardly into the hole . in fig5 a mold part 252 forms a series of holes in the particular surface to which an object is to be secured . the holes are formed in a desired spaced relation relative to one another dictated by the holes in the particular object that will ultimately be secured . the mold part 252 includes a top plate 254 having a series of dowel - like rods 240 , secured thereto , for example , by screws 256 . the rods 240 have diameters greater than the threaded fastener shafts ultimately to be embedded in the holes formed thereby . feet 242 , of polyethylene or the like and similar to those described above , form enlarged diameter areas at the bottoms of the holes . when , as in fig6 a , the concrete has been poured into a form or mold 260 , and has hardened about the rods 240 , the mold part 252 is removed , leaving the desired number of enlarged bottom holes in their appropriate locations . the end caps 242 remain behind . the holes thus formed are thereafter filled with a hardening securing agent and have a threaded fastener shaft embedded therein as described above . the rods 240 may also be a series of the bolts illustrated in fig4 a - 4e coated with a release agent , and having slightly larger diameters than the fastener shafts ultimately to be embedded . in that case , these bolts would need to be backed out of the holes . however , if smooth rods 240 are used to form the holes in a cast surface , it is preferable to roughen with a wire brush 6b the inner walls of the holes formed . this presents a roughened surface to the securing agent and provides a stronger bond of the securing agent to the inner wall of the hole . an alternative arrangement of the parts of the fastener of this invention appears in fig7 . there , a bolt 300 has a fixed head 302 , and a two part shaft 305 . the lower half 307 of the shaft has a threaded exterior 308 . the upper half 310 has a smooth exterior 311 . this is coated with a release agent as described . a smaller diameter projection 314 at the bottom of the upper half 310 of the shaft 305 is threaded externally to be threaded into an internally threaded bore 315 in the upper end of the lower half 307 of the shaft . when inserted into a hole filled with securing agent as described above , the lower half &# 39 ; s threaded exterior 308 provides a good grip to the hardened securing agent . the release agent coated upper part 311 of the shaft , however , easily withdraws from the hole by unthreading the projection 314 from the bore 307 and then sliding the upper portion out of the hole . this fastener may , if desired , also be fitted with a cup and pellet as in fig4 d and 4e to permit further tightening by screwing of both shaft parts farther into the hole after the securing agent cures , in which case both parts should be release agent coated . while preferred embodiments of the invention are described above , it will be appreciated by those skilled in the art that variations and modifications may be made thereto without departing from the spirit of the inventive concepts disclosed herein . all such variations and modifications are intended to fall within the scope of the appended claims . | 5 |
imrt ( intensity modulated radiation therapy ) is rapidly becoming a common treatment modality with a recent study claiming that it is used by a third of the radiation oncologists in the united states . the modern treatment machines are designed with dynamic mlc and imrt - ready systems integrated into them but many of the current linear accelerators still used today , have the mlc as an add - on . in either case the linear accelerator is designed such that imrt treatments and standard treatments can be carried out on the same unit . the conventional 3d conformal therapy treatment requires a flat beam because generally dose compensation to achieve uniformity within target volume for each individual beam is not performed . however , in generating imrt treatment plans , the planner ends up with a non - uniform density matrix to deliver the desired dose with the target volume , and spare the surrounding normal or critical structures . to achieve this goal , a flat beam is not required . modulation of beam during imrt planning and delivery is performed through segmented fields and many beam lets within the delivery port and in fact thinking out side of convention , one would see the advantages in having a cleaner beam that does not need to suffer all the scattering through a thick chunk of metal , namely the flattening filter . it is therefore , expected that removal of the flattening filter would lead to better imrt treatments due to the reduction in lateral photon scatter and the increase in central axis photon fluences . more specifically , by moving the flattening filter out of the path of the beam solely for imrt treatments , higher dose rates and sharper , more geometrically defined fields can be expected thus leading to better imrt plans and treatments . the deleterious properties of the flattening filter care caused by the increased lateral scatter and the decreased central axis fluence that the filter produces . in the special case of imrt , where fluence is varied by a combination of mlc movements and beam modulation at the patient level , the filter is no longer required . this has been shown for the specific case of tomotherapy ; a dedicated imrt system . here we show monte carlo simulations of radiation characteristics for the more general case of a linear accelerator . preferably , the higher dose rates are x - rays ranging from 4 mv to 25 mv . monte carlo simulations were carried out using the beamnrc code . using an elektra precise model sl - 25 photon beams of 6 mv and 10 mv energies were initially modeled and commissioned by comparing the simulations to data measured using a welhofer ( scanditronix wellhofer ) scanning water phantom . in the models the head of the accelerator was broken down into component modules , namely the target , primary collimator , flattening filter , monitor chamber , mirror , mlc and x and y jaws . an additional component was used to simulate the air gap between the exit of the accelerator and the water phantom surface , where the phase space plane was located . the energy cutoffs for transport were set as ecut = 0 . 7 mev , pcut - 0 . 01 mev and global electron cut - off - 2 . 0 mev . electron range rejection and selective bremsstahlung splitting were used , with sbs parameters nmin = 10 nd nmax = 100 . russian roulette and photon forcing were not employed . the phase space file created at the plane 100 cm from the source was then used as the input for the phantom , simulated using the dosxyzarc code . 400 × 10 6 histories were used for the simulation of the accelerator . for the dosxyz phantom , 200 × 10 6 histories were used for all field sizes , resulting in adequate statistics for the larger field sizes . both depth dose and transverse profiles depend greatly on the properties of the electron beam as it strikes the photon target . the parameters of importance are the mean electron energy , the energy spread and the spatial distribution of the beam . for the 6 mv and 10 mv beams respectively , the electron energy used was 6 . 50 mev and 9 . 50 mev , the energy spread was 1 . 0 mev and 0 . 8 mev fwhm and the radial distribution was 0 . 11 cm and 0 . 10 cm fwhm . depth dose curves obtained from these simulations deviated less than 1 % in the region of dose - maximum and less than 5 % at all other depths , when compared to water phantom measurements . once the monte carlo simulation was found to match the measured data to adequate levels , the flattening filters were removed from both of the 6 mv and 10 mv beam models . all other parameters remained unchanged . all measurements were made at 100 cm ssd in a welhofer scanning water phantom , with a 0 . 1 cc ionization chamber . both 6 mv and 10 mv beams were studied for comparison with the monte carlo simulations . after the monte carlo model commissioning data was obtained the 6 mv and 10 mv flattening filters were removed from the primary rotating carousel in the head of the accelerator . this left a hole in the carousel which the photon beam could pass through . depth - ionization profiles , transverse inline ( gun - target direction ) and cross - plane profiles were measured at d max and 10 cm . depth dose profiles were measured to a depth of 30 cm and normalized to the maximum chamber reading on the central axis . transverse profiles were measured in the inline and cross - plane directions for field sizes ranging from 5 × 5 to 30 × 30 cm 2 . these profiles were also normalized to the maximum chamber reading on the central axis . as mentioned , monte carlo simulations of the standard , flattened 6mv and 10mv beams where carried and they matched well with the measured data obtained with the scanning water phantom . the purpose of these measurements was to show that the monte carlo models accurately match the measurements of dose performed in the water phantom . fig1 ( a ) and 1 ( b ) show monte carlo and water phantom measurements of the cax percent depth - dose for 6 mv and 10 mv . central axis percent depth - dose profiles for a 10 × 10 cm 2 field at 100 cm ssd are shown for 6 mv and 10 mv , with the experimental measurements shown as solid points and the monte carlo model shown as hollow points . transverse profiles of a 30 × 30 cm 2 field were also obtained for comparison of the flatness and symmetry of the monte carlo models with respect to the measured data . fig2 ( a ) and 2 ( b ) show 6 mv and 10 mv monte carlo calculated transverse profiles for the inline direction at depths of d max and 10 cm , compared to the measured data . a good agreement between measured and monte carlo modeled data was found in all cases . fig3 shows a comparison between monte carlo and measured data for a 6 mv 10 × 10 cm2 beam . the top two curves are for a depth of 1 . 6 cm ( d max ) and the bottom two curves are for a depth of 10 cm . simulations were then carried out without the filter and compared to data measured after the flattening filters had been removed from the primary filter carousel of the elekta accelerator . the purpose of these measurements was to verify the accuracy of the monte carlo models to accurately simulate a beam without the flattening filter . a comparison for the cross - plane profiles is shown in fig3 . not shown are the comparisons between the inline ( gun - target ) direction measured and monte carlo profiles . these measured transverse profiles had poor symmetry and this was believed to be due to difficulties of steering the beam after removal of the flattening filter . it can be concluded from fig3 that the monte carlo models of filter free 6 mv and 10 mv beams were shown to accurately match the measured data . simulations were then carried out for various field sizes ranging from 2 × 2 cm 2 to 30 × 30 cm 2 . the graph below shows the transverse profiles obtained at 1 . 6 cm depth for a 6 mv beam without a flattening filter . the curves in fig4 are all normalized to the cax dose of the 10 × 10 cm 2 field . fig4 shows monte carlo computed transverse cross - plane profiles at a depth of 1 . 6 cm for a 6 mv filter free photon beam of field size ranging from 2 × 2 to 30 × 30 cm 2 . the next step was to compare the monte carlo models of the flattened and unflattened beams . fig5 shows monte carlo calculated transverse profiles and the effect on the central axis ( cax ) dose of removing the flattening filter . it was found that for the 6 mv photon beam of 10 × 10 cm 2 field size the cax dose was increased by a factor of 2 . 35 with the filter removed , compared to the standard flattened beam . this figure also shows the cax dose was increased by a factor of 2 . 35 with the filter removed , compared to the standard flattened beam . this figure also shows the cax dose for a 10 × 10 cm 2 10 mv beam with and without the flattening filter . in this case , since the 10 mv flattening filter for the elekta is more substantial in terms of mass of material used the cax dose without the filter is 4 . 18 times higher than the standard flattened beam . fig5 ( a ) and 5 ( b ) show a comparison between monte carlo simulations for a standard , flattened and an unflattened 6 mv and 10 mv 10 × 10 cm 2 beam at d max . all profiles are normalized to the central axis dose of the standard beam to show the effect on the cax dose of removing the flattening filter . the flatness of each transverse profile was calculated using the variation over the mean at 80 % of the field size , with the equation , for the 6 mv simulation of a 10 × 10 cm 2 beam , the flatness at d max was 2 . 37 % and 6 . 21 % for the flattened ad unflattened beam , respectively . similarly , at 10 cm depth the equivalent percentages were 1 . 88 % and 5 . 77 %. for the 10 mv simulations , flatness percentages of 3 . 96 % and 7 . 71 % were obtained at depths of 2 . 3 cm ( d max ) and 10 cm for the standard and unflattened beam , respectively . at 10 cm depth flatness was calculated to be 2 . 92 % for the flattened beam and 8 . 39 % for the unflattened beam . fig6 ( a ) and 6 ( b ) show monte carlo percent depth - dose curves comparing the standard flattened 6 mv and 10 mv beams to the equivalent filter - free beams . the faster decrease in dose with depth for the filter - free beam is consistent with a softer central axis beam . depth dose curves on the central axis were also obtained from simulations of the flattened and unflattened 10 × 10 cm2 6 mv and 10 mv beams . the dose deposited at depths greater than d max was found to decrease more rapidly with the filter removed . this is due to the fact that , with the filter removed the beam in the region of the central axis is no longer hardened by the filter . the faster decrease in dose with depth is consistent with a softer central axis beam . to investigate the effect of the flattening filter on the photon energy spectrum an analysis of various phase space files with the program beamdp was performed . photon fluence as a function of photon energy was graphed for the filter free beams versus the standard beams . as expected , the photon fluence per unit energy is significantly greater for the filter free beam , especially in the region of the peak photon energy . fig7 ( a ) and 7 ( b ) show photon fluences spectra for a 6 mv beam and a 10 mv beam showing the effect of removing the photon flattening filter . fig7 shows the photon fluence spectra across a 10 × 10 cm 2 field for both the 6 mv and the 10 mv beam . in both cases the peak photon energy is increased by removing the flattening filter , showing that the flattening filter has the effect of hardening the beam . for the 6 mv beam the peak energy with and without the flattening filter are 0 . 48 mv and 0 . 33 mev respectively . similarly , for the case of the 10 mv beam , where the design of the flattening filter leads to a greater beam hardening effect , the peak photo energies are 1 . 13 mev and 0 . 33 mev for the standard beam and the filter free beam . with the flattening filter removed , one would expect the amount of lateral photon scatter to decrease , the effect being that the dose at a point outside the field would be reduced . to investigate this effect a comparison between the relative dose at and beyond the edge of the radiation field was made between simulations made of a 6 mv beam with and without the flattening filter . simulations were run for a 6 mv beam for various field sizes ranging from 2 × 2 cm 2 to 30 × 30 cm 2 . in all cases the dose at the edge of the field was greater for the filter - free beam . in fig8 below , 2 × 2 cm 2 , 10 × 10 cm 2 and 30 × 30 cm 2 fields are shown for a flattened and filter - free 6 mv beam . it can be seen that , in the wings of the profile the relative dose for the filter - free beam is greater than that of the standard field in all cases . the profiles below are at a depth of 1 . 6 cm . the same profiles at a depth of 10 cm showed the same effect ; the out of field dose being higher for the filter free beam . fig8 is a comparison of absolute dose obtained from simulations of 2 × 2 , 10 × 10 and 30 × 30 cm 2 fields . the simulations shown here were for a 6 mv beam at a depth of 1 . 6 cm . for each field size a profile of the flattened beam and the unflattened beam are shown so that the dose at the edges of the radiation field can be compared . it can be seen that for all field sizes the dose at the edge of the field is greater for the filter - free beam . to quantify the out of field dose were considered a point 2 cm outside of the field ( e . g . at an off axis distance of 3 cm for a 2 × 2 cm 2 field ) and took the average of the relative doses for the voxels to the right and left of the central axis . the table below shows the relative dose ( the normalization is with respect to the cax dose for the standard , flattened beam for that field size ) at a point 2 cm outside the radiation field , for both the flattened and unflattened 6 mv beams . all profiles considered here are at a depth of maximum dose . table 1 . shows a comparison of out of field relative dose for various field sizes . for each field size the relative doses is given at a point outside or on the edge of the radiation field . with flattening filter removed , the photon beams will not suffer the remarkable scattering that they will go through otherwise , resulting in a much cleaner beam at the patient &# 39 ; s level . the conventional treatments requiring a flat photon beam are not necessary for imrt treatments as the beams are modulated to achieve dose uniformity within the target volume . in fact the fluence maps as generated from a beam end up being very nonuniform for imrt cases . the substantial increase in dose rate from a flattening filter free accelerator is significant in delivering a less contaminated beam at much shorter times . the computed depth dose plots for both 6 and 10 mv photon beams indicate that by removing the flattening filter out of the beam , better dose fall off beyond depth of maximum dose is achieved . on the other hand , because of a less hardened beam , the point of maximum dose ate depth will get closer to the surface ( 1 - 2 mm for 6 ×, and 2 - 3 mm for 10 ×). the out of field dose is a phenomenon that requires further study and will be discussed in detail in future works , but the measured and computed dose profiles in treatment fields indicate less scatter , significantly higher photon fluence , and overall a cleaner beam to be used for the imrt treatment . the better fall - off of the dose beyond depth of maximum dose in a flattening free accelerator is also another indication to cleaner beams when filter is removed . the quantities of scatter and lower energy photons contributing to dose depth is directly proportional to the energy of the beam and is considerable for clinical photon beams . specific compositions , methods , or embodiments discussed are intended to be only illustrative of the invention disclosed by this specification . variation on these compositions , methods or embodiments are readily apparent to a person of skill in the art based upon the teachings of this specification and are therefore intended to be included as part of the inventions disclosed herein . the above detailed description of the present invention is given for explanatory purposes . it will be apparent to those skilled in the art that numerous changes and modifications can be made without departing from the scope of the invention . accordingly , the whole of the foregoing description is to be construed in an illustrative and not a limitative sense , the scope of the invention being defined solely by the appended claims . | 6 |
fig1 illustrates a cross section through a highly integrated electrical module him according to an aspect of the invention . a layer construction or baw resonator stack bs is arranged on the surface of a substrate su . the layer construction includes the electrodes and piezoelectric layers required for operation , and a filter circuit fi , like the one shown in fig4 a or 4 b , which includes one or more baw resonators . the module him also includes a balun circuit bu , like the one shown in fig5 a or 5 b , electrically connected in series with the filter circuit fi , such as shown in fig2 a or 2 b . a capacitive element ke of the balun circuit bu is arranged alongside the baw resonator stack bs on the surface of the substrate su ; electrodes as metallization areas can be arranged in a plurality of layers . the cover de is arranged in a manner spaced apart from the substrate by means of spacers ah in such a way that the substrate su , the cover de and the spacers ah effect a hermetic encapsulation of the interior of the highly integrated module . an inductive element ie of the balun circuit bu , which can consist of structured metallization lines such as shown in fig3 , is arranged on the underside of the cover de . contact areas kf are arranged on the surface of the substrate su , which contact areas are electrically connected to the capacitive element ke of the balun circuit bu and the baw resonator stack bs , on the one hand , and by means of bump connections bv to structured metallization — e . g . of the inductive element ie — on the underside of the cover de , on the other hand . fig2 a illustrates a possible order of the interconnection of a filter circuit fi of the layer construction bs and a balun circuit bu of the module him : both the input p 1 and the output p 2 of the filter circuit fi are embodied symmetrically . the transmission of rf signals from the filter circuit fi to the balun circuit bu is correspondingly embodied symmetrically . such an arrangement can be used in a transmission path if the balun circuit bu is electrically connected between the filter circuit fi and an antenna ( not illustrated ). by contrast , fig2 b illustrates an alternate interconnection of the filter circuit fi and the balun circuit bu , where both the input p 1 and the output p 2 of the filter circuit fi are configured asymmetrically , and the signal line between the filter circuit fi and the balun circuit bu is correspondingly configured asymmetrically . such an interconnection can be used in a reception path if , e . g ., the filter circuit fi is electrically connected between an antenna ( not shown ) and the balun circuit bu . fig3 illustrates how interdigital structures ids of the balun circuit bu can be arranged in an interlocking finger configuration on the underside of the cover de in order to realize a balun functionality , for example . these interdigital structures ids can correspond to the inductive element ie of the balun circuit bu , for example . fig4 a illustrates an interconnection of resonators in a ladder - type arrangement ld of the filter circuit fi . in this example , three series resonators sr are connected in series and a respective parallel resonator pr in a parallel path connects the signal path sp to ground m . fig4 b illustrates an alternate configuration of the filter circuit fi , which is composed of resonators r arranged in a lattice - type structure lt . in contrast to the filter circuit ld in fig4 a , which is embodied in an unbalanced fashion , the filter circuit lt in fig4 b is embodied in balanced fashion . the lattice - type structure lt can comprise coupled resonators gr which have been deposited e . g . in an scf ( stack crystal filter ) arrangement on the substrate su . the balun functionality , however , is realized by means of the balun circuit provided for this purpose . therefore , the coupled resonators gr do not have to be optimized with regard to a balun functionality . therefore , their quality factor is not reduced by the fact that the resonators have to fulfill specifications with regard to a balun circuit bu . fig5 a illustrates an exemplary interconnection of capacitive elements ke and inductive elements ie which are electrically connected in a balun circuit bu with three paths . in a second path a capacitive element ke is connected in series , and an inductive element ie electrically connects the second path to ground m . in a third path an inductive element ie is connected in series , and a capacitive element ke electrically connects the third path to ground m . in this example , the second and third paths constitute the balanced signal port , while the first signal path , in which no passive element is electrically connected , constitutes the unbalanced port . fig5 b illustrates an alternate configuration of a balun circuit bu in which a resonator r is electrically connected in series in a first path , while an inductive element ie electrically connects the second path to ground m . in a third path an inductive element ie is electrically connected in series , while a resonator r electrically connects the third path to ground m . a highly integrated module according to aspects of the invention is not restricted to any of the exemplary embodiments described . combinations of the exemplary embodiments and variations which comprise e . g . further signal paths , further filter elements , further resonators or further inductive or capacitive elements likewise constitute exemplary embodiments according to the invention . | 7 |
with initial reference now directed to fig1 and 2 of the appended drawings , the inventions of the present invention comprise fittings or check valves which may be ideally employed in conjunction with those devices requiring periodic greasing and maintenance , particularly devices such as pump 40 employed in conjunction with a conventional pipeline 42 . pipeline 42 has been shown in diagrammatic form , and it will be realized that various pieces of support structure 41 will be necessary to elevate various portions of the pipeline over the terrain 43 . a worker 45 is illustrated performing maintenance on the pump , and in fig2 it will be noted that fitting apparatus 46 allowing input of grease through the pump 40 is usually employed . as best viewed in fig2 a , the fitting 50 , with its cap removed , includes a standard male , axially threaded coupling portion 48 . fitting 50 includes upper &# 34 ; button head &# 34 ; structure 52 engageable by conventional grease gun for inputting grease through the fitting 50 so as to periodically maintenance the pump 40 or other high pressure device being serviced . as explained previously herein , extremely high pressures are normally employed in conjunction with such grease fittings , because eventual wear of the fittings may necessitate the use of &# 34 ; bridging agents &# 34 ; to effectuate an appropriate seal . it is of the utmost importance that the apparatus such as fittings 46 , 50 be able to withstand extremely high pressure inputs , since proper greasing may require the delivery of input pressures in excess of fifteen thousand pounds per square inch . in a first mode of the present invention it is contemplated to provide the grease fitting , generally designated by the reference numeral 60 , which may be employed alone or in combination with other types of fittings . specifically , it is contemplated that the various fittings to be described hereinafter , such as fitting 60 , may replace fitting 50 of fig2 a , or fitting combinations 46 thereof . fitting 60 comprises an elongated , generally cylindrical rigid body , generally designated by the reference numeral 62 . the fitting 60 may be machined from 4140 billet stainless steel . as best viewed in fig4 the external appearance of the body 62 may be conventional , including lower threads 64 associated with the outlet 65 of the fitting , and upper threads 68 associated with the inlet of the fitting , which has been generally designated by the reference numeral 69 . a button head 70 is disclosed in association with inlet 69 , and an auxiliary internally threaded cap 72 ( not part of the invention ) may be assembled as indicated . it should be noted that conventional vent orifices 74 are associated with cap 72 ( fig5 ). manipulation of the fitting may be accomplished by grasping the nut portion 75 . the body of the fitting is generally tubular . it includes an elongated , central flow channel generally designated by the reference numeral 79 , which extends in fluid flow communication between the inlet passageway 82 and the outlet passageway 84 . the comparison of fig6 - 11 will reveal that the cross section of the inlet passageway 82 is circular . the cross section of the outlet passageway is also circular , and both passageways are preferably axially aligned . as best seen in fig6 a chamfered valve orifice 80 is disposed between the inlet passageway and the outlet passageway for selectively permitting high pressure grease inputted through the inlet passageway 82 to reach the larger diameter outlet portion 84 . a valve element 88 , preferably in the form of a rigid steel ball , may be moved into and out of contact with a valve seat 86 surrounding the valve orifice 80 . it will be apparent that the outlet passageway 84 , which is of a larger diameter than the inlet portion 82 , terminates in the chamfered valve orifice region 80 , forming the valve seat 86 . fig3 illustrates the blocking valve element 88 in the operational position moved away from the valve seat , which occurs in response to pressure input . fig5 illustrates the valve element 88 in its quiescent position , in contact with valve seat 86 blocking the inlet passageway 82 and orifice 80 . a biasing system preferably in the form of a coiled spring , has been generally designated by the reference numeral 90 . in fitting 60 , spring 90 is secured in the bottom of the flow channel , disposed within the outlet passageway . as will be explained hereinafter in conjunction with the discussion of fig1 through 16 , spring 90 is constrained by a box - like , generally cubical cage , generally designated by the reference numeral 94 . the cage substantially surrounds the spring 90 , and it is in fact biased upwardly ( as viewed in fig3 and 5 ) by the spring 90 , which is snugly received within its hollow interior 95 ( fig1 ). cage 94 includes a plurality of lower feet 97 and a plurality of relief orifices 98 in the form of slots defined about its lower periphery . these relief orifices establish fluid flow communication between the outside of the cage 94 and the interior 95 . the feet 97 extend downwardly , pointing towards a lower ring 100 . as viewed in fig3 maximum downward deflection of the valve element 88 against the cage 94 establishes contact with the upper rigid portion 101 of the ring 100 . however , an inner shelf 103 provided in the ring seats and retains spring 90 , in fluid flow from the outlet of the body 65 is effectuated through an output orifice 105 . a comparison of fig3 and 5 will also reveal that the cage 94 is disposed within the outlet passageway for axial movements therewithin , and it includes a somewhat circular depression 108 defined in its top 109 . ring 100 is press fitted into the bottom of the apparatus prior to formation of a travel limiting crimp 107 ( fig5 ) which maintains the ring in position . essentially the ring 100 forms a stop which limits cage travel , but it will be appreciated by those skilled in the art that the spring could be otherwise mounted against the crimp 107 such that the stop will result from metal to metal contact between the cage and other portions of the fitting . in embodiment 60 , the cross section of the cage 94 is substantially polygonal ; and preferably a generally cube like structure is employed . with additional references to fig1 - 16 , it will be seen that the cage interior 95 is generally circular , but that it has a box - like , preferably square outside periphery . although it is free to move axially up and down within the outlet passageway , passageway regions 111 are thus formed between the outside of the box - like cage 94 and the interior walls of the passageway 84 ( fig3 ). thus in operation when grease enters passageway 82 , it will deflect ball 88 away from valve seat 86 , and fluid flow will continue downwardly through the outlet passageway 84 , and fluid flow will continue through the regions 111 around the cage structure 94 . when fluid does flow , it will be forced through relief orifices 98 in the cage entering at least a portion of the cage interior 95 , and it will pass between adjacent spring windings , through the center of the spring , and out orifice 105 ( fig3 ). as will be appreciated by those skilled in the art , the cage may take on a variety of configurations . although illustrated having a square cross section ( fig1 , 15 ) in embodiment 60 will be apparent to those skilled in the art that a cage may take on any of a variety of generally polygonal cross sections . for example , it may be formed in a hexagonal or octagonal configuration , as long as the cage is free to slide within the passageway , and as long as passageways 111 ( fig8 ) are formed . in each case it is preferred that the generally castellated appearance of fig1 be preserved , and in the best mode feet 97 are disposed in the corners of the cage . it is important that some form of relief orifice 98 be defined in the cage , wherein fluids may flow from the exterior of the cage into the interior 95 . although the configuration of slots 98 are preferred , the apparatus will also function with circular orifice &# 39 ; s ( or other configurations ) as will hereinafter be described in conjunction with the &# 34 ; check valve &# 34 ; embodiment of fig2 through 28 . thus in the quiescent state the check valve 88 will abut the valve seat to close inlet passageway 82 . when an appropriate grease gun is coupled across the button head fitting , high pressure input through the chamfered valve orifice 80 will cause the ball 88 to be deflected downwardly against cage 94 , downwardly depressing the spring 90 . however , it will be apparent that spring deformation and compression will be controlled by the policing action of the cage 94 . specifically , it will be apparent that the spring cannot be fully compressed since travel of element 88 is limited by the cage 94 ( fig3 ). the spring windings 90 cannot be tightly compressed so as to form a cylinder . this &# 34 ; cylinderization &# 34 ; factor , often characteristic of known prior art devices , will be completely avoided since the spring cannot be compressed to that limit . turning now to fig1 - 24 , fitting 120 represents the best mode for a positive flow fitting presently known . the primary difference between embodiment 60 and embodiment 120 relates to the configuration of the cage structure . it should be appreciated that the body 122 of the fitting 120 will be virtually identical to the previously described structure . in addition , a conventional cap 72 may be employed , and the threaded regions and button head fitting portions , are all conventional and identical . an inlet passageway 124 is again separated from an outlet passageway 125 ( together comprising a flow channel ) by a valve seat , generally designated by the reference numeral 126 . a rigid spherical ball 128 may be moved in and out of contact with the valve seat by a lower coiled biasing spring generally designated by the reference numeral 130 . however , in this instance , the spring 130 directly contacts the valve ball 128 , and the ball may be yieldably deflected toward the cage into contact therewith . the cage member 134 is preferably of a circular profile ( fig1 ) and it is preferably threadably coupled to the body . however , cage 134 may be press fitted into the fitting , axial withdrawal being prevented by the crimp 133 . it will be apparent in fig1 that fluid flow through inlet passageway 124 , past the valve seat 126 , and around the ball 128 within outlet region 125 and into the interior 135 of the cage will be facilitated . grease can move between adjacent windings of spring 130 , and through its tubular interior , exiting from outlet orifice 137 . when in the quiescent state ( fig2 ) ball 128 will be forced against the valve seat as before . however , when the ball is deflected , downward movement thereof will be limited by contact with the upwardly projecting feet 144 . it will be noted that it is preferred in this embodiment that the body of the cage be substantially circular ( fig2 ) and the cage takes on a substantially castellated appearance . specifically , a plurality of relief orifices , preferably in the form of slots 146 , are defined between adjacent cage feet 144 . in this instance it is preferred that slots be employed for cage venting , since orifices merely defined in the side of the cage body ( as in the check valve embodiment of fig2 - 28 ) would not work . relief slots 146 thus ensure that grease traveling around the ball can be inputted into the cage interior from which passage is free through the middle of the unjammed spring . also , as best viewed in fig2 , limited grease passage through the cage slots 146 and through adjacent , uncompressed spring windings will be possible . again the spring 130 is concentrically disposed within the interior 135 of the cage , which is itself substantially circular in cross section . when pressure is released ( fig2 ) spring 130 will force ball 128 back into contact with the valve seat , and it will be apparent that spring deformation between compressed and uncompressed states will be avoided . specifically , because of the configuration disclosed , the opportunity for spring bending or twisting is obviated , and it will be impossible to compress the spring fully , since the ball will be stopped by contact with the cage feet 144 . even when the ball valve 128 is compressed against the cage by several thousand pounds of pressure , a blocking seal against the cage cannot be formed by the ball , since the relief slots 146 provide an effective bypass . the check valve embodiment 160 of the present invention is disclosed in fig2 - 27 . it should be appreciated by those skilled in the art that the check valve can take on a variety of configurations , and that therefore only one general configuration has been illustrated . the head 162 of the check valve includes internal threads 164 so that an appropriate fitting may be coupled to the internally threaded input end . again a valve seat is employed , and a preferably spherical check valve ball 161 may be moved into or out of contact with the seat . the check valve may employ a cage system as disclosed previously in conjunction with either fitting embodiment 60 or 120 . however , an axially slidable cage member 170 is illustrated , and it receives the upper portion of the coiled spring 166 which is secured within a lower sleeve 168 press fitted into the threaded outlet end 169 , circumscribing the outlet orifice 159 of the check valve . in this instance a circular cage relief orifice 167 is employed . in the quiescent state ball 161 will close the check valve by contact with the valve seat 163 . however , when the cage is forced downwardly a metal to metal contact with sleeve 168 will prevent over compression of the spring 166 . sleeve 168 is retained by a snap ring 165 . of course the configuration seen in fig1 , wherein the preferred cage construction is disclosed , may be employed in a check valve . it should also be appreciated by those skilled in the art that each of the fittings 60 or 120 may function as a check valve . correspondingly , the check valve 160 may function as a grease fitting , if for example a button head fitting is machined onto its body . each of the cage structures disclosed may be provided with slots , but in the axially slidable cage mode disclosed in fig3 and 26 , either a relief slot or other form of vent or orifice may be employed . also , it should be specifically appreciated that a fixed non axially movable cage structure such as that disclosed in fig1 and 20 may be substituted for the cage 170 of the check valve 160 . from the foregoing , it will be seen that this invention is one well adapted to obtain all the ends and objects herein set forth , together with other advantages which are inherent to the structure . it will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . as many possible embodiments may be made of the invention without departing from the scope thereof , it is to be understood that all matter herein set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense . | 8 |
as shown in fig1 , the process of this invention is carried out in an apparatus including a cstr ( equipped with a total condenser ) which connects to a reaction column equipped with a total condenser , and a distillation column . the reaction column can be separated into four zones , i . e ., from the bottom to top , ( 1 ) a cl 2 feed zone , ( 2 ) a reaction zone , ( 3 ) an organic feed zone and ( 4 ) a clean - up zone , as shown in fig1 . during the operation , the starting material ( 1240za and / or 1240zf ) is fed into the organic feed zone of the reaction column and flow downward via a liquid distributor , while an excess amount of cl 2 gas is fed into the cl 2 feed zone of the reaction column and flow upward via a gas distributor . downward flowing 1240za / 1240zf reacts with reversed flow of cl 2 gas in the reaction zone to produce 1 , 1 , 1 , 2 , 3 - pentachloropropane ( hcc - 240db ). un - reacted cl 2 moves further up and continues to react with 1240za / 1240zf in the vapor phase and / or in the liquid phase in the clean - up zone . excess cl 2 gas with organic vapor containing 1240za / 1240zf and 240db passes through the total condenser , where 1240za / 1240zf and 240db are condensed and returned back into the top of the reaction column as reflux . excess cl 2 is captured by a downstream scrubber . hcc - 240db produced in the reaction column moves downwards into the cstr and is dehydrochlorinated to hcc - 1230xa there by a dehydrochlorination catalyst ( such as fecl 3 ) at a controlled reaction temperature , residence time and fecl 3 / 240db ratio . hcl and the organic vapor containing mainly hcc - 240db and hcc - 1230xa produced in the cstr pass through the total condenser , where the organic vapor is condensed and returned back into the reactor and hcl is either captured as a byproduct or neutralized by a downstream scrubber . the crude hcc - 1230xa product is continuously discharged from the bottom of the cstr , with the fecl 3 catalyst removed by filtration , and fed into the distillation column , where the un - reacted intermediate hcc - 240db and other high boiling compounds are separated as heavies and hcc - 1230xa collected from the top of the column as the final product . a jacketed monel pipe ( namely , reaction column or pipe reactor ) with 1 - inch id and 28 - inch long is connected to a 1000 ml round - bottom glass flask via a rcv valve . the pipe reactor can be either heated by steam or cooled by cooling water via the jacket side to control the reaction temperature . the pipe reactor is packed with structured pfa packing ( 20 inches in length ), and equipped with a water - cooled total condenser . an organic feed line ( located at 16 inches above the bottom of the pipe reactor ) is connected to the 1240za supply container to feed the organic into the pipe reactor . two inches above the organic feed port , an organic recycle line with a liquid seal loop is connected to a 2000 ml glass receiver to maintain a maximum liquid level of 18 inches inside the pipe reactor . the 1000 ml round - bottom glass flask is equipped with an agitator ( namely , cstr ) and a water - cooled total condenser , and heated by an oil bath . at the start - up , after the pipe reactor is filled with about 240 g of 1240za (& gt ; 99 . 5 wt %), the pipe reactor is heated up to 80 ° c . by 30 # steam . cl 2 is fed into the pipe reactor via the cl 2 dispenser located at the bottom of the pipe reactor . when the pipe reactor temperature starts to rise , the steam supply to the pipe reactor jacket is switched to cooling water to control the pipe reactor temperature at 80 ± 5 ° c . the cl 2 feed rate is controlled via a mass flow meter so that a total of 139 g of cl 2 ( about 120 mol % of 1240za ) is fed into the pipe reactor in about 4 hours . thereafter , continuous 1240za and cl 2 feeds are started at flow rates of about 60 g / hr and about 12 std . l / hr for 1240za and cl 2 respectively . at the same time , the generated 240db in the pipe reactor is transferred into the cstr via rcv valve , with the transfer rate being controlled in such a way that the liquid level in the pipe reactor is stable ( indicated by a side tube installed between organic feed and recycle ports ). after 4 hours , the feeds to the pipe reactor and the transfer of 240db from the pipe reactor to cstr are stopped , and the cstr is agitated and heated to 120 ° c . after the cstr temperature reaches 120 ° c ., 3 . 5 g of anhydrous fecl 3 is added into the cstr via the fecl 3 loading port , which initiates the 4 hours of batching of the material in the cstr . after 4 hours , the cstr is well batched , and a continuous operation is resumed by restarting 1240za and cl 2 feeds into the pipe reactor , and 240db transfer from the pipe reactor to the cstr at previous rates . the crude product of 1230xa is continuously pumped off the cstr at a rate of about 74 g / hr and filtered for further purification . 1 . 7 - 2 . 2 g of anhydrous fecl 3 is added into the cstr every two hours to maintain the concentration of fecl 3 in the range of 1 . 0 - 1 . 2 wt % in the cstr . this example uses the same apparatus as described in example 1 . at the start - up , the pipe reactor is filled with about 280 g of 240db (& gt ; 99 wt %) and the cstr is filled with 350 g of 240db (& gt ; 99 wt %). the cstr is agitated and heated to 120 ° c . after the cstr temperature reaches 120 ° c ., 3 . 5 g of anhydrous fecl 3 is added into the cstr via the fecl 3 loading port , which initiates the 4 hours of batching of the material in the cstr . twenty minutes before the end of 4 hour batching , the pipe reactor is heated up to 80 ° c . by 30 # steam and ready for continuous operation . after 4 hours , the material in the cstr is well batched , the continuous operation begins by : initiating feeds to the pipe reactor at flow rates of about 60 g / hr and about 12 std . l / hr for 1240za and cl 2 , starting 240db transfer from the pipe reactor to the cstr at a rate that maintains the liquid level in the pipe reactor stable , and pumping off the crude 1230xa from the cstr at a rate of about 74 g / hr . during the operation , the temperature in the pipe reactor is maintained at 80 ± 5 ° c ., and the temperature in the cstr is maintained at 120 ± 2 ° c . the crude 1230xa product off the cstr is filtered for future purification . 1 . 7 - 2 . 2 g of anhydrous fecl 3 is added into the cstr every two hours to maintain the concentration of fecl 3 in the range of 1 . 0 - 1 . 2 wt % in the cstr . for the examples described herein , the liquid transferred from the pipe reactor into the cstr usually contains the following components : 1240za : 0 - 0 . 5 wt %, 1230xa : 1 . 0 - 2 . 0 wt %, 240db : 96 . 5 - 98 . 5 wt %, 230da / 230ab : 0 . 2 - 0 . 5 wt %, balanced with other impurities . the crude 1230xa product flow from the cstr contains the following components : 1230xa : 97 . 5 - 98 . 5 wt %, 240db : 0 . 5 - 1 . 0 wt %; 230da / 230ab : 0 . 2 - 0 . 5 wt %, 1230xa dimers : 0 . 1 - 0 . 5 wt %, balanced with other impurities . as used herein , the singular forms “ a ”, “ an ” and “ the ” include plural unless the context clearly dictates otherwise . moreover , when an amount , concentration , or other value or parameter is given as either a range , preferred range , or a list of upper preferable values and lower preferable values , this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value , regardless of whether ranges are separately disclosed . where a range of numerical values is recited herein , unless otherwise stated , the range is intended to include the endpoints thereof , and all integers and fractions within the range . it is not intended that the scope of the invention be limited to the specific values recited when defining a range . it should be understood that the foregoing description is only illustrative of the present invention . various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to embrace all such alternatives , modifications and variances that fall within the scope of the appended claims . | 2 |
a method for manufacturing circuit devices of the preferred embodiments will be described in detail with reference to fig1 through fig1 . a method for manufacturing circuit devices of the preferred embodiments comprises : a step for preparing a laminated plate by laminating a first conductive film 11 and a second conductive film 12 via a third conductive film 13 ; a step for forming a conductive wiring layer 11 a by etching the first conductive film 11 into a desirable pattern ; a step for removing the third conductive film 13 by use of said conductive film by use of the conductive wiring layer 11 a as a mask ; a step for covering front - surface portions of the second conductive film 12 exposed by removing the third conductive film 13 , end faces the conductive wiring layer 11 a and of the third conductive film 13 with an insulating layer 15 ; a step for partially exposing the conductive wiring layer 11 a by removing a part of the insulating layer 15 ; a step for fixedly fitting semiconductor elements onto the insulating layer and electrically connecting the semiconductor elements 19 with the conductive wiring layer 11 a ; a step for covering the semiconductor elements with a sealing resin layer ; a step for removing the second conductive film 12 to expose the third conductive film 13 on the rear surface ; and a step for forming external electrodes 24 at desirable positions of the third conductive film 13 . such respective steps will be described in the following . the first step of the preferred embodiments is , as shown in fig1 , for preparing a laminated plate 10 by laminating a thin , first conductive film 11 and a thick , second conductive film 12 via a third conductive film 13 . on the front surface of the laminated plate 10 , the first conductive film 11 is formed substantially throughout the whole area , and the second conductive film 12 is formed substantially throughout the whole area of the rear surface via a third conductive film 13 , as well . the first conductive film 11 and second conductive film 12 are , preferably , made of cu as a main material or are composed of a widely - known lead frame material . the first conductive film 11 , second conductive film 12 , and third conductive film 13 can be formed by a plating method , an evaporation method , or a sputtering method , or a metal foil formed by a rolling method or a plating method can be adhered to the same . moreover , as the first conductive film 11 and second conductive film 12 , al , fe , fe — ni , a widely - known lead frame material or the like can be employed . as the material of the third conductive film 13 , a material is employed which is not etched by an etchant used when the first conductive film 11 and second conductive film 12 are removed . in addition , since external electrodes 24 of solder or the like are formed on the rear surface of the third conductive film 13 , adhesion of the external electrodes 24 is also considered . concretely , a conductive film composed of gold , silver , and palladium can be employed as a material of the third conductive film 13 . the first conductive film is formed thin in thickness to form a fine pattern , and the thickness can be approximately 5 – 35 82 m . the second conductive pattern is formed thick to mechanically support the whole , and the thickness can be approximately 70 – 200 μm . the third conductive film 13 functions as a barrier layer when the first conductive film 11 and second conductive film 12 are etched , and can be formed with a thickness of approximately 1 – 10 μm . the preferred embodiments have an advantage that the second conductive film 12 is formed thicker than the first conductive film 11 . the first conductive film can be formed with a thickness of approximately 5 – 35 μm and is formed as thin as possible so that a fine pattern can be formed . the second conductive film 12 can be sufficient with a thickness of approximately 70 – 200 μm , and provision of supporting strength is regarded as important . accordingly , by forming the second conductive film 12 thick , flatness of the laminated plate 10 can be maintained , whereby workability in the following steps can be improved . furthermore , the second conductive film 12 is damaged through various steps . however , the thick , second conductive film 12 is to be removed in a later step , so that damage is prevented from remaining in a circuit device . in addition , since the sealing resin can be hardened while flatness is maintained , the rear surface of a package can also be flattened , and the external electrodes formed on the rear surface of the laminated plate can also be arranged flat . therefore , electrodes on a mounting substrate can be brought into contact with the electrodes on the rear surface of the laminated plate 10 , whereby a soldering failure can be prevented . next , a concrete manufacturing method for the aforementioned laminated plate 10 will be described . a laminated plate 10 can be manufactured by lamination by electroplating or by rolling and joining . when a laminated plate 10 is manufactured by electroplating , first , a second conductive film 12 is prepared . then , electrodes are provided on the rear surface of the second conductive film 12 , and a third conductive film is laminated by an electrolytic plating method . thereafter , similarly by an electrolytic plating method , a first conductive film is laminated on the third conductive film . when a laminated plate 10 is manufactured by rolling , a first conductive film 11 , a second conductive film 12 , and a third conductive film 13 which have been prepared in a plate shape are joined under pressure by a roll or the like . the second step of the preferred embodiments is , as shown in fig2 and fig3 , for forming a first conductive wiring layer 11 a by etching the first conductive film 11 into a desirable pattern . the first conductive film 11 is covered with a photoresist pr of a desirable pattern , and a conductive wiring layer 11 a to form bonding pads and wiring is formed by chemical etching . since the first conductive film 11 is made of cu as a main material , ferric chloride or cupric chloride is sufficient as an etchant . as a result of etching of the first conductive film 11 , the third conductive film 13 also comes into contact with the etchant , however , since the material for the third conductive film 13 is not etched by ferric chloride or cupric chloride , etching stops on the front surface of the third conductive film 13 . thus , since the first conductive film 11 has been formed with a thickness of approximately 5 – 35 μm , the first conductive wiring layer 11 can be formed into a fine pattern of 50 μm or less . in addition , as shown in fig3 , the resist pr is removed after the conductive wiring layer 11 a is formed . the preferred embodiments have an advantage that etching is stopped at the third conductive film 13 in a step for etching the first conductive film 11 . the first conductive film 11 to be etched in this step is formed mainly of cu , and ferric chloride or cupric chloride is used as an etchant to partially remove the cu . in contrast thereto , since the third conductive film 13 is formed of a conductive material which is not etched by ferric chloride or cupric chloride , etching stops at the front surface of the third conductive film 13 . as the material for the third conductive film 13 , gold , silver or palladium can be employed . the third step of the preferred embodiments is , as shown in fig4 , for removing the third conductive film 13 by use of the conductive wiring layer 11 a as a mask . the third conductive film 13 is selectively removed by use of , as a mask , the conductive wiring layer 11 a formed of the first conductive film 11 in the previous step . two methods can be employed for selectively removing the third conductive film 13 . a first method thereof is an etching method by use of a solution to remove only the third conductive film 13 . a second method thereof is a method for removing only the third conductive film 13 by electrolytic peeling . as the first method , a method for partially removing the third conductive film 13 by etching will be described . as an etchant used in this method , an etchant is employed which etches the third conductive film 13 and does not etch the conductive wiring layer 11 a or second conductive film 12 . for example , in a case where the conductive wiring layer 11 a and second conductive film 12 are formed of a material mainly of cu and the third conductive film 13 is an ag film , only the third conductive film 13 can be removed by using an iodine - based etchant . as a result of etching of the third conductive film 13 , the second conductive film 12 comes into contact with the iodine - based etchant , however , the second conductive film 12 made of , for example , cu is not etched by the iodine - based etchant . accordingly , etching herein performed stops at the front surface of the second conductive film 12 . therefore , the resist pr of fig2 can be removed after this step . as the second method , a method for removing only the third conductive film 13 by electrolytic peeling will be described . first , a solution containing metal ions is brought into contact with the third conductive film 13 . then , a positive electrode is provided in the solution , a negative electrode is provided on the laminated plate 10 , and a direct current is applied . thereby , only the third conductive film 13 is removed based on a principle reverse to that of plating film formation by an electrolytic method . the solution herein used is a solution used when the material composing the third conductive film 13 is plated . accordingly , in this method , only the third conductive film 13 is peeled off . the fourth step of the preferred embodiments is , with reference to fig5 through fig7 , for covering the conductive wiring layer 11 a and third conductive film 13 with an insulating layer 15 . referring to fig5 , the third conductive film 13 , conductive wiring layer 11 a and the partially exposed surface of the second conductive film 12 are covered with an insulating layer film 15 . concretely , the upper faces and side faces ( end faces ) of the partially removed third conductive film 13 and conductive wiring layer 11 a are covered with the insulating layer 15 . in addition , the front surface of the partially exposed second conductive film 12 is also covered with the insulating layer 15 . the process of covering with the insulating layer 15 of this step can be carried out by a vacuum press or laminating method . a vacuum press is a method for overlapping a prepreg sheet made of a thermosetting resin and pressing the same in vacuo , and a plurality of laminated sheets 10 can be batch processed . in a laminating method , a thermosetting resin or photosensitive resin sheet is applied to each semiconductor wafer 10 by means of a roller . in this method , although after - curing is carried out in a separate step by batch processing , an advantage such that the thickness can be accurately controlled is provided . next , referring to fig6 , in order to provide an electrical connection with semiconductor elements 19 to be mounted on the insulating layer 15 , the insulating layer 15 is partially removed to provide holes 16 . the conductive wiring layer 11 a exposed through the bottom portion of the holes 16 represents parts to become bonding pads . if the insulating layer 15 is made of a photosensitive material , the holes 16 can be formed by partially removing the second insulating layer 15 in a widely - known lithographic step . in addition , the holes 16 can also be formed by a laser . in this method , the insulating layer 15 is removed and the conductive wiring layer 11 a is exposed through the bottom of the holes 16 . as a laser , a carbon dioxide laser is preferred . in addition , if residue exists at the bottom portion of the aperture portion after the insulating layer 15 is evaporated by laser , this residue is removed by wet etching with sodium permanganate , ammonium persulfate or the like . next , referring to fig7 , a plated layer 21 is formed on the front surface of the conductive wiring layer 11 a exposed through the holes 16 to become bonding pads . the plated layer 21 can be formed by adhering gold or silver by an electrolytic plating method , and in this case , the second conductive film 12 can be used as a plating electrode . at this time , the second conductive film 12 and the rear surface excluding a plating electrode lead - out portion are protected by a resist to avoid the plating from adhering . this resist is unnecessary in partial jig plating where a front - surface plating portion is surrounded by a jig . the fifth step of the preferred embodiments is , as shown in fig8 , for fixedly fitting semiconductor elements 19 onto the insulating layer 15 and electrically connecting the semiconductor elements 19 with the conductive wiring layer 11 a . the semiconductor elements 19 are die - bonded in the state of bare chips onto the insulating layer 15 with an insulating adhesive resin . since the semiconductor elements 19 are electrically insulated from the underlying conductive wiring layer 11 a by the insulating layer 15 , the conductive wiring layer 11 a can be freely wired even below the semiconductor elements 19 . in addition , the respective electrode pads of the semiconductor element 19 are connected to bonding pads which are a part of the surrounding conductive wiring layer 11 a via bonding wires 20 . the semiconductor element 19 can be mounted face - down . in this case , solder balls or bumps are provided on the front surfaces of the respective electrode pads of the semiconductor element 19 , while on the front surface of the laminated plate 10 , electrodes similar to the bonding pads formed of the conductive wiring layer 11 a are provided at parts corresponding to the solder ball positions . now , an advantage of using the laminated plate 10 in wire bonding will be described . in general , when wire bonding is carried out with au wires , second conductive film 12 is heated up to 200 ° c .– 300 ° c . at this time , if the second conductive film 12 is thin , the laminated plate 10 warps , and in this condition , if the laminated plate 10 is pressurized via a bonding head , there is a possibility that damage occurs to the laminated plate 10 . however , these problems can be solved by forming the second conductive film 12 itself thick . the sixth step of the preferred embodiments is , as shown in fig9 , for covering the semiconductor elements 19 and bonding wires 20 with a sealing resin layer 22 . the laminated plate 10 is set in a molding device for resin molding . as a molding method , transfer molding , injection molding , coating , dipping and the like can be carried out . however , considering productivity , transfer molding and injection molding are suitable . in this step , it is necessary that the laminated plate 10 is brought into contact flatly with a lower metal mold of a mold cavity , and the thick , second conductive film 12 performs this function . moreover , even after removal from the mold cavity , flatness of the package is maintained by the second conductive film 12 until contraction of the sealing resin layer 22 is completely finished . namely , a role of mechanically supporting the laminated plate 10 until this step is assumed by the second conductive film 12 . the seventh step of the preferred embodiments is , as shown in fig1 , for removing the second conductive film 12 to expose the third conductive film 13 on the rear surface . in this step , the second conductive film 12 is etched without masking so that the whole surface is removed . in this etching , chemical etching by use of ferric chloride or cupric chloride is sufficient , and the second conductive film 12 is entirely removed . by thus entirely removing the second conductive film 12 , the third conductive film 13 is exposed through the insulating layer 15 . as described above , since the third conductive film 13 is formed of a material which is not etched by a solution to etch the second conductive film 12 , the third conductive film 13 is not etched in this step . the preferred embodiments have an advantage that in a step where the second conductive layer 12 is removed by etching , the third conductive film 13 functions as a barrier layer , whereby a rear surface composed of the insulating layer 17 and third conductive film 13 is formed to be flat . since the second conductive film 12 is entirely removed by etching , the third conductive film 13 also comes into contact with the etchant in the final stage of etching . as described above , the third conductive film 13 is formed of a material which is not etched by ferric chloride or cupric chloride that etch the second conductive film 12 made of cu . accordingly , since etching stops at the lower surface of the third conductive film 13 , the third conductive film 13 functions as an etching barrier layer . moreover , in and after this step , the ensemble is mechanically supported by the sealing resin layer 22 . the eighth step of the preferred embodiments is , as shown in fig1 through fig1 , for forming external electrodes 24 at desirable positions of the third conductive film 13 . at this time , for use in an environment where ag migration is considered to be a problem , it is preferable to remove the third conductive film 13 by selective etching before covering the conductive film 13 with an overcoat resin . first , referring to fig1 , the third conductive film 13 is , for the most part , covered with an overcoat resin 23 by screen printing with an epoxy resin dissolved in a solvent while exposing parts which form external electrodes 24 . next , referring to fig1 , external electrodes 24 are formed in these exposed parts by screen printing with a solder cream or by a solder reflow . lastly , referring to fig1 , since a large number of circuit devices are formed on the laminated plate 10 in a matrix form , these are separated into individual circuit devices by dicing the sealing resin layer 22 and overcoat resin 23 . in this step , since individual circuit devices can be separated by dicing the sealing resin layer 22 and overcoat resin 23 , frictional wear of a dicer to perform dicing can be reduced . with reference to fig1 , a concrete circuit device according to a manufacturing method of the preferred embodiments will be described . the pattern shown by dotted lines is a conductive wiring layer 11 a . in a manner so as to surround the semiconductor element 19 , bonding pads formed of the conductive wiring layer 11 a are provided , while pads formed of the conductive wiring layer 11 a are formed in a region below the semiconductor element 19 . herefrom , it is understood that a pattern formed of the conductive wiring layer 11 a can be formed in the region below the semiconductor element 19 as well . in addition , the conductive wiring layer 11 a can form a fine pattern , therefore , more external electrodes 24 can be formed . with such a structure , even a semiconductor element 19 having 200 pads or more , a finely patterned , desirable conductive pattern can be formed by utilizing the fine pattern of the conductive wiring layer 11 a , therefore , connection from external electrodes 24 to an external circuit can be carried out . with reference to fig1 , a concrete circuit device 1 a of another embodiments will be described . herein , in the circuit device 1 a , a conductive wiring layer 11 a shown by dotted lines is formed , and a semiconductor element 19 , chip elements 25 , and bare transistors 26 are mounted on the conductive wiring layer 11 a . for the chip elements 25 , passive components and active components such as resistors , capacitors , diodes , and coils can be employed in general . in addition , built - in components are electrically connected to each other via the conductive wiring layer 11 a or bonding wires 20 . | 7 |
referring first to fig1 , a beach walkway 10 is shown in exemplary form . walkway 10 is formed from joined walkway sections 20 , for example surfaced with vinyl decking 22 in known manner . decking 22 has an upper walking surface 21 , and a lower surface in contact with the beach sand 12 . walkway sections 20 are supported and connected by a system of longitudinal rails and splicers secured to the lower surface of each section and subsequently buried in the sand 12 when the sections 20 are placed face - down on the sand . walkway 10 is stable and substantially rigid , capable of supporting the weight of multiple people and / or mobility aids on any given section 20 without deforming or sinking into the sand . fig2 shows the lower side of two joined walkway sections 20 , with a first section labeled 20 and a second mating section labeled 20 ′. sections 20 and 20 ′ in the illustrated example are identical , unless otherwise noted . the sections 20 may be of any length , for example six to eight feet , and the width may vary depending on the intended use and expected traffic . the bottom surface 23 of decking 22 in sections 20 is essentially solid , sufficiently so that sand , gravel , wood mulch , or other soft or particulate ground material ( hereafter “ sand ” for convenience ) generally does not work its way up into any hollow interior in the decking material 22 , or up through the decking material 22 to the upper walking surface 21 . while the illustrated decking material has the appearance of planking with small gaps between adjacent planks , the decking may be molded or formed from a solid sheet or web of material and given the appearance of separate planks . the decking may have any other external appearance desired , and it would also be possible to have decking material 22 formed from individual planking , with or without spacing between the planks , provided that any spacing between planks is sufficiently small to prevent undue filtration of sand , gravel , wood chips , etc . up through the gaps , and to prevent undue settling of the decking into the sand , gravel , etc . over time — this would meet the definition of an essentially solid lower surface 23 as used herein . it has been found that perforated decking or grating may also be used , provided the lower surface area 23 has sufficient solid area to “ float ” the decking on the typical soft terrain . an example is shown in fig1 , where decking 20 ′ has the form of a grate pattern , perforated between upper and lower surfaces 21 ′, 23 ′ to allow dune grass or similar vegetation to receive sunlight and grow through the decking , and for improved traction in snowy conditions . referring to fig2 and 3 , the lower surfaces 23 of walkway sections 20 are provided with at least two outer parallel support rails 30 , and in the illustrated example with one or more interior support rails 30 ′ essentially identical and parallel to rails 30 . rails 30 and 30 ′ ( hereafter referred to simply as rails 30 , unless a distinction is being drawn between the inner and outer rails ) are structurally rigid , for example made from a metal such as aluminum or steel . rails 30 can be secured in various ways to the undersides 23 of their respective walkway sections 20 , for example with screws or adhesives , although other methods are acceptable . it might also be possible to mold rails 30 into the lower surfaces of sections 20 when the decking is being formed , for example by insert molding metal rails into the decking , or by molding the rails from the material of the decking itself — in such case , rails 30 might comprise sidewalls 32 extending directly from lower surface 23 of the decking , with lower surface 23 of the decking functioning as the “ base ” of the rail . it should be understood that the materials used for walkway 10 are not limited to the illustrated combination of polymer / vinyl decking and metal rails , although this combination is currently preferred . rails 30 have a generally u - shaped cross section , with sidewalls 32 joined by a base 34 , the base being secured to lower surface 23 of the decking section 20 so that the rail opens downwardly , into the sand , when the decking section 20 is placed lower side down on the beach . the open ends 36 of rails 30 terminate at or near the mating longitudinal ends 27 of the decking sections , in the preferred form being essentially flush therewith . rails 30 also include aligned pairs of holes 38 in their sidewalls 32 near ends 36 , for receiving splicer - securing cross members such as pins or cross - bolts 37 , 39 in various arrangements described below . a generally squared u - shape is preferred for the rail / splicer cross sections , as illustrated , although rounded u - shapes are possible where sidewalls 32 are part of a single continuously - curved wall . rails 30 on adjacent decking sections 20 are aligned with one another , at least at their ends , and are connected with splicers 40 . splicers 40 are short , open - ended , generally u - shaped channels , similar in shape to rails 30 but sized so that their sidewalls 42 fit inside ( illustrated , best shown in fig5 ) or optionally over the sidewalls 32 of rails 30 — the mating configuration could be described generally as a hollow male / female fit . splicers 40 have perforated bases or bottoms 44 with large holes 45 to freely admit sand into their interiors through the bottom . splicers 40 are installed facing upwardly into rails 30 , such that bottoms 40 are in contact with the sand when the decking sections are installed on a beach . the ends 46 of splicers 40 are open . the sidewalls 42 of splicers 40 include aligned pairs of holes 48 mating with those on the sidewalls of the ends of rails 30 for receiving pins and / or cross - bolts 37 , 39 to secure them to rails 30 . fig2 and 3 show a first type of splicer connection between adjacent walkway sections 20 , in which each section has two outer rails 30 and at least one and preferably two inner rails 30 ′. one end of the walkway section is defined as “ male ” by four identical splicers 40 secured at one end in the four rails 30 , with the free ends 41 of the splicers projecting beyond the end of the walkway to mate with four corresponding rails 30 in the next section 20 . splicers 40 are accordingly first secured or pre - installed in a semi - permanent manner with cross - bolts 39 to the male end of the first section 20 of walkway , and subsequently mated with the female end of the next section 20 ′ of walkway , whereupon the free ends of the outer splicers 40 are secured with more easily installed and removed detent - type pins 37 to the open rail ends in section 20 ′. the splicers 40 on the inner rails 30 ′ ( hereafter referred to as 40 ′ to distinguish their manner of connection ) may be left unsecured in their respective inner female rails 30 ′ on the next section 20 , or if access is possible they could be secured to the inner rails 30 ′ with pins or bolts . if left unsecured to inner rails 30 ′ on the next section 20 ′, the free ends 41 of inner splicers 40 ′ still provide lateral and some vertical stability to the joined walkway sections by virtue of their mating fit with the ends of inner rails 30 ′. an alternate connection is shown in phantom in fig2 and 3 , in which inner splicers 40 ′ are secured at the opposite end of section 20 , such that each walkway section 20 has two outer splicers 40 projecting from a first end and two inner splicers 40 projecting from a second , opposite end . the manner of securing the free ends 41 of the pre - installed splicers 40 and 40 ′ to their adjoining walkway sections 20 may be the same as described above . fig4 and 5 illustrate one of the splicer / rail connections 40 / 30 from fig2 and 3 at the joint 29 of two walkway sections 20 . the illustrated connection is one of the outer rail / splicer connections using a detent - type pin 37 . ( it will be understood that fig4 and 5 also generally represent the inner splicer / rail connections 40 ′/ 30 ′, with the exception of the connector pin 37 .) rails 30 are essentially buried in sand 12 , near or up to the lower surface 23 of the decking 22 of sections 20 , and their open bottoms are accordingly filled with sand , anchoring the walkway sections 20 in the beach . splicers 40 are likewise buried in sand 12 , and with their perforated bottom walls 44 and open ends 46 they fill with sand in a manner very similar to rails 30 , with perhaps some minor agitation in the sand to assist . fig5 shows preferred mating cross sections for rail 30 and splicer 40 , with the rail sidewalls 32 being angled at right angles relative to their base 34 , while splicer sidewalls 42 are angled inward relative to splicer base 44 , e . g . at 88 degrees or so . this preferred configuration permits relatively unimpeded initial vertical mating of the splicer and rail . it is also possible to have both rail and splicer sidewalls equally right - angled to permit free vertical mating and separation . it also should be understood that while the illustrated splicer 40 fits inside rail 30 , the splicer could be sized to fit over rail 30 with a similar fit . fig6 a , 6 b , 7 and 8 show another type of splicer connection in which the inner splicers 140 have a different configuration than outer splicers 40 , and in which a different type of connection is used to secure the inner splicers 140 to inner rails 30 ′. inner splicers 140 have through - holes 48 at one end , for pre - installation on inner rails 30 ′ with bolts , as shown and described above with respect to fig2 and 3 . however , the outer or free ends 41 of splicers 140 positioned to mate with the inner rails 30 ′ on the next walkway section 20 are provided with open - ended slots 141 . slots 141 are configured to mate in longitudinal sliding fashion with pins or bolts such as 37 or 39 pre - installed in the female ends of the inner rails 30 ′ on the next walkway section 20 , as best shown in fig6 b and 7 . this allows easier and more secure mating of the inner splicers with the next walkway section , especially when face - down in the sand , and produces a stronger joint at the inner rails than would result from merely mating free ends 41 with the rails . fig9 through 12 illustrate a junction rail useful for creating lateral ( perpendicular ) and parallel connections between walkway sections 20 , versus the longitudinal or series connections described and shown above in fig1 - 8 . referring first to fig9 , junction rail 50 includes sidewalls 52 , 53 joined by a base or bottom 54 and defining an upward - facing channel 55 sized to receive a sidewall 32 from one of support rails 30 in a close fit . junction rail outer sidewall 53 may be taller than inner sidewall 52 , and terminates in a horizontal shelf 56 . the height of sidewall 53 and the thickness of shelf 56 are chosen to match the height of support rail sidewall 32 , so that shelf 56 fits flush against the lower surface 23 of the walkway section 20 . shelf 56 preferably extends a distance from sidewall 53 equal to or less than the spacing of an outer support rail sidewall 32 from the side edge 25 of the decking portion 22 of walkway section 20 . fig9 , 10 , and 11 illustrate a junction rail 50 used to create a lateral connection between a first walkway section 20 and a second walkway section 20 ′ oriented perpendicularly to the first section 20 . junction rail 50 , made for example from the same material as rail 30 ( e . g ., aluminum or steel ), is mated with the outer sidewall 32 of an outer support rail 30 on section 20 with the sidewall 32 located in junction rail channel 55 . junction rail 50 may be secured to rail 30 in different ways , but in the illustrated example is provided with holes 58 that can be aligned with the holes already in rail 30 for receiving cross - bolts or pins such as 37 or 39 . a splicer 240 , similar to splicer 40 above but shortened and squared at the inner end , is secured with welds 60 to the underside of shelf 56 and optionally to the outer surface of sidewall 53 , with a free end projecting beyond the edge 25 of the walkway section 20 . normally more than one splicer 240 will be mounted on junction rail 50 ; for example , four splicers 240 are shown in fig1 to match the illustrated four support rails 30 in the mating walkway section 20 ′. once junction rail 50 and one or more splicers 240 have been secured to the first walkway section 20 , another walkway section 20 ′ can be mated perpendicularly to the first section using the free splicer ends , as described and shown above in preceding figures . the resulting walkway joint is shown in fig1 , with a lateral offshoot of walkway 20 ′ extending from the original longitudinal run 20 . it will be appreciated that while junction rail 50 is shown in use for a perpendicular walkway connection , angles other than perpendicular are possible provided that the mating end of the offshoot section of walkway is angled accordingly , and that the splicers 240 on the junction rail are welded onto the shelf 56 at a corresponding angle . referring next to fig1 and 13 , junction rail 50 is shown used in pairs to join sections of walkway 20 in parallel , i . e . with their side edges 25 abutting . a junction rail 50 is secured to each of the adjacent outer support rails 30 at the joint of their respective sections 20 of walkway , and then a junction plate or strip 59 ( e . g ., aluminum or steel ) wide enough to bridge the joint is welded at 60 to the undersides of the shelves 56 . it would also be possible to use junction rail 50 without using the shelf 56 as a weld support for additional connecting structure such as splicers 40 or junction plates 59 . for example , securing a junction rail 50 to the sidewall of a support rail 30 would reinforce the decking 22 that extends beyond the support rail 30 , by virtue of the contact between shelf 56 and the underside 23 of the decking . this might be especially useful for reinforcing the outer sides 25 of walkway sections 20 that extend beyond the outer support rails 30 . it will be understood that the disclosed embodiments represent presently preferred examples of how to make and use the invention , but are intended to enable rather than limit the invention . variations and modifications of the illustrated examples in the foregoing written specification and drawings may be possible without departing from the scope of the invention . it should further be understood that to the extent the term “ invention ” is used in the written specification , it is not to be construed as a limiting term as to number of claimed or disclosed inventions or discoveries or the scope of any such invention or discovery , but as a term which has long been conveniently and widely used to describe new and useful improvements in science and the useful arts . the scope of the invention supported by the above disclosure should accordingly be construed within the scope of what it teaches and suggests to those skilled in the art , and within the scope of any claims that the above disclosure supports in this application or in any other application claiming priority to this application . | 4 |
referring first to fig1 - 7 , the principles of the nurse induction apparatus can best be seen . the nurse inductor 20 enables the use of a standard air cart 10 for both the central hopper and the nurse system air source . the air cart fan can be used for both fertilizing and nursing operations simultaneously . the inductor 20 can be designed in an adapter arrangement which enables the air cart 10 to be readily converted from a roller type volumetric metering system to the nurse inductor system , and vice versa . such nurse mechanisms are described in , e . g ., u . s . pat . nos . 6 , 289 , 830 , 6 , 298 , 797 , and 6 , 267 , 067 , to mayerle et al ., the contents of which are incorporated herein by reference in their entirety . the nurse induction adapter is mounted on a conventional air seeder or air cart , and redirects the air stream 13 coming from the fan 11 in an air cart box 16 into a path that leads through the nurse inductor 20 . the air stream is guided into a nozzle region 24 that directs the air along a flow path that tangentially engages a pile of seed particles s exiting the opening 19 at the bottom of the seed hopper 12 . the turbulence of the blast of air from the nozzle 24 loosens the seed particles from this assemblage of seed particles s exiting the opening 19 in the bottom of the seed hopper 12 , entraining the individual seed particles into the air stream as it follows a path to the distribution lines 22 above the seed particle pile . the individual seed particles remain suspended in the air stream where the air bleeds off and the individual seed particles fall by gravity into a second pile or mass at the planting mechanism . the details of a single shoot , or single capability nurse distribution mechanism is disclosed in u . s . pat . no . 6 , 267 , 067 , the description of which is incorporated herein by reference . as disclosed in the &# 39 ; 067 patent , the air stream through the nurse inductor apparatus 20 is split at the general location of the seed particle mass at the bottom of the central seed hopper 12 on the air cart 10 into individual sections that are isolated by generally vertical walls . each individual section leads to a different seed distribution tube and , ultimately , to a different receiver header 23 and associated receivers 28 . in smaller planting systems , the primary nurse lines 22 run directly to the receivers 28 without benefit of a receiver header 23 . the nurse inductor 20 induces seed particles into the air stream when and where there is demand for the particles . the demand for particles is controlled by the level of product in each respective receiver 28 or receiver header 23 on the output end of the seed distribution tube . when the receiver 28 or receiver header 23 is full , air is restricted from escaping from the seed distribution tube by the massed seed particles within the seed distribution tube . as a result of the filled receiver or receiver header , the vent therein becomes blocked , which prevents the passage of air there through , thus the air flow and air velocity are reduced due to increased pressurization of the line . this resultant reduction in potential air pressure reduces the capacity of the flow of air to induce the seed particles into the corresponding seed distribution tube . since the flow of air through the nurse inductor 20 is spread across the entire unit , the flow of air will tend to go to the lines that have open receivers because of the less airflow resistance . the preferred configuration for dual capability nursed planters is depicted in fig8 as a parallel distribution system 30 designed with each primary line 22 delivering product to a single row unit 25 or seed meter 26 . a nurse distribution line 22 from each central tank 12 is routed to each row unit 25 . each row unit 25 preferably contains two seed meters 26 that are remotely operated when a change in seed type is required , thus providing an instantaneous change in seed variety that may be optionally controlled by a gps field locater . accordingly , this dual capability nurse system 30 provides complete independent control of seed varieties . alternatively , the preferred configuration of the dual capability nurse system 30 could be arranged to reduce cost and complexity , though at the expense of the time required to switch from one seed variety to another seed variety . a single meter 26 would be mounted on the row unit 25 with a multiple compartment receiver ( not shown ). the multiple compartment receiver 28 would be provided with a flapper to allow communication between only one compartment at a time and the seed meter 26 . an actuator ( not shown ) to switch between compartments could be remotely activated and electronically controlled by a gps field locater . a small quantity of seed ( e . g ., equal to the volume of the seed in the seed meter ) would need to be planted to empty the corresponding compartment before communication with the second compartment is initiated . a controller ( not shown ) would be operable to calculate the time required for the volume of seed remaining in the seed meter 26 to empty . the controller would then timely switch from one compartment to the other to match the location of the changing soil type as defined by a field map . using a controller in this manner would minimize the time for effecting the change in seed varieties . alternatively , the second compartment could be opened as the first is closed . this alternative configuration would provide for a greater blended planting time ; however , costs would be minimized as the controller , which would use a forecasting algorithm as described above , would not be required . a second preferred dual capability nurse distribution system 32 configuration for nursed planting mechanisms is depicted in fig9 . this alternative configuration 32 is also a parallel distribution system designed with each primary line 22 delivering seed product to a nurse header 23 that splits the product to two adjacent row units 25 . this second dual capability nurse distribution system 32 presents a cost reduced version as compared to the first preferred dual capability nurse distribution system 30 ; however , this second system 32 suffers slightly with respect to providing a quick change between seed varieties while planting “ on the go ”. a small receiver 28 is mounted on the seed singulator on each row unit 25 . a nurse header 23 , shown in fig1 a - 10 b , with two or more outlets 43 delivers seed down a flexible hose to the receiver 28 . the single inlet to the header 23 , as is disclosed in aforementioned u . s . pat . no . 6 , 267 , 067 , is replaced with two or more inlets 45 allowing product from a corresponding number of central tanks 12 on the air cart 10 to access the receiver 28 and the seed meter . either the product regulator on the nurse inductor box or the air supply to each tank 12 must be altered to stop the seed delivery from the associated tank 12 . controlling the alteration of the seed delivery can be accomplished remotely to switch seed varieties between the two tanks 12 “ on the go ”. accordingly , a limited zone within the planted part of the field , when switching from one seed variety to the other in the field , would consequently be planted with a mixture of seed varieties . a second configuration for smaller nursed planters is a parallel distribution system designed with each primary line delivering product to a single row unit . a small receiver is mounted onto one seed meter on each row unit . the inlet to the receiver is replaced with two or more inlets allowing product from a corresponding number of central tanks access to the receiver and seed meter . the air to the tank or the product regulator on the nurse inductor box would be remotely activated to stop the delivery of seed from one of the tanks and start the delivery to the second tank , thereby switching varieties . as before , there is a zone in the field that would be planted with a mixture of seed varieties . a third configuration for a dual capability nurse distribution system 35 is shown in fig1 , and entails a single - shoot distribution system , as described in the &# 39 ; 067 patent , with a combiner / selector valve 50 for each primary nurse line 22 , mounted near the central tanks 12 . the combiner / selector valve 50 is designed to allow the flow of seeds from one of the tanks 12 a , 12 b . a single primary nurse line 22 from each tank 12 a , 12 b is combined at the valve 50 , which is configured to allow seed flow from one of the central tanks 12 to the row unit 25 or nurse header 23 . for example , on a 40 foot wide planter configured to plant seeds in rows having a 30 inch spacing , sixteen seed meters are fed with eight primary nurse lines 22 . a bank of eight combiner valves 50 could be configured to use the entire seed product from tank 12 a before switching to access the seed product from the second tank 12 b . an alternative configuration of the combiner / selector valve bank 50 could involve four combiner valves 50 cooperable with the first tank 12 a and four additional combiner valves 50 cooperable with the second tank 12 b , thus allowing tanks 12 a and 12 b to drain simultaneously , if tanks 12 a and 12 b were of equal size . this configuration would give the operator the capability to carry additional seed for additional fields , or alternatively , to use the entire capacity of the combined tanks 12 in one field . the operation of the combiner / selector valves 50 could be remotely controlled to change tanks “ on the go ”; however , the use of a remote controller would create greater lag times compared to above - described configurations , but would be the most cost - effective method of delivering seed product from the two tanks 12 a , 12 b to the entire width of the planter mechanism , either individually or simultaneously . an alternate embodiment of the third dual capability nurse distribution system 35 configuration includes structure to permit a quick change of distribution lines 22 between tanks 12 a , 12 b . as depicted in fig1 , the primary nurse lines 22 from the tanks 12 a , 12 b are supported in groups on a plurality of quick - connect mechanisms 55 . a corresponding quick connect adapter structure 56 is engagable with and cooperable with the quick connect mechanisms 55 to couple the primary nurse lines 22 to the product delivery lines 22 a to allow seed product to be delivered from the tanks 12 a , 12 b . since the quick connect mechanisms 55 can be individually connected to a corresponding quick connect adapter 56 , seed product can be delivered from the first tank 12 a by connecting the quick connect mechanisms 55 associated the first tank 12 a to all of the adapters 56 , or from the second tank 12 b by connecting the quick connect mechanisms 55 associated with the second tank 12 b to all of the adapters 56 , or to combine delivery of seed product from both tanks 12 a , 12 b by connecting selected quick connect mechanisms 55 from both tanks 12 a , 12 b ( mixing and matching as desired ) to the adapters 56 . the unused quick connect mechanisms 55 can be stored on an adjacent mounting bracket 59 to seal the ends of the primary nurse lines 22 which eliminates airflow , and , as a result , eliminates product being nursed down the inactive lines 22 . the operator can selectively arrange the quick connect mechanisms 55 to get the desired seed product mix from the desired tanks 12 a , 12 b . the utilization of the quick connect mechanisms 55 is an alternative to the use of a combiner / selector valve 50 as describe above . the potential cost savings of the quick connect mechanisms 55 is offset by the inconvenience of having to manually switch quick connect mechanisms 55 each time a different seed variety mix is desired . one skilled in the art will recognize that a combinations of fig1 and 12 would result in a quick connect mechanism 55 located at the beginning at the nurse distribution lines 22 where the lines 22 originate at the nurse inductor box 20 instead of at the distal end of the distribution lines 22 as is shown in fig1 . such a configuration would permit the distribution lines 22 to be quickly and easily attached to either nurse mechanism 20 associated with two tanks 12 a , 12 b . in this configuration , only one of the nurse mechanisms 20 would be operable at a time to deliver seed to all of the row units across the transverse width of the associated planting mechanism that are activated for engagement with the ground for planting seeds therein . one skilled in the art will recognize that in some planter configurations , some row units are not activated when planting certain crops . for example , for a planter mechanism configured to plant soy beans in rows have a 15 inch spacing , the same configuration can be used to plant corn at 30 inch row spacings by deactivating alternate row units . the principal of the instant invention would provide a nurse mechanism that would be selectively operable to distribute seed from one of two tanks to those row units that are activated and engaged with the ground for the purpose of planting seed . the invention of this application has been described above both generically and with regard to specific embodiments . although the invention has been set forth in what is believed to be the preferred embodiments , a wide variety of alternatives known to those of skill in the art can be selected within the generic disclosure . the invention is not otherwise limited , except for the recitation of the claims set forth below . | 0 |
the method of fabricating mosfet devices , featuring sac openings and a local interconnect structure , and used to interconnect various regions of a mosfet cell , will now be covered in detail . in this description the mosfet device described will be a n channel , ( nfet ), device . however this invention can also be used with p channel , ( pfet ), devices , or complimentary , ( cmos ), devices , comprised of both pfet and nfet devices . fig1 schematically shows the early stages of fabrication of this invention . a p type semiconductor substrate 1 , with a & lt ; 100 & gt ; crystallographic orientation , is used . field oxide , ( fox ), region 2 , is formed for isolation purposes , as well as to provide a base for a subsequent capacitor structure to be fabricated on . fox region 2 , is formed via thermal oxidation , of exposed semiconductor substrate 1 , in an oxygen -- steam ambient , at a temperature between about 850 ° to 1050 ° c ., to a thickness between about 3000 to 5000 angstroms . subsequent device regions , or regions not converted to fox region 2 , are protected by a masking pattern of an oxidation resistant composite layer , comprised of an overlying silicon nitride layer , on an underlying pad silicon oxide layer . the desired masking pattern , of the oxidation resistant composite layer , is obtained via conventional photolithographic and dry etching procedures . after formation of the fox region 2 , the masking pattern is removed , using hot phosphoric acid for silicon nitride , and a buffered hydrofluoric acid solution for the pad oxide . a gate insulator layer 3 , comprised of silicon dioxide , is next formed via thermal oxidation , in an oxygen -- steam ambient , at a temperature between about 850 ° to 1000 ° c ., to a thickness between about 50 to 200 angstroms . a polycide layer 4 , is next deposited , comprised of an underlying , n type , in situ doped polysilicon layer , deposited to a thickness between about 1000 to 2000 angstroms , and followed by the deposition of tungsten silicide layer , at a thickness between about 500 to 1500 angstroms . a capping insulator layer 5 , of silicon oxide is next deposited using either lpcvd or plasma enhanced chemical vapor deposition , ( pecvd ), to a thickness between about 1000 to 3000 angstroms . capping insulator layer 5 , can also be a silicon nitride layer . the capping insulator layer -- polycide composite is next patterned to form polysilicon gate structures , shown schematically in fig1 . the patterning is accomplished using conventional photolithographic procedures , and using anisotropic reactive ion etching , ( rie ), where chf 3 is used as an etchant for capping insulator layer 5 , while cl 2 is used as an etchant for the polycide layer 4 . polysilicon gate structure 30 , and polysilicon gate structure 31 , are formed to the left of fox region 2 , while polysilicon gate structure 32 , and polysilicon gate structure 33 , are formed to the right of fox region 2 . polysilicon gate structure 40 , is formed on fox region 2 . lightly doped source and drain regions 6 , are next formed in regions not covered by polysilicon gate structures , or fox region 2 , via ion implantation of either arsenic or phosphorous , at an energy between about 20 to 80 kev , at a dose between about 7 × 10 13 to 3 × 10 74 atoms / cm 2 . an insulator layer of silicon oxide is next deposited , using either lpcvd or pecvd procedures , to a thickness between about 1000 to 2000 angstroms , and subjected to an anisotropic rie procedure , using chf 3 as an etchant , creating insulator spacers 7 , schematically shown in fig1 . insulator spacers 7 , can also be formed from a silicon nitride layer . heavily doped source and drain regions 8 , are than formed , in regions of semiconductor substrate 1 , not covered by either polysilicon gate structures , or by insulator spacers 7 , via ion implantation of either arsenic or phosphorous at an energy between about 25 to 80 kev , at a dose between about 1 × 10 15 to 6 × 10 15 atoms / cm 2 . a first silicon nitride layer 9 , is deposited using lpcvd or pecvd procedures , to a thickness between about 600 to 1000 angstroms . a photoresist shape 10 , with an opening exposing the source and drain region between polysilicon gate structure 30 , and polysilicon gate structure 31 , and with an opening exposing the source and drain region between polysilicon gate structure 32 , and polysilicon gate structure 33 , is formed . these openings are larger in width than the space between polysilicon gate structures , therefore these openings also expose a portion of first silicon nitride layer 9 , overlying the polysilicon gate structures . an anisotropic rie procedure , using chf 3 and argon as an etchant , is next performed removing the portions of first silicon nitride layer 9 , exposed in the openings in photoresist shape 10 , and creating sac openings 20 , shown schematically in fig2 . sac openings 20 , or the width of exposed source and drain regions , between the insulator spacer coated , polysilicon gate structures , is between about 0 . 30 to 0 . 80 μm . photoresist shape 10 , is removed via plasma oxygen ashing and careful wet cleans . a second silicon nitride layer 11 , is deposited using lpcvd or pecvd procedures , to a thickness between about 200 to 400 angstroms . an interlevel dielectric layer 12 , ( ild ), is then deposited , comprised of undoped plasma enhanced silicon oxide , ( peteos ), deposited to a thickness between about 1000 to 2000 angstroms , using tetraethylorthosilicate , ( teos ), as a source , and followed by an overlying layer of boro - phosphosilicate glass , ( bpteos ), layer , deposited to a thickness between about 3000 to 12000 angstroms . an anneal is next performed at a temperature between about 750 ° to 900 ° c ., to reflow ild layer 12 , resulting in the smooth top surface , schematically shown in fig3 . photoresist shape 13 , is next formed , featuring an opening exposing the area between polysilicon gate structure 30 , and polysilicon gate structure 33 . this opening will define the local interconnect region . an anisotropic rie procedure , using chf 3 as an etchant is used to remove ild layer 12 , exposed in the opening in photoresist shape 13 . this rie procedure offers the selectivity needed to prevent etching of second silicon nitride layer 11 , after removal of ild layer 12 . this is schematically shown in fig4 . another anisotropic rie procedure is performed , using chf 3 and argon as an etchant , and used to remove second silicon nitride layer 11 , exposed in the opening in photoresist shape 13 . the result of this rie procedure , schematically shown in fig5 again results in sac openings 20 , exposing a source and drain region between polysilicon gate structure 30 , and polysilicon gate structure 31 , and exposing a source and drain region between polysilicon gate structure 32 and polysilicon gate structure 33 . removal of photoresist shape is again accomplished via plasma oxygen ashing and careful wet cleans . a composite layer 14 , comprised of an underlying adhesive layer of titanium , and an overlying barrier layer of titanium nitride , is deposited using r . f . sputtering procedures , to a composite thickness between about 500 to 1500 angstroms . a layer of tungsten 15 , is then deposited , using lpcvd procedures , at a temperature between about 375 ° to 500 ° c ., to a thickness between about 4000 to 7000 angstroms , using tungsten hexafluoride and silane as a source , and completely filling the opening in ild layer 12 . the composite layer 14 , and the overlying tungsten layer 15 , directly contact the source and drain regions , exposed in sac openings 20 . this is schematically shown in fig6 . tungsten layer 15 , can be replaced by other conductive layers , such as molybdenum , doped polysilicon , or metal silicides . regions of unwanted composite layer 14 , and tungsten layer 15 , overlying ild layer 12 , are next removed using an anisotropic rie procedure , using sf 6 as an etchant , resulting in tungsten plug 15 , in the ild opening . the removal of these layers can also be accomplished using a chemical mechanical polishing , ( cmp ), procedure . this is schematically shown in fig7 . the conductive plug , comprised of composite layer 14 , and tungsten layer 15 , connects the source and drain region , between polysilicon gate structure 30 , and polysilicon gate structure 31 , to a source and drain region , between polysilicon gate structure 32 , and polysilicon gate structure 33 . this local interconnect structure allows the integration of these elements , at a local level , reducing subsequent topography concerns , which could occur if this connection were to realized using upper metal levels . while this invention has been particularly shown and described with reference to , the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of this invention . | 7 |
referring to fig1 it can be seen that the present invention comprises a cold water inlet 12a , a hot water inlet 12b , and a control head 6 . the control head 6 controls the flow of the water , whether to the shower ( upper pipe ) or to the bath faucet ( lower pipe ), as will be explained in more detail below . further referring to fig2 it can be seen that the control knob 6 is threadedly fixed to the neck 56 of the stem 5 . the stem 5 fits slidably in the chamber of the water housing . in fig2 the 3 - way faucet of the present invention is seen in closed or off position . in this position , no water can flow in any direction . note that in this position the stem 5 is locked in place by a protruberance 25 in a horizontal slot in the stem 5 . in fig3 - a , the 3 - way faucet of the present invention is in the ` b ` or shower on position . water flows from both the hot water inlet 12b and the cold water inlet 12a in proportion to the amount that the corresponding knobs , 8b and 8a , are turned . the hot water enters the shower chamber 14 through inner water passage 54a and cold water enters the chamber through inner water chamber 54b . fig3 - b shows more clearly the direction of flow of the water in a side cross - sectional view . fig4 shows the frontal faucet on or ` a ` position of the present invention . in this case water flows from through the outer water passages 55a and 55b , respectively , to the frontal faucet . the operation of the stem 5 , stem slot 51 , and protruberance 25 is identical in both the preferred and the second embodiment and as such will be described in detail below , in the description of the second embodiment . referring to fig5 a second embodiment can be seen in which like reference numbers designate like parts in the first ( preferred ) and second embodiments . the second embodiment comprises a water housing 1 , a sleeve 2 and a handle 6 . the handle 6 is vertically adjustable , and does not require turning , except to be locked into off position . there are three positions for the present invention , namely positions a , b , and off . position a , the frontal faucet on position , is shown in fig7 . position b , the shower connection on position , is shown in fig8 . the off position is shown in fig6 . these three positions will be explained more rigorously below . now referring to fig6 the off position of the second embodiment can be seen . the inside of the water housing 1 comprises a water inlet cavity 12 , a faucet cavity 13 , and a threadably engagable ( screw - in ) shower connection 11 . the handle 6 is connected by means of a stem 5 which in turn has a stem control head 53 slideably adjustable between the shower connection , the water inlet cavity 12 and the frontal faucet cavity 13 . the upper portion of the stem 5 is slideably retained in a sleeve 2 . there is a concavity 52 ( see fig7 and 3 - a ) on the stem 5 . this concavity 52 is engageable with the spring - loaded steel ball 22 . the spring 21 therein is loaded against the sleeve cover 24 . the sleeve cover 24 also serves to guide and align the handle 6 as it is urged upwards and downwards . the user can feel the steel ball 22 snap into the concavity 52 . at this point , the handle 6 may be rotated counterclockwise ( ccw ) so as to lock the stem 5 in place on the protruberance 25 . the protruberance 25 is stationary , as is the rest of the sleeve cover 24 ( and sleeve 2 ). since the vertical position of the horizontal stem slot is already properly fixed by the steel ball 22 and the concavity 52 , there is no line - up problem to worry about . to unlock , simply turn the handle 6 back in the clockwise ( cw ) direction until the ball 22 and the concavity 52 reengage . note they the ball 22 and concavity 52 disengage when the handle 6 is first put in locked position . therefore , the concavity cannot be seen in fig6 whereas it can be seen in fig7 ( front faucet on position ) and fig8 ( shower connection on position ). while in the preferred embodiment two concavities 52 and spring - loaded steel balls 22 are shown and in the second embodiment one concavity 52 and steel ball 22 are shown , it will be understood that any number of spring - loaded steel balls and convavities could be used . it should be noted that the water inlet could be separated into two compartments ( left and right , as could apply to fig6 ). this would be useful when controlling ( i . e . presetting ) the temperature of the water is desired . for example , the hot water knob could control input into the right side and the cold water knob could control input into the left side . the first time the user uses this method , he would have to first put the handle 6 in position a or b . then he could adjust the hot and cold knobs as desired . one improvement of the present invention over the prior art lies in the fact that to turn off the flow of water , the handle need only be put into off position . it is not necessary to turn the individual knobs off again . also , another inherent advantage is the next time the user wants to use the faucet , he does not have to readjust the faucet . in other words , the next time the user wants to use water of the same temperature , he simply pulls up or pushes down on the handle 6 , which is convenient since in that case all adjustment of knobs has been predetermined . even the flow rate can be previously adjusted . these convenient features could be summarized and labeled as presetable one - step temperature and flow adjustment means . referring now to fig7 the second embodiment can be seen in front faucet on position . in this position , the handle 6 has been pushed down from off position by the user . accordingly , the stem control head 53 is pushed down so that water flows from the water inlet cavity 12 through the upper water passages 55a and 55b to the faucet cavity 13 . obviously , no water can flow through the shower connection 11 in this position . in fig8 the handle is shown in the shower connection on position . in this position , water can flow freely from the water inlet cavity 12 through the lower water passages 54a and 54b to the shower connection 11 . the passage to the faucet cavity is , of course , cut off completely under these circumstances . it is significant to note that the stem 5 slides up and down and is kept in line by protruberance 25 , which guides the stem slot 51 . only when the present invention is in off position ( see fig6 ) can the handle 6 be rotated so as to be locked into place vertically . in all other situations , the movement of the handle 6 and stem is vertical . if , for example , the handle 6 and stem 5 are moved down from the position shown in fig8 then the concavity 52 will eventually engage with steel ball 22 . this in turn lets the user known that he is in off position ( since he can feel the engagement of the steel ball ) and that he may elect to lock the handle 6 by turning it ccw ( to the position seen in fig6 ). this in the only position in which the handle can be rotated because it is the only position in which the horizontal stem slot 56 and the protruberance 52 line up so as to allow rotation . as various possible embodiments might be made of the above invention without departing from the scope of the invention , it is to be understood that all matter herein described or shown in the accompanying drawing is to be interpreted as illustrative and not in a limiting sense . thus it will be appreciated that the drawings are exemplary of a preferred embodiment of the invention . | 8 |
attention is directed to fig1 and 5 , where respectively a perspective view and a cross - sectional view are shown of a ridge vent system installed in a flat tile type roof system 28 . roof rafters 30 and 32 have ridge ends 34 and 36 ending at a center beam 38 . above the center beam 38 is mounted a longitudinally running ridge beam 40 which extends across the roof system . first 42 and second 44 roof decking is affixed above the upper sides 46 and 48 of the respective rafters 30 and 32 . either through roof deck 42 , or preferably above the upper end 49 of first roof deck 42 and up to the first side 50 of ridge beam 40 , a first air gap g 1 is provided . first air gap g 1 is provided to allow air to flow upward or downward in the direction of reference arrows 60 and 62 , respectively . between the upper end 64 of second roof deck 44 and the second side 66 of ridge beam 40 , a second air gap g 2 is provided to allow air to flow upward or downward in the direction of reference arrows 70 and 72 , respectively . a first longitudinally extending sub - flashing 80 having a plurality of ventilation apertures a 1 therein is provided to span gap g 1 . a second longitudinally extending sub - flashing 84 having a plurality of apertures a 2 therein is provided to span gap g 2 . a first top batten 90 is provided to affix first sub - flashing 80 to the first roof deck 42 . a second top batten 92 is provided to affix the second sub - flashing 84 to the second roof deck 44 . each of first and second top battens 90 and 92 may be secured to first and second roof decks 42 and 44 , respectively , by nails or other suitable fasteners n as indicated in fig2 . first water proof roof felting 96 is provided above first roof deck 42 , below flat tiles generally noted with reference numeral 100 , but in this case , more specifically shown as 100 1 and 100 2 . a second water proof roof felting 102 is provided above second roof deck 44 , below flat tiles 100 3 and 100 4 . a top cap flashing 120 is mounted over the top 122 of ridge beam 40 . the top cap flashing 120 is longitudinally extending to support a plurality of ridge cap tiles 130 , or as more specifically identified , cap tiles in a series from 130 1 , 130 2 , to 130 z , where z is a positive integer . in the embodiment shown in this fig1 , the top cap flashing 120 has a downwardly directed u - shaped center section 132 and a pair of opposing first and second outward wing portions 134 and 136 , each of which may be bounded at the outer tip t thereof by a an upwardly directed flange portion f . preferably , a sealant layer s is provided between the lower side 138 and 140 of wing portions 134 and 136 , respectively , and the adjacent tiles 100 1 and 100 3 , respectively . in fig1 , a view of an exemplary ridge vent flashing is in place on a roof , showing the position of ( a ) the sub - flashing 80 and 84 , and ( b ) the top cap flashing 120 , and including flat tile roofing 100 and the longitudinally oriented ridge cap tiles 130 . also , the various figures provide general views of certain embodiments , without limitation as to details of exact size , for convenience of stocking distributors and for contractor installation , one set of exemplary dimensions for my ridge vent system as applied to flat type tile roofs can be provided , as detailed in fig1 , 12 , and 13 . for example , sub - flashing 80 and 84 can be provided in convenient widths , often of about 6 . 5 inch width , when measured flat , before forming into an “ s ” shape for installation , and in standard lengths of 48 inches . also , i have found it convenient to provide apertures a 1 and a 2 spaced at about 0 . 25 inch centers vertically ( y dimension ) and at about 0 . 20 inch centers longitudinally ( x dimension ) as also noted in fig3 . also , for strength of sub - flashing 80 and 84 , i have found it useful to provide apertures a 1 and a 2 in rectangular strips of about 10 . 8 inches long , and slightly over one inch wide , with about 1 . 2 inch strips of solid metal provided longitudinally between rectangular strips of apertures , and with the first aperture spaced about 1 . 1 inches from the edge e ( see fig1 for this detail ). however , these are merely exemplary embodiments and the actual dimensions and sizes may be varied to suit individual needs , without varying from the more general teachings hereof . turning now to the top cap 120 , fig1 shows a top plan view of a 48 inch long section of top cap flashing 120 for a flat type tile roof , shown flat during manufacture of the top cap flashing in a 14 . 25 inch width , before the top cap flashing 120 is shaped for installation in the roofing system . apertures a 3 and a 4 are provided in generally rectangular strips of about 10 . 8 inches long , longitudinally spaced apart by solid strengthening portions 150 of about 1 . 2 inches long , longitudinally ( see fig1 and 16 for this detail ). also , it has been found it convenient to provide apertures a 3 and a 4 spaced at about 0 . 25 inch centers vertically and at about 0 . 20 inch centers longitudinally ( see fig1 for this detail ). drain holes 152 are provided , about 0 . 1875 inches in diameter and spaced inward from tip t about 0 . 75 inches and spaced longitudinally apart about 2 inches or so ( compare fig1 and fig6 for these details ). returning now to fig2 and 4 , a series of steps in an exemplary method for installing a ridge vent system for flat type tile roofs is shown . a first step in a method of installation of a ridge vent in a flat tile roof system is shown in fig2 , wherein the roof decks 42 and 44 are is cut back to provide an air flow space , optionally , but not necessarily u - shaped , defined by edge wall portions 154 , and providing space between roof decks 42 or 44 and the center beam 38 . next , a second step involves covering the roof decking 44 with felt 102 prior to tile installation . next , a third step in a method of installation of the ridge vent in a flat tile roof system , involves installing ( a ) the sub - flashing 84 is installed , and ( b ) securing the sub - flashing by use of a top batten 92 which is nailed over the sub - flashing 84 , to hold the sub - flashing 84 in place over deck 44 . it is easily understood that the first sub - flashing 80 and first batten 90 are similarly installed , either before or after installation of the second sub - flashing and the second batten . now , a fourth step in a method of installation of a ridge vent in a flat tile roof , includes centering the top cap 120 and fastening it to the ridge beam 40 . the top cap flashing 120 is preferably fastened to the ridge beam 40 using a # 6 or better galvanized roofing nails n spaced 12 inch on center . further , as best seen in fig5 , a bead of caulking s is used to seal between the bottom 156 of first wing 134 and tile 100 1 , and between the bottom 158 of second wing 136 and tile 100 3 . in fig4 , a fifth step in a method of installation of a ridge vent in a flat type tile roof is shown , wherein the “ ridge cap ” tiles 130 are centered over the top cap flashing 120 , and sealed together per the tile manufacturer &# 39 ; s specifications . to understand the functionality , it should be recognized that air escapes outward ( or inward , as the case may be ) between the ridge tiles 130 and the top cap flashing 120 . more specifically , as shown in fig1 and fig6 between adjacent ridge tiles 130 , a slight triangular shaped gap is created between bottom edges 160 and 162 . and the upper surface 164 of the top cap flashing 120 therebelow . in fig1 and 6 , the gap is indicated by the area between bottom edges 160 and 162 and the broken line of position 170 therebelow . in other words , from the line of position indicated in broken lines , to the bottom edges 160 and 164 of the ridge tiles 130 directly thereabove , a gap exists through which an adequate amount of ventilation air can escape , as indicated by arrows v in fig1 and fig6 . of course , as shown in fig1 , a first laid ridge tile 130 1 may be provided flat against top cap flashing 120 , or , alternately , a suitable height block may be provided to allow ventilation to occur . attention is now directed to fig7 through 10 , where the installation of an exemplary ridge vent in two types of s - tile or “ undulating ” tile roof is shown . first , in fig7 and 8 , the installation of tile in a low profile type undulating roof is shown . roof rafters 230 and 232 have ridge ends 234 and 236 ending at a center beam 238 . above the center beam 238 is mounted a longitudinally running ridge beam 240 which extends across the roof system . first 242 and second 244 roof decking is affixed above the upper sides 246 and 248 of the respective rafters 230 and 232 . between the upper end 250 of first roof deck 242 and first side 254 of the ridge beam 240 , an air gap g 3 is provided to allow air to flow upward or downward in the direction of reference arrow 260 . between the upper end 264 of second roof deck 244 and the second side 266 of ridge beam 240 , an air gap g 4 is provided to allow air to flow upward or downward in the direction of reference arrow 270 . a first longitudinally extending sub - flashing 280 , preferably but not necessarily in a general s - shape , and having a plurality of ventilation apertures a 5 therein is provided to span gap g 3 . a second longitudinally extending sub - flashing 280 , preferably but not necessarily in a general s - shape , and having a plurality of apertures a 6 therein is provided to span gap g 4 . a first top batten 290 is provided to affix first sub - flashing 280 to the first roof deck 242 . a second top batten 292 is provided to affix the second sub - flashing 282 to the second roof deck 244 . each of first and second top battens 290 and 292 may be secured to first and second roof decks 242 and 244 , respectively , by nails or other suitable fasteners n ( not shown ). also , a water proof roof felting 296 is provided above first roof deck 242 . a similar waterproof roof felting 202 is provided above decking 244 . low profile type roof tiles 200 are shown affixed on the roof . a top cap flashing 220 is mounted over the top 222 of ridge beam 230 . the top cap flashing 220 is longitudinally extending to support a plurality of ridge cap tiles 290 , as clearly shown in fig7 and 8 . in the embodiment shown in fig7 and 8 , the top cap flashing 220 has a relatively flat , outwardly spreading center section 232 with a slight downward u - shape , and a pair of opposing first and second outward wing portions 234 and 236 , each of which may be bounded at the outer tip t thereof by a an upwardly directed flange portion f . placement of overlapping ridge cap tiles 290 , and resultant generally triangular air gap below the outer edges 292 and 294 thereof , is generally as just described above with respect to the flat tile type of ridge cap . in fig1 through 22 , i have provided a set of exemplary detailed dimensions for one embodiment of a ridge vent system as applied to undulating tile type roofs . for example , sub - flashing 280 and 284 can be provided in about a 8 . 5 inch width , when measured flat , before forming into an “ s ” shape for installation , and in standard lengths of 48 inches ( see fig1 for this detail ). also , it is convenient to provide apertures a 6 and a 7 spaced at about 0 . 25 inch centers laterally and at about 0 . 20 inch centers longitudinally ( see fig1 for this detail ). also , for strength of sub - flashing 280 and 284 , it is useful , but not necessary , to provide apertures a 6 and a 7 in rectangular strips of about 10 . 8 inches long , and slightly over one inch wide , with about 1 . 2 inch strips of solid metal provided longitudinally between rectangular strips of apertures , and with the first aperture spaced about 1 . 1 inches from the edge e ( see fig1 for this detail ). attention is now directed to fig2 , where the top cap 220 is shown . in this figure , a top plan view of a 48 inch long section of top cap flashing 220 for an s - tile type roof is provided , shown flat during manufacture of the top cap flashing in a 15 . 5 inch width , before the top cap flashing 220 is shaped into generally recognized w - shape for installation in a roofing system . apertures a 7 and a 8 are provided in generally rectangular strips of about 10 . 8 inches long , longitudinally spaced apart by solid strengthening portions 250 of about 1 . 2 inches long ( see fig2 and 22 for this detail ). also , i have found it convenient to provide apertures a 7 and a 8 spaced at about 0 . 25 inch centers laterally and at about 0 . 20 inch centers longitudinally ( see fig2 for this detail ). drain holes 252 are provided , about 0 . 1875 inches in diameter and spaced inward from tip t about 0 . 75 inches and spaced longitudinally apart about 2 inches or so ( see fig2 for these details ). a method of installing a ridge vent system for an s - tile ( undulating ) type tile roof system can be easily understood in view of the previously provided method for installing an exemplary roof vent system for a flat tile roof . a first step in a method of installation of an exemplary ridge vent in an s - tile roof system is shown , wherein the roof deck 244 is cut back from the center beam 238 and the ridge beam 240 in the roof , to provide an aperture defined by edge wall 299 . a second step in a method of installation of a ridge vent in an s - type tile roof system is to cover roof decking 244 with a conventional roofing felt 296 prior to installation of the tiles 200 . next , a third step in a method of installation of a ridge vent in an s - tile roof system , involves ( a ) installing the sub - flashing 284 , and ( b ) installing a top batten 292 by nailing it over the sub - flashing 284 , to hold the sub - flashing 284 in place . although the second sub - flashing and second batten installation procedure is discussed , it is easily understood that the first sub - flashing 280 and first batten 290 are similarly installed , either before or after installation of the second sub - flashing and the second batten . now , a fourth step in a method of installation of a ridge vent in an s - tile roof , involves centering the top cap 220 and fastening it to the ridge beam 240 ; this is preferably accomplished using a # 6 or better galvanized roofing nails n spaced 12 inch on center . finally , a fifth step in an exemplary method of installation of a ridge vent in a tile roof system is to install the “ ridge cap ” tiles 290 , centered over the top cap 220 flashing , and sealing the ridge cap tiles per the tile manufacturer &# 39 ; s specifications . in fig9 and 10 , yet another embodiment of a ridge vent for tile roofs is illustrated , wherein the top cap flashing 320 includes a slight downwardly u - shaped center section 322 . this top cap flashing section 320 is provided with apertures a 9 and a 10 each of which are defined by edge portions , preferably as illustrated in fig3 with respect to apertures a 1 . wing portions 334 and 336 are similar to portion 234 and 236 previously described . otherwise , larger s - shaped tiles 396 are provided , but remaining parts are structurally and functionally the same as previously identified with respect to the discussion of fig7 and 8 , and thus the parts are identified accordingly . in the various sub - flashing and top cap flashing designs , apertures are provided for passage of air therethrough . it is also a desirable function of such apertures , whether a 1 , a 2 , a 3 , a 4 , a 4 , a 6 , a 7 , or a 8 to resist the passage of water therethrough . consequently , note that an exemplary design applicable to any of the just mentioned apertures is set forth in fig3 . rather than the provision of a mere punched hole , in one embodiment it has been found desirable to provide the apertures in an outwardly directed “ volcano ” or “ cheese grater ” shape , wherein water that is wind blown from the outside does not funnel toward passage through the aperture . in contrast , water would have to hit the aperture opening itself , since sloping sidewalls 400 provide for a narrow throat 402 that ends at the interior periphery ( circumference 404 as shown in fig3 ) of the preferably annular face portion 406 . thus , the “ volcano ” shaped vent apertures protrude , in the outward direction ( against ingress of water ) for a preselected height h , as shown in fig3 , which height h may vary depending upon the desired ventilation and water intrusion results to be achieved . and , as currently seen in the embodiment depicted in fig1 , ingress of water is further thwarted when the intermost aperture a 9 in the top cap flashing 320 is laterally outward with respect to the intermost aperture ( below a 5 ) in the subflashing 280 , for example . although the various embodiments of an exemplary ridge vent design have been described herein in detail , it is important to note that such ridge vents have been tested according to the metro dade county florida number pa100 ( a )- 95 test procedure for wind and wind driven rain resistance , and the designs described herein passed such testing . in particular , the test results indicated that there was no lift of movement of any tile or ridge vent components during the test . also , the amount of water which entered through the vent opening during the test was well below the regulatory limits . in one test , 830 , 720 ml of water was delivered to an 8 foot by 6 foot test roofing area during 50 minutes of testing . in that test , the maximum amount of water infiltration allowable , per the test procedure , was 0 . 05 % of the water delivered to the test area . given the delivered quantity of water , a maximum of 415 ml was the regulatory limit established for the test . however , the novel ridge vent system disclosed and claimed herein was able to limit water passage to a total of only 194 ml ; in other words only 0 . 023 % of the water which was applied to the roof deck tested actually passed through the ridge vent system . in another test , where the ridge vent system was tested on a high profile spanish “ s ” tile type roof , a total of 830 , 720 ml of water was delivered to an 8 foot by 6 foot test area during 50 minutes of testing . again , the maximum amount of water infiltration per the test procedure was 0 . 05 % of the water delivered to the test area , or , given the delivered quantity of water , a maximum of 415 ml of leakage was permissible during the test . however , the test , as conducted by outside engineering experts , determined that only 1 ml of water ( 0 . 0001 %) of the water applied to the test deck entered the vent opening throughout the test . it is interesting that a portion of the two tests involved simulated rainfall of 8 . 8 inches per hour during wind velocity tests of 35 mph , 70 mph , 90 mph , and 110 mph . moreover , during the tests , there was no lift or movement of tile or vent components . these results were totally unexpected by the test facility . thus , the performance of the ridge vent design set forth herein represents an important advance in the state of the art of ridge vents for tile roofs . it is to be appreciated that the novel ridge vent system provided by way of the present invention is a significant improvement in the state of the art of ridge type roof vents for tile roofs . the vent is lightweight , being normally manufactured of lightweight metal or other structurally strong material , and is capable of being easily packaged and shipped . importantly , the ridge vent for tile roofs allows installation of a ridge vent system even in locales where it has heretofore been impossible to do so and comply with building code requirements , since the ridge vent system is fully capable of passing the most stringent regulatory tests for wind and wind driven rain resistance . although only a few exemplary embodiments and aspects of this invention have been described in detail , various details are sufficiently set forth in the drawing and in the specification provided herein to enable one of ordinary skill in the art to make and use such exemplary embodiments and aspects , which need not be further described by additional writing in this detailed description . importantly , the designs described and claimed herein may be modified from those embodiments provided without materially departing from the novel teachings and advantages provided by this invention , and may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . therefore , the embodiments presented herein are to be considered in all respects as illustrative and not restrictive . as such , this disclosure is intended to cover the structures described herein and not only structural equivalents thereof , but also equivalent structures . numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . thus having described some embodiments of the invention , though not exhaustive of all possible equivalents , what is desired to be secured by letters patent is claimed below . therefore , the scope of the invention , as set forth in the appended claims , and as indicated by the drawing and by the foregoing description , is intended to include variations from the embodiments provided which are nevertheless described by the broad interpretation and range properly afforded to the plain meaning of the claims set forth below . | 4 |
first of all , we will consider the reason why conventional distortion correction systems can not judge and correct scanning error ( overlapping scan 1 and underlapping scan 2 shown in fig1 ) distortion with reference to fig1 and 2 . fig2 shows the outline of the landsat 4 satellite tm sensor . an oscillating scanning mirror 8 reciprocatingly scans the ground surface in the direction corresponding to that indicated by an arrow 9 to take photographs of the ground surface . the image obtained by photographing the ground surface exhibits differences between forward scanning 6 and backward scanning 7 due to the attitude fluctuation of the scanning mirror and satellite as represented by the corrected image coordinate system 4 in fig1 . the following processes ( 1 ) through ( 3 ) are carried out in order to correct the received image . ( 1 ) the mapping function φ representing geometric correspondence from the received uncorrected image coordinate system 3 to the corrected image coordinate system 4 is determined . the mapping function φ is determined from data such as the orbit attitude data of the satellite , the scanning angle , and the like . ( 2 ) a representative point on the corrected image coordinate system 4 such as a point ( x i , y i ) on the received image corresponding to the normal grid point ( u i , v i ), for example , is obtained by repeated calculation of convergence of the mapping function φ ( primarily because the inverse mapping function φ - 1 can not be determined ), and the points corresponding to those other than the representative point are interpolated to approximate the inverse mapping function φ - 1 . ( 3 ) the point of the corrected pixel position ( u , v ) is obtained from the corresponding point ( x , y ) with the approximate inverse mapping function φ - 1 , and the surrounding received image data is interpolated to obtain a corrected image intensity value , since its position does not generally correspond to the pixel position on the received image . if the mapping function φ is continuous , the distortion correction processing described above can approximate the inverse mapping function φ - 1 with an arbitrary level of accuracy by increasing the density of the representative point on the output image ; hence , it does not present any problem . when the received image coordinate system 3 has an overlapping scan 1 or an underlapping scan 2 , however , the mapping function φ is a many - to - one or a zero - to - one relation and approximation with the continuous function is impossible . hereinafter , one embodiment of the present invention will be described with reference to the reciprocating two - plane distortion model of the landsat 4 satellite by referring to fig3 and 4 . the mapping function φ representing the correspondence between the corrected image coordinate system 4 and the uncorrected image coordinate system 3 is the function that uses the attitude angle θ ( t ) of the satellite , the position γ ( t ) and the scanning angle β ( t ) as its variables . mapping φ ( x , y ) from the uncorrected image coordinates x - y to the corrected image coordinates u - v can be expressed by the following formula . here , t represents the time , and is a function of the uncorrected image coordinates x - y as t = t ( x , y ): the present invention is practiced with the following [ a ] and [ b ]. [ a ]: introduction of double mapping functions φ 1 - 1 and φ 2 - 1 mapping φ - 1 from the corrected image coordinate system u - v to the uncorrected image coordinate system x - y is not 1 : 1 mapping on the tm image for the following reasons ( 1 ) and ( 2 ). ( 1 ) there is a region ω 1 , scanning overlap region , on the corrected image where mapping is a one - to - many relation . ( 2 ) there is a region ω 2 , the scanning underlap region , on the corrected image where no corresponding point exists on the uncorrected image coordinate system x - y . therefore , the present invention considers the two coordinates systems x 1 - y 1 and x 2 - y 2 to be the uncorrected image coordinate system 3 . these two coordinates are the following ( a ) and ( b ) are as shown in fig3 : ( a ) the coordinate system x 1 - y 1 formed by alternately coupling forward scanning data regions 6 and imaginary forward scanning data regions 16 ; and ( b ) the coordinate system x 2 - y 2 formed by alternately coupling backward scanning data regions 7 and imaginary backward scanning data regions 17 . the two coordinate systems define two mappings φ 1 - 1 and φ 2 - 1 corresponding to x 1 - y 1 and x 2 - y 2 , respectively . when carrying out imaginary forward ( backward ) scanning , mapping is obtained by proceeding as if scanning were made in practice forward ( or backward ) scanning with forward ( or backward ) scanning characteristics . therefore , mappings φ 1 - 1 and φ 2 - 1 are continuous , 1 : 1 mapping functions . the following can be judged from the relation between four kinds of points a , b , c , d on the corrected image coordinate system 4 and the corresponding points a 1 , b 1 , c 1 , d 1 , a 2 , b 2 , c 2 , d 2 on the uncorrected image : ( i ) the points a 1 , a 2 corresponding to the point a on the scanning overlap region ω 1 exist in the practical image data regions 6 , 7 on the uncorrected image coordinate system 3 ; and ( ii ) the points c 1 , c 2 corresponding to the point c on the scanning underlap region ω 2 exist in the imaginary image data regions 16 , 17 on the uncorrected image 2 . fig4 shows the flow of the reciprocating two - plane distortion model correction processing . step 18 : the coordinates ( u , v ) on the corrected image coordinate system 4 are determined . step 19 : the corresponding points ( x 1 , y 1 ), ( x 2 , y 2 ) on the uncorrected image coordinate system 3 are determined from the point ( u , v ) on the corrected image coordinate system 4 by mapping φ 1 - 1 ( u , v ) and mapping φ 2 - 1 ( u , v ). the satellite parameter data 20 are used when determining the mapping φ 1 - 1 and φ 2 - 1 . step 20 : data such as the satellite position , the attitude , the scanning angle of the sensor , and the like are calculated . step 21 : it is determined whether or not the corresponding point ( x 1 , y 1 ) exists on a real scan . if it does step 22 is followed , and if not , step 23 is followed . step 22 : it is determined whether or not the corresponding point ( x 2 , y 2 ) exists on the real scan . if it does step 24 is followed and if not , step 25 is followed . step 23 : it is determined whether or not corresponding point ( x 2 , y 2 ) exists on the real scan . if so , step 26 is followed and if not , step 27 is followed . step 24 : interpolation is made assuming that the point exists on an overlapping scan . step 25 : interpolation is made assuming that the point exists on a normal scan of the coordinates expressed by φ 1 - 1 . step 26 : interpolation is made assuming that the point exists on a normal scan of the coordinates expressed by φ 2 - 1 . step 27 : interpolation is made assuming that the point exists on an underlapping scan . after the procedures described above have been carried out for all points ( u , v ) on the corrected image , geometric distortion taking the scanning error into consideration can be corrected . the present invention is particularly effective for detecting scanning error when correcting a satellite image having geometric distortion such as scanning overlap or underlap resulting from reciprocating scanning . | 6 |
in the following , an embodiment of the invention is described referring to the drawings . in this embodiment , a lamp unit 14 is equivalent to a “ light source ” recited in the claims ; an imager unit 15 is equivalent to an “ imager portion ” recited in the claims ; a projection optical unit 17 is equivalent to a “ projection portion ” recited in the claims ; a projection lens unit 101 is equivalent to a “ projection lens portion ” recited in the claims ; a reflection mirror 102 is equivalent to a “ mirror portion ” recited in the claims ; a main control board 210 and an extension interface board 220 are equivalent to a “ circuit board ” recited in the claims ; a terminal panel 240 is equivalent to a “ terminal portion ” recited in the claims ; a holder 250 is equivalent to a “ holding member ” recited in the claims . the foregoing correspondence in description between the claims and this embodiment are merely examples , and do not limit the claims to this embodiment . fig1 a , 1 b and fig2 are diagrams showing an external construction of a projector embodying the invention . fig1 a is a perspective view of the projector when viewed from a front side , and fig1 b is a perspective view of the projector when viewed from a rear side . fig2 is a bottom view of the projector . to simplify the description , arrows respectively indicating forward , rearward , leftward , and rightward directions are depicted in fig1 a , 1 b and fig2 . hereinafter , the arrows indicating forward , rearward , leftward , and rightward directions are depicted in the same manner as above in the other drawings , as necessary . the projector of the embodiment is a so - called short focus projector . referring to fig1 a and 1b , the projector is provided with a main body cabinet 1 having a substantially rectangular parallelepiped shape . the main body cabinet 1 is constituted of a lower cabinet 2 , and an upper cabinet 3 which is placed on the lower cabinet 2 from above . a top surface of the main body cabinet 1 is formed with a first slope 1 a inclined downward and rearward , and a second slope 1 b continuing from the first slope 1 a and inclined upward and rearward . the second slope 1 b faces obliquely upward and forward , and a projection port 4 is formed in the second slope 1 b . image light emitted obliquely upward and forward through the projection port 4 is enlarged and projected onto a screen disposed in front of the projector . further , the top surface of the main body cabinet 1 is formed with a lamp cover 5 . the top surface of the main body cabinet 1 is formed with a lamp opening for use in exchanging a lamp unit , and a filter opening for use in exchanging a filter disposed in a fan unit for cooling the lamp unit . the lamp cover 5 is a cover for covering the lamp opening and the filter opening . further , the top surface of the main body cabinet 1 is provided with an operation portion 6 constituted of a plurality of operation keys . a terminal port portion 7 is formed in a right surface of the main body cabinet 1 . a terminal panel 240 having various terminals such as av terminals is attached to the terminal port portion 7 . the terminal panel 240 constitutes a part of a control circuit unit to be described later . audio visual ( av ) signals such as an image signal and an audio signal are inputted and outputted to and from the projector through the av terminals . further , an air inlet 8 is formed in the right surface of the main body cabinet 1 at a position above the terminal port portion 7 . the air inlet 8 is constituted of multitudes of slit holes , and external air is drawn into the main body cabinet 1 through the air inlet 8 . a first air outlet 9 and a second air outlet 10 are formed in a left surface of the main body cabinet 1 . each of the first and second air outlets 9 , 10 is constituted of multitudes of slit holes , and air inside the main body cabinet 1 is discharged to the outside of the projector through the first and second air outlets 9 , 10 . further , a sound output port 11 is formed in a rear surface of the main body cabinet 1 . sounds in accordance with images are outputted through the sound output port 11 at the time of image projection . referring to fig2 , a fixed leg 12 is disposed in the middle of a front portion on a bottom surface of the main body cabinet 1 , and two adjustable legs 13 are disposed at a rear end thereof . by expanding or contracting the two adjustable legs 13 up and down , it is possible to adjust the inclination of the main body cabinet 1 in forward / rearward directions and leftward / rightward directions . thus , it is possible to adjust the upward / downward position and the leftward / rightward inclination of an image projected on a screen . the projector of the embodiment may be installed in a suspended state from a ceiling with the main body cabinet 1 being upside down , other than an installation manner that the bottom surface of the main body cabinet 1 is placed on an installation plane such as a desk surface or a floor surface . further , a front surface of the main body cabinet 1 is a flat surface without the terminal panel 240 and the air inlet 8 . accordingly , it is possible to install the projector of the embodiment in such a manner that the front surface of the main body cabinet 1 is placed on an installation plane . in this case , an image is projected on the installation plane itself . fig3 is a diagram showing an internal structure of the projector . fig3 is a perspective view showing a state that the upper cabinet 3 is detached , when viewed from a front side . to simplify the description , in fig3 , an imager unit 15 and a projection optical unit 17 are indicated by the dotted lines . further , the position of the air inlet 8 is indicated by the one - dotted chain line . referring to fig3 , a lamp unit 14 , and the imager unit 15 for modulating light from the lamp unit 14 to generate image light are disposed on a front portion of the lower cabinet 2 . the lamp unit 14 is constituted of a light source lamp , and a lamp holder for holding the light source lamp ; and is configured so as to be detachably attached from above . a fan unit 16 is disposed behind the lamp unit 14 . the fan unit 16 supplies external air ( cooling air ) drawn through the air inlet 8 to the light source lamp to cool the light source lamp . the lamp holder is formed with an air duct for guiding the cooling air from the fan unit 16 to the light source lamp . the imager unit 15 includes a color wheel and a digital micromirror device ( dmd ). the color wheel separates white light from the light source lamp into light of respective colors such as red , green , blue in a time - sharing manner . the dmd modulates the light of the respective colors emitted from the color wheel based on an image signal . the projection optical unit 17 is disposed at a rear position of the imager unit 15 . the projection optical unit 17 enlarges image light generated by the imager unit 15 , and projects the enlarged image light onto a projection plane such as a screen . fig4 is a diagram schematically showing an arrangement of the projection optical unit 17 . in fig4 , the imager unit 15 , a control circuit unit 23 , and a noise filter unit 24 are schematically shown , in addition to the projection optical unit 17 . the projection optical unit 17 is constituted of a projection lens unit 101 , a reflection mirror 102 , and a housing 103 for housing the projection lens unit 101 and the reflection mirror 102 . the projection lens unit 101 has a plurality of lenses 101 a . the reflection mirror 102 is a curved mirror or a free curved mirror . as shown in fig4 , image light emitted from the imager unit 15 is entered into the projection lens unit 101 at a position shifted from the optical axis l of the projection lens unit 101 in a direction toward the top surface of the main body cabinet 1 . the entered image light receives a lens function by the projection lens unit 101 , and is entered into the reflection mirror 102 . thereafter , the projection angle of the image light is expanded by the reflection mirror 102 , and the image light is projected onto a projection plane ( screen ) via a light ray passage window 104 . as described above , image light is entered into the projection lens unit 101 at a position shifted from the optical axis l of the projection lens unit 101 in a direction toward the top surface of the main body cabinet 1 . in view of this , the reflection mirror 102 is disposed at a position shifted from the optical axis l of the projection lens unit 101 toward the bottom surface of the main body cabinet 1 . here , the reflection mirror 102 has a reflection surface larger than the lens surface of each lens 101 a constituting the projection lens unit 101 . accordingly , the shift amount of the reflection mirror 102 with respect to the optical axis l of the projection lens unit 101 is relatively large . consequently , there is defined a relatively large space g between a lower surface of the projection lens unit 101 and the bottom surface of the main body cabinet 1 ( lower cabinet 2 ). the space g is defined from the position where the projection lens unit 101 is disposed to the position where the imager unit 15 is disposed . referring back to fig3 , a power source unit 18 is disposed behind the fan unit 16 . the power source unit 18 is provided with a power source circuit to supply electric power to each electric component of the projector . a speaker 19 is disposed behind the power source unit 18 . sounds outputted through the speaker 19 are released to the outside through the sound output port 11 . a dmd cooling fan 20 is disposed on the right of the imager 15 . the dmd cooling fan 20 supplies external air drawn through the air inlet 8 to the imager unit 15 so as to cool the dmd . a lamp exhaust fan 21 is disposed on the left of the lamp unit 14 . the lamp exhaust fan 21 draws the air that has cooled the light source lamp , and discharges the air to the outside through the first air outlet 9 . a power source exhaust fan 22 is disposed on the left of the power source unit 18 . the power source exhaust fan 22 draws warmed air inside of the power source unit 18 , and discharges the warmed air to the outside through the second air outlet 10 . by flowing the air from the inside of the power source unit 18 to the power source exhaust fan 22 , fresh external air is supplied into the power source unit 18 through the air inlet 8 . as shown in fig3 and fig4 , in the projector of the embodiment , the control circuit unit 23 and the noise filter unit 24 are disposed in the space g defined below the projection lens unit 101 and the imager unit 15 . the noise filter unit 24 is provided with a circuit board mounted with a noise filter and a fuse thereon , and supplies electric power inputted from a commercial ac power source to the power source unit 18 after noise removal . fig5 a , 5 b , and 6 are diagrams showing a configuration of the control circuit unit 23 . fig5 a is a perspective view of the control circuit unit 23 in which the main control board 210 and the extension interface board 220 are not yet built into the holder 250 . fig5 b is a perspective view of the control circuit unit 23 in which the main control board 210 and the extension interface board 220 are built into the holder 250 . fig6 is a plan view of the holder 250 as seen from underneath . referring to fig5 a , 5 b , and 6 , the control circuit unit 23 is formed by the main control board 210 , the extension interface board 220 , a fixing board 230 , a terminal panel 240 , and the holder 250 . the main control board 210 has a control circuit for controlling various drive parts such as a light source lamp , a dmd , and the like . in addition , the main control board 210 has at a right end thereof various terminals 211 and has at a center thereof a connector 212 for connection with a dmd wiring board 15 a . the main control board 210 has total six attachment holes 213 formed at four corners , between two front corners , and between two back corners . in addition , the main control board 210 has positioning holes 214 formed next to the attachment holes 213 at the three corners other than the left and back corners . in fig5 a , the attachment holes 213 and the positioning holes 214 at the right and front corners are hidden by the terminal panel 240 . the extension interface board 220 has terminals 221 other than the terminals disposed on the main control board 210 . the fixing board 230 is made of a metallic material , and has the fixing portion 231 and the shielding portion 232 vertically integrated . the fixing portion 231 has one surface on which the interface board 220 and the main control board 210 are vertically aligned and fixed , and has the other surface on which the terminal panel 240 is fixed . the shielding portion 232 has a large number of openings 232 a with metallic meshes ( not shown ). as shown in fig3 , when the control circuit unit 23 is attached to the main body cabinet 1 , the shielding portion 232 is disposed on an inner side of the air inlet 8 . external air taken in by the air inlet 8 flows into the main body cabinet 1 through the openings 232 a . the shielding portion 232 blocks out electromagnetic waves that are about to leak outward from the air inlet 8 . the terminal panel 240 has openings shaped to be suitable for the terminals 211 and 221 . the terminals 211 and 221 are exposed from these openings . although not shown , the fixing portion 231 of the fixing board 230 has also openings through which the terminals 211 and 221 pass . the holder 250 is made of a metallic material ( for example , aluminum ), and has an upper plate 251 , and a front plate 252 and a back plate 253 on front and back sides of the upper plate 251 , respectively . the upper plate 251 has an opening 254 through which the dmd wiring board 15 a passes and an opening 255 for storing the bottom portion of the projection optical unit 17 at an incident end side . as shown in fig6 , the front plate 252 and the back plate 253 have six attachment pieces 256 corresponding to the six attachment holes 213 of the main control board 210 . the attachment pieces 256 have respective attachment holes 256 a . in addition , the two attachment pieces 256 of the front plate 252 on the both sides and the attachment piece 256 of the back plate 253 at a right end have respective positioning projections 256 b corresponding to the positioning holes 214 of the main control board 210 . further , the front plate 252 and the back plate 253 have at left ends respective attachment pieces 257 for attaching the holder 250 to the main body cabinet 1 . these attachment pieces 257 have also attachment holes 257 a . as shown in fig5 a , the main control board 210 and the extension interface board 220 are stored from underneath in a storage space surrounded by the upper plate 251 , the front plate 252 , and the back plate 253 . when stored in place within the storage space , the main control board 210 contacts the six attachment pieces 256 from underneath , and the three positioning holes 214 of the main control board 210 fit onto the corresponding positioning projections 256 b of the attachment pieces 256 . accordingly , the six attachment holes 213 of the main control board 210 are aligned with the corresponding attachment holes 256 a of the attachment pieces 256 . among the six attachment holes 213 of the main control board 210 , the two central attachment holes 213 and the corresponding attachment pieces 256 are fastened to each other by screws . accordingly , as shown in fig5 b , the main control board 210 and the extension interface board 220 are fixed to the holder 250 , whereby the control circuit unit 23 is completely assembled . at this point of time , the attachment holes 213 of the main control board 210 at the four corners and the corresponding attachment pieces 256 are not fastened to each other by screws . when the imager unit 15 ( not shown in fig5 b ) is attached to the top surface of the holder 250 , the dmd wiring board 15 a connected to the dmd is inserted through the opening 254 into the storage space of the holder 250 as shown in fig5 b . then , a connector ( not shown ) formed on the dmd wiring board 15 a is connected to the connector 212 on the main control board 210 . the dmd wiring board 15 a has a signal line for the dmd through which drive signals from the dmd driver on the main control board 210 are transmitted to the dmd . in addition , the main control board 210 may discharge electromagnetic waves during operation , but the holder 250 made of a metallic material can block out such electromagnetic waves . fig7 is a diagram showing a configuration of the optical unit u . fig8 is a diagram showing the main body cabinet 1 with the optical unit u not yet attached . as shown in fig7 , the lamp unit 14 , the imager unit 15 , the projection optical unit 17 , the fan unit 16 , and the dmd cooling fan 20 are fixed to the holder 250 of the control circuit unit 23 , by an appropriate fixing method such as screwing or the like . accordingly , the control circuit unit 23 , the lamp unit 14 , the imager unit 15 , the projection optical unit 17 , the fan unit 16 , and the dmd cooling fan 20 are integrated into one optical unit u . as shown in fig8 , for fixation of the optical unit u , the lower cabinet 2 is provided with four attachment portions 25 corresponding to the four attachment pieces 256 of the holder 250 not yet screwed at incorporation of the main control board 210 , two attachment portions 26 corresponding to the two attachment pieces 257 at the left end of the holder 250 , and one attachment portion 27 corresponding to an attachment piece ( not shown ) provided on the housing 103 of the projection optical unit 17 . the optical unit u is fixed to the bottom surface of the lower cabinet 2 as shown in fig3 , the seven attachment pieces 256 and 257 by screws to the corresponding seven attachment portions 25 , 26 , and 27 by fastening . as described above , the attachment holes 213 of the main control board 210 are aligned with the attachment holes 256 a of the four attachment pieces 256 . therefore , the main control board 210 is fastened together with the attachment pieces 256 to the attachment portions 25 by screws . accordingly , the main control board 210 is firmly fixed by screws at the total six points to the holder 250 . if the main control board 210 is broken , the main control board 210 needs to be removed from the holder 250 for repair or replacement with a new main control board 210 . in this case , an engineer ( service person ) unscrews the seven screws fixing the optical unit u and removes the optical unit u from the main body cabinet 1 . after that , he / she unscrews the two screws to remove the main control board 210 from the holder 250 . accordingly , this embodiment eliminates the need to follow a troublesome procedure : firstly removing the imager unit 15 and the projection optical unit 17 above the control circuit unit 23 from the main body cabinet 1 ; and then removing the control circuit unit 23 from the main body cabinet 1 . this facilitates replacement of the main control board 210 . as the foregoing , in this embodiment , when the reflection mirror 102 is disposed so as to be shifted from an optical axis of the projection lens unit 101 , a space g is produced under the projection lens unit 101 between the reflection mirror 102 and the main body cabinet 1 . the produced space g is used to dispose the main control board 210 and the extension interface board 220 in the space g . disposing the boards in this manner makes the projector 1 less prone to be larger in dimension in the direction of projection . accordingly , it is possible to make the outer shape of the projector 1 compact without deteriorating the projection capability of the projector 1 . fig9 is a diagram showing one projection mode in this embodiment . in this embodiment , the main control board 210 and the extension interface board 220 are disposed in the space g as described above , which prevents a dimension d 1 of the main body cabinet 1 from becoming larger in the direction of projection . in this case , the direction of projection is the front - back direction shown in fig9 . in this embodiment , since it is possible to prevent the dimension d 1 from becoming larger as stated above , a shortest value of a throw distance ( distance between the screen and the projection port 4 in the direction of projection ) d 2 can be reduced . the throw distance d 2 becomes shortest when a front surface c of the main body cabinet 1 is pressed against a wall as shown in fig9 . in the projection mode of fig9 , it is possible to change a size of an image projected onto the screen with variations in the throw distance d 2 by moving the projector backward and forward . in this embodiment , since the shortest value of the throw distance d 2 can be reduced , a projected image can be made smaller in size , thereby providing a wider adjustment range of projected image size by moving the projector backward and forward . in this embodiment , since the main control board 210 and the extension interface board 220 are disposed in the space g , it is possible to prevent the main body cabinet 1 from becoming larger in height . accordingly , the main body cabinet 1 does not block out projection light emitted from the projection port 4 . this allows the projector to be made compact without deteriorating the projection capability . in addition , in this embodiment , the main control board 210 and the extension interface board 220 are vertically aligned in the storage space of the holder 250 , that is , in the space g . accordingly , the control circuit unit 23 can be smaller in dimension in the direction of projection , which makes it possible to further prevent that the dimension d 1 of the main body cabinet 1 becomes larger in the direction of projection . further , in this embodiment , the terminal panel 240 is provided on the right surface of the main body cabinet 1 in a position corresponding to the space g in which the main control board 210 and the extension interface boad 220 are disposed . accordingly , it is possible to form the air inlet 8 above the terminal panel 240 , that is , in a position corresponding to the imager unit 15 and the projection lens unit 101 , without interference by the terminal panel 240 . this allows the air inlet 8 to be made wider in area without interference by the terminal panel 240 . therefore , it is possible to supply a large amount of intake air to the main body cabinet 1 and cool favorably heat - generating portions inside the main body cabinet 1 , such as the dmd of the imager unit 15 , and the like . although an embodiment of the present invention is as described above , the present invention is not limited to this embodiment . in addition , the embodiment of the present invention can be appropriately modified in various manners within the scope of technical ideas shown in the claims . for example , in the foregoing embodiment , the dmd is used as an imager constituting the imager unit 15 . alternatively , a liquid crystal panel may be used instead . in addition , in the foregoing embodiment , the lamp unit 14 having a light source lamp is used . alternatively , any light source other than a lamp light source , for example , a laser light source or an led light source may be used instead . further , in the foregoing embodiment , the holder 250 holds the extension interface board 220 together with the main control board 210 . alternatively , in addition to the extension interface board 220 or instead of the extension interface board 220 , the holder 250 may hold any other circuit board , for example , a communication circuit board , together with the main control board 210 . such a communication circuit board has a communication circuit for performing communications between the projector and another device such as a personal computer or the like . | 6 |
the trials below select three points of intervention chosen to demonstrate the claimed invention , namely ( 1 ) ex - screw press ( point 3 in fig2 ); ( 2 ) underflow sludge ( point 5 in fig2 ); and ( 3 ) effluent sludge ( sludge ex - centrifuge ) ( point 6 in fig2 ). three ultrasonic methods were selected to treat selected samples : ultrasound 1 ( us1 ) using a long titanium rod type sonotrode or a short titanium rod sonotrode , ultrasound 2 ( us2 ) and a two - step method ( us1 and us2 ). after mixing and preheating to 70 ° c . the samples were pumped through the ultrasonic system . the mixture was recirculated through the us1 system . in the us2 system , transducers are placed in a water bath at 70 ° c . and indirectly emit sound through the walls of a plastic centrifuge tube holding palm oil material . us1 1 is produced by a long titanium rod type sonotrode using a frequency of 20 khz and power of 238 db us1 s is produced by a short titanium rod type sonotrode using a frequency of 20 khz and power of 238 db us2 uses frequencies of 400 khz and 1 . 6 mhz and power of 231 db . in fig2 points 1 - 5 are separate interventions at selected frequencies . the flow through sonotrode horn utilised for us1 at frequency of 20 khz facilitates breakdown of the plant tissue and oil bearing cells and coalescence of released oil is facilitated with application of higher frequencies . ultrasonic frequencies ( 400 khz - 2 mhz ) obtained with plate transducers ( us2 ) unmix / split oil emulsion through coalescence and oil stripping from solid particulate interfaces by streaming . the decanter ( also called clarifier ) offers a static system where an undisturbed ultrasonic field allows coalescence to occur . increased coalescence promotes separation , decreasing the oil concentration in the underflow sludge at the bottom of the decanter , therefore decreasing residence times . the transducer three dimensional set up can be arranged to bring oil particles together to a point and enhance coalescence . further coalescence can be obtained by pulsing . ultrasonic treated and non - treated samples were placed in a settling tube and left to stand in a water bath at 85 ° c . for 1 hour . the height of the oil from the top layer was measured and the oil separated was removed by pipetting . the remaining sludge was then centrifuged at 1000 g and the height of the oil separated was measured . results are expressed as % oil volume separated from sample on a feed volume basis . tables 1 , 2 and 3 summarise the oil separation after different ultrasonic treatment combinations in the ex - screw press oil and in the sludge ex - centrifuge after ultrasound treatment . the three ultrasonic methods us1 1 , us2 and us1 1 + us2 provided increased yield in the ex - screw press feed sample ( table 1 ). this is partly due to an enhanced separation during settling . the most remarkable case is when using plate transducers ( us2 ) with a 25 % increase with respect to the static control during settling , which also indicates a faster rate of separation . however , ultrasonic method us1 , caused emulsification of the oil and reduced oil separation ( table 2 ). however , the only method that significantly enhanced oil separation in the underflow sludge from the settling tank was us2 showing an additional 7 % oil removal after decanting and an additional oil removal of 4 % with respect to the static control . results show the advantage of using plate transducers alone , as opposed to when the sludge was treated with the flow through low frequency sonotrodes . combination of both plates and sonotrode type transducers also provided negative results . pilot - scale trials further demonstrate other ultrasonic treatment conditions for enhanced oil extraction in various plate transducer configurations and with single frequencies or multiple frequency combinations . ultrasound was applied to the ex - screw press feed ( point 3 in fig2 ): ultrasound 3 ( us3 ), ultrasound 4 ( us4 ), and ultrasound 5 ( us5 ); configurations in fig6 a , b , and c , respectively ). fresh samples were obtained directly from the factory processing line at 85 ° c . and processed directly in an ultrasonic vessel for each configuration . in all cases transducers were held vertically or horizontally inside the vessel and directly emit sound into the palm oil material . us3 uses a frequency of 400 khz and power between 222 to 227 db with two vertical plate transducers arranged perpendicularly in two different planes ; us4 uses frequencies of 400 khz ( only ), or 400 khz and 1 mhz , or 400 khz and 2 mhz and power of 224 to 226 db ; two vertical 400 khz plate transducers were perpendicularly arranged to operate with higher frequency transducers horizontally located at the bottom ; and us5 uses frequencies of 400 khz , or 1 mhz , or 2 mhz and a power of 221 db with transducers placed horizontally at the bottom of the tank . oil separation during settling was followed in two identical tanks filled with the same ex - screw press feed . settling in one of the tanks occurred with operating transducers ( ultrasound on ), while the other tank had no operating transducers ( ultrasound off ). the height of the oil layer in each tank was measured at the end of the run . results are expressed as % oil separation from samples . samples were taken at various heights of the tank , centrifuged at 1000 g , and the volume of oil separated was measured . the oil remaining in the sludge after centrifugation and the oil content in the original feed were analysed using a soxhlet method . table 4 summarises the amount of oil separation from various ultrasonic treatment combinations in the ex - screw press oil and fig7 , 8 and 9 represent the increased rate of separation achieved with ultrasound . the three ultrasonic methods us3 , us4 and us5 provided increased oil removal in the ex - screw press oil sample ( table 4 ). a faster oil separation was observed when exposed to all transducer configurations . the most remarkable case is us3 with a 700 % increase in oil separation compared to the respective static control . soxhlet analysis also indicated a 44 % reduction of the oil remaining in the sludge after centrifugation . from the above it can be seen that this invention provides a significant improvement in yield of oil for specific plate transducer arrangements . in particular , benefits can be seen from using a single plate transducer in vertical form , and its combinations with another vertical plate located at a perpendicular plane , either at the same or at different levels of the settling tank . it is worth noticing that even though faster separation of oil was obtained using horizontal plate transducers , these could not provide additional oil yield . nevertheless , acceleration of oil removal entails significant benefits in reducing production times . pilot - scale trials with transducers mounted outside the vessel ( with active face in direct contact with the sample ) additional pilot - scale trials demonstrate that high frequencies are efficient in enhancing oil extraction when using transducers externally mounted on pre - fabricated windows ( or cut outs ) across the vessel walls . this prototype ( fig1 ) has the advantage that only the active area of the transducers is in direct contact with the sample thereby reducing the heat load on the transducer and increasing its lifetime . the pilot - scale systems in fig1 a and 10 b have been designed to accommodate 600 khz and 400 khz transducers , respectively . the system parts are assigned with numbers indicating the following : ( 1 ) spare cut - out cover , ( 2 ) holder clamp bar , ( 3 ) assembly screw , ( 4 ) cut - out support frame , ( 5 ) transducer cooling port , ( 6 ) transducer signal port , ( 7 ) 600 khz plate transducer , ( 8 ) side window , ( 9 ) removable covers , ( 10 ) bottom sampling port , ( 11 ) top sampling port , ( 12 ) upper sampling port , ( 13 ) lower sampling port , and ( 14 ) 400 khz transducer plate . ultrasound was applied to the ex - screw press feed ( point 3 in fig2 ): ultrasound 6 ( us6 ), ultrasound 7 ( us7 ), and ultrasound 8 ( us8 ); configurations in fig1 ). samples were obtained directly from the factory processing line at 85 ° c . and processed directly in an ultrasonic vessel for each sound condition . us6 uses a frequency of 600 khz and power of 230 db with a single transducer plate externally mounted against the side wall of the vessel with a cut - out window ; us7 uses a frequency of 400 khz and power of 220 db with a single transducer plate externally mounted against the side wall of the vessel with a cut - out window ; us8 and us9 use a frequency of 600 khz and power of 220 and 224 db , respectively with a single transducer plate externally mounted against the side wall of the vessel with a cut - out window . table 5 summarises the amount of oil separation from single treatments at the same frequency in the ex - screw press oil . the three replicate runs at us6 provided increased oil removal than the static control in the ex - screw press oil sample after settling ( table 5 ) and also an increase in total decantable oil removal ( table 5 ). table 6 summarises the amount of oil separation in the ex - screw press oil from parallel treatments in two vessels using the same feed at two 400 khz and 600 khz . this comparison demonstrates that higher frequencies ( 600 khz ) are as effective as treatment at 400 khz . from the above it can be seen that this invention provides a significant improvement in yield of oil for specific plate transducer arrangements . in particular , benefits can be seen from using a single plate transducer in vertical form , and its combinations with another vertical plate located at a perpendicular plane , either at the same or at different levels of the settling tank . it is worth noticing that even though faster separation of oil was obtained using horizontal plate transducers , these could not provide additional oil yield . nevertheless , acceleration of oil removal entails significant benefits in reducing production times . those skilled in the art will understand that this invention may be implemented in embodiments other than those described . other likely points of intervention are shown in fig2 . throughout this specification the word “ comprise ”, or variations such as “ comprises ” or “ comprising ”, will be understood to imply the inclusion of a stated element , integer or step , or group of elements , integers or steps , but not the exclusion of any other element , integer or step , or group of elements , integers or steps . any discussion of documents , acts , materials , devices , articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention . it is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . | 0 |
the embodiments provide an information processing method and an electronic device for solving the technical problem that exists in a deformable electronic device in that the options for change in the device &# 39 ; s configuration are limited . to solve the above - described technical problem , the technical solutions in the embodiments of the present application have the following general ideas . in one embodiment , the method comprises a determination of a current working state of the electronic device as a first working state , and a current configuration of the electronic device as a first configuration corresponding to the first working state . the method may also comprise detection of information , and control of the electronic device to be adjusted from the first working state to a second working state different from the first working state when the information satisfies a preset condition and the electronic device is deformed from the first configuration to a second configuration corresponding to the second working state , wherein the second configuration is different from the first configuration . in other words , on the basis of the current working state of the deformable electronic device , the current configuration of the deformable electronic device can be adjusted to a configuration corresponding to the current working state , so as to solve the technical problem where the options for configuration of the electronic device are limited . to better understand the above - described technical solutions , the technical solutions of the embodiments are described in detail with reference to the accompanying drawings and specific embodiments . it should be understood that the embodiments of the present application and the specific features in the embodiment are detailed descriptions of the technical solutions , rather than limitations of the technical solutions , and the embodiments of the present application and the technical features in the embodiments may be combined together without conflict . in one embodiment , the electronic device comprises a deformable device comprising a flexible screen , such as a smart phone , notebook computer , tablet computer , wearable device , or other deformable electronic device . fig1 depicts a method flow diagram for an information processing method . generally speaking , steps s 101 , s 102 , and s 103 involve the following : s 101 involves determining a current working state of a deformable electronic device as a first working state , and a current configuration of the electronic device as a first configuration corresponding to the first working state . s 103 involves controlling the electronic device to be adjusted from the first working state to a second working state different from the first working state when the information satisfies a preset condition , and the electronic device is deformed from the first configuration to a second configuration corresponding to the second working state , wherein the second configuration is different from the first configuration . in one embodiment , the specific implementation process of step s 101 to step s 103 is as follows . first , a current working state of the electronic device is determined and designated as a first working state . in one embodiment , this could be a screen - locked state . then , a first configuration is determined based on the current configuration of the electronic device . this first configuration corresponds to the first working state . consider the following illustrative example . when a user carries the electronic device when in the screen - locked state , it may be crumpled up , folded or otherwise configured so that it can be placed comfortably into a user &# 39 ; s pocket . at this time , the current configuration of the electronic device is a crumpled - up configuration corresponding to the screen - locked state . once the first working state and first configuration have been determined , information is detected . during a specific implementation , the information may be a piece of verification information , information input by the user , or some other information . after the information satisfies a preset condition , the electronic device is adjusted from the first working state to a second , different , working state . for example , if the user inputs verification information that is capable of releasing the screen - locked state that the electronic device is currently in , the electronic device is adjusted from the screen - locked state to the screen - unlocked state . meanwhile , the electronic device is deformed from the first configuration to the second configuration corresponding to the second working state . to continue the illustrative example , if the first configuration of the electronic device in the screen - locked state is a crumpled - up configuration , and the electronic device is adjusted from the screen - locked state to the screen - unlocked state , the current configuration of the electronic device will be changed from the first , crumpled - up configuration to a second , straight panel configuration which is convenient for the user to use , thereby greatly improving the user experience . this method further comprises controlling the electronic device to be adjusted from the first configuration to the second configuration corresponding to the second working state . in other words , the electronic device is capable of actively deforming to the second configuration as a result of a change of the current working state of the electronic device . alternatively , the method may comprise receiving an external force applied to the electronic device , wherein the electronic device is deformed from the first configuration to the second configuration under the effect of the external force . in such a case , the electronic device adjusts its current configuration to the second configuration corresponding to the current working state on the basis of the change in the current working state of the electronic device . to continue using the above unlocked screen as an example , when the current working state of the electronic device is adjusted from the screen - locked state to the screen - unlocked state , the electronic device is capable of adjusting the current configuration from the crumpled - up configuration to the straight panel configuration on the basis of the current screen - unlocked state , so that the user may perform operations on the device in a more comfortable and convenient way than would be possible in the crumpled - up configuration . in some embodiments , the information detected in step s 102 may have a variety of forms , and is not limited to the several forms mentioned below . when , however , the information comprises physiological parameter information , referring to fig2 , the method may further comprise the following : s 201 involves monitoring physiological parameters of a user currently using the electronic device . s 202 involves indicating that the preset condition is satisfied if the physiological parameters show that the electronic device is not in contact with at least one body part of the current user , after which the electronic device is deformed from the first configuration to the second configuration . s 203 involves the electronic device maintaining itself in the first configuration if the physiological parameters show that the electronic device is in contact with at least one body part of the current user . one specific implementation process of step s 201 to step s 203 is as follows . first , the physiological parameters of a user currently using the electronic device are monitored . these physiological parameters may include respiratory system parameters and circulatory system parameters , such as heart rate information , respiratory frequency , and others . if the physiological parameters show that the electronic device is not in contact with at least one body part of the current user , the preset condition is satisfied , and the electronic device is deformed from the first configuration to the second configuration . as an example , in some embodiments , the electronic device comprises a deformable smart phone and the user bends the smart phone to wrap around the user &# 39 ; s wrist , the current configuration of the smart phone is a circular configuration . when the heart rate information of the user is not detected by a pressure sensor within the smart phone , it means that the smart phone has been removed from the user &# 39 ; s wrist . in this case , the smart phone recognizes that it is not in contact with the skin surface of the user &# 39 ; s wrist , and as a result it is determined that the smart phone satisfies the preset condition and would therefore be deformed from the circular configuration to the straight panel configuration . additionally , in some embodiments , the user may be alerted by the change in the current configuration of the electronic device . for instance , once the smart phone is removed from the user &# 39 ; s wrist , the smart phone may be deformed to alert the user that the smart phone has changed to a new working state , which may indicate that the smart phone is being stolen . however , when the heart rate information of the user is obtained through the pressure sensor in the smart phone ( for example , 75 beats per minute ), it is indicated that the smart phone is in contact with the skin surface of the user &# 39 ; s wrist , and will stay in the circular configuration . in various embodiments , those skilled in the art may also obtain other physiological parameters of the user by monitoring the electronic device , so as to detect whether the electronic device satisfies the preset condition . these other physiological parameters may include respiratory frequency , skin texture and contact area with the user &# 39 ; s body part , among others . in some embodiments , determining whether the electronic device satisfies the preset condition may be based on the physiological parameters of the size of the contact area with the user &# 39 ; s body part . in such cases , the size of the contact area between the electronic device and the user &# 39 ; s body part may be detected through a relevant module for skin detection in the electronic device . if the detected contact area between the electronic device and the user &# 39 ; s body part passes a preset threshold , such information satisfies the preset condition , and the electronic device may be deformed from the first configuration to the second configuration , thereby immediately and efficiently avoiding the loss of the electronic device . various physiological parameters may be used to satisfy the preset condition , and other embodiments may include other physiological parameters , though they not explicitly detailed herein . in some embodiments , the information detected in step s 102 may comprise verification information corresponding to an input operation performed by an operating body for the electronic device . such verification information may include pattern information , fingerprint information , iris information , or other information sufficient for verification purposes . at this time , one embodiment of the implementation process of step s 101 to step s 103 may be illustrated wherein the electronic device comprises a smart phone , the first working state comprises the screen - locked state and the first configuration comprises a rolled - up configuration . when a detected input operation is a preset unlocking operation , the electronic device will be in the unlocked state and as a result , the current configuration of the electronic device will be adjusted from the rolled - up configuration to an un - rolled configuration . in such a situation , the preset unlocking operation may include inputting a particular unlocking pattern by the user for the electronic device , and on the basis of the unlocking pattern , the electronic device can be adjusted from the screen - locked state to the screen - unlocked state . this implementation process is not limited to the specific embodiment described herein . in some embodiments , wherein the information detected in step s 102 is a to - be - processed communication event from a second electronic device , the specific implementation process of step s 102 to step s 103 may comprise as follows . in one embodiment , the smart phone is in a standby state and is in a rolled - up configuration , and receives a to - be - processed communication event from another electronic device . this to - be - processed communication event may be a short message , wechat information , qq information or other incoming information . after this to - be - processed communication is received , the smart phone determines whether the to - be - processed communication satisfies the preset condition . if the preset condition is met , the smart phone will be adjusted from the standby state to a normal working state , and the configuration of the smart phone will be deformed from the rolled - up configuration to an un - rolled configuration , so as to facilitate the viewing of information by the user or the processing of an incoming request . this both improves service performance of the smart phone and simultaneously provides a better user experience . if the preset condition is not satisfied , the smart phone will remain in the standby state and in the rolled - up configuration . in some embodiments , the method further comprises : keeping the current working state of the electronic device as the first working state and maintaining the current configuration of the electronic device as the first configuration after verifying that the information does not satisfy the preset condition . in some embodiments , if the information does not satisfy the preset condition , the current working state of the electronic device is kept as the first working state , and the electronic device will be actively maintained in the first configuration . even if an external force is applied on the electronic device , as described in an earlier embodiment , the electronic device cannot be passively deformed from the first configuration to the second configuration . in other embodiments , the method further comprises a response by the electronic device . when in the first working state , the electronic device can respond to instructions in a first part of an instruction set , and when in the second working state , can respond to instructions in a second part of the instruction set . furthermore , the number of instructions in the first part is different from the number of instructions in the second part . for example , in one embodiment , the first working state and the second working state of the electronic device may be a screen - locked state and a screen - unlocked state respectively . in another , the first working state and the second working state may be the screen - unlocked state and the screen - locked state respectively . the method disclosed herein , in some embodiments , may additionally comprise a situation wherein the number of instructions in the first part of an instruction set corresponding to the first working state is less than the number of instructions in the second part of an instruction set corresponding to the second working state . in such a situation , the electronic device may be deformed from the first configuration to the second configuration , wherein the electronic device is deformed from a folded state to an unfolded state ; alternatively , the number of instructions in the second part corresponding to the second working state may be less than the number of instructions in the first part corresponding to the first working state . in this case , the electronic device may be deformed from the first configuration to the second configuration , wherein the electronic device is deformed from an unfolded state to a folded state . in one embodiment , the first working state and the second working state of the electronic device may respectively comprise a screen - locked state and a screen - unlocked state , and the electronic device is deformed from the first configuration to the second configuration , which respectively comprise a folded state and an unfolded state . that is , the electronic device is deformed from the corresponding folded configuration in the screen - locked state to the corresponding unfolded configuration in the screen - unlocked state , thereby greatly facilitating the user &# 39 ; s convenience of use . alternatively , the first working state and the second working state of the electronic device may respectively comprise the screen - unlocked state and the screen - locked state , and the electronic device is deformed from the first configuration to the second configuration , which respectively comprise an unfolded state and a folded state . in other words , the electronic device may also be deformed from the corresponding unfolded configuration in the screen - unlocked state to the corresponding folded configuration in the screen - locked state . moreover , the various embodiments may be applied to various life scenarios for alerting the user in time . by way of one specific example , user a is to process some important files in an office and the contents of these important files are relatively confidential . after user a enters the office , a smart phone of user a is controlled to be in a deformable state and is adjusted to a right - angle configuration , and then is snapped on a door of user a ′ s office , wherein one side of the smart phone faces a hallway and the other side faces an orientation that may be visible to user a . the side of the smart phone facing the hallway is provided with an infrared camera that may detect that there are other people approaching user a &# 39 ; s office . in response , the side of the smart phone bending towards the user a may , through continuous flashing of the provided led lamps or other visual or auditory signals , alert user a that the current environment is unsafe and that user a should pause review of the confidential files . then , after user a processes these confidential files , the smart phone is removed , and the electronic device may be maintained in a certain fixed configuration . again , by way of another specific example , user b rides a bicycle on a relatively remote road at night . in this situation , the current configuration of the smart phone may be maintained in the folded state , so that the smart phone is snapped on a handlebar of the bicycle . one side of the smart phone faces in a substantially forward direction of travel , and the other side faces a substantially backward direction . when the smart phone detects that there are other people approaching user b , the smart phone , through safety alert information such as voice broadcasting , flashing of red led lamps , or the like , timely alerts user b to adopt safety measures in time to avoid hazards . of course , the user may adapt the specific configuration ( s ) to meet his or her own needs . furthermore , other embodiments are contemplated , but are not enumerated herein . fig3 depicts one embodiment of a deformable electronic device , comprising a housing 10 , a processor 20 coupled to the housing 10 , wherein the processor 20 determines a current working state of the electronic device as a first working state , and a current configuration of the electronic device as a first configuration corresponding to the first working state . the processor 20 also may detect information and control the electronic device to be deformed from the first working state to a second working state different from the first working state when the information satisfies a preset condition . after the preset condition is satisfied , the electronic device is deformed from the first configuration to a second configuration corresponding to the second working state , wherein the second configuration is different from the first configuration . in some embodiments , the processor 20 is specifically used for controlling the electronic device to be adjusted from the first configuration corresponding to the first working state to the second configuration corresponding to the second working state . it may be further used for recognizing an external force applied to the electronic device , wherein the electronic device is deformed from the first configuration to the second configuration corresponding to the second working state under the effect of the external force . furthermore , the processor 20 may also be used for keeping the current working state of the electronic device as the first working state and maintaining the current configuration of the electronic device as the first configuration after verifying that the information does not satisfy the preset condition . in the embodiment of the present application , the processor 20 is further used to respond to instructions in a first part of an instruction set ; and the electronic device , when in the second working state , can respond to instructions in a second part of the instruction set , wherein the number of instructions in the first part is different from the number of instructions in the second part . fig4 , depicts an electronic device comprising a first determination unit 30 , configured for determining a current working state of the electronic device as a first working state , and a current configuration of the electronic device as a first configuration corresponding to the first working state ; a first detection unit 40 , configured for detecting information ; and a first control unit 50 , configured for controlling the electronic device to be adjusted from the first working state to a second working state different from the first working state when the information satisfies a preset condition , and the electronic device is deformed from the first configuration to a second configuration corresponding to the second working state , wherein the second configuration is different from the first configuration . in some embodiments , the first control unit 50 may be used for controlling the electronic device to be adjusted from the first configuration to the second configuration corresponding to the second working state ; or for recognizing an external force applied to the electronic device , and the electronic device is deformed from the first configuration to the second configuration corresponding to the second working state under the effect of the external force . in some embodiments , the electronic device further comprises : a first detection unit , configured for monitoring physiological parameters of a user currently using the electronic device ; a second control unit , configured for indicating that the preset condition is satisfied if the physiological parameters show that the electronic device is not in contact with at least one body part of the current user and the electronic device is deformed from the first configuration to the second configuration ; and a third control unit , configured for controlling the electronic device to maintain itself in the first configuration if the physiological parameters show that the electronic device is in contact with the at least one body part . in some embodiments , the electronic device further comprises a fourth control unit , configured for keeping the current working state of the electronic device as the first working state and maintaining the current configuration of the electronic device as the first configuration after verifying that the information does not satisfy the preset condition . furthermore , in some embodiments , the electronic device , when in the first working state , can respond to instructions in a first part of an instruction set , and when in the second working state , can respond to instructions in a second part of the instruction set , and the number of instructions in the first part is different from the number of instructions in the second part . in other embodiments of the electronic device , the number of instructions in the first part corresponding to the first working state is less than the number of instructions in the second part corresponding to the second working state , and the first control unit 50 is used for deforming the electronic device from a folded state to an unfolded state . alternatively , the number of instructions in the second part corresponding to the second working state may be less than the number of instructions in the first part corresponding to the first working state , and the first control unit 50 is used for deforming the electronic device from an unfolded state to a folded state . by means of one or more technical solutions in the embodiments , the following one or more technical effects can be achieved . the desired technical effects may be achieved by determining a current working state of the electronic device as a first working state , and a current configuration of the electronic device as a first configuration corresponding to the first working state ; detecting information ; controlling the electronic device to be adjusted from the first working state to a second working state different from the first working state when the information satisfies a preset condition ; and deforming the electronic device from the first configuration to a second configuration corresponding to the second working state , wherein the second configuration is different from the first configuration . in other words , based on the current working state of the deformable electronic device , the current configuration of the deformable electronic device can be adjusted to a configuration corresponding to the current working state , so as to solve the technical problem that exists in a deformable electronic device in that the options for change in the device &# 39 ; s configuration are limited . in some embodiments , the electronic device being deformed from the first configuration to the second configuration corresponding to the second working state may perform various functions , such as controlling the electronic device to be adjusted from the first configuration to the second configuration corresponding to the second working state ; or recognizing an external force applied to the electronic device , and the electronic device is deformed from the first configuration to the second configuration corresponding to the second working state under the effect of the external force . in some embodiments , the electronic device is capable of actively adjusting its current configuration on the basis of the current working state . in other embodiments , the electronic device , when under the effect of an external force , adjusts the current configuration of the electronic device , thereby improving performance of the electronic device and providing a more enjoyable experience for the user . in some embodiments , the physiological parameters of the user currently using the electronic device are monitored . a preset condition may be satisfied if the physiological parameters show that the electronic device is not in contact with at least one body part of the current user , and the electronic device is deformed from the first configuration to the second configuration . contrarily , the electronic device is able to maintain itself in the first configuration if the physiological parameters show that the electronic device is in contact with the at least one body part . in other words , the current configuration of the electronic device can be adjusted directly on the basis of the physiological parameter information of the current user , ensuring the device safety while also improving the user experience . those skilled in the art will understand that the embodiments may be provided as a method , a system or a computer program product . therefore , the embodiments may be in the form of a hardware - only embodiment , a software - only embodiment , or an embodiment of a combination of hardware and software . moreover , the embodiments may be in the form of a computer program product which is implemented on one or more computer available storage media ( including , but not limited to , disk storage , cd - rom , optical storage , and the like ) which comprises computer available program codes . the embodiments are described with reference to the methods , devices ( systems ) and flow diagrams and / or block diagrams of computer program products . it should be understood that computer program instructions may be used to implement each process and / or block in the flow diagrams and / or block diagrams , and combinations of processes and / or blocks in the flow diagrams and / or block diagrams . the computer program instructions may be provided to a universal computer , a dedicated computer , an embedded processor or the processor of another programmable data processing device to generate a machine , such that the computer or the processor of another programmable data processing device executes instructions to generate a unit to implement functions designated in one or more processes in a flow diagram and / or one or more blocks in a block diagram . the computer program instructions may also be stored in a computer readable storage that can cause a computer or another programmable data processing device to work in a specific manner , such that the instructions stored in the computer readable storage generates a product comprising an instruction unit , and the instruction unit implements functions designated by one or more processes in a flow diagram and / or one or more blocks in a block diagram . the computer program instructions may also be installed in a computer or another programmable data processing device , such that a series of operation steps are executed on the computer or another programmable device to generate computer implemented processing , and therefore , the instructions executed in the computer or another programmable device provide steps for implementing functions designated in one or more processes in a flow diagram and / or one or more blocks in a block diagram . specifically , the computer program instructions corresponding to the information processing method in the embodiment of the present application can be stored in a storage medium such as an optical disc , a hard disk , a usb flash disk , or other storage medium . when the computer program instructions corresponding to the information processing method in the storage medium are read or executed by an electronic device , the following steps may be included : determining a current working state of the electronic device as a first working state , and a current configuration of the electronic device as a first configuration corresponding to the first working state ; controlling the electronic device to be adjusted from the first working state to a second working state different from the first working state when the information satisfies a preset condition and the electronic device is deformed from the first configuration to a second configuration corresponding to the second working state , wherein the second configuration is different from the first configuration . as a result , when the computer instructions stored in the storage medium and corresponding to the step in which the electronic device is deformed from the first configuration to the second configuration are executed , the following steps may be included : controlling the electronic device to be adjusted from the first configuration to the second configuration corresponding to the second working state ; or recognizing an external force applied to the electronic device , and deforming the electronic device from the first configuration to the second configuration under the effect of the external force . optionally , when the computer instructions stored in the storage media and corresponding to the step are executed , the method may further comprises : monitoring physiological parameters of a user currently using the electronic device ; indicating that the preset condition is satisfied if the physiological parameters show that the electronic device is not in contact with at least one body part of the current user and the electronic device is deformed from the first configuration to the second configuration ; and maintaining the electronic device in the first configuration if the physiological parameters show that the electronic device is in contact with at least one body part . optionally , when the computer instructions stored in the storage media and corresponding to the information detection step are executed , the method may further comprise keeping the current working state of the electronic device as the first working state and maintaining the current configuration of the electronic device as the first configuration after verifying that the information does not satisfy the preset condition . optionally , in response to execution of the computer instructions stored in the storage media , the electronic device , when in the first working state , may respond to instructions in a first part of an instruction set . alternatively , when the electronic device is in the second working state , it may respond to instructions in a second part of the instruction set . in either case , the number of instructions in the first part is different from the number of instructions in the second part . optionally , when the computer instructions stored in the storage media that correspond to the step in which the number of instructions in the first part corresponding to the first working state is less than the number of instructions in the second part corresponding to the second working state , and the electronic device is adjusted from the first configuration to the second configuration , the electronic device may be deformed from a folded state to an unfolded state . optionally , when the computer instructions stored in the storage media that correspond to the step in which the number of instructions in the second part corresponding to the second working state is less than the number of instructions in the first part corresponding to the first working state , and the electronic device is adjusted from the first configuration to the second configuration , the electronic device may be deformed from an unfolded state to a folded state . while preferred embodiments have been described , variations and modifications may be made to these embodiments once the basic inventive concept is obtained by those skilled in the art . thus , the appended claims are intended to be explained as including the preferred embodiments and all variations and modifications that fall within the scope of the present disclosure . it is clear that various variations and modifications to the embodiments may be made by those skilled in the art without departing from the spirit and scope of the present disclosure . accordingly , if these variations and modifications to the embodiments fall within the scope of the claims and the equivalents thereof , it is also intended that the present disclosure encompass these variations and modifications . | 6 |
a trainer in accord with the concepts of the invention includes a vertically extending support consisting of a column 10 having a lower end affixed to a base 12 . in the figures , the base 12 is represented as a generally planer block , and may consist of a weighted base of the illustrated configuration , but it is to be understood that the lower end of the column 10 could be pointed as to be inserted into the ground , or the column maybe otherwise supported in any conventional manner so as to be generally vertically oriented . at its upper end , the column 10 includes a clamp 14 utilizing wing nuts or threaded fasteners for adjustable or frictionally holding the bracket base 16 . the bracket base 16 includes pair of spaced parallel legs 18 each terminating at its outer end with a pivot supporting adapter 20 whereby the bracket legs 18 support the annular ring 22 through holes or other structure defined in the ring at generally diametrical locations . the ring 22 constitutes a feeler support , and while it could be formed of a single member of metal or synthetic plastic , preferably , the ring 22 is formed by three or four synthetic plastic rod - like elements each having an end socket whereby the elements may be assembled into the annular ring configuration and yet may be easily packaged for shipment and handling purposes . a pair of socket clamps 26 are attached to the annular ring 22 each by a screw 28 extending into the ring , as will be appreciated from fig4 . the socket 26 may be of the form of a conventional plastic pipe clamp and includes a cylindrical portion which defines a cylindrical socket . as will be appreciated from the drawings , one of the socket clamps 26 is located above its associated bracket leg 18 , while the other socket clamp is located below its nearest bracket leg 18 . each of the socket clamps 26 is associated with a tension spring 30 consisting of a pluralality of wire coils wherein adjacent coils are contiguously related . the lower coils are represented at 32 and are located within the socket 26 , while the upper coils are represented at 34 , fig4 defining a cylindrical tubular configuration . the coil portions 32 and 34 are connected by an inter - connecting coil 36 which has been deformed from its normal configuration and comprises a flexible hinge or connecting element between the coil portions 32 and 34 . a feeler element 38 is inserted within each of the coil portions 34 as will be appreciated from fig4 . in the disclosed embodiment of the invention the feeler elements comprise quarter - inch wood doweling and are of such a diameter as to be snugly received within the coil portion 34 , and yet , upon sufficient axial force being applied to the feeler element the element will slide within the coil portion 34 for axial adjustment therein . the feeler elements 38 each include an outer end 40 and an inner end 42 . the element central region 44 is defined intermediate the outer and inner ends . in the normal arrangement , the coil porton 34 will be located relatively close to the inner end 42 as shown in fig4 providing a cantilever support of the element 38 and the ends 40 may be defined as a free cantilever supported end . in typical usage , the bracket base 16 is oriented to the column 10 and the ring 22 is oriented to the bracket legs 18 as shown in fig1 - 3 . in this manner the ring 22 is substantially vertical as will be apparent in fig2 . the feeler elements 38 are positioned within their associated spring coil portions 34 wherein the element ends 40 extend significantly to the right of the plane of the ring 22 , such as about 12 inches . the golfer positions himself , &# 34 ; in front of &# 34 ; the ring 22 as shown in fig2 and , depending upon which club is being used , and the natural and correct position of the golfer to a golf ball , the golfer will be spaced from the plane of the ring 22 such that with the correct golf club swing the golf shaft 48 will be moved adjacent to the feeler element ends 40 without touching the same . during the golfers backswing , and during the forward golf swing , the golfer is able to accurately sense the location of the golf club shaft to the feeler element ends 40 , and if the golf club shaft 48 engages the element &# 39 ; s ends 40 during the golf swing such engagement is readily sensed by the golfer and will laterally deflect the struck feeling element without damage thereto in view of the resilient nature of the support for the feelers 38 as provided by the coil 36 . as will be appreciated from fig2 the golf ball to be struck will be located below the ring 22 , and as the ends 40 of the elements 38 are usually in the same vertical plane parallel to the ring 22 the training device greatly aids the golfer in maintaining a consistent swing . with the feeler elements 38 positioned as illustrated in the drawings , the right element 38 , fig1 will indicate the position of the golf club shaft as the golf club head approaches the ball , while the left feeler element is particular useful in sensing the position of the golf club after impact with the ball would have occured . the device of the invention permits the golfer to move his body in the most natural and comfortable manner , without restraint , yet the presence of the ring 22 in front of the golfer , and the presence of the feeler element &# 39 ; s ends 40 such as to engage the golf club shaft if the golf club shaft is moved too close to the ring during movement , trains the golfer to realize what a correct golf club swing feels like and the &# 34 ; restraint &# 34 ; achieved by the trainer with respect to influence upon the golfer is primarily mental as compared with many of the prior art devices which physically restrain the golfers movement during swinging and such devices are rarely successful in correcting faults . fig5 illustrates another manner in which the apparatus of the invention may be used . by tilting the annular ring 22 about the pivot ends 20 of the bracket legs 18 the annular ring may be obliquly oriented to the vertical and the golfer may position himself inside the ring as shown . the feeler elements 38 are removed from the ring , and the golf club shaft 48 is located &# 34 ; outside &# 34 ; the ring and as the golfer swings at a real or imaginary ball the golfer will observe and sense the proximity of the golf club shaft to the ring 22 during the swinging movement thereby producing a golf club shaft swing which is substantially &# 34 ; planar &# 34 ; resulting in a more accurately driven golf ball . in the illustrated embodiment the feeler elements 38 comprise cylindrical rods of relatively rigid material , such as wood dowel rod . however , it is to be understood that the feeler elements 38 could be formed of a flexible resilient material capable of deflection wherein the feeler rod could be rigidly mounted to the ring 22 and the deflection occuring in the feeler element upon being struck by the moving golf club shaft would result from deforming and flexing of the rod material itself . in such instance a synthetic plastic material would be most suitable material for forming the feeler element . it is appreciated that various modifications to the inventive concepts may be apparant to those skilled in the art without departing from the spirit and scope of the invention . | 0 |
intramolecular heck synthesis substantially eliminates the benzoxocine structural isomer and is described by scheme iii below . ## str4 ## the process is stereospecific by using a chiral ether . 5 - chlorosalicylic acid is iodinated in the 3 position with n - iodosuccinamide in dmf and esterified with thionyl chloride in methanol to afford 7 . the mitsunobu condensation of 7 with r - 2 - cyclohexen - 1 - ol yields the chiral ether 8 which can be cyclized via an intramolecular heck reaction to afford 9 with retention of chirality . lithium hydroxide hydrolysis of 9 followed by reduction with 5 % palladium on carbon yields 2 - chloro -[ 5a ( s )- 9a ( s )-( 5a , 6 , 7 , 8 , 9 , 9a - hexahydro )] dibenzofuran - 4 - carboxylic acid ( 3 s , s ) in 6 steps . this results in a stereospecific synthesis and eliminates the presence of the benzoxocine isomer . the following reaction examples describe the process of this invention and are intended to be representative and not to limit the reaction conditions involved . 5 - chlorosalicylic acid ( 20 g , 115 . 8 mmol ) is dissolved in dmf ( 100 ml ). to this solution is added nis ( 26 . 1 g , 116 . 0 mmol ) which causes the reaction to warm up to 60 ° c . the reaction is stirred at room temperature for 20 hours . at this point ethyl acetate ( 100 ml ) is added and the solution washed with 0 . 1n hcl ( 100 ml ). the organic phase is then washed with water ( 3 × 100 ml ), dried with sodium sulfate and evaporated under reduced pressure to yield 5 - chloro - 3 - iodosalicylic acid as off - white solid . ( mp 160 °- 163 ° c .) thionyl chloride ( 30 ml , 411 mmol ) is added dropwise to methanol ( 100 ml ) in an ice bath . the addition is controlled to hold the temperature at 25 ° c . upon completion of the addition 6 ( 25 g , 84 mmol ) is added and the reaction heated to reflux for 4 hours . the solids dissolve at first then after 2 hours solids start to come out of solution . after 4 hours tlc ( hex : etoac ; 9 : 1 ) shows no starting material . the reaction is cooled in the refrigerator for 12h . the solids formed are filtered washed with water ( 30 ml ), and dried under vacuum at 27 ° c . to yield methyl 5 - chloro - 3 - iodosalicylate as an off white solid . ( mp 143 °- 145 ° c .) methyl 5 - chloro - 3 - iodosalicylate ( 1 . 5 g , 4 . 8 mmol ) and triphenylphosphine ( 1 . 53 g , 5 . 7 mmol ) are placed in a dry 3 neck flask and anhydrous thf ( 20 ml ) is added by cannula under nitrogen pressure . r - 2 - cyclohexen - 1 - ol ( 0 . 48 g , 4 . 8 mmol ) is added by syringe and the reaction cooled to 0 ° c . a solution of thf ( 5 ml ) and diethylazodicarboxylate ( 0 . 91 g , 4 . 8 mmol ) is added dropwise over 1 hour , holding the temperature at 0 ° c . the reaction is held at 0 ° c . for 30 minutes after the addition and then allowed to warm to room temperature . stirring is continued for 3 hours . evaporation of the solvent under reduced pressure results in methyl - 5 - chloro - 3 - iodo - 2 -( 1 &# 39 ; s - cyclohex - 2 - enyl ) salicylate which is used directly in the next step . the ether 8 ( 1 . 1 g , 2 . 7 mmol ) is dissolved in thf ( 10 ml ) and acetonitrile ( 10 ml ). tetrakistriphenylphosphinepalladium ( 0 ) ( 0 . 47 g , 0 . 41 mmol ) and triethylamine ( 0 . 8 ml ) are added to the solution and it is heated to reflux for 16 hours . the reaction is cooled to 25 ° c . and water ( 30 ml ) is added . this solution is extracted with ether ( 2 × 50 ml ). the ether extracts are combined , filtered and washed with saturated sodium bicarbonate ( 100 ml ) and water ( 100 ml ). the organic layer is then dried over magnesium sulfate , filtered , and evaporated under reduced pressure to yield methyl - 2 - chloro - 5a ( s ), 9a ( s )- 5a , 8 , 9 , 9a - tetrahydrodibenzofuran - 4 - carboxylate . to a slurry of 9 ( 0 . 7 g , 206 mmol ) in water ( 15 ml ) is added lithium hydroxide monohydrate ( 0 . 16 g , 3 . 7 mmol ) and the mixture heated to 65 ° c . when no more starting material remains by tlc ( hex : etoac ; 9 ; 1 ), the mixture is cooled overnight in the refrigerator . the precipitated solids are filtered and then slurried in ethyl acetate ( 10 ml ). deionized water ( 5 ml ) is added to this slurry , which is then acidified with 10 % aqueous hydrochloric acid to a ph of 1 - 2 . the layers are separated and the ethyl acetate phase concentrated to dryness to give methyl - 2 - chloro - 5a ( s ), 9a ( s )- 5a , 8 , 9 , 9a - tetrahydrodibenzofuran - 4 - carboxylic acid . the acid 10 ( 0 . 5 g , 2 . 0 mmol ) is slurried in ( 15 ml ) of ethanol in a parr shaker reaction bottle . 5 % palladium on carbon ( 0 . 05 g ) is added to this and the reaction placed on a parr shaker . the reaction flask is evacuated and flushed with nitrogen three times then flushed with hydrogen twice before being filled to 35 psi with hydrogen . the reaction is run for 2 . 5 h . the reaction mixture is filtered through a frit and the catalyst is washed with ethanol ( 25 ml ). the solvent is evaporated under reduced pressure , this material is then dissolved in hexane ( 1 ml ), cooled to 5 ° c . and filtered to yield 2 - chloro -[ 5a ( s )- 9a ( s )-( 5a , 6 , 7 , 8 , 9 , 9a - hexahydro )]- dibenzofuran - 4 - carboxylic acid ( m . p . 150 °- 154 ° c . ). | 2 |
the present invention encompasses the concept of encapsulating aminoglycosides , and more specifically gentamicin , as a spherical - like formation by dissolving a phospholipid in water , adding an alcohol to the dissolved phospholipid to cause the phospholipid - water solution to separate into three immiscible phases , separating the middle phase from the other two phases , adding a surface active protein to the middle phase , storing the mass under refrigeration until the solution separates into a relatively semi - polar to a non - polar colloid rich phase , and a relatively semi - polar to a polar colloid poor phase , and combining gentamicin with the colloid poor phase . thus , a two phase liquid system is formed consisting of a non - polar phase insoluble in , and in equilibrium with , a polar liquid aqueous phase . gentamicin in the colloid poor phase is recovered for administration , the remaining phases being either discarded , or used to prepare additional encapsulated gentamicin . the internal phase comprises about 10 % by weight of the two phase system . the external phase makes up correspondingly about 50 % to about 90 % by weight of the aqueous liquid system . the two phase system herein described can be prepared by dispersing from about 5 %, by weight , to about 15 %, by weight , of albumin in distilled water , containing about 1 % to about 5 %, by weight , urea , and subsequently adding from about 0 . 1 % to about 10 % by weight , of a surface active agent such as lecithin . lecithin is a preferred surface active agent although any of the following phospholipids , or mixtures thereof , may be used as a substitute for lecithin . these phospholipids include cephalin , isolecthin , sphingomyelin , phosphatidyl serine , phosphatidic acid , phosphatidyl inositol and phosphatidyl choline , and the like . other similar compounds , known to the art , may also be used . an alternative method for preparing the two phase system is by combining a gelatin solution and acacia usp with distilled water . the resulting solution is then adjusted , depending upon the desired effect , to a ph in the range of about 6 to about 9 by using either sodium hydroxide or sodium bicarbonate . the methods of preparation of the two phase system may be one of several . in practice , the underlying requirement is that any ingredient , or combination of ingredients , must be capable of forming a nontoxic two phase aqueous solution . further , the mode of preparation results in a two phase aqueous system having an external equilibrium phase and an internal suspension phase . although the two phases have similar molecules , the concentration of the component molecules will be different in each of the two phases . at this point gentamicin may be added and the two phases may be separated . alternatively , upon separation of the two phases , gentamicin is added to the recovered internal suspension phase . gentamicin may be added in an amount of about 0 . 005 %, by weight , to about 10 %, by weight , and preferably in an amount from about 0 . 1 % to about 4 . 5 %, by weight . in preparing the present composition , the internal phase is structured as water insoluble aqueous droplets which can coalesce . thus , this layer can be readily emulsified to form droplets of any desired size , such as in the range of about one to about seven microns in diameter , containing gentamicin . for oral administration , the recovered gentamicin within the internal phase may be processed into a gelatin capsule or may be dried and processed as a tablet , layered onto a pill , or other means suitable for oral administration . in order to more fully explain the present invention , the following general examples of the method of preparation are given . all parts are given by weight , unless indicated otherwise . in this example , the steps involving refrigeration take place at 10 degrees c . all other steps are carried out at 25 degrees c . twenty five grams of albumin is added to 500 mls . of distilled water containing 3 %, by weight , of urea . the resulting solution is then thoroughly mixed , placed in an appropriate glass container , sealed and left undisturbed in a refrigerator for twelve hours . 500 mls . of a 2 . 5 % solution of lecithin is then added . the solution is placed in a 2 liter flat bottom flask and thoroughly mixed . the flask is again sealed and refrigerated for seven days . after this period of time , the solution is adjusted to a ph of about 7 to about 7 . 5 , using sodium bicarbonate . the solution is agitated for one hour and then stored , undisturbed in a refrigerator at a temperature of 10 degrees c ., for seven days . at the end of this period , the solution separates into two layers , the bottom layer which consists of an internal aqueous phase , and the top layer which constitutes the equilibrium water phase . the phases are separated in a conventional manner . into the internal aqueous phase is then added 2 grams of gentamicin . then the internal aqueous phase is emulsified to give a suspension of globules containing gentamicin in the range of from about 1 to about 7 microns . the resultant emulsion can then be stored or introduced as a drug orally into a patient . obviously many modifications and variations of the invention may be made without departing from the essence and scope thereof . only such limitations should be applied as are listed in the appended claims . | 0 |
a “ resource ” includes a user , service , system , device , directory , data store , groups of users , combinations of these things , etc . a “ principal ” is a specific type of resource , such as an automated service or user that acquires an identity . a designation as to what is a resource and what is a principal can change depending upon the context of any given network transaction . thus , if one resource attempts to access another resource , the actor of the transaction may be viewed as a principal . an “ identity ” is something that is formulated from one or more identifiers and secrets that provide a statement of roles and / or permissions that the identity has in relation to resources . an “ identifier ” is information , which may be private and permits an identity to be formed , and some portions of an identifier may be public information , such as a user identifier , name , etc . some examples of identifiers include social security number ( ssn ), user identifier and password pair , account number , retina scan , fingerprint , face scan , etc . a “ processing environment ” defines a set of cooperating computing resources , such as machines , storage , software libraries , software systems , etc . that form a logical computing infrastructure . a “ logical computing infrastructure ” means that computing resources can be geographically distributed across a network , such as the internet . so , one computing resource at network site x and be logically combined with another computing resource at network site y to form a logical processing environment . the phrases “ processing environment ,” “ cloud processing environment ,” and the term “ cloud ” may be used interchangeably and synonymously herein . moreover , it is noted that a “ cloud ” refers to a logical and / or physical processing environment as discussed above . the phrase “ cloud network ” refers to a network of cloud processing environments logically being managed as a single collective network . the embodiments herein provide techniques so that a cloud management application programming interface ( api ) can be used by an enterprise to provide identity , role , and other such mechanisms via the api so that workloads in the cloud can be positively identified and the appropriate policies applied within the cloud . various embodiments of this invention can be implemented in existing network architectures . for example , in some embodiments , the techniques presented herein are implemented in whole or in part in the novell ® network and proxy server products , operating system products , cloud - based products or services , directory - based products and other products and / or services distributed by novell ®, inc ., of waltham , mass . also , the techniques presented herein are implemented in machines , such as processor or processor - enabled devices . these machines are configured to specifically perform the processing of the methods and systems presented herein . moreover , the methods and systems are implemented and reside within a non - transitory and computer - readable or processor - readable storage media and processed on the machines ( processing devices ) configured to perform the methods . of course , the embodiments of the invention can be implemented in a variety of architectural platforms , devices , operating and server systems , and / or applications . any particular architectural layout or implementation presented herein is provided for purposes of illustration and comprehension only and is not intended to limit aspects of the invention . it is within this context that embodiments of the invention are now discussed within the context of fig1 - 4 . fig1 is a diagram of an architecture for identity - enabled interface deployment within a cloud network , according to an example embodiment . it is noted that the architecture is presented for purposes of illustration and that other arrangements are possible to achieve the beneficial teachings presented herein and below . again , embodiments and components of the architecture are implemented , programmed , and reside in a non - transitory computer - readable medium that executes on one or more processors that are specifically configured to process the components described herein and below . the fig1 shows an embodiment in terms of the architecture diagram contained in the distributed management task force ( dmtf ) cloud management architecture white paper ( dsp - is0102 — 1 . 0 . 0 ). all 400 - level diagram elements are provided and integrated in a novel manner by the embodiments presented herein to enhance and improve on the dmtf teachings . an administrator 405 or configuration mechanism 407 provides information to the agent console 410 concerning agents 420 that are to interact with the various cloud providers via a cloud service provider ( csp ) interface 220 . in an embodiment , the agent console 410 authenticates with the identity provider of identity service ( idp ) 160 via 406 with credentials provided by the administrator 405 or configuration 407 . the authentication causes the crafting of an identity ( e . g ., saml assertion ) that contains the rights , permissions , roles , etc . that the agent console 410 is allowed to operate with . implicit in , but not shown in , the fig1 is the presence of a policy decision point ( pdp ) that evaluates each action in terms of the identity and the rights , permissions , roles , etc . contained within the identity . the agent console 410 , using information provided by the administrator 405 or configuration 407 starts , stops , clones , etc . agent 420 and provides operational events via 407 such that the agent 420 is able to interact with a cloud provider as detailed below . the agent 420 communicates with the idp 160 and authenticates via credentials obtained via 407 . successful authentication provides the agent 420 with an identity ( e . g ., saml assertion ) that contains rights , permissions , roles , etc . that the agent 420 is allowed to operate with . also contained within the identity is a ttl ( time - to - live setting ) or some other expiration specification . if the agent 420 is expected to operate longer than the expiration specification , an event is sent to event timer 430 via 431 that serves to allow event timer 430 to provide an event to agent 420 and / or agent console 410 and / or network operations center ( noc ) situation display 440 that results in credentials being provided to agent 420 so that a new authentication can be affected via 421 , which extends the expiration specification . in an embodiment , the noc situation display 440 receives events via 441 and 442 , which are displayed in the noc operational display to allow noc personnel to perform the appropriate activities ( e . g ., provide new credentials to agent 420 , etc .). the agent 420 communicates securely ( e . g ., via ssl ) with the security manager 225 within the csp interface 220 via the mechanism specified by the cloud provider ( e . g ., ( representational state transfer ( restful ), rest - like , simple object access protocol ( soap ), remote procedure call ( rpc ), etc .) requesting authentication of agent 420 and does so by providing the identity obtained via 421 . the identity is verified by security manager 225 by validating the identity ( e . g ., saml assertion ) via the idp 260 , which has a trust relationship previously established with the idp 160 . the trust relationship details the trust level that the cloud provider has with the enterprise so that the validity of the identity can be ascertained ( e . g ., verify the saml assertion &# 39 ; s digital signature ) as well as validating the rights , permissions , roles , etc . that the agent 420 is requesting to act under . the security manger 225 returns to the agent 420 a token that is specific to the cloud provider &# 39 ; s infrastructure and that is used with other requests from agent 420 to the csp interface 220 . in an embodiment , the security manager 225 within the csp interface 220 communicates securely ( e . g ., via ssl ) with the agent 420 via the mechanism specified by the cloud provider ( e . g ., restful , rest - like , soap , rpc , etc .) requesting authentication of security manager 225 within the csp interface 220 and does so by providing an identity obtained from idp 260 by the security manager 225 . the identity is verified by agent 420 by validating the identity ( e . g ., saml assertion ) via the idp 160 , which has a trust relationship previously established with the idp 260 . the trust relationship details the trust level the cloud provider has with the enterprise so that the validity of the identity can be ascertained ( e . g ., verify the saml assertion &# 39 ; s digital signature ) as well as validating the rights , permissions , roles , etc . that the security manager 225 within the csp interface 220 is requesting to act under . the agent 420 returns to the security manager 225 within the csp interface 220 a token that is specific to the enterprise infrastructure and that is used with other requests from security manager 225 within the csp interface 220 to the agent 420 . if both of the previous processing scenarios are used then a bidirectional mechanism is established so that requests from the enterprise to the cloud provider and from the cloud provider to the enterprise can be processed while applying policy ( via the pdp ) to all requests . in either case ( one way or two ways ) all requests can be evaluated according to identity ( rights , permissions , roles , etc .). the token supplied as specified above may be a globally unique identifier ( guid ) or a more complex structure , which is provided with subsequent requests . receiving processes can validate the request by establishing the relationship between the token and trust relationship ( perhaps by a table look up or request to the idp to verify ). the intent is to replace the heavy - weight identity ( e . g ., saml ) process with something much easier and quicker to implement / process . the token may or may not be encrypted . if it is encrypted , the token can be encrypted via a symmetric key since the processing load of a symmetric key cryptogram is much less than that of an asymmetric cryptogram . although if desired , the token in other embodiments can also be encrypted using asymmetric mechanisms as well . note that the token may have an expiration specification that is different from the identity expiration specification . this particular expiration specification is handled internal to the agent 420 or security manager 225 within the csp interface 220 because the renewal of the token is based on the already established identity . however , if the identity expiration specification is to expire before the next token expiration , the mechanism specified above for obtaining a new identity is performed followed by the steps to obtain a new token . with the invention , a secure and identity - enabled processing environment can be established between an enterprise and a cloud provider . fig2 is a method 200 for identity - enabled interface deployment , according to an example embodiment . the method 200 ( herein after referred to as “ cloud interface deployment manager ”) is implemented , programmed , and resides within a non - transitory computer - readable storage medium . one or more processors of a network are specifically configured to execute the cloud interface deployment manager . the network may be wired , wireless , or a combination of wired and wireless . at 210 , the cloud interface deployment manager configures a cloud agent for deployment to a target cloud environment . the cloud agent is configured to process on the processors of the target cloud environment and to use interfaces that the target cloud environment uses . at 220 , the cloud interface deployment manager authenticates the cloud agent and obtains a cloud agent identity . this can occur in a variety of manners and through a variety of interactions as discussed above with reference to the fig1 . for example , at 221 , the cloud interface deployment manager interacts with a third - party identity service . credentials are supplied for the cloud agent . in one case , the credentials are supplied to the identity service via an administrator that uses an agent console ( as discussed and presented above with reference to the fig1 ). at 230 , the cloud interface deployment manager assigns an expiration condition to the cloud agent identity . when the expiration condition is satisfied , the cloud agent identity becomes invalid or unusable . according to an embodiment , at 231 , the cloud interface deployment manager receives an event from a cloud agent that it will extend beyond the expiration condition . in response to this event , the cloud interface deployment manager re - authenticates the cloud agent to obtain a new and updated expiration condition that lasts for a length of time that the cloud agent anticipates to extend processing for . in another case , at 232 , the cloud interface deployment manager assigns the expiration condition as a time - to - live ( ttl ) attribute to the cloud agent identity . at 240 , the cloud interface deployment manager deploys the cloud agent to the target cloud environment for enforcement of enterprise policy within the target cloud environment . in an embodiment , at 250 , the cloud interface deployment manager requests , via the deployed cloud agent , a security token from a security manager of the target cloud environment . the security token is unique to the target cloud environment . continuing with the embodiment of 250 and at 251 , the cloud interface deployment manager uses , via the deployed cloud agent , the security token with each request issued within the target cloud environment to validate each request and to enforce the enterprise policy with each request . continuing with the embodiment of 250 and at 252 , the cloud interface deployment manager receives , via the deployed cloud agent , a token expiration condition with the security token . the security token becomes invalid for use within the target cloud environment when the token expiration condition is met . continuing with the embodiment of 252 and at 253 , the cloud interface deployment manager identifies , via the deployed cloud agent , the token expiration condition as being different from the expiration condition of the cloud agent identity . still continuing with the embodiment of 250 and at 254 , the cloud interface deployment manager recognizes , via the deployed cloud agent , the security token as a globally unique identifier for the target cloud environment . again continuing with the embodiment of 250 and at 255 , the cloud interface deployment manager uses , via the deployed cloud agent , a cloud provider interface dictated by the target cloud environment to interact with the security manager of the target cloud environment . fig3 is a diagram of another method 300 for identity - enabled interface deployment , according to an example embodiment . the method 300 ( herein after referred to as “ enterprise interface deployment manager ”) is implemented , programmed , and resides within a non - transitory computer - readable storage medium . one or more processors of a network are specifically configured to execute the cloud interface deployment manager . the cloud interface deployment manager represented by the method 200 of the fig2 is presented from the perspective of an enterprise deploying an interface for policy enforcement in a cloud environment . whereas the enterprise interface deployment manager is presented from the perspective of a cloud interface being deployed in an enterprise environment . it is not that the two methods 200 and 300 are not mutually exclusive such that both can be operational to establish a bi - directional deployment of identity based interfaces . at 310 , the enterprise interface deployment manager interacts with a cloud agent . the cloud agent previously deployed to a cloud environment by an enterprise environment using a cloud provider interface . the mechanism for deploying the cloud agent was presented above with respect to the fig1 and 2 . at 320 , the enterprise interface deployment manager requests that the cloud agent authenticate a security manager of the cloud environment to the enterprise environment . so , the deployed cloud agent is now authenticating a cloud provider &# 39 ; s security manager . according to an embodiment , at 321 , the enterprise interface deployment manager authenticates the security manager to specific rights , roles , and permissions within the enterprise environment . at 330 , the enterprise interface deployment manager receives , via the security manager , an enterprise token that is specific to the enterprise environment . this is done in response to the successful authentication of the security manager as presented with the processing of 320 in an embodiment , at 331 , the enterprise interface deployment manager obtains the enterprise token in an encrypted format . continuing with the embodiment of 331 and at 332 , the enterprise interface deployment manager uses a symmetric key to decrypt the encrypted format of the enterprise token . at 340 , the enterprise interface deployment manager uses , via the security manager , the enterprise token to enforce cloud policy within the enterprise environment . in an embodiment , at 350 , the enterprise interface deployment manager uses a pdp manager to enforce the cloud policy within the enterprise environment . in another situation , at 360 , the enterprise interface deployment manager operates the security manager as a particular cloud environment interface within the enterprise environment . so , one can now see via the discussions of fig1 - 3 how policy can be enforced from an enterprise environment within a cloud environment and from a cloud environment within an enterprise environment . the policy is identity - enabled via the authentication and identity mechanisms presented above . fig4 is a diagram of an identity - enabled interface deployment system 400 , according to an example embodiment . components of the identity - enabled interface deployment system 400 are implemented , reside , and programmed within non - transitory computer - readable storage medium as instructions that are executed on one or more processors of a network . the network can be wired , wireless , or a combination of wired and wireless . in an embodiment , the identity - enabled interface deployment system 400 implements , inter alia , portions of the architecture presented above with respect to the fig1 and the methods 200 and 300 of the fig2 and 3 , respectively . the identity - enabled interface deployment system 400 includes an enterprise processing environment 401 and a cloud processing environment 402 . each of these components and their interactions with one another will now be discussed in turn . the enterprise processing environment 401 includes a plurality of enterprise processing devices . example processing associated with the enterprise processing environment 401 was presented above with respect to the fig1 and 2 . the enterprise processing environment 401 configures a cloud agent for deployment to the cloud processing environment for purposes of enforcing enterprise policy within the cloud processing environment 402 . according to an embodiment , the cloud agent acquires a cloud token that is specific to the cloud processing environment 402 from a security manager to enforce the enterprise policy . the cloud processing environment 402 includes a plurality of cloud processing devices . example processing associated with the cloud processing environment 402 was presented above with respect to the fig1 and 3 . the cloud processing environment 402 uses a security manager of the cloud processing environment 402 to interact with the cloud agent for purposes of enforcing cloud policy in the enterprise processing environment 401 . in an embodiment , the security manager acquires an enterprise token that is specific to the enterprise processing environment 401 from the cloud agent for purposes of enforcing the cloud policy within the enterprise processing environment 401 . the above description is illustrative , and not restrictive . many other embodiments will be apparent to those of skill in the art upon reviewing the above description . the scope of embodiments should therefore be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled . | 7 |
in the following description , for purposes of explanation , specific numbers , materials and configurations are set forth in order to provide a thorough understanding of the invention . it will be apparent , however , to one having ordinary skill in the art , that the invention may be practiced without these specific details . in some instances , well - known features may be omitted or simplified so as not to obscure the present invention . furthermore , reference in the specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure or characteristic described in connection with the embodiment is included in at least one embodiment of the invention . the appearances of the phrase “ in an embodiment ” in various places in the specification are not necessarily all referring to the same embodiment . the term “ video data ” referred to in the descriptions of various embodiments of the invention herein described is intended to generally describe electronic audio and video signals containing or incorporating video for display on a television or other video display device . this term is used in the broadest sense as known in the electronic arts , and may include analog and / or digital signals . likewise , the term “ video stream ” is used in a non - limiting fashion and generally refers to the collection of video data , together with any carrier signals , data headers or other electronic information , which singularly or taken together allow the described embodiments to operate . for example , a digital video stream from a given video source might include multiple packets of compressed video data , each packet or group thereof having one or more packet headers . typically , one or more of the headers includes information relating to the video data , such as the compression algorithm used , the aspect ratio , etc . the term “ aspect ratio ” referred to in the descriptions of the various embodiments of the invention herein described refers to the ratio of the width of the video display image to the height of the video display image . for most ntsc television display images the current aspect ratio is 4 : 3 . high - definition television ( hdtv ) uses an aspect ratio of 16 : 9 , which is similar to the aspect ratio used by motion pictures . reference herein to displaying a video stream in a frame having a height and a width proportional to the video stream &# 39 ; s aspect ratio means that an hdtv video stream is displayed filling a frame having a width : height ratio of 16 : 9 . similarly , a standard ntsc television video stream would be displayed filling a frame having a width : height ration of 4 : 3 . as used herein , the terms “ picture frame ” and “ frame ” refer to the borders of a displayed picture . unless otherwise specified , a picture frame does not necessarily have a border of any particular width , i . e ., a displayed picture might occupy the entire area of the picture frame , or the picture frame may include a border . reference to locations on a display device may be made by referring to either the location of the picture frame or to the location of displayed picture itself , without limitation . reference to the size of a picture frame refers to the height and width of the frame , and frames of differing width and / or differing height are referred to as being of different sizes . as used herein , the term “ picture ” refers to the whole of the display image and its picture frame , unless otherwise indicated , without limitation . an embodiment of the present invention advantageously provides for the display of multiple pictures on a high resolution large screen television set without overlaying another picture , while preserving the high resolution and aspect ratio of the displayed pictures . fig1 is a block diagram of a television set 100 displaying a multi - picture frame and a frame controller 150 . television set 100 is an electronic device that receives and displays images and sounds . in one embodiment , television set 100 receives images and sounds as video data or a video stream from a television channel 131 , which may originate from a broadcast television network , a cable television network , a satellite television network , or internet protocol television ( iptv ) network . alternatively , the video data may originate from a vcr , a dvd player , a digital video recorder ( dvr ), a set top box , or any other video source . in an embodiment , television set 100 includes a screen capable of displaying a multi - picture frame 120 large enough for a user to comfortably watch multiple pictures from 6 feet away . in one embodiment television set 100 has a screen size of at least 32 inches , or 80 cm . in another embodiment , a user watches television set 100 from 15 feet away , and the screen size is at least 60 inches or 150 cm . multi - picture frame 120 includes multiple pictures 121 , 123 , 125 , 127 , 128 , 129 . picture 128 is a major picture having a display size larger than the smaller pictures 121 , 123 , 125 , 127 and 129 . multi - picture frame 120 differs from picture - in - picture ( pip ) in that a small picture does not overlay over the large picture 128 in multi - picture frame 120 . moreover , the large picture 128 does not occupy the full screen , as in a conventional pip . in an exemplary embodiment , television set 100 has a screen size of 32 inches diagonal , picture 128 has a size of 22 inches diagonal , and picture 121 has a size of 9 inches diagonal . in another exemplary embodiment , television set 100 has a screen size of 40 inches diagonal , picture 128 has a size of 27 inches diagonal , and picture 121 has a size of 12 inches diagonal . in still another exemplary embodiment , television set 100 has a screen size of 60 inches diagonal , picture 128 has a size of 42 inches diagonal , and picture 121 has a size of 16 inches diagonal . in various embodiments , picture 128 may have a picture resolution and aspect ratios of ntsc standard , defined by national television system committee , phase alternating line ( pal ), dvd video , or hdtv . in one embodiment , picture 128 has a better picture resolution than ntsc , pal or hdtv . the layout of the multiple pictures depicted in fig1 is exemplary in nature . in various embodiments the number , dimensions and positions of the various pictures or picture frames may differ . for example , in one embodiment the size of large picture 128 is as depicted , but the sizes of the small pictures are different . fig1 a is a block diagram depicting a picture 124 and a frame controller 150 . picture 124 can be a larger picture 128 or smaller picture 127 , as depicted in fig1 . in an embodiment , picture 124 displays images and sounds , i . e ., the video signal of television channel 134 . in one embodiment , picture 124 displays cable television channel 34 , or video from a dvd player . typically different pictures such as picture 123 and picture 129 display different television channels 133 and 139 . for example , in one embodiment , picture 123 displays cable television channel 34 , picture 129 displays broadcast television channel 48 , picture 123 displays satellite television channel 93 , and picture 127 displays a movie from a vcr . referring once again to fig1 , in an embodiment of the invention , pictures 121 , 123 , 125 , 127 , 128 , and 129 display television channels 131 , 133 , 135 , 137 , 138 and 139 , respectively . in one embodiment , television 120 displays the sounds of the largest picture 128 and not of other pictures . alternatively , in another embodiment , television 120 may display the sounds of picture 129 or of another picture as selected by the user . frame controller 150 controls multi - picture frame 120 . in an embodiment , frame controller 150 includes input interface 192 connecting to television channels 131 , 133 , 135 , 137 , 138 and 139 . input interface 192 may include any of a coaxial interface , a radio frequency ( rf ) interface , a high - definition multimedia interface ( hdmi ), a component interface such as ypbpr or ycbcr interface , a composite interface , an ethernet interface , or a wireless network interface . frame controller 150 receives video streams of the said television channels from the input interface 192 . frame controller 150 connects to television set 100 . in one embodiment , frame controller 150 includes an output interface 195 connecting to television set 100 . frame controller 150 sends frame signal 180 for multi - picture frame 120 over output interface 195 to television set 100 . in one embodiment , output interface 195 may include an rf interface , an hdmi interface , an s - video interface , a component interface , or a composite interface . output interface 195 may include a wireless network such as a wireless local area network ( wlan ), a worldwide interoperability for microwave access ( wimax ), or an ultra - wideband ( uwb ) network . referring back to fig1 a , frame controller 150 includes a tuner 154 handling a video stream or signal for picture 124 . based on television channel 134 of picture 124 , tuner 154 selects television channel 134 from input interface 192 , receives the video stream or signal 164 of television channel 134 , transforms channel video stream or signal 164 to sub - frame signal 184 . in fig1 , frame controller 150 includes multiple tuners 151 , 153 , 155 , 157 , 158 , 159 corresponding to multiple pictures 121 , 123 , 125 , 127 , 128 , and 129 , accordingly . tuners 151 , 153 , 155 , 157 , 158 and 159 generate sub - frame signals 181 , 183 , 185 , 187 , 188 and 189 . frame controller 150 combines sub - frame signals 181 , 183 , 185 , 187 , 188 and 189 into frame signal 180 , and transmits frame signal 180 over output interface 195 to television set 100 . television set 100 subsequently displays frame signal 180 . in one embodiment , television set 100 includes the frame controller 150 . in such an embodiment the output interface 195 may be an internal bus or other connection within the television set 100 . fig2 illustrates controlling operations of a multi - picture frame 120 . in an embodiment of the invention , frame controller 150 controls operations of the multi - picture frame 120 , and a user 104 uses a controlling device 106 to instruct frame controller 150 . frame controller 150 connects to the controlling device 106 through , for example infrared signals , radio signals , or a data network such as ethernet , wlan , or wimax . in alternative embodiments , the controlling device 106 is a remote control , a mobile device such as a cell phone , a personal computer or a laptop . fig2 a and 2 b are block diagrams illustrating picture swapping and changing operations , respectively , in an exemplary embodiment of the invention . in fig2 a , frame controller 150 provides a swap operation 115 a swapping picture 121 with picture 128 . user 104 selects , using controlling device 106 , picture 121 and picture 128 . the user 104 then selects swap operation 115 a . in response to receiving the swap operation 115 a signal from the controlling device 106 , frame controller 150 informs tuner 151 to transform channel signal 161 to sub - frame signal 181 using a large picture resolution of picture 128 . frame controller 150 informs tuner 158 to transform channel signal 168 to sub - frame signal 188 using a small picture resolution of picture 121 . when frame controller 150 composes sub - frame signals 181 , 183 , 185 , 187 , 188 and 189 , frame controller 150 places sub - frame signal 188 to the location of picture 121 and sub - frame signal 181 to the location of picture 128 . the replacement of picture 128 by picture 121 may be performed in several ways . in an embodiment , frame controller 150 informs tuner 158 to select television channel 131 . tuner 158 receives channel signals 168 from television channel 131 , transforms channel signals 168 to sub - frame signal 188 . in another embodiment , frame controller 150 informs tuner 158 not to transform channel signal 168 . frame controller 150 informs tuner 151 to transform channel signal 161 to sub - frame signal 188 using picture resolution of picture 128 , in addition to sub - frame signal 181 using current small picture resolution of picture 121 . frame controller places sub - frame signal 188 to the location of picture 128 . a user 104 may swap two small pictures , such as picture 123 and picture 125 , rather than swapping a small picture and a large picture . as depicted in fig2 b , in an embodiment , frame controller 150 provides a change operation 115 b to change a television channel of a displayed picture . in exemplary operation , a user 104 selects picture 125 , which is displaying television channel 135 . next , user 104 selects the change channel operation 115 b using the controlling device 106 , and further selects another television channel to display . in one embodiment , the user 104 selects the new television channel directly , whereas , in an alternative embodiments , the user 104 selects the next channel in a sequence of channels , or the previous channel , or another video source altogether , such as dvd player . in one embodiment , the user 104 keys in a television channel number or name . frame controller 150 determines television channel 235 and informs tuner 155 to switch to television channel 235 . fig3 a and 3 b illustrate the use of a television channel selection list and a television channel name list , respectively , for selecting a television channel to display . in one embodiment , frame controller 150 determines the second television channel 235 based on picture 125 . for example , picture 125 may be associated with a pre - determined television channel list 205 for picture 125 . fig3 a illustrates television channel list 205 for picture 125 . picture 125 is currently displaying television channel 135 . when the user 104 selects the next television channel , frame controller 150 determines the second television channel 235 from television channel list 205 to be cable channel 57 . in another , frame controller 150 connects to a datastore 220 that includes television channel list 205 . frame controller 150 matches picture 125 against datastore 220 and retrieves television channel list 205 . in another embodiment , frame controller 150 queries a network computing device 222 that includes television channel list 205 . frame controller 150 sends picture 125 and television channel 135 to computing device 222 . frame controller 150 obtains television channel 235 from computing device 222 . in an embodiment , the user 104 specifies television channel 235 by channel name 215 , as depicted in fig3 b . frame controller 150 matches channel name 215 against television channel name list 207 and retrieves the corresponding television channel 235 . in one embodiment , frame controller 150 connects a datastore 220 that includes television channel name list 207 . frame controller 150 matches picture 125 against datastore 220 and retrieves television channel name list 207 . in another embodiment , frame controller 150 queries a network computing device 222 that includes television channel name list 207 . frame controller 150 sends picture 125 and channel name 215 to computing device 222 . frame controller 150 obtains television channel 235 from computing device 222 . numerous other operations may be performed by the frame controller 150 as directed by a user 104 . for example , operation 115 can be used to increase or reduce the size of picture 128 . in one embodiment , operation 115 can be to swap the picture whose sounds are audible between picture 123 and picture 128 . in another embodiment , frame controller 150 connects to a recorder such as a dvd recorder , and operation 115 can be used to record television channel 135 of picture 125 . in yet another embodiment , operation 115 can be used to restart a television program of television channel 137 of picture 127 , or to pause , fast forward or fast backward television channel 137 of picture 127 . although the invention herein has been described with reference to particular embodiments , it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims . | 7 |
this invention relates to methods for the production of monoclonal antibodies to pythium aphanidermatum , the monoclonal antibodies per se , the hybridoma cell line capable of producing said antibodies and methods and kits employing the monoclonal antibodies to diagnose pythiaceae infection in plant tissue . fungi were cultured in 50 ml of pdb ( potato dextrose broth ) medium in 250 ml flasks , ( 2 liters of pythium aphanidermatum ( eds .) fitz . were generally employed ). after one week the fungal cultures were harvested from the medium , washed twice in pbs ( phosphate buffered saline ; ph 7 . 4 ). fungal cultures were transferred into a 300 ml batch chamber of a dyno - mi11 type kdl containing 240 ml of 0 . 50 mm / lead - free glass beads [ impandex ]. cooling jacket of the batch chamber was pre - cooled to 8 ° c . with cold tap water . extract was ground at 3000 rmp for 5 minutes after which the contents of the batch chamber were transferred to 50 ml polystyrene tubes and centrifuged at 17 , 000 rpm ( 34 , 540 g ) in a sorvall rc - 5b refrigerated centrifuge using a size ss - 34 rotor . the fungal supernatant was aliquoted and frozen until use . total protein content of samples were in the range of 0 . 5 - 2 mg / ml . procedure is a modification of that developed by kohler and milstein ( nature 256 : 495 ( 1975 ) and hammerling ( eur . j . immunol . 7 : 743 ( 1977 )). test animals 4 - 5 weeks old female balb / c mice purchased from charles river breeding laboratories , inc . wilmington , mass . ______________________________________day 11st injection : 0 . 05 mg of fungal protein in 0 . 1 ml of pbs buffer plus 0 . 1 ml freund &# 39 ; s complete adjuvant . ip injectionday 222nd injection : same as aboveday 363rd injection : 0 . 025 mg fungal protein in 0 . 05 ml solution in 0 . 05 ml freund &# 39 ; s complete adjuvant . ip injectionday 38fusion______________________________________ animal was sacrificed by cervical dislocation . the spleen was removed and placed in 20 ml of dulbecco &# 39 ; s modified eagle &# 39 ; s medium . the spleen was placed on an 80 mesh sterile screen . the spleen was then cut , perfused with dmem ( dulbecco &# 39 ; s modified eagle medium cat no . 320 - 1965 gibco labs .) and then gently massaged with a sterile plunger from a 10 cc disposable plastic syringe . during the entire process of spleen cell extraction , the screen was continually rinsed with dmem . contents were pipetted into a 50 ml disposable centrifuge tube and spun down at 1200 rpm for 10 minutes ( centrifugation done at room temperature ). the supernatant was decanted and the cell pellet washed with 10 mls of red blood cell lysing solution ( 0 . 83 % nh4cl ; 0 . 01 m khc03 ; 0 . 1 mm edta ) for 90 seconds at room temperature . the lysing reaction was stopped by diluting with 40 mls of dmem . the sample was left to stand for 3 minutes , and the supernatant pipetted to 50 ml centrifuge tubes . after centrifugation , the pellet was washed with 50 ml of dmem and recentrifuged . the final pellet was resuspended with 5 ml of dmem . a small sample of the spleen cells was retained for counting and to check for cell viability . optimal concentration of spleen cells is 10 to the 7 cells per ml . myeloma cells ( sp2 - 0 - ag 14 ) obtained from american type culture collection ) were transferred ( concentration 1 × 10 6 cells per ml ) from culture into a 50 ml falcon tube . the myeloma cells for fusion were centrifuged ( 1200 rpm for 10 minutes at room temperature ). after centrifugation , the supernatant was discarded into a clean glass beaker , the cells were washed with dmem , and recentrifuged . the spleen cells were added to the tube containing the washed myeloma pellet . the myeloma and spleen cells were gently resuspended with the aid of a 10 ml pipette and automatic pipetter and centrifuged for 10 minutes at 1200 rpm at room temperature . following centrifugation , the supernatant was decanted . the fusion medium , 50 % peg ( polyethylene glycol ) 1500 ( m . a . bioproducts cat . # 17 - 7802 ) prewarmed to 47 ° c ., was suspended in dmem . one ml of fusion medium was added dropwise to the tube containing the resuspended myeloma and spleen cells - time thirty seconds . the final 7 minutes of the fusion reaction was to allow the gradual dilution of the peg with dmem . at the end of the dilution , the final volume in the tube reached 50 mls . during the entire fusion period , the tube was gently tapped to insure proper mixing of the material . the tube was then centrifuged ( 1200 rpm for 10 minutes at room temperature ) and the supernatant removed . prewarmed hat medium ( described below ) ( 33 ml ) was added to the tube , and the cellular contents were suspended using a 10 ml pipette . the final concentration of spleen cells was 1 . 4 × 10 6 cells . cells were then added to the 60 central wells of a 96 well microtiter plate ( limbro multiwell ). to each well was added 150 μl of fused myeloma / spleen material . outer wells of the microtiter plate were then filled with hat medium . microtiter plates were placed in a water jacketed 7 % co 2 incubator , temperature 37 c . cells were refed with hat medium every 4 days . visible hybridoma growth began to appear after 7 to 10 days . table ii______________________________________hat medium compositiondulbecco &# 39 ; s modified eagle medium 766 mlcat # 320 - 1965 gibco labsl glutamine ( 200 mm ) 100 × concentration 10 mlcat # 320 - 5030 gibco labspencillin / streptomycin solution : 10 ml10 , 000 u / ml 10 mg / mlcat # p0781 sigmaaminopterin ( 50 ×) 4 mlcat # a - 5159 sigmahypoxanthine / thymidine solution : 10 mlthymidinecat # t - 9250 sigma 38 . 8 mghypoxanthinecat # h - 9377 sigma 136 . 1 mgadd 100 ml sterile water and ph to 8 . 5 withsterile 1 n naohfetal bovine serum 200 mlcat # 12 - 10378 hazleton dutchland , inc . ______________________________________ those hybridomas producing antibodies to fungal pathogens were identified by using prepared pythium aphanidermatum ( eds .) fitz . fungal material ( protein concentration 15 μg / ml in pbs buffer ) in an avidin / biotin amplified glutaraldehyde elisa format . this procedure relates to an enhancement procedure for screening hybridomas secreting antibodies to fungal pathogens . 1 . 200 μl of glutaraldehyde buffer was placed into each well ( immulon i plates ), incubated for 3 hours at 55 c ., cooled to room temperature and the plates washed 3 times with deionized ( di ) water . 2 . 200 μl of antigen diluted in 0 . 15m pbs , ph 7 . 2 , was dispensed into each well . one row was left empty for use as the glutaraldehyde control . the mixture was incubated for 24 hours at 4 c , the remaining suspension discarded and washed 3x with pbs . 3 . 200 μl of ( mono ) ethanolamine solution was dispersed into each well , incubated for 20 hours at 4c , the remaining solution discarded and plate washed 3x with pbs . 4 . 200 μl of appropriate serum sample diluted with 0 . 15m pbs , ph 7 . 2 was placed into each well , incubated for 2 hours at 33 ° c . with humidity . the remaining solution was discarded and the plate washed 3x with pbs . 5 . the supernatants were aspirated and washed 2 times with 200 μl pbs . 6 . biotinylated anti - mouse igg or igm ; peroxidase conjugated avidin reagent ( vector laboratories mouse anti igg or igm ; abc reagent ) 10 ml pbs + 100 μl normal horse serum + 1 drop biotinylated anti - mouse igg 10 ml pbs ( 0 . 1 % tween ) add 2 drops abc reagent a immediately add 2 drops abc reagent b , mix and let stand for 30 minutes before using . 7 . 50 μl / well biotin / anti - mouse solution was added and incubated for 15 minutes at room temperature . 8 . the mixture was aspirated and washed 2 times with 200 μl pbs . 9 . abc reagent ( see above ) was added at 50 μl / well incubated 15 minutes at room temperature , then aspirated and washed 5 times with 200 μl pbs / well . citrate phosphate buffer 7 . 1 g na 2 hpo 4 ( 500 ml ) 9 . 6 g citric acid ( 500 ml ) adjust ph of first solution to 6 . 0 by adding citric acid the mixture was incubated at room temperature for 10 minutes and absorbance read at 405 nm . 1 . glutaraldehyde buffer : 0 . 1 % glutaraldehyde in 0 . 1m carbonate buffer . the carbonate buffer , ph 9 . 0 , consists of 1 . 57g na2co 3 and 2 . 93g nahco 3 per liter of di water . 2 . pbs - tween : 8 . 0 nacl , 0 . 2 g kh 2 po 4 , 2 . 9 g , 1 . 15 g na 2 hpo 4 anhydrous , 0 . 2 g kcl , per liter of di water , ph 7 . 4 . those wells giving positive responses to the elisa tests undergo a limiting dilution so that pure strains of hybridoma cells might be grown . the limiting dilution method involved culturing serially diluted suspensions of hybridomas . each dilution series was set up in 6 - 12 wells of a 96 well culture plate . these wells were then retested for specific antibody activity to fungal proteins . positive wells were then transfered to 20 ml culture flasks for mass culturing . clone # pa5iiif11 secretes antibodies of the igm class against pythium aphanidermatum ( eds .) fitz clone # pa6vif9 - e8 - c6 secretes antibodies of the igg , class against pythium aphanidermatum ( eds .) fitz avidin / biotin with glutaraldehyde enhancement elisa screening against four plant pathogens . incubation of enzyme substrate reaction was performed at room temperature . table iii______________________________________absorbance ( 405 nm ) 10 minute incubation with enzyme substrate [ peroxidase conjugate ] ______________________________________ f11 / f9pythium aphanidermatum 1 . 15 / pathogen concentration ( eds .) fitz 0 . 78 10 μg / mlrhizoctonia solani 0 . 09 / pathogen concentrationkuhn . 0 . 16 10 μg / mlrhizoctonia cerealis 0 . 16 / pathogen concentrationvan der hoaven 0 . 11 10 μg / mlsclerotinia homoeocarpa 0 . 22 / pathogen concentrationbennett 0 . 06 10 μg / mlno antigen control 0 . 00 / phosphate buffered 0 . 05salineculture supernatant 0 . 01 / control ; dulbecco &# 39 ; s 0 . 01modified eaglesmedium with 15 % fetal calf serum______________________________________elisa crossreactivity tests with diseased turf absorbancealkaline phosphatase conjugate f11______________________________________pennlawn infected with pythium aphanidermatum 0 . 68pennlawn uninfected 0 . 02fylking infected with rhizoctonia cerealis 0 . 01fylking uninfected 0 . 03penncross infected with sclerotinia homoeocarpa 0 . 05penncross uninfected 0 . 02no antigen ( phosphate buffered saline ) 0 . 00uninfected grass : penncross 0 . 05agrostis tenuis sibthpennlawn 0 . 02festuca rubravar . commutata gaud . fylking 0 . 04kentucky bluegrasspoa pratensis l . ______________________________________ to further test the reactivity of two of the clones isolated by the above procedure , f11 , an igm secreting type , and f - 9 , and igg secreting - type were screened against a variety of fungal strains employing the avidin / biotin system described above . table iv______________________________________tests with f11 supernatants ( igm ) culture samples source absorbance reaction______________________________________p . aphanidermatumpa - 1 larsen from . 55 + schmitthener - wooster ohiopa - 2 cole - . 52 + penn statepa - 3 cole - . 84 + penn statepa - 4 wilkinson - . 45 + illinoispa - 5 atcc . 49 + # 36431pa - 6 atcc . 57 + # 26081pa - 9 schmitthenner . 58 + wooster , ohiopa - 10 p . sanders . 81 + ohiopa - 11 p . sanders . 61 + ohiopa - 13 p . sanders . 55 + ohiop . paroecandrum hagedorn . 67 + madison , wis . p . salpingophorum hagedorn . 66 + madison , wis . p . sylvaticum hagedorn . 71 + madison , wis . p . ultimumpu - 1 hagedorn . 85 + madison , wis . pu - 2 hagedorn . 78 + madison , wis . pu - 3 hagedorn . 72 + madison , wis . r . cerealis . 09 - brown patchr . solani lucas . 06 - rs - 1 north carolinars - 2 cole . 03 - penn staters - 3 cole . 04 - penn staters - 5 lucas . 02 - north carolinars - 7 oneil . 04 - beltsville , md . dollar spotsclerotinia homoeocarpash - 1 cole . 05 - penn state______________________________________ table v______________________________________tests with f9 supernatants ( igg ) culture samples source absorbance reaction______________________________________p . aphanidermatumpa - 1 larsen from . 32 + schmitthener - wooster ohiopa - 2 cole - . 30 + penn statepa - 3 cole - . 31 + penn statepa - 4 wilkinson - . 14 + illinoispa - 5 atcc . 26 + # 36431pa - 6 atcc . 41 + # 26081pa - 9 schmitthenner . 27 + wooster , ohiopa - 10 p . sanders . 21 + ohiopa - 11 p . sanders . 22 + pa - 13 p . sanders . 14 + ohiop . paroecandrum hagedorn . 12 +/- madison , wis . p . salipingophorum hagedorn . 03 + madison , wis . p . sylvaticum hagedorn . 71 + madison , wis . p . ultimumpu - 1 hagedorn . 36 + madison , wis . pu - 2 hagedorn . 02 - madison , wis . pu - 3 hagedorn . 06 - madison , wis . yellow patch . 09 - r . cerealisbrown patchr . solanirs - 1 lucas . 02 - north carolinars - 2 cole . 00 - penn staters - 3 cole . 06 - penn staters - 5 lucas . 01 - north carolinars - 7 oneil . 01 - beltsville , mddollar spotsclerotinia homoeocarpash - 1 cole . 04 - penn state______________________________________ a further set of experiments were conducted to demonstrate reactivity of f9 and f11 supernatants with other members of the pythiaceae . the experiments were conducted with a second set of supernatants derived from the f9 and f11 clones described above ; thus , although the absolute absorbance values are not comparable with those shown above , the pattern of reactivity is identical . these experiments demonstrate that the monoclonal antibodies produced by the f9 and f11 clones also react with members of the genus phytopthora . table vi______________________________________ f9 f11culture sample ( igg ) ( igm ) reaction______________________________________pythium aphanidermatum ( edson ) fitzpa 7 . 35 . 35 + pa 14 . 26 . 36 + pa 15 . 64 . 37 + pa 16 . 39 . 30 + pa 17 . 27 . 30 + pa 1 . 12 . 32 + pythium irregulare ( buisman ) . 48 . 33 + pi 1pythium myriotylum ( drechsler ) pmy 1 . 44 . 28 + pmy 2 . 48 . 36 + pythium vexans ( debary ) . 17 . 31 + pv 1pythium coloratum ( vaartaja ) . 16 . 29 + pc 1phytopthora parasiticavar nicotinae ( tucker ) ppn 0 . 19 . 34 + ppn 1 . 15 . 27 + phytopthora parasitica ( dastur .) . 63 . 32 + p . parasit . rhizoctonia solani . 03 . 00 - rhizoctonia cerealis . 01 . 00 - sclerotinia homoeocarpa . 01 . 00 - phosphate buffered saline . 00 . 00 -( control ) ______________________________________ a deposit of biologically pure cultures of the following hybridomas were made with the american type culture collection , 12301 parklawn drive , rockville , maryland on mar . 14 , 1985 and july 18 , 1985 the accession number indicated was assigned after successful viability testing , and the requisite fees were paid . access to said culture will be available during pendency of the patent application to one determined by the commissioner to be entitled thereto under 37 c . f . r . § 1 . 14 and 35 u . s . c . § 122 . all restriction on availability of said culture to the public will be irrevocably removed upon the granting of a patent based upon the application and said culture will remain permanently available for a term of at least five years after the most recent request for the furnishing of a sample and in any case for a period of at least 30 years after the date of the deposit . should the culture become nonviable or be inadvertently destroyed , it will be replaced with a viable culture ( s ) of the same taxonomic description . this invention contemplates the use of the monoclonal antibodies described above in a system for detection of pythiaceae infection . accordingly , a sample of plant material suspected of harboring the organism is subjected to an extraction procedure whereby the plant material is physically disrupted such as by grinding and the resultant crude extract is diluted into water or buffer . a sample of the crude extract is contacted with a first antibody specifically reactive with an antigenic determinant of the organism to be detected . preferably the antibody is immobilized on a solid support such as the walls of a microtiter plate . the antibody may be monoclonal antibody or a component of polyclonal sera . after removing the unreacted material by washing , the resulting binary complex ( antigen - antibody complex ) is contacted with monoclonal antibody specifically reactive to the antigen to be detected . of course if a monoclonal is employed as the first antibody the second monoclonal should be reactive with a different antigenic determinant than the first monoclonal , unless it can be shown that the determinant is present in multiple copies in the antigen . by contacting the immobilized binary complex with the second monoclonal antibody , a tertiary complex is formed . after washing to remove any of second antibody which did not bind to the binary complex , the tertiary complex may be detected by a variety of analytical techniques . the second monoclonal could be labelled directly and the tertiary complex indicated . alternatively , the elisa system described above may be employed whereby the tertiary complex is reacted with an biotin - labelled anti - immunoglobulin and that reaction product is subsequently contacted with an avidin - enzyme reagent . once reacted , the substrate of the enzyme is added and the enzyme reaction product detected , thus indicating the presence of the organism or antigen therefrom . to facilitate the detection the various reactants are provided in the form of a kit . | 8 |
this application claims priority under 35 usc § 119 to korean patent application no . 10 - 2006 - 0030751 , filed on apr . 4 , 2006 in the korean intellectual property office , the disclosure of which is incorporated herein in its entirety by reference . the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which exemplary embodiments of the invention are shown . the invention may , however , be embodied in different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like reference numerals refer to like elements throughout . a coding method in accordance with embodiments of the present invention may use two or more flags , i . e ., one or more flags in addition to an inversion indicator , to further reduce current consumption and / or noise . fig1 illustrates a flowchart of an encoding method in accordance with an embodiment of the present invention . first , a number of data “ 0 ” in the multi - bit data may be counted in step s 110 . then , this number may be compared to a predetermined value z in step s 120 . the predetermined value z may be equal to or greater than half a number of bits in the multi - bit data . if the predetermined value z is exceeded , the multi - bit data may be inverted and a first flag flag 1 may be set to a first value , e . g ., one , in step s 130 . if the predetermined value z is not exceeded , the multi - bit data may be maintained and the first flag flag 1 may be set to a second value , e . g ., zero , in step s 140 . again , the first flag flag 1 serves as the inversion indicator . then , in step s 150 , a sum of the number of “ 0 ” data counted in step s 110 and the value of the first flag flag 1 may be compared to a predetermined value m . the predetermined value m may be equal to the predetermined value z . if the sum is less than m , then a second flag flag 2 may be set to a first value , e . g ., zero , in step s 170 . then , in step s 180 , a sum of the number of “ 0 ” data counted in step s 110 , the value of the first flag flag 1 and the value of the second flag flag 2 may be compared to the predetermined value m . if the sum is greater than or equal to m , then the multi - bit data may be maintained , and the method may proceed to step 191 , which may transmit the data . if the sum is less than m , then at least two bits of the multi - bit data may be changed to zero . for example , up to half a number of bits in the multi - bit data may be changed to zero . then , the method may proceed to step 191 , which may transmit the data . if the sum is greater than or equal to m , then the multi - bit data may be maintained and the second flag flag 2 may be set to a second value , e . g ., one , in step s 160 . the method may then proceed to step 191 , which may transmit the data . fig2 illustrates a coding table for eight - bit data in accordance with an embodiment of the present invention . as can be seen therein , the multi - bit data , here 8 - bit data , may first be subjected to the dbi method such that the number of zeros in the encoded data may range between zero and at least half of the number of multi - bits , e . g ., four . then , the dbi coded data may be subjected to steps s 150 to s 190 of fig1 to reduce a difference in range of number of zeros among the multi - bit data , thereby reducing noise . in particular , a number of zeros in case 1 to case 5 exceed the predetermined number z , so the multi - bit data may be inverted , and the first flag flag 1 may be set to a first value , e . g ., one . in contrast , a number of zeros in case 6 to case 9 do not exceed the predetermined number z , so the multi - bit data may be maintained , and the first flag flag 1 may be set to a second value , e . g ., zero . as can be seen , for example , in fig2 , during balance encoding , for those cases having less than a middle number with the range of number of zeros after the dbi encoding , e . g ., two , here case 1 , case 2 and case 9 , the second flag flag 2 may be set to a first value , e . g ., zero . for all other cases , the second flag flag 2 may be set to be a second value , e . g ., one . note that the first and second values for the first flag flag 1 and the second flag flag 2 may not be the same . if a total number of zeros for a case still is less than the middle number , e . g ., case 1 , a number of least significant bits , e . g ., the final two bits , of the data may be set to zero , as indicated by 2b data 230 . therefore , the number of zeros now may range between two and four . thus , the code may be balanced , i . e ., a delta between different cases may be reduced , reducing noise . in this particular example , the delta may be reduced from 4idq to 2idq . fig3 illustrates a flowchart for decoding multi - bit data in accordance with an embodiment of the present invention . in step s 310 , the encoded multi - bit data , the first flag flag 1 and the second flag flag 2 may be received . in step s 320 , pattern correspondence may be determined , i . e ., the value of the second flag flag 2 and the number of zeros may be checked . if the second flag flag 2 is zero and the number of zeros is greater than m , the zeros in the coded multi - bit data may be restored to ones before proceeding to step s 340 . otherwise , the process may proceed to step s 340 . a value of the first flag flag 1 may be determined . if the first flag flag 1 is one , the multi - bit data may be inverted in step s 340 . otherwise , the multi - bit data may be maintained in step s 360 . fig4 illustrates a block diagram of a single - ended parallel data interface system 700 . the system 700 may include a transmitter 710 and a receiver 720 . the transmitter 710 may include a data storing unit 711 , an encoding unit 800 and a driver unit 714 . the encoding unit 800 may include a dbi encoding unit 810 and a balancing unit 820 . details of the encoding unit 800 will be described in detail below with reference to fig5 a and 5b . the receiver 720 may include a decoding unit 900 and a data storing unit 723 . the decoding unit 900 may include a balance reversing unit 910 and a dbi decoding unit 920 . details of the decoding unit 900 will be described in detail below with reference to fig6 a and 6b . fig5 a illustrates a block diagram of the encoding unit 800 , and fig5 b illustrates a schematic diagram of the encoding unit 800 , including the dbi encoding unit 810 and the balancing unit 820 . the balancing unit 820 may include a multiplexer ( mux ) 821 and a logic level detector 822 . for example , for each eight bits of data 8b , the first 6b of the 8b data may be output to the logic level detector 822 , and may otherwise pass through the balancing unit 820 without any further processing as dq 1 to dq 6 . the final 2b of the 8b data may also be output to the logic level detector 822 and to the mux 821 . the first flag flag 1 may also be output to the logic level detector 822 , and may otherwise pass through the balancing unit 820 without any further processing . the mux 821 also may receive the 2b data 830 externally and a trigger t from the logic level detector 822 . the trigger t may be determined in accordance with the number of zeros in the 8b data and the first flag flag 1 . the mux 821 may then output dq 7 and dq 8 , and the logic level detector 822 may output the second flag flag 2 . as may be seen in fig5 b , the logic level detector 822 may include a plurality of and gates and two or gates , and the mux 821 may include a pair of multiplexers . in particular , each bit of the multi - bit data and the first flag flag 1 may be subjected to an and operation , the result of which may be output as the trigger t to the mux 821 . when the trigger t is one , the input data in 7 , in 8 may be maintained and output as the output data dq 7 , dq 8 . when the trigger t is zero , the output data dq 7 , dq 8 may be output as zero . the trigger t may also be output to a final one of the or gates . remaining and gates may output a result of subjecting the multi - bit data having sequential inputs individually inverted to an and operation to an initial one of the or gates . the initial or gate may output a result thereof to the final or gate , which , in turn , may output the second flag flag 2 . fig6 a illustrates a block diagram of the decoding unit 900 , and fig6 b illustrates a schematic diagram of the decoding unit 900 , including the balance reversing unit 910 and the dbi decoding unit 920 . the balance reversing unit 910 may include a mux 911 and a pattern detector 912 . the first 6b of the 8b data may pass through the balance reversing unit 910 without any further processing to the dbi decoding unit 920 . the final 2b of the 8b data may be output to the pattern detector 912 and to the mux 911 . the first flag flag 1 may also be output to the pattern detector 912 , and may otherwise pass through the balance reversing unit 910 without any further processing . the mux 911 also may receive 2b data “ 11 ” externally and a trigger q from the pattern detector 912 . the trigger q may be determined in accordance with the final 2b data of the 8b data , the first flag flag 1 and the second flag flag 2 . the mux 911 may then output the final 2b data accordingly to the dbi decoding unit 920 . as may be seen in fig6 a , the pattern detector 912 may include an and gate receiving the first flag flag 1 , inverted inputs of dq 7 , dq 8 , and the second flag flag 2 , the result of which may be output as the trigger q to the mux 911 . when the trigger q is one , the output data dq 7 . dq 8 may be restored to ones . when the trigger q is zero , the output data dq 7 , dq 8 may be maintained . fig7 a and 7b illustrate eye diagrams for a signal having no coding and a signal coded in accordance with an embodiment of the present invention , respectively . as can be seen therein , coding in accordance with the present invention may significantly reduce jitter , e . g ., by more than half . fig8 illustrates a coding table for eight - bit data in accordance with another embodiment of the present invention . as can be seen therein , the multi - bit data , here 8 - bit data , may first be subjected to the dbi method such that the number of zeros in the encoded data ranges between zero and at least half of the number of multi - bits . then , the dbi coded data may be subjected to steps s 150 to s 180 of fig1 to reduce a difference in range of number of zeros among the multi - bit data , thereby reducing noise . however , rather than forcing the least significant bits , here the final three bits , of the multi - bit data to be zero when there are insufficient zeros present , the least significant bits may be inverted . as can be seen , for example , in fig8 , for those cases having less than or equal to a middle number within the range of number of zeros , e . g ., two , here case 1 , case 2 , case 3 , case 8 and case 9 , the second flag flag 2 may be set to be zero . for all other cases , the second flag flag 2 may be set to be one . if the number of zeros is still less than or equal to the middle number , e . g ., case 1 , case 2 and case 9 , the final three bits of the data may inverted . therefore , the number of zeros now may range between three and five . thus , a delta between different cases is reduced , reducing noise . in this particular example , the delta is reduced from 4idq to 2idq . while the least significant bits are illustrated as being set to “ 0 ” in the encoding in accordance with embodiments of the present invention , any of the bits of the data of the desired number may be set to “ zero ” in accordance with the present invention . in other words , the encoding of the present invention is concerned with a total number of zeros for each case , and each case may represent more than one data value . while embodiments of the present invention have been described in connection with a multi - bit data that is an eight - bit word for ease of description , the balance coding in accordance with embodiments of the present invention may be extended to other multi - bit data , e . g ., 16 - bit data , 64 - bit data , etc . further , while only one balance coding has been illustrated for ease of description , repeated balance codings may be employed . for example , when n balance codings are used , an initial delta δ i between a maximum number of zeros and a minimum number of zeros in the initial multi - bit data may be reduced by up to 2 ( n + 1 ) , where n = 0 indicates that only data bus inversion has occurred , i . e ., no balance codings have been performed . in other words , after n balance codings , a resultant delta δ n may be satisfy the following relationship ( 1 ). δ i & gt ; δ n ≥ δ i 2 ( n + 1 ) ( 1 ) additionally , a number of bits x within multi - bit data having m - bits that may be used as the least significant bits to be set to zero or inverted , may satisfy the following relationship ( 2 ). m 2 n & gt ; x ≥ m 2 ( n + 1 ) ( 2 ) exemplary embodiments of the present invention have been disclosed herein , and although specific terms are employed , they are used and are to be interpreted in a generic and descriptive sense only and not for purpose of limitation . for example , the balancing of multi - bit data of the present invention may be implemented in software , e . g ., by an article of manufacture having a machine - accessible medium including data that , when accessed by a machine , cause the machine to balance the multi - bit data in accordance with methods of the present invention . further , while 8 - bit data has been given as an example of multi - bit data , embodiments of the present invention may be adapted to other sizes of multi - bit data . it is noted that each additional flag may reduce a delta between coded data by up to a factor of two . accordingly , it will be understood by those of ordinary skill in the art that various changes in form and details may be made without departing from the spirit and scope of the present invention as set forth in the following claims . | 6 |
it is well known that , during inhalation therapy or systemic absorption via the respiratory tract , the human lung separates particles based on the aerodynamic diameter , which is a function of the actual average particle diameter ( i . e ., the geometric diameter ), as well as the shape and the density of the particle . more specifically , a lower particle density will produce a smaller aerodynamic diameter for particles of equivalent geometric since size , as illustrated by equation 1 as follows : where d ae and d geo are the aerodynamic and geometric diameters , respectively , and p is the particle density . because of the spherical particulates being hollow , they have an actual density lower than that of the solid particulates currently employed for respirable medicaments . thus , applicants have unexpectedly discovered that the spherical hollow particulates should be perceived by the lung as being of a smaller aerodynamic size than the aerodynamic size of the solid particulates of substantially the same actual average particle diameter , and thus the spherical hollow particulates should be deposited deeper in the lungs . moreover , the spherical hollow particulates can be made with an actual average particle diameter ( i . e ., the geometric diameter ) greater than that of the solid particulates currently employed for respirable medicaments . in that event , the spherical hollow particulate form would likely improve the deaggregation properties of the medicament for entrainment in the inhalation stream , as the medicament is moving from an inhalator device into the patient &# 39 ; s lungs , due to the large spherical hollow particulates having less surface - to - surface contact with each other as compared to the relatively smaller solid particulates . as a result , an increase in the respirable fraction of a medicament formulation should be achieved with large spherical hollow particulates as compared to small solid particles , where the mass median aerodynamic diameter of the two is approximately the same . as noted above , methods for spray drying of particles are well known , and it is also well known that controlling selected conditions for spray drying , such as the temperature , the type of solvent , the concentration of the active ingredient and / or the optional excipient , can result in the spray dried particles being hollow structures instead of solid . any of the various well known spray drying methods may be employed for spray drying the medicament particles in accordance with the present invention to form spherical hollow structures useful for inhalation therapy or systemic absorption via the respiratory tract , including those spray drying methods disclosed in the above - mentioned u . s . pat . no . 4 , 590 , 206 to forrester et al ., u . s . pat . no . 4 , 127 , 622 to watanabe et al . and pct international publication no . wo 91 / 12823 to illum et al ., the disclosures of which are incorporated herein by reference . various solvents may be employed during spray drying , including , but not limited to , hydrocarbons , halogenated hydrocarbons ( i . e ., fluorinated hydrocarbons or chlorinated hydrocarbons ), alcohols , ketones , and the like . examples of suitable solvents include , but are not limited to , water , hexane , perfluoromethylcyclohexane , perfluorohexane , perfluoropentane , dichloromethane , ethanol , acetone , and combinations thereof . medicament particles which may be spray dried in accordance with the present invention to form spherical hollow particulates are suitable for use as respirable medicaments for inhalation therapy or systemic absorption via the respiratory tract to treat respiratory disorders such as asthma , bronchitis , chronic obstructive pulmonary diseases and chest infection . additional medicaments may be selected from any other suitable drug useful in inhalation therapy and which may be presented as a suspension or in a dry powder inhalator . appropriate medicaments may thus be selected from , for example , analgesics , e . g ., codeine , dihydromorphine , ergotamine , fentanyl or morphine ; anginal preparations , e . g . diltiazem ; antiallergics , e . g . cromoglycate , ketotifen or neodocromil ; antiinfectives e . g . cephalosporins , penicillins , stretomycin , sulphonamides , tetracyclines and pentamidine ; antihistamines , e . g . methapyrilene anti - inflammatories , e . g . fluticasone , flunisolide , budesonide , tipredane or triamcinolone acetonide ; antitussives , e . g . noscapine ; bronchodilators , e . g . salmeterol , salmbutamol , ephedrine , adrenaline , fenoterol , formoterol , isoprenaline , metaproterenol , phenylephrine , phenylpropanolamine , pirbuterol , reproterol , rimiterol , terbutaline , isoetharine , tulobuterol orciprenaline , pirbuterol , reproterol , rimiterol , terbutaline , isoetharine , tulobuterol orciprenaline , or (−)- 4 - amino - 3 , 5 - dichloro - α -[[[ 6 -[ 2 -( 2 - pyridinyl ) ethoxy ]- hexyl ] amino ] methyl ] benzenemethanol ; diuretics , e . g . amiloride ; anticholinergics , e . g . ipratropium , atropine , oxitropium ; hormones , e . g ., cortisone , hydrocortisone or prednisolone ; xanthines e . g . aminophylline , choline theophyllinate , lysine theophyllinate or theophylline and therapeutic proteins and peptides , e . g . insulin or glucagon . it will be clear to a person skilled in the art that , where appropriate , the medicaments may be used in the form of salts ( e . g . as alkali metal or amine salts or as acids addition salts ) or as esters ( e . g . lower alkyl esters ) or as solvates ( e . g . hydrates ) to optimise the activity and / or stability of the medicament . preferred medicaments are salbutamol , salmeterol , fluticasone propionate , beclomethasone dipropionate , terbutaline , cromoglycate , budesonide , and triamcinolone acetonide and / or salts thereof . moreover , the medicaments optionally may be together with excipients acceptable for inhalation into the human body , which may be organic excipients , such as polysaccharides ( i . e ., starch , cellulose , and the like ), lactose , glucose , mannitol , amino acids , and maltodextrins , or may be inorganic excipients , such as calcium carbonate and sodium chloride . the excipient may be included with the medicament via well known methods , such as by admixing , co - precipitating , and the like . when entrained in an inhalation stream for inhalation by the patient , the spherical hollow particulates typically should acquire a mass median aerodynamic diameter , particularly from about 0 . 5 μm to about 7 . 0 μm , more particularly from about 1 μm to about 4 . 5 μm , as perceived by the patient &# 39 ; s lungs as the spherical hollow particulates pass into the lungs . also , the spherical hollow particulates typically should have & gt ; 50 % of the mass of hollow particulates , more particularly & gt ; 70 % of the mass of hollow particulates , particularly having a mass median aerodynamic diameter & lt ; 6 μm , more particularly & lt ; 5 μm , as perceived by the patient &# 39 ; s lungs as the spherical hollow particulates pass into lungs . as noted in the above discussion of prior art inhalators , it is particularly useful that particles of respirable particle size range have more than 50 % thereof with a mass median aerodynamic diameter & lt ; 6 μm , more particularly & lt ; 5 μm , for appropriate deposition into the lungs , which should be achieved with the present invention . the ability to control the geometric density of the substantially spherical hollow particulates offers an additional advantage over current inhalator systems which use a suspension of medicament particulates in a propellant . in existing systems containing drug and propellant suspensions , the suspension may separate or stratify because of the differences in the densities of the medicament and propellant . separation may be either classified as “ creaming ” wherein the medicament rises to the top of the more dense propellant , or “ sedimentation ” wherein the medicament settles to the bottom of the less dense propellant . regardless of the classification , separation of the medicament and component may cause a lack of dosage uniformity per activation , i . e ., each dose may not provide an equal amount of drug over the life a multi - dose inhalator . the uniformity of dosages delivered by multi - dose inhalators is of critical importance to the efficacy of the device and must be within narrow parameters to meet regulatory criteria . the problem of separation of the suspension is generally addressed by vigorously shaking the inhalator immediately before it is used . however , patient compliance with this simple task is difficult to control and even slight delays between shaking and use effect dosage uniformity . the present invention , however , overcomes the problem separation and , in so doing , conceivably eliminates the need to shake the inhalator before use . by allowing the drug to be density matched to the selected propellant , the tendency of the medicament and propellant to stratify is removed . the drug and propellant are uniformly distributed in suspension and it can be assumed that each dose would then also be similarly uniform . medicament density may be pre - selected and controlled by adjusting the spray drying conditions under which the particulates are created , as previously mentioned . in particular , though , density may be controlled by adjusting the thickness of the walls of the spheres as compared to sphere diameter , and by adjusting the ratio of drug to excipient when creating composite medicament particulates . in some embodiments , however , it may be preferred to use pure medicaments without excipients . in short , the ability to pre - select and control the geometric density of the medicament particulates offers a significant advantage over existing medicament / propellant suspension systems . with respect to dry powder inhalators , the spherical hollow particulates of the present invention are suitable for use in any carrier in any dry powder inhalator , including , but not limited to , any of the dry powder inhalators disclosed in the above - mentioned patents and published patent applications . the spherical hollow particulates of the present invention are also suitable for use in any metered dose inhalator , including the pressurized aerosolized type ( where the particulates are together with a propellant and an optional suspending agent ). with respect to pressurized aerosol metered dose inhalators , as such pressurized aerosol containers are well known in the art , the spherical hollow particulates may be placed in a pressurized container with a suitable propellant , and optionally with a suitable suspending agent ( also known as a dispersing agent or a surfactant ) by any of the well known methods therefor , such as that shown in the above - noted respiratory drug delivery , p . 185 et seq . in general , adding a medicament to a pressurized aerosol container is accomplished as follows . medicament is added to a high shear blender ( i . e ., mixer ) which contains propellant and may also contain a suspending agent . it may also be preferred to add a polar substance to increase solubility of surfactant in a propellant , e . g . ethanol . propellants may be of the chlorofluorocarbon variety ( i . e ., trichloromonofluoromethane , sold by dupont under the registered trademark freon 11 and colloquially known as cfc - 11 , or dichlorodifluoromethane , sold by dupont under the registered trademark freon 12 and colloquially known as cfc - 12 ), which , as mentioned above , are being phased out by the environmental protection agency of the u . s . government as each of freon 11 and freon 12 has an odp = 0 . alternatively , propellants may be of the more recently developed environmentally safe varieties . suitable environmentally safe propellants include , but are not limited to , any of the above - mentioned perfluoroethane , monochlorodifluoromethane , 1 , 1 , 1 , 2 - tetrafluoroethane , 1 , 1 ,- difluoroethane , 1 , 1 , 1 , 2 , 3 , 3 , 3 - heptafluoro - n - propane , and combinations thereof . suitable optional suspending agents include , but are not limited to , oleic acid , span ® 85 ( registered trademark for the partial esters of the common fatty acids ( lauric , palmitic , stearic , and oleic ) and hexitol anhydrides ( hexitans and hexides ), that are derived from sorbitol and that tend to be oil - soluble and dispersible or insoluble in water }, lecithin , and combinations thereof . if the propellant has a low boiling point so that it would volatilize during procedures at or near room temperature , then the mixer needs to be maintained well below room temperature to prevent evaporation or alternatively a sealed mixer ( one in a closed system with the container ) may be employed . once a homogenous suspension is obtained , the suspension is filled into aerosol containers . during the filling , the mixer can be used to maintain adequate suspension throughout the entire filling circuit by continuously circulating the suspension through the concentrated filling unit . at this point , there exist two main options . with the first option , especially for products not using the environmentally unsafe propellant , cfc - 11 , the entire formulation is prepared in a low temperature pressure vessel and then filled through the valve into evacuated , previously crimped containers . care must be taken with propellants such as hfc - 134a , that have a high vapor pressure , as filling through the valve of the container is difficult with such propellants . the second option involves the manufacture of a lower volatility concentrate . with this alternative technique , filling is in a controlled environment into containers , after which the valves are crimped in place . subsequently , the high pressure propellant is added through the valve . the tensile strength of the spherical hollow particulates will vary depending on the particular medicament ( and optional excipient ) being spray dried . in the event that the spherical hollow particulates have a weak enough tensile strength so that a large storage container of them , such as a kilogram quantity , would result in upper hollow particulates crushing lower hollow particulates in the container prior to deposition of the hollow particulates in an inhalator device , then formation of hollow particulates should be accomplished in - line so that the formed hollow particulates can be deposited directly after formation into an inhalator device . medicament powder of each of the two medicaments , albuterol sulfate and amiloride hcl ( abbreviated herein as alb s and amil hcl , respectively ), is employed in this example . also , the excipient , lactose , is employed in this example . aliquots of each of the medicaments , and also of lactose , are spray dried as follows . 15 g of alb s ( lot no . w 1946 fb ) are dissolved in 300 ml of water to create a 5 % solution . similarly , 3 . 479 g of amil hcl ( lot no . 9007h 902 ) are diluted in water to 1000 ml to create a solution . likewise , 15 g of lactose ( lot no . 1nc25 , 605 from sheffield products of norwich , n . y .) are diluted in water to 150 ml to create a solution . each solution is respectively spray dried using a virtis ™ ( a spray dryer commercially available from the virtis company of gardiner , n . y .) with each of the air from the nozzle and from the blower set at its respective maximum value under the following conditions of temperature and rate , as summarized in table a below : table a flow rate spray dried inlet temp outlet temp setting particles (° c .) (° c .) ( ml / minute ) alb s 150 101 7 ( medicament ) amil hcl 150 92 12 ( medicament ) lactose 180 127 5 ( excipient ) spray drying produced the following average particle diameters ( i . e ., the geometric diameters ) as summarized in table b below : table b spray dried geometric hollow particles diameter or solid alb s 1 to 5 μm dimpled solids amil hcl 1 to 5 μm hollow spheres lactose 2 μm hollow spheres as noted in table b and as can be seen in the photomicrographs in fig1 and 2 , spray drying the alb s produced dimpled solid structures and did not produce spherical hollow particulates . on the other hand , spray drying the amil hcl produced spherical hollow particulates , as can be seen in the photomicrographs in fig3 - 5 . spray drying the lactose produced spherical hollow particulates , with the largest lactose particulate having an average particle diameter of about 17 μm , as can be seen in the photomicrographs in fig6 and 7 . while it is not intended to be bound to any theory , it is believed that the concentration of alb s in water , namely a 5 % solution of 15 g in 300 ml , was not low enough for the spray drying to result in spherical hollow particulates of alb s , and thus , lowering the concentration of alb s should result in spherical hollow particulates . also , it is believed that admixing the alb s with an excipient , such as lactose , during the spray drying should result in spherical hollow particulates . the following is a discussion of how a diskhaler ™ ( a medicament dispersing device , i . e ., an inhalator , commercially available from glaxowellcome , inc .) and an aerobreather ™ ( available from api of hadley , mass .) may be employed with the spherical hollow medicament particulates of the present invention , such as the amil hcl made in example i , to determine how the powdered medicament is dispersed and thus illustrate that the spherical hollow medicament particulates are useful in a dry powder inhalator . more particularly , the extent to which a medicament is dispersed may be measured by its mass median aerodynamic diameter ( mmad ) in micrometers , and the percentage that is less than 6 micrometers , particularly less than 5 micrometers , is indicative of desirable particle size for inhalation into the lungs . several diskhaler ™ devices should be employed . the diskhaler ™ has a screen which serves to direct an air jet , thus helping to entrain the particles in the air jet . the 4 - blister compartment would be removed from the holder portion of each diskhaler ™. a dosage of each of the spray dried spherical hollow particulates would be respectively loaded onto the bottom of the holder portion of a diskhaler ™, the bottom serving as a carrier surface . next , each diskhaler ™ with its respective medicament would be attached to an aerobreather ™ for dispersion of the medicament from the carrier . the aerobreather ™ is a device that simulates inspiration by a human through the mouth at 60 liters / minute , with an acceleration of 19 liters / second 2 and a total volume of 1 liter . the inspired powder ( which would be approximately 1 milligram ) then would be drawn into the aerosizer ™ unit for aerodynamic particle size analysis . the photomultiplier tubes of the aerosizer ™ would be operated at 1100 volts , and the data would be analyzed in an auto - combine mode with software version 5 . 02 . 37 available from api of hadley , mass . as noted above , the extent to which the powder is dispersed is measured by the mmad in micrometers , and the percentage that is less than 6 micrometers , particularly less than 5 micrometers , is indicative of desirable particle size for inhalation into the lungs . the results for the dispersed spray dried spherical hollow medicament particulates should be a mmad from about 0 . 5 to about 7 μm , particularly about 1 to about 4 . 5 μm , and a % mass & lt ; 6μm of about 30 % or more , particularly about 50 % or more , and most particularly about 70 % or more . also , the spherical hollow particulates of the present invention should be deposited deeper in the lungs than are conventional micronized solid particulates ( with substantially the same geometric diameter ) from a dry powder inhalator . the following is a discussion of how an inhalator that is a pressurized aerosol container with a valve may be employed with the spherical hollow medicament particulates of the present invention , such as the amil hcl made in example i . example formulations suitable for a metered dose inhalator according to this invention include ( i ) a suspension consisting essentially of spherical hollow medicament particulates of respirable size and 1 , 1 , 1 , 2 - tetrafluoroethane ; and ( ii ) a suspension of spherical hollow medicament particulates of respirable size , 1 , 1 , 1 , 2 - tetrafluoroethane , oleic acid and sufficient ethanol to solubulize the oleic acid . the spherical hollow medicament particulates should be added to a high shear blender ( i . e ., mixer ) which contains , for instance , 1 , 1 , 1 , 2 - tetrafluoroethane propellant ( colloquially known under the trade name , hfc - 134a ) and lecithin suspending agent . however , the vapor pressure of 1 , 1 , 1 , 2 - tetrafluoro - ethane propellant at 68 ° f . is 68 . 4 psig , and hence , the vapor pressure is too great to meet the u . s . government department of transportation requirements for use in aerosol containers when the containers are transported and temperatures can go up to 130 ° f . thus , a vapor pressure depressant , such as a glycol ether ( i . e ., 2 - butoxyethanol ) or an alkyl acetate ( i . e ., butyl acetate ) should be used together with 1 , 1 , 1 , 2 - tetrafluoroethane propellant so that the resultant suspension in the aerosol container meets the department of transportation requirements and has a vapor pressure of less than 180 psig at 130 ° f . also , since 1 , 1 , 1 , 2 - tetrafluoroethane propellant has a low boiling point of − 15 . 5 ° f . (− 26 . 5 ° c .) so that it would volatilize during procedures at or near room temperature , then the mixer should be maintained well below room temperature to prevent evaporation . alternatively , a sealed mixer ( one in a closed system with the container ) may be employed . once a homogenous suspension is obtained , it is filled into aerosol containers . during the filling , the mixer can be used to maintain adequate suspension throughout the entire filling circuit by continuously circulating the suspension through the concentrated filling unit . because , as noted , 1 , 1 , 1 , 2 - tetrafluoroethane propellant has a high vapor pressure , care must be taken during filling as filling through the valve of the container is difficult with such high pressure propellants . with one technique , the entire formulation is prepared in a low temperature pressure vessel and then filled through the valve into evacuated , previously crimped containers . with an alternative technique , the propellant is not placed in suspension with the medicament and suspending agent prior to filling . rather , filling of the suspension of medicament and suspending agent into each container is accomplished in a controlled environment , after which the valve is crimped in place onto the containers . subsequently , the high pressure 1 , 1 , 1 , 2 - tetrafluoroethane propellant is added through the valve . as noted above , the extent to which a medicament is dispersed may be measured by its mass median aerodynamic diameter ( mmad ) in micrometers , and the percentage that is less than 6 micrometers , particularly less than 5 micrometers , is indicative of desirable particle size for inhalation into the lungs . accordingly , like the results noted above in example ii for the spray dried spherical hollow medicament particulates dispersed from a dry powder inhalator , the results for the spray dried spherical hollow medicament particulates dispersed from pressurized aerosol containers should be a mmad from about 0 . 5 to about 7 μm , particularly about 1 to about 4 . 5 μm , and a % mass & lt ; 6μm of about 30 % or more , particularly about 50 % or more , and most particularly about 70 % or more . also , the spherical hollow particulates of the present invention should be deposited deeper in the lungs than are conventional micronized solid particulates ( with substantially the same geometric diameter ) from an aerosol inhalator . it will be understood that various details of the invention may be changed without departing from the scope of the invention . furthermore , the foregoing description is for the purpose of illustration only , and not for the purpose of limitation — the invention being defined by the claims . | 0 |
the detailed description is divided into five sections . section 1 describes an overview of the network . section 2 sets forth an overview of the adaptive time division multiple access (&# 34 ; tdma &# 34 ;) media access control (&# 34 ; mac &# 34 ;) layer protocol of the present invention . section 3 describes the frame formats used . section 4 describes the scheduling method on the shared radio channel . section 5 presents the method for operating a repeater unit 15 explaining how a repeater can relay information from one remote region to a ccu 12 and vice versa . as shown in fig1 and 4 wireless network 10 of the present invention is based on a cellular topology . a single cell 11 includes a region covered by a single radio broadcast service . the cell 11 includes a single central control unit (&# 34 ; ccu &# 34 ;) 12 and plurality of remote or terminal units (&# 34 ; tus &# 34 ;) 14 each of which is radio frequency linked 13 to the ccu 12 . in areas of the cell 11 where the radio coverage does not reach a particular terminal unit , a repeater unit (&# 34 ; ru &# 34 ;) 15 is used to relay frames between remote tus 14a and 14b and the ccu 12 . as shown in fig1 a single wireless cell 11 including a single ccu 12 and multiple tus 14 is arranged in a star configuration . the ccu 12 is the cell controller . a tu 14 radio frequency linked 13 to ccu 12 represents a data terminal device , such as , a computer , a digital camera , a digital monitor , a computer terminal or the like . media access control protocol for the present invention employs an adaptive tdma process or cycle 20 . the cycle 20 of typical scheduling for media access is depicted in fig2 . a total cycle is divided into two phases , an up - link phase 21 followed immediately by a down - link phase 22 . the total cycle duration is variable as explained below . the up - link phase 21 of the cycle 20 starts with the ccu 12 broadcasting a synchronization frame , (&# 34 ; synch &# 34 ;) 23 . all tus 14 in the cell 11 use the synch frame 23 to schedule their access to the shared channel . as described below in greater detail , tu &# 39 ; s 14 will know how many other tu &# 39 ; s 14 are scheduled ahead of themselves in an up - link phase , and will be able to count slots to find their assigned slot to transmit in . tus 14 are required to monitor the channel and determine whether the ccu 12 had allotted an up - link slot for them in the next up - link cycle . as will be seen below , this task is accomplished by a tu &# 39 ; s receipt of an addressed confirmation bit set in the acknowledgement frame 29 by ccu 12 . the ccu 12 switches to a receive mode 24 after transmitting the synch frame 23 . ( fig3 ). the protocol provides for a specific time slot 25 , 27a , allocated by the ccu 12 by demand ( e . g . by request or reservation ) from a tu 14 in a prior up - link phase for the next up - link phase . each up - link slot is of equal duration or size during which a single data frame is transmitted from the tu 14 to the ccu 12 . only during its allotted up - link time slot is a tu allowed to transmit . for example , as shown in fig2 tu 1 is only allowed to transmit in slot 25 , tu 2 in slot 27 , tu n in slot 27a etc . if a tu , for some reason , misses the synch frame 23 , it loses its turn to transmit during the current cycle 20 . when all selected tus 14 finish transmitting their frames , they revert to the receive mode and the ccu 12 switches to the transmit mode 28 . ( fig3 ). as described below in greater detail the ccu 12 broadcasts a special fixed size acknowledgement (&# 34 ; ack &# 34 ;) frame 29 directed from the ccu 12 to all tus 14 . next , the down - link phase 22 immediately follows . the ccu 12 follows the ack frame 29 by broadcasting down - link data frames 31 directed to the respective tus 14 for whom the ccu has traffic . during the down - link phase the total number of down - link slots is variable . the ccu 12 may transmit zero frames up to the number of tus in its cell , with a maximum of one frame per tu . these frame slots , however , are of variable sizes depending on the size of the payload ( presence and amount of information ) intended to be transmitted by the ccu 12 to each respective tu 14 for whom it has traffic . as seen in fig2 the ccu 12 has downloaded data frames of different sizes for tu 2 and tu n only and had no data message for tu 1 . upon completion of the transmission of data frames to the tus 14 , the ccu 12 sends the next synch frame 23 to start another up - link phase 21 of a new cycle 20 . different cycles 20 may have different total durations of time . in this manner a ccu 12 acts as a frame relay between tus 14 in the same cell , as well as with tus 14 that may reside in different cells ( not shown ). in the latter case , the local ccu 12 forwards frames 31 to a remote ccu 12 ( not shown ) where the target tu 14 ( not shown ) is located . the mac layer protocol employs three types of frames : synch 23 , data 31 , and ack 29 . the digital hardware used in the preferred embodiment is a motorola 68302 processor . however , other processors are known and may also be used such as an motorola 68360 . since transmission over the radio channel preferably employs the hdlc capabilities of the motorola 68302 , all frame formats are based on the format of an hdlc frame 40 one embodiment of which is shown in fig2 a , 2b . hdlc frame 40 comprises a plurality of individual fields wherein each field is comprised of a number of 8 - bit bytes . applicant stresses , however , that this format is only one of many that are conventional and will work in the protocol of the present invention . as seen in fig2 a hdlc frame 40 has as its first field a header or preamble 41 , followed by a special beginning frame or start delimiter field 42 of 1 - byte , followed by a 2 - byte destination address field 43 , followed by a 2 - byte source address field 44 , followed by a frame length field 45 , followed by a variable length information field 46 which includes a two part control field 47 , having a 1 - byte control field portion 47a and a 1 - byte type field portion 47b , and a variable length data packet 48 , followed by a 4 - byte frame check sequence or crc field 49 , and terminated by an end frame or end delimiter field 50 of 1 - byte . as more fully described below and as seen in fig2 to identify each frame type , the type field 47b of the control field 47 of an hdlc frame 40 is programmed with a special code for each type as more fully described below . the data field of the hdlc frame 40 is used to carry the relevant information for the respective mac layer frame . a ccu 12 broadcasts a synch frame 23 at the beginning of each up - link phase 21 of cycle 20 . in destination address field 43 , hdlc frame 40 uses the ffff hex address for broadcast addressing to be received by all stations . the hdlc type field 47b is programmed for the synch frame with the identification byte ad hex . the identification flag field 47b consists of four repeats of the type field code ad hex , namely : adadadad hex . additionally , a 32 - bit identification flag ( not shown ) is also used in the hdlc data field 48 for redundant recognition of the synch frame 23 . ( it is important that no remote unit 14 miss the synch frame 23 which synchronizes the entire network .) these identification flags can be used to recognize the synch frame even if the hdlc frame has crc errors . the crc field 49 is generated automatically by the motorola 68302 when its serial control channel , scc , is programmed in the hdlc mode . the hdlc data frame 40 has a variable size data packet field 48 ranging between 23 octets and 128 octets . it is generated in the ccu 12 to forward data to a tu 14 during down - link phase 22 . when used by the ccu 12 , the data frame 40 has a variable length data packet field 48 which is reflected in the variable size of the down - link slots 31 . it also is generated in the tu 14 to send data to the ccu 12 during up - link phase 21 . when used by the tu 14 , the data frame 40 has a data packet field 48 of variable length , but which is restricted by the fixed size of the up - link slots 25 , 27 . thus , if a tu 14 uses only a few of the octets in the hdlc data packet field 48 of a data frame 40 which do not fully occupy up - link slots 25 , 27a , the balance of those slot widths would be unused . conversely , if the length of the data packet field 48 of a data frame 40 was so long that the data frame 40 exceeded the length of slot 25 , 27 , 27a , duration , some of the data would be lost . the 2 - byte 16 - bit hdlc frame 40 destination 43 address field is used to identify the ccu 12 address when data is directed from a tu 14 to ccu 12 , while it is used to identify the selected tu 14 address when data is directed from ccu 12 to tu 12 . the 2 - byte , 16 - bit hdlc frame 40 control field 47 , shown generally at 51 in fig2 a , 2b , is used to indicate the status of the last transaction and the data - link sequence number in control field 47a , and the type of data frame in type field 47b . as seen in fig2 b control field 47 , 51 is programmed as follows : bit 0 is a data link acknowledgement (&# 34 ; dlack &# 34 ;). in the case of data frames from a tu 14 to a ccu 12 , a zero indicates a tu 14 &# 39 ; s positive acknowledgement of receipt of ccu 12 &# 39 ; s data frame 31 . this field is ignored in the case of data frames from the ccu 12 to a tu 14 ( the ccu 12 uses the acknowledgment frame 29 to acknowledge all transmissions from all tus 14 at once ). bit 1 is used by a tu 14 in the present up - link phase 21 to make a request or reservation , directed to the ccu 12 , for allocation of a slot 25 , 27 , 27a during the next up - link phase 21 of the next cycle 20 . bits 5 - 7 contain the data link sequence number of the frame , each bit of which can take the values : 0 , 1 , 2 , and 3 . bits 8 - 15 contain the frame type identification field . the content of this frame is a sync frame ( ad hex ), or indicates if the frame contains data ( 10 hex ), ack only , ( 01 hex ), or data plus a piggybacked ack ( 11 hex ). the hdlc frame 40 data field 48 has a variable size of up to 122 octets of which 18 are reserved for higher level protocols and 104 for actual transport level data . information is encapsulated inside the hdlc frame data field . this frame format 40 is only used by the ccu 12 to send to the tus 14 for data link level acknowledgment and reservation confirmation . in addition to the standard hdlc fields , the ccu 12 acknowledgement / confirmation frame 40 includes inside the hdlc data field 46 , two hundred fifty - six ( 256 ) additional acknowledgement and confirmation fields , one field per tu . one such tu field 60 is shown in fig2 c for a typical ccu 12 format . each field consists of 2 bits , 1 bit 61 for acknowledgment and 1 bit 62 for confirmation of allocation of a transmission slot for the respective tu in the next up - link phase 21 of cycle 20 . in the acknowledgment field 61 , a zero indicates positive acknowledgement while a 1 indicates a negative acknowledgment . in the confirmation field 62 a 1 indicates allocation of a slot for the respective tu 14 in the next up - link phase 21 , while a zero indicates no allocation of a slot . the size of the total set of 256 acknowledgement / confirmation fields 60 of ccu 12 acknowledgment / confirmation frame 29 is 72 octets . since each tu receives the entire ack frame 29 and since the 256 fields are algorithimically mapped in rom to identify each of the 256 remote stations , thus , each tu knows precisely which ones and how many of the tus 14 are scheduled in the next up - link phase 21 and it can locate its up - link slot by simply counting a predetermined amount of elapsed time . the protocol of the present invention employs optimization techniques that allow better utilization of the shared channel . the topology is cellular in nature , where a ccu 12 coordinates the sharing of a channel among the tus 14 in the same cell 11 . under this protocol , a tu 14 does not have to use a slot 25 , 27 , 27a in every cycle , but is allowed to make a reservation whenever it has data to transmit to the ccu 12 . a typical down - link phase 22 cycle starts by the ccu broadcasting an ack frame 29 to all tus 14 . the first ack frame 29 will allocate a slot for each tu 14 in the cell 11 by setting bit 61 to 0 . the number of tus 14 in a cell , n , is a programmable parameter in the ccu 12 code . after the transmission of the ack frame 29 , the ccu 12 transmits data frames addressed to the tus 14 in its cell 11 for whom it has data . the ccu 12 then , broadcasts a synch frame 23 to all tus 14 in the cell 11 . at this point the ccu 12 switches 24 to a receive mode and waits a number of slots equal to the number of tus 14 it has programmed for transmission for this up - link phase 2 of this cycle 20 . tu 2 , for example , upon receiving the ack frame 29 from the ccu 12 , schedules itself for transmission during the upcoming cycle by counting a predetermined time interval to its slot 27 . for a tu , the cycle 20 starts at the instant it receives a synch frame 23 from the ccu . if a tu is scheduled to transmit during the time slot , it waits for the beginning of that slot and transmits one data frame 40 . a tu switches 26 , 28 to the receive mode as soon as it finishes its transmission of its data frame . during each transmission of a frame from the tu 14 to the ccu 12 , the tu indicates whether it needs to continue transmitting during the following cycle . it does this by setting bit 1 in the hdlc frame control field 47a , as described above . the ccu 12 responds to this request by setting a 1 in the appropriate confirmation field 62 for that tu 14 in the ack frame 29 , and allocates a slot for that tu 14 in the upcoming cycle . the ccu 12 confirms the allocation of a slot to the tu 14 in its ack frame broadcast during every cycle . if the tu 14 does not request transmission during the upcoming cycle ( bit 1 of control field 47a not set ), it is dropped from the next up - link phase 21 of the next cycle 20 and is left in a suspended state for a while . the tu might also be dropped by a higher - order software agent governed by its load analysis algorithm , thus , giving other tus priority . the ccu 12 , every k cycles of silence for each tu 14 , polls the tu 14 to inquire whether the suspended tu 14 wants to resume inclusion in the up - link phases 21 of cycles of transmission . such a periodic polling mechanism is a simple matter to implement in software and hardware . for example , a counter may be incremented each time the &# 34 ; for &# 34 ; loop scanning all queues ( open per tu ) looking for a data buffer to transmit finds no data buffer present for a specific queue . the counter may be compared to a threshold set by a higher - order agent in the system ( governed by a load analysis algorithm ), and if the count exceeds the threshold the confirmation bit 62 ( fig2 c ) would be set to 1 for the tu in the next ack frame . thus , every k cycles an idle tu would be polled . in addition , every time the ccu 12 schedules a tu 14 to receive a data frame 40 in a down - link slot 31 in the down - link phase 22 , it also schedules the selected tu 14 for transmission in the upcoming up - link phase 2 by setting the confirmation bit 62 of the ack frame 29 because ccu 12 anticipates at least an acknowledgment ( bit 0 in the hdlc frame control field 47a set to 0 ) to be returned from that tu 14 to the ccu 12 . this allows the tu 14 to resume entering the transmission cycle again . for example , during the initialization phase the ccu 12 gives all tus 14 a reservation by setting bit 62 to 1 in the ack frame 29 , and its receive timing is set to listen in all slots 25 , 27 , 27a that there are tus for . this makes for a long initial cycle . meanwhile , all tus 14 are in the listen mode and capture the ack frame 29 containing reservation bits 62 for all tus 14 including their own . immediately following reception of the ack frame 29 , each tu 14 tests the &# 34 ; confirmation &# 34 ; bits found there and simply counts them in sequential order up to its own tu identification number ( address ). the value of this counter is the slot that it ( the tu ) will use for its response to the ccu 12 . the term &# 34 ; reservation &# 34 ; and &# 34 ; confirmation &# 34 ; are complementary in that the tu sets a reservation request and the ccu confirms it in the ack . a tu 14 responds back to the ccu 12 following receipt of the synch frame 29 ( which begins a new cycle ) only if it had detected the ccu 12 confirmation bit 62 , regardless of whether or not it had made a reservation in an earlier frame . this then is an example of explicit polling by the ccu 12 which may occur either when it ( the ccu 12 ) has data to download to tu 14 ( whether or not formerly idle ), or it wishes to &# 34 ; test &# 34 ; a suspended or idle tu 14 to see if the tu 14 now has data to upload , or that the tu 14 is still within the cell and in a ready condition . the higher - order software scheduling algorithm would normally not suspend a tu that continues to make a reservation ( indicating a non - idle state ) if the mean throughput of the system is at or below some critical threshold . when the system load profile ( as determined by the algorithm ) exceeds this threshold , the value of k determining the number of idle cycles imposed upon a tu would be adjusted according to a priority list , with higher priority tus receiving a lower k number . entries to the priority list may be hard - coded by default or modified by a higher - order command directed toward the ccu from some other source . this heuristic adaptive scheduling algorithm optimizes the utilization of the shared channel particularly when the load profile from various tus 14 is different . this is a substantial performance improvement over the conventional systems . as shown in fig4 the repeater unit (&# 34 ; ru &# 34 ;) 15 operates in cells 11 where the coverage of a particular ccu 12 is not broad enough to reach all tus 14 in the cell 11 . a subset of tus 14a , 14b , which are in a blind region relative to the ccu 12 , are served by a repeater unit 15 . the ru 15 includes a ccu 17 -- tu 16 pair (&# 34 ; ccu - tu &# 34 ;) connected back to back as shown in fig4 . the ccu 17 part of the ru operates as if it is a central control unit for a mini - cell 18 consisting of the region serving the tu &# 39 ; s 14a , 14b that are in the blind region of the ccu 12 of the major cell 11 . the ccu 17 needs to use its own localized pn code for its spread - spectrum radio . any up - link data frame 25 , 27 , 27a received from a tu 14a , 14b in the mini - cell 18 is passed through the uart channel of the ccu 17 to the uart channel of the attached tu 16 . the tu 16 in turn acts as a regular tu 14 with respect to the ccu 12 of the major cell 11 . the tu 16 needs to use for its spread - spectrum radio the pn code used by the major cell ccu 12 . any down - link data frames 31 received by the tu 16 from the ccu 12 of the major cell 11 are forwarded directly to the attached ccu 17 of the ru 15 using the uart channel . these frames are then forwarded by the ccu 17 to the remote tus 14a , 14b within the mini - cell 18 . when a data frame is received by the ru 15 from either the ccu 17 or the tu 16 , only the hdlc header and trailer are stripped while the inner information is encapsulated again by a new hdlc header and trailer for forwarding to the respective radio . the present invention includes a hand off scheme for transient tus . in a given cell , every tu contains a table indicating all of the neighboring cells &# 39 ; spread spectrum codes and its own cell code . if the tu moves from its original cell to another cell , it correlates with the new cell code better than the old one or any other one . this change - over is done during normal broadcast of signaling from the ccu coordinating communications in this new cell . the code table in the tu is updated to represent this new situation . this update may be done internally after the proper spreading code is determined ( each cell code is tabled together with all of the adjacent cells &# 39 ; codes ). the other possibility is that the ccu periodically broadcasts this table . which one of the methods will be used depends on the particular situation at hand . a large number of cells may require ccu broadcasting , whereas a small number of cells may be handled by storing appropriate adjacent codes in the tu &# 39 ; s memory . ______________________________________hdlc timing scheme : transmission rate : 334 kb / stransmission delay : 2 . 994 micro sec ./ bit . transmission delay : 23 . 952 micro sec ./ octetframe types : all of the following frames include one leadingand one trailing flag octet . synch frame : size = 12 octets . transmission delay = 278 . 4 micro sec . data frame : size = 26 - 130 octets . transmission delay = 662 . 7 - 3 , 113 . 7 microsecondsack frame : size = 72 octets . transmission delay = 1 , 724 . 4 micron sec . ______________________________________ the foregoing description of a preferred embodiment and best mode of the invention known to applicant at the time of filing the application has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and obviously many modifications and variations are possible in the light of the above teaching . the embodiment was chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto . | 7 |
we will describe our specific effort using support vector machines ( svms ), but any classification algorithm can be used in their place . svms are based on the structural risk minimization principle from machine learning theory . the underlining principle of svm is to map the training vectors into a higher dimension using kernel method , and then try to find the separating hyper - planes with maximal margin in the higher dimension space . the svm system contains three major components , namely feature extractor , training system , and the classifier . the classification is independent of language . however , any non - statistical features , such as word part - of - speech or concept labeling , needs to be provided for that language . the invention is applied to situations where a spoken utterance needs to be mapped to a class . a class in the set of classes can refer to any group of one or more sentences upon which a learning algorithm may be trained . the more training examples for any given class , the better the precision and recall of that class . the purpose of the text classifier is to automatically map an input text into predefined groups . the invention combines a machine learning approach with a rule - based approach . the machine learning algorithm may be a neural net , a decision tree , a naïve bayesian , support vector machine ( svm ), a k - nearest neighbor classifier , or any other similar algorithm trained on the predefined classes . the rule - based approach uses regular expression rules to map text into “ templates .” the classification system presented here is the combination of two classifiers which improves the precision and coverage in the presence of asr error . the first component extracts hierarchical features using both linguistic and statistical features . the feature extraction algorithm combines the advantages from both linguistic analysis and statistical modeling to transform the term space into a more separable feature space , which in turn significantly improves the precision and recall of the classifier . the extracted linguistic features include , but are not limited to : part - of - speech ( pos ) tags semantic features stemmed words syntactic information named - entities or other lexical classes fig6 is an example of predictive features extracted from input english text . linguistic features such as part - of - speech ( pos ) tags , word stems , and lexical classes are first extracted from the input texts . the extracted information is combined and passed through a module to capture the statistical information between the surface - form words and linguistic structures . some examples of statistical features include n - grams , bag - of - words , statistical language models , and iwsvd vectors . this invention uses tagging rule based pattern matching method to extract semantic information , which is embodied in noisy input text . fig1 illustrates a system diagram of lexical class tagger for concept extraction . first , an input document undergoes linguistic pre - processing , such as text normalization and word stemming . then tagging rules are applied to the document to extract and label semantic information from input document . the output is concept - tagged document . the tagging rules consist of three components , namely macro definitions , state definitions , and action definitions . macros are abbreviations for regular expressions . a macro can also be embedded into another for more efficient and modularized representation of regular expressions . the macros can be automatically extracted from manually annotated lexical classes . a state acts as a constraint for the search scope of pattern matching . if the tagger is in state & lt ; s & gt ;, only expressions that are preceded by the starting condition & lt ; s & gt ; can be matched . the action defines the system &# 39 ; s response when certain parts of the text are matched given the macro expression in the current state . for example , the action tag will assign a specified concept tag for matched regular expression . the action state will perform the state transition for the matched text . we can use different algorithms , such as greedy search , to perform pattern matching between the input texts and defined lexical rules . the output of this system is tagged documents with extracted concepts . this invention introduces a way to extract discriminative features for text classification . in this invention , each class ( such as question type ) is modeled by a document . a word co - occurrence matrix is derived from training data across all documents information metric models , such as tf - idf , idf , and information gain ( ig ), are derived from a word - document matrix of the training corpus , to create discriminative weights . the final statistical model ( as an svd vector or a word or phrase value ) is the linear combination of information metric weighted word vectors or phrase values . fig4 is an illustration of procedures to create an information metric weighted singular value decomposition ( iwsvd ) model . the input texts are first processed using techniques such as text normalization . next , the word co - occurrence matrix is computed , which is used as input of singular value decomposition ( svd ) model training . information metric models , such as inverse document frequency ( idf ), term frequency - inverse document frequency ( tf - idf ), and information gain ( ig ), are computed from the text and their corresponding document vectors . the sentence level feature vector is a linear combination of word level svd vectors , weighted by information metric which measures the importance of each word inside the document . fig2 illustrates procedures to train models of a specific text classifier , namely svm , with both labeled and unlabeled training data . first , the labeled training data is pre - processed to make the distribution between the training classes more consistent . both linguistic and statistical features are extracted and combined from balanced training data . next , the labeled training examples are decomposed into active and inactive parts for iterative working set selection . the active part of the model denotes the set of parameters which will be optimized during current step of model training , and the parameters of the inactive part will keep unchanged during the current iteration . various kernel functions are applied to map the feature space into a higher dimensional space which maximizes the separation between the training classes . further parameter tuning is necessary to achieve optimal model parameters of the labeled training data . a certain amount of unlabeled training data is also used to adapt the “ labeled ” trained classification models . the unlabeled training data is constrained to have uniform distribution among classes , which improves the generative power of learned classification models for unobserved testing data . the output of svm training component consists of feature vocabulary and svm models . during the training stage , the extracted feature vectors are mapped into a higher dimensional space using kernel functions . some examples of the kernel functions include linear kernel , polynomial kernel , radial basis kernel ( rbf ), and sigmoid kernel . then a quadratic optimization algorithm is used to estimate the support vectors which maximize the separation margins between the training classes . the next step in model training called working - set selection decomposes the learning task into a series of smaller tasks . we split the training samples into an “ inactive ” and an “ active ” part . during recursive estimation , model parameters in the active part are estimated and updated , while parameters in the inactive part are fixed at the current iteration . the decomposition assures that this will lead to progress towards global minima in the objective function , if the selected working set fulfills certain constraints . the working set selection significantly reduces the memory requirement of the learning algorithm , especially in the case of large number of training samples , or high dimensionality of feature space . at the same time , it guarantees the convergence of the learning algorithm with sufficient number of iterations . in this invention , we also use two approaches to overcome the over - fitting problem of svm learning , which means the model trained with existing labeled data might achieve high classification precision , although it will lose generalization power when the test data is unseen from the training corpus , or the testing condition is significantly different from the training condition . in the first approach , we reduce the cross - entropy between training classes , so that the distributions of training data across different classes become more similar . second , we use a transductive training approach to compensate for unmatched testing conditions . we first train the svm with labeled training data . then we use a small amount of unlabeled data to adapt the learned models , with the constraint that the unlabeled adaptation data should have uniform distribution after classification . fig3 illustrates a procedure to classify an input document into paraphrased representation of the source language text . first , the input text is transformed into predictive features suitable for the classification task . linguistic features such as lexical classes and parts - of - speech ( pos ) tags are extracted from the input document . these linguistic features are combined with statistical features , such as n - grams , bag - of - n - grams , and statistical language model , to form attribute - value representation of the source language text . next , kernel functions are utilized to find the projection of input feature vector onto support vectors from learned svm models . a maximum projection criterion combined with dynamic thresholds learned from the training data , are used to select the final top - n classification results of the input document . the classification result is determined by maximum likelihood criterion using projection scores from feature vectors of testing sentences to each svm models . we also introduced a dynamic decision method , which tries to improve the precision of classifier in presence of noisy data . the basic idea is to collect first and second order statistics of the projection scores of test vectors into svm models , and use this information to determine optimal criterion for each test sentence , instead of fixed parameter across different testing sentences . next , we convert the svm projection score into confidence score , which gives a reliable measurement of the certainty of classification result , especially under noisy condition . the confidence score also helps the system to determine optimal back - off strategy , and rejection decision . fig5 is a system diagram of classification - based paraphrase translation under asr condition . first , the automatic speech recognizer ( asr ) output of the source language is transformed into attribute - value representation with both linguistic and statistical features . the transformed feature vector is passed through a text classifier to predict top - n paraphrase representation of the source language . next , a rule - based matching is conducted to search for matched templates between input text and linguistic formalization of the source - to - target translation . if we find perfect matching between processed source language text and predefined template , the template translation is output as target language translation . otherwise , we back off to top - 1 candidate of classification result , and evaluate the confidence score of such hypothesis . if the confidence score is above predefined threshold , we use the canonical translation of top - 1 hypothesis as our paraphrased translation . otherwise , the system will either prompt the user to rephrase his / her utterance , or reject the user query . the classification task can be implemented as a classification into a flat structure or a multi - level hierarchy of classes . a hierarchy allows the classifier to break up the problem of classification into stages . a hierarchical classification approach minimizes the degradation of classification accuracy with an increasing number of classes . the hierarchy ( or clustering ) of classes can be achieved through manual or automatic clustering . this classifier is trained at all levels within this hierarchy . a hierarchy groups a set of classes ( or documents ) together based upon some measure of similarity , such as semantic similarity ( see fig7 for an example ). each level within the hierarchy presents a classification task for the classifier . the combined clustering and classification technique provides an effective solution for mapping recognized speech to a group by capturing the most distinguishing features in the utterance be it for paraphrase - based mt or information extraction . fig7 is an example of hierarchical classification of an input query . the hierarchical classifier is created as virtual category tree , where each category can belong to at most one parent category , and documents can be assigned to one or multiple leaf classes . during the classification , information extracted from the input query are classified from coarse to fine granularity . there are two general approaches to creating the hierarchy : manual and automatic . a hierarchy can be manually created , wherein documents that someone determines belong in the same sub - domain may be grouped together . there is no requirement that the classes or group of classes ( at higher levels in the hierarchy ) be equally balanced . a hierarchy can also be created automatically . one approach is to perform confusion clustering . confusion clustering takes an approach which optimizes clustering based upon the task at hand . documents which the classifier has difficulty distinguishing between are clustered together to create each level in the hierarchy . the level of “ difficulty ” must be determined empirically to maximize the precision / recall of a development test - set of asr recognized sentences . although confusion clustering works , there is no reason that other clustering techniques , such as partitional ( such as k - means or fuzzy c - means ) hierarchical ( such as agglomerative ) or probabilistic clustering ( such as gaussian ). the method might proceed as follows . first a classifier is trained on clean ( no recognition error ) classes . second , a development set of test sentences , where each class has a statistically significant representation , is recognized using a speech recognition engine . third , the “ dirty ” sentences are classified . those that are mis - classified are considered confusable . such a confusion matrix is created , and clustering proceeds thereupon . note that the cutoffs for cluster membership must be determined empirically . in the top - down approach , a test sentence is first classified at the top level and then classified based on the child nodes of the lower level classifiers , and so forth . in the bottom plus top - down approach , the sentence is classified at the baseline , and , if the score is above a certain threshold , it is tagged with that class . if however , it is below that threshold , it is put into the top - down approach . this has the advantage of just using the hierarchy for those sentences which seem to have confusability . a modification of the bottom plus top - down approach would be to again first classify at the base level . if the sentence is below the threshold , however , reclassify it against the other members of the baseline winner &# 39 ; s cluster . further one could make use of the n - best classifications of the classifier . in the top - down approach one might take the top n classifications at the 1 st level and then consider the cumulative score of the top level and the lower level to achieve the winning class . a rejection model is necessary to capture inputs which are not handled by the classifier whether in a hierarchy or not . the result of a rejection classification depends on the task to which the classifier is applied , but in the case of an automated operator it could be to direct the caller to a human operator . a rejection model is trained on a group of sentences which are in the domain but not handled by the system . this can be created semi - automatically , by seeding the class with utterances which have very low classification scores , and then having them filtered by a human judge . subsequent iterations of the system should perform a classification between handled and not handled on the top level ( see fig7 ) as the first step in the system . this can also be simply created just from a list of utterances that we have in our system that are not being handled by the classification system . at any level utterances which have very low classification confidence scores can either be rejected or the system can back off to the previous classification step and the system , for example , can interact with the user and verify the specific class for example with a statement like : “ i think you asked about baggage . is that correct ?” and proceed to ask questions specific to this part of the hierarchy . a novel predictive feature extraction method which combines linguistic and statistical information for representation of information embedded in a noisy source language can be employed . an information metric weighted singular value decomposition ( iwsvd ) model , which incorporates measure of word &# 39 ; s importance ( with regard to classification task ) into svd vectors for discriminative statistical feature extraction can be utilized . a dynamic decision method , combined with confidence measurement , to provide a flexible solution to text classification with different accuracy and coverage requirements , can be employed as well . a mixed approach to refine the classification further by harnessing rule - based template matching , to perform robust interpretation and meaning extraction for asr recognized text can be utilized . we first use both rule - based system and automatic classifier to reinforce interpretation results with high confidence score for highly accurate meaning extraction . then we use the back - off strategy to further improve the coverage of interpretation engine . a training procedure can be used to alleviate the over - fitting problem in machine learning , through the reduction of cross - entropy between different training classes . a hierarchical classification method can be used , which combines clustering , automatic classification , and fuzzy matching methods , to perform information extraction and classification at different levels of granularities . a semi - supervised approach can be used to cluster and classify confusable documents with overlapping features . we first use small number of labeled training data to estimate statistical models of automatic classifier . then we group misclassified documents with relatively low confidence score , and high off - diagonal values in confusion matrix to adapt the decision boundaries of classifiers . we perform the above procedures recursively to discover optimal classifiers from large number of automatically generated auxiliary classification problems on unlabeled data . note all of this methodology assumes that our input is from a speech recognizer , however there is nothing preventing us from using the same system for classifying text data for such application as automatic question - answering . while the present invention has been described with reference to certain preferred embodiments , it is to be understood that the present invention is not limited to such specific embodiments . rather , it is the inventor &# 39 ; s contention that the invention be understood and construed in its broadest meaning as reflected by the following claims . thus , these claims are to be understood as incorporating not only the preferred embodiments described herein but also all those other and further alterations and modifications as would be apparent to those of ordinary skilled in the art . | 6 |
[ 0026 ] fig1 shows the typical ion cluster size distribution produced by a commonly available gcib source . the cluster formation process has been shown ( in n . kofuji , et al ., development of gas cluster source and its characteristics , proc . 14 th symp . on ion sources and ion - assisted technology , tokyo ( 1991 ) p . 15 ) to produce few small size clusters ( values of n from 2 to about 10 ), but molecular ions ( n = 1 ) are produced in abundance as are larger clusters ( n & gt ; a few tens , up to a few thousands .) it is known from the teachings of u . s . pat . no . 5 , 459 , 326 , yamada , that molecules in a cluster are not individually energetic enough ( on the order of a few electron volts ) to significantly penetrate a surface to cause the residual surface damage typically associated with the other types of ion beam processing in which individual molecular ions may have energies on the order of thousands of electron volts . nevertheless , according to yamada and matsuo , cluster ion beam processing , matl . science in semiconductor processing i , ( 1998 ) pp . 27 - 41 , the clusters themselves can be made sufficiently energetic ( some thousands of electron volts ), to effectively etch , smooth or clean surfaces . [ 0027 ] fig2 shows a typical configuration for a gcib processor 100 of a form known in prior art , and which may be described as follows : a vacuum vessel 102 is divided into three communicating chambers , a source chamber 104 , an ionization / acceleration chamber 106 , and a processing chamber 108 . the three chambers are evacuated to suitable operating pressures by vacuum pumping systems 146 a , 146 b , and 146 c , respectively . a condensable source gas 112 ( for example argon or n 2 ) is admitted under pressure through gas feed tube 114 to stagnation chamber 116 and is ejected into the substantially lower pressure vacuum through a properly shaped nozzle 110 . a supersonic gas jet 118 results . cooling , which results from the expansion in the jet , causes a portion of the gas jet 118 to condense into clusters , each consisting of from a few to several thousand weakly bound molecules . a gas skimmer aperture 120 separates the gas products that have not been formed into a cluster jet from the cluster jet so as to minimize pressure in the downstream regions where such higher pressures would be detrimental ( e . g ., ionizer 122 , high voltage electrodes 126 , and process chamber 108 ). suitable condensable source gases 112 include , but are not limited to argon , nitrogen , carbon dioxide , oxygen . after the supersonic gas jet 118 containing gas clusters has been formed , the clusters are ionized in an ionizer 122 . the ionizer 122 is typically an electron impact ionizer that produces thermoelectrons from one or more incandescent filaments 124 and accelerates and directs the electrons causing them to collide with the gas clusters in the gas jet 118 , where the jet passes through the ionizer 122 . the electron impact ejects electrons from the clusters , causing a portion the clusters to become positively ionized . a set of suitably biased high voltage electrodes 126 extracts the cluster ions from the ionizer , forming a beam , then accelerates them to a desired energy ( typically from 1 kev to several tens of kev ) and focuses them to form a gcib 128 having an initial trajectory 154 . filament power supply 136 provides voltage v f to heat the ionizer filament 124 . anode power supply 134 provides voltage v a to accelerate thermoelectrons emitted from filament 124 to cause them to bombard the cluster containing gas jet 118 to produce ions . extraction power supply 138 provides voltage v e to bias a high voltage electrode to extract ions from the ionizing region of ionizer 122 and to form a gcib 128 . accelerator power supply 140 provides voltage v acc to bias a high voltage electrode with respect to the ionizer 122 so as to result in a total gcib acceleration potential equal to v acc . one or more lens power supplies ( 142 and 144 shown for example ) may be provided to bias high voltage electrodes with potentials ( v l1 and v l2 for example ) to focus the gcib 128 . a workpiece 152 , which may be a semiconductor wafer or other workpiece to be processed by gcib processing , is held on a workpiece holder 150 , disposed in the path of the gcib 128 . since most applications contemplate the processing of large workpieces with spatially uniform results , a scanning system is desirable to uniformly scan the gcib 128 across large areas to produce spatially homogeneous results . two pairs of orthogonally oriented electrostatic scan plates 130 and 132 can be utilized to produce a raster or other scanning pattern across the desired processing area . when beam scanning is performed , the gcib 128 is converted into a scanned gcib 148 , which scans the entire surface of workpiece 152 . [ 0030 ] fig3 shows one possible embodiment of the invention utilizing of a basic gcib apparatus 200 having a modified configuration to implement the invention . in this embodiment , a fixed ( dc ) deflection voltage has been added to the beam scanning voltage waveforms at the y - scan deflection plates 202 to impose a fixed offset angle 210 between the initial beam trajectory 154 and the central path 206 of the scanned gcib 148 , the offset being imposed in the region between the scan plates 202 . at scan plates 202 , in addition to being deflected in the amount of offset angle 210 , the gcib also is scanned through a scanning angle 226 . one half of the scan angle 226 is referred to as the scan half angle 208 . any uncharged molecules or clusters that may be present in the gcib , are not responsive to the electrostatic field between scan plates 202 , and continue in a straight line along path 204 , which extends to a region now separated from the workpiece 152 processing region . a faraday enclosure 222 having a suppressor ring electrode 216 and a grounded ring electrode 218 at the beam entrance opening of the faraday enclosure 222 is disposed in the path of the straight line path 204 , which is an extension of the initial beam trajectory 154 . the suppressor ring electrode 216 is negatively biased with respect to the faraday enclosure 222 by a bias power supply , e s , so as to permit entrance of any energetic ions or uncharged particles traveling along path 204 with minimal influence , but yet also prevent the exit of low energy electrons , thus retaining all secondary electrons that may be produced in the faraday enclosure 222 . thus , if any uncharged molecules or clusters are stopped in the faraday enclosure 222 , they have no electrical effect , but any ions that are stopped in the faraday enclosure have their charged conducted by lead 220 to a time - of - flight analysis system 400 . workpiece 152 is held and positioned in the path of the scanned gcib 148 and away from the faraday enclosure 222 and the undeflected path 204 by workpiece holder 150 . still referring to fig3 the beam entrance to scan plates 202 is separated from the entrance to the faraday enclosure 222 by a drift distance , d , which may be any convenient distance , preferably many times greater than the length of scan plates 202 and also preferably greater than 30 cm . a scan generator 300 provides y - axis scanning voltages and deflection voltages to scan plates 202 through leads 212 and 214 . scan generator 300 also provides synchronization pulses to the time - of - flight analysis system 400 through lead 224 . [ 0032 ] fig3 further shows , for purposes of example , but not for limitation , a fixed angular deflection of the central path 206 from the scanned gcib 148 of approximately 15 degrees from the initial beam trajectory 154 and its extended undeflected path 204 , however , it is apparent that any deflection slightly larger than the scan half - angle 208 is potentially adequate to separate the scanned gcib 148 from the undeflected path 204 . [ 0033 ] fig4 shows details of scan generator 300 and of the signals it produces . the scan generator 300 produces scanning , deflection , and beam switching signals for y - scan plates 202 and produces synchronization signals for use by the time - of - flight analysis system 400 . a digital sequence generator 302 produces sequences of binary number and control signals that flow to a digital - to - analog converter ( dac ) 306 through signal bus 304 . the digital sequence generator 302 may consist of a microprocessor , micro - controller , small computer , or other digital logic system capable of generating the necessary digital number sequences and control signals for the dac 306 . it is easily appreciated that the digital sequence generator and its control may be implemented by any of a variety of techniques that are well known to those skilled in the art of digital and computer logic . the digital sequence generator may furthermore communicate by way of a communication bus 324 with an optional remote digital system controller 326 . although such a digital system controller may be part of an overall automated control system for a gcib processing apparatus and may be desirable from a point of convenience and efficiency in integrating and coordinating the functions of a gcib processor , it is not a necessary part of the invention . accordingly , the digital system controller 326 and the communication bus 324 are shown for purposes of example and not for limitation . still referring to fig4 the binary number sequences and control signals provided by the digital sequence generator 302 enable the dac 306 to produce a y - scanning signal that is amplified by inverting amplifier 308 and non - inverting amplifier 310 and by high - voltage amplifiers 312 and 314 to produce high level scanning signals 316 and 318 which are connected to the y - scan plates 202 by leads 214 and 212 respectively . during normal processing operations , the scan generator 300 produces a periodic saw - tooth waveform for each plate , having a period , t scn , ( which could , for example , but without limitation , be on the order of 1 to 100 milliseconds ) and an amplitude suitable to produce the desired scan angle 226 . consider the scanning signal 318 : the periodic saw - tooth waveform is superimposed on a dc deflection voltage , v d , which is chosen to impose a fixed offset angle 210 between the initial beam trajectory 154 and the central path 206 of the scanned gcib 148 as the beam travels through the region between the scan plates 202 . from time to time as required , either at least once before the start of gcib processing , or preferably , repeatedly during gcib processing , the digital sequence generator intersperses a beam switching pulse among the periodic saw - tooth scan waves . the timing of the waveform segments shown in the plots for signals 316 and 318 is chosen to include one such beam switching pulse . in the illustrated scanning signals , 316 and 318 , the onset of the beam switching pulse is labeled t 0 and the duration of the beam switching pulse is labeled t pw during the beam switching pulse duration , the y - scanning signal voltage is zero , and for that reason , the gcib is not deflected by offset angle 210 and is not scanned through scan angle 226 , but , rather , travels undeflected through the region of y - scan plates 202 along the straight line path 204 , which is an extension of the initial beam trajectory 154 . accordingly the undeflected gcib flies in a straight line to the faraday enclosure 222 , where it is stopped and the charge in the ions is converted into a detected current which flows into time - of - flight analyzer 400 through lead 220 . at time t 0 + t pw , the beam switching pulse ends , periodic saw - tooth scanning begins , the beam switches back to the offset path which is directed at the workpiece 152 and gcib processing resumes . note that scanning signal 316 is the negative of scanning signal 318 . a sample of the scanning signal 308 is conducted to pulse shaping circuit 320 . pulse shaping circuit processes the scanning signal to extract and provide a synchronization pulse signal 322 which has a leading edge occurring at time t 0 , synchronous with the onset of the beam switching pulse to the scan plates 202 . the synchronization pulse signal 322 is shown , for example , but not for limitation , to have a pulse duration equal to t spw , which may be equal to or different from t pw . synchronization pulse signal 322 is conducted by lead 224 to the time - of - flight analyzer 400 . during the beam switching pulse duration , t pw , molecular ions and cluster ions entering the entrance receive no deflection and so form a pulse of ions directed toward the faraday enclosure 222 . the undeflected ion pulse may contain molecular ions and cluster ions of various masses and correspondingly various velocities . as the ions fly toward the faraday enclosure 222 , their velocity differences cause them to become dispersed along the path 204 to the faraday enclosure 222 and the ion pulse becomes extended . consequently , the arrival times of the ions at the entrance to the faraday enclosure 222 are delayed by different amounts related to their velocities . [ 0036 ] fig5 shows one embodiment of a time - of - flight analyzer 400 to be used in the invention . the arrival of the electrically charged ions in the faraday enclosure 222 results in a corresponding current waveform induced in lead 220 to the time - of - flight analyzer 400 . a short delay time , t p , after t 0 , the lightest , fastest ions arrive at the faraday enclosure and are converted to an electrical current signal . according to their dispersion , the heavier , slower ions arrive later , with the heaviest , slowest ions arriving at the delayed time , t s . the total current signal 402 collected by the faraday enclosure as a result of the flight of a single dispersed ion pulse resulting from a single beam switching pulse may appear , for example , as shown the time amplitude plot 402 ( current signal ) in fig5 . in the example chosen for illustration of the principle , there is a current peak at time t p corresponding to the prompt arrival of the molecular ions and a broader peak occurring between t p and t s corresponding to the arrival of the slower cluster ions . current - to - voltage converter 404 receives the current signal 402 and produces a voltage signal subsequently amplified by amplifier 406 . the time - of - flight analyzer 400 also receives a synchronization pulse signal 322 conducted by lead 224 from scan generator 300 . a digital storage oscilloscope 408 , having a trigger signal input 414 , at least one vertical signal input 412 , internal time base generator for generating a display sweep signal , and a visual display 410 receives the synchronization pulse signal 322 and the amplified voltage signal derived from the current signal 402 . oscilloscope digitizes , stores , and displays the signal presented at vertical input 412 , which is a time - of - flight spectrum for the ions in the single beam pulse resulting from one beam switching pulse . oscilloscope 410 may also have data communications capabilities and remote readout capabilities and may communicate by way of a communication bus 416 with an optional digital system controller 326 . although such a digital system controller may be part of an overall automated control system for a gcib processing apparatus and may be desirable from a point of convenience and efficiency in integrating and coordinating the functions of a gcib processor , it is not a necessary part of the invention . accordingly , the digital system controller 326 and the communication bus 324 are shown for purposes of example and not for limitation . when an optional digital system controller is employed , is often has sufficient computational power to permit more sophisticated analysis and processing of the information in the time - of - flight signal . the time of flight resolution of the current signal 402 is dependent on the flight distance d and the duration of the beam switching pulse t pw for a given beam energy . it is preferable that the duration of the beam switching pulse be shorter by at least a factor of 10 than the flight time of the ions over the distance d . with a short t pw , the current signal 402 approaches the true time - of - flight spectrum . with longer values of t pw , the beam switching pulse duration t pw becomes mathematically convolved with the time - of - flight spectrum . in such a case , it must be deconvolved in order to provide a spectrum with acceptable time - of - flight resolution . it is preferable that the duration of the beam switching pulse width t pw be less than one tenth of the time - of - flight of the lightest ion for which good resolution is desired . when t pw is short compared to the flight time of the molecular ions , the oscilloscope display 410 will have good resolution for even the molecular ions , and a time - of - flight spectrum 550 such as shown in fig6 is produced on the display 410 . when t pw is short compared to the time - of - flight , the ion or cluster ion mass is related to the time - of - flight as follows : m l = 2 e v 2 = 2 e ( d t d ) 2 = 2 e ( t d ) 2 d 2 = 2 qev acc ( t d ) 2 d 2 ( eqn . 1 ) t d = t − t 0 = ion ( or cluster ion ) time of flight n = m l m m ( eqn . 2 ) using eqn . 2 and the value of ml from eqn . 1 it is possible to determine the relationship between t d , the time of flight of a cluster ion and its cluster size , thus making it possible to label the x - axis of the display 550 shown on the display 410 in units of cluster size , n , as well as in time - of - flight time units . when the ionized clusters all bear a single charge equal in magnitude to the unit charge ( electronic charge ), e , then q = 1 and eqn . 1 and eqn . 2 calculate the cluster size n . however , in general the ionized clusters may have a distribution in both size n and in charge state q , q being the number of electronic charges held by the ion . at the present , there is no easy separation of these distributions . consequently in this case the time - of - flight measurement is used to measure the distribution of n ′: while this generalization somewhat reduces the utility of the measurement , the time - of - flight derived n ′ distribution is very useful in determining consistency of operation in commercial production equipment and for facilitating the set - up of equipment operating parameters to achieve consistent processing . moreover , it is often possible to infer the size distribution separately by operating the cluster ionizer at low levels so that it is unlikely that the clusters acquire more than a single charge each — in such case the approximation that q = e ( ions are singly ionized ) is justified . the gcib processing system 200 shown in fig3 incorporates an embodiment of the invention which although operable , may be viewed as having a minor drawback . as drawn in fig3 straight - line path 204 passes very near to the x - scan plates 132 . as a result the pulses of gcib that are undeflected by scan plates 202 and therefore travel along straight line path 204 may be influenced by any x - scanning electrical field between the x - scan plates 132 , causing the gcib pulse which was not deflected at plates 202 to receive a small amount of scanning at scan plates 132 . this condition may be tolerated by choosing the shape faraday enclosure 222 to have a shape that is elongated in the x - scan direction so as to collect all of the gcib pulse even though it is somewhat extended in the x - scanning axis direction . alternatively , the condition of concern , namely that the straight line path 204 passes near to the x - scan plates 132 , can be avoided by increasing the fixed offset angle 210 , or by increasing the spacing between scan plates 202 and scan plates 132 by moving scan plates 132 further downstream the central beam path 206 . although these are various means to deal with the proximity of the straight - line path to the x - scan plates 132 , fig7 shows an alternate embodiment of the invention , which avoids the problem in a different way . the gcib processing system 250 shown in fig7 is similar to the gcib processing system 200 shown in fig3 except that rather than disposing the faraday enclosure 222 along the straight line path 204 , which is an extension of the initial beam trajectory 154 , it is instead disposed along a deflected path 252 which is deflected away from the central path 206 by a separation angle 254 that is greater than the offset angle 210 by an amount that separates the deflected path 252 from the x - scan plates 132 sufficiently for the beam pulse traveling along the deflected path 252 to avoid any scanning effects from x - scan plates 132 . such deflection can be achieved by utilizing a scanning signal 500 as shown in fig8 . in fig8 note that the scanning signal 500 is identical to the scanning signal 318 shown for the first embodiment except that the beam switching pulse switches to a value of − v d2 rather than zero . the negative value of − v d2 causes the switched beam pulse to travel along deflected path 252 rather than along straight - line path 204 . scanning signal 500 represents the positive scanning signal applied to lead 212 . of course , there is a corresponding signal that is the negative of the scanning signal 500 , which is generated and placed on lead 214 . scan generator 300 can generate signal 500 and its negative provided that the dac 306 , amplifiers 308 , 310 , 312 , and 314 all have bipolar output capabilities and provided that the digital sequence generator 302 generates the corresponding digital sequences having negative values for the beam switching pulse period . once gas cluster ion beam cluster mass and / or cluster size and / or cluster size per charge and / or cluster mass per charge is determined by the present invention as described in the various embodiments set forth above , appropriate adjustments ( for example adjusting source gas flow or adjusting ionizer filament voltage vf or anode voltage va ) can be made to the gcib apparatus via conventional manual operator controls or via conventional feedback circuitry connected to conventional automation controls in order to maintain preferred gas cluster ion beam cluster mass and / or cluster size and / or cluster size or mass per charge during workpiece processing to assure proper quality or rate of processing , and thereby improving the processing of the workpiece . alternatively , during workpiece processing , gas cluster ion beam cluster characteristics may be determined to assure proper continued workpiece processing . should cluster characteristics drift out of desired specifications , conventional control and alarm circuitry can suspend processing and signal for operator attention to restore proper processing conditions , and thereby improve the processing of the workpiece . although the invention has been described with respect to various embodiments , it should be realized this invention is also capable of a wide variety of further and other embodiments within the scope of the claims . | 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.