text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the phospholipase is an enzyme that catalyzes the release of fatty acyl groups from a phospholipid . it may be a phospholipase a2 ( pla2 , ec 3 . 1 . 1 . 4 ) or a phospholipase a1 ( ec 3 . 1 . 1 . 32 ). it may or may not have other activities such as triacylglycerol lipase ( ec 3 . 1 . 1 . 3 ) and / or galactolipase ( ec 3 . 1 . 1 . 26 ). the phospholipase may be a native enzyme derived from mammalian or microbial sources . an example of a mammalian phospholipase is pancreatic pla2 , e . g . bovine or porcine pla2 such as the commercial product lecitase ® 10 l ( porcine pla2 , product of novozymes a / s ). microbial phospholipases may be derived from fusarium , e . g . f . oxysporum phospholipase a1 ( wo 1998 / 026057 ), f . venenatum phospholipase a1 ( described in wo 2004 / 097012 as a phospholipase a2 called fvpla2 ), from tuber , e . g . t . borchii phospholipase a2 ( called tbpla2 , wo 2004 / 097012 ). the phospholipase may also be a lipolytic enzyme variant with phospholipase activity , e . g . as described in wo 2000 / 032758 or wo 2003 / 060112 . the phospholipase may be added in an amount of 500 - 20 , 000 units ( leu ) per kg of batter , e . g . 1000 - 10 , 000 units ( leu ) per kg . the phospholipase may also catalyze the release of fatty acyl groups from other lipids present in the batter , particularly wheat lipids . thus , the phospholipase may have triacylglycerol lipase activity ( ec 3 . 1 . 1 . 3 ) and / or galactolipase activity ( ec 3 . 1 . 1 . 26 ). compared to a conventional cake recipe the amount of egg protein may be reduced and may be replaced by non - egg - protein . for example , compared to a conventional cake recipe , the amount of egg white protein may be reduced and may be replaced by non - egg protein . thus , the batter used in the invention may contain 0 . 5 - 3 . 0 % by weight of egg protein , and may contain 0 . 1 - 6 % ( particularly 0 . 5 - 2 %) by weight of non - egg protein . for example , the batter used in the invention may contain 0 . 5 - 2 . 5 % by weight of egg white protein , and may contain 0 . 1 - 6 % ( particularly 0 . 5 - 2 %) by weight of non - egg protein . the non - egg protein may particularly be a water - soluble , globular protein . the non - egg protein may particularly be partially or fully purified or isolated protein , such as , a water - soluble , globular protein . the non - egg protein may be denatured , and it may be one that partially unfolds to a rod - shaped or flexible molecule under the interaction of lyso - lecithin formed by the action of the phospholipase on the egg yolk lecithin . protein sources with a good waterbinding , emulsifying and gelling properties in presence of lysophospholecithin are considered especially suitable examples of non - egg proteins are wheat proteins . further examples of non - egg proteins are casein , whey protein , wheat gluten , legume protein ( e . g . from soy bean , pea or lupine ). the non - egg protein may be subjected to a limited hydrolysis , e . g . enzymatic hydrolysis to 0 - 6 % hydrolysis . the enzymatic hydrolysis may be carried out with an amino - acid specific protease , e . g . one which is specific for arg , lys , glu , asp and / or pro , such as the protease described in wo 91 / 13554 . the modification may include steps of shear treatment and acidic or alkaline ph , e . g . as described in wo2003 / 13266 , increased temperature to denature partially or completely , protein deamidation , and separation steps including centrifugation , decanting and ultracentrifugation . the protein ( or hydrolyzed ) protein may be enzymatically modified , e . g . with a cross - linking enzyme like transglutaminase or another protein modifying enzyme like protein - glutaminase . furthermore the protein may be modified physically or chemically , e . g . through denaturation and deamidation . the cake batter comprises egg yolk lecithin , e . g . in the form of whole eggs , egg yolks , or egg powder . the invention makes it possible to reduce the amount of egg material , e . g . to about half of a conventional cake . thus , the batter may contain 0 . 3 - 1 . 5 % by weight of egg lecithin or 5 - 25 % ( particularly 7 - 20 , or 8 - 15 ) by weight of whole eggs . advantageously , the batter may contain 0 . 1 - 1 . 5 %, such as 0 . 1 - 1 . 2 %, or 0 . 1 - 0 . 9 %, or 0 . 2 - 1 . 5 %, or 0 . 2 - 1 . 2 %, or 0 . 2 - 0 . 9 %, or 0 . 3 - 1 . 5 %, or 0 . 3 - 1 . 2 %, or 0 . 3 - 0 . 9 % by weight of egg lecithin or 5 - 25 % ( particularly 7 - 20 , or 8 - 15 ) by weight of whole eggs . the cake batter may comprise other conventional ingredients , typically in the following amounts ( in % by weight of the batter ): flour ( untreated , heat treated , chlorinated ): 15 - 30 % starch ( modified , native ): 0 - 10 % sugar : 15 - 25 % emulsifier ( mono and diglycerides of fatty acids , propylene glycol esters of fatty acids , lactic acid esters of mono and diglycerides of fatty acids , sodium stearoyl - 2 - lactylate ): 0 . 1 - 1 % baking powder ( containing soda and acid or acidic salts ): 0 . 5 - 1 % hydrocolloids ( locust bean gum , guar gum , tara gum , xanthan gum , carrageenan , acacia gum , cellulose , modified cellulose , pectin ): 0 - 1 % vegetable fat ( ex . oil , margarine , shortening , fat paste , powdered fat ): 5 - 30 % water : up to 100 % an example of cake is a cake prepared with eggs - sugar - wheat flour - vegetable oil - starch - baking powder : sodium bicarbonate ( e500ii ), sodium acid pyrophosphate ( e450i )- emulsifier : mono and diglycerides of fatty acids ( e471 ), lactic acid esters of mono and diglycerides of fatty acids ( e472b ), sodium stearoyl - 2 - lactylate ( e481 )- hydrocolloid : xanthan gum . another example of cake is a cake prepared with eggs - sugar - wheat flour - starch - margarine - baking powder : sodium bicarbonate ( e500ii ), sodium acid pyrophosphate ( e450i )- emulsifier : mono and diglycerides of fatty acids ( e471 )- propylene glycol esters of fatty acids ( e477 )- lactic acid esters of mono and diglycerides of fatty acids ( e472b ), sodium stearoyl - 2 - lactylate ( e481 )- hydrocolloid : carrageenan a further example of cake is a cake prepared with eggs - sugar - wheat flour - starch - margarine - baking powder : sodium bicarbonate ( e500ii ), sodium acid pyrophosphate ( e450i )- emulsifier : mono and diglycerides of fatty acids ( e471 )- propylene glycol esters of fatty acids ( e477 )- lactic acid esters of mono and diglycerides of fatty acids ( e472b )- hydrocolloid : carrageenan lecithin is hydrolyzed under constant ph and temperature , and the phospholipase activity is determined as the rate of titrant ( 0 . 1n naoh ) consumption during neutralization of the liberated fatty acid . the substrate is soy lecithin ( l - α - phosphotidyl - choline ), and the conditions are ph 8 . 00 , 40 . 0 ° c ., reaction time 2 min . the method is further described in dk 99 / 00664 ( novo nordisk a / s , denmark ). the phospholipase from porcine pancreas has an activity of 510 leu / mg and is taken as standard . two consecutive deformations of a cylindrical crumb sample ( φ = 45 mm ) performed with a cylindrical probe ( φ = 100 mm ) with a maximum deformation of 50 % of the initial height of the product are performed at a deformation speed of 2 mm / s and waiting time between consecutive deformations of 3 s . force is recorded as a function of time . cohesiveness is calculated as the ratio ( expressed in percent ) between the surface under the second deformation curve ( downwards + upwards ) and the surface under the first deformation curve ( downwards + upwards ). springiness is calculated as the ratio between the height of the sample after the first deformation and 3 seconds waiting time and the initial height of the product . penetration of cake crumb with a cylindrical probe ( φ = 25 mm ) until a total deformation of 25 % of the initial height of the sample , at a deformation speed of 2 mm / s and keeping the target deformation constant during 20 s . force is registered as a function of time . elasticity is the ratio ( expressed in percent ) between the force measured after 20 s at constant deformation to the force applied to obtain the target deformation . cakes were made using a typical batter cake recipe . 15 - 25 % eggs , 20 - 30 % flour , 0 - 10 % starch , vegetable fat 15 - 20 %, 20 - 25 % sugar , 0 . 1 - 1 % emulsifier ( mono and diglycerides of fatty acids , propylene glycol esters of fatty acids , lactic acid esters of mono and diglycerides of fatty acids , sodium stearoyl - 2 - lactylate ), baking powder 0 . 8 % ( soda and sapp ( sodium acid pyrophosphate )), 0 - 1 % hydrocolloids , 0 - 1 % protein and water to 100 % were mixed for 2 minutes at speed 2 ( low ) and 2 minutes at speed 5 ( medium ) in a hobart mixer . phospholipase was added directly to the dry mix , and finally eggs and oil and water were added to form the batter . a total of 1 . 875 kg cake batter was prepared per trial . 300 g cake batter was weighed into aluminium pans . the cakes were baked at a temperature of 180 ° c . for 45 minutes . 6 cakes with a total weight of 1 . 66 kg were made from each batter . afterwards the cakes were cooled and packed in a plastic bag . textural properties were measured on day 1 and day after baking using the method described above . cohesiveness , springiness and elasticity as well as volume of the cakes were evaluated . in the first example 1500 leu / kg or 3750 leu / kg was added to the batter where 50 % of the eggs ( corresponding to 7 . 5 - 12 . 5 % by weight of the batter ) were replaced by flour and water . a control was made with 100 % egg ( corresponding to 15 - 25 % by weight of the batter ); the volume and textural properties were taken as 100 %. the following results show the effect of phospholipase on volume and texture of cake with 50 % egg reduction and a comparison between microbial phospholipases and pancreatic phospholipase ( table 1 ). the results show that for 50 % egg replaced by flour , the volume of the cake was only 90 %, the cohesiveness on day was only 70 %, and the elasticity on day 14 was 90 % compared to the control . by the addition of tbpla2 , lecitase 10 l , and fvpla2 the volume of the 50 % egg cakes was improved by 4 - 7 %. 7 % volume increase was achieved for 3750 leu / kg batter lecitase 10 l . the cohesiveness on day 14 was improved by 12 - 28 %. highest increase in cohesiveness was achieved by 3750 leu / kg batter lecitase 10 l . the elasticities of the resulting cakes were increased by 2 - 10 % on day 14 . highest increase was measured for lecitase 10 l ( 1500 leu / kg batter and 3750 leu / kg batter ), fvpla2 ( 3750 leu / kg batter ) and tbpla2 ( 1500 leu / kg batter ). cake texture and cake volume were improved by all 3 phospholipases . lecitase 10 l gave , with only 3 % difference in volume , an elasticity and a cohesiveness on day 14 comparable to a control cake with 100 % egg . cakes were prepared as in example 1 , but with phospholipase ( lecitase 10 l ) and various non - egg proteins . the following results show the effect of a combination of phospholipase and non - egg protein on volume and texture of cake prepared with 50 % egg reduction ( table 2 ). provabis is a soy protein ; the other proteins tested are all whey proteins . the amount of protein ( dry material ) added in % by weight of the batter was 1 . 87 - 2 . 35 % for soy protein ( corresponding to all dry material of the replaced egg ) and 0 . 935 - 1 . 175 % for the other proteins ( corresponding to 50 % of the dry material of the replaced egg ). foamalac , probake m , carbelac 80 uhg : carberry group , cork , ireland hiprotal 45 : borculo domo ingredients , the netherlands lacprodan , nutrilac be - 7602 , nutrilac bk - 8310 : arla foods ingredients , denmark provabis : cargill n v , belgium hygel 8293 , hyfoama dsn : kerry bio - science , the netherlands the results ( table 2 ) show that by replacing 50 % of the eggs and adding a non - egg protein together and a phospholipase it was possible to reach the same cake volume and / or the same level of cohesiveness and / or elasticity after 14 days as the control . 50 % egg replaced by flour resulted in a volume loss of 15 % compared to the control . by the addition of lecitase 10 l the volume was increased again by 9 %. with some of the non - egg proteins the volume of the 50 % egg cake was improved to above the volume of the control cake , while other proteins also showed an increase of the volume , but not up to the level of the control . cohesiveness and elasticity were generally comparable or even above the values measured for the control . springiness was improved by the non - egg proteins , but remained below the values measured for the control on day 14 . thus , the addition of non - egg protein together with a phospholipase can improve the volume , elasticity and cohesiveness of a 50 % egg cake and make it comparable to the control . cakes were prepared as in example 1 , but with addition of phospholipase and non - egg protein , alone or in combination ( table 3 ). the effect of the non - egg protein is illustrated in the data where the addition of non - egg protein alone and in combination with phospholipase is compared to 50 % egg where egg has been replaced by flour and to 100 % egg cakes (= control ). it can be clearly seen that the addition of non - egg protein alone only gives slight improvement on the volume , while when combined with the lecitase 10 l the volume is superior to the control . here also the cohesiveness and the elasticity were comparable or above the values measured for the control on day 14 . example 4 : effect of combination of phospholipase and non - egg protein : wheat protein cakes were prepared as in example 1 , but with phospholipase ( lecitase 10 l ) and various non - egg proteins , i . e . wheat proteins ( tables 4a to 4d ). a substantial amount of wheat proteins have been added such that the quantity of wheat protein is increased by at least 30 % compared to the quantity originally present in the flour . the following results show the effect of a combination of phospholipase and non - egg protein on volume and texture of cake prepared with 50 % egg reduction . the amount of protein ( dry material ) added in % by weight of the batter was 0 . 9067 % and 1 . 813 % ( corresponding to respectively 50 % and 100 % of the dry material of the replaced egg ). the effect of the non - egg protein ( s ) is illustrated in the data presented on the tables 4a to 4d where the addition of non - egg protein ( s ) alone or in combination with phospholipase is compared to 50 % egg formulations where egg has been replaced by flour and to 100 % egg cakes (= control ). table 4a . when combining wheat protein and phospholipase ( lecitase 10 l ) in cake prepared with 50 % less egg , volume of cake prepared with 100 % egg can be completely recovered . when adding prolite 100 or prolite 200 in combination with phospholipase to 50 % egg formulations cohesiveness and elasticity of crumb 14 days after baking can be recovered or even increased and springiness is improved . table 4b . meripro 420 , when added alone , has only a slight positive effect on volume of cake prepared with 50 % less egg . volume of cake prepared with 100 % egg can be completely recovered by adding a combination of phospholipase and meripro 420 to a 50 % egg formulation . cohesiveness is highly improved when adding both phospholipase and meripro 420 . table 4c . wheat proteins tested , when added alone , have only a slight positive effect on volume . hwg2009 has a positive effect on volume but not on texture properties of cake prepared with 50 % egg and phospholipase . gemtec 2170 has no effect on volume of cake prepared with 50 % egg and phospholipase but a positive effect on cohesiveness 14 days after baking and springiness 1 and 14 days after baking . arise 5000 in combination with phospholipase has a positive effect on volume and cohesiveness of 50 % egg cake . table 4d . when adding wheat proteins : meripro 420 , super gluten 75 , super gluten 80 , glutastar ec75 or glutastar ec80 to a 50 % egg cake recipe containing lecitase 10 l , cohesiveness and resiliency measured 7 days after baking are significantly increased ( between 7 and 9 %) when comparing these parameters measured 7 days after baking on 50 % egg cake only containing lecitase 10 l . example 5 : effect of combination of phospholipase and non - egg proteins : sensorial analysis cakes were prepared as in example 1 , but without hydrocolloids and with phospholipase ( lecitase 10 l ) and two different non - egg proteins : prolite 100 ( adm speciality food ingredients , keokuk , usa ) and meripro 420 ( tate & amp ; lyle europe n . v ., aalst , belgium ). five different cake samples have been subjected to sensorial analysis by 29 subjects . 2 . reference cake with 50 % egg and replacement of egg by flour and water . 3 . reference cake with 50 % egg and replacement of egg by 3750 leu lecitase 10 l / kg batter + 9 g / kg batter meripro 420 + 9 g / kg batter of flour + water . 4 . reference cake with 50 % egg and replacement of egg by 3750 leu lecitase 10 l / kg batter + 9 g / kg batter prolite 100 + 9 g / kg batter of flour + water . 5 . reference cake with 50 % egg and replacement of egg by 3750 leu lecitase 10 l / kg batter + 18 g / kg batter meripro 420 . subjects have been asked to rank the different cakes according to their preference with the highest value for the highest appreciated cake and the lowest value for the less appreciated cake ( table 5 ). the sum of rankings indicates that cake prepared with only 50 % egg is less appreciated and that the four other types of cake are equally appreciated . example 6 : effect of combination of phospholipase and non - egg protein : different types of cakes cakes were prepared with two different types of commercial dry mixes from puratos ( brussels , belgium ): tegral satin cream cake and tegral allegro cake and with phospholipase ( lecitase 10 l ) and meripro 420 ( tate & amp ; lyle europe n . v ., aalst , belgium ). the margarine added is aristo cake ( puratos , brussels , belgium ). the oil added is rapeseed oil . batter is prepared and cakes are baked as described in example 1 . the regular composition of the batters is given in table 6 . the following results show the effect of a combination of phospholipase and non - egg protein ( s ) on volume and texture of cake prepared with 50 % egg reduction ( table 7 ). | 0 |
the present invention now will be described more fully hereinafter , in which some , but not all embodiments of the inventions are shown . indeed , these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will satisfy applicable legal requirements . it is well established that in organosilane chemistry , a silane - alkoxy group ( i . e . si — or ) is known as a silane ester . equally well known in the art of organosilane chemistry , a transesterification reaction is an exchange reaction in which two different alkoxy groups are exchanged with each other . for example , if si — och 3 is reacted with hoch 2 ch 2 oh the methoxy group is exchanged with glycol ether resulting in the formation of si — och 2 ch 2 oh by the transesterification reaction . embodiments of the present invention are produced by reacting an organosilicon compound with a diol in the presence of heat to facilitate a transesterification reaction for the replacement of one or two alkoxy groups of the organosilicon . the diol can be variably supplied in excess depending on the need of the final composition . final products , in accordance with various embodiments of the present invention , are suitable for imparting water repellency and for changing the surface characteristics of organic , inorganic or cellulosic surfaces . for example , transesterified organosilicons and compositions comprising transesterified compounds are especially useful as water - proofing agents , adhesion promoters and other traditionally known uses for organosilicon compounds and compositions thereof . in one embodiment of the present invention , the transesterified organosilicon comprises an ionic organosilicon including compounds having a formula selected from the group consisting of : y is ( och 2 ch 2 ) n oh radical where n has a value of one through ten , or [ oc 3 h 5 ] n oh ( propylene glycol ) radical where n has a value of one through ten , or [ c 3 h 7 o 3 ], ( glycerol ) radical ; r is an alkyl radical including one to ten carbons ; r ′ is an alkyl radical including one to three carbons , or ( och 2 ch 2 ) n oh radical where n has a value of one through ten , or [ oc 3 h 5 ] n oh ( propylene glycol ) radical where n has a value of one through ten , or [ c 3 h 7 o 3 ] ( glycerol ) radical , or [ o ( ch 2 ) m ch 3 ] radical where m has a value of 0 , 1 , 2 or 3 , or ( ch 3 och 2 ch 2 o ) radical , or ( ch 3 ch 2 och 2 ch 2 o ) radical ; r ″ is an alkyl radical including one to three carbons , or [ o ( ch 2 ) m ch 3 ] radical where m has value 0 , 1 , 2 or 3 or ( ch 3 och 2 ch 2 o ) radical , or ( ch 3 ch 2 och 2 ch 2 o ) radical ; r ′″ is an alkylene group including one to four carbon atoms ; r iv , r v and r vi are alkyl groups including one to twenty two carbon atoms wherein at least one such group is larger than eight carbon atoms , — ch 2 c 6 h 5 , — ch 2 ch 2 oh , — ch 2 oh , and —( ch 2 ) x nhc ( o ) r vi wherein x has a value of from two to ten and r vi is a perfluoroalkyl radical having one to twelve carbon atoms ; x is chloride , bromide , fluoride , iodide , acetate or tosylate ; z is a positively charged aromatic pyridinium ring of formula c 5 h 6 n + ; and m is na , k , or li or h . in one alternative embodiment , the transesterified organosilicon comprises an ionic organosilicon selected from the formula : wherein y is ( och 2 ch 2 ) n oh radical where n has a value of one through ten , or [ oc 3 h 5 ] n oh ( propylene glycol ) radical where n has a value of one through ten , or [ c 3 h 7 o 3 ], ( glycerol ) radical ; a has a value of zero , one or two ; r ′ is an alkyl radical including one to three carbons , or [ o ( ch 2 ) m ch 3 ] radical where m has value 0 , 1 , 2 or 3 or ( ch 3 och 2 ch 2 o ) radical , or ( ch 3 ch 2 och 2 ch 2 o ) radical ; r ″ is an alkylene group including one to four carbon atoms ; r ′″ is methyl or ethyl ; r ″″ and r v are alkyl groups containing one to twenty two wherein at least one such group is larger than eight carbon atoms and x is chloride , acetate or tosylate . a non - exhaustive list of specific examples of transesterified organosilicon compounds within the scope of the present invention are represented by the formulas : ( ohch 2 ch 2 o )( och 3 ) 2 si ( ch 2 ) 3 n + ( ch 3 ) 2 c 18 h 37 cl − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 si ( ch 2 ) 3 n + ( ch 3 ) 2 c 18 h 37 cl − ( ohch 2 ch 2 o )( och 3 ) 2 si ( ch 2 ) 3 n + ( ch 3 ) 2 c 18 h 37 br − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 si ( ch 2 ) 3 n + ( ch 3 ) 2 c 18 h 37 br − ( ohch 2 ch 2 o )( och 3 ) 2 si ( ch 2 ) 3 n + ch 3 ( c 10 h 21 ) 2 cl − ( ohch 2 ch 2 o )( och 2 h 3 ) 2 si ( ch 2 ) 3 n + ch 3 ( c 10 h 21 ) 2 cl − ( ohch 2 ch 2 o )( och 3 ) 2 si ( ch 2 ) 3 n + ch 3 ( c 10 h 21 ) 2 br − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 si ( ch 2 ) 3 n + ch 3 ( c 10 h 21 ) 2 br − ( ohch 2 ch 2 o )( och 3 ) 2 ( ch 2 ) 3 n + ( ch 3 ) 2 ch 2 c 6 h 5 cl − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 si ( ch 2 ) 3 n + ( ch 3 ) 2 ch 2 c 6 h 5 cl − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 si ( ch 2 ) 3 n + ( ch 3 ) 2 c 18 h 37 cl − ( ohch 2 ch 2 o )( och 3 ) 2 si ( ch 2 ) 3 n + ( ch 3 ) 2 ( ch 2 ) 3 nhc ( o )( cf 2 ) 6 cf 3 cl − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 si ( ch 2 ) 3 n + ( ch 3 ) 2 ( ch 2 ) 3 nhc ( o )( cf 2 ) 6 cf 3 cl − in yet another alternative embodiment , the transesterified organosilicon compound may be selected from the formula : wherein y is ( ch 2 ch 2 o ) n oh radical where n has a value of one through ten , ( ch 3 och 2 ch 2 o ), or ( ch 3 ch 2 och 2 ch 2 o ) radical or [ oc 3 h 5 ] n oh ( propylene glycol ) radical where n has a value of one through ten , or [ c 3 h 7 o 3 ], ( glycerol ) radical ; a has a value of one or two ; r ′ is an alkyl radical including one to three carbons , or [ o ( ch 2 ) m ch 3 ] radical where m has value 0 , 1 , 2 or 3 , or ( ch 3 och 2 ch 2 o ) radical , or ( ch 3 ch 2 och 2 ch 2 o ) radical ; r ′″, r ″″ and r v are alkyl groups containing one to twenty two carbon atoms wherein at least one such group is larger than eight carbon atoms , — ch 2 c 6 h 5 , — ch 2 ch 2 oh , — ch 2 oh , and —( ch 2 ) x nhc ( o ) r vi wherein x has a value of from two to ten and r vi is a perfluoroalkyl radical having one to twelve carbon atoms ; and x is chloride , bromide , fluoride , iodide , acetate or tosylate . specific examples of such transesterified organosilicon compounds within the scope of the present invention include , but are not limited to the following : ( ohch 2 ch 2 o )( och 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ( ch 3 ) 2 c 18 h 37 cl − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ( ch 3 ) 2 c 18 h 37 cl − ( ohch 2 ch 2 o )( och 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ( ch 3 ) 2 c 18 h 37 br − ohch 2 ch 2 o )( och 2 ch 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ( ch 3 ) 2 c 18 h 37 br − ( ohch 2 ch 2 o )( och 3 ) 2 ch 2 ch ( ch 3 ) ch 2 n + ch 3 ( c 10 h 21 ) 2 cl − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ch 3 ( c 10 h 21 ) 2 cl − ( ohch 2 ch 2 o )( och 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ch 3 ( c 10 h 21 ) 2 br − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ch 3 ( c 10 h 21 ) 2 br − ( ohch 2 ch 2 o )( och 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ( ch 3 ) 2 ch 2 c 6 h 5 cl − ( ohch 2 ch 2 o )( och 2 ch 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ( ch 3 ) 2 ch 2 c 6 h 5 cl − ( ohch 2 ch 2 o )( och 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ( ch 3 ) 2 ( ch 2 ) 3 nhc ( o )( cf 2 ) 6 cf 3 cl − ohch 2 ch 2 o )( och 2 ch 3 ) 2 sich 2 ch ( ch 3 ) ch 2 n + ( ch 3 ) 2 ( ch 2 ) 3 nhc ( o )( cf 2 ) 6 cf 3 cl − in another alternative embodiment , the transesterified organosilicon compound may be selected from the formula : wherein y is ( ch 2 ch 2 o ) n oh radical where n has a value of one through ten , ( ch 3 och 2 ch 2 o ), or ( ch 3 ch 2 och 2 ch 2 o ) radical or [ oc 3 h 5 ] n oh ( propylene glycol ) radical where n has a value of one through ten , or [ c 3 h 7 o 3 ], ( glycerol ) radical ; a has a value of one or two ; r ′ is an alkyl radical including one to three carbons , or [ o ( ch 2 ) m ch 3 ] radical where m has value 0 , 1 , 2 or 3 or ( ch 3 och 2 ch 2 o ) radical , or ( ch 3 ch 2 och 2 ch 2 o ) radical ; r ′″, r ″″ and r v are alkyl groups containing one to twenty two carbon atoms wherein at least one such group is larger than eight carbon atoms , — ch 2 c 6 h 5 , — ch 2 ch 2 oh , — ch 2 oh , and —( ch 2 ) x nhc ( o ) r vi wherein x has a value of from two to ten and r vi is a perfluoroalkyl radical having one to twelve carbon atoms ; and x is chloride , bromide , fluoride , iodide , acetate or tosylate . in another embodiment of the present invention , the transesterified organosilicon comprises an organosilane including compounds selected from the formula : where x is ( och 2 ch 2 ) n oh radical where n has a value of one through ten or [ oc 3 h 5 ] n oh ( propylene glycol ) radical where n has a value of one through ten , or [ c 3 h 7 o 3 ], ( glycerol ) radical ; m has value 1 or 2 ; r ′ is an alkyl group including one to three carbons or ( och 2 ch 2 ) n oh radical where n has a value of one through ten or [ oc 3 h 5 ] n oh ( propylene glycol ) radical where n has a value of one through ten , or [ c 3 h 7 o 3 ] ( glycerol ) radical , or ch 2 ═ ch 2 radical , och 3 , och 2 ch 3 or oc 3 h 5 radical or ( ch 3 och 2 ch 2 o ) or ( ch 3 ch 2 och 2 ch 2 o ) radical ; r ″ is an alkyl group including one to three carbons or ( och 2 ch 2 ) n oh radical where n has a value of one through ten or [ oc 3 h 5 ] n oh ( propylene glycol ) radical where n has a value of one through ten , or [ c 3 h 7 o 3 ], ( glycerol ) radical , or ch 2 ═ ch 2 radical , och 3 , och 2 ch 3 or oc 3 h 5 radical or ( ch 3 och 2 ch 2 o ), or ( ch 3 ch 2 och 2 ch 2 o ) radical ; r ′″ is an alkylene group including one to four carbon atoms or perfluoroalkyl radical having one to twelve carbon atoms ; y is an organofunctional group including nh 2 , ( ch 3 ) nh , ( ch 3 ) 2 n , nh 2 ch 2 ch 2 nh , nh 2 ch 2 ch 2 nhch 2 ch 2 nh , cl , br , f , i , cn , methacryloxy , glycidoxy , acetoxy , h or hs . specific examples of transesterified organosilanes in accordance with various embodiments of the present invention include , but are not limited to the following : compositions in accordance with embodiments of the present invention can be made by mixing or dissolving at least one transesterified orgaonsilicon compound in water . in one embodiment of the present invention , an aqueous composition can comprise a mixture of at least one transesterified ionic organosilicon compound and at least one transesterified organo - functional silicon compound . furthermore , compositions in accordance with various embodiments of the present invention can include traditionally known excipients . for example , aqueous - based compositions of the present invention may optionally include a variety of known wetting agents , surfactants , buffering agents , and antimicrobial agents . as such , one embodiment of the present invention comprises a solution comprising at least one transesterified organosilicon and optionally comprising any combination of well - known excipients to further tailor the composition for a specific application . in an alternative embodiment , the present invention comprises an aqueous - based emulsion comprising at least one transesterified organosilicon and optionally comprising any combination of well - known excipients to further tailor the composition for a specific application . additionally , embodiments of the present invention may comprise an aqueous - based solution or emulsion consisting essentially of at least one transesterified organosilicon . compositions according to embodiments of the present invention can be applied to a wide variety of surfaces by any known means including for example by brush , roller , air spray , and airless spray techniques . any surface with functional groups that will bond with the silanols created by hydrolysis of the silane alkoxy groups may be rendered water repellant upon treatment with aqueous compositions of the present invention . some suitable surfaces for example include heavy and light weight concrete , masonry products , gypsum , concrete blocks , cinder blocks , soft mud bricks , sand lime bricks , drain tiles , ceramic tiles , sandstone , plaster , clay bricks , natural stones and rocks , roofing tiles , calcium silicate bricks , cement articles , slag stones and bricks , stucco , limestone , macadam , marble , grouts , mortar , terrazzo , clinker , pumice , terra , cotta , porcelain , adobe , coral , dolomite sand and aggregates . non - cement surfaces may be treated with compositions of the present invention including but not limited to perlite , cellular glass , vermiculite , mica , silica and diatomaceous earth . after an aqueous - based composition according to embodiments of the present invention is applied and allowed to dry , a treated surface is obtained comprising a protective water resistant layer bonded to the substrate . aqueous - based compositions according to one embodiment of the present invention comprises at least about 0 . 1 weight percent of at least one transesterified organosilicon compound . additionally , some embodiments may comprise from about 0 . 1 to about 10 weight percent of at least one transesterified organosilicon compound while others may comprise between about 5 to about 95 weight percent or about 10 and 70 weight percent . in one alternative embodiment , the aqueous - based composition comprises from about 20 to about 60 weight percent of at least one transesterified organosilicon compound or from about 30 to about 50 weight percent or of at least one transesterified organosilicon compound . a two liter , three - necked flask equipped with a condenser , stirrer , thermometer and a distillation head , was charged with 360 grams ( six moles ) of ethylene glycol . next , 315 grams of a 70 % solution of methanol containing 3 -( trimethoxysilyl ) propyloctadecyl - dimethyl ammonium chloride ( hereinafter “ product i ”) was added to the flask . the mixture was slowly heated under vacuum to 80 ° c . and free methanol 80 grams was distilled . the resulting composition was product ii . the product solution ( i . e . product ii ) from example 1 was further heated to 120 ° c . under vacuum . the reaction was allowed to continue . the transesterification resulted in methanol liberation which was removed and condensed . after 16 grams of methanol ( 0 . 5 mole ) was collected , vacuum was released and cooling was applied . the average structure of the components of the crude product mixture in ethylene glycol was ( och 3 ) 2 ( och 2 ch 2 oh ) sich 2 ch 2 ch 2 n + ( ch 3 ) 2 ( c 18 h 37 ) cl − , namely 3 -[( 2 - hydroxyethoxy ) dimethoxysilyl ] propyldimethyloctadecyl ammonium chloride ( i . e . product iii ). products i , ii and iii were each subjected to a flash point test . the results are summarized in table - 1 . each product was then heated to 80 ° c . for 4 days to simulate long storage life and subjected to a second flash point determination . the results are summarized in table - 1 . the data provided in table - 1 demonstrates that product iii , namely the transesterified orgaonsilicon , not only exhibited a higher flashpoint than the comparative products but also did not exhibit any reduction in flash point upon aging at 80 ° c . for four days . it is well known in the art that intermolecular condensation of water soluble orgaonisilicon compounds cause solutions thereof to become cloudy and thus exhibit an increased level of turbidity . specifically , an increase in clouding or milkiness of an aged solution is an interpretation of the extent of inter - molecular condensation . products i , ii , and iii were added to water in the proportion of 1 : 10 and maintained at a room temperature of approximately 30 ° c . for 7 days . the prepared aqueous solutions were monitored for an increased turbidity level . the results are summarized in table - 2 . unlike products i and ii , product iii ( i . e . containing a transesterified organosilicon ) exhibited a substantial improvement in shelf - life by maintaining a clear solution for around 150 hours . end - users find this property desirable for a variety of applications . products i , ii and iii were diluted at a 1 : 10 ratio in water . the respective solutions were applied on cement sheets , sand stones , concrete and brick . water repellency was determined based on the observed beading effect for each solution , wherein the beading effect of each solution was assigned a value from 1 to 5 . a value of 1 represents a flat drop ( i . e . low repellency ) and a value of 5 represents an almost circular drop ( i . e . high repellency ). product iii ( i . e . containing a transesterified organosilicon ) exhibited the best beading effect or roll - off effect demonstrating the improved hydrophobicity or water repellency . the results are summarized in table - 3 . additionally , the compositions were evaluated for gloss , wherein no gloss was assigned a value of zero and a high gloss was assigned a value of five . the gloss of a composition is an indication of its degree of surface penetration and intermolecular condensation . in particular , a composition exhibiting reduced gloss is indicative of good substrate penetration and reduced intermolecular condensation . unlike products i and ii , product iii ( i . e . containing a transesterified organosilicon ) exhibited minimum gloss thus indicating that the product has penetrated into the substrate and intermolecular condensation has been minimized . the results are summarized on table - 4 . a two liter , three - necked flask equipped with a condenser , stirrer , thermometer and a distillation head , was charged with 360 grams ( six moles ) of ethylene glycol . to this , 220 grams ( 1 mole ) of isobutyltriethoxysilane was added . the mixture was slowly heated to 100 ° c . and held for one hour . the temperature was raised to 120 ° c . and slowly vacuum was applied . the resulting transesterification reaction liberated ethanol which was removed and condensed . after approximately 46 g of ethanol ( 1 mole ) was collected , vacuum was released and cooling applied . the average structure of the components of the crude product mixture was isobutyl ( 2 - hydroxyethoxy ) diethoxysilane : ( ch 3 ch 2 o ) 2 ( ohch 2 ch 2 o ) sic 4 h 9 . a two liter , three - necked flask equipped with a condenser , stirrer , thermometer and a distillation head , was charged with 300 grams ( six moles ) of ethylene glycol . to this , 150 grams ( 1 mole ) of vinyltrimethoxysilane was added . the mixture was slowly heated to 80 ° c . and held for one hour . the temperature was then raised to 120 ° c . and slowly vacuum was applied . the transesterification reaction liberated methanol which was removed and condensed . after approximately 30 g of methanol ( 1 mole ) was collected , vacuum was released and cooling applied . the average structure of the components of the crude product mixture was vinyl ( 2 - hydroxyethoxy ) dimethoxysilane : ( ch 3 o ) 2 ( ohch 2 ch 2 o ) sich ═ ch 2 ( i . e . product iv ). product iv was subjected to flash point test . the results are summarized in the table - 5 . samples were then heated to 80 ° c . for 4 days to simulate long storage life and then subjected to a second flash point determination . the results are summarized in table - 5 . the data provided in table - 5 demonstrates that product iv , including a transesterified organosilicon , did not exhibit any reduction in flash point upon aging at 80 ° c . for four days . many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation . | 2 |
referring to all figures generally , embodiments of the glueless dustless composite flooring system 100 and production method 200 are illustrated . referring to fig1 & amp ; fig2 , the glueless dustless composite flooring system 100 comprises three layers 20 , 30 , 40 of different materials strongly bonded one to another without the use of separate glues or adhesives , and an optional underlayment layer 10 . the optional underlayment layer 10 can be a natural material such as cork or rubber , or a synthetic material such as either an open - cell or a closed - cell plastic foam . ethylene vinyl acetate ( eva ) is a suitable material . the glueless dustless composite flooring system 100 provides a waterproof covering for any type of optional underlayment layer 10 used , allowing the use of water - sensitive materials for the underlayment . the optional underlayment layer 10 can be omitted , or can be affixed to the finished flooring during manufacture , or can be made available as a separately packaged item . depending upon the ability of any particular underlayment material to withstand the hot - melt overlaying process disclosed below , the underlayment can be affixed to the rest of the glueless dustless composite flooring system 100 either earlier or later in the manufacturing process . the glueless dustless composite flooring system 100 provides a flooring base layer 20 , which is formed by fusion , extrusion , and mold , forming of a blended mixture of pvc resins and other materials according to the glueless dustless composite flooring system method 200 illustrated in fig8 and disclosed in more detail below . optionally , two or more different mixtures of pvc resins and other materials can be co - extruded into the same mold , which will produce a fused flooring base layer 20 with different sublayers or strata , such as the first base extrusion 21 and the second base extrusion 22 illustrated . the pvc - resin blend can be adjusted through the use of different materials and fillers , or different proportions of materials and fillers , to have different properties when fused and extruded . if one pvc - resin blend yields a desired hardness and stability , but is deficient in sound - deadening or other sponginess qualities , then a different pvc - resin blend or a different extrusion technique can be applied as a co - extrusion in order to provide the otherwise - missing qualities . in a preferred co - extruded embodiment , a stiffer , harder stratum is formed for strength and a dense - foam , springier stratum is formed for cushioning and sound absorption . the ability to adjust the characteristics of the flooring base layer 20 , and therefore of the overall finished flooring , by adjustment of one or more pvc - resin blends and one or more extrusion methods eliminates the need to use compressed dust , which is vulnerable to moisture and is otherwise problematic in some climates and for some uses . for example , the formation of a controlled amount of a dense foam consistency in the flooring base layer 20 , either in that entire layer or stratified within that layer , depending on the concurrent need for stiffness , can duplicate the desirable qualities of a compressed - dust core , but without the disadvantages of the dust . a preferred embodiment of the mix of materials comprising a suitable flooring base layer 20 is ( 1 ) pvc : 50 kg ; ( 2 ) 800 - 1000 caco3 : 75 - 100 kg ; ( 3 ) stabilizer : ca / zn : 3 . 8 - 5 . 0 kg ; ( 4 ) chlorinated polyethylene cpe : 2 . 5 - 4 . 0 kg ; ( 5 ) modifier acr : 3 . 0 - 4 . 0 kg ; ( 6 ) high density polyethylene oxide oa6 : 0 . 2 - 0 . 3 kg ; ( 7 ) internal lubrication g60 : 0 . 4 - 0 . 6 kg ; and ( 8 ) high melting point polymer pe - wax : 0 . 5 - 0 . 7 kg . this mixture is suitable for either a singly extruded base layer or for a co - extruded layer . another preferred embodiment of the mix of materials , comprising a suitable co - extruded layer , is pvc : 50 kg ; 800 - 1000 caco3 : 25 - 50 kg ; stabilizer : ca / zn : 3 . 0 - 4 . 0 kg ; chlorinated polyethylene cpe : 2 . 0 - 4 . 0 kg ; modifier acr : 2 . 0 - 3 . 5 kg high density polyethylene oxide oa6 : 0 . 1 - 0 . 2 kg ; internal lubrication g 6 0 : 0 . 2 - 0 . 4 kg ; high melting point polymer pe - wax : 0 . 15 - 0 . 35 kg ; epoxy soybean oil dobs : 1 . 0 - 2 . 0 kg . the method of producing the glueless dustless flooring material system provides for the mixing of the materials for the flooring base layer 20 in a suitable large container until the materials are thoroughly mixed . then , either in the same large container or in a different one , the fusing step provides for the heating of the mixture of materials while continuing the mixing of the materials . a preferred embodiment of the method heats the mixture to 115 - 130 ° c . while stirring at a high speed approaching , but not exceeding , 1600 rpm . after fusion is complete , the fused pvc material is allowed to cool somewhat . the pvc material is destined to be re - heated in the extrusion process , so if the batch of fused mixture is to be immediately sent to the extruder , then the fused mixture needs to be cooled enough to be safely and efficiently conveyed from the dusty mixing and fusing area to the cleaner environs of the extrusion and molding area . this conveyance or delivery can be effected by using a large pipe , as is known in the art . water or another coolant can be circulated in a jacket around the container used for fusing in order to carry heat away from the fused pvc mixture , taking care not to force too rapid of cooling , which might affect the plastic properties of the flooring base layer 20 . the mixing , fusing , and cooling steps are by nature batch processes . however , by careful adjustment and control of the processes , or by setting up more than one production line and staggering its operation , an essentially continuous supply of fused pvc material can be produced and supplied to the subsequent operations . the fused pvc mixture is conveyed to a screw extruder for extrusion to an extrusion mold at an elevated temperature and pressure . a preferred embodiment is extruded using an 80 mm - diameter screw at a speed not exceeding 40 rpm , an extrusion pressure of 20 - 35 mpa , and a temperature of 160 - 186 ° c . more than one mixture can be co - extruded to the same extrusion mold for the purpose of forming different strata , as disclosed above . this extruding and mold - forming process yields a sheet of flooring base layer 20 . the sheet can be very long , or essentially continuous . if the mixing - fusing - cooling - delivering steps of the process are properly coordinated so as to provide a continuous supply of fused pvc material to the screw extruder , then the extruder can supply an essentially continuous sheet of flooring base layer 20 for hot - melt overlaying of an essentially continuous sheet of flooring face layer 30 . the flooring face layer 30 comprises a decorative face sublayer 31 fused to a wearing face sublayer 32 . the decorative face sublayer 31 can be formed from a pvc decorative film , and will usually be opaque and of a color acting as a base color or background color for any decorative pattern 33 that is intended to be applied , such as imitations of wood , stone , or tile , or other decorative patterns . the wearing face sublayer 32 can be formed from a high - molecular wear - resistant pvc polymer film , usually clear or mostly clear , so that the decorative face sublayer 31 may be seen . in most embodiments of the glueless dustless composite flooring system 100 , a decorative pattern 33 will be applied to the decorative face sublayer 31 before it is fused with the wearing face sublayer 32 . the decorative pattern 33 is likely to be in imitation of traditional flooring materials such as wood , stone , or tile . referring briefly to fig3 , illustrating schematically that the flooring face layer 30 might have a decorative pattern in imitation of marble , terrazzo , or wood , different decorative patterns 33 can be used with the glueless dustless composite flooring system 100 . the patterns can be applied with a printing roller or with a digital image - printing device . an advantage of digital printing is that an image with no exact repetition or a very long period of repetition can be produced , in contrast with the repetition inherent in roller printing . another advantage of digital printing is that several different colors , shades , or tones can be applied or even blended in place , which is either very cumbersome or is not possible with roller printing in a floor - manufacturing environment . the pvc decorative film forming the decorative face sublayer 31 can be supplied in large rolls . the strength and wear characteristics of this pvc decorative film do not significantly influence the strength and wear characteristics of the finished flooring , because other elements provide such strength and wear characteristics . as a practical matter , the pvc decorative film should be strong enough to avoid tearing during the floor - manufacturing process . the use of a high - molecular wear - resistant pvc polymer film for the wearing face sublayer 32 provides a significant portion of the desired wear resistance of the finished flooring , with the flooring coating layer 40 providing the rest . this film can also be supplied in large rolls . an essentially continuous sheet of flooring face layer 30 can be produced by using large rolls of the pvc films , or by having an efficient re - loading method . although the wearing face sublayer 32 can be fused to the decorative face sublayer 31 as a separate step in the manufacturing process , before subsequently being fused with the flooring base layer 20 , a preferred embodiment of the glueless dustless composite flooring system method 200 provides for simultaneous fusing of the wearing face sublayer 32 , the decorative face sublayer 31 , and the flooring base layer 20 in one pass . this fusion is achieved by hot - melt overlaying , bringing the sublayers and layers into contact with one another in the proper order , and simultaneously heating and applying compression to the stack to fuse the layers together without the use of glue or adhesive , and therefore essentially eliminating potential problems of delamination or other failure of the finished flooring . the hot - melt overlaying can be effected by feeding the wearing face sublayer 32 , the decorative face sublayer 31 , and the flooring base layer 20 into a set of heated rollers . where the wearing face sublayer 32 and the decorative face sublayer 31 are supplied as large rolls of pvc polymer films of essentially equal width , and the flooring base layer 20 is formed in sheets of essentially the same width as the rolls of films , or in divisions of that width allowing side - by - side simultaneous processing of multiple sheets , the hot - melt overlaying can be performed in a continuous or nearly continuous run . optionally , a textured , embossed , or debossed surface pattern can be applied to the flooring face layer 30 of the fused base and face layers . such a texture can be an imitative decorative texture complementing a printed decorative pattern 33 , or can be a texture intended to improve traction , light reflection , or other qualities of the finished flooring . the textured , embossed , or debossed surface pattern can be applied to the flooring face layer 30 of the fused base and face layers either concurrently with the hot - melt overlaying compression stage or immediately after , while the flooring face layer 30 is still partially melted and pliable . the hot - melt roller or rollers making contact with the flooring face layer 30 can be configured to emboss the texture , although the arrangement would require either a small repetitive period of the texture or a large roller . the embossing can be performed by one or more rollers , plates , or other devices , such as rakes pressing into the flooring face layer 30 of the now - fused base and face layers immediately after the hot - melt overlaying compression , while the partial assembly is still pliable . depending on the amount and nature of the texturing , cylinders of stiff wire could be used as rollers for debossing , perforated cylinders could be used as rollers for embossing , or a rake arrangement , possibly allowing for movement of the tines in order to create variation , could be used . the hot - melt overlaying fuses the flooring face layer 30 and the flooring base layer 20 together without the use of glue or adhesive . the face - and - base subassembly emerges from the hot - melt overlaying and optional texturing at a very high temperature . the face - and - base subassembly is then conditioned . this conditioning step allows the face - and - base subassembly to cool to the ambient temperature fairly slowly and evenly , without quenching or other sudden cooling , in order to prevent the development of stress in the sheet . because the face - and - base subassembly is a thin sheet that is almost completely surface area , the cooling does not require an inordinate amount of time , and conditioning can be effected on a continuous - run basis by providing a sufficient extra length of conveyor belt to allow for cooling . optionally , additional conditioning procedures can be performed , such as corona discharging or flaming in order to prepare the pvc surface for application of the flooring coating layer 40 . the optional underlayment 10 can be added to the subassembly at this point or subsequent points after the hot - melt overlaying and optional texturing have been performed . an essentially continuous sheet of the face - and - base subassembly can be produced by the hot - melt overlaying step if there is a continuous supply of base - layer and face - layer sheet . after the face - and - base subassembly has cooled in the conditioning step , the subassembly is then coated on the top or flooring - face - layer 30 side with a plastic resin which can be cured under ultraviolet ( uv ) light , forming a flooring coating layer 40 . uv - curing primers and top coatings suitable for application onto pvc are known in the art . generally , the uv - curing primer and top coating will be clear , colorless , and transparent , allowing the decorative pattern 33 to show through . generally , colorless coatings can be cured more quickly and with less exposure than colored coatings . uv - curing top coats are available which provide a glossy finish or a matte finish , and which have such desirable properties as scratch resistance . optionally , a gritty particulate material such as aluminum oxide can be added to the uv - curing plastic resin and incorporated into the flooring coating layer 40 to provide additional traction and additional wear resistance . in a preferred embodiment , the uv primer and the uv top coats are applied with a series of rollers in long runs or a continuous run . there should be an application of uv - curing primer and at least one application of uv - curing top coat , although more than one application of uv - curing top coat will likely improve the appearance and durability of the finished flooring . the curing is effected by exposure to uv light from , for example , mercury ( hg ) lamps or gallium ( ga ) lamps . uv curing is effected very quickly , in only a few seconds , and can be accomplished in the time that a workpiece travels on a conveyer belt passing under a bank of uv lights . in contrast , oxidative curing of polyurethane is likely to take eight to ten hours , and curing of a two - part epoxy is likely to take at least thirty minutes or more . the use of uv - curing plastic resins in the flooring coating layer 40 of the glueless dustless composite flooring system method 200 eliminates a potential bottleneck in the manufacturing process , which enables production of an essentially continuous sheet of fully assembled , fused , decorated , coated , and cured flooring material . the coating and uv curing of the fused base - and - face subassembly yields a finished - large - sheet assembly of a composite flooring material that incorporates the flooring base layer 20 , the flooring face layer 30 , and the flooring coating layer 40 , with an optional underlayment layer 10 . this finished - large - sheet assembly is intended to be divided into segments of desired size and configuration , such as a tile or a plank , which can be easily handled during installation , or a large rolled sheet . the final steps in the glueless dustless composite flooring system method 200 are profile processing , in which the large sheet of finished flooring material is cut to the desired size and has the appropriate notches , grooves , tabs , or other installation - related components formed , then inspecting , and then packing the finished , profiled flooring material for transport and sale . referring to fig8 , a flowchart representation of the glueless dustless composite flooring system production method 200 , the flooring base layer 20 is formed from pvc and other raw materials by the mixing , fusing , cooling , delivering , extruding , mold - forming , and conditioning - cooling , yielding a sheet - form supply of flooring base layer 20 that can be essentially continuous . the flooring face layer 30 is separately , and potentially simultaneously , formed by providing pvc decoration film , optionally printing a decorative pattern 33 upon it , and then adding pvc wear - resistant film , yielding a sheet - form supply of flooring face layer 30 that can also be essentially continuous . then the sheets of flooring base layer 20 and flooring face layer 30 are brought into proximity in the appropriate orientation and fused together , without glue or adhesives , by hot - melt overlaying , optionally followed by texturing , yielding a sheet - form supply of base - and - face subassembly that can also be essentially continuous . then a conditioning step allows the hot - melted base - and - face subassembly to cool , and optionally provides other conditioning procedures . then a coating of uv - curing plastic resin is applied as a primer layer and at least one top coat layer . after each application of uv - curing plastic resin , the sheet of coated flooring material is subjected to uv curing by exposure to uv light , effecting a very rapid curing . the conditioning , coating , and uv curing processes can be performed on an essentially continuous , sheet - form supply of base - and - face subassembly , and yields a sheet - form supply of finished , fused , coated , and cured flooring material that can also be essentially continuous . then the sheet of finished flooring is cut to size and has any notches , grooves , or tabs for installation purposes formed in the profile processing step . inspecting and packing the profiled flooring - material pieces are the finals steps . the glueless dustless composite flooring system method 200 provides an ability to manufacture flooring on a continuous - run assembly - line conveyor - belt basis . it also provides an ability to efficiently change production from one color or design pattern to another . it yields a flooring - material product that contains no dust and no glue , yet possesses the desirable qualities associated with dust and glue , which are achieved by other , novel means . many changes and modifications can be made in the present invention without departing from the spirit thereof . i therefore pray that rights to the present invention be limited only by the scope of the appended claims . | 1 |
this proximity - sensing scheme involves both the capacitance sensing areas themselves , the circuitry used to detect a small change in capacitance , as well as the wiring used to connect the two . referring now to fig1 what is depicted is a child &# 39 ; s toy in the form of a doll , here illustrated at 10 , in which the doll has a number of sensing areas 12 underneath the skin of the doll . in this embodiment , the sensing areas are in the feet , hands , stomach , eyes , mouth , and cheeks of the doll . each of these sensing areas is fitted with buried coaxial cables shown in dotted outline at 14 to connect the sensing areas to the control circuitry of the doll . also shown is a child generally indicated at 16 using her lips 18 , to activate the doll to perform one of a number of functions by kissing the doll on the cheek . other types of functions may be activated when the child &# 39 ; s body part is adjacent to the other sensing areas so that the doll can be made to respond in different manners to increased capacitance sensed at different sensing areas . it will be noted that the sensing areas are buried within the skin of the doll , as are the lengths of coaxial cable to couple the various sensing areas to control circuitry carried within the doll . referring to fig2 one such sensing area is illustrated as including a strip of copper tape 20 to which the center conductor 22 of a coaxial cable 24 is soldered as illustrated at 26 . this inexpensive and simple sensing area comprises a sensor which can be used in the proximity sensing described above . referring to fig3 a number of sensing areas 30 , 32 , 34 and 36 are coupled via low capacitance coaxial cable 40 to a multiplexing circuit 42 shown symbolically as having a number of taps 44 contacted through a wiper arm 46 to a common tap 48 . each of these contact points is connected to the center conductor of the associated coaxial cable , with a resistor r connected between the center conductor of this coaxial cable and the output of an oscillator 50 . in one embodiment , this oscillator is a schmitt - trigger inverter acting as an rc - controlled oscillator . it will be appreciated that the frequency of the output pulses generated by this schmitt - trigger inverter are inversely proportional to the capacitance at point 44 of the selected tap , with the output of the oscillator coupled to an external event counter 56 within a micro - controller 58 , with the micro - controller controlling the addressing of the sensing areas as illustrated by signals 60 . in this embodiment , the micro - controller has an associated 6 - megahertz crystal 68 and a speaker 70 for an audio output , should such be desired . the microprocessor continually scans each of the sensor areas using the multiplexer to select each one sequentially . when a body part comes into proximity of a sensing area , micro - controller 58 can sense the increase in capacitance of the particular sensing area and cause the toy to respond in a preprogrammed way , depending on the sensing area activated . for instance , if the user touches the doll &# 39 ; s lips , the doll may be made to make a kissing sound , emanating from speaker 70 . additionally there are many types of movements or sounds that the doll can make , depending on what is preprogrammed into micro - controller 58 . referring to fig4 oscillator 50 has as its output a frequency which is inversely proportional to the total capacitance . the total capacitance is the sum of the variable capacitance c v , and the fixed capacitance c f . fixed capacitance c f is due to the capacitance of the low capacitance coaxial cable , circuit board , and other electrical components in the circuit , whereas c v is variable and depends upon the proximity of a body part near a sensing area . the rc circuit is formed by a fixed resistor r in the feedback path of the schmitt - trigger inverter oscillator such that the frequency of the output of the oscillator is changed by variable capacitor c v due to the proximity of a human body part to the sensing area . in operation , the capacitance sensing areas are small conductive surface areas made of conductive tape , copper - clad - pcb , flat copper braid , or any of the many available low - cost conductive materials used in electronics manufacturing . the material can be chosen based on cost , manufacturability , and the tactile quality desired . if the sensing area is to be used in a plush stuffed animal , for example , the sensing area should be soft and malleable , such as copper tape or flat copper braid , as to be undetectable from the outside when the stuffed animal is squeezed . the surface area used in the preferred embodiment is approximately one square inch . another feature of the subject invention is the method by which the above sensing areas are wired to the detection circuitry , which in one embodiment is on a central circuit board in the toy . the sensing areas are likely to be spread out all over the toy , and may be over twelve inches from the circuit board . low - capacitance coaxial cable , such as low - cost standard 75 - ohm video coax cable , can be used . the center conductor of the coax cable is used to connect the capacitive sensing area to the detection circuitry . the outside shield of the coax cable is connected to ground , and this prevents the detection circuitry from detecting false capacitance changes due to human skin near the cabling itself . this method keeps the capacitance sensing localized to the sensing area only . the detection circuitry must be able to reliably sense very small changes in capacitance at the remote sensing area , usually a few picofarads . this small increase in capacitance is a small percentage of the total capacitance of the coax cable , input capacitance of the detection circuitry , and stray capacitances on the circuit board . it would be possible for a very fast micro - controller to time how long it takes to charge this capacitance through a resistor with fine enough resolution to detect this small change in capacitance . however , the preferred embodiment of the invention uses an rc oscillator scheme to allow a low - speed , low - power micro - controller to detect this small change . in the illustrated embodiment , micro - controller 58 allows oscillator 50 to run for a pre - determined amount of time , and counts how many low - to - high transitions occurred . this allows the minute difference in oscillator frequency to add up over many cycles , making it easy for a slower micro - controller to accurately detect the percentage of change in the capacitance . the detection circuitry consists of a single schmitt - trigger inverter acting as the rc oscillator 50 , which oscillates at a frequency inversely proportional to the capacitance that it is connected to . there is an analog multiplexer 42 which selects which sensing area is connected to the oscillator . a transistor circuit in an emitter - follower configuration on each sense area may be used which acts as an analog buffer in order to greatly reduce the impedance so that the large capacitance of the analog multiplexer does not affect the oscillation frequency . the output of oscillator 50 is connected to the external event counter 56 input on the micro - controller . note that a low - dropout regulator may be used which regulates the voltage to the analog oscillator / multiplexer circuit and the micro - controller . this helps to keep the oscillator frequency from drifting over time , and reacting to noise on the battery supply . all of the components used in the circuit are commonly available , mature , low - cost components . the software algorithm used in the micro - controller in the preferred embodiment is described in the flowchart of fig5 . referring now to fig5 this flow chart represents the algorithmic operation of the subject system . in the flowchart and elsewhere , the term ‘ pad ’ is used to refer to a sensing area , and the two terms are interchangeable . also , the term ‘ touched ’ is used to indicate when a person &# 39 ; s skin is near enough to the sensing area to trigger the capacitive sensing mechanism . the person doesn &# 39 ; t necessarily have to be ‘ touching ’ the sensing area for this to occur , since it is proximity sensing . however , the word ‘ touched ’ is used throughout this patent in order to make it easier to understand . the capacitance reading that will be referred to in fig5 reflects the actual capacitance at the sensing area , and is therefore inversely proportional to the actual number of oscillations counted by the microprocessor . the microprocessor sets the multiplexer to select the sensing area in question , then counts the number of oscillations based on its capacitance in a predetermined period of time , then takes the inverse of that count to arrive at the capacitance reading . for example , assume that the counter is an 8 - bit counter , the predetermined period is 1 ms ( one millisecond ), and that a particular pad has a quiescent ‘ untouched ’ capacitance such that it oscillates at 200 khz when the pad is connected to the rc oscillator . when the microprocessor selects this pad using the multiplexer , it will read a count of 200 when it counts for 1 ms . in one embodiment , the microprocessor could subtract this count from the 8 - bit maximum , 255 , in order to arrive at a ‘ capacitance ’ reading , in this case a value of 55 . when this pad is touched , the capacitance will rise , and cause the oscillator frequency to fall , let &# 39 ; s say to 180 khz . now , when the microprocessor takes a reading of this pad , it will get a count of 180 in 1 ms . subtracting this from 255 , it would arrive at a ‘ capacitance ’ reading of 75 . as shown in this example , the capacitance reading as referred to in fig5 reflects the actual capacitance of the sensing area , not the rc oscillation frequency or the raw oscillation count . more particularly , the micro - controller starts up in a power - up block 80 , then advances to a threshold initialization block 82 , where thresholds of all of the sensing areas are initialized to the maximum value . next , the microprocessor advances to a multiplexer initialization block 84 , where it selects the first of the sensing areas . in this case , the first pad is selected . as can be seen by block 86 , the capacitive sensing algorithm is inhibited if audio is currently being played through a speaker . if audio is not currently playing , the counter is allowed to count the external pulses from the oscillator during a given time interval , as illustrated at 90 . the algorithm prevents readings from being taken while a sound is being played through the speaker so that any electrical noise created on the board due to high current spikes from the audio playback do not give false readings . as illustrated in block 90 , the current reading is saved , and at a decision block 94 , it is ascertained if the capacitance reading for the current pad is less than the pad &# 39 ; s calibrated threshold . it should be noted that the thresholds for all sensing areas are initially set to the maximum value , so that block 94 is always true when the toy has just been turned on . if , as illustrated at block 94 , the current capacitance reading for the given pad is smaller than its threshold , this indicates that the threshold may need to be reset . it is first determined if there were enough readings below the threshold to warrant a new threshold value , as seen in block 122 . this debounce feature of requiring x number of consecutive readings below the threshold is utilized to prevent a single noisy reading from erroneously adjusting the threshold . if there hasn &# 39 ; t been x number of consecutive readings below the threshold , then this pad is marked as ‘ untouched ’, and the threshold value is unchanged , as illustrated in block 112 . if there has been x number of consecutive readings below the threshold , then this pad is marked as ‘ untouched ’, and the current capacitance reading is established as the new threshold as seen in block 124 , and the process iterates back . in order to ascertain if the current pad is being ‘ touched ’, a determination is made at block 98 whether the current reading is above this pad &# 39 ; s threshold by a given amount . if so , the pad is marked as being touched . as illustrated in block 98 , what constitutes a sensing area being touched is that the current reading minus the current threshold is larger than a predetermined delta value . if so , then the pad is considered ‘ touched ’, as illustrated at 100 . the delta value being set to a large enough constant so that the system is not triggered by noise , which causes minor changes in the sensed capacitance readings . it should be noted that this delta value may be set to a different value for each sensing areas . this is useful for deliberately setting the touch sensitivity differently on the various sensing areas . in block 98 , if the current reading is not larger than the threshold , or the difference is less than the predetermined delta , then the pad is marked as ‘ untouched ’ as indicated at 112 and at the micro - controller proceeds to block 102 . below is an example of how the threshold initially adjusts to the quiescent capacitance of each sensing area , and why the continual adaptive threshold algorithm is important . when the unit is first turned on , all thresholds are set to maximum value . at this time , each pad is always going to have a reading that is less than the threshold in block 94 . this is how the system automatically stores the initial quiescent settings for each pad . for instance , let &# 39 ; s assume that the current capacitance reading is 100 on the left hand of the doll , the threshold starts at 255 . the microprocessor will continually read 100 for the left hand sensing area until block 122 is true , and 100 is now set as the new threshold value to which all subsequent readings of the left hand sensing area is compared . the adaptive threshold algorithms is also important in the case when , for instance , the left hand of the doll is touched when the unit is first turned on . the quiescent ‘ untouched ’ reading should be 100 , but the sensing area repeatedly returns a reading of 120 because the left hand is being held by the child , so the threshold gets set to 120 . when the child lets go of the hand , the reading will jump down to 100 and stay there . when that happens , the algorithm notices that the reading is less than the stored threshold , and the ‘ untouched ’ reading of 100 will now correctly be stored as the new threshold . in one embodiment , even if a pad is determined to be ‘ touched ’, it is not acted upon immediately . all of the pads are read in a single scanning cycle before the appropriate response is determined . this scheme allows for multiple - pad detection . for example , if only one hand is touched , the doll may say “ i love to hold hands with mommy ”, but if both hands are held , the doll may react differently , for example , by singing “ ring around the rosie ”. block 102 checks to see if all of the pads have been read , and if not , the next pad is selected in block 108 and the reading process is repeated . if at block 102 , it is determined that all pads have been read , then block 104 resets the multiplexer to the first pad . block 106 takes into consideration which pad or combination of pads were marked as ‘ touched ’, and triggers the appropriate response . in summary , the subject invention has sensing areas that can detect when human skin is in close proximity . all sensing areas are inside of a toy , where it is visually and tactilely undetectable by the user . moreover , the software algorithm self - calibrates all of the sensing areas each time it is turned on , so the absolute capacitance of a given sensing area , its cabling , and detection circuitry are irrelevant . moreover , the sensitivity of each area can be set separately . while the subject system has been described in connection with its use within a doll , it will be appreciated that the subject system is useful anywhere that proximity sensing is required . it will be noted that the system may be activated by a person &# 39 ; s finger or other body part which is spaced from the actual sensor itself . this makes burying of the sensors for whatever reason practical so that a covering or other layer of material may be interposed between the sensor and the body part doing the activation of the system . having now described a few embodiments of the invention , and some modifications and variations thereto , it should be apparent to those skilled in the art that the foregoing is merely illustrative and not limiting , having been presented by the way of example only . numerous modifications and other embodiments are within the scope of one of ordinary skill in the art and are contemplated as falling within the scope of the invention as limited only by the appended claims and equivalents thereto . | 7 |
in accordance with the process of the present invention , the direct photolysis process for depositing an oxide layer is conducted as generally described in u . s . pat . no . 4 , 371 , 587 , the details of which are incorporated herein by reference . the selected vapor phase reactant contains the element for which the oxide is desired as the final product . such vapor phase reactants include , for example , silane , trimethyl aluminum , trimethyl gallium , germane , diborane , trimethyl indium , titanium tetrachloride , tungsten hexafluoride , hafnium hydride , dimethyl zinc , zirconium acetylacetonate , tetraethyl lead , tetramethyl tin , tin chloride , and dimethyl cadmium . the substrate may be , for example , a semiconductor wafer such as silicon or mercury cadmium telluride , a glass or plastic lens , a metal layer in a multilayer semiconductor device , a mirrored surface , or a solar cell . in the direct photolysis method as practiced in the art and previously described herein , the oxygen - containing precursor comprises either pure nitrous oxide or a mixture of oxygen in nitrogen . pure nitrous oxide offers the advantage of controllability , but has the disadvantage of a very low deposition rate . a mixture of about 10 percent oxygen in nitrogen diluent gas provides a faster deposition rate than nitrous oxide . however , molecular oxygen is so reactive with metal precursors , such as sih 4 or al ( ch 3 ) 3 , that a spontaneous thermal reaction can occur in the reaction chamber or associated tubing and can cause serious problems such as uncontrollability , unwanted powder formation , and degradation of the reaction equipment . in accordance with the present invention , we have discovered that by using a mixture of a relatively small quantity of oxygen in nitrous oxide as the oxygen - containing precursor , unexpectedly high oxide deposition rates can be achieved . these deposition rates are much higher than those to be expected from the separate use of either partial pressure component of the precursor gas mixture , namely , oxygen or nitrous oxide alone . the direct dissociation of nitrous oxide and of oxygen by 1849 angstrom radiation is shown in reactions ( 1 &# 39 ;) and ( 2 &# 39 ;) below . while 1849 å radiation is indicated , any radiation within the range of 1750 to 1950 å is sufficient to produce the required direct dissociation , as previously discussed herein . the ground state , triplet - p oxygen atom , indicated as o ( 3 p ), is much more reactive with the vapor phase reactant for oxide thin film deposition than the excited state , singlet - d oxygen atom , indicated as o ( 1 d ), since the former undergoes an oxidative termination reaction of the type required to oxidize the vapor phase reactant , while the latter undergoes a chemical bond insertion reaction in which the oxygen is inserted between two bonded atoms . in addition , o ( 3 p ) has a longer lifetime than o ( 1 d ). moreover , it is known that o ( 1 d ) is converted to o ( 3 p ) by third body collision ( m ), such as a wall or another gaseous species , e . g ., n 2 , as indicated in reaction ( 4 ). the latter reaction further limits the availability of o ( 1 d ) for reaction . ## str1 ## thus , the main reaction for oxide formation in accordance with the present invention uses o ( 3 p ), as shown in reaction ( 5 ). the overall reaction for the process of the present invention is as shown in reaction ( 6 ). ## str2 ## even though the photodissociation of o 2 alone yields ground state atoms in reaction ( 2 ) above , complications can occur from a series of reactions including : ozone formation in reaction ( 7 ); ozone photodissociation in reaction ( 8 ); excited molecular oxygen formation in reactions ( 8 ) and ( 9 ); and excited molecular oxygen reactions with ozone in reactions ( 10 ) and ( 11 ), below . ## str3 ## o 2 ( 1 δ g ) and o 2 ( 1 σ g + ) indicate neutral oxygen molecules in excited singlet states . the potential energy curves for these various states of the oxygen molecule are presented by calvert and pitts , in the book entitled &# 34 ; photochemistry ,&# 34 ; john wiley and sons , new york , 1966 , at page 180 . while not limiting the present invention to a particular theory of operation , it is believed that the enhanced deposition rate is achieved as the result of synergistic oxygen photochemistry which could involve several possible paths for producing ground state oxygen atoms from excited state atoms more efficiently than previously achieved . to explain the observed enhancement mechanism , it is hypothesized that the synergistic reactants are species that do not normally come in contact with each other during n 2 o photolysis as in reactions ( 1 ) and ( 4 ) or during o 2 photolysis as in reactions ( 2 ) and ( 7 ) through ( 11 ). for example , interactions between excited oxygen atoms and oxygen molecules are possible that may lead to more efficient production of ground state oxygen atoms . two possible mechanistic paths for such interactions are illustrated below . mechanism 1 involves physical quenching of o ( 1 d ) to o ( 3 p ) by molecular oxygen , as shown in reaction ( 12a ) or ( 12b ) below ; and mechanism 2 involves chemical quenching of o ( 1 d ) by o 2 to form ozone , as shown in reaction ( 13 ) below and subsequent photolysis of ozone to form o ( 3 p ) as shown in reaction ( 8 ). ## str4 ## since the absorption characteristics of o 3 for the formation of ground state atomic oxygen are broader and stronger than those for either n 2 o or o 2 , reactions ( 13 ) and ( 8 ) may play important synergistic roles in the observed enhancement . in addition , since reaction ( 11 ) is known to occur at a very fast rate , this particular step may play an important synergistic role in the observed enhancement . either mechanism 1 or mechanism 2 may account for the enhanced production of o ( 3 p ). however , in mechanism 1 , the physical quenching of o ( 1 d ) by o 2 , under certain conditions , is known to be equal to or less than physical quenching with molecular nitrogen which is formed in reaction ( 1 ) in excess . therefore , the physical quenching pathway described in mechanism 1 is probably less significant than the chemical quenching pathway shown in mechanism 2 . mechanism 2 illustrates how o ( 1 d ) can be converted to the desired o ( 3 p ) in a more effective manner than the third body collision mechanism ordinarily encountered in the photolysis of n 2 o alone . the net effect of this synergistic oxygen photochemistry is to provide the desired oxidative species , i . e . o ( 3 p ), in larger quantities , more efficiently , and more practically than could be previously achieved and to thus provide substantially increased oxide deposition rates of practical utility . in addition , this enhancement of the desired oxidative species in accordance with the present process occurs independently of the particular vapor phase reactant , such as silane , trimethyl aluminum , etc ., used . thus , the present process may be applied to any of the vapor phase reactants previously discussed , to produce significant enhancement in the rate of oxide deposition . using the apparatus and process described in u . s . pat . no . 4 , 371 , 587 for the third embodiment therein , the process of the present invention was performed on a 3 - inch silicon wafer to deposit a layer of silicon dioxide . the silicon dioxide product was identified by its optical , physical , and chemical properties . a low pressure mercury vapor lamp was used as the source of 1849 å radiation . fig1 presents experimental data for the deposition rates at various operating pressures in practising the process of the present invention and in practising two prior art processes . the silane , oxygen , nitrous oxide , and nitrogen were each contained in a separate chamber with an associated control valve or flow meter by which the flow rate of the respective gases was controlled . the flow rate of silane was 2 standard cubic centimeters per minute ( sccm ); the flow rate was 100 sccm for the oxygen - containing mixture comprising oxygen and nitrous oxide for the present process or oxygen and nitrogen or nitrous oxide alone for the comparative prior art processes ; and the operating pressure in the reaction chamber was varied from 0 . 5 to 2 . 0 torr ( millimeters of mercury ) or about 60 to 270 pascals . in the process of the present invention , the oxygen and nitrous oxide may be introduced separately into the reaction chamber or they may be premixed in the desired proportion and then introduced into the reaction chamber . in fig1 solid lines form families of data with identical ratios of components in the oxygen - containing mixture . the data presented in fig1 are for the following compositions of the oxygen - containing precursor and are designated as such in fig1 : ( a ) 100 % n 2 ( control ) ( b ) 100 % n 2 o ( prior art ); ( c ) 1 % o 2 in n 2 ( prior art ); ( d ) 10 % o 2 in n 2 ( prior art ); ( e ) 1 % o 2 in n 2 o in accordance with the present invention ; and ( f ) 10 % o 2 in n 2 o in accordance with the present invention . as indicated by the data of fig1 the greatest enhancement in deposition rate was achieved using mixtures of oxygen and nitrous oxide in accordance with the process of the present invention . fig2 presents experimental data for the rate of oxide deposition achieved using various oxygen - containing mixtures . the same flow rates as in fig1 were used and an operating pressure of 0 . 5 torr was used . the following compositions of the oxygen - containing precursor were used and are designated as such in fig2 : ( a ) a mixture of oxygen and nitrogen varying from 0 to 10 percent oxygen ( prior art ); ( b ) a mixture comprising oxygen and nitrous oxide varying from 0 to 10 percent oxygen in accordance with the present invention ; and ( c ) nitrous oxide alone as the oxidant ( prior art ). as can be seen from the data in fig2 the process of the present invention using a mixture of oxygen and nitrous oxide achieves a deposition rate of 1200 å / 30 minutes , which represents a 23 - fold increase as compared to the 50 å / 30 minutes deposition rate produced by nitrous oxide alone , and a 7 - fold rate increase as compared to the 170 å / 30 minutes deposition rate produced by a mixture of oxygen and nitrogen . such significantly increased deposition rates , which are clearly not due to a simple additive effect , are unexpected in view of the rates achieved by the closely related prior art processes using nitrous oxide alone or molecular oxygen alone as the oxygen - containing precursor . in relation to fig2 it should also be noted that 1 percent oxygen in nitrous oxide gives an enhancement of the deposition rate nearly as high as 10 percent oxygen in nitrous oxide , which suggests that enhancement becomes saturated as the oxygen / nitrous oxide ratio is increased . in practice , the amount of molecular oxygen incorporated in the mixture of nitrous oxide and oxygen used in the process of the present invention may be increased to 20 percent or even higher , with the practical upper limit for molecular oxygen being determined by the point at which the oxide starts to deposit in the form of a powder , rather than a specular film . this upper limit depends also , in part , on process parameters , such as operating pressure and silane flow rate . fig3 shows the variation in the oxide deposition rate in accordance with the process of the present invention as the silane flow rate is varied . the combined flow rate of oxygen and nitrous oxide was 100 sccm and the operating pressure in the reaction chamber was 0 . 5 torr . fig3 presents the data for the process of the present invention using an oxygen - containing mixture comprising : ( a ) 1 percent oxygen in nitrous oxide ; and ( b ) 20 percent oxygen in nitrous oxide . the refractive index of the silicon dioxide product was measured to be 1 . 46 . as can be seen by examining fig3 a mixture of 1 percent oxygen in nitrous oxide produces nearly as high an enhancement of the deposition rate as a mixture of 20 percent oxygen in nitrous oxide . in addition , the deposition rate is nearly linear with silane flow rate . fig3 indicates that a sufficient quantity of oxidizing species is present to react with essentially all of the silane and that the deposition rate is limited by the amount of silane available for deposition . thus , by increasing the amount of silane in the reactant gases , enhancement can be increased even more . this result suggests that a small oxygen / nitrous oxide ratio can be used with a higher silane flow rate to increase enhancement even more . in addition , it has been experimentally determined that the area of uniformity of the deposited layer can be increased at higher flow rates of the reactants and lower operating pressures . however , the ratio of the oxidant to silane must be maintained at about 50 : 1 or higher in order to produce silicon dioxide of the desired stoichiometry . as indicated by the data of fig1 - 3 previously discussed , in accordance with the process of the present invention , a deposition rate of silicon dioxide of about 1200 angstroms in 30 minutes at about 0 . 5 torr ( 60 pascals ) can be readily achieved without the formation of powder . it is recognized that deposition rates are dependent on equipment design . using conventional equipment and an operating pressure of 0 . 5 torr ( 60 pascals ), typical deposition rates of about 2 å / minute for the prior art nitrous oxide reactant and 5 - 10 å / minute for 10 percent oxygen in nitrogen are usually achieved . however , using the process of the present invention and the same conventional equipment , it is anticipated that deposition rates can be increased about twenty - fold to 100 to 200 å / minute . in addition , by the process of the present invention using o 2 / n 2 o mixtures , significantly higher deposition rates are obtained at 0 . 5 torr ( 60 pascals ) than for the known process using o 2 / n 2 mixtures while simultaneously avoiding powder formation which can be manifested at higher pressures , such as 1 . 0 to 2 . 0 torr ( 133 to 270 pascals ). thus , the process of the present invention provides a method for depositing a layer of an oxide material on a chosen substrate at practical deposition rates which are compatible with a production environment . in addition , the process of the present invention can be readily controlled by controlling the reactant gas flow rates , reaction chamber pressure , and radiation intensity . the prior art problem of the spontaneous reaction of the vapor phase reactant with molecular oxygen is avoided by the present process in which dilute oxygen mixtures are used . moreover , the process of the present invention avoids the use of mercury and the previously discussed problems associated therewith . in addition to avoiding the problems of possible mercury contamination , the process of the present invention is more controllable than a mercury - sensitized process in which surface evaporation depends on the prior history of the mercury , which cannot be readily controlled . having thus described exemplary embodiments of the present invention , it should be noted by those skilled in the art that the disclosures within are exemplary only and that various other alternatives , adaptations , and modifications may be made within the scope of the present invention . accordingly , the present invention is not limited to the deposition of a layer of silicon dioxide which was used merely as an example , but is intended to include the photochemical vapor deposition of other oxide materials , such as aluminum oxide , gallium oxide , germanium oxide , boron oxide , indium oxide , titanium dioxide , tungsten oxide , hafnium oxide , lead oxides , tin oxides , zinc oxide , zirconium oxide , tellurium oxide , and cadmium oxide . | 7 |
exemplary embodiments of this invention will be described in relation to clock adjustment . however , it should be appreciated , that in general , the systems and methods of this invention will work equally well for any type of communication system and any environment , can be used with the exchange of any type of data , and can adjust any type of clock . the exemplary systems and methods of this invention will also be described in relation to communication systems and associated communication hardware , software and communication channels and networks . however , to avoid unnecessarily obscuring the present invention , the following description well - known structures , network components and devices that may be shown in block diagram form , are well known or are otherwise summarized . for the purposes of explanation , numerous details are set forth in order to provide a thorough understanding of the present invention . it should be appreciated however that the present invention may be practiced in a variety of ways be on the specific details set forth herein . furthermore , while the exemplary embodiments illustrated herein show the various components of the system collocated , it is to be appreciated that the various components of the system can be located at distant portions of a distributed network , such as a communications network and / or the internet , or within a dedicated secure , unsecured and / or encrypted system . thus , it should be appreciated , that the components of the system can be combined into one or more devices , such as a receiving device , or collocated on a particular node of a distributed network , such as an analog and / or digital communications network , a circuit - switched network and / or a packet - switched network . as will be appreciated from the following description , and for reasons of computational efficiency , the components of the system can be arranged within a distributed network without affecting the operation of the system . for example , the various components can be located in a pbx , a receiving device , or some combination thereof . similarly , one or more functional portions of the system can be distributed between a communications device and , for example , an associated computing device . it should also be appreciated that the various links , including any communications channels and links 5 connecting the elements , can be wired or wireless links or any combination thereof , or any other known or later developed element ( s ) that is capable of supplying and / or communicating data to and from the connected elements . the term module used herein can refer to any known or later developed hardware , software , firmware , or combination thereof that is capable of performing the functionality associated with that element . the terms determine , calculate and compute , and variations thereof as used herein are used interchangeably and include any type of methodology , process , mathematical operation or technique . furthermore , it is to be noted that the term “ a ” or “ an ” entity refers to one or more of that entity . as such , the terms “ a ” or “ an ”, “ one or more ” and “ at least one ” can be used interchangeably herein . it is also to be noted that the terms “ comprising ,” “ including ” and “ having ” can be used interchangeably . also , while the flow charts are described in relation to a particular sequence of events , it should be appreciated that changes , additions and omissions to this sequence can occur without materially affecting the operation of the invention . fig1 illustrates an exemplary embodiment of a communications network 100 . the communications network 100 comprises a sending device 110 , a receiving device 120 , and one or more optional additional devices 130 , all interconnected by one or more networks 10 and links 5 . between the sending device 110 and the receiving device 120 there is an rtp stream 140 . additionally , each of the devices 110 , 120 and 130 can include well known componentry such as a buffer , processor , internal clock ( ic ), and the like . as discussed in relation to fig2 , each of the devices can also include , or be connected to , a clock management module 150 . as will be appreciated , a communication system 100 comprises other well - known components which will not be discussed here in detail . for example , the system 100 can include one or more telephony switch / media servers that can be of any architecture for directing communications to one or more communications devices . also , the network 10 can , and typically includes proxies , registers , switches and other routers that are well - known . the devices 110 , 120 and 130 can be any communication device or device with a clock that is suitable for interfacing to the network to which they are connected or for the purpose of managing the timing of received information . for example , the devices 110 , 120 and 130 can be wired or wireless phones , such as an ip hard phone , ip soft phones , personal digital assistants , personal computers , laptops , mobile phones , traditional pstn type phones , cellular phones , audio and / or video devices , multimedia devices , gaming consoles , etc ., or any combination thereof . a typical communication device can comprise a handset or headset in a cradle assembly . the cradle assembly can comprise a display , a known programmable or hard keypad and programmable or soft keypad . in operation , and using , for example , the rtp stream as the calibration source ensures a continual update of very accurate calibration information and also does not require any additional protocols to execute in the pursuit of the calibration or synchronization . large changes in jitter within an acceptable range such as 500 ms does not affect the accuracy of the clock calibration determination ensuring that the solution works equally well in a wan as in a lan or other type of communication network , and in fact , is not dependant upon network properties . an exemplary solution also handles periods of packet loss without loss of accuracy once the packet transmission resumes . in addition , the timing information can be generated by the appropriate clock , e . g ., the a / d converter or tdm clock rather than the processor clock , which may not actively control the rate in which samples are sourced or synced . exemplary embodiments also allow greater efficiency in terms of processor resources and utilization and are independent of network traffic . fig2 illustrates an example of the exchange of packets between the sending device 110 and the receiving device 120 , and how the internal clock at the receiving device is adjusted based on a deviation from a baseline . more specifically , the sending device 110 forwards a first packet to the receiving device 120 . the first packet is received by the receiving device 120 and a time stamp extracted . this time stamp is utilized to establish an initial baseline . packet 2 is then forwarded from the sending the device 110 to the receiving device 120 and the deviation from the baseline is determined with the cooperation of the clock management module 150 . a determination is then made if the delta is positive or negative . if the delta is negative , the baseline is updated by the negative amount . if the delta is positive , the smallest positive delta in the current window is stored . if there is no change , no action is taken . the next packet is then received , for example packet 3 , and further packets until the window period ( if utilized ) has elapsed . if the window period has elapsed , a determination is made if the smallest delta is greater than zero . if the smallest delta is greater than zero , the baseline is updated by the positive delta . the ratio of the baseline deviation to the elapsed time is then determined with the assistance of the clock management module 150 for deltas less than zero , zero , and greater than zero . then , the local clock at the receiving device 120 , for example , a digital pll , vco , the conversion rate , such as an a / d or d / a conversion rate , or the like , can be updated so as to calibrate the clock at the receiving device 120 to the clock of the sending device 110 . fig3 - 5 illustrate exemplary adjustments to a baseline over time . more specifically , fig3 illustrates a graph showing the relationship between drift time and elapsed time where the first packet determines the drift baseline , which is 0 . drift time for each subsequent packet ( if the drift is positive ) is measured for a window of x seconds with an update performed , for example , every second , however updates can be performed at any time interval . as illustrated in fig3 , the drift for subsequent packets is positive ranging from 2 to 12 . for negative drift , the updating can occur immediately . fig4 illustrates a graph of drift time verses elapsed time where the drift baseline has been dynamically shifted to the minimum drift time as now recorded in the previous “ window .” in this case , it would be six units of time . drift time for subsequent packets are again measured for a window of x seconds . if , as illustrated in fig5 , a packet arrives earlier than the baseline , the baseline can be immediately readjusted to the drift time of the packet . in this case , the baseline moves − 8 units from the previous baseline . the absolute baseline difference from the start of the measurement is now − 2 units . fig6 illustrates an exemplary method for adjusting a local clock according to this invention . iteratively this process can be generically summarized as : where “ this ” packet becomes “ prev_packet ” on the next iteration and “ this_packet ” is the latest received packet . control begins a step s 100 and continues to step s 110 . in step s 110 , a first packet is received . next , step s 120 , the time stamp from the received packet is extracted . then , in step s 130 , an initial baseline is established . control then continues to step s 140 . in step s 140 , the next packet is received , if there are more packets . next , in step s 150 , the deviation , or delta , from the baseline is determined . then , in step s 160 , a determination is made whether the delta is negative . if the delta is negative , control continues to step s 170 where the baseline is updated by the negative amount . if the delta is positive , smallest positive delta in the current window is recorded in step s 180 . if the delta is zero , no action is taken and no change needs to be made . control then continues to step s 190 . in step s 190 , a determination is made whether the window period has elapsed . if the window period has not elapsed , control jumps to step s 220 . otherwise , control continues to step s 200 . in step s 200 , a determination is made as to whether the smallest delta greater than zero . if the smallest delta is greater than zero , the baseline is updated by the positive delta in step s 210 . otherwise , control jumps to step s 220 . in step s 220 , a ratio of the baseline deviation to elapsed time is determined . control then continues to step s 230 where a local clock , such as a digital pll , vco , conversion rate , or the like , is updated . while the above - described flowcharts have been discussed in relation to a particular sequence of events , it should be appreciated that changes to this sequence can occur without materially effecting the operation of the invention . additionally , the exact sequence of events need not occur as set forth in the exemplary embodiments . the exemplary techniques illustrated herein are not limited to the specifically illustrated embodiments but can also be utilized with the other exemplary embodiments and each described feature is individually and separately claimable . the above - described system can be implemented on wired and / or wireless telecommunications devices , such a telephone , mobile phone , pda , a wired and / or wireless wide / local area network system , a satellite communication system , or the like , or on a separate programmed general purpose computer having a communications device ( s ) or in conjunction with any compatible communications protocol ( s ). additionally , the systems , methods and protocols of this invention can be implemented on a special purpose computer , a programmed microprocessor or microcontroller and peripheral integrated circuit element ( s ), an asic or other integrated circuit , a digital signal processor , a hard - wired electronic or logic circuit such as discrete element circuit , a programmable logic device such as pld , pla , fpga , pal , a communications device , such as a phone , any comparable means , or the like . in general , any device capable of implementing a state machine that is in turn capable of implementing the methodology illustrated herein can be used to implement the various communication methods , protocols and techniques according to this invention . furthermore , the disclosed methods may be readily implemented in software using object or object - oriented software development environments that provide portable source code that can be used on a variety of computer or workstation platforms . alternatively , the disclosed system may be implemented partially or fully in hardware using standard logic circuits or vlsi design . whether software or hardware is used to implement the systems in accordance with this invention is dependent on the speed and / or efficiency requirements of the system , the particular function , and the particular software or hardware systems or microprocessor or microcomputer systems being utilized . the communication systems , methods and protocols illustrated herein can be readily implemented in hardware and / or software using any known or later developed systems or structures , devices and / or software by those of ordinary skill in the applicable art from the functional description provided herein and with a general basic knowledge of the computer and telecommunications arts . moreover , the disclosed methods may be readily implemented in software that can be stored on a storage medium , executed on a programmed general - purpose computer with the cooperation of a controller and memory , a special purpose computer , a microprocessor , or the like . in these instances , the systems and methods of this invention can be implemented as program embedded on personal computer such as an applet , java ® or cgi script , as a resource residing on a server or computer workstation , as a routine embedded in a dedicated communication system or system component , or the like . the system can also be implemented by physically incorporating the system and / or method into a software and / or hardware system , such as the hardware and software systems of a communications device or system . it is therefore apparent that there has been provided , in accordance with the present invention , systems and methods for clock management . while this invention has been described in conjunction with a number of embodiments , it is evident that many alternatives , modifications and variations would be or are apparent to those of ordinary skill in the applicable arts . accordingly , it is intended to embrace all such alternatives , modifications , equivalents and variations that are within the spirit and scope of this invention . | 7 |
fig1 illustrates the alignment of fig2 a , 2b and 2c . fig2 a , 2b , and 2c illustrate a top plan view of the package loader 10 including an in - feed section 12 , product packing section 14 , carton assembly section 16 of fig4 a - 4b , carton gluing section 18 , and outflow conveyor section 20 . in - feed section 12 includes in - feed conveyor 22 which is moved by a drive system 24 , and a product sensor 26 . the in - feed conveyor 22 is preferably constructed to 7 . 5 &# 34 ; wide rexnord brand tabletop chains driven by a 1 horsepower drive motor and a one - way clutch . product 28 is transferred to the in - feed conveyor 22 by any type of prior art equipment desired by the user . guide rails 30a - 30n are mounted over an in - feed conveyor 22 to separate product 28 into the number of desired lanes . for example , when filling 24 - pack cases of cans , six lanes are used ; when filling 12 - packs of cans , four lanes are used . while the present invention is described in terms of a device for inserting cans into containers , the apparatus may be used by one skilled in the art by various other types of product . guide rails 30a - 30n are suspended from supports 32 , which include a threaded rod 34 mounted on side members 36 . guide rails 30a - 30n are affixed to the threaded rod 34 and separated by nuts mounted on the threads . a product sensor 26 best illustrated in fig7 and 8 , determines if product is missing from the stream or is dislodged from proper position . a pair of side supports 40 support a rod 42 extending transversely across in - feed conveyor 22 . a plurality of nylon detection fingers 44a - 44n are mounted in a rotatable manner on rod 42 . there is preferably one detection finger for each lane in the apparatus . a photo - eye transmitter 46 transmits normally to a photo - eye receiver 47 when the product 28 is in its proper position . the top of the product 28 holds fingers 44a - 44n in an elevated position . when no product 28 is present , one or more of the fingers 44a - 44n falls to the position such as shown in dotted lines in fig8 blocking photo - eye transmitter 46 transmission to the photo - eye receiver 47 . this would happen if there is a can missing on the conveyor , or the can has fallen down . when photo - eye receiver 47 senses product error , it signals the system control that there is a product error . photo - eye transmitter 46 and photo - eye receiver 47 are electronically connected to the system under control so that all detected errors are transmitted to allow the system controller to signal the users to take corrective action . guide rails 30a - 30n begin to angle outwardly in area 50 at preferably a 22 ° angle , or any other suitable angle , with respect to in - feed conveyor 22 . guide rails 30a - 30n in angled area 50 begin to separate the flow of product 28 into two diverging streams near the inboard end of in - feed conveyor 22 . a pair of mirror - image stationary guide decks 60 on either side of package loader 10 move product 28 from in - feed conveyor 22 further along the system . each guide deck 60 includes a first angled section 62 , straight section 64 and second inwardly angled section 66 . first angled section 62 is designed to mate at the preferable 22 ° angle , or any other suitable angle , against the side of in - feed conveyor 22 so that lane area 68 of guide deck 60 aligns with lanes of product guided by corresponding guide rails 30a - 30n of in - feed section 12 . therefore , product 28 moves down in - feed conveyor 22 , is guided at an angle in angled area 50 of guide rails 30a - 30n , and then is slid off in - feed conveyor 22 onto the fixed lane area 68 of guide deck 60 by the guide rails 30a - 30n . product 28 continues to flow through the guide deck 60 by the force of flow of successive product 28 coming off of in - feed conveyor 22 . in other words , in - feed conveyor 22 is an active conveyor , whereas guide deck 60 is a passive conveyor where cans are only moved by the pressure of the product stream . first and second separator bar conveyors 70 are mounted on opposite sides of package loader 10 outboard from in - feed conveyor 22 and guide deck 60 . the conveyors 70 has a drive system 72 , including a drive shaft 73 and another shaft 75 , which moves sets of bar mounts 74 through a range from area 50 where guide rails 30a - 30n start to diverge from conveyor 22 up to a point where product 28 is loaded . each pair of separator bar mounts 74 carries a separator bar 76 . the separator bars 76 are constructed of hard core aluminum and are mounted to the separator bar mounts 74 which in turn are mounted to two chains 78 which are moved by drive system 72 . separator bars 76 have an angled inner end 80 . as product 28 is moving generally from left to right in fig2 a - 2c , mirror image chains 78 are also moving separator bars 76 in a parallel path at generally the same speed . as shown in the figures , separator bars 76 extend inwardly from chains 78 . at the beginning of separator bar conveyor 70 , separator bars are in free air spaced apart from the stream of product 28 . as the separator bars 76 and product 28 move down the system , guide rails 30a - 30n begin to guide product 28 outwardly at a 22 ° angle . this is continued as guide deck 60 picks up product 28 and continues its outward diverging path . as the stream of product 28 diverges outwardly , the angled edge 80 of the separator bar 76 is inserted in product stream between successive product 28 . separator bars 76 are spaced on separator bar conveyor 70 to divide product 28 into sets as it progresses down guide deck 60 . in the example illustrated , product 28 is divided into sets of 12 . this means that 12 units of product 28 will be inserted into the container from each side , making a 24 - container case . in this manner , product 28 is divided into sets with a minimum of moving parts in separator bar conveyor 70 . no complex finger mechanism is needed to separate the product 28 . product 28 is separated into sets long before the loading process . this avoids the bottle neck of dual function separator bars . separation does not slow down the later product loading process . when 12 - packs are being filled , a second bar 81 is mounted against each separator bar 76 to adjust spacing as shown on the right side of fig2 b . when 24 - can cases are being filled , bars 81 are rendered . once separator bars 76 engage product 28 and divide the stream into sets of product 28 , the separator bars 76 move product 28 along through guide deck 60 so that product 28 is no longer propelled merely by the force of successive product in the stream . separator bars 76 move product 28 along guide deck 60 into second angled section 66 which diverges inwardly preferably at a 22 ° angle . second and third product sensors 82 and 84 sense whether any product is missing or have fallen in guide deck 60 . product sensors 82 and 84 are constructed in the manner as product sensor 26 , and are electrically connected to system controller in the same manner for signaling a product placement error . a central conveyor 90 is the focus of loading operations . control conveyor 90 has a first end at a point where guide deck 60 has diverged , so that central split loading conveyor 90 , with mirror image like halves , comes up in the middle of package loader 10 between the two guide decks 60 . the central loading conveyor 90 is moved by drive system 92 and like opposing chains 93 and carries carton flight bars 94 . flight bars 94 run along a central flight guide 95 and are illustrated having a fixed portion 96 and a removable portion 98 . the spacing between flight bars 94 is adjusted by removing removable portion 98 , such as for 24 - can product operation , and replacing it with a different width portion . alternatively , removable portion 98 may be left out , such as for 12 - pack product packaging . opposing finger members 99 extend vertically from the flight member 44 to assist a package carton along the central loading conveyor 40 . central loading conveyor 90 is synchronized in timing with the separator bar conveyor 70 . carton flight bars 94 are positioned generally the same distance apart as separator bars 76 , and are timed so that they match one - for - one with each said separator bar 76 . the outboard end 100 of each flight bar 94 is shaped to generally mate with the angled end 80 of separator bar 76 . the shape of end 100 is not important in that it does not engage product 28 , but it should be shaped to generally mate with angled end 80 either by forming an angle or a step so that there is no large gap between flight bar 94 and separator bar 76 . carton assembly section 16 illustrated in fig4 a - 4b includes a hopper 102 and a rotary placer 104 . here cartons are placed on the conveyor 90 between successive flight bars 94 and positioned across from adjacent separator bars 76 in oncoming product 28 in the lane area 68 for subsequent loading . cartons are loaded into the hopper in horizontal position with the manufacturer &# 39 ; s joint in the carton down and trailing . the cartons are urged into the hopper 102 by three powered belts . a vibrator on the incline hopper assists in feeding the cartons to the front of the hopper . hold back clips hold the cartons in the pick position , while allowing clearance of the cartons as they are pulled from the hopper by vacuum cups on rotary placer 104 . rotary placer 104 has four heads . each rotary head has a vacuum cup shaft on which two vacuum cup stems are mounted . the rotary head is gear driven in a planetary motion around horizontal drive shaft . the horizontal drive shaft rotates 120 ° from the hopper to the placement position . during each revolution of the horizontal drive shaft , the vacuum cup shafts each rotate three times . when the vacuum cups contact the front carton in the hopper 102 , the vacuum pressure in the cups attaches the carton to the cups . when the vacuum cups are rotated to the place position , the vacuum cup extends straight up and down and the carton is inserted between a pair of successive carton flight bars 94 . at this place position , the vacuum cup is vented to atmosphere and the carton is released to be held by flight bars 94 . at this point , the carton is in the open position where its cross section is rectangular , and is ready to receive product 28 . in operation , as central loading conveyor 90 is moving flight bars 94 down the center of package loader 10 , product 28 is being moved down guide deck 60 by separator bars 76 . product 28 in the straight section 64 of guide deck 60 has diverged out of the center of package loader 10 , and one of the flight bars 94 comes up from below the system on the central loading conveyor 90 and mates against the two opposing separator bars 76 . from this point , the unified combination of flight bar 94 and the two opposing separator bars 76 moves together through product packing section 14 of package loader 10 . when each guide deck 60 begins to converge again towards the center of package loader 10 through second angled sections 66 , product 28 follows the plurality of lane area 68 of guide deck 60 onto central loading conveyor 90 . as angled section 66 nears central loading conveyor 90 , product 28 is urged onto conveyor 90 by bars 76 . a product 28 enters conveyor 90 it begins to be engaged by flight bars 94 . as angled section 66 converges with conveyor 90 , flight bars 76 loose contact with product stream 28 and return under the system back again to the beginning of separator bar conveyor 70 . once the opposing flight bars 76 are disengaged from the stream of product 28 , product 28 is guided into centrally located cartons 106 as the angled sections 66 merge with central loading conveyor 90 . a set of parallel hold down bars 91a - 91b secure to a plurality of pneumatically adjustable plates 93a - 93n , suspend longitudinally over and above the top of carton 106 , and extend to the area of the compression belts 116 . a set of parallel opposing longitudinal upper flap guides 97a - 97b hold the upper carton flaps in a horizontal or above horizontal position so that product can be loaded into the interior of the cartons 106 . this technique allows a rapid stream of transfer of product 28 . for example , an embodiment loading 12 the present invention , is capable of loading 2 , 400 cans per minute . the smooth operation of externally intruding separator bars 76 and carton holding flight bars 94 allows for fast movement of product 28 . after leaving product packing section 14 , the carton 106 , filled with product 28 , enters carton loading section 18 . a can seating wheel 110 on either side of central loading conveyor 90 assist in final loading of the product 28 in the carton 106 . there are cutouts or recesses on the can seating wheels 110 to clear the leading and trailing carton flaps during this sealing process , whereby the can seating wheels 110 contact product 28 without disturbing the flaps . rotary tucker wheels 112 are mounted on vertical shafts to rotate relative to the central conveyor . the leading carton flap is plowed closed by a recess on the can seating wheel 110 , and then the rotary tucker wheels 112 close the trailing flaps . plows 101a and 101b hold both leading and trailing flaps closed as the carton 106 moves down stream . upper and lower flap plows 103a - 103b and 105a - 105b are positioned down stream of the rotary tucker wheels 112 to close the upper and lower flaps . opposing plows 103a - 103b firstly maneuver the bottom flaps upwardly , and secondly the opposing plows 105a - 105b maneuver the top flaps downwardly over the bottom flaps . the mirror image can seating wheels 110 include a plurality of can seating cams 111a - 111n for final positioning of the product cans within the carton 106 from both ends of the carton 106 . a plurality of recesses 113a - 113n and 114a - 114n flanking the can seating cams 111a - 111n serve to hold the dust flaps open and away from the sides of the carton ends so that the can seating cams 111a - 111n may have unrestricted access to the carton ends . recess closes the leading edge dust flap . opposing rotary tucker wheels 112 turn five times the rate of the can seating wheels 110 , and include a recess 115 for closure of the trailing edge flap . compression belts 116 then engage the closed carton 106 . the compression belts 116 transfer cartons 106 to a plurality of discharge flights 118 mounted on outflow conveyor section 20 . the discharge flights 118 include a plurality of like opposing vertically oriented finger members 119 . the outflow conveyor section 20 , including conveyor belts 20a and 20b , is an active conveyor which is moved by drive system 120 to move cartons 106 out of package loader 10 . like other flight bars in the package loader 10 , discharge flights 118 are constructed of hard coated aluminum . the spacing between discharge flights 118 is adjustable in a similar fashion to carton flight bars 94 . only a small number of discharge , flights are illustrated for purposes of brevity and clarity of illustration . the conveyor belts 20a and 20b and discharge flights 118 carry the carton 106 containing product to the right so that opposing plows 107a and 107b engage and turn the upper flaps horizontal . hot opposing nordson glue systems 122a and 122b then apply hot glue to the lower flaps after which opposing plows 123a - 123b position the upper flaps downwardly over the lower flaps . the lower portion of the carton 106 is also guided by opposing formed guide bars 130a and 130b . the upper portion of the carton 106 is guided by opposing formed upper guide bars 132a and 132b . the carton 106 engages the upper and lower guide bars 130a - 130b and 132a - 132b to form the carton upper and lower flaps about the beveled product can top and bottom edges , thus positioning the upper and lower flaps in their most advantageous position for tight packaging about the product as illustrated in fig1 . nordson glue systems 122a - 122b , or other similar hot melt glue systems , are used to glue flaps on cartons 106 in a manner known in the prior art . a compression station 124 having opposing longitudinal compression members of which sides 125a and 125b are illustrated , is down stream from the glue systems 122a and 122b to compress the flaps on carton 106 to make sure the glue sets . in the preferred embodiment , compression station 124 is 6 feet long . the apparatus constructed of the present invention greatly speeds up the product - loading techniques of the prior art . while the concept of converging product streams being loaded into a central carton is attempted in numerous prior art devices , none of them achieve the speeds and consistency of the present invention . the prior art techniques , where the central flight bar both separates cans into sets and holds the cartons , could not achieve these speeds . the prior art techniques of belt and finger methods to separate cans into sets are simply not fast enough or dependable enough to match today &# 39 ; s speed requirements . by having a conveyor with separator bars merging into product stream from the outside and then having cartons held by separate flight bars in the central conveyor , dependability and speed can be achieved . those skilled in the art may adapt the present invention to load any type of product which is suitable for conveyance by angled feed into containers . fig4 a and 4b illustrate a side plan view of the package loader 10 of fig2 a - 2c where all numerals correspond to those elements previously described . illustrated in particular is the hopper 102 and the rotary placer 104 . a plurality of clear panels 126a - 126n align about the upper portion of the package loader 10 above the bottom enclosure 128 . fig6 a and 6b illustrate a cross - sectional view along line 6 -- 6 of fig2 a - 2c where all numerals correspond to those elements previously described . fig7 illustrates a top view of the product sensor 26 where all numerals correspond to those elements previously described . fig8 illustrates a side view of the product sensor 26 where all numerals correspond to those elements previously described . fig9 illustrates a view along line 9 -- 9 of fig2 c where all numerals correspond to those elements previously described . illustrated in particular are the upper and lower formed guide bars 132a - 132b and 130a - 130b , respectively , which cause the major flaps of the carton 106 to be formed snugly over and about the beveled corner of the product cans as described in fig1 . fig1 illustrates a cross - sectional view of the formed guide bars 132a - 132b and 130a - 130b where all numerals correspond to those elements previously described . each of the formed guide bars include vertical and horizontal surfaces joined by a chamfered surface . for purposes of example and illustration the upper formed guide bar 132b has a horizontal guide surface 134 and a vertical guide surface 136 with an interceding chamfered guide surface 138 . similar surfaces are also used in the other formed guides 132a , 130a and 130b . the beveled surface 138 of each formed guide bar insures that the flaps are held tight against the upper and lower beveled edges 140 and 142 of a product can 144 to provide a tight &# 34 ; wrap &# 34 ; about the product cans 144 in the carton 106 . holding the upper flap tight against the upper beveled can edge 140 allows the bottom edge of the upper flap to be positioned further down on the carton side . in a like manner holding the lower flap tight against the lower beveled can edge 142 allows the upper edge of the lower flap to be positioned further up on the carton side . tight wrapping provides for a more secure package with improved integrity due to the fact that the product cans are more secure and less apt to cause carton or product damage as caused by shifting contents of loosely packaged items which can self - destruct from the inside out . appendix 1 is incorporated herein by reference as to the operation of the packaging system for packing patterns of cans into a cardboard carton , whereupon cans are firmly positioned with respect to each other and the flaps are forced together and glued as illustrated in fig1 . this packaging system operates at high packaging speed and provides a secure positioning of all the cans with respect to each other in the carton as illustrated in fig1 . various modifications can be made to the present invention without departing from the apparent scope hereof . ______________________________________10 package loader12 in - feed section14 product packaging section16 carton assembly section18 carton gluing section20 outflow conveyor section20a - b conveyor belts22 in - feed conveyor24 drive system26 product sensor28 product30a - n guide rails32 supports34 threaded rod36 side member38 side member40 side support42 rod44 fingers46 photo - eye transmitter47 photo - eye receiver48 sensor50 angle60 guide deck62 first angled section64 straight section66 second angled section68 lane area70 separator bar conveyors72 drive system73 shaft74 bar mounts75 shaft76 separator bars78 chains80 angled end81 separator bar82 product sensor84 product sensor90 central loading conveyor91a - b hold down bars92 drive system93 chains93a - n plates94 carton flight bars95 central flight guide96 fixed portion97a - b upper flap guides98 removable portion99 fingers100 end101a - b plows102 hopper103a - b plows104 rotary placer105a - b plows106 carton107a - b plows110 can seating wheel111a - n can seating cams112 rotary tucker wheel113a - n recesses114a - n recesses115 recess116 compression belts118 discharge flights119 finger members120 drive system122a - b nordson gluing system123a - b plows124 compression station124a - b compression station members125 longitudinal compression member126a - n clear panels128 bottom enclosure130a - b lower formed guide bars132a - b upper formed guide bars134 horizontal guide surface136 vertical guide surface138 chamfered guide surface140 beveled can edge142 beveled can edge144 product can______________________________________ | 1 |
a call monitoring and service system overriding system is provided in a communication environment that allows a system user (“ user ”) to monitor and , at the user &# 39 ; s option , connect to a call that has been forwarded to a remote service system . the remote service system may be , for example , a backup system such as a messaging system , an answering service , a third party &# 39 ; s phone and a unified messaging system . for simplicity of description , the term telephone system is used herein where the term communication environment could also be used . also , the term telephone line is used herein , where the term communication line could be otherwise used . the telephone line can be a line shared by telephone and data network access services , or can be another telephone line , or other lines , physically or logically separate . fig1 illustrates a communication environment , such as telephone system 100 . the telephone system 100 connects via telephone lines a calling party (“ caller ”) 110 to a called party , i . e ., a user 120 of monitoring and overriding service . a serving switch 130 connects a calling party telephone line 125 to the called party &# 39 ; s telephone line 123 to direct an incoming call from the caller 110 to the user 120 . when the user &# 39 ; s telephone is busy , the user does not otherwise answer the incoming call , or as set up by the user , the incoming call is forwarded to a remote service system 140 . telephony trunks capable of conveying caller and redirecting numbers , such as integrated services digital network ( isdn ) trunks , connect the serving switch 130 to the remote service system 140 . the remote service system 140 includes a message system , for example , voice - mail , and an answering service automatic call distribution system , such as when a call center agent answers the forwarded call and takes a message . other types of remote service systems 140 could also be used , such as , automatically sending the call to a third party &# 39 ; s phone , e . g ., a colleague &# 39 ; s phone , or sending the call to a unified messaging service . the unified messaging service is a service that allows for the storage and retrieval of message in various media formats and that , for example , converts an e - mail text message to a voice message or vice versa . to provide for the monitoring and service system overriding service without a screening function included in the serving switch , a bridge and control component 150 is added to the remote service system 140 . the bridge and control component 150 determines if the called party of a given forwarded call has the monitoring and / or overriding service registered and activated . the bridge and control component 150 also alerts the user about the monitoring opportunity . the bridge and control component 150 bridges the user 120 into the monitoring session and can detect the user &# 39 ; s intention to override the service system . if the user 120 indicates a desire to override the service system , the bridge and control component 150 sets up two - way voice path between the caller and the user and requests the serving switch 130 to directly connect the caller 110 and user 120 . the user 120 can signal his or her election to override the forwarded call by , for example , pressing a telephone key or speaking into the telephone handset . fig2 shows an alternate communication environment , such as telephone system 200 , that also uses the call monitoring and overriding service of the preferred embodiments . the caller 110 connects to the user 120 via the telephone system 200 . telephone line 125 connects the caller 110 to the serving switch 130 and the serving switch 130 connects the caller 110 to the user 120 via the telephone line 123 . unlike the configuration shown in fig1 , the serving switch 130 is not directly connected to the remote service system 140 , but connects through a bridge and control subsystem 210 . the bridge and control subsystem 210 contains hardware , software , and data necessary to accomplish the monitoring and service system overriding functions of the forwarded call without modifying the original remote service system 140 . the bridge and control subsystem 210 functions similarly to the bridge and control component 150 in fig1 . fig3 shows a state diagram illustrating an application 300 that enables call monitoring and service system overriding functions according to the preferred embodiments . it should be noted that this diagram depicts a state machine for a single user handled by the monitoring and service overriding function , but the function can simultaneously handle multiple independent users . the application 300 includes a program or process that resides on software , firmware or hardware , or combinations thereof . the application preferably resides with the bridging and control function as a subsystem 210 or as a component 150 in the remote service system 140 . to utilize the monitoring and overriding service , the user 120 preferably registers via a registration procedure . the registration procedure records that the user desires the ability to monitor and override calls forwarded from their telephone line 123 . the user 120 preferably can also deregister from the monitoring and overriding service , and can activate or deactivate the service when registered . various mechanisms can be used to register with or deregister ( or activate or deactivate ) from the monitoring and overriding service , including the user manually registering or deregistering with the service using a telephone . other methods for registering and deregistering the user 120 could also be used , such as the user 120 using a world - wide web session to register with or deregister from the service . returning to fig3 , at state 310 , the application 300 resides in an idle state before a call is forwarded to the remote service system 140 . at block 320 , the call arrives at the bridging and control subsystem 210 or component 150 with the condition that the called party is not registered as a monitoring service user 120 or the user has deactivated the monitoring service . in this case the service system interacts with the caller 110 normally , and the monitoring and overriding service is not invoked . the application 300 remains at the idle state ( state 310 ). in a preferred embodiment , to determine whether the called party is registered with the service and the service is activated , call - processing logic located at the bridging and control subsystem 210 or component 150 determines the called party &# 39 ; s telephone number . for example , the call - processing logic can recognize a redirecting number in a call - setup - signaling message , which is the called party &# 39 ; s telephone number . thereafter , the called party &# 39 ; s telephone number is compared with active registered users &# 39 ; telephone numbers to determine whether the called party is registered for the monitoring and overriding service . at block 330 , a call arrives at the bridging and control subsystem 210 or the remote service system 140 and the called party is a registered and active user 120 . the application 300 initiates a second call to the user &# 39 ; s telephone line 123 and connects the second call with the caller 110 via a one - way voice path . the one - way voice path allows the voice of the caller 110 to be audible to the user 120 without making the user &# 39 ; s voice audible to the caller 110 . the user 120 can be notified of the second call with a distinct ring as directed by the application 300 and provided by the serving switch 130 . if the telephone line of user 120 is equipped with a caller identification ( id ) device , the calling party &# 39 ; s telephone information may appear as provided by the bridging and control subsystem 210 or component 150 . at state 335 , the application 300 waits for a user interaction or for a timeout to occur while the caller 110 leaves a message with the remote service system 140 and the second call is being sent to the user 120 . at block 340 , when the user 120 fails to answer the second call before a determined time out period elapses or the caller 110 disconnects from the call , the application terminates the one - way voice path connection with the caller 110 and returns to the idle state ( state 310 ). at block 350 , the user 120 answers the second call upon receipt of the second call . thereafter , the user 120 can listen to the forwarded call , e . g ., the interaction between the caller 110 and the remote service system 140 via the one - way voice path . the voice path can be implemented by the bridge and control subsystem 210 or the bridge and control component 150 . those skilled in the art with appreciate that that voice path can be implemented in other ways , such as with digital signaling processing and packet voice transmission and processing . at state 355 , the application 300 waits while the user 120 monitors the caller &# 39 ; s call to the remote answering service 140 . upon listening to the caller 110 , the user 120 can elect to override the forwarded call or disconnect from the call . at block 360 , if the user 120 disconnects from the forwarded call or the caller interaction with the remote service system 140 ends , the application 300 terminates the one - way voice path and enters the idle state ( state 310 ). at block 370 , the user 120 elects to override the forwarded call . the user 120 can signal his or her election to override the forwarded call by , for example , pressing a telephone key or speaking into the telephone handset . the user may speak a command into the telephone handset or merely say anything , depending on how the application 300 is set up . the application 300 , upon detecting the pressed key or the user &# 39 ; s voice , provides a two - way voice path between the user 120 and the caller 110 . the application 300 also preferably detaches the caller 110 from the remote service system 140 , for example , the recording or attendant leg of the forwarded call . the bridge and control subsystem 210 or component 150 can request the serving switch 130 to bridge out the forwarded call and connect the caller 110 directly with the user 120 . at block 375 , the application 300 waits for the serving switch 130 to bridge out . at block 380 , when the serving switch 130 bridges out the forwarded call and connects the caller 110 directly with the user 120 , the application 300 can return to the idle state ( state 310 ). the application 300 also returns to the idle state ( state 310 ) if the caller 110 or the user 120 disconnects from the call before the bridging out occurs . while the invention has been described above by reference to various embodiments , it will be understood that many changes and modifications can be made without departing from the scope of the invention . it is therefore intended that the foregoing detailed description be understood as an illustration of the presently preferred embodiments of the invention , and not as a definition of the invention . it is only the following claims , including all equivalents , which are intended to define the scope of this invention . | 7 |
referring to the drawings and more particularly to fig1 and 2 , the apparatus there shown is generally identified by the numeral 10 . it depicts a machine for making and folding reinforced flat bottom bags , such as bags of the type substantially as disclosed in u . s . letters pat . no . 3 , 970 , 241 . the apparatus or machine 10 for making and folding flat bottom bags requires a relatively small floor area because it is disposed generally vertically , extending upwardly from a base 12 . the frame of the apparatus 10 includes a pair of front corner posts 13 , corner posts 14 intermediate cross - bars 15 , header beams 16 . integral with the header beam 16 are a pair of pillow blocks 17 providing a journal for a rod 18 on which is a freely rotatably held supply roll of heat sealable material 19 from which the flat bottom bags are to be formed . the supply roll of bag forming material 19 is substantially continuous in length and may be supplied in the form of a closed sleeve . it is not unusual for manufactures of such rolls of closed sleeve plastic material to supply the same with flat faces and inwardly gussetted sides as seen in fig2 . hence , it is possible to utilize a supply of material 19 that has a sleeve shape and that may or may not be pregussetted to eliminate the need to form such gussets at a later time in the present bag forming machine 10 . the supply roll of bag forming material 19 may be of a heat sealable plastic material . although it is not necessary that the sides or faces of the machine or apparatus 10 need be denominated as such , it is convenient for purposes of description that the space between the front posts 13 be denominated as the front and that the space between the rear posts 14 be referred to as the rear , while the front to rear spaces between the posts 13 and 14 on each side be referred to as the sides left and right , respectively as seen in fig1 . mounted , also on the header beams 16 , is a second pair of pillow blocks 20 in which is journalled an idler roll rod 21 . preferably , the roller rod 21 is located slightly to the rear of the center line between the front and rear posts 13 and 14 respectively , so that the bag supply material 19 can roll therein and depend vertically therefrom . in this manner , the bag forming material 19 can be made to freely pass sleeve - like over a bag forming assembly generally depicted by the numeral 22 , wherein , in a cyclic and continuous manner , the material is pulled down , its leading section formed into a flat bottomed bag , sealed and removed . the bag forming assembly 22 as seen more fully in fig2 comprises an upper mandrel generally depicted by the numeral 23 adapted to guide and at the same time pre - open and shape the tubular supply of bag material 19 , and a lower mandrel generally depicted by the numeral 24 which is caused to move between a raised inoperative position and a lowered operative position in which the bottom of the completed bag is formed . the upper and lower mandrel sections are mounted on opposite sides of a central post 25 , the upper mandrel section 23 being non - movable , while the lower mandrel section 24 is raiseable and lowerable as will be seen hereinafter . the upper mandrel section 23 as seen in fig2 and 3 includes a pair of flat plates 26 hinged to the center post 25 , generally parallel to the central plane of the vertically depending bag material 19 . the plates 26 are slightly sprung outward along their lower edges to cause the bag material to correspondingly spread out . mounted in the plane of the vertically depending bag material 19 to either side of the material are a pair of gusset plates 27 adapted to enter into the gussets of the bag and thus stabilize the bag material as the flat plates 26 spring the material outward . the lower mandrel section comprises a sleeve 28 slidably mounted over the central post 25 . fixed on the sleeve 28 is a collar 29 against which a pair of lateral extending arms 30 hinged at their upper end 31 movably slide . at the lowered end of each of the arms 29 there is pivotably mounted a rectangular plate 32 . as the collar 29 is caused to be raised or lowered relative to the center post 25 by movement , the arms 30 cause the plates 32 to move between a vertical inoperative position shown in dotted lines , the horizontal operative position shown in full lines and extending perpendicular to the plane of the drawing paper ( fig3 a ) by which it fully stretches the bag outward transverse to its width to form the partial completely flat bottom . serving to raise and lower movable section 24 of the mandrel and simultaneous pull or draw down the bag forming material 19 are an upper roller system , generally depicted by the numeral 33 and a lower roller system generally depicted by the numeral 34 . each roller set 33 and 34 comprises two pairs of inner rollers 35 and a pair of outer rollers 36 so that the flat sides of the bag material 19 is capable of being threaded therebetween as seen in the fig2 and 3c so as to be firmly held for the bag forming process yet being capable of being pulled down through the upper roller set 33 by the lower roller set 34 . as seen in fig1 and 2 , the rollers 35 and 36 of the upper roller set 33 are journalled on a transverse carriage 37 slideably guided over a pair of vertical rods 38 respectively fixed fixed between the base 12 and header beam 16 on the left and right side of the apparatus . the carriage 37 is fixed at each of its ends on a piston rod 39 actuable by a hydraulic or pneumatic cylinder 40 . the transverse carriage 37 is adapted to be raised and lowered by the hydraulic ( or pneumatic ) cylinder 40 fixed at one end on the base 12 . the piston rod 39 is secured by a bolt 41 to the carriage 37 . although two such piston cylinder arrangements are shown , only one may be really essential and thus used . the lower roller set 34 is connected to the carriage 37 for relative movement therewith , by a second set of hydraulic ( pneumatic ) cylinders 42 and extending piston rods 43 . the piston rods 43 are each fixed to a box journal 44 to which only the outer rollers 36 of the lower roller set 34 are journalled . the inner set of rollers 35 are fixed to the sleeve 28 , to be conjointly moveable along the post 25 . it will thus be apparent that the entire lower section of the mandrel assembly 24 including the upper rollers 33 and the lower rollers 34 is movable by actuation of the cylinders 39 while the lower roller section 34 is movable relative to the upper roller section 33 by independent actution of the cylinders 42 . operation of the cylinder 40 and 42 in timed cylindrical sequence can be readily effected by known techniques combining suitable connection to a source of hydraulic or pneumatic fluid from the source to the cylinders and in return , as well as timers , relays and the like , to effect the necessary sequence . such known techniques may be conventionally adopted here . by lowering the entire mandrel assembly 24 , the roller sets 33 and 34 pull down the bag material 19 from the supply roll . the degree of pull - down can be varied by modifying the piston strokes of actuator 40 and 42 and , thus , the ultimate size of the bag determined . further , by separate and independent lowering of the lower roller assembly 24 , the sleeve 28 on which the collar 29 is fixed , will cause the hinged arms 30 and plate 32 shown in fig3 to flair outwardly into the horizontal position to thereby open the bag material and initiate the formation the flat bottom . located at a position below the lower mandrel assembly 24 and above the extreme position wherein the mandrel mechanism may be lowered by actuation of both cylinders 40 and 42 is a heat sealer and cutter mechanism 50 . prior to the flairing of the bag by operation of cylinders 40 and 42 and the mechanism shown in fig3 this sealer and cutter mechanism 50 is caused to be operated to form as seen in fig4 a and 4b , a transverse seal 51 in the bag material 19 and to cut any preceding excess material or precedingly formed bag from the supply material . the transverse seam 51 thus closes the supply material 19 just below the plates 32 prior to forming the flat bottom , so that upon further movement of the lower roller assembly 24 , the plates 32 push against the closed bottom . it is this closure of the bag material that , in fact , the cylinders 40 and 42 are sequentially operated . because the bag is thus sealed , the plates 32 of the movable mandrel section causes the material not only to flair but also to move further downwardly . spaced below the sealer cutter assembly 50 by a distance equal to the distance of the ultimate bag height is a platform 52 against which the flaired mandrel plates 32 push the closed end of the bag material , producing folded portions 51a . as the bag material , already sealed along seam 51 , is pushed by the extending plates 32 against the platform 52 , the sealed end is folded over against the platform 52 as seen in fig1 . the reinforced flat bottom of the bag is then completed as shown in fig4 b . the platform 52 , as seen more clearly in fig1 and 19 , is provided with a pair of electrical heating elements 53 , one on each side , extending transversely to the closing seal 51 . the electrical heating elements 53 are mounted on the end of a piston / cylinder 53a and is moveable up into engagement with the folded bottom to further tack the folded portions 51a of the flat bottom together with a pair of side seam 54 . simultaneously , a pair of gusset retention members 55 , pivotably mounted adjacent the platform 52 , move inwardly into the gusset , causing the gusset flap 54a to fold inwardly , to be sealed also by seam 54 to the reinforced bottom of the bag ( fig4 ). in this manner , the bag is completed . immediately thereafter , the completed bag is released at its upper end from the material supply 19 by activation of the sealer / cutter mechanism 50 , which not only severs the bag which has been completed , but simultaneously forms the closure seal 51 for the next succeeding bag . the completed bag b is removed from the platform 52 by an ejector assembly generally depicted by numeral 56 shown in fig1 and in detail in fig1 , comprising two pair of articulated arms 57 and 57a pivoted at their upper ends 58 to a header beam 16 and depending downward at the rear of the frame . the ejector assembly 56 is provided with a frame 59 having a pivotable bottom plate 59a extending forwardly and adapted to enter below the flat bottom bag remaining on the platform 52 , and an upper plate 60 pivotally mounted on the frame 59 which closes jaw - like over on the flat bottom plate 59a . the completed bag bottom lying flat against the plate 52 is thereby capable of being grasped between plates 59a and 60 which thus flattens due to the action of the plates 59a and 60 . rubber gripping bumpers are located on the upper plate 60 to insure holding of the bag . the plates 59a and 60 are pivoted by operation of hydraulic or pneumatic actuators 59b and 60b respectively . the arms 57 are then swung outwardly from the machine frame carrying with it the bag , which then slides in the direction of the arrow between the plate 52 and a roller 61 ( fig1 ) to flatten itself as it is withdrawn . the plates 59a and 60 are then opened allowing bag to be then stacked one on top of the other on a pallet p to the rear of the frame . because the arms 57 and 57a , the frame 59 and the header 16 make an articulated quadrilateral , the frame 59 remains horizontal during its entire movement . the ejector assembly is actuated via vertical lever arm 62 extending from the upper end of the ejector arm 37 to the base 12 where it is provided as seen in fig1 with a cam follower c1 riding on a cam c rotatable by connection to a power transmission shaft s connected to a motor m . the cam c also functions to operate several micro switches capable of regulating the function of the solenoids and valves operating the actuators 59b and 60b respectively . the heat sealer and cutter mechanism 50 as seen in detail in fig5 and 6 comprises a back - up assembly 63 and a heater assembly 64 . both of these assemblies are mounted on side support rails 65 ( or cylindrical bars ) fastened to the machine frame so as to be easily slideable inwardly and outwardly relative to each other on either side of the plane of the bag material 19 ( see fig1 and 2 ). each of the back - up assembly 63 and heater assembly 64 are actuated by piston cylinder actuators 66 and 67 respectively , the cylinders being fixed to the frame of the housing on opposite sides of the machine frame . each of the cylinders are provided with a return spring 68 ( fig6 ) to insure immediate return of the associated piston upon release of the cylinder actuation . while each of the assemblies 63 and 64 are shown here with two actuators , it will be clear from the later description , that only one may be necessary . both the back - up assembly 63 and the heater assembly 64 are formed of rectalinear box - like hollow members . the back - up assembly 63 is provided with a hard rubber face 69 to dampen the shock when it meets and abuts the heater assembly 64 , and to resiliently squeeze the folded bag material together . the heater assembly 64 contains one or more heating elements 70 ( fig6 ) arranged along the length of the face thereof connected in a conventional manner through terminal 71 to a source of electrical current . preferably the heating elements 70 are mounted on or are constituted by elongated bar 72 . in any event , they are reciprocable perpendicularly to the plane of the face so that the elements may be moved into and out of engagement with the faces of the bag material , independent of the movement of the back - up member 63 or the heater assembly 64 as a whole . the heater elements 70 or the bar 72 as a whole , is moveable by hydraulic or pneumatic piston cylinder actuators 73 , the cylinder being mounted on the heater assembly 64 and the piston passing into and through the heater assembly 64 . passing through the heater assembly 64 from the rear toward the front , are a plurality of air lines 74 ( fig5 ) connected by a manifold ( not shown ) via one or more air lines 75 to a source of air , preferably under pressure , regulated by one or more valves 76 ( fig5 ). the air holes 74 communicate with vertical air holes 77 ( fig6 ) set back from the face of the heater assembly . the vertical air holes 77 are open at each end to the atmosphere . small bleeder holes 78 may also be made in the face . application of air into the heater assembly is made simultaneously with the heating operation , as well as before and after the elements are provided with current . in this manner , the face of the heater assembly is constantly cooled ; avoiding overheating , burning of the plastic bag material , sticking of the bag material to the heater assembly or the rubber back up pad , or burning of the rubber pad itself . as a result , the closing of the bag can be cycled at a very high rate . the forward thrust of the back - up member and the heater assembly is sensed by a limit switch 79 which also initiates the cycle return of the heater assembly etc . mounted below the forward edge of the heater assembly 64 is a cutter blade 80 having its sharp edge along its lower face . a counter blade 81 is similarly mounted below the forward edge of the back - up member 63 . the counter has its sharp edge on its upper face and is adapted to slide below the cutter blade 80 . thus , the plastic bag material can be simultaneously cut and severed from the plastic sheet roll together with the formation of the bottom seam 51 by action of movement of the back - up and heater assemblies 63 and 64 . a modified version of the heater and cutter mechanism is schematically shown in fig7 using the same reference numerals for similarly functioning elements . it this construction , the heater assembly 64 comprises a hollow rectilinear chamber 82 open at its forward face 83 , and having vertical bleed holes 78 in its upper wall only . the air is fed via a nozzle 84 directly into the chamber 82 . the heater elements 72 are mounted on a solid strip 85 which is actuated by the piston in cylinder 73 . fig8 illustrates schematically the sequence of five steps necessary to simultaneously heat , seal and sever the completed bag using either embodiment of the heater and cutter mechanism . step 1 shows the position of the back - up member 63 and the heating assembly 64 at rest . in step 2 , the back - up assembly 63 and the heating assembly 64 are moved into abuttment by operation of their actuators 66 and 67 thus clamping the plastic bag material firmly therebetween . thereafter , in step 3 , the actuator 73 is operated causing the heating element 72 to move forwardly and engage the plastic material , thus forming seam in step 4 , the heating element 72 is withdrawn followed by step 5 which returns the back - up assembly and heating assembly to the initial rest position , whereupon the plastic material can be pulled down as previously illustrated and described , to form the flat bottom of the sealed and formed bag and at the same time , present the next succeeding bag in placed for sealing . fig9 and 10 show the electric circuit and hydraulic / pneumatic circuits for accomplishing the steps as shown in fig8 in fig1 the drive motor and belt and cam transmission is illustrated . the cam c and separate micro switches following this cam , are arranged so as to provide for pull down cutting and heating as well as for control of the remaining elements of the machine . during operation the position of the heating and sealing assemblies are such that they are spaced from each other , allowing the bag material to be pulled down between them , and flaired by operation of the lower forming mandrel 24 which also passes within the back - up and heating assemblies 63 and 64 . once the bag bottom is flattened against the platform 52 and the side gusset fingers 55 engage the bag , and edge clamp means 55a ( fig2 ) engage the bag bottom , thus holding the bag firmly to allow the lower mandrel 24 and is plates 32 to be raised . once the lower mandrel is raised , the heater assembly is free to seal the next bag bottom and sever the bag on the platform 52 . the two heater cutter elements are then so moved toward each other so as to be in abuttment , and the power is turned on , the heater element and the selenoid valves operating the heating element are actuated , and maximum air is supplied to maintain the temperature of the heating element being regulated by the flow of the air through the air holes . thereafter , the forming assembly comprising the upper and lower mandrels , are actuated to create the succeeding bag . the high speed at which the heater apparatus works and the fact that the air flows over the heating strip negates the requirement to use teflon covers or other cover means for the back - up assembly . both the back - up and the heater assembly move toward the center . the plastic film is immediately cut by the cutting blades and held and squeezed generally between the two assemblies . when the heating element is brough into contact with the gussetted plastic film by the extension of the cylinder , this contact is a very short duration , and with the presure of the cooling air on deactivation of the cylinder , the sealing element is easily withdrawn from the plastic film and does not stick to it . in the modified apparatus shown in fig1 to 17 , like elements are depicted with the same numerals as heretofore and unless specified , function in the same way . differing from the earlier version , in that of fig1 , the material supply roll 18 is mounted on a roller 18 journalled at each end in a reawardly extending bracket arm 100 integral with the cross beam 15 . this permits easier loading of new rolls . the headers 16 extend pyramidally upward and the plastic material 19 passes over an idler roller 101 journalled on a vertical standard 102 integrally fixed to the headers 16 . the material passes downwardly over the bag forming apparatus 22 which in general , comprises the upper and lower mandrel assemblies 23 and 24 as described earlier . here , however , the roller sets 33 and 34 are mounted on associated carriage blocks 103 and 104 respectively , on each of the lateral sides of the machine . the lower blocks 104 holding roller sets 34 , slides reciprocally on a pair of vertical rods 105 and is actuated to move upwardly and downwardly through an articulated linkage 106 connected to the cam shaft mounted on the base 12 , being the cam shaft shown in fig1 . the upper cariage block 103 carrying the roller set 33 rests on the lower carriage block 104 , but is slightly off - set inwardly therefrom . in this manner , movement of the lower carriage block 104 conjointly moves the upper carriage block 103 . the necessary relative movement between the two roller sets 33 and 34 , required to permit the lower mandrel to pull down the plastic bag material , is effected by providing a vertical post 107 beneath the upper carriage block 103 . the post 107 is mounted on an adjustable arm 108 so that the upper end 109 of the post 107 can be located and given height to arrest the downward movement of the upper carriage block 103 at a predetermined point thereby permitting only the lower carriage block 104 to move further downwardly . another difference seen in fig1 , as well as in fig1 and 16 , is in the shape of the flairing plate of the lower mandrel assembly which is shown here as an elongated member 110 . turning to fig1 , additional detail is shown with regard to the platform 52 and the clamping members for holding the bag in place , allowing the lower mandrel assembly to be raised , before the ejector assembly removes the bag . here , a transversely extending arm 11 fixed at each end to a pivoted arm 112 , is mounted on the side of the platform 52 adjacent the ejector assembly 56 . the arm 112 is pivoted at its centre 113 and fixed to a horizontal strip 114 which is connected to a vertical rod riding on a cam connected to the drive cam c described earlier so that as the horizontal strip 114 is raised and lowered , arm 112 is swung toward or away from the platform 52 . the rod 111 is thus caused to clamp and release the bag bottom to the platform , functioning as the clamp 55a shown in fig2 which it can easily replace , if desired . on the opposite side of the platform , there is similarly mounted an elongated transverse roller 115 on a pair of end arms 116 articulately connected to follow another cam connected to the drive cam , in a conventional manner . the clamp arm 111 is held against the bag until such time as the ejector assembly 115 grasps the bag as previously described and pulls the bag causing the bag to fall on to the platform 52 being pulled beneath the clamp arm 111 . once this being to occur , the arm 111 raises slightly and the roller 115 is caused to swing onto the fallen bag exerting sufficient roller pressure to flatten the entire bag , as it is being pulled . once the bag is removed from the platform 52 , the arm 111 and roller 115 are withdrawn , preparing the platform for receipt of the next bag in the cycle . as seen also in fig1 , the gussett fingers 55 are articulately connected to a scissor - like linkage 117 operated also by connection to a cam so that it will , in the necessary timed sequence of operation , cause the tucking inward of the gusset and its hold down during formation of the side seams 54 prior to the removal of the lower mandrel 24 . each of modifications and elements shown in fig1 - 17 could be equally adopted and used in the embodiment of fig1 - 13 replacing or augmenting the similarly functioning elements . various modifications , changes , and embodiments have been disclosed , and others will be apparent to those skilled in the art . accordingly , it is intended that the disclosure be taken as illustrative and not limiting of the scope of the invention . | 1 |
the heat treatment apparatus illustrated in fig1 to 3 has a stand comprising a cruciform base 2 running on casters 1 and supporting a vertical tube 3 which is selectively longitudinally displaceable and axially rotatable . two side arms 5 at the upper end 4 of the stand tube 3 each carry a lateral infra - red radiator 6 . furthermore , the upper end 4 carries a substantially horizontally projecting support arm 7 to which two substantially downwardly radiating central infra - red radiators 9 are secured . the upper end 4 of the stand tube 3 is provided with a control desk 10 with a control panel 11 on the side remote from the infra - red radiators 6 , 9 . a handgrip 10a fastened to the desk 10 permits common vertical adjustment and rotation of the infra - red radiators 6 , 9 . the control desk 10 is connected to a temperature sensor 12 by a flexible lead 13 . fig1 shows a human head 14 with hair wound on curl rollers 15 in the radiation region of the radiators 6 , 9 , from which the treatment arrangement may be seen . one of the rollers 15 holds the temperature sensor 12 in contact with the strand of hair wound on it by means of a clip ( not shown ). for the purpose of adjusting the optimum head spacing between radiators 6 , 9 and the head 14 , the upper end 4 of the stand tube 3 carries an optical adjusting device for fixing the position of the head 14 ; it is formed by two adjacently disposed projector lamps 17 providing two intersecting optical beams whose axes 18 together form an angle , α , preferably of 24 ° to 35 °. the lamps 17 produce on the head 14 in the region of the hair line ( neck contour 27 ) a bright horizontal line 20 and a vertical line 21 , respectively , which with a correctly adjusted head spacing are each reproduced sharp and preferably form a cross 22 with equal limbs , as illustrated in fig9 . if the head spacing is wrong , the two lines 20 and 21 are located side by side , as additionally illustrated in dot - dash lines in fig9 . the lateral arms 5 are each connected to the upper end 4 of the stand tube 3 by means of a joint 19 rotatable about a vertical axis , so that in the rest position the arms 5 with the lateral radiators 6 are tilted towards one another into the centre , as illustrated in fig4 thus reducing the space occupied by the heat treatment apparatus when not in use . the construction of the infra - red radiators 6 , 9 may best be seen from fig3 and 5 . each radiator 6 or 9 comprises an elongate slightly curved tubular heating element 23 of quartz glass which is arranged in front of a reflector 24 . the open side of each radiator 6 , 9 is covered by a grid 25 operating as a protection against contact . fig5 clarifies the longitudinal curvature of the heating element 23 , which preferably has a radius of curvature r of 800 mm . the median axis 26 of each of the two lateral radiators 6 defines the respective main radiation direction . the median axes 26 of the two lateral radiators 6 preferably include between them an angle β of 108 °, the spacing s of the common intersection point m from the respective heating element 23 amounting to approximately half the radius of curvature r . the ratio between the length l of each heating element 23 and its respective radius of curvature r amounts to at least 0 . 4 , preferably 0 . 6 . it has been found that it is advantageous if the received power of an infra - red radiator amounts to 250 w , and the minimum distance d between each heating element 23 and the hair or -- when curl rollers are used -- each curl roller preferably amounts to 25 to 30 % of the prevailing radius of curvature r . the longitudinal axis of each lateral radiator 6 has a rise angle φ of approximately 10 ° to 12 ° relatively to the horizontal 29 , as indicated in fig1 . fig5 shows the optical beam axes 18 of the projector lamps 17 , the common intersection point of which lies in the region of the hair line on the neck contour 27 indicated in broken line . the geometry of the central infra - red radiators 9 illustrated in fig6 is analogous to the arrangement illustrated in fig5 of the lateral infra - red radiators 6 . the median axes 28 of the two central radiators 9 preferably include between them an angle γ of 68 . 5 °, the distance h of the common intersection point p from the respective tubular heating element 23 preferably amounting to approximately half the radius of curvature r . furthermore , the median axis 28 of the lower one of the central radiators 9 and the horizontal 29 include between them an angle ψ of approximately 55 °. it is attained thereby that a comfortable head position can be assumed in the sitting position . the minimum spacing d of each heating element 23 from the hair or -- when curl rollers are used -- from the respective curl roller preferably amounts to 25 to 30 % of the prevailing radius of curvature r . the reflector 24 in each central radiator 9 is in the form of a channel section with divergent side walls , i . e . in cross - section it is shaped as a trapezium , with limbs preferably of equal lengths , the base being perpendicular to the optical beam axis 18 . it is attained thereby that the radiation is not focussed along a line on the head , but as uniform an irradiation as possible of the surface of the head is obtained . as may be seen more clearly from fig7 the semi - opening angle δ of the reflector 24 is approximately 30 °. in relation to the horizontal 29 , the median axis 26 of each of the lateral radiators 6 is inclined upwardly , preferably by an angle ε of 10 °, to a first position of use for hair preferably wound upon curl rollers , or short hair . for the treatment of long hair , in particular hair of shoulder length , the lateral radiators 6 may be swung downwards into a second position of use , as illustrated in fig8 . in this case the median axis 26 is inclined downwardly by an angle λ ( preferably 20 °) relatively to the horizontal 29 . thus the swing range ( ε + λ ) of the lateral radiators 6 preferably amounts to 30 °. three different hair treatment processes are possible by means of the above - described apparatus , namely a permanent waving programme , a remedial and dyeing programme , and a drying programme , each of which will be described below . the control panel 11 illustrated in fig1 comprises at the bottom right six press keys of a first key field 30 for inserting the numbers 1 to 6 , each key always being allocated to a separate number value and provided on its operating side with the corresponding numer value inscription . five different number values can be inserted successively by depressing the respective key , the respective successively inserted number values being indicated on below another from top to bottom in five single - position 7 - segment indicators ( led ) 31 , in an appropriately associated arrangement . for example , in fig1 the number values 1 - 1 - 1 - 1 - 5 have been successively inserted in the control panel 11 and are correspondingly indicated on the indicators 31 . when a non - permissible number value is inserted , the corresponding indicator 31 blinks and the permanent waving programme selected is blocked . the number value adjusted in the lowest indicator 31 ( provided with the number &# 34 ; 5 &# 34 ; in fig1 ) is a code number for the kind of permanent waving treatment previously performed on the hair . the dwell period stored for this in the internal programme store is subsequently indicated by a two - position 7 - segment indicator 32 ( for example , a dwell period of 15 min is indicated in fig1 ). after depression of the key denoted by &# 34 ; d &# 34 ; of a second key field 33 , the permanent waving programme is started . the dwell period still remaining is indicated by the indicator 32 ( e . g . the dwell period of 15 min given by way of example would be reduced in steps of one minute by means of a backward counter ). the permanent waving programme switches off when the dwell period still remaining is indicated as zero . during the running period of this permanent waving programme , the lateral and central infra - red radiators 6 and 9 heat the hair , the temperature sensor 12 ( secured by a curl roller 15 ) measuring the temperature produced and the heating power of the heating elements 23 being controlled accordingly by an internal control , preferably by switching off and on . a nominal temperature in the range of 45 ° c . to 55 ° c ., preferably 50 ° c ., is adjusted at the temperature sensor 12 . after the termination of the permanent waving programme , an additional dwell period predetermined by the programme can be selected by depressing the key 34 denoted by &# 34 ; n &# 34 ; and is indicated by the indicator 32 . by repeated depression of the key denoted by &# 34 ; d &# 34 ; of the second key field 33 the associated backward counter is started and the remaining additional dwell period is appropriately counter backwards down to zero . this process may be repeated several times , until the permanent waving treatment is concluded . in order that the user may recognise the end of the respective heating period in good time , at a remaining running speed of 3 min indicated by the indicator 32 the number starts to blink , and from a remaining running period of 10 sec onwards additionally an acoustic buzzer is started . for the purpose of monitoring the originally predetermined dwell period or additional dwell period , the number value thereof can be indicated briefly on the indicator 32 by depressing for a short time the key 35 denoted by &# 34 ; m &# 34 ;. furthermore , the control panel 11 is provided with a key 36 denoted by &# 34 ; c &# 34 ;, upon depression of which the prevailing permanent waving programme is stopped and the cancellable store contents are cancelled and thus also the heating by means of the infra - red radiators 6 , 9 is switched off . for example , in the case of insertion of a wrong number value by means of a key of the first key field 30 all single - position 7 - segment indicators 31 can be cancelled by depressing the key 36 denoted by &# 34 ; c &# 34 ; and thereafter correctly inserted again . the respective associated pre - selectable number values for the permanent waving programme are arranged on inscribed fields 37 ( not illustrated in detail ) which are disposed adjacent the respective single - position 7 - segment indicators 31 . in this case the effect on the hair during hair dyeing or upon deposition of care emulsion is to be improved , in particular accelerated , by the influence of heat . for this purpose , by means of a third key field 39 , the dwell period is adjusted by depressing its tens and units keys ( the corresponding denominations &# 34 ; 10 &# 34 ; and &# 34 ; 1 &# 34 ; are provided on the keys 39 in fig1 ) and is indicated by the indicator 32 . as long as the corresponding key remains depressed , the respective tens or units position , respectively , of the number value of the dwell period is counted up at a slow rhythm . upon depression of a key denoted by &# 34 ; f &# 34 ; of the second key field 33 , the remedial and dyeing programme is started ; it is switched off owing to expiry of time when a remaining dwell period of zero is attained . in this case the nominal temperature at the hair sensor 12 is preferably 40 ° c ., which is preferably produced at a heating power of 250 w per infra - red radiator 6 , 9 by means of an impulse pause ratio between a switch - on period of 13 sec and a switch - off period of 8 sec . the indication of the end of this programme is effected analogously to the permanent waving programme . the heat treatment apparatus may likewise be used for drying wet hair . the dwell period is inserted correspondingly by means of the third key field 39 and is started by means of a key denoted by &# 34 ; t &# 34 ; of the second key field 33 . according to an internally stored programme the infra - red radiators are initially operated at maximum heating power , preferably for 5 min . thereafter the heating power is appropriately reduced by means of an impulse pause ratio between approximately 15 sec switch - on period and 7 sec switch - off period . such an impulse pause control is effected in a known manner by means of so - called triac semiconductors . the treated person may switch over to a reduced heating power having an impulse pause ratio of preferably 10 sec switch - on duration to 9 sec switch - off duration by means of a switch ( not illustrated ) which is arranged on the front of the upper central infra - red radiator ; the temperature of the hair is reduced thereby in a corresponding manner . the lateral radiators 6 may be switched off by means of a key 40 denoted by &# 34 ; to &# 34 ;, so that solely the central infra - red radiators 9 are heated . alternatively , by depressing the key 41 denoted by &# 34 ; tu &# 34 ; the central radiators 9 may be switched off , so that solely the lateral heaters 6 are heated . this switching on and off can be performed in all three programmes and permits individual adjustment to the hair - do of the person to be treated . a person whose hair is to be treated sits , for example , on an appropriate chair arranged within the irradiation range of the infra - red radiators and assume a position similar to that illustrated in fig1 . the required minimum spacing d is then adjusted by means of the projector lamps 17 in such a manner that the horizontal line 20 and the vertical line 21 together form an equal limbed cross 22 in the region of the neck contour 27 of the hair line in accordance with fig9 . for example , the hair strands have already be wound upon curl rollers and appropriately wetted with permanent waving fluid . for accelerating the conversion process in the keratin of the hair , the previously described permanent waving programme is then started . if , because of the particular hair construction , for example thick hair , the dwell period predetermined by the permanent waving programme is not sufficient , this dwell period is appropriately lengthened by a predetermined value by means of actuation of the key 34 denoted by &# 34 ; n &# 34 ; ( fig1 ). the operator of the heat treatment apparatus is rendered aware of the end of the heat treatment by an optical and towards the end also an acoustic warning signal . selectively , one of the other two programmes may be started correspondingly in the manner described above . fig1 illustrates a second embodiment of the heat treatment apparatus in which , instead of a stand , a wall bracket 42 supports the support arm 7 . in a known manner the bracket 42 consists of a socket 43 secured to the wall and carrying an upper arm 45 which is rotatable about a vertical axis 44 and at the other end of which a lower arm 49 is arranged which is selectively rotatable about a vertical axis 46 and vertically pivotable about a horizontal axis 47 . at the other end of the lower arm 49 a projection 51 is articulated about a horizontal axis 50 by way of a parallel motion guide and supports the selectively horizontally rotatable support arm 7 . thereby the infra - red radiators 6 and 9 may be adjusted in a known manner by means of the hand grip 10a to any desired position relatively to the head 14 to be treated , at a predetermined minimum spacing d . in a further embodiment ( not shown ), in place of the optical adjusting device carrying two projector lamps 17 , another spacing device e . g . of a mechanical kind , may be used for adjusting the minimum spacing of the head 14 from the infra - red radiators 6 and 9 . | 5 |
hereinafter , an embodiment of this invention will be described with reference to the accompanying drawings . a mimo communication system according to a first embodiment of this invention will be described . fig1 a is a configuration diagram of the mimo communication system according to the first embodiment of this invention . the mimo communication system includes a transmitter 1 , a receiver 2 , transmission antennas 3 ( 3 a and 3 b ), and reception antennas 4 ( 4 a and 4 b ). the transmitter 1 simultaneously sends transmission data items ( t 1 , t 2 ) in the form of transmission signals at an identical frequency by using the two different transmission antennas 3 . it should be noted that the transmission signals are influenced by channel impulse responses ( h 11 to h 22 ) of propagation channels . the receiver 2 receives the signals , which have been influenced by the channel impulse responses ( h 11 to h 22 ), by using the two different reception antennas 4 . since a plurality of transmission data items are mixed in the received signals , the receiver 2 performs a signal separation process to separate the corresponding mixed transmission signals from the received signals to obtain estimation signals ( r 1 ′, r 2 ′). it should be noted that the two transmission antennas 3 and the two reception antennas 4 are shown in fig1 a , but three or more different transmission antennas or reception antennas may be provided . when the two transmission antennas 3 and the two reception antennas 4 are used , the relationship between transmission signals and reception signals is expressed by the following formula . fig1 b is a configuration diagram of the receiver 2 according to the first embodiment of this invention . the receiver 2 includes an rf reception circuit unit 5 and a baseband signal processing unit 6 . the rf reception circuit unit 5 includes reception circuits 7 ( 7 a and 7 b ). the reception circuits 7 amplify the amplitudes of the signals received from the reception antennas 4 and input the amplified received signals to the baseband signal processing unit 6 . the baseband signal processing unit 6 includes a qrm - mld process unit 8 , a log likelihood calculation unit 9 , and a decoding process unit 10 . the qrm - mld process unit 8 separates transmission - signal interferences from the received signals . it should be noted that details of the qrm - mld process unit 8 will be described later with reference to fig2 . the log likelihood calculation unit 9 calculates the log likelihood of each signal obtained through the separation . the decoding process unit 10 performs a decoding process such as turbo decoding , based on the calculated log likelihood . in order to reduce the amount of calculation , the qrm - mld process unit 8 of the first embodiment of this invention generates a plurality of channel matrices which have different element orders , and applies qr decomposition to each of the generated channel matrices , which have different element orders . further , the qrm - mld process unit 8 partially performs an mld process by using an upper triangular matrix obtained through the qr decomposition applied to each of the channel matrices . at the last stage , in order to improve the quality of an optimum solution , the qrm - mld process unit 8 performs an integrated mld process by combining results obtained through the respective mld processes . the above - mentioned process is called a multiplex qrm - mld process , and an example case in which the multiplex count is two is shown in fig2 . fig2 is a configuration diagram of the qrm - mld process unit 8 according to the first embodiment of this invention . the qrm - mld process unit 8 includes an each - channel estimation unit 21 , a channel matrix generation unit 22 , qr decomposition process units 24 ( 24 a and 24 b ), signal conversion units 25 ( 25 a and 25 b ), a channel matrix counterchange unit 23 , mld process units 26 ( 26 a and 26 b ), and an integrated mld process unit 27 . the each - channel estimation unit 21 estimates a channel impulse response of each propagation channel by using a known pilot signal . the channel matrix generation unit 22 generates a channel matrix having the channel impulse responses estimated by the each - channel estimation unit 21 , as matrix elements . the channel matrix counterchange unit 23 counterchanges the order in the channel matrix generated by the channel matrix generation unit 22 . for example , the channel matrix counterchange unit 23 counterchanges the orders in the channel matrices included in the formula ( 2 ) to generate the channel matrices having the reverse orders . the qr decomposition process unit 24 a applies qr decomposition to the channel matrix generated by the channel matrix generation unit 22 . the qr decomposition process unit 24 b applies qr decomposition to the channel matrix having the reverse order and generated by the channel matrix counterchange unit 23 , to obtain a formula ( 5 ). the signal conversion units 25 each multiply the received signals by the complex conjugate transpose matrix of a unitary matrix obtained through the qr decomposition , to convert the received signals to new signals . for example , the signal matrix is transformed based on the qr decomposition expressed by the formula ( 5 ) to obtain a formula ( 6 ). each of the mld process units 26 partially performs the mld process . specifically , the mld process unit 26 b performs the mld process for t 1 and t 2 based on the formula ( 6 ) to determine transmission signal candidates . similarly , the mld process unit 26 a performs the mld process for t 3 and t 4 to narrow down the transmission signal candidates . the integrated mld process unit 27 performs the mld process by combining the results obtained by the mld process units 26 . specifically , the integrated mld process unit 27 performs the mld process based on the results of the transmission signal candidates for t 1 and t 2 , and the transmission signal candidates for t 3 and t 4 . fig3 is a flowchart of the multiplex qrm - mld process according to the first embodiment of this invention . the multiplex qrm - mld process is started when received signals are input to the qrm - mld process unit 8 . first , the qrm - mld process unit 8 estimates , in the each - channel estimation unit 21 , propagation channels used between the transmission antennas 3 and the reception antennas 4 ( 502 ). specifically , channel impulse responses of the propagation channels are estimated by using known pilot signals . next , the qrm - mld process unit 8 generates a channel matrix in the channel matrix generation unit 22 ( 503 ). it should be noted that details of generation of a channel matrix will be described later with reference to fig4 . the qrm - mld process unit 8 applies qr decomposition to the generated channel matrix in the qr decomposition process unit 24 a , and converts the received signals in the signal conversion unit 25 a ( 504 ). specifically , qr decomposition is applied to the generated channel matrix , and the received signals r are multiplied by the complex conjugate transpose matrix of a unitary matrix q obtained through the qr decomposition , to obtain conversion signals z . the qrm - mld process unit 8 applies the mld process to the upper triangular matrix obtained through the qr decomposition and to the conversion signals z obtained by the signal conversion unit 25 a , to determine candidates for t 3 and t 4 ( 505 ). specifically , the mld process unit 26 a performs the mld process based on the upper triangular matrix h ′ obtained through the qr decomposition and the conversion signals z until candidates for the transmission signals t 3 and t 4 are determined ( the mld process is not performed for the transmission signals t 1 and t 2 ). the qrm - mld process unit 8 counterchanges , in the counterchange matrix counterchange unit 23 , the channel matrix generated in step 503 to generate a new channel matrix ( having the reverse order , for example ) ( 506 ). the qrm - mld process unit 8 applies qr decomposition to the counterchanged channel matrix in the qr decomposition process unit 24 b , and converts the received signals in the signal conversion unit 25 b ( 507 ). the qrm - mld process unit 8 applies the mld process to the upper triangular matrix obtained by applying the qr decomposition to the counterchanged channel matrix and to the conversion signals , to determine candidates for t 1 and t 2 ( 508 ). specifically , the mld process unit 26 b performs the mld process until candidates for the transmission signals t 1 and t 2 are determined . the qrm - mld process unit 8 uniquely determines estimation values of the transmission signals t 1 to t 4 based on the candidates for the transmission signals t 3 and t 4 determined in step 505 and the candidates for the transmission signals t 1 and t 2 determined in step 508 ( 509 ). specifically , the euclidean distances for the candidates for the transmission signals t 3 and t 4 determined in step 505 and the euclidean distances for the candidates for the transmission signals t 1 and t 2 determined in step 508 are calculated , and candidates for the transmission signals t 1 to t 4 having the integrated shortest euclidean distances are determined to be estimation values . the qrm - mld process unit 8 ends the process . generation of a channel matrix is now discussed . in a case where the absolute value of h 44 ′ which is a lower right diagonal term of the upper triangular matrix shown in the formula ( 3 ), obtained through the qr decomposition , and the absolute value of h 41 ″ which is a lower right diagonal term of the upper triangular matrix shown in the formula ( 6 ), obtained through the qr decomposition , are each small , since noise is included in transmission signals , when a candidate for the transmission signal t 4 shown in the formula ( 3 ) and a candidate for the transmission signal t 1 shown in the formula ( 6 ) are to be determined , the influence of the noise becomes larger to increase errors . therefore , it is more effective to generate each channel matrix in such an order that the absolute value of a lower right diagonal term of the matrix is as large as possible ( for example , a smaller one of the absolute values of two lower right diagonal terms is the maximum ), because the influence of noise exerted upon determining a candidate for a transmission signal is small . hereinafter , a process of generating a channel matrix will be described specifically . fig4 is a flowchart of a channel matrix setting process according to the first embodiment of this invention . first , the qrm - mld process unit 8 initializes a variable used in the channel matrix setting process ( α max = 0 ) ( 802 ). next , the qrm - mld process unit 8 sets a channel matrix having a first order based on estimated channel impulse responses ( 803 ). further , the qrm - mld process unit 8 sets a channel matrix having a second order different from the first order of the channel matrix set in step 803 ( 804 ). the qrm - mld process unit 8 applies qr decomposition to the set channel matrix having the first order and channel matrix having the second order ( 805 ). the qrm - mld process unit 8 calculates the absolute values of lower right diagonal terms of upper triangular matrices obtained through the qr decomposition applied to the channel matrix having the first order and the channel matrix having the second order ( 806 ). the qrm - mld process unit 8 compares the calculated absolute values of the lower right diagonal terms of the upper triangular matrices of the channel matrix having the first order and the channel matrix having the second order , and determines a larger one of the absolute values to be “ α ” ( 807 ). the qrm - mld process unit 8 compares “ α ” with the variable α max to determine whether “ α ” is larger than α max ( 808 ). when “ α ” is larger than α max , the qrm - mld process unit 8 advances to step 809 . on the other hand , when “ α ” is not larger than α max , the qrm - mld process unit 8 advances to step 810 . the qrm - mld process unit 8 sets α max to “ α ” ( 809 ). the qrm - mld process unit 8 determines whether there is a candidate for a channel matrix ( 810 ). when there is a candidate for a channel matrix , the qrm - mld process unit 8 returns to step 803 . on the other hand , when there is no candidate for a channel matrix , the qrm - mld process unit 8 advances to step 811 . the qrm - mld process unit 8 determines the channel matrix having the first order and the channel matrix having the second order , one of which has α max ( 811 ). the qrm - mld process unit 8 ends the process . fig5 is an operation diagram of the integrated mld process according to the first embodiment of this invention . the mld process is performed for t 3 and t 4 by using the m algorithm . the mld process is omitted for t 1 and t 2 ( skip process ) because another mld process is performed to determine a plurality of candidates for transmission signals t 1 and t 2 . specifically , the mld process is first performed for t 3 and t 4 to determine a plurality of candidates for t 3 and t 4 . next , when the plurality of candidates for t 1 and t 2 determined in advance by the other mld process are selected , the mld process is performed for the plurality of candidates for t 1 and t 2 , so that it is unnecessary to apply a new mld process to all signal replicas for t 1 and t 2 , and , as a result , the mld process for t 1 and t 2 can be partially omitted . when the integrated mld process is performed after ones of the candidates determined through the mld process applied to t 1 and t 2 and the candidates determined through the mld process applied to t 3 and t 4 are narrowed down to one based on the euclidean distances calculated through the mld process , the amount of calculation can be reduced though the quality of an optimum solution may deteriorate . for example , when one candidate is determined through the mld process applied to t 3 and t 4 , a process for t 3 and t 4 is skipped and the mld process is applied to t 1 and t 2 in the integrated mld process , whereby the amount of calculation is reduced by skipping the process in the latter stage of a tree structure shown in fig5 . fig6 is an evaluation diagram showing a comparison of the amount of calculation between the first embodiment of this invention and a conventional technology . when 16 qam is used as a modulation and demodulation system , and the number of transmission signal candidates to be selected is 16 , complex - multiplication counts are compared between a case where 4 × 4 transmission and reception antennas ( four transmission antennas and four reception antennas ) are used and a case where 6 × 6 transmission and reception antennas ( six transmission antennas and six reception antennas ) are used . processes to be considered in making the comparison include qr decomposition , generation of signal replicas , and calculation of squared euclidean distances . in a case of n transmission antennas , c levels of modulation and demodulation , s candidates to be selected , and a multiplex count of g , the complex - multiplication count needs to be about n cubic in the qr decomposition . further , an amount of calculation of c + sc ( n / g − 1 )( n / g + 2 )/ 2 is required in generating signal replicas . further , an amount of calculation of c + sc ( n / g − 1 ) is required in calculating squared euclidean distances . with the conventional technology , 3253 calculations are performed for 4 × 4 transmission and reception antennas , and 6862 calculations are performed for 6 × 6 transmission and reception antennas . the amount of calculation increases by approximately the square of 10 multiplied by the number of transmission and reception antennas . on the other hand , when the signal division ( multiplex ) count is two in this invention , 2522 calculations are performed for 4 × 4 transmission and reception antennas , and 5236 calculations are performed for 6 × 6 transmission and reception antennas . it is found that the amount of calculation is reduced ( by 22 % to 24 %) compared with the conventional technology . this is because the amount of calculation required for the qr decomposition doubles , but the amount of calculation required for the generation of signal replicas and the calculation of the squared euclidean distances in the mld process is significantly reduced compared with the increase in qr decomposition . it should be noted that , when the signal division ( multiplex ) count is three for 6 × 6 transmission and reception antennas , the qr decomposition is performed three times to determine , in each time , signal candidates for a combination of two transmission signals , and the integrated mld process is performed , thereby executing maximum likelihood decoding . formulae ( 7 ) to ( 9 ) show signal conversion formulae used when the signal division count is three . specifically , the mld process is partially performed for ( t 5 , t 6 ) based on the formula ( 7 ). the mld process is partially performed for ( t 3 , t 4 ) based on the formula ( 8 ). the mld process is partially performed for ( t 1 , t 2 ) based on the formula ( 9 ). the integrated mld process is performed based on results of transmission signal candidates determined by partially performing the mld processes , to perform maximum likelihood decoding . it should be noted that , when the signal division count is three , the amount of calculation can be reduced to 4458 times ( reduced by 35 %). while the present invention has been described in detail and pictorially in the accompanying drawings , the present invention is not limited to such detail but covers various obvious modifications and equivalent arrangements , which fall within the purview of the appended claims . | 7 |
with reference to the fig1 to 4 the functional element 10 shown there is provided with a head part 14 having a ring - like contact surface 12 and a tubular rivet section 16 provided at the side of the contact surface 12 of the head part 14 and extending away from the head part 14 . the functional element has a central longitudinal axis 11 . a tubular guide section 18 is arranged concentric to the tubular rivet section 16 and radially within the latter , with a ring gap 20 , which is only evident from fig4 , being provided between the guide section 18 and the rivet section 16 . as likewise evident from fig4 the free end 22 of the wall of the ring - like rivet section 16 is rounded when seen in the axial section plane of fig4 , both at the radially outer side 24 and also at the radially inner side 26 and has here a rounded shape resembling an arrow tip . the tip of the shape resembling an arrow tip could however likewise be rounded , whereby a semicircular shape would result , which is however not shown . in the representation of fig4 the ring gap has a radial dimension of 0 mm , i . e . the rivet section contacts the guide section 18 , is however first connected to the guide section 18 where the ring gap 20 finishes at a short axial distance “ a ” in front of the ring - like contact surface 12 . the functional element of fig1 to 4 is normally manufactured by a cold heading process , the basic principles of which are well known . for the manufacture of the rivet section , which closely contacts the guide section , it can be necessary to first manufacture the rivet section with a certain radial spacing from the guide section by cold heading and to subsequently press the rivet section against the guide section in a further face of the cold heading process , or to dilate the guide section until it contacts the rivet section , or to achieve the reduction of radial spacing by a combination of both measures . it is favorable when the ring gap 20 has the smallest possible radial width since this leads to a compact design of the functional element and saves material . the guide section 18 is formed here as a piercing section and has a ring - like cutting edge 28 at its end face remote from the contact surface 12 , i . e . at its free end . the fig1 to 4 furthermore show features 30 providing security against rotation in the region of the ring - like contact surface 12 and at the rivet section 16 , with the features providing security against rotation being formed here by noses which are present in raised form at the contact surface 12 and at the rivet section 16 in the region of the transition from the contact surface into the rivet section 16 . the noses providing security against rotation shown here are provided with side flanks 30 and 32 which lie in planes extending in the longitudinal direction of the element . the noses providing security against rotation , which have sharp edges in fig1 and 4 at 34 and 36 , can instead be provided with rounded edges . the noses providing security against rotation can also be realized by recesses in the contact surface or in the rivet section . the possibility also exists of providing the jacket surface 36 of the head part 14 with a polygonal or grooved shape . the functional element is realized here as a nut element and has a thread cylinder 38 which is arranged coaxial to the longitudinal axis 11 of the functional element and in this example is present partly in the guide section 18 . a further special feature of the nut element of fig1 to 4 is to be seen in the two lugs 40 which project out from the upper end face of the element 10 and which are produce in that material is displaced upwardly from the regions 42 during the cold heading process so that corresponding recesses arise at the points 42 , with the designation “ upwardly ” to be understood only in regard to the representation of fig1 and , as other descriptions of position in this application , is only used in relation to the figures , and does not represent any spatial restriction of the subject of the invention . the lugs 40 ensure that a cable shoe can be secured on the functional element by means of a screw inserted from above without the cable shoe being rotated with the screw during the attachment of the screw , since a co - rotation of the cable shoe is prevented by the lugs 40 . as is in particular evident from fig4 the functional element 10 has cylindrical recesses 44 and 46 above and below the thread cylinder 38 , with these free spaces having a diameter which is normally made fractionally larger than the outer diameter of a screw which is screwed into the thread cylinder 38 . although the thread cylinder 38 is present here partly in the head 10 part 14 and partly in the guide section 18 of the functional element it could also be arranged fully in the head part or fully in the guide section . fig4 shows the functional element 10 in a first stage of the attachment to the sheet metal part , with the sheet metal part 50 being supported in the representation of the fig4 on a die 52 and being pressed against the die 52 by means of a ring - like hold - down member 54 , with the hold - down member 54 preferably being provided but not being essential . the representation of fig4 assumes that the attachment of the functional element to the sheet metal part 50 takes place in a press , with the die being arranged in the lower tool of the press ( not shown ) and the functional element 10 being pressed by means of a likewise not illustrated setting head onto the sheet metal part 50 , with it being possible for the setting head to be attached to an intermediate plate of the press or to an upper tool of the press . such setting heads and hold - down members 54 are extremely well known in the prior art and are thus not especially described here . it should however also be brought to expression that other arrangements within a press are possible . for example , the die 52 can be arranged in an intermediate plate of the press , with the setting head with or without a hold - down member then being attached to the upper tool of the press . it is also possible to provide the die 52 at the upper tool of the press and to then attach the setting head with or without a hold - down member on an intermediate plate of the press or on the lower tool of the press , i . e . to attach the functional element 10 in the inverse direction beneath the sheet metal part 50 . it is also entirely possible to attach the functional element 10 to the sheet metal part 50 by a robot , with the robot or an auxiliary robot then holding the die 52 beneath the sheet metal part and serving for the application of the pressing force onto the functional element 10 which is required for the attachment . in fig4 a two - part design of the die 52 is shown . this consists of an outer ring - like die part 54 and an inner likewise ring - like die part 56 with a central longitudinal bore 58 . in this example the inner die part 56 has a slightly conically extending outer wall which cooperates with a correspondingly shaped conically extending inner wall 53 of the outer die part 54 so that the upper end face 60 of the inner die part 56 comes to lie below the upper end face 62 of the outer die part 54 and hereby forms a recess 64 . the upper end 60 of the inner die part 56 thus forms the base surface of the recess 64 and has in other respects a ring - like , concavely arched surface 66 . the central bore 58 of the central die part 56 has a diameter which is fractionally larger than the outer diameter of the guide section 18 . the recess 64 has a diameter which is somewhat larger than the outer diameter of the head part 14 of the functional element 10 plus twice the thickness of the sheet metal part 50 . both the inner die part 56 and also its bore 58 and also the outer die part 54 and the recess 64 defined between the two die parts are arranged coaxial to the central longitudinal axis 11 of the functional element 10 . the die 52 could also be formed in one piece . starting from the stage of fig4 the functional element 10 is now pressed against the sheet metal part 50 in accordance with fig5 by the application of a force in the direction of the arrow 70 onto the upper end face of the functional element 10 by means of the setting head , for example in the press , or by using a robot and with simultaneous support of the die , with the optionally provided hold - down member 54 having been omitted in fig5 for the sake of the illustration . one sees that the guide section presses the sheet metal part against the upper end face 60 of the inner die part 56 and has drawn the metal sheet into a conically extending recess 72 . at this stage the ring - like cutting edge 28 of the guide section which is formed as a piercing section 18 has not yet started to cut through the sheet metal part 50 and the free lower end 22 of the rivet section 16 has not yet contacted the sheet metal part 50 . in the further stage of fig6 the guide section 18 has cut out a piercing slug 74 from the base of the conical recess of the sheet metal part and has partly pressed the latter through the central bore 58 of the die , with it being possible for this central bore 58 to be formed so that it also diverges slightly downwardly , so that the piercing slug can be disposed off via this central longitudinal bore by gravity , optionally with pneumatic assistance . after the separating out of the piercing slug the rounded outer wall 64 at the free end of the rivet section 16 has also pressed the wall of the conical recess of the sheet metal part 50 away from the central longitudinal axis 11 , i . e . brought the wall into a somewhat steeper position and dilated the hole 76 , which has arisen by the cutting out of the piercing slug 74 , to such an extent that the free end of the rivet section 16 can now be pressed through the hole 76 , so that the inner curved wall 26 of the free end of the rivet section can be brought into contact with the ring - like recess 66 , whereby , during a further downwardly directed movement of the functional element as a result of the pressure in the direction of the arrow 70 , the tubular rivet section 16 is turned over to form a rivet bead 78 in accordance with fig7 . through this turning over ( or riveting ) process the sheet metal part 50 is so deformed in the region of the previous conical recess that it is clamped in form - fitted manner between the ring - like contact surface 12 and the turned over rivet section . at the same time the noses 30 providing security against rotation are pressed into the sheet material so that a corresponding security against rotation also arises . when the features providing security against rotation are formed by corresponding recesses then the sheet material is pressed into such recesses whereby a security against rotation likewise arises . the sheet material is however simultaneously partly pressed into the recesses 42 which have arisen through the formation of the lugs 40 so that a security against rotation also arises in this region . should the head part 14 with the functional element 10 have a polygonal or grooved or ribbed shape , then a corresponding form - fitted connection between the sheet metal part and the functional element is also produced in this region . one can see from fig7 that the guide section 18 enters ever deeper into a central bore 58 of the inner die 56 during the attachment of the functional element 10 , whereby a reliable guidance of the functional element is achieved . the finished component assembly consisting of the functional element 10 and the sheet metal part 50 is then shown in fig8 after the removal out of the attachment tooling , i . e . out of the press or out of the robot or out of attachment tools which are conceived differently . one can see that the guide section projects significantly beyond the turned over rivet section 16 and it is thus possible to subsequently use this guide section as a cylindrical bearing surface . this likewise applies to the jacket surface of the head part 14 which projects out of the sheet metal part 50 at the other side of the sheet metal part . it is in other respects also possible to dimension the arrangement such that the body part 14 is accommodated still further within the recess in the sheet metal part or indeed fully within this recess . in the finished state in accordance with fig8 a further component , i . e . another sheet metal part or a cable shoe can be secured either to the upper end face of the functional element or to the lower end face of fig8 , i . e . the corresponding screw can be introduced into the thread cylinder coming from above or from below . it would be possible to attach components both at the bottom and also at the top . furthermore , both the guide section 18 and also the head part 14 can act as a spacer element , so that the element can be introduced into a hollow component consisting of two sheet metal parts . however it would here probably be necessary to pre - hole the component 50 , which is basically also possible and indeed also when the sheet metal part is on its own , i . e . is not assembled to a further sheet metal part to form a hollow component . the lugs 40 are only optionally provided and indeed in particular when the element is to be used as an electrical connection element , for example as a earth connection element in a vehicle body . the functional element 10 in accordance with the present invention has the special advantage that it can also be used with sheet metal parts 50 provided with protective layers or paint layers and nevertheless generates an excellent electrical connection , and indeed in the region of the pierced hole , with the noses providing security against rotation which locally cut through the protective coating , especially with a sharp edged design of the noses providing security against rotation and serving for a metallic connection to the sheet metal part 50 . moreover , the protective layer is damaged at points which lie within the form - fit between the sheet metal part 50 and the functional element so that a seal takes place there and corrosion is prevented . the form - fitted connection between the sheet metal part and the functional element is so intensive that the connection represents a sealed connection which , when a special seal is required , can also be assisted by the application of an adhesive to the element of the sheet metal part . through the recess of the sheet metal part 50 in the region of the functional element an excellent connection to the sheet metal part is ensured , so that a high resistance against pullout forces in both directions is generated and , moreover , a high resistance against shear forces and torsional forces is present . in addition the element can be used with alternating dynamic loadings and fatigue effects with dynamic loadings are not to be feared . the functional elements described here can for example be manufactured from all materials which reach the strength class 5 . 6 or higher . such metal materials are normally carbon steels with 0 . 15 to 0 . 55 % carbon content . in all embodiments all materials can be named as an example for the material of the functional elements which achieve the strength values of class 8 in accordance with the iso standard in the context of cold deformation , for example a 35b2 alloy in accordance with din 1654 . the so formed fastening elements are suitable , amongst other things , for all commercially available steel materials for drawing quality sheet metal parts as well as for aluminium or its alloys . aluminium alloys , in particular those of higher strength , can be used for the functional elements , for example almg5 . moreover , functional elements of higher strength magnesium alloys such as , for example , am5o can also be considered . | 5 |
the present invention is a method , system and apparatus for co - locating multiple business operations in a single , host computing platform . in accordance with the present invention , a business facility can be programmatically defined so that one or more instances of a business facility can be created by different business operations in the computing platform . each business facility can include one or more business elements , which when combined , provide the functionality of the business facility . to that end , each business element can include assets managed in and by the facility , policies for interacting with the assets , and logic defined for interacting with the facility . different business operations can be defined in terms of the underlying business facilities and their constituent business elements . in this regard , for each business operation , the requisite number and arrangement of business elements can be instantiated and rendered operable to support the business operation . consequently , by providing a common architecture for supporting multiple , different business operations , multiple different business operations can be co - located in a single , host computing platform . as such , several previously unattainable advantages can be realized including cost - savings , ease of management and performance enhancement . in more particular illustration of the foregoing inventive arrangement , fig1 is a schematic illustration of a computing platform configured for deploying multiple e - commerce systems for different business operations . the computing platform can include a computing server 110 coupled to one or more computing clients 130 over a computer communications network 120 . the computing server 110 can be configured to host one or more e - commerce systems representative of one or more respective business operations . the computing server 110 can include an application server 160 programmed to host and manage a distributable application over the network 120 . the computing server 110 further can include a data store 140 configured to store an application interface 150 to one or more applications 180 operating through the application server 160 . importantly , the computing server 110 also can include a defined business operation application architecture 170 . specifically , instances of the business operation application architecture 170 can be created through the application server 160 to support corresponding business operations . consequently , multiple business operations can be co - located within the platform of fig1 . as a more specific illustration , fig2 is an object diagram illustrating an e - commerce architecture for deploying multiple e - commerce systems for different business operations in the computing platform of fig1 . the architecture can include one or more business elements 235 . each of the business elements 235 can be an aggregation of one or more assets 240 , one or more policies 245 and one or more algorithmic processes 250 . the assets 240 can include data stored on a file system graphics files , markup language documents , and server pages . the assets 240 further can include data stored in a database such as member , catalog , and order information . the business policies 245 , by comparison , can include contract policies that determine the price of products . finally , the algorithmic processes 250 can include commands and tasks that perform business logic and render views . one or more of the business elements 235 can be grouped together as a facility fragment 230 . the facility fragment 230 can be private or shareable . notably , a business facility 225 can create one or more facility fragments 230 in furtherance of the activities of the business facility , such as the operation of an on - line store . in a preferred aspect of the invention , the facility 225 can be modeled as an on - line store . notably , the assets 240 can be used to present a visual interface to the business activity to end users . the business policies 245 and the algorithmic processes , in turn , can be programmed to drive the process flow of the business activity , to enforce the rules of the business activity , and to define the capabilities of the business activity . a business 205 can be composed from one or more facilities 225 and the business 205 can subscribe 280 to an authorization domain 260 . the authorization domain 260 can provide access control to determine those users allowed to create , update , delete or invoke the various business elements 235 of a business 205 . in this regard , the authorization domain 260 can include both registration policies 265 , and also access control policies 270 . notably , a business 205 can be an owning business 210 or a partner business 215 . an owning business 210 can include a business which maintains control over all of its associated facilities 225 . an example of an owning business can include a business to consumer ( b2c ) store where the merchant supplies and control all the file assets , data assets , business policies , and algorithmic processes . a partner business 215 , by comparison , can include a business which has only limited control over its facilities 225 . a partner business 215 can include , for instance , a merchant who is acting as a reseller for part of a catalog . in this case , the partner business 215 can supply its own assets 240 and business policies 245 that provides a different look and feel to the catalog , though the data and algorithm processes can be accessed from shareable facility fragments 230 not controlled by the partner business 215 . to maintain control over shareable facility fragments 230 , a business provisioning hub 255 can be included in the architecture of fig2 . the business provisioning hub can control one or more shareable facility fragments 230 . the business provisioning hub 255 also can control its own facility 225 which can provide self - management features to allow a partner business 215 to register itself and to obtain shareable assets . the business provisioning hub 255 can have an association with an owning business 210 which can subscribe to facility creation policies 275 that govern what self - management operations a partner business 215 is allowed to perform and the rights of the partner business 215 in managing its own facilities 225 . using the artifacts illustrated in the architecture of fig2 , e - commerce systems can be implemented and deployed in a single , hosting platform , which e - commerce systems can range from a simple b2c online businesses to very complex channel management deployments . for instance , fig3 is a hierarchical diagram illustrating a b2c e - commerce system implemented according to the architecture of fig2 . in the diagram businesses are represented as organizations , shown as ovals . in a computing environment all the businesses are owned by a single organization known as the root organization 310 . the root organization 310 can control other businesses , but the root organization 310 does not control in many cases its own facilities . the user organization 320 can control an administrators organization 340 and a shopper organization 350 . the user organization 320 further can control other organizations that contain users because , if there is need to integrate with external user repositories such as an ldap directory , then the other non - user organizations need not be persisted to ldap . rather , in the case of an ldap integration , the user organization 320 can map to the ldap root organization . the seller organization 330 , unlike the user organization 320 , can control the b2c organization 360 which itself controls a standalone facility . the facility controlled by the b2c organization 360 can contain business elements that enable the b2c organization 360 to operate an online store . in this regard , shoppers 380 can browse the wares of the b2c organization 360 by electronically referencing the b2c store front 390 . the pages of the b2c store front 390 that the shoppers 380 can browse typically can be composed from the b2c file assets 355 . for example , the b2c file assets can include server pages , markup and graphic images . the data 365 obtained by the file assets 355 can include user personalization data , product data , pricing data and the like . the business policies 345 limit the type and content of information which can be displayed to the shoppers 380 , such as prices for products . the shoppers further can perform any activities that are part of the b2c algorithmic processes 325 such as executing a command to add a new item to a shopping cart , or to check out from the store , provided that this is allowed by the access control policies 335 governed by the b2c authorization policies 315 to which the b2c business subscribes . finally , shoppers 380 associated with the shopper organization 350 and administrators 370 associated with the administrators organization 340 participate in a particular role in the business operations , which in conjunction with the access control policies 335 determine what operations a user is allowed to perform when interacting with the business operation . while fig3 depicts a simpler b2c e - commerce system deployment , the invention is not so limited and more complex arrangements are made possible by the architecture shown in fig2 . as an example , fig4 is a hierarchical diagram of a multi - reseller e - commerce system regulated through a management hub and implemented in a single , host computing platform according to the architecture of fig2 . as before in the case of the simple b2c system , in the multi - reseller system depicted in fig3 , a root organization 410 can own a user organization 415 . in addition , the root organization 410 can own a re - seller organization 420 and hub organization 425 , which can be associated with a re - seller registration policy 490 . the re - seller organization 420 can include a multiplicity of reselling organizations 440 , 445 ( only two shown for purposes of simplicity ), each providing the operative functionality of a virtual store 470 , 475 using the business element mechanism of the architecture of the present invention . notably , the reselling organizations 440 , 445 do not in of themselves control their inventory assets . rather , the reselling organizations 440 , 445 merely access the assets of the asset organization 450 as a partner business rather than an owning business . the user organization 415 can control both an administrative organization 430 and a shopper organization 435 . the administrative organization 430 can provide a role for the administrators 460 with which the administrators 460 can access and managing the operations of the reselling organizations 440 , 445 . the shopper organization 435 , by comparison , can include the shoppers 465 empowered to shop the virtual stores 470 , 475 provided by the reselling organizations 440 , 445 . in this regard , to the shoppers 465 , the virtual stores 470 , 475 appear as if to own the inventory assets managed by the asset organization 450 and purchase transactions with the reselling organizations 440 , 445 appear to be seamless from the perspective of the shoppers 465 . importantly , the hub organization 425 provides management capabilities to allow the partner businesses to self - register themselves to access the assets and functionality managed through organizations controlled by the hub organization 425 . the management capabilities are provided by the management organization 455 and all of its artifacts provided through the “ management store ” 485 . separately , the hub organization 425 can provide through the asset organization 450 those business elements that can be used by the reselling organizations 440 , 445 through an “ asset store ” 480 . in operation , a business partner can register by visiting the management store 485 provided by the management organization 455 . as part of the registration process a partner business can be created . for example , the partner business can be a reselling organization 440 , 445 . notably , the partner business can be bootstrapped with an administrator who has been given administrative roles as defined by the registration policies 490 . these administrative roles allow the business partner to create additional administrators 460 to manage its customers , and administrator its store . in the example shown in fig4 , the administrators 460 can be owned by the administrative organization 430 . also , the created business partner can be given access to use the shareable resources owned by the asset organization 450 to host within the store of the business partner . significantly , the architecture of fig2 can permit additional combinations of business operations , such as multi - reseller and direct b2c configurations ( as well as b2b configurations ) in a single , host computing platform . in this regard , each new business operation can be added as an organization owned by the root organization . while the seller organizations can control their own assets , just the same the seller organizations can access the assets of business partner organization through a management hub . in this way , the operations of the different businesses can coexist in a single host computing platform without requiring separate computing facilities for each business operation . specifically , fig5 is a hierarchical diagram of a mixed multi - reseller and b2c e - commerce system regulated through a management hub and implemented in a single , host computing platform according to the architecture of fig2 . as shown in fig5 , a multi - reseller e - commerce system can be coupled to the root organization 510 which can own a first user organization 515 a for the multi - reseller e - commerce system . in addition , the root organization 510 can own a re - seller organization 520 and hub organization 525 , which can be associated with a re - seller registration policy 590 . the re - seller organization 520 can include a multiplicity of reselling organizations 540 , 545 ( only two shown for purposes of simplicity ), each providing the operative functionality of a virtual store 570 , 575 using the business element mechanism of the architecture of the present invention . notably , the reselling organizations 540 , 545 do not in of themselves control their inventory assets . rather , the reselling organizations 540 , 545 merely access the assets of the asset organization 550 as a partner business rather than an owning business . the user organization 515 can control both an administrative organization 530 and a shopper organization 535 . the administrative organization 530 can provide a role for the administrators 560 with which the administrators 560 can access and managing the operations of the reselling organizations 540 , 545 . the shopper organization 535 , by comparison , can include the shoppers 565 empowered to shop the virtual stores 570 , 575 provided by the reselling organizations 540 , 545 . in this regard , to the shoppers 565 , the virtual stores 570 , 575 appear as if to own the inventory assets managed by the asset organization 550 and purchase transactions with the reselling organizations 540 , 545 appear to be seamless from the perspective of the shoppers 565 . as in the multi - reseller case of fig4 , the hub organization 525 provides management capabilities to allow the partner businesses to self - register themselves to access the assets and functionality managed through organizations controlled by the hub organization 525 . the management capabilities are provided by the management organization 525 and all of its artifacts provided through the “ management store ” 585 . separately , the hub organization 555 can provide through the asset organization 550 those business elements that can be used by the reselling organizations 540 , 545 through an “ asset store ” 580 . in addition to the multi - reseller e - commerce system , a b2c e - commerce system can be deployed within the same host computing platform as shown in fig5 . in particular , the root organization 510 can control both a second user organization 515 b and a seller organization 595 . the seller organization 595 can control the b2c organization 620 which itself controls a standalone facility . the facility controlled by the b2c organization 620 can contain business elements that enable the b2c organization 620 to operate an on - line store . in this regard , shoppers 640 can browse the wares of the b2c organization 620 by electronically referencing the b2c store front 650 . it will be recognized by the skilled artisan that the business models implemented in the host computing platform are not limited strictly to the multi - reseller and b2c paradigm . rather , it is also contemplated that other business models can be accommodated within the single host computing platform of the present invention . for instance , a business - to - business ( b2b ) direct model can be accommodated in which a merchant sells directly to companies . also , a b2b direct extended sites model can be accommodated in which merchants can request for their stores to be hosted by an internet service provider ( isp ). in the b2b direct extended sites model , a new merchant access the hosting hub of the isp to request a new store . subsequently , the new merchant can proceed to create a store . finally , the new merchant can open the store to the general public . the isp , however , can maintain control over shared assets for the hosted stores . a demand chain model also can be accommodated in which a channel hub acts as the marketplace where resellers buy products from distributors to resell to the consumers . the consumer direct stores , distributors , and their relationships can be dynamically created in the demand chain model . similarly , a supply chain model can be accommodated in which a supplier hub acts as the marketplace bringing together suppliers and their buyers . the supplier stores and buyers in addition to their relationships with one another can be dynamically created in the supply chain model . the present invention can be realized in hardware , software , or a combination of hardware and software . an implementation of the method and system of the present invention can be realized in a centralized fashion in one computer system , or in a distributed fashion where different elements are spread across several interconnected computer systems . any kind of computer system , or other apparatus adapted for carrying out the methods described herein , is suited to perform the functions described herein . a typical combination of hardware and software could be a general purpose computer system with a computer program that , when being loaded and executed , controls the computer system such that it carries out the methods described herein . the present invention can also be embedded in a computer program product , which comprises all the features enabling the implementation of the methods described herein , and which , when loaded in a computer system is able to carry out these methods . computer program or application in the present context means any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following a ) conversion to another language , code or notation ; b ) reproduction in a different material form . significantly , this invention can be embodied in other specific forms without departing from the spirit or essential attributes thereof , and accordingly , reference should be had to the following claims , rather than to the foregoing specification , as indicating the scope of the invention . | 6 |
a process for producing 8 - alkyl - 8 - tricyclodecanyl 5 - norbornene - 2 - carboxylate according to the present invention will now be described in detail . as shown in the following reaction scheme ( 1 ), tricyclodecan - 8 - one and an alkyl grignard reagent or an alkyl lithium reagent are reacted to induce an alkyl group to a 8 - position of tricyclodecan - 8 - one , thereby synthesizing 8 - ethyl - 8 - tricyclodecanol . reaction scheme ( 1 ) ## str3 ## wherein r is methyl or ethyl , and x is cl or br . in view of side reaction inhibition and reaction yield , if 8 - ethyl - 8 - tricyclodecanyl 5 - norbornene - 2 - carboxylate is a desired compound , ethyl magnesium bromide or ethyl magnesium chloride is preferably used as a grignard reagent . since the above - described reaction is carried out by a general grignard reaction mechanism , the reaction temperature and pressure are meaningless in the present invention . next , as shown in the following reaction scheme ( 2 ), 8 - alkyl - 8 - tricyclodecanol and acryloyl chloride are reacted to synthesize 8 - alkyl - 8 - tricyclodecanyl acrylate . finally , as shown in the following reaction scheme ( 3 ), a norbornene substitute is prepared by the diels - alder reaction of 8 - alkyl - 8 - tricyclodecanyl acrylate and cyclopentadiene , thereby obtaining 8 - alkyl - 8 - tricyclodecanyl 5 - norbornene - 2 - carboxylate . the present invention is described in more detail below by referring to the following examples , and the examples are intended to illustrate but not limit the invention . 440 ml of a solution of ethyl magnesium bromide ( 1 . 0 m ) in tetrahydrofuran ( thf ) was diluted with 100 ml of anhydrous thf . then , the solution was put into a 1 liter flask and then maintained at 0 ° c . tricyclodecan - 8 - one ( 60 g , 0 . 4 mol ) was dropped slowly using a dropping funnel and then the reaction was stirred at room temperature for about 12 hours . after completion of the reaction , excess thf was removed using a rotary evaporator and then the resultant product was poured into water . then , the resultant product was neutralized with dilute sulfuric acid and extracted using diethyl ether and was then dried over magnesium sulfate . the obtained crude product was filtered by column chromatography ( n - hexane : ethylacetate = 8 : 1 ) to yield the desired product 8 - ethyl - 8 - tricyclodecanol ( yield : 70 %). 8 - ethyl - 8 - tricyclodecanol ( 36 g , 0 . 2 mol ) and triethylamine ( 0 . 22 mol ) were dissolved in 250 ml of thf and then acryloyl chloride ( 19 g , 0 . 21 mol ) was added slowly thereto using a dropping funnel . then , the reaction was stirred at room temperature for about 12 hours . after completion of the reaction , excess thf was removed using a rotary evaporator and then the resultant product was poured into water . then , the resultant product was neutralized with dilute chloric acid and extracted using diethyl ether and was then dried over magnesium sulfate . the obtained crude product was filtered by column chromatography ( n - hexane : ethylacetate = 4 : 1 ) to yield the desired product 8 - ethyl - 8 - tricyclodecanyl acrylate ( yield : 80 %). 1 h - nmr ( cdcl 3 ; ppm ): 6 . 3 ( 1h , d ), 6 . 1 ( 1h , dd ), 5 . 7 ( 1h , d ), 2 . 5 ( 1h , s ), 2 . 2 ( 2h , m ), 1 . 4 ( 2h , d ), 0 . 8 ( 3h , t ). ft - ir ( nacl ; cm - 1 ): 2947 , 2863 , 1722 , 1638 , 1621 , 1402 , 1205 8 - ethyl - 8 - tricyclodecanyl acrylate ( 47 g , 0 . 2 mol ) was dissolved in 250 ml of thf , cyclopentadiene ( 20 g , 0 . 3 mol ) was added slowly thereto at 0 ° c . and then the reaction temperature was raised to about 50 ° c . then , the reaction was stirred for about 20 hours . after completion of the reaction , excess thf was removed using a rotary evaporator and then the crude product was vacuum - distilled to yield the desired compound of viscous colorless liquid ( yield : 90 %) fig1 and 2 are nmr and ft - ir spectrums of the compound . 1 h - nmr ( cdcl 3 ; ppm ): 6 . 2 ( 1h , m ), 6 . 1 ( 1h , s ), 5 . 9 ( 1h , m ), 3 . 2 ( 1h , s ), 2 . 9 ( 2h , m ), 2 . 4 - 0 . 8 ( m ). ft - ir ( nacl ; cm - 1 ): 2944 , 2863 , 1727 , 1335 , 1270 , 1177 , 712 the title compound was prepared in the same manner as in example 1 , except that 3 . 0 m diethyl ether solution of methyl magnesium bromide was used instead of 1 . 0 m thf solution of ethyl magnesium chloride ( yield : 70 %). 8 - alkyl - 8 - tricyclodecanyl 5 - norbornene - 2 - carboxylate according to the present invention can be produced in a high yield by a simple process and is advantageous for mass production of a commercial scale . a norbornene compound having a bulky substituent can be commercially used as various kinds of flame retardants and is capable of copolymerizing with existing monomers to be used as polymer flame retardants . further , the norbornene compound can be useful in various applications which require the intrinsic reactivity of norbornene itself . | 2 |
a first embodiment of the present invention is described with reference to the drawings . fig3 is a drawing that schematically shows the entire configuration of an adaptive dispersion compensating element according to the first embodiment of the present invention . in fig3 number 101 is input light , 102 is an optical circulator , 103 is an optical coupler , 104 is a chirp bragg fiber grating , 105 is a temperature gradient impression device , 106 is a spectral resolution device , 107 is a spectrum analyzer , 108 is a controller , 109 is an optical fiber , and 110 is output light . the operation of the adaptive dispersion compensating element constituted as described above is described . the input light 101 passes through the optical circulator 102 and is incident on the chirp bragg fiber grating 104 and reflected as light whose dispersion is compensated , then returns to the circulator 102 again . subsequently , signal light is branched by the optical coupler 103 . the branched monitor light on the one side is incident on the spectral resolution device 106 and a frequency is analyzed by the spectrum analyzer 107 , then an electric signal that is the output of the spectrum analyzer 107 enters the controller 108 . further , the branched signal light on the other hand changes to the output light 110 . for example , if very - short - frequency pulse light is input , the light is provided with a broad frequency spectral component and necessarily susceptible to waveform dispersion . the light whose frequency is resolved by the spectral resolution device 106 is analyzed for the frequency by the spectrum analyzer 107 . if control is performed based on the signal , a high - speed light receiver is not necessary for compensation control of a dispersion value . the temperature gradient impression device 105 is controlled via the controller 108 so as to decrease a residual dispersion value in a desired waveform band . [ 0050 ] fig4 ( a ) is a graphical representation showing a residual dispersion value in the input light . fig4 ( b ) is a graphical representation showing a residual dispersion value in the output light . further , fig5 ( a ) is a graphical representation showing a pulse time width in the input light . fig5 ( b ) is a graphical representation showing a pulse time width in the output light . as described above , according to this embodiment , an adaptive dispersion compensating element that performs decentralized control in an optical fiber transmission path , such as performing dispersive compensation and waveform shaping in optical fiber transmission , can be realized . besides , in this embodiment , it is evident that the present invention is validated by suitably setting and executing structural parameters , such as the number of the chirp bragg fiber gratings 104 and temperature gradient impression devices 105 and the control of the distance between the chirp bragg fiber grating 104 and the temperature gradient impression device 105 by polishing the side of an optical fiber in which a chirp bragg grating is formed and forming a fine uneven shape by etching in accordance with characteristics , such as a bandwidth and a dispersion amount of an optical fiber to be compensated . a second embodiment of the present invention is described with reference to the drawings . fig6 ( a ) is a perspective view showing the entire configuration of a grating coupler used for spectral resolution . fig6 ( b ) is a top view of the grating coupler equally and fig6 ( c ) is a side view of the grating coupler equally . in fig6 ( a ), a number 201 is input light , 202 is a chirp bragg fiber grating , 203 is an optical fiber in which the chirp bragg fiber grating is formed , 204 is a top substrate , 205 is an optical fiber , 206 is a bottom substrate , and 207 is output light . the operation of the grating coupler constituted as shown above is described . the top substrate 204 that buries the optical fiber 203 in which the chirp bragg fiber grating 202 is formed and the surface of the bottom substrate 206 that buries the optical fiber 205 are smoothly worked to the vicinity of the optical fiber core by abrasion respectively . when the respective worked surfaces are stuck , both the optical fibers draw nearer and five fiber couplers are formed in fig6 ( a ). each of the fiber couplers has such structure as shown in the top drawing of fig6 ( b ) and the side view of fig6 ( c ). however , this fiber coupler differs from a usual fiber coupler in that a grating is formed in the fiber on the one side . for example , in fig6 ( b ) and 6 ( c ), a spectrum that is equivalent to a reflected wavelength which corresponds to a grating pitch among the output light from pin can be taken out from a p 2 port in a narrow band ( less than 1 nm ). beside , the crossing angle θ of both fibers at this time will be set to about several degrees . when the input light 201 , such as very - short - frequency pulse light , is incident on the optical fiber 203 in which the chirp bragg fiber grating 202 is formed , a grating pitch depends on a location . accordingly , a spectrum that is equivalent to a reflected wavelength which corresponds to the grating pitch at the location of each fiber coupler can be taken out respectively . consequently , the respective different spectrums whose wavelengths λ 1 to λ 5 can be taken out to the five optical fibers 205 . even if a grating coupler constituted of an optical fiber and an optical fiber in which a diffraction grating is formed is used for spectral resolution of the input light as shown above , the operation of an adaptive dispersion compensating element is the same operation as the first embodiment . the spectral resolution of an ultrahigh speed optical pulse of femto - second levels is simply performed by performing control based on the size of each spectral component taken out using a grating coupler and the optimum control is simply performed by performing decentralized control based on the result . as described above , an adaptive dispersion compensating element that performs dispersive compensation in simple and optimum conditions can be realized by the control based on the spectral resolution in optical fiber transmission . besides , in this embodiment , it is evident that the present invention is validated by suitably setting and executing structural parameters , such as the number of the chirp bragg fiber gratings 104 and temperature gradient impression devices 105 and the control of the distance between the chirp bragg fiber grating 104 and the temperature gradient impression device 105 by polishing the side of an optical fiber in which a chirp bragg grating is formed and forming a fine uneven shape by etching in accordance with characteristics , such as a bandwidth and a dispersion amount of an optical fiber to be compensated . an embodiment of the present invention is described with reference to the drawings . fig7 is a drawing showing a configuration of a chirp bragg grating . the configuration consists of areas ( areas a and b ) having two nonlinear chirp characteristics and a temperature gradient can independently be impressed to each area . a number 301 is a first nonlinear chirp bragg grating , 302 is a first temperature gradient impression device , 303 is a second nonlinear chirp bragg grating , and 304 is a second temperature gradient impression device . [ 0063 ] fig8 ( a ) is a drawing showing a group delay versus waveform characteristic of the chirp bragg grating according to the third embodiment of the present invention . [ 0064 ] fig8 ( b ) is a drawing showing a secondary dispersion versus wavelength characteristic of the chirp bragg grating according to the third embodiment of the present invention . [ 0065 ] fig8 ( c ) is a drawing showing a tertiary dispersion versus waveform characteristic of the chirp bragg grating according to the third embodiment of the present invention . the band of a chirp fiber diffraction grating is assumed to be 5 nm and the temperature characteristic ( wavelength change ) of a chirp fiber bragg grating is assumed to be 0 . 01 nm /° c . respectively . fig8 ( a ) is a drawing showing a group delay versus waveform characteristic of the chirp bragg grating according to the third embodiment of the present invention . the solid line of fig8 ( a ) shows an example of the wavelength dependence of a group delay of a nonlinear chirp bragg grating in the areas a and b . hereupon , when the temperature gradient of 50 ° c . is assigned to the area a , as shown in a dotted line , the reflection characteristic according to the temperature characteristic of the fiber diffraction grating changes from 1 , 555 nm to 1 , 554 . 5 nm by 0 . 5 nm . accordingly , fig8 ( b ) is a drawing showing a secondary dispersion versus wavelength characteristic of the chirp bragg grating according to the third embodiment of the present invention . as shown in fig8 ( b ), the group velocity slope ( secondary dispersion ) changes from − 30 ps / nm to − 37 . 5 ps / nm . further , fig8 ( c ) is a drawing showing a tertiary dispersion versus waveform characteristic of the chirp bragg grating according to the third embodiment of the present invention . as shown in fig8 ( c ), the tertiary dispersion ( secondary dispersion slope ) changes from − 4 ps / nm 2 to − 6 . 1 ps / nm 2 . accordingly , if a group velocity gradient can be changed by assigning the temperature gradient of 50 degrees to a specific part of the area a , the tertiary dispersion can be controlled in the order of several ps / nm 2 . as described above , a chirp bragg grating is constituted of multiple areas having a nonlinear chirp characteristic . when a wavelength dispersive characteristic is also controlled by independently impressing a temperature gradient to each area , the operation of an adaptive dispersion compensating element is the same operation as the first embodiment , and it can be realized that residual dispersion , such as higher order dispersion , is compensated . as described above , this embodiment has operation that compensates the residual dispersion , such as higher order dispersion , by controlling a wavelength dispersion characteristic finely and adaptively . besides , in this embodiment , it is evident that the present invention is validated by suitably setting and executing structural parameters , such as the number of the chirp bragg fiber gratings 104 and temperature gradient impression devices 105 and the control of the distance between the chirp bragg fiber grating 104 and the temperature gradient impression device 105 by polishing the side of an optical fiber in which a chirp bragg grating is formed and forming a fine uneven shape by etching in accordance with characteristics , such as a bandwidth and a dispersion amount of an optical fiber to be compensated . an embodiment of the present invention is described with reference to the drawings . fig9 shows an outline of the entire configuration of an adaptive dispersion compensating element . in fig9 a number 401 is input light , 402 is a first optical circulator , 403 is a first chirp bragg fiber grating , 404 is a first temperature gradient impression device , 405 is an optical fiber , and 406 is a second optical circulator . further , number 407 is a second chirp bragg fiber grating , 408 is a second temperature gradient impression device , 409 is an optical fiber , 410 is an optical coupler , 411 is a spectral resolution device , 412 is a spectrum analyzer , 413 is a controller , 414 is an optical fiber , and 415 is output light . the operation of the adaptive dispersion compensating element constituted as shown above is described . the input light 401 passes through the optical circulator 402 and is incident on the chirp bragg fiber grating 403 and reflected as light whose dispersion is compensated , then returns to the circulator 402 again . subsequently , the input light passes through the second optical circulator 406 and is incident on the first chirp bragg fiber grating 407 and reflected as light whose dispersion is compensated , then returns to the second circulator 406 . at this time , the first chirp bragg fiber grating and the second chirp bragg fiber grating are connected so that the chirping direction will be reverse in the connection with each optical circulator and has the configuration in which the secondary dispersion generated in this dispersion compensating element can be cancelled . subsequently , signal light is branched by the optical coupler 410 . the branched monitor light on the one side is incident on the spectral analytical device 411 and a frequency is analyzed by the spectrum analyzer 412 . an electric signal that is the output from the spectrum analyzer 412 enters the controller 413 . further , the branched signal light on the other side changes to the output light 415 . for example , when very - short - frequency pulse light is input , the light is provided with a broad frequency spectrum component and necessarily susceptible to waveform dispersion . the light whose frequency is analyzed by the spectral resolution device 411 is analyzed for the frequency by the spectrum analyzer 412 . if control is performed based on the signal , a high - speed light receiver is not necessary for compensation control of a dispersion value . the temperature gradient impression device 410 and the second temperature gradient impression device 408 are controlled via the controller 413 so as to decrease a residual dispersion value in a desired waveform band . as described above , according to the present embodiment , an adaptive dispersion compensating element that performs decentralized control in an optical fiber transmission path , such as performing dispersive compensation and waveform shaping in optical fiber transmission , can be realized . besides , in this embodiment , it is evident that the present invention is validated by suitably setting and executing structural parameters , such as the number of the chirp bragg fiber gratings 104 and temperature gradient impression devices 105 and the control of the distance between the chirp bragg fiber grating 104 and the temperature gradient impression device 105 by polishing the side of an optical fiber in which a chirp bragg grating is formed and forming a fine uneven shape by etching in accordance with characteristics , such as a bandwidth and a dispersion amount of an optical fiber to be compensated . the present invention is described based on desirable embodiments shown in the drawings . however , it is evident that a person skilled in the art can easily change and alter the present invention , and such changing part is also included within the scope of the invention . | 6 |
in the preferred embodiment of this invention the book shown in fig1 and 2 , having five leaves , is made from a continuous web or foil of cloth a shown in fig3 a and 3b , which web is approximately 681 / 2 &# 34 ; by 9 &# 34 ;. the book &# 39 ; s final dimensions are an overall thickness of about two and one - half inches , a height of 71 / 2 inches and a width of 6 inches . the marks or &# 34 ; notches &# 34 ; numbered 0 and 00 through 38 in fig3 a and 3b ( and in the succeeding figures ) are used for alignment of the respective sections of web a during construction of the book and must be located on web a in a precise manner for best results . referring to fig3 a and 3b , and starting at the right - hand margin of web a , with the &# 34 ; right &# 34 ; side of the material facing up , the marks or notches , in the case of the particular size web herein described , are located as follows : a suitable seam allowance plus an extra one - quarter inch -- one half the separation of leaves at the binding or spine -- is provided for by placing the first two notches , 11 and 22 , one inch to the left of the right - hand margin ; notches 10 and 21 are then placed six inches ( the eventual leaf width ) from notches 11 and 22 ; notches 9 and 20 are located one half inch ( the eventual leaf thickness ) from notches 10 and 21 ; notches 8 and 19 are located six inches from notches 9 and 20 and the sequence is repeated until notches 0 and 00 are located six inches to the left of notches 1 and 12 . at that point , in order to provide for what will be the binding or spine of the book the next notches , 30 and 38 , are located two and one - half inches ( equal to the thickness of the five eventual leaves ) from 0 and 00 and then notches 29 and 37 are located six inches from 30 and 38 ; notches 28 and 36 are located one - half inch from notches 29 and 37 ; notches 27 and 35 are placed six inches from notches 28 and 36 and so on until notches 23 and 31 are located approximately one inch from the left - hand margin of web a , thus providing further seam allowance plus an additional quarter - inch for the reason indicated above . all notches should be made quite accurately at right angles to the longitudinal margins of the web prior to beginning to construct the pockets identified in some of the drawings as d and d &# 39 ;. for purposes of explanation herein , fig3 a and fig3 b show the locations of fold lines ( phantom ) and the eventual stitch lines ( dotted ). it will be understood that neither the numbers nor the lines need actually be placed on the web in order to construct the book and that , indeed , if they were , they would have to be readily eraseable . referring now to fig4 the &# 34 ; right &# 34 ; side of web a has been folded upon itself along a line intermediate the two sets of notches 1 and 2 , and 12 and 13 so that such notches as well as notches 0 and 3 and 00 and 14 are exactly aligned as shown in fig4 . after thus aligning those notches , lines of stitches , paralleling the upper and lower margins of the web and one - half inch in from the respective margins , are run from notches 0 and 3 and notches 00 and 14 to the fold as shown in fig5 . upon completion of these two lines of stitching the first pocket ( still inside - out at this point ) shown as d in fig6 has been formed . to form the second pocket d &# 39 ; ( in fig7 ), web a is first folded as shown in fig6 along the line intermediate notches 5 and 6 on the top margin and 16 and 17 on the bottom margin . once those notches are aligned and notches 4 and 7 are aligned with notches 15 and 18 , two lines of stitches , one - half inch in from and parallel to the respective margins , are run from notches 4 and 7 on top and 15 and 18 on the bottom to the fold as shown in fig7 . in like manner , the remaining pockets are formed as shown in fig7 - 9 . after having thus formed the five pockets , the final step , before turning them right - side - out , is to do the stitching shown in enlarged detail , in fig1 a , 11b and 11c to form what will be squared corners on each of the leaves , after the pockets have been turned right - side - out . such a squared corner is preferably formed by the steps of ( 1 ) holding an inside - out pocket in a vertical position ; ( 2 ) flattening the pocket on a table or other surface so as to form apex e of the resulting triangular configuration with seam f bisecting the triangle ; ( 3 ) fold flap g flat and stitch a one - half inch seam h perpendicular to seam f , i . e . extending a quarter inch on either side of seam f and forming the base of a triangle with termini at i and j . such procedure should be carried out at the ten corners of the five pockets . once the squared corners have been made , the pockets may be turned right - side - out and , as shown in fig1 , the five foamed inserts k -- sized to fit quite snugly in the pockets -- are inserted . when all five inserts are in place , the book has reached the form shown in fig1 . the final stitching can then be carried out along the length of the binding area between each of the leaves as shown at l in fig1 . the ends m and n of web a are lapped , and a lengthwise seam ( not shown ) is stitched to fix the two together and at the same time attach the two ends to binding p . if desired , a final stitching , e . g . zig - zag , may be used to close up the top and bottom openings between the backs of the pockets and the binding and thus prevent fingers , dirt , etc . from intruding . while the foregoing description has been given in connection with a preferred embodiment of a book of a particular size constructed from a web of a particular size , it will be understood , of course , that the number of leaves and their dimensions , including leaf thickness , may be varied without departing in any way from the invention . set forth below is an equation which can be used to determine the length of the web for a book of any desired dimensions . the width of the web for any size book should be equal to the desired length of a leaf plus twice the seam allowance . and it has been found generally satisfactory to provide for a seam allowance of three - quarters of an inch . while the notches at each end of web a are one inch from the margin , only three - quarters of this is seam allowance with the remainder providing spacing distance between leaves . referring to the above equation and for purposes of example , calculating the length of a web to make a seven leaf book having leaves seven inches in width and one - quarter inch in thickness , it can readily be determined that the web should be 100 . 0 inches . assuming further that the desired length of a leaf is eight inches , the width of the web should be nine and one - half inches . the notches would then be located in accordance with these same values of n , x , y , and z . the first notches would be placed about seven - eighths of an inch in from the margin , the next notches would be located seven inches therefrom , the next one - quarter inch further to the left , the next seven inches further on , etc . the section for the binding or spine , which would be an inch and three - quarters would likewise be provided for . the binding section may be anywhere on the web but it is preferred in the approximate center of the web . whereas a book of this type could theoretically be of almost any size , its use by a small child generally will dictate sizes such as have been described herein . the individual leaves can likewise vary fairly widely in thickness without departing from the invention , but again , for practical usage of the ultimate product and ease of construction , it is preferred that a leaf thickness of from about one - eighth inch to not more than about three - quarters of an inch be used . to demonstrate that the invention is in no sense limited dimensionally to a book which a child or even a parent could hold in his or her hand , a book having pages an inch or more in thickness and a length and width , for example , of several feet could be made as a model , a special novelty item , etc . and even used as a piece of furniture such as a table , seat or bed . the web shown in the drawings is laid out with the multiple sections for the pages more or less evenly divided on either side of the binding section , but such a layout is only preferred and not essential . it is preferred because the final stitching which combines the free ends and attaches them to the binding ends up in a location between two internal leaves rather than , for example , on the outside of the book . while the preferred embodiment of the book and its construction has been described in terms of forming seams by sewing , some or all of such seams may also be formed by other means , e . g . adhesive , velcrol , etc . without departing from the spirit of the invention . from the standpoint of the child &# 39 ; s safety , the permanence of the seams and the fun of constructing the book when the same is supplied in kit form , sewing is the preferred technique for forming the seams . the web material may be woven , non - woven , natural fiber , synthetic resin , etc . a readily washable material is preferred for reasons which are apparent to those familiar with the habits of small children . while described as continuous , in accordance with the preferred embodiment of the invention , it will be understood that the web need not necessarily be a continuous piece of the same material but can comprise a series of connected pieces of different color , texture , etc . | 1 |
it has surprisingly been found that the use of a contact protective dithiocarbamate fungicide along with at least one systemic fungicide effectively penetrates the dense canopy barrier of the infected leguminous plant while simultaneously not allowing the rust pathogen to move up the plant foliage . without wishing to be bound by theory , it is believed that the contact protective dithiocarbamate fungicide component of the combination effectively penetrates the dense plant foliage , while the systemic fungicide component effectively prevents the rust pathogen from infecting the remaining portion of the plant effectively reducing the susceptibility of the plant towards the infection . this synergistic complementation was not seen when either the foliar protective fungicide or the systemic fungicide were individually used in isolation , but was observed when the two fungicides were used in conjunction . this synergistic complementation between the contact preventive dithiocarbamate fungicide and a systemic fungicide for the treatment and control of phakopsora species of fungicides was unexpected and surprising . thus , in an aspect , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with at least one multi - site contact fungicide ; and concurrently , prior or subsequently to the multi - site contact fungicide , with at least one systemic fungicide . the multi - site contact fungicides of the present invention inhibit fungal growth through multiple sites of action and have contact and preventive activity . in an embodiment , the multi - site contact fungicide may be selected from copper fungicides , sulfur fungicides , dithiocarbamate fungicides , phthalimide fungicides , chloronitrile fungicides , sulfamide fungicides , guanidine fungicides , triazines fungicides and quinone fungicides . the copper fungicides of the present invention are inorganic compounds containing copper , typically in the copper ( ii ) oxidation state and are preferably selected from copper oxychloride , copper sulfate , copper hydroxide and tribasic copper sulfate ( bordeaux mixture ). the sulfur fungicides of the present invention are inorganic chemicals containing rings or chains of sulfur atoms and is preferably elemental sulfur . the dithiocarbamate fungicides of the present invention contain a dithiocarbamate molecular moiety and are selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb . the phthalimide fungicides of the present invention contain a phthalimide molecular moiety and are selected from folpet , captan and captafol . the chloronitrile fungicide of the present invention comprises an aromatic ring substituted with chloro - and cyano - substituents and is preferably chlorothalonil . the sulfamide fungicides of the present invention are preferably selected from dichlofluanid and tolylfluanid . the guanidine fungicides of the present invention are preferably selected from dodine , guazantine and iminoctaadine . the triazine fungicide of the present invention is preferably anilazine . the quinone fungicide of the present invention is preferably dithianon . in an embodiment , the multi - site contact fungicide of the present invention is a dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb . thus , in this aspect , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with at least one dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb ; and concurrently , prior or subsequently to the dithiocarbamate fungicide , with at least one systemic fungicide . in an embodiment , the multi - site contact fungicide is a combination of mancozeb and chlorothalonil . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with at least one systemic fungicide . the term contact fungicide as used herein for the dithiocarbamate fungicides denotes a fungicide that remains at the site where it is applied but does not travel within the plant . typically , these fungicides do not show any post - infection activity . in an embodiment , the contact dithiocarbamate fungicide may be applied repeatedly at the site of the infection at pre - determined time intervals . the term “ systemic fungicide ” as used herein shall denote a fungicide that is absorbed into the plant tissue and possesses at least some amount of an after - infection activity . preferably , the systemic fungicide of the present invention is capable of moving freely throughout the plant . however , the term “ systemic fungicide ” is intended herein to include the upwardly systemic fungicide as well as the locally systemic fungicide . in an embodiment , the systemic fungicide is preferably a quinone outside inhibitor ( qol ). in this embodiment , the quinone outside inhibitor is selected from an imidazolinone fungicide , an oxazolidinedione fungicide or a strobilurin fungicide . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with at least one dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb , or combinations thereof with chlorothalonil ; and concurrently , prior or subsequently to the dithiocarbamate fungicide , with at least one quinone outside inhibitor . the qol inhibitors useful in this embodiment of the present invention effect the inhibition of complex iii : cytochrome bcl ( ubiquinol oxidase ) at qo site i . e . cyt b gene . in another embodiment , the strobilurin fungicide is selected from the group consisting of azoxystrobin , mandestrobin , coumoxystrobin , enoxastrobin , flufenoxystrobin , pyraoxystrobin , dimoxystrobin , enestrobin , fluoxastrobin , kresoxim - methyl , metominostrobin , orysastrobin , picoxystrobin , pyrametostrobin , triclopyricarb , fenaminstrobin , pyraclostrobin and trifloxystrobin . in another embodiment , the systemic fungicide of the present invention is preferably a demethylation inhibitor ( dmi ). thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with at least one dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb or combinations thereof with chlorothalonil ; and concurrently , prior or subsequently to the dithiocarbamate fungicide , with at least one demethylation inhibitor . in this embodiment , the preferred dmi inhibitor is preferably a conazole fungicide selected from the group consisting of climbazole , clotrimazole , imazalil , oxpoconazole , prochloraz , prochloraz - manganese , triflumizole , azaconazole , bitertanol , bromuconazole , cyproconazole , diclobutrazol , difenoconazole , diniconazole , diniconazole - m , epoxiconazole , etaconazole , fenbuconazole , fluotrimazole , fluquinconazole , flusilazole , flutriafol , furconazole , furconazole - cis , hexaconazole , imibenconazole , ipconazole , metconazole , myclobutanil , pencoconazole , propiconazole , prothioconazole , quinconazole , simeconazole , tebuconazole , tetraconazole , triadimefon , triadimenol , triticonazole , uniconazole , perfurazoate and uniconazole - p . in another embodiment , the preferred dmi inhibitor is preferably selected from triflumizole , triforine , pyridinitrile , pyrifenox , fenarimol , nuarimol and triarimol . in another embodiment , the systemic fungicide of the present invention is a combination of at least one quinone outside inhibitor and at least demethylation inhibitor . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with at least one dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb ; and concurrently , prior or subsequently to the dithiocarbamate fungicide , with at least one quinone outside inhibitor and at least one demethylation inhibitor . in an embodiment , the preferred quinone outside inhibitor is a strobilurin fungicide and the preferred demethylation inhibitor is a conazole fungicide . in this embodiment , the preferred dithiocarbamate is selected from the group consisting of thiram , ziram , mancozeb , maneb , metiram , propineb and zineb . therefore , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with at least one dithiocarbamate fungicide selected from thiram , ziram , mancozeb , maneb , metiram , propineb and zineb or combinations thereof with chlorothalonil ; and concurrently , prior or subsequently to the dithiocarbamate fungicide , with at least one strobilurin fungicide and at least one conazole fungicide . in an embodiment , the preferred dithiocarbamate is mancozeb . in this embodiment , the preferred strobilurin fungicide is selected from trifloxystrobin , picoxystrobin , azoxystrobin or pyraclostrobin , while the preferred conazole fungicide is selected from prothioconazole , tebuconazole , cyproconazole , epoxiconazole , metconazole and tebuconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb or combinations thereof with chlorothalonil ; and concurrently , prior or subsequently to mancozeb , with at least one strobilurin fungicide selected from trifloxystrobin , picoxystrobin , azoxystrobin or pyraclostrobin and at least one conazole fungicide selected from prothioconazole , tebuconazole , cyproconazole , epoxiconazole , metconazole and tebuconazole . in one embodiment , the preferred strobilurin is trifloxystrobin and the preferred conazole is prothioconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with trifloxystrobin and with prothioconazole . in one embodiment , the preferred strobilurin is picoxystrobin and the preferred conazole is tebuconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with picoxystrobin and with tebuconazole . in one embodiment , the preferred strobilurin is picoxystrobin and the preferred conazole is cyproconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with picoxystrobin and with cyproconazole . in one embodiment , the preferred strobilurin is azoxystrobin and the preferred conazole is cyproconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with azoxystrobin and with cyproconazole . in one embodiment , the preferred strobilurin is pyraclostrobin and the preferred conazole is epoxiconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with pyraclostrobin and with epoxiconazole . in one embodiment , the preferred strobilurin is pyraclostrobin and the preferred conazole is tebuconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with pyraclostrobin and with tebuconazole . in one embodiment , the preferred strobilurin is pyraclostrobin and the preferred conazole is metconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with pyraclostrobin and with metconazole . in another embodiment , the preferred strobilurin is trifloxystrobin and the preferred conazole is selected from cyproconazole , propiconazole or tebuconazole . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with mancozeb ; and concurrently , prior or subsequently to mancozeb , with trifloxystrobin and with at least one compound selected from cyproconazole , propiconazole or tebuconazole . in another embodiment , the systemic fungicide of the present invention is a quinone inside inhibitor . preferably , the quinone inside inhibitor includes cyanoimidazole fungicides and sulfamoyltriazole fungicides . in an embodiment , the quinone inside inhibitor is selected from cyazofamid and amisulbrom . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with at least one dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb or combinations thereof with chlorothalonil ; and concurrently , prior or subsequently to the dithiocarbamate fungicide , with at least one quinone inside inhibitor . in another embodiment , the systemic fungicide of the present invention is a succinate dehydrogenase inhibitor fungicide ( sdhi ). preferably , the succinate dehydrogenase inhibitor is selected from the group consisting of benodanil , flutolanil , mepronil , fluopyram , fenfuram , carboxin , oxycarboxin , thifluzamide , bixafen , fluxapyroxad , furametpyr , isopyrazam , penflufen , penthiopyrad , sedaxane and boscalid . thus , in this embodiment , the present invention provides a method for treating soybean rust in a host leguminous plant , wherein the method comprises treating the plant at the locus of the infection with at least one dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb or combinations thereof with chlorothalonil ; and concurrently , prior or subsequently to the dithiocarbamate fungicide , with at least one succinate dehydrogenase inhibitor . it has been found that a combination of a multi - site contact fungicide , preferably a dithiocarbamate fungicide , along with a systemic fungicide selected from at least one qo inhibitor ( quinone outside inhibitors ), at least one qi ( quinone inside ) inhibitor , at least one dm inhibitor ( demethylation inhibitor ) or at least one sdh inhibitor ( succinate dehydrogenase inhibitors ) leads to an unexpected and surprisingly good control of soybean rust as compared to other fungicides reported in the art . surprisingly , it has been found that dithiocarbamates , preferably mancozeb or combinations thereof with chlorothalonil , acts as a synergist to improve disease control and plant health of a host legume plant infected with soybean rust when applied concurrently or subsequently to at least two fungicides selected from qo inhibitors ( quinone outside inhibitors ), dm inhibitors ( demethylation inhibitor ), sdh inhibitors ( succinate dehydrogenase inhibitors ), qi inhibitors ( quinone inside inhibitors ) or combinations thereof . the present inventors believe that these combinations have never been hitherto reported in the art and many of their surprising properties never been envisaged . these combinations were found to possess surprisingly improved efficacy of enhanced disease control of asian soybean rust caused by phakopsora pachyrhizi and / or phakopsora meibomiae infections . these combinations were also found to improve the quality of the plant by decreasing stress and improving nutrition levels , thereby increasing the yield of the plant that was infected with a fungicidal infection , especially with the soybean rust infection . in an embodiment , these combinations were also found especially effective against corynespora , antbracnose , cercospora , leaf spot , rhizoctonia and sclerotinia families of fungi apart from their superior efficacy against phakopsora family of fungi . thus , in this aspect , the present invention provides a fungicidal combination comprising at least one multi - site contact fungicide , a first systemic fungicide and a second systemic fungicide . in this aspect , the multi - site contact fungicide may be selected from copper fungicides , sulfur fungicides , dithiocarbamate fungicides , phthalimide fungicides , chloronitrile fungicides , sulfamide fungicides , guanidine fungicides , triazines fungicides and quinone fungicides . the copper fungicides of this aspect are inorganic compounds containing copper , typically in the copper ( ii ) oxidation state and are preferably selected from copper oxychloride , copper sulfate , copper hydroxide and tribasic copper sulfate ( bordeaux mixture ). the sulfur fungicides of this aspect are inorganic chemicals containing rings or chains of sulfur atoms and is preferably elemental sulfur . the dithiocarbamate fungicides of this aspect contain a dithiocarbamate molecular moiety and are selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb . the phthalimide fungicides of this aspect contain a phthalimide molecular moiety and are selected from folpet , captan and captafol . the chloronitrile fungicide of this aspect comprises an aromatic ring substituted with chloro - and cyano - substituents and is preferably chlorothalonil . the sulfamide fungicides of this aspect are preferably selected from dichlofluanid and tolylfluanid . the guanidine fungicides of this aspect are preferably selected from dodine , guazantine and iminoctaadine . in an embodiment , the multi - site contact fungicide of this aspect is preferably selected from ( a ) a dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb ; and ( b ) a chloronitrile fungicide , which is chlorothalonil . thus , in this aspect , the present invention provides a fungicidal combination comprising : ( i ) a multi - site contact fungicide selected from ( a ) a dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb ; or ( b ) a chloronitrile fungicide , which is chlorothalonil and combinations thereof ; ( ii ) a first systemic fungicide selected from a quinone outside inhibitor , a quinone inside inhibitor , demethylation inhibitor and succinate dehydrogenase inhibitor ; and ( iii ) a second systemic fungicide selected from a quinone outside inhibitor , a quinone inside inhibitor , demethylation inhibitor and succinate dehydrogenase inhibitor . in an embodiment , the first and second systemic fungicides are preferably different from each other . in an embodiment , when the multi - site contact fungicide is a combination of mancozeb and chlorothalonil , the preferred systemic fungicide is at least one systemic fungicide selected from quinone outside inhibitor , quinone inside inhibitor , demethylation inhibitor or a succinate dehydrogenase inhibitor . in a preferred embodiment , the first and second systemic fungicides are selected from different classes of systemic fungicides . for example : ( i ) when the first systemic fungicide is a demethylation inhibitor , the second systemic fungicide is selected from a quinone outside inhibitor , a quinone inside inhibitor and succinate dehydrogenase inhibitor ; or when ( ii ) the first systemic fungicide is a quinone outside inhibitor , the second systemic fungicide is selected from a quinone inside inhibitor , demethylation inhibitor and succinate dehydrogenase inhibitor ; or when ( iii ) the first systemic fungicide is a quinone inside inhibitor , the second systemic fungicide is selected from a quinone outside inhibitor , a demethylation inhibitor and a succinate dehydrogenase inhibitor ; or when ( iv ) the first systemic fungicide is a succinate dehydrogenase inhibitor , the second systemic fungicide is selected from a quinone outside inhibitor , a quinone inside inhibitor and a demethylation inhibitor . thus , in this aspect , the present invention provides a fungicidal combination comprising : ( i ) a multi - site contact fungicide selected from ( a ) a dithiocarbamate fungicide selected from amobam , asomate , azithiram , carbamorph , cufraneb , cuprobam , disulfiram , ferbam , metam , nabam , tecoram , thiram , urbacide , ziram , dazomet , etem , milneb , mancopper , mancozeb , maneb , metiram , polycarbamate , propineb and zineb ; or ( b ) a chloronitrile fungicide , which is chlorothalonil or combination thereof ; ( ii ) a first systemic fungicide selected from a quinone outside inhibitor , a quinone inside inhibitor , demethylation inhibitor and succinate dehydrogenase inhibitor ; and ( iii ) a second systemic fungicide selected from a quinone outside inhibitor , a quinone inside inhibitor , demethylation inhibitor and succinate dehydrogenase inhibitor ; such that ( a ) when the first systemic fungicide is a demethylation inhibitor , the second systemic fungicide is selected from a quinone outside inhibitor , a quinone inside inhibitor and succinate dehydrogenase inhibitor ; or when ( b ) the first systemic fungicide is a quinone outside inhibitor , the second systemic fungicide is selected from a quinone inside inhibitor , demethylation inhibitor and succinate dehydrogenase inhibitor ; or when ( c ) the first systemic fungicide is a quinone inside inhibitor , the second systemic fungicide is selected from a quinone outside inhibitor , a demethylation inhibitor and a succinate dehydrogenase inhibitor ; or when ( d ) the first systemic fungicide is a succinate dehydrogenase inhibitor , the second systemic fungicide is selected from a quinone outside inhibitor , a quinone inside inhibitor and a demethylation inhibitor ; or ( e ) when the multi - site contact fungicide is a combination of mancozeb and chlorothalonil , the systemic fungicide is at least one of a quinone outside inhibitor , a quinone inside inhibitor , a succinate dehydrogenase inhibitor and a demethylation inhibitor in a preferred embodiment , the preferred quinone outside inhibitor is a strobilurin fungicide and the preferred demethylation inhibitor is a conazole fungicide . in this embodiment , the preferred dithiocarbamate is selected from the group consisting of thiram , ziram , mancozeb , maneb , metiram , propineb and zineb . therefore , in this embodiment , the present invention provides a fungicidal combination comprising at least one multi - site contact fungicide selected from thiram , ziram , mancozeb , maneb , metiram , propineb , zineb and chlorothalonil or combinations thereof ; at least one strobilurin fungicide and at least one conazole fungicide . in an embodiment , the preferred dithiocarbamate is mancozeb . in this embodiment , the preferred strobilurin fungicide is selected from trifloxystrobin , picoxystrobin , azoxystrobin or pyraclostrobin , while the preferred conazole fungicide is selected from prothioconazole , tebuconazole , cyproconazole , epoxiconazole , metconazole and tebuconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil or combinations thereof ; at least one strobilurin fungicide selected from trifloxystrobin , picoxystrobin , azoxystrobin or pyraclostrobin and at least one conazole fungicide selected from prothioconazole , tebuconazole , cyproconazole , epoxiconazole , metconazole and tebuconazole . in one embodiment , the preferred strobilurin is trifloxystrobin and the preferred conazole is prothioconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil ; trifloxystrobin and prothioconazole . in one embodiment , the preferred strobilurin is picoxystrobin and the preferred conazole is tebuconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil ; picoxystrobin and tebuconazole . in one embodiment , the preferred strobilurin is picoxystrobin and the preferred conazole is cyproconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil ; picoxystrobin and cyproconazole . in one embodiment , the preferred strobilurin is azoxystrobin and the preferred conazole is cyproconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil ; azoxystrobin and cyproconazole . in one embodiment , the preferred strobilurin is pyraclostrobin and the preferred conazole is epoxiconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil ; pyraclostrobin and epoxiconazole . in one embodiment , the preferred strobilurin is pyraclostrobin and the preferred conazole is tebuconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil ; pyraclostrobin and tebuconazole . in one embodiment , the preferred strobilurin is pyraclostrobin and the preferred conazole is metconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil ; pyraclostrobin and metconazole . in another embodiment , the preferred strobilurin is trifloxystrobin and the preferred conazole is selected from cyproconazole , propiconazole or tebuconazole . thus , in this embodiment , the present invention provides a fungicidal combination comprising mancozeb or chlorothalonil ; trifloxystrobin and at least one compound selected from cyproconazole , propiconazole or tebuconazole . it was thus found that the addition of a dithiocarbamate fungicide to at least a demethylation inhibitor or a quinone outside inhibitor or a quinone inside inhibitor or a succinate dehydrogenase inhibitor or combinations thereof greatly increased the activity of the systemic fungicides over the expected disease control and expected yield . in an embodiment , the application of the dithiocarbamate fungicide may be prior , subsequent or concurrent to the application of the systemic fungicide . when the systemic fungicide is applied subsequently to the dithiocarbamate fungicide , such sequential application of the systemic fungicide may be within 24 hours to 4 weeks of the application of the dithiocarbamate fungicide . in the case of concurrent application , the dithiocarbamate may be tank mixed with other actives or per - formulated mixtures may be conveniently used . the addition of mancozeb to existing combination products greatly increased the efficacy of the known combinations , thereby acting as a synergist , improving the rate of disease control and improving the overall health of the plant . the amount of dithiocarbamate to be applied may range from 1 kg / ha to 2 . 5 kg / ha , preferred being 1 . 5 kg / ha to 2 . 0 kg ha . in an embodiment , the dithiocarbamate may be applied in an effective amount so as to act as a synergist to the systemic fungicides of the present invention . however , the appropriate amounts of the fungicides used in the present invention , whether multi - site contact fungicides or systemic fungicides , is not particularly limiting and may be conveniently chosen by a skilled artisan . the method of control of the present invention may be carried out by spraying the suggested tank mixes , or the individual fungicides may be formulated as a kit - of - parts containing various components that may be mixed as instructed prior to spraying . in an embodiment , the fungicides or the combinations thereof contemplated according to the present invention may be pre - formulated and may be in the form of water dispersible granules ( wdg ), wettable powders , suspension concentrates , emulsifiable concentrate , suspoemulsions , capsule suspensions etc . however , the choice of any preferred formulation type is not particularly limiting . adjuvants and ancillary ingredients may be used to formulate such pre - formulated compositions and may employ wetters , adhesives , dispersants or surfactants and , if appropriate solvent or oil and other agriculturally acceptable additives . in an embodiment , the present invention thus provides a composition comprising any of the fungicidal combinations such as herein described along with agriculturally acceptable excipients . it is readily understood that the method of treatment of the present invention may be used on all host plants that are infected by both phakopsora pachyrhizi and / or phakopsora meibomiae . such exemplary host plants may include soybean , fenugreek , kidney beans , pinto beans , fava or broadbeans , lima beans , mung beans , winged or goa beans , black - eyed pea , cowpea or yard - long bean , green peas , pigeon pea , swordbean , urd or black - gram etc . as will be demonstrated in the examples , the addition of a multi - site contact fungicide to a systemic fungicide ( s ) for the treatment of asr , greatly improved the disease control as well as improved yield . the lower the mixture performance in the rust control , the greater the additional benefit of the multi - site contact fungicide was seen . the method of the present invention improves the existing disease control to an unexpectedly high degree and surprisingly improves the yield obtained . the method of the present invention also allows for greater resistance control and decreases the amount of the actives used . these and other advantages of the invention may become more apparent from the examples set forth herein below . these examples are provided merely as illustrations of the invention and are not intended to be construed as a limitation thereof . a study was conducted to determine the fungitoxicity of the multi - site contact fungicide , a dithiocarbamate fungicide mancozeb to phakopsora pachyrhizi causal agent of asian soybean rust ( asr ) and the contribution of its incorporation to mixtures of strobilurin and triazole fungicides [ demethylation inhibitor ( dmi )+ quinone outside inhibitor ( qol )]. experiments were conducted in the field in nine locations where fungitoxicity of mancozeb to soybean rust was determined . two doses were tested ( 1 . 5 and 2 . 0 kg / ha in various application numbers for mancozeb . the effect of mancozeb ( 1 . 5 kg / ha ) incorporated to commercial mixtures was also tested . the tests were conducted on soybean cultivar monsoy 9144 rr . a commercially available mancozeb 750 wdg ( wettable granules ) formulation was used for applying mancozeb . the combination mixtures were used as follows : s no . combination used dosage a ( 1 ) 200 g / l azoxystrobin + 80 g / l cyproconazole 300 ml / ha a ( 2 ) mancozeb 750 wdg + 200 g / l azoxystrobin + 1500 g / ha + 300 80 g / l cyproconazole ml / ha b ( 1 ) 85 g / l pyraclostrobin + 62 . 5 g / l epoxiconazole 500 ml / ha b ( 2 ) mancozeb 750 wdg + 85 g / l pyraclostrobin + 1500 g / ha + 500 62 . 5 g / l eposiconazole ml / ha c ( 1 ) cyproconazole 80 g / l + picoxystrobin 200 g / l 300 ml / ha c ( 2 ) mancozeb 750 wdg + cyproconazole 80 g / l + 1500 g / ha + 300 picoxystrobin 200 g / l ml / ha d ( 1 ) picoxystrobin 200 g / l + tebuconazole 80 g / l 300 ml / ha d ( 2 ) mancozeb 750 wdg + picoxystrobin 200 g / l + 1500 g / ha + 300 tebuconazole 80 g / l ml / ha the percentage control of these experimental trials were noted and tabulated as hereunder : it was thus found that the incorporation of mancozeb increased the rust control of the conventional strobilurin + conazole fungicide treatment standard . it was further found that the lower the mixture performance in the rust control , the greater the additional benefit of mancozeb . it was thus concluded that the addition of a multi - site contact fungicide such as mancozeb acted as a synergist to the combination products registered for the treatment of asian soybean rust . the addition of a dithiocarbamate increased disease control and improved yield of plants . the instant invention is more specifically explained by above examples . however , it should be understood that the scope of the present invention is not limited by the examples in any manner . it will be appreciated by any person skilled in this art that the present invention includes aforesaid examples and further can be modified and altered within the technical scope of the present invention . | 0 |
number 1 in fig1 to 6 indicates as a whole a folding device fitted to a wrapping machine 2 to form a tubular wrapping 3 ( fig9 ), defined by a sheet of wrapping material 4 , about a substantially parallelepiped - shaped product — in the example shown , a group 5 of cigarettes 6 . device 1 comprises a wrapping wheel 7 fitted to wrapping machine 2 to rotate continuously clockwise , in fig1 to 6 , about an axis ( not shown ) perpendicular to the fig1 plane . wrapping wheel 7 supports a number of folding heads 8 ( only one shown ) equally spaced about the axis ( not shown ) of wrapping wheel 7 , and each comprising a cylindrical base 9 fitted to wrapping wheel 7 to oscillate , under the control of a known control device not shown , about a respective axis 10 parallel to the axis ( not shown ) of wrapping wheel 7 . each folding head 8 also comprises a radial tubular arm 11 , which has an axis 12 , extends outwards of wrapping wheel 7 from relative base 9 , and oscillates in known manner with relative base 9 about relative axis 10 . tubular arm 11 houses a rod 13 , coaxial with axis 12 , of a pusher 14 , which also comprises a plate fitted to the free end of rod 13 and defining the end wall 15 of a u - shaped pocket 16 , which is positioned with its concavity facing outwards of wrapping wheel 7 , has a longitudinal axis 17 ( fig2 ) parallel to relative axis 10 , and houses a respective group 5 with relative cigarettes 6 extending parallel to longitudinal axis 17 . end wall 15 is crosswise to respective axis 12 , and relative pocket 16 also comprises a lateral wall 18 downstream in the travelling direction of pocket 16 ; and a lateral wall 19 , which is upstream in the travelling direction of pocket 16 , faces and is substantially parallel , at least in a closed work position , to lateral wall 18 , and is crosswise to end wall 15 . lateral wall 18 is defined by one arm of a rocker arm 20 , which is hinged to the end of tubular arm 11 to oscillate , with respect to tubular arm 11 , about an axis 21 parallel to relative axis 10 , and comprises a further arm , which extends inside tubular arm 11 , alongside rod 13 , and defines a tappet 22 , which is pushed by a spring 23 into contact with a cam 24 fitted to rod 13 and movable with rod 13 to set lateral wall 18 to a normal closed position ( fig2 ) when end wall 15 is withdrawn to the back of pocket 16 , and to an open position when end wall 15 is in an extracted position ( fig1 ) outside lateral walls 18 and 19 . lateral wall 19 , which is similar in form to lateral wall 18 , is defined by the free end of one arm 25 of a rocker arm 26 fitted to a powered shaft 27 , which is parallel to relative axis 10 and oscillates about a respective axis to move relative lateral wall 19 between said closed work position ( fig6 ) and an open position ( fig3 ). lateral wall 19 is also provided , on a front surface 28 , with a heating device 29 . rocker arm 26 comprises a further arm 30 , which extends substantially perpendicularly to relative arm 25 towards relative axis 12 , and is fitted on its free end with a pin 31 parallel to relative axis 10 and sliding transversely inside an axial slot 32 of a link 33 fitted to tubular arm 11 to oscillate about axis 21 . link 33 extends from axis 21 towards rocker arm 26 , and is fitted on its free end with a contrast member defined by a plate 34 , which is substantially perpendicular to link 33 and oscillates with link 33 between a withdrawn rest position ( fig6 ), in which plate 34 is positioned radially inwards of relative pocket 16 , and a forward work position ( fig4 ), in which plate 34 is positioned partly inside relative pocket 16 , with a front lateral surface 35 of plate 34 positioned coplanar with the position occupied by front surface 28 of relative lateral wall 19 when lateral wall 19 is in the closed work position . link 33 and rocker arm 26 are connected , by relative pin 31 engaging relative slot 32 , so that , when relative lateral wall 19 moves to and from the closed work position , plate 34 moves to and from the withdrawn rest position . with reference in particular to fig3 to 6 , wrapping wheel 7 feeds pockets 16 continuously along an endless , in particular , circular path p extending through a folding station 36 , through which pockets 16 travel successively , and which comprises a disk 37 fitted to wrapping machine 2 to rotate continuously anticlockwise , in fig3 to 6 , about an axis 38 parallel to axis 10 . folding station 36 also comprises a shaft 39 fitted through disk 37 , parallel to and eccentric with respect to axis 38 , to oscillate about a respective axis under the control of a known cam device ( not shown ); and a folding member 40 defined by a blade fitted to shaft 39 and extending outwards of disk 37 from shaft 39 . operation of device 1 will be described below with reference to one pocket 16 and one group 5 , which , on reaching , in known manner , a position facing pocket 16 together with a respective sheet of wrapping material 4 , is fed , in known manner , along path p at the same speed as pocket 16 , and is gripped between a pusher 41 ( fig1 ) external to pocket 16 , and end wall 15 moved by pusher 14 into an extracted position ( fig1 ) radially outwards of lateral walls 18 and 19 , which are both in the open position , lateral wall 18 by tappet 22 contacting cam 24 fitted to rod 13 , and lateral wall 19 by operation of shaft 27 . subsequent movement of end wall 15 and external pusher 41 inwards of wrapping wheel 7 , together with a simultaneous movement of lateral wall 18 and a subsequent movement of lateral wall 19 into their closed positions ( fig2 ), forms pocket 16 and causes insertion inside pocket 16 of group 5 and relative sheet of wrapping material 4 , which , as it is being inserted inside pocket 16 , is folded about group 5 to define a narrow portion 42 contacting front surface 28 of lateral wall 19 and of a transverse dimension smaller than half the width of lateral wall 19 ; an inner portion 43 extending along end wall 15 ; and a lateral portion 44 extending along lateral wall 18 . a portion , integral with lateral portion 44 , of the sheet of wrapping material 4 projects from pocket 16 , and comprises an outer portion 45 , which , as pocket 16 travels along path p , is folded ( fig2 ) in known manner , e . g . by encountering an outer plate 46 , onto group 5 into a position parallel to and facing inner portion 43 ; and a portion 47 projecting rearwards , in the form of an extension of portion 45 , outwards of and beyond pocket 16 in a direction crosswise to portion 42 . portion 47 is of a transverse dimension greater than the transverse dimension of portion 42 , and greater than the width of front surface 28 of lateral wall 19 minus the width of portion 42 . pocket 16 , together with relative group 5 and relative sheet of wrapping material 4 , is then fed by wrapping wheel 7 through folding station 36 , prior to reaching which , lateral wall 19 is moved , by oscillation of powered shaft 27 and in the opposite direction to the travelling direction of pocket 16 , from the closed work position shown in fig2 , to the open position shown in fig3 to 5 . at the same time , the coupling between pin 31 and slot 32 causes relative plate 34 to move from the withdrawn rest position to the forward work position , in which plate 34 is positioned parallel to axis 12 , with its lateral surface 35 contacting portion 42 ( fig4 and 8 ) to hold portion 42 folded down on group 5 throughout the time lateral wall 19 remains in the open position . pocket 16 , still with lateral wall 19 in the open position , eventually reaches folding station 36 ( fig4 ) where , by continuous rotation of disk 37 about axis 38 and oscillation of shaft 39 , folding member 40 accompanies pocket 16 rotating about the axis ( not shown ) of wrapping wheel 7 , and , at the same time , is inserted radially through plate 46 into pocket 16 , between group 5 and lateral wall 19 in the open position , to fold portion 47 ( fig4 ) inside pocket 16 , onto group 5 , and into a position at least overlapping portion 42 ( fig5 and 9 ). as shown in fig7 , to enable passage of folding member 40 through plate 46 , plate 46 is defined , at least at folding station 36 , by a number of parallel strips 48 , and the blade defining folding member 40 is comb - shaped , and comprises a succession of teeth 49 , each of which engages a relative gap defined between two adjacent strips 48 . after smoothing portion 47 onto group 5 ( fig5 and 9 ), folding member 40 withdraws from pocket 16 , while still remaining substantially parallel to lateral wall 18 ( fig6 and 10 ). just before folding member 40 withdraws , lateral wall 19 is returned to the closed work position , thus moving plate 34 into the withdrawn rest position . as shown in fig7 , for it to close fully despite the presence of folding member 40 , lateral wall 19 comprises an end portion defined by a row of teeth 50 , which , when lateral wall 19 is in the closed work position , engage teeth 49 of folding member 40 comb - fashion . as front surface 28 of lateral wall 19 contacts lateral portion 47 , the heating device 29 on lateral wall 19 glues portion 47 to portion 42 , at the overlap between portions 42 and 47 , by melting hot - melt glue ( not shown ) deposited beforehand on at least one of portions 42 and 47 . alternatively , if the sheet of wrapping material 4 is made of heat - seal material , heating device 29 simply seals portions 42 and 47 to each other . | 1 |
referring to fig1 an internal combustion engine 1 is supplied with a mixture of fuel and air through appropriate conventional air - fuel mixing and proportioning means 2 ( carburetor or fuel injection ). engine 1 exhausts its spent gases through an exhaust conduit 3 including a catalytic converter 4 . catalytic converter 4 is a device of the type in which exhaust gases flowing therethrough are exposed to a catalytic substance which , given the proper air - fuel ratio in the exhaust gases , will promote simultaneous oxidation of carbon monoxide and hydrocarbons and reduction of oxides of nitrogen . exhaust conduit 3 is provided with an oxygen sensor 5 upstream from catalytic converter 4 . oxygen sensor 5 is preferably of the zirconia electrolyte type which , when exposed to engine exhaust gases at high temperatures , generate an output voltage which changes appreciably as the air - fuel ratio of the exhaust gases passes through the stoichiometric level , and the minimum and maximum levels of the sensor can vary greatly with its temperature . the signal from oxygen sensor 5 is fed into a dc amplifier 6 which supplies an amplified oxygen sensor signal to the noninverting input of an operational amplifier 7 for comparison with a reference voltage fed to the inverting input . the reference voltage is obtained from an averaging circuit which averages out the fluctuation of input voltage to representative a time integral of the oxygen sensor output . the averaging circuit is formed by a resistor r1 coupled to amplifier 6 and a capacitor c1 connected between resistor r1 and ground to develop an integrated voltage thereacross representing the time integral of the oxygen sensor output . the inverting input of operational amplifier 7 is connected to a junction point 8 by a resistor r2 and further coupled to the output by a feedback resistor rf having an appropriate value so that the operational amplifier 7 acts as a comparator providing an output at one of two discrete values depending upon whether the amplifier 6 output is above or below the reference voltage applied to its inverting input . the resistance value of feedback resistor rf is chosen in consideration of the operating characteristic of the later stage which includes proportional and integral control circuitry . the output from the comparator 7 is coupled to a proportional controller formed by a circuit including a normally closed relay contacts s1 and a resistor r3 , and also to an integral controller formed by operational amplifiers 10 and 11 . the inverting input of operational amplifier 10 is coupled to the output of comparator 7 by a resistor r4 and also to its output by an integrating capacitor c2 which is parallel connected with a normally open relay contacts s2 . the output of amplifier 10 is in turn connected by a resistor r5 to the inverting input of the amplifier 11 . amplifier 11 serves to invert the polarity of the input voltage so that its output is in phase with the output from the proportional controller . the output of amplifier 11 is coupled by a resistor r6 to the summing junction 12 of a summation amplifier 13 . to the summing junction 12 is also coupled the resistor r3 of proportional controller so that the output from summation amplifier 13 is a summation of the integration and proportioning of the sensed oxygen content in the exhaust gases and used to drive the air - fuel mixing and proportioning device 2 . the output from the comparator 7 is also coupled to the base of a transistor t1 by a circuit including a diode d1 and resistor r7 and r8 connected in series . the junction of resistors r7 and r8 is connected to ground by a capacitor c3 , and the base of transistor t1 is connected to ground by a capacitor c4 which is coupled in parallel with a resistor r9 . the emitter of transistor t1 is coupled to ground by a resistor r10 , the collector being connected to voltage supply vcc . capacitors c3 and c4 are charged when the comparator output rises in voltage and provides a bias for the transistor t1 . when transistor t1 is conductive , a voltage vl &# 39 ; is developed across the resistor r10 which is coupled to the junction point 8 by a diode d3 . the lower level of the voltage at the junction 8 is clamped to a voltage vl determined by the junction of resistors r11 and r12 . the voltage vl is chosen to represent the temperature in the exhaust conduit that warrants the start of closed control operation . the junction of resistors r11 and r12 is coupled by a diode d4 to the junction 8 so that the voltage at junction 8 is maintained at the voltage vl when the time integral of the oxygen sensor output reduces below vl . the voltage vl &# 39 ; is chosen at a value higher than voltage vl to represent the temperature in the exhaust conduit that warrants the suspension of closed control operation . once the oxygen sensor is in operative temperature range , the reference voltage at the junction 8 is raised to the voltage level vl &# 39 ; from vl so that vl &# 39 ; is a threshold level for detecting when the closed control operation is to be suspended . suspension of closed control operation is appropriate when the engine is idled for an extended period of time before the exhaust temperature falls below the sensor operating temperature level vl &# 39 ;. the voltage at the reference junction point 8 is also clampled to an upper voltage level set by a circuit including series connected resistors r13 and r14 , and a diode d5 having its cathode connected to the junction of resistors r13 , r14 and its anode connected to the summing junction 8 . the resistors r13 , r14 are coupled in parallel with a capacitor c5 which is charged by a voltage supplied from the output of amplifier 6 by a diode d6 . the voltage across capacitor c5 is thus scaled down in proportion to the ratio of resistor r13 to resistor r14 so as to set up the upper limit voltage vu at the junction of resistors r13 , r14 . when the reference voltage at point 8 exceeds voltage vu , diode d5 conducts and prevents the reference voltage from becoming higher than the upper limit level vu . therefore , under normal operating conditions , the voltage level at point 8 varies between lower and upper voltage levels vl &# 39 ; and vu . the output from the comparator 7 is also connected to the base of a transistor t2 by a circuit including a diode d2 and a resistor r15 . the base of transistor t2 is connected to ground by a capacitor c6 coupled in parallel with a resistor r16 . the circuit formed by resistor r15 and capacitor c6 is a charging circuit with a smaller time constant value than that of a discharging circuit formed by resistor r16 and capacitor c6 . the bias for the transistor t2 sharply rises as the voltage across capacitor c6 develops by the charging current supplied from the output of comparator 7 and decreases gradually in the absence of the charging current . the emitter of transistor t2 is connected to ground by series - connected resistors r17 and r18 and its collector connected to the voltage supply . the base of a transistor t3 is connected to the junction of resistors r17 , r18 by a resistor r19 . transistor t3 has its collector connected to the voltage supply by a load resistance r20 and its emitter connected to ground . the collector of transistor t3 is also connected to ground through the winding of a relay s and to the inverting input of the comparator 7 by a differentiator circuit formed by a resistor r21 and a capacitor c7 . transistors t2 and t3 are simultaneously rendered conductive when the comparator output rises in voltage . the turn - on of transistor t3 switches the potential at its collector to a low voltage level which de - energizes the relay s . the differentiator circuit r21 , c7 differentiates the change in voltage at the collector of transistor t3 when it turns on and provides a negative bias to the inverting input of the comparator 7 . in operation , it is assumed that the internal combustion engine 1 is under cold start operation . the sensor voltage under cold start operation remains low . transistors t2 and t3 are turned off so that the voltage at the collector of transistor t3 is at a high voltage level which energizes relay s to open the contacts s1 and close the contacts s2 . therefore , both proportional and integral signals are disabled and the feedback control is suspended . when the engine has been warmed up and the sensor voltage reaches the lower limit voltage vl at time t 1 ( a solid line curve 14 in fig4 a ), the output of comparator 7 will jump to a voltage which may be midway between its high and low voltage levels . ( fig4 b ) this output is passed through diode d2 and charges capacitor c6 to turn on transistors t2 and t3 simultaneously . the relay s is de - energized to cease the suspension of feedback control . at the same time the inverting input of the comparator 7 is negatively biased by the differentiated pulse ( fig4 c ) and results in a lowering of the voltage at the inverting input as indicated by the broken - line curve 15 . as a consequence the output of comparator 7 jumps to the high voltage level . this high voltage level is coupled to the proportional and integral controllers so that air - fuel ratio changes in response to the high level output from the comparator 7 . this in turn reduces the sensor voltage as shown in fig4 a . however , the reference potential is lower than the oxygen sensor voltage during time interval t 1 to t 2 , the comparator 7 remains in the high output voltage state until the latter falls below the former at time t 2 . therefore , it will be understood that when the oxygen sensor voltage reaches the lower threshold level vl , the feedback control is instantly commenced even though the oxygen sensor voltage tends to stay at the same voltage as its time integral value after the threshold level has been reached . once the exhaust gas sensor reaches its operating temperature range , the signal from the comparator 7 produces a voltage across resistor r10 which is coupled to the summing junction 8 via diode d3 so that the potential at the summing junction 8 is raised to the voltage vl &# 39 ; representing the condition that warrants the suspension of closed control operation and is higher than the operating temperature level vl . if the sensor output falls below the suspension level vl &# 39 ; and remains there due to a prolonged idling operation , for example , the transistor t3 is switched to the output high state which energizes the relay s so that closed control operation is disabled . fig2 illustrates an alternative embodiment of the invention , in which identical parts are numbered with identical numerals to those used in fig1 . in fig2 an operational amplifier 20 is provided which is designed to have a higher amplification than that of operational amplifier 7 . the inverting input of amplifier or comparator 20 is connected to the summing junction 8 by a resistor r30 and its noninverting input connected to the output of amplifier 6 by a resistor r31 , the output comparator 20 being connected to the anode terminal of the diode d2 , which in this embodiment is separated from the anode of diode d1 . with the higher amplification , comparator 20 provides an output which assumes at one of two discrete levels of higher amplitude depending upon the relative levels of the input signals applied thereto than that provided by the comparator 7 . when the amplifier 6 output rises above the voltage vl , the comparator 20 is switched to a high output state which instantly charges the capacitor c6 to turn on transistors t1 and t2 . in a manner identical to that described in the previous embodiment , the collector t2 voltage falls to a low voltage level which is differentiated by resistor r21 and capacitor c7 to provide a negative polarity output which is applied to the inverting input of the comparator 7 . fig3 is a modification of the embodiment of fig1 . the modification shown in fig3 differs from the embodiment of fig1 in that an operational amplifier or comparator 30 is provided having its inverting input connected to the output of comparator 7 and its noninverting input connected to a voltage source v1 formed by series connected resistors r40 , r41 . the voltage v1 is chosen at a value lower than the voltage delivered from the comparator 7 when its two input signals assume the same voltage level . the output of comparator 30 is connected to the inverting input of comparator 7 by a resistor r42 . when the temperature within the exhaust conduit 3 is below the operating level of oxygen sensor 5 , comparator 7 delivers a low level voltage output to the comparator 30 so that the output from the comparator 30 is a high voltage level output which is attenuated by the resistor r42 and applied to the inverting input of the comparator 7 . as a result , the combined voltage level at the inverting input of comparator 7 is slightly raised above the voltage at the summing junction 8 . it is to be noted that the combined voltage level is chosen to correspond to the lower voltage level vl as referred to above as a sensing threshold level for enabling closed control operation . when the exhaust temperature rises and the amplifier 6 output consequently reaches the combined voltage level at the inverting input , comparator 7 delivers a high voltage level output which causes comparator 30 to change its output state so that the inverting input of comparator 7 slightly falls below the reference voltage vl as illustrated in fig5 a . since the sensor output tends to increase , the reduction of reference level at the time of coincidence of two input voltages allows the comparator 7 to deliver a definite voltage signal ( fig5 b ) rather than the indeterminate output which is midway between the high and low voltage levels . the potential at the inverting input of comparator 7 is thereafter caused to fluctuate in response to the change in output voltage level . however , the amplitude of this fluctuation is of the order not affecting the reference level of the feedback control operation ( fig5 c ). | 5 |
for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiments illustrated in the drawings and described in the following written specification . it is understood that no limitation to the scope of the invention is thereby intended . it is further understood that the present invention includes any alterations and modifications to the illustrated embodiments and includes further applications of the principles of the invention as would normally occur to one of ordinary skill in the art to which this invention pertains . a novel system has been developed to enable the detection of deoxyribonucleic acid ( dna ) biomarkers in an automated , or a semi - automated process , and operated by non - technical ( i . e . non - molecular biologists ) personnel . the system can be used to detect dna biomarker ( s ). it should be appreciated that a system according to the present disclosure can be used for both ( a ) qualitative detection , meaning that the system simply detects the presence of one or more dna biomarkers , and ( b ) quantitative detection , where the absolute or relative amount of dna is present within a sample . furthermore , a detection probe system according to the present disclosure can be used to detect one or more changes or differences in dna sequence , such as single nucleotide polymorphisms ( snps ). a system according to the present disclosure provides the capability to screen samples within the food processing industry to allow for a rapid , qualitative screening of consumable materials for evidence of pathogenic microorganisms . the purpose of such a system is to screen for dna sequences that are unique to specific pathogens and provide a warning to a user if evidence of a pathogen is present , based on the detection of these dna sequences . a schematic of an exemplary embodiment of the system designed for optical emission and detection of dna sequences is depicted in fig1 . the system in fig1 includes a detection device which is designed to reduce the costs associated with 2 - dimensional imaging . the system advantageously utilizes a linear charge coupled device ( ccd ) array 105 that is , in at least one embodiment , perpendicular to the lines 137 created by the placement of the detection device , similar to a barcode reader . the “ raw barcode ” data collected from the system can be converted via image analysis into a graphical representation , an example of which is demonstrated by the graph in fig2 . noteworthy functions of a dna screening system according to the present disclosure are to ( 1 ) amplify the gene region of interest using common thermocycling methods ( e . g . polymerase chain reaction ( pcr )), and ( 2 ) detect a color - change in the fluorescence of the capture probe , all within a single reaction chamber . the system uses a fluorescence - based color change , rather than known methods of detecting presence / absence of fluorescence commonly used in dna microarray technology , to detect the dna biomarkers , which significantly reduces the risk of false negative detection in samples . these functions are achieved by generating a specialized microarray that includes dual - labeled fluorescent oligonucleotide probes such as that shown in fig4 . as shown in fig3 and 4 , the microarray fluoresces red 422 in the absence of sequence - specific binding , using fluorescence resonance energy transfer ( fret ), and fluoresces green 421 in the presence of sequence - specific binding ( due to the disruption of fret ). furthermore , at least one embodiment of the present disclosure is designed to utilize quality controls inherent to the detection probe system that can be verified before , during , and after a sample is analyzed , which provides the system with more rigorous detection parameters than that common to dna microarray technology , and can be employed to check the integrity of the system after a sample is analyzed and determine if the system can be used to analyze another sample ( without changing the probe system ). a detection device according to at least one embodiment of the present disclosure is shown in fig5 - 7 . fig5 shows a perspective view and fig6 shows a top view of a detection device embodiment . fig7 shows an exploded view of the detection device embodiment depicted in fig5 and 6 . such a detection device comprises a top clamp 510 and a bottom clamp 514 that operably holds together the components of the detection device . the top clamp 510 contains an optical aperture 511 , which provides a window to allow for laser - based excitation 104 and ccd - based detection 105 , 805 of the oligonucleotide probes on a microarray 108 , 708 . as shown in fig7 , a dna microarray slide 708 ( that contains the dual - labeled fluoro - probes as shown in fig4 ) is sandwiched between a top clamp cushion 715 positioned under the top clamp 510 and a sealing gasket 718 positioned above a reaction chamber 513 . the reaction chamber 513 is where test samples , primers , and / or buffers ( e . g ., 100 μl in volume ) can be introduced . the reaction chamber 513 is configured to provide sufficient volume to perform multiplex pcr ( amplifying more than one target dna sequence at a time ). as indicated by fig1 , such a detection device contains inlet 101 and outlet 102 ports on the reaction chamber 513 , which are sealed using valves 1223 , 1225 , 1229 ( 2 and 3 way pinch valve parts available from biochem fluidics , such as part numbers 075p2nc12 - 02s , 075p3mp12 - 02s , 100pd3mp12 - 02s ). the reaction chamber 513 may be capable of quickly heating or cooling for pcr - based amplification of the pathogenic gene templates , and can achieve temperatures that open or close the fret - probe ( s ) as shown in fig3 . the heating and cooling functions of the detection device are achieved using thermoelectric ( peltier ) modules 109 , 509 , which are located between a water block 520 and the reaction chamber 513 , as shown in fig5 . the thermoelectric peltier modules 509 and water block 520 ( peltier heaters ( 40 mm × 40 mm ) and ( 20 mm × 20 mm ) and water block parts available at custom thermoelectric , such as part numbers 12711 - 5l31 - 05c , 03111 - 9l31 - 04cg , and wba - 1 . 62 - 0 . 55 - cu - 01 ) are used to perform thermocycling for cell lysis , pcr , and detection . the thermoelectric module 509 is driven via a solidstate relay connected to a do port on a c series 9274 module . the temperature of the system is controlled by integrated thermocouples ( and other sensor systems , including biosensors ) 1131 at the microscope slide surface , which provides precise temperature control of the reaction chamber 513 for real - time temperature readings . the thermocouples 1131 provide a feedback loop by providing heating / cooling signals to the peltier modules 109 , 509 and reaction chamber temperatures . this provides the basic i / o for the development of a control software system and supporting circuit board control system . temperature control is implemented in labview using a gain scheduling pi controller . fig1 shows a schematic of an exemplary fluidic system according to at least one embodiment of the present disclosure . as depicted in fig1 , the system uses fluidics controls , valves 1123 , 1125 , 1129 , pumps 1130 ( dosing pump parts available from biochem fluidics , such as part number 120sp1220 - 5tv ), and sensors 1131 ( tubing fluid sensors available from newark components , such as part number 47p7966 ) to precisely control the buffers ( and other fluids ) in the system . the fluidic system also contains a set of reservoirs 1122 a - c each connected to a valve 1123 a - c that can be turned “ on ” or “ off ”. the valves 1123 a - c are connected to the p1 position of a valve 1125 a . when in the p2 position , the valve 1125 a is connected to an air line 1124 a . the valve 1125 a is connected to another valve 1125 b . the valve 1125 b is connected to the reagent reservoir 1134 via the p1 position and another valve 1125 c via the p2 position . valve 1125 c is connected to the reagent dosing point 1132 through the p2 position and the sample dosing point 1133 through the p1 position . the reagent reservoir 1134 is connected to a sensor 1131 d . the sample dosing point 1133 is connected to another sensor 1131 c . both sensors 1131 c and d are connected to sensor 1131 b , which is connected to a valve 1125 d . when valve 1125 d is in the p2 position , it is connected to the reaction chamber 1113 . when valve 1125 d is in the p1 position , it is connected to the p1 position of valve 1125 e . the p2 position of valve 1125 e is connected to sensor 1131 a , which is connected to the reaction chamber 1113 . valve 1125 e is also connected to a pump 1130 b and a valve 1123 d . valve 1123 d is connected to the waste chamber 1136 . pump 1130 b is connected to valve 1125 f . valve 1125 f is connected via the p2 position to valve 1129 a and to an air line 1124 b via the p1 position . pump 1130 a is connected to valve 1125 f , and valve 1125 f is connected via the p2 position to valve 1129 b and via the p1 position to an air line 1124 c . pump 1130 a is used to push fluid through the system . pump 1130 b is used to pull fluid through the system . valve 1125 f is a dual tubing 3 way pinch valve . only air passes through the pumps . all liquids are deposited to waste . with valve 1125 f at p1 , pump 1130 a can use an unrestricted air line to push fluid through the system . with valve 1125 f at p2 , pump 1130 b uses a restricted air line to push fluid through the system and it operates at a lower flow rate . this lower flow rate can be set using the needle valves 1129 a and b ( needle valve parts available from pneuaire components , such as part number f - 28 22 - 40 - b80 - k ). pump 1130 b operates in a similar manner but with the unrestricted and restricted air lines 1124 connected to the outlet 102 as opposed to the inlet 101 , such as shown in fig1 . the fluidic system control software system can be programmed in several states . first , the fluid system can operate for reagent reservoir loading through the activation of the “ reagent loading ” state . in this state , valve 1125 d and valve 1125 e are set to p1 and valve 1123 d is set to on . next , the system can be sent into “ begin ” state in which input and control parameters ( pcr temperatures , etc .) are entered into the system . the system then begins to verify the probes by setting valve 1123 a to on , valve 1123 d to off , and valves 1125 a , b , d , and e are set to p1 . pump 1130 b then switches “ on ” until a requisite amount of buffer / rinse is drawn from reservoir 1122 a . then , valve 1123 a is set to off , valve 1123 d is set to on , and pump 1130 a is switched on . when fluid triggers sensor 1131 b , valves 1125 d and e switch to p2 . when fluid triggers sensor 1131 a , pump 1130 a is switched “ off ” and valves 1125 d and e switch to p1 . after this step , the laser 104 and ccd 105 are activated and the fluorescence emission spectrum is logged . the laser 104 and ccd 105 , such as shown in fig1 , are then deactivated , which activates the heater 109 , 509 , such as shown in fig1 and 5 . once the detection temperature is reacted , the laser 104 and ccd 105 are reactivated and the fluorescence emission spectrum is logged again . the laser 104 and ccd 105 are again deactivated along with the heater 109 , 509 . at this time , valves 1125 d and e switch to p2 and pump 1130 a is switched “ on ” until liquid deposited in waste chamber 1136 . valves 1125 d and e then switch to p1 . at this point , the device can proceed to the “ sample loading ” state unless the system has found that the probes are damaged . the user is then prompted to load a sample for the “ sample loading ” state , and the system will notify the user once loading is complete . valves 1125 a and b are then switched to p2 and valve 1125 c is switched to p1 . pump 1130 b is switched “ on ” until sensor 1131 c is triggered . the reagents are then metered in the device during the “ reagent metering ” state by switching valve 1125 c to p2 and switching “ on ” pump 1130 b until sensor 1131 d is triggered . as depicted in fig1 , after the “ reagent metering ” state , the device enters the ‘ mixing ’ state . mixing occurs in the device through switching valve 1125 a to p1 and valve 1125 f to p2 . when pump 1130 a is switch on , valve 1125 c switches between p1 and p2 . as shown with arrows 1137 a , fluid then activates sensor 1131 c , and valves 1125 d and e are switched to p2 . fluid then activates sensor 1131 a , pump 1130 a switched off , and valves 1125 d and e are switched to p1 . the pcr reaction then takes place within the device through the activation of the heater 109 , 509 and temperature cycling during the “ pcr cycling ” state . after the specified cycle number has been reached , the reaction chamber 513 is set to the detection temperature . this activates the laser 104 and ccd 105 and the fluorescence emission spectrum is logged . the laser 104 and ccd 105 are then deactivated and the reaction chamber 513 can be returned to temperature cycling . the above is repeated until end of pcr cycling . as depicted in fig1 , during the “ pcr cycling ” state , the feed line can be cleaned during the “ feed line cleaning ” state by setting valves 1125 a , c , d , and e to p1 , and valve 1125 b is set to p2 . valve 1123 a is then set to “ on ” and valve 1123 d is set to off . this activates pump 1130 b until requisite amount of detergent is drawn from reservoir 1122 c . once this occurs , valve 1123 a is set to off , valve 1123 d is set to on , and pump 1130 a is switched on . as shown by arrows 1137 b , fluid is then pushed through system to a waste chamber 1136 . the above is repeated for detergent in reservoir 1122 b and buffer / rinse in reservoir 1122 a . during pcr cycling after detection has begun , real time data logging and analysis can be performed . the device presents the user with a graph of the logged fluorescence emission spectra . the device then performs a numerical analysis on the fluorescence emission spectra providing the user with numerical value (+/−) for the increase or decrease in fluorescence intensity for each target dna sequence in both green and red . the device writes the chamber temperature and fluorescence spectra to spread sheet files . the user is alerted automatically of any positive targets . a control action can then be performed automatically by the device or manually by the user . upon completion of pcr cycling , the device enters “ reaction mixture removal ” state . during this state , valves 1125 d and e are set to p2 and valve 1123 d is set to on . pump 1130 a then switches “ on ” until the reagent is sent to waste chamber 1136 or collected by the user via the tapping point . after this , the device enters “ chamber cleaning ” state as shown in fig1 where the device can self - clean the chamber via the steps for “ feed line cleaning ” followed by switching valves 1125 d and e to p2 , shown by arrows 1137 c . after this step , the device returns to “ probe verification ” state unless the user overrides the device and sends it to “ end state ” or the device automatically moves to “ end state ” due to lack of reagent . in operation , a sample is collected and prepared and is to be suspended in a liquid volume of 25 μl . the sample is loaded into the fluidics system , as shown in fig1 - 14 , of the detection device using a standard pipette . the sample dosing point 1132 , such as shown in fig1 , consists of a manually removable cap allowing direct access to a tubing line . the cap is reattached once loading is complete . the 25 μl sample volume is mixed with a 75 μl volume containing the pcr reagents ( primers , buffers , polymerase etc .) to give a total reaction volume of 1004 as shown in fig1 , mixing is achieved by alternating flow from the sample and reagent lines using a valve system 1123 , 1125 , 1129 and pumps 1130 . the 75 μl volume is drawn from a reservoir 1122 held at a temperature of 4 degrees celsius to prevent degradation . the temperature of the reaction chamber 513 , as shown in fig5 , is controlled using a thermocouple 1131 while varying the voltage ( and polarity ) applied to the thermoelectric heater 509 , as shown in fig5 . a water block 520 attached to one side of the thermoelectric heater 509 , such as shown in fig5 , allows for a more stable operation of the heater . the water block 520 is connected to a radiator cooling system , shown in fig1 - 14 , consisting of the radiator 1126 , the cooling system reservoir 1127 , and the cooling system pump 1128 . the 100 μl reaction volume is then deposited into the reaction chamber 513 , 1113 . the inlet 101 and outlet 102 ports , such as shown in fig1 , of the chamber are then sealed by valves 1123 , 1125 , 1129 . the reaction volume is heated to 95 degrees celsius to ensure cell lysis ( where whole cells are introduced in the sample volume ). temperature is monitored by a thermocouple 1131 embedded in the reaction chamber 513 , 1113 wall . following this step a standard pcr thermocycling takes place . the number of cycles , denaturing , annealing and extension temperatures , final elongation and holding temperatures ( if required ) can be set by the user . the user can also input the number of cycles required before detection begins and detection temperature ( s ) ( if required ). when a pre - determined number of cycles have occurred , the sample is held at a detection temperature . as shown in fig1 , the oligonucleotide probes on the microarray are excited using a five milliwatt 532 nm laser 104 ( 532 nm dpss green laser module parts available from lasermate , such as part number gmp - 532 - 20f3 - cp ) spread into a line 137 by a plano concave lenses 138 ( parts available from thorlabs , such as part number lb1450 - a ). as shown in fig1 and 8 , fluorescence is detected by focusing a double image of the microarray 108 , 708 onto a 2048 pixel linear ccd 105 , 805 ( 2048 element linear ccd array parts available from ames photonics inc , such as part number larry 2048 ) via two spherical lenses 106 , 806 ( parts available from thorlabs , such as part number lb1450 - a ), with one half of the image filtered in red 821 and one half in green 822 ( 568 nm and 671 nm band pass filters , available from edmund optics , such as part numbers nt43 - 127 and nt43 - 139 ). fig8 shows passage of light to the ccd 805 under excitation in the detection device of fig5 - 7 . the emission intensity spectrum taken after each detection step is stored on the control computer . analysis of the change in the ratio of green to red fluorescence is used to indicate whether a test sample is positive or negative for the target dna ( see fig2 ). after completion of the pcr and detection cycles , the reaction volume is removed from the reaction chamber 513 , 1113 . it can be sent directly to a waste chamber 1136 or collected by the user via a tapping point as shown in fig1 - 14 . the cleaning cycle begins while the pcr and detection steps are running . the sample loading line and mixing line are cleaned using a three step cleaning cycle . as shown in fig1 , the detergents and rinsing fluid are drawn from reservoirs 1122 . the spent fluid is deposited in the waste chamber 1136 via a line running parallel to the reaction chamber 513 , 1113 , see arrows 1137 b . this reduces the amount of contamination entering the chamber between test runs . upon removal of the reaction volume from the reaction chamber 513 , 1113 , the same three step cleaning cycle is conducted in the chamber itself and deposited to the waste chamber 1136 ( see fig1 , arrows 1137 c ). the operation of the probes is then verified as described above . the operation of the oligonucleotide probes is checked after the cleaning cycle to ensure they are functioning correctly . the operator is alerted in case of a malfunction and an appropriate action is taken . the above described steps are then repeated . four genes common to e . coli o157 : h7 were selected for detection by the system . these genes are eaea , hlyc , rfbe and stx1 . to test the functionality of the reaction chamber 513 , 1113 in amplifying these dna sequences , 100 μl samples each containing target dna and the relevant primers and buffers were prepared . each sample was loaded into the reaction chamber 513 , 1113 sequentially and underwent a 30 cycle pcr with temperature stages at 95 ° c ., 50 ° c ., 72 ° c . respectively . there was a 5 minute hold at 95 ° c . before cycling and a 10 minute hold at 72 ° c . after cycling after which the sample was cooled to 4 ° c . and removed from the reaction chamber 513 , 1113 . the thermal response of the reaction chamber 513 , 1113 is shown in fig9 . the overall reaction time was less than 80 minutes with maximum heating and cooling rates of 2 . 3 ° c ./ s and 3 . 1 ° c ./ s , respectively . the faster cooling rate was achieved by changing the polarity of the voltage supplied to the thermoelectric heater 509 . gel electrophoresis was performed on each sample after pcr , an example of which is shown in fig1 , using a 1 kb ladder to confirm amplification had occurred . after studying the present disclosure , those skilled in the art will recognize that numerous modifications can be made to the specific implementations of the detection system described above . therefore , the system is not to be limited to the specific embodiments illustrated and described above . the system , as originally presented and as it may be amended , encompasses variations , alternatives , modifications , improvements , equivalents , and substantial equivalents of the embodiments and teachings disclosed herein , including those that are presently unforeseen or unappreciated , and that , for example , may arise from applicants / patentees and others . | 1 |
as embodiments of the present invention are described with reference to the aforementioned drawings , various modifications or adaptations of the specific structures and or methods may become apparent to those skilled in the art . all such modifications , adaptations , or variations that rely upon the teachings of the present invention , and through which these teachings have advanced the art , are considered to be within the spirit and scope of the present invention . fig1 is a schematic cross - sectional view showing a portion of a chemical mechanical polishing ( cmp ) apparatus 100 including a wafer 110 and a cmp heterodyne in - situ sensor ( c - his ) optical assembly 120 , in accordance with the present invention . wafer 110 has a front surface 108 and a back surface 106 . in some embodiments , wafer 110 includes a substrate 148 and a planarization film 112 . in such embodiments , film 112 is separated from substrate 148 by an interface surface ( hereinafter interface 104 ), and front surface 108 is understood to encompass film 112 as depicted in fig1 . planarization film 112 has a thickness 102 measured from interface 104 to front surface 108 . likewise a substrate thickness 114 is defined between back surface 106 and interface 104 , and a wafer thickness 116 is defined between back surface 106 and front surface 108 . back surface 106 of wafer 110 is attached to a rotatable carrier 150 using conventional methods ( see for example , aiyer et al ., u . s . application ser . no . 09 / 047 , 322 , filed mar . 24 , 1998 ). front surface 108 is pressed downward against the working surface of a rotatable platen - mounted polishing pad ( not shown ). typically a polishing slurry is applied between front surface 108 and the working surface of the polishing pad . optical assembly 120 comprises a laser source 118 , a conventional reference beam splitter ( bs ) 122 , a polarization beam splitter ( pbs ) 124 , a reference beam quarter - wave plate 126 , a reference beam reflector 128 , a measurement beam quarter - wave plate 130 , a measurement mixing polarizer 132 , a measurement photodetector 134 , a reference mixing polarizer 136 , a reference photodetector 138 , and a signal - processing assembly 140 electrically connected to the outputs of measurement photodetector 134 and reference photodetector 138 using signal leads 182 and 184 respectively . the optical arrangement is similar , for example , to that described by sommargren et al . u . s . pat . no . 4 , 688 , 940 issued aug . 25 , 1987 ( hereinafter sommargren ). the components of optical assembly 120 are mounted above and proximate to rotatable carrier 150 to which wafer 110 is attached . in some embodiments optical assembly 120 is physically attached relative to the rotation axis of rotatable carrier 150 . laser source 118 is configured to produce two substantially superimposed collinear beams b 1 and b 2 of optical frequencies ω 1 and ω 2 respectively . frequency ω 1 is offset from frequency ω 2 by a heterodyne offset frequency δω , such that ω 1 = ω 2 + δω . additionally beams b 1 and b 2 are orthogonally polarized ; illustratively beam b 1 is initially plane polarized perpendicular to the plane of fig1 ( shown by solid circles ) and beam b 2 is initially plane polarized parallel to the plane of fig1 ( shown by arrows ). generation of beams b 1 and b 2 is typically accomplished by placing an acousto - optic device ( not shown ) in the output beam b 1 of a well - stabilized laser having a linearly polarized output of single - frequency ω1 . by driving the acousto - optic device at an acoustic frequency equal to heterodyne offset frequency δω , a portion of the output is shifted into an orthogonally polarized beam b 2 of frequency ω2 ( for example , see sommargren ). beams b 1 and b 2 propagate collinearly from laser source 118 to reference beam splitter 122 , where a fraction of both beams 142 and 144 , respectively , is deflected through reference mixing polarizer 136 into reference detector 138 . the transmitted portions of beam b 1 and beam b 2 continue to propagate as beam 152 and beam 154 respectively . at polarization beam splitter ( pbs ) 124 , beam 154 is transmitted without deflection and passes through quarter - wave plate 126 , where the polarization of beam 154 is converted from plane to circular . beam 154 is then reflected from reflector 128 back through quarter - wave plate 126 as beam 164 ; the circular polarization of beam 154 is converted to plane polarization for beam 164 . the polarization plane of beam 164 is oriented perpendicular to the original polarization plane of beam b 2 . beam 164 is then reflected from pbs 124 . as can be seen , all optical elements encountered by beams b 2 , 154 , and 164 collectively are fixed in their positions . thus beams b 2 , 154 , and 164 collectively traverse an optical path of fixed length . beam 152 is reflected from pbs 124 through quarter - wave plate 130 , whereupon the polarization of beam 152 is converted from plane polarization to circular polarization . to provide optical access of beam 152 to back surface 106 , it is necessary for rotatable carrier 150 to be optically transparent in whole or in part . this is accomplished , for example , by forming rotatable carrier 150 in whole or in part of transparent materials , e . g . acrylic plastic or fused silica ; or alternatively by forming open slots through rotatable carrier 150 to provide an optical transmission path . beam 152 undergoes partial reflections at back surface 106 , interface 104 , and front surface 108 respectively , producing partially reflected beams 162 s , 162 t , and 162 b respectively , which propagate back through quarter - wave plate 130 . upon transmission back through quarter - wave plate 130 , the polarization of each of beams 162 s , 162 t , and 162 b is converted from circular polarization to plane polarization ; each of the respective polarization planes is perpendicular to the original polarization plane of beam b 1 . reflected beams 162 s , 162 t , and 162 b are then transmitted through pbs 124 , whereupon each of beams 162 s , 162 t , and 162 b propagates collinearly with reference beam 164 . during a polishing process , planarization film thickness 102 is reduced , thereby shortening the optical path traversed by beams b 1 , 152 , and 162 b collectively . thus beams b 1 , 152 , and 162 b collectively traverse an optical path of variable length . the polarization planes of reference beam 164 and reflected beams 162 s , 162 t , 162 b are each rotated 90 degrees relative to the polarization planes of their respective original beams b 2 and b 1 . thus reflected beams 162 s , 162 t , 162 b are still polarized orthogonally relative to reference beam 164 . reference beam 164 and reflected beams 162 s , 162 t , 162 b now propagate collinearly from pbs 124 onto mixing polarizer 132 . mixing polarizer 132 provides respective output beams 172 s , 172 t , 172 b and 174 all having the same polarization ( for example , see sommargren ). these similarly polarized beams 172 s , 172 t , 172 b and 174 are then mixed on the face of the measurement photodetector 134 to produce an electrical measurement signal s 1 . likewise the orthogonally polarized fractions 142 and 144 , respectively , of initial beams b 1 and b 2 are combined by reference mixing polarizer 136 ( for example , see sommargren ) and then are detected by reference photodetector 138 to produce an electrical reference signal s 2 . measurement signal s 1 and reference signal s 2 are applied using electrical leads 182 and 184 respectively , or by wireless means to signal processing assembly 140 . signal processing assembly 140 comprises analog and / or digital circuitry to amplify , condition , compare , and process measurement and reference signals s 1 , s 2 , respectively . signal processing assembly 140 thereupon generates output signals representing the status of the cmp process . optionally , signal processing assembly 140 generates output signals to provide dynamic process control , as described in detail below . in accordance with principles of optical heterodyne interferometry familiar in the art , reference beam 174 at measurement photodetector 134 is represented by the exponential factor represents the frequency and phase dependence of reference beam 174 having frequency ω 2 . likewise measurement beams 172 s , 172 t , and 172 b at measurement photodetector 134 are represented respectively by e 2 = e 02 e i ( ω 1 * t + φ s ) ; e 3 = e 03 e i ( ω 1 * t + φ t ) ; e 4 = e 04 e i ( ω 1 * t + φ b ) ; e 02 , e 03 , and e 04 are amplitudes of beams 172 s , 172 t and 172 b , respectively ; t is time ; and the exponential factors represent the frequency and phase dependencies of the above measurement beams , respectively , having frequency ω 1 and undergoing optical phase shifts of φ s , φ t , and φ b upon reflection from back surface 106 , interface 104 , and front surface 108 respectively . in accordance with the principles of square - law mixing , familiar in the art , measurement signal s 1 of measurement photodetector 134 arising from combined beams 174 , 172 s , 172 t , and 172 b is given by : s 1 ∞ e 2 + 2 e 02 e 03 cos ( δφ ts )+ 2 e 02 e 04 cos ( δφ sb ) + 2 e 03 e 04 cos ( δφ tb )+ 2 e 01 e 02 cos ( δω * t − φ s )+ 2 e 01 e 03 cos ( δω * t − φ t )+ 2 e 01 e 04 cos ( δω * t − φ b ); the first two terms of measurement signal s 1 are time invariant terms . the third and fourth terms will change in magnitude as the film is polished . the consequence of this magnitude change is a change in signal contrast . the fifth and sixth terms are heterodyne terms , but do not undergo any doppler shift , since phases φ s and φ t do not change during a polishing operation . the last term of measurement signal s 1 is the only heterodyne term that undergoes a doppler frequency shift during the polishing process . reference signal s 2 , generated by reference photodetector 138 , is represented by which depends on heterodyne offset frequency δω , but does not undergo a phase shift . illustratively , fig2 is a plot of a simulation of measurement and reference signals s 1 and s 2 respectively , normalized to an arbitrary vertical scale . the horizontal axis represents time in fractional microseconds . a lower plot 212 represents reference signal s 2 ; an upper plot 214 represents measurement signal s 1 . for convenience of simulation , a 2 - mhz heterodyne frequency δω is assumed . the shift between plots 212 and 214 is equivalent to a change in planarization film thickness 102 of about 10 nm . thus , in accordance with the invention , signals are generated by an in - situ method , that provide sensitive , accurate , and fluctuation - free measurement of film thickness change during a polishing process . in this manner , the thickness 102 of planarization film 112 , as it approaches a predetermined value , is determined without the need to stop the polishing process . optionally , the apparatus depicted in fig1 also incorporates a dynamic feedback system 52 for routing a signal 52 a from signal processing assembly 140 to a computing device 53 . in embodiments of the present invention , signal 52 a is a signal derived from c - his optical assembly 120 that represents the thickness 102 of planarization film 112 on wafer 110 . typically , signal 52 a is routed from signal processing assembly 140 through dynamic feedback system 52 which includes computing device 53 . in some embodiments of the present invention , computing device 53 is a general purpose computing device having software routines encoded within its memory for receiving , and evaluating input signals such as signal 52 a . in some embodiments , computing device 53 is an application specific computing device , essentially hardwired for a specific purpose . in some embodiments , device 53 is a combination of general purpose and specific purpose computing devices . regardless of form , device 53 receives one or more input signals 52 a and , using encoded routines , generates a result as one or more output signals 52 b , 52 c , 52 d , and 52 e . each output signal 52 b , 52 c , 52 d , and 52 e can be a control signal for providing dynamic process control of one or more of the various sub - systems of cmp apparatus 100 . illustratively , an input signal 52 a from c - his optical assembly 120 enables computing device 53 to continuously calculate a rate of removal of planarization film 112 . in turn , process variables , for example platen drive speed , platen pressure , slurry supply , and / or rotatable carrier motion are each dynamically controlled based upon the input signal 52 a and rate calculated by computer device 53 . in some embodiments , one or more of output signals 52 b - 52 e are informational display or alert signals intended to call the attention of a human operator rather than dynamic control signals . for example , in some embodiments of the invention , computing device 53 produces an output signal 52 b - 52 e that planarization film thickness 102 is approaching or reaching a predetermined value . in addition to receiving and evaluating input signals 52 a from c - his optical assembly 120 , computing device 53 is also capable of receiving process programming inputs from human operators or from other computing devices ( not shown ). in this manner , computing device 53 is used to control essentially all functions of cmp apparatus 100 . in view of the foregoing , it will be realized that embodiments of the present invention have been described , wherein an improved planarization system has been enabled . embodiments of the present invention allow improved optical access to the active surface being polished , as compared to prior art systems , thus allowing continuous in - situ monitoring of the process , for example thickness and end point detection , as well as dynamic process control . although the invention has been described in terms of a certain preferred embodiment , other embodiments apparent to those skilled in the art are also within the scope of this invention . accordingly , the scope of the invention is intended to be defined only by the claims which follow . | 1 |
the invention relates to an aqueous beverage for bone health and prevention or treating osteoporosis , to processes therefor and a composition of powdered ingredients for preparing an aqueous beverage . the reaction of acidic compositions , hereinafter referred to as the “ acid factor ,” with bicarbonate or carbonate - containing compositions , hereinafter referred to as the “ carbonate factor ,” in an aqueous environment , such as a solution , to produce or release carbon dioxide is well known in the art and will hereinafter be referred to as an “ effervescent reaction .” products that undergo the effervescent reaction upon use normally comprise a dry , solid mixture of an acid factor and a carbonate factor , the mixture being hereinafter referred to as an “ effervescent composition .” the acid factor and the carbonate factor in the effervescent compositions are normally dry solids and are water soluble , at least in the presence of each other . additionally , the acid and carbonate factors utilized must be compatible with their intended use , i . e ., they must be physiologically acceptable . an effervescent composition of calcium carbonate , glycine phosphate and glycine citrate provides an aqueous beverage for bone health and preventing or treating osteoporosis upon adding the effervescent composition to a proper amount of water . the effervescent composition causes an effervescent reaction when added to water . upon completion of the effervescent reaction , the aqueous beverage contains completely solubilized and bioavailable calcium phosphate , calcium citrate and glycine . optionally , the effervescent composition can include zinc carbonate . upon completion of the effervescent reaction , the aqueous beverage also contains completely solubilized and bioavailable zinc citrate . the calcium component of the present invention is derived from calcium carbonate . the phosphorus moiety comes from glycine phosphate ( phosphoglycine ). optionally , zinc is obtained from zinc carbonate . glycine citrate ( citroglycine ) is added not only as a critical reactant but also to aid complete solubilization of calcium carbonate , calcium citrate , zinc carbonate and zinc citrate . calcium citrate and optionally , zinc citrate are reaction products , along with calcium phosphate ( hydroxyapatite ), glycine , carbon dioxide and water . the inclusion of zinc carbonate as a reactant or zinc citrate as a reaction product in the aqueous solution of this invention is not needed to enhance solubility of calcium carbonate or enhance bioavailability or stability of the solubilized hydroxyapatite ( calcium phosphate ). the mineral zinc imparts its own therapeutic properties . the use of zinc is therefore optional . stoichiometric ratios of the effervescent composition of calcium carbonate , glycine citrate and glycine phosphate and optionally zinc carbonate , are added to a proper amount of water , such as 20 fluid ounces of water at room temperature in a suitable stainless steel or glass vessel with moderate mechanical stirring . water can be tap water or it can be purified , deionized , carbonated or distilled . more preferably , reverse osmosis purified water is used . the effervescent reaction begins which lasts for 30 - 60 minutes . mixing at moderate speed is maintained and can be stopped anytime during this time period . more preferably , mixing is maintained for 45 minutes . stoichiometric ratios of the reactants are calculated to provide 500 mg of elemental calcium , 350 mg of elemental phosphorus and 7 . 5 mg of elemental zinc , when present , in each 20 fluid ounces of the aqueous solution of the present invention . next , sweetener ( s ), acidulents ( s ) and other nutritional and / or herbal ingredients , when used are added . mixing is continued at moderate speed for 15 - 30 minutes , more preferably for 20 minutes . flavor ( s ) are then added and mixing at moderate speed is continued preferably for 10 minutes . the aqueous solution of the present invention containing completely solubilized and bioavailable hydroxyapatite ( calcium phosphate ) and optionally zinc citrate preferably provides 50 % of the recommended daily intake ( rdi ) of calcium , 35 % of phosphorus and optionally 50 % of zinc in each 20 fluid ounce serving . two servings supply 100 % of the rdi of calcium , 70 % of phosphorus and 100 % of zinc . serving size can be reduced or increased . serving sizes of 12 fluid ounces and up to 24 fluid ounces are common and acceptable . the preferred serving size of the present invention is 20 fluid ounces . recommended daily intake of calcium and phosphorus and optionally zinc can be reduced by up to 50 % or increased by up to 50 % for the preferred serving size . reducing the rdi would require more servings to be consumed per day . however , consumers may be averse to drinking more than two 20 fluid ounce servings daily . not consuming the full servings would leave consumers deficient in the essential bone building minerals and thus negate the advantage inherent in the aqueous beverage of the present invention . increasing the rdi of these minerals in the preferred serving size renders the aqueous beverage less palatable and thus less acceptable . the aqueous solution of the present invention containing 50 % rdi of calcium , 35 % rdi of phosphorus and optionally 50 % rdi of zinc in each 20 fluid ounce serving and after addition of other ingredients and further treatment as described above can be packaged in larger volume containers for ease of handling and cost savings . containers of half gallon and one gallon size may be appropriate , bearing labels specifying directions for use as necessary . the present invention also provides for combining stoichiometric ratios of zinc carbonate and glycine citrate and adding to a proper amount of water , such as 16 fluid ounces of water . the aqueous solution resulting from the effervescent reaction , contains completely solubilized zinc citrate and glycine . stoichiometric ratios are calculated to provide 100 % of the rdi of zinc which is 15 mg . serving size may vary between 12 and 20 fluid ounces . preferred serving size is 16 fluid ounces . to this aqueous solution are added flavor ( s ), sweetener ( s ) and acidulent ( s ). other ingredients that may be added , methods of processing and packaging are same as above . the aqueous beverage containing completely solubilized hydroxyapatite ( calcium phospate ), optionally zinc citrate and other ingredients can be sterilized . sterilization can be accomplished by the incorporation of preservatives / antimicrobial agents or heat . more preferably , sterilization is accomplished by heating . heating can be accomplished in a heat exchanger or jacketed steam kettles . more preferably , heat exchanger is used to provide for faster and continuous processing . the aqueous solution is heated to between 140 ° f . and 200 ° f . more preferably to 195 ° f . and maintained at this temperature for 20 - 60 seconds , but more preferably for 30 seconds . the aqueous beverage is allowed to cool to 186 ° f . and bottled at this temperature . the ph of the aqueous beverage is in the range of 2 . 8 and 4 . 8 . prior to heating , the aqueous beverage of the present invention can be carbonated . more preferably , the aqueous beverage is maintained in the still , non - carbonated form . when preservatives / antimicrobial agents are used , the heating step is by - passed . preservatives / antimicrobial agents are added along with flavor ( s ), sweetener ( s ), acidulent ( s ) and other ingredients and the process continued as described above . the aqueous beverage of the present invention containing completely solubilized and bioavailable hydroxyapatite ( calcium phosphate ) and optionally zinc citrate in flavored , sweetened , palatable form can be packaged in tightly capped polyethylene terephthalate ( pet ) or glass bottles or jugs but more preferably in pet bottles / jugs . the caps ( lids ) have tamper - evident rings that detach when bottles / jugs are opened . pet bottles / jugs can be clear or tinted . processed and packaged by the methods of the present invention , the aqueous beverage of the present invention containing completely solubilized and bioavailable hydroxyapatite ( calcium phosphate ), and optionally zinc citrate and other ingredients has been found to be stable with no change in taste , appearance , chemical or physical properties after two years . in an alternate embodiment , the effervescent composition of the present invention can be used in powder form . in this embodiment , the ingredients used in the effervescent composition of calcium carbonate , glycine phosphate ( phosphoglycine ), glycine citrate ( citroglycine ), and optionally zinc citrate in their stoichiometric ratios , flavor ( s ), sweetener ( s ), acidulents ( s ) and other ingredients are mixed together and packaged in sachets for reconstitution . the stoichiometric ratios will yield the same rdi of each mineral as if they were to be used in water . the contents of the sachets are added to a predetermined amount of water , such as 20 fluid ounces of commercially available aqueous beverages . the aqueous beverages used for reconstitution of the sachet contents include , but are not limited to seven - up ®, seltzer waters , sprite ®, plain bottled water and ice tea . the sachet contents can be added to less than 20 fluid ounces or more than 20 fluid ounces of the reconstitution beverage . adding to less than 20 fluid ounces appreciably altered the taste and flavor which were not acceptable . adding to more than 20 fluid ounces was acceptable but required that the entire volume be consumed in one day to derive the intended bone health benefit . the preferred volume of the reconstitution beverage is 20 fluid ounces . after the sachet contents are added to a container of the aqueous beverage , the container can be closed and shaken lightly for 30 seconds . within a minute , the cap can be removed to allow escape of the evolved carbon dioxide gas . the resulting beverage now also contains completely solubilized and bioavailable hydroxyapatite ( calcium phosphate ) and optionally zinc and is ready for consumption as such or after refrigeration . the effervescent composition of the present invention can also be combined with commercially available powdered drink mixes prior to their reconstitution in water . the powdered drink mixes utilized for combining with the effervescent composition of the present invention include , but are not limited to , kool - aid ®, crystal light ®, ice tea to - go ® and green tea to - go ®, following the reconstitution directions on the packages of these powdered drink mixes . in both cases above of reconstitution of the sachet contents of the present invention in commercial aqueous beverages or combining with other commercially available powdered drink mixes , the flavor ( s ), sweetener ( s ) and acidulents ( s ) concentrations in the sachet contents may need to be changed . more preferably , the amounts of these additives may need to be reduced as commercially available aqueous beverages and powdered drink mixes may already contain these additives in adequate amounts . a laboratory study was conducted to compare the relative affects of the aqueous beverage of this invention and calcium carbonate powder on bone development in young , growing rats . ten male weanling sprague - dawley derived albino rats weighing 70 - 80 g were used in each group . all animals were fed the same basal diet . control group received calcium from calcium carbonate powder incorporated in the diet . drinking water was provided ad - libitum . test group was provided the aqueous beverage of this invention containing completely solubilized hydroxyapatite ( calcium phosphate ) and calculated to contain the same amount of elemental calcium as the control group . the calculated volume was lower than the volume of drinking water consumed by the control group . the difference was made up by mixing drinking water with it . food consumption , volume of drinking water , volume of the aqueous beverage of this invention and animal weights were recorded daily . at the end of 30 days the animals were sacrificed and both femurs from each animal were removed for evaluation . results show that bone mineral density , tensile strength , femur ash , femur calcium and phosphorus were all much higher for the test group compared to the control . bone density and bone strength numbers were 2 . 5 - 3 times greater for test group than the control . on day 30 , the individual mean body weight gain for the test group was almost 15 % lower . it is to be understood that the above - described embodiments are illustrative of only a few of the many possible specific embodiments , which can represent applications of the principles of the invention . numerous and varied other arrangements can be readily devised in accordance with these principles by those skilled in the art without departing from the spirit and scope of the invention . | 0 |
in the following , preferred embodiments of the present invention are described with reference to the accompanying drawings . fig1 is a diagram showing a group 3 facsimile apparatus according to an embodiment of the present invention . in the illustrated group 3 facsimile apparatus , a system control unit 1 performs processes for controlling the components of the present apparatus and predetermined group 3 facsimile transmission control processes , a system memory 2 , which is used as a working area by the system control unit 1 , stores control process programs to be executed by the system control unit 1 and data used to execute process programs , a parameter memory 3 stores information unique to the present apparatus , and a clock circuit 4 outputs current time information . also , a scanner 5 reads a document image at a predetermined resolution , a plotter 6 records / outputs an image at a predetermined resolution , and an operations / display unit 7 includes operation keys and a display , for example , for operating the present apparatus . further , an encoding / decoding unit 8 performs compression on an image signal and performs decompression on compressed image information , and an image accumulating device 9 stores plural sets of compressed image information . a group 3 facsimile modem 10 implements group 3 facsimile modem functions including a low - speed modem function ( e . g ., v . 21 modem ) for enabling exchange of transmission procedure signals and a high - speed modem function ( e . g ., v . 17 modem , v . 34 modem , v . 29 modem , v . 27 ter modem ) for primarily enabling exchange of image information . a network control device 11 connects the present group 3 facsimile apparatus to an analog public communications network pstn and has an automatic call transmitting / receiving function . the system control unit 1 , the system memory 2 , the parameter memory 3 , the clock circuit 4 , the scanner 5 , the plotter 6 , the operations / display unit 7 , the encoding / decoding unit 8 , the image accumulation device 9 , the group 3 facsimile modem 10 , and the network control device 11 are interconnected by an internal bus 12 , and data exchanges between these elements are primarily performed via this internal bus 12 . it is noted that data may be directly exchanged between the network control device 11 and the group 3 facsimile modem 10 . in one embodiment , the group 3 facsimile apparatus may include address book information as is illustrated in fig2 a . the address book information may register address information including information items shown in fig2 b such as a number for identifying the registered address information , a destination name , and a facsimile number . in one embodiment , input number confirmation operations may be performed when registering address information or inputting a transmission destination through operation of the operations / display unit 7 . specifically , a user may be prompted to input a number two times so that the number input the first time and the number input the second time may be compared , and the input number may be validated only when the first input number and the second input number are determined to match , for example . in a further embodiment , a determination may be made as to whether the input number confirmation operations are to be performed by referring to the value of an input number confirmation flag registered in input number confirmation information as is illustrated in fig2 c . the value of the registered input number confirmation flag may be changed by the user via the operations / display unit 7 , for example . fig3 is a flowchart illustrating an exemplary process for registering address information in the address book information . it is noted that input operations in this process may be performed through operation of the operations / display unit 7 by a user , for example . also , relevant information may be displayed to the user via the operations / display unit 7 , for example . according to the illustrated process , when a user selects address information input operations ( step 101 ), the user is prompted to input a destination name ( step 102 ). then , a first facsimile number input screen is displayed , and the user is prompted to input a facsimile number and wait for the input number to be ascertained ( loop formed by step 103 and negative determination no in step 104 ). when the first input of the facsimile number is ascertained so that a positive determination ( yes ) is made in step 104 , a determination is made as to whether the input number confirmation flag value of the input number confirmation information is on ( step 105 ). when a positive determination ( yes ) is made in step 105 , a second facsimile number input screen is displayed to prompt the user to input the facsimile number for a second time and wait for the input to be ascertained ( loop formed by step 106 and negative determination no in step 107 ). when the second input of the facsimile number is ascertained so that a positive determination ( yes ) is made in step 107 , the facsimile number input the first time and the facsimile number input the second time are compared ( step 108 ), and a determination is made as to whether the two input facsimile numbers match ( step 109 ). when the two input facsimile numbers match so that a positive determination ( yes ) is made in step 109 , for example , a number match indication screen as is shown in fig4 a indicating that the two inputs match or a number match indication screen as is shown in fig4 b indicating that the two inputs match and the input number itself may be displayed ( step 110 ). then , a determination is made as to whether designation operations ( e . g ., operation of the ‘ confirm ’ button of the number match indication screen of fig4 b ) have been performed for indicating acceptance of the facsimile number input by the user as a valid number ( step 111 ). if a positive determination ( yes ) is made in step 111 , the input number is registered as a facsimile number of a new set of address information ( step 112 ) and the process is ended . if a negative determination ( no ) is made in step 111 , the input number is discarded ( step 113 ), and registration operations are not performed . it is noted that when the facsimile number input the first time and the facsimile number input the second time do not match so that a negative determination ( no ) is made in step 109 , a warning screen as is shown in fig4 c indicating that the input numbers do not match may be displayed ( step 114 ) after which the process moves on to step 113 where the input numbers are discarded and the process is ended . also , it is noted that when the value of the input number confirmation flag of the input number confirmation information is off so that a negative determination ( no ) is made in step 105 , the process moves on to step 111 . fig5 is a flowchart illustrating an exemplary process that is preformed in response to the issuance of a facsimile transmission command . it is noted that input operations in this process may be performed through operation of the operations / display unit 7 by a user , for example . also , information may be displayed to the user via the operations / display unit 7 , for example . according to the illustrated process , when operations for inputting a transmission destination are performed by a user ( step 201 ), a determination is made as to whether use of the address book is selected for inputting the transmission destination ( step 202 ). when the user selects to use the address book so that a positive determination ( yes ) is made in step 202 , operations are performed for enabling selection ( input ) of a transmission destination from the address book and waiting for the input to be ascertained ( loop formed by step 203 and negative determination no of step 204 ). when the input transmission address is ascertained so that a positive determination ( yes ) is made in step 204 , predetermined facsimile transmission operations may be performed using the input transmission destination ( step 205 ). on the other hand , when the user inputs a transmission destination directly through operation of the operations / display unit 7 without using the address book so that a negative determination ( no ) is made in step 202 , a first facsimile number input screen is displayed , and the user is prompted to input a facsimile number and wait for the input operations to be ascertained ( loop formed by step 206 and negative determination no in step 207 ). when the facsimile number input the first time is ascertained so that a positive determination ( yes ) is made in step 207 , a determination is made as to whether the value of the input number confirmation flag of the input number confirmation information is on ( step 208 ). if a positive determination ( yes ) is made in step 208 , a second facsimile number input screen is displayed , and the user is prompted to input the facsimile number for a second time and wait for the input operations to be ascertained ( loop formed by step 209 and negative determination no of step 210 ). when the facsimile number input the second time is ascertained so that a positive determination ( yes ) is made in step 210 , the facsimile number input the first time and the facsimile number input the second time are compared ( step 211 ), and a determination is made as to whether the two input facsimile numbers match ( step 212 ). when the two input facsimile numbers match so that a positive determination ( yes ) is made in step 212 , the number match indication screen as is shown in fig4 a or fig4 b may be displayed ( step 213 ). then , a determination is made as to whether designation operations ( e . g ., operation of the ‘ confirm ’ button of the number match indication screen of fig4 b ) have been performed for indicating acceptance of the facsimile number input by the user as a valid number ( step 214 ). when a positive determination ( yes ) is made in step 214 , the input number may be set as the destination facsimile number ( step 215 ), and the process may move on to step 205 where facsimile transmission is performed according to the input destination . when a negative determination ( no ) is made in step 214 , the input number is discarded ( step 216 ) and facsimile transmission is not performed . when the facsimile number input the first time and the facsimile number input the second time do not match so that a negative determination ( no ) is made in step 212 , for example , the warning screen as is shown in fig4 c indicating that the input numbers do not match may be displayed ( step 217 ), and the process may move on to step 216 where the input numbers are discarded and the process is ended . also , when the input number confirmation flag value is off so that a negative determination ( no ) is made in step 208 , the process moves on to step 214 . as can be appreciated , according to an embodiment of the present invention , when registering a facsimile number in address book information or directly inputting a facsimile transmission destination number , a user is prompted to input the number to be registered or the destination number twice , and the registration operations or transmission operations may be enabled only when it is determined that the first and second input numbers match . in this way , registration of wrong address information or transmission to a wrong destination may be prevented . in a preferred embodiment , when the number input the first time and the number input the second time match , a number match indication screen indicating that the input numbers match may be displayed to provide assistance to the user in input operations by informing the user that the input number is probably an accurate number . in a further embodiment , the input number itself may be displayed on the number match indication screen so that the user may confirm whether the input number is accurate . in this way , registration of wrong address information or transmission to a wrong destination may be prevented . in a further embodiment , a selection element for selecting to cancel or validate a designated number may be provided on the number match indication screen so that the user may select whether to use the input number . in another embodiment , when the number input the first time and the number input the second time do not match , a warning screen may be displayed indicating that the input numbers do not match in order to inform the user that at least one of the input numbers is inaccurate to thereby prevent transmission to a wrong destination , for example . in a further embodiment , the number input the first time and the number input the second time may be displayed on the warning screen being displayed when the input numbers do not match , so that the user may acknowledge his / her input operations error . in another preferred embodiment , a selection element is provided for enabling a user to select whether to require a facsimile number to be input two times or only one time so that an environment conforming to the preferences of the user may be established . it is noted that in the above - described embodiments of the present invention , applications of the group 3 facsimile apparatus are illustrated . however , the present invention is not limited to such applications and may equally be applied to other types of transmission apparatuses having facsimile communication functions . although the present invention is shown and described with respect to certain preferred embodiments , it is obvious that equivalents and modifications may occur to others skilled in the art upon reading and understanding the specification . the present invention includes all such equivalents and modifications , and is limited only by the scope of the claims . the present application is based on and claims the benefit of the earlier filing date of japanese patent application no . 2005 - 359793 filed on dec . 14 , 2005 , the entire contents of which are hereby incorporated by reference . | 7 |
embodiments of the present disclosure are described herein . it is to be understood , however , that the disclosed embodiments are merely examples and other embodiments can take various and alternative forms . the figures are not necessarily to scale ; some features could be exaggerated or minimized to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . as those of ordinary skill in the art will understand , various features illustrated and described with reference to any one of the figures can be combined with features illustrated in one or more other figures to produce embodiments that are not explicitly illustrated or described . the combinations of features illustrated provide representative embodiments for typical applications . various combinations and modifications of the features consistent with the teachings of this disclosure , however , could be desired for particular applications or implementations . candidate metallic bipolar plate ( mbpp ) materials can be formed into a series of channels having widths and depths designed to satisfy desired fuel cell performance criteria . to increase fuel cell performance , deep , narrow channels with vertical side wall geometries essentially mimicking a flat bottom “ u ” are preferred in certain circumstances . such geometries , however , can be difficult or impossible to form from thin metallic materials in a cost effective manner . formability limits of certain thin metallic materials , such as stainless steel foil , can thus restrict their usage as mbpp materials for fuel cell applications . for example , stamping deep , straight channels into thin metallic materials can produce excessive material thinning at channel geometry transition regions such as at channel edges . such thinning can result in tearing of the plate during channel formation , assembly of the fuel cell , or operation of the fuel cell stack . moreover , to the extent that the bipolar plate is a structural component of the fuel cell stack , such thinning can compromise the rigidity of the bipolar plate . conventional mbpp designs commonly feature channels with cross - sections resembling a flat - bottom “ v ” ( or trapezoidal shape ). these configurations tend to have moderate side wall angles and restricted channel depths in an effort to accommodate the forming limits of the precursor plate material and to minimize strain - induced thinning during the forming process . in some cases , base alloy processing steps can be altered to improve the ability of mbpp precursor materials to form past their normal limits . alteration of the material base chemistry or manufacturing process , however , can detrimentally impact other characteristics desired of an alloy to be used in fuel cell applications such as corrosion resistance and electrical conductivity . changes in material composition and processing can also be cost prohibitive . in fuel cells , increasing flow channel cross - sectional area , particularly on the cathode side of the respective membrane electrode assembly ( mea ), can substantially increase fuel cell performance . if the channel opening is too wide , however , the mea can bow inward toward the channel . for this reason , it could be preferable for the channels to be formed with narrower openings and deeper channels . the ability to form mbpps with deeper channels , particularly when the channels are formed by a stamping process , can be improved by altering the forming limits of the precursor plate material at the expense of other characteristics as mentioned above . it has been discovered , however , that altering channel geometry to accommodate the inherent forming limits of the selected precursor material can also improve the ability to form mbpps with deeper channels without significantly impacting such characteristics as corrosion resistance and electrical conductivity . disclosed herein are examples of “ stepped ” sidewall mbpp channel geometries as shown , for example , in fig1 . flow channels with stepped sidewalls can be distinguished from the more traditional trapezoidal channel configuration shown in fig2 . the segments of the sidewall forming the shoulder ( or step ) need not form a 90 degree angle relative to each other . any suitable angle ( e . g ., 80 degrees , 100 degrees , etc .) that permits deep channel formation without significant thinning can be used . testing and / or simulation can determine optimum step dimensions . finite element analysis ( fea ) of the stepped sidewall geometry ( shown , for example , in fig1 ) has been compared to fea of a traditional trapezoidal - shaped channel ( shown , for example , in fig2 ) with equivalent depth . this comparison revealed that material thinning of the stepped geometry of fig1 is far less than that of the trapezoidal channel geometry of fig2 , and material strain across the stepped sidewall geometry of fig1 is more balanced . the fea comparison also revealed that for the equivalent channel depth , d , the trapezoidal channel of fig2 is more likely to experience material failure in its highly strained upper radius zones , r . the fea model results have been empirically verified in further studies . usage of the stepped sidewall geometry similar to that illustrated in fig1 could allow for deeper channels with greater sidewall angles , a , to be formed from existing metallic materials while maintaining acceptable channel opening widths w . these two characteristics can result in improved fuel cell stack operational performance without diminishing the structural integrity of interfacing fuel cell stack components . referring to fig3 , a vehicle 98 such as a car can include a fuel cell stack 100 arranged , as known in the art , to provide power to move the vehicle 98 . the fuel cell stack 100 can include a plurality of fuel cells 102 electrically connected together . each of the fuel cells 102 can include a membrane electrode assembly ( mea ) 104 disposed between first and second bipolar plates 106 , 108 . the membrane electrode assembly 104 includes a cathode portion on one side and an anode portion on the other side . where the term “ gas ” is used in the figures , it is intended to represent the fuel of the fuel cell 102 exposed to the anode side of the mea 104 . in a hydrogen fuel cell , for example , the gas would be hydrogen gas . where the term “ ox ” is used in the figures , it is intended to represent oxygen ( or air containing oxygen ) exposed to the cathode side of the mea 104 . referring to fig4 , each of the bipolar plates 106 can be stamp - formed from a precursor metal sheet such as a sheet of stainless steel foil or other appropriate conductive metallic material . alternative forming methods such as hydro - forming and adiabatic forming can also be used . each of the bipolar plates 106 defines adjacently aligned flow channels 110 ( normal to the page ) alternately disposed on opposing sides of the bipolar plate 106 . further , each of the bipolar plates 106 includes at least partially stepped sidewalls 112 having shoulder portions 114 , and proximal and distal peak portions 116 , 118 where the stepped sidewalls 112 connect with each other ( giving the bipolar plate 106 a corrugated appearance ). hence , each of the stepped sidewalls 112 , in this example , have two end portions and a body portion disposed between the end portions . each of the end portions is adjacent to one of the peak portion 116 , 118 . the shoulder portions 114 are formed in the body portions . the proximal peak portions 116 of each bipolar plate 106 can be in direct contact with the mea 104 ( fig3 ). the distal peak portions 118 of adjacent bipolar plates can be aligned and in electrical contact with one another . particularly in instances in which the bipolar plates 106 are stamp - formed , the bipolar plates 106 can have a substantially uniform web thickness , t . such thickness can be , for example , in the range of approximately 100 microns . any suitable thickness , however , can be used ( e . g ., 80 to 250 microns , etc .) a similar description applies to the bipolar plates 108 of fig3 . referring to fig5 , a portion of a bipolar plate 206 includes at least partially stepped sidewalls 212 having shoulder portions 214 and proximal and distal peak portions 216 , 218 respectively . the channel depth , d , in this example , is at least as equal to the channel width , w . in other examples , the channel depth , d , can be greater than the channel width , w . for example , d can be approximately 500 microns and w can be approximately 100 microns . referring to fig6 , a portion of a bipolar plate 306 includes at least partially stepped sidewalls 312 having shoulder portions 314 and proximal and distal peak portions 316 , 318 respectively . in this example , each of the stepped sidewalls 312 can have two ( or more ) shoulder portions 114 . other configurations are also contemplated . referring to fig7 , a portion of a fuel cell stack 400 includes meas 404 and bipolar plates 408 , 420 in contact with each other and disposed between the meas 404 . in this example , the bipolar plate 408 includes stepped sidewalls 412 and the bipolar plate 420 does not . referring to fig8 , a portion of a fuel cell stack 500 includes meas 504 , bipolar plates 506 , 508 , and a center plate 522 . the center plate 522 is disposed between and in contact with the bipolar plates 506 , 508 to prevent nesting of adjacent bipolar plates and to increase the number of coolant flow channels associated with the bipolar plates 506 , 508 . other arrangements are also contemplated . referring to fig9 , a portion of a fuel cell stack 600 includes meas 604 and bipolar plates 608 , 620 . similar to the example of fig7 , the bipolar plate 608 includes stepped sidewalls 612 and the bipolar plate 620 does not . the bipolar plates 608 , 620 are arranged such that their sidewalls are in contact with each other ( e . g ., connected via welding , bonding , etc . ), which can increase surface contact ( and electrical conductivity ) therebetween , provide alternative weld locations , and decrease stack height . referring to fig1 , a portion of a fuel cell stack 700 includes meas 705 and bipolar plates 706 , 708 . similar to the example of fig9 , the bipolar plates 706 , 708 are arranged such that their sidewalls are in contact with each other to form a nested pair . while exemplary embodiments are described above , it is not intended that these embodiments describe all possible forms encompassed by the claims . the words used in the specification are words of description rather than limitation , and it is understood that various changes can be made without departing from the spirit and scope of the disclosure . as previously described , the features of various embodiments can be combined to form further embodiments of the invention that may not be explicitly described or illustrated . while various embodiments may have been described as providing advantages or being preferred over other embodiments or prior art implementations with respect to one or more desired characteristics , those of ordinary skill in the art recognize that one or more features or characteristics can be compromised to achieve desired overall system attributes , which depend on the specific application and implementation . these attributes can include , but are not limited to : cost , strength , durability , life cycle cost , marketability , appearance , packaging , size , serviceability , weight , manufacturability , ease of assembly , etc . as such , embodiments described as less desirable than other embodiments or prior art implementations with respect to one or more characteristics are not outside the scope of the disclosure and can be desirable for particular applications . | 7 |
the technology of the present application will be further explained with reference to fig1 through 10 . fig1 shows a front plan view of one embodiment of a canopy frame 10 for a collapsible canopy shelter . in this embodiment , canopy frame 10 comprises a plurality of eaves 12 linking a plurality of upwardly extending poles 14 . each eave 12 may comprise a series of pivotally coupled scissor - jacks 18 1 - n . each scissor - jack 18 1 - n may include a left cross member 20 1 - n and a right cross member 22 1 - n , crossed and pivotally coupled at a cross point 24 . to provide additional rigidity to improve the structural integrity of canopy frame 10 , two reinforcing cross members 26 may be crossed and pivotally coupled to left cross members 20 1 - n and right cross members 22 1 - n at each intersection 28 of scissor - jacks 18 1 - n . all pivoting joints may be pinned , bolted , riveted , joined by rotational fasteners , or otherwise rotatively connected as is known in the art . each eave 12 may be collapsibly coupled to a pair of upwardly extending poles 14 through two fixed eave mounts 30 and two sliding eave mounts 32 . fixed eave mounts 30 may be fixably coupled to the top ends 34 of upwardly extending poles 14 , and sliding eave mounts 32 may be slidably coupled to poles 14 , such that sliding eave mounts 32 slide over the length of upwardly extending poles 14 from the bases 36 of poles 14 to just below fixed eave mounts 30 . in turn , a first left cross member 20 1 and a final right cross member 22 n may be pivotally coupled to sliding eave mounts 32 while a first right cross member 22 1 and a final left cross member 20 n may be fixably coupled to fixed eave mounts 30 , allowing scissor - jacks 18 1 - n to collapse in a manner similar to the compression of an accordion when one or more of sliding eave mounts 32 are released and slid in a downward direction denoted by arrow a . of course , one of ordinary skill in the art will readily understand that several alternative mechanisms could be used to collapsibly couple eaves 12 to upwardly extending poles 14 . for example , eaves 12 could be coupled to upwardly extending poles 14 through locking channel systems or a quick release for scissor - jacks 18 1 - n , as is generally known in the art . fig2 shows a side plan view of sliding eave mount 32 slidably coupled to upwardly extending pole 14 and fixably coupled to first left cross member 20 1 . in this embodiment , sliding eave mount 32 may comprise a sliding body 38 , a plurality of arms 40 to fixably attach to eaves 12 , and a latch 42 . in further detail , latch 42 may comprise a spring - loaded lever 44 with a locking pin 46 that is pivotally coupled to sliding body 38 through a hinge pin 48 that may be press fit into sliding body 38 . a torsion spring 50 ( fig3 , 4 ) may encircle hinge pin 48 , such that a first leg 52 and a second leg 54 of torsion spring 50 compress when lever 44 is pulled in the direction of arrow b . lever 44 and locking pin 46 may be configured to allow locking pin 46 to mate with a pin hole 56 located in upwardly extending pole 14 when latch 42 and locking pin 46 are slid into alignment with pin hole 56 . fig3 and 4 show sectional views of one embodiment of sliding eave mount 32 with latch 42 in the locked and unlocked positions , respectively . to unlock latch 42 , a user may swivel latch 42 in the direction of arrow c , thereby withdrawing locking pin 46 from pin hole 56 and compressing torsion spring 50 . as a result , sliding eave mount 32 may slide in a downward direction along upwardly extending pole 14 ( fig1 ) and allow eave 12 to collapse as upwardly extending pole 14 is moved inward towards the remaining upwardly extending poles 14 . to lock latch 42 , a user may slide sliding eave mount 32 upward into alignment with pin hole 56 . once in alignment , torsion spring 50 automatically pivots latch 42 in the direction of arrow d ( fig4 ), thereby snapping locking pin 46 into pin hole 56 and locking sliding eave mount 32 into an assembled position . while described as a torsion spring here , other elastically deformable devices are possible , including , for example , helical or coil springs , leaf springs , or the like . these deformable devices may be formed of spring metals such as music wire or metal alloys , plastics , composites , or any other suitable material known in the art . to ventilate air from the collapsible canopy shelter , one embodiment of the collapsible canopy shelter may include at least one . collapsible flap that may be opened and closed as desired . fig5 shows a partial side plan view of one embodiment of canopy frame 10 having a cover support member 73 , as well as a canopy cover 60 having at least one collapsible flap 62 supported by a pivoting support 70 , 100 ( fig9 , 10 ). to ventilate air from beneath canopy cover 60 , pivoting support 70 , 100 may be used to pivot collapsible flap 62 in the direction of arrow e . into an open position . alternately , collapsible flap 62 may be pivoted in the direction of arrow f into a closed position to prevent air flow . one of ordinary skill in the art will readily understand that a user may also position collapsible flap 62 in any intermediate position between the open and closed positions . in further detail , fig6 and 7 show side plan views of one embodiment of pivoting support 70 in the open and a closed positions , respectively . in this embodiment , pivoting support 70 may comprise a cantilever 72 attached to collapsible flap 62 through a set of cover straps 63 or any other means of attachment generally known in the art , including , for example , a sheath formed of canopy material , snaps , velcro ®, and the like . cantilever 72 may also be pivotally coupled to cover support member 73 through a fixed fastener 74 and an adjustable fastener 76 , each of which may intersect cover support member 73 and cantilever 72 along an axis that is perpendicular to cantilever 72 . fixed fastener 74 may be set at a fixed height y and held in position by a nut 78 . adjustable fastener 76 may comprise a handle 80 and be threaded into a threaded receiving hole 82 in cantilever 72 , such that rotating handle 80 in a first direction pivots cantilever between the closed position and the open position in the direction of arrow g , and rotating adjustable fastener in a second , opposite direction pivots the cantilever between the open position and the closed position in the direction of arrow h . a first flexible spacer 84 may encase fixed fastener 74 between a top surface 86 of cover support member 73 and a bottom surface 88 of cantilever 72 , while a second flexible spacer 90 may encase adjustable fastener 76 between a top surface 86 of cover support member 73 and a bottom surface 88 of cantilever 72 . first and second flexible spacers 84 , 90 stabilize cantilever 72 and allow it to pivot between the closed and open positions in response to the rotation of adjustable fastener 76 . flexible spacers may be formed of rubber or any other suitable elastic material with a density sufficient to withstand the downward force exerted by the weight of cantilever 72 and collapsible flap 62 . fixed fastener 74 and adjustable fastener 76 may consist of a variety of rotational fasteners , including , for example , screws , bolts , adjustable pins , or any other suitable fastener as is generally known in the art optionally , pivoting support 70 may further comprise a sleeve 92 . sleeve 92 may provide aesthetic benefits as well as protect cover support member 73 from exposure to light and moisture at the points where it has been drilled to accommodate fixed fastener 74 and adjustable fastener 76 . fig8 and 9 illustrate side plan views of another embodiment of pivoting support 100 in the open and closed positions , respectively . pivoting support 100 may comprise a cantilever 102 that is attached to cover support member 73 in the same manner discussed with respect to cantilever 72 above . moreover , cantilever 102 may be pivotally coupled with cover support member 73 through a pivoting bracket 104 located at a pivot point 105 . pivoting bracket 104 may be offset a distance x from a pivot end 106 of cantilever 102 , such that pivot end 106 serves as a hard stop to prevent cantilever 102 from rotating beyond the open position shown in fig8 . in addition , a fulcrum 108 may be slidably coupled to cover support member 73 such that it restrains cantilever 102 when in the closed position and props cantilever 102 when in the open position or any position between the closed and open positions . fig1 shows a front plan view of one embodiment of fulcrum 108 . in this embodiment , fulcrum 108 may comprise a cantilever hole 110 sized to frictionally engage cantilever 102 when cantilever 102 is in the closed position shown in fig9 . fulcrum 108 may further comprise a roof support hole 112 configured to slidably engage with roof support member 73 , such that it props cantilever 102 when in the open position shown in fig8 . of course , one of ordinary skill in the art will readily understand that fulcrum 108 may prop cantilever 102 in any intermediate position between the closed and open positions to provide varying levels of air flow . cantilever 102 , bracket 104 , and fulcrum 108 may be formed of metal , plastic , or any other material of suitable strength as is generally known in the art . the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . | 4 |
as noted above , the invention dispenses with conventional staking techniques to join together in an assembly a mount plate and an actuator arm . reliance is placed on a split ring to achieve insertion in the first instance and radial tension or compression in the second in making an effective hsa . in the preferred embodiment , described in more detail below , the actuator arm circular opening has a 0 . 005 inch through slot cut in it its full height . this slot allows the actuator circular opening diameter to expand slightly , allowing a cylindrical boss of the mount plate to be inserted into the hole by simply a press fit . this press fit replaces ball staking . the annular boss is preferably specially adapted for press fitting with a lead or chamfer at the distal end of the cylinder , the slot structure , the actuator arm circular opening diameter , and the mount plate annular boss are absolutely and relatively sized so that the actuator circular opening will expand from its starting original or initial diameter to the boss diameter in elastic deformation only . thus , the arm circular opening will return ( contract ) to its original size if the wedging effect of mount plate annular boss is removed . the annular boss will enter the unexpanded original sized actuator circular opening with the assistance of a lead or chamfer that forces the opening to enlarge elastically so that the cylinder walls of the opening can close upon the annular boss and being resilient hold it firmly without deforming it . 1 ) the mount plate , including the annular boss , can be made of harder , stronger material ( for example , full hard type 302 / 304 stainless steel ( sst ) with a hardness of rc 40 - 45 and yield strength of 175 - 195 kpsi ). with staking , it was typically necessary to use softer metal ( only ¼ hard 302 / 304 sst with a hardness of rc 25 - 30 and yield strength of 90 - 120 kpsi ) because the metal had to be deformable to be staked into position ; 2 ) the now possible use of the harder material makes the mount plate more resistant to undesirable deformations , and , therefore , less susceptible to gram load change due to deformation as discussed above ; 3 ) the harder material is more rigid , and enhances performance of its function as a rigid support for the load beam to act from ; 4 ) the invention assembly and method permit the use of a thread - sealing type of adhesive to the interfacing surfaces between the boss and the mating hole to enhance the torque resistance of the mount plate ; and 5 ) rework is easier than before since the slot may be pried apart to release the mount plate ( if done before adhesive is applied ) and the actuator boss is relatively undamaged compared to the prior art staked case . with reference now to the drawings in detail , in fig1 the invention assembly is shown at 10 and comprises an actuator arm 12 having at its distal end 11 a circular opening 14 having a cylindrical wall 16 of a predetermined diameter . the assembly 10 further comprises a mount plate 18 having an annular boss 22 formed of wall 24 . load beam 13 is fixed to the mount plate base 15 by welding or the like . boss 22 is greater in diameter than the circular opening 14 . a split ring structure 26 is provided in the boss 22 as shown including through slot 28 having opposing faces 28 a , 28 b , the slot being adapted to be compressed to a lesser than initial width by the entry of the boss into the circular opening 14 , effecting a contraction of the boss 22 , cf . fig5 . in fig2 and 4 an alternate form of the invention assembly is shown at 30 . assembly 30 comprises an actuator arm 32 having at its distal end 31 a circular opening 34 having a cylindrical wall 36 of a predetermined diameter . the assembly 30 further comprises a mount plate 38 having an annular boss 42 formed of wall 44 . load beam 33 is fixed to the mount plate base 35 by welding or the like . boss 42 is greater in diameter than the circular opening 34 . a split ring structure 46 is provided in the distal end 31 of the actuator arm 32 as shown including a through slot 40 having opposing faces 40 a , 40 b , the slot being adapted to be expanded to a greater than initial width by the entry of the boss 42 into the circular opening 34 , effecting an expansion of the diameter of the opening . in fig3 an alternate form of the invention assembly is shown at 50 . assembly 50 comprises an actuator arm 52 having at its distal end 51 a circular opening 54 having a cylindrical wall 56 of a predetermined diameter . the assembly 50 further comprises a mount plate 58 having an annular boss 62 . load beam 53 is fixed to the mount plate base 55 by welding or the like . boss 62 is greater in diameter than the circular opening 54 . a double split ring structure 56 a , 56 b is provided in the boss 62 as shown including through slots 58 , 59 having opposing faces 58 a , 58 b , and 59 a , 59 b , respectively . slots 58 , 59 are adapted to be compressed to a lesser than initial width by the entry of the boss 62 into the circular opening 54 , effecting a contraction of the boss 62 . cf . fig5 . in fig5 a and 5b , an alternate form of the invention assembly is shown at 70 . assembly 70 is like the embodiment of fig1 or fig3 in having an actuator arm 72 having at its distal end 71 a circular opening 74 having a cylindrical wall 76 of a predetermined diameter . the assembly 70 further comprises a mount plate 78 having an annular boss 82 formed of wall 84 . load beam 73 is fixed to the mount plate base 75 by welding or the like . boss 82 is greater in diameter than the circular opening 74 . ln addition , boss wall 84 has chamfered insertion shoulders 85 at its distal end 87 , a feature equally applicable to the other embodiments herein . in addition , the boss wall 84 has at its distal end 87 an outwardly projecting annular shoulder 89 which can be a tapered portion of the boss 82 , sized to further compress the slot 88 to an enhanced degree to be less than its initial width in the assembled condition of the actuator arm 72 and mounting plate 78 thereby to progressively increase by camming action the radial forces between the boss 82 and the arm opening 74 . split ring structure 86 is provided in the boss 82 as shown including the through slot 88 having opposing faces 88 a , 88 b , the slot being adapted to be compressed to a less than initial width by the entry of the boss 82 into the circular opening 74 , effecting a contraction of the boss 82 , compare fig5 a with fig5 b . in the foregoing embodiments , typically , the mounting plate is formed of full hard stainless steel having an rc of 40 - 45 , the through slot is about 0 . 005 inch in width and sufficiently deep to extend through the annular boss wall boss or the actuator circular opening wall , and the annular boss is chamfered about its outer upper edge to facilitate entry of the boss into the circular opening . as previously noted , a typical assembly of the invention where the arm has the split ring structure will have a mounting plate base of about 0 . 2 inch square and about 0 . 010 inch or less deep and a central annular boss extending about 0 . 012 inch in height from the mounting plate base , the boss having an outside diameter of about 0 . 1075 inch . the actuator an arm will have a distal end with a thickness of about 0 . 03 inch , the actuator circular opening having an inside diameter of about 0 . 1050 inch and smaller than the boss outside diameter with the actuator opening extending through the arm distal end . also , in a given embodiment , the axis of revolution of the actuator circular opening wall will be located about 0 . 085 inch from the arm distal end . a typical assembly where the boss has the split ring structure will include a mounting plate base of about 0 . 2 inch square and about 0 . 010 inch or less deep and a central annular boss comprising an annular wall extending about 0 . 012 inch in height from the mounting plate base , the boss having an outside diameter of about 0 . 1075 inch . the actuator arm will have a distal end with a thickness of about 0 . 03 inch , the actuator arm defining a wall surrounding the circular opening , the circular opening having an inside diameter of about 0 . 1050 inch and smaller than the boss outside diameter , the actuator opening extending through the arm distal end , with the through slot extending through the boss annular wall for substantially the height of the annular boss wall . in practicing the invention method , the mounting plate having an annular boss and carrying a load beam in fixed relation is mounted to an actuator arm having a circular opening smaller than and congruent with the boss . a slot is defined having an original width in the annular boss or the circular opening boss , the annular boss is inserted into the circular opening , expanding or contracting the slot to accommodate the insertion step . the force generated by the slot tending to return to its original width maintains the annular boss within the circular opening effecting a fixing of the load beam to the actuator arm . the invention thus provides an alternative method of hga attachment to the actuator in the stack build using a mounting plate boss larger , not smaller , than the arm circular opening , and assembling the mounting plate and arm together not by swaging or staking , but by the use of a split ring structure . the split ring structure , incorporated into the annular boss or the boss - receiving arm opening allows the fitting of parts by expanding or contracting depending on whether the split ring is in the inside or outside component of the assembly , and preserves their angular orientation by resiliently urging the parts into engagement as a function of the split ring slot tending to return to its preassembly larger or smaller width . insertion of the boss is facilitated by a chamfer on the boss , and the invention provides a camming shoulder on the boss to increase radial forces in the assembled device . the foregoing objects are thus met . | 6 |
the present invention is similar to that disclosed in parant u . s . pat . no . 5 , 655 , 540 , ( from which priority derives ), with the exception that a single subject ecg cycle is utilized in analysis rather than a composite subject ecg cycle . in the following a specific embodiment of the present invention is presented much as it was in the earlier parent patent , and previous examples are provided . said specific embodiment assumes the use of an ( ecg ) system which utilizes frank ( ecg ) orthogonal x - y - z leads . it is to be understood , however , that the present invention is not limited to such and can be practiced with ( ecg ) systems in which any number of leads , ( eg . standard twelve ( 12 ), sixteen ( 16 ), or mapping arrays of twenty - four ( 24 ) or more etc . ), are present , and in which only some of the present leads are utilized . the following specific embodiment is presented as it is well documented and is presently the preferred embodiment . turning now to the drawings , there is shown in fig1 ( a ) a frontal view of a torso of a human , with ( ecg ) frank x and y leads properly affixed thereto . fig1 ( b ) shows a cross section taken at a — a in fig1 ( a ) with ( ecg ) frank z leads properly attached thereto . in use said ( ecg ) frank x - y - z leads are attached to an ( ecg ) system and serve to effect orthogonal monitoring of ( ecg ) full cardiac cycle pqrst signals which are essentially shaped as shown in fig2 . the present invention requires as a starting point that a significant data base be available , which significant data base contains representative composite ( ecg ) data for all , or some portion of full ( ecg ) pqrst cycles for each ( ecg ) lead , for a normal population . ( note , a normal population is defined as one in which the subjects have no detectable coronary artery disease ( cad ) by history and multiple conventional diagnostic tests , and are not at risk therefore based upon age , family history etc .) such a significant data base for normals was acquired by obtaining a number of full ( ecg ) pqrst cycles from each of the frank x - y - z ( ecg ) leads present in the presently discussed embodiment of the invention , from each of two - hundred - fifty ( 250 ) normals . ( it is noted that the present invention is not limited to cases in which all leads present in an ( ecg ) system are monitored but that a preferred embodiment does utilize all available information ). next , a random sample of one - hundred - forty - six ( 146 ) of said two - hundred - fifty ( 250 ) normals was selected and a representative number of the full ( ecg ) pqrst cycles from each , ( typically one - hundred ( 100 )), for each frank x - y - z ( ecg ) lead , were then selected and each subjected to a sampling procedure which provided some number of data points for each , ( six - hundred ( 600 ) was chosen in the presently discussed embodiment ). next , the sampled data points corresponding to the qrs depolarization complexes in each selected full ( ecg ) pqrst cycle were selected and a representative composite qrs complex for each frank ( ecg ) x - y and z leads formed therefrom by mathematical averaging thereof . said representative composite was then subjected to filtering and windowing techniques to provide a number of data sets for each of the frank ( ecg ) x - y - z leads . said data sets in the presently preferred embodiment of the present invention provide information present in said representative composite in the frequency bands : for each of the frank ( ecg ) x - y - z leads then , five ( 5 ) sets of data were derived as described , and from each of said sets of data a root - mean - square ( rms ) mean and ( rms ) standard deviation were calculated . this , it will be appreciated , resulted in fifteen ( 15 ) rms representative composite means and standard deviations being available , ( five for each frank ( ecg ) x - y - z lead ). in view of the described rms mean and rms standard deviations ( sd &# 39 ; s ) available clinical application of the present invention can be practiced . in prior practice data were obtained from a subject in a manner essentially the same as described infra for normals , but the present embodiment provides that a single ecg cycle be obtained and utilized . that is , a number of full ( ecg ) pqrst full cardiac cycles from each frank ( ecg ) x - y - z lead are obtained and a representative one selected and subjected to a sampling procedure . some portion of a selected full pqrst waveform is selected , ( eg . the qrs depolarization complex is utilized in the presently preferred embodiment of the present invention ), for each frank ( ecg ) system x - y - z lead . for said representative ( ecg ) cycle a rms mean is then calculated so that a table equivalent to that shown in fig3 but containing subject rms mean data , is formed . with the described normal rms mean and rms standard deviation data , and subject rms mean data then available , the algorithm of the method of the present invention can be applied to arrive at a diagnostic mathematical “ score ”. a . normal and subject rms means in view of normal rms standard deviation ; b . ratios of normal and subject rms frequency range and means to the summation of rms means for all frequency range bands for each frank ( ecg ) x - y - z lead in view of normal standard deviation for the numerator frequency band . c . ratios of normal and subject frank ( ecg ) x - y - z lead rms means in view of normal standard deviations of said ratios . briefly , application of each of the identified steps provides a numerical result ( pi ), which in general is typically not a whole integer . the next step is to process said numerical result ( pi ) by comparison to an assumed gaussian distribution derived from the normal population data to arrive at a whole number integer which represents how many rms standard deviations the subject rms mean is away from the normal rms mean , and assign a whole integer “ score ” component number ( si ) based thereupon . the algorithm then requires that a ninety - five ( 95 %) confidence interval , based upon normal rms standard deviation data be applied to determine if a “ score ” component should be accepted and included in calculation of a final “ score ”, said final “ score ” being arrived at by an addition of accepted “ score ” components . said algorithm will now be described in detail . the first step in applying the algorithm of the presently described presently preferred embodiment of the present invention is perform up to fifteen ( 15 ) calculations comprising subtracting the subject rms mean from a corresponding normal rms mean and dividing the result by a corresponding normal rms standard deviation for each frank ( ecg ) x - y - z lead in each frequency range identified infra , to provide numbers ( pi ). for all frequencies : ( subject rms mean - normal rms mean ) normal rms standard deviation = px1 = p1 for the frequency range band zero ( 0 ) to ten ( 10 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = px2 = p2 for the frequency range band ten ( 10 ) to sixty ( 60 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = px3 = p3 for the frequency range band sixty ( 60 ) to one - hundred - fifty ( 150 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = px4 = p4 for the frequency range band one - hundred - fifty ( 150 hz ) to two - hundred - fifty ( 250 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = px5 = p5 for all frequencies : ( subject rms mean - normal rms mean ) normal rms standard deviation = py1 = p6 for the frequency range band zero ( 0 ) to ten ( 10 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = py2 = p7 for the frequency range band ten ( 10 ) to sixty ( 60 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = py3 = p8 for the frequency range band sixty ( 60 ) to one - hundred - fifty ( 150 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = py4 = p9 for the frequency range band one - hundred - fifty ( 150 hz ) to two - hundred - fifty ( 250 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = py5 = p10 for the frank ( ecg ) z lead , ( ie . front to back axis ): ps for all frequencies : ( subject rms mean - normal rms mean ) normal rms standard deviation = pz1 = p11 for the frequency range band zero ( 0 ) to ten ( 10 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = pz2 = p12 for the frequency range band ten ( 10 ) to sixty ( 60 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = pz3 = p13 for the frequency range band sixty ( 60 ) to one - hundred - fifty ( 150 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = pz4 = p14 for the frequency range band one - hundred - fifty ( 150 hz ) to two - hundred - fifty ( 250 hz ): ( subject rms mean - normal rms mean ) normal rms standard deviation = pz5 = p15 twelve ( 12 ) additional groups of calculations are then performed in which the relative rms mean content of each frequency range band identified infra is determined as a percentage of the rms mean of the sum of the filter derived frequency range bands for each frank ( ecg ) system x - y - z system lead , for both subject and normal data , the differences therebetween being divided by the corresponding normal rms standard deviation to provide additional numbers ( pi ): define : ( 100 × subject rms ( 0 – 10 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sx0 ( 100 × normal rms ( 0 – 10 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = nx0 define : ( 100 × subject rms ( 10 – 60 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sx1 ( 100 × normal rms ( 10 – 60 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = nx1 define : ( 100 × subject rms ( 60 – 150 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sx2 ( 100 × normal rms ( 60 – 150 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = nx2 define : ( 100 × subject rms ( 150 – 250 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sx3 ( 100 × normal rms ( 150 – 250 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = nx3 define : ( 100 × subject rms ( 0 – 10 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) ( 150 – 250 hz ) ) = sy0 = sy0 ( 100 × normal rms ( 0 – 10 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = ny0 define : ( 100 × subject rms ( 10 – 60 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sy1 ( 100 × normal rms ( 10 – 60 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = ny1 define : ( 100 × subject rms ( 60 – 150 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sy2 ( 100 × normal rms ( 60 – 150 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = ny2 define : ( 100 × subject rms ( 150 – 250 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sy3 ( 100 × normal rms ( 150 – 250 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = ny3 define : ( 100 × subject rms ( 0 – 10 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sz0 ( 100 × normal rms ( 0 – 10 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = nz0 define : ( 100 × subject rms ( 10 – 60 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sz1 ( 100 × normal rms ( 10 – 60 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = nz1 define : ( 100 × subject rms ( 60 – 150 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sz2 ( 100 × normal rms ( 60 – 150 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = nz2 define : ( 100 × subject rms ( 150 – 250 hz ) mean ) ( subject rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = sz3 ( 100 × normal rms ( 150 – 250 hz ) mean ) ( normal rms mean ( 0 – 10 hz ) + ( 10 – 60 hz ) + ( 60 – 150 hz ) + ( 150 – 250 hz ) ) = nz3 three ( 3 ) additional calculations are then performed in which subject rms means of ratios of rms means obtained from the frank ( ecg ) x - y - z leads , are subtracted from corresponding rms means of ratios obtained similarly from normals , the results of which subtraction are then divided by rms standard deviations of normal corresponding rms ratios to provide additional numbers ( pi ): for the frank ( ecg ) x - y - z leads : subject rms ( x / y ) mean - normal rms ( x / y ) mean normal standard deviation ( x / y ) = p ( x / y ) = p28 subject rms ( y / z ) mean - normal rms ( z / y ) mean normal standard deviation ( y / z ) = p ( y / z ) = p29 subject rms ( x / z ) mean - normal rms ( x / z ) mean normal standard deviation ( x / z ) = p ( x / z ) = p30 continuing , each of the above up to thirty ( 30 ) calculated numbers : ( px 1 - p 1 , px 2 - p 2 , px 3 - p 3 , px 4 - p 4 , px 5 - p 5 , px 6 - p 6 px 7 - p 7 , px 8 - p 8 , px 9 - p 9 ), ( py 1 - p 10 , py 2 - p 11 , py 2 - p 11 , py 3 - p 12 , py 4 - p 14 , py 6 - p 15 , py 7 - p 16 , py 8 - p 17 , py 9 - p 18 ), ( pz 1 - p 19 , pz 2 - p 20 , pz 3 - p 21 , pz 4 - p 22 , pz 5 - p 23 , pz 6 - p 24 , pz 7 - p 25 , pz 8 - p 26 , pz 9 - p 27 ), p ( x / y - p 28 ), p ( y / z )- p 29 and p ( x / z )- p 30 ), ( generally identified as ( pi )), can optionally be compared to a corresponding assumed gaussian distribution of normal data to arrive at a “ score ” component number . if a number ( pi ) is within some +/− “ x ” rms standard deviation range of the rms mean as shown below , a “ score ” component number ( si ) is taken to be : if - 1 x & lt ; ( pi ) & lt ; 1 x then si = 0 ; if - 2 x & lt ; ( pi ) & lt ; - 1 x or if 1 x & lt ; ( pi ) & lt ; 2 x then si = 1 ; if - 3 x & lt ; ( pi ) & lt ; - 2 x or if 2 x & lt ; ( pi ) & lt ; 3 x then si = 2 ; if - 4 x & lt ; ( pi ) & lt ; - 3 x or if 3 x & lt ; ( pi ) & lt ; 4 x then si = 3 etc . continuing , each of this resulting “ score ” component ( pi ) or ( si ) calculated as just described is then subjected to a final test to determine if it should be accepted or rejected . said final test involves comparing the subject rms mean to the data from which the normal rms mean was calculated . if less than or equal to ninety - five ( 95 %) percent of the data points from which the normal rms mean was calculated are more than the subject &# 39 ; s rms mean the associated “ score ” component ( si ) is accepted , otherwise it is rejected . accepted “ score ” component numbers are then added to provide a final numerical “ score ”. it has been found that if said final numerical “ score ” is “ low ”, ( eg . approximately 0 to 7 ), then the subject involved is more likely to be normal . if the final numerical “ score ” is “ high ”, ( eg . greater than about 8 ), then the subject is more likely to be abnormal . a particularly relevant approach to presenting the results of applying the disclosed method of the present invention is demonstrated by fig5 . fig5 shows a plot in which the abscissa is ( 100 - specificity ) and the ordinate is ( sensitivity ). these terms are well known and mean : specificity = normals with negative test all normals tested sensitivity = abnormal with positive test all abnormals tested . the curve in fig5 is demonstrative of those which populations of subjects provide in an ( roc ) format . the present invention method provides that ( roc ) curves be prepared by associating a “ score ” value with the abscissa , in a nonlinear manner , and the percentage of a group having said “ score ” value with the ordinate of such a plot . the success of the present invention in identifying and distinguishing abnormal subjects has been demonstrated to be quite striking . fig8 and 9 , discussed supra , better serve to demonstrate this with actual empirically derived data . fig6 x 1 through 6 z 4 show twelve ( 12 ) diagrams , 6 x 1 , 6 x 2 , 6 x 3 , 6 x 4 , 6 y 1 , 6 y 2 , 6 y 3 , 6 y 4 , 6 z 1 , 6 z 2 , 6 z 3 and 6 z 4 , of subject time domain sample data recorded from frank x , y and z leads . higher frequency band data are presented as one progresses from fig6 x 1 to 6 x 4 , and from fig6 y 1 to 6 y 4 , and from fig6 z 1 to 6 z 4 . more particularly , fig6 x 1 , 6 y 1 and 6 z 1 show filtered composite subject ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system in frequency band range of 0 . 0 - 10 hz . fig6 x 2 , 6 y 2 and 6 z 2 show filtered composite subject ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system for the frequency band of 10 - 60 hz . fig6 x 3 , 6 y 3 and 6 z 3 show filtered composite subject ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system for the frequency band of 60 - 150 hz . fig6 x 4 , 6 y 4 and 6 z 4 show filtered composite subject ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system for the frequency band of 150 - 250 hz . it is noted that the plots for the 60 - 150 and 150 - 250 hz bands present as “ envelopes ” as signals go positive to negative and vice versa in very short time periods , ( ie . over a few “ sample numbers ”). all plots in fig6 x 1 - 6 z 4 have the ordinate marked in micro - volts , and the abscissa is marked in digital filter data points 0 to 600 , taken at progressive times during an ( ecg ) cycle . it is noted that fig6 y 2 and 6 y 4 show “ rhomboids ” present in the segment past the qrs complex region , ( ie . in channels 375 - 600 ). the rhomboids are shown as dashed - line to indicate that they were added to the actual patient data graph . this was done in preference to cluttering the disclosure with an additional page of drawings , however , the point to be made is that the presence of said “ rhomboids ” in at least one time domain , frequency band plot , and especially said presence in more than one such frequency band plot , is very indicative of a patient in danger of sudden death . fig7 a x 1 - 7 a z 5 show fifteen ( 15 ) diagrams of typical subject data in frequency domain power spectral density form , ( with magnitude on ordinate ), plotted as a function of frequency , ( on abscissa ). fig7 b x 1 - 7 b z 5 show fifteen ( 15 ) diagrams of typical subject data in time domain form , ( magnitude on ordinate ), plotted as a function of time , ( on abscissa ). all said identified plots provide magnitude , on the ordinate , in microvolts . more particularly , it is noted that fig7 a x 1 , 7 a y 1 and 7 a z 1 show subject composite ( ecg ) data set frequency domain power spectral density plots derived from x , y and z leads , respectively , of a frank ecg system , over a frequency band of 0 . 0 to 100 hz . fig7 a x 2 , 7 a y 2 and 7 a z 2 show subject composite ( ecg ) data set frequency domain power spectral density plots derived from x , y and z leads , respectively , of a frank ecg system , over a frequency band of 0 . 0 to 15 hz . fig7 a x 3 , 7 a y 3 and 7 a z 3 show subject composite ( ecg ) data set frequency domain power spectral density plots derived from x , y and z leads , respectively , of a frank ecg system , over a frequency band of 0 . 0 to 80 hz . fig7 a x 4 , 7 a y 4 and 7 a z 4 show subject composite ( ecg ) data set frequency domain power spectral density plots derived from x , y and z leads , respectively , of a frank ecg system , over a frequency band of 50 to 200 hz . fig7 a x 5 , 7 a y 5 and 7 a z 5 show subject composite ( ecg ) data set frequency domain power spectral density plots derived from x , y and z leads , respectively , of a frank ecg system , over a frequency band of 100 to 300 hz . all plots in fig7 a x 1 - 7 a z 4 have the ordinate marked in micro - volts , and the abscissa is marked in hz , ( ie . cycles per second ). as well , fig7 b x 1 , 7 b y 1 and 7 b z 1 show subject composite ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system in an unfiltered full requisite frequency band . fig7 b x 2 , 7 b y 2 and 7 b z 2 show subject composite ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system in a filtered frequency band range of 0 . 0 - 10 hz . fig7 b x 3 , 7 b y 3 and 7 b z 3 show subject composite ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system in a filtered frequency band range of 10 - 60 hz . fig7 b x 4 , 7 b y 4 and 7 b z 4 show subject composite ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system in a filtered frequency band range of 60 - 150 hz . fig7 b x 5 , 7 b y 5 and 7 b z 5 show subject composite ( ecg ) data set time domain waveforms obtained from x , y and z leads , respectively , of a frank ecg system in a filtered frequency band range of 150 - 250 hz . it is noted that the plots for the 60 - 150 and 150 - 250 hz bands present as “ envelopes ” as signals go positive to negative and vice versa in very short time periods , ( ie . over a few “ sample numbers ”). all plots in fig7 b x 1 - 7 b z 5 have the ordinate marked in micro - volts , and the abscissa is marked in digital filter sample number data points , taken at progressive times during a ( ecg ) cycle . the present invention the makes use of such visual aids as an added feature . the three curves in each plot represent normal mean and plus / minus one standard deviations , and subject data . it is also to be understood that the above described approach to diagnosis can be applied to tracking patients over time and can be applied before and after various stress tests which attempt to provoke otherwise indolent or silent coronary artery abnormalities . stress tests can , for example , involve treadmill exertion or a cold pressor test in which a subject simply places an arm into cold water for a few minutes . changes in “ score ” results combined with changes in the appearance of power spectral density ( psd ) and amplitude plots over time or before and after stress tests can provide insight as to a subject &# 39 ; s coronary health not made available by less vigerous testing . multiple mean curves can be simultaneously presented on a single plot to allow easy visual comparison of changes in power spectral density as a function of time or stress . observation of changes in ( psd ) plots in the various frequency bands is a correlated part of the method of the present invention . of particular interest , the inventor has noted that plots of ( psd ) in the frequency ranges of sixty ( 60 ) to one - hundred - fifty ( 150 ) hz and one - hundred - fifty ( 150 ) hz to two - hundred - fifty ( 250 ) hz show the greatest change in visually observable shape when a cold pressor test is administered . this is considered a significant observation . note also that as shown in fig7 a x 1 , it is common to include numerical representation in frequency as well as the time domain plots . four numbers can be present . using the power spectral density plot as an example , when present said numbers are representations of : upper left — the number of standard deviations a subject power spectral density value is away from a corresponding normal power spectral density value for the frequency band in the plot . lower left — the percentage of normals which are below the subject power spectral density value for the frequency band in the plot . upper right — the number of normalized , ( ie . subject power spectral density value in the frequency band of the plot divided by the sum of power spectral density values for all frequency bands ), standard deviations of subject power spectral value is away from a corresponding normalized subject power spectral density value for normals for the frequency band in the plot . lower right — the percentage of normals which are below the normalized subject power spectral density value for the frequency band in the plot . ( note that ( rms ) values can be substituted for power spectral density ). said numbers and visual plots aid in interpretation of a subject &# 39 ; s “ score ”. fig8 and 9 show ( roc ) plots for actual data arrived at using the present invention method . again , ( roc ) curves typically plot sensitivity vs . ( 100 - specificity ) on ordinate and abscissa respectively , presented as percentages . said plots in fig8 and 9 were generated by associating the present invention “ score ” with the abscissa ( 100 - specificity ), but with the zero ( 0 ) thereof being at the right side so that the “ score ” increases to the left . as the “ score ” increases the percentage of each group of subjects associated therewith is plotted on the ordinate . by observation of fig8 and 9 it will be appreciated that as the “ score ” increases the percentage of normals in a group of known normals having said “ score ” value drops off rapidly , but the percentage of known abnormals in a group of known abnormals drops off much more slowly . for instance , at a “ score ” of zero ( 0 ) all members of all groups are present . at a “ score ” of five ( 5 ) approximately eighty ( 80 %) percent of all members of an abnormal group will be present , but only approximately eleven ( 11 %) percent of normals are present . it is noted that a “ score ” scale along the abscissa will be nonlinear , when compared to the ( 100 - specificity ) scale . fig8 shows data presented in ( roc ) format for abnormals in various categories : for subjects known to have had a myocardial infarction ( mi ) shown by twelve ( 12 ) lead ( ecg ), identified as ( bemi ); for subjects with non - specific st - t wave abnormality on twelve ( 12 ) lead ( ecg ), identified as ( best ); for a subjects with normal twelve ( 12 ) lead ( ecg ) but awaiting surgery , identified as ( bnob ). for a test set of patients who have ( cad ), identified as ( btest ) and ( bgensia ). fig9 shows data plotted in fig8 plotted in a different format in which the abcissa is scaled in terms of the “ score ” developed by the present invention method . present is also a curve for normals data , identified as ( norm ). also included are curves for two groups additional groups of volunteer subjects which contain patients who have known risk factors for ( cad ) identified as ( bmaq ) and ( btnr ). these constitute a “ real - world ” population of what are considered normals , in that both normals and abnormals are present . as would be expected , the data for the ( bmaq ) and ( btnr ) groups is generally positioned between the data for the known abnormal ( btest ) and normal groups . the important thing to note is that the method of the present invention very definitely separates the various groups whether presented in the format of fig8 or fig9 . fig1 provides a flow chart representation of the primary focus of the preferred embodiment of the method of the present invention , said method comprising a noninvasive approach to investigating cardiac status of a subject , and enabling classification of a subject into normal and abnormal cardiac categories utilizing electrocardiography ( ecg ) data obtained therefrom . it has further been found by investigation of cami / 11 data base data for subjects known to be at risk for sudden death , that if dividing a present invention “ score ” for a patient , ( as provided by the described practice of the present invention ), by the ejection fraction , ( in percent ), of the patient , provides a result greater than one ( 1 . 0 ), then the patient involved is at high risk of sudden death . a visual presentation of the just described phenomona is quite striking , as is shown by in fig1 a and 11 b which show scatter - graphs demonstrating the relationship between said present invention : plotted against the present invention “ score ”, ( termed “ seecad ”™ score . (“ seecad ” is a trademark owned by r & amp ; s incorporated , a canadian corporation ). note , as shown in fig1 b , that a population of subjects not at risk for sudden death present with results wherein subject data “ scatter ” is closely confined about the line which begins at ( 0 . 0 , 0 . 0 ) and ends at ( 50 , 1 . 5 ); whereas a population which demonstrated sudden death presents with data which demonstrate a much larger range of scatter . in addition , and most importantly on an individual patient basis , note that no subject data in fig1 b exceed that value of 1 . 0 on the abscissa , whereas a large number of subjects shown in fig1 a provide data points above 1 . 0 . the bottom line conclusion to be appreciated is that should a subject present with a : value greater than 1 . 0 , said subject should be considered to definitely be a risk for sudden death . if said ratio is coupled with the presence of previously described “ rhomboids ” present following a qrs complex in time domain plots , ( see for instance demonstration in fig6 y 3 and 6 y 4 ), then the patient involved should be considered to be at very high risk for sudden death . this combination of present invention “ seecad ” score with other typically obtained cardiac data provides insight to the potential scope of application of the present invention . the definition of and availability of the described “ seecad ” score provided by practice of the present invention , has opened a whole new and very promising avenue in the area of subject evaluation . fig1 shows a three - dimensional presentation of data components utilized in computing a “ seecad ”™ score . fig1 is included to show that such a presentation indicates that patterns of : which data components were derived utilizing present invention methodology , can identify specific subject abnormality data patterns . it is emphasized that known efforts of previous researchers have had as a focus the diagnosis of subject abnormality by the comparison of : subject data to abnormal subject population data , and looking for a match . the present invention then has a new focus , emphasis added . again , the present invention focus is on comparing subject data to normal subject population data , and patterns of data components which naturally arise thereform are found to be indicative of specific categories of abnormality . the fact that the present invention approach , based in comparing subject data to normal subject population data , results in data patterns which serve to idicate a specific subject abnormality is a distinguishing factor of the present invention , and provides an extremely exciting area of continued development . it is projected that further work utilizing present invention non - invasively obtained “ seecad ” score data and methodology will provide the ability to not only separate abnormal from normal subjects , ( already possible ), but to further identify the most likely anatomical location of the source of identified abnormality , ( eg . specific myocardium , specific coronary - arteries etc ). fig1 shows a diagram of the basic components of a system which can be utilized to practice the present invention method . a partial human torso is shown with a chest mounted bioelectric interface ( bi ) thereon . ( note that equivalent limb electrodes ( ra ), ( la ) ( ll ) are present therein ). conventional individual limb and precordial ( ie . ( v 1 ), ( v 2 ), ( v 3 ), ( v 4 ), ( v 5 ) and ( v 6 )) leads can , of course , be utilized as well . it has been found , however , that use of a chest mountable bioelectric interface ( bi ), as shown , provides better ( ecg ) signals by maintaining relatively better electrode contact to a subject and relatively constant electrode spacing , in use . a cable ( c ) provides electrical signals from said electrodes ( ra ), ( la ), ( ll ), ( v 1 ), ( v 2 ), ( v 3 ), ( v 4 ), ( v 5 ) and ( v 6 ) to an ( ecg ) monitor ( ecg ), which feeds to a computational means ( computer ), which in turn provides seecad ™ data to a ( visual display ) and to a ( printer / plotter ). of course fig1 is only demonstrative and the present invention system is not limited to the configuration shown . it is to be understood that throughout this disclosure the rms mean values are cited . it is possible to utilize other calculated values , such as averages , in the method of the present invention . the term “ mean ” should be interpreted broadly to include such alternatives . the terms “ assumed gaussian ” have also been used throughtout this disclosure when refering to data distribution rms means and rms standard deviations . it is noted that in fact , analysis of empirically obtained data has proven the assumption to be valid . it is also to be understood that the term “ rhomboid ” is used herein only to generally identify the presence of ( ecg ) activity beyond the qrs complex as shown by dashed lines in fig6 y 3 and 6 y 4 , and does not impose any plot locus shape limitations . a print - out of major portions of the computer program utilized in the practice of the present invention was included in u . s . pat . no . 5 , 655 , 540 , said patent being incorporated herein by reference . the present invention practice is similar but does not require the combining of numerous subject ecg waveforms , in that it operates on a single ecg cycle . it is also disclosed that tracking of a subject can be continuous , and can utilize data obtained before and after , for instance : a suitable stress test ; intervention ( angioplasty etc . ); and / or medical therapy . of interest is the fact that signal magnitude in frequency domain plots , ( eg . 7 a x 1 - 7 a z 5 ), particularly in 60 - 150 and 150 - 250 hz ranges has routinely been noted to drop by thirty ( 30 %) percent or more upon subjecting patients who are prone to ischemia , to a cold - pressor test . it is also to be understood that the terminology “ coronary artery disease ” is used throughout this disclosure , the present invention serves to identify coronary disfunction generally , which can include myocardial poblems separate from coronary artery disease per se . finally , it is generally described herein that , for instance , as differences between normal subject population , and subject representative parameters increase , the “ score ” of the present invention increases . it would be a simple matter indeed to place a negative sign on the “ score ” and declare that it “ decreases ” when differences between normal subject population and subject representative parameters increase . it would further be a simple matter to utilize slightly different but substantially the same normal subject population , and subject data frequency bands , or select slightly different but substantially the same normal subject population , and subject data ( ecg ) cycle portions . as to attempt to draft definite claim language to overcome all such possibilities would be an impossible task in view of the complexity of the present invention subject matter , it is therefore to be understood that the doctrine of equivalent applies to , and the claims are to be interpreted to include all such contrived and substantially indifferent functional equivalents in the practice of the recited method of the present invention , emphasis added . having hereby disclosed the subject matter of the present invention , it should be obvious that many modifications , substitutions and variations of the present invention are possible in light of the teachings . it is therefore to be understood that the invention may be practiced other than as specifically described , and should be limited in breadth and scope only by the claims . | 0 |
fig3 is a block - level depiction of a ramp - up circuit 300 configured in accordance with the present invention . like ramp - up circuit 150 of fig1 circuit 300 receives a programming ( erase ) voltage level vpp on an octal pin 145 and creates from that voltage a ramped - up program voltage vpp_r . unlike circuit 150 , however , circuit 300 performs this function without raising internal circuit nodes above the voltage level vpp . this and other advantages are discussed below . ramp - up circuit 300 includes a bank of level shifters 305 , an input ramp - up sub - circuit 310 , a booster sub - circuit 315 , and an output stage 320 . these elements are detailed below in fig4 - 8 . fig4 is a detailed schematic of level shifters 305 of fig3 . level shifters 305 receive a control input ctrl and a pair of clock inputs clk 1 and clk 2 . these three inputs can be provided externally , developed using cpld resources , or a combination of the two . the control and clock signals are logic signals that alternate from zero volts to vdd , or between e . g . zero volts and approximately 1 . 8 volts for cplds manufactured using a 0 . 18 - micron process . level shifters 305 alter the logic levels of these signals , shifting the voltage level representative of a logic one to the programming voltage vpp . level shifters 305 also develop complimentary clock signals for both clk 1 and clk 2 . the level shifted signals are terminated with the letter “ s ” to indicate that these signals are sourced from level shift circuit 305 . the signal vpp_s is essentially control signal ctrl level - shifted to transition between zero volts and vpp . fig5 details ramp - up sub - circuit 310 of fig3 . ramp - up sub - circuit 310 receives control signal ctrl , programming voltage vpp , the controlled programming voltage vpp_s from level shift bank 305 , and the complementary clocks clk 1 _s and clk 1 b_s , also from level shift bank 305 . complementary clock signals clk 1 _s and clk 1 b_s connect to respective transistors 500 and 505 . these and other transistors with similarly depicted gate structures are pull - back - drain transistors , which are more voltage tolerant than more typical mos transistors . clock signal clk 1 _s periodically turns on transistor 500 to charge a capacitor 510 . clock signal clk 1 b_s then turns on transistor 505 to dump the charge collected on capacitor 510 onto a second capacitor 515 . capacitor 510 is substantially smaller than capacitor 515 ( 400 times smaller in one embodiment ), so the output signal on a terminal vppr 1 rises gradually from zero to vpp . the frequencies and duty cycles of clock signals clk 1 _s and clk 1 b_s can be adjusted to alter the rise time rt 1 of signal vppr 1 . ramp - up sub - circuit 310 includes some control circuitry 520 that removes the charge collected on capacitors 510 and 515 when control signal ctrl is brought low . control circuit 520 additionally includes an output terminal rgnd that grounds the output terminal vpp_r of the entire ramp - up circuit 300 , as discussed below in connection with fig7 . fig6 depicts an embodiment of booster sub - circuit 315 of fig3 another type of ramp - up circuit similar to ramp - up sub - circuit 310 of fig5 . booster sub - circuit 315 receives the programming voltage vpp , the complimentary clocks clk 2 _s and clkk 2 b_s from level shift bank 305 , and the ramped programming voltage vppr 1 from input ramp - up sub - circuit 310 . booster 315 includes a pair of high voltage or gates 600 and 605 , a series of inverters 610 , and a ramp - up circuit 615 similar to the ramp - up portion of input ramp - up sub - circuit 310 of fig5 . inverters 610 conventionally include both pmos transistors and nmos transistors . the first pmos transistor in the series is wider than the first nmos transistor , so the threshold voltage vth of the first inverter is close to the threshold voltage of the first pmos transistor . the second and third inverters are added to sharpen the edge of the resulting inverted version of signal vppr 1 ( vppr 1 b ). the falling edge of signal vppr 1 b is delayed from the beginning of the rising edge of ramped up signal vppr 1 by the time required for vppr 1 to rise to within a threshold voltage vth of programming voltage vpp . in one embodiment , a single inverter takes the place of inverters 610 to save area . or gates 600 and 605 or the inverted ramp signal vppr 1 b and respective clock signals clk 2 _s and clk 2 b_s and provide the resulting complementary output signals to a pair of transistors 620 and 625 within ramp - up circuit 615 . ramp - up circuit 615 functions in the same manner as the similar portion of ramp - up sub - circuit 310 , except capacitors 630 and 635 within ramp - up circuit 615 have a ratio of approximately 1 to 225 , which is to say that capacitor 630 is 225 times smaller than capacitor 635 . ramp - up sub - circuit 315 produces a second ramp up signal vppr 2 , the rise time rt 2 of which can be modified by changing the frequencies and duty cycles of clock signals clk 2 _s and clk 2 b_s . the capacitor values here and in fig5 can also be modified to change the rise time of the various ramped - up voltages . fig7 depicts output stage 320 of fig3 . output stage 320 receives the first and second ramp - up signals vppr 1 and vppr 2 , the program voltage vpp , the controlled program voltage vpp_s sourced from level shift block 305 , and the signal rgnd from ramp - up sub - circuit 310 . output stage 320 includes two n - type transistors 700 and 705 and four p - type transistors 710 , 715 , 720 , and 715 . transistors 700 and 710 are connected together in parallel to form a pass gate 717 capable of pulling terminal vpp_r substantially to the programming voltage vpp without requiring any node within ramp - up circuit 300 to rise above vpp . the operation of output stage 320 and the remaining circuits within ramp - up circuit 300 is explained below in connection with fig8 . fig8 is a waveform diagram depicting the operation of ramp - up circuit 300 of fig3 as detailed in fig4 - 7 . the process begins when the programming voltage vpp is brought high , to 13 volts for example ( edge 802 ). next , a control signal ctrl , typically brought in externally from a tester , is brought high to enable the various circuits within ramp - up circuit 300 ( edge 804 ). as a result of the control signal being brought high , level shift circuit 305 produces the controlled version vpp_s of the programming voltage vpp . vpp_s transitions between zero and programming voltage vpp when control signal ctrl transitions between zero and vdd . although not depicted in fig8 level shifter 305 produces complimentary clock signals that oscillate between approximately zero volts and the programming voltage vpp . turning now to fig5 the voltage on terminal vpp_s and the complementary clock signals clk 1 _s and clk 1 b_s cause the voltage on output terminal vppr 1 ( the first ramp - up voltage ) to gradually climb from zero volts to approximately vpp , as indicated by arrow 805 of fig8 . turning next to fig6 inverter chain 610 transitions when the first ramp - up signal vppr 1 rises to approximately within one threshold voltage vth of the first pmos transistor of the programming voltage vpp ( arrow 810 of fig8 ). the resulting low voltage on line vppr 1 b enables both of or gates 600 and 605 ( fig6 ), causing their respective outputs to begin oscillating as defined by clocks clk 2 _s and clk 2 b_s . these clocks then periodically and alternately enable transistors 620 and 625 of ramp - up circuit 615 so that terminal vppr 2 ( the second ramp - up voltage ) gradually rises from approximately zero volts to vpp . the falling level on line vppr 1 b thus initiates the gradual rise of output terminal vppr 2 ( arrow 815 of fig8 ). referring now to fig7 the rising edge on the first ramp - up signal vppr 1 gradually turns on transistor 700 , thus pulling output terminal vpp_r up toward programming voltage vpp . this transition is depicted in fig8 using arrow 820 . because terminal vppr 1 rises only as high as vpp , transistor 700 cannot , by itself , raise output terminal vpp_r to the level of the programming voltage vpp . however , terminal vppr 2 begins going high after vppr 1 , gradually turning on transistor 705 to pull the gate of transistor 710 toward ground potential . grounding the gate of transistor 710 turns on transistor 710 , which then pulls output terminal vpp_r the rest of the way to programming voltage vpp ( arrow 825 of fig8 ). ramp - up circuit 300 thus achieves the goal of providing a substantially undiminished programming voltage on terminal vpp_r to bit lines of selected memory cells without requiring any internal node on the cpld to rise above programming voltage vpp . returning to fig3 control terminal ctrl is brought low each time steering logic 160 ( fig1 ) is to convey the programming voltage to a different bit line . returning the control signal ctrl to ground disables each of the elements in fig3 and control circuit 520 of fig5 pulls output terminal vpp_r to ground . the entire cycle then begins again with the next assertion of control signal ctrl . fig9 depicts an output stage 900 similar to output stage 320 , like - numbered elements being the same . output stage 900 , employed in place of output stage 320 in one embodiment , provides better control over the turn - on time of transistor 705 . output stage 900 differs from output stage 320 in that the gate of transistor 705 receives a control signal vbon , where “ bon ” stands for “ booster on .” vbon is a ramped - up signal that weakly follows the rising voltage transitions on terminals vppr 1 and vppr 2 , and consequently turns transistor 705 on more slowly than does output stage 320 . also different from output stage 320 , a signal vpub , where “ pub ” stands for “ pull - up bar ,” is taken from the node connected to the gate of transistor 710 . the source of signal vpub is depicted below in fig1 . fig1 depicts a circuit 1000 used to generate the signal vbon , which controls transistor 705 in fig9 . circuit 1000 includes a pair of parallel - connected nmos transistors 1005 and 1010 , the gates of which connect to respective control signals vppr 2 and vppr 1 ( fig5 and 6 ). circuit 1000 also includes a pair of transistors 1015 and 1020 , the gates of which connect to terminal vpub of fig9 and a transistor 1025 , the gate of which connects to terminal vppr 1 b of fig5 . in operation , signal vbon rises toward vpp as ramp - up signals vppr 2 and vppr 1 turn on respective transistors 1005 and 1010 . transistors 1005 and 1010 are relatively weak , so the maximum voltage on terminal vbon is several threshold voltages below vpp . the weak transistors 1005 and 1010 provide a slow rise time on the gate of transistor 705 . as signal vbon rises , transistor 705 pulls node vpub toward ground , eventually turning on transistors 710 and 1015 . as in the embodiment of fig7 transistor 710 pulls output terminal vpp_r all the way to programming voltage vpp ; transistor 1015 likewise pulls terminal vbon all the way to programming voltage vpp , and consequently turns on transistor 705 completely . when terminal vpp_s returns to ground , transistors 1020 and 1025 pull terminal vbon to ground . in one embodiment , transistors 1020 and 1025 are replaced with a single transistor controlled by either signal vppr 1 b or signal vpub . while the present invention has been described in connection with specific embodiments , variations of these embodiments will be obvious to those of ordinary skill in the art . for example , application of the invention is not limited to the above - described cpld architecture , or even to cplds . moreover , some components are shown directly connected to one another while others are shown connected via intermediate components . in each instance , the method of interconnection establishes some desired electrical communication between two or more circuit nodes , or terminals . such communication may often be accomplished using a number of circuit configurations , as will be understood by those of skill in the art . therefore , the spirit and scope of the appended claims should not be limited to the foregoing description . | 7 |
a key novel element of the compounds of this invention is the incorporation of a fluorine atom at the 4 - position of the piperidine ring . the installation of fluorine into small molecule drugs can greatly enhance the pharmacokinetic and physicochemical properties such as improved metabolic stability and enhanced membrane permeation . [ j . enzyme inhibition medicinal chem . ( 2007 ), 22 , 527 - 540 ]. a further application of the fluorine atom is the use of 18 f as a radiolabel tracer atom in the technique of positron emission tomography imaging . furthermore , a common limitation of piperidine - containing molecules in drug development is the high basicity of the ring nitrogen , resulting in strong ion pairing on exposure to strong acids ( such as hydrochloric acid as found in the stomach ) and as a result poor oral bioavailability is observed . for example , the development of ly255582 , a piperidine based mu opioid antagonist , as an anti - obesity agent was ceased due to very poor oral bioavailability . [ bioorg . medicinal chem . lett . ( 2007 ), 17 , 6841 - 6846 ]. it is contended that , as the incorporation of fluorine into the compounds of this invention greatly reduces the basic nature of the piperidine nitrogen , it is non - obvious that the compounds of the invention would have affinity for the mu opioid receptor . additionally , the compounds of the invention have clear pharmacokinetic and diagnostic advantages over existing piperidine - based opioid ligands . in one aspect , the invention relates to compounds of formula i : in some aspects of the invention , r 1 can represent one substituent . in other aspects , r 1 represents two substituents . in still other aspects , r 1 represents three substituents . in the cases where r 1 represents two or three substituents , each substituent is chosen independently ; that is , one could have both a halogen and a hydroxy substituting the phenyl . in each occurrence , r 1 can represent hydrogen , halogen , halo ( c 1 - c 6 ) alkyl , ( c 1 - c 6 ) alkyl , ( c 1 - c 6 ) acyl , ( c 1 - c 6 ) alkoxy ( c 1 - c 6 ) alkyl , hydroxy ( c 1 - c 6 ) alkyl , heteroaryl , benzenesulfonyl , toluenesulfonyl , hydroxy , ( c 1 - c 6 ) alkoxy , hydroxy ( c 1 - c 6 ) alkoxy , halo ( c 1 - c 6 ) alkoxy , ( c 1 - c 6 ) oxaalkyl , carboxy , carboxy ( c 1 - c 6 ) alkoxy , ( c 1 - c 6 ) alkoxycarbonyl , ( c 1 - c 6 ) alkoxycarbonylamino , carboxamido , ( c 1 - c 6 ) alkylaminocarbonyl , ( c 1 - c 6 ) alkylaminocarbonyloxy , ( c 1 - c 6 ) alkylaminocarbonylamino , cyano , acetoxy , nitro , amino , ( c 1 - c 6 ) alkylamino , di ( c 1 - c 6 ) alkylamino , ( c 1 - c 6 ) alkylamino ( c 1 - c 6 ) alkyl , di ( c 1 - c 6 ) alkylamino ( c 1 - c 6 ) alkyl , di ( c 1 - c 6 ) alkylamino ( c 1 - c 6 ) alkoxy , mercapto , ( c 1 - c 6 ) alkylthio , ( c 1 - c 6 ) alkylsulfonylamino , benzenesulfonylamino , toluenesulfonylamino , ( c 1 - c 6 ) alkylaminosulfonyl , di ( c 1 - c 6 ) alkylaminosulfonyl , ( c 1 - c 6 ) alkylsulflnyl , ( c 1 - c 6 ) alkylsulfonyl , ( c 1 - c 6 ) acylamino , aryl , benzyl , heterocyclyl , heterocyclyl ( c 1 - c 6 ) alkyl , phenoxy , benzyloxy , heteroaryloxy , hydroxyimino , ( c 1 - c 6 ) alkoxyimino , oxaalkyl , amidino , or guanidine . in some aspects of the invention , r 1 is hydrogen . in some aspects of the invention , r 1 is halogen . in some of these aspects , r 1 is chlorine . in other aspects of the invention , r 1 is fluorine . in some of these aspects , the fluorine or chlorine is in the para position relative to the attachment of the piperidine . in some aspects of the invention , r 1 is hydroxy . in some of these aspects , the hydroxy is in the para or meta position relative to the attachment of the piperidine . in some aspects of the invention , r 1 is ( c 1 - c 6 ) alkoxy . in some aspects of the invention , r 1 is carboxy ( c 1 - c 6 ) alkoxy . in some aspects of the invention , r 1 is carboxymethoxy . in some aspects of the invention , r 1 is amino . in some aspects of the invention , r 1 is toluenesulfonylamino . in some aspects of the invention , r 1 is ( c 1 - c 6 ) alkylsulfonylamino . in some of these aspects , r 1 is methylsulfonylamino . in some aspects of the invention , r 1 is ( c 1 - c 6 ) alkylaminocarbonyloxy . in some of these aspects , r 1 is ethylaminocarbonyloxy . in some aspects of the invention , r 1 is ( c 1 - c 6 ) alkylaminocarbonylamino . in some of these aspects , r 1 is t - butylaminocarbonylamino . in some aspects of the invention , r 1 is hydroxy ( c 1 - c 6 ) alkoxy . in some of these aspects , r 1 is hydroxyethoxy . in some aspects of the invention , r 2 is hydrogen . in some aspects of the invention , r 2 is ( c 1 - c 6 ) alkyl . in some aspects of the invention , r 3 is hydrogen . in some aspects of the invention , r 3 is ( c 1 - c 6 ) alkyl . in some aspects of the invention , r 2 is hydrogen and r 3 is hydrogen . in other aspects of the invention , r 2 is hydrogen and r 3 is ( c 1 - c 6 ) alkyl . in some aspects of the invention , a is a direct bond . in some aspects of the invention , a is a ( c 1 - c 8 ) alkylene chain . in some aspects of the invention when a is a ( c 1 - c 8 ) alkylene chain , one , two or three methylenes may be optionally replaced by — cr 4 r 5 —. for instance , a may be — c ( r 4 r 5 )—, — c ( r 4 r 5 ) c ( r 6 r 7 )— or — c ( r 4 r 5 ) c ( r 6 r 7 ) c ( r 8 r 9 )—. in some aspects of the invention when a is a ( c 1 - c 8 ) alkylene chain , one , two or three methylenes may be optionally replaced by oxygen . for instance , a may be — c ( r 4 r 5 ) o — or c ( r 4 r 5 ) c ( r 6 r 7 ) o —. in some aspects of the invention , a is chosen from — c ( r 4 r 5 ) c ( r 6 r 7 )— and — c ( r 4 r 5 ) o —. in some aspects of the invention , r 4 and r 5 are independently chosen from hydrogen , ( c 1 - c 10 ) alkyl , halo ( c 1 - c 6 ) alkyl , ( c 1 - c 6 ) acyl , hydroxy ( c 1 - c 6 ) alkyl , hydroxy , ( c 1 - c 6 ) alkoxy , hydroxy ( c 1 - c 6 ) alkoxy , halo ( c 1 - c 6 ) alkoxy , ( c 1 - c 6 ) oxaalkyl , carboxy , ( c 1 - c 6 ) alkoxycarbonyl , ( c 1 - c 6 ) alkoxycarbonylamino , carboxamido , ( c 1 - c 6 ) alkylaminocarbonyl , amino , ( c 1 - c 6 ) alkylamino , di ( c 1 - c 6 ) alkylamino , aryl , benzyl , heterocyclyl , heterocyclyl ( c 1 - c 6 ) alkyl , phenoxy , benzyloxy and heteroaryloxy . in some embodiments , r 4 , r 5 , r 6 , r 7 , r 8 and r 9 may each independently be hydrogen , hydroxy , carboxy , ( c 1 - c 10 ) alkyl , aryl or benzyl . in these cases , no more than two of r 4 , r 5 , r 6 , r 7 , r 8 and r 9 are other than hydrogen . in some embodiments , a is — ch 2 ch 2 —. in some embodiments , a is — ch 2 o —. in other embodiments , a is — ch 2 ch 2 ch 2 —. in still other embodiments , a is in all of these examples , u indicates the point of attachment to u . in some embodiments , u is optionally substituted ( c 3 - c 8 ) carbocycle . in some of these embodiments , u is optionally substituted phenyl . in other embodiments , u is optionally substituted cyclohexyl . in other embodiments , u is optionally substituted heterocyclyl . in some of these embodiments , u is optionally substituted thiophene . in some of these embodiments , u is optionally substituted furanyl . examples of substitution for these u rings include hydrogen , halogen , halo ( c 1 - c 6 ) alkyl , ( c 1 - c 6 ) alkyl , cyano , acetoxy , ( c 1 - c 6 ) alkylthio , aryl , aryl ( c 1 - c 6 ) alkyl , heterocyclyl , heterocyclyl ( c 1 - c 6 ) alkyl , phenoxy , benzyloxy , aryloxy and heteroaryloxy . u may be optionally substituted by more than one substituent ; for instance , the substituent may be only methyl , or two substituents may be methyl and phenyl . in some aspects of the invention , r 1 is chosen from hydrogen , chlorine , fluorine , hydroxy , carboxymethoxy , amino , toluenesulfonylamino , methylsulfonylamino , ethylaminocarbonyloxy , t - butylaminocarbonylamino and hydroxyethoxy ; r 2 and r 3 are independently chosen from hydrogen and ( c 1 - c 6 ) alkyl ; a is chosen from a direct bond , — c ( r 4 r 5 ) c ( r 6 r 7 )—, — c ( r 4 - r 5 ) o — and — c ( r 4 r 5 ) c ( r 6 r 7 ) c ( r 8 r 9 )—; u is chosen from optionally substituted phenyl , cyclohexyl , thiophene and furanyl ; and r 4 , r 5 , r 6 , r 7 , r 8 and r 9 are independently chosen from hydrogen , hydroxy , carboxy , ( c 1 - c 10 ) alkyl , aryl and benzyl . in these instances , no more than two of r 4 , r 5 , r 6 , r 7 , r 8 and r 9 are other than hydrogen . in another embodiment of the invention , r 1 is chosen from chlorine in the para position and hydroxy in the para or meta position , each position relative to the attachment of the piperidine ; r 2 is hydrogen ; r 3 is chosen from hydrogen and methyl ; a is chosen from — ch 2 ch 2 —, — ch 2 o —, — ch 2 ch 2 ch 2 —, wherein u indicates the point of attachment to u ; and u is chosen from phenyl , cyclohexyl , thiophene and furanyl . in one embodiment , the invention relates to a compound of formula in some embodiments , r 20 and r 20a are both hydrogen . in other embodiments , r 20 and r 20a are taken together and are ═ o . in some embodiments , r 30 is hydrogen . in some embodiments , r 30 is lower alkyl . in other embodiments , r 30 is alkenyl . in some embodiments , r 30 is aryl . in still other embodiments , r 30 is heterocyclyl . in some embodiments , r 30 is benzyl . in other embodiments , r 30 is hydroxyalkyl . in some embodiments , r 40 is hydrogen . in some embodiments , r 40 is hydroxy . in some embodiments , r 40 is amino . in some embodiments , r 40 is lower alkoxy . in some embodiments , r 40 is c 1 - c 20 alkyl . in some embodiments , r 40 is c 1 - c 20 alkyl substituted with hydroxy . in some embodiments , r 40 is c 1 - c 20 alkyl substituted with carbonyl . in still other embodiments , r 40 , r 50 , r 60 and r 70 may form one optionally substituted ring . in yet other embodiments , r 40 , r 50 , r 60 and r 70 may form two optionally substituted rings . in further embodiments , r 40 , r 50 , r 60 and r 70 may form three optionally substituted rings . in other embodiments , r 40 , r 50 , r 60 and r 70 may form four optionally substituted rings . in still other embodiments , r 40 , r 50 , r 60 and r 70 may form five optionally substituted rings . in some embodiments of the invention , r is a cns - nonpenetrant μ - opioid antagonist residue attached to q via nitrogen . in other embodiments of the invention , r is a cns - nonpenetrant μ - opioid antagonist residue attached to q via oxygen . in other embodiments of the invention , r is a cns - nonpenetrant μ - opioid antagonist residue attached to q via carbonyl . in still other embodiments of the invention , r is a residue of a compound of formula i in some embodiments of the invention , q is a ( c 1 - c 6 ) alkylene chain . in some embodiments , one methylene may be replaced by oxygen . in some embodiments , one methylene may be replaced by — c (═ o )—. in some embodiments , two methylenes may be each replaced by oxygen . in some embodiments , two methylenes may be each replaced by — c (═ o )—. in still other embodiments , one methylene may be replaced by oxygen and another methylene may be replaced by — c (═ o )—. in those embodiments when r is attached by carbonyl , q may also be a direct bond . the term “ a residue of a compound ”, when used to describe “ r ”, refers to a compound of formula i minus the functional groups that may be considered part of “ q ”. for example , in the molecule illustrated below : , while the parent compound of the “ r ” residue would be represented by the structure as is clear in this instance , an h — o — h is removed from the linkage of the “ r ” carbonyl and the phenolic oh of “ w ”, while “ q ” is a direct bond ( as may be the case when r is a carbonyl ). therefore , r becomes a residue of the parent compound shown above . this and similar structures of formula i that may lose some atoms at the points of attachment of “ q ” to “ r ” are referred to herein as “ a residue of a compound ”. examples of cns - penetrant μ - opioid agonist residues that could be represented by “ w ” include the following compounds in charts 1 , 2 and 3 . other opioid receptor ligands are described in aldrich , j . v . “ analgesics ” in burger &# 39 ; s medicinal chemistry and drug discovery , m . e . wolff ed ., john wiley & amp ; sons 1996 , pages 321 - 44 , the disclosures of which are incorporated herein by reference . alkyl is intended to include linear or branched , or cyclic hydrocarbon structures and combinations thereof . a combination would be , for example , cyclopropylmethyl . lower alkyl refers to alkyl groups of from 1 to 6 carbon atoms . examples of lower alkyl groups include methyl , ethyl , propyl , isopropyl , cyclopropyl , butyl , s - and t - butyl , cyclobutyl and the like . preferred alkyl groups are those of c 20 or below . cycloalkyl is a subset of alkyl and includes cyclic hydrocarbon groups of from 3 to 8 carbon atoms . examples of cycloalkyl groups include c - propyl , c - butyl , c - pentyl , norbornyl and the like . to be perfectly clear , for purposes of this application , when a is ( c 1 - c 8 ) alkylene , it is meant that it can be a straight chain ( for instance , methylene or ethylene ), a branched chain ( e . g ., t - butylene ), a cycloalkylene ( for instance , cyclopropylene or cyclobutylene ), or a combination ( e . g ., methylenecyclopropylene ). alkoxy or alkoxyl refers to groups of from 1 to 8 carbon atoms of a straight , branched , or cyclic configuration and combinations thereof attached to the parent structure through an oxygen . examples include methoxy , ethoxy , propoxy , isopropoxy , cyclopropyloxy , cyclohexyloxy and the like . lower - alkoxy refers to groups containing one to four carbons . aryl and heteroaryl mean a 5 - or 6 - membered aromatic or heteroaromatic ring containing 0 - 3 heteroatoms selected from o , n , or s ; a bicyclic 9 - or 10 - membered aromatic or heteroaromatic ring system containing 0 - 3 heteroatoms selected from o , n , or s ; or a tricyclic 13 - or 14 - membered aromatic or heteroaromatic ring system containing 0 - 3 heteroatoms selected from o , n , or s . the aromatic 6 - to 14 - membered carbocyclic rings include , e . g ., benzene , naphthalene , indane , tetralin , and fluorene and the 5 - to 10 - membered aromatic heterocyclic rings include , e . g ., imidazole , pyridine , indole , thiophene , benzopyranone , thiazole , furan , benzimidazole , quinoline , isoquinoline , quinoxaline , pyrimidine , pyrazine , tetrazole and pyrazole . as used herein aryl and heteroaryl refer to residues in which one or more rings are aromatic , but not all need be . arylalkyl means an alkyl residue attached to an aryl ring . examples are benzyl , phenethyl and the like . heteroarylalkyl means an alkyl residue attached to a heteroaryl ring . examples include , e . g ., pyridinylmethyl , pyrimidinylethyl and the like . c 1 to c 20 hydrocarbon means a linear , branched , or cyclic residue comprised of hydrogen and carbon as the only elemental constituents and includes alkyl , cycloalkyl , polycycloalkyl , alkenyl , alkynyl , aryl and combinations thereof . examples include benzyl , phenethyl , cyclohexylmethyl , camphoryl and naphthylethyl . unless otherwise specified , the term “ carbocycle ” is intended to include ring systems in which the ring atoms are all carbon but of any oxidation state . thus ( c 3 - c 10 ) carbocycle refers to both non - aromatic and aromatic systems , including such systems as cyclopropane , benzene and cyclohexene ; ( c 8 - c 12 ) carbopolycycle refers to such systems as norbornane , decalin , indane and naphthalene . carbocycle , if not otherwise limited , refers to monocycles , bicycles and polycycles . heterocycle means a cycloalkyl or aryl residue in which one to two of the carbons is replaced by a heteroatom such as oxygen , nitrogen or sulfur . heteroaryls form a subset of heterocycles . examples of heterocycles that fall within the scope of the invention include pyrrolidine , pyrazole , pyrrole , indole , quinoline , isoquinoline , tetrahydroisoquinoline , benzofuran , benzodioxan , benzodioxole ( commonly referred to as methylenedioxyphenyl , when occurring as a substituent ), tetrazole , morpholine , thiazole , pyridine , pyridazine , pyrimidine , thiophene , furan , oxazole , oxazoline , isoxazole , dioxane , tetrahydrofuran and the like . as used herein , the term “ optionally substituted ” may be used interchangeably with “ unsubstituted or substituted ”. the term “ substituted ” refers to the replacement of one or more hydrogen atoms in a specified group with a specified radical . for example , substituted alkyl , aryl , cycloalkyl , heterocyclyl etc . refer to alkyl , aryl , cycloalkyl , or heterocyclyl wherein one or more h atoms in each residue are replaced with halogen , haloalkyl , alkyl , acyl , alkoxyalkyl , hydroxyloweralkyl , carbonyl , phenyl , heteroaryl , benzenesulfonyl , hydroxy , loweralkoxy , haloalkoxy , oxaalkyl , carboxy , alkoxycarbonyl [— c (═ o ) o - alkyl ], alkoxycarbonylamino [ hnc (═ o ) o - alkyl ], carboxamido [— c (═ o ) nh 2 ], alkylaminocarbonyl [— c (═ o ) nh - alkyl ], cyano , acetoxy , nitro , amino , alkylamino , dialkylamino , ( alkyl )( aryl ) aminoalkyl , alkylaminoalkyl ( including cycloalkylaminoalkyl ), dialkylaminoalkyl , dialkylaminoalkoxy , heterocyclylalkoxy , mercapto , alkylthio , sulfoxide , sulfone , sulfonylamino , alkylsulfinyl , alkylsulfonyl , acylaminoalkyl , acylaminoalkoxy , acylamino , amidino , aryl , benzyl , heterocyclyl , heterocyclylalkyl , phenoxy , benzyloxy , heteroaryloxy , hydroxyimino , alkoxyimino , oxaalkyl , aminosulfonyl , trityl , amidino , guanidino , ureido , benzyloxyphenyl , and benzyloxy . “ oxo ” is also included among the substituents referred to in “ optionally substituted ”; it will be appreciated by persons of skill in the art that , because oxo is a divalent radical , there are circumstances in which it will not be appropriate as a substituent ( e . g . on phenyl ). in one embodiment , 1 , 2 or 3 hydrogen atoms are replaced with a specified radical . in the case of alkyl and cycloalkyl , more than three hydrogen atoms can be replaced by fluorine ; indeed , all available hydrogen atoms could be replaced by fluorine . as used herein , anti - addition medications can be used interchangeably with the term drug addiction , which includes alcohol , cocaine , heroine , amphetamine and nicotine addiction . many of the compounds described herein contain one or more asymmetric centers and may thus give rise to enantiomers , diastereomers , and other stereoisomeric forms that may be defined , in terms of absolute stereochemistry , as ( r )— or ( s )—. the present invention is meant to include all such possible isomers , as well as their racemic and optically pure forms . optically active ( r )— and ( s )— isomers may be prepared using chiral synthons or chiral reagents , or resolved using conventional techniques . when the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry , and unless specified otherwise , it is intended that the compounds include both e and z geometric isomers . likewise , all tautomeric forms are also intended to be included . some of the compounds of the invention are quaternary salts , i . e . cationic species . therefore they will always be presented as salts , and the term “ pharmaceutically acceptable salt ” refers to salts whose counter ion ( anion ) derives from pharmaceutically acceptable non - toxic acids including inorganic acids , organic acids and water ( which formally furnishes the hydroxide anion ). suitable pharmaceutically acceptable anions for the compounds of the present invention include hydroxide , acetate , benzenesulfonate ( besylate ), benzoate , bicarbonate , bisulfate , carbonate , camphorsulfonate , citrate , ethanesulfonate , fumarate , gluconate , glutamate , glycolate , bromide , chloride , isethionate , lactate , maleate , malate , mandelate , methanesulfonate , mucate , nitrate , pamoate , pantothenate , phosphate , succinate , sulfate , tartrate , trifluoroacetate , p - toluenesulfonate , acetamidobenzoate , adipate , alginate , aminosalicylate , anhydromethylenecitrate , ascorbate , aspartate , calcium edetate , camphorate , camsylate , caprate , caproate , caprylate , cinnamate , cyclamate , dichloroacetate , edetate ( edta ), edisylate , embonate , estolate , esylate , fluoride , formate , gentisate , gluceptate , glucuronate , glycerophosphate , glycolate , glycollylarsanilate , hexylresorcinate , hippurate , hydroxynaphthoate , iodide , lactobionate , malonate , mesylate , napadisylate , napsylate , nicotinate , oleate , orotate , oxalate , oxoglutarate , palmitate , pectinate , pectinate polymer , phenylethylbarbiturate , picrate , pidolate , propionate , rhodanide , salicylate , sebacate , stearate , tannate , theoclate , tosylate and the like . the desired salt may be obtained by ion exchange of whatever counter ion is obtained in the synthesis of the quat . these methods are well known to persons of skill . although pharmaceutically acceptable counter ions will be preferred for preparing pharmaceutical formulations , other anions are quite acceptable as synthetic intermediates . thus x may be pharmaceutically undesirable anions , such as iodide , oxalate , trifluoromethanesulfonate and the like , when such salts are chemical intermediates . when the compounds of the invention are bisquats , one may employ as counter ions either two monoanionic species ( e . g . cl 2 ) or a single dianionic species ( e . g . fumarate ). similarly , one could employ oligoanionic species and make salts having appropriate ratios of quat to counterion , such as ( quat ) 3 citrates . these would be obvious equivalents . it will be recognized that the compounds of this invention can exist in radiolabeled form , i . e ., the compounds may contain one or more atoms containing an atomic mass or mass number different from the atomic mass or mass number usually found in nature . radioisotopes of hydrogen , carbon , phosphorous , fluorine , and chlorine include 2 h , 3 h , 13 c , 14 c , 15 n , 35 , 18 f , and 36 cl , respectively . compounds that contain those radioisotopes and / or other radioisotopes of other atoms are within the scope of this invention . tritiated , i . e . 3 h , and carbon - 14 , i . e ., 14 c , radioisotopes are particularly preferred for their ease in preparation and detectability . compounds that contain isotopes 11 c , 13 n , 15 o and 18 f are well suited for positron emission tomography . for instance , the 4 - fluorine could easily be substituted by 18 f . radiolabeled compounds of formula i of this invention and prodrugs thereof can generally be prepared by methods well known to those skilled in the art . conveniently , such radiolabeled compounds can be prepared by carrying out the procedures disclosed in the examples and schemes by substituting a readily available radiolabeled reagent for a non - radiolabeled reagent . although this invention is susceptible to embodiment in many different forms , preferred embodiments of the invention are shown . it should be understood , however , that the present disclosure is to be considered as an exemplification of the principles of this invention and is not intended to limit the invention to the embodiments illustrated . it may be found upon examination that certain members of the claimed genus are not patentable to the inventors in this application . in this event , subsequent exclusions of species from the compass of applicants &# 39 ; claims are to be considered artifacts of patent prosecution and not reflective of the inventors &# 39 ; concept or description of their invention ; the invention encompasses all of the members of the genus ( i ) that are not already in the possession of the public . it may happen that residues in the substrate of interest require protection and deprotection during the conversion of the phenol to the desired q . terminology related to “ protecting ”, “ deprotecting ” and “ protected ” functionalities occurs throughout this application . such terminology is well understood by persons of skill in the art and is used in the context of processes which involve sequential treatment with a series of reagents . in that context , a protecting group refers to a group which is used to mask a functionality during a process step in which it would otherwise react , but in which reaction is undesirable . the protecting group prevents reaction at that step , but may be subsequently removed to expose the original functionality . the removal or “ deprotection ” occurs after the completion of the reaction or reactions in which the functionality would interfere . thus , when a sequence of reagents is specified , as it is below , the person of ordinary skill can readily envision those groups that would be suitable as “ protecting groups ”. suitable groups for that purpose are discussed in standard textbooks in the field of chemistry , such as protective groups in organic synthesis by t . w . greene [ john wiley & amp ; sons , new york , 1991 ], which is incorporated herein by reference . step 1 : preparation of tert - butyl 4 -( 4 - chlorophenyl )- 4 - hydroxypiperidine - 1 - carboxylate . to a solution of 4 -( 4 - chlorophenyl )- 4 - hydroxypiperidine ( 1 . 75 g , 8 . 22 mmol ) in methylene chloride ( 100 ml ) was added di - tert - butyldicarbonate ( 1 . 98 g , 9 . 10 mmol ) followed by diisopropylethylamine ( 1 . 17 g , 9 . 10 mmol ) and the resulting solution stirred at room temperature for 6 hours . after this time the reaction was quenched by the addition of 25 % aqueous ammonium chloride ( 250 ml ) and the layers separated . the organic layer was washed with water ( 100 ml ) and brine ( 100 ml ) and dried over magnesium sulfate . subsequent filtration and concentration under reduced pressure afforded tert - butyl 4 -( 4 - chlorophenyl )- 4 - hydroxypiperidine - 1 - carboxylate in 81 % yield as a viscous clear oil which solidified on standing . 1 h nmr ( cdcl 3 ): δ = 7 . 41 ( d , j = 6 . 8 hz , 2h ), 7 . 32 ( d , j = 6 . 8 hz , 2h ), 3 . 99 ( m , 2h ), 3 . 22 ( m , 2h ), 2 . 15 ( bs , 1h ), 1 . 94 ( dd , j = 12 . 1 , 9 . 5 hz , 2h ), 1 . 70 ( bd , j = 14 . 4 hz , 2h ) and 1 . 47 ppm ( s , 9h ). step 2 : preparation of 4 -( 4 - chlorophenyl )- 4 - fluoropiperidine hydrochloride . to a solution of tert - butyl 4 -( 4 - chlorophenyl )- 4 - hydroxypiperidine - 1 - carboxylate ( 2 . 00 g , 6 . 40 mmol ) in methylene chloride ( 100 ml ) was cooled in an ice / salt bath and a solution of diethylaminosulfur trifluoride ( 1 . 24 g , 7 . 68 mmol ) in methylene chloride ( 10 ml ) added drop - wise over 1 hour . the resulting solution was then stirred for 14 hours during which time it slowly warmed to room temperature . after this time the reaction was quenched by the cautious addition of saturated sodium bicarbonate ( 50 ml ) and the layers separated . the aqueous layer was extracted with ethyl acetate ( 50 ml ) and the combined organics dried over magnesium sulfate . subsequent filtration and concentration under reduced pressure afforded crude tert - butyl 4 -( 4 - chlorophenyl )- 4 - fluoropiperidine - 1 - carboxylate as a viscous yellow oil . this material was immediately dissolved in 10 % methanolic hydrogen chloride ( 100 ml ) and the resulting yellow solution stirred at room temperature for 64 hours then concentrated under reduced pressure . the resulting dark yellow oil was triturated with ethyl acetate ( 100 ml ) for 4 hours after which time a white crystalline solid resulted . this material was isolated by filtration and vacuum dried for 3 hours to afford 4 -( 4 - chlorophenyl )- 4 - fluoropiperidine hydrochloride in 73 % overall yield . 1 h nmr ( cdcl 3 ): δ = 9 . 81 ( bs , 2h ), 7 . 35 ( s , 4h ), 3 . 54 ( bd , j = 10 . 6 hz , 2h ), 3 . 32 ( m , 2h ), 2 . 66 ( m , 1h ), 2 . 58 ( m , 1h ), 2 . 13 ( m , 1h ) and 2 . 13 ppm ( d , j = 14 . 4 hz , 2h ). step 3 : preparation of 4 -( 4 - chlorophenyl )- 1 -( 3 , 3 - diphenylpropyl )- 4 - fluoropiperidine hydrochloride . a solution of 4 -( 4 - chlorophenyl )- 4 - fluoropiperidine hydrochloride ( 100 mg , 0 . 40 mmol ) and 3 , 3 - diphenyl - 1 - iodopropane ( 145 mg , 0 . 45 mmol ) in dmf ( 2 . 5 ml ) was treated with potassium carbonate ( 560 mg , 4 . 05 mmol ) and the resulting suspension heated at 80 ° c . for 14 hours . after this time the reaction was cooled to room temperature and quenched by pouring into 25 % aqueous ammonium chloride solution ( 20 ml ). the resulting suspension was then extracted with ethyl acetate ( 2 × 10 ml ) and the combined extracts washed with water ( 10 ml ) and brine ( 10 ml ) then dried over magnesium sulfate . subsequent filtration and concentration under reduced pressure afforded crude 4 -( 4 - chlorophenyl )- 1 -( 3 , 3 - diphenyl - propyl )- 4 - fluoropiperidine as a yellow oil . this material was treated with 10 % methanolic hydrogen chloride ( 10 ml ) and the solution concentrated under reduced pressure . trituration of the resulting oil with 1 : 1 ethyl acetate / 2 - butanone ( 10 ml ) afforded a solid which was isolated by filtration and vacuum dried . this afforded a 41 % yield of 4 -( 4 - chlorophenyl )- 1 -( 3 , 3 - diphenylpropyl )- 4 - fluoropiperidine hydrochloride as an off - white solid . 1 h nmr ( cdcl 3 ): δ = 12 . 6 ( bs , 1h ), 7 . 37 ( s , 4h ), 7 . 35 - 7 . 20 ( m , 10h ), 4 . 03 ( t , j = 7 . 7 hz , 1h ), 3 . 58 ( bd , j = 8 . 0 hz , 1h ), 3 . 47 ( m , 1h ), 3 . 31 ( m , 1h ), 3 . 11 ( m , 2h ), 2 . 95 ( m , 2h ), 2 . 76 ( m , 2h ), 2 . 55 ( m , 1h ) and 2 . 13 ppm ( dd , j = 21 . 9 , 8 . 3 hz , 2h ). mass spectrum : m / z = 408 [ m + h ] + the title compound was obtained by the alkylation of 4 -( 4 - chlorophenyl )- 4 - fluoropiperidine hydrochloride with 1 - bromo - 2 - phenoxyethane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 64 % overall yield . 1 h nmr ( cdcl 3 ): δ = 13 . 2 ( bs , 1h ), 7 . 39 ( s , 4h ), 7 . 33 ( m , 2h ), 7 . 04 ( t , j = 7 . 3 hz , 1h ), 6 . 93 ( d , j = 8 . 0 hz , 2h ), 4 . 61 ( bs , 2h ), 3 . 71 ( bd , j = 10 . 6 hz , 2h ), 3 . 51 ( m , 2h ), 3 . 37 ( dd , j = 22 . 0 , 10 . 3 hz , 2h ), 3 . 12 ( m , 1h ), 2 . 99 ( m , 1h ) and 2 . 16 ppm ( m , 2h ). mass spectrum : m / z = 334 [ m + h ] + the title compound was obtained by the alkylation of 4 -( 4 - chlorophenyl )- 4 - fluoropiperidine hydrochloride with 1 - bromo - 3 - phenylpropane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 63 % overall yield . 1 h nmr ( cdcl 3 ): δ = 12 . 5 ( bs , 1h ), 7 . 42 - 7 . 20 ( m , 5h ), 7 . 36 ( s , 4h ), 3 . 51 ( bd , j = 7 . 8 hz , 2h ), 3 . 09 ( m , 2h ), 2 . 99 ( m , 4h ), 2 . 78 ( t , j = 7 . 2 hz , 2h ), 2 . 32 ( m , 2h ) and 2 . 13 ppm ( m , 2h ). mass spectrum : m / z = 332 [ m + h ] + step 1 : preparation of methyl 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate . to a solution of 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidine hydrochloride ( 280 mg , 1 . 12 mmol ) in methanol ( 5 ml ) was added sodium bicarbonate ( 500 mg , 5 . 94 mmol ) followed by methyl acrylate ( 1 ml ). the resulting mixture was stirred at room temperature for 14 hours then filtered and concentrated under reduced pressure . the residue was treated with ethyl acetate ( 10 ml ) and the resulting suspension re - filtered and concentrated under reduced pressure . this afforded methyl 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate as a viscous yellow oil in 94 % yield , which was used without further purification . 1 h nmr ( cdcl 3 ): δ = 7 . 32 ( s , 4h ), 3 . 71 ( s , 3h ), 2 . 83 ( m , 2h ), 2 . 79 ( t , j = 7 . 3 hz , 2h ), 2 . 56 ( t , j = 7 . 3 hz , 2h ), 2 . 47 ( bt , j = 11 . 6 hz , 2h ), 2 . 14 ( td , j = 13 . 3 , 4 . 4 hz , 2h ) and 1 . 98 ppm ( m , 2h ). step 2 : preparation of methyl 2 - benzyl - 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate hydrochloride . a solution of methyl 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate ( 75 mg , 0 . 23 mmol ) in toluene ( 5 ml ) was placed under a dry nitrogen atmosphere and cooled in a dry ice acetone bath . a 1m solution of lithium hexamethyldisilazide ( 0 . 28 ml , 0 . 28 mmol ) was then added drop - wise over 10 minutes . the resulting bright yellow solution was stirred for 1 hour then benzyl bromide ( 43 mg , 0 . 25 mmol ) added in one portion . the reaction was then allowed to warm to room temperature with stirring over a 16 hour period then quenched by the addition of 25 % aqueous ammonium chloride solution ( 10 ml ). the resulting mixture was extracted with ethyl acetate ( 2 × 10 ml ) and the combined extracts dried over magnesium sulfate , filtered and stripped to a viscous yellow oil . this oil was treated with 10 % methanolic hydrogen chloride ( 5 ml ) and the solution re - concentrated . the resulting oil was triturated with 1 : 1 ethyl acetate / heptanes ( 10 ml ) to afford a light yellow solid which was collected by filtration . after drying under vacuum for 12 hours methyl 2 - benzyl - 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate hydrochloride was obtained as a light yellow solid in 44 % yield . 1 h nmr ( cdcl 3 ): δ = 12 . 25 ( bs , 1h ), 7 . 33 - 7 . 18 ( m , 5h ), 7 . 21 ( s , 4h ), 3 . 61 ( s , 3h ), 3 . 36 ( m , 4h ), 3 . 01 ( m , 5h ) and 1 . 96 ppm ( m , 4h ). mass spectrum : m / z = 390 [ m + h ] + step 3 : preparation of 2 - benzyl - 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionic acid hydrochloride . to a solution of methyl 2 - benzyl - 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate hydrochloride in methanol ( 2 . 5 ml ) was added 50 % aqueous sodium hydroxide solution ( 1 ml ) and the resulting solution heated to reflux under n 2 for 14 hours . after this time the reaction was cooled and concentrated . the residue was treated with 2n hydrochloric acid ( 6 ml ) and the mixture stirred for 1 hr . the reaction was then extracted with 2 - butanone ( 3 × 10 ml ) and the extracts dried over magnesium sulfate , filtered and concentrated . the oily residue was re - dissolved in etoac ( 10 ml ) re - filtered and concentrated . the residue was then re - dissolved in 2 - butanone and concentrated to afford a yellow foam . this material was dried under high vacuum for 16 hours to afford a 55 % yield of the title compound as a yellow foam . 1 h nmr ( cd 3 od ): δ = 7 . 43 ( bs , 4h ), 7 . 39 - 7 . 22 ( m , 5h ), 3 . 60 ( m , 4h ), 3 . 47 ( bd , j = 10 . 6 hz , 1h ), 3 . 04 ( dd , j = 14 . 0 , 5 . 8 hz , 1h ) 2 . 98 ( m , 1h ) 2 . 51 ( m , 2h ) 2 . 39 ( m , 1h ) and 2 . 22 ppm ( m , 3h ). mass spectrum : m / z = 376 [ m + h ] + step 1 : preparation of methyl 2 , 2 - dibenzyl - 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate . this compound was prepared from methyl 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate and 2 . 5 equivalents of both lithium hexamethyldisilazide and benzyl bromide as described in step 2 of example 4 in 38 % yield . 1 h nmr ( cdcl 3 ): δ = 11 . 26 ( bs , 1h ), 7 . 45 ( d , j = 8 . 5 hz , 2h ), 7 . 32 ( m , 8h ), 7 . 28 ( s , 4h ), 3 . 79 ( s , 3h ), 3 . 58 ( d , j = 5 . 5 hz , 4h ), 3 . 49 ( m , 2h ), 3 . 21 ( m , 3h ), 2 . 17 ( m , 2h ) and 1 . 96 ppm ( t , j = 9 . 5 hz , 1h ). mass spectrum : m / z = 480 [ m + h ] + step 2 : preparation of 2 , 2 - dibenzyl - 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ]- propionic acid hydrochloride . the title compound was obtained by the hydrolysis of methyl 2 , 2 - dibenzyl - 3 -[ 4 -( 4 - chlorophenyl )- 4 - fluoropiperidin - 1 - yl ] propionate and subsequent acidification with hydrochloric acid as described in step 3 of example 4 in 61 % overall yield . 1 h nmr ( cdcl 3 ): δ = 8 . 92 ( bs , 1h ), 7 . 42 ( d , j = 8 . 8 hz , 2h ), 7 . 26 ( bs , 12h ), 5 . 48 ( bs , 1h ), 3 . 57 ( bd , j = 14 . 0 hz , 2h ), 3 . 46 ( m , 1h ), 3 . 18 ( m , 1h ), 3 . 04 ( bs , 5h ) 2 . 91 ( bd , j = 14 . 2 hz , 2h ) and 2 . 77 ppm ( bs , 3h ). step 1 : preparation of tert - butyl 4 -( 3 - benzyloxyphenyl )- 4 - hydroxypiperidine - 1 - carboxylate . a suspension of magnesium metal ( 0 . 144 g , 6 . 0 mmol ) in thf ( 10 ml ) was rapidly stirred for 30 minutes under nitrogen then a solution of 3 - benzyloxybromobenzene ( 1 . 58 g , 6 . 00 mmol ) in thf ( 10 ml ) added slowly via dropping funnel . once approximately 1 ml of the bromide solution had been added a crystal of iodine was added to the reaction and the mixture gently heated until grignard formation began . the remaining bromide solution was then added at a rate to maintain a reaction temperature range of 50 - 60 ° c . once addition was complete the reaction was heated to gentle reflux for 1 hour then cooled in an ice bath . a solution of tert - butyl 4 - oxopiperidine - 1 - carboxylate ( 1 . 00 g , 5 . 02 mmol ) in thf ( 10 ml ) was the added to the reaction over a period of 30 minutes then the mixture was allowed to warm to room temperature with stirring over a 2 hour period . after this time the reaction was quenched by the addition of 25 % ammonium chloride solution ( 50 ml ) and the layers separated . the aqueous was extracted with ethyl acetate ( 2 × 10 ml ) and the combined organics were washed with water ( 20 ml ) and brine ( 20 ml ) then dried over magnesium sulfate . subsequent filtration , concentration and purification of the residue by column chromatography ( sio 2 , 0 - 25 % ethyl acetate / heptanes ) afforded a 61 % yield of tert - butyl 4 -( 3 - benzyloxyphenyl )- 4 - hydroxypiperidine - 1 - carboxylate as a viscous clear oil that became a white solid on standing . 1 h nmr ( cdcl 3 ): δ = 7 . 41 - 7 . 33 ( m , 5h ), 7 . 29 ( d , j = 7 . 3 hz , 1h ), 7 . 15 ( t , j = 1 . 9 hz , 1h ), 7 . 06 ( d , j = 7 . 8 hz , 1h ), 6 . 91 ( dd , j = 8 . 0 , 2 . 1 hz , 1h ), 5 . 09 ( s , 2h ), 4 . 03 ( m , 2h ), 3 . 25 ( bt , j = 12 hz , 2h ), 2 . 00 ( bt , j = 11 . 1 hz , 2h ), 1 . 73 ( bd , j = 12 . 6 hz , 2h ) and 1 . 50 ppm ( s , 9h ). step 2 : preparation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidine hydrochloride . this material was prepared from the reaction of tert - butyl 4 -( 3 - benzyloxyphenyl )- 4 - hydroxypiperidine - 1 - carboxylate with diethylaminosulfur trifluoride followed by direct deprotection of the crude product with methanolic hydrogen chloride as described in step 2 of example 1 in 75 % overall yield . 1 h nmr ( cdcl 3 ): δ = 7 . 43 ( d , j = 7 . 0 hz , 1h ), 7 . 40 - 7 . 16 ( m , 6h ), 7 . 14 ( d , j = 6 . 7 hz , 1h ), 7 . 03 ( m , 1h ), 5 . 06 , ( s , 2h ), 3 . 57 ( m , 3h ), 3 . 07 ( dd , j = 14 . 0 , 6 . 9 hz , 1h ), 2 . 94 ( m , 1h ), 2 . 64 ( m , 1h ), 2 . 52 ( q , j = 11 . 2 hz , 1h ) and 1 . 94 ppm ( m , 1h ). step 3 : preparation of 4 -( 3 - benzyloxyphenyl )- 1 -( 3 , 3 - diphenylpropyl )- 4 - fluoropiperidine hydrochloride . this material was obtained by the alkylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidine hydrochloride with 3 , 3 - diphenyl - 1 - iodopropane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 59 % overall yield . 1 h nmr ( cdcl 3 ): δ = 12 . 52 ( bs , 1h ), 7 . 46 - 7 . 14 ( m , 16h ), 7 . 11 ( s , 1h ), 7 . 02 ( d , j = 8 . 1 hz , 1h ), 6 . 93 ( dd , j = 8 . 1 , 2 . 2 hz , 1h ), 5 . 07 ( s , 2h ), 4 . 08 ( m , 2h ), 3 . 52 ( bs , 2h ), 3 . 06 ( m , 2h ), 2 . 93 ( m , 2h ), 2 . 74 ( bs , 2h ) and 2 . 10 ppm ( m , 3h ). step 4 : preparation of 1 -( 3 , 3 - diphenylpropyl )- 4 - fluoro - 4 -( 3 - hydroxyphenyl ) piperidine hydrochloride . a solution of 4 -( 3 - benzyloxyphenyl )- 1 -( 3 , 3 - diphenyl - propyl )- 4 - fluoropiperidine hydrochloride ( 40 mg , 0 . 08 mmol ) in methanol ( 5 ml ) was treated with palladium on carbon ( 10 mg , 10 % pd , 50 % h 2 o ) and the mixture rapidly stirred under 1 atmosphere of hydrogen gas for 8 hours . after this time the hydrogen was replaced by nitrogen and the reaction mixture filtered through a celite pad . the pad was washed with additional methanol ( 10 ml ) and the filtrate concentrated under reduced pressure . trituration of the residue with a 1 : 1 mixture of 2 - butanone / ethyl acetate ( 10 ml ) and subsequent filtration and drying afforded a 64 % yield of 1 -( 3 , 3 - diphenylpropyl )- 4 - fluoro - 4 -( 3 - hydroxyphenyl ) piperidine hydrochloride as an off - white solid . 1 h nmr ( cd 3 od ): δ = 7 . 33 ( m , 8h ), 7 . 22 ( m , 2h ), 7 . 13 ( t , j = 7 . 8 hz , 2h ), 6 . 69 ( m , 2h ), 4 . 07 ( t , j = 7 . 9 hz , 1h ), 3 . 63 ( bd , j = 11 . 8 hz , 2h ), 3 . 05 ( m , 2h ), 2 . 93 ( m , 2h ), 2 . 79 ( pent , j = 7 . 4 hz , 1h ) 2 . 61 ( m , 2h ) and 2 . 04 ppm ( m , 3h ). mass spectrum : m / z = 373 [ m - oh + h ] + step 1 : preparation of methyl 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ] propionate . this compound was prepared from 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidine hydrochloride and methyl acrylate as described in step 1 of example 4 in 86 % yield . 1 h nmr ( cdcl 3 ): δ = 7 . 43 - 7 . 23 ( m , 6h ), 7 . 05 ( t , j = 1 . 9 hz , 1h ), 6 . 97 ( t , j = 7 . 5 hz , 1h ), 6 . 88 ( m , 1h ), 5 . 03 ( s , 2h ), 3 . 67 ( s , 3h ), 2 . 80 ( m , 1h ), 2 . 76 ( t , j = 3 . 4 hz , 2h ), 2 . 70 ( t , j = 5 . 6 hz , 1h ), 2 . 57 ( m , 1h ), 2 . 52 ( t , j = 3 . 4 hz , 2h ), 2 . 40 ( dd , j = 7 . 9 , 2 . 5 hz , 1h ), 2 . 12 ( ddd , j = 26 . 7 , 13 . 4 , 0 . 5 hz 1h ) and 1 . 98 ppm ( m , 3h ). step 2 : preparation of methyl 2 , 2 - dibenzyl 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ] propionate . this compound was prepared from methyl 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ] propionate and 2 . 5 equivalents of both lithium hexamethyldisilazide and benzyl bromide as described in step 2 of example 4 with the exception that thf was used as the reaction solvent as opposed to toluene . the desired product was obtained in 42 % overall yield . 1 h nmr ( cdcl 3 ): δ = 7 . 41 - 7 . 11 ( m , 14h ), 7 . 06 ( t , j = 1 . 8 hz , 1h ), 6 . 93 ( m , 2h ), 6 . 89 ( dd , j = 8 . 0 , 2 . 1 hz , 2h ), 5 . 02 ( s , 2h ), 3 . 69 ( s , 3h ), 3 . 66 - 3 . 52 ( m , 4h ), 3 . 45 ( bd , j = 10 . 4 hz , 2h ), 3 . 34 ( m , 1h ), 3 . 23 - 3 . 09 ( m , 3h ) 7 . 06 ( td , j = 13 . 8 , 7 . 0 hz , 2h ), and 2 . 05 ppm ( m , 2h ). mass spectrum : m / z = 552 [ m + h ] + step 3 : preparation of 2 , 2 - dibenzyl - 3 -[ 4 -( 3 - hydroxyphenyl )- 4 - fluoropiperidin - 1 - yl ]- propionic acid hydrochloride . this material was obtained by debenzylation of methyl 2 , 2 - dibenzyl 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ] propionate as described step 4 of example 6 , followed by immediate alkaline hydrolysis and salt formation as described in step 3 of example 4 . this afforded the title compound in 33 % overall yield . 1 h nmr ( cdcl 3 ): δ = 7 . 33 ( bs , 8h ), 7 . 27 - 7 . 13 ( m , 4h ), 6 . 73 ( m , 2h ), 5 . 48 ( bs , 1h ), 3 . 73 ( bd , j = 10 . 5 hz , 2h ), 3 . 23 ( d , j = 13 . 7 hz , 2h ), 3 . 13 ( d , j = 13 . 7 hz , 2h ), 3 . 02 ( m , 1h ) 2 . 95 ( m , 1h ), 2 . 83 ( m , 2h ) 2 . 25 ( m , 1h ) and 2 . 02 ppm ( bs , 3h ). mass spectrum : m / z = 430 [ m - oh ] step 1 : preparation of 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ]- 1 , 1 - dibenzylpropan - 1 - ol . a solution of methyl 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ] propionate ( 100 mg , 0 . 27 mmol ) in thf ( 5 ml ) was cooled in an ice bath and a 2m solution of benzylmagnesium chloride in thf ( 0 . 338 ml , 0 . 68 mmol ) added dropwise over 5 minutes . the resulting yellow solution was then stirred for 14 h during which time the reaction reached room temperature . the mixture was then quenched with 25 % aqueous ammonium chloride solution ( 10 ml ) and diluted with ethyl acetate ( 3 × 10 ml ). the organic layers were then combined and dried over magnesium sulfate . subsequent filtration , concentration and purification by silica gel chromatography ( sio 2 , 50 % ethyl acetate / heptanes ) afforded 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ]- 1 , 1 - dibenzylpropan - 1 - ol as a clear viscous oil in 49 % yield . 1 h nmr ( cdcl 3 ): δ = 7 . 33 ( bs , 8h ), 7 . 27 - 7 . 13 ( m , 4h ), 6 . 73 ( m , 2h ), 5 . 10 ( s , 2h ), 2 . 94 ( bd , j = 2 . 6 hz , 2h ), 2 . 88 ( d , j = 13 . 5 hz , 2h ), 2 . 78 ( d , j = 13 . 5 hz , 2h ), 2 . 57 ( t , j = 5 . 8 hz , 2h ) 2 . 51 ( m , 1h ), 2 . 44 ( m , 3h ), 2 . 25 ( m , 1h ), 1 . 94 ( m , 1h ) and 1 . 63 ppm ( t , j = 5 . 8 hz , 2h ). step 2 : preparation of 1 , 1 - dibenzyl - 3 -[ 4 - fluoro - 4 -( 3 - hydroxyphenyl )- piperidin - 1 - yl ] propan - 1 - ol hydrochloride . the title compound was prepared via the debenzylation of 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ]- 1 , 1 - dibenzylpropan - 1 - ol as described in step 4 of example 6 , followed by salt formation using methanolic hydrogen chloride in 77 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 35 - 7 . 16 ( m , 10h ), 7 . 13 ( t , j = 8 . 2 hz , 1h ), 6 . 67 ( m , 3h ), 3 . 39 ( bs , 2h ), 3 . 12 ( t , j = 7 . 8 hz , 2h ), 2 . 91 ( d , j = 14 . 0 hz , 2h ), 2 . 86 ( m , 1h ), 2 . 81 ( d , j = 14 . 0 hz , 2h ), 2 . 75 ( m , 1h ), 2 . 01 ( m , 2h ) and 1 . 84 ppm ( m , 4h ). step 1 : preparation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro )- 1 -( 2 - phenoxyethyl ) piperidine hydrochloride . this material was prepared by the alkylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidine hydrochloride with 1 - bromo - 2 - phenoxyethane and subsequent salt formation with 10 % methanolic hydrogen chloride as described in step 3 of example 1 in 58 % overall yield . 1 h nmr ( cdcl 3 ): δ = 13 . 16 ( bs , 1h ), 7 . 48 - 7 . 29 ( m , 9h ), 7 . 12 ( t , j = 1 . 9 hz , 1h ), 7 . 05 ( m , 2h ), 6 . 95 ( dd , j = 16 . 1 , 8 hz , 2h ), 5 . 09 ( s , 2h ), 4 . 62 ( t , j = 3 . 7 hz , 2h ), 3 . 69 ( d , j = 10 . 8 hz , 2h ), 3 . 52 ( bs , 2h ), 3 . 37 ( m , 2h ), 3 . 14 ( m , 1h ), 2 . 99 ( m , 1h ) and 2 . 19 ppm ( dd , j = 14 . 4 , 9 . 1 hz , 2h ). mass spectrum : m / z = 406 [ m + h ] + hydrochloride . the title compound was obtained via debenzylation 4 -( 3 - benzyloxyphenyl )- 4 - fluoro )- 1 -( 2 - phenoxyethyl ) piperidine hydrochloride as described in step 4 of example 6 in 62 % yield . 1 h nmr ( cd 3 od ): δ = 7 . 34 ( t , j = 7 . 5 hz , 2h ), 7 . 15 ( t , j = 7 . 7 hz , 1h ), 7 . 03 ( m , 3h ), 6 . 77 - 6 . 66 ( m , 3h ), 4 . 42 ( bs , 2h ), 3 . 76 ( bd , j = 10 . 8 hz , 2h ), 3 . 52 ( bs , 2h ), 3 . 37 ( m , 2h ), 3 . 14 ( m , 1h ), 2 . 99 ( m , 1h ) and 2 . 19 ppm ( dd , j = 14 . 4 , 9 . 1 hz , 2h ). mass spectrum : m / z = 298 [ m - oh ] + step 1 : preparation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 1 -( 3 - phenylpropyl ) piperidine hydrochloride . this material was prepared by the alkylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidine hydrochloride with 1 - bromo - 3 - phenylpropane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 43 % overall yield . 1 h nmr ( cdcl 3 ): δ = 12 . 68 ( bs , 1h ), 7 . 48 - 7 . 26 ( m , 11h ), 7 . 10 ( s , 1h ), 7 . 05 ( d , j = 7 . 7 hz , 1h ), 6 . 95 ( m , 1h ), 5 . 07 ( s , 2h ), 3 . 51 ( bd , j = 7 . 2 hz , 2h ), 3 . 12 ( m , 3h ), 2 . 99 ( m , 2h ) 2 . 76 ( t , j = 7 . 1 hz , 2h ), 2 . 34 ( m , 2h ) and 2 . 13 ppm ( m , 2h ). step 2 : preparation of 4 - fluoro - 4 -( 3 - hydroxyphenyl )- 1 -( 3 - phenylpropyl ) piperidine hydrochloride . the title compound was obtained via debenzylation 4 -( 3 - benzyloxyphenyl )- 4 - fluoro )- 1 -( 3 - phenylpropyl ) piperidine hydrochloride as described in step 4 of example 6 in 82 % yield . 1 h nmr ( cdcl 3 ): δ = 7 . 44 - 7 . 12 ( m , 6h ), 6 . 94 ( s , 1h ), 6 . 82 ( d , j = 7 . 2 hz , 1h ), 6 . 73 ( d , j = 7 . 4 hz , 1h ), 3 . 61 ( bd , j = 8 . 8 hz , 2h ), 3 . 24 ( m , 2h ), 2 . 95 ( m , 2h ) 2 . 76 ( t , j = 7 . 0 hz , 2h ), 2 . 66 ( m , 4h ) and 2 . 16 ppm ( m , 2h ). mass spectrum : m / z = 296 [ m - oh ] + step 1 : preparation of 4 -( 3 - benzyloxyphenyl )- 1 -( 3 - cyclohexylpropyl )- 4 - fluoropiperidine hydrochloride . this material was prepared by the alkylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidine hydrochloride with 1 - bromo - 3 - cyclohexylpropane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 32 % overall yield . 1 h nmr ( cdcl 3 ): δ = 12 . 72 ( bs , 1h ), 7 . 48 - 7 . 26 ( m , 6h ), 7 . 12 ( t , j = 2 . 0 hz , 1h ), 7 . 04 ( d , j = 7 . 9 hz , 1h ), 6 . 94 ( m , 2h ), 5 . 09 ( s , 2h ), 3 . 54 ( bd , j = 7 . 3 hz , 2h ), 3 . 16 ( m , 3h ), 2 . 98 ( bs , 2h ), 2 . 15 ( m , 2h ), 1 . 98 ( bs , 2h ), 1 . 72 ( m , 6h ), 1 . 23 ( m , 6h ) and 0 . 91 ppm ( m , 2h ). step 2 : preparation of 1 -( 3 - cyclohexylpropyl )- 4 - fluoro - 4 -( 3 - hydroxyphenyl ) piperidine hydrochloride . the title compound was obtained via debenzylation 4 -( 3 - benzyloxy - phenyl )- 1 -( 3 - cyclohexylpropyl )- 4 - fluoropiperidine hydrochloride as described in step 4 of example 6 in 69 % yield . 1 h nmr ( cd 3 od ): δ = 7 . 15 ( t , j = 7 . 8 hz , 1h ), 6 . 74 ( d , j = 7 . 8 hz , 1h ), 6 . 71 ( s , 1h ), 6 . 68 ( d , j = 7 . 8 hz , 1h ), 3 . 66 ( bd , j = 11 . 7 hz , 2h ), 3 . 11 ( m , 4h ), 2 . 83 ( m , 1h ), 2 . 13 ( m , 2h ), 2 . 02 ( m , 2h ), 1 . 78 ( m , 6h ), 1 . 27 ( m , 6h ) and 0 . 99 ppm ( m , 2h ). mass spectrum : m / z = 302 [ m - oh ] + step 1 : preparation of tert - butyl 4 -( 3 - benzyloxyphenyl )- 4 - hydroxy - 3 - methylpiperidine - 1 - carboxylate . this compound was prepared from tert - butyl 3 - methyl - 4 - oxopiperidine - 1 - carboxylate and 3 - benzyloxyphenylmagnesium bromide as described in step 1 of example 6 in 44 % yield . 1 h nmr ( cdcl 3 ): δ = 7 . 40 - 7 . 35 ( m , 5h ), 7 . 23 ( t , j = 7 . 0 hz , 1h ), 7 . 12 ( bs , 1h ), 7 . 06 ( d , j = 8 . 0 hz , 1h ), 6 . 91 ( d , j = 8 . 0 hz , 1h ), 5 . 03 ( s , 2h ), 3 . 98 ( m , 2h ), 3 . 17 ( bs , 1h ), 2 . 98 ( bs , 1h ), 2 . 05 ( m , 1h ), 1 . 90 ( m , 1h ), 1 . 66 ( bd , j = 11 . 7 hz , 2h ), 1 . 47 ( s , 9h ) and 0 . 60 ppm ( d , j = 6 . 6 hz , 3h ). step 2 : preparation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride . this material was prepared from the reaction of tert - butyl 4 -( 3 - benzyloxyphenyl )- 4 - hydroxy - 3 - methylpiperidine - 1 - carboxylate with diethylaminosulfur trifluoride and deprotection of the crude product using methanolic hydrogen chloride as described in step 2 of example 1 . this afforded 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride in 72 % overall yield . 1 h nmr ( cd 3 od ): δ = 9 . 90 ( bs , 1h ), 9 . 70 ( bs , 1h ), 7 . 42 ( bs , 6h ), 7 . 03 - 6 . 91 ( m , 3h ), 5 . 06 , ( s , 2h ), 3 . 47 ( m , 1h ), 3 . 04 ( m , 3h ), 2 . 70 ( m , 2h ), 2 . 07 ( m , 1h ) and 0 . 72 ppm ( bs , 3h ). step 3 : preparation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methyl - 1 -( 3 - phenylpropyl ) piperidine hydrochloride . this material was obtained by the alkylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride with 3 - phenyl - 1 - bromopropane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 32 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 44 ( d , j = 7 . 2 hz , 1h ), 7 . 38 ( d , j = 6 . 8 hz , 1h ), 7 . 35 - 7 . 22 ( m , 6h ), 7 . 01 ( m , 3h ), 5 . 12 ( s , 2h ), 3 . 55 ( m , 2h ), 3 . 22 ( bs , 3h ), 3 . 06 ( bt , j = 12 . 3 hz , 1h ), 2 . 75 ( bs , 2h ), 2 . 62 ( m , 1h ), 2 . 48 ( m , 1h ), 2 . 17 ( m , 3h ) and 0 . 73 ppm ( d , j = 6 . 7 hz , 3h ). step 4 : preparation of 4 - fluoro - 4 -( 3 - hydroxyphenyl )- 1 -( 3 - phenylpropyl )- 3 - methylpiperidine hydrochloride . the title compound was prepared by the debenzylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methyl - 1 -( 3 - phenylpropyl ) piperidine hydrochloride as described in step 4 of example 6 in 88 % yield . 1 h nmr ( cdcl 3 ): δ = 7 . 33 - 7 . 16 ( m , 6h ), 6 . 94 ( m , 2h ), 6 . 83 ( m , 1h ), 3 . 68 ( t , j = 6 . 4 hz , 1h ), 3 . 40 ( bs , 2h ), 3 . 25 ( m , 1h ) 3 . 06 ( m , 2h ), 2 . 85 - 2 . 68 ( m , 4h ) 2 . 26 ( bs , 2h ), 1 . 89 ( m , 1h ) and 0 . 62 ppm ( d , j = 6 . 8 hz , 3h ). mass spectrum : m / z = 328 [ m + h ] + step 1 : preparation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methyl - 1 -( 2 - phenoxyethyl ) piperidine hydrochloride . this material was prepared by the alkylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride with 1 - bromo - 2 - phenoxyethane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 67 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 47 - 7 . 29 ( m , 8h ), 7 . 03 ( m , 6h ), 5 . 12 ( s , 2h ), 4 . 47 ( t , j = 2 . 5 hz , 2h ), 3 . 72 ( bs , 2h ), 3 . 63 - 3 . 36 ( m , 2h ), 2 . 60 ( m , 2h ) 2 . 25 ( m , 1h ) and 0 . 77 ppm ( d , j = 6 . 8 hz , 3h ). step 2 : preparation of 4 - fluoro - 4 -( 3 - hydroxyphenyl )- 3 - methyl - 1 -( 2 - phenoxyethyl ) piperidine hydrochloride . the title compound was obtained via debenzylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methyl - 1 -( 2 - phenoxyethyl ) piperidine hydrochloride as described in step 4 of example 6 in 91 % yield . 1 h nmr ( cdcl 3 ): δ = 7 . 20 ( m , 2h ), 7 . 08 ( t , j = 7 . 7 hz , 1h ), 6 . 96 ( m , 2h ), 6 . 83 ( m , 3h ), 4 . 47 ( bs , 2h ), 3 . 47 ( m , 4h ), 3 . 17 ( bs , 1h ), 2 . 89 ( m , 2h ), 2 . 28 ( bs , 1h ), 2 . 09 ( d , j = 8 . 6 hz , 1h ) and 0 . 61 ppm ( d , j = 4 . 6 hz , 3h ). mass spectrum : m / z = 330 [ m + h ] + step 1 : preparation of 4 -( 3 - benzyloxyphenyl )- 1 -( 3 - cyclohexylpropyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride . this material was prepared by the alkylation of 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride with 1 - bromo - 3 - cyclohexylpropane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 48 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 46 - 7 . 31 ( m , 6h ), 6 . 99 ( m , 3h ), 5 . 12 ( s , 2h ), 3 . 57 ( m , 2h ), 3 . 12 ( m , 5h ), 2 . 60 ( m , 1h ), 2 . 46 ( m , 1h ), 2 . 20 ( m , 1h ), 1 . 72 ( m , 6h ), 1 . 23 ( m , 6h ), 0 . 91 ppm ( m , 2h ) and 0 . 76 ppm ( d , j = 6 . 7 hz , 3h ). step 2 : preparation of 1 -( 3 - cyclohexylpropyl )- 4 - fluoro - 4 -( 3 - hydroxyphenyl )- 3 - methylpiperidine hydrochloride . the title compound was obtained via debenzylation of 4 -( 3 - benzyloxyphenyl )- 1 -( 3 - cyclohexylpropyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride as described in step 4 of example 6 in 54 % yield . 1 h nmr ( cdcl 3 ): δ = 6 . 89 ( m , 2h ), 6 . 75 ( d , j = 6 . 9 hz , 1h ), 6 . 64 ( m , 1h ), 3 . 54 ( bs , 1h ), 3 . 42 ( m , 1h ), 2 . 98 ( m , 3h ), 2 . 79 ( m , 1h ), 1 . 83 ( m , 2h ), 1 . 60 ( m , 5h ), 1 . 17 ( m , 6h ) 0 . 81 ppm ( m , 2h ) and 0 . 69 ppm ( d , j = 6 . 5 hz , 3h ). mass spectrum : m / z = 334 [ m + h ] + step 1 : preparation of methyl 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidin - 1 - yl ] propionate . this compound was prepared from 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride and methyl acrylate as described in step 1 of example 4 in 81 % yield . 1 h nmr ( cdcl 3 ): δ = 7 . 44 - 7 . 29 ( m , 5h ), 7 . 25 ( t , j = 8 . 0 hz , 1h ), 6 . 99 ( t , j = 1 . 8 hz , 1h ), 6 . 88 ( m , 2h ), 5 . 04 ( s , 2h ), 3 . 69 ( s , 3h ), 2 . 75 ( m , 4h ), 2 . 56 ( t , j = 7 . 3 hz , 2h ), 2 . 41 ( m , 1h ), 2 . 20 ( m , 2h ), 2 . 11 ( m , 1h ), 1 . 99 ( dt , j = 11 . 7 , 3 . 1 hz , 1h ) and 0 . 66 ppm ( d , j = 6 . 3 hz , 3h ). step 2 : preparation of methyl 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidin - 1 - yl ]- 2 , 2 - dibenzylpropionate . this compound was prepared from methyl 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidin - 1 - yl ] propionate and 2 . 5 equivalents of both lithium hexamethyldisilazide and benzyl bromide as described in step 2 of example 4 with the exception that thf was used as the reaction solvent as opposed to toluene . the desired compound was obtained in 42 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 45 ( m , 5h ), 7 . 38 - 7 . 27 ( m , 11h ), 7 . 04 ( m , 1h ), 6 . 95 ( m , 2h ), 5 . 09 ( s , 2h ), 3 . 73 ( s , 3h ), 3 . 71 ( m , 4h ), 3 . 69 - 3 . 49 ( m , 3h ), 3 . 05 ( m , 4h ), 2 . 52 ( m , 1h ), 2 . 21 ( m , 1h ) and 0 . 69 ppm ( t , j = 6 . 7 hz , 3h ). mass spectrum : m / z = 566 [ m + h ] + step 3 : preparation of 2 , 2 - dibenzyl - 3 -[ 4 -( 3 - hydroxyphenyl )- 4 - fluoro - 3 - methylpiperidin - 1 - yl ] propionic acid hydrochloride . the title compound was obtained by the debenzylation of methyl 3 -[ 4 -( 3 - benzyoxyphenyl )- 4 - fluoropiperidin - 1 - yl ]- 2 , 2 - dibenzyl - propionate as described step 4 of example 6 , followed by immediate alkaline hydrolysis and salt formation as described in step 3 of example 4 . this afforded the title compound in 38 % overall yield . 1 h nmr ( dmso - d 6 ):= 7 . 29 ( m , 10h ), 7 . 12 ( t , j = 7 . 7 hz , 1h ), 6 . 79 ( bs , 2h ), 6 . 71 ( m , 1h ), 3 . 22 ( m , 4h ), 3 . 13 ( d , j = 15 . 1 hz , 2h ), 2 . 98 ( m , 3h ), 2 . 84 ( m , 1h ), 2 . 76 ( bs , 1h ) and 0 . 56 ppm ( t , j = 5 . 4 hz , 3h ). mass spectrum : m / z = 462 [ m + h ] + step 1 : preparation of tert - butyl 4 -( 3 - n , n - dibenzylaminophenyl )- 4 - hydroxypiperidine - 1 - carboxylate . a suspension of magnesium metal ( 0 . 192 g , 8 . 00 mmol ) in thf ( 20 ml ) was rapidly stirred for 30 minutes under nitrogen then a solution of 3 - dibenzylamino - bromobenzene ( 2 . 50 g , 7 . 09 mmol ) in thf ( 10 ml ) added slowly via dropping funnel . once approximately 2 ml of the solution had been added a crystal of iodine was added to the reaction and the mixture gently heated until grignard formation began . the remaining bromide solution was then added at a rate to maintain a reaction temperature range of 40 - 60 ° c . once addition was complete the reaction was heated to gentle reflux for 1 hour then cooled in an ice bath . tert - butyl 4 - oxopiperidine - 1 - carboxylate ( 1 . 30 g , 6 . 50 mmol ) was then added in small portions over a period of 30 minutes . once this addition was complete the mixture was stirred at 0 ° c . for one hour . after this time the cooling bath was removed and the reaction stirred at room temperature for an additional 13 hours . the reaction was then quenched by the addition of 25 % ammonium chloride solution ( 50 ml ) and the organic layer separated . the aqueous was extracted with ethyl acetate ( 20 ml ) and the combined extracts dried over magnesium sulfate and filtered . subsequent concentration afforded a viscous oil that was purified by column chromatography ( 20 - 60 % etoac / heptanes , silica gel ) to afford 1 . 76 g , ( 57 % yield ) of tert - butyl 4 -( 3 - n , n - dibenzylaminophenyl )- 4 - hydroxypiperidine - 1 - carboxylate as a viscous clear oil . 1 h nmr ( cdcl 3 ): δ = 7 . 28 - 7 . 12 ( m , 8h ), 7 . 09 ( t , j = 8 . 0 hz , 2h ), 6 . 85 ( bs , 1h ), 6 . 72 ( d , j = 7 . 8 hz , 1h ), 6 . 58 ( dd , j = 8 . 1 , 2 . 2 hz , 2h ), 4 . 59 ( s , 4h ), 4 . 03 ( bd , j = 5 . 5 hz , 2h ), 3 . 47 ( bs , 2h ), 1 . 76 ( m , 2h ), 1 . 63 ( m , 2h ) and 1 . 45 ppm ( s , 9h ). step 2 : preparation of 4 -( 3 - n , n - dibenzylaminophenyl )- 4 - fluoropiperidine dihydrochloride : this material was prepared from tert - butyl 4 -( 3 - n , n - dibenzylaminophenyl )- 4 - hydroxypiperidine - 1 - carboxylate via diethylaminosulfur trifluoride mediated fluorination as described in step 2 of example 1 with the exception that the reaction was carried out in toluene for solubility purposes . the crude product was deprotected using methanolic hydrogen chloride as described in step 2 of example 1 to afford the desired product in 79 % overall yield as a white solid . 1 h nmr ( cd 3 od + cdcl 3 ): δ = 7 . 38 ( bs , 6h ), 7 . 22 - 7 . 11 ( m , 8h ), 4 . 83 , ( s , 4h ), 3 . 32 ( m , 4h ), 2 . 59 - 2 . 35 ( m , 2h ) and 1 . 93 ppm ( bs , 2h ). step 3 : preparation of 4 -( 3 - n , n - dibenzylaminophenyl )- 4 - fluoro - 1 -( 2 - phenoxyethyl ) piperidine dihydrochloride this material was obtained by the alkylation of 4 -( 3 - n , n - dibenzylaminophenyl )- 4 - fluoropiperidine dihydrochloride with 2 - phenoxy - 1 - bromoethane and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 72 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 49 - 7 . 24 ( m , 16h ), 7 . 08 - 7 . 01 ( m , 3h ), 5 . 01 ( s , 4h ), 4 . 47 ( t , j = 3 . 7 hz , 2h ), 3 . 63 ( m , 4h ), 3 . 50 ( td , j = 12 . 8 , 2 . 21 hz , 2h ), 2 . 60 ( td , j = 14 . 5 , 4 . 6 hz , 1h ) 2 . 47 ( m , 1h ) and 2 . 12 ppm ( m , 2h ). step 4 : preparation 4 -( 3 - aminophenyl )- 1 -( 2 - phenoxyethyl ) 4 - fluoropiperidine dihydrochloride : a solution of 4 -( 3 - n , n - dibenzylaminophenyl )- 4 - fluoro - 1 -( 2 - phenoxyethyl ) piperidine dihydrochloride ( 500 mg , 0 . 88 mmol ) in methanol ( 30 ml ) was treated with palladium on carbon ( 100 mg , 10 % pd , 50 % wet ) and the mixture rapidly stirred under 1 atmosphere of hydrogen gas for 8 hours . after this time the hydrogen was replaced by nitrogen and the reaction mixture filtered through a celite pad . the pad was washed with additional methanol ( 10 ml ) and the filtrate concentrated under reduced pressure . the resulting viscous tan oil was dried under high vacuum for 28 hours to afford a 70 % yield of 4 -( 3 - aminophenyl )- 1 -( 2 - phenoxyethyl ) 4 - fluoropiperidine dihydrochloride as a tan colored glassy solid . 1 h nmr ( cd 3 od ): δ = 7 . 55 - 7 . 29 ( m , 6h ), 7 . 07 - 7 . 00 ( m , 3h ), 4 . 46 ( bs , 2h ), 3 . 83 ( bd , j = 11 . 5 hz , 2h ), 3 . 67 ( bs , 2h ), 3 . 04 ( m , 1h ), and 2 . 17 ppm ( bs , 5h ). mass spectrum : m / z = 297 [ m - nh 3 ] + to a suspension of 4 -( 3 - aminophenyl )- 1 -( 2 - phenoxyethyl ) 4 - fluoropiperidine dihydrochloride ( 100 mg , 0 . 26 mmol ) in methylene chloride ( 5 ml ) was added diisopropylethylamine ( 118 mg , 0 . 91 mmol ) and the mixture stirred at room temperature until a clear solution resulted . this solution was then cooled to 0 ° c . and 4 - methyl - benzenesulfonyl chloride ( 58 mg , 0 . 28 mmol ) was then added and the reaction stirred at 0 ° c . for 1 hour then room temperature for 3 hours . after this time the mixture was quenched by the addition of 25 % ammonium chloride solution ( 10 ml ). the organic layer was separated and the aqueous extracted with ethyl acetate ( 2 × 10 ml ). the combined extracts were dried over magnesium sulfate and filtered and concentrated . the residue was re - dissolved in ethyl acetate ( 20 ml ), washed with water ( 2 × 10 ml ) and brine ( 10 ml ), dried over magnesium sulfate and filtered . the filtrate was concentrated to a viscous yellow oil which was treated with 10 % methanolic hydrogen chloride ( 10 ml ) and re - concentrated . the residue was triturated with ethyl acetate ( 5 ml ) and then dried under high vacuum to afford a 49 % yield of the title compound as a light yellow solid . 1 h nmr ( cdcl 3 ): δ = 12 . 47 ( bs , 1h ), 12 . 19 ( bs , 1h ), 7 . 76 ( t , j = 8 . 6 hz , 2h ), 7 . 32 ( d , j = 8 . 0 hz , 2h ), 7 . 22 ( m , 5h ), 7 . 13 ( d , j = 6 . 9 hz , 1h ), 7 . 02 ( t , j = 7 . 3 hz , 1h ), 6 . 91 ( d , j = 8 . 0 hz , 2h ), 4 . 58 ( bs , 2h ), 3 . 83 ( bd , j = 10 . 0 hz , 1h ), 3 . 74 ( bd , j = 12 . 6 hz , 1h ), 3 . 57 ( bs , 2h ), 3 . 33 ( bd , j = 9 . 1 hz , 1h ), 3 . 00 ( m , 1h ), 2 . 46 ( bd , j = 8 . 3 hz , 1h ), 2 . 36 ( s , 3h ), 2 . 10 ( dd , j = 13 . 3 , 8 . 3 hz , 1h ), and 1 . 93 ppm ( bs , 2h ). mass spectrum : m / z = 469 [ m + h ] + the title compound was prepared from the reaction of 4 -( 3 - aminophenyl )- 1 -( 2 - phenoxyethyl ) 4 - fluoropiperidine dihydrochloride with methanesulfonyl chloride in the presence of excess diisopropylethylamine as described in example 17 . the desired material was obtained in 64 % yield as an off - white solid . 1 h nmr ( cdcl 3 ): δ = 11 . 83 ( bs , 1h ), 11 . 42 ( bs , 1h ), 7 . 76 ( bs , 1h ), 7 . 30 - 7 . 19 ( m , 4h ), 7 . 12 ( q , j = 6 . 9 hz , 1h ), 6 . 98 - 6 . 90 ( m , 3h ), 4 . 48 ( bs , 2h ), 3 . 69 ( bs , 3h ), 3 . 49 ( s , 3h ), 3 . 36 ( bd , j = 8 . 9 hz , 1h ), 3 . 13 ( bs , 1h ), 2 . 95 - 2 . 70 ( m , 2h ), 2 . 29 ( m , 1h ) and 1 . 92 ppm ( m , 2h ). mass spectrum : m / z = 393 [ m + h ] + the title compound was prepared from the reaction of 4 -( 3 - aminophenyl )- 1 -( 2 - phenoxyethyl ) 4 - fluoropiperidine dihydrochloride with tert - butylisocyanate in the presence of excess diisopropylethylamine as described in example 19 , with the exception that hydrochloride salt formation was not carried out . the desired material was obtained in 24 % yield as a white solid . 1 h nmr ( cdcl 3 ): δ = 7 . 24 - 7 . 08 ( m , 6h ), 6 . 90 - 6 . 77 ( m , 3h ), 5 . 26 ( bs , 1h ), 4 . 07 ( t , j = 5 . 8 hz , 2h ), 3 . 05 ( bd , j = 9 . 5 hz , 2h ), 2 . 79 ( bs , 2h ), 2 . 42 ( m , 1h ), 2 . 15 ppm ( bs , 2h ), 1 . 75 ( bs , 3h ) and 1 . 29 ppm ( s , 9h ). mass spectrum : m / z = 414 [ m + h ] + step 1 : preparation of 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ]- n -( 4 - bromophenyl ) propionamide hydrochloride . to a solution of n -( 4 - bromophenyl ) acrylamide ( 340 mg , 1 . 50 mmol ) in methanol ( 10 ml ) was added 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidine hydrochloride ( 321 mg , 1 . 00 mmol ) followed by sodium bicarbonate ( 840 mg , 10 . 0 mmol ) and the resulting suspension stirred at room temperature for 52 hours . after this time the reaction was filtered and the filtrate concentrated under reduced pressure . the residue was treated with ethyl acetate ( 10 ml ) and the resulting suspension re - filtered and concentrated under reduced pressure . the resulting solid was treated with 10 % hydrogen chloride in methanol ( 10 ml ) and the solution re - concentrated . subsequent trituration with ethyl acetate ( 10 ml ) afforded 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ]- n -( 4 - bromophenyl ) propionamide hydrochloride in 64 % yield as a light yellow solid . 1 h nmr ( cdcl 3 ): δ = 7 . 36 - 7 . 16 ( m , 12h ), 6 . 97 ( dd = 5 . 9 , 1 . 6 hz , 2h ), 6 . 85 ( m , 2h ), 4 . 99 ( s , 2h ), 3 . 21 ( d , j = 2 . 7 hz , 1h ), 2 . 93 ( bd , j = 11 . 6 hz , 1h ), 2 . 74 ( m , 3h ), 2 . 54 ( m , 1h ), 2 . 49 ( bs , 3h ) and 2 . 02 ppm ( m , 3h ). step 2 : preparation of 3 -[ 4 - fluoro - 4 -( 3 - hydroxyphenyl )- piperidin - 1 - yl ]- n - phenyl - propionamide hydrochloride . the title compound was prepared via debenzylation of 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoropiperidin - 1 - yl ]- n -( 4 - bromophenyl ) propionamide as described in step 4 of example 6 in 73 % yield . 1 h nmr ( cd 3 od ): δ = 7 . 61 ( dd , j = 8 . 6 , 1 . 2 hz , 2h ), 7 . 33 ( m , 2h ), 7 . 14 ( m , 2h ), 6 . 89 ( bs , 1h ), 6 . 80 ( m , 1h ), 6 . 70 ( m , 1h ), 3 . 74 ( m , 2h ), 3 . 62 ( t , j = 6 . 9 hz , 1h ), 3 . 55 ( t , j = 6 . 9 hz , 1h ), 3 . 46 ( m , 1h ), 3 . 20 ( m , 1h ), 3 . 09 ( m , 1h ), 3 . 00 ( t , j = 6 . 8 hz , 1h ), 2 . 63 - 2 . 39 ( m , 1h ) 2 . 31 ( bd , j = 9 . 1 hz , 1h ) and 2 . 02 ppm ( bt , j = 15 . 2 hz , 2h ). mass spectrum : m / z = 343 [ m + h ] + step 1 : preparation of 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidin - 1 - yl ]- n -( 4 - bromophenyl ) propionamide hydrochloride . this material was synthesized by the reaction of n -( 4 - bromophenyl ) acrylamide with 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidine hydrochloride as described in step 1 of example 20 . the desired compound was obtained as a light yellow solid in 65 % yield . 1 h nmr ( cd 3 od ): δ = 7 . 59 ( d , j = 8 . 6 hz , 2h ), 7 . 46 ( m , 4h ), 7 . 35 ( m , 4h ), 7 . 07 ( bs , 1h ), 7 . 03 ( d , j = 8 . 3 hz , 1h ), 6 . 96 ( m , 1h ), 5 . 13 ( s , 2h ), 3 . 61 ( m , 5h ), 3 . 05 ( m , 4h ), 2 . 61 ( m , 1h ), 2 . 28 ( bd , j = 14 . 4 hz , 1h ), and 0 . 77 ppm ( d , j = 6 . 8 hz , 3h ). step 2 : preparation of 3 -[ 4 - fluoro - 4 -( 3 - hydroxyphenyl )- 3 methylpiperidin - 1 - yl ]- n - phenylpropionamide hydrochloride . the title compound was prepared via debenzylation of 3 -[ 4 -( 3 - benzyloxyphenyl )- 4 - fluoro - 3 - methylpiperidin - 1 - yl ]- n -( 4 - bromophenyl ) propionamide as described in step 4 of example 6 in 88 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 60 ( d , j = 7 . 8 hz , 2h ), 7 . 33 ( t , j = 7 . 7 hz , 2h ), 7 . 25 ( m , 1h ), 7 . 12 ( t , j = 7 . 4 hz , 1h ), 6 . 85 ( m , 3h ), 3 . 56 ( bt , j = 6 . 1 hz , 2h ), 3 . 49 ( bs , 3h ), 3 . 01 ( m , 4h ), 2 . 44 ( m , 1h ), 2 . 23 ( m , 1h ) and 0 . 78 ppm ( d , j = 7 . 5 hz , 3h ). mass spectrum : m / z = 357 [ m + h ] + step 1 : preparation of tert - butyl 4 - hydroxy - 4 -( 3 - methoxyphenyl ) piperidine - 1 - carboxylate . this compound was prepared from tert - butyl 4 - oxopiperidine - 1 - carboxylate and 3 - methoxyphenylmagnesium bromide as described in step 1 of example 6 in 55 % yield . 1 h nmr ( cdcl 3 ): δ = 7 . 19 ( t , j = 7 . 9 hz , 1h ), 7 . 00 ( m , 1h ), 6 . 97 ( d , j = 7 . 8 hz , 1h ), 6 . 72 ( dd , j = 8 . 0 , 2 . 0 hz , 1h ), 3 . 91 ( bd , j = 12 . 6 hz , 2h ), 3 . 72 ( s , 3h ), 3 . 17 ( bt , j = 12 . 2 hz , 2h ), 3 . 01 ( bs , 1h ), 1 . 87 ( dt , j = 13 . 0 , 4 . 6 hz , 2h ), 1 . 64 ( bd , j = 12 . 8 hz , 2h ) and 1 . 41 ppm ( s , 9h ). step 2 : preparation of 4 -( 3 - methoxyphenyl )- 4 - fluoropiperidine hydrochloride . this material was prepared from the reaction of tert - butyl 4 - hydroxy - 4 -( 3 - methoxyphenyl ) piperidine - 1 - carboxylate with diethylaminosulfur trifluoride and deprotection of the crude product using methanolic hydrogen chloride as described in step 2 of example 1 to afford 4 -( 3 - methoxyphenyl )- 4 - fluoropiperidine hydrochloride in 76 % yield . 1 h nmr ( cd 3 od ): δ = 7 . 30 ( t , j = 8 . 0 hz , 1h ), 7 . 00 ( m , 2h ), 6 . 67 ( td , j = 8 . 2 , 1 . 8 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 68 ( bs , 2h ), 3 . 48 ( m , 2h ), 2 . 82 ( m , 1h ), 2 . 63 ( bd , j = 15 . 0 hz , 1h ) 2 . 41 ( bs , 1h ), and 2 . 28 ppm ( m , 1h ). step 3 : preparation of 1 -( 3 - cyclohexylpropyl )- 4 - fluoro - 4 -( 3 - methoxyphenyl ) piperidine hydrochloride this material was obtained by alkylation of 4 -( 3 - methoxyphenyl )- 4 - fluoropiperidine hydrochloride with 3 - cyclohexyl - 1 - bromopropane followed by salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 81 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 35 ( t , j = 8 . 1 hz , 1h ), 7 . 01 ( m , 2h ), 6 . 68 ( dt , j = 8 . 2 , 1 . 7 hz , 1h ), 3 . 83 ( s , 3h ), 3 . 66 ( bd , j = 9 . 2 hz , 2h ), 3 . 36 ( m , 2h ), 3 . 20 ( t , j = 8 . 4 hz , 2h ), 2 . 56 ( m , 2h ), 2 . 28 ( m , 2h ), 1 . 83 ( m , 7h ), 1 . 28 ( m , 6h ) and 0 . 97 ppm ( m , 2h ). mass spectrum : m / z = 334 [ m + h ] + this material was obtained by the alkylation of 4 - fluoro - 4 -( 3 - methoxyphenyl ) piperidine hydrochloride with 3 -( 2 - bromoethyl ) thiophene and subsequent salt formation with methanolic hydrogen chloride as described in step 3 of example 1 in 49 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 46 ( dd , j = 4 . 9 , 2 . 9 hz , 1h ), 7 . 36 ( t , j = 8 . 2 hz , 1h ), 7 . 32 ( bd , j = 1 . 9 hz , 1h ), 7 . 12 ( dd , j = 4 . 9 , 1 . 1 hz , 1h ), 7 . 01 ( m , 2h ), 7 . 12 ( dd , j = 8 . 2 , 2 . 3 hz , 1h ), 3 . 83 ( s , 3h ), 3 . 72 ( bd , j = 7 . 9 hz , 2h ), 3 . 49 ( m , 4h ), 3 . 23 ( m , 2h ), 2 . 59 ( m , 1h ), 2 . 52 ( m , 1h ) and 2 . 17 ppm ( m , 2h ). mass spectrum : m / z = 320 [ m + h ] + step 1 : preparation of 4 - fluoro - 4 -( 3 - hydroxyphenyl ) piperidine hydrochloride . this material was prepared from the catalytic hydrogenation of 4 - fluoro - 4 -( 3 - benzyloxyphenyl ) piperidine hydrochloride as described in described step 4 of example 6 . this afforded 4 -( 3 - hydroxyphenyl )- 4 - fluoropiperidine hydrochloride in 76 % overall yield . 1 h nmr ( cd 3 od ): δ = 7 . 14 ( t , j = 7 . 8 hz , 1h ), 6 . 75 ( bd , j = 7 . 8 hz , 1h ), 6 . 71 ( m , 1h ), 6 . 67 ( td , j = 8 . 1 , 1 . 6 hz , 1h ), 3 . 50 ( bd , j = 12 . 6 hz , 2h ), 3 . 14 ( m , 1h ), 2 . 84 ( tt , j = 12 . 0 , 3 . 6 hz , 1h ), 2 . 07 ( bd , j = 15 . 0 hz , 2h ) and 1 . 94 ppm ( m , 2h ). step 2 : preparation of 4 - fluoro - 4 -( 3 - hydroxyphenyl )- 1 -( trans - 3 - phenylcyclopropyl - methyl ) piperidine hydrochloride to a suspension of 4 - fluoro - 4 -( 3 - hydroxyphenyl ) piperidine hydrochloride ( 100 mg , 0 . 43 mmol ) in thf ( 3 ml ) was added triethylamine ( 108 mg , 1 . 07 mmol ) and the resulting mixture cooled in an ice bath . a solution of trans - 2 - phenylcyclopropanecarbonyl chloride ( 194 mg , 1 . 07 mmol ) in thf ( 2 ml ) was added slowly via syringe over a period of 5 minutes . the reaction was then stirred for additional 3 hours during which time it was allowed to warm to room temperature . the reaction was then quenched by pouring into water ( 20 ml ) and the mixture extracted with ethyl acetate ( 2 × 20 ml ). the extracts were dried over magnesium sulfate and filtered . the filtrate was then concentrated to afford crude 3 -[ 4 - fluoro - 1 -( trans - 2 - phenylcyclopropanecarbonyl ) piperidin - 4 - yl ]- phenyl trans - 2 - phenylcyclopropane carboxylate as a viscous clear oil . this oil was dissolved in thf ( 5 ml ) and a 65 wt % solution of vitride in toluene ( 1 . 35 ml , 4 . 50 mmol ) added . the resulting mixture was then stirred at room temperature for 2 hours . after this time the reaction was heated to 60 ° c . for a further 2 hours then cooled back to room temperature . the reaction was then cooled in an ice - bath and ethyl acetate ( 10 ml ) slowly added . the resulting mixture was then slowly added to 10 % hydrochloric acid solution ( 25 ml ) and the mixture rapidly stirred for 1 hour . the reaction mixture was then adjusted to ph 8 by the addition of solid sodium bicarbonate and the layers separated . the aqueous was extracted with ethyl acetate ( 3 × 10 ml ) and the combined organics dried over magnesium sulfate . subsequent filtration and concentration afforded a brown oil . this material was treated with 10 % methanolic hydrogen chloride ( 5 ml ) and re - concentrated . the resulting oil was triturated with 1 : 1 ethyl acetate / acetone to afford a light brown solid . this solid was isolated by filtration and dried on the pump overnight . this afforded the title compound in 11 % overall yield as a tan colored solid . 1 h nmr ( cd 3 od ): δ = 7 . 24 ( m , 2h ), 7 . 11 ( m , 4h ), 6 . 91 ( bd , j = 7 . 8 hz , 1h ), 6 . 71 ( m , 1h ), 6 . 73 ( bd , j = 7 . 0 hz , 1h ), 3 . 98 ( bs , 1h ), 3 . 64 ( m , 1h ), 3 . 55 ( bd , j = 9 . 7 hz , 1h ), 3 . 34 ( bd , j = 7 . 6 hz , 2h ), 3 . 19 ( m , 1h ), 2 . 85 ( bs , 1h ), 2 . 52 ( m , 1h ), 2 . 27 ( bs , 2h ), 2 . 10 ( bs , 1h ) 1 . 51 ( bs , 1h ) and 1 . 30 ppm ( m , 2h ). to a solution of morphine hydrochloride ( 1 equivalent ) in water ( 100 volume equivalents ) is added sodium bicarbonate ( 30 equivalents ) and the resulting mixture stirred rapidly . 2 - benzylacryloyl chloride ( 5 equivalents ) is then added drop - wise manner and the reaction mixture stirred overnight . after this time the reaction mixture is extracted several times with ethyl acetate and the combined extracts washed with 5 % aqueous sodium carbonate and then with water . the organics are then dried over magnesium sulfate , filtered and concentrated under reduced pressure . the crude product obtained is then purified by column chromatography to afford morphine - 3 -( 2 - benzylacrylate ). step 2 : preparation of morphine - 3 -{ 2 - benzyl - 3 -[ 4 -( 3 - methoxyphenyl )- 4 - fluoropiperidin - 1 - yl ] propionate } to a solution of morphine - 3 -( 2 - benzylacrylate ) ( 1 . 5 equivalents ) in methanol ( 30 volume equivalents ) is added 4 -( 3 - methoxyphenyl )- 4 - fluoropiperidine hydrochloride ( 1 . 0 equivalents ) followed by sodium bicarbonate ( 10 equivalents ) and the resulting suspension stirred at room temperature for 72 hours . after this time the reaction is filtered and the filtrate concentrated under reduced pressure . the resulting crude material is purified by silica gel column chromatography to afford morphine - 3 -{ 2 - benzyl - 3 -[ 4 -( 3 - methoxyphenyl )- 4 - fluoropiperidin - 1 - yl ] propionate . compounds of the invention were assayed for affinity for the mu opioid receptor using the methodology described in zhang et al . ( j . pharmacol . exp . ther ., ( 1998 ) 286 : 136 - 141 ). compounds were assessed in human recombinant ( hek - 293 ) cells using tritium labeled diprenorphine ( 0 . 4 nm ) as the specific determinant and non - specific binding was assayed with naltrexone ( 1 μm ). cells were incubated for 120 minutes at 22 ° c . before isolation and radioactivity determination by scintillation counting . the ic 50 values ( concentration causing a half - maximal inhibition of control specific binding ) and hill coefficients ( nh ) were determined by non - linear regression analysis of the competition curves generated with mean replicate values using hill equation curve fitting ( y = d +[( a − d )/( 1 +( c / c 50 )], where y = specific binding , d = minimum specific binding , a = maximum specific binding , c = compound concentration , c 50 = ic 50 , and nh = slope factor ). the inhibition constants ( k i ) were calculated using the cheng - prusoff equation ( k i = ic 50 /( 1 +( l / k d )), where l = concentration of radioligand in the assay , and k d = affinity of the radioligand for the receptor ). each data point was obtained in duplicate and results are the mean value . | 2 |
the preparation of functional resins are illustrated by the following examples . these examples are intended only to illustrate the invention and not in any sense to limit the manner in which the invention can be practiced . the petroleum resin is characterized by gpc , ir , 1h nmr , and 13 c nmr - apt techniques . based on gpc analysis , more than 90 % of the resin has molecule weight between 100 and 800 , and the number average molecule weight is about 400 , which corresponds to a hexamer of cyclopentadiene . the local molecular structure of this oligomer can be understood by 1 h and 13 c nmr - atp techniques . in 13 c nmr spectrum , two broad bands are observed : one at 20 - 60 ppm corresponding to saturated carbons and the other at 120 - 140 ppm corresponding to unsaturated carbons . to understand both broad bands in detail , an attached proton test , apt , was applied to resolve the band into several resonance structures which distinguish carbons with different numbers of protons , such as c , ch , ch 2 , and ch 3 . the majority of the saturated carbon shows strong negative intensity between 60 and 40 ppm and is tertiary carbon -- c -- h . some positive intensity between 39 and 23 ppm is due to ch 2 chemical shift ; a small amount of ch 3 , negative intensity at 14 ppm , may be due to methyl cyclopentadiene . on the other hand , the band ( 123 - 137 ppm ) shows a negative intensity , implying unsaturated carbon of ═ c -- h which are located in cyclopentene and in norbornene . overall , the results are consistent with the molecule of multiple cyclic structure as shown before . the detailed nature of the double bonds was further explored by 1 h nmr spectrum . two distinctive chemical shifts of double bond were observed : one ( 5 . 9 - 6 . 2 ppm ), corresponding to the double bond in norbornene , and the other ( 5 . 3 - 5 . 7 ppm ) corresponding to the double bond in cyclopentene . the intensity ratio between them is about 2 . this is also in good agreement with that of the proposed average molecular structure . under an inert atmosphere , a dry three neck 500 ml flask equipped with a magnetic stirring bar was charged with 15 g of petroleum resin and 150 ml thf , which was purified by distillation over na + naph - . after resin as completely dissolved in thf , 4 g of 9 - borobicyclononane ( 9 - bbn ) was added into the reactor . the mixture was stirred at room temperature for 1 hour before injecting 10 ml of methanol to terminate the reaction . the naoh / h 2 o 2 reagents were used to oxidize borane group to hydroxyl group . an additional funnel was then connected to the flask under a strong nitrogen flow . the 5 . 6 ml ( 6n ) naoh solution was deoxygenated in additional funnel by bubbling nitrogen through the solution for five minutes before adding it into the reactor . a similar deoxygenation process was done for 11 . 4 ml , 30 % h 2 o 2 . temperature of the solution was maintained at - 10 ° c . during the dropwise addition of h 2 o 2 agent . the resulting mixture as then heated up to 50 ° c . for 1 hour to complete the oxidation reaction . after cooling down the solution to room temperature , the hydroxylated resins were then precipitated from solution by adding 200 ml water . after washing with methanol several times , the final product was dried in vacuum oven for 12 hours resulting in 15 g white powder . the overall yield in this process was almost quantitative . the molecule structure of the hydroxyl resin from example 2 ) was analyzed by ir 1 h nmr , and 13 c nmr - atp techniques . comparing ir spectra before and after modification , two new peaks at √ oh = 3300 cm - 1 and √ c -- o = 1060 cm - 1 were observed after modification . these clearly correspond to the hydroxyl group functionalization . in 1 h nmr spectrum , the chemical shifts ( 5 . 9 - 6 . 2 ppm ) for the double bond in norbornene were completely diminished , while the chemical shifts ( 5 . 3 - 5 . 7 ppm ) for the double bond in cyclopentene were relatively unaffected . moreover , the multiple cyclic structure was unchanged during modification . as shown in the 13 c nmr - apt experiment , tertiary carbon on the ring stayed the same , and secondary alcohol was shown at 71 ppm . following the procedure of example 2 , 15 g of polycyclopentadiene resin was reacted with 9 g of 9 - bbn ( 2 equivalent to resin ) in 200 ml thf solvent . the reaction was affected with constant stirring at 40 ° c . after a period of 2 hours , 10 ml of methanol was used to terminate the hydroboration . the hydroborated resin was then oxidized by naoh / h 2 o 2 solution , 12 . 6 ml of 6n naoh and 25 . 4 ml of 30 % h 2 o 2 . to ensure the complete reaction , the mixture as heated up to 50 ° c . for 1 hour . after cooling down to room temperature , the hydroxyl resin was precipitated from solution by adding 200 ml water , than washed with methanol several times . the drying process was done in a vacuum oven overnight ; 15 . 6 g white powder was obtained with overall yield - 90 %. comparing ir spectra of hydroxyl resins with 1 and 2 equivalent hydroxyl groups , a significant decrease in intensity at √ c -- h = 3040 cm - 1 and increase at √ o -- h = 3300 cm - 1 and √ c -- o = 1060 cm - 1 was observed . following the procedure of example 2 , 15 g of petroleum resin was mixed with 13 . 5 g of 9 - bbn ( 3 equivalent to resin ) and 300 ml thf solvent under a nitrogen atmosphere . the mixture was stirred at room temperature for 3 hours . the unreacted 9 - bbn was terminated by adding 10 ml of methanol . a 19 ml ( 6n ) naoh solution was injected into the reactor , followed by dropwise 38 . 3 ml , 33 % h 2 o 2 at - 10 ° c . for over half hour . the resulting mixture was then heated up to 50 ° c . for 1 hour to complete the oxidation . after cooling down to room temperature , the modified resin was then precipitated from solution by adding 300 ml water . after filtering and washing , the wet resin was then dried in vacuum oven overnight , and 15 . 2 g of white powder was obtained . the molecular structure of hydroxyl resin was identified by the ir spectrum : very strong absorption peaks , √ oh = 3300 cm - 1 and √ c -- o = 1060 cm - 1 , for hydroxyl group , and almost no vibration mode for the double bond . in an inert atmosphere , 10 g of hydroxylated resin from example 2 was dissolved into 100 ml thf solution . a 2 . 56 g of triethylamine was added before injecting 2 . 56 g of acetyl anhydride into the reaction . after sufficient mixing , 0 . 2 g of dimethylaminopyridine was added as a catalyst . the mixture was then stirred at room temperature for 6 hours to complete the reaction . the resulting resin was then precipitated by adding methanol into the solution . the precipitate was collected by filtration , washed with methanol several times , and vacuum dried overnight to yield 12 . 5 g of functional resin with ester groups . both 13 c nmr and ir experiments clearly show a complete reaction to convert the hydroxyl group to the ester group . comparing the 13 c nmr spectra of two functional resins , before and after esterification , the only changes are two new chemical shifts at 70 . 5 ppm ( c ═ o ) and 21 . 4 ppm ( ch 3 - in acetyl group ) and a complete disappearance of the chemical shift at 71 ppm for the secondary alcohol group . a similar conclusion is obtained by comparing the ir spectra . the vibration modes √ o -- h = 3300 cm 1 and √ c -- o = 1060 cm - 1 have completely disappeared , and the vibration modes √ c ═ o = 1730 cm - 1 and √ c -- o -- c = 1240 cm - 1 for ester group have very strong intensities . the thermal properties of both hydroxylated ( example 2 ) estified ( example 5 ) resins were evaluated by perkin - elmer tgs - 2 thermogrammetric analyzer . a sample size of 10 mg and a heating rate of 10 ° c ./ min in nitrogen atmosphere were used . both modified resins exhibit surprising thermal stability ; no weight loss can be detected before 300 ° c ., while the non - functionalized resin start to decompose at 150 ° c . | 2 |
preferred embodiments of the invention are wherein m is 1 or 2 ; preferred embodiments of the invention are r 2 is trifluoromethyl , or c 1 - 6 alkyl ; preferred embodiments of the invention are wherein r 3 is selected from the group consisting of halogen , c 1 - 6 - alkoxy , c 1 - 6 - sulfanyl , c 1 - 6 - alkyl , hydroxy or trifluoromethyl ; particularly preferred embodiments of the invention are wherein the compound of the invention is any of the following : 1 -[ 2 -( 2 - trifluoromethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 4 - bromophenylsulfanyl ) phenyl ] piperazine , 1 -{ 2 -[ 4 -( methylsulfanyl ) phenylsulfanyl ] phenyl } piperazine , 1 -[ 2 -( 4 - hydroxyphenylsulfanyl ] phenyl } piperazine , 1 -[ 2 -( 2 , 4 - dimethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 3 , 5 - dimethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 2 , 6 - dimethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 2 , 5 - dimethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 2 - trifluoromethylphenylsulfanyl ) phenyl ][ 1 , 4 ] diazepane , 1 -[ 2 -( 3 - methylphenylsulfanyl ) phenyl ]-[ 1 , 4 ]- diazepane , 1 -[ 2 -( 4 - butylphenoxy ) phenyl ] piperazine , 1 -[ 2 -( 4 - methoxyphenoxy ) phenyl ] piperazine , 2 -( 4 - methylphenylsulfanyl ) phenyl - 1 - piperazine , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- piperazine , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - chlorophenyl ] piperazine , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - methylphenyl ] piperazine , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - methylphenyl ] piperazine , 1 -[ 2 -( 4 - fluorophenylsulfanyl )- 5 - methylphenyl ] piperazine , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - trifluoromethylphenyl ] piperazine , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- 3 - methylpiperazine , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- 3 , 5 - dimethylpiperazine , 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ]- 3 , 6 - dihydro - 2h - pyridine , 4 -[ 2 -( 4 - methoxyphenylsulfanyl ) phenyl ]- 3 , 6 - dihydro - 2h - pyridine or 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ] piperidine the expression c 1 - 6 - alk ( en / yn ) yl means a c 1 - 6 - alkyl , c 2 - 6 - alkenyl or a c 2 - 6 - alkynyl group . the expression c 3 - 8 - cycloalk ( en ) yl means a c 3 - 8 - cycloalkyl - or cycloalkenyl group . the term c 1 - 6 alkyl refers to a branched or unbranched alkyl group having from one to six carbon atoms inclusive , including but not limited to methyl , ethyl , 1 - propyl , 2 - propyl , 1 - butyl , 2 - butyl , 2 - methyl - 2 - propyl and 2 - methyl - 1 - propyl . similarly , c 2 - 6 alkenyl and c 2 - 6 alkynyl , respectively , designate such groups having from two to six carbon atoms , including one double bond and one triple bond respectively , including but not limited to ethenyl , propenyl , butenyl , ethynyl , propynyl and butynyl . the term c 3 - 8 cycloalkyl designates a monocyclic or bicyclic carbocycle having three to eight c - atoms , including but not limited to cyclopropyl , cyclopentyl , cyclohexyl , etc . the term c 3 - 8 cycloalkenyl designates a monocyclic or bicyclic carbocycle having three to eight c - atoms and including one double bond . in the term c 3 - 8 - cycloalk ( en ) yl - c 1 - 6 - alk ( en / yn ) yl , c 3 - 8 - cycloalk ( en ) yl and c 1 - 6 - alk ( en / yn ) yl are as defined above . the terms c 1 - 6 - alk ( en / yn ) yloxy , c 1 - 6 alk ( en / yn ) ylsulfanyl , hydroxy - c 1 - 6 - alk ( en / yn ) yl , halo - c 1 - 6 - alk ( en / yn ) yl , halo - c 1 - 6 - alk ( en / yn ) yloxy , c 1 - 6 - alk ( en / yn ) ylsulfonyl etc . designate such groups in which the c 1 - 6 - alk ( en / yn ) yl are as defined above . as used herein , the term c 1 - 6 - alk ( en / yn ) yloxycarbonyl refers to groups of the formula c 1 - 6 - alk ( en / yn ) yl — o — co —, wherein c 1 - 6 - alk ( en / yn ) yl are as defined above . as used herein , the term acyl refers to formyl , c 1 - 6 - alk ( en / yn ) ylcarbonyl , arylcarbonyl , aryl - c 1 - 6 - alk ( en / yn ) ylcarbonyl , c 3 - 8 - cycloalk ( en ) ylcarbonyl or a c 3 - 8 - cycloalk ( en ) yl - c 1 - 6 - alk ( en / yn ) yl - carbonyl group . the term 3 - 7 - membered ring optionally containing one further heteroatom as used herein refers to ring systems such as 1 - morpholinyl , 1 - piperidinyl , 1 - azepinyl , 1 - piperazinyl , 1 - homopiperazinyl , 1 - imidazolyl , 1 - pyrrolyl or pyrazolyl , all of which may be further substituted with c 1 - 6 - alkyl . the heterocycles formed by two adjacent r 3 substituents and fused to the parent ring may together form rings such as 5 - membered monocyclic rings such as 3h - 1 , 2 , 3 - oxathiazole , 1 , 3 , 2 - oxathiazole , 1 , 3 , 2 - dioxazole , 3h - 1 , 2 , 3 - dithiazole , 1 , 3 , 2 - dithiazole , 1 , 2 , 3 - oxadiazole , 1 , 2 , 3 - thiadiazole , 1h - 1 , 2 , 3 - triazole , isoxazole , oxazole , isothiazole , thiazole , 1h - imidazole , 1h - pyrazole , 1h - pyrrole , furan or thiophene and 6 - membered monocyclic rings such as 1 , 2 , 3 - oxathiazine , 1 , 2 , 4 - oxathiazine , 1 , 2 , 5 - oxathiazine , 1 , 4 , 2 - oxathiazine , 1 , 4 , 3 - oxathiazine , 1 , 2 , 3 - dioxazine , 1 , 2 , 4 - dioxazine , 4h - 1 , 3 , 2 - dioxazine , 1 , 4 , 2 - dioxazine , 2h - 1 , 5 , 2 - dioxazine , 1 , 2 , 3 - dithiazine , 1 , 2 , 4 - dithiazine , 4h - 1 , 3 , 2 - dithiazine , 1 , 4 , 2 - dithiazine , 2h - 1 , 5 , 2 - dithiazine , 2h - 1 , 2 , 3 - oxadiazine , 2h - 1 , 2 , 4 - oxadiazine , 2h - 1 , 2 , 5 - oxadiazine , 2h - 1 , 2 , 6 - oxadiazine , 2h - 1 , 3 , 4 - oxadiazine , 2h - 1 , 2 , 3 - thiadiazine , 2h - 1 , 2 , 4 - thiadiazine , 2h - 1 , 2 , 5 - thiadiazine , 2h - 1 , 2 , 6 - thiadiazine , 2h - 1 , 3 , 4 - thiadiazine , 1 , 2 , 3 - triazine , 1 , 2 , 4 - triazine , 2h - 1 , 2 - oxazine , 2h - 1 , 3 - oxazine , 2h - 1 , 4 - oxazine , 2h - 1 , 2 - thiazine , 2h - 1 , 3 - thiazine , 2h - 1 , 4 - thiazine , pyrazine , pyridazine , pyrimidine , 4h - 1 , 3 - oxathiin , 1 , 4 - oxathiin , 4h - 1 , 3 - dioxin , 1 , 4 - dioxin , 4h - 1 , 3 - dithiin , 1 , 4 - dithiin , pyridine , 2h - pyran or 2h - thiin . the term aryl refers to carbocyclic , aromatic systems such as phenyl and naphtyl . the acid addition salts of the invention are preferably pharmaceutically acceptable salts of the compounds of the invention formed with non - toxic acids . exemplary of such organic salts are those with maleic , fumaric , benzoic , ascorbic , succinic , oxalic , bis - methylenesalicylic , methanesulfonic , ethanedisulfonic , acetic , propionic , tartaric , salicylic , citric , gluconic , lactic , malic , mandelic , cinnamic , citraconic , aspartic , stearic , palmitic , itaconic , glycolic , p - aminobenzoic , glutamic , benzenesulfonic and theophylline acetic acids , as well as the 8 - halotheophyllines , for example 8 - bromotheophylline . exemplary of such inorganic salts are those with hydrochloric , hydrobromic , sulfuric , sulfamic , phosphoric and nitric acids . further , the compounds of this invention may exist in unsolvated as well as in solvated forms with pharmaceutically acceptable solvents such as water , ethanol and the like . in general , the solvated forms are considered equivalent to the unsolvated forms for the purposes of this invention . some of the compounds of the present invention contain chiral centres and such compounds exist in the form of isomers ( i . e . enantiomers ). the invention includes all such isomers and any mixtures thereof including racemic mixtures . racemic forms can be resolved into the optical antipodes by known methods , for example , by separation of diastereomeric salts thereof with an optically active acid , and liberating the optically active amine compound by treatment with a base . another method for resolving racemates into the optical antipodes is based upon chromatography on an optically active matrix . racemic compounds of the present invention can also be resolved into their optical antipodes , e . g . by fractional crystallization of d - or l - ( tartrates , mandelates or camphorsulphonate ) salts . the compounds of the present invention may also be resolved by the formation of diastereomeric derivatives . additional methods for the resolution of optical isomers , known to those skilled in the art , may be used . such methods include those discussed by j . jaques , a . collet and s . wilen in “ enantiomers , racemates , and resolutions ”, john wiley and sons , new york ( 1981 ). optically active compounds can also be prepared from optically active starting materials . the pharmaceutical formulations of the invention may be prepared by conventional methods in the art . for example : tablets may be prepared by mixing the active ingredient with ordinary adjuvants and / or diluents and subsequently compressing the mixture in a conventional tabletting machine . examples of adjuvants or diluents comprise : corn starch , potato starch , talcum , magnesium stearate , gelatine , lactose , gums , and the like . any other adjuvants or additives usually used for such purposes such as colourings , flavourings , preservatives etc . may be used provided that they are compatible with the active ingredients . solutions for injections may be prepared by dissolving the active ingredient and possible additives in a part of the solvent for injection , preferably sterile water , adjusting the solution to desired volume , sterilising the solution and filling it in suitable ampules or vials . any suitable additive conventionally used in the art may be added , such as tonicity agents , preservatives , antioxidants , etc . the pharmaceutical compositions of this invention or those which are manufactured in accordance with this invention may be administered by any suitable route , for example orally in the form of tablets , capsules , powders , syrups , etc ., or parenterally in the form of solutions for injection . for preparing such compositions , methods well known in the art may be used , and any pharmaceutically acceptable carriers , diluents , excipients or other additives normally used in the art may be used . conveniently , the compounds of the invention are administered in unit dosage form containing said compounds in an amount of about 0 . 01 to 100 mg . the total daily dose is usually in the range of about 0 . 05 - 500 mg , and most preferably about 0 . 1 to 50 mg of the active compound of the invention . the compounds of the invention are prepared by the following general methods : a ) deprotection or cleavage from a polymer support of a compound with formula ii and r 1 , r 2 , r 3 , m , p , q , s , x , y and the dotted line are as described above , and r ′″ is a tert - butyl , methyl , ethyl , allyl or benzyl group or r ′″ oco 2 is a solid supported carbamate group , such as the wang resin - based carbamate linker . b ) chemical transformation of a compound with formula iii wherein r 1 , r 2 , m , p , q , y and the dotted line are as described above , to the corresponding diazonium compound , and subsequently reacting with a compound hxz , wherein x and z are as defined above . c ) reacting a compound with formula iv wherein r 2 , r 3 , x , s and q are as described above with an alkylating agent of formula ( cl —( ch 2 ) m + 1 ) nh ( ch 2 ) 2 cl or ( br —( ch 2 ) m + 1 ) nh ( ch 2 ) 2 br wherein m are as defined above . d ) reacting a compound with formula v wherein r 2 , r 3 , x , s and q are as described above and g is a bromine or iodine atom with a compound of formula vi wherein r 1 , m and p are as defined above . e ) dehydrating and optionally simultaneously deprotecting a compound of formula vii wherein r 1 , r 2 , r 3 , x , m , p , q and s are as described above and r is either a hydrogen atom or a boc group . f ) hydrogenate the double bond in a compound of formula viii wherein r 1 , r 2 , r 3 , x , m , p , q and s are as described above . the deprotection according to method a ) was performed by standard techniques , known to the persons skilled in the art and detailed in the textbook protective groups in organic synthesis t . w . greene and p . g . m . wuts , wiley interscience , ( 1991 ) isbn 0471623016 . starting materials of formula ii wherein r ′″= tert - bu were prepared according to the procedure as outlined below . fluoronitrobenzene derivatives were reacted with phenols or thiophenols according to the procedure of sawyer et al . j . org . chem . 1998 , 63 , 6338 followed by reduction using standard procedures known to the persons skilled in the art . this includes reduction to the corresponding aniline using a metal hydride salt such as sodium borohydride in conjunction with palladium on carbon catalyst in an alcoholic solvent or reduction using a metal chloride salt such as zinc chloride or tin chloride . the resulting aniline was then converted to a properly substituted 3 , 5 - diketopiperazine in a modification of the procedure of kruse et al . recl . trav . chim . pays - bas 1998 , 107 , 303 using n - butyloxycarbonyliminodiacetic acid . the 3 , 5 - diketopiperazine derivative was then reduced with for example borane to the corresponding boc protected piperazine , which was then deprotected to the piperazine in situ . the compounds shown in formula ii , wherein y ═ ch and the optional double bond is reduced , were prepared from their tertiary alcohol precursors vii wherein r is a boc group , by a modified barton reduction in a similar manner as described in hansen et al . synthesis 1999 , 1925 - 1930 . the intermediate tertiary alcohols were prepared from the corresponding properly substituted 1 - bromo - phenylsulfanylbenzenes or their corresponding ethers by metal - halogen exchange followed by addition of an appropriate electrophile of the formula ix in a similar manner as described in palmer et al . j . med . chem . 1997 , 40 , 1982 - 1989 . the properly substituted 1 - bromo - phenylsulfanylbenzenes were prepared in a similar manner as described in the literature by reaction of properly substituted thiophenols with properly substituted aryliodides according to schopfer and schlapbach tetrahedron 2001 , 57 , 3069 - 3073 bates et al ., org . lett . 2002 , 4 , 2803 - 2806 and kwong et al . org . lett . 2002 , 4 , ( in press ). the corresponding substituted 1 - bromo - phenoxybenzenes may be prepared as described by buck et al . org . lett . 2002 , 4 , 1623 - 1626 . the cleavage from a polymer support , such as from the wang resin based carbamate linker , according to method a ) was performed according to literature known procedures ( zaragoza tetrahedron lett . 1995 , 36 , 8677 - 8678 and conti et al . tetrahedron lett . 1997 , 38 , 2915 - 2918 ). the starting material of formula ii may also be prepared according to the methods described in patent application wo 01 / 49681 . the diamines were either commercially available or synthesised by methods known to chemists skilled in the art . iron - complexes , like η 6 - 1 , 2 - dichlorobenzene - η 5 - cyclopentadienyliron ( ii ) hexafluorophosphate and substituted analogues were synthesised according to literature known procedures ( pearson et al . j . org . chem . 1996 , 61 , 1297 - 1305 ) or synthesised by methods known to chemists skilled in the art . the diazotation followed by reaction with a compound hxz according to the method b ) was performed by addition of the diazonium salt of the corresponding aniline to a solution of sodium salt of a thiophenol or a phenol in an aqueous suspension of copper . the starting material of formula iii was prepared as outlined in the following . a fluoronitrobenzene derivative was reacted with a piperazine derivative in a solvent such as dmf , nmp or other dipolar aprotic solvent containing an organic base such as triethylamine to afford the orthonitophenylpiperazine derivative . the intermediate orthonitrophenylpiperazine was subsequently reduced using standard procedures as stated above to give the starting material of formula iii . the reaction of a compound of formula iv with an alkylating agent of formula ( cl —( ch 2 ) m + 1 ) nh ( ch 2 ) 2 cl or ( br —( ch 2 ) m + 1 ) nh ( ch 2 ) 2 br as its hydrobromide or hydrochloride salt , wherein m is as defined above was performed in a similar manner as described in sircar et al . j . med . chem . 1992 , 35 , 4442 - 4449 . starting materials of formula iv were prepared as described above for starting materials of formula ii . the reaction of a compound of formula v with a diamine of formula vi in method d ) was performed in a similar manner as described in nishiyama et al . tetrahedron lett . 1998 , 39 , 617 - 620 . the starting material of formula v was prepared in a similar manner as described in schopfer et al . tetrahedron 2001 , 57 , 3069 - 3073 . the dehydration reaction and optional simultaneous deprotection of a compound of formula vii in method e ) was performed in a similar manner as described in palmer et al j . med . chem . 1997 , 40 , 1982 - 1989 . the starting material of formula vii wherein r ═ h was prepared from a compound of formula vii wherein r is a boc group ( see above ) by deprotection with hydrochloric acid in methanol . compounds of formula vii wherein r = boc , may be prepared as described in palmer et al . j . med . chem . 1997 , 40 , 1982 - 1989 . the reduction of the double bond according to method f ) was generally performed by catalytic hydrogenation at low pressure (& lt ; 3 atm .) in a parr apparatus , or by using reducing agents such as diborane or hydroboric derivatives as produced in situ from nabh 4 in trifluoroacetic acid in inert solvents such as tetrahydrofuran ( thf ), dioxane , or diethyl ether . the starting material of formula viii was prepared from ii as described in method a ). analytical lc - ms data were obtained on a pe sciex api 150ex instrument equipped with ionspray source and shimadzu lc - 8a / slc - 10a lc system . column : 30 × 4 . 6 mm waters symmmetry c18 column with 3 . 5 μm particle size ; solvent system : a = water / trifluoroacetic acid ( 100 : 0 . 05 ) and b = water / acetonitrile / trifluoroacetic acid ( 5 : 95 : 0 . 03 ); method : linear gradient elution with 90 % a to 100 % b in 4 min and with a flow rate of 2 ml / min . purity was determined by integration of the uv ( 254 nm ) and elsd trace . the retention times ( rt ) are expressed in minutes . preparative lc - ms - purification was performed on the same instrument . column : 50 × 20 mm ymc ods - a with 5 μm particle size ; method : linear gradient elution with 80 % a to 100 % b in 7 min and with a flow rate of 22 . 7 ml / min . fraction collection was performed by split - flow ms detection . 1 h nmr spectra were recorded at 500 . 13 mhz on a bruker avance drx500 instrument or at 250 . 13 mhz on a bruker ac 250 instrument . deuterated methylenchloride ( 99 . 8 % d ), chloroform ( 99 . 8 % d ) or dimethyl sulfoxide ( 99 . 8 % d ) were used as solvents . tms was used as internal reference standard . chemical shift values are expressed in ppm - values . the following abbreviations are used for multiplicity of nmr signals : s = singlet , d = doublet , t = triplet , q = quartet , qui = quintet , h = heptet , dd = double doublet , dt = double triplet , dq = double quartet , tt = triplet of triplets , m = multiplet and b = broad singlet . for ion - exchange chromatography , the following material was used : scx - columns ( 1 g ) from varian mega bond elut ®, chrompack cat . no . 220776 . prior to use , the scx - columns were pre - conditioned with 10 % solution of acetic acid in methanol ( 3 ml ). for de - complexation by irradiation , a ultaviolet light source ( 300 w ) from philipps was used . as starting polymer supports for solid phase synthesis , wang - resin ( 1 . 03 mmol / g , rapp - polymere , tuebingen , germany ) was used . ferrocene ( 167 g ), anhydrous aluminium trichloride ( 238 g ) and powdered aluminium ( 24 g ) were suspended in 1 , 2 - dichlorobenzene ( 500 ml ) and heated to 90 ° c . in a nitrogen atmosphere for 5 h with intensive stirring . the mixture was cooled to room temperature and water ( 1000 ml ) was added carefully in small portions while cooling on an ice bath . heptane ( 500 ml ) and diethylether ( 500 ml ) were added , and the mixture was stirred at room temperature for 30 minutes . the mixture was extracted with diethylether ( 3 × 300 ml ). the aqueous phase was filtered , and aqueous ammonium hexafluorophosphate ( 60 g in 50 ml water ) was added in small portions under stirring . the product was allowed to precipitate at room temperature . after 3 hours the precipitate was filtered off , washed intensively with water and dried in vacuo ( 50 ° c .) to give 81 g ( 21 %) of the title compound as a light yellow powder . 1 h nmr ( d 6 - dmso ): 5 . 29 ( s , 5h ); 6 . 48 ( m , 2h ); 7 . 07 ( m , 2h ). 4 -[( 4 - nitrophenoxy ) carbonyloxymethyl ] phenoxymethyl polystyrene ( 267 g , 235 mmol ) was suspended in dry n , n - dimethylformamide ( 2 l ). n - methylmorpholine ( 238 . 0 g , 2 . 35 mol ) and piperazine ( 102 . 0 g , 1 . 17 mol ) were added and the mixture was stirred at room temperature for 16 h . the resin was filtered off and washed with n , n - dimethylformamide ( 2 × 1 l ), tetrahydrofuran ( 2 × 1 l ), water ( 1 × 500 ml ), methanol ( 2 × 1 l ), tetrahydrofuran ( 2 × 1 l ) and methanol ( 1 × 1 l ). finally , the resin was washed with dichloromethane ( 3 × 500 ml ) and dried in vacuo ( 25 ° c ., 36 h ) to yield an almost colourless resin ( 240 . 0 g ). 4 -({ 4 -[ η 6 -( 2 - chlorophenyl )- η 5 - cyclopentadienyliron ( ii )] piperazin - 1 - yl } carbonyloxymethyl ) phenoxymethyl polystyrene hexafluorophosphate ( intermediate for 1a - 1h and 1k - 1l ) 4 -[( piperazin - 1 - yl ) carbonyloxymethyl ] phenoxymethyl polystyrene ( 115 . 1 g , 92 mmol ) was suspended in dry tetrahydrofuran ( 1 . 6 l ), and η 6 - 1 , 2 - dichlorobenzene - η 5 - cyclopentadienyliron ( ii ) hexafluorophosphate ( 76 . 0 g , 184 mmol ) was added followed by potassium carbonate ( 50 . 9 g , 368 mmol ). the reaction mixture was stirred at 60 ° c . for 16 h . after cooling to room temperature , the resin was filtered off and washed with tetrahydrofuran ( 2 × 500 ml ), water ( 2 × 250 ml ), tetrahydrofuran ( 2 × 500 ml ), water ( 2 × 250 ml ), methanol ( 2 × 250 ml ), dichloromethane ( 2 × 250 ml ) and methanol ( 2 × 250 ml ). finally , the resin was washed with dichloromethane ( 3 × 500 ml ) and dried in vacuo ( 25 ° c ., 36 h ) to yield a dark orange resin ( 142 g ). 4 -({ 4 -[ η 6 -( 2 - chloro - phenyl )- η 5 - cyclopentadienyliron ( ii )]-[ 1 , 4 ]- diazepan - 1 - yl } carbonyloxymethyl ) phenoxymethyl polystyrene hexafluorophosphate ( intermediate for 1i and 1j ) a solution of buli ( 2 . 5 m in hexane , 12 . 0 ml , 30 mmol ) was slowly added to a stirred solution of 1 - bromo - 2 -( 4 - methylphenylsulfanyl ) benzene ( 30 mmol ) in dry thf ( 75 ml ) under argon at − 78 ° c . the solution was stirred for 10 min before 4 - oxo - piperidine - 1 - carboxylic acid tert - butyl ester ( 5 . 98 g , 30 mmol ) was added in one portion . the solution was allowed to warm up to room temperature and then stirred for 3 h . saturated aqueous nh 4 cl ( 150 ml ) was added and the solution was extracted with ethylacetate ( 150 ml ). the organic phase was washed with brine , dried ( mgso 4 ) and the solvent was evaporated in vacuo . crude 1 was purified by flash chromatography on silica gel ( eluent : ethylacetate / heptane 20 : 80 ) to produce the target compound as a white foam . lc / ms ( m / z ) 399 . 3 ( mh + ); rt = 3 . 82 ; purity ( uv , elsd ): 98 %, 100 %; yield : 5 . 02 g ( 42 %). 2 -( 4 - methylphenylsulfanyl ) aniline ( 2 . 9 g , 13 . 5 mmol ) was dissolved in dry thf ( 200 ml ) and placed under a nitrogen atmosphere . n -( tert - butylocycarbonyl ) iminodiacetic acid ( 4 . 7 g , 20 . 2 mmol ) and carbonyl diimidazole ( 4 . 2 g , 40 . 4 mmol ) were added to the solution and the reaction was refluxed for 60 hours . the reaction mixture was cooled to room temperature and ethyl acetate ( 500 ml ) was added . the resulting solution was then washed with 2 n nahco 3 ( 2 × 200 ml ), 2 n hcl ( 2 × 200 ml ) and saturated sodium chloride solution ( 100 ml ) and the solvents evaporated in vacuo . yield 6 . 0 g , 107 %, 1 h nmr ( cdcl 3 ) 1 . 5 ( s , 9h ); 2 . 32 ( s , 3h ); 4 . 4 - 4 . 6 ( m , 4h ); 7 . 02 - 7 . 18 ( m , 3h ); 7 . 2 - 7 . 45 ( m , 5h ). the following 3 , 5 diketopiperazine derivatives were prepared in an analogous fashion : 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2b ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - chlorophenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2c ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - methylphenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2d ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - methylphenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2e ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - fluorophenylsulfanyl )- 5 - methylphenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2f ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - trifluoromethylphenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2g ) fluoronitrobenzene ( 7 . 1 g , 50 mmol ) was dissolved in dmf ( 100 ml ) containing triethylamine ( 10 g , 100 mmol ) and placed under a nitrogen atmosphere . to the solution was added 2 - methyl - piperazine ( 5 . 5 g , 55 mmol ). the reaction was heated to 80 ° c . for 16 hours . the reaction was allowed to cool to room temperature before the solvent was reduced to half volume in vacuo . ethyl acetate ( 200 ml ) and ice - water ( 250 ml ) were added to the solution and the product was extracted with diethyether ( 2 × 200 ml ). the aqueous phase was saturated with sodium chloride and extracted with ethyl acetate ( 2 × 200 ml ). the organic phases were combined , washed with saturated brine , dried over magnesium sulfate , filtered and the filtrate was concentrated in vacuo . the product ( 10 . 5 g ) was dissolved in ethanol ( 250 ml ). palladium on charcoal catalyst ( 10 % w / w , 2 . 2 g ) was added to the solution and the solution was hydrogenated in a parr apparatus at 3 bar for 3 hours . the solution was filtered and the solvents evaporated in vacuo to give the aniline product . yield ( 8 . 0 g , 83 %) to a solution of 2 - trifluoromethylthiophenol ( 1 . 75 g , 9 . 8 mmol ) in a 1 : 1 mixture of tetrahydrofuran / dimethylformamide ( 30 ml ), sodium hydride ( 7 . 4 mmol , 60 % in mineral oil ) was carefully added at room temperature ( caution : generation of hydrogen ). the mixture was stirred for an additional 30 min after the generation of hydrogen had ceased . subsequently , 4 -({ 4 -[ η 6 -( 2 - chloro - phenyl )- η 5 - cyclopentadienyliron ( ii )] piperazin - 1 - yl } carbonyloxymethyl ) phenoxymethyl polystyrene hexafluorophosphate ( 3 . 5 g , 2 . 45 mmol ) was added and the mixture was stirred at 55 ° c . for 12 h . after cooling to room temperature , the resin was filtered off and washed with tetrahydrofuran ( 2 × 50 ml ), tetrahydrofuran / water ( 1 : 1 ) ( 2 × 50 ml ), n , n - dimethylformamide ( 2 × 50 ml ), water ( 2 × 50 ml ), methanol ( 3 × 50 ml ), tetrahydrofuran ( 3 × 50 ml ), and subsequently with methanol and tetrahydrofuran ( each 50 ml , 5 cycles ). finally , the resin was washed with dichloromethane ( 3 × 50 ml ) and dried in vacuo ( 25 ° c ., 12 h ) to yield a dark orange resin . the thus obtained resin and a 0 . 5 m solution of 1 , 10 - phenanthroline in 3 : 1 mixture of pyridine / water ( 20 ml ) was placed in light - transparent reactor tube . the suspension was agitated by rotation under irradiation with visible light for 12 h . the resin was filtered and washed with methanol ( 2 × 25 ml ), water ( 2 × 25 ml ) and tetrahydrofuran ( 3 × 25 ml ) until the washing solutions were colourless ( approx . 5 cycles ) and the irradiation procedure was repeated until decomplexation was complete ( approx . 5 cycles ). after the decomplexation was completed , the resin was washed with dichlormethane ( 3 × 25 ml ) and dried in vacuo ( 25 ° c ., 12 h ) to obtain a light brown resin . 100 mg ( 77 μmol ) of the thus obtained resin were suspended in a 1 : 1 mixture of trifluoroacetic acid and dichlormethane ( 2 ml ) and stirred at room temperature for 2 h . the resin was filtered off and washed with methanol ( 1 × 0 . 5 ml ) and dichloromethane ( 1 × 0 . 5 ml ). the filtrates were collected and the volatile solvents evaporated in vacuo . the crude product was purified by preparative lc - ms and subsequently by ion - exchange chromatography . lc / ms ( m / z ) 339 ( mh + ); rt = 2 . 39 ; purity ( uv , elsd ): 92 %, 100 %; overall yield : 1 mg ( 4 %). 1b , 1 -[ 2 -( 4 - bromophenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 350 ( mh + ); rt = 2 . 46 ; purity ( uv , elsd ): 75 %, 92 %; yield : 2 mg ( 7 %). 1c , 1 -{ 2 -[ 4 -( methylsulfanyl ) phenylsulfanyl ] phenyl } piperazine : lc / ms ( m / z ) 317 ( mh + ); rt = 2 . 39 ; purity ( uv , elsd ): 91 %, 100 %; yield : 2 mg ( 8 %). 1d , 1 -[ 2 -( 4 - hydroxyphenylsulfanyl ] phenyl } piperazine : lc / ms ( m / z ) 287 ( mh + ); rt = 1 . 83 ; purity ( uv , elsd ): 84 %, 100 %; yield : 3 mg ( 13 %). 1e , 1 -[ 2 -( 2 , 4 - dimethylphenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 48 ; purity ( uv , elsd ): 95 %, 100 %; yield : 4 mg ( 17 %). 1f , 1 -[ 2 -( 3 , 5 - dimethylphenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 51 ; purity ( uv , elsd ): 96 %, 100 %; yield : 5 mg ( 21 %). 1g , 1 -[ 2 -( 2 , 6 - dimethylphenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 42 ; purity ( uv , elsd ): 97 %, 100 %; yield : 4 mg ( 17 %). 1h , 1 -[ 2 -( 2 , 5 - dimethylphenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 46 ; purity ( uv , elsd ): 97 %, 100 %; yield : 1 mg ( 4 %). 1i , 1 -[ 2 -( 2 - trifluoromethylphenylsulfanyl ) phenyl ]-[ 1 , 4 ]- diazepane : lc / ms ( m / z ) 353 ( mh + ); rt = 2 . 46 ; purity ( uv , elsd ): 70 %, 96 %; yield : 1 mg ( 4 %). 1j , 1 -[ 2 -( 3 - methylphenylsulfanyl ) phenyl ]-[ 1 , 4 ]- diazepane : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 44 ; purity ( uv , elsd ): 76 %, 93 %; yield : 1 mg ( 4 %). 1k , 1 -[ 2 -( 4 - butylphenoxy ) phenyl ] piperazine : lc / ms ( m / z ) 311 ( mh + ); rt = 2 . 77 ; purity ( uv , elsd ): 91 %, 100 %; yield : 4 mg ( 17 %). 1l , 1 -[ 2 -( 4 - methoxyphenoxy ) phenyl ] piperazine : lc / ms ( m / z ) 285 ( mh + ); rt = 2 . 08 ; purity ( uv , elsd ): 93 %, 100 %; yield : 4 mg ( 18 %) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ]- 3 , 5 - dioxo - piperazine ( 5 . 5 g , 13 mmol ) was dissolved in dry thf ( 50 ml ) and placed under a nitrogen atmosphere . borane tetrahydrofuran complex ( 50 mmol , 1 . 0 m ) in tetrahydrofuran was added and the reaction was refluxed for ten minutes . excess borane was quenched by the addition of an excess of ethyl acetate and the reaction was refluxed for a further 20 minutes . the reaction was allowed to cool to room temperature before hydrogen chloride dissolved in methanol ( 50 ml , 4 m ) was added and the reaction was refluxed for 4 . 5 hours . the reaction was allowed to cool to room temperature and the reaction was concentrated in vacuo . the compound was crystallised from the gum residue by the addition of ether / methanol solution . the crystalline solid was filtered and washed with ether / methanol ( 1 : 1 ) to give a white crystalline solid . yield ( 2 . 0 g , 47 %) 1 h nmr ( d 6 - dmso ) 2 . 35 ( s , 3h ); 3 . 18 ( br s , 8h ); 6 . 68 ( d , 2h ); 7 . 02 ( m , 1h ); 7 . 18 ( m , 1h ); 7 . 3 - 7 . 5 ( m , 4h ); ms ( mh + ) 285 . 2b , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ] piperazine lc - ms ( m / z ) 305 . 1 ( mh + ) rt = 2 . 46 purity ( uv , elsd ) 71 %, 91 % yield 0 . 096 g , 100 % 2c , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - chlorophenyl ] piperazine lc - ms ( m / z ) ( mh + ) 335 . 2 rt = 2 . 38 purity ( uv , elsd ) 98 %, 100 % yield 0 . 22 g , 62 % 2d , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - methylphenyl ] piperazine lc - ms ( m / z ) ( mh + ) 315 . 1 rt = 2 . 33 purity ( uv , elsd ) 97 %, 100 % yield 0 . 21 g , 56 % 2e , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - methylphenyl ] piperazine lc - ms ( m / z ) ( mh + ) 315 . 2 rt = 2 . 38 ( uv , elsd ) 98 %, 100 % yield 2 . 3 g , 58 % 2f , 1 -[ 2 -( 4 - fluorophenylsulfanyl )- 5 - methylphenyl ] piperazine lc - ms ( m / z ) ( mh + ) 303 . 2 rt = 2 . 46 ( uv ) 98 % yield 2 . 1 g , 62 % 2g , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - trifluoromethylphenyl ] piperazine lc - ms ( m / z ) ( mh + ) 369 rt = 2 . 50 ( uv , elsd ) 96 %, 100 % yield 0 . 54 g , 31 % 2 -( 3 - methylpiperazin - 1 - yl ) phenylamine ( 0 . 96 g , 5 mmol ) was dissolved in 30 ml water containing sulfuric acid ( 0 . 28 ml , 5 . 2 mmol ) and the solution was cooled to 0 ° c . and sodium nitrite ( 0 . 36 g , 5 . 2 mmol ) was added . the reaction was stirred for 30 minutes before the ph of the reaction was adjusted to ph 7 with sodium acetate . the diazonium salt solution was then added dropwise to a solution of 4 - chlorothiophenol in a suspension of copper ( 0 . 3 g , 5 mmol ) in 2 m naoh ( 4 ml ). after addition , the reaction mixture was heated to 60 ° c . for 30 minutes before being allowed to cool to room temperature and ethyl acetate ( 10 ml ) was added . the reaction mixture was filtered and the layers were separated . the aqueous layer was extracted with ethyl acetate ( 2 × 10 ml ). the combined organic phases were dried ( mgso 4 ) and volatile solvents evaporated in vacuo . the crude product was purified by flash chromatography using silica gel , eluting with ethyl acetate / methanol / ammonia 96 : 3 : 1 . the pure product was isolated as a colourless oil . yield ( 0 . 18 g , 11 %) 1 h nmr ( cdcl 3 , 500 mhz ) 1 . 12 ( d , 3h ); 2 . 6 - 2 . 72 ( br m , 2h ); 3 . 0 - 3 . 15 ( m , 5h ); 6 . 9 ( m , 2h ); 7 . 08 ( d , 1h ); 7 . 15 ( m , 1h ); 7 . 25 - 7 . 35 ( m , 4h ); ms ( mh + ) 319 . 1 . 3b , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- 3 , 5 - dimethylpiperazine lc - ms ( m / z ) ( mh + )+ 333 . 1 rt = 2 . 29 ( uv , elsd ) 83 %, 100 % yield 0 . 54 g , 31 %. concentrated aq hydrochloric acid ( 10 ml ) was added to a stirred solution of 1 - tert - butoxycarbonyl - 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ] piperidin - 4 - ol ( 0 . 84 g , 2 . 1 mmol ) in acetic acid ( 30 ml ). the solution was boiled under reflux overnight , cooled to room temperature and then stirred in an ice bath . an aqueous solution of naoh ( 9 . 1 m , 40 ml ) was slowly added and the unclear solution was extracted with ethyl acetate ( 2 × 40 ml ). the combined organic phases were dried ( mgso 4 ) and the solvents evaporated in vacuo . the crude material ( 0 . 48 g ) was dissolved in ethyl acetate ( 3 . 2 ml ) at 50 ° c . and a solution of oxalic acid ( 0 . 11 g ) in etoh ( 3 . 2 ml ) was slowly added . the target compound was collected as a white oxalic salt . 1 h ( dmso - d 6 ) δ 7 . 3 - 7 . 2 ( m , 7h ); 7 . 15 ( m , 1h ); 7 . 00 ( m , 1h ); 5 . 6 ( d , 1h ); 3 . 7 ( d , 2h ); 3 . 25 ( t , 2h ); 2 . 6 ( m , 2h ); 2 . 3 ( s , 3h ). lc / ms ( m / z ) 282 . 2 ( mh + ); rt = 2 . 24 ; purity ( uv , elsd ): 99 %, 100 %; yield : 0 . 31 g ( 40 %). 4b , 4 -[ 2 -( 4 - methoxyphenylsulfanyl ) phenyl ]- 3 , 6 - dihydro - 2h - pyridine lc / ms ( m / z ) 298 ( mh + ); rt = 2 . 00 ; purity ( uv , elsd ): 97 %, 100 %; yield : 0 . 28 g ( 30 %). methyl chloro - oxo - acetate ( 1 . 37 g , 11 . 25 mmol ) was added to a stirred solution of 1 - tert - butoxycarbonyl - 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ] piperidin - 4 - ol ( 3 . 00 g , 7 . 5 mmol ) and 4 -( dimethylamino ) pyridine ( 1 . 65 g , 13 . 5 mmol ) in a mixture of dry ch 3 cn ( 24 ml ) and chcl 3 ( 12 ml ) at 0 ° c . under argon . the reaction mixture was allowed to reach room temperature and then stirred 2 h . ethyl acetate ( 140 ml ) was added and some salts were removed by filtration through celite . the organic phase was washed with sat . nahco 3 ( 140 ml ), brine ( 140 ml ) and dried ( mgso 4 ). the solvents were evaporated in vacuo and the crude material was dried in vacuo . this material was dissolved in dry toluene ( 48 ml ) under argon . bu 3 snh ( 3 . 27 g , 11 . 25 mmol ) and aibn ( 0 . 31 g , 1 . 88 mmol ) were added . the solution was stirred under argon at 90 ° c . for 2 . 5 h . the solvent was evaporated in vacuo , and the crude material was purified by flash chromatography on silica gel ( eluent : a stepwise gradient of ethylacetate in heptane from 10 : 90 to 20 : 80 ) to produce 4 -( 2 -( 4 - methylphenylsulfanyl ) phenyl )- piperidine - 1 - carboxylic acid tert - butyl ester as a clear oil ( 1 . 94 g , 67 %). this oil was dissolved in meoh ( 9 . 2 ml ) and hcl in diethylether ( 2 . 0 m ) was added at 0 ° c . the reaction mixture was allowed to warm to room temperature and stirred overnight . the target compound was collected as its hydrochloride . m . p 229 - 231 ° c . calculated for c 18 h 21 ns . hcl : c , 67 . 58 ; h , 6 . 63 ; n , 4 . 38 . found : c , 67 . 33 ; h , 6 . 97 ; n , 4 . 31 . lc / ms ( m / z ) 284 ( mh + ); rt = 2 . 12 ; purity ( uv , elsd ): 96 %, 100 %; yield : 0 . 26 g ( 46 %). [ heading - 0182 ] inhibition of the uptake of [ 3 h ] serotonin into whole rat brain synaptosomes the compounds were tested with respect to their 5 - ht reuptake inhibiting effect by measuring their ability to inhibit the uptake of [ 3 h ] serotonin into whole rat brain synaptosomes in vitro . the assay was performed as described by hyttel psychopharmacology 1978 , 60 , 13 . the compounds were tested with respect to their efficacy on 5 - ht 2c receptor - expressing cho cells ( euroscreen ) as determined by fluorometric imaging plate reader ( flipr ) analysis . this assay was carried out according to molecular devices inc . instructions for their flipr calcium assay kit and as modified from porter et al . british journal of pharmacology 1999 , 128 , 13 . preferred compounds of the present invention exhibit serotonin reuptake inhibition below 200 nm ( ic 50 ) in the assay above . more preferred are the compounds which exhibit inhibition below 100 nm and most preferably below 50 nm . compounds of particular interest exhibit serotonin reuptake inhibition below 10 nm ; | 2 |
the preferred embodiments are directed to the analysis of a patterned or bare surface of a semiconductor wafer , but it must be understood that this is done for purposes of illustration only , and that the invention can be applied to the analysis of any surface . the scattering that results from the illuminated pattern on the wafer is different in nature from the one that results from a small particle . the signal from the pattern is due to diffraction from edges and corners of the pattern lines . if the pattern is repetitive ( like in memory cells ), then the scattered intensity is the result of interference between all the diffraction sources within the spot . the interference intensity pattern that is received and detected by a large aperture fiber bundle is not sensitive to small fluctuations in the illuminating wavelength . the intensity pattern as a function of wavelength is given by ( one dimension approximation ): i = ca 2 [ sin ( qa ) qa ] 2 [ sin ( nqa ) sin ( qd ) ] 2 q = 2 π sin θ λ where c is a constant , 2 a is the width of a single line , d is the separation between the lines , n is the number of lines which the spot covers in one direction , λ is the illumination wavelength and θ is the elevation angle measured from the zero order reflected beam direction . simulation made to study the behavior of the above equation shows that by integrating the intensity in the range θ = 2 - 10 ° ( as the fiber bundle does ) and using n = 5 - 10 , one gets no more than a 2 % difference in intensity by changing the illumination wavelength from 630 nm to 670 nm . on the other hand , the scattered intensity resulted from a very small particle ( d & lt ;& lt ; λ where d is the particle radius ), lying on the same area of the wafer and illuminated by the same laser beam , is given by : i s ∝ d 6 λ 4 where i s is the scattering intensity in some direction in space . by differentiating the intensity with respect to the wavelength , one finds that a change in 1 % in the wavelength brings to a change of 4 % in the intensity . that means that we can expect to get a 20 % difference in scattered intensity from the particle on the wafer by changing the illumination wavelength from 630 nm to 670 nm . fig1 schematically illustrates the formation of the illuminating laser beam footprints or spots in a first embodiment of the invention , in which said two laser beams , having different wavelengths λ 1 and λ 2 , generate overlapping footprints or spots on the surface to be checked for the presence of small particles . in fig1 numeral 10 designates the spot generated by the light source with wavelength λ 1 . numeral 11 designates the light spot generated by the laser beam of wavelength λ 2 . 12 indicates pattern lines of the wafer under examination . for purposes of illustration , the two light spots are shown as not completely overlapping , but in practice they could and desirably should be completely overlapping . number 13 designates a small particle , the dimensions of which are considerably smaller than the wavelength of the two laser beams . apart from the differences in wavelengths , all the parameters of two illuminating lasers are identical . in this example , the λ 1 is 630 nm and λ 2 is 670 nm . fig2 a shows how the two laser beams are generated according to an embodiment of the invention and are concentrated on the wafer surface under examination . 15 indicates a diode laser generating a beam of 630 nm and 16 designates a diode beam generating a beam of 670 nm . the two beams are directed onto the dichroic beam splitter 17 , which directs them to focusing lens 18 . the beam splitter could be substituted by other beam deviating means and the lens could be substituted by other focusing means , e . g . more complex optical components . lens 18 concentrates the two beams on the surface of wafer 19 , to produce the two overlapping spots illustrated in fig1 . fig2 b shows how the two laser beams are generated according to another embodiment of the invention . numeral 20 indicates a laser diode . the beam 21 generated by it , having a first desired wavelength , is directed onto a dichroic beam splitter 22 , which produces a beam directed to mirror 23 . said mirror directed reflects said beam to a non - linear crystal 24 , from which emerges a beam 25 having the second desired wavelength . beam 25 is reflected by mirror 26 to another dichroic beam splitter 27 , by which it is united to the beam that has passed through beam splitter 22 and has the first wavelength , to form a composite beam 28 . beam 28 is focused onto the wafer as shown in fig2 a . the scattered light is analyzed as schematically illustrated in fig3 . numeral 124 designates , once again , the wafer . at any given moment , a specific pixel of the wafer scatters the light , as indicated by arrow 125 , and scattered light is collected by optical fiber bundle 126 , which is divided into two branches , 127 and 128 . 129 and 130 are two edge type filters , the first of which passes the light of the wavelength λ 1 and does not pass the light having wavelength λ 2 , while the other one passes wavelength λ 2 and not wavelength λ 1 . the scattered light of wavelength λ 1 is then detected by a detector 131 , while the light of wavelength λ 2 is detected by a detector 32 . detectors 131 and 132 produce analog electrical signals , which are then sampled , and the samples are conveyed to comparing means , which may be hardware or software means . the pattern lines 12 of the wafer will produce a difference in intensity of the signals outputted by detectors 131 and 132 , even if there is no small particle such as particle 13 . scatter signals that result from the illuminated pattern of a wafer are different from those which result from a small particle . the scatter signal of the pattern is due to diffraction from edges and corners of the pattern lines . if the pattern is repetitive ( as in memory cells ), the scattered intensities result from interference between all the diffraction sources within the footprint or spot of the laser beams on the wafer . the interference intensity pattern that is received and detected by a large aperture fiber bundle is not sensitive to small fluctuations in the illuminating wavelength . for instance , a change in the illumination wavelength of 630 nm to 670 nm will cause no more than a 2 % difference in intensity of the scatter signal . on the other hand , the scatter signal intensity due to a very small particle , lying on the same area of the wafer and illuminated by the same laser beam , is much more sensitive to the laser wavelength . for example , a change of 1 % in the wavelength will bring a change of 4 % in the intensity of the scatter signal . therefore , by using two different wavelengths of 630 nm and 670 nm , as in this example , a difference in the intensity of the light scattered from the particle on the wafer will be found to exceed 20 %. subtracting the output of detector 31 from detector 32 and enhancing the difference by amplifier electronics , one obtains a combined signal that will practically cancel the background noise due to the pattern and will magnify the effective signal - to - noise relation from the particle in the illuminated area . fig4 illustrates another embodiment of the invention , in which two laser beams of wavelengths λ 1 and λ 2 are so directed onto the wafer surface as to produce two adjacent , non - overlapping footprints or spots indicated by 40 and 41 . 42 represents pattern lines in a periodic area of the wafer , for instance , a memory area . numeral 43 indicates a small particle . since the footprints or spots are not superimposed , one could not state in general that the same signal would be expected from the two beams , even if there were no particle on the surface . however , if the surface is smooth or is patterned in uniform manner , such as in memory areas , or if anyway the illuminating spot or footprints of each wavelength is so large as to cover a few tens of pattern lines , it would be expected that the two scatter signals resulting from each of the beams be practically constant , unless one of the beams contains a particle . therefore , this embodiment differs from the previous one only in the way of focusing the beams on the surface under examination . the analysis of the scatter signals is the same as in the previous case . although this invention is directed to the detection of small particles , a variant thereof permits to detect particles of any size on bare or uniformly patterned surfaces . this can be achieved by the embodiment of fig4 . if the scanned area is uniform and neither of the two beam spots impinges on a particle , the difference between the two signals received from the two beams should be zero and remains about zero even after amplification . however , if one of the two beams impinges on a particle , the difference signal will be significant and will become very large after amplification . this means that the ratio of signal to noise is almost ideal and one can detect even small changes in signal over zero noise . the opposite would occur if a single wavelength scanning spot were used , in which case small changes in signal would have to be detected over greater noise . the difference between the two methods is very considerable : the use of the two wavelength difference signal as the main signal to be amplified and analyzed , results in the reduction or cancellation of the noise from the inspected surface . fig5 schematically illustrate the relationship between the wafer and the optical components in an apparatus according to an embodiment of the invention . wafer 30 is supported by support disk 31 and rotated by shaft 32 about an axis passing through the center of the wafer . the wafer is shifted parallel to itself , as indicated by arrows 33 , by means not shown as they may be conventional . numeral 34 symbolically indicates the illuminating apparatus of fig2 which , in this embodiment , direct the two laser beams on the wafer surface at an angle α . two laser generators comprised in apparatus 34 , and not shown , emit beams of two slightly different wavelengths , which are collected by fiber bundle 36 and processed by collecting device 35 , illustrated in fig3 as set at an angle β to the wafer surface , to generate two superimposed or adjacent beams , as desired . a plurality of fiber bundles , such as 36 , distributed about the wafer in any desired number of directions , could be used , and each one of them would produce two scatter signals , that could be processed as described hereinbefore . the light collected by optical fiber bundle 36 ( or each such bundle , if a plurality are used ) is separated into two beams of the two wavelengths , which are transmitted to two photodetectors , all as illustrated in fig3 . the output of every photodetector is sampled by a sampler and the output of the samplers is transmitted to hardware and / or software comparing means , not shown . while embodiments of the invention have been described by way of illustration , it will be apparent that many modifications , variations and adaptations may be made therein by persons skilled in the art , without departing from the spirit of the invention or exceeding the scope of the claims . | 6 |
referring now to the drawings and , first , particularly to fig1 thereof , there is show therein a greatly simplified illustration of a gripper actuatable by a rotary drive on a pre - gripper . a rotary drive 5 is mounted on a pre - gripper lever 1 , which is accommodated so as to be pivotabe about a frame point 6 configured as a pivot pin . this rotary drive 5 , which may be in the form , for example , of an electric motor , a piezoelectric actuator or a magnetostrictive actuator , acts upon a gripper shaft 3 ( note fig2 for example ), which is concealed by the drive 5 and on which sheet grippers 2 are accommodated in a distribution extending over the width of the pre - gripper . via one or more rotary drives , the gripper shaft 3 , whereon the individual sheet grippers 2 are accommodated , can drive each individual gripper or groups of grippers simultaneously . in the configuration according to fig1 the rotary drive 5 is accommodated on a moving component 1 , i . e ., the pre - gripper lever . [ 0049 ] fig2 shows a sheet gripper located on a pre - gripper and actuatable via a linear drive . the pre - gripper lever 1 , which is represented diagrammatically in fig2 is shown greatly reduced in scale relative to the sheet gripper 2 , which is pivotable about the gripper shaft 3 . an abutment of a linear drive 4 is accommodated at an articulation point 26 on the pre - gripper lever 1 , an extendable actuating rod of the linear drive 4 being accommodated at an articulation point 25 of the sheet grippers 2 , which are movable about the gripper shaft 3 . the linear drive 4 may be a cylinder that is subjectible to the action of a pressure medium , for example , a pneumatic or a hydraulic cylinder . in the exemplary embodiment according to fig2 the drive 4 on the pre - gripper lever 1 is configured as a cylinder . [ 0051 ] fig3 and 4 show drives for pre - gripper systems with frame - mounted drives . the configuration according to fig3 shows a rotary drive 5 which may be fastened to a side wall of a printing unit . the output of the rotary drive 5 acts upon a gearwheel 9 , which , with the interposition of an intermediate wheel 27 , accommodated on a stub shaft 28 on the pre - gripper lever 1 , actuates the gripper shaft 3 . the sheet grippers 2 are accommodated , once again , on the gripper shaft 3 ; in the configuration according to fig3 a gripper gap 29 , i . e ., a spacing is defined between the underside of the sheet grippers 2 and the top side of the gripper support formed by the pre - gripper lever 1 . during the closing movement of the sheet gripper 2 , i . e ., the movement of the sheet gripper 2 relative to the support formed by the pre - gripper lever 1 , a sheet introduced into the gripper gap 29 is gripped at the leading edge thereof and accelerated to machine speed . [ 0053 ] fig4 shows a pre - gripper lever 1 whereon the sheet gripper 2 is accommodated so as to be pivotable about a gripper shaft 3 . in this exemplary embodiment , the linear drive 4 , in the form of an actuating cylinder , which is subjectible to the action of a pressure medium ( hydraulically or pneumatically ), is mounted frame - fixedly on the side wall of a printing unit of a rotary printing machine . the pre - gripper lever 1 is mounted so as to be rotatable about the pivot pin 6 thereof , while the linear drive 4 is accommodated at a different mounting point on the side wall . the actuating rod , which is extensible from the linear drive is accommodated at the point of articulation 25 on the sheet gripper 2 and causes the latter to move about the gripper shaft 3 . the movement of the respective sheet gripper 2 can take place either individually for each sheet gripper or for groups of individual sheet grippers 2 on the pre - gripper lever 1 . [ 0054 ] fig5 shows a mounting support for the gripper drive , which coincides with the pivoting point of the pre - gripper lever . in this configuration , the linear drive 4 is mounted simultaneously at the pivot point 6 of the pre - gripper lever 1 , the extensible actuating rod of the linear drive 4 being connected at the point of articulation 25 to the sheet gripper 2 , which can be pivoted about the gripper shaft 3 . it is possible for the linear drive 4 , which is formed , for example , as a pneumatically or hydraulically activatable actuating cylinder , to be accommodated so as to be pivotable about the pivot pin 6 , directly on the moving pre - gripper system ; it is also possible for the abutment 7 of the linear drive 4 to be arranged just as easily in stationary side frames , allbeit coinciding with the pivot point of the pre - gripper lever about the pivot pin 6 thereof . this possible configuration offers the advantage that , upon activation of the linear drive 4 , there is no need to take into account the movements resulting from the pivoting movements of the pre - gripper lever 1 and the movement of the sheet gripper 2 superposed thereon ; furthermore , the masses which are to be moved are considerably smaller because , at least a main subassembly can be mounted rotatably in the side wall of a printing unit . a further advantage , which can be achieved by the embodiment according to fig5 is that the supply lines for energy and information , i . e . the activating lines , may be of quite simple and straightforward configuration . if only a single drive has been discussed heretofore herein , it is possible for undesired torsion of the gripper shaft 3 to be kept to a low level , or for the overall size of the drive 4 or 5 , which is dependent upon the power requirement , to be reduced , by providing a plurality of drives connected in parallel . it is thus possible to provide , for example , instead of one large drive 4 or 5 , respectively , at one end of the gripper shaft 3 , two considerably smaller drives 4 and 5 at the two ends of the gripper shaft 3 . furthermore , it is also conceivable for the gripper shaft 3 to be driven from the middle thereof . in this construction based upon the inventive concept , the linear drive 4 , in the form of an actuating cylinder executing an extension movement , is articulated rotatably on the pre - gripper lever 1 , the extensible actuating rod of the linear drive 4 being articulated , for example , in the joint of a toggle lever 10 . the toggle lever 10 is mounted at the point of articulation 26 on the pre - gripper lever 1 and is also fixed at the point of articulation 25 to the sheet gripper 2 , which is pivotable about the gripper shaft 3 . the pre - gripper lever 1 , for its part , can be moved cyclically reciprocatingly about the pivot pin 6 , which is accommodated in the machine frame . via the toggle lever 10 on the pre - gripper system , which is used in fig6 it is possible for the power of the linear drive 4 to be boosted to a considerable extent in an advantageous and straightforward manner . [ 0059 ] fig7 shows in greater detail a pre - gripper system driven via a cam mechanism or transmission . also , in the case of this embodiment of the invention , the pre - gripper lever 1 is movable about a frame - mounted pivot pin 6 . here , too , the sheet gripper 2 is movable about a gripper shaft 3 ; furthermore , play exists between the sheet gripper 2 , which is movable about the gripper shaft 3 relative to the pre - gripper lever 1 , and the gripper support formed by the pre - gripper lever 1 , i . e ., in other words , the gripper gap 29 . in this embodiment of the invention , the control or the actuation , i . e ., the operations of opening and closing the sheet gripper 2 about the gripper shaft 3 relative to the gripper support , may be produced by providing that a cam plate 11 be driven by a rotary drive 5 , which produces a rotary movement . depending upon the configuration of the outer contour of the cam plate 11 , the cam roller 12 establishes the path of movement of the opening and closing movements , respectively , and the points in time , respectively , at which the sheet gripper 2 opens and closes . via the cam control provided in this embodiment for the pre - gripper system , it is possible for the force flux and moment distribution to be predetermined extremely accurately . [ 0061 ] fig8 shows a rotary drive 5 which can be accommodated , for example , coaxially with the gripper shaft 3 , and subjects the sheet gripper 2 to a rotary movement relative to the pre - gripper lever 1 . in order to boost the closing and opening force of the sheet gripper 2 in relation to the support surface , and thus in relation to the geometry of the gripper gap 29 and the closing forces which can be produced there , the sheet gripper 2 is braceable by an energy storage device 13 . the energy storage device 13 , whether a tension spring or a compression spring , may be fastened to the pre - gripper lever 1 at the articulation point 26 , while the other end of the energy storage device 13 is secured at the articulation point 25 of the sheet gripper 2 . this additional energy storage makes it possible to produce , on the one hand , a desired prestressing in a desired central position and , on the other hand , automatic movement of the gripper in a given rest position in the event of a power failure . instead of providing the compression spring 13 , which is indicated only diagrammatically here , as the energy storage device , it is also possible to provide other energy storage devices . fig9 shows in greater detail a pre - gripper gripper control with a drive arrangement , which utilizes advantageous movements of the components relative to one another . the linear drive 4 that is used is accommodated at a rotational point 7 in the stationary machine frame of a printing unit of a rotary printing machine . as has already been explained hereinabove , the linear drive 4 may be configured as a pneumatic cylinder or as an hydraulic cylinder , and a configuration as a piezoelectric actuator or magnetostrictive actuator of the linear drive 4 is also conceivable . according to the configuration from fig9 the piston rod , which serves as the displaceable element of the linear drive 4 , is articulated at the articulation point 8 on the sheet gripper 2 . the latter can be moved about the gripper shaft 3 in the same manner as has been explained hereinabove , and it is also true for this exemplary embodiment , that individual activation of a sheet gripper is possible , as is also groupwise activation of a plurality of sheet grippers 2 over the width of the pre - gripper lever 1 . it is also the case here that the gripper gap 29 is produced between the underside of the sheet gripper 2 and the support surface on the pre - gripper lever 1 . in the exemplary embodiment according to fig9 the line of action 23 of the linear drive 4 runs parallel to the movement direction 24 of the coupling link - mounted articulation point 8 of the linear drive 4 . in the closed state of the sheet gripper 2 , the articulation point 8 may be located at least approximately on the connecting line between the center of the gripper shaft 3 and the rotational point 6 of the pre - gripper ; furthermore , an alternative possibility is that , in the closed state of the sheet gripper 2 , the articulation point 8 is located between the gripper shaft 3 and the rotational point 6 of the pre - gripper lever 1 . the articulation point 7 of the linear drive 4 may advantageously be accommodated in the stationary machine frame , i . e ., a side wall of the printing unit . with such an arrangement of the articulation points 7 and 8 , the linear drive 4 , during the closing movement of the sheet gripper 2 , assists the immediately following pivoting movement of the pre - gripper lever 1 about the pivot pin thereof . this advantageously achieves a situation wherein the drives assist one another . during the opening of the sheet gripper or grippers 2 , the pivoting movement of the pre - gripper lever 1 about the pivot pin 6 thereof may be utilized in order to accelerate the opening operation to a great extent , because the movements of the linear drive 4 and of the pre - gripper lever 1 are advantageously superposed , with the result that favorable movements of the components relative to one another may be utilized . it is also advantageous , in this arrangement , that the masses , which are to be moved on the pre - gripper lever 1 , are relatively small because it is essentially only the push rod of the linear drive 4 , which moves along with the movement of the pre - gripper lever 1 . further advantageous are the low forces of inertia which act on the linear drive 4 itself , because the latter only executes a relatively small , and thus slow , pivoting movement and , in addition , because an actuator subassembly , i . e . the linear drive 4 , may be mounted rotatably in the stationary machine frame . consequently , the transverse accelerating forces , which are to be borne by the components are also relatively low , which has , amongst others , a positive effect upon the service life of the sliding joints . [ 0067 ] fig1 shows in greater detail a possible actuation device of the sheet grippers accommodated on a pre - gripper system , wherein a toggle - lever system is coupled to a linear drive . the pre - gripper lever 1 , once again pivotable about the pivot pin 6 thereof , which is accommodated on both sides in the machine frame , comprises a gripper shaft 3 which , analogously to the aforedescribed embodiments , extends at least approximately parallel to the pre - gripper and whereon a plurality of sheet grippers 2 are accommodated in a pivotable manner . the actuating movements , i . e ., the opening and the closing movements , respectively , of the sheet gripper 2 , are provided by a frame - mounted linear drive 4 , which acts upon the toggle joint of the toggle lever 10 . the levers of the toggle lever 10 are mounted , on the one hand , at the articulation point 26 on the pre - gripper lever 1 and , on the other hand , at the articulation point 25 on the sheet gripper 2 . this configuration ensures that the closing forces are considerably increased and maintained during the pivoting movement of the pre - gripper lever 1 about the pivot pin 6 thereof . the exemplary embodiment according to fig1 provides for the linear drive 4 to be mounted in a stationary manner and for an actuating lever 37 to be provided with a joint 38 . by this measure , virtually no transverse forces act upon the linear drive . in a favorable embodiment , the actuating lever 37 is guided between the linear drive 4 and the joint 38 . [ 0070 ] fig1 shows the entire sheet - feeder region of a sheet - processing machine , whether a multi - color rotary machine for offset printing or a digital sheet - printing machine , in greater detail . a sheet 20 which is to be printed abuts a front guide 15 on the feeding table 14 by the leading edge 21 of the sheet 20 , aligned by a side or pull guide 34 . the pre - gripper lever 1 is illustrated in the starting position thereof . the initially open sheet grippers 2 close and grip the leading edge 21 of the sheet - like material 20 ; the front guides 15 swing away downwardly ; thereafter , the pre - gripper lever 1 pivots in accordance with the double - headed arrow 30 about the frame - mounted pivot pin 6 thereof . in this case , the sheet - like material 20 is accelerated to the printing - machine speed . just before the transfer center line 22 has been reached , grippers 17 of a feed cylinder 16 grip the leading sheet edge 21 , and the sheet grippers 2 of the pre - gripper lever 1 open a short time later . the sheet - like material 20 is then guided by a lateral surface 33 of the feed cylinder 16 and , a little later , transferred to grippers 19 of an impression cylinder 18 . after the transfer of the sheet - like material 20 , the pre - gripper lever 1 swings the sheet - like material 20 onto the lateral surface 33 of the feed cylinder 16 and , after reversing the movement direction 30 thereof , pivots back into the starting position thereof again . in order to avoid collisions of the sheet grippers 2 with the feed cylinder 16 and the sheet - like material 20 , the sheet grippers 2 move away downwardly during the returning pivoting operation , i . e . they close partially before they open again fully in order to accommodate the next sheet - like material 20 . if the sheet grippers 2 , then , with the linear drives 4 and the rotary drives 5 , respectively , are isolated mechanically from the main drive , then , in combination with a freely programmable control and regulatable drives , a flexible movement control of the sheet grippers 2 is possible , with the result that adaptation of the gripper movement to different types of operation , printing - material properties , for example , the printing - material thickness , and to different printing speeds is possible without high - cost conversion operations . | 1 |
referring now to fig1 a device designated generally by the numeral 11 , is a replacement for a twin triode vacuum tube . in distinction over single envelopes or cylinders of other known solid - state devices for replacing vacuum tubes , the device 11 has a lower cylinder 12 and an upper cylinder 13 for housing various circuit components . a plurality of pins 16 extend from a base surface 17 of the lower cylinder 12 . in the preferred embodiment , nine pins 16 are arranged in a pattern corresponding to the pattern of pins on the respective twin triode vacuum tube to facilitate a one - for - one replacement of the tube . assembling the circuit components of the device 11 in the two distinct cylinders 12 and 13 offers advantages in the manufacture of the device 11 . the lower cylinder 12 is used to house already packaged components . unpackaged components , such as semiconductor chips , are mounted and electrically connected in a conventional manner in the upper cylinder 13 . it should be realized , however , that packaging all components of the device 11 within a single cylinder is nevertheless within the scope of the present invention . in the device 11 , electrical connections between the lower cylinder 12 and the upper cylinder 13 are established by connector pins similar to the connector pins 16 and by corresponding standard tube pin sockets ( not shown ). other provisions for joining the upper cylinder 13 to the lower cylinder 12 , such as by permanent solder connections , are also contemplated as being within the scope of this invention . referring now to fig2 there is shown a schematic diagram of circuits and of the components housed in the cylinders 12 and 13 . in general , two distinct amplifier circuits 21 and 22 are shown . these circuits 21 and 22 correspond , respectively , to a first and a second triode amplifier of a twin triode tube ( not shown ). in each of the circuits 21 and 22 , field - effect transistors are similarly used as basic amplifier elements by interconnecting in a conventional manner a high - voltage transistor and a low - voltage transistor in what is commonly referred to as a cascoding arrangement . in the amplifier circuit 21 , a high voltage field - effect transistor 26 is connected in cascode with a low - voltage , high - gain field - effect transistor 27 . as shown in fig2 a source terminal 28 of the high - voltage transistor 26 is coupled to a drain terminal 29 of the low - voltage transistor 27 , and a gate terminal 31 of the high - voltage transistor 26 is coupled to a source terminal 32 of the low - voltage transistor 27 . in this connection , the high - voltage transistor 26 shields the low - voltage transistor 27 from excessive drain voltages , while other significant characteristics such as the gain characteristics of the low - voltage transistor 27 become the characteristics of the combination of the two transistors . a gate terminal 33 of the transistor 27 becomes the signal input terminal for the combination of the transistors 26 and 27 . in the circuit 21 , the anode of a diode 36 is coupled toward the source terminal 28 of the transistor 26 and the cathode of the diode 36 is coupled to the corresponding pin 16 . the diode 36 , as a discrete device , is housed in the lower cylinder 12 of the device 11 . diodes are known to have been coupled into source leads of prior art solid - state vacuum tube replacements to prevent reverse source voltages from damaging respective solid state components and other related components . the diode 36 , however , is used in the circuit 21 to change pentode - like cutoff characteristics of the junction field - effect transistor to a more sudden drain current cutoff characteristic similar to that obtained with triodes . as current through the diode 36 decreases , its rapidly increasing impedance biases the circuit 21 into a pinch - off condition . it has been found that without the use of the diode 36 in the source lead of the circuit 21 , regulation requirements of an exemplary circuit of the type shown in fig3 were not met . similarly to the transistors 26 and 27 in the circuit 21 , two cascoded transistors form , in combination , an amplifier element of the circuit 22 . a source terminal 42 of a high voltage field - effect transistor 41 is coupled to a drain terminal 43 of a low voltage field - effect transistor 44 . a gate terminal 46 of the low voltage transistor 44 is the signal input terminal of the cascoded circuit 22 . a gate terminal 48 of the transistor 41 is consequently coupled directly to a source terminal 49 of the transistor 44 to complete the cascoded circuit . referring to fig2 a drain lead 51 of the transistor 26 and a drain lead 52 of the transistor 41 are coupled to fuses 53 and 54 respectively . the fuses 53 and 54 protect circuit components external to the device 11 from damage which might result from unchecked excessive drain current through the circuits 21 or 22 . referring now to fig2 and 3 , the amplifier circuit 21 corresponds to a first amplifier stage 56 which is coupled through a capacitor 57 to a second amplifier stage 58 . the amplifier circuit 22 corresponds to the second amplifier stage 58 . output signals from the first stage 56 , which appear on the drain lead 51 are coupled through the capacitor 57 and through a gate terminal lead 59 to the gate terminal 46 of the transistor 44 of the second stage 58 . the second stage 58 further amplifies the signals . the amplified signals from the second stage 58 are coupled to an inductive load , in particular to a primary coil 61 of a coupling transformer 62 . a secondary coil 63 of the transformer 62 is part of a demodulator circuit 66 . the exemplary circuit of fig3 receives signals of a specific carrier frequency from a channel band filter 67 . the carrier frequency typically lies in a range between 168 and 264 kilohertz . at these frequencies , device capacitances of the field - effect transistors 41 and 44 tend to shunt signal currents from the capacitor 57 , thus affecting the voltages of the applied signals . a resistor 68 , coupled into the lead 59 , is selected to isolate the signals from such effective device capacitances which would shunt the signals to ground through the source terminal 49 of the transistor 44 . an acceptable value of the resistor 68 has been selected by considering , in the exemplary case , the lowest frequency as the most significant frequency . the frequency of 168 kilohertz corresponds to a period of 6 × 10 - 6 seconds . a value for the resistor 68 has been chosen as one factor in the product with an effective device capacitance of 30 × 10 - 12 farads to yield a resistor - capacitance time constant of 6 × 10 - 6 seconds . dividing 6 × 10 - 6 by 30 × 10 - 12 results in a resistor value of 200 , 000 ohms . while the resistor 68 with such a value lowers the voltage gain of the circuit 22 , a loss in the gain is acceptable because of initially higher gain characteristics of the pentode - like field - effect transistor circuit 22 with respect to the voltage gain characteristics of the replaced triode vacuum tube . the inductance of the primary coil 61 in the output circuit of the second stage 58 causes a phase shift in the output signals with respect to the input signals . even small device capacitances in the circuit 22 tend to feed back the output signals to the gate terminal 46 of the transistor 44 . such feedback signals are vectorially added to the input signals applied through the capacitor 57 to result in distorted signals . to reduce signal distortion it is , therefore , desirable to eliminate undesirable feedback paths . a feedback path has been eliminated by grounding a metal mounting base or header 69 ( see fig1 ) to which the transistors 26 , 27 , 41 and 44 are mounted in a conventional manner . grounding is effected by an appropriate case connection 71 to one of the pins 16 which corresponds to a ground pin in the replaced vacuum tube . the connection 71 shunts to ground all stray capacitances caused by mounting the transistors to the header 69 to minimize drain - to - gate capacitances in the circuit 22 . even with such precautions as grounding stray capacitances , signal distortion is nevertheless not eliminated . the signal distortion is apparently caused by input signals to the gate terminal 46 which forward bias the gate junction of the transistor 44 . it is known that an increased transconductance and a resulting increased gain also increases gain - dependent device capacitances which are also referred to as miller - effect capacitances . and , as the gate terminal 46 becomes forward biased , the gain of the circuit 22 increases substantially . it is theorized that upon the gate terminal 46 becoming more forward biased by positive swinging input signals , a resulting increase in the feedback of the phase - shifted output signals from the circuit 22 accounts for distortion of the input signals . subsequent demodulation of the distorted output signals by the demodulator circuit 66 causes an erroneous d . c . bias voltage to be fed back through a lead 76 and resistor 77 , 78 and 68 . such erroneous bias voltages , in turn , prevent proper regulation of the signal level . it has been discovered that such undesirable distortion of the input signals applied to the gate terminal 46 and the resulting erroneous bias feedback can be minimized or avoided to restore signal regulation similar to that obtained by the corresponding triode vacuum tube circuit . accordingly , a semiconductor &# 34 ; p - n &# 34 ; junction device or diode 81 is coupled across the resistor 68 . a cathode 82 , the cathode being the &# 34 ; n &# 34 ; or negative type domain of the junction device of the diode 81 , is coupled to the terminal of the resistor 68 which connects to the gate terminal 46 . an anode 83 , the anode being the &# 34 ; p &# 34 ; or positive type domain of the junction device of the diode 81 , is coupled to the other side of the resistor 68 . it is believed that , as the signal voltage applied through the resistor 68 to the gate terminal 46 forward biases the gate terminal 46 , and initial space charge current flow alters the voltage field applied through the gate terminal 46 to cause a change in the drain current of the circuit 22 . the space charge current through the gate terminal 46 , however , is complemented by a space charge current flow through the diode 81 . as a result , the voltage applied to the gate terminal 46 corresponds substantially to the desired signal voltage applied through the resistor 48 . the resulting field at the gate terminal 46 properly controls the drain current and the output voltage swing of the circuit 22 . the storing and release of charge in the diode 81 during the forward biasing of the diode 81 and the gate terminal 46 corrects the signal distortion that would otherwise be caused by a drain current of the forward biased transistor 44 which affects the signal input voltage . the capacity of the diode 81 to store a charge temporarily is significant to the extent that it is desirable to match the stored charge to that of the transistor 44 . it has been found that a capacity of the diode 81 for storing 450 - 600 picocoulombs is desirable for the described embodiment . it should be understood that in lieu of the diode 81 , a p - n junction of a transistor having an adequate storage charge characteristic can be used . the described shunting of the resistor 68 with the diode 81 substantially eliminates undesirable distortion of the output signal amplitude . as a result , the output circuit of the device 11 generates regulated signals which substantially match those of the replaced vacuum tube . an initially higher transconductance of the circuit 22 is offset by the added input impedance of the resistor 68 and the diode 81 . the net result is that the device 11 functions substantially as the twin triode vacuum tube with a self - biased transconductance of 3500 to 5500 micromhos . referring to fig3 the output signals from the second stage 58 are coupled through the transformer 62 to the demodulator circuit 66 . the circuit 66 is a full wave rectifier including four diodes 86 . a load resistor 87 is coupled across the output from the circuit 66 . a positive terminal of the rectifier circuit is clamped to an 18 volt reference or zener diode 88 which , in turn , is referenced to ground . a dropping resistor 89 isolates the 18 volt reference potential from a high voltage plate or drain bias supply (+ b ). a negative terminal of the demodulator 66 is coupled through the lead 76 to provide the dc bias voltage to the input terminals of both amplifier stages 56 and 58 . the supplied bias voltage is applied to the stage 56 through a current limiting resistor 91 , and to the second stage 58 through the resistor 77 which functions as a voltage divider with a resistor 92 . an inductor 93 functions as part of the signal coupling circuit in conjunction with the capacitor 57 . capacitors 96 , 97 and 98 block d . c . bias components from ground or signal ground terminals . it should be realized that the circuitry described with respect to fig3 is a simplified schematic of a telephone regulator circuit known by its bell system designation as an n - 1 channel regulator . as a result of its operation voice frequency signals of regulated levels are separated from the demodulated carrier signals in the demodulator circuit 66 and are applied through a voice frequency filter 99 to a telephone user line ( not shown ). referring again to fig2 it is seen that input gate impedances such as the disclosed resistor 68 and the diode 81 can be usefully applied in amplifier circuits other than second stages of a twin triode vacuum tube replacement circuit . the disclosed combination of the resistor 68 and the diode 81 becomes of value to circuits wherein input signals cause an input gate of a field - effect transistor to become forward biased , and wherein an inductance in an output loop of such circuit would result in a phase - shifted output signal . certain aspects of the present invention consequently find useful application in amplifier circuits in general . the scope of the present invention is also not restricted to n - channel field - effect transistor circuits . while an illustrative example of the present invention is given specifically with respect to a vacuum tube replacement circuit for which n - channel field - effect transistors are ideally suited , signal distortions caused by feedback through device capacitances can occur in circuits employing p - channel type field - effect transistors as well . consequently a resistor with a shunting diode can be employed in a gate lead of a p - channel transistor circuit to minimize such distortions . in the p - channel transistor circuit , however , because of the negative type conductivity of the gate region of the transistor , the anode of the diode would face the gate terminal , rather than the cathode 82 , as it is disclosed for the n - channel transistor circuit 22 shown in fig2 . it should , therefore , be kept in mind that various changes and modification in the novel aspects of the device 11 and in their application to other solid state devices are possible without departing from the scope and spirit of the invention . the invention is intended to be limited only by the scope of the appended claims . | 7 |
as shown in fig1 strand advancing means 10 advances core yarn 12 and effect yarn 14 at substantially constant velocities to texturizing jet 18 to produce texturized yarn 16 . strand advancing means 10 and texturizing jet 18 can be of the type well - known in the art . for the production of a texturized yarn of glass filaments , it is preferred that the strand advancing means 10 be of the type described in u . s . pat . nos . 3 , 488 , 670 and 3 , 411 , 287 and texturizing jet 18 be of the type described in u . s . pat . nos . 3 , 402 , 446 and 3 , 381 , 346 which are hereby incorporated herein . control unit 20 , located intermediate the feed roll ( not shown ) of strand advancing means 10 and texturizing jet 18 , serves to intermittently accumulate and release a portion of the overfeed of yarn 14 being advanced to texturizing jet 18 to provide a texturized yarn 16 having regions of increased texturization therealong . as is well - known in the art , the core and effect yarns are fed to the texturizing jet at velocities greater than the velocity of the resulting texturized yarn exiting the texturizing jet . strand 14 can be advanced to the control unit , or first zone , 20 at a substantially constant first velocity . as shown in fig2 control unit 20 can be energized to delay or retard a portion of the overfeed of strand 14 and accumulate the slack of the strand formed thereby within the control unit 20 . first member , or body , 22 having a passageway 24 therethrough abuts second member 40 having a passageway 42 at least partially therethrough . threaded boss 44 having restricted orifice , or venturi member , 46 rigidly located therein , serves to align and rigidly fasten member 22 to member 40 by means of a mating threaded portion located in member 22 . when member 22 is suitably engaged with member 40 , passageway 24 extends through venturi 46 in communication with passageway 42 . passageway 42 is transversely disposed with respect to passageway 24 . as shown in fig2 passageway 42 is substantially perpendicular to passageway 24 , and passageway 42 serves to contain the slack material of strand 14 therein when control unit 20 is energized . strand entrance 50 can be located coaxially with first passageway 24 to provide an unobstructed , substantially straight path for yarn 14 to follow during the times when control unit 20 is not energized . strand entrance 50 can be located on the opposite side of member 40 with respect to venturi 46 . guide eye 48 , which is fixed within member 40 at strand entrance 50 can be made of a suitable material , such as micarta , to reduce the abrasive affects of running contact between the strand and the second member 40 . strand entrance 50 and venturi 46 is located at one end of passageway 42 and cap 52 is located at the opposite end of passageway 42 . cap 52 is fastened to member 40 by any suitable means such as screws 53 and 54 . member 40 and cap 52 are fabricated to form a passageway 64 in communication with passageway 42 . passageway 64 forms a conical clearance between cap 52 and member 40 and is angled , or disposed , to direct a stream of fluid , such as air , away from the passageway 24 through exhaust port 66 in cap 52 . the fluid can be supplied to passageway 64 via supply port 68 in communication therewith and located in cap 52 . the supply of pressurized fluid , or air , is not shown . elongated needle 26 is rigidly held in place in passageway 24 by means of cap section 28 and suitable fasteners such as screws 29 and 30 extending therethrough into member 22 . passageway 27 of needle 26 is coaxially aligned with venturi 46 to provide a passageway through which yarn 14 can travel . the tip of elongated needle 26 extends partially into the conical section venturi 46 , and the axes of the venturi 46 and passageway 27 are parallel but can be offset or canted with respect to each other if desired . supply port 60 located in member 22 is in communication with passageway 24 by means of passageway 62 formed by the clearance between needle 26 and member 22 . when a pressurized fluid , such as air , is delivered to supply port 60 from a suitable source ( not shown ), member 22 and needle 26 cooperate to direct a stream of air along the length of the strand 14 in contact with the strand in a first direction opposite to the direction of advancement of the strand . the stream of air is sufficient to cause the strand to cave the control unit , or first zone , at a second velocity less than the velocity of the yarn entering the control unit , or first velocity . the degree to which the fluid retards the advancement of the strand depends upon , among other things , the velocity at which the fluid impinges the strand . the strand entrance orifice 50 can be of such a size that a substantial portion of the stream of fluid flowing through passageway 24 can be caused to flow through passageway 42 . with the strand 14 being fed into control unit 20 at a substantially constant first velocity and the strand 14 leaving the control unit at a second velocity less than the first velocity due to the action of the fluid stream upon the strand , a relatively loose segment of strand , or slack , can form within passageway 42 . with the stream of fluid and the strand 14 moving therein , the strand can assume a loop type formation within passageway 42 due to the influence of the moving fluid stream upon the slack strand . that is , the slack formed when the control unit 20 is energized is contained and controlled within said unit and is not left free to foul the surrounding machinery and other yarns . depending upon various factors such as line speed , running tension , and the amount of strand overfeed , an additional force may be necessary to adequately control the slack created in the strand . to accomplish this , a second stream of fluid , such as air , can be fed through passageway 64 . the orientation and location of passageway 64 with respect to passageways 24 and 42 will tend to establish fluid flow from passageway 24 through passageway 42 towards exhaust port 66 . such a fluid flow will have a tendency to urge strand 14 to assume the looped position within passageway 42 when control unit 20 is activated , that is , when pressurized air is supplied to ports 60 and 68 . in producing a texturized yarn having slubbed regions of increased texturization , the effect yarn 14 is advanced to the control unit , or first zone , 20 at a substantially constant first velocity . the control unit 20 is intermittently energized , or supplied with pressurized air , to direct a first stream of fluid along the strand in a first direction through passageway 24 opposite to the direction of advancement of the strand and sufficient in quantity to cause the strand to leave the control unit , or first zone , at a second velocity . to maintain an overfeed situation , the second velocity must be greater than the withdrawal velocity of the yarn from the texturizing jet 18 , and the withdrawal velocity must be less than the first velocity . then , at a region intermediate the strand advancing means 10 and member 22 , the stream of fluid is directed in a second direction transverse to the first direction to control the strand accumulating within the housing defining the first zone . under the influence of the texturizing jet and the feed rolls ( not shown ) of strand advancing means 10 which withdraw the strand from texturizing jet 18 , the accumulated strand , or slack , strand 14 will be available to provide a momentary increase in the rate of overfeed when the control unit 20 is de - energized . it is preferred that the action of the control unit 20 upon strand 14 not produce any substantial texturizing affect . by intermittently supplying the pressurized fluid to the control unit , the strand leaving the control unit is capable of having an exit velocity that varies between the second velocity and a third velocity which is greater than the first velocity . that is , the amount of overfeed yarn 14 can vary between a second amount of overfeed which is less than the first amount of overfeed entering control unit 20 , and a third amount of overfeed which is greater than the first amount of overfeed entering the control unit 20 . fig3 depicts an alternative embodiment of the present invention including a means for intermittently supplying the working fluid for energizing control unit 80 . as shown , strand 81 passes through first passageway 84 extending through housing 82 . second passageway 86 is in communication with first passageway 84 and extends at least partially through housing 82 . second passageway 86 is disposed transversely with respect to first passageway 84 . third passageway 88 is in communication with passageway 84 , and is spaced from passageway 86 . third passageway 88 is obliquely oriented with respect to passageway 84 to direct a first stream of fluid through passageway 84 towards second passageway 86 , thereby directing the first stream of fluid along the length of the advancing strand 81 but in a direction opposite to the direction of advancement strand 81 . fourth passageway 89 is in communication with a second passageway 86 and is spaced from the first passageway 84 . passageway 89 is obliquely oriented with respect to passageway 86 to direct a second stream of fluid through passageway 86 but away from passageway 84 . conduit 90 is connected to passageways 88 and 89 , and solenoid operated valve 96 . valves 92 and 94 control the flow rate of the working fluid delivered to passageways 88 and 89 respectively . solenoid valve 96 is connected to a suitable source of pressurized fluid , such as air , ( not shown ). solenoid valve 96 can be electrically interconnected to a suitable power source via leads l1 and l2 . bump switch 98 which is interconnected with lead l2 serves to intermittently energize solenoid valve 96 to intermittently supply the working fluid to control unit 80 . bump switch 98 can be activated by a conventional bump wheel ( not shown ) known in the art . during operation , passages 88 and 84 cooperate to provide a stream of fluid opposed to the advancement of strand 81 to retard the advancement thereof , and to create a slack segment therein . passageways 89 and 86 cooperate to provide a second stream of fluid to urge the first stream of fluid and strand 81 contained therein into passageway 86 to control and contain the slack portion of strand 81 during the periods that the working fluid is supplied to the control unit . as shown in fig4 strand 101 moves through first passageway 104 of housing 102 of control unit 100 . passageway 104 can extend completely through housing 102 . second passageway 106 is in communication with first passageway 104 , and second passageway 106 is disposed transversely with respect to first passageway 104 . as shown in fig4 passageway 106 is substantially perpendicular to passageway 104 . third passageway 108 in housing 102 is in communication with first passageway 104 and is disposed obliquely thereto to direct a stream of working fluid through passageway 104 towards passageway 106 to retard the advancement of strand 101 and create a slack segment therein . fourth passageway 110 is in communication with passageway 106 and is spaced from 104 . conduit 116 cooperating with valve 118 is connected to passageway 108 and solenoid operated valve 122 . solenoid operated valve 122 can be connected to a suitable source of pressurized air ( not shown ). conduit 112 cooperating with valve 114 is connected to chamber 110 and solenoid operated valve 120 . solenoid operated valve 120 can be connected to a suitable source of vacuum ( not shown ). leads l1 and l2 can be electrically interconnected with bump switch 124 and solenoid operated valves 120 and 122 to intermittently provide a stream of air to passageway 104 to intermittently retard the advancement of strand 101 and to form a slack segment therein . simultaneously , passageway 110 is evacuated through conduit 112 and valve 120 to urge the air flowing through passageway 104 through passageway 106 thereby drawing the slack segment of strand 101 into passageway 106 to control and contain the strand therein . during the periods that the solenoid valves are de - energized , the accumulated strand in passageway 106 is capable of being withdrawn from the control unit and then fed into a suitable texturizing jet . as shown in fig5 strand 141 passes through first passageway 144 of housing 142 . second passageway 146 extends completely through housing 142 and is disposed transversely to passageway 144 and is in communication therewith . third passageway 148 located in housing 142 is in communication with passageway 144 and is oriented obliquely with respect to passageway 144 to direct a stream of air to passageway 144 towards passageway 146 , the stream of air having sufficient force to retard the advancement of strand 141 and form a slack segment therein . conduit 150 is connected with the third passageway 148 , and valve 152 cooperating with conduit 150 serves to control the flow of air to passageway 148 . conduit 150 is also connected to valve 153 which is connected to nozzle 151 . nozzle 151 is disposed to provide a second stream of air through passageway 146 sufficient to urge the strand 141 into passageway 146 during the periods when control unit 140 is energized . thus , the accumulated slack of strand 141 is controlled and contained within housing 142 at passageway 146 . similar to fig3 conduit 150 is connected to solenoid operated valve 155 which can be suitably connected to a source of pressurized air ( not shown ). solenoid operated valve 155 is connected with a suitable source of power through leads l1 and l2 and bump switch 157 which can be activated by a bump wheel ( not shown ). it is apparent that , within the scope of the invention , modifications and different arrangements can be made other than as here and disclosed . the present disclosure is merely illustrative with the invention comprehending all the variations thereof . | 3 |
turning now to the drawings , fig1 is a perspective view of a first embodiment 10 of a game chassis in accordance with the present invention , and fig2 is a rear perspective view thereof . the game broadly comprises a hollow , generally wedge - shaped body 12 having a top surface 14 which slopes forward and downward as a result of the wedge - shape . in addition , body 12 is formed with a pair of rear legs 16 , 16 which raise the rear of body 12 further above a supporting surface than the front , causing surface 14 to have an increased slope . surface 14 has a plurality of generally circular openings 14 a , in the preferred embodiment , 18 openings . at the rear of body 12 , there is provided an upright goal structure 18 which has the appearance of a football goal with uprights 18 a , 18 a . along either side and its front edge , surface 14 includes a plurality of upstanding walls 14 b . these walls are constructed to permit a template plate 40 to be placed on top of surface 14 and to be retained in position by the upright walls 14 b . in the preferred embodiment , a plurality of such template plates 40 - 1 through 40 - n are provided and include a subset of the holes 14 a provided on surface 14 , thereby masking the excluded holes . as a result , different template plates may be placed upon surface 14 so as to modify the number and configuration of openings 14 a which are exposed . as explained further below , this permits the game to be modified so as to permit different games to be placed . those skilled in the art will appreciate that walls 14 b could be replaced by small upright projections or any other form of fixation may be used for the plates 40 - 1 through 40 - n , such as small hook - and - pile fasteners of the type known in the trade under the trademark “ velcro ”. the embodiment illustrated in fig1 and 2 is intended to be a football game . accordingly , surface 14 is preferably provided with indicia related to football activities , as illustrated in fig3 , which is a plan view of surface 14 with all indicia on it . it should be noted that each opening is associated with the result of running a play in football . for example , the upper right hand opening corresponds to “ 30 yard up and out ” and the opening immediately below corresponds to “ 20 yard slant .” similarly , the upper left hand opening corresponds to “ 35 yard deep out ” and the opening immediately below corresponds to “ 25 yard fly .” in between these four openings , there are three openings which correspond to negative results , such as a “ 15 yard roughing penalty ,” a “ 10 yard sack ,” and an “ interception .” the central opening has the highest value (“ 50 yard bomb ”) and is surrounded by openings corresponding to negative results . similarly , the lower right hand opening is a “ 10 yard counter ”, and the opening immediately above is a “ 15 yard sweep .” the lower left hand opening is a “ 10 yard pitch ” and the opening immediately above is a “ 15 yard draw .” the lower middle opening is a “ 5 yard drive ,” but the openings immediately above it all correspond to negative results . the close proximity of negative results to positive ones introduces an element of risk and excitement . those skilled in the art will appreciate that the indicia indicated in fig3 may be provided directly on surface 14 , or they may be placed upon one of the template plates 40 - 1 through 40 - n . it is also to be anticipated herein that other and different configurations can be used for the indicia related to the openings , but preferably maintaining the positive and negative results in close correspondence to each other . the disclosed embodiment of game chassis 10 is preferably about 10 inches long , 6 inches wide and 4 inches high at the highest point , with a goal post assembly 18 extending upward an additional 4 . 5 inches . the goal post opening is preferably 2¼ inches square and each of the openings 14 a is preferably about one inch in diameter . at the front , surface 14 is preferably about an inch above the surface on which the chassis stands . a game of this size can conveniently be used on a tabletop with the players standing 4 - 5 feet away . each player is provided with a number of game playing pieces , which may be a coin , a token , a puff , a beanbag , or the like . the game also includes a scoreboard element 30 as shown in fig1 . in this embodiment , the scoreboard is related to football scoring . accordingly , there is provided a down marker 32 with a slide 34 which is moved to indicate the down for the team in possession of the ball . as it may be seen , there are four predetermined positions for slide 34 corresponding to first , second , third , and fourth down . above the down marker 32 there is provided a field position marker 36 which has a slide 38 , which moves vertically , to indicate the position of the ball on the field . at the side of the position marker , there is also provided a slide 42 which marks the first down position , that is , the position on the field that must be reached by a player in order to achieve a first down . above the position marker , there is a quarter marker 44 having a horizontal slide 46 with four marked positions indicating the first , second , third , and fourth quarters . above the quarter marker , there is an erasable score area 48 having columns for the home team and visitor . the score is maintained in real time , and four separate lines 50 are provided for respective quarters . at the bottom of the area 48 , is provided a “ total ” line 52 into which a final score is written . the preferred embodiment also includes a pen 54 , which is inserted is a channel in element 30 . play begins with a coin toss , the winner of which can decide whether he wishes to be the home team or the visitor . the visitor team will receive first . then , the home team takes his position at the toss line and the field position marker 36 is set at his 20 yard line , and the first down slide is positioned at the 30 yard line . thereafter , the home team will toss one of the game pieces at the game chassis 10 in an effort to have it drop into one of the holes in the surface 14 . the field position marker is then adjusted in relationship to the hole into which the playing piece falls . for example , if a playing piece falls into the lowest center hole , the field position marker is advanced by 5 yards . the down marker is similarly advanced by one . if the playing piece does not drop into any of the holes , only the down marker is advanced . a player is given four opportunities to reach or pass the position of the first down slide 34 , with the down marker being incremented after each attempt . if a player achieves a first down , the down slide 34 is reset to its original position , giving the player an additional four downs . if the player fails to achieve a first down , “ possession ” of the ball changes and the other player steps to the toss line . at that point , both the field position slide 38 and the first down slide 40 are moved in the opposite direction . scoring occurs when the field position slide 38 reaches one of its extreme ends . if a player reaches the extreme end of slide 38 at his own ( starting ) end of the field ( i . e ., 0 yards ) a “ safety ” ( and possession ) is awarded to the other player and two points are added to his score . if a player reaches the extreme of the slide 38 opposite his starting and ( i . e ., 100 yards ), he scores a touchdown and six points are added to his score . after a player scores a touchdown , he is given the opportunity to “ kick ” for an extra point , or if he has reached or passed the 30 - yard line on the opposite side of the field , he may attempt to “ kick ” a field goal . in order to attempt the “ kick ” a player steps to the kick line which is , preferably , one foot closer to the game chassis 10 and attempts to toss a game piece between the two uprights 18 comprising the goal 18 . the player who is successful in a kick after a touchdown is awarded one point and a player who is successful in a field goal attempt is awarded three points . the players toss position for a field goal is determined by the position of the field position slide 38 . for every 10 yards closer than the 30 - yard line , the player may step forward six inches . if he chooses , a player may try for a 2 - point conversion instead of a kick after a touchdown . if he wishes to try for a 2 - point conversion , he must state so after scoring a touchdown and must then toss a playing piece from the normal toss position . he will score two points if the playing piece falls into any opening on surface 14 with a positive yardage value . after a player scores , the other player will assume possession and begin play from his own 20 - yard line . the one exception is that after scoring a safety , a player retains possession and begins play from his own 20 - yard line . preferably , a quarter will end after each player has had two possessions . however , the players may agree that a game will be timed . for example , the players may agree that a game will take twenty minutes and that each quarter will last five minutes . the third quarter will begin with the visitor having possession . one overtime period will be available if , at the end of the fourth quarter , the teams are tied . a coin toss determines which team goes first , and the first team to score in overtime wins . it is contemplated that the present embodiment would permit different games to be played by simply overlaying a template 20 - 1 through 20 - n on surface of 14 of game chassis 10 , in order to change games . for example , fig4 illustrates an overlay template 40 - 1 , which permits a game of basketball to be played . in this case , template 40 - 1 exposes only eight of the openings 14 a in surface 14 . in this case , the indicia at the openings correspond to basketball events . this game is preferably played by two players , but it may be played by one player for practice . the players will toss a coin to determine which one goes first . that player positions himself at the tossing line and begins play by tossing a game piece at the game chassis 10 . if the game piece goes into one of the openings corresponding to a point score , he is awarded that many points , and gets another opportunity to toss a game piece . if a player fails to score points on a game piece toss , the other player steps up to the tossing line and begins tossing game pieces . the first player to reach a score of 21 the wins . alternatively , the players could toss alternately . another variation of the game would be that the first player attempts a shot of his choice . if he misses the shot , the second player has the opportunity to attempt a shot of his choice . if a player makes a shot of his choice , the other player must immediately make the same shot or the successful player wins a point . the first player to score an agreed number of points , for example five , is the winner . fig5 illustrates an overlay template 40 - 2 which emulates playing a game of soccer . in this case , template 40 - 2 exposes only five of the openings 14 a in surface 14 , and the indicia at the openings correspond to soccer events . preferably , the game is played by two players , but one player may play for practice . the players will toss a coin to determine which one goes first . that player positions himself at the tossing line and begins play by tossing a game piece at the game chassis 10 . the only way he can score is if the game piece falls into the middle opening in the lower row . the player can continue to toss game pieces as long as the game piece falls into the goal opening , and he is awarded one point for each goal . as soon as he misses the goal , it is the other player &# 39 ; s turn . the first player to score 10 goals is the winner . fig6 illustrates an overlay template 40 - 3 which emulates playing a game of golf . in this case , template 40 - 3 exposes only nine of the openings 14 a in surface 14 . in this case , the indicia at the openings correspond to golf events . preferably , the game is played by two players , but one player may play for practice . the players will toss a coin to determine which one goes first . that player positions himself at the tossing line and begins play by tossing a game piece at the game chassis 10 . in his first turn , he must drop the game piece into whole 1 . he must keep tossing at hole 1 until the game piece goes in . his score for that hole will be the number of tosses necessary for a game piece to go in . next , the other player attempts to toss a game piece into hole 1 , and his score for that hole will be the number of attempts necessary . the nine holes are played in order , with each player getting a score for each hole , and the winner of the game is the one with the lowest total score . fig7 illustrates an overlay template 40 - 4 which emulates auto racing . in this case , template 40 - 4 exposes only twelve of the openings 14 a in surface 14 , and the indicia at the openings correspond to auto racing events . preferably , the game is played by two players , but one player may play for practice . the players will toss a coin to determine which one goes first . that player positions himself at the tossing line and begins play by tossing a game piece at the game chassis 10 . thereafter , the other player will toss , and the players will take turns tossing . depending upon the opening into which the game piece falls , the players will gain or lose laps . any player whose game piece drops into the center opening is awarded an additional toss . no player &# 39 ; s accumulated laps can ever be less than zero . the first player to reach 10 laps is the winner . fig8 illustrates an overlay template 40 - 5 which provides a general toss game . in this case , template 40 - 5 exposes only eight of the openings 14 a in surface 14 , and the indicia at the openings correspond to points , there being two openings at the top valued at 20 points each , two openings at the bottom valued at 10 points each , and four central openings and a diamond pattern valued at five points each . preferably , the game is played by two players , but one player may play for practice . the players will toss a coin to determine which one goes first . that player positions himself at the tossing line and begins play by tossing a game piece at the game chassis 10 . thereafter , the players take turns tossing . if a game piece drops into an opening , the tossing player is awarded that number of points . the first player to reach an agreed score , say 100 points , is the winner . game chassis 10 is preferably made of cardboard or corrugated cardboard , but it may be made of any firm sheet material that can be folded . fig9 is a plan view of a preferred blank form 50 for manufacturing game chassis 10 . the form 50 broadly comprises a generally rectangular central panel 52 , left and right wing panels 54 l and 54 r , left and right leg panels 56 l and 56 r , a lower panel 58 and a goal panel 60 . form 50 is conveniently formed from a single sheet of material by a known process , such as stamping . thereafter , it may be formed conveniently into the game chassis 10 as will be explained further below . those skilled in the art will appreciate that central panel 52 will provide surface 14 of the finished game chassis 10 , and the openings 14 a therein correspond to the openings 14 a in surface 14 . the wing panels 54 l , 54 r are identical mirror images . accordingly , only panel 54 r will be described . at the juncture between panels 52 and 54 r , a fold line 60 is provided , along which three rectangular cuts in panel 52 are interspersed . the outer margin 64 of panel 54 r forms approximately a 15 ° angle to fold line 60 , so that panel 54 r is generally triangular . at the top edge of panel 54 r , there is formed a tab 64 , which is slightly undercut at 64 ′, 64 ′ along the top edge of the panel 54 r . the bottom end 66 of panel 54 r is separated from the main panel by a fold line 68 , which has a slot 69 formed therein . the leg panels 56 l , 56 r are identical mirror images . accordingly , only panel 56 r will be described . panel 56 r is separated from panel 52 by a fold line 70 and has a laterally protruding portion 72 which is separated from the main panel by a fold line 74 including a slit 76 , which is somewhat narrower than tab 64 . slit 76 is positioned to be the same distance from fold line 70 that tab 64 is from fold line 74 , which permits tab 64 to be inserted within slit 76 when game chassis 10 is assembled , as explained further below . lower panel 58 is separated from central panel 52 by a fold line 78 , along which there are formed two rectangular cuts 80 , 80 in panel 52 . on either side of panel 58 , a tab 82 protrude laterally and is undercut slightly along fold line 60 . tab 82 is somewhat wider than slit 69 and is positioned to be the same distance from fold line 78 that slit 69 is from fold line 60 . this permits tabs 82 to be inserted within slits 69 when game chassis 10 is assembled , as explained further below . goal panel 60 is separated from panel 52 by a fold line 84 . it will be appreciated that panel 60 comprises the goal 18 with the uprights 18 a , 18 a . in addition , a strut element 86 projects between the uprights from a fold line 88 . strut element 86 is formed with an undercut tab 90 , which is dimensioned to fit within an undercut slot 92 in panel 52 . the initial step in assembling game chassis 10 is folding down the wing panels 54 l and 54 r along fold lines 60 . this causes the rectangular cutouts 62 , 62 , 62 to protrude upwardly , forming the small walls 14 b , 14 b , 14 b . next , lower panel 58 is folded down along the line 78 , causing the rectangular cutouts 80 , 80 to protrude upwardly , to form the small walls 14 b , 14 b . tabs 82 may then be inserted into slits 69 , causing the walls 54 l , 58 , and 54 r to be assembled together . portion 72 may then be folded down along line 74 , panel 56 r folded down along line 70 , and tab 64 inserted into slits 76 , causing leg panel 56 r and panel 54 r to be joined together . leg panel 506 l may be joined to wing panel 54 l the same manner . the entire game chassis 10 is then assembled , except for the goal 18 . to assemble the goal 18 , panel 60 is folded upwardly along line 84 , strut portion 86 is folded downwardly along line 88 , and tab 90 is inserted into slot 92 . with the goal so assembled , strut portion 86 assists in supporting goal 18 in an upright position . fig1 is a perspective view of a second embodiment 10 ′ of a game chassis in accordance with the present invention . game chassis 10 ′ broadly comprises a primary panel 110 supported on a forward incline via a front pedestal 112 and a rear pedestal 114 , and a goal assembly 18 ′ projecting upwardly at the rear of chassis 10 ′. as best seen in fig1 , panel 110 has an upper surface 14 which is identical to the surface 14 illustrated in fig3 . in this embodiment , the dimensions a generally the same as the dimensions of game chassis 10 . panel 110 is preferably a sheet of plywood , particleboard , or the like . pedestal 112 is preferably a board and pedestal 114 may similarly be formed from boards or from a sheet of plywood , or the like . goal assembly 118 ′ is preferably formed of a tubular material and is preferably mounted in a recess in panel 110 . although chassis 10 ′ is illustrated as being made of wooden components 110 , 112 and 114 , those skilled in the art will appreciate that it could also be made with plastic panels , or the like , or it could be molded as a single element . chassis 10 ′ would be used in the same way as chassis 10 , requiring the use of game pieces and a scoreboard element . fig1 is a perspective view of a third embodiment 10 ″ of a game chassis in accordance with the present invention . whereas the first two embodiments were tabletop models , chassis 10 ″ is a floor model . accordingly , it is approximately 2 feet wide and 40 inches long . the chassis is also approximately 7 inches high at the front and in 16 inches high at the rear . chassis 10 ″ has a primary panel 120 , defining a plane surface , which is preferably about 2 feet wide and the 3 feet long . at the rear of chassis 10 ″, an upwardly projecting chute 122 defines a goal assembly , and a cutout 124 which is approximately 8 inches high and 5½ inches wide defines the actual goal opening between the uprights . preferably , chassis 10 ″ is made of wood , but those skilled in the art will appreciate that it could be made of many other materials , including plastic . also , chassis 10 ″ preferably has a plane surface 14 ′ which is identical to surface 14 , except that it is proportionately larger . owing to the larger size of game chassis 10 ″, the game pieces are preferably bean bags . moreover , utilizing a chute for the goal assembly guarantees that a game piece passing between the uprights will be trapped in the chute and fall downwardly , instead of instead of flying beyond the chassis 10 ″. also owing to the larger size of the chassis , the toss line is preferably at a distance of 15 feet from the chassis . similarly , an extra point and field goal kick are preferably taken from a line which is 12 feet away from the chassis . also , for each 10 yards closer ( than the yard line ) that a field goal attempt is made , a player may toss from a position which is one foot closer to the chassis . otherwise , the method of play would be identical . fig1 is a perspective view of a fourth embodiment 10 ′″ of a game chassis in accordance with the present invention . this chassis is a floor model and , therefore , approximately the same size as chassis 10 ″. however , its construction is somewhat similar to the chassis 10 ′. specifically , it is formed of a primary panel 110 ′ and four simple legs 120 , the rear legs being longer than the front legs to impart a forward tilt to panel 110 ′. the construction of panel 110 ′ is preferably wood , essentially the same as that of panel 110 . the game would be played the same way and would use bean bags for game pieces , as well as a scoreboard of the type already shown . however , those skilled in the art will appreciate that other materials could be used for the construction , such as reinforced plastic panels and molded legs . although preferred embodiments of the invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that many additions , modifications , and substitutions are possible without departing from the scope and spirit of the invention as defined by the accompanying claims . | 0 |
in the following description of the invention , the same reference numeral will be used to identify the same or similar elements in the each of the figures . fig1 through 5 , and 7 illustrate a waste milk treatment system 20 in accordance with the present invention , including : a controller 22 ; a milk pump 24 ; an inlet conduit 26 ; an outlet conduit 28 ; a pump inlet conduit 29 ; an ultraviolet milk treatment device 30 ( referred to herein as “ uv reactor ”); and an outlet conduit 32 . a storage vat 34 and a mobile platform 36 ( fig5 ) are used in connection with the milk treatment system 20 . generally , the depicted milk treatment system 20 uses the milk pump 24 to pump milk through the inlet conduit 26 , and into the uv reactor 30 . while being treated in the uv reactor 30 , the milk is heated or cooled in a heat exchanger to be in a temperature range that minimizes the growth of bacteria without destroying the immunoglobulins that are important for calf health . the treated milk moves through the outlet conduit 28 to be temperature adjusted and stored in the storage vat 34 . the milk storage vat 34 may be supported on the mobile platform 36 for transporting the milk to calves before the treated milk falls out of a predetermined temperature range . the mobile platform 36 may also include a milk distribution pump 39 to pump milk through a feed tube 41 to calves . more specifically , the controller 22 activates the pump 24 to circulate milk to the uv reactor 30 which is preferably surrounded by a heat exchanger 38 to raise milk temperature to between 85 ° f . and 120 ° f . and then circulates the warmed milk through the uv reactor 30 at an appropriate rate and frequency to kill harmful bacteria . the milk can then be chilled and stored or fed directly to calves . by raising the milk temperature to only the range of 85 ° f . to 120 ° f ., there is much less destruction of immunoglobulins and the milk is still safely pasteurized by the uv light from the uv reactor 30 . unlike batch pasteurizers , uv reactors do not rely on the temperature of the milk to kill bacteria . instead , the uv light alone in the range of 200 to 280 nanometers , uvc range ( germicidal range ), kills the bacteria . nonetheless , milk temperature is important because cold milk is churned by the pump and piping system and butter flakes can form that are less likely to be adequately treated by the uv light . raising milk temperature to 85 ° f . or higher is sufficient to melt or reduce the size of butter flakes that form so that the milk is adequately treated by the uv reactors . preferably , the milk temperature is raised to above 95 ° f ., and more preferably to above 100 ° f . on the other hand , heating the milk to too high of a temperature can destroy beneficial immunoglobulins . an upper end of the temperature range to minimize destruction of the immunoglobulins is 120 ° f . a temperature range of about 85 ° f . to about 120 ° f . includes a feeding temperature range of between about 100 ° f . and about 110 ° f . if the milk is to be fed directly to calves , then heating to the feeding temperature range of between about 100 ° f . to 110 ° f . for pasteurizing is appropriate . if the milk is to be chilled and stored after pasteurization , a milk temperature in the lower end of the range of 85 ° f . to 120 ° f . will produce adequate results in the present invention . it is noted that treated waste milk may need to be transported to the calves where they are kept in the dairy facility . in this situation , heating the milk to above the feeding temperature range can compensate for milk cooling as it is being transported . heat loss is a function of ambient conditions , the time between pasteurization and feeding , and other factors . thus , using the present invention , milk temperature can be adjusted to compensate for these and other factors in any particular dairy situation . a preferred heat exchanger 38 for use with the present invention is disposed around the uv reactor 30 . the heat exchanger 38 is depicted in fig7 and includes an inlet 62 , a water jacket 64 , and an outlet 66 . the water jacket 64 surrounds and is substantially coaxial with the uv reactor 30 to define an annular space through which water , air or other heat exchanger fluid can flow to adjust the temperature of the uv reactor 30 and the milk being pasteurized therein . preferably , the water jacket 64 is made of stainless steel , but other materials can be used . the inlet 62 is in communication with a source of water or other fluid , and the fluid source can be a hot water heater , for example . preferably , the hot water heater is a dedicated unit for the heat exchanger 38 , in a closed loop configuration with the heat exchanger 38 . other types of heat exchangers can be used with the present invention , and be positioned at any point in the milk flow path . a temperature sensor 44 is used to determine milk temperature throughout the pasteurizing process . preferably , the temperature sensor 44 is a precision fahrenheit temperature sensor model lm34 , available from national semiconductor . if the pasteurization process has been completed and the desired milk temperature has not been reached , milk will continue to be circulated until the desired temperature is reached . further , the controller 22 is preferably in communication with a milk quantity sensor 43 , which is preferably an integrated silicon pressure sensor ( mpx5010gp , case 867b - 04 ) available from freescale semiconductor ( www . freescale . com ) that uses a long stand tube 42 that traps air when the liquid level of the vat 34 increases . as the milk level in the vat 34 rises , pressure in the long stand tube 42 increases . the milk quantity sensor 43 generates a voltage readout signal that is communicated to the controller 22 to automatically determine run time for any batch size of milk . preferably , the controller 22 is set initially by a skilled installer or technician . adjustments can be made by any dairy operator at an operator interface 45 to adjust temperature , flow rates , treatment time or any other condition in the pasteurizing process . the controller 22 also provides a display 42 indicating how long it has been since the pasteurizing process has been completed and the milk &# 39 ; s current temperature so that re - circulation through the heat exchanger 38 can bring milk temperature back within a desired range . the display 42 can provide a dairy operator with any relevant information , including operating times , flow rates , milk temperature , component failure , maintenance requirements , and so on . finally , after pasteurized milk has been distributed to calves or the mobile platform 36 , the milk treatment system 20 can be coupled to a wash system ( not illustrated ) for automatic cleaning and preparation for the next pasteurizing cycle . the milk treatment system 20 can include one or more uv milk pasteurizer reactors 30 . three uv reactors 30 are used in the illustrated embodiment . uv milk pasteurizers for use in the present invention can be those of the type disclosed in rix et al ., u . s . pat . no . 6 , 916 , 452 ( incorporated herein by reference ). the uv reactors 30 as depicted in fig7 include an inlet 50 , an outlet 60 , a quartz tube 52 , a uv light bulb 56 disposed inside the quartz tube 52 to prevent milk from contacting the light bulb 56 . other types of tubes can be used to protect the light bulb 56 from being damaged by milk . surrounding the quartz tube 52 is an outer tube 58 ( preferably made of stainless steel ) that defines with the quartz tube 52 , an annular milk flow channel . the heat exchanger 38 surrounds the outer tube 58 . milk flows through the inlet 50 , the annular flow channel 58 where it is pasteurized by uv light , and out the outlet 60 . the uv light bulb 56 is preferably a gia972t5lca / 2s07 / pt - 18 ″/ 4w / n / cb - 061 ( uv pure ) available from first light technologies , inc ., p . o . box 191 , 212 ideal way , poultney , vt . 05764 . ballasts for use in the uv reactor 30 preferably are electronic ballasts , evg 100 . . . 200w / 230v ac , available from zed — ziegler electronic devices gmbh . the quartz tube 52 is about one inch in outside diameter and the inside diameter of the outer tube 58 is about 1 . 37 inches . further , the outside diameter of the outer tube 58 is about 1 . 50 inches in diameter and the inside diameter of the water jacket 64 is about 2 . 37 inches , but other dimensions of the water jacket 64 are possible . other combinations of bulbs and ballasts are possible , and it is desirable that the combination be ul rated . the uv reactors 30 can be used in series or parallel to reduce the number of times milk is circulated through the uv reactors . preferably , the controller 22 of the present invention is in monitoring communication to monitor uv reactor 30 components and adjust treatment time to accommodate defective uv light bulbs 56 , ballasts or related components . one way to monitor such components is to monitor electrical current flow through a light bulb , for example . if the bulb is not working no current will be flowing through the bulb . the pump 24 pumps milk through the uv reactor 30 at a rate that ensures optimal sterilization of milk and / or colostrum and prevents stagnation in the uv reactor 30 related piping , connections , and control systems . preferably , the flow rate is about 17 gallons per minute , but other flow rates may be used as other system components are changed in size or type . preferably , the controller 22 is programmed to operate the milk pump 24 at about seventeen gallons per minute flow rate . using one uv reactor 30 alone , this flow rate will result in pasteurized milk after about 40 “ passes ” through the uv reactor 30 . using two uv reactors 30 in series will require about 20 passes , and using three uv reactors in series will require about 13 . 4 passes through the reactors 30 . for fifty gallons of waste milk at 2 . 9 minutes per pass , the uv pasteurizing process will take about 59 minutes . this is an improvement over batch pasteurizing heating , treatment , and cooling times . further , the present invention saves time and energy primarily because the milk does not require heating to such high temperatures . tests have shown 30 % to 70 % time savings for the present invention over the batch pasteurizing process . further , the present invention promotes efficiencies in dairies because a milk vat 34 can be filled hours before milk is needed , and the pasteurizing process can be initiated automatically by the controller 22 at an appropriate time to warm , pump , pasteurize and store the milk on a mobile platform 36 for transport to calves . this function is preferably set by a pasteurization start timer accessible at the operator interface 45 . as depicted in fig6 , the present invention also can include a stand pipe 42 with milk volume detector 38 for determining the amount of milk in the vat 34 . the controller 22 calculates and controls treatment time based on the milk quantity in the vat 34 . for example , a 100 gallon vat 34 can be filled or partially filled with 100 gallons or 5 gallons of milk , and the present invention will automatically set the approximate treatment time . apparatus of the present invention can also include a mobile platform 36 ( fig5 ) or storage vat 34 for transporting the milk from the pasteurizer to the calves at remote locations . the mobile vat 36 can be insulated and include a spray ball or device for cleaning the mobile vat 36 . a mobile platform 36 may simply be a frame and wheels to transport the vat 34 in which the milk was stored during pasteurization . comparisons between the present invention and the prior art batch pasteurizers illustrate the efficacy of the present invention for use with waste milk and colostrum . in this example a , the standard batch pasteurizer is more effective than the uv pasteurizer for all the organisms tested in killing harmful bacteria , but when milk is used , the invention is effective for all three organisms tested ( 99 . 98 % for e . coli , 100 % for b . cereus and 99 . 992 % for salmonella ). however , when colostrum is used the invention is certainly less effective for all three to the point where it may not be effective enough . more research may be needed to determine the maximum effectiveness , in terms of increasing treatment time , for effective bactericidal action on microorganisms when present in colostrum . further , single radial immunodiffusion assays were also run for these samples for bovine igg . the batch pasteurizer samples displayed a significant reduction in igg ( around 43 %) whereas the uv samples had no reduction in igg at all . thus , the present invention as shown in example a results in healthier waste milk , but possibly not healthier colostrum . b substrate ( milk or colostrum ) right after getting up to the pasteurization temperature ( time = 0 ). this takes about one - half an hour . for this example , the uv pasteurizer trial for the milk was repeated , with the addition of another time at 22 minutes exposure of the milk to uv light . these results are very similar to example a with a satisfactory level of kill after 15 minutes exposure for 10 gallons of milk with all three bacteria tested . the second part of the study utilized colostrum which example a had an ineffective level of kill after 15 minutes for the organisms tested . example b utilized exposure levels of 30 and 45 minutes . these results indicated better efficacy in two of the three organisms at 15 minutes versus example a . example a shows the efficacy at 15 minutes to be marginal for two organisms and unacceptable for the third ( bacillus ). at both 30 and 45 minutes exposure , however , the efficacy of the pasteurizer of the present invention for all three organisms was adequate to very good . further , single radial immunodiffusion assays were also run for these samples for bovine igg . the results indicated no reduction in immunoglobulin ( igg ) after 15 minutes and a relatively minimal reduction in immunoglobulin ( igg ) after 30 and 45 minutes . thus , the present invention as reflected in example b results in healthier milk and colostrum than the prior art batch pasteurizer . this example utilized colostrum at the same exposure levels of 15 , 30 and 45 minutes as example b . these results indicated that the uv pasteurizer of the present invention overall is still effective at 30 and 45 minutes , especially the latter time . the only possible exception is possibly the bacillus where only the 45 minute exposure time showed solid results . the results generally showed less percent kill then the previous test at the same exposure times , but the time 0 concentrations were also higher , which probably accounts for this reduction in kill . in real field use , the concentration of these pathogens is very unlikely to be anywhere near what is being tested in this example . it can therefore be concluded that the kill rates are satisfactory at both 30 and 45 minutes . further , single radial immunodiffusion assays were also run for these samples for bovine igg . the results indicated minimal or no reduction in immunoglobulin ( igg ) after 15 , 30 and 45 minutes . this is therefore , a distinct improvement over batch pasteurizing . the above examples illustrate the effectiveness of the present invention in killing three types of pathogens while preserving essentially all of the immunoglobulins in milk and colostrum . the previous detailed description of the preferred embodiments of the invention are presented for clearness of understanding , and are not intended to limit the scope of the following claims . further , the term “ milk ” as used in the claims is intended to be broad enough to include milk , waste milk , non - saleable milk , colostrum or any other calf feed supplement that would benefit from pasteurizing prior to feeding to calves . | 0 |
it has been found that in order to handle the increasing software complexity , the solution is to create a central functionality that takes care of the prioritization and coordination . the combustion manager acts as a bridge between all the software strategies that need to take over the control of the injection system and the strategies that manage the combustion parameter calculation . it has been found that in order to handle the big memory requirement the solution is that the calibration tables are not assigned prior to a defined combustion mode and injection but give the flexibility to calibrate engineer to link the available tables or maps to a defined physical event such as first pilot injection in dpf regeneration mode . thereby allowing the reuse of tables across injections or even across combustion modes . fig2 schematically illustrates the architecture of the combustion related strategies in a diesel common rail ems . the main inputs of the combustion management strategy are torque request ( manager 1 ) from the driver and the combustion modes requested from external managers 2 through 7 . a mode manager is the software where the activation and request for each combustion modes are calculated . the main outputs of the combustion manager 9 are the individual combustion set points such as fuel mass setpoint 10 , injection phasing setpoint 11 , injection phasing setpoint 12 , air mass setpoint 13 , boost pressure setpoint 14 , egr setpoint 15 that are inputs to the strategies such as injection realization 16 , fuel pressure realization 17 and air path realization controlling the actuators . as an example : the dpf manager 2 decides the event when particle filter regeneration is necessary and then sends a request to the combustion manager 9 to initiate the dpf regeneration mode . the combustion manager 9 in turn will command the actuators to perform the dpf regeneration . the nature and the number and of the external managers are dependent on the system components and the final original equipment manufacturer ( oem ). the general trend of the number of such external managers increases along with the emission legislation . depending on the external manager strategy , one or more combustion modes are assigned . in general a combustion mode can be understood as a specific combustion target ( e . g . start the engine , heat up the dpf filter , regenerate the dpf filter , etc .). the combustion manager 9 is introduced as a central coordination strategy in the ems . the strategy takes care of mode request prioritization and controls the transitions between combustion modes . the combustion manager 9 acts as a bridge between the external managers 2 to 7 and the individual combustion set point strategies 10 to 15 . thus giving the flexibility to develop a generic combustion set point strategy that is independent of the external environment of the combustion management strategy . the combustion manager 9 commands individual combustion set points for three independent systems within the engine : the injectors 16 the rail pressure system actuators 17 the air path actuators 18 each with a different reaction time . it is important to take such aspects into consideration for the coordination of the transition between combustion modes . for example a mode transition could trigger the transition of the set points for the slower system ( air path actuators with the parameters map_sp : mass air pressure setpoint and maf_sp : mass air flow setpoint ) followed by the set point for the faster system ( rail pressure system actuators with the parameter fup_sp : fuel pressure setpoint ) and finally the set points for the fastest system component ( injectors with the parameters mf_sp : fuel mass setpoint and soi_sp : start of injection set point ). fig4 illustrates a simplified example of the possible implementation of a transition from combustion mode x to combustion mode y . the transition factor t 5 for mass air pressure map_sp and the transition factor t 4 mass air flow maf_sp are identical and result in this example to t 4 , 5 = t 4 − t 1 wherein t 1 is the time when the transition starts and t 4 is the time when the transition ends . as can be seen from fig4 the transition factors t 4 and t 5 are the longest followed by transition factor t 3 of the fuel pressure fup_sp defined as t 4 − t 2 . the shortest transition factor t 1 for mass fuel mf and transition factor t 2 for start of injection soi are defined as t 4 − t 3 . with these transition factors it is possible to make a transition from one mode to another mode whereby each parameter reaches at the same the other combustion mode , here at time t 4 . it is possible to define transition times and / or delays for each combustion setpoint . anyway it is not necessary to calibrate these times for each possible transition instead a limited set of times are defined and can be reuse as shown in fig5 . this figure shows in the left lower corner 5 × 5 array wherein the lines define the target mode and the columns define the current mode . according to the transition from one combustion mode to another combustion mode automatically the transition factor set is defined . here in this example the engine is in the current mode 3 and a transition from this mode 3 to target mode 2 is requested . in the middle of this 5 × 5 array a black box 20 is marked . in this box 20 a pointer 23 is stored pointing to the transition factor set 22 ( marked as black column ) from a transition time table 21 . a transition factor set 22 is for example the transition times t 1 to t 5 as shown on the right side of fig5 . fig3 a shows requested modes from one or several managers 1 to 7 over the time . in fig3 b the corresponding transition factors are depicted thereby only showing the transition factor of one parameter , for example t 4 of mass air flow . in fig3 c there different combustion modes cm 1 to cm 3 for one parameter are shown . at the beginning the engine runs in combustion mode cm 1 . at time t 5 a jump to combustion mode cm 2 is requested . the system is reacts instantly . the parameter is set to cm 2 as shown in fig3 c . at time t 6 combustion mode cm 3 is requested in the transition time t a . automatically the transition factor t a in fig3 b is set ( shown as a ramp ). the normal case is shown between t 11 and t 14 . at time t 11 combustion mode cm 2 is requested in the transition time t c (= t 13 − t 11 ). during this transition from cm 1 to cm 2 at time t 12 another combustion mode cm 3 is requested . as long as the transition from one mode to another mode is not terminated the new request is ignored . the transition from cm 2 to cm 3 only starts when the old transition has been terminated . this situation can be seen in time t 13 as the transition factor receives a new ramp . in certain situation the above rule has to be broken for example if a zero torque or a sudden high torque is requested . in this case a jump over rules any prioritization of the combustion modes . this is shown between t 8 and t 9 . at time t 8 a combustion mode cm 2 in the transition time t b (= t 10 − t 8 ) is requested . at time t 9 a jump to combustion mode cm 1 is requested . although the transition from cm 3 to cm 2 has not been regularly terminated at the time t 10 . the jump request has already been performed thereby overruling the transition from cm 3 to cm 2 . it is annotated that a request from a current mode ( e . g . cm 1 ) to a target mode ( e . g . cm 2 ) could always be passed over neutral nominal mode nm . the request would then be translated as cm 1 --& gt ; nm --& gt ; cm 2 . this by - pass over the nominal mode has the big advantage that the number of predefined transitions are reduced and the adaptation of a generic project to a oem - project is much simpler and thereby reducing time and money during development . the known approach for calibration tables would be to define a calibration structure for each combustion set point in every combustion mode giving the advantage that the calibration structure could be adapted to the specific needs of the combustion mode . on the other side , wastage of the ecu resources would be seen , since the calibration tables can not be reused across the combustion modes . in addition , after tuning phase many calibration tables could stay unused . a deeper analysis shows that the basic dependencies like requested torque , engine speed and coolant temperature required for the calibration structures remain the same across combustion modes . this makes it possible to break the paradigm of a hard coded link between the calibration tables and a specific combustion set point in a specific combustion mode . by introducing a single scalable calibration structure , a flexible linking between the calibration tables , the combustion set points and the combustion modes solves the problem in a much more efficient way . fig6 shows a schematic example of how the links between combustion modes , sub - modes and calibration tables could be established for a given combustion set point . both layers of links can be freely chosen by the calibration team during tuning activities . as shown in fig6 , reuse of calibration tables is possible at two different levels : in the first level two or more combustion modes can share areas where the calibration of all combustion set points is identical by sharing the same sub - modes . fig7 illustrates an example where modes 0 and 1 share same calibration in most of the working area except for the region of high engine speed . in the second level two or more combustion sub - modes can reuse the same calibration table . in figure this is the case for sub - modes 1 , 2 and 3 as they are all linked to table map [ 1 ]. the combustion mode is converted into a combustion sub - mode . a combustion sub - mode can be understood as an injection profile ( pattern of active injections ). in order to avoid toggling a hysteresis is implemented as shown in fig8 a for engine revolution and in fig8 b for torque output . in order to improve the adaptability of the combustion management strategy to the needs of each project , the calibration tables are not defined as single elements but as arrays of several tables wherein number of elements as well as the dimensions of each array element can be configured . defining the calibration tables for a given combustion set point as one single array would have the disadvantage that they all share the dimension of the biggest required table and thereby wasting cpu resources . in order to overcome this problem , several calibration table types are implemented for each combustion set point . for each table type , the dimensions can be configured separately . in case that one of the implemented table types is not required , the number of elements can be reduced to 1 and the element size to the minimum ( 2 × 2 ) so that the rom consumption is negligible . the increasing number of combustion modes in diesel common rail projects increases the optimization effort for the calibration engineers . at least the following combustion set points need to be tuned at each working point in order to reach emissions , noise and fuel consumption targets : injection activation profile fuel mass for each active injection position of each active injection ( injection phasing ) rail pressure air mass flow or exhaust gas recirculation ( egr ) rate boost pressure regardless of the calibration methods used to reach the optimization , the work of the calibration engineers is facilitated if the ems shows the same software architecture for the calculation of each combustion set point . due to the increasing requirements set to an ems , an optimized combustion management strategy has become essential . a strategy having as main features a centralized combustion management and a flexible calibration structure is considered to be a suitable solution for systems fulfilling current and future emission standards . to summarize , the advantage of the centralized combustion management is that the strategy can be easily configured and adapted according to the needs either at the initial project phases or even at later stages of the project development . indications from current implementations show that with a proper combustion strategy configuration and careful calibration strategy it is possible to reach the euro 5 targets without significant increase in cpu resources consumption compared with euro 4 systems . | 5 |
fig1 is a block diagram illustrating a general configuration of an image forming system 10 of a first embodiment . the image forming system 10 includes a printer 11 and a client 13 that are connected with each other via a network 12 , so that data can be communicated between the printer 11 and the client 13 . the client 13 transmits print data including information on a client user and a print permit to the printer 11 . the client 13 includes an application 62 , a printer driver 61 , an inputting device 63 such as a key board , a display unit 64 such as a crt . the application 62 is software that produces documents and images , and prints the documents and the images . the printer driver 61 includes an image forming data producing section 66 , a user identifying section 67 , and an operation mode identifying section 68 . when the application 62 issues a print command , the user identifying section 67 identifies a user who requested printing . the operation mode identifying section 68 identifies the setting of operation mode that has been set previously in the printer driver 61 . the image forming data producing section 66 converts a variety of drawing instructions into commands as image forming data that can be interpreted in the printer 11 . the image forming data producing section 66 also converts print processing information that can be interpreted in the printer 11 . the print processing information includes print processing information ( i . e ., user information ) that is identified by the user identifying section 67 , and print restricting information ( i . e ., an operation mode ) identified by the operation mode identifying section 68 . then , the image forming data producing section 66 combines these items of data into print data , and transmits the print data to the printer 11 . the printer 11 includes a receiving section 51 , a data analyzing section 52 , a color / monochrome data identifying section 53 , a print restriction determining section 55 , an image forming section 58 , a display unit 57 , a notifying section 56 that indicates to the user when printing is not allowed , and a print restriction information storing section 54 that stores print restriction information on individual users . the receiving section 51 receives the print data from the client 13 . the data analyzing section 52 extracts the user information and the operation mode for the user from the commands contained in the received print data . the color / monochrome data identifying section 53 determines whether the image data in the print data is for color printing or for monochrome printing . the print restriction determining section 55 reads the print restricting information on the user , who is identified by the data analyzing section 52 , from the print restriction information storing section 54 . the print restriction determining section 55 also reads the operation mode identified by the data analyzing section 52 . then , the print restriction determining section 55 determines based on these items of information whether printing should be carried out . if printing should be carried out , the print restriction determining section 55 sends a command to print to the image forming section 58 , which in turn performs printing in response to the command . fig2 illustrates a data structure as an example of print restriction information stored in the print restriction information storing section 54 . referring to fig2 , the data structure includes individual users and their corresponding print restrictions . for example , the quota on pages to print for “ smith ” has been used up already . therefore , the print restriction for smith is “ on ”. the print restriction for “ lincoln ” has not been set to “ on ” yet . fig3 illustrates a data structure as an example of print data transmitted from the client 13 to the printer 11 . referring to fig3 , the print data transmitted from the client 13 includes user name =“ smith ”, operation mode =“ temporary permit mode ”, and image forming data =“ color data ”. fig4 illustrates an example of an operation mode setting screen that is displayed on the display unit 64 , via a driver - user interface of the printer driver 61 . the printer driver 61 includes two options : “ normal mode ” and “ temporary permit mode ”. “ normal mode ” is a mode in which the state of the print restriction is checked for each user stored in the print restriction information storing section 54 of the printer 11 to determine whether printing should be carried out for the user . if the print restriction is in the “ on ” state , printing is allowed . if the print restriction is in the “ off ” state , printing is allowed . “ temporary permit mode ” is a mode in which the user is allowed to print despite the fact that the state of the print restriction for the user is “ on ”. the print restriction for “ smith ” is in the “ on ” state in fig2 , but the operation mode for “ smith ” is “ temporary permit mode ” in fig3 . thus , the print restriction is temporarily disabled , and the image forming data is printed . the operation of the image forming systems of the aforementioned configuration will be described . fig5 is a flowchart illustrating the operation of the client 13 . the flowchart assumes that the user is “ smith ”. the operation of the client 13 will be described . “ smith ” is desperate to print urgently and opens the operation mode setting screen ( step s 101 ). then , the user selects the operation mode within the property of the print driver 61 by clicking the checkbox of “ temporary permit mode ”. when the application outputs a print instruction ( s 102 ), the user identifying section 67 obtains the user name , the name of pc , and pc address , and transfers these items of information to , for example , the image forming data producing section 66 ( step s 103 ). a screen is displayed on the display unit 64 via the driver interface so that the user inputs his name via the inputting device 63 . the operation mode identifying section 68 reads the operation mode , which has been set at step s 101 , via the driver interface , and then sends the operation mode to the image forming data producing section 66 ( step s 104 ). the image forming data producing section 66 converts image forming data into print data that can be interpreted by the printer 11 , and transmits the print data that includes the user information and the operation mode to the printer 211 ( step s 105 ). after transmission of print data , the printer driver 61 automatically resets the operation mode from “ temporary permit mode ” to “ normal mode ” ( step s 106 ). thus , when the next print instruction is issued next , “ normal mode ” will be set unless the user sets “ temporary permit mode ” again . fig6 is a flowchart illustrating the operation of the printer 11 . the operation of the printer 11 will be described with reference to fig6 . the receiving section 51 receives the print data from the client 13 ( step s 151 ), and extracts the user information and the operation mode for the user from the commands contained in the received print data ( step s 152 ). then , the print restriction determining section 55 makes a decision to determine whether printing should be carried out , i . e ., whether the state of the print restrictions is “ on ” or “ off ” ( step s 153 ). if the answer is no , ( no at step s 156 ), the program proceeds to step s 156 where printing is performed immediately . if the answer is yes ( yes at step s 153 ), a check is made to determine whether the image data is color data or monochrome data ( step s 154 ). if the image data is monochrome data , the program proceeds to step s 156 where printing is performed immediately . if the image data is color data , the program proceeds to step s 155 where a check is made to determine whether the operation mode is “ temporary permit mode ” ( step s 155 ). if the operation mode is “ temporary permit mode ” ( yes at step s 155 ), the program proceeds to step s 156 where printing is performed immediately . if the operation mode is “ normal mode ” ( no at step s 155 ), the program proceeds to step s 157 where printing is not performed . then , the program proceeds to step s 158 where the notifying section 56 advises the user by means of , for example , a set of characters that printing is not permitted ( step s 159 ), and the display unit 57 displays by means of a set of characters that printing is not permitted ( step s 159 ). as described above , if “ smith ” is the user who has been set to print restriction , the operation mode is set to “ temporary permit mode ,” and the image forming data is color data , then the program proceeds through steps s 151 - s 156 to print the image forming data . if “ smith ” is set to print restriction , the image forming data is color data , and the operation mode is “ normal mode ,” the image forming data is not printed . in the first embodiment , the permit information is a single item of information . instead , the permit information may be a combination of a plurality of items of information including , for example , a password , in which case , the processing may be additionally altered as follows : ( 1 ) when “ temporary permit mode ” is selected , a password is requested . ( 2 ) a user inputs a password . this password may be processed at step s 101 ( fig5 ). ( 3 ) the driver transmits the password and the operation mode ( i . e ., “ temporary permit mode ”) to the printer . the password and the operation mode are processed simultaneously at step s 105 ( fig5 ). ( 4 ) when the operation mode is “ temporary permit mode ”, the printer compares the received password with passwords previously stored in the printer , and permits printing if the passwords are coincident . this processing may be performed at step s 155 ( fig6 ). instead of using “ temporary permit mode ”, the user may input only a password and printing may be permitted only when the received password coincides one of the passwords previously stored in the printer . the advice issued by the notifying section 56 to the user may be transmitted in the form of data to the client so that the data may be displayed on the display unit 64 . as described above , if a user is desperate to print , the user may be allowed to print despite the fact that the user is subjected to print restriction . fig7 is a block diagram illustrating the configuration of a printer 71 of a second embodiment . the printer 71 differs from the printer 11 in that a number - of - print permits determining section 73 is added to a print restriction determining section 72 . elements similar to those in the first embodiment have been given the same reference numerals and their description is omitted . an image forming system of the second embodiment differs from that of the first embodiment in that the printer 71 is used in place of the printer 11 in fig1 . fig8 illustrates a data structure as an example of print restriction information stored in the print restriction information storing section 54 . referring to fig8 , the each item of data includes a user , print restriction (“ on ” or “ off ” of color printing ) for the user , and permit condition . the permit condition represents the remaining number of times of performing printing when print restriction is cancelled . the print restriction of “ smith ” is set “ on ” ( e . g ., the quota on pages to print for “ smith ” has been used up ), and the permit condition ( i . e ., the number of times of performing printing ) is 10 times . the print restriction of user “ lincoln ” is set “ off ” and the permit condition ( i . e ., the number of times of performing printing ) is 10 times . a client 13 transmits print data to the printer 71 . fig3 illustrates an example of the print data . referring to fig3 , the user name and operation mode of the print data transmitted from the client 13 are “ smith ” and “ temporary permit mode ”, respectively , and the image forming data is color data . the detailed description of the client 13 is omitted . fig9 is a flowchart illustrating the operation of the printer 71 . the operation of the printer 71 will be described with reference to the flowchart . a receiving section 51 receives the print data form the client 13 ( step s 251 ), and extracts the user information and the operation mode for the user from the received print data ( step s 252 ). then , the print restriction information storing section 54 reads the permit condition ( i . e ., the number of print permits ) from the print data ( step s 253 ). the print restriction determining section 55 determines whether printing should be carried out , i . e ., the state of print restrictions is “ on ” or “ off ” ( step s 254 ). if the answer is no , ( no at step s 254 ), the program proceeds to step s 259 where printing is performed immediately . if the answer is yes ( yes at step s 254 ), a check is made to determine whether the image data is color data or monochrome data ( step s 255 ). if the image data is monochrome data , the program proceeds to step s 259 where printing is performed immediately . if the image data is color data , the program proceeds to step s 256 where a check is made to determine whether the operation mode is “ temporary permit mode ”. if the operation mode is “ temporary permit mode ” ( yes at step s 256 ), the program proceeds to step s 257 where a check is made to determine whether the permit condition ( the number of print permits ) is “ 0 ”. if the operation mode is “ normal mode ” at step 256 or permit condition is “ 0 ”, the program proceeds to step s 260 where printing is not performed . if printing is not to be performed , the notifying section 56 advises the user that printing is not permitted ( step s 261 ), and the display unit 57 displays by means of a set of characters that printing is not permitted ( step s 262 ). if the permit condition is not “ 0 ” at step s 257 , the permit condition ( i . e ., the remaining number of times of performing printing ) is decremented by “ 1 ” ( step s 258 ), and then printing is performed ( step s 259 ). as described above , if “ smith ” is the user who has been set to print restriction as shown in fig2 , the operation mode is set to “ temporary permit mode ”, and the image forming data is color data , then the program proceeds through steps s 251 - s 259 to continue to print the image forming data until the number of remaining times of print permits reaches “ 0 ”. if “ smith ” is set to print restriction and the image forming data is color data , and if the operation mode is “ normal mode ” or the number of remaining times of print permits has reached “ 0 ”, the image forming data is not printed . as described above , the number of times of performing printing in the “ temporary permit mode ” is set , and “ temporary permit mode ” is not permitted after the number of times of performing printing has been reached “ 0 ”. instead , the user may continue to be allowed to print , and when the quota on pages to print has been used up , the log ( user information , total number of printed pages , time at which individual printing operations are performed ) may be written into the memory area or reported to the system administrator . still alternatively , the number of remaining times ( n ) of performing printing may be transmitted to the client which in turn displays the number of remaining times ( n ). for example , fig4 illustrates an example “ temporary permit mode ( n is 4 ). the advice issued by the notifying section 56 to the user may be transmitted in the form of data to the client so that the data may be displayed on the display unit 64 . in the first embodiment , the permit information is a single item of information . instead , the permit information may be a combination of a plurality of items of information including , for example , a password . as described above , if a user is desperate to print , the user may be allowed to print even though the user is subjected to print restriction . further , the image forming system of the second embodiment is capable of restricting the number of times of performing printing in the “ temporary permit mode .” instead of restricting the number of times of performing printing in the “ temporary permit mode ,” the number of pages to be printed may be restricted . fig1 is a block diagram illustrating an image forming system 110 of a third embodiment . the image forming system 110 differs from the image forming system 10 of the first embodiment in that a document title identifying section 118 is added to a client 113 and a document title identifying section 116 is added to a printer 111 . referring to fig1 , the document title identifying section 118 identifies the title of a document of the image forming data produced by an application 117 . an image forming data producing section 66 converts various drawing instructions , which is received in a printer driver 114 from an application 117 , into commands that can be interpreted by the printer 111 . the image forming data producing section 66 also converts print processing information that can be interpreted in the printer 111 . the print processing information includes print processing information ( i . e ., user information ) identified by the user identifying section 67 , an operation mode identified by the operation mode identifying section 68 , and the title of a document identified by the document title identifying section 118 . then , the image forming data producing section 66 converts these items of data into the print data , and then transmits the print data to the printer 111 . a print restriction determining section 115 of the printer 111 incorporates a number - of - print permits determining section 73 and a document title identifying section 116 . fig1 illustrates a data structure of print restriction information previously stored in the print restriction information storing section 54 . referring to fig1 , the data includes a user , print restriction (“ on ” state or “ off ” state ) permit condition , and title - of a document ( ) that was printed last time in “ temporary permit mode ”. in this example , for “ smith ”, print restriction is “ on ” ( e . g ., due to the fact that the quota on pages to print has been used up ), permit condition ( the number of times of performing printing ) is 10 , and the title of a document is “ accounting data . doc ”. for “ lincoln ”, print restriction is “ off ”, i . e ., no print restriction is set . fig1 illustrates a data structure as an example of print data transmitted from the client 113 to the printer 111 . referring to fig1 , the print data transmitted from the client 13 includes user name =“ smith ”, operation mode =“ temporary permit mode ”, title of a document =“ accounting data . doc ”, and image forming data =“ color data .” the operation of the image forming system of the aforementioned configuration will be described . fig1 is a flowchart illustrating the operation of the client 113 . the flowchart assumes that the user is “ smith ”. the operation of the client 13 will be described . “ smith ” is desperate to print immediately and opens the operation mode setting screen . then , the user selects the operation mode by clicking on the checkbox of “ temporary permit mode ” ( step s 301 ). when the application outputs a print instruction ( step s 302 ) the user identifying section 67 obtains the user information including the user name “ smith ”, the name of pc , and pc address , and sends these items of information to , for example , the image forming data producing section 66 ( step s 303 ). the operation mode identifying section 68 reads the operation mode , which has been set at step s 301 , via the driver user interface , and then transfers the operation mode to the image forming data producing section 66 ( step s 304 ). when the application 117 outputs a print command , the document title identifying section 118 identifies the document title of the image forming data received from the application 117 . then , the document title identifying section 118 sends the document title to the image forming data producing section 66 ( step s 305 ). the image forming data producing section 66 produces image forming data as print data that includes the user information , operation mode , and document title , the print data being in the form that can be interpreted by the printer 111 . then , the image forming data producing section 66 transmits the print data to the printer 111 ( step s 306 ). after transmission of the print data , the printer driver 114 automatically resets the operation mode from “ temporary permit mode ” to “ normal mode ” ( step s 307 ). thus , when the next print instruction is issued next time , “ normal mode ” will be set unless the user sets “ temporary permit mode ” again . fig1 is a flowchart illustrating the operation of the printer 111 . the operation of the printer 111 will be described with reference to fig1 . a receiving section 51 receives the print data form the client 113 ( step s 351 ), and extracts the user information and the operation mode for the user from the commands contained in the received print data ( step s 352 ). then , the permit condition ( the number of print permits and document title assigned to the user are read out from the print restriction information storing section 54 ( see fig1 , step s 353 ). then , the print restriction determining section 55 determines whether print restriction has been set to the user ( i . e ., whether printing should be carried out ) ( step s 354 ). if the answer is no , ( no at step s 354 ), the program proceeds to step s 361 where printing is performed immediately . if the answer is yes ( yes at step s 354 ), a check is made to determine whether the image data is color data or monochrome data ( step s 355 ). if the image data is monochrome data , the program proceeds to step s 361 where printing is performed immediately . if the image data is color data , the program proceeds to step s 356 where a check is made to determine whether the operation mode is “ temporary permit mode ”. if the operation mode is “ temporary permit mode ” ( yes at step s 356 ), the program proceeds to step s 362 where the document title stored in the print restriction information storing section 54 is cleared . if the operation mode is “ normal mode ” ( no at step s 356 ), the program proceeds to step s 362 where the document title stored in the print restriction information storing section 54 is cleared . then , printing is not performed ( step s 363 ). as described above , if “ smith ” is the user who has been set to print restriction ( i . e ., the operation mode is set to “ temporary permit mode ”, then the notifying section 56 notifies the display unit 57 that printing is not allowed ( step s 364 ). the display unit 57 displays , for example , a set of characters indicative that the user is not allowed to print ( step s 365 ). if the permit condition ( i . e ., the number of times of performing printing ) is not “ 0 ” ( no at step s 357 , the document title is read from the print data ( step s 358 ) and a check is made to determine whether the document title in the print restriction information storing section 54 for the user is empty ( step s 359 ). if the document title in the print restriction information storing section 54 is not empty ( no at step s 359 ), then a check is made to determine whether the document title read from the print data is the same as that read from the print restriction information storing section 54 ( step s 360 ). if the document title is empty ( yes step s 359 ), then the program proceeds to step s 366 . if the two document titles are not coincident ( yes step s 360 ), the program proceeds to step s 366 . at step s 366 , the document title read from the print data is overwritten onto the area of document title in the print restriction information storing section 54 ( step s 366 ). then , the permit condition ( the number of remaining times of performing printing , n ) is decremented by “ 1 ” ( step s 367 ), and thereafter printing is performed ( step s 361 ). if print restriction is set to “ smith ” who sent the print data , the operation mode is “ temporary permit mode ”, the document title is “ accounting data . doc ”, and the image forming data is color data , then the print data is printed through steps s 351 - s 361 without decrementing the remaining number of times of performing printing because the “ accounting data . doc ” has been stored previously . if the document title is not “ accounting data . doc ,” a new document title is stored and the image forming data is printed , in which case , the remaining number of times of performing printing is decremented . if restriction is set to the user , the operation mode is “ temporary permit mode ”, and the image forming data is color data , and if the operation mode is “ normal mode ” or the number of times of performing printing is “ 0 ”, then the image data is not printed . in the third embodiment , the permit information is a single item of information . instead , the permit information may be a combination of a plurality of items of information including , for example , a combination of restriction permit and a password . alternatively , step s 360 may be performed shortly after step s 354 so that printing may be carried out if the answer is yes at step s 366 and steps s 355 - s 357 are executed if the answer is no at step s 360 . this alternative allows printing without setting “ temporary permit mode ”. as described above , if user is desperate immediately , a user may be allowed to print even though the user is under print restriction . further , the image forming system of the third embodiment is capable of restricting the number of times of performing printing in “ temporary permit mode ”. if print data has the same document title as that printed last time , printing is allowed without decrementing the remaining number of ties of performing printing . this enables the document to be re - printed without decrementing the remaining number of ties of performing printing , for example , when a modification should be made to the document . fig1 is a block diagram illustrating an image forming system 210 of a fourth embodiment . the image forming system 210 differs from the image forming system 10 of the first embodiment in that a print time identifying section 218 is added to a client 213 and a time identifying section 216 is added to a printer 211 . elements similar to those of the image forming system 10 ( fig1 ) have been given the same reference numerals and their description ifs omitted . referring to fig1 , the client 213 incorporates the print time identifying section 218 in a printer driver 214 . the print time identifying section 218 identifies the time at which a user inputs a print command . an image forming data producing section 66 converts a variety of drawing instructions into commands as image forming data . the image data is in the format that can be interpreted in the printer . an image forming data producing section 66 also converts print processing information that can be interpreted in the printer 211 . the print processing information includes user information identified by a user identifying section 67 , an operation mode identified by an operation mode identifying section 68 , and a time - of - day of printing identified by the print time identifying section 218 . then , the image forming data producing section 66 combines these items of data into print data , and transmits the print data to the printer 211 . the printer 211 incorporates the time identifying section 216 in a print restriction information storing section 215 . fig1 illustrates a data structure as an example of print restriction information stored in a print restriction information storing section 54 . referring to fig1 , for individual users , the data structure includes individual users , their corresponding “ on ” states and “ off ” states of print restriction , restriction of the available amount of time for printing after the system enters “ temporary permit mode ”, and the time - of - day of printing at which the first printing is performed after the system enters the “ temporary permit mode ”. for “ smith ”, the print restriction is “ on ”, permit condition ( the available amount of time for printing is 60 minutes , and information is absent from the time - of - day of printing . the fact that the information is absent from the time - of - day of printing is that printing has not been performed in “ temporary permit mode ” yet . for the user “ lincoln ”, the print restriction is “ off ”. fig1 illustrates a data structure as an example of print data transmitted from the client 213 to the printer 211 . the print data transmitted from the client 213 includes user name =“ smith ”, operation mode =“ temporary permit mode ”, time - of - day of printing = 9 : 00 , in oct . 4 , 2005 , and image forming data =“ color data ”. the operation of the image forming system of the aforementioned configuration will be described . fig1 is a flowchart illustrating the operation of the client 213 . it is assumed that “ smith ” is subjected to print restriction . the operation of the client 213 will be described . “ smith ” is desperate to print immediately , and opens an operation mode setting screen ( fig4 ). the user selects the operation mode in the property of the printer driver 214 by clicking the checkbox of “ temporary permit mode ” ( step s 401 ). when an application outputs a print instruction , the user identifying section 67 obtains the user name , the name of pc , and pc address , and sends these items of information to , for example , the image forming data producing section 66 ( step s 403 ). the operation mode identifying section 68 reads the operation mode , which has been set at step s 401 , via the driver / user interface , and then sends the operation mode to the image forming data producing section 66 ( step s 404 ). the print time identifying section 218 identifies the time at which the application outputted the print instruction , and then transfers the identified time to the image forming data producing section 66 ( step s 405 ). the image forming data producing section 66 produces print data including image forming data ( i . e ., a variety of drawing instructions ), user information , operation mode , and time - of - day of printing that are in the format that can be interpreted in the printer 11 . then , the image forming data producing section 66 transmits the print data together with the user information and the operation mode to the printer 211 ( step s 406 ). after transmission of print data to the printer 211 , the printer driver 214 automatically resets the operation mode from “ temporary permit mode ” to “ normal mode ” ( step s 407 ). thus , when a print instruction is issued next , “ normal mode ” will be set unless the user sets “ temporary permit mode ” again . fig1 is a flowchart illustrating the operation of the printer 211 . the operation of the printer 211 will be described with reference to fig1 . the receiving section 51 receives the print data from the client 213 ( step s 451 ), and extracts the user information and the operation mode for the user from the commands contained in the received print data ( step s 452 ). then , the print restriction determining section 55 reads the permit condition ( available amount of time for printing and time - of - day of printing assigned to the user from the print restriction information storing section 54 ( step s 453 ). the print restriction determining section 55 then determines whether print restriction is set to the user ( i . e ., whether printing should be carried out ) ( step s 454 ). if the answer is no at step s 454 , the program proceeds to step s 461 where printing is performed immediately . if the answer is yes at step s 454 , a check is made to determine whether the image data is color data or monochrome data ( step s 455 ). if the image data is monochrome data , the program proceeds to step s 461 where printing is performed immediately . if the image data is color data , the program proceeds to step s 456 where a check is made to determine whether the operation mode is “ temporary permit mode ”. if the operation mode is “ normal mode ” ( no at step s 456 ), the area for the available amount of time for printing in the print restriction information ( step s 462 ) is emptied ( step s 462 ) and printing is not performed ( step s 463 ). if printing is not performed , the notifying section 56 notifies the display unit 57 that printing is not allowed ( step s 464 ). the display unit 57 displays to the user by means of a set of characters indicative that printing is not allowed ( step s 465 ). if the operation mode is “ temporary permit mode ” ( yes at step s 456 ), the time - of - day of printing information is extracted from the print data ( step s 457 ). the print restriction determining section 55 checks the memory area in the print information storing section 54 for the time - of - day of printing to determine whether a specific time has been stored in the area ( step s 458 ). if the area for the time - of - day of printing is empty due to the fact that printing has not been performed in “ temporary permit mode ” yet ( no at step s 458 ), the print information storing section 54 stores the time - of - day of printing read out at step s 457 into a corresponding area for the time - of - day of printing in the print restriction information ( fig1 ) ( step s 460 ), and the image forming section 58 performs printing ( step s 461 ). if printing has been performed in “ temporary permit mode ” and the time - of - day of printing for the print data has been stored ( yes at step s 458 ), the print restriction determining section 55 compares at step s 459 the print time read out at step s 457 with the time - of - day of printing stored in the area , thereby determining whether the time elapsed from the time - of - day of printing for the print data that has been printed to the time - of - day of printing for the print data that is going to be printed exceeds the available amount of time for printing ( 60 minutes ) read out at step s 453 . if the elapsed time has not exceeded the available amount of time for printing ( no at step s 459 ), printing is performed ( s 461 ). if the elapsed time has exceeded ( yes at step s 459 ), the program proceeds to step s 463 where printing is not performed . as described above , if “ smith ” is the user who has been set to print restriction , the operation mode is set to “ temporary permit mode ”, and the time - of - day of printing is “ 9 : 00 , oct . 4 , 2005 ”, then the area for the time - of - day of printing is empty in the print restriction information storing section 54 . thus , printing is performed by executing steps s 451 - s 458 and step s 460 to print the image forming data . during the printing , the time - of - day of printing “ 9 : 00 , oct . 4 , 2005 ” is stored into the area for the time - of - day of printing in the print restriction information storing section 54 . likewise , if the print data having a specific print time within 60 minutes of “ 9 : 00 , oct . 4 , 2005 ” is transmitted , steps s 451 - s 459 and s 461 are performed to print the image data as many times as required . if the print data has a time - of - day of printing later than “ 9 : 00 , oct . 4 , 2005 ”, the image forming data is not printed . in the fourth embodiment , the permit information is a single item of information . instead , the permit information may be a combination of a plurality of items of information including , for example , a password . steps s 457 - s 459 may be carried out after step s 454 , in which case , if yes at s 458 , then the program proceeds to step s 459 : if no at step s 458 , then the program proceeds to step s 455 . further , if yes at s 459 , then the program proceeds to step s 455 : if no , then printing is performed . as described above , if the user is desperate to print immediately , a user may be allowed to print even though the user has been under print restriction . further , the image forming system of the fourth embodiment is capable of setting available amount of time for printing after performing a printing operation in the temporary permit mode ”. instead of restricting the available amount of time for printing after a printing operation is performed in the “ temporary permit mode ”, the time interval between consecutive printing operations may be restricted . fig2 is a block diagram illustrating an information processing apparatus 250 of a fifth embodiment . the information processing apparatus 250 includes all the sections in the client 13 of the image forming system 10 and the following additional sections : a data analyzing section 52 , a color / monochrome data identifying section 53 , a print restriction determining section 55 , and a notifying section 56 . in the image forming system 10 of the first embodiment , the image forming section 58 performs printing in response to a print instruction received from the print restriction determining section 55 . in contrast , an image forming data outputting section 251 of the image processing apparatus 250 outputs image forming data in response to a print instruction received from the print restriction determining section 55 . the image processing apparatus 250 outputs the image forming data to the image processing section 252 , which in turn performs printing unconditionally . the remaining operation is exactly the same as the image forming system 10 of the first embodiment , and their description is omitted . the image processing apparatus 250 implements the tasks of sections other than the image forming section 58 in the image forming system of the first embodiment . just as in the printer 71 of the second embodiment ( fig7 ), a number - of - print permits determining section 73 of the second embodiment may be added to the image processing apparatus 250 so that the image processing apparatus 250 may operate in the same way as in the second embodiment . just as in the image forming system 110 ( fig1 ) of the third embodiment , the number - of - print permits determining section 73 , the document title identifying section 116 , document title identifying section 118 may be added to the image processing apparatus 250 so that the image processing apparatus 250 may operate in the same way as in the third embodiment . just as in the image forming system 210 ( fig1 ) of the fourth embodiment , time identifying section 216 , and the print time identifying section 218 may be added to the image processing apparatus 250 so that the image processing apparatus 250 may operate in the same way as in the fourth embodiment . the present invention may be applicable to not only printers but also to copying machines , faxes , and multifunction apparatus . fig2 is a block diagram illustrating a configuration of a sixth embodiment . referring to fig2 , a printing system 500 includes an administrator terminal 100 , an administration database server 200 , a user information database server 300 , user terminal 400 , and network 900 . the administrator terminal 100 takes the form of a personal computer ( pc ) connected to the network 900 . the administrator terminal 100 includes an operation section 101 , a registration section 102 , a transmitter 103 , and a network interface 104 . an administrator sends cancellation information to the administration database server 200 over the network 900 . the operation section 101 includes keyboard switches and a display device from which the administrator inputs various data such as user name , group name to which the user belongs , attribute of document , expiration date , print restriction list , and a quota on pages to print for the user . in other words , the operation section 101 is a man - machine interface for the administrator to communicate with the administrator terminal 100 . the registration section 102 is a section in which the administrator terminal 100 performs computer - based functions . a cpu , not shown , reads a control program stored from a rom , not shown , and executes the program to display a predetermined screen on the operation section 101 and to produce a registration request , based on various items of data received through the operation section 101 . the transmitter 103 receives the registration request from the registration section 102 , produces a registration requesting signal in the form of a packet , and sends the registration requesting signal to the network interface 104 . the network interface 104 is a network interface between the administrator terminal 100 and the network 900 . the network interface 104 receives the registration requesting signal from the transmitter 103 , and sends the registration requesting signal to the network 900 . the administration database server 200 includes a network interface 211 , a cancellation encoding section 212 , a cancellation code processing section 213 , an administration database 214 , and a cancellation code obtaining section 215 . the administration database server 200 is a server that encodes the registration request to produce a cancellation code , and register the cancellation code therein . upon a request from the user terminal 400 , the administration database server 200 sends a cancellation code signal to the user terminal 400 . the network interface 211 is a network interface that connects the administration database server 200 and the network 900 . in accordance with a predetermined protocol , the network interface 211 receives the registration requesting signal and a cancellation code requesting signal , and sends a cancellation code signal to the network 900 . the cancellation encoding section 212 encodes the content of the registration request in the registration requesting signal received from the network interface 211 , thereby producing the cancellation code . the cancellation code processing section 213 is a computer - based function performed in the administration database server 200 . specifically , a cpu , not shown , reads a control program from a rom , not shown , and executes the program to implement the function in which the cancellation encoding section 212 encodes the content of the registration request and produces the cancellation code , and a function in which the cancellation code processing section 213 registers the cancellation code with the administration database 214 and manages the registered cancellation code . the administration database 214 receives the cancellation code from the cancellation code processing section 213 , and stores the cancellation code therein . fig2 a and 22b illustrate data registered with the administration database 214 . for example , fig2 a illustrates cancellation information including user name , group name to which the user belongs , attribute of document , expiration data of document , print restriction list , and quota on pages to print for the user . the cancellation information is input via the network interface 211 . then , the cancellation encoding section 212 produces the cancellation code based on the cancellation information . by using lossless data compression , each item of the cancellation information coded in ascii is converted into a series of bytes , which is the cancellation code . the thus obtained cancellation code and the user name and group name are combined into a data structure in fig2 b , which is stored in the administration database 214 . referring back to fig2 , the cancellation code obtaining section 215 is a computer - based functions performed in the administration database server 200 . specifically , a cpu , not shown , reads a control program stored from a rom , not shown , and executes the program to produce a cancellation code signal based on the various data received from the administrator . in other words , the cancellation code obtaining section 215 receives the cancellation code requesting signal from the user terminal 400 through the network 900 and network interface 211 , and then reads a cancellation code from the administration database 214 . the cancellation code obtaining section 215 then sends the cancellation code as a cancellation code signal to the user terminal 400 . the user information database server 300 includes a network interface 321 , a user information obtaining section 322 , a user information database 323 , a decoding section 324 , and a code inputting section 325 . the user information database server 300 stores the user restriction information . the user information database server 300 produces restriction cancellation information for each user based on a cancellation request received from the cancellation code inputting section 433 of the user terminal 400 , the cancellation request indicating that the user requests cancellation of restriction . the restriction cancellation information includes information on specific print restrictions placed on individual users and information on cancellation of the specific print restrictions . the network interface 321 is an interface located between the user information database server 300 and the network 900 . the network interface 321 receives a cancellation request and a print request from the network 900 . also , the network interface 321 sends a cancellation signal to the network 900 . the decoding section 324 decodes the content of the cancellation request received from the network interface 321 to produce restriction cancellation information . the code inputting section 325 is a computer - based function performed in the user information database server 300 . specifically , a cpu , not shown , reads a control program stored from a rom , not shown , and executes the control program in which the decoding section 324 encodes the cancellation request to produce the restriction cancellation information . the code inputting section 325 registers the restriction cancellation information with the user information database 323 , and manages the registered restriction cancellation information . the user information database 323 is a database ( i . e ., memory ) that receives the restriction cancellation information from the code inputting section 325 and stores the restriction cancellation information and its history record . fig2 illustrates an example of the restriction cancellation information in the user information database 323 . referring to fig2 , the restriction cancellation information includes a user name , group name to which the user belongs , print restriction list , a valid cancellation code list , an invalid cancellation code list , which have been decoded and still held in corresponding memory areas . the invalid cancellation code list is a list of the cancellation codes that were inputted in the past and are now invalid . referring back to fig2 , upon receiving the print request from the user terminal 400 via the network 900 and the network interface 321 , the user information obtaining section 322 reads the restriction cancellation information from the user information database 323 and sends the restriction cancellation information as a cancellation signal to the user terminal 400 . the user information obtaining section 322 is a computer - based function performed in the user information database server 300 . specifically , a cpu , not shown , reads a control program stored from a rom , not shown , and executes the control program to implement the function in which the user information database 323 is produced . the user terminal 400 includes a network interface 431 , a cancellation code obtaining section 432 , a cancellation code inputting section 433 , a print setting processing section 420 , and a printer driver 430 . the user terminal 400 sets print settings in response to a print command based on the restriction cancellation information for each user , and produces print data based on the print settings before outputting the print data to a print engine , not shown . the network interface 431 is a network interface that connects the user terminal 400 to the network 900 . the network interface 431 receives the cancellation signal and cancellation code signal from the network 900 , and sends a print request and a cancellation request to the network 900 . in response to a request from the user input from an operating means , not shown , the cancellation code obtaining section 432 sends a cancellation code requesting signal that specifies the user name and the group name to which the user belongs , to the administration database server 200 via the network interface 431 and the network 900 , thereby obtaining the cancellation code associated with the user . the cancellation code corresponds to the cancellation code requesting signal . the cancellation code obtaining section 432 is a computer - based function performed in the user terminal 400 . specifically , a cpu , not shown , reads a control program stored from a rom , not shown , and executes the program to implement the function . in accordance with the user &# 39 ; s choice , the cancellation code inputting section 433 receives a cancellation code that the user requests the user information database server 300 to store , the cancellation code being selected from among the cancellation codes associated with users which the cancellation code obtaining section 432 obtained . the cancellation code inputting section 433 is a computer - based function performed in the user terminal 400 . specifically , a cpu , not shown , reads a control program stored from a rom , not shown , and executes the program to implement the function . a print commanding section 434 monitors print commands that are received from a host apparatus , not shown , or users via the operating means . upon detecting a print command , the print commanding section 434 identifies the user name and the attribute of document , produces a print request , and sends the print request to a controller 435 . a print setting processing section 420 includes the controller 435 , a code selecting section 436 , and a number - of - copies inputting section 437 . in accordance with the restriction cancellation information under management of the user information database server 300 , the print setting processing section 420 sets a print setting in response to the print request received from the print commanding section 434 . this print setting is a print setting that has been previously assigned to the user . upon receiving the print request from the print commanding section 434 , the controller 435 obtains the restriction cancellation information from the user information database server 300 via the network 900 and the network interface 431 in accordance with the user name contained in the print request . then , the controller 435 prompts the user to make selection and decision via the code selecting section 436 and the number - of - copies inputting section 437 , and produces a print setting in accordance with the user &# 39 ; s selection and decision . then , the controller 435 sends the print setting to print settings specifying section 441 , and updates the content of the user information database 323 . the code selecting section 436 displays the restriction cancellation information , which was obtained by the controller 435 , on a display means , not shown , so that the user can select a cancellation code specified by the print request . the number - of - copies inputting section 437 displays the restriction cancellation information , which was obtained by the controller 435 , on a display means , not shown , prompting the user to select the number of pages that requires cancellation of restriction code specified by the print request . the printer driver 430 includes a print settings specifying section 441 , a document receiving section 442 , a rendering section 443 , and an image outputting section 444 . under control of the print setting processing section 420 , the printer driver 430 outputs print data to the print engine through the document receiving section 442 . the document receiving section 442 receives a document to be printed from the host apparatus . under the control of the controller 435 , the print settings specifying section 441 provides the printing setting for the document to be printed to the rendering section 443 . in accordance with the print settings received from the print settings specifying section 441 , the rendering section 443 converts the document into an image ( i . e ., print data ) that can be printed by the print engine . the operation of the printing system 500 will be described in terms of ( 1 ) cancellation code registering processing activated by the system administrator registers , ( 2 ) cancellation code obtaining processing activated by the user , ( 3 ) cancellation code inputting process activated by the user , and ( 4 ) printing . fig2 a is a flowchart illustrating the cancellation code registering processing . fig2 b illustrates an example of a cancellation information inputting screen . the flowchart in fig2 a illustrates the operation in which the system administrator registers a cancellation code with the administration database server 200 from the administrator terminal 100 . when the system administrator depresses a predetermined key on the operation section 101 , a cpu activates a program for registering cancellation information so that the registration section 102 begins to operate . the registration section 102 displays the screen in fig2 b on the display unit of the operation section 101 , prompting the system administrator to input predetermined information including the user name ( e . g ., smith ), the group name to which the user belongs ( e . g ., department of soft ware ), the attribute of document ( e . g ., word ), the expiration date ( e . g ., 2005 / 12 / 31 ), print restriction list ( e . g ., color , n - up ), and quota on pages to print for the user ( e . g ., 20 pages ). if the system administrator clicks on a button “ ok ” after having inputted the necessary information , the program proceeds to step s 505 . if the button “ ok ” is not pressed , the program proceeds to step s 504 . if the system administrator clicks a button “ cancel ”, the program ends . if the answer is no , then the program returns to step s 503 . the transmitter 103 converts the information inputted by the system administrator into the registration requesting signal in the form of a packet , and sends the thus produced signal to the network interface 104 and then to the administration database server 200 via the network 900 . the cancellation encoding section 212 encodes the content of the registration requesting signal into a cancellation code , for example , in the form of “ cancellation code xxxyyyzzz : user name = john smith ; group name = department of soft ware ; attribute of document = word , expiration date of document = 2005 / 12 / 31 ; print restriction list = color , n - up ; and the number of pages permitted to print = 20 pages ”. the cancellation code processing section 213 stores this cancellation code into the administration database 214 . fig2 a is a flowchart illustrating the cancellation code obtaining processing . fig2 b illustrates an example of a cancellation information inputting screen . the flowchart in fig2 a illustrates the operation in which the user obtains all the cancellation codes associated with the user from the administration database server 200 and selects his desired cancellation code from among the cancellation codes . when the user depresses a predetermined key on the user terminal 400 , a cpu activates a program for requesting to obtain a cancellation code so that the cancellation code obtaining section 432 begins to operate . the cancellation code obtaining section 432 displays the screen in fig2 b on the display unit of the operation section 101 , prompting the user to input predetermined information including the user name ( e . g ., smith ) and the group name to which the user belongs ( e . g ., department of soft ware ). when the user clicks on the button “ ok ” after inputting the user name and the group name to which the user belongs , the cancellation code obtaining section 432 sends the cancellation code requesting signal to the administration database server 200 via the network interface 31 and the network 900 . the cancellation code obtaining section 215 receives the cancellation code requesting signal via the network interface 31 and the network 900 . based on the content of the cancellation code requesting signal , the cancellation code obtaining section 215 searches the cancellation codes registered in the administration database 214 to determine whether the administration database 214 has the cancellation code that coincides the content of the cancellation code requesting signal in fig2 b . if yes , the program proceeds to step s 516 ; if no , the program proceeds to step s 517 . here , assume that the following cancellation code has been registered . “ cancellation code xxxyyyzzz : user name = john smith ; group name = department of soft ware ; attribute of document = word , expiration date of document = 2005 / 12 / 31 ; print restriction list = color , n - up ; and the number of pages permitted to print = 20 pages ”. the cancellation code obtaining section 215 reads all the cancellation codes that coincide with that in the cancellation code requesting signal from the administration database 214 . then , the cancellation code obtaining section 215 produces a cancellation code signal in the form of a packet , and sends the cancellation code signal to the cancellation code obtaining section 432 through the network interface 211 and over the network 900 . the cancellation code obtaining section 215 produces an invalidity notification and sends the invalidity notification to the network interface 31 through the network interface 211 and over the network 900 . the cancellation code obtaining section 432 receives the cancellation code signal or the invalidity notification over the network 900 and through the network interface 31 . the cancellation code obtaining section 432 displays the content of the cancellation code signal or invalidity notification on a display unit of an operating means , not shown . here , “ cancellation code xxxyyyzzz ” appears on the display unit . fig2 a is a flowchart illustrating the cancellation code inputting process performed by the user . fig2 b illustrates an example of a cancellation code inputting screen . this screen is a screen via which the user inputs a request for cancellation of restriction . the flowchart in fig2 a illustrates the operation in which the user selects the only necessary one ( s ) of all the cancellation codes associated with the user from the administration database 214 , and inputs the selected ones ) as a cancellation code issued by the user into the user information database 323 . when the user depresses a predetermined key on the user terminal 400 , a cpu , not shown , activates a program for inputting cancellation code requested by the user so that the cancellation code inputting section 433 begins to operate . the cancellation code inputting section 433 displays the screen in fig2 b on the display unit of the operation section 101 , prompting the user to input the user name and the cancellation code . when the user clicks on the button “ ok ” in the screen , after inputting the necessary information , e . g ., the user name and “ cancellation code xxxyyyzzz ”, the cancellation code inputting section 433 sends a cancellation code inputting signal to the administration database server 200 through the network interface 31 and over the network 900 . the code inputting section 325 receives the cancellation code inputting signal over the network 900 and through the network interface 211 . the decoding section 324 begins to decode the content of the cancellation code inputting signal . using the information ( user name and cancellation code , the code inputting section 325 compares the content of the cancellation code issued by the user with the content of the cancellation code stored in the user information database 323 at steps s 527 to s 531 . assume that the cancellation code issued by the user is “ cancellation code xxxyyyzzz : user name = john smith ; group name = department of soft ware ; attribute of document = word , expiration date of document = 2005 / 12 / 31 ; print restriction list = color , n - up ; and the number of pages permitted to print = 20 pages ”, and the user information database 323 stores the valid cancellation code list , e . g ., “ cancellation code aaabbbccc : user name = john smith ; group = department of soft ware ; attribute of document = pdf , expiration date of document = 2005 / 11 / 01 ; print restriction list = color , duplex printing ; and the number of pages permitted to print = 15 pages ”. also assume that the user information database 323 stores “ cancellation code mmmnnnooo ” and “ cancellation code pppqqqrrr ” that have been previously stored . the code inputting section 325 checks whether the content of the cancellation code is before the expiration date . if yes , the program proceeds to step s 528 and if no , the program proceeds to step s 533 . the code inputting section 325 checks whether the content of the cancellation code issued by the user is one of the “ cancellation codes that have been previously stored in the user information database 323 . if no , the program proceeds to step s 529 and if yes , the program proceeds to step s 533 . the code inputting section 325 checks whether the content of the cancellation code is one of the valid cancellation codes . if no , the program proceeds to step s 530 and if yes , the program proceeds to step s 533 . the code inputting section 325 checks whether the user name of the cancellation code is valid . if yes , the program proceeds to step s 531 and if no , the program proceeds to step s 533 . the code inputting section 325 checks whether the group name of the cancellation code is valid . if no , the program proceeds to step s 532 and if yes , the program proceeds to step s 533 . the code inputting section 325 adds the cancellation code inputted by the user ( cancellation code requested by the user and the information obtained from the results obtained by decoding the cancellation code inputted by the user , into the valid cancellation code list . here , the valid cancellation code is , for example , “ cancellation code xxxyyyzzz : user name = john smith ; group name = department of soft ware ; attribute of document = word , expiration date of document = 2005 / 12 / 31 ; print restriction list = color , n - up ; and the number of pages permitted to print = 20 pages ”. in other words , this valid cancellation code is added to the valid cancellation code list in addition to the “ cancellation code aaabbbccc : user name = john smith ; group name = department of soft ware ; attribute of document = pdf , expiration date of document = 2005 / 11 / 01 ; print restriction list = color , duplex ; and the number of pages permitted to print = 15 pages ”. the code inputting section 325 discards the cancellation code . for example , if the cancellation code is “ cancellation code xxxyyyzzz : user name = betty smith ; group name = department of soft ware ; attribute of document = word , expiration date of document = 2005 / 12 / 31 ; print restriction list = color , n - up ; and the number of pages permitted to print = 20 pages ”, the user name is not coincident . thus , the cancellation code is discarded . the code inputting section 325 sends a result notification which indicates the result of step s 533 or step s 532 to the user terminal 400 through the network interface 321 and over the network 900 . the cancellation code inputting section 433 receives the result notification which indicates the results of step s 533 or step s 532 through the network interface 431 and over the network 900 . the cancellation code inputting section 433 displays the content of the result notification on the display unit , thereby indicating the result to the user . fig2 is an initial portion of a flowchart illustrating the printing operation . fig2 is an additional portion of the flowchart of fig2 . fig2 illustrates the operation of the user terminal 400 and fig2 illustrates the operation of the user information database server 300 . the print commanding section 434 detects a print command from the user or a host apparatus , not shown . upon detecting the print command , the print commanding section 434 produces a print request that identifies the user name and the attribute of document , and sends the print request to the controller 435 . here , assume that print request identifies the user name = john smith and attribute of document = word ). the controller 435 sends the print request to the user information database server 300 through the network interface 431 and over the network 900 . the user information obtaining section 322 of the user information database server 300 receives the print request over the network 900 and through the network interface 321 . using the user name and attribute of document that are identified by the print request , the user information obtaining section 322 reads the restriction cancellation information from the user information database 323 ). here , the restriction cancellation information is read using the user name = john smith and attribute of document = word . the user information obtaining section 322 checks the restriction cancellation information read from the user information database 323 to determine whether a valid cancellation code out of the expiration date exists . if yes , the program proceeds to step s 548 ; if no , the program proceeds to step s 547 . the user information obtaining section 322 makes a decision to determine whether a valid cancellation code having no quota on pages to print for the user exists in the restriction cancellation information . if yes , the program proceeds to step s 548 ; if no , the program proceeds to step s 549 . the user information obtaining section 322 moves the valid cancellation code having no quota on pages for the user into the invalid cancellation code list . the user information obtaining section 322 reads the content of the valid cancellation code list ( fig2 ) and produces the cancellation signal . then , the user information obtaining section 322 sends the cancellation signal to the controller 435 of the user terminal 400 through the network interface 321 and over the network 900 . for example , the user information obtaining section 322 reads “ cancellation code xxxyyyzzz : user name = john smith ; group name = department of soft ware ; attribute of document = word , expiration date of document = 2005 / 12 / 31 ; print restriction list = color , n - up ; and the number of pages permitted to print = 20 pages ” is , the user name is not coincident . thus , the cancellation signal is produced based on this cancellation code xxxyyyzzz . the controller 435 receives the valid cancellation code list over the network 900 and through the network interface 31 . the code selecting section 436 displays the list of the cancellation signals that the controller 435 received on a display means , not shown , prompting the user to select a cancellation code that needs to be cancelled in accordance with the current print request . if the user makes a selection , the program proceeds to step s 552 ; if the user does not make a selection , the program proceeds to step s 558 . the code selecting section 436 makes a decision to determine whether the selected cancellation code is appropriate for the document to be printed . if yes , then the program proceeds to step s 553 ; if no , the program returns to step s 551 . the number - of - copies inputting section 437 displays the content of the restriction cancellation information that the controller 435 obtained on a display means , not shown , prompting the user to input the necessary number of pages for which cancellation of restriction should be cancelled in accordance with the current print request . here , assume that the user inputs “ 8 pages ”. the number - of - copies inputting section 437 makes a decision to determine whether the number of pages inputted is larger than the quota on pages for the user . if no , the program returns to step s 553 ; if yes , the program proceeds to step s 555 . the controller 435 produces a user information database updating request by subtracting the inputted number of pages from the quota on pages for the user . in other words , the user information database updating request indicates a remaining number of pages that the user is allowed to print . the controller 435 sends the user information database updating request to the user information obtaining section 322 through the network interface 31 and over the network 900 . then , the program proceeds to step s 560 . here , the difference between the quota on pages for the user and the number of pages inputted is 20 − 8 = 12 . the user information obtaining section 322 receives the user information database updating request over the network 900 and through the network interface 321 . the user information obtaining section 322 updates the user information database 323 with the content of the user information database updating request , and completes the flow on the user information database server 300 side . here , assume that “ cancellation code xxxyyyzzz : user name = john smith ; group name = department of soft ware ; attribute of document = word , expiration date of document = 2005 / 12 / 31 ; print restriction list = color , n - up ; and the quota on pages for the user = 20 pages ” is updated to “ cancellation code xxxyyyzzz : user name = john smith ; group name = department of soft ware ; attribute of document = word , expiration date of document = 2005 / 12 / 31 ; print restriction list = color , n - up ; and the quota on pages for the user = 12 pages ”. the controller 435 discards the received valid cancellation code list . the controller 435 notifies the printer driver 430 of the selected print setting . as described above , the printing system of the sixth embodiment includes the administration database server 200 , the user information database server 300 , and the print setting processing section 420 . despite the fact that users are individually forced to limited a print setting , the print restriction may be cancelled temporarily if certain conditions are met . thus , the sixth embodiment offers a more flexible print environment to the users . in the sixth embodiment , only the administrator is allowed to register a cancellation code with an administration database server 700 . in a seventh embodiment , an assistant administrator is also allowed to register the cancellation code with the administration database server 700 . therefore , a printing system 1000 of the seventh embodiment is configured such that the assistant administrator is also allowed to register the cancellation code with the administration database server 700 . fig2 is a block diagram illustrating the printing system of the seventh embodiment . referring to fig2 , the printing system 1000 includes a administrator terminal 600 , a administration database server 700 , a user information database server 300 , user terminal 400 , network 900 , and an assistant administrator terminal 800 . elements similar to those of the sixth embodiment have been given the same reference numerals and their description is omitted . the administrator terminal 600 includes an operation section 101 , a registration section 602 , an assistant administrator registering section 651 , a transmitter 652 , and a network interface 604 . the administrator sends cancellation information to an administration database server 700 over the network 900 . the assistant administrator is allowed to register the cancellation code from one of the personal computers connected to the network 900 . the assistant administrator registering section 651 registers the assistant administrator with the administration database server 700 , so that not only the administrator but also the assistant administrator may register cancellation codes with the administration database server 700 . the assistant administrator registering section 651 is a computer - based function performed in the administrator terminal 600 . specifically , a cpu , not shown , reads a control program stored from a rom , not shown , and executes the program to implement the function . the transmitter 652 receives a registration request from the registration section 102 , and produces a registration requesting signal in the form of a packet . the transmitter 652 then sends a registration requesting signal to the network interface 604 . the transmitter 652 also receives an assistant administrator registration request from the assistant administrator registering section 651 , produces an assistant administrator registration requesting signal , and sends the assistant administrator registration requesting signal to the network interface 604 . the administration database server 700 includes a network interface 711 , a cancellation code processing section 658 , an administration database 714 , a cancellation code obtaining section 715 , an assistant administrator registering section 759 , and an assistant administrator database 760 . the administration database server 700 produces a cancellation code by encoding a request for cancellation of restriction , which is issued by the administrator or assistant administrator , into a cancellation code . the thus encoded cancellation code is registered with the administration database 714 . an assistant administrator who was requested by the administrator is registered with the assistant administrator database 760 . the administration database server 700 also sends a cancellation code signal to the user terminal 400 in response to a request from the user terminal 400 . the cancellation code processing section 758 is a section in which the administration database server 700 performs computer - based functions . specifically , a cpu , not shown , reads a control program stored from a rom , not shown , and executes the program to implement the computer - based functions . specifically , a cancellation encoding section 712 encodes the content of the registration request to produce the cancellation code , registers the thus produced cancellation code with the administration database 714 , and manages the registered cancellation code . the seventh embodiment has a function of determining whether the registration request is issued by the administrator or the assistant administrator . the assistant administrator registering section 759 is a section in which assistant administrator information is registered with an assistant administrator database 760 in accordance with the content of an assistant administrator registration requesting signal . the assistant administrator database 760 is a database ( i . e ., memory ) that stores the assistant administrator information received from the assistant administrator registering section 759 . the assistant administrator information includes , for example , the user name , acceptable group name , and the number of pages that may be permitted to actually print . here , the user name is the name of the administrator . acceptable group name is the name of a group whose members are allowed to print . the assistant administrator terminal 800 includes an operation section 853 , a registration section 854 , a transmitter 855 , and a network interface 856 . the assistant administrator sends the cancellation information to the administration database server 700 over the network 900 . the assistant administrator terminal 800 is implemented by one of the personal computers connected to the network 900 . the operation section 853 includes keyboard switches and a display device from which the administrator inputs various data such as user name , group name to which the user belongs , attribute of document , expiration date , print restriction list , and the quota on pages for the user . in other words , the operation section 853 is a man - machine interface for the assistant administrator to communicate with the assistant administrator terminal 800 . the registration section 854 is a computer - based function in the assistant administrator terminal 800 . specifically , a cpu , not shown , reads a control program stored from a rom , not shown , and executes the program to implement the function . specifically , the registration section 854 displays a predetermined screen on the operation section 853 , and produces a registration request based on the various data received from the assistant administrator . the transmitter 855 receives the registration request from the registration section 854 and produces the registration requesting signal . then , the transmitter 855 sends the registration requesting signal to the network interface 856 . the network interface 56 is located between the assistant administrator terminal 800 and the network 900 , and connects the assistant administrator terminal 800 to the network 900 . the network interface 856 receives the registration requesting signal from the transmitter 55 , and provides the registration requesting signal to the network 900 . the operation of the printing system 1000 will be described in terms of ( 1 ) an assistant administrator information registering processing performed by the system administrator and ( 2 ) a cancellation code registering processing performed by the system administrator or assistance administrator . fig3 a is a flowchart illustrating the assistant administrator information registering processing . the flowchart in fig3 a illustrates the operation in which the system administrator registers the assistant administrator information with the administration database server 700 . fig3 b illustrates an example of a screen for inputting the assistant administrator information , i . e ., an assistant administrator information inputting screen . when the system administrator depresses a predetermined key on the operation section 101 of the administrator terminal 600 , a cpu , not shown , activates a program for requesting registration of assistant administrator information so that the assistant administrator registering section 651 begins to operate . the assistant administrator registering section 651 displays an assistant administrator information inputting screen in fig3 b on a display unit of the operation section 101 , prompting the system administrator to input various data including the user name , acceptable group name , and the number of pages that may be permitted to actually print . when the system administrator clicks on a button “ ok ” on the assistant administrator information inputting screen after having inputted the necessary data , the transmitter 652 receives an assistant administrator registration request from the assistant administrator registering section 651 , and produces an assistant administrator registering signal . then , the transmitter 652 sends the assistant administrator registering signal to the administration database server 700 through the network interface 604 and over the network 900 . the assistant administrator registering section 759 receives the assistant administrator registering signal over the network 900 and through the network interface 211 . the assistant administrator registering section 759 stores the assistant administrator information , extracted from the assistant administrator registering signal , into the assistant administrator database 760 . fig3 a is an initial portion of a flowchart illustrating the cancellation code registering processing . fig3 a is a flowchart illustrating the operation of the administrator terminal 600 or the assistant administrator terminal 800 . fig3 b illustrates an example of a cancellation information inputting screen . fig3 is an additional portion of the flowchart of fig3 a illustrating the operation of the administration database server 700 . fig3 a and fig3 illustrates the operation in which the system administrator registers a cancellation code with the administration database server 700 from the administrator terminal 600 or the assistant administrator registers a cancellation code with the administration database server 700 from the assistant administrator terminal 800 . the operation in which the system administrator registers the cancellation code is essentially the same as that in which the assistant administrator registers the cancellation code . therefore , a description will be given of the operation in which the system administrator registers the cancellation code . the operation performed by the assistant administrator is described in brackets . when the system administrator depresses a predetermined key on the operation section 601 of the administrator terminal 600 , a cpu , not shown , activates a program for registering cancellation information so that the registration section 602 begins to operate . the registration section 602 ( or 854 ) displays the cancellation information inputting screen in fig3 b on a display unit of the operation section 601 , prompting the system administrator to input the necessary data including the user name , group name to which the user belongs , attribute of document , expiration date , print restriction list , and the quota on pages for the user . if the system administrator clicks on the button “ ok ” in the screen after having inputted all the information , the program proceeds to step s 2 - 15 . if no , the program proceeds to step s 2 - 14 . if the system administrator clicks on “ cancel ” in the screen , the program proceeds to step s 2 - 27 . if no , the program returns to step s 2 - 13 . the transmitter 652 ( or 855 ) converts the information inputted by the system administrator ( or assistant administrator ) into a registration requesting signal in the form of a packet , and sends the thus produced registration requesting signal to the administration database server 700 through the network interface 604 and then over the network 900 . the cancellation code processing section 758 receives the registration requesting signal over the network 900 and through the network interface 711 . the cancellation code processing section 658 detects the source of the registration requesting signal , and makes a decision determine whether the source is the administrator or not . if the source is an administrator , the program proceeds to step s 2 - 18 . if the source is not an administrator , the program proceeds to step s 2 - 20 . the cancellation code processing section 758 controls the cancellation encoding section 712 to encode the content of the registration requesting signal . the cancellation code processing section 758 adds the encoded content as a cancellation code , which is a combination with the user name and group name , to the administration database 714 . the cancellation code processing section 758 consults the assistant administrator database 760 for the user name of the source . a decision is made to determine whether the source of the registration requesting signal is the assistant administrator . if yes , the program proceeds to step s 2 - 22 . if no , the program proceeds to step s 2 - 24 . the cancellation code processing section 758 compares the quota on pages for the user contained in the cancellation information with the number of pages permitted to actually print , stored in the assistant administrator database 760 . if yes , then the program proceeds to step s 2 - 23 . if no , the program proceeds to step s 2 - 24 . the cancellation code processing section 758 compares the group name contained in the cancellation information with the group name stored in the assistant administrator database 760 . if they coincide , then the program proceeds to step s 2 - 18 . if they don &# 39 ; t coincide , the program proceeds to step s 2 - 24 . the cancellation code processing section 758 discards the registration request , and the program proceeds to step s 2 - 25 . the cancellation code processing section 758 sends a reply ( i . e ., acceptance or rejection ) to the registration request to the administrator terminal 600 ( or assistant administrator terminal 800 ) through the network interface 711 and over the network 900 . the transmitter 652 ( or 855 ) receives the result notification ( i . e ., acceptance or rejection ) to the registration request over the network 900 and through the network interface 604 ( or network interface 856 ). the transmitter 652 ( or 855 ) displays the result notification on the display unit of the operation section 601 . as described above , an assistant administrator may be assigned , thereby decreasing the burden of the system administrator . the seventh embodiment provides more flexible printing environment to the users . while the present invention has been described in terms of a printer , the invention may also be applicable to copying machines and multifunction printers . | 6 |
fig1 shows a microfiche carrier 10 that takes the form of a plate having a transparent portion 11 , adapted to receive a microfiche 12 , and an opaque portion 13 . carrier 10 may be formed in any suitable manner , such as by bonding two sheets 14 of a transparent , flexible , slippery material such as mylar to an opaque sheet 15 of celluloid or other more rigid plastic material so that the two transparent sheets form a folder as shown in fig1 . alternatively , a single transparent sheet can be folded over upon the more rigid plastic material in such a manner that a transparent pocket is formed in the carrier . in any case , the resultant microfiche carrier is a relatively rigid plate in the transparent portion of which a microfiche can be suitably positioned and contained . microfiche carrier 10 has two detent elements 16 and 17 , positioned at respective front corners thereof and cut - outs 18 and 19 at the rear corners . the illustrated detent elements each comprise an outer flexible leg 20 that can flex transversely , in the manner of a clothes pin . this flexing movement is permitted by a hole - and - slot arrangement 21 . each flexible leg 20 has , on its outer edge , a detent concavity 22 , and also has , at its outer end portion , a chamfer 23 . microfiche carrier 10 also has a coding tab 24 on its front edge . the coding tabs are located at different positions along the front edge of the microfiche carriers so that each tab is offset horizontally from every other tab in a set of carriers . in use the microfiche carrier of fig1 containing a microfiche is placed , along with other microfiche carriers comprising a set , into a magazine . because a standard sized carrier is used , microfiche having differing sizes and formats can be intermixed within the magazine . fig2 shows a magazine 30 in which the front corners and one rear corner have been partially broken away . magazine 30 holds a plurality of microfiche carriers 10 . a portion of the microfiche carriers have also been broken away at the rear corner of magazine 30 . each individual carrier contains an individual microfiche 12 . the individual microfiche carriers 10 as shown lay on each other without separation . if desired , the magazine may be divided into compartments by means of a suitable separator in order to reduce the weight of the plurality of carriers upon the bottom carrier in each compartment . magazine 30 may hold about thirty carriers , and be about five - eighths of an inch in height . magazine 30 contains side walls 31 and 32 , top 33 , bottom 34 and front wall 35 containing window 36 . the back of magazine 30 is open . the side walls 31 and 32 contain vertically extending protruding arcuate detent elements 37 and 38 . the top 33 contains cut - outs 39 at each of the rear corners . to load magazine 30 the microfiche carriers 10 are inserted into the open back of magazine 30 with the opaque portion 13 containing flexible legs 20 and tab 24 facing towards the front of magazine 30 . when chamfers 23 of flexible legs 20 abut the vertically extending protruding arcuate detent elements 37 and 38 on the side walls 31 and 32 of magazine 30 , the flexible legs 20 flex inwardly until the movement of microfiche carrier 10 causes detent elements 37 and 38 to engage detent concavities 22 of flexible legs 20 and hold each microfiche carrier 10 securely in place within magazine 30 . coding tabs 24 of the various microfiche carriers 10 extend outwardly through window 36 of front wall 35 of magazine 30 . these coding tabs are short enough so that they do not extend beyond the limits of the magazine . moreover , the various coding tabs are shown to be staggered or offset horizontally from each other to enable convenient selection of a desired microfiche . this selection can be performed manually or , if desired , by means of a vertically oriented pusher bar which is moved transversely of magazine 30 and by means of which sufficient force can be exerted upon the selected coding tab to disengage the detent concavities 22 of the selected microfiche carrier 10 from the detent elements 37 and 38 of magazine 30 and to partially eject the selected carrier out of the open back of the magazine . the disclosed invention provides many advantages over prior art systems . first of all , it protects individual microfiche . second , the disclosed microfiche carrier permits the intermixing of microfiche having differing sizes and formats . third , it permits the selection and display of any selected frame in a random access manner . fourth , it permits unlimited storage by having the magazine separate from the readout and display device and permits the magazine to assume any reasonable size . fifth , the file integrity is protected , because the microfiche are contained in a magazine capable of retaining an entire file or at least a substantial part thereof . sixth , the data are easily updated by removing a given microfiche carrier and replacing the microfiche contained therein with an updated microfiche . this invention has been described with reference to certain specific embodiments and to various suggested conditions of operation . however , other embodiments can be utilized in the practice of this invention . it is therefore intended that this invention is not to be limited except as defined in the following claims . | 1 |
in one embodiment , as shown in fig1 , an imaging apparatus 2 includes an imaging device 4 with a radiation source 6 , a radiation detector 8 , and a collimator 10 . the imaging device 4 may be an x - ray machine . the apparatus 2 may be controlled by a control unit 12 that includes a processing unit 14 . a patient 18 positioned on a patient positioning table 16 may be moved into a beam path 20 emitted by a radiation source 6 . a series of recordings of a region under examination of the patient 18 may be made using the imaging device 4 . an image sequence may be recorded during a medical intervention with continuous irradiation of the patient 18 . a method for capturing an image sequence is shown in the block diagram of fig2 a . a reference image b r with high image sharpness is taken with a high radiation dose d h ( see fig2 c ). the reference image b r may be stored and / or displayed on a display 22 . the display 22 provides the treating physician with visual assistance during the medical intervention . a series of current images b a of the entire region under examination may be taken . the current images b a may correspond to the reference image b r with respect to their size and position relative to the patient . a lower radiation dose d n is used . for example , the current images b a are less sharp . the processing unit 14 may automatically compare each of the current images b a with the reference image b r in respect of a visualization parameter , for example , the grayscale value of each image pixel . a predefined adjustable threshold value may be used for the comparison . if the two images coincide , for example , if the changes in the current image b a are below the threshold value , a further current image b a is taken . if changes exceeding the threshold value are detected in the current image b a compared to the reference image b r , depending on the position of these changes , an image detail 24 is captured using a high radiation dose . in the current image b a according to fig2 a , the changes are in a first quadrant i of the image b a . the control unit 12 accordingly controls the collimator 10 to mask out part of the beam path 20 . only the first quadrant i is captured as an image detail 24 . the size of an aperture 26 of the collimator 10 may be adjusted so that only a quarter of the total image , such as the first quadrant i , is captured . the image detail 24 is then automatically inserted into the reference image b r , for example , at the position where the change was detected . for example , the image detail 24 is inserted in the first quadrant i of the reference image b r . an updated reference image b r may be obtained , stored , and simultaneously displayed on the display 22 . the updated reference image b r may be used as the basis for comparison with the subsequent current images b a . fig2 c shows a radiation dose d and a dose - area product p . fig2 c shows radiation dose per irradiated area over time t . the item instants t 0 to t 6 specify the times where the acts of the method are carried out . when the reference image b r is taken , a high radiation dose is used . the high radiation may be about 100 % of the radiation dose d . the beam path 20 may remain unrestricted when the reference image b r and the current image b a are taken , so as to produce a maximally large - area complete image , as shown in fig2 b . as the reference image b r has a size which is defined as maximally large , the dose - area product p may remain 100 %. when the current image b a is taken , a much lower radiation dose d is used . the lower radiation dose d may be about 25 % of the maximum possible radiation dose d h . the radiation dose d is regulated via an x - ray generator ( not shown in greater detail here ) of the x - ray device 4 . the generator may be controlled via the control unit 12 . the current image b a may be as large as the reference image b r . the dose - area product p may be only about 25 % based on the low radiation dose d n . in one embodiment , the collimator 10 is not used to screen off the beam path 20 , apart from the first quadrant i in which a change was detected , until capture of the image detail 24 at time t 4 . to capture the image detail 24 , a maximum radiation dose d h is used . as the image area is restricted to a quarter of the total image area in this case , the dose - area product is only 25 %. as shown in fig2 c , this method is particularly non - damaging for the patient , while at the same time the images displayed to assist the medical personnel have optimum image quality . while the invention has been described above by reference to various embodiments , it should be understood that many changes and modifications can be made without departing from the scope of the invention . it is therefore intended that the foregoing detailed description be regarded as illustrative rather than limiting , and that it be understood that it is the following claims , including all equivalents , that are intended to define the spirit and scope of this invention . | 0 |
referring now to fig1 , a flowchart is shown for a methodic for monitoring myocardial wall thickness and for detecting abrupt changes in such wall thickness is shown . as will be described in more derail below , the invention provides dynamic harmonic analysis and frequency tracking with cusum testing . the method segments in real time images of the lv , step 100 . here , the real time images are acquired on an mr scanner and an existing and establish left ventricular ( lv ) segmentation such as described in a paper by jolly , m . ( 2001 ), combining edge , region , and shape information to segment the left ventricle in cardiac mr images ., in ‘ miccai ’, pp . 482 - 490 has been adapted to estimate the endocardial ( inner ) and epicardial ( outer ) contour of the lv myocardium , step 200 . the contours are initialized with approximate localization of the left ventricle and a local deformation in the temporal domain as a starting point . than they are propagated to adjacent temporal frames where the local deformation is applied . the original propagation method relies that phases for an entire cardiac cycle are available . in a real time image scenario we do not have any phase information about the current image therefore we changed the algorithm that way that the propagation copy the contours from the processor image to the next before the local deformation is applied . the myocardial wall thickness is calculated for a region determined by the user according to the aha 17 compound model such described in cerqueira , m . d . ; weissman , n . j . ; dilsizian , v . ; jacobs , a . k . ; kaul , s . ; laskey , w . k . ; pennell , d . j . ; rumberger , j . a . ; ryan , t . ; verani , m . s . ; on myocardial segmentation , a . h . a . w . g . & amp ; for cardiac imaging , r . ( 2002 ), ‘ standardized myocardial segmentation and nomenclature for tomographic imaging of the heart : a statement for healthcare professionals from the cardiac imaging committee of the council on clinical cardiology of the american heart association .’, circulation 105 ( 4 ), 539 - 542 . the measured values for each region result in a wall thickness signal s t . wall thickness measurements derived from mr images are subjects to a considerable measurement error . the thickness curves due not adequately reflect the smooth myocardial wall . this is due to errors in the automatically tracing of the endocardial and epicardial contours . the aim of this invention provides a mean to predict and estimate wall thickness in time and detect changes that might result in an alarm . the wall thickness signal is a periodical signal . one period has the length of one heart beat . the harmonic decomposition of the signal shows that two harmonics are enough to model the signal adequately . therefore we could describe the wall thickness signal s t using the following state space model : where w is the process noise with distribution w ˜ n ( 0 , q ) and x is the ( 5 × 1 ) state vector with x =( c 0 , a 1 , b 1 , a 2 , b 2 ) y is the observation vector ( y t , y t − 1 , . . . y t - m ) k = 1 . . . m is the number of samples and δt is the sampling interval . the wall thickness measurements are fed to a pair of regressive filters ( i . e ., predictors ), here kalman filters 300 , 400 ; one ( 300 ) for removing noise on the wall thickness measurement signal and the other ( 400 ) for measuring the frequency , f , of the beating heart . for this state space model the kalman filter is applied . this could be treated with the kalman algorithm . the kalman filter is suited to solve this prediction problem since it does not need deterministic dynamics or stationary properties . in the above section we assumed that the frequency is constant which is not the case in a real life scenario . therefore we introduce a second kalman filter to track the frequency , which is measured either by means of the ecg or using short time fft in the wall thickness signal . the frequency tracker has the following simple where the state vector f consists in the frequency f , w f ˜ n ( 0 , q f ) is the process noise and v f ˜ n ( 0 , r f ) the measurement noise . the state vector will be initialized with values determined by a fft which is obtained at an initialization phase at the beginning of the monitoring process . the measurement and process noise will be determined by the user with an initial guess or estimate . better possibilities of estimating these noise distribution are still under investigation . fig2 a shows a simulated ( clean ) wall thickness signal for a lv of a periodically varying ( i . e ., a beating heart ). it is noted that at time 25 a simulation is made of injection of a pharmaceutical that you would simulate the heart being placed in a stress condition . in fig2 b noise ( the noise distribution was estimated based on real volunteer data ) and is added to the clean signal in fig2 a . a predictor , here a regressive filter , here a kalman filter is applied to the signal fig2 b to produce the signal shown in fig2 c . the error between the signal shown in fig2 c and the signal shown in fig2 b is shown in fig2 d . referring to fig2 e , the upper pair of signals is the estimated mean wall thinness of the lv when the heart is in a systolic condition as determined from the kalman filter ( predictor ) and the actual wall thickness of the lv when the heart is in a systolic condition . the lower pair of signals is the estimated mean wall thinness of the lv when the heart is in a diastolic condition as determined from the kalman filter ( predictor ) and the actual wall thickness of the lv when the heart is in the diastolic condition . the quotient of the estimated one of the upper pair of signals to the estimated lower one of the pair of signals is used by clinician to evaluate the viability of the myocardium . fig2 f shows the signal by a predictor for estimating the frequency of the periodically changing lv as a result of the beating heart , it being noted that the heart beat increases in frequency ( i . e ., periodicity ) at time 25 . two cusum ( statistical processing ) algorithms 500 , 600 are applied to detect rapid changes in the estimated measurements errors : ( a ) the wall thickness itself , here the difference between the predicted ( the result of the state equation ) and the estimated ( included the measurement ) is tested ( b ) the mean and variance of the frequency estimation and prediction is tested a change occurs in both cases if a significant difference between the estimated and the prediction occurs or a significant difference between consecutive residuals are found . if the cusum test is positive an alarm is given and / or a feedback is given to the estimation algorithm to reset the kalman filters and take the current state vectors as initial values , step 700 . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are within the scope of the following claims . | 6 |
the arrangement for the known dfs 3000 synchroniser is shown in fig1 . a video input is received by processing amplifier 10 which feeds sync separator 11 controlling a write clock generator 12 . the clock generator output is received by an analogue to digital converter ( adc ) 13 which converts the video signal to digital form prior to storage in a frame store 14 . the write clock generator 12 also has an output received by a store control 15 which controls the operation sequence of the store 14 . the store output is received by digital to analogue converter 16 which is under the control of clocks from read clock generator 17 receiving sync pulses from sync pulse generator 18 . the analogue output of converter 16 is received by output processor 19 which provides the composite video output of the synchroniser . the sync pulse generator 18 is controlled by means of externally generated sub carrier and sync inputs directly or via an output sync separator 20 which receives a composite video signal . the store control of the synchroniser has the facility of freezing the picture within the frame store ( see also for example british patent application ser . no . 6585 / 76 or u . s . patent application ser . no . 764 , 148 ). the synchroniser has the facility of frame compression by only storing selected picture point samples so that if every other picture point is not stored ( in both horizontal and vertical directions ) a quarter sized picture is produced ( see also for example british patent application ser . no . 21024 / 76 or u . s . patent application ser . no . 795 , 513 ). the frame compressor 23 allows this compressed picture to be stored in any one of four quadrants by means of selectors 24 - 27 which control the picture point counter addresses . in addition a joystick control 28 is provided which allows the quarter size picture to be moved anywhere within the normal picture frame area by defining the pertinent varying address as the stick is moved . the remote control arrangement 30 of the invention is connectable to the store control of the known synchroniser to provide the standard functions just described together with additional functions at a position remote from the synchroniser ( e . g . in the studio mixer ) by a distance of up to several hundred feet if required . a typical layout for the manual controls of unit 30 is shown if fig2 . a frame freeze button 31 is provided for freezing captions . a field freeze button 32 is provided for stopping fast moving objects on the picture . in addition an update control 34 is provided which allows a variable update interval to be selected by the producer to automatically update the frozen picture between a rate of say once per second to infinity ( i . e . hold ). five preselect buttons 33 are provided for the compressed picture position . these buttons not only select the compressed function when depressed but also have the capability to memorize positions previously chosen at the beginning of the t . v . programme so that these can be recalled by the producer when required and thus allow rehearsal of a programme prior to transmission in the confidence that when he moves from event to event on air the chosen sequence will be faithfully reproduced . the chosen position is recalled merely by pressing the appropriate button and the cancellation of this effect to normal size and position is effected by depressing the appropriate button once again . the memory facility is actuated during rehearsal in conjunction with ` live ` button 36 and joystick positioner 37 . the picture position is determined by varying the joystick 37 with live button 36 depressed . if one of the preselect buttons 33 is also depressed the position of the joystick is remembered for recall later . it is also possible to move and memorise a full frame of video by means of joystick 37 by depressing live button 38 and one of the five preset buttons 35 in a similar way to compressed frame . by only depressing the live button 36 or 38 it is possible to rely only on live position control without using the preselect facilities of buttons 33 and 35 . two buttons 40 and 41 are provided to switch off respectively the x and y axes of the joystick to allow a smooth live single dimentional pan or tilt . a transition time control 42 is provided to allow the producer to select the rate of pan or tilt from one preselected position to another . the rate can be varied typically from instantaneous to a time of several seconds . alternatively the rate of velocity may be varied . an auto key button 45 is also provided . the auto key facility is provided to make life easier for the camera man . the control is able to measure the centre of the chroma key area when the chroma key signal is fed into the synchroniser and computes the appropriate position for the compressed image to be centred over the key signal so that if the camera pans the compressed image automatically follows . thus auto key is used where a chroma key signal is being fed to the synchroniser and the producer has approximately centred a compressed picture over the key area using one of the five preselector buttons . pressing the auto key button 45 will ensure that the compressed image is automatically centred over the key area even if this key area should move . the various buttons described above may incorporate a lamp to clearly indicate that a button is depressed . a circuit arrangement suitable for the compressed picture position presetting of fig2 is shown in fig3 . the position data from joystick control 37 can be passed via live switch 36 directly to the synchroniser so that the joystick operates in the known live mode . if however the preset switch 33 is closed , the position data is fed into a memory 50 where it is stored . when the position data is recalled this is passed to the synchroniser to cause movement to this position to be implemented . enter and recall for the memory can be arranged to be actuated respectively with the preset switch 33 . the memory may be analogue or digital depending on the type of output provided by the joystick and the synchroniser input . to provide the requirements of the fig2 arrangement five such switches 33 and memories 50 would be required for the compressed picture position and five similar arrangements for the full frame position . although such a system can be constructed solely from known hardware elements it is more convenient to use a microprocessor system with related circuitry to effect the above arrangements and such a system will be described later with reference to fig5 . fig4 shows analogue arrangements for the joystick , update intervals and transition time controls . joystick control 37 comprises two variable resistors one for vertical and horizontal position respectively . update interval control 34 comprises one variable resistor which controls a simple timing circuit ( not shown ) that operates on the freeze lines . the transition time or velocity control 42 also comprises a variable resistor and this operates a simple ramp circuit ( not shown ) that constrains the rate at which the voltage that controls the position is allowed to change from one location to another . the controls receive a voltage from a precision analogue supply 52 which may be in the control unit or taken from the synchroniser . the use of a microprocessor system to effect the above control functions is shown in fig5 . the heart of the system is a microprocessor unit ( mpu ) 60 ( e . g . motorola 6800 ). a random access memory ( ram ) 62 ( e . g . motorola 6810 ) is connected to the mpu which acts as working space for the programme , which processor programme is contained in read only memory ( rom ) 63 ( e . g . motorola 6830 ). the memories are connected to the mpu by common address bus 64 and common data bus 65 . the various switches 31 , 32 , 45 , 33 , 36 , 35 , 38 ( and their associated lamps ) are connected to i / o circuits 68 , 69 ( peripheral interface adaptors e . g . type 6820 ). these interface adaptors are connected to the mpu via common buses 64 , 65 . an additional adaptor 72 is provided together with line drivers 73 and line receivers 74 to provide the necessary digital interfacing to and from the synchroniser . the analog controls of fig4 are now included in fig5 and are connected to the microprocessor system via a multiplexer 75 and an analogue to digital converter ( adc ) 76 which converts the analogue signal to digital form to allow purely digital interfacing to and from the synchroniser of all required functions . the programming of microprocessors is well known and so will not be described in detail . the microprocessor programme is written in such a way that the pushing of the relevent selector button and moving the joystick effects memorising of that location for the compressed or full frame picture to allow the picture to move from one position to another at a rate chosen by the variable transition control . another advantage of the microprocessor system is that the programme can be written in such a manner that non - linear movement of the picture from one stored location to another is possible . in this way picture movement similar to that achieved by the camera man when having to accelerate and decelerate the mass of his camera can be obtained thereby creating greater realism . the variable transition control is achieved by causing the programme to incrementally count from one location to another . clearly if this count is fed as the address of the picture to the synchroniser , smooth movement between , instead of an instantanious jump from one location to another , is obtained . the concept of non - linear movement can be realised by producing a non - linear transfer function in the programme space so that linear vectors demanded by the main programme are ` bent ` to move slower at the start and finish of the process . | 7 |
fig1 shows a block diagram of the hardware for the communications system , showing the central communications station , pabx system , electronic mail server , radio transmitter , some of the remote receiving stations , and one of the communication units carried by users . the central communications station 3 , which consists of a 16 - bit microprocessor , memory , a 1 khz real - time clock , and appropriate communication interfaces , transmits messages in the form of digital bitstreams by means of the frequency - shift - keyed radio transmitter 4 and antenna 5 . a typical frequency for transmitting data to the communications units is 1 , 900 mhz . a message is received by communications unit 6 , which decodes it , enters the message into its internal memory , and displays the message visually and turns on visual indicators and / or auditory alarms , as appropriate . the unit will also generate an acknowledgement for each message , that is sent to the central station . each communications unit 6 transmits an identification code in the form of digitally encoded infrared light , which is received and stored by one or more remote stations 7 , 8 , and 9 receiving it . other data , such as acknowledgements of received messages , responses , or original messages are also included with the identification signal when available . the remote station then forwards the response from the unit to the central station via radio on a different channel than that used for data from the central station to the communications units . the response includes the unit identification code , any additional data that the station has received from the communication unit , and an identification code for the remote station . each remote station consists of one or more photodiode infrared detectors , an analog - to - digital converter , a microprocessor , memory , a real - time clock , serial communications interfaces , a radio transmitter and modulator , and antenna . a typical frequency for transmitting data from the remote station and receiving it at the central station is 1 , 920 mhz . these frequencies are in the band recently allocated for unlicensed personal communications services in buildings . ( until this band becomes fully operational more conventional bands can be used ). the two primary sources of messages are the electronic mail network and incoming telephone calls . an incoming electronic mail message is transmitted by a remote workstation through an electronic mail server 1 and to the central communications station 3 , which transmits the message via radio 4 to the appropriate communications unit 6 . the user can , if desired , choose a response that will be transmitted back to the originator of the message . an incoming call to the user &# 39 ; s extension enters the pabx system control 2 , with the call indication , extension number called , calling number and any further identification of caller , if available , passed to the central communications station 3 and then transmitted by radio 4 as a message to the communications unit 6 . ( a &# 34 ; message &# 34 ;, in the present application , means either text or a paging signal such as that indicating an incoming telephone call .) the user may select a response , which is passed by infrared light to a remote station 7 ( with a code added to identify the remote station ), with the response sent to the central communications station 3 and then to the pabx control 2 , which can , if desired , initiate a call transfer , either to a receptionist , to a voicemail system , to the extension where the user is located , or to another extension . ( in an alternative embodiment , ultrasonic sound is used instead of infrared light for communication from the communications unit 6 to the remote stations 7 , 8 , and 9 . in this case each remote station has an ultrasonic microphone and appropriate signal processing hardware instead of a photodiode infrared detector . in this application , references to &# 34 ; infrared light &# 34 ; can usually be interpreted as meaning &# 34 ; infrared light or , in an alternative embodiment , ultrasonic sound .&# 34 ; the two media of infrared light and ultrasonic sound form a class of radiated energy that has as its primary common characteristics the inability to penetrate walls , ceilings , floors , and doors , the ability to be reflected by walls , ceilings , floors , and doors , and relatively short - range transmission capabilities when used at the power levels practical with miniature , battery operated devices .) fig2 shows the configuration of infrared detectors and associated remote communications stations in different rooms of a building and along a corridor , with each detector and station shown as a circle . station 15 , for example , is installed in an office , while station 16 is installed in a corridor . infrared detectors may be mounted on walls or on the ceiling , and more than one detector may be used in a given room to provide more reliable coverage . repeater stations may be used , in addition , as shown by repeater 17 . a repeater 17 receives an infrared signal and then retransmits it via infrared to a remote station 18 . fig3 is a block diagram that shows the hardware architecture of the communications unit . all of the integrated circuits in the communications unit are especially miniature , lightweight , and have low power consumption . the radio signal broadcast from the central communications station is picked up by the antenna 21 and passed to the radio receiver 22 and to the frequency - shift - keyed detector 23 . the output of the fsk detector is applied to a shift register and associated logic 24 which converts the 19 , 200 bit / second bit serial data to 8 - bit parallel form before providing it to the microprocessor 25 , generating an interrupt when each character is received . the microprocessor itself 25 is a 8 - bit processor . a colpitts crystal oscillator 26 operating at 3 . 932 mhz provides a real - time clock signal directly to the microprocessor at this frequency and also to frequency dividing counters 27 that provide a 307 . 2 khz ( 16 times the 19 , 200 bit / second bit rate ) clock signal to the asynchronous character receiver ( shift register ) 24 , a 38 . 4 khz clock signal to an asynchronous character transmitter 28 , and a 1 . 2 khz clock signal to the microprocessor for use as a clock generating an interrupt for use with timing of the thumbwheel position encoder and auditory and visual indicators . the thumbwheel position is sampled 18 . 75 times per second . ( a different clock frequency is provided for the transmitter 28 in the case of ultrasonic transmission ). associated with the microprocessor is a programmable read only memory ( prom ) 30 with 4k bytes of storage , and a random access memory ( ram ) 29 with 8k bytes of storage . the prom contains the program for the microprocessor while the ram contains messages after conversion to digital codes , information extracted from the messages for display to the user , and other information . software in the microprocessor extracts information to be displayed , which is placed into a memory and causes characters to be displayed on the liquid crystal display 31 . the display also includes indicators indicating that a message is available and its priority . lamps 38 and 39 also indicate when there is a ring or urgent message or indicate the status of the communications circuit . in addition , an auditory bit , audio amplifier , and speaker 37 can provide an auditory alarm . a thumbwheel 32 allows the user to display messages and responses that are stored in memory . the thumbwheel is sampled by an encoder 33 that sends a 10 - bit representation of its position to the microprocessor . a user may also press the control key 34 to send a response to a message , to transmit a message , to select a command , or to delete a message . data from the communications unit is sent at a rate of 38 , 400 bits per second , with the microprocessor sending each 8 - bit character to the asynchronous transmitter 28 , which sends each bit to a driver 35 and to an infrared emitter diode 36 . ( more than one emitter may be used to provide coverage in different directions ). ( in the alternative embodiment using ultrasound , the driver and infrared light emitter is replaced by an ultrasonic frequency synthesizer , pulse encoder , amplifier , and ultrasonic transducer , and the transmission rate is much reduced .) when an auditory signal is desired to alert the user , the microprocessor produces it by toggling an auditory output bit at an auditory signal rate that is amplified by an operational amplifier and speaker 37 . fig4 a shows a front view of the physical layout of the communications unit . at the very top left are infrared diode emitters 40 and 41 ( replaced by one or two ultrasonic transducers in the alternative embodiment using ultrasound ). lamp 42 at the top indicates when a ring or urgent message has been received , with the lamp flashing at a rate of two flashes per second indicating a ring and the lamp flashing at a rate of one flash every two seconds for 20 seconds , then turning solid , indicating an urgent message . at the far right is the communications lamp 43 , which indicates the status of the communications circuits . if the lamp is turned on for any significant period of time , it indicates trouble . if a user has sent input data ( i . e ., responded to a message ) but has not received an acknowledgement of it , the lamp is solidly on . if the unit has failed to receive data and no response from the unit has been received recently , the lamp is also turned on . in contrast , a momentary flicker ( 150 ms ) of the lamp indicates a successful transmission from the unit . just below is the liquid crystal display 44 , with a mark at the center left of the display that serves as a cursor 45 indicating the response being selected or the message being deleted . below the display is an optional identification photo 46 , included when the communications unit is incorporated into a corporate identification badge . at the bottom left is a speaker 47 capable of emitting sounds in the sonic range to server as an auditory alarm . at the bottom center is a key 48 used for deleting messages , for sending a response that has been selected , for executing proprogrammed commands , and for making other selections depending upon the context . at the bottom right is a thumbwheel -- a small cylinder 49 that can be rotated either up or down by the user &# 39 ; s thumb that is used to control the display of messages , responses , and other information . fig4 b is a rear view of the unit , showing optional corporate and employee identification information 52 and a clip 53 for attaching the unit to the user &# 39 ; s clothing . an access plate 54 for replacing the battery is also shown . fig4 c is a side view of the unit , showing the infrared emitters ( or ultrasonic transducers ) 40 and 41 , liquid crystal display 44 , and clip 53 . fig5 is a block diagram showing the architecture of the hardware for a remote station . an infrared signal arrives at the infrared detector 55 and is converted to an analog electrical signal and provided to the analog - to - digital converter 56 , which , in turn , provides its output to a microprocessor 57 . ( the analog - to - digital converter 56 is not essential for the use of infrared , but it allows adjustment of the mark / space signal threshold depending upon the strength of the received signal at a given time , improving the ability of the station to successfully decode signals with a low signal - to - noise ratio . the converter is necessary if ultrasonic transmission is used .) the microprocessor 57 executes a program contained in the programmable read only memory ( prom ) 59 . the id for the remote station could be contained in the prom or , alternately , in switches ( such as those packaged similar to dual inline plastic chips ) that are set at the time of installation . the random - access - memory ( ram ) 60 temporarily stores received data and other information . a real - time clock 58 provides timing pulses to the microprocessor 57 and to the asynchronous transmitter 61 , which takes 8 - bit parallel data characters from the microprocessor 57 and converts them to serial data at 38 , 400 bits per second , adding a start and stop bit . the serial data is provided to a radio transmitter 62 , which modulates a radio signal at 1 , 920 mhz by frequency - shift - keying . the transmitter provides its output to an antenna 63 . fig6 a . 6b , and 6c show front , side , and rear views , respectively , of a physical implementation of a remote station packaged with a picture frame . this is one approach to a remote station that is quickly and easily installed and that blends in with the existing environment . fig6 a shows a front view of the station , indicating a picture frame 64 , with a picture 65 mounted in it . in this version , the center of the picture has an infrared detector 66 in it . ( pictures selected for picture frames with remote stations installed are preferably recognizable as similar in some way -- a particular form of abstract art , seascapes , etc ., so that users can easily tell which pictures contain a remote station and which do not . alternatively , the picture frame itself could have a distinctive color or style .) fig6 b shows a side view , with a picture frame 64 , picture 65 , and infrared detector 66 . in addition , the electronics 67 for the station microprocessor , clock , radio transmitter , memory , etc .) are contained in a compartment in back of the picture , as is a battery or other power source 68 . fig6 c shows a rear view , with a dipole antenna 69 and a hanger 70 . ( a vertical dipole or whip antenna could also be used .) fig7 shows a block diagram of the architecture of the hardware for a repeater station . an infrared signal arrives at the infrared detector 71 , and is converted to an analog electrical signal and provided to an analog - to - digital converter 72 , which in turn provides its digital output to a microprocessor 73 . the microprocessor 73 executes a program contained in a prom 75 , with a ram 76 storing received data and other information . the repeater may also be assigned an optional identification code , which can be contained in the prom or set by switches at the time of installation . a real - time clock 74 provides timing pulses to the microprocessor 73 and to the asynchronous serial character transmitter 77 , which takes 8 - bit parallel data , converts it to serial at the same bit rate as that received at the infrared detector 71 , and provides it to an amplifier and driver 78 and then to an infrared emitter 79 . fig8 a and 8b show a physical implementation of a repeater station and how a repeater and remote station might be installed together in a room . fig8 a shows a front view ( analogous to fig6 a ) of a repeater packaged with a picture frame . the repeater is packaged similarly to the remote station shown in fig6 b and 6c . picture frame 88 contains a picture 89 , which in turn contains an infrared detector 80 . the picture frame also contains an infrared emitter 81 . the infrared emitter might usefully be mounted on a swivel base so that it can be aimed at the infrared detector in a remote station . fig8 b shows the layout of a repeater and remote station in a room and how it is used . a communications unit 82 transmits a packet of data via infrared , which is received and stored at repeater station 83 . alter a delay , the repeater station transmits the data again , in the same format as was transmitted by the communications unit , by means of the infrared emitter 84 , which is then received by the infrared detector 85 at remote station 86 so that it can be retransmitted . whether a repeater or repeaters are necessary or desirable in any given situation depends upon many factors , including the layout , size of , and obstructions in particular rooms , the reflectance of walls , the power ( and resulting battery drain ) of the infrared emitter ( or ultrasonic transducer ) in the communications unit , and whether infrared or ultrasound is used ( with infrared generally more likely to require repeaters ). fig9 shows the format of a message sent to the communications unit , how it is broken down into packets for transmission , and the format of a data packet . the upper part of the figure shows the message text , which begins with an stx 91 , followed by a 7 - bit channel number 92 ( assigned when the first packet in the message is placed in the queue for transmission ), the actual text of the message 93 , ending with an eom 94 . the message text may include special characters designating specific situations , such as the receipt of a fax , voicemail message , or print job , that causes indicators in the communications unit to be displayed . if the entire message stored in the email incoming message archive is not contained in the message , an ascii etb character just before the eom indicates this . the message text is broken up into from 1 to 8 packets , depending upon the length of the message , with the example shown a message with 3 packets . each packet can hold a maximum of 42 data characters . the middle part of the figure shows how the message text 93 is divided up and placed into packets 95 , 96 , and 97 , with header and error check information added to the beginning and end of each packet . the lower part of fig9 shows the format of a data packet . the packet begins with an ascii start - of - header ( soh ) character 98 , with the higher order bit ( which is sent last ) set to 0 . all data in the figures showing packet formats show 7 - bit characters for simplicity ; however , each character transmitted is actually 8 bits in length ( plus start bit and stop bit for a total of 10 bits ). the 8th ( higher order ) bit is set to 1 except in two cases : an soh character and an ascii end - of - transmission ( eot ) character . the character following the soh character in the data packet contains 2 bits designating the packet type 99 ( 00 if data , 01 if input data acknowledgement , 10 if ackack , and 11 if not responding ). two following bits in the character are used to indicate the priority of the packet 100 ( ring , urgent , high , or normal ). the remaining 3 bits of this character and the 7 bits of the following character contain a 10 - bit identification field 101 designating the communications unit . the two characters following that 102 contain a 14 - bit packet sequence number ( 7 bits in each character ), followed by from 1 to 42 data characters 103 , a 7 - bit cyclic redundancy check ( crc ) 104 , and an eot 105 . the first 2 bits of the packet sequence number are the same as the packet priority . a data packet thus has a total of from 8 to 49 characters . fig1 - 12 ( and part of 9 ) show the data formats associated with the transmission of data in packets from the central communications station to the communication units and in the return direction . fig1 shows the format of an input acknowledgement packet . this packet is received by the unit via radio . there are two forms of this packet : inputack and unitack . an inputack acknowledges an input data packet sent by the unit . a unitack acknowledges the id sent by the unit if input data is not sent . the packet begins with an soh character 107 , with the following character consisting of the following fields : a 2 - bit field indicating the packet type 108 ( data , input data acknowledge , ackack , or not responding ), a bit 109 indicating whether this is an inputack or unitack , an unused bit 110 , and 3 bits 111 for the upper 3 bits of a 10 - bit identification field designating the communications unit . the following character contains the remaining 7 bits 112 of the unit id , and the character following that 113 a 7 - bit input packet number , a packet sequence number for the input data packet that is being acknowledged . the character after that 114 is a crc and the character following that is an eot 115 . fig1 shows the format of an &# 34 ; ackack &# 34 ; or &# 34 ; acknowledgement of an acknowledgement &# 34 ; packet . this packet is received by the unit via radio , and its purpose is to cause the termination of repeated transmissions of acknowledgements from the communications unit . the packet begins with an soh character 117 , with the following character consisting of the following fields : a 2 - bit field indicating the packet type 118 ( data , input data acknowledge , or ackack ), 2 unused bits 119 , and 3 bits 120 for the upper 3 bits of a 10 - bit identification field designating the communications unit . the following character contains the remaining 7 bits 121 of the unit id , and the two characters following that 122 and 123 a 14 - bit packet sequence number for the data packet for which an acknowledgement has been received . the character after that is a crc 124 and the character following that 125 is an eot . fig1 shows the format of a confirm data packet . this packet is sent via radio to the communications unit at frequent intervals to confirm that all data packets sent ( except ring packets ) have been received by the unit . the packet begins with an soh character 126 , with the following character consisting of the following fields : a 2 - bit field indicating the packet type 127 ( 11 if confirm data ), 2 unused bits 128 , and 3 bits for the upper 3 bits of a 10 - bit id field 129 designating the communications unit . the following character contains the remaining 7 bits of the unit id . the following two characters contain the last packet sequence number transmitted for the urgent priority 130 , the next two the same for the high priority 131 , and the next two the same for the normal priority 132 . the following character 133 contains the time since a response has been received by the unit , in tenths of a second . the character following that 134 contains a crc , and the final character 135 an eot . fig1 shows the format of packets sent from the communications unit to one or more remote stations via infrared light . the top diagram in the figure shows the general structure of the packet , including an soh character 136 , a 3 - character header / id sequence 137 , an acknowledge sequence 138 of 1 or 2 characters , input data 139 of 3 to 32 characters , a crc 140 and an eot character 141 . the acknowledge sequence and input data sequence are optional , as indicated by the bits set in the header / id sequence . the diagram just below shows details of the header / id sequence . the first character consists of the following fields : a 2 - bit field 142 indicating the acknowledgement type ( 00 indicates that no acknowledgement is being transmitted , 10 indicates that a single packet is being acknowledged , while 11 indicates that more than one packet , in a continuous sequence , is being acknowledged ), a 1 - bit field 143 indicating whether or not input data is being transmitted . 1 bit for a repeater tag bit 144 , and 3 bits of the 10 - bit unit id code 145 . the repeater tag bit is 0 when the packet is sent by a unit , but set to 1 if the packet is retransmitted by a repealer station . ( in an alternative embodiment a 10 - bit repeater id code is substituted for the repeater tag bit ). the second character consists of a single 7 - bit field with the remaining 7 bits of the id code . the third character contains a 7 - bit field 146 containing a number representing the calculated reliability of the radio transmissions being received by the unit . the two diagrams below the header / id sequence show the two alternative formats for sending an acknowledgement of a data packet received by the unit . in one format 148 a single data packet is acknowledged ( with a two - character sequence containing the 14 - bit packet sequence number of the data packet ). in the other format a continuous sequence of packets is acknowledged , with the first two characters containing the 14 - bit packet sequence numbers 149 of the beginning packet being acknowledged and a 7 - bit field in the third character 150 containing the length of the sequence being acknowledged . the next diagram shows the format of an input data sequence , including a 7 - bit input packet number 151 in the first character of the input data packet , a 7 - bit channel number 152 referring to the original packet that this is a response to ( with the number set to 0 if this is an original message and 1 if a response to a message from the pabx control ) and 1 - 20 characters of data 153 . a specific form of the input data sequence 151 , 152 , and 153 includes as data only a single ascii del character , indicating that the user has deleted the message referred to by the channel number and that the channel number should be deassigned and the message deleted from the email incoming message archive . another form has two del characters in succession , indicating an undelete -- that is the previous delete command is to be reversed . the next two sequences show the input data formats . there are two formats , a two - character compressed fixed length sequence , and a variable length sequence . the two - character sequence consists of an ascii character 156 indicating the type of code , followed by a 7 - bit character 157 indicating the particular code . the ascii characters used for indicating code type are enq , bel , bs , ht , and vt . if the type character 156 is an enq , this is a response code . if the 7 - bit code that follows 157 is from 0 to 19 , the response indicates one of the responses ( with 0 referring to the first response , 1 to the second , etc .) included with the message sent to the unit . if the code 157 is from 21 to 127 , the response indicates one of the preprogrammed responses in the preprogrammed response list . if the code is 20 , it indicates that the user has selected the * more * response to obtain more of the email message . ( the preprogrammed response list , preprogrammed message list , and preprogrammed email address list are contained in data structures in both the central station and communications unit .) if the type character 156 is a bel , this is a response but using one of the preprogammed messages in the preprogrammed message list , its indicated by the code 0 - 127 . if the type character is an ht , this is a command code , with the code as indicated by the code character 0 - 127 and retrieved from a hard - coded command list . if the type character is a vt , this is an email address code , with the code as indicated by the code character 0 - 127 and retrieved from the preprogrammed email address list . multiple addresses can be used by providing additional character sequences . if the type character is a bs , this is an original message , with the message as indicated by the code 0 - 127 and retrieved from the preprogrammed message list . the message will be sent to the email address sent in the same or previous transmission of input data . if the type character is a ff , so , or si , this is a variable - length ( uncompressed ) sequence , which consists of a type character 158 , 1 to 30 characters of text 159 , followed by an etx character 160 . an ff indicates a composed response . so a composed message , and si a composed email address . multiple email addresses can be used by using additional character sequences . fig1 shows the format of a packet sent from a remote station to the central station via radio . the packet begins with an soh character 162 and has a subpacket for each unit that it has received a signal for within the timeout period ( two are shown in the figure , 163 and 164 ), a two - character ( 14 - bit ) crc 165 , and an eot 166 . each subpacket consists of the fields shown : a 2 - character header / id sequence 171 , a 2 - character elapsed time sequence 172 , an ack sequence of 1 or 2 characters 173 , input data of 3 to 22 characters 174 , a signal reliability field 175 7 bits in length ( from the same field in the header id sequence from the unit ), a signal amplitude field 176 ( indicating the amplitude of the infrared signal as received from the unit at the remote station ), and an etx character 177 . the header / id sequence consists of a 2 - bit ack type field 178 ( 00 if no acknowledgement transmitted , 01 if a single packet is being acknowledged , 10 if a sequence of packets is being acknowledged ), a 1 - bit field indicating whether input data is being transmitted 179 . 1 bit that is unused 180 , and 3 bits of the 10 - bit unit id code 181 . the second character consists of a single 7 - bit field with the remaining 7 bits of the id code . the elapsed time sequence 182 consists of 2 characters , with each character holding 7 bits of a 14 - bit code representing the elapsed time in seconds ( 0 - 4095 ) since the remote station has received a packet from a given communications unit . the ack and input data sequences are formatted as shown in fig1 . fig1 shows the format of an inquiry from remote agent software concerning the location of an individual and a corresponding response containing relevant information . the inquiry message from the agent software contains an inquiry code 183 , indicating that a location inquiry is being made , followed by an identification code 184 for an individual , which is either an email address or a telephone number . the response message consists of the date and time 185 the individual was identified at the general location the system is installed in , followed by a telephone number 186 that is the best number to use to contact the individual , the label 187 assigned to that number , a field 188 indicating whether or not that number is a private office for that individual , and another field 189 indicating whether the individual is presently in that office . fig1 a shows the format of message text sent from the central station to a communications unit , including particularly the responses that can be selected to that message . the message text 191 is followed by an etx character 192 , then the first response 193 , with successive responses 195 and 197 separated by etx characters 194 and 196 , and with the final response followed by an eom character 198 . note that there is a maximum of 20 responses for any message . the message text and , particularly , responses are formatted with newline characters terminating each physical line , should the text or response exceed the capacity of a single line . an etx character terminates a response or message text and also terminates the physical line . if there are no responses , the message is terminated by an eom . ( a newline character is an ascii carriage return .) fig1 b shows the format of a message defining preprogrammed responses , messages , and email adresses . this data is sent from the central station to the communications unit to define the preprogrammed responses , messages , and email addresses that can be selected by the user . the definition character 201 is an ascii enq , bs , or vt , depending upon whether a set of responses , messages , or email addresses are being defined , respectively . following that are the separate responses 202 , 204 , and 206 , separated by an etx character 203 and 205 , and terminated by an eom character 207 . as above , responses are formatted with newline characters terminating each physical line , should the response or message exceed the capacity of a single line . an etx or eom character terminates a response or message and also terminates the physical line . fig1 shows a flowchart of the software architecture for the central communications station . software is divided into a number of different modules , of four different types : ( 1 ) pabx modules for processing messages to and from the pabx related to telephone calls ; ( 2 ) email modules for processing messages received via the electronic mail system or sent through that system ; ( 3 ) communications modules for handling the transmission of data to the communication units via radio and for handling communication with remote stations , including the receipt of acknowledgements and input data and other necessary functions ; and ( 4 ) a clock module that initiates certain events at appropriate times . in all cases a module is entered as the result of a particular test being passed ; if the test is not passed control is passed to the next test . when a module has completed processing program control passes to the first test 211 . a test is first made 211 of whether an incoming message has been received from the pabx control . an interrupt service routine receives characters that constitute messages from the pabx , which can be either a message reporting an incoming call or a message reporting that a particular extension has gone on - hook or off - hook . when the last such character in a message has been received a flag is set indicating to the main program that a message has ken received , and the pabx module is then called 212 to process it . an incoming call message will result in any additional caller id information that may be available at the central station being added and result in the creation of a list of extensions that the user could transfer a call to . the message created for transmission to the unit is then placed in the message to unit queue , and the first : packet of that message placed in one of the packet to unit queues . an on - hook or off - hook message is not sent to the communications unit , but changes the extension on - hook list , which records the on / off - hook status of each extension , which is used in evaluating whether a given extension might be available for transferring a call . a test is then made 213 of whether a message has completed transmission to the pabx . if so , a test is made 214 of whether another message is available to be sent to the pabx . if yes , that transmission is initiated 215 . a test is then made 217 to see if an electronic mail message has been received over the local area network connecting the central station with computer workstations . if so , a module is called to process 218 the received email message . an interrupt service routine receives each character from the network , with the end of a message resulting in a flag being set indicating that a message is available to the main program in a buffer memory . electronic mail intended for a communications unit is sent to a pseudoaddress similar to the normal address of a user . for example , if a user &# 39 ; s address is &# 34 ; peterson @ cogdes . com &# 34 ;, the user &# 39 ; s communication unit address might be &# 34 ; peterson % pager @ cogdes . com &# 34 ;, with all such messages forwarded by the email system to the central station . if such a message has arrived , the central station looks up the address to see if it is a legitimate user ; if not an error message is returned to the originator of the message . if the user exists , the entire message is placed in the email incoming message archive . the message is then processed to extract only the most significant information ( stripping off most of the header data ) and also to extract only the first pan of long messages . in addition , if the sender has indicated a set of responses for the communications unit user to choose from , these are extracted , formatted , and added to the message . the resulting message , together with the unit id , is placed in the message to unit queue and the first packet of the message extracted and placed in the appropriate packet to unit queue depending upon its priority . details of this can be found in fig1 and the associated text . a test is then made 220 to see if an outgoing electronic mail message has completed transmission ( and another can be sent ). if yes , a test is made 221 to see if another message is available ( in the email outgoing message queue ) to be sent . if yes , the message is initiated 222 . an electronic mail message transmission is initiated by the central station in the following way : the message is placed in a buffer memory and the first character in the message transmitted to the electronic mail interface hardware . the completion of transmission of each character causes an interrupt handler to obtain the next character and transmit it , with the handler setting a flag when the message has been completely sent . when a new message is to be sent , the message that has been in the queue the longest is selected . a test is then made 223 of whether a response has been received from a remote station . if so , a module is called 224 to process the response . if the response is a successfully error checked packet , a subpacket for each communications unit that sent a response is extracted . for each acknowledgement included in the subpacket , the original packet is deleted from the appropriate packet to unit queue , an ackack ( acknowledgement of an acknowledgement ) packet is placed in the appropriate packet to unit queue , and , if there is another packet in the original message , that packet is also placed in a packet to unit queue . if input data is included in the subpacket , that data is routed to the appropriate destination ( email server , pabx , or other communications unit ), and an input acknowledge packet placed in the appropriate packet unlit queue . if a message has been deleted from the unit memory , that message is also deleted from the email incoming message archive , and the channel is deassigned . ( the information is saved in a temporary store in case the user performs an undelete operation ). if a unit was previously not receiving or responding ( i . e ., likely out of the building ), data packets that were on hold because of this are tagged to be selected and sent . details can be found in fig1 and 20 . a test is then made 225 of whether a packet has completed transmission to the unit via radio . a packet to be sent is then selected from those in the packet to unit queues , or , if the queues are all empty , a short dummy packet is sent to a dummy unit address . the packet selected depends on a calculation of the relevant urgency of transmitting different packages in queues with different priorities ( which are related to the priority of the packet , ring , urgent , high , or normal ). the status of the communications unit -- whether it is receiving data and responding , whether it is not responding and not likely to be receiving ( because of being out of the building )-- is also a factor , as is the priority of the packet , with ring packets , for example , not transmitted if the unit is out of the building . a selected packet is then formatted and sent 226 . for more details , see fig2 . finally , a test is made 227 of whether a clock event has occurred . the time event flag is first tested to see if another second has elapsed . if so , that flag is cleared and the clock event queue is tested to see if one or more events are to be executed at the current time . the event is a unit id response timeout , and the unit status field in the unit status list is updated ( to indicate that the unit is not responding ), and packet to unit queues are checked for packets addressed to that unit that have the waiting for ack bit set . for each such packet , the waiting for ack bit is set to 0 . if the status of the unit is not receiving or not responding , the hold bit is set to 1 . if there are one or more data packets with hold bits set , a confirm data packet is moved from packet to unit queue g to packet to unit queue f , if it is not already in queue f . after processing the clock event 228 , program control returns to the start of the program . fig1 shows a flowchart of the software module in the central communications station that processes incoming electronic mail messages . incoming email arrives through the email server as a result of it being addressed to a pseudoaddress ( e . g ., &# 34 ; peterson % pager &# 34 ;) associated with the user &# 39 ; s normal email address ( e . g ., &# 34 ; peterson &# 34 ;). this may be a result of the originator of the message sending the message specifically to the communications unit ( using the pseudoaddress ) or the originator sending a message to the normal message address with a copy to the communications unit . it may also result from the user &# 39 ; s workstation having email software set up to forward certain messages automatically . this may be all messages from a certain sender , all with certain keywords in the subject line and / or text , messages with a certain ( e . g ., urgent ) priority , or a combination of the above . a test is first made 231 of whether the email address is legitimate by looking it up in the email address to unit id map . if the address is not found , a response message is generated 241 to the sender indicating that a communications unit is not active for that address , the response message placed in the email outgoing message queue , and the module is done . if the email address is legitimate , a test is made 232 of whether the message is a request for the user &# 39 ; s present location , a maintenance message froth the user or system administrator , or a message intended for a user . ( a location request message has &# 34 ;%!&# 34 ; as the first 2 characters in the message text , and no other characters , while a maintenance message has &# 34 ;%$&# 34 ; as the first 2 characters in the message text , and no other characters on that line .) if the message is a location request , the present location of the communications unit and the time the unit last responded is looked up in the unit status list 233 , a response email message containing this information is sent to the originator , and the module is done . ( if the user has set privacy mode , the response says only &# 34 ; privacy mode set &# 34 ;). if the message is a maintenance message , the user &# 39 ; s or system administrator &# 39 ; s password ( contained in encrypted form in the message ) is checked and , if the originator has the appropriate privileges , the appropriate changes are made 234 , a response message sent 235 verifying the changes , and the module is done . changes to and queries of tables that define users , user ids , telephone extensions , and locations and telephone extensions near remote stations are made using a simple set of commands contained in email messages that can be originated at any workstation connected via the email server to the system . users can also define preprogrammed responses , messages , and email addresses , and set parameters , in this way . if the message is intended for a user &# 39 ; s communications unit , the first 2048 byes of the message are entered 236 into the email incoming message archive , which allows users access to substantial parts of most messages . while most traffic is likely to involve very short messages , there are situations ( such as a user stuck in a meeting ) where a user may want to read a longer message via the communications unit . the most significant information in the incoming message is then extracted 237 and packed into the first message to the unit ( up to 128 bytes if it is the first part of an incoming message ; up to 336 bytes if a user has requested more data from a message stored in the email incoming message archive ). this is done by identifying separate lines in the header message and taking only the text in the subject line , the email address of the sender , message text , and the signature at the end of the message . in addition , canned responses that have been added to the message by the sender ( either by the person originating the message or by a software message - sending tool that automatically appends appropriate responses ) are extracted , tagged appropriately , and added to the end of the extracted text . the first such response is identified by a &# 34 ;!&# 34 ; character in the first column of the line . when this character is found , the remaining characters on the same line are considered the first response , and each following line ( with a newline character , defined as an ascii carriage return , indicating a new line ) containing an additional response . a priority is then assigned 238 to the message , either urgent , high , or normal . an urgent priority is given when it is specified by the originator of the message ( with % urgent as the first text of the message indicating this ). the user can also cause messages from certain email addresses to be sent as urgent . messages sent to the communications unit directly are given a high priority , while messages forwarded from the user &# 39 ; s workstation are given a normal priority . other criteria for assigning priority levels are also possible , and such criteria could be modified by the user . examples include the length of the message , priority codes that are part of the email header , specific words indicating topics of particular interest , etc . a channel number is then assigned 239 for this particular message . this is done by scanning the channel to email address map until an unassigned channel is found , and assigning that channel to the incoming message . the assigned bit is set to indicate that the channel is being assigned , the email address of the message originator is entered , and a pointer to the incoming email message archive that designates the beginning of the message is entered , all in the channel to email address map . the compressed form of the message ( with the channel number the first byte after the stx ) is then placed 240 in the message to unit queue , and the first part of the message ( up to 42 characters ) defined as the first packet and placed in the appropriate packet to unit queue , depending upon the priority of the message . fig1 shows a flowchart of the first part of the communications software for the central station that processes packets received from the remote station . the response is assumed to be a packet with a correct error check , and the module begins at point 1 . at point 1 , the next unit subpacket is extracted 152 from the packet , and the unit id for that subpacket is also extracted . the station id , current time , signal reliability , and signal amplitude is then saved 253 in the unit status list for the unit involved and the station the response was received from . a test is then made 254 of the unit status , obtained from the unit status list . if the status has changed from that stored , and the new status is receiving and responding , the packet to unit queues are scanned for packets for the unit that are on hold , the hold tag is removed 255 from any such packets , and control passes to point 2 . otherwise , control passes immediately to point 2 . at point 2 , a test is made 256 of whether an acknowledgement sequence is included in the unit subpacket . if yes , control passes to point 3 . if an acknowledgement sequence is not included , a test is made 257 of whether sufficient time has elapsed ( i . e ., a timeout ) since the transmission of the packet for an acknowledgement to be expected . if yes , the &# 34 ; wait for ack &# 34 ; tag bit is removed 258 from any such packets ( to allow them to be retransmitted if the hold bit is not on ). if the new unit status is not receiving but responding , the hold bit is also set for those packets with high or normal ( but not urgent ) priority , so that an attempt to transmit will not be made until the unit status has changed . control then passes to step 259 . if a unit response timeout is not presently in the time event queue , a unit response timeout request is then entered 259 in the time event queue , with the time set to the current time plus 90 seconds . if a request is already in the queue , its time is reset to the current time plus 90 seconds . program control then passes to point 5 in fig2 . at point 3 , the packet number of a packet needing acknowledgement is extracted 261 from the subpacket ( including intervening packet numbers if a sequence of numbers is specified ). an ackack packet for each acknowledgement data packet is then placed 262 in packet to unit queue c . in addition , each original packet is deleted 263 from its original packet to unit queue . if another packet is contained in the message , that packet is extracted and entered 264 in the appropriate packet to unit queue . a test is then made 265 of whether there are more acknowledgements in the subpacket . if yes , control passes to point 3 . if there are no more acknowledgements in the subpacket , a test is made 266 of whether there are other packets still waiting ( in hold mode ) that have not been acknowledged . if yes , the data confirm packet for the unit is moved 268 to packet to unit queue f if it is not in that queue already . control then passes to step 257 . if no , the data confirm packet is moved 267 to packet to unit queue g if it is not in that queue already . control then passes to step 257 . fig2 shows a flowchart of part of the communications software for the central station that processes the part of packets from the remote station that contain input data . at point 5 , a test is made 281 of whether input data is included in the unit subpacket . if not , control passes to point 6 . if input data is included in the unit subpacket , control passes to step 287 . at point 6 , a test is made 282 of whether a delete message sequence is included in the unit subpacket . if not , control passes directly to step 283 . if yes , control passes to step 285 . at step 283 , the status of the unit is set 283 to receiving and responding or not receiving but responding , as appropriate . a test is then made 284 of whether another unit subpacket is in the response . if yes , control passes to point 1 in fig1 . if not , the module is done and control passes to the start of fig1 . at step 285 , a channel number is extracted from the unit subpacket , and that channel number used to delete the corresponding original message from the message to unit queue and the email incoming message archive . the channel number is then deassigned from use by clearing the assigned bit in the channel to email address map for the corresponding channel . a test is then made 286 of whether more messages should be deleted . if yes , control passes to step 285 . if not , control passes to step 283 . at step 287 , input data is extracted for one message . the message channel number indicates the message involved . an input acknowledge packet containing the input packet number is then sent 288 by placing it in packet to unit queue c . a test is then made 289 of the input packet number by comparing it with the last packet received number ( which , unlike the case of the packet numbers used for output data , is the same for all priorities ). the comparison is made modulo 128 , with a received number considered greater than a last packet received number if it is between 1 and 63 above , modulo 128 , the last packet received . ( thus , if the last packet received was 125 , and the new packet just received had a number of 3 , the new packet would be considered greater than the last packet received and thus not a duplicate ). if the number of the packet just received is less than or equal to that of the last packet received , it is considered a duplicate and is ignored , with control passing to step 294 . a received packet number is considered less than a last packet received number if it is between 1 and 63 below modulo 128 , the last packet received . if the number of the packet just received is greater than that of the last packet received , the input packet is processed . a test is then made 290 of whether the input data is a request for more data from an email message only part of which was sent to the communications unit . if yes , another message and packet is formatted and placed 295 in the message to unit queue and the appropriate packet to unit queue . control then passes to step 294 . if the input data is not a request for more data , the email address for the input data is then determined 291 . if the input data is a response ( either a response selected from those provided with the message , a preprogrammed response , or an original message sent as a response ), the channel number is used to look up the corresponding email address of the sender of the message in the channel to email address map . if the input data is an original message , it either contains a 7 - bit code that is converted to an email address by looking it up in the proprogrammed email address list , or it contains the actual email address . if the message or response is in compressed form , it is expanded 292 . fig1 describes the format of different forms of compressed and uncompressed messages and responses . in the case of compressed responses the text is obtained by using a code to look up the expanded form of the response in an appropriate table , which replaces the codes before transmission of the message or response to its destination . the resulting text after expansion and the addition of the electronic mail address of both the destination and originator is placed 293 in the email outgoing message queue . however , if the email address is another communications unit , the message is not placed in the email outgoing message queue but , instead , placed in the email incoming message archive and email incoming message queue . a test is then made 294 of whether there is input data for more messages in the unit subpacket . if yes , control passes to point test 287 . if no , control passes to point 6 . fig2 shows a flowchart of the part of the communications software for the central station that selects and sends data and other packets to communications units via radio . when stated , the module first selects 301 the next packet to be sent . this is done as follows : there are seven queues : ( packet to unit queues a , b , c , d , e , f , and g ) that hold packets , with an incoming message , such as that from a workstation via electronic mail , an incoming telephone call from a pabx system , or a message indicating that a fax has come in , broken down into packets , with each packet placed in one of the packet to unit queues depending upon the priority of the message . packets that acknowledge input data from communication units ( input acknowledge packets ), or that acknowledge acknowledgements of data packets ( ackack packets ) are also placed in one of the queues ( queue c ). a data confirm packet for each communications unit is entered in either packet to unit queue f or g , depending upon the circumstances . at any given time , a data confirm packet for each unit is contained in either queue f or queue g . to select the next packet to be sent , the oldest packet in each queue is retrieved ( but ignoring packets marked as &# 34 ; hold &# 34 ; or &# 34 ; wait for ack &# 34 ;) and a calculation is made of the &# 34 ; urgency &# 34 ; of sending that packet , with urgency a measure of the extent to which not sending the data packet would result in allowing performance to lag behind what is expected for a particular queue . the urgency calculation is made as follows : urgency = t actual / t expected , where t actual is the actual time elapsed since the packet was entered into the queue , and t expected is a parameter selected for each queue so as to allocate priority between the queues and that generally reflects the amount of time a packet is normally expected to be in each queue . typical values are 50 ms for queue a ( ring ), 500 ms for queue b ( urgent ), 1 second for queue c ( input ack , and ackack ) 5 seconds for queue d ( high ), 10 seconds for queue e ( normal ), 60 seconds for queue f ( data confirm , expected acknowledgement ), and 600 seconds for queue g ( data confirm , no expected acknowledgement ). these values can vary depending upon the dam rate of the radio circuit chosen , the number of units in the system , and the average level of traffic per unit . in making the calculation , only data packets that have the &# 34 ; hold &# 34 ; and &# 34 ; wait for ack &# 34 ; bits set to 0 are considered . the packet to be sent is that packet from the queue that has the highest urgency measure , except that in making this decision , urgency values for packets in queues f and g are set to a maximum value if they exceed that value ( to avoid these latter queues from taking too much capacity in peak load periods ). after a packet has been selected , a test is made 302 of the status of the unit that the packet is to be sent to . there are live possible status states : receiving and responding , not receiving but responding , not receiving or responding ( i . e ., out of building ), receiving but not responding ( i . e ., in a room with no infrared sensor ) and not responding ( not responding and unclear why ). for purposes of this module , these are collapsed into two states , depending upon whether the unit is receiving ( receiving and responding , receiving but not responding , or not responding ) or not receiving ( either not receiving but responding or not receiving or responding ). if the unit is receiving , the packet is formatted and the first character is transmitted 303 to initiate the interrupt handler . if the packet is a data packet , the wait for ack bit is set and the packet remains in the queue . data confirm packets also remain in the queue . if the packet is an input acknowledge or ackack packet , the packet is removed immediately from the queue . if the packet just initiated is a data packet and the next packet from the same message is available , it is placed 304 into the appropriate packet to unit queue . the module is then done and control passes to test 211 in fig1 . if the status of the unit is not receiving , a further test is made 306 of the priority of the packet . if it is ring , a further test is made 307 of whether caller id information is included in the packet . if yes , packet to unit queue d is searched 308 to see if there are any other packets that are exactly the same ( i . e ., with the same caller id information ) as the selected packet , and in which the timing indicates they are simply additional rings of the same call . if so , the selected packet is removed from the queue . if there are no such duplicate packets , the packet priority is changed to high and the packet removed from packet to unit queue a and placed in packet to unit queue d , and the hold bit set so it will not be transmitted until a response is received from the unit ( this provides a message to the user that a call was received , but not in real time ). the module is then done . if there is no caller id information , the ring packet is removed 309 from the queue ( resulting in the ring being ignored ) and the module is done . if the packet priority resulting from test 306 is other ( urgent , high or normal ), the packet is tagged 310 as hold , and the module is done . fig2 shows a flowchart of the real - time clock interrupt module . the clock causes an interrupt every 1 ms , resulting in execution of the interrupt module . the second clock , a memory location which provides a clock with one - second resolution , is first incremented 324 . the result is then tested 325 . if the result is 1000 ms , the time of day clock , a memory location which represents the absolute time and which has a resolution of 1 second , is then incremented 326 , and the time event flag is set 327 , so that the main program will check the time event queue . the second clock is then cleared . the interrupt routine then dismisses . fig2 - 31 show the data structures of the lists and queues used in the software for the microprocessor in the central communications station . fig2 shows the format of the unit status list . this list , for each unit , holds the unit id code 330 ( 10 bits ), the unit status 331 ( 3 bits ), the last packet sequence number ( 14 bits ) for output data packets of 4 different priorities 332 , 333 , 334 , and 335 , the last input packet number ( 7 bits ) for input data packets 336 , and information from up to 10 stations ( with three shown , 337 , 338 , and 339 ) that have reported a response from the unit . the unit status field 331 has five possible states : receiving and responding , not receiving but responding . receiving but not responding , not receiving or responding , and not responding . receiving and responding means that the last response received from the unit reported a radio received signal reliability above a threshold value , and that the response was received within a timeout period ( e . g ., 120 seconds ). not receiving but responding means that the last response received from the unit reported a radio received signal reliability below the threshold value , and that the response was received within a timeout period . not receiving or responding means that a response has not been received within the timeout period and that the last response was near an exit to the building ( and the unit is presumed out of the building ). receiving but not responding means that a response has not been received within the timeout period and that the last response was near an area with no infrared sensors . not responding means that a response has not been received within the timeout period but there is no evidence the unit is in an unsensed area or out of the building . the data structure for each station associated with a unit consists of the station id 340 , the time of last contact with that station 341 ( 14 bits ), the reliability of the radio signal received by the unit 342 ( 7 bits ), and the amplitude of the infrared signal from the unit received by that station 343 ( 7 bits ). the stations are ordered such that the most recent contact with the station is listed first , the next most recent contact second . etc . however , only time differences greater than a threshold tithe are considered in performing this ordering : stations reporting time differences less than this are considered to have received the signal at the same time . this threshold takes into account the maximum time between successive repetitions of a signal from a unit . in addition , for those stations receiving the last signal at the same time , according to this rule , the stations are listed in order of strength of the received signal from the unit , with the strongest signal listed first . etc . a single station is only listed once , with the most recent contract ( or strongest , if there is no time difference according to the above rule ) listed . fig2 shows the message to unit queue , which holds messages to be sent to units . for each message in the queue the data structure consists of the unit id 351 and the text 352 of the message ( with the first character in the message an stx and the second character the channel number assigned to the message ). each message in this queue is eventually broken down into packets and copied to one of the data packet queues . fig2 shows the data structure of the packet to unit queues , including queues a , b , c , d , e , f , and g . these queues hold data . input acknowledge , ackack , and confirm data packets that are waiting to be transmitted to a unit . each queue hits the same structure ( not all fields are necessarily used ), which consists of a unit id code 361 ( 10 bits ), a hold bit 362 , a wait for ack bit 363 , a count of the number of transmissions attempted 364 , a pointer to text 365 ( to the message to unit queue ), and the packet sequence number 366 ( 14 bits ) entered when the packet is sent , and used to process the acknowledgement when it is received . the hold bit is normally 0 but is set to 1 when the packet is to be held until a response has been received from the unit . the wait for ack bit is normally 0 but is set to 1 when the packet has been transmitted and the central station is waiting for it to be acknowledged . queue a is liar ring data packets , queue b for urgent data packets , queue c for input acknowledge and ackack packets , queue d for high priority data packets . queue e for normal priority data packets , queue f for confirm data packets for which data has been sent and an acknowledgement not received after an expected time , and queue g for confirm data packets for which all acknowledgements have been received . fig2 a shows the data structure for the email incoming message queue . the email incoming message queue contains electronic mail messages received through the email server that are waiting to be processed . each item in the queue includes an email address 381 and message text 382 . fig2 b shows the data structure for the email incoming message archive . the email incoming message archive contains the complete message and holds it until the user deletes it at the communications unit . each item in the message includes an email address 383 , a pointer 384 to the next text byte that has not yet been copied to the message to unit queue , and message text 385 . fig2 shows the data structures for the email outgoing message queue . the email outgoing message queue contains responses and messages waiting to be sent via the email server to an email destination . each item in the queue includes the destination email address 386 , the originator &# 39 ; s email address 387 , and the text of the message 388 . fig2 shows the data structures for the maps between email addresses and unit ids and channels . the email address to unit id map allows conversion of an email address 401 to the corresponding unit id 402 , while the unit id to email address map allows conversion of the unit id 403 to the corresponding email address 404 . the channel to email address map allows a channel number 405 sent by the communications unit to be translated to an email address 407 for a response to be sent , without the communications unit using an actual email address . an additional assigned bit field 406 indicates whether a particular channel is assigned or not , and another field 408 contains a pointer to the email incoming message archive , indicating the message involved . note that channels 0 and 1 are not assigned in tiffs way , being permanently reserved for original message transmissions ( 0 ) or communication with the pabx ( 1 ). the channel number is also included in a delete message sent by the unit when the user has deleted a message , causing the message in the email incoming message archive to be deleted and the channel deassigned . space is also provided to hold all information from a delete operation in case the user reverses it with an undelete . fig2 shows the data structure for the input data from unit queue , which holds packets received from a communications unit . this structure consists of the 10 - bit id of the unit the packet is from 409 , the 7 - bit channel number 410 , the 7 - bit input packet number 411 , and the input text 412 . fig3 shows the data structures that hold the proprogrammed responses , messages , and email addresses . these include the preprogrammed response list ( consisting , for each entry , of a 7 - bit code 421 and the text for the response 422 ), the proprogrammed message list ( consisting , for each entry , of a 7 - bit code 423 and the text of the message 424 ), the preprogrammed email address list ( consisting , for each entry , of a 7 - bit code 425 and an email address 426 ). fig3 shows the data structures for the time event queue . this includes , for each entry , the absolute time of the future event 427 . the type of event 428 ( 1 for unit response timeout ), the queue involved 429 ( a particular packet to unit queue ), and an id field 430 containing either the unit id or station id , as appropriate . fig3 shows the layout of the lamps , display and cursor , key , and thumbwheel on the front side of the remote unit . the ring / urgent lamp 42 begins flashing at a rate of two flashes per second when a ring packet is received , but then turns off after 4 flashes . the lamp also begins flashing at a rate of one flash every two seconds when an urgent message is received , with the lamp turning to solid after 20 seconds . if selected by the user , indicators will also be presented auditorily by means of the speaker 47 . the communications lamp 43 indicates the status of the communications circuits . if the lamp is turned on for any significant period of time , it indicates trouble . if a user has sent input data ( i . e ., responded to a message ) but has not received an acknowledgement of it , the lamp turns solidly on . in addition , if data ( other than ring ) packets are found to be missing and the unit has not responded recently , the lamp will also be turned solidly on . in contrast , a momentary flicker of the lamp indicates that the circuit is working , with a single short flicker ( 150 ms ) indicating a successful transmission of input data from the unit . the action resulting from the key 48 depends on the location of the cursor 45 ( represented as an arrow ) relative to the text being displayed by the lcd 44 . if the cursor is pointing to received message text , that message is deleted . ( if the user deletes a message in error , selecting the &# 34 ; undelete &# 34 ; command afterward will restore the message ). if the cursor points to a response , that response is sent . if the cursor points to a command , that command is executed . if the cursor points to a preprogrammed message , that message is sent after prompting for an email address . the thumbwheel 49 is rotated by the user &# 39 ; s thumb to move the display window ( i . e ., that text actually displayed at any one time ) up and down in the display memory . the &# 34 ; distance &# 34 ; covered by a particular degree of rotation depends upon the speed of rotation -- rapid rotation results in more movement than does slower rotation . fig3 shows a variety of displays illustrating different situations and the interface presented in each situation . display 451 indicates a typical message , with the example shown having the message aligned by the user with the thumbwheel so that the top line of the message is displayed at the top of the display field . the beginning and end of the message are indicated by right and left single brackets , while responses that have been sent along with the message are displayed on each line surrounded by square brackets . the responses are chosen by the sender or software associated with origination of the message and are optional . if no responses are provided or none are appropriate , the user can choose from a set of preprogrammed responses or compose a response letter by letter . to respond to a message by choosing one of the responses received from a message , the user simply orients the display using the thumbwheel so that the desired response is to the right of the cursor , and presses the key . ( alternatively , instead or in addition to a cursor , the line the cursor is pointing to could display the characters in reverse , white on black , or with some similar distinctive form .) if one of the responses is &# 34 ;* more *&# 34 ;, it indicates that additional data is available in the original message beyond that displayed . selecting this response will cause transmission of this data to the communications unit . just after the list of responses received with each message are two additional selections : &# 34 ; go to responses &# 34 ; and &# 34 ; go to messages &# 34 ;. pressing the key when the cursor points to either of these will cause the menu of preprogrammed responses or messages to be displayed , as appropriate . display 452 shows the top line that is displayed when a user moves the thumbwheel to the highest position in the display memory . ( another way to get there is by reversing the rotation of the thumbwheel twice in rapid succession .) the top two lines display status indicators , with one or more of the indicators shown displayed at a given time , as appropriate . if &# 34 ; high &# 34 ; is displayed it indicates that one or more of the unread messages has a priority of high . if &# 34 ; voicemail &# 34 ; is displayed it indicates that the user has one or more unheard voicemail messages . the user can either call the central voicemail system from a local telephone to listen to them or send a message asking that the messages be transcribed and sent to the communications unit . if &# 34 ; fax &# 34 ; is displayed it indicates that a fax message is waiting for the user . a message will also be received indicating which machine the fax is at if there is more than one machine , and , optionally , a set of responses . if &# 34 ; unread &# 34 ; is displayed , one or more messages have been received but not displayed by the user . similarly , if &# 34 ; print &# 34 ; is displayed it indicates that a print job is waiting for the user . if &# 34 ; rcvr &# 34 ; is displayed it means that the received signal reliability has been less than 100 % over the last n minutes , where n is typically 2 . if &# 34 ; trans &# 34 ; is displayed it means that a transmission from the unit has not been received by a remote station for the last n minutes , where n is typically 2 . ( the user can tell this from receipt of a confirm data packet ). &# 34 ; ok &# 34 ; means that the signal reliability has been 100 % since receipt of the last packet successfully transmitted to the specific unit , or since receipt of a confirm data indicating that all packets sent have been received . below the status indicators are menu selections that cause the display to move to a particular point appropriate to a specific goal . this is simply a shortcut to reach these menus ; the same effect can also be achieved by moving the thumbwheel to move the display window through the display memory . display 453 shows an example of a display where a ring message arrival has interrupted the normal display . this display is set by the user to display : for a fixed period of time ( e . g ., 30 seconds ) and then disappear if no action by the user is taken within this period . the second line indicates the id ( extension number and name ) of the calling party , if known . the two lines at the bottom indicate the current location of the communications unit ( room number , extension , person or department associated with extension ). lines 3 - 5 have the following menu selections : the &# 34 ; send to voicemail &# 34 ; selection transfers the caller immediately to the voicemail system to take a message , while the &# 34 ; transfer to ext &# 34 ; selection will cause the incoming call to be routed to the indicated extension the communications unit is nearest to . the &# 34 ; transfer to new ext &# 34 ; selection will display a different menu , not shown , that allows a variety of other options for allowing the user to transfer to an extension other than the one the user is nearest , including arranging for the caller to be placed on hold until the transfer is made . these options , when chosen , will result in a new message from the central station displayed as a ring interrupt on the lcd verifying the action , such as &# 34 ; transfer to x5410 accepted .&# 34 ; display 454 shows examples of preprogrammed responses that can be selected by the user and sent . the user orients the desired response so it is to the right of the cursor and presses the key . the last selection in this list (&# 34 ; return to display &# 34 ;) does not send a response but causes a redisplay of the last message to be displayed . the display will also redisplay the last message after any response is sent . display 455 shows examples of preprogrammed original messages that can be selected by the user , with each message enclosed in curly brackets . if this display is entered by selecting the &# 34 ; go to messages &# 34 ; selection from a displayed message , the message will be sent as a response to that message . otherwise , selection of the message ( by pressing the key ) will result in the display of a menu of electronic mail addresses . when that selection is made ( again with the key ) the message will be sent . one of the choices from the menu of electronic mail addresses allows the user to compose an email address letter by letter . if none of the canned messages is appropriate , the user selects the first item on the list (&# 34 ; go to compose message &# 34 ;) which allows messages to be composed letter by letter . display 456 shows the list of individual characters and associated commands that can be selected to compose a message or email address . the composed material is displayed at the top of this part of the display memory , as shown in the example &# 34 ; this is text of message &# 34 ;. each letter is selected by pressing the key ; the message is sent when done is selected . &# 34 ; clear &# 34 ; will erase the composed message and allow the user to start over . &# 34 ; backspace &# 34 ; erases one letter . another display , not shown in a figure , allows the user to choose one or more commands to be executed that control operation of the remote communications unit . some parameters for operation are set by the user using the thumbwheel and key ; other parameters are set at the central communications station by a user addressing an email message ( from a workstation ) appropriately to a utility program that sets such parameters , with the email message containing the appropriate information . the following me examples of commands that can be selected by the user at the unit : &# 34 ; beep if message rcvd &# 34 ; causes an auditory alarm if any message has been received . &# 34 ; beep if urg msg &# 34 ; causes an auditory alarm if an urgent message has been received . &# 34 ; flash if ring &# 34 ; causes the ring / urg lamp to flash if a ring message has been received . &# 34 ; beep if ring &# 34 ; causes an auditory alarm if a ring message has been received . &# 34 ; menu if ring &# 34 ; causes a display of the user &# 39 ; s location and the menu ( shown as 453 ) to be displayed when a ring message has been received to allow the user to transfer the call to a nearby extension . &# 34 ; locate &# 34 ; prompts for an email address and returns the last known location of the unit associated with that address . &# 34 ; set privacy mode &# 34 ; turns off the &# 34 ; locate &# 34 ; command ( which allows other users to determine the last known location of a user ) for this user . other commands allow a user to define new responses to be added to the menu , new original messages , and new email addresses . fig3 shows a flowchart of the architecture of the software for the communications unit . software is divided into five primary modules : ( 1 ) a module for processing packets that have been received from the central station : ( 2 ) a module for redisplaying message and menu text when the thumbwheel has been moved ; ( 3 ) a module for processing presses of the key on the communications unit : ( 4 ) a module for transmitting a packet from the unit : and ( 5 ) a module that changes indicators such as the lamps and auditory alarm at specific times to provide appropriate flashing or beeping effects . in addition , clock and communications interrupt modules , not shown in the figure , provide support to the above software . at the start of the module , a test is made 461 of whether a packet has been received by the unit from the central station via radio . such a packet is detected by an interrupt service routine that processes incoming characters from the unit communications interface , which generates an interrupt for each received character . the interrupt handler looks for an soh character , placing received characters into a buffer when an soh has been detected . when an eot character is received , the handler sets a flag indicating that a packet is ready to be processed . if a packet has been received , the packet processing module 462 is called , resulting in different actions depending on whether the packet is a data . input acknowledge , ackack , or confirm data packet . details arc described in fig3 - 36 and the associated text . in general , packets are first error checked and the unit id compared with the internal id of the unit and ignored ( except for use in computing signal reliability statistics ) if an error is detected or if the packet is for another unit . a data packet is entered into memory , displayed , and an indicator alarm triggered , depending upon the packet priority and other factors . an input acknowledge packet causes an input data packet that the unit hits been holding to be deleted , and an ackack packet causes an acknowledge packet that the unit has been holding to be deleted . receipt of either causes the unit to transmit immediately if there is input data or acknowledgements remaining in the input data queue or packet acknowledgement queue after the above deletions . a confirm data packet , if there is missing received data , causes an indicator light to turn on to alert the user that the unit must be reoriented in direction or moved in position to allow data from the unit to be received . if a packet has not been received , a test is made 463 of whether the thumbwheel has moved . an interrupt handler is used , with a clock tick every 0 . 83333 ms resulting ( after a software divide - by - 64 counter ) in the thumbwheel position being checked every 53 . 33 ms and , if it has moved beyond a threshold allowable drift , a flag is set indicating that the window in the display memory should be moved , and a value for the amount of movement calculated . if the thumbwheel has not moved , a test is made 465 of whether the key has been pressed . if yes , the appropriate action is taken 466 , depending upon the location of the cursor in the displayed text and the context . this action may be to display different text , to execute a command that changes a local parameter ( e . g ., silencing the auditory alarm ), or to execute a command or select a response that results in input data being transmitted to a remote station and then to the central station . if a response is selected a subpacket is formatted with an appropriate response sequence , including an input packet number and a channel number indicating the destination address of the response . this sequence number is entered after incrementing the current input packet number saved as a variable . the channel number is that found in the display memory associated with the message the response is to . if an original message is selected a subpacket is formatted in the same manner its described above . either a channel number or the text of an email address is sent , depending upon whether the address is in the preprogrammed list or composed by the user . any such input data is held in the input data queue until the next transmission of an input packet . if input data has been generated , the transmit flag is set so that the packet will be transmitted immediately . if a key has not been pressed , a test is made 467 of whether it is time for a transmission to be made from the unit . this is done by testing the state of the transmit flag . this flag is set ( as indicated above ) by a key press that results in input data that needs to be sent , the receipt of a non - ring data packet ( resulting in an ack that needs to be sent ), by a timer that sets the flag at regular intervals , or by the receipt of an input ack or ackack packet when data still remains to be sent . the average time between intervals varies depending upon the receipt of data packets , the generation of input data , and the passage of time . there are three different intervals : a &# 34 ; short interval &# 34 ; results in transmissions being made at an interval from 10 - 25 seconds , with the exact time determined by adding 10 to a 4 - bit random number . a &# 34 ; medium &# 34 ; interval is from 26 - 57 seconds , determined by adding 26 to a 5 - bit random number . a &# 34 ; long &# 34 ; interval is from 58 - 121 seconds , determined by adding 58 to a 6 - bit random number . the entry of input data results in transmission at short intervals , after the initial transmission which is done immediately . the receipt of a data . input ack , or ackack packet results in transmission at medium intervals ( if the unit is not already transmitting at short intervals ), after the initial transmission done immediately . after a unit has transmitted at short intervals for 5 minutes , it proceeds to transmit at medium intervals ( if there has been no additional activity ). after a unit has transmitted at medium intervals for 10 minutes , it proceeds to transmit at long intervals ( if there has been no additional activity ). increasing the time between transmissions reduces drain on the battery in the unit , and also , together with random determination of the time between transmissions , reduces the likelihood of collisions between transmissions of different units in the same room . ( in an alternative embodiment , the time interval between transmissions is determined by three factors : the type of information in the packet ( whether acknowledge , input data , or neither ), the amount of data in the packet , and the lime since an event such its receipt of a data packet or entry of input data . an interval is calculated by first determining a range of possible values , with the maximum of this range determined by multiplying the length of the packet to be transmitted by a factor reflecting the relative priority of the information contained in the packet and then by a function that decreases with the time since the last event . the minimum of the range is 0 . a number is then randomly determined within this range to serve as the delay interval .) when a unit transmits , it selects the first sequence of input data from the input data queue , and the first acknowledgement ( or sequence , if continuous ) from the packet acknowledgement queue . this data is entered , along with the unit id , into the unit transmission buffer , according to the format shown in fig1 , and the transmission of that buffer initiated 468 . if input data is being transmitted the communications stale variable is set to 3 to indicate that the input data timer is on , and the input data timer is set to 20 seconds . the same clock interrupt handler that is used for periodically checking the position of the thumbwheel is also used , by means of software counters , to measure the time between transmission intervals its well as the time to change the visual and auditory indicator states , as described below . if it is not time to transmit , a test is made 469 of whether it is time to change the indicators , including toe ring / urgent lamp , the communications lamp , or the auditory alarm . these operations 470 are performed by the clock interrupt handler , and details are shown in fig3 and 38 . after each event has been processed , control is passed to the start of the module , with the sequence of tests ensuring that the highest priority tasks we performed first . fig3 shows a flowchart of the part of the software module in the communications unit devoted to processing incoming packets that have been received by the unit via radio . a test is first made 481 of whether the unit id in the packet matches the internal id of of the unit and that the packet successfully passes an error check ( by comparing the received cyclic redundancy check with one computed from the received data ). if the unit id does not match or if an error is found , the packet is not used . a calculation is then made 482 of the received signal reliability and the packet processing module is done . if the reliability drops below a certain threshold , the &# 34 ; rcvr &# 34 ; indicator is turned on , and &# 34 ; ok &# 34 ; is turned off if it was previously on . ( signal reliability is based on the proportion of packets received with a correct error check , regardless of the unit id , as a function of the total number of packets received over a window of the last 120 seconds .) if there are no errors and the unit id is correct , a calculation is made 483 of the received signal reliability , and a test is then made 484 of the packet type . if the packet is a data packet , a test is made 485 of the status of the received packet , in the sense of how it should be processed , with this status determined largely by the sequence number of the packet number and its relationship with the last packet received for the given priority ( referred to as the lprgp ). a packet is &# 34 ; displayable &# 34 ; if the received packet has a sequence number exactly one above the lprgp , or if it has a sequence number more than one above the lprgp ( implying one or more missed packets ) and the packet is the first packet in a message . a packet is &# 34 ; unassigned to message &# 34 ; ( meaning that it cannot be identified its belonging to a particular message ) if it has a sequence number more than one above the lprgp and the packet is not the first packet in a message . a packet is a &# 34 ; retransmitted missing packet &# 34 ; if the sequence number is less than the lprgp . if the packet has a sequence number exactly matching the lprgp , it is a duplicate copy of a previously received packet and is ignored . if the received packet is displayable , it is placed 486 in the appropriate item in the incomplete message packet map ( determined by searching the map for an item in which the sequence number fits , or creating a new item if the packet is the first in a message ). the received packet number is then stored in the lprgp as its new value , and control passed to point 1 in fig3 so that the packet can be displayed or otherwise acted upon . if the received packet is a retransmitted missing packet , the incomplete message packet map is searched 487 to see if the packet unambiguously lib in a map item . if yes , the packet is entered 488 into that item ( or a new item created if the packet is the first in a message ). the packets unassigned to messages list is then searched to see if there are packets that can be fit into the incomplete message packet map as a result of the most recent entry . if so , those packets are moved 489 to the map . a test is then made 490 of whether there are new displayable packets in the map item just modified . if yes , control passes to point 1 in fig3 so that they can be displayed . if not , the module is done . if the received retransmitted missing packet does not lit in the map item ( test 487 ), control passes to step 491 . if the received packet is unassigned to message ( resulting from the packet not having a previous packet received and not being a first packet in a message , and thus unable to be stored in the incomplete message packet map ), the packet is entered 491 in the packets unassigned to messages list , and the module is done . if the packet type is confirm data , a test is made 492 of whether a packet is missing ( as indicated by either packet sequence numbers for one or more priorities contained in the confirm data packet , not matching the unit &# 39 ; s lprgp , or noncontinuous packet numbers of received packets ). if yes , and , in addition , a response has not been received for a threshold time period ( 30 seconds for urgent packets , 120 seconds for others ), the unit must successfully respond before that packet will be retransmitted , and thus the communications lamp is turned solidly on 493 ( by setting the communications state to 1 and the communications lamp bit to 1 ) to indicate to the user that the unit should be moved in orientation or position so as to reestablish contact . the module is then done . if no packets are missing , the module is done immediately . if the packet type is ackack , the packet sequence number contained in the ackack packet is removed 494 from the packet acknowledgement queue . ( if the packet sequence number is not in the list the packet is ignored as redundant .) control then passes to step 495 . if the packet received is an input acknowledge , the relevant packet is deleted 496 from the input data queue . in addition , the input data state is set to 0 , turning off the associated timer . a test is then made 495 of whether there is input remaining -- either input data or acknowledgements -- in either the packet acknowledgement queue or input data queue , after the above deletions have been made . if yes , the transmit flag is set 496 so that the unit will transmit immediately . if the communications lamp is on , it is turned off 497 . if the lamp is not on , and only if an input ack was received , it is set to flicker for 150 ms ( by setting the communications state to 2 and the communications timer to 180 ), indicating in either case that the central station has received input data from the unit . the module is then done . if the packet type is input acknowledge , the indicated input packet in the input data queue is deleted 498 . in addition , the &# 34 ; ok &# 34 ; indicator is turned on if the rcvr indicator is also off , and the &# 34 ; trans &# 34 ; indicator turned off , if previously on . the transmit received timer is also set to 0 . control is then passed to step 495 . if the indicated input packet is not in the input data queue , the input acknowledge packet is ignored as redundant . fig3 shows a flowchart of the part of the software in the communications unit that processes displayable incoming data packets that have been received . at point 1 , a test is made 511 of the priority of the packet . if the priority is ring ( indicating an incoming telephone call ), a further test is made 512 of whether this is the first packet in the message ( indicated by an stx as the first character in the text field ). if yes , a further test is made 513 of whether the entire message is contained in the first packet . if no , the message is not displayed at this time , and the module is done . if yes , a further test is made 514 of whether the message is a normal ring message or a ring followup message , which is identified with an ascii sub character just after the channel number . if the message is a ring followup message , control is passed to step 519 . if the message is a normal ring , the ring state is set 515 to 8 to start the ring / urgent lamp flashing . the auditory ( or vibratory ) alarm state variable is also set to 8 to initiate it , if appropriate . a test is then made 516 of whether a ring interrupt display is being displayed at the present time . if no , control passes to step 519 . if yes , a test is made 517 of whether the ring message is from the same caller as the ring interrupt being displayed . if yes , the time that the present ring interrupt display will be displayed is extended 518 ( by setting the ring interrupt state to 1 and the ring interrupt timer to be 30 seconds from the present time ), and the module is done . if no , the ring interrupt is displayed 518 for the new call , and the module is done . the ring interrupt display will be maintained until either the user selects a response , 30 seconds have elapsed , a ring followup message has been received , or a new ring packet has been received for a different incoming call than that just displayed . if the received packet is not the first packet in the message ( test 512 ), a further test is made 520 of whether previous packets in the same message have been received . if yes , control passes to step 514 . if no , the just - received packet is discarded 521 . ( if a ring packet is lost , other packets in the same message are discarded , with the unit then waiting until the next ring ). the module is then done . if the packet priority is urgent , a further test is made 522 of whether the received packet is the first packet in the message . if yes , the urgent state is set 523 to 22 to initiate the lamp blinking , and the auditory alarm state set to 8 if appropriate . in addition , the &# 34 ; unread &# 34 ; message variable is set . control then passes to step 524 . if this is not the first packet in the message , control passes immediately to step 524 . the packet is then entered 524 into the display memory . if the message has a special character indicating that this announces that a fax , voicemail message , or print job is available , the appropriate text is entered into the display memory to allow the appropriate indicator to be turned on . if the character just before the eom is an etb , indicating that there is additional data , a &# 34 ;* more *&# 34 ; response is provided to the user as an option . the packet number of the received packet ( note that its first 2 bits consist of the packet priority ) is then placed 525 in the packet acknowledgement queue . the transmit flag is then set 526 so as to initiate transmission of the unit transmission buffer immediately . the module is then done . if the packet priority is high or normal , a further test is made 527 of whether the received packet is the first in the message . if yes , the &# 34 ; high &# 34 ; and / or &# 34 ; unread &# 34 ; message variable is set 528 , as appropriate , and control passed to step 524 . if the received packet is not the first in the message , control is passed immediately to step 524 . fig3 shows a flowchart of the first part of the clock interrupt software for the microprocessor in the communications unit . an interrupt occurs every 0 . 83333 ms , resulting in execution of the clock interrupt software . once initiated , a test is first made 531 of whether the thumbwheel has moved beyond a certain threshold level . this is done by first checking a thumbwheel timer , which ranges from 0 - 63 . if it is 0 , the thumbwheel movement is calculated and the timer reset to 63 . if not , the thumbwheel timer is decremented . this results in checking the thumbwheel position every 53 . 333 ms . if the thumbwheel moved , the thumbwheel movement flag is set 532 so that the main program can respond to the movement . the transmit timer , which holds the time remaining until the next transmission from the unit , is then decremented by an appropriate amount 533 , and the result tested 534 . if the result is 0 , the transmit flag is set 535 , indicating to the main program that a transmission should be initiated . a test is then made 536 of the auditory alarm state . this variable is 0 if the alarm has not been initiated , from 1 to 7 if it has , and 8 if the initiation has just been requested by the main program . each of the states 1 - 7 represent time intervals in which the alarm is sounding or silent , with the intervals having the following lengths : sounding for 50 ms , silent for 150 ms , sounding for 50 ms , silent for 750 ms , sounding for 50 ms , silent for 150 ms , and sounding for 50 ms ( for states 7 through 1 , respectively ). if the auditory alarm state variable is 8 , control is passed to point 1 . if it is 0 , control passes to step 551 . if it is from 1 to 7 , the auditory alarm timer is decremented 537 and the result tested 538 . if the result is 0 ( end of alarm interval ), control is passed to point 1 . at point 1 , the auditory alarm state variable is decremented 539 , the auditory alarm timer is set to the maximum value for the new state ( depending upon the time interval for that state ), and the sounding / silent flag is set to 1 or 0 depending upon whether the new state is sounding or silent , respectively . control then passes to step 540 . if the result of test 538 is greater than zero , indicating that time still remains in that alarm interval , and the sounding / silent flag indicates sounding , the state of the auditory output bit is toggled 540 ( so as to create an on - off square wave with a period of 1 . 667 ms , resulting in an audio frequency of 600 hz plus harmonics ). ( alternative embodiments might use a different sound pattern for different events , e . g ., ring , second ring for same caller , urgent , etc ., with a clock interrupt routine based on that shown here ). control then passes to step 551 . a test is then made 551 of the ring indicator state . if the ring indicator state variable is 8 , control passes to point 2 to initiate a ring indicator cycle . at point 2 , a test is made of whether the urgent state is nonzero ( indicating that an urgent message is pending ). if yes , the display indicating it is put on hold 552 . this is done as follows : if the urgent state is 1 , indicating that the lamp is solidly on , the urgent hold state is set to 2 , indicating a solid hold . if the urgent state is 2 to 22 , indicating that the lamp is in its blinking stage , the urgent hold state is set to 1 , indicating a blinking hold . the ring / urgent lamp bit is then set to 0 . control then passes to step 555 . if the ring indicator state is 1 - 7 , the ring indicator timer is decremented 553 , and the value after decrementing tested 554 . if the result is greater than 0 , control passes to point 4 in fig3 . if the result is 0 , the ring / urgent lamp bit is toggled 555 , the ring indicator state is decremented 556 , and the ring timer is set 557 to 300 , representing a value of 250 ms . control then passes to point 4 in fig3 . if the ring indicator state ( test 551 ) is 0 , ringing is not occurring , and control passes to point 3 in fig3 . fig3 shows a flowchart of the last part of the clock interrupt software for the microprocessor in the communications unit . at point 3 , a test is made 561 of whether a ring interrupt is pending , by testing the ring interrupt state . if it is 1 ( yes , pending ), the ring interrupt timer is decremented 562 . a test is then made 563 of the value of the ring interrupt timer . if the result is 0 , the old display is restored 564 ( from the appropriate location in the display memory ), and the ring interrupt state set to 0 . control then passes to step 565 . if the ring interrupt timer is greater than 0 , control passes immediately to step 565 . if the result of the test 561 of the ring interrupt state is 0 , control also passes immediately to step 565 . a test is then made 565 of whether the urgent indicator has been put on hold . ( this is done by testing the urgent hold state , which is 2 if on hold from a solidly on lamp , 1 if on hold from a blinking lamp state , and 0 if not on hold .) if it is on hold , being solidly on , the ring / urgent lamp bit is turned on 566 , the urgent state is set 567 to 1 , and control passes to point 4 . if the urgent indicator has been put on hold from a blinking state , the urgent state is set 568 to 22 , to reinitiate the blinking cycle from the beginning , and control passed to step 572 . if the urgent indicator has not been put on hold , a test is made 569 of the urgent state . if the urgent state is 0 ( no urgent message pending ) or 1 ( lamp solidly on ), control is passed to point 4 . if the urgent state is from 2 to 21 ( representing intervals of on - off toggling every 1 second , resulting in a 1 sec on -- 1 sec of duty cycle every 2 seconds ), the urgent timer is decremented 570 by 1 , and a further test made 571 of the value of the urgent timer after such decrementing . if it is greater than 0 , then the interval is not over , and control is passed to point 4 . if the urgent timer is 0 , then the interval has expired , the urgent state variable is decremented 573 , the ring / urgent lamp bit is toggled 574 ( to turn the lamp on if previously off and vice - versa ), and the urgent timer is set 575 to a value of 1200 . ( this represents 1000 ms , with each tick of the 0 . 83333 ms clock causing the timer to be decremented by 1 ). control is then passed to point 4 . if the urgent state is 22 ( urgent just initiated ), the ring / urgent lamp bit is set 572 to off ( to make sure ), and control passed to step 573 . at point 4 , a test is made 585 of file communications state . if it is set to 2 ( flicker ), indicating that a single flicker is being displayed , the flicker timer is decremented and , if the result is 0 , the flicker has ended and the the communications state and communications lamp bit are set 586 to 0 . if the communications state is set to 1 ( input data sent ), indicating that the input data timer is on , the timer is decremented 587 and the result tested 588 . it it is 0 , the communications lamp bit is set 589 to be solidly on . the module is then done and the interrupt is dismissed . if the input data timer is greater than 0 , the module is also done . if the communications state ( test 585 ) is 0 , the interrupt is dismissed immediately . also included in the interrupt module ( but not shown in the figure ) is code for determining whether an input acknowledge packet ( either an inputack or unitack ) has been received within a timeout period . each clock interrupt causes a transmit received timer to be incremented , and a test is made to see if the timer is greater than a timeout period , e . g ., 180 seconds . if yes , the &# 34 ; trims &# 34 ; indicator is displayed , and the &# 34 ; ok &# 34 ; indicator is turned off , if previously on . similarly , a signal received timer is incremented and used to determine whether a reliable signal has been received for at least the last 120 seconds . if not , the &# 34 ; rcvr &# 34 ; indicator is turned on , and &# 34 ; ok &# 34 ; is turned off , if previously on . fig3 - 43 show the data structures used in the software for the communications unit . fig3 shows the data structure for the incomplete message packet map . each item in the map contains information available about packets related to a specific message that is incomplete ( i . e ., all packets in the message -- a first packet , a last packet , and all intervening packets -- have not been received ). an entry is made in the map only if the first packet in the message has been received ; otherwise , a packet is entered in the packets unassigned to messages list . this implies that the first packet entered into the map for each message is the first packet in that message . each item in the map consists of a priority for the message 601 , a &# 34 ; packet slot &# 34 ; ( e . g ., 602 ) for each of the 8 packets that can potentially be in a message ( 0 through 7 ), and the sequence number for the first packet 603 ( 14 bits ). each packet slot , in turn , expanded as indicated by the arrow , consists of a received bit 604 , which is set to either 1 or 0 depending on whether the corresponding packet has been received or not , and an indirect pointer 605 to the packet text list , which contains the actual text received for each message . ( the pointer references the address of a pointer in the pointer list that contains the actual address in the packet text list ). during error - free transmission the first packet and any number of succeeding packets may be received ( received bit set to 1 ) while following packets have not been received ( bit set to 0 ). if a packet has been received , however , and any packet slot preceding it ( i . e ., to the left in the diagram ) has its received bit set to 0 , the associated packet is missing . note that the channel number tier each message is stored in the packet text list in the first packet received for that message , just after the stx character . also associated with the map ( but not shown in a figure ) are four 14 - bit counters , one for each packet priority , known as the lprgp ( last packet received for given priority ). this contains the packet sequence number for the last packet received for each priority . fig4 shows the data structure for the packets unassigned to messages list , used in the software in the communications unit . this list holds those packets that have been received but have not been assigned to a message in the incomplete message packet map because there is no information , or the information is ambiguous , about their relationship to a particular message . the list consists of the following fields for each received packet : the priority 606 , the packet sequence number 607 ( 14 bits ), and a pointer 608 to the packet text list . fig4 shows the data structures for the packet text list . this contains the text of packets being tracked by the incomplete message packet map and packets unassigned to messages list . the upper part of the figure contains the text itself ( 612 , 614 , and 616 ), with packets placed in the packet text list in the order in which they are received , with each text packet beginning with an soh ( 611 , 613 , and 615 ), and terminated 617 by either an soh ( indicating the start of a following packet ) or an etb ( if no packet follows ). the lower part of the figure contains a 16 - bit pointer for each packet that indicates the address of the beginning of the packet . when a packet with n bytes is removed from the list the remaining text in the list is moved up by n bytes to take the place of the deleted packet and the pointers recalculated appropriately . fig4 shows the data structure for the display memory and the associated display window . the display memory 621 contains all of the information that can be displayed by the unit , in the order that a user might view it by rotating the thumbwheel . at any given time , only a narrow window ( equal to the size of the display ) is visible , with data transferred from the display memory to the display window 622 ( a small buffer memory that is part of the lcd and which drives the display ) whenever the thumbwheel is moved . the information contained in the display memory includes status indicators and the top - level menu ( see the description of the unit interface ), all text of the received messages , text of preprogrammed responses , text of preprogrammed messages , text and data liar the compose operation , text of electronic mail addresses , and text of commands . also shown is a pointer list 623 , which contains 10 - bit addresses pointing to the beginning of each of the significant areas of memory , in bytes . a pointer is included for each of 3 priorities of received messages ( urgent , high , and normal ) and for each of the areas shown in the display memory diagram 621 . ( the status indicator area begins at address 0 ). within a message priority , messages are stored in the display memory in the order of receipt of the first packet . each message has been formatted at the central station to fit into specific lines ( with a maximum of 20 character per line ). each message begins with ( just after the stx character ) a nondisplayed character that contains the channel number . each physical line of text is terminated by a newline character . the message itself is terminated by an ascii etx ( or a bel if the full message has not been received ). each response included with the message is then terminated by an etx . ( if the response extends across more than one physical line each line is terminated by a newline character ). the last response is terminated by an eom , with the eom appearing at the end of the message even if there are no responses . preprogrammed responses , messages , addresses , commands , and the compose menu are coded similarly , with each physical line terminated by a newline character if the response extends across a single physical line , and each response terminated by an etx . the compose menu also includes space for holding a response composed by the user . fig4 shows the data structures for the input data queue , packet acknowledge queue , and unit transmission buffer . each entry in the input data queue consists of the channel number for the message 631 , a tag 632 indicating whether the input data is in the form of actual text or compressed text using a code , and a pointer ( 10 bits ) to the actual input text or the actual code in the display memory . each entry in the packet acknowledgement queue consists of the 14 - bit packet sequence number 634 for the packet being acknowledged . the unit transmission buffer consists of the current input packet being ( repeatedly ) transmitted , and consists of a packet header 635 , unit id 636 , data 637 ( either input data , an acknowledgement , or both ), error check 638 and eot 639 . ( an alternative embodiment would allow either input data or an acknowledgement , but not both , or , at the other extreme , multiple input packets and acknowledgement packets , with the transmission capacity and reliability in both directions and battery capacity determining the optimum design ). fig4 shows the timing of relationships between transmissions by communications units and remote stations receiving from the communications units . a unit transmits a packet 641 of 70 to 410 bits in length , which takes 1 . 82 to 10 . 66 ms at an infrared transmission rate of 38 , 400 bits per second . a remote station receives and stores this transmission and retransmits it via radio 642 , also at 38 , 400 bits per second , after a randomly deterairier delay . a second remote station may also receive the transmission from the communications unit and retransmit it 643 , but usually with a different delay so as to avoid conflict . ( occasional conflicts will occur that cause both retransmissions to be destroyed ; this is rare and requires only that the system wait for another transmission from the unit ). in cases where a second communications unit transmits 644 during the delay period , the remote station will store that packet as well and retransmit 645 both packets at the end of the delay period . ( note that the length of the packet transmissions shown here and in the following figure are in terms of the number of bits rather than time .) fig4 shows the timing of relationships between transmissions by communications units , repeater stations , and remote stations . a unit transmits a packet 646 , which is received at two different repeater stations . repeater station # 1 retransmits the packet 647 by infrared after a delay determined randomly within a given range ( e . g ., 0 to 600 ms , with the range determined by factors such as the type and amount of information in the packet ). repeater station # 2 retransmits the packet 648 also by infrared but ( as the result of chance ) after a longer delay . assuming that the first repeater transmission 647 is received at remote station # 1 , the station will initiate a delay and then retransmit the packet 649 . if both transmissions from the two repeaters originating from the same communications unit are received at the remote station , only one will be retransmitted by the remote station . in the case of transmissions by two different communications units 646 and 650 that are received by repeater station # 1 , the repeater will wait until the end of the delay period and then retransmit both packets independently in succession 651 . fig4 shows a flowchart of the software for a remote station . at the start of the module , a test is made 661 of whether a packet has been received from a unit ( or repeater ), which is temporarily stored in memory as characters are received . this is done by checking the packet ready flag , a flag that is set by an interrupt service routine when a complete packet has been received . the interrupt service routine does this by first looking : for an soh and , when it is found , placing each received character in a buffer until an eot is received , at which time the flag is set . the interrupt service routine , in addition to sampling the data , also measures the amplitude of the infrared signal received and , when an eot is received , appends that measurement to the packet , in the form of an 7 - bit character placed just before the etx character , as indicated in fig1 . if a complete packet has not been received , a test is made 662 of whether it is time to transmit a packet -- that is , at least one packet has been received and is in the received packets list for the remote station , a delay time has been set , and that delay period has passed . if no , control passes to step 661 . if yes , a packet ( including data from all packets in the received packets list ) is formatted and transmitted 663 . control then passes to step 661 . if a packet has been received from a unit or repeater ( test 661 ), as indicated by receipt of an eot character , an error check is calculated and a test made 664 of the result . if the packet was not received correctly , control passes to step 661 . if the packet was received correctly , a test is made 665 of whether the packet is a duplicate . this is determined by comparing the packet just received with those packets in the received packets list . ( the repeater tag bit or repeater ids are ignored in such comparisons .) if the packet is a duplicate , control passes to step 661 . if the packet is not a duplicate , the received packet is then placed 666 in the received packets list . the signal amplitude measure is added to the packet if it was received directly from the remote station . if the packet was received through a repeater , the measure is set to 0 to indicate that the measure is not relevant . a test is then made 667 of whether a delay period ( and corresponding time to transmit ) has been set . if yes , control passes to step 661 . if no , a time delay is calculated . this is done by generating a random number representing the delay time , with the range of the random number dependent on the type of packet received . if input data is included in the received packet , and the packet is less than 13 characters in length , the range is from 0 to 200 ms . if input data is included and the packet is from 14 to 25 characters in length , the range is 0 to 400 ms . if input data is included and the packet is 26 characters or more in length , file range is 0 to 600 ms . if input data is not included but an acknowledgement is , the range is from 0 to 1000 ms . if neither input data nor an acknowledgement is included in the packet , the range is from 0 to 2000 ms . an absolute time is then calculated 668 by adding the time delay to the current time . control then passes to step 661 . ( in an alternative embodiment , the delay before transmission of a packet is determined by multiplying the amount of data in the packet by a factor that depends upon the type of data in the packet . this factor is , for example , 20 ms per character for packets with input data , 40 ms per character for packets with acknowledgements but no input data , and 100 ms per character for packets with neither input nor acknowledgement data .) fig4 shows a flowchart of the software for a repeater station . a test is first made 671 of whether a packet has been received from a unit , which is temporarily stored in memory as characters are received . this is done by checking the packet ready flag , a flag that is set by an interrupt service routine when a complete packet has been received . the interrupt service routine does this by first looking for an soh and , when it is found , placing each received character in a buffer until an eot is received , at which time the flag is set . the interrupt service routine , in addition to sampling the data , also measures the amplitude of the infrared signal received and , when an eot is received , appends that measurement to the packet , in the form of an 7 - bit character placed just before the etx character , as indicated in fig1 . if a complete packet has not been received , a test is made 672 of whether it is time to transmit a packet -- that is , at least one packet has been received and is in the received packets list for the repeater station , a delay time has been set , and that delay interval has passed . if no , control passes to step 671 . if yes , the receiver is turned off 673 by simply ignoring input data from the infrared detector ( or ultrasonic microphone ). a single received packet is then transmitted 674 by infrared . before transmitting the packet , the repeater tag bit is set if it is not already . a test is then made 675 of whether all packets in the received packets list have been sent . if no , control passes to step 674 to transmit another packet . if yes , all packets are deleted 676 from the received packets list and the receiver is turned back on 677 . control then passes to step 671 . if a packet has been received from a unit or another repeater ( test 671 ), indicated by receipt of an eot character , an error check is calculated and a test is made 678 of the result . if the check showed that the packet was not received correctly , control passes to step 671 . if the packet was received correctly , a test is made 679 of whether the packet has been sent by a unit or a repeater ( by checking the repeater tag bit ). if it has been sent by a repeater , the packet is discarded and control passed to step 671 . if the packet was not sent by a repeater , the packet ( including signal amplitude measure ) is then entered 680 into the received packets list . a test is made 681 of whether a delay period ( and corresponding time to transmit ) has been set . if yes , control passes to step 671 . if no , a time delay is calculated . this is done by generating a random number representing the delay time , with the range of the random number dependent on the type of packet received . if input data is included in the received packet , and the packet is less than 13 characters in length , the range is from 0 to 200 ms . if input data is included and the packet is from 14 to 25 characters in length , the range is 0 to 400 ms . if input data is included and the packet is 26 characters or more in length , the range is 0 to 600 ms . if input data is not included but an acknowledgement is , the range is from 0 to 1000 ms . if neither input data nor an acknowledgement is included in the packet , the range is from 0 to 2000 ms . an absolute time is then calculated 682 by adding the time delay to the current time . control then passes to step 681 . ( in an alternative embodiment , repeater stations are assigned identification codes that are added to received packets before they are retransmitted , with another id code added to the packet whenever it passes through another repeater station . each repeater would , however , discard without retransmitting those received packets containing the repeater &# 39 ; s own id . the result of this is that a given packet can only be retransmitted once by a given repeater , allowing multiple chains of repeaters to improve coverage . at the same time , it prevents a single packet from reverberating continuously by being passed back and forth between two or more repeaters .) | 7 |
the method disclosed herein provides an optimum yield of the desired 3 - amino - 5 -( t - butyl ) isoxazole . the method is carried out stepwise . in the first step , a lower alkyl ester of pivalic acid , suitably methyl pivalate , is allowed to react with acetonitrile in the presence of a base , such as sodium hydride , in the presence of a solvent under an atmosphere of nitrogen at the reflux temperature of the reaction mixture for a time sufficient to bring about substantial completion of the reaction . other bases which can be used in the reaction include sodium ethoxide and sodium methoxide . suitable solvents include tetrahydrofuran , ether , toluene , ethanol and methanol . while substantial completion of the reaction occurs in about 7 hours , longer times of reflux , for example , up to about 24 hours , can be employed . at the end of the reaction time , the reaction mixture is concentrated in vacuo to remove the solvent , water is added , and the aqueous mixture made acid with , for example , aqueous hydrochloric acid . the desired product , the pivalyl acetonitrile , precipitates from the acid solution and is filtered off and dried . the second step of the synthesis of 3 - amino - 5 -( t - butyl ) isoxazole is carried out by allowing the pivalyl acetonitrile , prepared as described hereinabove , to react with hydroxylamine under carefully controlled conditions of ph , in a suitable solvent at a suitable temperature for a period of time such that substantially complete reaction is obtained to form the preferred 3 - amino - 5 -( t - butyl ) isoxazole . in one embodiment the hydroxylamine is used in salt form , for example , hydroxylamine hydrochloride , and the hydroxylamine salt is added to a mixture of the pivalyl acetonitrile and base in the solvent , and the ph is adjusted to the preferred range . temperatures of from about 0 ° c . to about the reflux temperature of the reaction mixture can be employed , with the preferred reaction temperatures ranging from about room temperature to about the refluxing temperature of the reaction mixture . reaction times of course vary inversely with the reaction temperature , i . e ., from about 3 days to about 1 hour . thus , reaction times at the reflux temperature of the reaction mixture come within the range of from about 1 hour to about 24 hours , preferably from about 7 hours to about 22 hours , with the latter range of reaction time providing generally optimum yields of the desired 3 - amino - 5 -( t - butyl ) isoxazole . suitable solvents include mixtures of an alcohol and water , such as ethanol - water , methanol - water , ethylene glycol - water , isopropanol - water , and n - butanol - water . the optimum solvent system is composed of ethanol and water , with ratios of from about 95 : 5 to 42 : 58 ethanol : water , all providing acceptable yields of the 3 - amino isomer . while hydroxylamine hydrochloride is the salt form of choice , hydroxylamine sulfate also can be used , albeit less favorable product isomer ratios appear to be obtained . suitable bases include sodium hydroxide , lithium hydroxide , potassium hydroxide , calcium hydroxide , sodium carbonate , sodium bicarbonate , and potassium carbonate . the preferred base is selected from the group consisting of sodium hydroxide , lithium hydroxide , and potassium hydroxide . in adding the hydroxylamine hydrochloride to the reaction mixture , it appears that a quick addition is preferable . best results appear to be obtained by adding an aqueous solution of the hydroxylamine hydrochloride to the basic solution of the pivalyl acetonitrile , and then , within the first 15 to 30 minutes , adjusting the ph to within the range of from about 5 . 0 to about 8 . 0 , preferably from about 6 . 0 to about 7 . 0 , with the ph range of choice being ph about 6 . 2 to about 6 . 5 . this careful control of the ph of the reaction mixture is important in order to obtain the maximum yield of the 3 - amino - 5 -( t - butyl ) isoxazole since the reaction is very sensitive to the ph . a ph lower than about 5 . 0 results in the formation of an isoxazolone compound as the principal product . higher ph values , that is , above about ph 8 . 0 , result in unacceptably large amounts of the 5 - amino - 3 -( t - butyl ) isoxazole , compared to the amount of the desired 3 - amino - 5 -( t - butyl ) isoxazole . even at ph 7 . 0 , the ratio of the desired 3 - amino compound to the 5 - amino compound is less desirable . this careful control of the ph is important , as explained above , and should extend over about the first 6 hours of the reaction time between the hydroxylamine and the pivalyl acetonitrile . alternatively , the second step of the synthesis of 3 - amino - 5 -( t - butyl ) isoxazole can be carried out using the hydroxylamine free base . thus , for example , a solution of the hydroxylamine salt in water is prepared and is adjusted to a neutral ph by addition of base , for example , aqueous sodium hydroxide . this neutral solution of hydroxylamine is then added to the neutral solution of the pivalyl acetonitrile . following the addition , the ph of the reaction mixture is then carefully controlled within the limits set forth above . such control should extend over the first approximately 6 hours of the reaction time in order to obtain the optimum yield of the 3 - amino isomer . in working up the reaction mixture , the most effective procedure presently known is to allow the crystallization of the 3 - amino isomer to occur after the solvent is removed in vacuo without applying heat . although it is possible to obtain the 3 - amino isomer from the reaction mixture by changing the ph , or forcing the crystallization with colder temperatures , or by the addition of sodium chloride , such measures appear to yield the desired 3 - amino - 5 -( t - butyl ) isoxazole in a less pure form . that the invention may be more fully understood , the following examples further illustrate the novel method . in a 1 l . flask under an atmosphere of dry nitrogen there was placed 26 . 4 g . of a 50 % oil dispersion of sodium hydride together with 240 ml . of dry tetrahydrofuran . while this mixture was refluxed there was added thereto dropwise over a period of about 1 hour a mixture of 40 . 6 g . of methyl pivalate and 22 . 6 g . of acetonitrile in 40 ml . of dry tetrahydrofuran . when addition was complete , the mixture was refluxed overnight . the reaction mixture was worked up by evaporating part of the tetrahydrofuran in vacuo and dissolving the remaining solution in about 300 ml . of water . this aqueous mixture was acidified to about ph 4 using concentrated aqueous hydrochloric acid . the remainder of the tetrahydrofuran was then removed using a rotovapor . the solid which was formed was filtered and slurried with 150 ml . of hexane to remove mineral oil . the crystals were filtered and dried . the crystals had a melting point of about 57 °- 59 ° c . and were identified as pivalyl acetonitrile . yield : 36 . 3 g . ( 83 %). in a 1 l . 3 - neck round bottom flask there was placed 30 g . of pivalyl acetonitrile , 13 . 5 g . of lithium hydroxide , 394 ml . of water and 281 ml . of ethanol . this mixture was heated to reflux and there was added thereto over a period of 10 minutes 94 ml . of an aqueous solution of 22 . 2 g . of hydroxylamine hydrochloride . the ph of the reaction mixture after the addition was complete was about 7 . 3 . this ph was adjusted to about ph 6 . 7 using concentrated aqueous hydrochloric acid . after 30 minutes the ph was about 6 . 1 . after 1 hour the ph was about 6 . 3 . the ph was checked again at 2 hours and at 3 hours after the addition was complete and the ph at those times was about 6 . 6 . a recheck of the ph at 4 hours , 5 hours , and 6 hours revealed the ph to be at about 6 . 7 . the reaction mixture was then refluxed overnight . the following morning the ph was about 6 . 8 . the reaction mixture was cooled and the ethanol removed from the mixture on the rotovapor at room temperature . a solid which separated was filtered off and dried . it weighed 18 . 65 g . and it was determined by vpc that the product contained 97 % of the desired 3 - amino - 5 -( t - butyl ) isoxazole , and 1 . 6 % of 5 - amino - 3 -( t - butyl ) isoxazole . yield : 52 % of desired isomer . in this preparation sodium hydroxide was used as the base in place of lithium hydroxide . in a 1 l . round bottom 3 - neck flask there was placed 30 g . of pivalyl acetonitrile , 12 . 8 g . of sodium hydroxide , 394 ml . of water , and 281 ml . of ethanol . this mixture was heated to refluxing and there was added thereto over a period of about 10 minutes an aqueous solution of 22 . 2 g . of hydroxylamine hydrochloride . the ph of the reaction mixture after addition was complete was about 6 . 4 . after 30 minutes the ph was determined to be about 6 . 5 . after 11 / 2 hours the ph was about 6 . 8 , and after 2 hours the ph was about 7 . 0 . the ph was adjusted to about 6 . 2 using concentrated aqueous hydrochloric acid . after another 3 hours the ph was about 6 . 6 . the reaction mixture was refluxed overnight and at the end of 22 hours of reaction time the ph was about 7 . 3 . the reaction mixture was cooled and ethanol removed in vacuo . the solid which separated was filtered off and dried . it weighed 18 . 9 g ., had a melting point of about 103 °- 105 ° c ., and was determined by vpc to contain 91 . 2 % of 3 - amino - 5 -( t - butyl ) isoxazole and 5 . 2 % of 5 - amino - 3 -( t - butyl ) isoxazole . yield : 56 % of desired isomer . in a 100 ml . round bottom flask there was placed 2 g . of pivalyl acetonitrile , 0 . 64 g . of sodium hydroxide , 35 ml . of water , and 25 ml . of ethanol . this mixture was heated to reflux and the ph was determined to be about 8 . 9 . then an aqueous solution of 1 . 0 g . of hydroxylamine hydrochloride was slowly added . at the end of the addition the ph was about 6 . 3 . the ph of the reaction mixture was adjusted to about 6 . 5 . after 1 hour , the ph was about 6 . 3 and was again adjusted to about 6 . 5 . after 2 hours the ph was observed to be about 7 . 0 and was again adjusted to ph about 6 . 5 . at 3 hours and again at 4 hours , the ph was determined to be about 6 . 5 . the reaction mixture was allowed to reflux overnight and the following morning the ph was determined to be about 6 . 1 . the ethanol was removed using a rotovapor and a yellow solid precipitated . this solid was filtered off and dried . it weighed 1 . 1 g . and it was determined by vpc to contain 94 . 2 % of 3 - amino - 5 -( t - butyl ) isoxazole and 3 . 7 % of 5 - amino - 3 -( t - butyl ) isoxazole . the product had a melting point of about 103 °- 105 ° c . yield : 73 . 6 % of desired isomer . in a 100 ml . round bottom flask there was placed 2 g . of pivalyl acetonitrile , 0 . 64 g . of sodium hydroxide , 35 ml . of water , and 25 ml . of ethanol . this mixture was heated to reflux . the ph of the mixture was determined to be about 8 . 6 . then 1 . 1 g . of hydroxylamine hydrochloride in 15 ml . of water was added dropwise . at the end of the addition the ph of the reaction mixture was about 5 . 1 . the ph of the reaction mixture was adjusted to about 7 . 0 . after 1 hour the ph was determined to be about 7 . 6 and was adjusted back to about 7 . 0 . after 2 hours the ph was determined to be about 6 . 9 and was readjusted to about 7 . 0 . after 3 hours the ph was determined to be about 7 . 5 and was adjusted to about 7 . 0 . after 4 hours the ph was determined to be about 6 . 8 and was readjusted to about 7 . 0 . the reaction mixture was allowed to reflux overnight and the following morning the ph was determined to be about 6 . 3 and was readjusted to about 7 . 0 . the ethanol solvent was stripped using a rotovapor and a yellow solid precipitated . the solid was filtered off and dried . the solid weighed 1 . 1 g . and had a melting point of about 101 °- 104 ° c . it was determined by vpc to contain 92 . 6 % of 3 - amino - 5 -( t - butyl ) isoxazole and 4 % of 5 - amino - 3 -( t - butyl ) isoxazole . yield : 72 . 9 % of desired isomer . in a 100 ml . round bottom flask there was placed 2 g . of pivalyl acetonitrile , 0 . 64 g . of sodium hydroxide , 17 . 5 ml . of water and 12 . 5 ml . of ethanol . this mixture was heated to refluxing and a aqueous solution of 1 . 1 g . of hydroxylamine hydrochloride was added dropwise . when addition was complete the ph of the mixture was about 7 . 2 . this was adjusted to ph about 6 . 3 using 10 % aqueous hydrochloric acid . after 1 hour the ph was about 7 . 0 and was adjusted with 10 % hcl to ph about 6 . 5 . at the end of 2 hours the ph was about 6 . 8 . at the end of 3 hours the ph was about 6 . 9 . at 31 / 2 hours the ph was about 6 . 5 . the reaction mixture was refluxed overnight and the following morning the ph was about 6 . 8 . the reaction mixture was concentrated using the rotovapor and the solid material which precipitated was filtered off and dried . it weighed 1 . 3 g ., had a melting point of about 103 °- 104 ° c ., and was determined by vpc to contain 90 . 68 % of 3 - amino - 5 -( t - butyl )- isoxazole and 6 . 68 % of 5 - amino - 3 -( t - butyl ) isoxazole . yield : 65 . 9 % of desired isomer . in a 100 ml . round bottom 3 - neck flask there was placed 2 g . of pivalyl acetonitrile , 25 ml . of ethanol , and 10 ml . of water . while this mixture was refluxed , a solution of 0 . 89 g . of lithium hydroxide and 1 . 5 g . of hydroxylamine hydrochloride in 25 ml . of water was added . at the end of the addition , the ph of the reaction mixture was about 7 . 2 . the ph was adjusted to about 6 . 8 using concentrated aqueous hydrochloric acid . after 30 minutes the ph was about 6 . 0 and was readjusted to about 6 . 5 using an aqueous solution of lithium hydroxide . after 1 hour the ph was about 6 . 2 and was adjusted to about 6 . 8 using an aqueous solution of lithium hydroxide . at 1 . 5 hours the ph was about 6 . 6 . at 2 hours the ph was about 6 . 7 . at 21 / 2 hours the ph was about 6 . 8 . at 3 hours the ph was about 7 . 0 and was adjusted to about 6 . 5 using concentrated aqueous hydrochloric acid . after 20 hours the ph was about 7 . 0 . the reaction mixture was cooled and the ethanol stripped on the rotovapor . the solid which precipitated was filtered off and dried . it weighed 1 . 4 g ., had a melting point of about 105 °- 106 ° c ., and was determined by vpc to contain 98 . 5 % of 3 - amino - 5 -( t - butyl ) isoxazole and 1 % of 5 - amino - 3 -( t - butyl ) isoxazole . yield : 62 . 5 % of desired isomer . in a 100 ml . round bottom 3 - neck flask was placed 2 g . of pivalyl acetonitrile , 0 . 64 g . of sodium hydroxide , 35 ml . of water and 12 . 5 ml . of ethanol . this mixture was heated to reflux and an aqueous solution of 1 . 1 g . of hydroxylamine hydrochloride was added . the ph at the end of the addition was about 6 . 0 . after 1 hour the ph was determined to be about 6 . 3 . after 2 hours the ph was determined to be about 6 . 7 . after 3 hours the ph was determined to be about 6 . 5 . the following morning after the reaction mixture had refluxed overnight the ph was about 7 . 2 . the ethanol was removed in vacuo using the rotovapor . the solid which separated was filtered off and dried . it had a melting point of 105 °- 106 ° c ., and weighed 1 . 1 g . it was determined by vpc that the product contained 92 . 49 % of 3 - amino - 5 -( t - butyl ) isoxazole and 4 . 67 % of 5 - amino - 3 -( t - butyl ) isoxazole . yield : 60 . 7 % of desired isomer . in a 100 ml . round bottom 3 - neck flask there was placed 2 g . of pivalyl acetonitrile , 0 . 9 g . of potassium hydroxide , 25 ml . of ethanol , and 35 ml . of water . the mixture was heated to refluxing , and an aqueous solution of hydroxylamine hydrochloride was added . after the addition was complete , the mixture showed a ph of 5 . 6 . the ph was immediately adjusted to 6 . 2 by adding aqueous saturated sodium bicarbonate solution . the ph of the reaction mixture after 1 hour was 6 . 3 . after 2 hours , the ph of the reaction mixture was 6 . 4 . after 3 hours , the ph of the reaction mixture was 6 . 5 . the reaction mixture was allowed to reflux overnight , and the following morning the ph was 6 . 8 . the reaction mixture was cooled and the ethanol stripped on the rotovapor . the white solid which separated was filtered off and dried . the solid weighed 0 . 8 g ., and was determined by vpc to contain 91 . 9 % 3 - amino - 5 -( t - butyl ) isoxazole and 5 . 7 % of 5 - amino - 3 -( t - butyl ) isoxazole . yield of desired isomer was 48 %. in a 100 ml . round bottom 3 - neck flask was placed 2 g . of pivalyl acetonitrile in 25 ml . of ethanol . to this mixture a solution of 1 . 1 g . of hydroxylamine hydrochloride in 15 ml . of water was added quickly . the ph of the reaction mixture was adjusted to ph 7 , using aqueous 10 % sodium bicarbonate solution , and heated to refluxing . after 1 hour the ph was 8 . 5 , and was adjusted to ph 7 , using concentrated aqueous hydrochloric acid . after 2 hours , the ph was 8 . 5 , and was again adjusted to ph 7 . after 3 hours , the ph was 8 . 0 , and was adjusted to ph 6 . 7 . refluxing of the reaction mixture was continued overnight . the next morning , the ph was 7 . 2 , and was adjusted to ph 7 . the reaction mixture was cooled and the ethanol stripped on the rotovapor . the remaining mixture was filtered and the solid thereby obtained dried . the solid has a melting point of about 105 °- 106 ° c ., and weighed 0 . 7 g . this solid was determined by vpc to contain 93 % of 3 - amino - 5 -( t - butyl ) isoxazole and 5 . 6 % of 5 - amino - 3 -( t - butyl ) isoxazole . the yield of desired isomer was 31 %. | 2 |
examples of packet switching networks such as network 100 ( fig1 ) are the arpanet network of the u . s . department of defense , the network disclosed in u . s . pat . no . 4 , 506 , 358 of w . a . montgomery , issued mar . 19 , 1985 , and a network comprised of multiple , integrated packet switching and circuit switching systems such as the system disclosed in u . s . pat . no . 4 , 592 , 048 of m . w . beckner et al ., issued may 27 , 1986 . the invention is applicable in networks comprising many telephone switching offices , and specifically in an integrated services digital network ( isdn ). an isdn is defined as a network evolved from the telephony integrated digital network that provides end - to - end digital connectivity to support a wide range of services , including voice and non - voice services , to which users have access by a limited set of standard multipurpose customer interfaces . the portion of network 100 shown in fig1 comprises a plurality of packet switching nodes 101 through 113 , and bidirectional , interconnecting links comprising terrestrial links , such as links 151 , 152 , and 153 emanating from node 101 , and a satellite link 154 between nodes 104 and 110 . each node includes a processor , a memory , and interface facilities to adjacent nodes or to data terminal equipment ( dte ) served by network 100 . for example , node 113 includes processor 181 , memory 182 , interface facilities 183 , 184 , and 185 to nodes 111 , 110 , and 112 , respectively , and interface facility 186 to dte 12 . packet communication between a given dte and network 100 is effected in accordance with a known communication protocol , for example the ccitt standard protocol x . 25 . within network 100 , an additional packet header shown in fig2 is added to the x . 25 packets . the packet header includes the following fields : ( 1 ) the packet type field defines the packet as one of a number of predefined types . examples of such packet types include the following : call request , call accept , permanent virtual circuit ( pvc ) setup , pvc accept , receiver ready ( rr ), receiver not ready ( rnr ), data , interrupt , interrupt confirm , reset , clear , reset confirm , reject , reconnect request , reconnect confirm , etc . ( 2 ) the alt field defines whether the packet is being transmitted over a primary or alternate route through network 100 . ( 3 ) the destination address is specified by psn , ii1 , ii2 , and ii3 fields . the psn field specifies a packet switch number defining the packet switching node serving the destination dte . the ii1 , ii2 , and ii3 fields collectively define the particular destination interface of that packet switching node . ( 4 ) the source address is similarly specified by psn , ii1 , ii2 , and ii3 fields . ( 5 ) the psn1 , psn2 , psn3 , and psn4 fields define the packet switch numbers of the tandem switches or intermediate packet switching nodes used for a particular packet connection through network 100 . ( 6 ) the tc and ps fields specify the throughput class and maximum packet size used over the particular packet connection . ( 7 ) the dseq , fseq , and fcn fields are flow control fields . each data packet transmitted for each direction of transmission includes a data sequence number ( dseq ) and a flow control sequence number ( fseq ). the data sequence numbering scheme of the packets is performed modulo 128 with the data packet sequence numbers cycling through the entire range of 0 to 127 . the flow sequence numbering scheme of the packets is performed modulo 8 with the flow packet sequence numbers cycling through the entire range of 0 through 7 . each acknowledgment , in the form of a data , rr , or rnr packet , carries a flow credit number ( fcn ) used to authorize data packets to cross network 100 . ( 8 ) the delay data field specifies data relevant to the cross - network delay for determining the window size used for packet flow control across the particular packet connection as discussed in detail herein . when a packet connection is being established across network 100 , the network route is initially unknown . therefore , in the header added to the initial packet transmitted across network 100 , the tandem switch fields psn1 , psn2 , psn3 , and psn4 are empty . for example , if a virtual call between dte 11 and dte 12 is being established , a call request packet is transmitted from node 101 with the destination address section of the packet header completed but with the tandem switch fields empty . the tc and ps header fields define a proposed throughput class and packet size for the connection . node 101 executes a local routing program to determine the next node to be used for the connection based on the destination address . node 101 may determine , for example , that the connection should be established via terrestrial link 152 to intermediate node 104 . once the routing determination is made , node 101 adds the address of intermediate node 104 into the psn1 field of the packet header . node 101 also sets a terrestrial hop count subfield ht in the delay data field of the packet header ( fig2 option 1 ) to one , and transmits the call request packet via link 152 to node 104 . in response to the call request packet , node 104 executes a local routing program and determines , for example , that the connection should be continued via satellite link 154 to intermediate node 110 . node 104 adds the address of intermediate node 110 into the psn2 field of the packet header , sets a satellite hop count subfield hs in the delay data field to one , and transmits the call request packet via link 154 to node 110 . in response to the call request packet , node 110 executes a local routing program and determines that the connection is continued via a terrestrial link 155 to destination node 113 . node 110 increments the terrestrial hop count subfield ht by one such that ht = 2 and transmits the call request packet via link 155 to node 113 . in response to the call request packet , node 113 obtains values of a set of parameters ( tc , ps , csd , qd , id , tpd , spd ), where tc is a throughput class , ps is a packet size , csd is a cross switch delay , qd is a queuing delay , id is an insertion delay , tpd is a terrestrial propagation delay , and spd is a satellite propagation delay . the parameters csd , qd , id , tpd , and spd are static parameters which node 113 stores in memory 182 . the parameters tc and ps are determined by negotiation during an exchange of x . 25 packets between node 113 and dte 12 . assume for example that the tc and ps fields of the call request packet received by node 113 specify a throughput class of 19 . 2 kilobits per second and a packet size of 128 bytes . dte 12 is allowed to either accept or reduce the proposed throughput class and packet size . in the present example , dte 12 may reduce the throughput class to 4800 bits per second and accept the packet size of 128 bytes . the parameters csd , qd , id , tpd , and spd are average delays determined prior to system initialization either by measurement , analytical calculation or some other estimation procedure . the cross switch delay , csd , is defined as the time between the receipt of the initial bit of a packet and the time the packet is placed in a node output queue for transmission on an outgoing link . the queuing delay , qd , is defined as the time that the packet remains in the output queue awaiting transmission . the insertion delay , id , is defined as the time between the transmission of the first bit of the packet on the outgoing link and the transmission of the last bit . the propagation delays , tpd and spd , are defined as the times required for information to be transmitted across terrestrial and satellite links , respectively . in the present example , it is assumed that the delay characteristics of the nodes and links are substantially uniform throughout network 100 and are given as indicated in table 1 . once node 113 has obtained values of the set of parameters ( tc , ps , csd , qd , id , tpd , spd ), node 113 calculates the cross - network delay , d , according to : the delay terms are in seconds . in the present example , d =( 2 + 1 + 1 )( 0 . 040 )+ 2 ( 0 . 040 + 0 . 020 + 0 . 010 )+( 0 . 040 + 0 . 020 + 0 . 250 )= 0 . 610 seconds . node 113 then calculates the window size , given by n , a number of packets , according to : where [ x ] is the smallest integer not less than x , d is in seconds , tc is in bits per second , and ps is in bits . in the present example , n =[ 2 *( 0 . 610 )*( 4800 )/( 128 * 8 )]=[ 5 . 7 ]= 6 packets . ( alternatively , n may be determined by rounding the value of the expression to the nearest positive integer or to the next lower positive integer .) node 113 then transmits a call accept packet to node 101 via the reverse route through network 100 . in contrast to the call request packet , the call accept packet and all data packets transmitted during the call specify the intermediate nodes in the tandem switch fields psn1 , psn2 , psn3 , and psn4 of the packet header . the window size n = 6 is defined in the dseq field of the call accept packet . the window size is used to control packet flow in both directions for the duration of the call between dte 11 and dte 12 . node 113 transmits packets to node 101 such that , at any given time , no more than six packets transmitted by node 113 are unacknowledged by node 101 . similarly , node 101 transmits packets to node 110 such that , at any given time , no more than six packets transmitted by node 101 are unacknowledged by node 113 . a similar procedure is used to establish a permanent virtual circuit between nodes 101 and 113 except that rather than transmitting call request and call accept packets , pvc setup and pvc accept packets are exchanged . it should be noted that the window size established by the above - described procedure is the internal window size for network 100 and is independent of external window sizes that may be established for the x . 25 packet communications between dte 11 and network 100 and between dte 12 and network 100 . tables 2 through 5 give window sizes calculated using equations ( 1 ) and ( 2 ). note that the window size is not allowed to exceed seven . table 2______________________________________window size ( hs = 0 , ps = 128 bytes ) tc , bits per secondht 75 150 300 600 1200 2400 4800 9600 19 . 2k 48k______________________________________0 1 1 1 1 1 1 1 1 2 41 1 1 1 1 1 1 2 3 6 72 1 1 1 1 1 2 3 5 7 73 1 1 1 1 1 2 4 7 7 74 1 1 1 1 2 3 5 7 7 75 1 1 1 1 2 3 6 7 7 7______________________________________ table 3______________________________________window size ( hs = 0 , ps = 256 bytes ) tc , bits per secondht 75 150 300 600 1200 2400 4800 9600 19 . 2k 48k______________________________________0 1 1 1 1 1 1 1 1 1 21 1 1 1 1 1 1 1 2 3 72 1 1 1 1 1 1 2 3 5 73 1 1 1 1 1 1 2 4 7 74 1 1 1 1 1 2 3 5 7 75 1 1 1 1 1 2 3 6 7 7______________________________________ table 4______________________________________window size ( hs = 1 , ps = 128 bytes ) tc , bits per secondht 75 150 300 600 1200 2400 4800 9600 19 . 2k 48k______________________________________0 1 1 1 1 1 2 4 7 7 71 1 1 1 1 2 3 5 7 7 72 1 1 1 1 2 3 6 7 7 73 1 1 1 1 2 4 7 7 7 74 1 1 1 1 2 4 7 7 7 7______________________________________ table 5______________________________________window size ( hs = 1 , ps = 256 bytes ) tc , bits per secondht 75 150 300 600 1200 2400 4800 9600 19 . 2k 48k______________________________________0 1 1 1 1 1 1 2 4 7 71 1 1 1 1 1 2 3 5 7 72 1 1 1 1 1 2 3 6 7 73 1 1 1 1 1 2 4 7 7 74 1 1 1 1 1 2 4 7 7 7______________________________________ in the previous example , the delay characteristics of the nodes and links were assumed to be uniform throughout network 100 . in an alternative embodiment , each node transmitting a call request packet adds a one - way delay component into the packet header ( fig2 option 2 ). consider the same packet connection established in the previous example , via nodes 101 , 104 , 110 , and 113 . the characteristics of node 101 and link 152 are , for example , such that the cross switch delay is 0 . 040 seconds , the queuing delay is 0 . 040 seconds , the insertion delay is 0 . 020 seconds , and the terrestrial propagation delay on link 152 is 0 . 010 seconds node 101 adds a one - way delay component of 0 . 110 seconds into a one - way delay field of the packet header . node 104 , however , is a switching system of a different manufacturer and the relevant parameters are a cross switch delay of 0 . 060 seconds , a queuing delay of 0 . 035 seconds , an insertion delay of 0 . 015 seconds , and a satellite propagation delay on link 154 of 0 . 250 seconds . node 104 therefore adds a one - way delay component of 0 . 360 seconds to the previous value of 0 . 110 seconds and stores the cumulative one - way delay of 0 . 470 seconds in the packet header . node 110 has a cross switch delay of 0 . 050 seconds , a queuing delay of 0 . 040 seconds , an insertion delay of 0 . 030 seconds , and a terrestrial propagation delay on link 155 of 0 . 020 seconds ( link 155 may , for example , be twice as long as link 152 ). node 110 adds a one - way delay component of 0 . 140 seconds to the previous value of 0 . 470 seconds and stores the cumulative one - way delay of 0 . 610 seconds in the packet header . since the window being established is for the internal packet connection through network 100 and not for the external connection between network 100 and dte 12 , the delay component added in by node 113 comprises only a cross switch delay , for example , of 0 . 060 seconds . the total one - way delay is therefore 0 . 670 seconds . assuming the same throughput class and packet size as before , the window size calculated using equation ( 2 ) is n = 7 packets . in another alternative embodiment , each node transmitting a call request packet adds a two - way delay component into the packet header ( fig2 option 3 ). for example , the delay component added in by node 110 may include a cross switch delay of 0 . 050 seconds , a queuing delay of 0 . 040 seconds , an insertion delay of 0 . 030 seconds , and a terrestrial propagation delay of 0 . 020 seconds for one direction of transmission and a cross switch delay of 0 . 050 seconds , a queuing delay of 0 . 035 seconds , an insertion delay of 0 . 030 seconds , and a satellite propagation delay of 0 . 250 seconds for the other direction of transmission . the two - way delay component added into the call request packet by node 110 is therefore 0 . 505 seconds . of course , node 113 adds in insertion , queuing , and propagation delays only for the transmission from node 113 to node 110 and not for the transmission from node 113 to dte 12 . similarly , node 101 adds in insertion , queuing , and propagation delays only for the transmission from node 101 to node 104 and not for the transmission from node 101 to dte 11 . ( nodes 113 and 101 each add in cross switch delays for both directions of transmission .) node 113 uses the total two - way delay , d , to compute the window size in accordance with once a packet connection is established for a virtual call between dte 11 and dte 12 , as in the above - discussed example via nodes 101 , 104 , 110 and 113 , a failure of a node or link or excessive network congestion may be detected by node 101 either by receiving a failure packet from one of the nodes or by experiencing substantially reduced throughput . node 101 may then formulate a reconnect request packet to change the packet connection through network 100 without dte 11 and dte 12 even becoming aware of the changed connection . the reconnect request packet has the same general format as the call request packet discussed above . the tandem switch fields psn1 , psn2 , psn3 , and psn4 are not filled in initially . the routing program executed by node 101 determines , for example , that link 152 is the primary route and links 151 and 153 are alternate routes . the first choice for routing the new connection is via one of the alternate routes . if one of the alternate routes is selected , the alt field of the reconnect request packet header is set accordingly . only if the alternate routes are unavailable is the connection established again via the primary route . assume for the present example , that links 151 and 153 are unavailable . the reconnect request packet is routed via the primary route of link 152 . the address of node 104 is added into the tandem switch field psn1 of the packet header . the delay data is added into the delay data field in accordance with the particular option ( fig2 ) that is being used . node 104 determines that the alternate route via link 156 to node 106 is presently available , adds the node 104 address in the tandem switch field psn2 and the delay data into the delay data field , and transmits the reconnect request packet via link 156 to node 106 . the process continues and the reconnect request packet is further transmitted via link 157 to node 110 , and via link 155 to node 113 . in response to the reconnect request packet , node 113 calculates the window size for the changed packet connection based on the delay data field of the reconnect request packet . the window size is , for example , reduced due to the removal of the satellite link from the packet connection even though one additional node is included . the new window size is returned in a reconnect confirm packet via the reverse route through network 100 to node 101 . | 7 |
in describing the preferred embodiments , certain terminology is utilized for the sake of clarity . such terminology is intended to encompass the recited embodiment , as well as all technical equivalents which operate in a similar manner for a similar purpose to achieve a similar result . reference is made in the following detailed description of the preferred embodiment to the drawings accompanying this disclosure . these drawings illustrate specific embodiments in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural changes may be made by one skilled in the art and in light of this disclosure and without departing from the scope of the claims of the present invention . referring now generally to the figures and particularly to fig1 the effects of a physical object 2 upon the receipt of signals or energy from a source 4 or an emitter 4 of radiation or sound energy can be measurable and repeatable . as one example , objects 2 , to include human body elements , can distort or effect energy transmissions as received by a sensor 6 . in particular , objects 2 cast shadows 5 upon planar light sensors 6 a , interfere with radio signals as received by radio wave sensors 6 b and distort sound energy as received by sound sensors 6 c . where the emitting energy is known , and the relationships among the energy source 4 or emitter 4 , the sensors 6 and the object 2 are understood , the effect of the position and shape of the object 2 upon the sensors 6 can be used to interpret the position , configuration or shape of the object 2 as providing informational content to the sensors or an information technology system that is in communication with the sensors 6 . in various alternate preferred embodiments of the present invention the sensors 6 may be or comprise an electromagnetic sensor , a photonic sensor , a motion sensor , an audio sensor , a heat sensor , a sonic sensor , and / or another suitable sensor known in the art . the emitters 4 or energy sources 4 may be matched to the sensors 6 and may be comprise an electromagnetic emitter , a photonic emitter , a vibration emitter , an audio emitter , a heat emitter , a sonic emitter , and / or another suitable emitter known in the art . referring now generally to the figures and particularly to fig2 it is noted that as the object 2 is located closer to a point source of energy 8 , e . g . a light bulb 8 a , a radio wave transmitter , or a sound signal , the energy distorting or absorbing effect of the object 2 is increased . for example , a shadow 10 cast upon a planar light sensor 12 by a hand 14 , where the hand 14 is placed in between the light bulb 8 a and the planar light sensor 6 a is increased as the hand 14 is placed and closer to the light bulb 8 a . the physics of this distortion effect upon energy received by the sensor 6 is often dependent upon an inverse square relationship wherein the energy received by a point in space is inversely proportional to the square of the distance between the point in space and the origin of the emitted energy . by this effect , the degree , nature or amount of distortion imposed upon a sensor 6 by an object can be inversely proportional to the square of the distance between the object 2 and the energy source 4 . referring now generally to the figures and particularly to fig3 the distortion , shadow 10 , reflection or image imposed upon the sensor 6 by the object 2 can change as the location , instantaneous shape and instantaneous configuration of the object 2 or a body element , e . g . the hand 14 , change . an open hand 16 may cause a shadow 18 a of a certain size upon a point or non - point sensor 20 having a sensing surface area 20 a , such as the planar sensor 20 , whereas a closed hand 22 may cause a shadow 18 b or other energy transmission pattern distortion of a second size upon the sensing surface area 20 a . the intensity of the shadow 18 a ( or other energy transmission pattern distortion ) may also be measured by the sensor 6 , 20 and interpreted by the method of the present invention as having informational content regarding the position of the hand 14 or object 2 . referring now generally to the figures and particularly to fig4 and 5 , a first object 24 is placed within a cubic embodiment of the present invention , or invented cube 26 . the invented cube 26 comprises three individual sensors sensing surfaces 28 a , 28 b & amp ; 28 c having sensing surfaces and three energy emitters 30 a , 30 b & amp ; 30 c . the position of the first object 24 causes an energy distortion , e . g ., a shadow 5 if the energy transmitters 30 a , 30 b & amp ; 30 c are light emitters , upon the individual sensors sensing surfaces 28 a , 28 b & amp ; 28 c , or sensing surfaces 28 a , 28 b & amp ; 28 c . the degree of distortion on all three sensing surfaces 28 a , 28 b & amp ; 28 c is measurable as three separate parameters generated by the sensing surfaces 28 a , 28 b & amp ; 28 c . the three parameters may then be matched by a computer system 31 , as shown in fig9 to associate the three values as a meaningful input , instructions or data to the computer system 31 or a networked computing system 32 . for example , placing the first object 24 in a certain position within the invented cube 26 may inform a computer game system 31 that a game player instructs the game system 31 to initiate or start a game program . the invented cube 26 is superior to prior art in that the computer system 31 or networked computing system 32 of fig9 is directed by moving the first object 24 and without the invented cube 26 detecting or imaging or transferring the image of the exact shape of the first object 24 to the computer system 31 or networked computing system 32 . referring now generally to the figures and particularly to fig6 a set of individual images 34 , or total but separate effects , of the first object 24 upon each of the sensing surfaces 28 a , 28 b & amp ; 28 c is measured and quantified as single parameters . the unique set of three values is associated by the invented cube 26 with a unique position and orientation of the object 24 within the invented cube 26 . referring now generally to the figures and particularly to fig7 and 8 , the invented cube 26 detects motion and rates of motion of a hand 14 placed within the invented cube 26 by monitoring the changing values of the outputs of the sensors 6 . additionally , the invented cube 26 tracks changes in the shape or configuration the hand 14 by monitoring the values of the outputs of the sensors 6 as a set of individual images 36 a & amp ; 36 b , or total but separate effects , of the first object 24 upon each of the sensing surfaces 28 a , 28 b & amp ; 28 c referring now generally to the figures and particularly to fig9 the invented cube 26 comprises analog to digital converters 38 , or a / d converters 38 , each a / d converter 38 coupled with a sensor 6 having a sensing surface 40 . ( note that the fig9 shows a redundancy of a / d converters 38 & amp ; 40 for the sake of illustration ; a preferred embodiment of the invented cube 26 would have either one universal a / d converter 42 or a set of a / d converters 38 .) the a / d converters 38 receive analog inputs from the sensing surfaces 40 , where the analog inputs are measures of , or related to , the quantities or pattern ( s ) of energy received by sensing surfaces 40 . the a / d converters 38 , or alternately a unified a / d converter 42 , convert a received analog signal from a sensing surface 40 and converts the analog signal into a digital value . the a / d converters 38 or the unified a / d converter 42 then communicate the digital values to a data processing or information technology system 44 , or it system 44 , that may be or comprise the computer 31 and / or the networked computing system 32 . the it system 44 has an interface 46 to the a / d converter ( s ), a memory 48 and a central processor 50 . the central processor 50 , or processor 50 , or cpu 50 , associates two or more digital values received from the a / d converters 38 or the unified a / d converter 42 as sets of values . each set of measured values is then compared for matches with sets of values stored within the memory 48 . the cpu 50 selects the closest match , or a set of close matches between stored values , as found by comparing a particular set of measured values with the stored sets of values . alternatively or additionally , the invented cube 26 may generate sets of values by mathematically modeling the first object 24 or a body element , e . g ., the hand 14 , and comparing the set of measured values with sets of values generated by the modeling computation . the cpu 50 then associates the set of measured values with an informational content , where the informational content is selected or indicated by a relatedness between the informational content and one or more stored or generated sets of measured values . the cpu 50 then informs the it system 44 of the informational content , e . g ., turn a virtual switch on . the it system 44 may be or comprise a personal computer , a networked communications network , or other suitable information technology system known in the art . the memory 48 may be or comprise a memory coupled with the cpu via a computer network , and may be or comprise a hard disk , a cd disk , a dvd , a random access memory , a read only memory , a programmable memory , a reprogrammable memory , and / nother suitable memory known in the art , in combination , in distributed combination , or as a unified memory . the memory 48 may hold or employ , or empower the it system 44 to employ , an applications program . the applications program may enable the it system 44 to interpret sensor inputs as providing informational content about the speed of motion of the hand 14 or object 24 sensed by the sensors 6 . alternatively or additionally , the applications program may correlate assigned meanings , or assign meanings to , signals sent from the sensors 6 and to the it system 44 . these meanings may , for example , be or be associated with language content , medical data , therapeutic data , computer game data , or other suitable meanings , values and scenarios known in the art . referring now generally to the figures and particularly to fig1 , a sphere 52 imposes shadows 10 upon three mutually orthogonal sensing planes 40 . the amount of light area received by each of the three sensing planes 40 is separately measured and communicated to the it system 44 . a set of measurements generated substantially simultaneously by the sensing planes 40 can be interpreted by the it system 44 is indicating that the sphere 52 is located at an approximate position within the invented cube 26 . the sphere 52 example is offered to illustrate that the state of all three shadows 10 imposed on the sensors 6 can be uniquely associated with a unique position of the sphere 52 within the invented cube 26 . referring now generally to the figures and particularly to fig1 a , 11b and 18 , a second preferred embodiment 54 , or second system 54 , has a control zone 56 , having a free movement zone 58 , or free zone 58 , for surrounding a field of play 60 . the field of play 60 of the free zone 58 is three dimensional and provides a free zone 58 large enough to accept and envelope a human player 62 . the sensors 40 monitor the effect of the hands 14 instantaneous position on three separate areas or planes 28 a , 28 b & amp ; 28 c . referring now generally to the figures and particularly to fig1 , the second system 54 monitors the user &# 39 ; s hand 14 across a range of motion 64 within the control zone 56 . the it system 44 determines how fast the hand 14 is moving by comparing sensor signals at two or more times . referring now generally to the figures and particularly to fig1 . the second system 54 having the play zone 56 is applied to teach the it system 44 to compensate for an arthritic hand &# 39 ; s 66 range of motion 67 in interpreting positions and speed of the arthritic hand 14 as commands , data and / or status values . the it system 44 may be calibrated and personalized to associate the positions and locations of a unique users hands 66 with a range of values or meanings of the applications program . by this method an arthritic game player may be enabled to play against a more nimble opponent by either interpreting the nimble player &# 39 ; s hand 14 motions in a “ handicapped ” system , e . g ., golf handicapping , or by providing a value multiplier or additive to the arthritic person &# 39 ; s movements and / or hand 14 positions . in various alternate preferred embodiments , alternatively or additionally the motions of other objects 2 and / or body parts as moved or manipulated by a player may be handicapped or increased in relative value within a computer applications program scenario . the method of the present invention may be employed to enhance the computer usage of persons with disabilities other than arthritis , e . g ., palsey , amputations , carpal tunnel , or repetitive stress injuries . referring now generally to the figures and particularly to fig1 , the use of the sensors 6 of the control zone 56 measures the degree of shade or shadow 68 the hand 14 imposes upon three separate surface sensors 70 . referring now generally to the figures and particularly to fig1 , fig1 is a flowchart of the teaching mode of the second system 54 . referring now generally to the figures and particularly to fig1 , fig1 is a flowchart of the input mode of the second system 54 . referring now generally to the figures and particularly to fig1 , an enhanced third preferred embodiment of the present invention 72 , or third system 72 , comprises a squash racket 74 , wherein the squash racket 74 is used to input commands and data the it system 44 . in various alternate preferred embodiments , alternatively or additionally the motions of other objects 2 and / or body parts as moved or manipulated by a player may be within suitable alternate computer applications program scenarios , to include such objects as a hockey stick , a golf club , a foot , or a glove . referring now generally to the figures and particularly to fig1 , an enhanced fourth preferred embodiment of the present invention 76 , or fourth system 76 , enables the user &# 39 ; s body position 78 to be interpreted as input commands and data to the it system 44 . in various alternate preferred embodiments , alternatively or additionally the motions of other objects and / or body parts as moved or manipulated by a player may be interpreted within suitable alternate computer applications program scenarios , such as ice hockey , golf , dance , or a martial art . referring now generally to the figures and particularly to fig1 , fig1 is a flowchart of an optional implementation of the control zone of fig1 wherein the present invention is used as a therapeutic tool . referring now generally to the figures and particularly to fig2 , fig2 is a flowchart of an optional implementation of the control zone of fig1 wherein the control zone is used as a sports performance - training tool . those skilled in the art will appreciate that various adaptations and modifications of the just - described preferred embodiments can be configured without departing from the scope and spirit of the invention . other suitable sensory input computer interfacing equipment , techniques and methods known in the art can be applied in numerous specific modalities by one skilled in the art and in light of the description of the present invention described herein . therefore , it is to be understood that the invention may be practiced other than as specifically described herein . the above description is intended to be illustrative , and not restrictive . many other embodiments will be apparent to those of skill in the art upon reviewing the above description . the scope of the invention should , therefore , be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled . | 6 |
an example of this invention will be described hereunder based on the drawings . fig1 and fig2 indicate a lever type hoist of this invention . this lever type hoist is provided with a hoist body 1 constituted by a pair of parallel side plates 1a , 1b and a load sheave 2 held rotatably between those side plates 1a , 1b by bearings 3 , 3 . the load sheave 2 has a shaft hole 2a provided along its axis and a drive shaft 4 inserted in that hole . on the outside of one side plate 1a , a gear case 5 is mounted and one end of the drive shaft 4 protrudes into the gear case 5 . the other end of the drive shaft 4 protrudes to outside of the other side plate 1b . the transmission of rotation between the drive shaft 4 and the load sheave 2 is performed by connecting a pinion 6 and a gear 7 through a geared transmission system 8 . the pinion 6 is fixed to one end of the drive shaft 4 and the gear 7 is fixed to the shaft part of the load sheave 2 . the geared transmission system 8 is constituted by a plural number of gears which are rotatably supported by shaft between the side plate la and the gear case 5 . on the drive shaft 4 protruding to outside of the side plate 1b , the first right - handed screw 4a and the second right - handed screw 4b are formed in succession from the side closer to the side plate 1b . the first right - handed screw 4a is screw connected and fixed with a pressure receiving member 9 while the second right - handed screw 4b is screw connected to a presser drive member 15 . the pressure receiving member 9 is constituted by a disk 9a and a boss 9b put together . the disk 9a is formed on the side plate 1b side and the boss 9b is formed in a way to protrude to the presser drive member 15 side . on the boss 9b , a ratchet wheel 10 and a pair of frictional members 11 , 11 are held rotatably by a round hole provided at their center . the ratchet wheel 10 is provided for prevention of reverse rotation while the pair of frictional members 11 , 11 get in contact with the both faces of the ratchet wheel 10 in a way to be pressed against the latter . the ratchet wheel 10 and the pair of frictional members 11 , 11 are pressed against the disk 9b of the pressure receiving member 9 by the pressing force in axial direction of the presser drive member 15 . between the pressure receiving member 9 and the presser drive member 15 , a reinforcing spring 16 is provided . the reinforcing spring 16 adds a force in a direction to separate the pressure receiving member 9 and the presser drive member 15 from each other , and the presser drive member 15 presses the ratchet wheel 10 and the pair of frictional members 11 , 11 against the disk 9b of the pressure receiving member 9 in resistance to the force of the reinforcing spring 16 . the ratchet 12 is supported by a shaft 13 protruding from the side plate 1b and is linked with the ratchet wheel 1 by the springy force of a resilient 14 mounted on the shaft 13 . this enables the ratchet wheel 10 to rotate only in the direction of lifting of the load sheave 2 . the ratchet wheel 10 , the pair of frictional member 11 , 11 and the ratchet 12 constitute a drive force transmission mechanism which transmits the rotational force in the direction of lifting of the presser drive member 15 to the pressure receiving member 9 . the presser drive member 15 forms on its external end face a first boss 15a of a large diameter and a second boss 15b of a small diameter is formed on the end face of the first boss 15a . on the circumferential face of the first boss 15a , a plural number ( 3 pieces in the illustrated example ) of notches 15c are provided at equal intervals in the circumferential direction . on the circumferential face of the second boss 15b , a male screw 15d is formed . a conical frictional member 17 is hollow and its circumferential face is formed in a conical face having a prescribed vertical angle . at the end on the small diameter side of this conical frictional member 17 , a collar 17d is formed inwardly in the radial direction and a round hole 17a is formed at the inner end of this collar 17d . the first boss 15a of the presser drive member 15 is inserted in the round hole 17a . on the inner circumferential face of this round hole 17a , a plurality of projections 17b are provided . those projection 17b are connected respectively with the notches 15c , 15c ,-- provided on the first boss 15a to constitute a spline connection . on the other hand , at the end face on the large diameter side of the conical frictional member 17 , three cutouts 17c in axial direction are provided at equal intervals in the circumferential direction . the conical frictional member 17 is fitted in a conical hole 18b of a rotational force transmitting member 18 and is pressed inwardly in the axial direction by a reinforcing member 19 . on the circumferential face of the rotational force transmitting member 18 , a gear 18a is formed . the reinforcing member 19 , which is either a belleville spring or a coil spring , is mounted on the second boss 15b of the presser drive member 15 in the internal space of the conical frictional member 17 and is in contact at its circumferential edge with the inward collar 17d of the conical frictional member 17 . the reinforcing member 19 is tightened by a nut member 20 screw connected to the second boss 15b and the conical frictional member 17 is pressed inwardly in the axial direction . as a result , the conical face of the conical frictional member 17 and that of the rotational force transmitting member 18 are put in frictional contact with each other . and , with an adjustment of the tightening quantity by the nut member 20 , the pressing force of the conical frictional member 17 is set and the value of the rated load to be hung on the load sheave 2 is set accordingly . on the large diameter side of the conical frictional member 17 , an operating wheel 21 is connected by spline to a spline 4c formed on the drive shaft 4 . the operating wheel 21 is prevented from falling from the drive shaft 4 by a nut 22 . the nut 22 is screw connected to a small diameter screw 4d formed at the small diameter part at the tip of the drive shaft 4 . on the operating wheel 21 , a projection for connection 21a is provided facing the large diameter side of the conical frictional member 17 . this projection for connection 21a is connected to one of the concavities for connection 17c , 17c ,-- of the conical frictional member 17 . the length in the circumferential direction of the projection 21a of the operating wheel 21 is short compared with the length in the circumferential direction of the cutouts 17c , 17c ,-- of the conical frictional member 17 . for that reason , when the operating wheel 21 is rotated in the lowering direction together with the drive shaft 4 and the conical frictional member 17 is rotated in the lowering direction at a rotational speed slightly slower than the drive shaft 4 , the conical frictional member 17 moves to the pressure receiving member 9 side along the drive shaft 4 until the time when the projection 21a of the operating wheel 21 contacts the side wall of the cutouts 17c of the conical frictional member 17 . this is because the conical frictional member 17 rotates in unison with the presser drive member 15 and the rotational force transmitting member 18 while the presser drive member 15 relatively rotates against the right - handed screw 4b of the drive shaft 4 and progresses spirally on this right - handed screw 4b . on the surface side of the side plate 1b , a brake cover 23 is mounted . this brake cover 23 covers the entire part of the pressure receiving member 9 , the ratchet wheel 10 and the ratchet 12 and covers a part of the presser drive member 15 . at one end of the brake cover 23 , a flange 23a is formed and this part of flange 23a is screwed to the side plate 1b . on the other end of the brake cover 23 , a cylindrical part 23b is formed . the cylindrical part 23b is located close to the circumferential face of the presser drive member 15 . the cylindrical part 23b holds an operating lever 24 rotatably against both the brake cover 23 and the operating wheel 21 . the operating lever 24 drives the presser drive member 15 to rotate in either the lifting direction or the lowering direction through the rotational force transmitting member 18 and the conical frictional member 17 . this operating lever 24 consists of an inner cover 24a and an outer cover 24b of steel , the outer cover 24b being fitted on the outside of the inner cover 24a and the peripheral part of those two covers being connected to each other by means of a plural number of bolts 25 . the peripheral cover of those two covers 24a and 24b covers the entire part of the rotational force transmitting member 18 . in the inner cover 24a , an inner cylindrical part 24a is provided facing the cylindrical part 23b of the brake cover 23 and this inner cylindrical part 24a is inserted in the inner side of the cylindrical part 23b and held there in a rotatable condition . a connecting member 26 prevents disconnection with the brake cover 23 . this connecting member 26 is mounted on the inner face of the inner cylindrical part 24a and is bent to the cylindrical part 23b side of the brake cover 23 . on the outside in axial direction of the outer cover 24b , an outer cylindrical part 24b is formed . the outer cylindrical part 24b covers the connecting portion of the concavities for connection 17c of the conical frictional member 17 and the projection for connection 21a of the operating wheel 21 . inside the operating lever 24 is mounted a rotational direction selecting claw 27 . the rotational direction selecting claw 27 switches the rotational direction of the rotational force transmitting member 18 , the conical frictional member 17 and the presser drive member 15 to either lifting direction or lowering direction . the rotational direction selecting claw 27 is fixed to a supporting shaft 28 . the supporting shaft 28 is held rotatably by the operating lever 24 and protrudes at one end to outside from the operating lever 24 . this protruding part of the supporting shaft 28 is provided with a handle 29 for switching . with a rotational operation of this handle 29 , the rotational direction selecting claw 27 is selectively switched to two connecting positions ( lifting position and lowering position ) to be connected to the gear 18a of the rotational force transmitting member 18 and to a neutral position not to be connected to the gear 18a . at the two connecting positions , the reciprocating rotational operation of the operating lever 24 is transmitted to the rotational force transmitting member 18 through the rotational direction selecting claw 27 . for that reason , the rotational force transmitting member 18 rotates the presser drive member 15 in either the lifting position or the lowering position through the conical frictional member 17 . on the other hand , at the neutral position , the rotational force transmitting member 18 does not turn in any direction because it is disconnected from the rotational direction selecting claw 27 of the operating lever 24 . the lower end part of the rotational direction selecting claw 27 is pressed springily upward by a positioning member 30 reinforced by a coil spring 31 . and , under the pressing force of the coil spring 31 , the rotational direction selecting claw 27 is held springily at either the two connecting positions or the neutral position . an upper hook 33 for lifting the hoist body 1 is attached to a connecting shaft 32 which connects the side plates 1a , 1b . a lower hook 35 for lifting the baggage is provided at the lower end of the load chain 34 . next , description will be given hereunder of the motion of the lever type hoist constructed as above . if you move the operating lever 24 in two ways under the state that the rotational direction selecting claw 27 is switched to the lifting position , the rotational force transmitting member 18 will rotate the conical frictional member 17 in the lifting direction through a conical face contact with the conical frictional member 17 due to the pressing force of the reinforcing member 19 within the established rated load . this rotational force is transmitted to the presser drive member 15 with the connection between the convexities for connection 17b of the conical frictional member 17 and the notches 15c of the presser drive member 15 . and the presser drive member 15 spirally progresses to inside in axial direction on this right - handed screw 4b of the drive shaft 4 to rotate the pressure receiving member 9 in unison through the ratchet wheel 10 and the frictional members 11 , 11 on both sides , causing the drive shaft 4 to rotate in the lifting direction ( clockwise direction seen from the operating wheel 21 side ). the rotational force of the drive shaft 4 is transmitted to the load sieve 2 through the geared transmission system 8 connected with the pinion 6 at one end of the drive shaft 4 . the load sieve 2 rotates in the same direction as the drive shaft 4 . as a result , the baggage within the rated load hung at the lower hook 35 of the load chain 34 is hoisted by the two - way operation of the operating lever 24 . on the other hand , in the case where a baggage in excess of the rated load is hung at the lower hook 35 , sliding is produced between the rotational force transmitting member 18 and the conical frictional member 17 even if you make a two - way operation of the operating lever 24 , making it impossible to rotate the conical frictional member 17 in the lifting direction . as a result , the drive shaft 4 and the load sheave 2 are not rotated in the lifting direction and lifting of a baggage in excess of the rated load is automatically prevented to maintain the safety of work . on the other hand , if you move the operating lever 24 in two ways under the state that the rotational direction selecting claw 27 is switched to the lowering position , the presser drive member 15 will be made to move in the direction not to press the ratchet wheel 10 and the frictional members 11 , 11 by the rotational force transmitting member 18 and the conical frictional member 17 , allowing the pressure receiving member 9 and the drive shaft 4 to turn in the lowering direction by a certain angle against the ratchet wheel 10 . as a result , the baggage within the rated load hung at the lower hook 35 will be lowered intermittently with repetitions of two - way operations of the operating lever 24 . if you switch the rotational direction selecting claw 27 to the neutral position and pull the end side of the load chain 34 under the no - load condition where no baggage is hung on the lower hook 35 , you can make a free rotation of the load sheave 2 smoothly with a small pulling force . namely , if you turn the load sheave 2 by pulling the end side of the load chain 34 , the drive shaft 4 is also rotated in the same direction by the geared transmission system 8 which is engaged with the gear 7 of the load sheave 2 . however , even if the drive shaft 4 rotates , the presser drive member 15 is rotated at a speed somewhat slower than the drive shaft 4 because it is pressed outwardly in the axial direction by the reinforcing member 16 mounted between the presser drive member 15 and the pressure receiving member 19 and its frictional force with the frictional members 11 is small . for that reason , the presser drive member 15 screw connected with the right - handed screw 4b of the drive shaft 4 is moved toward the operating wheel 21 together with the conical frictional member 17 which is linked with the notch 15c of the first boss 15a . as a result of this movement , the rotational force transmitting member 18 which is in contact with both the presser drive member 15 and the conical frictional member 17 also moves toward the operating wheel 21 to come closer to the inner face of the external cover 24b of the operating lever 24 and other component members . however , before this rotational force transmitting member 18 gets in contact with the inner face of the external cover 24b of the operating lever 24 and other component members , the projection for connection 21a of the operating wheel 21 which rotates in unison with the drive shaft 4 contacts the side wall of the contacts 17c of the conical frictional member 17 . as a result , the conical frictional member 17 , the rotational force transmitting member 18 and the presser drive member 15 are rotated in the same direction and at the same speed as the drive shaft 4 , thus preventing the rotational force transmitting member 18 from moving outwardly in the axial direction along the drive shaft 4 . consequently , when you switch the rotational direction selecting claw 27 to the neutral position and pull the end side of the load chain 34 , the presser drive member 15 is maintained in a state not to get in contact with the inner face of the external cover 24b of the operating lever 24 , etc . and , as a result , it becomes possible to make a smooth free rotation of the load sieve 2 continuously with a small pulling force . the conical face of the conical frictional member connected to the presser drive member is put in frictional contact in the conical hole of the rotational force transmitting member by a pressing force set by a reinforcing member . for that reason , if the baggage hung at the lower hook of the load chain has become heavier than the rated load , the rotational force transmitting member runs idle as it cannot rotate the conical frictional member and the presser drive member on which a load larger than the rated load is acting , even if you try to rotate the rotational force transmitting member in the lifting direction . consequently , lifting of a baggage heavier than the rated load is automatically prevented to ensure the safety of work . moreover , in a case where the rotational force transmitting member is moved outwardly in the axial direction along the drive shaft together with the presser drive member and the conical frictional member connected to it , the concavity for connection on the large diameter side of the conical frictional member and the projection for connection of the operating wheel facing it are positioned in such a way as to get in touch with each other before the rotational force transmitting member gets in contact with the external cover of the operating lever and other component members . for that reason , in a case where you switch the rotational direction selecting claw to the neutral position and pull the end side of the load chain under the no - load condition , the rotational force transmitting member also rotates in unison with the drive shaft by the operating wheel before it gets in contact with the external cover of the operating lever and other component members . therefore , it becomes possible to make a smooth free rotation of the load sieve continuously with a small pulling force , thus enabling a rapid movement of the lower hook . the concrete example given in the section of the detailed description of the invention is intended to clarify the content of technology of the invention . therefore , this invention should not be interpreted in a narrow sense as restricted to the above - mentioned concrete example only but shall be interpreted in a broad sense as available for embodiment with various modifications within the range of the spirit of this invention and the claims . | 8 |
the present invention relates to an apparatus operable to fully fill a hollow pillar cavity of a vehicle . fig1 illustrates a side view of a vehicle showing pillars a , b , and c of the vehicle . it is common and well known for a vehicle to have the a , b , c and / or d pillars to support the body of the vehicle . it is further known to provide for a roof , rocker or an other area having an open or hollow space allowing for the transmission of noise from the road , wind , or engine . the carrier of the present invention is suitable for any cavity or hollow space requiring the blockage of noise . the vehicle 10 includes a plurality of carriers 12 and 12 a - 12 g . the vehicle includes a front end 14 and a rear end 16 wherein the a pillar is positioned closest to the front end 14 and the c pillar is positioned closest to the rear end 16 . the carriers 12 and 12 a - 12 g are positioned at various points within the pillars to prevent the transmission of noise into the vehicle cabin 15 . by way of example , the a pillar which is closest to the front end 14 of the vehicle 10 is close to the engine . the engine naturally creates a significant amount of noise which can be transmitted into the vehicle cabin 15 . the inclusion of the carriers with the expandable foam material 12 , 12 a , 12 b positioned within the a pillar significantly blocks the transmission of noise from the engine at the front end of the vehicle 14 into the vehicle cabin 15 . similarly , the carriers 12 d , 12 e within the b pillar prevent the transmission of noise , specifically road noise , into the vehicle cabin 15 . further , carriers 12 c , 12 f , 12 g located within the c pillar prevent the transmission of noise , either road noise or otherwise , into the vehicle cabin 15 . fig2 and 3 illustrate a cross - sectional view of the b pillar and carrier 12 along the line 2 - 3 as shown in fig1 . fig2 illustrates the expandable foam on the carrier before heat expansion of the expandable foam occurs . the carrier 12 is mounted within the b pillar . the b pillar is made of a shell - like construction having a first portion 20 and a second portion 22 . the first portion 20 and the second portion 22 are molded or stamped together to form the b pillar . further structural supports within the b pillar include the supports 24 , 26 . the support 28 of the b pillar includes structural support 29 for accepting a clip portion 38 of the carrier 12 . the structural support of the b pillar is made typically of a metal or metal - like material , or a plastic or plastic - like material such as aluminum , steel , polymers , or other strong materials . the carrier 12 is positioned within the b pillar before the b pillar is fully constructed ( i . e . during the time before the first portion 20 and the second portion 22 are stamped together ). the carrier 12 is generally planar having an upper surface 34 and a lower surface 42 . the main base of the carrier 12 is made of a plastic or plastic - like , or polymer or polymer - like material which is adapted not to expand under high heat conditions . the base of the carrier 12 includes a plurality of pins 32 operable to secure an expandable foam 36 . the pins 32 are made of the same material as the base of the carrier 12 . the expandable foam 36 surrounds a peripheral edge of the carrier 12 . the expandable foam is flush with the upper surface 34 of the carrier 12 . the expandable foam 36 rests on a ledge 44 of the carrier 12 . the ledge 44 is an extension of the lower surface 42 of the carrier 12 . the expandable foam 36 may be different colors or textures as compared to the material making up the base of the carrier or the upper surface 34 of the carrier to distinguish the expandable foam 36 from the carrier base or upper surface 34 . the expandable foam 36 includes a plurality of extended flanges 30 extending away from the carrier at the generally four corners of the expandable foam 36 of the carrier 12 . the extended flanges 30 are molded out of the expandable foam 36 and are a one piece construction with the expandable foam 36 . the extended flange 30 extends at a distance of between 1 millimeter and 15 millimeters away from the carrier 12 . the flange may include a generally rounded free end 31 . the flange 30 ranges in thickness from 0 . 5 millimeter to 10 millimeters in thickness depending on the amount of expandable foam required to fill the cavity 35 of the b pillar . as the vehicle body undergoes heat treatment of between 150 - 400 ° fahrenheit , the heat 60 warms the expandable foam 36 to an exploded end state 36 a as shown in fig3 . this expansion typically occurs at 320 ° fahrenheit . the heat 60 is operable to expand the foam 36 and the expandable foam of the flange 30 to fully fill the area / cavity 35 of the b pillar . the extended flange 30 extends the expandable foam to areas to which the expandable foam would not ordinarily reach . further , the flange 30 acts as a support structure against the inner wall 21 , 23 of the b pillar to further support the carrier 12 before the foam 36 is in the exploded end state 36 a . fig4 illustrates a perspective and cross - sectional view of the carrier 12 . the carrier 12 includes an upper surface 34 and a lower surface 42 . the carrier further includes a ledge 44 wherein the expandable foam 36 rests upon . the upper surface 34 of the carrier 12 is generally planar . the expandable foam 36 includes an upper surface 48 and a side wall 46 . the upper surface 48 is parallel to and rests flush with the upper surface 34 of the carrier 12 . the side wall 46 is generally perpendicular to the upper surface 48 of the expandable foam 36 . the flange 30 further includes an upper surface 37 , a side wall 31 , and a lower surface 33 . the upper surface 37 is flush with and undisturbed from the upper surface 48 of the expandable foam 36 and also flush with the upper surface 34 of the carrier 12 . the side wall 33 of the flange 30 is generally perpendicular to the upper surface 37 of the flange 30 and generally perpendicular to the lower surface 33 of the flange 30 . fig5 illustrates a cross - sectional view along the line 5 - 5 as shown in fig4 . the pin 32 of the base of the carrier 12 is shown operable to support the expandable foam 36 resting on the ledge 44 . the pin 32 is shown to be a one - piece construction with the carrier 12 and portions of the carrier 12 including the upper surface 34 of the carrier 12 . fig6 illustrates a cross - sectional view along the line 6 - 6 as shown in fig4 . the flange 30 is shown having a generally rounded free end 31 . the flange 30 extends away from the expandable foam 36 generally parallel with the upper surface 34 of the carrier and generally parallel with the upper surface 48 of the expandable foam 36 . the flange 30 is generally perpendicular to the side wall 46 of the expandable foam 36 . fig6 further illustrates the expandable foam 36 resting on the ledge 44 . fig6 , 7 and 8 illustrate a small indentation located between the flange 30 and the side wall 46 . the indentation is provided to increase the flexibility of the flange 30 . as a secondary embodiment , no indentation is present between the flange 30 and the side wall 46 of the expandable foam 36 . fig7 illustrates a movement in cross - sectional view of the flange 30 moving 50 to come into contact with the inner surface 21 of the second portion 22 of the b pillar . movement 50 of the carrier 12 and the flange 30 comprised of the expandable foam 36 will allow the flange 30 to come into contact with the inner surface 21 and allow the flange 30 to move , flex , and bend before expansion to further secure the carrier 12 within the cavity 35 of the b pillar . fig8 illustrates the flange 30 of the expandable foam 36 in contact with the inner surface 21 of the second portion 22 of the b pillar when the carrier 12 is in a resting position before heat exposure . fig9 illustrates a view of the carrier 12 having the expandable foam 36 in an exploded end state 36 a . as heat 60 is applied to the expandable foam 36 , the expandable foam 36 expands up to ten times its original volume to the exploded end state 36 a . fig9 illustrates the expandable foam 36 in the exploded end state 36 a expanded and fully in contact with and fully filling the cavity 35 and in contact with the inner surface 21 of the second portion 22 of the b pillar . the carrier of the present invention is injected molded together at the same time as the expandable foam is molded . although made of two materials , it is molded as a one piece construction with the expandable foam material around the peripheral edge . alternatively , the part is molded in a two step process where the expandable foam and the carrier are molded separately , and later assembled together as one piece . this method is utilized for various different expandable foams . the final assembly is put together whether by hand or machine . a method is further provided to prevent or reduce the transmission of noise in a hollow cavity , such as a pillar . the method of reducing noise in a hollow cavity of a vehicle , the method comprising the steps of , creating a flange on a portion of expandable foam , connecting the expandable foam to the cavity of the vehicle , allowing the flange of the expandable foam to contact an inner wall of the hollow cavity and heating the expandable foam and flange to a predetermined temperature thereby allowing the expandable foam to fill the cavity thereby preventing the transmission of noise . the predetermined temperature ranges between 150 - 400 ° fahrenheit . allowing the flange to contact the inner surface of the hollow cavity further ensures stability of the expandable foam ( before expansion ) and ensures complete filling of the expandable foam within the hollow cavity . the invention is not restricted to the illustrative examples and embodiments described above . the embodiments are not intended as limitations on the scope of the invention . methods , apparatus , compositions , and the like described herein are exemplary and not intended as limitations on the scope of the invention . changes therein and other uses will occur to those skilled in the art . the scope of the invention is defined by the scope of the appended claims . | 1 |
the following describes an apparatus for and method of connecting wires to a glow plug . a harness assembly includes a plurality of glow plug connectors , each of which connects to a glow plug for an internal combustion engine . the harness assembly and glow plug connectors described herein may be modified for use with spark plugs and engine sensors , including multi - wire sensors . [ 0052 ] fig1 shows a harness assembly 1400 for a plurality of glow plug connectors 1401 . the harness assembly 1400 includes a glow plug wire connector 1403 that connects a power source to glow plug wires 1405 for each of the glow plug connectors 1401 . the glow plug wires 1405 extend through a wire conduit 1407 , which may be flexible or rigid wire conduit , and a t - connector 1409 for each glow plug connector 1401 . a close - up of the glow plug connector 1401 is shown in fig1 . [ 0053 ] fig1 illustrates a properly inserted glow plug connector 1401 within a part of a rocker carrier 1603 , as viewed from inside the rocker carrier 1603 where the glow plugs are disposed . inside each glow plug connector 1401 is a glow plug terminal 1605 that provides electrical connection to the glow plug , as shown in fig1 . a retention arm 1607 that is part of a retainer 1601 is also shown . [ 0054 ] fig1 shows a harness assembly 1400 that utilizes flexible wire conduit 1407 . fig1 and fig1 illustrate the harness assembly 1400 with each glow plug connector 1401 inserted into the rocker carrier 1603 of an internal combustion engine . the harness assembly 1400 and / or glow plug connectors 1401 described herein may be utilized , for example , with v - type , inline , or l - type engines . [ 0055 ] fig2 . is a side view of the glow plug connector 1401 with the retainer 1601 installed . fig2 illustrates the inner glow plug terminal 1605 disposed within the glow plug connector 1401 . fig2 is a cross - sectional view of the glow plug connector 1401 showing the glow plug terminal 1605 in relation to the connector 1401 . the part of the glow plug connector 1401 that surrounds the glow plug terminal 1605 may be comprised of velox material . [ 0056 ] fig2 illustrates a cross - section of the glow plug connector 1401 disposed within an opening in a rocker carrier 1603 , showing compression of an o - ring seal 2303 and a stopper 2301 . once the outer diameter of the o - ring seal 2303 is no longer visible above the rocker carrier 1603 , the glow plug connector 1401 is properly mounted . once the glow plug connector 1401 is installed , retention arms 1607 for the retainer 1601 expand below the surface of the rocker carrier 1603 . [ 0057 ] fig2 illustrates a side view of the glow plug connector 1401 without the seal 2303 and the retainer 1601 , and fig2 illustrates a side view of the glow plug connector 1401 with the seal 2303 and the retainer 1601 . an upper flange 2401 is encased within a lower portion of the t - connector 1409 , as shown in fig1 . an installation tool groove 2403 is located between an installation flange 2405 and the stopper 2301 of the connector 1401 . an installation tool is inserted into the installation tool groove 2403 in order to assist with the installation and removal of the glow plug connector 1401 . the stopper 2301 is advantageously configured to have an external tapered seating face 2407 . the tapered seating face 2407 engages a complimentarily configured top glow plug passage section 816 ( shown in fig8 ) of the rocker carrier 1603 when the glow plug connector 1401 is installed . the o - ring seal 2303 and the tapered seating face 2407 allow the glow plug connectors 1401 to be appropriately sealed in the rocker carrier 1603 and to be properly disposed in the top glow plug passage 816 when the glow plug connectors 1401 are installed . a pair of seal flanges 2409 and a seal groove 2411 are configured to hold an o - ring type seal 2303 as shown in fig2 and fig2 to seal a glow plug passage 810 ( as shown in fig8 ) in the rocker carrier 1603 . the o - ring seal 2303 is advantageously comprised of a rubber - based material , e . g ., a teflon coated viton o - ring . other materials may instead be utilized to accomplish the sealing function . a retainer groove 2413 is disposed between a pair of retainer flanges 2415 such that the retainer 1601 may be disposed in the groove between the retainer flanges 2415 . an optional overmold 2417 is provided to secure the retainer 1601 to the connector 1401 , thereby preventing the retainer 1601 from becoming dislodged from the connector 1401 . a spacer 2419 is disposed between the seal flanges 2409 and the retainer flanges 2415 to provide a suitable length for the glow plug connector 1401 to mate with the glow plug . [ 0061 ] fig2 illustrates a top view of the retainer 1601 . the retainer 1601 is used to positively retain the glow plug connector 1401 in the rocker carrier 1603 . the retention arms 1607 are angled on both sides , allowing the retainer 1601 to compress as the glow plug connector 1401 is inserted into the rocker carrier 1603 and to snap back to its full dimensions once inside the engine . the angle on the opposite side allows the connector 1401 to also be removed from the rocker carrier 1603 without damage to either the connector 1401 or the engine . the retainer 1601 is advantageously comprised of a metal or metal alloy that is compressible , expandable , and at least slightly flexible . a retention arm 1607 is disposed at each end of an expandable spring 2601 . the expandable spring 2601 expands as it encompasses the retainer groove 2413 , then contracts slightly once in place ( as shown in fig2 ). the expandable spring 2601 advantageously has curved section having a partially circular segment at one end and a u - shaped section at the other end . the retention arms 1607 are disposed at each end of the expandable spring 2601 . compression of the retention arms 1607 toward each other compresses the expandable spring 2601 , and driving the retention arms 1607 apart expands the expandable spring 2601 . the retention arms 1607 are advantageously disposed perpendicular to the expandable spring 2601 , as shown in fig2 . [ 0062 ] fig2 illustrates a side view of the retainer 1601 . the retention arms 1607 are shown each comprising an outer member 2801 and an inner member 2803 that are disposed at an angle with respect to each other . the retention arms 1607 may advantageously be disposed in the same plane , and the retention arms 1607 may advantageously be disposed in a plane substantially perpendicular to the plane in which the expandable spring 2601 is disposed . when the glow plug connector 1401 is inserted into the rocker carrier 1603 , the inner members 2803 compress such that the retainer 1601 fits within the glow plug passage 810 of the rocker carrier 1603 as the glow plug connector 1401 is inserted . once the elbow , where the outer member 2801 and inner member 2803 meet , clears the end of the glow plug passage 810 , the retention arms 1607 expand and hold the glow plug connector 1401 in the rocker carrier 1603 . when the glow plug connector 1401 is removed from the rocker carrier 1603 , the outer members 2801 compress such that the retainer 1601 fits within the glow plug passage 810 of the rocker carrier 1603 as the glow plug connector 1401 is removed . [ 0063 ] fig2 shows a cross - section of the connector as taken through the retainer groove 2413 , when the retainer 1601 is disposed on the connector 1401 . the retainer groove 2413 advantageously runs only partially around the outer diameter of the glow plug connector 1401 between the retainer flanges 2415 . a retainer locator 2901 between the retainer flanges 2415 is utilized to orient the retainer 1601 to the glow plug connector 1401 , with a certain amount of play between the retainer 1601 and the retainer locator 2901 . the present invention provides the advantage of positively connecting glow plug connectors within a rocker carrier by use of a retainer . the retainer is flexible , which facilitates installation and removal , in addition to securing the glow plug connector within the rocker carrier . installation and removal are facilitated by providing a groove in which an installation tool may be inserted . the apparatus may be utilized in other applications than glow plug connection . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope . | 8 |
in the discussion of various embodiments and aspects of the system and method of this disclosure , examples of a processor may include any one or more of , for instance , a personal computer , portable computer , personal digital assistant ( pda ), workstation , or other processor - driven device , and examples of network may include , for example , a private network , the internet , or other known network types , including both wired and wireless networks . those with skill in the art will appreciate that the inventive concept described herein may work with various system configurations . in addition , various embodiments of this disclosure may be made in hardware , firmware , software , or any suitable combination thereof . aspects of this disclosure may also be implemented as instructions stored on a machine - readable medium , which may be read and executed by one or more processors . a machine - readable medium may include any mechanism for storing or transmitting information in a form readable by a machine ( e . g ., a computing device , or a signal transmission medium ), and may include a machine - readable transmission medium or a machine - readable storage medium . for example , a machine - readable storage medium may include read only memory , random access memory , magnetic disk storage media , optical storage media , flash memory devices , and others . further , firmware , software , routines , or instructions may be described herein in terms of specific exemplary embodiments that may perform certain actions . however , it will be apparent that such descriptions are merely for convenience and that such actions in fact result from computing devices , processors , controllers , or other devices executing the firmware , software , routines , or instructions . described herein is an exemplary algorithm which may be implemented through computer software running in a processor to determine optimal collateral allocations based on user - selected criteria . this algorithm is not intended to be limiting , but is merely provided to describe one way of accomplishing the functions associated with determining optimal collateral allocations . in the discussion of various embodiments and aspects of the system and method of this disclosure , examples of trading parties include , but are not limited to , broker - dealers , institutional investors , and hedge fund managers . in various embodiments , a web - based collateral management system or platform links dealers with investors to conduct collateral transactions in a safe , efficient , and reliable way . online dealers and investors can manage collateral among a diverse range of instruments , including tri - party repo agreements in all major currencies , securities lending transactions , municipal deposits , bank loans , derivatives transactions , letters of credit , and structured trades , for example . the system may be managed by the tri - party agent , and may additionally provide , for example , daily mark - to - market valuations , haircuts / margins , and concentration limits ( i . e ., maintain percentages of market capitalization , dollar amount limits for a particular security , or a percentage of the portfolio in a particular security , for example ), as well as manage , track , and settle collateral transactions across global capital markets by working collaboratively with clients to provide collateral transparency . the enhanced collateral allocation aspect of this disclosure may allow dealers ( i . e . the sellers in repos ) to control and / or automatically permit the shifting of collateral associated with a plurality of deals that are under the management of the tri - party agent , even though the collateral is titled to the buyers in the repo . such transfers may “ optimize ” the allocations , so , for example , the fewest number of deals are under - collateralized or over - collateralized , while the collateral allocations meet buyer and / or seller requirements for the deals , as described in greater detail below . fig1 illustrates a functional block diagram of an embodiment of post - trade management system 100 . post - trade management system 100 is established to permit seller 110 and buyer 115 to access collateral management system 140 via network 130 and platform manager 120 , or optionally bypasses platform manager 120 . collateral management system 140 may utilize one or more processors ( not shown ), housed within one or more computers , which may be networked together by any appropriate mechanism , including , for example , network 130 . the one or more processors are configured to run one or more modules , as described below . for example , the modules of collateral management system 140 may include network communication module 145 , configured to process external communications between collateral management system 140 and network 130 . account search module 150 may be configured to search one or more databases associated with client assets held in custody for , or for the benefit of various existing clients of platform manager 120 . account search module 150 may be configured to search for a particular type of security or asset , a particular security issuer , or a security rating , for example . in some embodiments , account search module 150 may be configured to access memory storage device ( s ) 155 , which may include one or more databases 160 therein . memory , storage device 155 may be any type of conventional storage mechanism for example , one or more hard drives , solid state drives , network storage , random access memory ( ram ), combinations thereof , or so on . database 160 may be any type of appropriate database , as would be known by a person of ordinary skill in the art , for example . operator input / output and display module 165 represents various techniques and computer peripheral devices for providing operator input and output to collateral management system 140 . in some embodiments , operator input / output and display module 165 may communicate with network communication module 145 , to provide seller 110 and / or buyer 115 with remote access to collateral management system 140 via network 130 . collateral management system 140 may additionally include reporting and messaging module 170 , which may be configured to provide standard and / or custom report and messaging formats that may be transferred to network 130 by collateral management system 140 , ( optionally ) through platform manager 120 , or through an alternate communications path illustrated by the dashed double - ended arrow in fig1 . in some embodiments , collateral management system 140 may include payment processing module 175 , indicated in dashed lines , which may have optional functionality associated with business payment activities for services rendered by the system manager ( i . e . the third party agent ) in processing , evaluating , and optimizing reallocation of collateral for managed deals such as the tri - party repos . as further shown in fig1 , and described in greater detail below , collateral management system 140 further includes collateral allocation module 180 , which may be configured to us the one or more processors to evaluate various security positions that are being utilized as collateral for a repo deal , or may be eligible to be utilized in a repo deal , and ascertain the allocations of the security positions across a plurality of repo deals . fig2 a depicts a flowchart illustrating an embodiment of a method / process of collateral allocation ( process 200 ), which may be configured to optimize or otherwise enhance or make more efficient the allocations of collateral across a plurality of the repo deals . in some embodiments , process 200 may be implemented by one or more algorithms which may be configured to operate in collateral allocation module 180 . although reference herein will be made to elements of post - trade management system 100 described above , in other embodiments , process 200 may be operable through another such system , or over a plurality of systems . process 200 starts at 205 , and continues to 210 where data associated with the collateral allocation is loaded into memory . in an embodiment , the data may be read from database 160 . in an embodiment , the data may be copied from the database residing on a durable storage medium to a faster access storage medium ( i . e . from a hard drive to random access memory ). in various embodiments , the data may include one or more of tri - party repo deals , positions , security data , rulesets , concentration limit data , or so on . in an embodiment , application locks may be read into the memory as well , so as to prevent duplicate allocations from running simultaneously . in an embodiment , the data may be responsive to a query implemented on account search module 150 . for example , in some embodiments , the data may be narrowed to include data involving a particular buyer 115 , or a particular class of collateral , as described in greater detail below . in an embodiment , the data loaded at 210 may be over - inclusive , so to minimize access of database 160 , which may otherwise increase network latency when memory / storage device ( s ) 155 are located away from the one or more processors . in an embodiment , each of a plurality of processors may be associated with only a subset of the deals to manage primarily that subset , however data corresponding to all deals may be loaded into memory associated with each processor , to balance the load of processing said data , regardless of any interrelatedness of the data . for example , in an embodiment wherein process 200 is operable on a clustered computing architecture , each of a plurality of message passing interface ( mpi ) nodes may be responsible for a subset of the deals returned by the query . once the data is loaded at 210 , process 200 may continue to initialize the data at 215 . data initialization at 215 may be configured to structure the data in a manner that may permit greater efficiency of data handling further in process 200 . for example , data initialization at 215 may include at 220 performing eligibility testing of the positions against the rulesets , basket identifier ( bid ) schedules , and collateral preference schedules ( cps ) for all relevant deals . in an embodiment , only the mpi nodes responsible for a given subset of the deals will test eligibility for those deals . in an embodiment , each node may process multiple deals in parallel , using , for example , an openmp architecture . data initialization at 215 may further include at 225 creating a margin array data structure , such that non - eligible positions for a given deal will have a margin of zero , while eligible positions will have their margin or haircut loaded into the structure . in an embodiment , the margin array may be a double array indexed by repo number and position number , however may be stored as a single contiguous area of memory . in an embodiment , different parts of the margin array may be populated by different mpi nodes , however may be synchronized across the cluster of mpi nodes . in an embodiment , deals sharing a group level concentration limit are grouped onto the same node so that concentration limit data does not have to be communicated through the cluster to help improve performance . in an embodiment , a load balancing algorithm is used to authorize a node as manager of a specific deal so that each node in the cluster has an equal work load . data initialization at 215 may further include at 230 refreshing the margins in database 160 for any margin of the array that is different from previously allocated margins loaded into memory at 210 . such differences may arise , for example , due to changes in security data or rulesets . at 235 , data initialization continues with populating a concentration linked list for repo and position combinations . such a list may permit allocation and de - allocation of positions by iterating through the linked list to update concentration buckets without reparsing the ruleset to identify applicable concentration limits . in an embodiment , concentrations that were not correctly populated in database 160 for previously allocated positions are refreshed in database 160 . data initialization at 215 may further include at 240 populating a cost of carry array , which may be a double array indexed by deal and position . in an embodiment , the cost of carry array may be populated by mpi nodes managing their associated deals , and then synchronized across the cluster of mpi nodes . data initialization at 215 may further include at 245 taking a snapshot of a previous allocation , then returning all previously allocated positions back to a dealer box in the memory . once data initialization at 215 is completed , process 200 may continue at 250 by performing pre - optimization of the positions for the deals . such pre - optimization may allow selection of various features for particular deals , which may override optimized or otherwise enhanced allocations performed later in process 200 . in an embodiment , pre - optimization at 250 may include at 255 allocating all collateral that is eligible for a given deal to that deal , even if the deal becomes over - collateralized . in an embodiment , any collateral allocated to those deals may be locked , and not utilized for other optimizations . in an embodiment , pre - optimization at 250 may include at 260 a minimum modification feature , which may be associated with a given deal such that an attempt would be made to reallocate any collateral previously allocated to that deal ( i . e . indicated in the backup snapshot at 245 ) back to the deal . in an embodiment , if the position is no longer eligible , would break a concentration limit , or would over - collateralize that deal , then that position might not be allocated , or might be partially allocated . in an embodiment , any position allocated to the deals designated for minimum modification would not be accessed for optimization , or otherwise reallocated for the remainder of process 200 . in an embodiment , the deals selected for minimum modification may still have additional positions allocated to it to prevent under - collateralization . for example , if the account is short , additional collateral may be allocated to the deal . furthermore , if the account is over - collateralized , some collateral may be removed , but not enough to make the account under - collateralized . again , any collateral already allocated would remain collateral ; however this may exclude collateral that is no longer eligible collateral , if the rulesets for the deal are modified . in an embodiment , the allocations during the pre - optimization at 250 may utilize a parallel replacement algorithm , described in greater detail below . once the pre - optimization phase at 250 is complete , process 200 may continue with mathematically optimizing the collateral allocations at 270 , where the one or more processors may be used to find an allocation of the portfolio that minimizes current required collateral across the plurality of deals . in an embodiment , seller 110 and buyer 115 may agree to allow such movements of the collateral in their deals , either automatically or at the request of one or both parties . typically , as seller 110 has agreed to buy back the collateral at a later time , seller 110 would be the one who would want to shift collateral , so that additional collateral may be freed up which may be utilized for other purposes . in an embodiment , the mathematical optimization at 270 may also utilize the parallel replacement algorithm , again described below , which may be iterated repeatedly until the portfolio comes fully collateralized , or when the derivative of the weighted average of the previous ten iterations becomes zero or negative . the mathematical optimization at 270 may include , at 275 , indexing and sorting the deals based on position eligibility . in an embodiment , a bipartite graph may be created between the set of positions and the set of deals . edges may be drawn showing eligibility between the sets of positions and deals . in an embodiment , vertex degrees are calculated for each set , representing the number of edges connecting to each member of the set . in an embodiment , the sorting may include sorting the set by vertex degree , such that repo accounts may subsequently be collateralized in the increasing order of their vertex degrees . such collateralization may allow allocation of positions which have lower eligibility . mathematical optimization at 270 may further include at 280 creating groups of positions , which may be utilized to parallelize the allocation process . in an embodiment , a self organizing map ( som )/ kohonen map , or other similar neural network technique may be utilized to create the groups . the som may use vectors of margins for individual positions as inputs to train the network in a learning mode . a mapping mode may then classify a new input vector . in an embodiment , the som algorithm may utilize the euclidian distance formula to categorize and group the positions . in an embodiment , the vectors may include the margins for a position applied to each deal . once the positions are grouped at 280 , the position groups may then be sorted at 285 . in an embodiment where the best use of margins is the basis for enhancement / optimization , sorting the position groups at 285 may comprise ordering the groups according to the average margins of positions within the group . in an embodiment , the som algorithm may be configured to split the position into a number of categories . in an embodiment , the number of categories may be equal to the number of mpi nodes . in some embodiments , the som algorithm may ensure that positions in the same category would have similar margins across all associated deals . as an example , if the margins for each position within each repo account ( ra ) corresponds to what is reflected in table i below , then when the positions are grouped and sorted as reflected in table ii , the groups may be ordered such that the group with the lowest margins has higher priority in allocation , as follows : in an embodiment , where two groups have the same average margins ( such as g1 and g2 in the example of table ii ), then the group having positions with the lower eligibility may be awarded the higher priority . in some embodiments , once the groups are sorted at 285 , the mathematical optimization at 270 may continue with assigning the deals among nodes at 290 . in some embodiments , the deals are assigned to groups as part of loading the data at 210 . such assignment may be performed to parallelize the collateral allocation process . in an embodiment , a deal or a group of deals may be assigned to a particular node based on maximum / minimum concentration limits . as noted above , in some embodiments the deals may be balanced to the mpi nodes , which in some cases may account for group level concentration limits , whereby deals sharing a group level concentration limit are assigned to the same node , while other deals are split across the remaining nodes . in an embodiment , only the mpi node managing a particular deal would allocate collateral to that deal , while any mpi node could de - allocate collateral from a given deal . in an embodiment , the number of nodes would equal the number of position groups for maximum efficiency . in an embodiment , the position groups may be rotated across the mpi nodes so that all nodes have an opportunity to allocate any position from any position group . in an embodiment , the position groups are assigned to a node using pipeline architecture to ensure that lowest margin collateral are considered first for allocation . an example of such allocation is depicted in table iii below . once the groups are sorted in order of their vertex degrees , and in various embodiments assigned to particular nodes , the mathematical optimization at 270 may continue at 295 by performing a maximal allocation . in an embodiment , the maximal allocation may comprise sorting repo accounts by ascending order of vertex degree , based on positions in the dealer box . the maximal allocation may continue by sorting the sorted repo accounts by the vertex degree based on position in an allocated securities box ( although in the first iteration of the maximal allocation at 295 , the allocated securities box would be empty ). maximal allocation at 295 would continue with the position groups being arranged such that those with the lowest average of margins are allocated first . following the maximal allocation at 295 , some of the ras may be left undercollateralized , with some collateral still left in the dealer box . a replacement procedure may be implemented at 300 to swap some of the collateral in the fully collateralized repo accounts with the remaining eligible collateral in the dealer box , and reallocate the freed up collateral to the undercollateralized deals . as above , eligibility may be ascertained by any appropriate mechanism , including but not limited to allowance by buyer 115 in rulesets associated with the deals , preference by seller 110 through the bid schedule , or so on . in an embodiment , the reallocation may again give greater importance to the margins . in an embodiment , the replacement procedure at 300 may comprise sorting the ras first by vertex degree based on the positions left in the dealer box , then by vertex degree based on the positions now in the allocated securities box . during the replacement allocations , securities in the dealer box would be considered first , before securities in the allocated securities box . the undercollateralized accounts would continue to be collateralized with securities from the allocated securities box , once the eligible collateral in the dealer box is depleted . in an embodiment , the replacement procedure at 300 may be iterated across all accounts until all accounts are fully collateralized , or there is a shortage of collateral . in an embodiment , the replacement procedure at 300 may utilize the bipartite graph method to establish priorities for the replacement collateralization . an example of the mathematical optimization performed at 270 is depicted in fig3 , wherein the complete collateralization of all repo accounts r1 - r8 is accomplished in three iterations ( iter 0 , iter 1 , and iter 2 ). for each iteration , the number of securities allocated ( sa ) to a given account is presented , as well as the number of eligible securities in both the dealer box ( db ) and the number of eligible securities in the allocated securities box ( as ). as shown , the order that the repo accounts are presented following the replacement procedure reflects the order in which the repo accounts are collateralized during that procedure : ascending in order based on the number of eligible securities in the db , followed by the number of eligible securities in the as , ( or r6 → r8 → r2 → r7 → r4 → r1 → r5 → r3 ). when making the collateral available , it would be in the reverse order , starting with what is left in the db ( i . e . db → r3 → r5 → r1 → r4 → r7 → r2 → r8 → r6 ). for example , when allocating collateral to account r6 in iter 2 , the collateral considered first will be the eligible collateral in the db ( sorted internally by margins ) followed by the eligible collateral that was allocated to r3 ( sorted internally by margins ) in iter 1 , followed by r5 in iter 1 , and so on . by proceeding in this manner , collateral is being taken from accounts that still have a large amount of eligible collateral left in the dealer box , before moving on to taking collateral from repo accounts that have more limited amounts of eligible collateral . a stopping point for the mathematical optimization at 270 may be determined by any suitable determination criteria . in an embodiment , the mathematical optimization at 270 may simply proceed for a predetermined number of iterations . in another embodiment the stopping point for the mathematical optimization at 270 may be ascertained from a moving average calculated from the prior iterations . as shown in the illustrated embodiment of process 200 in fig2 a , after the replacement process is run at 300 , it may be determined at 305 if an optimal collateral allocation has been ascertained . if not , then the mathematical optimization at 270 may continue by returning to 295 for further collateral reallocations . in an embodiment , the optimal collateral allocation may be selected from the processed iterations of the replacement process 300 at a stopping point for the optimization calculations . an example of ascertaining the optimal collateral allocations at 305 is depicted in the example collateralization table presented in table iv . as shown in table iv , in an embodiment a weighted average of the undercollateralized amount may be calculated from the previous ten iterations of the replacement process at 300 . the “ undercollateralized amount ” indicates the amount by which the account is undercollateralized at the end of the maximal allocation process at 295 . the replacement algorithm at 300 attempts to collateralize this amount by swapping eligible collateral between ras and the dealer box , before allocating the collateral to the given ra . the slope may then be calculated , representing the difference between the current iteration &# 39 ; s weighted average and the weighted average of the tenth prior iteration . in an embodiment , the stopping point may be ascertained when this slope becomes greater than or equal to zero . in table iv , the stopping point is reached with iteration 42 , where the slope becomes positive . the optimal allocation , having the least undercollateralized amount , may then be selected from the calculated iterations , which in the example of table iv is found in iteration 37 . during the swapping of collateral , it may be observed that the replacement algorithm at 300 continues to run iteratively despite there not being any eligible collateral available in any of the accounts . in an embodiment , instead of a set number of iterations being run , as was depicted in table iv , the optimized collateral allocation determination at 305 may detect when the collateralization value has become constant , indicating a lack of further eligible collateral , recognizing that as a termination point . in an embodiment , the optimized collateral allocation determination at 305 may ascertain that the iteration should terminate when the under - collateralized amount becomes zero . in an embodiment , if the moving average value over ten iterations remains constant or increases , the allocation may be ascertained at 305 to be complete . the moving average may be a greater determination of optimal collateralization , because in cases where larger collateral is swapped for smaller collateral , the under - collateralized amount value may increase for that particular iteration , however , this may decrease again in subsequent iterations , and it may be desirable to continue the iterations of the replacement process at 300 . once it is determined at 305 that the collateral allocations have been mathematically optimized , the mathematical optimization at 270 may end , and process 200 may continue to a , which continues at fig2 b . as is shown in fig2 b , process 200 may continue at 310 with a business optimization of the collateral . in an embodiment , the business optimization at 310 may be implemented if there is insufficient collateral to collateralize the entire portfolio . in an embodiment , a determination of which deal or deals should be left undercollateralized may be made at 315 . in an embodiment , multiple considerations may exist , which may be used together and prioritized by seller 110 and specified via operator i / o & amp ; display 165 , as described in greater detail below . in an embodiment , one such consideration may include basket prioritization 320 . basket prioritization 320 may prioritize deals classified as basket trades or having bid schedules over deals that are not classified as basket trades , or do not have bid schedules . in an embodiment , another such consideration may include internal short prioritization 325 . internal short prioritization 325 may collateralize older deals ahead of newer deals . in an embodiment , another consideration may include market deadline prioritization 330 . such market deadline prioritization 330 may prioritize deals that accept collateral only from markets which are closed ahead of deals that only accept collateral from markets which are still open . in yet another embodiment , another consideration may include dealer prioritization 335 , wherein the dealer ( i . e . seller 110 ) may specify particular deals to have a higher prioritization . again , such demarcation of higher priority deals may be specified via operator i / o & amp ; display 165 , or any other interface with the collateral allocation system running process 200 . the implementation of the undercollateralization determination at 315 may be by any suitable mechanism , including but not limited to via the parallel replacement mechanism of the mathematical optimization described above . as further shown , the business optimization at 310 may further include at 340 determining which of a dealer &# 39 ; s preferred collateral should be allocated to a deal . the dealer &# 39 ; s preferred collateral may be of any appropriate type , and may correspond , for example , to the dealer &# 39 ; s bid schedule , and the intersection of the bid schedule with the deal &# 39 ; s ruleset ( which may specify the collateral acceptable to buyer 115 ). in an embodiment , any collateral that is allocated with a higher cost of carry may be swapped with eligible collateral still in the dealer box that has a lower cost of carry . in an embodiment , any collateral that is allocated with a higher margin may be swapped with eligible collateral still in the dealer box that would have a lower margin . in an embodiment wherein deals are associated with particular mpi processes , deals may be processed in parallel using shared memory programming within the same mpi node . in an embodiment , for each repo deal managed by an mpi process , priority may be established as either by margins 345 or by cost of carry 350 . for each deallocation position equal to the position desc ( in sql syntax ) that is allocated to the deal , and for each allocation position equal to the allocation asc ( in sql syntax ) that is available in the dealer box , the dealer preferred collateral determination at 340 may include breaking out of the position desc and position asc loops if the allocation position is equivalent to the deallocation position . otherwise , the determination algorithm may comprise deallocating the deallocation position , allocating the allocation position , and trying to fully collateralize the deal with the position that was de - allocated . if the deallocation position was fully removed , the loop over all mpi nodes may end . in prioritizing by margin at 345 , if a position is eligible for two different deals , if there is a lower margin in one deal , it should be allocated to that deal so that fewer positions are used to collateralize the portfolio . in prioritizing by cost of carry at 350 , seller 110 may analyze the collateral from a risk / desirability standpoint , determining which collateral is the cheapest to deliver , and how they believe the collateral &# 39 ; s value will change during the course of the deal . although in some embodiments , other business optimizations may be included in the business optimization at 310 , in an embodiment process 200 may continue at 355 with a final allocation of deals in the dealer box . in an embodiment , these final allocations at 355 may be utilized to collateralize the portfolio of deals if there are any positions in the dealer box after both the mathematical optimizations at 270 and the business optimizations at 310 . in an embodiment , the parallel replacement algorithm may again be utilized for the final allocations at 350 . in an embodiment , process 200 may continue with a submission of allocation instructions at 360 . for example , in an embodiment the current allocations that were tracked at 245 may be compared with the optimized portfolio calculated in process 200 . the differences between the pre - optimized allocations at 245 and the newly optimized allocations may be forwarded to a separate instruction allocation server , which may utilize instructions from a collateral optimization server , such as collateral management system 140 , to implement the optimized instructions across the deals . in an embodiment , removal of positions that shouldn &# 39 ; t be allocated would be performed by the instruction allocation server first , followed by a reallocation of collateral to new deals . in an embodiment , if there exists an instruction where the position cannot be allocated due to eligibility , concentration limits , or so on , the instruction server may update database 160 or another storage construct with the reason for the failure . in an embodiment , the instruction allocation server may then perform the remaining position movements , collateralizing the deal associated with the erroneous instruction at a later time . in some embodiments , the instruction allocation server may be configured to perform position movements so as to minimize financial exposure to the tri - party agent , or other similar party . as an example , where collateral is removed from multiple accounts before being reallocated , the tri - party agent would be exposed for the entire uncollateralized amount over the multiple accounts . however if the collateral were reallocated from some of the accounts to others of the accounts prior to removing collateral from those other accounts , the exposure to the tri - party agent would be reduced . as such , in some embodiments the movements of collateral may be ordered to minimize shortage . as shown in the simplified example of table v , the tri - party agent would be exposed by the value of each collateral removed from a given deal . in scenario a , between steps 2 and 3 , the tri - party agent would be exposed by the value of collateral owed to account a plus the value of collateral owed to account b . in scenario b , however , by allocating collateral x to account b immediately after removing it from account a , account b is never shorted , reducing the exposure to the tri - party agent . in more complicated embodiments , where collateral is being reallocated over and between a greater number of accounts , any number of determination criteria may be utilized to ascertain the order of deallocation and reallocation , to reduce exposure to the tri - party agent . in some embodiments , multiple movements may be processed together ( i . e . as a single transaction ), which may also reduce or eliminate exposure to the tri - party agent . for example , if movements 1 - 4 of either scenario a or scenario b were performed as a single transaction , then there would not be any exposure to the tri - party agent , as the account holders would never see a shortage to the deals in their accounts . in some such embodiments , an automatic cash crediting system for providing credit from the tri - party agent to shorted accounts may calculate at a transaction level , comparing differences in exposure at the start of the transaction to the end of the transaction . returning to fig2 b , in some embodiments , statistics regarding the data initialization at 215 , and / or the optimized allocations calculated in process 200 may be saved at 365 . in an embodiment , the save may be made to durable memory , such as memory / storage device ( s ) 155 of collateral management system 140 . in an embodiment , the statistics may be recorded to database 160 . as noted , such statistics may include collateralization failures , however may also include any other information calculated during process 200 , including but not limited to data regarding margins and cost of carry . finally , process 200 may end at 370 . as indicated above , in an embodiment optimization may include consideration of bid schedules . in an embodiment wherein there is insufficient collateral for a given deal , upgrades may also be considered for the deals . for example , in an embodiment a cps ( or an “ upgrade ” schedule ) may be utilized to prioritize collateral allocation . in an embodiment , the eligibility of collateral may be simply indicated in the margin array . in an embodiment , during the dealer preferred allocations 340 of the business optimizations at 310 , collateral with a high cost of carry ( determined by the cps ) may be swapped with collateral of a lower cost of carry , which would utilize the cps in a descending direction . in an embodiment , the cps may determine eligibility of collateral in the ascending direction , while dealer preferred collateral may be ascertained by reading the cps in the descending direction . in an embodiment , if a given deal reaches a specified maximum number of positions , an extra check may be performed after allocating each position . in an embodiment , if the number of positions equals the maximum allowable position count , and if the current required collateral of the deal is greater than zero , then the smallest allocated position may be removed , which may allow for the potential of a larger position to be allocated . as noted above , in an embodiment , the parallel design of the computation of the deals is appreciated , wherein various memory locks may be implemented to prevent multiple processes from allocating positions to the deal . in an embodiment , however , any mpi process may be configured to remove any position from any deal , regardless of whether the specific mpi process is responsible for managing that deal . in an embodiment , groups of ras may be allocated using a pipeline architecture , such that in a first time - cycle , a first node will process a first group g1 , while in a subsequent time - cycle , the first node will process a second group g2 , while a second node will process the first group g1 . such grouping of positions may allow multiple mpi processes to allocate in parallel , preventing multiple processes from allocating the same position at the same time . in an embodiment , the grouping of positions may permit allocation of the lowest average margin positions , which can reduce the number of positions used to collateralize the portfolio of deals . in an embodiment , the positions are synchronized across the mpi nodes between each time - cycle allowing each mpi node to know the current state of all positions in the group it is about to allocate from in the next time - cycle . the system and method of this disclosure may be implemented in various ways . for example , as noted above , access to collateral management system 140 may be provided via operator i / o & amp ; display 165 . in an embodiment , operator i / o & amp ; display 165 may be accessible over network 130 , such that seller 110 and / or buyer 115 may have access to collateral allocation module 180 , for example . in an embodiment illustrated in the “ screenshot ” of fig4 , graphical user interface ( gui ) indicated generally by letter “ a ” may be provided to facilitate such access to collateral management system 140 . as shown , a gui “ a ” may allow creation or modification of an allocation template identified at letter “ b ”, which may permit a user of gui “ a ” to establish preferences for process 200 to optimize collateral allocations . at letter “ c ”, pre - optimization options may be established . in an embodiment , the pre - optimization options may correspond with the pre - optimization at 250 . in the illustrated embodiment , pre - optimization options “ c ” for allocation template “ b ” permit selectively enabling the minimize modifications features 260 , which again would attempt to reallocate any collateral previously allocated to a given set of deals . in an embodiment , different accounts and / or deals that are added or controlled over post - trade management system 100 may selectively be associated with a minimum modification ( minmod ) tag , such that if the minimize modifications feature 260 is enabled in pre - optimization options “ c ”, the collateral allocation module 180 would attempt to retain the collateral as allocated to those accounts . optimization options for mathematical optimization 270 in allocation template “ b ” may be controlled at letter “ d ”. as shown , a number of features are controllable in the illustrated embodiment . for example , in an embodiment , a fussy factor may be presented , giving a user of the gui “ a ” the ability to establish a percentage of a position that is allocated in each iteration of the optimization . a forced fussy factor option may control how strictly the fussy factor is enforced . in an embodiment , a full replacement option may be presented to control the number of passes that may be run in a full replacement algorithm for the optimization . an option may be presented to selectively include minmod tagged accounts in the replacement procedure at 300 . furthermore , it may be selected that the replacement algorithm at 300 may run the deals with an older stat date option , or a lower priority option . another option presented in the optimization options “ d ” may include a number of times to retry the optimization and / or post - optimization phases ( i . e . mathematical optimization 270 and business optimization 310 ). at letter “ e ” options for the business optimization at 310 are presented . as shown , there may be separate sections for both the determining of which deals to short at 315 , and the determining dealer - preferred allocations at 340 . as shown , the user of gui “ a ” may prioritize from basket prioritization 320 , internal short prioritization 325 , market deadlines 330 , and dealer priority at 335 . again , for basket prioritization at 320 , accounts assigned to a basket tag should be allocated before accounts not assigned to a basket tag . with internal short prioritization 325 , deals with older state dates , still undercollateralized , would be allocated before accounts with earlier start dates . in market deadline prioritization 330 , accounts with closed markets would be allocated before accounts with open markets . in dealer prioritization 320 , undercollateralized deals with lower priority would be allocated before accounts with higher priority . in the dealer - preferred allocations at 340 , the options presented in some embodiments may include assigning a priority to use better margins compared to the cost of carry . likewise , a priority may be assigned to use a cost of carry profile as compared to a better margin profile . although the options depicted in letters “ c ”, “ d ” and “ e ” are presented as drop - down lists that permit selection of “ yes ,” “ no ,” numerical elements ( such as for prioritization or percentages ) and so on , other graphical user interface elements may also or alternatively be utilized in gui “ a ”. for example , a series of push buttons or radio buttons may be presented to make the applicable options selections . furthermore , in some embodiments a text based interface ( or a text base element in a gui ) may be utilized , allowing a user to type in an applicable response to an option prompt . in some embodiments , combinations of gui and text elements may be utilized . for example , at letter “ f ”, instructions for the instruction allocation server are input . as shown , the applicable dealer id ( identifying seller 110 , for example ) is a text interface , while a “ submit ” dropdown box allows for a constant , intermittent , or delayed submission of the optimization instructions to the instruction allocation server . shown at letter “ g ” is a pushbutton that would reset the values input at letters “ c ” through “ f ” to default values . such default values may be , for example , all “ no ” responses , all “ yes ” responses , zeroed numerical prioritizations , or so on . in an embodiment , the default values implemented by the reset pushbutton “ g ” may be the most commonly implemented response for each optimization element . pushbutton “ h ” is a submission pushbutton , configured to accept the responses established for allocation template “ b ”. as shown , pushbutton “ h ” is a preview pushbutton , which would advance the user to a summary page depicted in the screenshot of fig5 . as seen in fig5 , a reporting of the selections made for allocation template “ b ” is presented at letter “ i ”, allowing a user of gui “ a ” to review his or her responses . if an error has been made in a response , a cancel pushbutton is provided at letter “ j ”, returning the user to the screen depicted in fig4 , allowing editing of allocation template “ b ”. in an embodiment , all responses in made previously to allocation template “ b ” will remain , so that a user need only change the source of the error . if the allocation template review at “ i ” is correct , a confirmation pushbutton is provided at letter “ k ”, saving the allocation template responses . in an embodiment , the name identifying application template “ b ”, by which the template responses may be saved under , is established prior to accessing the options for allocation template “ b ”. in other embodiments , a space to label or otherwise demark a template name for the optimization configurations may be provided either in the editing screen of fig4 , the preview report of fig5 , or following confirmation through pushbutton “ k ”. clicking of the confirmation button “ k ” may in an embodiment save the selected options in memory / storage device ( s ) 155 . in an embodiment , the selected options may be recorded in database 160 , and may be associated with some or all deals for associated with seller 110 . in an embodiment seller 110 may run the optimization for deals associated with a particular buyer 115 , or a series of buyers 115 all associated with the tri - party agent . in an embodiment , a portion of gui “ a ” may allow for a listing of previously created templates , and the ability to create new templates . in fig6 , a new template may be added at letter “ l ”, wherein a template name may be input in the textbox at letter “ m ”. after clicking on the add button at letter “ n ”, the allocation template editing screen of fig4 may be presented , and would ultimately be saved under the specified template name . as further shown in fig6 , previous templates may be listed at letter “ o ”, along with the option of modifying the templates , copying the options from the template into a new template having a new name , or deleting the templates . in the illustrated embodiment , allocation template “ b ” appears on the list , wherein clicking the modify button indicated at letter “ p ” would return to the view of fig4 . as illustrated in fig7 , in an embodiment a portion of gui “ a ” may provide user input to apply the settings of an allocation template , such as allocation template “ b ” established in fig4 , to optimize collateral allocations from the dealer box . as shown , the allocation template may be selected at letter “ q ”. in the illustrated embodiment , the allocation template is selected by a dropdown box , however in other embodiments the allocation template may be searched for , identified by a text - box , or by any other suitable mechanism . in the illustrated embodiment , allocation template “ b ” established in fig4 is selected in the dropdown box at letter “ q ”. as shown , in an embodiment the allocations may be performed by designating a particular dealer box , and a particular dealer id , as is shown generally at letter “ r ”. in other embodiments a dealer allocation group may be selected or otherwise designated to submit an allocation , as may be selected by clicking on the tab indicated at letter “ s ”. fig8 illustrates that in an embodiment , after an allocation is submitted the status of the allocation may be presented through a portion of gui “ a ”. as shown , the allocation may be searched by a number of associated criteria presented generally at letter “ t ”, including but not limited to allocation date , allocation status , allocation type , dealer or purchaser id , allocation id , dealer box , dealer allocation group , basket id , combinations thereof , or so on . in the illustrated embodiment , basic selection criteria that includes at least a date range for the allocations may be combined with more particular selection criteria ( i . e . the dealer / purchaser ids , the allocation id , the dealer box , the dealer allocation group , or the basket / purchaser ids ) when searching an allocation history . by entering the associated search information and clicking the find buttons “ u ”, the associated allocations may be presented , such as is depicted in fig9 . in the embodiment of gui “ a ” depicted in fig9 , the allocations associated with the search terms entered at letter “ t ” in fig8 are presented , and may include at letter “ v ” the status of the optimization process described above . as shown , in an embodiment , the status of completed optimizations may be indicated as “ done ”, while “ in progress ” may designate that an optimization is under way for the associated allocation id . also shown is that certain allocations may be designated as “ abort ”, which may indicate the failure of the allocation procedure . in an embodiment , clicking on the “ abort ” indicator may present information as to the reason for the abortion of the optimization procedure , such as an improper ruleset configuration , a computer failure , a time - out , or so on . in an embodiment , selecting the allocation id indicated generally at letter “ w ” from the allocation history results illustrated in fig9 may provide a detailed description page , such as that depicted in fig1 . fig1 illustrates a detailed description page of gui “ a ”, which may correspond to the allocation id “ w ” selected in fig9 . as shown , the allocation template utilized for the selected allocation ( which in the illustrated embodiment is allocation template “ b ” established in fig4 ) may be listed , as well as the associated report for the allocation . as shown , a dropdown box “ x ” may provide different types of report data associated with the allocation . for example , in the illustrated embodiment , the initial screen may indicate the current amount of collateral associated with or needed in the selected allocation . in an embodiment , other reports may also or alternatively be provided , such as by selecting a different report type from the dropdown box “ x ”. in an embodiment , the reports may include a list of the allocated positions by the cost of carry . for example , the report may allow comparison based on account id , security id , id type , depository , dealer box , par , collateral value , cps ruleset , and / or the cost of carry number . in an embodiment , the reports may be for all positions , including unallocated positions . in an embodiment , the weighted average of the cost of carry for the allocated positions may be provided , where the weight is determined by the size of the positions . in an embodiment , the positions that indicate zero cost of carry ( i . e . the cost of carry could not be derived ) are presented , so that a user may determine a gap in their schedule designations ( i . e . in the cps ) that prevents complete prioritization . in an embodiment , the weighted margins for the account ( s ) are presented , to indicate the excess in collateral provided for a given account . other reports are possible , and the reports described above are provided solely as examples of how data may be presented to users , so that users may use the gui “ a ” to determine if or how to best make associated collateralization decisions . as further shown in fig1 , once a user of gui “ a ” is fished viewing the allocation reports , they may press the button “ y ” that may return them to the allocation history list of fig9 . the above - discussed embodiments and aspects of this disclosure are not intended to be limiting , but have been shown and described for the purposes of illustrating the functional and structural principles of the inventive concept , and are intended to encompass various modifications that would be within the spirit and scope of the following claims . various embodiments may be described herein as including a particular feature , structure , or characteristic , but every aspect or embodiment may not necessarily include the particular feature , structure , or characteristic . further , when a particular feature , structure , or characteristic is described in connection with an embodiment , it will be understood that such feature , structure , or characteristic may be included in connection with other embodiments , whether or not explicitly described . thus , various changes and modifications may be made to this disclosure without departing from the scope or spirit of the inventive concept described herein . as such , the specification and drawings should be regarded as examples only , and the scope of the inventive concept to be determined solely by the appended claims . | 6 |
fig1 illustrates a presently preferred embodiment of the tank cleaning system 10 of this invention in a tank 12 with dividing plates 14 and a center hole 16 in each dividing plate . it should be understood that only a portion of the tank 12 is illustrated , and it may extend a substantial distance above and / or below the portion illustrated in fig1 . the system 10 comprises a feed sub - system 20 , a support 22 , and a nozzle jet sub - system 24 . the feed sub - system 20 includes a prime mover 26 which imparts lateral movement to a feed tube 28 as shown by an arrow 30 . the prime mover 26 also imparts rotational movement to the feed tube 28 , as shown by an arrow 32 . the feed tube carries fluid , typically water , under high pressure for cleaning the interior of the tank 12 as described in greater detail below . the high pressure fluid is provided by a high pressure source , typically a compressor ( not shown ). the prime mover thus controls the lateral and rotational movement of the feed tube . the lateral movement of the tube is controlled at such a rate as to create a controlled helical movement of the spray from the nozzle jet sub - system 24 for complete and efficient cleaning , as described further below . the feed tube 28 passes through and is supported by a feed pedestal 34 which also serves to support a feed tube sheath 36 . the feed tube sheath is a flexible , non - rotating conduit through which the rotating feed tube passes . the other end of the feed tube sheath 36 is coupled to the support 22 , which is typically mounted to a structural member 38 in the vicinity of the tank 12 . the feed tube sheath 36 has an opening 40 through which the feed tube 28 passes . the feed tube 28 is then directed downwardly into the tank 12 , where it continues to rotate as shown by an arrow 42 . also , movement back and forth of the prime mover 26 as shown by the arrow 30 results in lateral movement of the feed tube 28 as shown by an arrow 44 . the nozzle jet sub - system 24 is illustrated in fig1 already deployed within the tank 12 . while fig1 is not necessarily to scale , it should be recognized that the horizontal diameter of the tank is large compared to the horizontal diameter of the center hole 16 , so that the nozzle jet sub - system must be small enough in its own horizontal diameter to pass through the center hole 16 . once through the center hole 16 , however , the nozzle jet sub - system must then direct high pressure fluid against the interior surfaces of the tank in order to adequately clean these surfaces . the present invention accomplishes this difficult task by providing two motions to the nozzle jet sub - system , to be described below in greater detail . the nozzle jet sub - system 24 comprises a centrally disposed swivel 50 with at least two arms 52 extending therefrom . while the nozzle jet sub - system is being deployed within the tank 12 , the arms 52 extend substantially vertically , i . e . parallel with the direction of travel of the system . once the nozzle jet sub - system is properly positioned about midway between dividing plates 16 , the arms are rotated to a horizontal positioned , as shown in phantom in fig1 . then , nozzle extensions 54 telescope out to a deployed position , carrying a nozzle jet 56 on the end of each nozzle extension 54 to a position adjacent an interior surface 58 of the tank 12 . it should be noted that the arms 54 may also be flexible to assist in drawing them through small access holes or center holes in dividing plates . to clean vessel walls 58 , the sub - system 24 must be properly positioned within the tank between divider plates . once a portion of the tank is cleaned , the sub - system 24 is collapsed , repositioned through center hole 16 , and redeployed to clean the next portion of the tank . thus , the distance between dividing plates within the tank must be greater than the length between nozzle jets before the extension arms are extended so that the sub - system 24 can freely rotate into position between divider plates . further , once the sub - system 24 is horizontally deployed with the jets near the interior surface of the tank , the sub - system is then lifted until the extension arms , which are now parallel to the dividing plates , are as close as possible to the dividing plate immediately above the sub - system 24 so that the portion of the inside surface of the tank immediately beneath the divider plate will be properly cleaned . once the sub - system 24 is properly positioned within the tank , the feed tube 28 is pressurized with fluid , typically water . the nozzle jets 56 are then activated and the telescopic extension arms 54 extend , thereby positioning the nozzle jets 56 close to the vessel wall 58 . no dampening of extension arm movement is applied . with the activation of the nozzle jets , the sub - system 24 is then rotated about the vertical axis of the tank to direct the jet spray around the interior surface of the tank , as controlled by the feed system 20 . with the start of the rotation of the sub - system 24 , the sub - system 24 is then lowered by feeding the high pressure feed hose 28 at a controlled feed rate . the feed rate is determined by a predetermined length of feed for each rotation of the sub - system 24 to provide some overlap for each track of the spray against the interior surface of the tank . once sub - system has been lowered as much as possible , thereby cleaning the portion of the tank between the dividing plates , the nozzle jets are stopped and the telescopic arms are retracted . the sub - system 24 is then centered between the dividing plates and the extension arms are rotated into a vertical position . the tank cleaner can now be lowered in the next tank section between the next set of dividing plates . note that the preceding detailed description was directed to cleaning the interior surfaces of the tank in between dividing plates . however , the dividing plates themselves must also be cleaned . to clean dividing plate surfaces , two jets per extension arm are installed with the jet direction vertically up and down parallel to vessel center axis when in operation . the sub - system 24 is positioned along the axis of the tank and then lowered into the individual tank sections with the extension arms in a vertical position as previously described . when the sub - system 24 is positioned in the center between two dividing plates , the extension arms are rotated into a horizontal position . the sub - system is then lifted until the extension arms , which are now parallel to the dividing plate , are as close as necessary to the upper dividing plate for proper cleaning results . the nozzle jets are then activated and the telescopic extension arms extend at a preset speed , determined by a dampening system . the system then operates as previously described , this time to spray a high pressure fluid against the bottom surface of the dividing plate above the sub - system 24 and the top surface of the dividing plate below the sub - system 24 . the rotational speed of the sub - system 24 is coordinated with the extension speed of the telescopic arms 54 so that the resulting movement of the water nozzle jets is a spiral pattern . we have found that the jets which face in a downward direction have less of a cleaning effect on the lower dividing plate than the upwardly directed jets . however , the downwardly direction jets must be active as a counter force to the jets facing up to provide a balanced force acting upon the ends of the extension arms . once the extension arms have extended all the way to their full extent , water pressure through the feed tube 28 is stopped and the extension arms retract . the sub - system 24 is then lowered until the extension arms are as close as necessary to the lower dividing plate . the process is then repeated with the cleaning of the top surface of the lower dividing plate in a manner just described in respect of the dividing plate above the sub - system 24 . after cleaning both dividing plate surfaces , the system is centered between the dividing plates and the extension arms are rotated into a vertical position . the sub - system 24 is then lowered into the next tank section . fig2 illustrates the application of the tank cleaning system 10 in an open tank 60 without dividing plates or internally installed moving parts . as previously described , the system 10 comprises the feed sub - system 20 , the support 22 , and the nozzle jet sub - system 24 . the feed sub - system 20 includes the prime mover 26 which imparts lateral movement to the feed tube 28 as shown by the arrow 30 . the prime mover 26 also imparts rotational movement to the feed tube 28 , as shown by the arrow 32 . the feed tube 28 passes through and is supported by the feed pedestal 34 which also serves to support the feed tube sheath 36 . the other end of the feed tube sheath 36 is coupled to the support 22 , which in the embodiment illustrated in fig2 is adapted to mate with an upper access port 62 of the tank 60 . the feed tube 28 is then directed downwardly into the tank 60 , where it continues to rotate as shown by the arrow 42 . also , movement back and forth of the prime mover 26 as shown by the arrow 30 results in up and down movement of the feed tube 28 as shown by the arrow 44 . in the embodiment of fig2 , the cleaning apparatus is positioned along the center axis of the tank 60 near the top of the tank , with the distance of sub - system 24 to the top of the tank equal to the radius of the vertical part of vessel . the length from the center of the sub - system 24 to the water jet outlet nozzles equals the horizontal radius of the vessel minus the distance for an individual jet outlet to the vessel wall for best cleaning results . if the nozzle is too close to the vessel wall , the jet is too narrow , resulting in a pencil beam of water against the vessel wall and inadequate overlap from one track to the next . if the nozzle is too far from the vessel wall , the water spray has too little force to clean certain tenacious depots on the vessel wall . with the initial positioning of the sub - system 24 , the extension arms are vertical , one jet facing the top of the vessel and one jet facing the bottom . when activated , the lower jet will typically be too far from the bottom of the tank to have much of a cleaning effect . once the water jets are activated , the extension arms will rotate to a horizontal position . also , simultaneously with the activation of the jets , the sub - system 24 will begin to rotate about the vertical axis , beginning a cleaning action along the inside top surface of the tank . this additional rotation is provided by the prime mover 26 through rotation of the feed tube 28 . the rotational speed around the vertical axis is coordinated with extension arm rotational speed around the sub - system 24 , so that the resulting spiral pattern track of water jets on the vessel wall provides an overlap of one jet track to the next . the distance between tracks and traveling speed of the water jets may require some adjustment , depending on type of material that has to be removed from the tank walls . once the extension arms have reached a horizontal position , the sub - system 24 is lowered into the tank with its rotation around the tank vertical axis maintained , thus creating a spiral cleaning track down the wall of the vessel . the cleaning apparatus is lowered by feeding the high pressure water feed tube at a controlled feed rate in relation to the rotational speed of the sub - system 24 . the prime mover 26 coordinates the rotation of the cleaning apparatus around the vertical tank axis and the downward movement of apparatus . the downward movement of the apparatus is stopped once the apparatus reaches a position in the center of the vessel with a distance of the sub - system 24 to the bottom of the vessel equal to the radius of the vertical part of the vessel , thus the distance of the jet outlet to the vessel wall required for best cleaning results will be reached . now the extension arms will be rotated back into vertical position at the same rotational speed as they were rotated into horizontal position at the beginning of the cleaning process with the high pressure water pump continuing to run . with the tank cleaner rotation along the tank vertical axis maintained the jet moving towards the lower center of the tank will clean the bottom in a spiral pattern . alternatively , the supply of pressurized water through the feed tube may be stopped , and the extension arms rotated into a vertical position and the same procedure as in the very beginning is repeated to clean the bottom of the tank by starting at a vertical position and moving in a controlled fashion to a horizontal position . however , at the end of the cleaning process , the arms are returned to a vertical position in order to pull the tank cleaner out of the tank . fig3 a and 3b depict a presently preferred embodiment of the sub - system 24 , which may be referred to herein as the “ tank cleaner ”. fig3 c depicts an alternative spray nozzle for use on the sub - system 24 for cleaning dividing plates within a tank as described above , in which spray outlets from the nozzle are directed in diametrically opposed directions . the sub - system 24 includes a frame 70 suspended by the rotating high pressure water hose or feed tube 72 in the center of the tank . a center plate 74 is held by the suspended frame and supported by a bearing 76 that allow the plate to rotate around an axis perpendicular to the vessel center axis . the two extension arms 54 are coupled to center plate , with one water jet insert 76 each at each extension arm tip . the extension arms may vary in length , depending on the specific cleaning job or application . the jet directions and extension arm length axes are in the same geometrical plane perpendicular to the rotational axis of the center plate , and jet forces of the two jets match each other and are directed in opposite directions with one jet presenting the counter force to the other jet . the jet and extension arm length axes are offset , thus , the jet reaction forces generate a torque with a direction perpendicular to the vertical tank center axis . this torque rotates the center plate with the extension arms . the rotational movement is dampened by a hydraulic cylinder 78 and restricted to 90 ° between vertical and horizontal extension arm positions . the damping can be adjusted with an adjustable orifice 80 in order to control the rotational speed of extension arms . fig4 depicts a schematic view illustrating the damping feature of the spray sub - system 24 . as previously described , the sub - system 24 is fed with high pressure fluid from a tube 28 , which is coupled into the swivel 50 . fluid pressure is directed through the arms 52 and the extensions 54 , creating a moment to rotate the swivel as shown by the arrows in fig4 . rotation of the swivel 50 rotates a pinion gear 92 which meshes with a rack 94 . the rack 94 is joined to a piston 96 within a cylinder 98 . moving the rack to the right pushes hydraulic fluid from the cylinder to the right out through the adjustable orifice 80 to the other side of the piston 96 . thus , the rate of rotation of the swivel is controlled by the setting on the orifice 80 . preferably , the orifice 80 is an adjustable throttle check valve . the spray sub - system 24 is shown in fig4 at the full horizontal position . once the spray process with the spray sub - system in the horizontal position is complete , the arm extensions retract and the swivel rotates to place the arms in a vertical position . a weight 90 provides a biasing means to pull the arms to a vertical position . to aid in this movement , the orifice includes a check valve which permits unrestricted flow from left to right as seen in fig4 to more quickly move the arms to a vertical position . the arm extensions 54 also include a biasing means to assist in retracting the arm extensions when the high pressure fluid is no longer being supplied to the spray nozzles 56 . the principles , preferred embodiment , and mode of operation of the present invention have been described in the foregoing specification . this invention is not to be construed as limited to the particular forms disclosed , since these are regarded as illustrative rather than restrictive . moreover , variations and changes may be made by those skilled in the art without departing from the spirit of the invention . | 1 |
a detailed description of a first preferred embodiment of the present invention will now be given . fig1 is a perspective view of a coil in a first embodiment . fig2 is a cross sectional view of the coil mounted on a split type stator core . in fig2 , the coil is shown with eight turns for convenience of explanation . fig3 is a perspective view of a stator . a coil 10 is formed by winding a flat rectangular conductor 20 . this conductor 20 is a metal wire superior in electric conduction property , such as copper , having an outer surface applied with an insulating coating film 21 . the rectangular conductor 20 has a rectangular cross section . this rectangular conductor 20 is wound in two layers and six rows ( 2 - layer x b - row ), resulting in a coil 10 shown in fig1 . assuming that the row is defined in the radial direction of a split core unit 25 and the layer is defined in the circumferential direction of the same , the coil 10 is formed by winding the rectangular conductor 20 by twelve turns with two layers and six rows . a stator core piece 30 is a member constituting the split core unit 25 and is made of laminated electric steel sheets . each core piece 30 is formed with a teeth portion 31 . the core pieces 30 are arranged in a cylindrical shape to form the core unit 25 . the coil 10 is mounted on the teeth portion 31 by interposing an insulator 26 therebetween . the core pieces 30 in this state are arranged in the cylindrical shape and then an outer ring 27 is fitted around the core pieces 30 , thus completing a stator 50 . in fig3 , each core piece 30 is resin molded for the purpose of taking measures against vibration or the like . winding steps of the coil 10 will be explained below . fig4 is an exploded perspective view of the coil . a winding for the coil 10 in fig4 starts to first form a second layer ( layer 2 )- first row ( row 1 ) in fig2 as seen by comparison with fig2 . thus , a winding start portion 10 a is located in layer 2 - row 1 . the numerals given at the center of each cross section of the rectangular conductor 20 in fig2 represent the number of turns . the number of turns is defined by counting , as one turn , one winding of a coil 10 by a winding device 100 mentioned later . in a first turn of the coil 10 , the conductor is wound by one turn to form layer 2 - row 1 which is an outer circumferential side of the coil 10 . in a second turn , the conductor is wound to form layer 1 - row 1 which is an inner circumferential side of the coil 10 . in other words , the winding proceeds inward in the circumferential direction of the split core unit 25 from the first turn to the second turn . at a lead side 10 x of the coil 10 , a first bridging portion 10 c 1 is formed to extend from layer 1 - row 1 to layer 1 - row 2 , then the conductor shifts to a third turn . in a third turn , the conductor is wound to form layer 1 - row 2 which is the inner circumferential side of the coil 10 . at the lead side 10 x , the conductor shifts to layer 2 - row 2 . in a fourth turn , the conductor is wound to form layer 2 - row 2 which is the outer circumferential side of the coil 10 . at the lead side 10 x of the coil 10 , a second bridging portion 10 c 2 is formed to extend from layer 2 - row 2 to layer 2 - row 3 to shift to a fifth turn . in other words , the winding is turned from the second turn and proceeds outward in the circumferential direction of the core unit 25 to form the third turn and the fourth turn . in the fifth turn , the conductor is wound to form layer 2 - row 3 which is the outer circumferential side of the coil 10 . in a sixth turn , the conductor is wound to form layer 1 - row 3 which is the inner circumferential side of the coil 10 . at the lead side 10 x of the coil 10 , a third bridging portion 10 c 3 is formed to extend from layer 1 - row 3 to layer 1 - row 4 and shift to a seventh turn . in other words , the winding is turned from the fourth turn and proceeds inward in the circumferential direction of the core unit 25 to form the fifth turn and the six turn . in a seventh turn , the conductor is wound to form layer 1 - row 4 which is the inner circumferential side of the coil 10 . in an eighth turn , the conductor is wound to form layer 2 - row 4 row which is the outer circumferential side of the coil 10 . fig5 is a cross sectional view of a lead side of a coil , viewed along arrows a in fig1 . by the above winding steps , the rectangular conductor 20 is wound in two layers at an opposite - lead side 10 y of the coil 10 and on both sides thereof . at the lead side 10 x of the coil 10 , the conductor 20 is formed in three layers . this is because it is necessary to form the second bridging portion 10 c 2 and a fourth bridging portion 10 c 4 on an upper side to detour around the conductor 20 wound inside as shown in fig5 , and the first bridging portion 10 c 1 , the third bridging portion 10 c 3 , and a fifth bridging portion 1005 on a lower side to detour the conductor 20 wound outside . as a result , the odd - numbered turns of the coil 10 are formed in the second layer while the even - numbered turns are formed in the first layer or the third layer . a winding device of the coil 10 will be briefly explained below . fig6 is a schematic view of the device . fig7 is a schematic plan view of a winding step 1 . fig8 is a schematic plan view of a winding step 2 . the winding device 100 includes an uncoiler 140 , a feed mechanism 120 , a damper 130 , and a winding mechanism 150 . the feed mechanism 120 is a device to feed the rectangular conductor 20 . this mechanism 120 is configured to grasp the rectangular conductor 20 with a feed damper 121 and then draw the conductor 20 from the uncoiler 140 . the feed damper 121 is controlled to move by a predetermined amount by a ball screw 23 connected to a servo motor 122 . the damper 130 is provided with a retaining damper 131 and a feed roller 132 . the retaining damper 131 and the feed damper 121 alternately clamp the conductor 20 . the winding mechanism 150 is configured to edgewise bend the rectangular conductor 20 to form the coil 10 . an inner circumferential jig 151 is a member for holding a surface of the rectangular conductor 20 which will be the inner circumferential side of the coil 10 on completion . a first rotating jig 152 and a first bending jig 154 are moved by rotation as shown in fig7 and 8 to edgewise bend the conductor 20 . a second rotating jig 153 is also used to edgewise bend the conductor 20 . a first guide 155 and a second guide 156 are jigs for guiding the opposite surface of the conductor 20 to the surface contacting the first rotating jig 152 and the second rotating jig 153 when the conductor 20 is edgewise bent . the guides 155 and 156 are therefore appropriately retractable when the coil 10 is wound . an upper support 157 is a guide member to support an upper surface of the coil 10 and configured to gradually move upward as winding of the coil 10 proceeds . a fixed guide 159 is intended to support the rectangular conductor 20 moving straight . those mechanisms are arranged on a base 158 . with those mechanisms , the rectangular conductor 20 is edgewise bent as shown in fig7 and 8 , thereby forming the coil 10 . the detailed explanation thereof is omitted . the coil 10 in the first embodiment exhibiting the above configuration and operation can provide the advantages described below . as a first advantage , the rectangular conductor 20 with a reduced thickness can be used . the stator 50 in the first embodiment includes the stator core pieces 30 each formed with the teeth portions 31 and the slots 32 , and the coils 10 each inserted in the slots 32 while the conductor in a wound state forms a plurality of layers ( two layers ) in the circumferential direction of the core pieces 30 . in each coil 10 , the conductor is wound from an outer layer to an inner layer in the first row , from the inner layer to the outer layer in the second row , and from the outer layer to the inner layer in the third row . the number of layers of a portion of the coil 10 inserted in a slot 32 is two , while the number of layers in a coil end portion on at least one side is three or more . the coil 10 is configured , as shown in fig1 and 2 , to have two layers in the circumferential direction of the core unit 25 and six rows ( four rows in fig2 by omission ) in the radial direction of the core unit 25 . at the lead side 10 x , three layers are formed . accordingly , the number of the conductor sections is smaller in the circumferential direction of the core unit 25 . the winding of the coil 10 proceeds in the circumferential direction of the core unit 25 . after the winding is performed by two layers , it proceeds in an inverse direction . the winding device 100 stores in advance a program for winding the coil 10 . accordingly , the feed mechanism 120 , the damper 130 , the uncoiler 140 , and the winding mechanism 150 of the winding device 100 are operated according to the program to wind the coil 10 . by winding conducted as above , a potential difference between the adjacent portions of the rectangular conductor 20 only corresponds to three turns ; specifically , between a first turn and a fourth turn , between a third turn and a fifth turn , between a sixth turn and an eighth turn , and so on . as shown in patent documents 1 and 2 , when winding proceeds in a direction in which the number of the conductor sections is larger , if a potential difference between a winding start portion 10 a and a winding end portion 10 b of a coil 10 with twelve turns is 100v , the start portion 10 a and the end portion 10 b of the rectangular conductor 20 are adjacently located . accordingly , the conductor 20 has to be covered with an insulating coating film 21 resistant to a potential difference of 100v . in contrast , according to the method of the first embodiment , in the case of a coil 10 with twelve turns , a potential difference is as small as one - third of the above . thus , the thickness of the insulating coating film 21 can be made thinner by just that much . since the thickness of the insulating coating film 21 can be reduced as above , the film 21 occupies only a space at a small ratio in each slot of the stator 50 , thus enabling improvement of the space factor . further , the thinner thickness of the film 21 can also contribute to cost reduction by just such a decreased film thickness . patent document 4 mentions the coil 200 but fails to disclose the processing of a coil end . thus , the method of patent document 4 could not directly manufacture the coil 200 . this method seems to be uncompleted . in contrast , the present embodiment of the invention discloses a manufacturing method of the coil 10 in detail . specifically , for the processing of the lead side 10 x of the coil 10 , the inner - layer - side bridging portions such as the first bridging portion 10 c 1 and the third bridging portion 10 c 3 and the outer - layer - side bridging portions such as the second bridging portion 10 c 2 are formed to provide a three - layered configuration at the lead side 10 x to enable winding of the coil 10 . further , the coil 10 and the core unit 25 are insulated from each other by the insulator 26 . for insulation between the coil ends at the lead side 10 x and the non - lead side 10 y formed on both end faces of the core unit 25 , a method of using an interphase sheet or other method are conceivable . it is therefore only necessary to simply determine the thickness of the insulating coating film 21 according to the potential difference between adjacently located portions of the rectangular conductor 20 . the winding start position of the coil 10 is set in an outermost position in a circumferential direction of the core unit 25 . this can achieve a reduction in the number of rows . in the coil 10 of the present embodiment , the winding start portion 10 a is on an outer circumferential side of the coil 10 and also the winding end portion 10 b is on the outer circumferential side of the coil 10 . thus , the start portion 10 a and the end portion 10 b do not interfere with the coil 10 . if the winding start portion 10 a or the winding end portion 10 b is located on the first layer side of the coil 10 , for instance , the rectangular conductor 20 to be located at the lead side 10 x has to be wound by detouring the start portion 10 a or the end portion 10 b . in this case , the rectangular conductor 20 has to detour outward or inward of the coil 10 by a distance corresponding to the thickness of the conductor 20 . therefore , the coil 10 is apt to involve redundant thickness . since the coil 10 is a two - layered coil , it can reduce the thickness of the stator 50 . in the case where the rectangular conductor 20 is edgewise bent by the winding device 100 , it is hard to edgewise bend the conductor 20 with a bend or curve having a diameter equal to or smaller than the width of the conductor 20 . accordingly , it is possible to maintain the width of a coil end more equally than in edgewise bending a rectangular conductor 20 having a double width in a single layer configuration . fig9 is a cross sectional view showing a relationship between a coil and a teeth portion . a section of the coil 10 to be inserted in a slot 32 between teeth portions 31 needs to be straight . accordingly , the thickness of a coil end is r + width x in a single - layered coil and r + width x × 3 in a two - layered coil . bending r is equal to the width x and hence the single - layered coil needs a thickness of 2x and the two - layered coil needs a thickness of 4x at each coil end . assuming that the width x is 10 mm , the thickness of the single - layered coil at the coil end is 20 mm and that of the two - layered coil is 20 mm . thus , the thickness of the lead side 10 x is theoretically the same in the single - layered coil and the two - layered coil . at the non - lead side 10 y , the single - layered coil has a thickness of 2x and the two - layered coil has a thickness of 3x . the coil end of the two - layered coil can be thinner than that of the single - layered coil . consequently , from the viewpoint of the entire stator 50 , the two - layered coil 10 can more contribute to a reduction in thickness of the stator 50 . the second embodiment of the invention is slightly different from the first embodiment in the number of turns of a coil 10 and the shape of a bridging portion . the following explanation is focused on such differences . fig1 is a plan view of a coil in the second embodiment . fig1 is a cross sectional side view of the coil taken along a line b - b in fig1 . fig1 is a cross sectional side view of the coil taken along a line c - c in fig1 . the coil 10 in the second embodiment , as with the coil 10 of the first embodiment , is formed by winding a flat rectangular conductor 20 in two layers so that a lead side 10 x which is one of the coil ends provides a three - layered configuration . in this respect , the second embodiment is identical to the first embodiment except that the coil 10 of the second embodiment has two layers and eight rows ( 2 - layer × 8 - row ), i . e ., a total of sixteen turns . accordingly , a winding starts from the winding start portion 10 a to form a first turn t 1 for layer 2 - row 1 , a second turn t 2 for layer 1 - row 1 , a first bridging portion 10 c 1 extending from layer 1 - row 1 to layer 1 - row 2 , and shifts to a third turn t 3 for layer 1 - row 2 . then , the winding makes a fourth turn t 4 for layer 2 - row 2 and a second bridging portion 10 c 2 extending from layer 3 - row 2 to layer 3 - row 3 , and shifts to a fifth turn t 5 for layer 2 - row 3 . a sixth turn t 6 following the fifth turn t 5 is formed for layer 1 - row 3 . a third bridging portion 10 c 3 is formed to extend from layer 1 - row 3 to layer 1 - row 4 , thereby forming a seventh turn t 7 for layer 1 - row 4 . an eighth turn t 8 is formed for layer 2 - row 4 , a fourth bridging portion 10 c 4 is formed to extend from layer 3 - row 4 to layer 3 - row 5 , thereby forming a ninth turn t 9 for layer 2 - row 5 . a tenth turn t 10 following the ninth turn t 9 is formed for layer 1 - row 5 , a fifth bridging portion 10 c 5 is formed to extend from layer 1 - row 5 to layer 1 - row 6 . then , an eleventh turn t 11 is formed for layer 1 - row 6 . sequentially , a twelfth turn t 12 is formed for layer 2 - row 6 , a sixth bridging portion 1006 is formed to extend from layer 3 - row 6 to layer 3 - row 7 , and then a thirteenth turn t 13 is formed for layer 2 - row 7 . a fourteenth turn t 14 following the thirteenth turn t 13 is formed for layer 1 - row 7 , a seventh bridging portion 1007 is formed to extend from layer 1 - row 7 to layer 1 - row 8 , and then a fifteenth turn t 15 is formed for layer 1 - row 8 . a sixteenth turn t 16 is formed for layer 2 - row 8 , extending to the winding end portion 10 b . fig1 is a side view of the coil , viewed along arrows d in fig1 . the second bridging portion 10 c 2 , the fourth bridging portion 10 c 4 , and the sixth bridging portion 1006 are formed on an outer side of the lead side 10 x as shown in fig1 , that is , in the third layer , while the first bridging portion 10 c 1 , the third bridging portion 10 c 3 , the fifth bridging portion 10 c 5 , and the seventh bridging portion 10 c 7 are similarly formed on an inner side of the lead side 10 x of the coil not shown , that is , in the first layer . at the non - lead side 10 y of the coil 10 , on the other hand , only two layers are formed as mentioned above as with other two sides as shown in fig1 and no bridging portion is formed . the first bridging portion 10 c 1 to the seventh bridging portion 10 c 7 each include three regions ; a first end section 10 d 1 , a second end section 10 d 2 , and a lane change section 10 d 3 joining the first end section 10 d 1 and the second end section 10 d 2 . fig1 is a schematic view showing a manner of forming a lane change section . the lane change section 10 d 3 is formed by use of an upper die 181 and a lower die 182 provided in a base 158 of the winding device 100 shown in fig6 . the upper die 181 is formed with a first die surface 181 a to form the lane change section 10 d 3 while the lower die 182 is formed with a second die surface 182 a . the edgewise - bent rectangular conductor 20 is pressed by the upper die 181 and the lower die 182 sandwiching therebetween the conductor 20 , thereby forming the lane change section 10 d 3 between the first end section 10 d 1 and the second end section 10 d 2 . this lane change section 10 d 3 is formed on a short side of the coil 10 wound in a rectangular form . the upper die 181 and the lower die 182 are connected to a thrust power generator not shown which has a pressure function by moving from above and below in fig1 to hold the rectangular conductor 20 therebetween . the upper die 181 and the lower die 182 are configured to be retract to regions where the dies are not interfere with the conductor 20 in winding the conductor 20 to form a coil 10 . the first end section 10 d 1 and the second end section 10 d 2 can exhibit their functions as long as they have a width of about several millimeters . accordingly , depending on the necessary width to form the lane change section 10 d 3 , the width of the first end section 10 d 1 and the second end section 10 d 2 is determined . the first end section 10 d 1 and the second end section 10 d 2 are formed with a shape conforming to a portion of the rectangular conductor 20 forming an adjacent layer . specifically , as shown in fig1 , the first end section 10 d 1 of the first bridging portion 10 c 1 has a shape conforming to the connection side between the first turn t 1 in the second layer and the second turn t 2 , which are adjacent to each other in a short side ssc of the lead side 10 x . the second end section 10 d 2 of the first bridging portion 10 c 1 has a shape conforming to the connection side between the third turn t 3 in the second layer and the fourth turn t 4 , which are adjacent to each other in the short side ssc of the lead side 10 x . the coil 10 made by winding the rectangular conductor 20 in the configuration as shown in the second embodiment provides the following operations and advantages . as a first advantage , the wound coil can have a reduced thickness , resulting in an increased space factor of the stator 50 . fig1 is a perspective view of a coil produced by a coil winding method that forms no lane change section . fig1 is a schematic cross sectional view of the coil produced by the coil winding method that forms no lane change section . in the stator 50 in the second embodiment , at least one of the first bridging portion 10 c 1 and the second bridging portion 10 c 2 includes the first end section 10 d 1 , the second end section 10 d 2 , and the lane change section 10 d 3 between the first end section 10 d 1 and the second end section 10 d 2 . these first and second end portions 10 d 1 and 10 d 2 are formed along the adjacent layer , that is , the second layer of the rectangular conductor 20 . the conductor 20 is lane - changed to an adjacent row ( e . g ., from the first row to the second row for the first bridging portion 10 c 1 ) in the lane change section 10 d 3 . with the lane change section 10 d 3 in each of the first bridging portion 10 c 1 to the seventh bridging portion 10 c 7 , the thickness of the coil 10 can be minimized . if the rectangular conductor 20 is wound to form a coil 10 without providing the lane change section 10 d 3 , this coil 10 will be widened by a bulging x 2 as shown in fig1 depending on the shape of the bridging portions . the thickness of the lead side 10 x provided with the bridge is a thickness x 3 , while the thickness of the non - lead side 10 y is a thickness x 1 . thus , the thickness of the lead side 10 x is thicker by a difference from that of the non - lead side 10 y . if the coil bulges in this way , it becomes a factor of deteriorating the space factor when the coil is inserted in the core unit 25 . the conceivable reason thereof results from interference between the portions of the rectangular conductor 20 caused by the processing of the bridging portions . each of the first bridging portion 10 c 1 to the seventh bridging portion 10 c 7 is formed in the short side ssc of the coil 10 . however , the bridging portions may come into such a state as shown in fig1 depending on the material of the rectangular conductor 20 and the length of the short side ssc . an upper interference region z 1 and a lower interference region z 2 come about in a long side lsc , causing a bulging portion at the lead side 10 x . to be concrete , if the first bridging portion 10 c 1 is formed in the short side ssc as shown in fig1 , a portion of the rectangular conductor 20 in the long side lsc is also twisted . this may generate the upper interference region z 1 and the lower interference region z 2 in the long side lsc . these upper and lower interference regions z 1 and z 2 are regions that may cause interference with adjacently located portions of the rectangular conductor 20 and may be formed mainly in the long side lsc close to the lead side 10 x . these upper and lower interference regions z 1 and z 2 have only a little influence on the adjacently located portions of the conductor 20 , but the influence becomes remarkably larger as the number of turns increases . further , the upper and lower interference regions z 1 and z 2 cause problems only in a multilayered wound coil 10 . specifically , as shown in fig1 , the side a of the first turn t 1 is formed horizontal from the winding start portion 10 a and also the side c is formed horizontal . the side a of the second turn t 2 is also formed horizontal . however , the side c of the second turn t 2 continues to the first bridging portion 10 c 1 connecting to the side a of the third turn t 3 formed in an adjacent row . thus , the side c of the second turn t 2 and the side a of the third turn t 3 are twisted . the side c of the third turn t 3 is formed horizontal and the side a of the fourth turn t 4 a is also formed horizontal . the side c of the fourth turn t 4 and the side a of the fifth turn t 5 are twisted because they are continuous to the second bridging portion 10 c 2 . as a result , the horizontally formed sides and the twisted sides are both contained in the long side lsc . thus , the upper interference region z 1 and the lower interference region z 2 cause problems , resulting in an increased thickness of the lead side 10 x at which twisting influence is present . such a problem is less likely to occur in a single - layered coil including a wire is wound in a uniform shape in all rows . this problem is considered as being specific to a multilayered coil . however , the coil 10 formed with the lane change section 10 d 3 as in the second embodiment can solve such problems . the reason thereof is as follows . with the first end section 10 d 1 and the second end section 10 d 2 formed on both sides of the lane change section 10 d 3 , the lane change can be completed in concentric manner in the lane change section 10 d 3 . this results in no influence of the lane change on the long side lsc . in other words , the first end section 10 d 1 and the second end section 10 d 2 are formed in a shape conforming to the adjacent layers , so that the influence of the lane change section 10 d 3 on the long side lsc can be suppressed . thus , the coil 10 can be wound with a reduced thickness . a conceivable method is achieved by twisting the long side or twisting the connection portion between the long side lsc and the short side ssc to make the long side lsc longer than the width of the core unit 25 , thereby minimizing the influence of twisting in the slot of the core unit 25 , that is , the influence of the upper interference region z 1 and the lower interference region z 2 . however , this configuration results in a longer coil end , which will disturb reduction in size . this configuration also needs a longer rectangular conductor to be used for a coil 10 , which will disturb reduction in cost . specifically , the first end section 10 d 1 and the second end section 10 d 2 in the bridging portion even though they are short can also contribute to reduction in size and cost . the present invention is explained along the above embodiments but is not limited thereto . the present invention may be embodied in other specific forms without departing from the essential characteristics thereof . for instance , the material of the coil 10 and the material of the insulating coating and others may be any changed from the exemplified materials . furthermore , the winding using the winding device 100 is just an example . another type of winding device may be used to form a coil 10 . the number of turns of the coil 10 may be increased or decreased . in particular , the coil ends on the lead side and the non - lead side are preferably small but do not give any limit to an increase in the number of layers . the winding method shown in the above embodiments should be selected appropriately according to the width of a slot 32 and the necessary number of turns of a coil 10 . | 8 |
referring now to the drawings wherein reference characters designate like or corresponding parts throughout the several views , there shown in fig1 a grounded brake housing 10 having a contact surface 12 and containing a set of friction or separator plates 14 being alternatively spaced with rotating brake discs 16 . each of the friction plates 14 has at least one side 18 engaging the corresponding side 20 of the discs 16 in a friction producing manner when a hydraulically actuated piston 22 , movable within a piston housing 24 , compresses discs 16 against friction plates 14 . the piston housing 24 is rendered leak proof by virtue of o - ring seal 26 . the disc brakes 16 are driven by spline extension of the output shaft which is not shown in fig1 but is well known in the art . the compression of brake discs 16 against the friction plates 14 brakes the rotational motion of said discs 16 . one of the friction plates 14 has a tab portion 26 including an aperture 28 , as best shown in fig2 . the aperture 28 has a round configuration with two flattened and diametrically opposed sides 30 . a contact probe 32 comprises a tip 34 at one end of a stem 36 . the stem 36 has a threaded portion 38 and a recess or slot 40 at its other end or butt 42 . a bushing 44 has a t - shape configuration with a locking cylinder portion 46 extending from a coaxial cylinder collar portion 48 of a significantly larger diameter than the locking cylinder 46 . the cylinder 46 has a bevel edge 50 , outer wall 52 and front surface 54 . the outer wall 52 is truncated by two parallel planes forming two flattened surfaces or sides 56 matching the aperture flattened sides 30 . the bushing 44 includes a threaded bore 58 engageable with the probe threaded portion 38 . the bushing 44 is made out of heat resistant material such as black phenolic or any other suitable material . the collar 48 has a contact surface 60 contiguously abutting an inner side or surface 62 of the tab 26 , which also has outer surface or side 63 , when the bushing 44 is inserted in the aperture 28 . a cylinder - shaped spacer 64 comprises a central bore 66 having a diameter larger than that of the cylinder 46 passing therethrough . the spacer 64 , which is made from a heat resistant material , such as black phenolic or other suitable material , is mounted on the cylinder 46 in a sandwich - like relation between the tab outer surface 63 and a washer 68 . a locking nut 70 is threadably engaged with the probe threaded portion 38 . an electrical connector terminal 72 has a clevis portion 74 slidably attachable to the probe 32 and soldered to a wire 76 connecting it with the warning signal , such as lights or sounds . a nut 78 connects the terminal 72 to the locking nut 70 . in operation , a bushing 44 threadably engaged with a probe is placed into a tab aperture 28 with a probe tip 34 facing the housing contact surface 12 . a locking cylinder 46 is projected through the aperture 28 . the bushing collar 48 is firmly pressed against the inner surface 62 of the tab 26 so that the locking cylinder flattened sides 56 being in registry with the matching aperture sides 30 prevent the bushing 44 from rotation within the aperture 28 . a spacer 64 , which is slidably mounted on the cylinder 46 , abuts the tab outer surface 63 . both the bushing 44 and spacer 64 electrically insulate the probe 32 from the tab 26 . washer 68 slidably mounted on the probe is positioned between the spacer 64 and a locking nut 70 . an electrical connector terminal 74 hooked on a probe threaded portion 38 is attached to the locking nut 70 by a nut 78 . a recess 40 in the stem butt 42 is adapted to receive an associate instrument , such as a screwdriver or other suitable mechanical means , to turn the probe within the aperture , thereby adjusting the distance between the probe tip 34 and a contact surface 12 of the brake housing 10 . when the friction plates 14 are worn to a predetermined limit , the probe tip 34 will contact the brake housing surface 12 thereby completing the electric circuit and thus lighting a warning signal light at an operator &# 39 ; s station . the probe mount assembly lends itself to a facile fabrication , installation and convenient adjustment of an axial displacement position of the contact probe being supported by and electrically insulated from the friction plate tab . the foregoing description and drawings expressed and illustrated in the invention and the invention is not limited thereto except insofar as the appended claims are so limited , as those skilled in the art who have the disclosure before them will be able to make modifications and variations therein without departing from the scope of the invention . | 5 |
fig5 shows entities of a wireless network involved in service authorization according to an embodiment of the invention . it should be noted that the term used herein may well correspond to a particular protocol and the skilled reader will appreciate that the concepts of the invention are equally applicable to other and even future protocols . for example , the user device terminal or equipment is referred to generally herein as ue in accordance with 3g standards . nevertheless , it is apparent that such terminology is not limiting but rather that the function of each network entity described is of the essence and not its nomenclature . in fig5 , a ue shown as a pda ( which could equally be a mobile telephone , laptop or any other wireless device ) connects wirelessly to a public dns which is used by the ue in this case to retrieve the ip address of the authorization server . the ue also links wirelessly to a aaa server which is connected within the core network to a user database referred to herein as the hlr . the ue also connects wirelessly to an authorization server which is linked within the home network to the aaa server and an internal dns used to retrieve the ip address of the pdg through which a specific service is accessed . finally , the ue connects wirelessly to a pdg for tunnel set - up . the pdgs are linked to the authorization server for the reasons described in the following . fig5 is a clear graphical indication of the separation of service authorization and tunnel set - up . it indicates the communication path in the form of a tunnel directly between the ue and the service and also illustrates that the service authorization is carried out with a different entity of the network than the tunnel set - up . fig6 gives a detailed sequential explanation of authorization according to one embodiment of the invention . the steps are further explained below : 1 . the terminal or ue obtains the fqdn of the home authorization service in a network selection phase . this step is optional because the fqdn could be pre - configured by the home operator in the terminal . it is unlikely to change often . 2 . authentication takes place between the terminal and the aaa server , and a security key is also generated for authentication of the user . 3 . the terminal resolves the ip address of the authorization server from the dns server in the wlan . this step is also optional if the ip address of the authorization server is pre - configured in the terminal . there will not be many authorization servers in operator &# 39 ; s network and their ip addresses will not change often . 4 . based on the key generated during authentication , the terminal establishes a tls ( transport layer security ) connection with the authorization server . how the tls is established is outside the scope of the invention , but available from the tls specification . 5 . the user chooses the service requested and the terminal sends an https get containing the user id and requested apn to the authorization server . 6 . the authorization server retrieves user subscription data from the aaa server which has an interface with hlr . the aaa server authorises all the services which the user is allowed to access and returns all the corresponding apns to the authorization server . 7 . the authorization server resolves the ip addresses of the pdgs based on returned apns from an internal dns server . 8 . the authorization server then installs the tunnel parameters to a pdg . such parameters include , for example , user id , tunnel id , and quality of service ( qos ) parameters . 9 . the authorization server installs tunnel parameters to any further pdgs . 10 . the authorization server returns an https put containing the ip addresses of the pdgs and corresponding tunnelling parameters . 11 . the browser application in the terminal can display a webpage - like interface to the user indicating all the services that the user can access . 12 . the user then can choose the service he / she wants to access by clicking the link to the service which appears in the browser application . this action triggers the tunnelling establishment to the corresponding pdg . 13 . the user can choose further services without any extra tunnelling set up because all possible tunnels to available services have already been prepared . fig7 shows a roaming scenario . the individual steps in the service authorization are explained below : 21 . the terminal obtains the fqdn of the visited or v - authorization server in a network selection phase . this step is mandatory because more information is required in the roaming scenario than in the home network . 22 . authentication takes place between the terminal and aaa server , and a security key is also generated . 23 . the terminal resolves the ip address of the v - authorization server from the visited dns server in the wlan . there will not be many authorization server in any operator &# 39 ; s network and their ip addresses will not change often . so allowing the v - authorization servers ip address to be resolved in a public dns server does not have much negative impact on the operator &# 39 ; s network . 24 . based on the key generated during authentication , the terminal establishes a tls connection with the v - authorization server . 25 . the user chooses the service and the terminal sends a https get containing the user id and requested apn to the v - authorization server . 26 . the v - authorization server proxies the request to the home or h - authorization server . 27 . the h - authorization server retrieves user subscription data from the home aaa server . the aaa server authorises all the services which the user is allowed to access including visited or v - apns and have h - apns in the home network and returns all the corresponding apns to the h - authorization server . 28 . the h - authorization server resolves the ip addresses of the home pdgs or hpdgs based on h - apns from an internal dns server . 29 . the h - authorization server then installs the tunnel parameters to the hpdgs such as user id , tunnel id , qos parameters . 30 . the h - authorization server returns v - apns and ip addresses of hpdgs to the v - authorization server . 31 . the v - authorization server resolves the ip addresses of the visited pdgs or vpdgs based on v - apns from an internal dns server . 32 . the v - authorization server then installs the tunnel parameters to the vpdgs e . g . user id , tunnel id , qos parameters . 33 . the v - authorization server returns an https put containing the ip addresses of the hpdgs and vpdgs and corresponding tunnelling parameters . 34 . the browser application in the terminal can display a webpage like interface to the user indicating all the services the user can access and the user can choose a service by clicking a link . 35 . no further tunnelling set - up is needed because all available tunnels have been prepared . in this example the user chooses the service requested and receives all possible services . in another example , the user request could return authorization for that service only . potentially , there may be no specific service request or a request for all available services . the skilled reader would appreciate that all three possibilities may be provided on the same ue as alternatives . fig8 shows an embodiment of the invention in which the aaa server acts as both the authorization and the authentication server . this server embodiment is shown without involvement of a public dns server . 41 . the ue is authenticated with the aaa server using eap - aka and a shared security key is generated . after successful authentication , a url identifying a location in the aaa server used for authentication can be returned to the user ( or alternatively the url is pre - configured in the terminal ). the url is used by the terminal to retrieve the pdg addresses from the 3g network 42 . based on the security key , the ue establishes a tls secure connection with the aaa server . the terminal uses https to access the url and the source of the url will be located in an entity in a 3g network which is responsible for authorization ( aaa server in the example ). 43 . the ues browser application sends a http request to the aaa server for service authorization . no apn is required . 44 . the aaa server retrieves all ue subscribed apns from the user profile in an internal dns . 45 . the aaa server resolves the ip addresses of each apn using an internal dns server . 46 . the aaa server returns a list of ip addresses corresponding to each apn the user is subscribed to . the https response to the terminal contains the ip addresses of the pdgs against each user subscribed apn as a format of web page link . ( the ip address is hidden , but the service name is presented to the end user ). 47 . the ue browser application displays service names corresponding to the ip addresses . 48 . the ue selects the service to be accessed by clicking the link under the service name . this click triggers a tunnel set - up towards the ip address of that pdg . the terminal can cache this returned https response for future access to services , so it saves network sources . when the operator has a new service available to the user or for some reason the operator changes its dns setting ( which results in the change of ip addresses against apns ), the operator can indicate in the successful authentication message that the terminal shall restart the https authorization . it will be understood that the present invention has been described above purely by way of example , and modifications of details can be made within the scope of the invention . the various embodiments which have been described above may be implemented using software communications modules running on one or more processors provided of part of any of the entitles on the network ( for example , to act as the means defined in the claims ), for example a digital signal processor , or any other type of processor . the programming of such modules will be apparent to the skilled person from the description of the various functions . the skilled person will appreciate that such modules may be programmed on any appropriate processor using any appropriate programming language . alternatively , some or all of the functions described above may be implemented using dedicated hardware or firmware . | 7 |
an embodiment of the present invention will now be described with reference to fig3 to 6 . fig3 is a longitudinal sectional view showing the stationary state of a rotary shaft . fig4 is a sectional view taken along the line iv -- iv in fig3 . ( fig3 corresponds to the view taken along line iii -- iii of fig4 ). fig5 is a sectional line taken along the line v -- v of fig4 and fig6 is an enlarged view of portion c of fig3 . referring now to fig3 to 6 , reference numeral 7 designates a weir formed in the bearing housing 3 for isolating the roller bearing 2 and the oil tank 4 . the upper end of the weir 7 is formed slightly higher than the level of the oil gauge 5 . an oil reservoir 8 formed by the weir 7 has a volume capable of reserving an amount of lubricating oil which is small when compared with the volume of the tank 4 . an oil supply passage 9 passes through the lower part of the weir 7 and provides communication between the oil tank 4 and the reservoir 8 . at the bottom end of the oil supply passageway 9 is an inlet which opens onto the oil tank 4 . a liner 10 is detachably threaded into the inlet of the bottom of the passage 9 and has a predetermined diameter 11 . an oil exhaust runner 12 is secured to the shaft 1 . an oil exhaust passage 13 , one end of which opens upon the runner 12 and the other end of which opens above the surface of the oil in the tank 4 , is formed on each side of the bearings 2 . as shown in fig3 and 4 , the tank 4 is filled with lubricating oil 6 so as not to overflow the weir 7 when the shaft 1 is stationary . since the tank 4 and the reservoir 8 are partitioned by the weir 7 , the bearing 2 is not immersed directly in the lubricating oil in the tank 4 and only a small portion of the outer race 2a and a plurality of rollers 2c are dipped in a small amount of lubricating oil of the reservoir 8 when the shaft 1 is stationary as described above . when the shaft 1 is rotated , the lubricating oil which lubricates the bearing 2 is radially splashed due to the rotation of the runner 12 as shown in fig5 and exhausted through the passage 13 into the tank 4 from the opening 13a . the lubricating oil of the reservoir 8 is scattered due to the rotation of the bearing 2 as shown in fig7 splashes over the upper end of the weir 7 , and returns to the tank 4 . as a result , there occurs a difference between the oil levels of the tank 4 and the reservoir 8 , and the lubricating oil in the tank 4 is automatically supplied through the liner 10 and the passage 9 into the reservoir 8 , as designated by the arrow d , due to the differential pressure thus produced , and the bearing 2 is lubricated to maintain sufficient oil level in reservoir 8 to cover only the lowermost part of the lowermost roller as illustrated in fig7 . fig9 is a diagram showing the relationship between the oil amount supplied to the bearing and the bearing temperature , wherein the diameter 11 of the liner 10 is the abscissa and the bearing temperature and oil amount are the ordinate . if the diameter 11 of the liner 10 is varied from e 1 to e 2 when a roller bearing of a predetermined size is rotated at a predetermined rate , if the diameter 11 of the liner 10 is small , the oil supply amount q 2 is less than the minimum amount q 1 necessary to cool the bearing as designated by the range f , with the result that the bearing temperature t rises . on the contrary , if the diameter 11 of the liner 10 is excessively large , the oil supply amount q 2 becomes excessive as designated by the range h , with the result that the bearing temperature t becomes high due to the stirring of excess oil . in the range j of a conventional oil bath lubricating structure , the bearing temperature t abruptly rises due to the excess lubricating oil . when the diameter 11 of the liner 10 is within the range designated by g , the oil supply amount q 2 is appropriate , with the result that the bearing temperature t decreases . from experiments using a bearing of a predetermined size , it is known that when the diameter 11 of the liner 10 is from 3 to 6 mm , the roller bearing lubricating device can be applied in a high speed range in which the d m n value of the roller bearing is 500 , 000 to 800 , 000 . since oil stirring is almost eliminated in the above - described lubricating device , oil splashing can be reduced , thereby preventing oil leakage . further , since the oil reservoir and the oil tank are partitioned by the weir , surface waves in the oil and variations in the oil level can be substantially eliminated with the result that a normal oil level indication can be obtained with an oil gauge . in the embodiment described above , a liner 10 is provided in the inlet at the bottom of the oil supply passage 9 . however , the liner 10 may be dispensed with ( eliminated ), as shown in fig8 in which case the predetermined diameter 11 becomes the diameter of the inlet of the bottom of the passageway 9 . thus , it will be appreciated that according to the present invention since the oil reservoir and the oil tank in which the roller bearing is partly dipped are isolated by the weir and communication between the tank and the reservoir is through an oil supply passage , a part of which has a predetermined cross - sectional area , a predetermined amount of lubricating oil is supplied from the tank to the reservoir . since excess oil is not supplied to the bearing , the temperature rise in the bearing can be decreased . | 5 |
fig1 is a block diagram of key portions of a numerical controller 10 according to the present invention . a cpu 11 reads a system program stored in a rom 12 via a bus 20 and controls the numerical controller 10 as a whole in accordance with the read system program . a ram 13 stores temporary calculation data and display data and further stores a variety of data inputted by an operator via a display / mdi unit 70 . a cmos 14 is configured as a nonvolatile memory that is backed up with a battery that is not shown so that a stored state is held even when the numerical controller 10 is powered off . the cmos 14 stores a machining program read via an interface 15 , a machining program inputted via the display / mdi unit 70 , and other types of information . the rom 12 further stores a variety of pre - written system programs for carrying out a process of an edit mode necessary for creation and editing of a machining program and a process for automatic operation . the variety of machining programs , such as a machining program for implementing the present invention , can be inputted via the interface 15 and the display / mdi unit 70 and stored in the cmos memory 14 . the interface 15 allows connection between the numerical controller 10 and an external apparatus 72 , such as an adapter . a machining program , a variety of parameters , and other types of information are read from the external apparatus 72 . a machining program edited in the numerical controller 10 can be stored in an external storage section via the external apparatus 72 . a programmable machine controller ( pmc ) 16 outputs a signal via an i / o unit 17 to an auxiliary device ( an actuator , such as a robot hand for tool exchange , for example ) in a machine tool based on a sequence program built in the numerical controller 10 to control the auxiliary device . the pmc 16 also receives signals from a variety of switches on an operation board disposed in a main body of the machine tool , performs necessary processing on the signals , and delivers the processed signals to the processor 11 . the display / mdi unit 70 is a manual data input device including a display , a keyboard , and other components , and an interface 18 receives a command and data from the keyboard in the display / mdi unit 70 and delivers them to the cpu 11 . an interface 19 is connected to an operation board 71 including a manual pulse generator and other components . axis control circuits 30 and 31 associated with respective axes receive commanded movement amounts of the respective axes and output commands associated with the respective axes to servo amplifiers 40 and 41 . the servo amplifiers 40 and 41 receive the commands and drive a drive - axis motor 50 and a driven - axis motor 51 . each of the axes is provided with a servo motor having a built - in position / velocity detector , and a position / velocity feedback signal from the position / velocity detector is fed back to the corresponding one of the axis control circuits 30 and 31 for feedback control . in the block diagram of fig1 , the configuration of the position / velocity feedback is omitted . fig2 is a functional block diagram showing the function of the numerical controller in fig1 . the numerical controller 10 is primarily formed of a numerical control unit 100 and a servo control unit 200 . the numerical control unit 100 includes a position command section 110 , a commanded movement - amount adjustment section 120 , and a commanded movement - amount adjustment deviation accumulation section 130 , and the servo control unit 200 includes a positional deviation counter 210 . the position command section 110 calculates a commanded movement amount the drive - axis motor 50 should operate based on a movement command commanded by a machining program or an operator and a residual movement amount acquired from the commanded movement - amount adjustment deviation accumulation section 130 and outputs the calculated commanded movement amount . the present invention is characterized in that the numerical control unit 100 of the numerical controller 10 includes the commanded movement - amount adjustment section 120 . the commanded movement - amount adjustment section 120 carries out a commanded movement amount adjustment process , which will be described later , to calculate an adjusted command movement amount in a movement - command output cycle based on the commanded movement amount outputted from the position command section 110 , positional deviation acquired from the positional deviation counter 210 in the servo control unit 200 , and a velocity feedback value fed back from the drive - axis motor 50 and outputs the calculated adjusted command movement amount to the positional deviation counter 210 and the commanded movement - amount adjustment deviation accumulation section 130 . the commanded movement - amount adjustment deviation accumulation section 130 accumulates the adjusted command movement amount acquired from the commanded movement - amount adjustment section 120 on the residual movement amount and outputs the accumulated value to the position command section 110 . the positional deviation counter 210 subtracts a position feedback value from the position / velocity detector ( not shown ) that is provided in the drive - axis motor 50 from the adjusted command movement amount from the commanded movement - amount adjustment section 120 to determine positional deviation . the servo control unit 200 controls the velocity of the drive - axis motor 50 based on the positional deviation determined by the positional deviation counter 210 . the process of controlling the drive - axis motor 50 based on the positional deviation in the servo control unit 200 will not be further described because the process is a known process that have been carried out in a numerical controller that controls a machine or any other apparatus . an outline of a first example of a commanded movement amount adjustment process carried out by the commanded movement - amount adjustment section 120 in fig2 will be described with reference to fig3 and 4 . fig3 describes an outline of changes in velocity of the drive - axis motor 50 in fig2 . in the numerical controller 10 , in a situation in which the drive - axis motor 50 is driven at a velocity greater than a limit velocity vlim thereof , the movement amount commanded to the drive - axis motor 50 in a distributed cycle , as shown in fig7 ( distributed cycle [ a ] in fig7 ) cancels positional deviation (& lt ; 1 & gt ;+& lt ; 2 & gt ;+& lt ; 3 & gt ;) accumulated in the positional deviation counter 210 , which is greater than or equal to a commanded velocity vcmd , and the difference ( vcmd − v 0 ) between the commanded velocity vcmd and the actual velocity v 0 lowered by an external load , and an adjusted command movement amount pout is so calculated that the actual velocity of the drive - axis motor 50 is clamped at the limit velocity vlim as shown in fig3 and output to the servo control unit 200 . the cancelled positional deviation (& lt ; 1 & gt ;+& lt ; 2 & gt ;+& lt ; 3 & gt ;) and the velocity difference ( vcmd − v 0 ) are output to the commanded movement - amount adjustment deviation accumulation section 130 and accumulated as the residual movement amount . fig4 is a flowchart showing the first example of the commanded movement amount adjustment process carried out by the commanded movement - amount adjustment section 120 . the processing is now explained according to respective steps with reference to the flowchart of fig4 . [ step s 401 ] a commanded movement amount pcmd issued to the servo control unit 200 is acquired . [ step s 402 ] a positional deviation err is acquired from the positional deviation counter 210 . [ step s 403 ] the actual velocity v 0 fed back from the drive - axis motor 50 is acquired . [ step s 404 ] the commanded movement amount pcmd acquired in step s 401 is converted into the movement amount in each distributed cycle ( t ) to determine the commanded velocity vcmd , and the positional deviation err read in step s 402 is converted into the movement amount in each distributed cycle ( t ) to determine a velocity verr based on the positional deviation , and the determined velocity vcmd is added to the velocity verr to obtain a velocity v . [ step s 405 ] it is determined whether the velocity v is greater than the limit velocity vlim or not . when the velocity v is greater than the limit velocity vlim ( yes ), the process proceeds to step s 406 , whereas when the velocity v is smaller than or equal to the limit velocity vlim ( no ), the process proceeds to step s 409 . [ step s 406 ] an adjusted movement amount vadj (=−( v − v 0 )) used to cancel the velocity v is calculated from the difference between the velocity v and the actual velocity v 0 ( v − v 0 ) as represented by the following expression ( 1 ), and then the difference ( vlim − v 0 ) between the limit velocity vlim and the actual velocity v 0 is added to the adjusted movement amount vadj (=−( v − v 0 )) used to cancel the velocity v described above as represented by the following expression . ( 2 ) to calculate the adjusted command movement amount pout . [ step s 407 ] the adjusted travel vadj (=−( v − v 0 )), which has been calculated in step s 406 and is used to cancel the velocity v is output to the commanded movement - amount adjustment deviation accumulation section 130 . [ step s 408 ] the adjusted command movement amount pout (=−( v − vlim )), which has been calculated in step s 406 , is output to the servo control unit 200 , and the commanded movement amount adjustment process in this distributed cycle is terminated . [ step s 409 ] the commanded movement amount pcmd is set to be the adjusted commend movement amount pout , and proceed to step s 408 . as described above , when the velocity abruptly changes , the commanded movement - amount adjustment section 120 adjusts the commanded movement amount to be issued to the servo control unit 200 to suppress the abrupt change in the velocity , and the commanded movement - amount adjustment deviation accumulation section . 130 feeds the thus suppressed movement amount back to the residual movement amount used by the position command section 110 , whereby the drive axis can be controlled based on a command with the abrupt change in the velocity of the drive axis suppressed . a summary of a second example of the commanded movement amount adjustment process carried out by the commanded movement - amount adjustment section 120 in fig2 will next be described with reference to fig5 and 6 . in the second example of the commanded movement amount adjustment process , specified acceleration acmd is further set in the commanded movement amount adjustment process carried out by the commanded movement - amount adjustment section 120 to adjust the adjusted command movement amount pout so that change in the velocity of the drive - axis motor 50 undergoes transitions at a velocity determined from the commanded acceleration . fig5 describes an outline of changes in the velocity of the drive - axis motor 50 in fig2 . in the numerical controller 10 , in a situation in which the drive - axis motor 50 is driven at a velocity greater than a limit velocity vlim thereof , the movement amount commanded to the drive - axis motor 50 in a distributed cycle , as shown in fig7 ( distributed cycle [ a ] in fig7 ) cancels positional deviation (& lt ; 1 & gt ;+& lt ; 2 & gt ;+& lt ; 3 & gt ;) accumulated in the positional deviation counter 210 , which is greater than or equal to a commanded velocity vcmd , and the difference ( vcmd − v 0 ) between the commanded velocity vcmd and the actual velocity v 0 lowered by an external load , and an adjusted command movement amount pout is so calculated that the actual velocity of the drive - axis motor 50 undergoes gentle a transition as shown in fig5 and output to the servo control unit 200 . the cancelled positional deviation (& lt ; 1 & gt ;+& lt ; 2 & gt ;+& lt ; 3 & gt ;) and the velocity difference ( vcmd − v 0 ) are output to the commanded movement - amount adjustment deviation accumulation section 130 and accumulated as the residual movement amount . thereafter , until the velocity reaches the limit velocity vlim , an adjusted command movement amount pout determined from the actual velocity v 0 and the specified acceleration acmd are calculated in each distributed cycle and issued to the servo control unit 200 . after the velocity reaches the limit velocity vlim , the velocity of the drive - axis motor 50 is so controlled that it is clamped at the limit velocity vlim . the specified acceleration acmd may be set at a value within a set region provided in advance , for example , in the cmos 14 in consideration of the performance of each of the drive - axis motors or may be issued by a program , such as an nc program , or an input signal to the numerical controller 10 . fig6 is a flowchart showing the second example of the commanded movement amount adjustment process carried out by the commanded movement - amount adjustment section 120 . the processing is now explained according to respective steps with reference to the flowchart of fig6 . [ step s 601 ] the commanded movement amount pcmd issued to the servo control unit 200 is acquired . [ step s 602 ] the positional deviation err is acquired from the positional deviation counter 210 . [ step s 603 ] the actual velocity v 0 fed back from the drive - axis motor 50 is acquired . [ step 604 ] the commanded movement amount pcmd acquired in step s 601 is converted into the movement amount in each distributed cycle ( t ) to determine the commanded velocity vcmd , the positional deviation err read in step s 602 is converted into the movement amount in each distributed cycle ( t ) to determine the velocity verr based on the positional deviation , and the determined velocity vcmd is added to the velocity verr to calculate the velocity v . [ step s 605 ] it is determined whether the velocity v is greater than the limit velocity vlim or not . when the velocity v is greater than the limit velocity vlim ( yes ), the process proceeds to step s 606 , whereas when the velocity v is smaller than or equal to the limit velocity vlim ( no ), the process proceeds to step s 609 . [ step s 606 ] it is determined whether or not the adjusted command movement amount pout , obtained by adding the movement amount ( acmd × t ) determined from the specified acceleration acmd to the adjusted movement amount vadj (=−( v − v 0 )) used to cancel the velocity v is smaller than or equal to vlim . when the pout is smaller than or equal to vlim , the process proceeds to step s 607 , whereas when pout is greater than vlim , the process proceeds to s 610 . [ step s 607 ] the adjusted movement amount vadj (=−( v − v 0 )) used to cancel the velocity v is calculated based on the difference ( v − v 0 ) between the velocity v and the actual velocity v 0 , as represented by the above expression ( 1 ), and then the movement amount ( acmd × t ) determined from the commanded acceleration is added to the adjusted travel vadj , as represented by the following expression ( 3 ), to calculate the adjusted command movement amount pout . [ step s 608 ] the adjusted travel vadj (=−( v − v 0 )) used to cancel the velocity v is output to the commanded movement - amount adjustment deviation accumulation section 130 . [ step s 609 ] the adjusted command movement amount pout is output to the servo control unit 200 . [ step s 610 ] the difference ( vlim − v 0 ) between the limit velocity vlim and the actual velocity v 0 is added to the adjusted travel vadj (=−( v − v 0 )) used to cancel the velocity v to calculate the adjusted command movement amount pout , as represented by the above expression ( 2 ), that is , the following calculation is carried out to calculate the adjusted command movement amount pout (= vlim − v ), and the process proceeds to step s 608 . [ step s 611 ] the commanded movement amount pcmd is set to be the adjusted command movement amount pout , and the process proceed to step s 609 . as described above , in the second example of the commanded movement amount adjustment process , when the velocity abruptly changes , the commanded movement - amount adjustment section . 120 can adjust the commanded movement amount to be issued to the servo control unit 200 to suppress the abrupt change in the velocity and adjust the adjusted command movement amount pout in such a way that changes in the velocity of the drive axis undergoes gentle transition at the velocity determined from the specified acceleration acmd . | 6 |
an object of the present invention is to overcome these drawbacks . a clutch friction disc for a dry friction clutch , more particularly for a motor vehicle , having two friction crowns , is , in accordance with the invention , characterised in that the said friction crowns include means for generating an air pressure force under the effect of the rotation of the friction disc , in that the said means for generating an air pressure force comprise grooves formed on the face of each of the friction crowns adapted to come into contact with a reaction plate and a pressure plate , respectively , of a clutch , and in that the said grooves comprise a circumferential groove in communication with a plurality of radial grooves which are open at the inner periphery of the friction crown . thus the disengagement of the friction crowns and the release of the disc from being clamped are correctly ensured . in accordance with further aspects of the invention , taken separately or in all their technically possible combinations : the grooves are disposed symmetrically , as between one friction crown and the other , with respect to a median plane of the friction disc , in such a way as to set up air pressure forces on either side of the rotating friction disc which are substantially equal and opposite ; at least one radial groove has a cross section which becomes wider in the radial direction towards the outside of the crown ; the said circumferential groove is isolated from the outer periphery of the friction crown ; the said circumferential groove is in communication with the outer periphery of the friction crown through at least one groove having a cross section which becomes wider in the radial direction towards the outside of the crown ; the said circumferential groove is in communication with the outer periphery of the friction crown through an element which creates a loss of energy ; the said element for creating a loss of energy comprises at least one groove of smaller cross section than the said circumferential and / or radial grooves ; the said element for creating a loss of energy comprises at least one groove having a constriction ; the said circumferential groove is situated in a zone lying between the halfway point on the radius of the friction crown and the outer periphery of the latter ; the said circumferential groove is on a radius situated between about two - thirds of the radius of the friction crown and its outer periphery ; the invention also provides a friction crown for a friction disc for a dry friction clutch , having grooves formed on a face arranged to come into contact with a reaction plate or a pressure plate of a clutch , which is characterised in that the said grooves comprise a circumferential groove communicating with a plurality of radial grooves which are open at the inner periphery of the friction crown . in accordance with further aspects taken separately or in all their technically possible combinations : at least one radial groove has a cross section which becomes wider in the radial direction towards the outside of the crown ; the said circumferential groove is isolated from the outer periphery of the friction crown ; the said circumferential groove is in communication with the outer periphery of the friction crown through at least one groove having a cross section which becomes wider in the radial direction towards the outside of the crown ; the said circumferential groove is in communication with the outer periphery of the friction crown through an element which creates a loss of energy ; the said element for creating a loss of energy comprises at least one groove of smaller cross section than the said circumferential and / or radial grooves ; the said element for creating a loss of energy comprises at least one groove having a constriction ; the said circumferential groove is situated in a zone lying between the halfway point on the radius of the friction crown and the outer periphery of the latter ; the said circumferential groove is on a radius situated between about two - thirds of the radius of the friction crown and its outer periphery ; it has been possible to establish that , thanks to the invention , during the declutching operation there is set up a mattress of air under pressure of the same value between each crown of the friction disc and the associated plate of the clutch ( i . e . the reaction plate or pressure plate ), the effect of which is to cause effective and symmetrical disengagement of the friction crowns to take place , and in consequence a complete and total disengagement of the clutch . further features and advantages of the invention will appear in the description , given below , of one example of an embodiment of the invention , with reference to the single figure which represents a partial front view of a friction crown in accordance with the invention . a friction disc for a dry friction clutch includes in the usual way two friction crowns , each of which is directly or indirectly fixed to a metallic support which may be common to the two crowns and which preferably forms , or is associated with , a progressive engagement device . a torsion damper is preferably disposed between the support or supports of the friction crowns and a splined hub , which is adapted to be mounted on the input shaft of a gearbox . each friction crown 10 ( see the single figure ) comprises means 20 , 30 for generating an air pressure force under the effect of the rotation of the friction disc . the said means for generating an air pressure force comprise grooves 20 , 30 which are formed on the face 11 of each of the friction crowns 10 which are arranged to come into contact with , respectively , a reaction plate and a pressure plate of a clutch which , as between one crown and the other , are disposed symmetrically with respect to a median plane of the friction disc , in such a way as to set up , on either side of the friction disc when the latter is rotating , air pressure forces which are substantially equal and opposite . it has been proposed in the past to provide friction crowns with grooves , but these latter , arranged to collect and evacuate the dust that results from wear in the friction material constituting the crowns , has no effect on the disengagement of the crowns , and can even have a detrimental effect . as can be seen in the drawing , the said grooves comprise a circumferential groove 20 which is isolated from the outer periphery 12 of the crown 10 , together with a plurality of radial grooves 30 which are open into the circumferential groove 20 and at the inner periphery 13 of the crown . in another version , not shown , the circumferential groove is in communication with the outer periphery 12 of the crown through an element which sets up a loss of energy , such as at least one groove which , over at least part of its extent , has a general cross section which is narrower than that of the circumferential groove 20 and or radial grooves 30 . the circumferential groove 20 is situated in a zone which lies between the halfway point on the radius of the friction crown and the outer periphery 12 of the latter , and , as shown , the circumferential groove 20 is situated on a radius lying between about two - thirds of the radius of the friction crown 10 and its outer periphery 12 . the circumferential groove 10 and / or the radial grooves 30 , and preferably all of them , have a trapezoidal cross section . the applicant has discovered in this connection that , thanks to such a form of cross section which displaces towards the outside the centre of gravity of the mattress of air trapped by the grooves , the repulsion force tending to disengage each crown 20 from the associated plate of the clutch is greatly increased , which contributes to the achievement of clean and total clutch disengagement . experiments have shown that the circumferential groove 20 traps a mattress of air under pressure when the clutch is in rotation , and that the radial grooves 30 feed the circumferential groove 20 with air by centrifugal effect . all or part of the radial grooves have a cross section which widens in the radial direction towards the outside of the crown ; the circumferential groove is in communication with the outer periphery of the friction crown through at least one radial groove having a cross section which becomes wider in the radial direction towards the outside of the friction crown ; the radial grooves 30 are replaced by oblique grooves , but in such a way that , as between one crown and the other , in the position where they are mounted on the friction disc , the grooves have a symmetry with respect to a median plane of the friction disc ; several circumferential grooves are provided , more particularly when the friction disc has a large diameter , and they are in communication with each other through radial grooves . | 5 |
fig1 illustrates a systems architecture for the pic order process , as described in prior art . an iec 10 may take a new customer &# 39 ; s order for long distance service at a telemarketing center 12 , for example . this order is fed into an order entry system 14 that communicates with a customer order database 16 . a pic order is generated and provided to a lec interface system ( nlis ) 18 . the lec interface system 18 sends the pic order to the customer &# 39 ; s lec via a conventional communication network 20 . the lec 22 then processes the order at 24 and updates its switch 26 with the newly selected pic of the customer 28 . in greater detail , an iec signs up new customers for service via a number of methods . one method is via a telemarketing center 12 . when a new customer selects iec 10 for long distance service , an order for that customer is placed in an order entry system 14 and logged to a customer order database 16 . a pic order is created and provided to a national lec interface system ( nlis ) 18 . the pic order specifies the ani of the customer , the carrier identification code ( cic ) of the newly selected iec , service indicators for the customer &# 39 ; s services , the customer &# 39 ; s lec , and other information as needed . the nlis formats the pic order to a care record and determines the address of the lec that is to receive it . it then sends the pic order to the appropriate lec . several conventional methods are available . network data mover ( ndm ) is a communications product for transmitting volumes of data between ibm mainframe computers , and is used because the nlis and order processing systems 24 of lecs are commonly built on ibm mainframes . ndm uses telephone networks 20 to transmit pic orders as batches of care records to a lec &# 39 ; s order processing system 24 . the nlis can also write the pic / care records to magnetic tape . the iec then delivers the tape to the lec . the lec loads the tape onto their order processing system . paper can also be used as a medium of transferring pic / care records . when the lec processes the pic order , it updates its switch 26 that serves the specified customer . specifically , the cic for the iec that has been selected as the pic is assigned to the port that supports the customer &# 39 ; s access line . thus , when the customer makes a dial 1 call , the lec switch automatically routes the call to the iec &# 39 ; s switch . the iec uses one of these methods ( ndm , tape , paper ) to transmit pic / care records as a batch on a daily basis . because of the expense and time required , a batch is sent once a day . this introduces a time delay of up to one day for the pic order process . when the lec receives a daily batch of pic / care records , it must load them to its order processing system , and process the orders . this introduces another delay of up to one day for the pic order process . thus , it can take up to two days for a pic order from the nlis to the lec switch . if the order entry system feed to the nlis is a daily batch , this introduces up to a third day in the process . fig2 is a block diagram illustrating the systems architecture of quick pic order processing , as provided by the present invention . quick pic replaces the batch processing and transmission of the previous method of pic order processing , with real - time processing and interfaces . quick pic reduces the three - day pic order processing cycle to one that is completed in less than one minute . first , it introduces a real - time feed from the order entry system 14 to the nlis 18 . this removes the dependency on a daily batch feed from the process , and thus removes the first ( up to ) one day delay . in the preferred embodiment , a proprietary middleware messaging product of applicant , mci , known as registry , is used for real - time communications between the order entry system 14 and the nlis . registry is described in copending patent application no . 08 / 560 , 550 , filed on nov . 17 , 1995 . briefly , registry , is a system that resides on each application resource ( both clients and servers ) of a distributed computing platform . it is a communications agent that supports a suite of communications messaging products and network protocols . it serves as a logical layer of communications between applications and the transport mechanisms of the network . by doing this , registry shields the application programmers from all of the underlying complexities of proprietary messaging and transport protocols . registry accepts application - specific messages from clients , encapsulates them into standard registry - specific messages , and then translates them into the protocol necessary for whichever transport and messaging mechanisms that are to be used . at the other end , registry takes the client - sent message and translates it from the transport protocol that was used to an application - specific message that is used by the server . therefore , registry provides enterprise - wide application connectivity across a broad array of operating systems , hardware platforms , messaging products , and network protocols . another advantage of registry that it eliminates the need for each application to have specific interfaces to the various messaging and transport protocols that are in use . quick pic introduces a real - time interface between the iec 10 and the lec 22 that reduces the 1 - 2 day process of sending and completing a pic order , to a process that completes in 10 seconds . quick pic uses a midrange telecommunications gateway , identified as an iec gateway 30 , 30a , 30b in this example , to provide standardized communications between the iec 10 and lec ( 22 , 22a , 22b ). in the preferred embodiment , one iec gateway per lec is used to support scaleability and high volumes of data . the iec gateway provides the communications protocols specified in fig3 in accordance with each layer of the osi protocol model . it uses common management information protocol ( cmip ) for the application layer . at the lec , a lec gateway 32 provides the same functionality as the iec gateway . dedicated 256 kbps communications links are used between the iec gateway and the lec gateway . multiple lines may be used for redundancy and scaleability . quick pic also uses a transaction controller 34 . this is a process that , in the preferred embodiment , is implemented on a midrange computer that is distinct from the computers used for the iec gateways . it is also possible to implement the transaction controller on a same midrange computer as an iec gateway . the nlis 18 , which is implemented on a mainframe computer , receives the pic order from the order entry system 14 . it posts the order to a database internal of the nlis for tracking . it then determines the lec that is to receive it , and the method for transmitting the record to that lec . the present invention not only supports the real - time interface to the lec , but also the conventional methods of interface , including ndm , tape , and paper . it may be that only some lecs are capable of supporting the real - time interface provided by quick pic . thus , nlis determines what method ( quick pic , ndm , tape , paper ) of transmission is to be used , based on the lec . nlis then formats the pic order into a care record . for care records that are to be transmitted to a lec using quick pic , nlis sends the care record to the transaction controller 34 . nlis is also responsible for tracking each pic order and ensuring a confirmation is received back from the lec . the transaction controller 34 logs a transaction representing the processing of the pic order . it then distributes the pic / care record to the iec gateway ( 30 , 30a , 30b ) that interfaces with the appropriate lec ( 22 , 22a , 22b ). the transaction controller can also perform analysis on the various transactions ( pic orders ) for reporting purposes . in the preferred embodiment , conventional tcp / ip is used for communications between the nlis and the transaction controller , and between the transaction controller and the iec gateways . other communications protocols and methods may be used . middleware messaging products ( such as mci &# 39 ; s registry or ibm &# 39 ; s mq series ), x . 25 networks , and even shared memory can be used . the following discussion relates to communication between iec gateway 30 and lec 22 . the iec gateway uses cmip to establish a session with the lec gateway 32 . the iec gateway functions as a manager , and the lec gateway functions as an agent . this processing is shown and discussed in connection with fig4 . the iec gateway converts the pic / care record to cmip , and transmits it to the lec gateway 32 via a dedicated 256 kbps link . it then waits for a confirmation sent back from the lec gateway . this confirmation is sent after the lec has processed the pic order and updated its switch . it is sent in the same session as the original pic / care record , and thus the manager / agent roles do not change . the iec gateway sends a confirmation for each pic order to the transaction controller 34 . the transaction controller logs the confirmation as a transaction for analysis and reporting purposes , and sends it to the nlis 18 . the nlis updates its internal database to indicate the pic order has been completed , and passes confirmation on to the order entry system 14 , so that the customer order database 16 can be updated . the customer has now been converted to a new pic , and the iec &# 39 ; s customer database reflects that . the present invention also enables an iec 10 to increase the frequency of care transmission to a lec , by eliminating much of the expenses incurred by previous methods . for example , an iec can only afford to deliver a batch of care records by magnetic tape once a day , but can perform the real - time transmission afforded by quick pic several times a day . in fact , care record transmission can now be performed on - demand . also shown in fig2 as an additional aspect , an nlis enhanced workstation ( news ) server 36 is connected to the nlis 18 and the transaction controller 34 . the news server provides system monitoring and control , reporting , and event notification through automated paging and e - mail notification processes . the transaction controller logs each transaction . it can also perform analysis on these transaction , such as daily volume measurements . results of these analyses can be reported through the news server 36 . also , certain transactions or thresholds can trigger automated messaging through the news server . for example , if a confirmation to a pic order is not received , or if the operating system of the transaction controller or nlis experiences a failure , the news server can automatically issue a page to a specified number to notify the appropriate personnel . fig3 is a table that identifies the standardized telecommunications industry protocols used by quick pic for each of seven layers of the osi data communications model . the iec gateway provides communications with the lec gateway using these protocols . fig4 illustrates the pic order process , using standardized pic / care record objects , between the manager ( iec gateway 30 , 30a , 30b ) and agent ( lec gateway 32 ) in assigning a pic for a single billing telephone number ( btn ) that is associated with a single working telephone number ( wtn ). the manager sends a pic order for a btn with a single wtn as a cr - request message to the agent . a response to that pic order is matched at the cmip application layer using an invoke -- id of the cr - request message . when the agent has processed the pic order ( processed by the lec &# 39 ; s order processing systems and switches ), it sends a picresponse attribute value change notification to the manager . a response to that notification is matched using an invoke -- id , and is sent to the agent . the cycle is indicated in fig4 by steps 1 - 4 . the connectivity transactions ( called messages ) are ( 1 , 2 ) ( 3 , 3a ), ( 4 , 4a ). the business transactions are 1 , 3 for single btn / wtn . fig5 illustrates the pic order process , using standardized pic / care record objects , between the manager and agent in assigning pics for multiple telephone numbers . the manager sends multiple pic orders as cr - request messages , and the responses to those pic orders , at the cmip application level , are again matched using invoke -- ids of the corresponding cr - request messages . responses to the cr - request messages do not necessarily return in the same order as the cr - request messages were sent . they are matched using invoke -- ids . when a manager sends a cr - request message for a pic order to an agent , the cr - response message sent by the agent contains a managed object instance ( moi ) for the pic order object that was created . the manager will use the picorderid contained within the moi to match future picorderresponse notifications sent as the agent processes the corresponding pic order . the cycle is indicated in fig5 by steps 1 - 8 . the connectivity transactions ( called messages ) are {( 1 , 2 ) ( 3 , 3a ), ( 4 , 4a )}, {( 5 , 6 ), ( 7 , 7a ), ( 8 , 8a )}. the business transactions are ( 1 , 3 ) for a single btn / wtn id =&# 34 ; abc &# 34 ;; ( 5 , 7 ) for a single btn / wtd id =&# 34 ; def &# 34 ;. fig6 illustrates the pic order process , using standardized pic / care record objects , between the manager and agent in assigning a pic for a single billing telephone number that is associated with multiple working telephone numbers . in this example , a single btn is associated with three wtns . three picorder response notifications are received by the manager , each containing an moi with the picorderid value the same as the picorderid returned in the cr - response message . the manager and agent track responses to messages at the cmip level using invoke -- ids . the cycle is indicated in fig6 by steps 1 - 6 . connectivity transactions ( called messages ) are ( 1 , 2 ), ( 3 , 3a ), ( 4 , 4a ), ( 5 , 5a ), ( 6 , 6a ). business transactions are 1 , 3 , 4 , 5 for a single btn / multiple wtns . the following relates to copending patent application 08 / 560 , 550 entitled &# 34 ; registry communications middleware &# 34 ;, filed on nov . 17 , 1995 . that invention uses a telecommunications gateway to provide a real - time interface to an lec for the exchange of trouble tickets related to equipment problems . it also uses cmip as an application layer protocol , but uses a different application process . specifically , the related invention conforms to ansi t1 . 227 /. 228 telecommunications standard that specifies definitions and formats of data for trouble reporting . it also uses a single gateway , which is sufficient due to the lower volumes of trouble ticket records that are exchanged between carriers . pic orders are of much higher volumes . in summary , the present invention allows new pic orders to be processed within seconds , thus allowing long distance carrier customers , who are switching carriers , to almost immediately use their newly selected carrier for dial 1 calls . no other iec has been able to implement this method . the application that uses the present invention is known and publicized as quick pic . quick pic includes use of the iec gateway for cmip communications , and the transaction controller , which represent the novelty of the present invention . quick pic also includes a real - time interface between the order entry system ( mci &# 39 ; s ocis ) and nlis . other improvements made to pic order processing to realize quick pic include converting nlis from vsam to db2 , and increasing the frequency of care transmissions to the lec . in addition to pic order processing , the present invention can also used for &# 34 ; fyi &# 34 ; notices sent by a lec to an iec . an fyi notice informs the iec that one of its customers has changed its pic to another carrier . the present invention allows these notices to be sent to the iec in real - time , so that the iec can take immediate action , such as following up with the customer . the present invention can also be used for customer inquiries , in which an iec sends an inquiry to the lec for customer information , such as billing address or selected services . it should be understood that the invention is not limited to the exact details of construction shown and described herein for obvious modifications will occur to persons skilled in the art . | 7 |
fig2 shows a circuit arrangement of an embodiment of the invention . in this figure , a reference numeral 1 denotes a motor corresponding to that in fig1 . this embodiment of the invention is composed of various parts : namely , a control volume 3 ; a comparator section 4 including an amplifier 401 , comparators 402 , 403 and resistors 404 to 407 ; a differentiation circuit section 5 including transistors 501 , 502 , and gate 503 , resistors 504 to 513 and capacitors 514 , 515 ; a timer section 6 including a mono - multi ic 601 , which may be a commercially available unit such as hd 14538 , a resistor 602 and a capacitor 603 ; a gate section 7 including and gates 701 , 702 ; a motor driving section 8 including a motor driving ic 801 which may be a commerically available unit such as ba 6209 , capacitors 802 , 803 ; and a motor sensor volume 9 . before turning to the description of the motor driving circuit in accordance with the invention , the principle of operation of the motor actuator of the invention will be explained with specific reference to fig1 . referring to fig1 the valve 2 is actuated by the motor 1 to rotate within the maximum angular range θ between the positions a and b . the time length required for the valve 2 to rotate through this maximum angular range is represented by ( t ). this time length ( t ) will be referred to as the &# 34 ; maximum time &# 34 ;, hereinunder . thus , the time length between the moment at which the valve 2 is started and the moment at which any motor lock occurs cannot be longer than the maximum time ( t ), regardless of the initial position and the locking position . according to the invention , the supply of driving current to the motor 1 is stopped at all events within the maximum time ( t ). thus , the state of motor lock cannot continue longer than the maximum time ( t ). in an ordinary motor actuator of the type described , the maximum time ( t ) is quite short , say 10 seconds or shorter . therefore , the motor does not get burnt out nor damaged even if it is held in the state of motor lock for the period of the maximum time ( t ). from this point of view , the motor driving circuit of the invention for use in a motor actuator is constructed such that the supply of the driving current does not continue beyond the above - mentioned maximum time ( t ). the invention will be more fully understood from the following description of the preferred embodiment when the same is read in conjunction with fig2 . referring to fig2 the control voltage for driving the motor 1 is inputted through the control volume 3 , while the motor sensor volume 9 is operatively connected to the motor 1 so that it can produce and output a voltage corresponding to the position of the valve 2 shown in fig1 . the input voltage from the control volume 3 and the output voltage from the motor sensor volume 9 are compared with each other in the comparator section 4 , and the driving current supplied to the motor 1 is controlled in accordance with the result of the comparison . the operation of the embodiment shown in fig2 will be explained with reference to fig1 . in order to simplify the explanation , the output voltage of the motor sensor volume 9 ( referred to as &# 34 ; sensor voltage e &# 34 ;, hereinunder ) and the directions of rotation of the motor 1 are defined as follows : ( i ) the sensor voltages obtained when the valve 2 ( see fig1 ) takes the positions a and b , respectively , are expressed by e ( a ) and e ( b ) which meet the condition of e ( a )& lt ; e ( b ). thus , the motor sensor volume 9 produces a sensor voltage e which varies within the range of ea ≦ e ≦ eb , corresponding to the position of the valve 2 within the maximum angular range θ of movement . ( ii ) the direction of the operation of motor for rotating the valve 2 in the direction of an arrow ( b ) is defined as the &# 34 ; forward &# 34 ; direction , while the direction of operation for driving the valve 2 in the direction of an arrow ( a ) is defined as the &# 34 ; reversing &# 34 ; direction . the operation of the embodiment shown in fig2 will be explained hereinunder . it is assumed here that the motor actuator is in a safe condition without suffering any abnormality such as motor lock , and the valve 2 is stationed at the position θ 1 shown in fig1 . in this state , the motor sensor volume 9 produces an output , i . e ., the sensor output , e ( θ 1 ) which falls within the range expressed by { e ( a )& lt ; e ( θ 1 )& lt ; e ( b )}. this sensor voltage e ( θ 1 ) is supplied to the (+) terminals of the comparators 402 , 403 of the comparator section 4 . meanwhile , a voltage inputted through the control volume 3 is amplified by the amplifier 401 and is divided by the resistors 404 to 407 , and a divided voltage is applied to the (-) terminal of the comparator 402 . this voltage is referred to as &# 34 ; control voltage v (-)&# 34 ;, hereinunder . the control voltage has a potential below that of the sensor voltage e ( θ 1 ). similarly , a voltage ( referred to as &# 34 ; control voltage v (+)&# 34 ;, hereinunder ) is applied to the (+) terminal of the comparator 403 . the control voltage v (+) has a potential higher than the sensor voltage v ( θ 1 ). consequently , the comparators 402 and 403 produce outputs of low level ( referred to as &# 34 ; l &# 34 ;, hereinunder ). therefore , in each of the and gates 701 and 702 in the gate section 7 , one of the input terminals receives a signal &# 34 ; l &# 34 ;, regardless of the state of output from the terminal q of the mono - multi ic 601 in the timer section 6 . consequently , the f and r terminals of the motor driving ic 801 in the motor driving section 8 receive signals &# 34 ; l &# 34 ;, so that the out terminal of the motor driving ic does not deliver the driving current to the motor 1 . the motor driving ic 801 is adapted to deliver through its out terminal a driving current for forward rotation when its terminal f receives a signal h , and delivers through its out terminal a driving current for reversing rotation when its r terminal receives a signal h . thus , the valve 2 shown in fig1 holds the position θ 1 unless the control voltage inputted through the control volume 3 is changed . for rotating the valve 2 to a desired angular position , the motor actuator operates in the following manner . for instance , in order to rotate the valve 2 from the position θ 1 to a new position θ 2 as shown in fig1 the control volume 3 is operated to raise the levels of the control voltage (-) applied to the comparator 402 and the control voltage (+) applied to the comparator 403 by a level corresponding to the rotation angle θ ( see fig1 ) of the valve 2 , so that the conditions of ( 1 ) control voltage v (-)& gt ; sensor voltage e ( θ 1 ) and ( 2 ) control voltage v (+)& gt ; sensor voltage e ( θ 1 ) are met . in consequence , the output from the comparator 402 is inverted to &# 34 ; h &# 34 ;, while the output from the comparator 403 remains &# 34 ; l &# 34 ;. as a result of the inversion of the output of the comparator 402 from &# 34 ; l &# 34 ; to &# 34 ; h &# 34 ;, the output from the comparator 402 is differentiated by the differentiation circuit 5 and converted into a single pulse by the differentiation circuit 5 , whereby the timer 6 is started . namely , the mono - multi ic 601 in the timer section 6 continues to output , through its terminal q , the output h for the period ( t ) corresponding to the time constant ( t ) which is determined by the resistance of the resistor 602 and the capacitance of the capacitor 603 , from a moment at which the pulse signal &# 34 ; l &# 34 ; is received by the in terminal thereof . ( this time period ( t ) corresponds to the maximum time ( t ) mentioned before ) therefore , one of the inputs of the and gate 701 receives the &# 34 ; h &# 34 ; signal from the comparator 402 , and the other of the inputs receives the &# 34 ; h &# 34 ; signal outputted from the time section 6 . consequently , the and gate 701 produces an output signal &# 34 ; h &# 34 ;. as the &# 34 ; h &# 34 ; signal is supplied to the f terminal of the motor driving ic 801 , the out terminal of the ic 801 delivers the driving current for the forward driving of the motor 1 as stated before . as a result , the motor 1 commences its forward operation so as to drive the valve 2 in the direction of the arrow ( b ) in fig1 . the rotation of the valve in the direction of the arrow ( b ) increases the output of the motor sensor volume 9 , i . e ., the sensor voltage e . when the valve 2 has been rotated to the position θ 2 , the sensor voltage e is increased to e ( θ 2 ) which is equal to the control voltage v (-). consequently , the output of the comparator 402 is changed to &# 34 ; l &# 34 ; thereby stopping the motor 1 . from the foregoing description , it will be understood how the driving circuit operates for rotating the valve 2 in the direction of the arrow ( b ) and stopping the same at the command position . in the event that the valve 2 is locked mechanically for some reason , the motor 1 inevitably undergoes the state of the motor lock as explained before . in the event of the motor lock , the motor driving circuit of the invention operates in the following manner . the sensor voltage e of the motor sensor volume 9 after the occurrence of the motor lock is lower than the voltage e ( θ 2 ) mentioned before . therefore , the comparator 402 continues to produce and output the &# 34 ; h &# 34 ; signal . therefore , the supply of the driving current to the motor 1 is continued to hold the motor in the state of motor lock , insofar as the timer section 6 maintains the output signal &# 34 ; h &# 34 ;. according to the invention , however , the timer section 6 is constructed to maintain the output &# 34 ; h &# 34 ; only for a time period ( t ), i . e ., the maximum time . thus , when the maximum time ( t ) has passed after the moment of commencement of rotation of the valve 2 , the output of the timer section 6 is changed from &# 34 ; h &# 34 ; to &# 34 ; l &# 34 ;, so that the supply of the driving current to the motor 1 is stopped to cease the state of motor lock . according to the invention , the state of motor lock can last only for a period of the maximum time ( t ) at the longest . since the maximum time ( t ) is usually 10 seconds or shorter , the accident such as burning out of the motor can be avoided even if the motor lock has occurred . the foregoing description of the controlling operation is based on an assumption that the motor lock has occurred during the rotation of the valve 2 in the direction of the arrow ( b ) in fig1 towards the desired position , by a forward rotation of the motor 1 . it will be clear , however , that the same controlling operation can apply to the case where the motor lock has occurred during the rotation of the valve in the direction of the arrow ( a ). as will be understood from the foregoing description , according to the invention , it is possible to cease the state of motor lock in a motor actuator within a predetermied period of time , so that the accident such as burning out of the motor can be prevented advantageously . | 7 |
the present invention supports two types of processes in which a network side enables a mss to enter the idle mode : i . when the network side sends a request of getting the mss into the idle mode , the network entity enables the mss to enter the idle mode directly without delay ; and ii . when the network side sends a request of enabling the mss to enter the idle mode , the network entity requires the mss to wait for a period of time before entering the idle mode . moreover , the present invention specifies another scenario . for example , if multiple hosts are attached to a mss , the mss may need a period of time of waiting before entering the idle mode due to interaction with the host , when the network is initialized to get the mss into the idle mode . the present invention is hereinafter described in detail with reference to the embodiments in different scenarios . scenario 1 : fig3 shows the process of a mss entering the idle mode initiated by a network side according to a first embodiment of the present invention . as shown in fig3 , the process of includes the following steps : ( 1 ) when deciding to let the mss enter the idle mode , the pa / sbs sends a mss info req message to the relay pc , with the message carrying the following information : indication of the mss entering the idle mode , mss id , idle mode retain information ( indicating the information to be retained in the idle mode ), bs id , anchor dpf / fa id , anchor authenticator id , and so on ; ( 2 ) after receiving the message , the relay specifies an anchor pc id for the mss , allocates the recommended paging parameters ( for example , pg id , paging_cycle , paging_offset , pc id ), and then sends the message to the anchor dpf / fa , with the recommended paging parameters added into the message ; ( 3 ) after receiving the message , the anchor dpf / fa stores the corresponding information , and sends a mss info req message to the anchor pc specified in the message . the mss info req message carries the mss id , idle mode retain information , bs id , recommended paging parameters , service flow id ( sf id ), and anchor authenticator id , which are required for the mss to enter the idle mode ; ( 4 ) after receiving the mss info req message , the anchor pc knows that the mss requests to enter the idle mode according to the content of the message . at this time , the anchor pc contacts the anchor authenticator to verify whether the mss is allowed to enter the idle mode . if the verification result allows the mss to enter the idle mode , the anchor pc will reallocate the paging parameters , according to the specific conditions ( for example , the requirements on setting the parameter ), and reply with a mss info rsp message . the message carries a mss id , the actual paging parameters ( including selected pg id , paging cycle , paging offset ), pc id , and idle mode authorization indication . meanwhile , the anchor pc requires the lr to retain the information on the mss ; ( 5 ) after receiving the mss info rsp , the fa replies with a mss info rsp message to the relay pc if the idle mode authorization indication allows the mss to enter the idle mode . the message carries a mss id , the actual paging parameters , a pg id , a pc id , an idle mode authorization indication , and so on . after receiving the message , the relay pc forwards the message to the pa / sbs ; ( 6 ) after the pa / sbs receives the message , if the idle mode authorization indication allows the mss to enter the idle mode , the pa / sbs sends a dreg_cmd message to the mss from the air interface . the message carries an action code “ 0x05 ” ( which instructs the mss to enter the idle mode directly ) and the parameter information is specified in the 802 . 16e protocol . meanwhile , the pa / sbs starts the resource retaining timer ; ( 7 ) after receiving the message , the mss replies with a dreg_req message to the sbs . the message carries an action code “ 0x02 ”, indicating that the mss enters the idle mode successfully , and may be in the format specified by the 802 . 16e protocol . the mss clears the information related to the link and the session , and enters the idle mode ; ( 8 ) after the pa / sbs receives the dreg_req message from the mss , it indicates that the mss enters the idle mode successfully . therefore , the pa / sbs sends a data path rel req message to the relay dpf , requesting to release the data path and connection related to this mss . the message carries the information required for the mss to enter the idle mode ; ( 10 ) the anchor dpf / fa responds to the request message , releases the data path and replies with a data path rel rsp message to the relay dpf ; and ( 11 ) after receiving the data path rel rsp message forwarded by the relay dpf , the pa / sbs confirms success of entering the idle mode . through a relay dpf , the pa / sbs replies with a data path rel ack message to the fa , indicating that the mss enters the idle mode successfully . the relay dpf notifies the relay pc to delete the information on the mss . meanwhile , the fa sends a mss info ack message to the anchor pc , confirming completion of the mss entering the idle mode . the anchor pc finally finishes data update in the lr . further , the anchor pc needs to notify the anchor authenticator to update and retain the information on the mss idle state , including the anchor pc id , anchor dpf id , and security context information . when the resource retaining timer times out , the sbs deletes the information on the local mss . it should be noted that the relay pc is optional in the foregoing step . if the relay pc does not exist , the pa / sbs will communicate with the fa directly . what is described below is a scenario that the mss does not enter the idle mode until a period of time expires after the network side sends a request of enabling the mss to enter the idle mode . as shown in fig4 , the process is as follows : steps ( 1 )-( 5 ) are the same as the counterpart in the foregoing embodiment , except that in the process , any of the pa / sbs , relay pc / dpf , anchor dpf / fa and anchor pc / lr can decide whether to require the mss to send a dreq_request message to enter the idle mode after expiry of a req_duration according to the actual conditions ; ( 6 ) after the pa / sbs receives the message , the pa / sbs sends a dreg_cmd message to the mss from the air interface , if the idle mode authorization indication allows the mss to enter the idle mode . the message carries an action code “ 0x05 ” ( which instructs the mss to enter the idle mode ) and the req_duration parameter . the dreg_cmd message may adopt the format specified in the 802 . 16e protocol ; ( 7 ) after receiving the message , the mss replies with a dreg_req message to the sbs after expiry of a duration indicated by the req_duration . the message carries an action code “ 0x01 ”, indicating that the mss will enter the idle mode . the message may adopt the format specified by the 802 . 16e protocol . the mss is ready to enter the idle mode ; ( 8 ) after receiving the message , the pa / sbs sends a data path rel req message to the relay dpf on the mss link through the dpf entity , requesting to release the link of this mss . the message carries mss id , idle mode retain information , bs id , recommended paging parameters ( for example , pg id , paging cycle , paging offset , pc id ), access service network data path function id ( asn - dpf id ), and authenticator id , which are required for the mss to enter the idle mode . some parameters in the message are obtained and stored in steps ( 1 )-( 5 ). the relay dpf on the link forwards the data path rel req message to the anchor dpf ( namely , the dpf that is located together with the fa ); ( 9 ) after receiving the message , the anchor dpf / fa stores the corresponding information , and sends a mss info req message to the anchor pc specified in the message . the mss info req message carries the mss id , idle mode retain information , bs id , recommended paging parameters , service flow id ( sf id ), and anchor authenticator id , which are required for the mss to enter the idle mode ; ( 10 ) after receiving the mss info req message , the anchor pc knows that the mss requests to enter the idle mode , according to the content of the message . since , in step ( 4 ), it is already verified whether to allow the mss to enter the idle mode , the anchor pc does not perform such verification again . the anchor pc may select the paging parameters recommended by the local pc , or reallocate the paging parameters again , according to the specific conditions and reply with a mss info rsp message . the message carries a mss id , the actual paging parameters ( including selected pg id , paging cycle , paging offset ), pc id , and an idle mode authorization indication . meanwhile , the anchor pc requires the lr to retain the information on the mss ; ( 11 ) after receiving the mss info rsp , the fa stores the corresponding information such as pc id , and replies with a data path rel rsp message to the relay pc . the response message carries a mss id , the actual paging parameters , a pg id , a pc id , and so on . the relay pc on the link forwards the message to the pa / sbs ; ( 12 ) after receiving the data path rel rsp , the sbs confirms that the mss enters the idle mode successfully , and replies , from the air interface , a dreg_cmd message to the mss . the message carries an action code “ 0x05 ”. meanwhile , the pa / sbs starts the resource retaining timer ; generally , the resource retaining timer must be started , after the sbs sends a reg cmd message ( except that the message carries req_duration ). the information on the local mss will be deleted unconditionally when the resource retaining timer times out . if the reg cmd message carries a req_duration , the resource retaining timer can also be started , but the timer needs to be restarted in this step ; ( 13 ) after receiving the message , the mss deletes information related to the connection and the session ; and ( 14 ) through a relay pc , the pa / sbs replies with a data path rel ack message to the fa , indicating that the mss enters the idle mode successfully . the relay pc deletes the information on the mss . meanwhile , the fa sends a mss info ack message to the anchor pc , confirming completion of the mss entering the idle mode . the anchor pc finally finishes data update in the lr . further , the anchor pc needs to notify the anchor authenticator to update and retain the information on the mss idle state , including the anchor pc id , anchor dpf id , and security context information . upon expiry of the resource retaining timer , the pa / bs deletes the information on the local mss . in this embodiment , the network requires the mss to send a request of entering the idle mode after waiting for a req_duration . therefore , in steps ( 1 )-( 5 ), the fa or relay pc replies to the pa / bs with a mss info rsp message directly , indicating the waiting time of req_duration . the pa / bs replies to the mss with a dreg_cmd message . the message carries the req_duration parameter and the action code “ 0x05 ”. after a req_duration expires , the mss sends a request of entering the idle mode again . namely , the actions executed by the fa and the anchor pc can be omitted . if the relay pc or the fa replies to the pa / sbs directly with a mss info rsp message , in step ( 10 ) it is needed to verify whether the mss is allowed to enter the idle mode . in the process shown in fig4 , the process of storing the mss context information into the anchor pc is synchronous to the process of releasing the data path . an alternative process of this embodiment is shown in fig5 . unlike the preceding process , this process separates the transfer of the mss information from the release of the data path ; and the mss information and paging - related parameters are transferred through mss info req / mss info rsp messages . the process is briefly described below : steps ( 1 )-( 3 ) are the same as the counterpart of the preceding embodiment . the network side decides whether the mss will send request of entering the idle mode only after expiry of a req_duration according to the actual conditions . if so , the corresponding mss info req message or mss info rsp message will carry the req_duration parameter ; ( 4 ) after receiving the message , the pa / sbs sends a dreg_cmd message to the mss . the message carries an action code “ 0x05 ” and a req_duration parameter , and may adopt the format specified by the 802 . 16e protocol ; ( 5 ) after receiving the message , the mss replies with a dreg_req message to the sbs after expiry of a duration indicated by the req_duration . the message carries an action code “ 0x01 ”, indicating that the mss will enter the idle mode . the message may adopt the format specified by the 802 . 16e protocol . the mss is ready to enter the idle mode ; ( 6 ) after receiving the dreg_req message from the mss , the pa / sbs sends a mss info req message to the corresponding relay pc , requesting to determine whether the mss is allowed to enter the idle mode ; ( 7 ) after receiving the message , the relay pc allocates information to the mss , including : pc id , paging parameters , mss id carried in the message , idle mode retain information , bs id , asn - dpf id , and anchor authenticator id ; and sends the information to the anchor pc through an fa by means of a mss info req message ; ( 8 ) after receiving the mss info req message , the anchor pc knows that the mss requests to enter the idle mode , according to the content of the message . at this time , the anchor pc contacts the anchor authenticator to verify whether the mss is allowed to enter the idle mode . if the verification result allows the mss to enter the idle mode , the anchor pc will reallocate the paging parameters , according to the specific conditions ( for example , the requirements on setting the parameter ), and reply with a mss info rsp message to the pa / sbs . meanwhile , the anchor pc requires the lr to retain the information on the mss ; ( 9 ) after receiving the mss info rsp message , the pa / sbs replies to the mss with a dreg_cmd message , starts the resource retaining timer , and sends a data path rel req to the relay dpf on the mss link . the data path rel req carries : mss id , actual paging parameters ( selected pg id , paging cycle , paging offset , and pc id ), and idle mode authorization indication ; ( 10 ) the relay dpf on the link forwards the data path rel req message to the anchor dpf / fa . the anchor dpf / fa responds to the request message , releases the data path and replies with a data path rel rsp message to the pa / sbs ; and ( 11 ) after receiving the data path rel rsp message , the pa / sbs confirms success of entering the idle mode . through a relay dpf , the pa / sbs replies with a data path rel ack message to the fa , indicating that the mss enters the idle mode successfully . the relay pc will delete the information on the mss . meanwhile , the fa sends a mss info ack message to the anchor pc , confirming completion of the mss entering the idle mode . the anchor pc finally finishes data update in the lr . upon expiry of the resource retaining timer , the pa / sbs deletes the information on the local mss . the process shown in fig5 can implement the functions of the process shown in fig4 . the practical application also involves another scenario : if multiple hosts are attached to a mss , when the network is initialized to enable the mss to enter the idle mode , the mss may need to wait for a cmd_duration before entering the idle mode due to interaction with the host . after expiry of the cmd_duration , the process of entering the idle mode will be initiated again . the detailed procedure is as follows : a . the first step and the preceding operations are the same as the counterpart of the foregoing two embodiments ; b . in the second step , the mss decides to enter the idle mode only after expiry of a cmd_duration , according to the actual conditions , and hence replies with a dreg_req message , which carries an action code “ 0x02 ” and the cmd_duration information . after receiving this message , the network - side sbs stops the pre - set resource retaining timer if such a timer is set previously when the sbs sends a dreg_cmd to the mss ; and waits for the mss to send a request of entering the idle mode ; and c . after a cmd_duration expires , the mss sends a new dreg_req , requesting to enter the idle mode . the subsequent steps are the same as the counterpart steps in the foregoing embodiment . the cmd_duration parameter is newly added in the air interface message , dreg_req message , in the prior art , and is designed to notify the network to wait for a cmd_duration before the mss enters the idle mode . an alternative process of this embodiment is shown in fig7 . unlike the process shown in fig6 , this process separates the transfer of mss information from the release of the data path ; and the mss information and paging - related parameters are transferred through mss info req / mss info rsp messages . the functions implemented by the process are the same . it should be noted that the relay pc is optional in the foregoing step . if the relay pc does not exist , the pa / sbs will communicate with the fa directly . in the foregoing embodiments , the process of the network enabling the mss to enter the idle mode involves several relevant parameters such as idle mode timeout , paging interval length , and paging cycle req . the dreg_req message of the mss may carry one or more parameters , so that the parameters are transferred and stored into the anchor pc . regarding the idle mode timeout parameter , after the mss enters the idle mode , both the mss and the pc will start an idle mode timer at the mss side , upon expiry of which the mss will initiate location update ; or , in the pc , start an idle mode system timer , upon expiry of which the pc will initiate paging to the mss to require location update if the pc receives no location update request from the mss , or will delete the context information of the mss directly if the pc believes that the mss is off network . the idle mode timeout parameter is used by the mss and the pc to set the foregoing timers , and is negotiated by the mss and the network side in the process of registering the mss onto the network . in the process of the mss entering the idle mode , the idle mode timeout parameter needs to be transferred and stored in the anchor pc for the purpose of setting the idle mode system timer . if the anchor pc is migrated when the mss is in the idle mode , the parameter needs to be transferred to the new anchor pc . for that purpose , the idle mode timeout parameter needs to be transferred to the current network side during the handover , including the target bs . this parameter is negotiated in the process of registering the mss onto the network ; and the bs or serving network that serves the mss when the mss accesses the network may be different from the bs or serving network that serves the mss when the mss enters the idle mode later . therefore , this parameter must be transferred together with the mss context during the handover of the mss . moreover , this parameter can also be configured by the network side directly , and carried in the dreg_req message to the mss , without being negotiated in the process of registering the mss onto the network . regarding the paging interval length parameter , according to the paging cycle and the paging offset , it is practicable to calculate the specific radio frame ( nframe ) after which the bs begins to send paging messages . the paging interval length refers to the number of continuous frames ( n ) starting from nframe , where n is not nframe . namely , the mss can receive the paging messages in n continuous frames starting from nframe after the paging message occurs . the paging interval length parameter is also determined through negotiation with the network side in the process of registering the mss onto the network . in the process which the mss entering the idle mode , the paging interval length parameter needs to be transferred and stored in the anchor pc ; and needs to be transferred to the bs when the anchor pc initiates paging for the purpose of determining the scheduling policy of sending the paging message . if the anchor pc is migrated when the mss is in the idle mode , the parameter needs to be transferred to the current network side , including the target bs . this parameter is negotiated in the process of registering the mss onto the network ; and the bs or serving network that serves the mss when the mss accesses the network may be different from the bs or serving network that serves the mss when the mss enters the idle mode later . therefore , this parameter must be transferred , together with the mss context during the handover of the mss . regarding the paging cycle req parameter , it is carried in the dreg_req message in the process of the mss entering the idle mode , and serves as a basis for the network side to determine the paging cycle for this mss . therefore , in the process of the mss entering the idle mode , this parameter needs to be carried to the pc . regarding the mac hash skip threshold parameter , it is a threshold of a number of continuously sent paging messages ( mob - pag - adv ). if no paging message specific to the mss exists among a set number ( threshold ) of paging messages that are sent continuously , the pc or pa / bs will send a paging message specific to the mss . therefore , the mac hash skip threshold parameter needs to be transferred and saved into the pc so that the pc or pa / bs can handle accordingly in the case that the conditions are fulfilled . this parameter may be determined through negotiation with the network side in the process of registering the mss onto the network , carried in the mss info req message or the dreg_req message , and hence transferred and stored into the relay pc or anchor pc . the idle mode timeout , paging interval length , paging cycle req , and mac hash skip threshold parameters mentioned above can be configured by the network side uniformly , so that they will vary with the terminal . in this case , they are not necessarily transferred in the process of the mss entering the idle mode in an embodiment of the present invention . regarding the paging preference parameter , every service flow created by the mss has a paging preference parameter . if this parameter is set , it means that the network can generate a paging message to page the mss after the mss enters the idle mode if the service flow has an incoming downlink packet ; if this parameter is not set , the network will not generate a paging message to page the mss when the service flow has an incoming downlink packet ; when a downlink packet of the mss arrives but finds no corresponding service flow , the anchor pc may initiate or may not initiate the paging to the mss , according to the presetting . after the mss enters the idle mode , the network will retain only the service flow information whose paging preference is set to 1 , if the 7th bit of the idle mode retain information parameter is set to 1 . for other service flow information the anchor dpf / fa will delete the service flow information which is not to be retained , and notify the service flow authorization ( sfa ) entity and the policy function ( pf ) entity to delete and release the service flows , after the mss enters the idle mode . the information stored in the anchor pc / lr may include the service flow information of the mss for which a paging preference parameter is set , and exclude the service flow information for which no paging preference parameter is set . like in the foregoing embodiments , the anchor pc must record the following information into the context carried in the request of entering the idle mode sent by the mss : id of the current anchor dpf / fa ( which may be ip address of the asn gw that contains the anchor dpf / fa ), and the anchor authenticator id . the anchor authenticator of the mss must record the anchor pc id which exists when the mss is in the idle mode . the anchor pc id may be recorded when the anchor pc consults the anchor authenticator whether the mss can enter the idle mode ; or the anchor pc notifies the anchor pc id to the anchor authenticator of the mss after confirming that the mss enters the idle mode . moreover , the anchor dpf / fa records the anchor pc id of the mss . for this purpose , the anchor pc may notify the anchor pc id to the anchor dpf / fa of the mss , after confirming that the mss enters the idle mode . although the wimax system is used as an example in describing the technical solution under the present invention , the technical solution under the present invention is not limited to the wimax system , but is applicable to other wireless mans such as 802 . 20 - based wireless mans . as analyzed above , the method under the present invention enables the network side to send a request of getting the mss into the idle mode , thus standardizing and perfecting the process of the mss entering the idle mode and making the process more stable . the embodiments described above are only preferred embodiments of the invention and are not intended for limiting the invention . any modification , equivalent substitution , and improvement without departing from the spirit and principle of this invention shall be covered in the protection scope of the invention . | 7 |
a first embodiment of the invention is a compound represented by formula i as described above , or a pharmaceutically acceptable salt , ester or prodrug thereof , alone or in combination with a pharmaceutically acceptable carrier or excipient . a second embodiment of the invention is a compound represented by formula ii as described herein , or a pharmaceutically acceptable salt , ester or prodrug thereof , alone or in combination with a pharmaceutically acceptable carrier or excipient . certain aspects of the invention include , but are not limited to : where a , g , rx , ry and z are as defined in formula i . wherein each z 1 and z 2 is independently selected from aryl , substituted aryl , heteroaryl , and substituted heteroaryl ; wherein a , g and u are as defined in formula i . wherein each z 1 and z 2 is independently selected from aryl , substituted aryl , heteroaryl , and substituted heteroaryl ; w is selected from ch 2 , o , s , nr 4 r 5 , co , ch 2 ch 2 , c ( o ) nh , ch 2 o , ch 2 s , ch 2 nr 4 ; and wherein r 4 , r 5 , a , g and u are as defined in formula i . wherein each z 1 and z 2 is independently selected from aryl , substituted aryl , heteroaryl , and substituted heteroaryl ; w is selected from ch 2 , o , s , nr 4 r 5 , co , ch 2 ch 2 , c ( o ) nh , ch 2 o , ch 2 s , ch 2 nr 4 ; and wherein r 4 , r 5 , a , g and u are as defined in formula i . representative compounds of the invention include , but are not limited to , the compounds 2 - 40 of the formula xv : wherein a , q and g are delineated for each example in table 1 . according to an alternate embodiment , the pharmaceutical compositions of the present invention may further contain other anti - hcv agents . examples of anti - hcv agents include , but are not limited to , interferon ( e . g ., alpha - interferon , beta - interferon , consensus interferon , pegylated interferon , or albumin or other conjugated interferon ), ribavirin , and amantadine . for further details see s . tan , a . pause , y . shi , n . sonenberg , hepatitis c therapeutics : current status and emerging strategies , nature rev . drug discov ., 1 , 867 - 881 ( 2002 ); wo 00 / 59929 ( 2000 ); wo 99 / 07733 ( 1999 ); wo 00 / 09543 ( 2000 ); wo 99 / 50230 ( 1999 ); u . s . pat . no . 5 , 861 , 297 ( 1999 ); and us2002 / 0037998 ( 2002 ) which are herein incorporated by reference in their entirety . according to an additional embodiment , the pharmaceutical compositions of the present invention may further contain other hcv protease inhibitors . according to yet another embodiment , the pharmaceutical compositions of the present invention may further comprise inhibitor ( s ) of other targets in the hcv life cycle , including , but not limited to , helicase , polymerase , metalloprotease , and internal ribosome entry site ( ires ). according to another embodiment , the pharmaceutical compositions of the present invention may further comprise another anti - viral , anti - bacterial , anti - fungal or anti - cancer agent , or an immune modulator , or another therapeutic agent . according to still another embodiment , the present invention includes methods of treating hepatitis c infections in a subject in need of such treatment by administering to said subject an anti - hcv virally effective amount of a compound of the present invention or a pharmaceutically acceptable salt , ester , or prodrug thereof according to a further embodiment , the present invention includes methods of treating hepatitis c infections in a subject in need of such treatment by administering to said subject an anti - hcv virally effective amount or an inhibitory amount of a pharmaceutical composition of the present invention . an additional embodiment of the present invention includes methods of treating biological samples by contacting the biological samples with the compounds of the present invention . yet a further aspect of the present invention is a process of making any of the compounds delineated herein employing any of the synthetic means delineated herein . listed below are definitions of various terms used to describe this invention . these definitions apply to the terms as they are used throughout this specification and claims , unless otherwise limited in specific instances , either individually or as part of a larger group . the terms “ c 1 - c 6 alkyl ,” or “ c 1 - c 8 alkyl ,” as used herein , refer to saturated , straight - or branched - chain hydrocarbon radicals containing between one and six , or one and eight carbon atoms , respectively . examples of c 1 - c 6 alkyl radicals include , but are not limited to , methyl , ethyl , propyl , isopropyl , n - butyl , tert - butyl , neopentyl , n - hexyl radicals ; and examples of c 1 - c 8 alkyl radicals include , but are not limited to , methyl , ethyl , propyl , isopropyl , n - butyl , tert - butyl , neopentyl , n - hexyl , heptyl , octyl radicals . the terms “ c 2 - c 6 alkenyl ,” or “ c 2 - c 8 alkenyl ,” as used herein , denote a monovalent group derived from a hydrocarbon moiety containing from two to six , or two to eight carbon atoms having at least one carbon - carbon double bond by the removal of a single hydrogen atom . alkenyl groups include , but are not limited to , for example , ethenyl , propenyl , butenyl , 1 - methyl - 2 - buten - 1 - yl , heptenyl , octenyl and the like . the term “ c 2 - c 6 alkynyl ,” or “ c 2 - c 8 alkynyl ,” as used herein , denote a monovalent group derived from a hydrocarbon moiety containing from two to six , or two to eight carbon atoms having at least one carbon - carbon triple bond by the removal of a single hydrogen atom . representative alkynyl groups include , but are not limited to , for example , ethynyl , 1 - propynyl , 1 - butynyl , heptynyl , octynyl and the like . the term “ c 3 - c 8 - cycloalkyl ”, or “ c 3 - c 12 - cycloalkyl ,” as used herein , denotes a monovalent group derived from a monocyclic or polycyclic saturated carbocyclic ring compound by the removal of a single hydrogen atom , respectively . examples of c 3 - c 8 - cycloalkyl include , but not limited to , cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cyclopentyl and cyclooctyl ; and examples of c 3 - c 12 - cycloalkyl include , but not limited to , cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , bicyclo [ 2 . 2 . 1 ] heptyl , and bicyclo [ 2 . 2 . 2 ] octyl . the term “ c 3 - c 8 - cycloalkenyl ”, or “ c 3 - c 12 - cycloalkenyl ” as used herein , denote a monovalent group derived from a monocyclic or polycyclic carbocyclic ring compound having at least one carbon - carbon double bond by the removal of a single hydrogen atom . examples of c 3 - c 8 - cycloalkenyl include , but not limited to , cyclopropenyl , cyclobutenyl , cyclopentenyl , cyclohexenyl , cycloheptenyl , cyclooctenyl , and the like ; and examples of c 3 - c 12 - cycloalkenyl include , but not limited to , cyclopropenyl , cyclobutenyl , cyclopentenyl , cyclohexenyl , cycloheptenyl , cyclooctenyl , and the like . the term “ aryl ,” as used herein , refers to a mono - or bicyclic carbocyclic ring system having one or more aromatic rings including , but not limited to , phenyl , naphthyl , tetrahydronaphthyl , indanyl , idenyl and the like . the term “ arylalkyl ,” as used herein , refers to a c 1 - c 3 alkyl or c 1 - c 6 alkyl residue attached to an aryl ring . examples include , but are not limited to , benzyl , phenethyl and the like . the term “ heteroaryl ,” as used herein , refers to a mono -, bi -, or tri - cyclic aromatic radical or ring having from five to ten ring atoms of which at least one ring atom is selected from s , o and n ; wherein any n or s contained within the ring may be optionally oxidized . heteroaryl includes , but is not limited to , pyridinyl , pyrazinyl , pyrimidinyl , pyrrolyl , pyrazolyl , imidazolyl , thiazolyl , oxazolyl , isooxazolyl , thiadiazolyl , oxadiazolyl , thiophenyl , furanyl , quinolinyl , isoquinolinyl , benzimidazolyl , benzooxazolyl , quinoxalinyl , and the like . the term “ heteroarylalkyl ,” as used herein , refers to a c 1 - c 3 alkyl or c 1 - c 6 alkyl residue residue attached to a heteroaryl ring . examples include , but are not limited to , pyridinylmethyl , pyrimidinylethyl and the like . the terms “ heterocyclic ” and “ heterocycloalkyl ,” can be used interchangeably and referred to a non - aromatic 3 -, 4 -, 5 -, 6 - or 7 - membered ring or a bi - or tri - cyclic group fused system , where ( i ) each ring contains between one and three heteroatoms independently selected from oxygen , sulfur and nitrogen , ( ii ) each 5 - membered ring has 0 to 1 double bonds and each 6 - membered ring has 0 to 2 double bonds , ( iii ) the nitrogen and sulfur heteroatoms may optionally be oxidized , ( iv ) the nitrogen heteroatom may optionally be quatemized , and ( iv ) any of the above rings may be fused to a benzene ring . representative heterocycloalkyl groups include , but are not limited to , [ 1 , 3 ] dioxolane , pyrrolidinyl , pyrazolinyl , pyrazolidinyl , imidazolinyl , imidazolidinyl , piperidinyl , piperazinyl , oxazolidinyl , isoxazolidinyl , morpholinyl , thiazolidinyl , isothiazolidinyl , and tetrahydrofuryl . the term “ substituted ” as used herein , refers to independent replacement of one , two , or three or more of the hydrogen atoms thereon with substituents including , but not limited to , — f , - cl , - br , — i , — oh , protected hydroxy , — no 2 , — cn , — nh 2 , protected amino , — nh — c 1 - c 12 - alkyl , — nh — c 2 - c 12 - alkenyl , — nh — c 2 - c 12 - alkenyl , — nh — c 3 - c 12 - cycloalkyl , — nh - aryl , — nh - heteroaryl , — nh - heterocycloalkyl , - dialkylamino , - diarylamino , - diheteroarylamino , — o — c 1 - c 12 - alkyl , — o — c 2 - c 12 - alkenyl , — o — c 2 - c 12 - alkenyl , — o — c 3 - c 12 - cycloalkyl , — o - aryl , — o - heteroaryl , — o - heterocycloalkyl , — c ( o )— c 1 - c 12 - alkyl , — c ( o )— c 2 - c 12 - alkenyl , — c ( o )— c 2 - c 12 - alkenyl , — c ( o )— c 3 - c 12 - cycloalkyl , — c ( o )- aryl , — c ( o )- heteroaryl , — c ( o )- heterocycloalkyl , — conh 2 , — conh — c 1 - c 12 - alkyl , — conh — c 2 - c 12 - alkenyl , — conh — c 2 - c 12 - alkenyl , — conh — c 3 - c 12 - cycloalkyl , — conh - aryl , — conh - heteroaryl , — conh - heterocycloalkyl , — oco 2 — c 1 - c 12 - alkyl , — oco 2 — c 2 - c 12 - alkenyl , — oco 2 — c 2 - c 12 - alkenyl , — oco 2 — c 3 - c 12 - cycloalkyl , — oco 2 - aryl , — oco 2 - heteroaryl , — oco 2 - heterocycloalkyl , — oconh 2 , — oconh — c 1 - c 12 - alkyl , — oconh — c 2 - c 12 - alkenyl , — oconh — c 2 - c 12 - alkenyl , — oconh — c 3 - c 12 - cycloalkyl , — oconh - aryl , — oconh - heteroaryl , — oconh - heterocycloalkyl , — nhc ( o )— c 1 - c 12 - alkyl , — nhc ( o )— c 2 - c 12 - alkenyl , — nhc ( o )— c 2 - c 12 - alkenyl , — nhc ( o )— c 3 - c 12 - cycloalkyl , — nhc ( o )- aryl , — nhc ( o )- heteroaryl , — nhc ( o )- heterocycloalkyl , — nhco 2 — c 1 - c 12 - alkyl , — nhco 2 — c 2 - c 12 - alkenyl , — nhco 2 — c 2 - c 12 - alkenyl , — nhco 2 - c 3 - c 12 - cycloalkyl , — nhco 2 - aryl , — nhco 2 - heteroaryl , — nhco 2 - heterocycloalkyl , — nhc ( o ) nh 2 , — nhc ( o ) nh — c 1 - c 12 - alkyl , — nhc ( o ) nh — c 2 - c 12 - alkenyl , — nhc ( o ) nh — c 2 - c 12 - alkenyl , — nhc ( o ) nh — c 3 - c 12 - cycloalkyl , — nhc ( o ) nh - aryl , — nhc ( o ) nh - heteroaryl , — nhc ( o ) nh - heterocycloalkyl , nhc ( s ) nh 2 , — nhc ( s ) nh - c 1 - c 12 - alkyl , — nhc ( s ) nh — c 2 - c 12 - alkenyl , — nhc ( s ) nh — c 2 - c 12 - alkenyl , — nhc ( s ) nh — c 3 - c 12 - cyloalkyl , — nhc ( s ) nh - aryl , — nhc ( s ) nh - heteroaryl , — nhc ( s ) nh - heterocycloalkyl , — nhc ( nh ) nh 2 , — nhc ( nh ) nh — c 1 - c 12 - alkyl , — nhc ( nh ) nh — c 2 - c 12 - alkenyl , — nhc ( nh ) nh — c 2 - c 12 - alkenyl , — nhc ( nh ) nh — c 3 - c 12 - cycloalkyl , — nhc ( nh ) nh - aryl , — nhc ( nh ) nh - heteroaryl , — nhc ( nh ) nh - heterocycloalkyl , — nhcnh )— c 1 c 12 - alkyl , — nhc ( nh )— c 2 - c 12 - alkenyl , — nhc ( nh )— c 2 - c 12 - alkenyl , — nhc ( nh )— c 3 - c 12 - cycloalkyl , — nhc ( nh )- aryl , — nhc ( nh )- heteroaryl , — nhc ( nh )- heterocycloalkyl , — c ( nh ) nh — c 1 - c 12 - alkyl , — c ( nh ) nh — c 2 - c 12 - alkenyl , — c ( nh ) nh — c 2 - c 12 - alkenyl , — c ( nh ) nh — c 3 - c 12 - cycloalkyl , — c ( nh ) nh - aryl , — c ( nh ) nh - heteroaryl , — c ( nh ) nh - heterocycloalkyl , — s ( o )— c 1 - c 12 - alkyl , — s ( o )— c 2 - c 12 - alkenyl , — s ( o )— c 2 - c 12 - alkenyl , — s ( o )— c 3 - c 12 - cycloalkyl , — s ( o )- aryl , — s ( o )- heteroaryl , — s ( o )- heterocycloalkyl — so 2 nh 2 , — so 2 nh — c 1 - c 12 - alkyl , — so 2 nh — c 2 - c 12 - alkenyl , — so 2 nh — c 2 - c 12 - alkenyl , — so 2 nh — c 3 - c 12 - cycloalkyl , — so 2 nh - aryl , — so 2 nh - heteroaryl , — so 2 nh - heterocycloalkyl , — nhso 2 - c 1 - c 12 - alkyl , — nhso 2 - c 2 - c 12 - alkenyl , — nhso 2 — c 2 - c 12 - alkenyl , — nhso 2 — c 3 - c 12 - cycloalkyl , — nhso 2 - aryl , — nhso 2 - heteroaryl , — nhso 2 - heterocycloalkyl , — ch 2 nh 2 , — ch 2 so 2 ch 3 , - aryl , - arylalkyl , - heteroaryl , - heteroarylalkyl , - heterocycloalkyl , — c 3 - c 12 - cycloalkyl , polyalkoxyalkyl , polyalkoxy , - methoxymethoxy , - methoxyethoxy , — sh , — s — c 1 - c 12 - alkyl , — s — c 2 - c 12 - alkenyl , — s — c 2 - c 12 - alkenyl , — s — c 3 - c 12 - cycloalkyl , — s - aryl , — s - heteroaryl , — s - heterocycloalkyl , or methylthiomethyl . it is understood that the aryls , heteroaryls , alkyls , and the like can be further substituted . in some cases , each substituent in a substituted moiety is additionally optionally substituted with one or more groups , each group being independently selected from — f , - cl , - br , — i , — oh , — no 2 , — cn , or — nh 2 . in accordance with the invention , any of the aryls , substituted aryls , heteroaryls and substituted heteroaryls described herein , can be any aromatic group . aromatic groups can be substituted or unsubstituted . it is understood that any alkyl , alkenyl , alkynyl , cycloalkyl and cycloalkenyl moiety described herein can also be an aliphatic group , an alicyclic group or a heterocyclic group . an “ aliphatic group ” is non - aromatic moiety that may contain any combination of carbon atoms , hydrogen atoms , halogen atoms , oxygen , nitrogen or other atoms , and optionally contain one or more units of unsaturation , e . g ., double and / or triple bonds . an aliphatic group may be straight chained , branched or cyclic and preferably contains between about 1 and about 24 carbon atoms , more typically between about 1 and about 12 carbon atoms . in addition to aliphatic hydrocarbon groups , aliphatic groups include , for example , polyalkoxyalkyls , such as polyalkylene glycols , polyamines , and polyimines , for example . such aliphatic groups may be further substituted . it is understood that aliphatic groups may be used in place of the alkyl , alkenyl , alkynyl , alkylene , alkenylene , and alkynylene groups described herein . the term “ alicyclic ,” as used herein , denotes a monovalent group derived from a monocyclic or polycyclic saturated carbocyclic ring compound by the removal of a single hydrogen atom . examples include , but not limited to , cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , bicyclo [ 2 . 2 . 1 ] heptyl , and bicyclo [ 2 . 2 . 2 ] octyl . such alicyclic groups may be further substituted . it will be apparent that in various embodiments of the invention , the substituted or unsubstituted alkyl , alkenyl , alkynyl , cycloalkyl , cycloalkenyl , cycloalkynyl , arylalkyl , heteroarylalkyl , and heterocycloalkyl are intended to be monovalent or divalent . thus , alkylene , alkenylene , and alkynylene , cycloaklylene , cycloalkenylene , cycloalkynylene , arylalkylene , hetoerarylalkylene and heterocycloalkylene groups are to be included in the above definitions , and are applicable to provide the formulas herein with proper valency . the term “ hydroxy activating group ”, as used herein , refers to a labile chemical moiety which is known in the art to activate a hydroxy group so that it will depart during synthetic procedures such as in a substitution or elimination reactions . examples of hydroxy activating group include , but not limited to , mesylate , tosylate , triflate , p - nitrobenzoate , phosphonate and the like . the term “ activated hydroxy ”, as used herein , refers to a hydroxy group activated with a hydroxy activating group , as defined above , including mesylate , tosylate , triflate , p - nitrobenzoate , phosphonate groups , for example . the term “ protected hydroxy ,” as used herein , refers to a hydroxy group protected with a hydroxy protecting group , as defined above , including benzoyl , acetyl , trimethylsilyl , triethylsilyl , methoxymethyl groups . the terms “ halo ” and “ halogen ,” as used herein , refer to an atom selected from fluorine , chlorine , bromine and iodine . the compounds described herein contain one or more asymmetric centers and thus give rise to enantiomers , diastereomers , and other stereoisomeric forms that may be defined , in terms of absolute stereochemistry , as ( r )— or ( s )—, or as ( d )- or ( l )- for amino acids . the present invention is meant to include all such possible isomers , as well as their racemic and optically pure forms . optical isomers may be prepared from their respective optically active precursors by the procedures described above , or by resolving the racemic mixtures . the resolution can be carried out in the presence of a resolving agent , by chromatography or by repeated crystallization or by some combination of these techniques which are known to those skilled in the art . further details regarding resolutions can be found in jacques , et al ., enantiomers , racemates , and resolutions ( john wiley & amp ; sons , 1981 ). when the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry , and unless specified otherwise , it is intended that the compounds include both e and z geometric isomers . likewise , all tautomeric forms are also intended to be included . the configuration of any carbon - carbon double bond appearing herein is selected for convenience only and is not intended to designate a particular configuration unless the text so states ; thus a carbon - carbon double bond depicted arbitrarily herein as trans may be cis , trans , or a mixture of the two in any proportion . the term “ subject ” as used herein refers to a mammal . a subject therefore refers to , for example , dogs , cats , horses , cows , pigs , guinea pigs , and the like . preferably the subject is a human . when the subject is a human , the subject may be referred to herein as a patient . as used herein , the term “ pharmaceutically acceptable salt ” refers to those salts of the compounds formed by the process of the present invention which are , within the scope of sound medical judgment , suitable for use in contact with the tissues of humans and lower animals without undue toxicity , irritation , allergic response and the like , and are commensurate with a reasonable benefit / risk ratio . pharmaceutically acceptable salts are well known in the art . the term “ hydroxy protecting group ,” as used herein , refers to a labile chemical moiety which is known in the art to protect a hydroxy group against undesired reactions during synthetic procedures . after said synthetic procedure ( s ) the hydroxy protecting group as described herein may be selectively removed . hydroxy protecting groups as known in the are described generally in t . h . greene and p . g ., s . m . wuts , protective groups in organic synthesis , 3rd edition , john wiley & amp ; sons , new york ( 1999 ). examples of hydroxy protecting groups include benzyloxycarbonyl , 4 - nitrobenzyloxycarbonyl , 4 - bromobenzyloxycarbonyl , 4 - methoxybenzyloxycarbonyl , methoxycarbonyl , tert - butoxycarbonyl , isopropoxycarbonyl , diphenylmethoxycarbonyl , 2 , 2 , 2 - trichloroethoxycarbonyl , 2 -( trimethylsilyl ) ethoxycarbonyl , 2 - furfuryloxycarbonyl , allyloxycarbonyl , acetyl , formyl , chloroacetyl , trifluoroacetyl , methoxyacetyl , phenoxyacetyl , benzoyl , methyl , t - butyl , 2 , 2 , 2 - trichloroethyl , 2 - trimethylsilyl ethyl , 1 , 1 - dimethyl - 2 - propenyl , 3 - methyl - 3 - butenyl , allyl , benzyl , para - methoxybenzyldiphenylmethyl , triphenylmethyl ( trityl ), tetrahydrofuryl , methoxymethyl , methylthiomethyl , benzyloxymethyl , 2 , 2 , 2 - triehloroethoxymethyl , 2 -( trimethylsilyl ) ethoxymethyl , methanesulfonyl , para - toluenesulfonyl , trimethylsilyl , triethylsilyl , triisopropylsilyl , and the like . preferred hydroxy protecting groups for the present invention are acetyl ( ac or — c ( o ) ch 3 ), benzoyl ( bz or — c ( o ) c 6 h 5 ), and trimethylsilyl ( tms or - si ( ch 3 ) 3 ). berge , et al . describes pharmaceutically acceptable salts in detail in j . pharmaceutical sciences , 66 : 1 - 19 ( 1977 ). the salts can be prepared in situ during the final isolation and purification of the compounds of the invention , or separately by reacting the free base function with a suitable organic acid . examples of pharmaceutically acceptable include , but are not limited to , nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid , hydrobromic acid , phosphoric acid , sulfuric acid and perchloric acid or with organic acids such as acetic acid , maleic acid , tartaric acid , citric acid , succinic acid or malonic acid or by using other methods used in the art such as ion exchange . other pharmaceutically acceptable salts include , but are not limited to , adipate , alginate , ascorbate , aspartate , benzenesulfonate , benzoate , bisulfate , borate , butyrate , camphorate , camphorsulfonate , citrate , cyclopentanepropionate , digluconate , dodecylsulfate , ethanesulfonate , formate , fumarate , glucoheptonate , glycerophosphate , gluconate , hemisulfate , heptanoate , hexanoate , hydroiodide , 2 - hydroxy - ethanesulfonate , lactobionate , lactate , laurate , lauryl sulfate , malate , maleate , malonate , methanesulfonate , 2 - naphthalenesulfonate , nicotinate , nitrate , oleate , oxalate , palmitate , pamoate , pectinate , persulfate , 3 - phenylpropionate , phosphate , picrate , pivalate , propionate , stearate , succinate , sulfate , tartrate , thiocyanate , p - toluenesulfonate , undecanoate , valerate salts , and the like . representative alkali or alkaline earth metal salts include sodium , lithium , potassium , calcium , magnesium , and the like . further pharmaceutically acceptable salts include , when appropriate , nontoxic ammonium , quaternary ammonium , and amine cations formed using counterions such as halide , hydroxide , carboxylate , sulfate , phosphate , nitrate , alkyl having from 1 to 6 carbon atoms , sulfonate and aryl sulfonate . the term “ amino protecting group ,” as used herein , refers to a labile chemical moiety which is known in the art to protect an amino group against undesired reactions during synthetic procedures . after said synthetic procedure ( s ) the amino protecting group as described herein may be selectively removed . amino protecting groups as known in the are described generally in t . h . greene and p . g . m . wuts , protective groups in organic synthesis , 3rd edition , john wiley & amp ; sons , new york ( 1999 ). examples of amino protecting groups include , but are not limited to , t - butoxycarbonyl , 9 - fluorenylmethoxycarbonyl , benzyloxycarbonyl , and the like . as used herein , the term “ pharmaceutically acceptable ester ” refers to esters of the compounds formed by the process of the present invention which hydrolyze in vivo and include those that break down readily in the human body to leave the parent compound or a salt thereof . suitable ester groups include , for example , those derived from pharmaceutically acceptable aliphatic carboxylic acids , particularly alkanoic , alkenoic , cycloalkanoic and alkanedioic acids , in which each alkyl or alkenyl moiety advantageously has not more than 6 carbon atoms . examples of particular esters include , but are not limited to , formates , acetates , propionates , butyrates , acrylates and ethylsuccinates . the term “ pharmaceutically acceptable prodrugs ” as used herein refers to those prodrugs of the compounds formed by the process of the present invention which are , within the scope of sound medical judgment , suitable for use in contact with the tissues of humans and lower animals with undue toxicity , irritation , allergic response , and the like , commensurate with a reasonable benefit / risk ratio , and effective for their intended use , as well as the zwitterionic forms , where possible , of the compounds of the present invention . “ prodrug ”, as used herein means a compound which is convertible in vivo by metabolic means ( e . g . by hydrolysis ) to afford any compound delineated by the formulae of the instant invention . various forms of prodrugs are known in the art , for example , as discussed in bundgaard , ( ed . ), design of prodrugs , elsevier ( 1985 ); widder , et al . ( ed . ), methods in enzymology , vol . 4 , academic press ( 1985 ); krogsgaard - larsen , et al ., ( ed ). “ design and application of prodrugs , textbook of drug design and development , chapter 5 , 113 - 191 ( 1991 ); bundgaard , et al ., journal of drug deliver reviews , 8 : 1 - 38 ( 1992 ); bundgaard , j . of pharmaceutical sciences , 77 : 285 et seq . ( 1988 ); higuchi and stella ( eds .) prodrugs as novel drug delivery systems , american chemical society ( 1975 ); and bernard testa & amp ; joachim mayer , “ hydrolysis in drug and prodrug metabolism : chemistry , biochemistry and enzymology ,” john wiley and sons , ltd . ( 2002 ). the term “ acyl ” includes residues derived from acids , including but not limited to carboxylic acids , carbamic acids , carbonic acids , sulfonic acids , and phosphorous acids . examples include aliphatic carbonyls , aromatic carbonyls , aliphatic sulfonyls , aromatic sulfinyls , aliphatic sulfinyls , aromatic phosphates and aliphatic phosphates . examples of aliphatic carbonyls include , but are not limited to , acetyl , propionyl , 2 - fluoroacetyl , butyryl , 2 - hydroxy acetyl , and the like . the term “ aprotic solvent ,” as used herein , refers to a solvent that is relatively inert to proton activity , i . e ., not acting as a proton - donor . examples include , but are not limited to , hydrocarbons , such as hexane and toluene , for example , halogenated hydrocarbons , such as , for example , methylene chloride , ethylene chloride , chloroform , and the like , heterocyclic compounds , such as , for example , tetrahydrofuran and n - methylpyrrolidinone , and ethers such as diethyl ether , bis - methoxymethyl ether . such solvents are well known to those skilled in the art , and individual solvents or mixtures thereof may be preferred for specific compounds and reaction conditions , depending upon such factors as the solubility of reagents , reactivity of reagents and preferred temperature ranges , for example . further discussions of aprotic solvents may be found in organic chemistry textbooks or in specialized monographs , for example : organic solvents physical properties and methods of purification , 4th ed ., edited by john a . riddick et al ., vol . ii , in the techniques of chemistry series , john wiley & amp ; sons , ny , 1986 . the terms “ protogenic organic solvent ,” or “ protic solvent ” as used herein , refer to a solvent that tends to provide protons , such as an alcohol , for example , methanol , ethanol , propanol , isopropanol , butanol , t - butanol , and the like . such solvents are well known to those skilled in the art , and individual solvents or mixtures thereof may be preferred for specific compounds and reaction conditions , depending upon such factors as the solubility of reagents , reactivity of reagents and preferred temperature ranges , for example . further discussions of protogenic solvents may be found in organic chemistry textbooks or in specialized monographs , for example : organic solvents physical properties and methods of purification , 4th ed ., edited by john a . riddick et al ., vol . ii , in the techniques of chemistry series , john wiley & amp ; sons , ny , 1986 . combinations of substituents and variables envisioned by this invention are only those that result in the formation of stable compounds . the term “ stable ”, as used herein , refers to compounds which possess stability sufficient to allow manufacture and which maintains the integrity of the compound for a sufficient period of time to be useful for the purposes detailed herein ( e . g ., therapeutic or prophylactic administration to a subject ). the synthesized compounds can be separated from a reaction mixture and further purified by a method such as column chromatography , high pressure liquid chromatography , or recrystallization . as can be appreciated by the skilled artisan , further methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art . additionally , the various synthetic steps may be performed in an alternate sequence or order to give the desired compounds . in addition , the solvents , temperatures , reaction durations , etc . delineated herein are for purposes of illustration only and one of ordinary skill in the art will recognize that variation of the reaction conditions can produce the desired bridged macrocyclic products of the present invention . synthetic chemistry transformations and protecting group methodologies ( protection and deprotection ) useful in synthesizing the compounds described herein are known in the art and include , for example , those such as described in r . larock , comprehensive organic transformations , vch publishers ( 1989 ); t . w . greene and p . g . m . wuts , protective groups in organic synthesis , 2d . ed ., john wiley and sons ( 1991 ); l . fieser and m . fieser , fieser and fieser &# 39 ; s reagents for organic synthesis , john wiley and sons ( 1994 ); and l . paquette , ed ., encyclopedia of reagents for organic synthesis , john wiley and sons ( 1995 ). the compounds of this invention may be modified by appending various functionalities via any synthetic means delineated herein to enhance selective biological properties . such modifications are known in the art and include those which increase biological penetration into a given biological system ( e . g ., blood , lymphatic system , central nervous system ), increase oral availability , increase solubility to allow administration by injection , alter metabolism and alter rate of excretion . the pharmaceutical compositions of the present invention comprise a therapeutically effective amount of a compound of the present invention formulated together with one or more pharmaceutically acceptable carriers . as used herein , the term “ pharmaceutically acceptable carrier ” means a non - toxic , inert solid , semi - solid or liquid filler , diluent , encapsulating material or formulation auxiliary of any type . some examples of materials which can serve as pharmaceutically acceptable carriers are sugars such as lactose , glucose and sucrose ; starches such as corn starch and potato starch ; cellulose and its derivatives such as sodium carboxymethyl cellulose , ethyl cellulose and cellulose acetate ; powdered tragacanth ; malt ; gelatin ; talc ; excipients such as cocoa butter and suppository waxes ; oils such as peanut oil , cottonseed oil ; safflower oil ; sesame oil ; olive oil ; corn oil and soybean oil ; glycols ; such a propylene glycol ; esters such as ethyl oleate and ethyl laurate ; agar ; buffering agents such as magnesium hydroxide and aluminum hydroxide ; alginic acid ; pyrogen - free water ; isotonic saline ; ringer &# 39 ; s solution ; ethyl alcohol , and phosphate buffer solutions , as well as other non - toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate , as well as coloring agents , releasing agents , coating agents , sweetening , flavoring and perfuming agents , preservatives and antioxidants can also be present in the composition , according to the judgment of the formulator . the pharmaceutical compositions of this invention can be administered to humans and other animals orally , rectally , parenterally , intracisternally , intravaginally , intraperitoneally , topically ( as by powders , ointments , or drops ), buccally , or as an oral or nasal spray . the pharmaceutical compositions of this invention may be administered orally , parenterally , by inhalation spray , topically , rectally , nasally , buccally , vaginally or via an implanted reservoir , preferably by oral administration or administration by injection . the pharmaceutical compositions of this invention may contain any conventional non - toxic pharmaceutically - acceptable carriers , adjuvants or vehicles . in some cases , the ph of the formulation may be adjusted with pharmaceutically acceptable acids , bases or buffers to enhance the stability of the formulated compound or its delivery form . the term parenteral as used herein includes subcutaneous , intracutaneous , intravenous , intramuscular , intraarticular , intraarterial , intrasynovial , intrasternal , intrathecal , intralesional and intracranial injection or infusion techniques . liquid dosage forms for oral administration include pharmaceutically acceptable emulsions , microemulsions , solutions , suspensions , syrups and elixirs . in addition to the active compounds , the liquid dosage forms may contain inert diluents commonly used in the art such as , for example , water or other solvents , solubilizing agents and emulsifiers such as ethyl alcohol , isopropyl alcohol , ethyl carbonate , ethyl acetate , benzyl alcohol , benzyl benzoate , propylene glycol , 1 , 3 - butylene glycol , dimethylformamide , oils ( in particular , cottonseed , groundnut , corn , germ , olive , castor , and sesame oils ), glycerol , tetrahydrofurfuryl alcohol , polyethylene glycols and fatty acid esters of sorbitan , and mixtures thereof . besides inert diluents , the oral compositions can also include adjuvants such as wetting agents , emulsifying and suspending agents , sweetening , flavoring , and perfuming agents . injectable preparations , for example , sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents . the sterile injectable preparation may also be a sterile injectable solution , suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent , for example , as a solution in 1 , 3 - butanediol . among the acceptable vehicles and solvents that may be employed are water , ringer &# 39 ; s solution , u . s . p . and isotonic sodium chloride solution . in addition , sterile , fixed oils are conventionally employed as a solvent or suspending medium . for this purpose any bland fixed oil can be employed including synthetic mono - or diglycerides . in addition , fatty acids such as oleic acid are used in the preparation of injectables . the injectable formulations can be sterilized , for example , by filtration through a bacterial - retaining filter , or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use . in order to prolong the effect of a drug , it is often desirable to slow the absorption of the drug from subcutaneous or intramuscular injection . this may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility . the rate of absorption of the drug then depends upon its rate of dissolution , which in turn , may depend upon crystal size and crystalline form . alternatively , delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle . injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide - polyglycolide . depending upon the ratio of drug to polymer and the nature of the particular polymer employed , the rate of drug release can be controlled . examples of other biodegradable polymers include poly ( orthoesters ) and poly ( anhydrides ). depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues . compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the compounds of this invention with suitable non - irritating excipients or carriers such as cocoa butter , polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound . solid dosage forms for oral administration include capsules , tablets , pills , powders , and granules . in such solid dosage forms , the active compound is mixed with at least one inert , pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and / or : a ) fillers or extenders such as starches , lactose , sucrose , glucose , mannitol , and silicic acid , b ) binders such as , for example , carboxymethylcellulose , alginates , gelatin , polyvinylpyrrolidinone , sucrose , and acacia , c ) humectants such as glycerol , d ) disintegrating agents such as agar - agar , calcium carbonate , potato or tapioca starch , alginic acid , certain silicates , and sodium carbonate , e ) solution retarding agents such as paraffin , f ) absorption accelerators such as quaternary ammonium compounds , g ) wetting agents such as , for example , cetyl alcohol and glycerol monostearate , h ) absorbents such as kaolin and bentonite clay , and i ) lubricants such as talc , calcium stearate , magnesium stearate , solid polyethylene glycols , sodium lauryl sulfate , and mixtures thereof . in the case of capsules , tablets and pills , the dosage form may also comprise buffering agents . solid compositions of a similar type may also be employed as fillers in soft and hard - filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like . the active compounds can also be in micro - encapsulated form with one or more excipients as noted above . the solid dosage forms of tablets , dragees , capsules , pills , and granules can be prepared with coatings and shells such as enteric coatings , release controlling coatings and other coatings well known in the pharmaceutical formulating art . in such solid dosage forms the active compound may be admixed with at least one inert diluent such as sucrose , lactose or starch . such dosage forms may also comprise , as is normal practice , additional substances other than inert diluents , e . g ., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose . in the case of capsules , tablets and pills , the dosage forms may also comprise buffering agents . they may optionally contain opacifying agents and can also be of a composition that they release the active ingredient ( s ) only , or preferentially , in a certain part of the intestinal tract , optionally , in a delayed manner . examples of embedding compositions which can be used include polymeric substances and waxes . dosage forms for topical or transdermal administration of a compound of this invention include ointments , pastes , creams , lotions , gels , powders , solutions , sprays , inhalants or patches . the active component is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required . ophthalmic formulation , ear drops , eye ointments , powders and solutions are also contemplated as being within the scope of this invention . the ointments , pastes , creams and gels may contain , in addition to an active compound of this invention , excipients such as animal and vegetable fats , oils , waxes , paraffins , starch , tragacanth , cellulose derivatives , polyethylene glycols , silicones , bentonites , silicic acid , talc and zinc oxide , or mixtures thereof . powders and sprays can contain , in addition to the compounds of this invention , excipients such as lactose , talc , silicic acid , aluminum hydroxide , calcium silicates and polyamide powder , or mixtures of these substances . sprays can additionally contain customary propellants such as chlorofluorohydrocarbons . transdermal patches have the added advantage of providing controlled delivery of a compound to the body . such dosage forms can be made by dissolving or dispensing the compound in the proper medium . absorption enhancers can also be used to increase the flux of the compound across the skin . the rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel . an inhibitory amount or dose of the compounds of the present invention may range from about 0 . 1 mg / kg to about 500 mg / kg , alternatively from about 1 to about 50 mg / kg . inhibitory amounts or doses will also vary depending on route of administration , as well as the possibility of co - usage with other agents . according to the methods of treatment of the present invention , viral infections are treated or prevented in a subject , such as a human or lower mammal , by administering to the subject an anti - hepatitis c virally effective amount or an inhibitory amount of a compound of the present invention , in such amounts and for such time as is necessary to achieve the desired result . an additional method of the present invention is the treatment of biological samples with an inhibitory amount of a compound of composition of the present invention in such amounts and for such time as is necessary to achieve the desired result . the term “ therapeutically effective amount ” of a compound of the invention , as used herein , means a sufficient amount of the compound so as to decrease the viral load in a subject and / or decrease the subject &# 39 ; s hcv symptoms . as is well understood in the medical arts a therapeutically effective amount of a compound of this invention will be at a reasonable benefit / risk ratio applicable to any medical treatment . the term “ anti - hepatitis c virally effective amount ” of a compound of the invention , as used herein , mean a sufficient amount of the compound so as to decrease the viral load in a biological sample or in a subject . as well understood in the medical arts , an anti - hepatitis c virally effective amount of a compound of this invention will be at a reasonable benefit / risk ratio applicable to any medical treatment . it will be understood , however , that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment . the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder ; the activity of the specific compound employed ; the specific composition employed ; the age , body weight , general health , sex and diet of the patient ; the time of administration , route of administration , and rate of excretion of the specific compound employed ; the duration of the treatment ; drugs used in combination or contemporaneously with the specific compound employed ; and like factors well known in the medical arts . the total daily dose of the compounds of this invention administered to a human or other animal in single or in divided doses can be in amounts , for example , from 0 . 01 to 50 mg / kg body weight or more usually from 0 . 1 to 25 mg / kg body weight . single dose compositions may contain such amounts or submultiples thereof to make up the daily dose . in general , treatment regimens according to the present invention comprise administration to a patient in need of such treatment from about 10 mg to about 1000 mg of the compound ( s ) of this invention per day in single or multiple doses . lower or higher doses than those recited above may be required . specific dosage and treatment regimens for any particular patient will depend upon a variety of factors , including the activity of the specific compound employed , the age , body weight , general health status , sex , diet , time of administration , rate of excretion , drug combination , the severity and course of the disease , condition or symptoms , the patient &# 39 ; s disposition to the disease , condition or symptoms , and the judgment of the treating physician . the term “ inhibitory amount ” of a compound of the present invention means a sufficient amount to decrease the hepatitis c viral load in a biological sample or a subject . it is understood that when said inhibitory amount of a compound of the present invention is administered to a subject it will be at a reasonable benefit / risk ratio applicable to any medical treatment as determined by a physician . the term “ biological sample ( s ),” as used herein , means a substance of biological origin intended for administration to a subject . examples of biological samples include , but are not limited to , blood and components thereof such as plasma , platelets , subpopulations of blood cells and the like ; organs such as kidney , liver , heart , lung , and the like ; sperm and ova ; bone marrow and components thereof , or stem cells . thus , another embodiment of the present invention is a method of treating a biological sample by contacting said biological sample with an inhibitory amount of a compound or pharmaceutical composition of the present invention . upon improvement of a patient &# 39 ; s condition , a maintenance dose of a compound , composition or combination of this invention may be administered , if necessary . subsequently , the dosage or frequency of administration , or both , may be reduced , as a function of the symptoms , to a level at which the improved condition is retained when the symptoms have been alleviated to the desired level . patients may , however , require intermittent treatment on a long - term basis upon any recurrence of disease symptoms . an additional method of the present invention is the treatment of biological samples with an inhibitory amount of a compound of the present invention in such amounts and for such time as is necessary to inhibit viral replication and / or reduce viral load . the term “ inhibitory amount ” means a sufficient amount to inhibit viral replication and / or decrease the hepatitis c viral load in a biological sample . the term “ biological sample ( s )” as used herein means a substance of biological origin intended for administration to a subject . examples of biological samples include , but are not limited to blood and components thereof such as plasma , platelets , subpopulations of blood cells and the like ; organs such as kidney , liver , heart , lung , and the like ; sperm and ova ; bone marrow and components thereof , or stem cells . thus another embodiment of the present invention is a method of treating a biological sample by contacting said biological sample with an inhibitory amount of a compound or pharmaceutical composition of the present invention . unless otherwise defined , all technical and scientific terms used herein are accorded the meaning commonly known to one with ordinary skill in the art . all publications , patents , published patent applications , and other references mentioned herein are hereby incorporated by reference in their entirety . abbreviations which have been used in the descriptions of the schemes and the examples that follow are : acn for acetonitrile ; ac for acetyl ; boc for tert - butoxycarbonyl ; bz for benzoyl ; bn for benzyl ; cdi for carbonyldiimidazole ; dba for dibenzylidene acetone ; cdi for 1 , 1 ′- carbonyldiimidizole ; dbu for 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ; dcm for dichloromethane ; diad for diisopropylazodicarboxylate ; dmap for dimethylaminopyridine ; dmf for dimethyl formamide ; dmso for dimethyl sulfoxide ; dppb for diphenylphosphino butane ; etoac for ethyl acetate ; hatu for 2 -( 7 - aza - 1h - benzotriazole - 1 - yl )- 1 , 1 , 3 , 3 - tetramethyluronium hexafluorophosphate ; iproh for isopropanol ; nahmds for sodium bis ( trimethylsilyl ) amide ; nmo for n - methylmorpholine n - oxide ; meoh for methanol ; ph for phenyl ; popd for dihydrogen dichlorobis ( di - tert - butylphosphino ) palladium ( ii ); tbahs for tetrabutyl ammonium hydrogen sulfate ; tea for triethylamine ; thf for tetrahydrofuran ; tpp for triphenylphosphine ; tris for tris ( hydroxymethyl ) aminomethane ; bme for 2 - mercaptoethanol ; bop for benzotriazol - 1 - yloxy - tris ( dimethylamino ) phosphonium hexafluorophosphate ; cod for cyclooctadiene ; dast for diethylaminosulfur trifluoride ; dabcyl for 6 -( n - 4 ′- carboxy - 4 -( dimethylamino ) azobenzene )- aminohexyl - 1 - o -( 2 - cyanoethyl )-( n , n - diisopropyl )- phosphoramidite ; dcm for dichloromethane ; diad for diisopropyl azodicarboxylate ; dibal - h for diisobutylaluminum hydride ; diea for diisopropyl ethylamine ; dmap for n , n - dimethylaminopyridine ; dme for ethylene glycol dimethyl ether ; dmem for dulbecco &# 39 ; s modified eagles media ; edans for 5 -( 2 - amino - ethylamino )- naphthalene - 1 - sulfonic acid ; dmf for n , n - dimethyl formamide ; esi for electrospray ionization ; et dmso for dimethylsulfoxide ; duphos for the compounds and processes of the present invention will be better understood in connection with the following synthetic schemes that illustrate the methods by which the compounds of the invention may be prepared . all of the 15 - membered macrocyclic compounds of the present invention were prepared from the common intermediate 1 - 7 . the synthesis of compound 1 - 7 is outlined in scheme 1 . coupling of commercially available trans - boc - hydroxyproline 1 - 1 with cyclopropyl - containing amine 1 - 2 using hatu , afforded intermediate 1 - 3 . deprotection of 1 - 3 with hcl in dioxane followed by coupling with the acid 1 - 5 yielded tri - peptide 1 - 6 . other amino acid derivatives containing a terminal alkene may be used in place of 1 - 5 in order to generate varied macrocyclic structures ( for further details see wo / 0059929 ). finally , ring - closing metathesis with a ruthenium - based catalyst gave the desired key intermediate 1 - 7 ( for further details on ring closing metathesis see recent reviews : grubbs et al ., acc . chem . res ., 1995 , 28 , 446 ; shrock et al ., tetrahedron 1999 , 55 , 8141 ; furstner , a . angew . chem . int . ed . 2000 , 39 , 3012 ; trnka et al ., acc . chem . res . 2001 , 34 , 18 ; and hoveyda et al ., chem . eur . j . 20 2001 , 7 , 945 ). the arylalkyl substituted compounds 2 - 2 was prepared by an alkylation at the hydroxyl group on the proline . the typical conditions for the alkylation includes , but not limited to nah / dmf , dbu / thf , koh / dmf , naoh aq . with phase transfer reagent , etc . the alkylating reagents include , but not limited to , compounds 2 - 1 - a to 2 - 1 - e as shown in scheme 2 . the alkylated intermediates were then hydrolyzed by lioh in aq . methanol or thf to yield compounds 2 - 2 . the sulfonamides 2 - 3 were prepared from the corresponding acids 2 - 2 by subjecting the acid to a coupling reagent ( i . e . cdi , hatu , dcc , edc and the like ) at rt or at elevated temperature , with the subsequent addition of the corresponding sulfonamide r 3 — s ( o ) 2 — nh 2 in the presence of base wherein r 3 and z are as previously defined in formula i . the tripeptide analogs 3 - 4 and 3 - 5 of the present invention were synthesized according scheme 3 . similarly as described in scheme 1 , coupling of an amino acid 3 - 1 with the dipeptide 1 - 4 provided the tripeptide intermediate 3 - 2 . the tripeptide intermediate 3 - 2 was then alkylated to form 3 - 3 followed by hydrolysis to afford the acids 3 - 4 as described in scheme 2 . the sulfonamides 3 - 5 were prepared from the corresponding acids 3 - 4 by subjecting the acid to a coupling reagent ( i . e . cdi , hatu , dcc , edc and the like ) at rt or at elevated temperature , with the subsequent addition of the corresponding sulfonamide r 3 — s ( o ) 2 — nh 2 in the presence of base wherein r 3 , u and z are as previously defined in formula i . scheme 4 illustrates the modification of the n - terminal of the macrocycle . deprotection of the boc moiety with an acid , such as , but not limited to hydrochloric acid yields compounds of formula ( 4 - 2 ). the amino moiety of formula ( 4 - 2 ) can be alkylated or acylated with appropriate alkyl halide or acyl groups to give compounds of formula ( 4 - 3 ). compounds of formula ( 4 - 3 ) can be hydrolyzed with base such as lithium hydroxide to free up the acid moiety of formula ( 4 - 4 ). subsequent activation of the acid moiety ( i . e . cdi , hatu , edc and the like ) followed by treatment with an sulfonamide including , but not limited to cyclopropylsulfonamide , phenyl sulfonamide , thienylsulfonamide , methyl sulfonamide etc . groups to provide compounds of formula ( 4 - 5 ), wherein a , z and r3 are as previously defined in formula i . scheme 5 illustrates an alternative method for the modification of the n - terminal of the macrocycle . deprotection of the boc moiety of 2 - 3 with an acid , such as , but not limited to hydrochloric acid yields compounds of formula ( 5 - 1 ).) the amino moiety of formula ( 5 - 1 ) can be alkylated or acylated with appropriate alkyl halide or acyl groups to give compounds of formula ( 5 - 2 ). wherein a and z are as previously defined in formula i . the modification of the n - terminal of the tripeptide compounds 3 - 4 and 3 - 5 are done by the same method outlined in scheme 4 and 5 . all references cited herein , whether in print , electronic , computer readable storage media or other form , are expressly incorporated by reference in their entirety , including but not limited to , abstracts , articles , journals , publications , texts , treatises , internet web sites , databases , patents , and patent publications . the compounds and processes of the present invention will be better understood in connection with the following examples ( example numbers correlate with numbers within table 1 ), which are intended as illustrations only and not to limit the scope of the invention . various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art and such changes and modifications including , without limitation , those relating to the chemical structures , substituents , derivatives , formulations and / or methods of the invention may be made without departing from the spirit of the invention and the scope of the appended claims . 1a . to a solution of commercially available trans - boc - hydroxyproline 1 - 1 ( 12 . 72 g , 55 mol ) and amino acid 1 - 2 ( 10 . 54 g , 55 mol ) in 65 ml dmf was added hatu ( 20 . 9 g , 55 mmol ) and diea ( 28 . 7 ml , 165 mmol ). the coupling was carried out at 0 ° c . over a period of 1 hour . the reaction mixture was diluted with 500 ml etoac , and directly washed with 1m nahco 3 ( 4 × 100 ml ) and brine ( 2 × 50 ml ). the organic phase was dried over anhydrous na 2 so 4 , filtered , and then concentrated in vacuo , affording the dipeptide 1 - 3 that was identified by hplc ( retention time = 8 . 9 min , 30 - 70 %, 90 % b ), and ms ( found 369 . 18 , m + h + ). 1b . dipeptide 1 - 3 from step 1b was dissolved in 140 ml of 4n hcl in dioxane . the reaction mixture was stirred at room temperature for 2 h until lcms showed the complete consumption of starting material . the solvent was removed in vacuo to afford the intermediate 1 - 4 , ms ( found 269 . 15 , m + h + ). 1c . to a solution of boc - l - 2 - amino - 8 - nonenoic acid 1 - 5 ( 14 . 9 g , 55 mol ) and the compound from step 1b in 70 ml dmf was added hatu ( 20 . 9 g , 55 mmol ) and diea ( 28 . 7 ml , 165 mmol ). the coupling was carried out at 0 ° c . over a period of 1 hour . the reaction mixture was diluted with 500 ml etoac , and directly washed with 1m nahco 3 ( 4 × 100 ml ) and brine ( 2 × 50 ml ). the organic phase was dried over anhydrous na 2 so 4 , filtered , and then concentrated in vacuo , purified by flash column ( ethyl acetate ) to afford the tripeptide 1 - 6 ( 21 . 16 g , 74 % 3 steps ; ms : 522 . 29 , m + h + ). 1d . ring closing metathesis ( rcm ). a solution of the linear tripeptide 1 - 6 ( 10 g , 19 . 2 mmol ) in 2 . 2 1 anhydrous dcm was deoxygenated by n 2 bubbling . hoveyda &# 39 ; s 1 st generation catalyst ( 8 . 5 mol % eq .) was then added as a solid . the reaction was refluxed under n 2 atmosphere for 12 hours . the solvent was evaporated and the residue was purified by silica gel flash chromatography using etoac . the cyclic peptide precursor 1 - 7 was isolated as a white powder ( 3 . 40 , 36 %, ms : 494 . 29 m + h ). to a solution of macrocyclic precursor 1 - 7 ( 50 mg , 0 . 1 mmol ) and 8 - bromomethyl - quinoline ( 28 mg , 0 . 12 mmol ) in 3 ml methylene chloride was added 50 % aq . naoh ( 0 . 5 ml ) and tbai ( tetrabutylammonium iodide , 5 mg , catalyst ). the reaction mixture was stirred at rt for 1 hour . lc - ms showed the completion of the reaction . the aq . portion ( at the bottom of container ) was taken up and discarded . the organic layer was washed with saturated aqueous nahco3 solution , water and brine consequently . the organic layer was dried over anhydrous sodium sulfate . the organic phase was then filtered , concentrated in vacuo to give a light yellow solid which was used directly in the next step . the compound of step 2a and lithium hydroxide ( 10 equiv .) in thf / meoh / h 2 o ( 2 : 1 : 0 . 5 ) was stirred at room temperature for 10 hours . the excess solvents were evaporated in vacuo , and the resulting residue was diluted with water and acidified to ph ˜ 5 . the mixture was extracted with etoac ( 2 ×). the combined organic extracts were washed once with brine , dried ( mgso 4 ), filtered and concentrated in vacuo to give an oily residue , which was purified by column chromatography eluting with 2 - 10 % methanol - chloroform to give the title compound ( 36 . 0 mg 60 % for 2 steps ). the title compound was prepared following the procedure described in example 2 by starting with the corresponding halide . the title compound was prepared following the procedure described in example 2 by starting with the corresponding halide . the title compound was prepared following the procedure described in example 2 by starting with the corresponding halide . the title compound was prepared following the procedure described in example 2 by starting with the corresponding halide . the title compound was prepared following the procedure described in example 2 by starting with the corresponding halide . the title compound was prepared following the procedure described in example 2 by starting with the corresponding halide . the title compound was prepared following the procedure described in example 2 by starting with the corresponding halide . the title compound was prepared following the procedure described in example 2 by starting with the corresponding halide . the title compound is prepared following the procedure described in example 2 by starting with the corresponding halide . step 12a : cyclopropylsulfonyl chloride ( 1 . 4 g , 10 mmol ) was dissolved in 0 . 5 m ammonia in dioxane ( 50 ml , 25 mmol ) at rt . the reaction was kept at rt for 3 days . the large amount of precipitation was filtered and discarded . the clear filtrate was evaporated in vacuo and the white residue was dried on vacuum for 24 hours to give the cyclopropylsulfonamide ( 0 . 88 g , 74 %). 1 h - nmr ( 500 mhz , cd 3 cl ): δ 4 . 62 ( 2h , s ), 2 . 59 ( 1h , m ), 1 . 20 ( 2h , m ), 1 . 02 ( 2h , m ). step 12b : the title compound from example 4 ( 20 . 0 mg , 0 . 031 mmol ) and carbonyldiimidazole ( 7 . 2 mg , 0 . 044 mmol ) were dissolved in 1 . 0 ml anhydrous dmf and the resulting solution was heated to 40 ° c . for 1 hour . cyclopropylsulfonamide ( 10 . 0 mg , 0 . 08 mmol ) was added to the reaction followed by dbu ( 6 . 1 mg , 0 . 04 mmol ). the reaction mixture was stirred at 40 ° c . for 10 hour . lcms showed the formation of the desired product . the reaction was cooled down and 10 ml ethyl acetate was added to the solution . the mixture was washed with saturated aqueous nahco 3 solution , water and brine . the organic layer was dried over anhydrous sodium sulfate . the organic phase was then filtered , concentrated in vacuo and subsequently purified by flash chromatography ( ethyl acetate / hexanes 1 : 1 ) to give 12 . 0 mg ( 52 %) of the title compound . the title compound was prepared following the procedure described in example 12 by starting with the title compound of example 6 . the title compound from example 13 ( 20 mg , 0 . 027 mmol ) and phenyltributyltin ( 13 . 0 mg , 0 . 035 mmol ) were dissolved in 1 . 0 ml anhydrous toluene . the resulting solution was degassed and flushed with nitrogen . tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 4 . 0 mg , 0 . 003 mmol ) was added to the reaction solution . the resulting mixture was heated to 100 ° c . for 2 hours . the solvent was then removed in vacuo and the residue was subsequently purified by flash chromatography ( ethyl acetate / hexanes 1 : 1 ) to give 21 . 0 mg ( 100 %) of the title compound . the title compound was prepared following the procedure described in example 14 by using thienyltributyltin . the title compound was prepared following the procedure described in example 12 by starting with the title compound of example 2 . the title compound was prepared following the procedure described in example 12 by starting with the title compound of example 8 . the title compound is prepared following the procedure described in example 12 by starting with the title compound of example 9 . the title compound was prepared following the procedure described in example 12 by starting with the title compound of example 10 . the title compound from example 12 ( 177 mg , 0 . 25 mmol ) was treated with hcl ( 4 m in dioxane , 5 ml , 20 mmol ). the reaction mixture was stirred at room temperature for 1 h until lcms showed the complete consumption of starting material . the solvent was removed in vacuo . the chloroformate reagent was prepared by dissolving 1 . 25 mmol of cyclobutanol in thf ( 5 ml ) and adding 2 . 5 mmol of phosgene in toluene ( 20 %). the resulting reaction mixture was stirred at room temperature for 2 hours and the solvent was removed in vacuo . to the residue was added dcm and subsequently concentrated to dryness twice in vacuo yielding chloroformate reagent . the resulting residue from step 20a ( 88 . 0 mg , 0 . 145 mmol ) was dissolved in dcm ( 5 . 0 ml ) then treated with cyclobutyl chloroformate prepared in step 20b ( 100 mg , 0 . 75 mmol ) and ipr 2 net ( 0 . 20 ml , excess ). the reaction mixture was stirred for 10 h . ethyl acetate ( 15 ml ) was added to the solution . the mixture was washed with saturated aqueous nahco3 solution , water and brine consequently . the organic layer was dried over anhydrous sodium sulfate . the organic phase was then filtered , concentrated in vacuo and subsequently purified by flash chromatography ( ethyl acetate / hexanes 1 : 1 ) to give 55 . 0 mg ( 55 %) of the title compound . the title compound was prepared following the procedure described in example 20 by using the cyclopentyl chloroformate . the title compound is prepared following the procedure described in example 20 by using thiophene - 2 - carboxylic acid and edc in the place of the chloroformate . the title compound is prepared from the title compound of example 19 following the procedure described in example 20 by using thiophene - 2 - carboxylic acid and edc in the place of the chloroformate . additional compounds ( example 24 - 40 ) of the present invention that may be prepared via methods described in examples 1 - 23 are shown in table 3 below : step 41a . to a solution of boc - l - tert - leucine 41 - 1 ( 0 . 37 g , 1 . 6 mmol ), the compound from step 1b ( 1 - 4 ) ( 414 mg , 1 . 36 mmol ), and diea ( 1 . 0 ml , 5 . 0 mmol ) in dmf ( 3 . 0 ml ) at 0 ° c . was added in hatu ( 0 . 6 g , 1 . 6 mmol ). the mixture was stirred at rt for 10 h , diluted with etoac and washed with half - sat .- aq . nacl four times . the organic phase was dried over anhydrous mgso 4 , filtered , and then concentrated in vacuo . the residue was purified by silica gel chromatography ( hexane / etoac = 1 : 1 to 1 : 2 ) to afford the desired compound 41 - 2 ( 535 mg . 83 %). ms ( esi ): m / e 482 . 34 ( m + h ). step 41b . to a solution of the compound from step 41a ( 100 mg , 0 . 21 mmol ) and 2 - bromomethyl - naphthalene ( 48 mg , 0 . 22 mmol ) in 4 ml methylene chloride was added 50 % aq . naoh ( 0 . 2 ml ) and tbai ( tetrabutylammonium iodide , 15 mg , catalyst ). the reaction mixture was stirred at rt for 1 hour . lc - ms showed the completion of the reaction . the aq . portion ( at the bottom of container ) was taken up and discarded . the organic layer was washed with saturated aqueous nahco3 solution , water and brine consequently . the organic layer was dried over anhydrous sodium sulfate . the organic phase was then filtered , concentrated in vacuo to give 41 - 3 as a light yellow solid which was used directly in the next step . step 41c . the compound of step 41b and lithium hydroxide ( 10 equiv .) in thf / meoh / h 2 o ( 2 : 1 : 0 . 5 ) was stirred at room temperature for 10 hours . the excess solvents were evaporated in vacuo , and the resulting residue was diluted with water and acidified to ph ˜ 5 . the mixture was extracted with etoac ( 2 ×). the combined organic extracts were washed once with brine , dried ( mgso 4 ), filtered and concentrated in vacuo , and was purified by column chromatography eluting with 2 - 10 % methanol - etoac to give the title compound 41 - 4 ( 120 . 0 mg 95 % for 2 steps ). the title compound was prepared from the compound of example 41 following the procedure described in example 12 . additional compounds ( example 43 - 79 ) of the present invention that may be prepared via methods described in example 41 are shown below in table 4 . the general methods for such substitution on proline is either illustrated in schemes 2 and 3 , or in examples 2 - 40 by substituting the macrocyclic core structures with the acyclic structure from example 41 . the compounds of the present invention exhibit potent inhibitory properties against the hcv ns3 protease . the following examples describe assays in which the compounds of the present invention can be tested for anti - hcv effects . hcv protease activity and inhibition is assayed using an internally quenched fluorogenic substrate . a dabcyl and an edans group are attached to opposite ends of a short peptide . quenching of the edans fluorescence by the dabcyl group is relieved upon proteolytic cleavage . fluorescence is measured with a molecular devices fluoromax ( or equivalent ) using an excitation wavelength of 355 nm and an emission wavelength of 485 nm . the assay is run in corning white half - area 96 - well plates ( vwr 29444 - 312 [ corning 3693 ]) with full - length ns3 hcv protease 1 b tethered with ns4a cofactor ( final enzyme concentration 1 to 15 nm ). the assay buffer is complemented with 10 μm ns4a cofactor pep 4a ( anaspec 25336 or in - house , mw 1424 . 8 ). ret s1 ( ac - asp - glu - asp ( edans )- glu - glu - abu -[ coo ] ala - ser - lys -( dabcyl )- nh 2 ,- anaspec 22991 , mw 1548 . 6 ) is used as the fluorogenic peptide substrate . the assay buffer contains 50 mm hepes at ph 7 . 5 , 30 mm nacl and 10 mm bme . the enzyme reaction is followed over a 30 minutes time course at room temperature in the absence and presence of inhibitors . the peptide inhibitors hcv inh 1 ( anaspec 25345 , mw 796 . 8 ) ac - asp - glu - met - glu - glu - cys - oh , [− 20 ° c .] and hcv inh2 ( anaspec 25346 , mw 913 . 1 ) ac - asp - glu - dif - cha - cys - oh , are used as reference compounds . ic50 values are calculated using xlfit in activitybase ( idbs ) using equation 205 : y = a +(( b − a )/( 1 +(( c / x )̂ d ))) quantification of hcv replicon rna ( hcv cell based assay ) is accomplished using the huh 11 - 7 cell line ( lohmann , et al science 285 : 110 - 113 , 1999 ). cells are seeded at 4 × 10 3 cells / well in 96 well plates and fed media containing dmem ( high glucose ), 10 % fetal calf serum , penicillin - streptomycin and non - essential amino acids . cells are incubated in a 7 . 5 % co 2 incubator at 37 ° c . at the end of the incubation period , total rna is extracted and purified from cells using ambion rnaqueous 96 kit ( catalog no . am 1812 ). to amplify the hcv rna so that sufficient material can be detected by an hcv specific probe ( below ), primers specific for hcv ( below ) mediate both the reverse transcription of the hcv rna and the amplification of the cdna by polymerase chain reaction ( pcr ) using the taqman one - step rt - pcr master mix kit ( applied biosystems catalog no . 4309169 ). the nucleotide sequences of the rt - pcr primers , which are located in the ns5b region of the hcv genome , are the following : detection of the rt - pcr product is accomplished using the applied biosystems ( abi ) prism 7500 sequence detection system ( sds ) that detects the fluorescence that is emitted when the probe , which is labeled with a fluorescence reporter dye and a quencher dye , is degraded during the pcr reaction . the increase in the amount of fluorescence is measured during each cycle of pcr and reflects the increasing amount of rt - pcr product . specifically , quantification is based on the threshold cycle , where the amplification plot crosses a defined fluorescence threshold . comparison of the threshold cycles of the sample with a known standard provides a highly sensitive measure of relative template concentration in different samples ( abi user bulletin # 2 dec . 11 , 1997 ). the data is analyzed using the abi sds program version 1 . 7 . the relative template concentration can be converted to rna copy numbers by employing a standard curve of hcv rna standards with known copy number ( abi user bulletin # 2 dec . 11 , 1997 ). the rt reaction is performed at 48 ° c . for 30 minutes followed by pcr . thermal cycler parameters used for the pcr reaction on the abi prism 7500 sequence detection system are : one cycle at 95 ° c ., 10 minutes followed by 40 cycles each of which include one incubation at 95 ° c . for 15 seconds and a second incubation for 60 ° c . for 1 minute . to normalize the data to an internal control molecule within the cellular rna , rt - pcr is performed on the cellular messenger rna glyceraldehyde - 3 - phosphate dehydrogenase ( gapdh ). the gapdh copy number is very stable in the cell lines used . gapdh rt - pcr is performed on the same rna sample from which the hcv copy number is determined . the gapdh primers and probesare contained in the abi pre - developed taqman assay kit ( catalog no . 4310884e ). the ratio of hcv / gapdh rna is used to calculate the activity of compounds evaluated for inhibition of hcv rna replication . activity of compounds as inhibitors of hcv replication ( cell based assay ) in replicon containing huh - 7 cell lines . the effect of a specific anti - viral compound on hcv replicon rna levels in huh - 11 - 7cells is determined by comparing the amount of hcv rna normalized to gapdh ( e . g . the ratio of hcv / gapdh ) in the cells exposed to compound versus cells exposed to the dmso vehicle ( negative control ). specifically , cells are seeded at 4 × 10 3 cells / well in a 96 well plate and are incubated either with : 1 ) media containing 1 % dmso ( 0 % inhibition control ), or 2 ) media / 1 % dmso containing a fixed concentration of compound . 96 well plates as described above are then incubated at 37 ° c . for 4 days ( ec50 determination ). percent inhibition is defined as : % inhibition = 100 - 100 * s / c1 where s = the ratio of hcv rna copy number / gapdh rna copy number in the sample ; c1 = the ratio of hcv rna copy number / gapdh rna copy number in the 0 % inhibition control ( media / 1 % dmso ). the dose - response curve of the inhibitor is generated by adding compound in serial , three - fold dilutions over three logs to wells starting with the highest concentration of a specific compound at 1 . 5 um and ending with the lowest concentration of 0 . 23 nm . further dilution series ( 500 nm to 0 . 08 nm for example ) is performed if the ec50 value is not positioned well on the curve . ec50 is determined with the idbs activity base program “ xl fit ” using a 4 - paramater , non - linear regression fit ( model # 205 in version 4 . 2 . 1 , build 16 ). in the above assays , representative compounds are found to have activity . although the invention has been described with respect to various preferred embodiments , it is not intended to be limited thereto , but rather those skilled in the art will recognize that variations and modifications may be made therein which are within the spirit of the invention and the scope of the appended claims . | 2 |
only in so far as it is required in order to understand the present invention , fig1 shows a cylinder head 1 of a valve - controlled reciprocating - piston internal combustion engine , in particular of a four - stroke reciprocating - piston internal combustion engine ( diesel engine ), in which , in addition to the inlet valves which cannot be seen , two outlet valves 2 , 3 ( only the valve stems can be seen ) are guided displaceably . the valve springs which hold the valves 2 , 3 closed in a known manner are not shown here . the valve train which acts on the outlet valves 2 , 3 is composed of a driving cam 4 , of a camshaft of the internal combustion engine , a rocker arm 6 which is mounted pivotably on a fixed rocker - arm axis 5 , and a valve crosshead 7 which bridges the two outlet valves 2 . here , the functionally two - arm rocker arm 6 is of two - part configuration by way of example , having a cam lever 6 a and an actuating lever 6 b which acts on the valve crosshead 7 , which levers 6 a , 6 b project to both sides from the mounting on the rocker - arm axis 5 . the cam lever 6 a of the rocker arm 6 is mounted pivotably on the actuating lever 6 b by means of a separate pivot axis 8 and carries a roller 10 which is mounted rotatably on an axis 9 and runs on the cam 4 in order to drive the rocker arm 6 . lying outside the pivot axis 3 , a hydraulic valve - play compensation element 11 is arranged between the cam lever 6 a and the actuating lever 6 b , which valve - play compensation element 11 will be explained in further detail in the following text in conjunction with fig2 . the actuating lever 6 b of the rocker arm 6 loads the valve crosshead 7 via a setting screw 12 ( with lock nut ) and via a connecting cup 13 which is mounted spherically thereon , at a location which is positioned between the two outlet valves 2 , 3 . furthermore , a stationary brace 14 is provided above the valve crosshead 7 , the function of which brace 14 will be explained later . a piston / cylinder unit 15 is arranged within the valve crosshead 7 , having a piston 17 which is guided displaceably to a limited extent in one pressure space 16 and acts on the one outlet valve 2 . the pressure space 16 is connected via a feed channel 18 to an integrated non - return valve element , for example a ball check valve 19 , and via feed channels ( not shown in further detail ) which are denoted generally by 20 in the connecting cup 13 , the setting screw 12 , in the rocker arm 6 and finally via the rocker - arm axis 5 to the pressure - circulating lubricating - oil system of the internal combustion engine . it goes without saying that further channels 20 for lubricating the moving parts of the valve train are also provided in the rocker arm 6 ( cf . also fig2 ). in addition , a discharge channel 21 of defined cross section is provided in the valve crosshead 7 , which discharge channel 21 opens into the pressure space 16 of the piston / cylinder unit 15 and is controlled via the stationary brace 14 , as will be described in the following text . in an enlarged illustration and diagrammatically , fig2 shows a section of the rocker arm 6 with the cam lever 6 a and partially the actuating lever 6 b , into which the hvc 11 which is likewise configured as a piston / cylinder unit is intearated . to this end , a pressure space 22 which is connected to a feed channel 20 is configured in the actuating lever 6 b , in which pressure space 22 a first piston 23 is guided displaceably which acts on the cam lever 6 a by means of a tappet 24 . a second piston 25 is guided displaceably in the piston 23 , which second piston 25 delimits a second pressure space 26 , in which a non - return valve element , in particular a ball check valve 27 , is arranged . furthermore , a ventilating bore 20 a is provided . in a known way , valve play which occurs , for example , as a result of wear in the transmission chain between the cam 4 and the outlet valves 2 , 3 and / or the valve crosshead 7 can be eliminated by means of the hvc 11 , the tappet 24 extending or retracting correspondingly and changing the spacing s ( fig1 ) between the cam lever 6 a and the actuating lever 6 b of the rocker arm 6 correspondingly . in the regular mode of the internal combustion engine without engine braking , the two outlet valves 2 , 3 are opened via the rocker arm 6 and the valve crosshead 7 when passing the cam and are closed again when the cam base circle is reached . oil can escape from the pressure space 16 via the discharge opening 21 which is free when passing the cam , which oil , however , is replaced again via the feed channels 20 and the non - return valve 19 when passing the base circle . this dynamic equilibrium changes in the case of engine braking , in which an exhaust - gas flap in the exhaust - gas section of the internal combustion engine is closed and a considerable exhaust - gas backpressure or exhaust - gas pressure acts on that side of the outlet valves which faces away from the combustion chamber , which exhaust - gas backpressure or exhaust - gas pressure holds the outlet valve 2 open in an intermediate position in the case of corresponding coordination of the valve spring of the outlet valve and the design of the piston / cylinder unit 15 . it is to be ensured here that the control effect between the valve crosshead 7 ( discharge channel 21 ) and the brace 14 is not disrupted by excessively large valve play which possibly occurs . to this end , at least one means which exerts a force which is directed counter to the adjusting action of the hvc in the valve train is provided between the cam 4 and the cutlet valves . according to fig1 and 2 , said means is formed by at least one permanent magnet 28 ( shown using hatched lines ) which is inserted into the cam lever 6 a and exerts a magnetic force ( attractive force ) on the adjacent section of the actuating lever 6 b and / or the piston 23 or tappet 24 . this force has to be lower than the adjusting moment which is exerted by the hvc 11 , in order not to impair the regular , fired mode of the internal combustion engine and / or the regular valve - play adjustment . this permanent magnet 28 or possibly a further permanent magnet 28 a ( fig1 ) could also be provided in the brace 14 , the attractive force of which permanent magnet 28 or further permanent magnet 28 a is directed at the valve crosshead 7 , in order thus to counteract the valve crosshead 7 rising up from the brace 14 when passing the base circle of the cam lever 6 a in the case of engine braking . instead of or possibly also in addition to the arrangement in the brace 14 , the permanent magnet 28 a could also be provided in the connecting cup 13 or , in a reverse way in kinematic terms , in the valve crosshead 7 . fig2 shows further alternative means for exerting the force which is directed counter to the adjusting action of the hvc 11 , which alternative means can possibly also be used in a combined manner . for instance , a leg spring 29 with two spring arms 29 a which project radially can be arranged around the pivot axis 8 between the cam lever 6 a and the actuating lever 6 b , the spring arms 29 a engaging with ends 29 b which project at right angles into recesses or holes ( without reference numerals ) of the levers 6 a , 6 b and exerting a slight prestress on the levers 6 a , 6 b counter to the adjusting direction of the hvc . in a further additional or alternative refinement , a spring - elastic and / or elastomeric element , a pull band 30 here by way of example , can be provided between the cam lever 6 a and the actuating lever 6 b , which element prestresses the two levers 6 a , 6 b with respect to one another in a defined manner . for example , the pull band could be buttoned or fastened in another way to corresponding receptacles at free end sides of the cam lever 6 a and the actuating lever 6 b . the graphs according to fig3 to 5 show the function of the means 28 and / or 28 a and / or 29 and / or 30 which counteract the adjusting action of the hvc 11 with a lower force , which graphs illustrate the valve stroke and the opening curves 31 , 32 of the outlet valve 2 and an inlet valve over 720 degrees crank angle ( ca ) of the crankshaft of the internal combustion engine . here , the graph according to fig3 and 4 corresponds to the function without the use of the means 28 , 29 and / or 30 which exert an oppositely directed force , whereas the graph in fig5 describes this with the means 28 , 29 and / or 30 . fig3 first of all shows the operating state of the internal combustion engine with engine braking or evb function . starting from a zero line which corresponds to closed inlet valves and outlet valves 2 , 3 , the outlet valve 2 ( curve 31 ) is open in the intermediate position ( curve section 31 a ). during passing of the cam section of the cam 4 , the outlet valves 2 , 3 are opened at approximately 180 degrees ca and are closed again at approximately 330 degrees ca , as shown in the curve section 31 b . on account of the prevailing exhaust - gas backpressure and after the filling of the pressure space 16 in the piston / cylinder unit 15 ( curve section 31 c ), the outlet valve 2 is opened again into the intermediate position ( curve section 31 d ) for compression braking . the relatively linear curve 33 which is illustrated above this describes the measured position of the tappet 24 of the hvc 11 during this operating cycle and without the means 28 , 29 or 30 which exert an oppositely directed force . the curve 33 shows minimum lowering 33 a of the tappet 24 under the load of the valve opening at 31 b and , in particular , an adjustment ( arrows 38 ) of the tappet 24 after the closure of the outlet valves 2 , 3 in the region 33 b . this adjustment results from the indifferent movement sequences during the opening of the outlet valve 2 , controlled via the exhaust - gas backpressure , and can disrupt reliable functioning of the evb . fig4 shows the operating state of the internal combustion engine in the transition from the braking mode into the fired mode , the outlet valve 2 still being open in the intermediate position in the region 31 a ( combustion stroke ). after passing the cam region of the cam 4 with corresponding opening of the outlet valves 2 , 3 ( curve section 31 b ), both outlet valves 2 , 3 close again regularly at zero ( curve section 31 c ) on account of the absence of the exhaust - gas backpressure with the exhaust - gas flap now open in the exhaust - gas section of the internal combustion engine . the inlet valves with the opening curve 32 open and close in the region between 330 degrees ca and 540 degrees ca in the usual way . the curve 33 , lying above this , of the tappet 24 of the hvc in turn shows the lowering at 33 a and the required adjustment at curve section 33 b which lies above the curve section 31 c . the graph according to fig5 shows the described valve train with the means 28 , 29 or 30 which counteract the adjusting action of the hvc 11 with a lower force in the engine braking mode . here , the lines 34 limit the region from approximately 120 degrees ca to 420 degrees ca , in which region these means 28 , 29 , 30 do not act on account of the substantially higher actuating forces of the cam drive ( outside the cam base circle ). the relevant difference to the above - described graphs consists in the fact that , in the dynamic movement sequences over the work cycle of the internal combustion engine and , in particular , during the transition from the closed position of the outlet valve 2 into its intermediate position , no disruptive valve play occurs any more in the valve train and accordingly , according to curve 33 , no adjusting movement ( arrows 38 of fig3 and 4 and section 33 b ) takes place . as a result , the engine braking function evb is stabilized reliably as long as the exhaust - gas backpressure prevails . fig6 and 7 show the arrangement of a third piston / cylinder unit 35 in the brace 14 , both figures diagrammatically showing the position of the valve crosshead 7 relative to the brace 14 in two different wear phases / service life phases of an internal combustion engine . during the service life cycle of the valve train , changes in play and / or changes in spacing of adjacent components of the valve train can occur . a defined play or a virtually play - free spacing between individual components of the valve train are to be ensured by the hvc 11 at least in the operating state of the internal combustion engine ( at least after the operational oil pressure has been built up ). furthermore , however , the functionally reliable closing of the discharge channel 21 by the brace 14 during the passing of the base circle of the cam 4 is also essential . since the hvc 11 brings about an adjustment in order to compensate for wear , the position of the valve crosshead 7 can change during passing of the cam base circle , which is shown diagrammatically in fig6 and 7 by the different vertical position of the valve crosshead 7 with regard to the brace 14 . however , the abovementioned closure of the discharge channel 21 also has to be ensured in this case . this is achieved in the embodiment according to fig6 and 7 by the third piston / cylinder unit 35 . by means of a prestressing means which is arranged in the brace 14 ( for example , as shown , a spring 36 , as an alternative or in combination the prestressing element can also be configured as an elastomer or by means of magnets which repel one another ) which prestresses a piston 39 in the direction of the closure position of the discharge channel 21 in the valve crosshead 7 , reliable closure or shut - off of the discharge channel 21 is always achieved despite the changed position of the valve crosshead 7 . both the hvc 11 and the third piston / cylinder unit 35 have to provide extension and retraction reserves in the factory state , that is to say in the state of a new , unused engine . every possible change in the valve - train mechanism is therefore taken into consideration . in addition , a permanent magnet 37 , 38 can be arranged in each case in the brace 14 and the valve crosshead 7 . these two permanent magnets 37 , 38 attract one another , as a result of which a force which counteracts the adjusting action of the hvc 11 is exerted via the valve crosshead 7 and the connecting cup 13 . as an alternative or in addition to the embodiment which is shown , the third piston / cylinder unit 35 can also be furthermore , it can be seen from fig6 and 7 that the magnets can preferably be arranged in a separate component region , next to , for example , further elements , such as the third piston / cylinder unit 35 which is shown . the invention is not restricted to the exemplary embodiments which have been described . thus , instead of the two - part rocker arm 6 , a single - part rocker arm or swinging arm with or without roller contact with the cam 4 can also be provided , for example . the means for exerting a force which is directed counter to the adjusting action of the hvc can also be configured in a different way to that shown , but with the same function . | 5 |
reference will now be made in detail to the present preferred embodiments of the invention as described in the accompanying drawings . prior art : fig . p illustrates a prior art wall assembly p 00 . the prior art wall assembly p 00 comprises both sides of one or more panels p 02 , one or more studs p 20 , a top track p 23 , a bottom track p 22 , a mud compound p 05 , a porous paper p 10 , “ floating ” mud compound p 12 , a smooth surface p 14 which has been sanded and a plurality of non - removable fasteners p 04 . typically , the prior art wall assembly p 00 has a base board p 30 , a top track p 23 , and a bottom track p 22 . typically , the studs p 20 are aligned vertically using the top track p 23 and the bottom track p 22 . the panels p 02 are affixed to the studs p 20 using the non - removable fasteners p 04 . typically , the panels are fixed to the top track p 23 and the bottom track p 22 using the non - removable fasteners p 04 . the non - removable fasteners p 04 can be screws , nails , staples , and the like . it is appreciated by those skilled in the art that many different non - removable fasteners p 04 can be used in the manufacture of the prior art wall assembly p 00 . the fasteners p 04 are non - removable because of how they are used . for example , typically , the fasteners p 04 are used so that they are covered with a mud compound p 05 , p 13 . covering the fastener p 04 with the mud compound p 05 , p 13 makes accessing , finding , and removing the fasteners p 04 not practical . adjacent panels p 02 form a joint or seam p 03 at , for example , a first stud p 20 a . the non - removable fasteners p 04 are used to fixably secure the panels p 02 to the first stud p 20 a . similarly , a second stud p 20 c is used to securably affix the panel p 02 at its edge using the non - removable fasteners p 04 . typically , there is at least one intermediate stud p 20 b between the first stud p 20 a and the third stud p 20 c . the intermediate stud p 20 b is needed , for example , to prevent the panel p 02 from vibrating with normal building use , such as for example , to control panel shape distortion where panels p 02 are wide and the opening and closing of doors , heating and air conditioning blowers turning on and off , etc . to prevent the panel p 02 from vibrating , a plurality of non - removable fasteners p 04 affix the panel p 02 to the intermediate stud p 20 b . once the panels p 02 are affixed to the stud p 20 a , the non - removable fasteners p 04 a and the seam p 03 a must be concealed to form a continuous smooth wall p 14 a . the non - removable fasteners p 04 b affixed to the intermediate stud p 20 b are covered with the mud compound p 13 b or “ floated ” over . thereafter , the float mud compound p 13 is sanded smooth so that it provides a continuous smooth surface p 14 . with respect to the studs p 20 a , p 20 c at the panel seams p 03 , a more lengthy process is required . the joint or seam p 03 a is filled with a mud compound p 05 a . the mud compound p 05 a fills and hides the fastener p 04 a heads . when the fastener p 04 a heads are filled with the mud compound p 05 a removal is impractical , if not impossible . also , the mud compound p 05 a sticks to the panel p 02 making reuse of the panel p 02 impractical , if not impossible . thereafter , a porous paper tape p 10 a is placed over the mud compound p 05 a which also covers the non - removable fasteners p 04 a . a mud compound p 12 a is applied over or “ floated ” over the porous paper tape p 10 a . the porous paper tape p 10 a helps to hold the panels p 02 together . the porous paper tape p 10 a and the mud compound p 05 a , p 12 a adheres to or bonds with the panels p 02 . the porous paper tape p 10 a provides structural integrity to the mud compound p 05 a , p 12 . after the mud compound p 05 a , p 12 is sufficiently cured , a unitary bond with the porous paper tape p 10 a , the panel p 02 of sheet rock , the fasteners p 04 a and the mud compound p 05 a , p 12 a is formed . the mud compound p 05 a , p 12 a has a purpose of adhering to or bonding with the panels p 02 and the porous paper tape p 10 a . thereafter , the mud p 05 a , p 12 a is sanded to a smooth surface p 14 a . the smooth surface p 14 a provides that the seam p 03 a is invisible . the mud compound p 05 a , p 12 a has another purpose which is to provide a surface that can be sanded to a floated smooth surface to make the seam p 03 a invisible . thereafter , a baseboard p 30 is typically placed over the extremity of the panels p 02 . with respect to the intermediate stud p 20 b , the panel p 02 is also secured by the non - removable fasteners p 04 b . similarly , the non - removable fasteners p 04 can be nails , staples , or the like . it is understood by those skilled in the art that the non - removable fasteners p 04 can not be easily accessed , found , or removed without damage to the panel p 02 . the non - removable fasteners p 04 are hidden under the covering of the mud compound p 13 and are impracticable , if not impossible , to remove . in the prior art wall assembly p 00 , the long - term , non - removable fasteners p 04 create holes in the panels p 02 . the holes created by the fasteners p 04 are filled with or “ floated ” over with the mud compound p 05 , p 12 , p 13 . the mud compound p 05 , p 12 , p 13 hides the fastener p 04 screws and fills the holes and screw heads and adheres to the panel p 02 . the non - removable fasteners p 04 are not easily accessed , found and removed without damage to the panel p 02 . the mud compound p 05 , p 12 , p 13 cures to form a unitary bond with the porous paper tape p 10 , the panel p 02 of sheet rock , the fasteners p 04 , and the mud compound p 05 , p 12 , p 13 , thereby inhibiting reuse of any of the components . fig . pa is a plan view cross section of the seam p 03 a illustrating the prior art methodology in concealing and securing the seam p 03 between the panels p 02 in a conventional wall p 00 . the panels p 02 are abutted at the seam p 03 a as illustrated in fig . pa . a base layer of mud compound p 05 a is applied to the seam p 03 a . thereafter , a porous tape p 10 a is applied over the base layer of mud compound p 05 a . thereafter , finish mud p 12 a is applied over the porous tape p 10 a . thus , anything under the porous tape p 10 a is inaccessible and cannot be removed . the panels p 02 are joined so that the joint or seam p 03 a between the panels p 02 is turned into a smooth surface p 14 a , and the abutting panels p 02 form a single , continuous unitary panel p 02 . fig . pb is a flow chart describing a prior art wall p 00 as illustrated in fig . p and fig . pa . fig . pa defines the treatment of the seam p 03 a . fig . pb illustrates the prior art wall p 00 where the supports or studs p 20 a , p 20 c are at the panel p 02 edges . the seam p 03 a is treated to form a continuous , unitary panel p 02 having a smooth surface p 14 a . fig . pb illustrates a prior art wall p 00 where a stud p 20 is at the panel p 02 , edge p 03 , and the seam p 03 a is rendered invisible . fig . pc is a flow chart describing a prior art wall p 00 as illustrated in fig . p . fig . pc defines the treatment of the supports or studs p 20 b not located at the edges of the panel p 02 . fig . pb illustrates the prior art wall p 00 where the supports or studs p 20 b are located between the panel p 02 , edges p 03 , and is treated to form a smooth surface p 14 . fig1 : supports or studs 120 at the panel 102 edge and “ zip ” tape 110 a assists to form an invisible seam 114 a . fig1 is an illustration of a preferred embodiment of the wall system 100 of the present invention with the supports or studs 120 at the panel 102 edge and the zip tape 110 a assists to form an invisible seam 114 a . the wall system 100 provides an innovative wall 100 having a support or stud 120 a at the edge of a panel 102 so as to form a seam 103 a . the wall system 100 of the present invention is different from the prior art wall assemblies in that the wall system 100 can be readily disassembled , relocated , and reassembled . the wall system 100 illustrated in fig1 has the primary elements of one or more panels 102 , a plurality of long - term removable fasteners 104 , one or more studs 120 , a bottom track 122 , a “ zip ” tape 110 , and a tab 111 associated with the zip tape 110 . the zip tape 110 used in practicing the present invention may be , for example , a releasable , removable self - adhering fiberglass mesh tape that has a mesh porosity such that the screw heads are not filled with compound 112 . also , the present invention optionally provides that the screws 104 are treated to prevent the compound 112 from adhering to the screws 104 . the screws 104 can be treated before being used or after being installed . for example , treatment of the screws 104 before use may be by applying a teflon ® coat to the screw heads , or making the outer surface of the screws 104 of a non - sticking substance , or by making the entire screw 104 from a non - sticking substance . further by example , treatment of the screws 104 after use may be by applying a spray teflon ® coat to the screw heads , or coating the outer surface of the screws 104 with a non - sticking substance . the non - sticking substance can be in any appropriate form , such as liquid , powder , etc . it can be appreciated by those skilled in the art that various and sundry combinations of the screws 104 and the non - sticking substances may be used depending on the situation . the wall system 100 of the present invention provides that the studs 120 are engaged for support in the “ floor ” or bottom track 122 and optionally in a “ head ” or top track 123 , or the like . optionally , the wall system 100 provides that a top track 123 or the like may not be attached to or reach the ceiling and likewise the bottom track 122 or the like may not be attached to or reach the floor . it can be appreciated by those skilled in the art that the type of studs 120 , top track 123 , and bottom track 122 can be varied depending on the project need and requirements . the panels 102 are affixed to the studs 120 at the panel edges to form a seam 103 . the “ long - term , removable ” fasteners 104 are used to secure the adjacent panels 102 to the studs 120 a , 120 c . the long - term , removable fasteners 104 h at the head trim 131 and the long - term , removable fasteners 104 f at the floor trim 130 are optional , and releasable adhesive can be used in their place . the studs 120 can be of any shape , dimension , or material . various shapes , dimensions , and materials are readily known to those skilled in the art . when referring to the tab 111 , it is any portion of the zip tape used to disengage the zip tape 110 from the panel 102 . the panels 102 can be placed on either or both sides of the studs 120 . the height of the wall system 100 can by varied and there is no need for the wall system 100 to be full height . the joint or seam 103 a is required to be conditioned so as to be a smooth congruent surface 114 a with the adjacent panels 102 a . to form the smooth congruent surface 114 a , the seam 103 a and long - term removable fasteners 104 a are covered with the “ zip ” tape 110 a and floated with mud compound 112 a . the “ zip ” tape 110 a is sufficiently strong to be removed as a single piece , in unison . further , the zip tape 110 can be of varying porosity depending on the application of the present invention . the “ zip ” tape 110 a is removed as a single piece in unison by pulling a tab 111 a . as the tab 111 a is pulled , the “ zip ” tape 110 a and the mud compound 112 a disengage from the panels 202 thereby exposing the short term removable fasteners 104 a . once the short term removable fasteners 104 are exposed , the fasteners 104 a can be easily removed . since short term removable fasteners 104 a are covered by the zip tape 110 a before the mud compound 112 a is applied , the heads of the long - term permanent fasteners 104 a are kept clean for easy engagement and removal . also , the “ zip ” tape 110 a is sufficiently unporous to prevent mud compound 112 a from penetrating through the tape 110 a to fill the heads of the fasteners 104 a . as one skilled in the art can appreciate , the “ zip ” tape 110 a can be installed in various ways . the tab 111 a is typically at the extremity of the zip tape 110 a and normally under a removable trim at the base 130 or under other trim such as removable crown trim at the head or removable chair rail trim . another embodiment of the tab 111 of the zip tape 110 is to locate the zip tape 110 so that an “ incision ” can be made in the smooth sanded surface 114 so as to form a tab 111 . the incision can be made without damage to the panel 102 . the zip tape 110 can be pried up so as to form a tab ( not shown ) that can be pulled up so as to disengage the whole length of the zip tape 110 together with the mud compound 112 . fig1 a is a plan view cross section of the seam 103 a in fig1 illustrating the methodology in concealing and securing the seams 103 a between panels 102 in a wall system 100 . the panels 102 are abutted at a seam 103 a . thereafter , a zip tape 110 a is applied over the seam 103 a . thereafter , finish mud 112 a is applied or floated over the zip tape 110 a . thus , anything under the zip tape 110 a is accessible by removal of the zip tape 110 a . the panels 102 are joined so that the seam 103 a between the panels 102 is turned into a smooth surface 114 a , and the abutting panels 102 form a single , continuous unitary panel 102 , yet demountable . fig1 b is a flow chart describing the wall 100 of the present invention as illustrated in fig1 . the flow chart describes the treatment of the seam 103 a . fig1 b describes the wall 100 where the supports or studs 120 a , 120 c are at the panel 102 edges . the seam 103 a is treated to form a continuous , unitary panel 102 having a smooth surface 114 a , yet demountable . fig1 c is an illustration of a preferred embodiment of the wall system 100 of the present invention using releasable adhesive 106 with the supports or studs 120 at the panel edge 103 including an invisible seam 114 and a bottom track 122 . fig1 d is an illustration of a preferred embodiment of the wall system 100 of the present invention with the supports or studs 120 at the panel edge 103 including an invisible seam 114 . fig2 : releasable adhesive is at intermediate stud or support . fig2 is an alternate embodiment of the wall system 200 of the present invention where the releasable adhesive 206 b is used at the intermediate supports or studs 220 b . the wall system 200 illustrated in fig2 has the primary elements of one or more panels 202 , a plurality of long - term removable fasteners 204 , one or more studs 220 , a “ zip ” tape 210 , one or more short - term removable fasteners 208 , and a tab 211 associated with the zip tape 210 . with respect to the structure of the wall 200 at the seam 203 a , all the description of fig1 is applicable for fig2 . the long - term removable fasteners 204 h , 204 f are typically used along the alternate perimeters to secure the upper and lower portion of the panels 202 . preferably , the panels 202 are removably secured to the intermediate stud 220 b using a releasable adhesive 206 b . an option of the present invention is to omit the intermediate stud 220 b altogether . ( see fig1 ). to provide for the removable , although affixed , securement of the panel 202 to the intermediate stud 220 b , one or more short - term removable fasteners 208 b are used . after the removable adhesive 206 b cures so as to secure the panel 202 to the stud 220 b , the short - term removable fasteners 208 b can be easily removed . to cover the holes left by the short - term removable fasteners 208 b , a mud compound 213 b is applied or “ floated ” over the holes and sanded to a smooth surface 214 b . the short - term removable fasteners 208 b are used to hold the panels 220 in place while the releasable adhesive 206 b cures . the short - term removable fasteners 208 b are fasteners that only remain in the wall system 200 during the time required for the releasable adhesive 206 b to cure . as described in fig1 , 1 a , 1 b and also described here for clarity the joint or seam 203 a is required to be conditioned so as to be a smooth congruent surface 214 a with the adjacent panels 202 a . the joint or seam 203 a is required to be conditioned so as to be a smooth congruent surface 214 a with the adjacent panels 202 a . to form the smooth congruent surface 214 a , the seam 203 a , and long - term removable fasteners 204 a are covered with the “ zip ” tape 210 a and floated with mud compound 212 a . the “ zip ” tape 210 a is sufficiently strong to be removed as a single piece , in unison . the zip ” tape 210 a is removed as a single piece in unison by pulling a tab 211 a . as the tab 211 a is pulled , the “ zip ” tape 210 a and the mud compound 212 a disengage from the panels 202 thereby exposing the short term removable fasteners 204 a . once the short term removable fasteners 204 are exposed , the fasteners 204 a can be easily removed . since short term removable fasteners 204 a are covered by the zip tape 210 a before the mud compound 212 a is applied , the heads of the long - term permanent fasteners 204 a are kept clean for easy engagement and removal . also , the “ zip ” tape 210 a is sufficiently unporous to prevent mud compound 212 a from penetrating through the tape 210 a to fill the heads of the fasteners 204 a . as one skilled in the art can appreciate , the “ zip ” tape 210 a can be installed in various ways . the tab 211 a is typically at the extremity of the zip tape 210 a and normally under a removable trim at the base 230 or under other trim such as removable crown trim at the head or removable chair rail trim . another embodiment of the tab 211 of the zip tape 210 is to locate the zip tape 210 so that an “ incision ” can be made in the smooth sanded surface 214 so as to form a tab 211 . the incision can be made without damage to the panel 202 . the zip tape 210 can be pried up so as to form a tab ( not shown ) that can be pulled up so as to disengage the whole length of the zip tape 210 together with the mud compound 212 . to form a smooth congruent surface , the seam 203 a and removable fasteners 204 a are covered with the zip tape 210 a . the zip tape 210 a is sufficiently strong to be removed as a single piece , in unison . the zip tape 210 a is removed as a single piece in unison by pulling the tab 211 a . as the tab 211 a is pulled , the zip tape 210 a , and the mud compound 212 a disengage from the panels 202 thereby exposing the short term removable fasteners 204 a . once the short term removable fasteners 204 are exposed , the fasteners 204 a can be easily removed . the short term removable fasteners 204 a being covered by the zip tape 210 a before the mud compound 212 a is applied keeps the heads of the fasteners 204 a clean for easy engagement and removal . also , the zip tape 210 a is sufficiently unporous to prevent mud compound 212 a from penetrating through the tape 210 a to fill the heads of the fasteners 204 a . the zip tape 210 a can be installed in various ways . fig2 a is illustrated in fig1 a and described here for clarity . fig2 a is a plan view cross section of the seam 203 a illustrated in fig2 showing the methodology of securing the seams 203 a between panels 202 in a wall system 200 . the panels 202 are abutted to form the seam 203 a . thereafter , a zip tape 210 a is applied over the seam 203 a . also , the zip tape 210 a is applied over any long - term removable fastener 204 a that may be securing the panels 202 . thereafter , the finish mud 212 a is applied or floated over the zip tape 210 a . the panels 202 are joined so that the joint 203 a between the panels 202 is transformed into a smooth surface 214 a , and the abutting panels 202 form a single , continuous unitary panel 202 having a smooth surface 214 a , yet demountable . a finishing mud compound 212 a is placed over the zip tape 210 at all portions except for a tab 211 a . the tab 211 a is lifted away from the wall 200 for removing the zip tape 210 a from the panels 202 . thus , the zip tape 210 a can be accessed and pulled away removing the mud compound 212 a and exposing any long - term removable fasteners 204 a . the zip tape 210 used in practicing the present invention may be , for example , a releasable , removable self - adhering fiberglass mesh tape that has a mesh porosity such that the screw heads are not filled with compound 212 . also , the present invention optionally provides that the screws 204 are treated to prevent the compound 212 from adhering to the screws 204 . the screws 204 can be treated before being used or after being installed . for example , treatment of the screws 204 before use may be by applying a teflon ® coat to the screw heads , or making the outer surface of the screws 204 of a non - sticking substance , or by making the entire screw 204 from a non - sticking substance . further by example , treatment of the screws 204 after use may be by applying a spray teflon ® coat to the screw heads , or coating the outer surface of the screws 204 with a non - sticking substance . the non - sticking substance can be in any appropriate form , such as , liquid , powder , etc . it can be appreciated by those skilled in the art that various and sundry combinations of the screws 204 and the non - sticking substances may be used depending on the situation . fig2 b is a flow chart describing the wall 200 of the present invention as illustrated in fig2 . the flow chart illustrates the relationship between the panels and supports or studs that are not at the panel edges . fig2 b describes the wall 200 illustrated in fig2 where the supports or studs 220 a , 220 c are not at the panel 202 edges . fig2 c is an illustration of a preferred embodiment of the wall system 200 of the present invention using releasable adhesive 206 with the supports or studs 220 at the panel edge 203 including an invisible seam 214 and a bottom track 222 . fig2 d is an illustration of a preferred embodiment of the wall system 200 of the present invention with the supports or studs 220 at the panel edge 203 including an invisible seam 214 . fig3 : zip tape at intermediate studs or supports . fig3 illustrates yet another preferred embodiment of the wall system 300 of the present invention where zip tape is used at intermediate supports or studs 320 b . the wall system 300 provides a system similar to the wall systems 100 , 200 in fig1 and 2 with the difference being that the panel 302 is secured to the intermediate stud 320 b using long - term removable fasteners 304 b in conjunction with the zip tape 310 b . the wall system 300 comprises the elements of the earlier discussed wall system 100 including the seam - related parts : the panels 302 , the end studs 320 a , 320 c , the removable fasteners 304 a , the zip tape 310 a , the mud compound 312 a , the smooth sanded surface 314 a , as well as the intermediate - panel - related parts : the long - term removable fasteners 304 b , the intermediate stud 320 b , the zip tape 310 b , the floated mud compound 312 b and the smooth sanded surface 314 b . also , the wall system 300 uses a tab 311 a , 311 b which is at an extremity of the zip tape 310 a , 310 b . while the end studs 320 a , 320 c are used to affix the panels 302 at the seams 303 , the intermediate stud 320 b is used to affix to the panels 302 between seams . the panels 302 are removably secured to the intermediate stud 320 b using the removable fasteners 304 b . the removable fasteners 304 b are covered with the zip tape 310 a . the zip tape 310 b is provided so that it is strong enough and unporous enough to protect the removable fasteners 304 b from being held inoperable due to the mud compound 312 b . the zip tape 310 b is covered with or floated over with the mud compound 312 b . when the mud compound 312 b dries , it can be sanded . the mud compound 312 b can be sanded to a smooth surface 314 b . the smooth surface 314 b hides the location of the removable fasteners 304 b . with respect to the studs 320 , typically at a remote end of each stud 320 is a tab 311 of the zip tape 310 . the tab 312 is provided so that it can be pulled to disengage the mud compound 312 from the panel 302 such that the removable fasteners 304 are exposed and readily removed to disengage the panel 302 from the studs 320 . further , the zip tape 310 removes the excess mud compound 312 from the panel 302 so that the panel 302 is essentially pristine . it can be appreciated that the tab 311 of the zip tape 310 can be utilized in different ways . a first utilization of the tab 311 of the zip tape 310 is to expose the tab 311 in an area that is not covered or floated with mud compound 312 . fig1 , fig2 , and fig3 illustrate a tab 111 , 211 , 311 being located so as to be covered by the removable base trim 330 . the tab 311 can be readily accessed by removing the removable base trim 330 . thereafter , the tab 311 can be lifted from the bottom of the panel 302 expose the removable fasteners 304 by disengaging the mud compound 312 from the panels 302 . the tab 311 can be found and pulled so as to disengage the whole length of zip tape 310 which coincides with the dimension of the panel 302 and further removes the mud covering 312 . as described in fig1 and fig2 and also described here for clarity the joint or seam 303 a is required to be conditioned so as to be a smooth congruent surface 314 a with the adjacent panels 302 a . the joint or seam 303 a is required to be conditioned so as to be a smooth congruent surface 314 a with the adjacent panels 302 a . to form the smooth congruent surface 314 a , the seam 303 a and long - term removable fasteners 304 a are covered with the zip tape 310 a and floated with mud compound 312 a . the zip tape 310 a is sufficiently strong to be removed as a single piece in unison . the zip tape 310 a is removed as a single piece in unison by pulling a tab 311 a . as the tab 311 a is pulled , the zip tape 310 a and the mud compound 312 a disengage from the panels 302 thereby exposing the short term removable fasteners 304 a . once the short term removable fasteners 304 are exposed , the fasteners 304 a can be easily removed . since short term removable fasteners 304 a are covered by the zip tape 310 a before the mud compound 312 a is applied , the heads of the long - term permanent fasteners 304 a are kept clean for easy engagement and removal . also , the zip tape 310 a is sufficiently unporous to prevent mud compound 312 a from penetrating through the tape 310 a to fill the heads of the fasteners 304 a . as one skilled in the art can appreciate , the zip tape 310 a can be installed in various ways . the tab 311 a is typically at the extremity of the zip tape 310 a and normally under a removable trim at the base 330 or under other trim such as removable crown trim at the head or removable chair rail trim . another embodiment of the tab 311 of the zip tape 310 is to locate the zip tape 310 so that an incision can be made in the smooth sanded surface 314 so as to form a tab 311 . the incision can be made without damage to the panel 302 . the zip tape 310 can be pried up so as to form a tab ( not shown ) that can be pulled up so as to disengage the whole length of the zip tape 310 together with the mud compound 312 . the wall system 300 is a fire rated wall . as in the other embodiments , the zip tape 310 used in practicing the present invention may be , for example , a releasable , removable self - adhering fiberglass mesh tape that has a mesh porosity such that the screw heads are not filled with compound 312 . also , the present invention optionally provides that the screws 304 are treated to prevent the compound 312 from adhering to the screws 304 . the screws 304 can be treated before being used or after being installed . for example , treatment of the screws 304 before use may be by applying a teflon ® coat to the screw heads , or making the outer surface of the screws 304 of a non - sticking substance , or by making the entire screw 304 from a non - sticking substance . further by example , treatment of the screws 304 after use may be by applying a spray teflon ® coat to the screw heads , or coating the outer surface of the screws 304 with a non - sticking substance . the non - sticking substance can be in any appropriate form , such as , liquid , powder , etc . it can be appreciated by those skilled in the art that various and sundry combinations of the screws 304 and the non - sticking substances may be used depending on the situation . fig3 a is a plan view cross section of the seam 303 illustrated in fig3 showing the methodology of securing the seams 302 between panels 302 in the wall system 300 . fig3 b is a flow chart describing the wall system 300 illustrated in fig3 where the support or stud 320 is not at the panel 302 edges and the panel 302 is secured at the extremities by long term fasteners 304 ( a fire rated wall ). the panel 302 is secured by removable means 304 . the zip tape 310 is applied over the removable means 304 . the mud 312 is floated over the zip tape 310 and then sanded smooth to form a smooth surface 314 . fig3 c is an illustration of a preferred embodiment of the wall system 300 of the present invention using releasable adhesive 306 with the supports or studs 320 at the panel edge 303 including an invisible seam 314 and a bottom track 322 . the wall system 300 is a fire rated wall . fig4 : removable substance at panel edge supports or studs to form an invisible seam . fig4 is an illustration of yet another wall system 400 of the present invention . the wall system 400 uses panels 402 , studs 420 , long - term removable fasteners 404 , short - term removable fasteners 408 , and a removable substance 442 . the panels 402 are abutted one adjacent the other to form the seam 403 . the panels 402 are held using the studs 420 a , 420 c , and optionally the stud 420 b . typically on alternate sides of the studs 420 are panels 402 . the panels 402 are secured to the stud 420 a , which is aligned with the seam 403 a by a plurality of long - term removable fasteners 404 a and short - term removable fasteners 408 b . also , the panels 402 are optionally secured along the upper perimeter using by a plurality of removable fasteners 404 h . similarly , the panel 402 is optionally secured along the lower portion along with the removable fasteners 404 f . the panels 402 are typically disposed on alternate sides of a bottom track 422 . the studs 420 rest in the bottom track 422 such that the panels 402 are displaced one from the other an equal distance along the surface of the panels 402 . the removable substance 442 is applied over the seam 403 a and the removable fasteners 404 a . as the removable substance 442 dries , it may shrink in size . if the removable substance 442 shrinks , additional layers may be required . thus , a first layer 442 aa of the removable substance 442 is applied , and allowed to cure . thereafter , a second layer 442 ab of the removable substance 442 is applied , and allowed to dry . thereafter , a third layer 442 ac of the removable substance 442 is applied , and allowed to dry . the sequence is continued until such time as the entire gap formed by the seam 403 a is filled so as to form a flush surface or concave surface , if so desired . the removable substance 442 may be a composition that can then be sanded to provide a smooth surface 414 a with the panel 402 . the intermediate stud 420 b is affixed to the panels 402 using a releasable adhesive 406 b . the panels 402 are secured to the intermediate stud 420 b using the temporary short - term fasteners 408 b . after the releasable adhesive 406 b secures the panels 402 to the intermediate stud 420 b , the temporary fasteners 408 b are removed . the holes left by the temporary short - term fasteners wall system 400 where the supports or studs 420 a , 420 c are at the panel 402 edges . the seam 403 a is treated using the removable substance 442 to form a continuous , unitary panel 102 having a smooth surface 114 a . fig4 c is a flow chart of the wall system 400 of the present invention as illustrated in fig4 where the support or stud 420 is not at the panel 402 edges . more particularly , fig4 c describes the wall system 400 where the supports or studs 420 a , 420 c are intermediate of the panel 402 edges . fig4 d is an illustration of a preferred embodiment of the wall system 400 of the present invention as illustrated in fig4 , but without the extensive bottom track 422 . alternately , a releasable adhesive 406 may be used with the supports or studs 420 at the panel edge 403 in place of the long - term screws 404 , but in conjunction with the short - term screws 408 . fig5 : releasable adhesive at panel edge supports or studs ; invisible seam optional . fig5 is yet another embodiment of a wall system 500 of the present invention where releasable adhesive 506 a is used at the panel edge supports or studs 520 a . the wall system 500 includes the panels 502 , the studs 520 , the long - term removable fasteners 504 h , 504 f , the short - term removable fasteners 508 a , 508 b , the releasable adhesive 506 , the float mud compound 516 a , 513 b or removable substance , and the bottom track 522 . the bottom track 522 receives the studs 520 . the panels 502 are typically placed on alternate sides of the studs 520 and the bottom track 522 . the panels 502 are removable secured to the studs 520 using the releasable adhesive 506 . the panels are allowed to engage the releasable adhesive 506 and the studs 520 in a fixed manner by using the removable short - term fasteners 508 . after the releasable adhesive 506 cures , the removable short - term fasteners 508 can be removed . thereafter , a float mud compound 516 a , 513 b or the removable substance is used to fill the holes created by the removable short - term fasteners 508 . in the shown embodiment of the wall system 500 illustrated in fig5 , the seam 503 a is not filled or treated . thus , the bevel 505 a formed at the seam 503 a between the two abutting panels 502 is left unchanged so as to provide a decorative linear effect . also , the use of the removable fasteners 504 h at the top of the panel 502 and the removable fasteners 504 f at the bottom of the panel 502 are optional . fig5 a is a perspective , cross section of the seam 503 a associated with the two abutting panels 502 as illustrated in fig5 . the seam 503 a provides that the bevel 505 a yields a linear decorative effect . in an alternate embodiment , there may also be a gap between the two panels 502 . fig5 b is a flow chart of the wall system 500 of the present invention as illustrated in fig5 where the support or stud 520 is at the panel 502 edges and the seam 503 a is visible . more particularly , fig5 b describes the wall system 500 where the supports or studs 520 a , 520 c are at the panel 502 edges . the seam 503 a is not treated , but rather left to provide a decorative linear wall design . fig5 c is a flow chart of the wall system 500 of the present invention as illustrated in fig5 where the support or stud 520 is not at the panel 502 edges . more particularly , fig5 c describes the wall system 500 where the supports or studs 520 a , 520 c are intermediate of the panel 502 edges . fig5 d is an illustration of a preferred embodiment of the wall system 500 of the present invention using releasable adhesive 506 with the supports or studs 520 at the panel edge 503 including an invisible seam 514 and a bottom track 522 . fig6 : vertical cross - section of the wall system . fig6 illustrates a cross section of the wall system 600 of the present invention . fig6 illustrates a wall panel 602 removably engaged with a removable floor or bottom track 622 and a removable head track 623 . the floor track 622 is removably engaged with a subfloor 665 . the wall panels 602 have at one extreme a removable base trim 630 and at the other extreme a removable head trim 631 . the removable base trim 630 and the removable head trim 631 typically cover the removable long - term fasteners 604 . the removable long - term fasteners 604 removably engage the wall panels 602 and the stud 620 with the floor track 622 and the head track 623 . when the wall panels 602 and the studs 620 are secured , one or more cavity 660 is created between the opposing wall panels 602 , the studs 620 the top track 623 and the bottom track 622 , respectively . the base trim 630 and the subfloor 665 are removably engaged . a floor finish or carpet 666 is typical . the removable top track 623 is typically engaged with a t support 661 . the t support 661 is suspended in place by a hanger or support cable 662 . the t support 661 is provided for accepting a plurality of ceiling tiles 663 . when the ceiling tiles 663 are engaged with the t support 661 , a space 664 is created between the ceiling tiles 663 and the head track 662 . preferably , the head trim 631 abuts the ceiling tile 663 . a data channel 622 a is provided in the floor track 622 . fig7 shows a flow chart for a method of assembling a paneling system . the method includes fastening one or more panels on a support system with one or more mechanical fasteners , applying a tape to substantially cover the one or more mechanical fasteners , placing a layer of compound over the tape , permitting the compound to cure , and then , removing the tape from the paneling system in a manner that sufficiently exposes the one or more mechanical fasteners . fig8 : top track . fig8 is a partial cutaway of an upper portion of the wall system 800 of the present invention . illustrated in fig8 is a head track 823 in association with the wall panels 802 . the wall panels 802 are removably affixed to the head track 823 using removable long - term fasteners 804 h . the long - term removable fasteners 804 h are optional and may be used or not . the removable head trim 831 is typically used to cover the removable long - term fasteners 804 , although zip tape may be used in lieu of head trim . fig9 : bottom track . fig9 is a partial section illustrating a lower portion of the wall system 900 of the present invention . fig9 illustrates a removable bottom track 922 in association with the wall panels 902 . the wall panels 902 are removably secured to the removable bottom track 922 and a stud 920 using the removable long - term fasteners 904 f . also , a releasable adhesive 906 may be used to secure the wall panel 902 with the stud 920 . the removable long - term fasteners 904 f are typically covered using the removable base trim 930 , and zip tape may be used in lieu of base trim 930 . a floor finish 966 is typically used adjacent the removable base trim 930 . fig1 : alternate bottom track . fig1 illustrates yet another embodiment of a wall system 1000 of the present invention , showing a partial cross - section of a wall panel 1002 in association with a removable bottom track 1022 . the wall panel 1002 is typically secured to the removable bottom track 1022 using the removable long - term fasteners 1004 f . similarly as discussed above , a removable base trim 1030 is used to cover the removable long - term fastener 1004 f . a floor finish 1066 is typically used adjacent the removable base trim 1030 . the bottom track 1022 is removably affixed to the subfloor using various methods ; and for the present invention the bottom track 1022 can be secured using the releasable adhesive 1006 . also , the bottom track 1022 can be affixed to a subfloor using a removable fastener or knockoff fasteners 1024 . fig1 is an illustration of a tri - channel head track 1123 for use in association with the wall system of the present invention . the tri - channel head track 1123 provides for accepting wall panels 1102 a , 1102 b on alternate sides of a stud 1120 . the wall panels 1102 are secured to the stud 1120 and the tri - channel head track 1123 using removable long - term fasteners 1104 . the tri - channel head track 1123 has a plurality of channels , with the embodiment illustrated having three channels 1123 a , 1123 b , 1123 c . the outermost channels 1123 a , 1123 b are disposed on alternate sides of the middle channel 1123 c . the removable long - term fasteners 1104 can be treated as described herein in other embodiments of the present invention . for example , the removable long - term fasteners 1104 can be taped and floated , covered with caulking , etc . fig1 a is a cut - away illustration of the tri - channel head track 1123 for use in association with the wall system 1100 of the present invention as illustrated in fig1 having an unfeathered extension 1123 d and a releasable adhesive 1106 . fig1 b is an illustration of the tri - channel head track 1123 for use in association with the wall system 1100 of the present invention as illustrated in fig1 having a feathered extension 1123 d and a releasable adhesive 1106 . fig1 is a sectional illustration of a tri - channel bottom track 1222 used in association with the wall system of the present invention . the tri - channel bottom track 1222 has two protrusions 1222 d on its upper surface 1222 e such that the stud 1204 is accepted into the channel 1222 f formed by the two protrusions 1222 d in the bottom track 1222 . the wall panels 1202 a , 1202 b are accepted on the outer portion on the upper surface 1222 e of the bottom track 1222 . the tri - channel bottom track 1222 has knockouts 1222 b and an isolated data cavity 1222 a . further , the tri - channel bottom track 1222 has a roughened surface 1222 c in which a releasable adhesive can be used to secure the tri - channel bottom track 1222 to a floor or subfloor . typically , a knock - off 1224 is used to removable secure the track 1222 . fig1 a is a sectional illustration of a tri - channel bottom track 1222 used in association with the wall system of the present invention having an enclosed data channel 1222 a and using removable adhesive 1206 . fig1 is a sectional view of a quad - channel bottom track 1322 used with the wall system of the present invention . the quad - channel bottom track 1322 comprises an isolated data cavity 1322 a , knockouts 1322 b , beveled edges 1322 d in association with the upper channels , and a roughened surface 1322 c . the roughened surface 1322 c is used to removably secure the quad - channel bottom track 1322 to a floor or subfloor . the isolated data channel 1322 a is used in association with the knockouts 1322 b to pull wiring and cable for data , phones , or lights . the three open channels are used for accepting a stud 1320 in the middle channel , and for accepting wall panels 1302 in the outermost channels . optionally , the quad - channel bottom track 1322 can be secured to the wall panels 1302 using long term removable fasteners 1304 . as still a further option , the long term removable fasteners 1304 can be covered with a zip tape 1310 and a mud compound 1316 so that they can be later accessed for easy disassembly of the wall panels 1320 and the quad - channel bottom track 1322 . also a cover plate 1322 bb is removably engaged in selected punch outs 1322 b . the cover plates 1322 bb can be of various shapes , sizes , and affixed in various ways , for example , snap on , glue on , screw on , etc . fig1 a is a sectional illustration of a tri - channel bottom track 1322 used in association with the wall system of the present invention having an enclosed data channel 1322 a and using removable adhesive 1306 fig1 is yet another embodiment of the tri - channel bottom track 1422 for use with the wall system of the present invention . the tri - channel bottom track 1422 comprises a bottom track 1422 a , one or more knockouts 1422 b , and a roughened surface 1422 c . the bottom track 1422 a , preferably receives a stud 1420 . the stud 1420 has one or more knockouts 1420 a . the combination of the stud knockouts 1420 a and the track knockouts 1422 b provide for easy access of wires and cables within a stud cavity 1460 between two wall panels 1420 a , 1420 b . also a cover plate 1422 bb is removably engaged in selected punch outs 1422 b . the cover plates 1422 bb can be of various shapes , sizes , and affixed in various ways , for example , snap on , glue on , screw on , etc . typically , a knock - off 1424 is used to removably secure the track 1422 . fig1 a is a sectional illustration of a tri - channel bottom track 1422 used in association with the wall system of the present invention having an enclosed data channel 1422 a and using removable adhesive 1406 . fig1 is a sectional illustration of another tri - channel bottom track 1522 used in association with the wall system of the present invention having an enclosed data channel 1522 a . fig1 a is a sectional illustration of the tri - channel bottom track 1522 used in association with the wall system of the present invention having an enclosed data channel as illustrated in fig1 and having an unfeathered extension 1522 d and releasable adhesive 1506 . fig1 b is a sectional illustration of the tri - channel bottom track used in association with the wall system of the present invention having an enclosed data channel as illustrated in fig1 and having a feathered extension 1522 d and a releasable adhesive 1506 and a slotted data channel 1522 a . fig1 is yet another embodiment of the tri - channel bottom track 1622 for use with the wall system of the present invention having a slotted data channel 1622 a for receiving the studs 1620 . the tri - channel bottom track 1622 is adapted for use with load - bearing walls . fig1 a is a sectional illustration of another tri - channel bottom track 1622 used in association with the wall system of the present invention having a slotted data channel 1622 as illustrated in fig1 and having an unfeathered extension 1622 d and a releasable adhesive 1606 . fig1 illustrates a cross section of a wall system 1700 of the present invention with a wall panel 1702 removably engaged with a removable electrical fixture 1762 and a plumbing fixture 1764 . fig1 is a sectional illustration of a tri - channel bottom track 1822 used in association with the wall system of the present invention having elements that are of bendable metal . fig1 is a sectional illustration of another embodiment of a tri - channel bottom track 1922 used in association with the wall system of the present invention having elements that are bendable metal . fig2 is a sectional illustration of yet another embodiment of a tri - channel bottom track 2022 used in association with the wall system of the present invention having elements that are bendable metal . fig2 a is a sectional illustration of another channeled bottom track 2122 used in association with the wall system of the present invention having a data channel 2122 a . the bottom track 2122 has flush base trim 2130 with a raised channel seat for accepting the stud 2120 . as in the other embodiments , the base trim 2130 is affixed to the bottom track 2122 , but not the panel 2102 , for easy remove . as with the other embodiments of the present invention , treated screws 2104 f may be used . fig2 aa is a sectional illustration of another channeled bottom track 2122 used in association with the wall system of the present invention having a data channel 2122 a . the bottom track 2122 has flush base trim 2130 with a raised channel seat for accepting the stud 2120 . as in the other embodiments , the base trim 2130 is affixed to the bottom track 2122 , but not the panel 2102 , for easy removal . as with the other embodiments of the present invention , treated screws 2104 f may be used . fig2 aaa is a sectional illustration of yet another channeled bottom track 2122 used in association with the wall system of the present invention having a data channel 2122 a . the bottom track 2122 has flush base trim 2130 with a raised channel seat for accepting the stud 2120 . as in the other embodiments , the base trim 2130 is affixed to the bottom track 2122 , but not the panel 2102 , for easy removal . as with the other embodiments of the present invention , treated screws 2104 f may be used . fig2 b is a sectional illustration of another channeled bottom track 2122 used in association with a load - bearing wall system of the present invention having a data channel 2122 a . the bottom track 2122 has flush base trim 2130 with a raised channel seat for accepting the stud 2120 . as in the other embodiments , the base trim 2130 is affixed to the bottom track 2122 , but not the panel 2102 , for easy removal . as with the other embodiments of the present invention , treated screws 2104 f may be used . fig2 a is a sectional illustration of another channeled bottom track 2222 used in association with a wall system of the present invention having a data channel 2222 a . the bottom track 2222 has flush base trim 2230 with a raised channel seat for accepting the stud 2220 . as in the other embodiments , the base trim 2230 is affixed to the bottom track 2222 , but not the panel 2202 , for easy removal . as with the other embodiments of the present invention , treated screws 2204 f may be used . fig2 aa is a sectional illustration of an alternate embodiment of the one piece base track with a raised channel - seat for the stud . fig2 b is a sectional illustration of another channeled bottom track 2222 used in association with a wall system of the present invention having a data channel 2222 a . the bottom track 2222 has flush base trim 2230 with a raised channel seat for accepting the stud 2220 . as in the other embodiments , the base trim 2230 is affixed to the bottom track 2222 , but not the panel bottom track 2122 has flush base trim 2130 with a raised channel seat for accepting the stud 2120 . as in the other embodiments , the base trim 2130 is affixed to the bottom track 2122 , but not the panel 2102 , for easy removal . as with the other embodiments of the present invention , treated screws 2104 f may be used . fig2 b is a sectional illustration of another channeled bottom track 2122 used in association with a load - bearing wall system of the present invention having a data channel 2122 a . the bottom track 2122 has flush base trim 2130 with a raised channel seat for accepting the stud 2120 . as in the other embodiments , the base trim 2130 is affixed to the bottom track 2122 , but not the panel 2102 , for easy removal . as with the other embodiments of the present invention , treated screws 2104 f may be used . fig2 a is a sectional illustration of another channeled bottom track 2222 used in association with a wall system of the present invention having a data channel 2222 a . the bottom track 2222 has flush base trim 2230 with a raised channel seat for accepting the stud 2220 . as in the other embodiments , the base trim 2230 is affixed to the bottom track 2222 , but not the panel 2202 , for easy removal . as with the other embodiments of the present invention , treated screws 2204 f may be used . fig2 b is a sectional illustration of another channeled bottom track 2222 used in association with a wall system of the present invention having a data channel 2222 a . the bottom track 2222 has flush base trim 2230 with a raised channel seat for accepting the stud 2220 . as in the other embodiments , the base trim 2230 is affixed to the bottom track 2222 , but not the panel . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow . | 4 |
an apparatus for producing photographic copies on a web - shaped endless material , in the following , simply called “ printer ”, is referred to by reference numeral 10 in fig1 . the printer 10 includes a section for the feeding of negatives or positives in the form of an endless web . this arrangement 11 includes a carousel with two web reels with webs 12 , which are fed into the apparatus 10 . a scanning arrangement 14 a , b , which includes a colour scanner ( 14 b , right ) with low resolution and a black and white scanner ( 14 a , left ) with high resolution , scans the web with image information . the black and white scanner detects whether the images on the web 12 are sufficiently focussed so that the production of a photographic copy would be meaningful or not , and the colour scanner detects colour density values in order to enable and optimize control of the intensities of the individual colours with which later a negative or the like is to be illuminated in order to make an optimized copy possible . the image data from the scanner duo 14 a , 14 b , are also assembled in a computer or processor to coloured image data of high resolution with which an index print can be produced for each respective order . a material web section of exposed negative or positive material can be received in a material web storage 16 which corresponds to a maximum order volume , i . e ., for example , 36 negative . in this manner , a statement can be made regarding all pictures or a part of the pictures of an order prior to the illumination of the first negative of an order , for example , regarding the general mood of the pictures , such as an evening mood , a twilight mood , possibly a row of portrait pictures , or the like . these data can also be used to produce exposure data . the negatives or positives of the web 12 are then fed to an exposure station 18 which in the example described is a conventional optical exposure station . of course , a crt exposure station can also be provided here , or an exposure station operating with lasers . the here explicitly provided optical exposure station adjusts an exposure on the basis of the light amounts or coloured light amounts determined by the exposure data captured by the scanner duo 14 a , 14 b and calculated by a computer , possibly through a subtractive filter arrangement or the like . the exposure station 18 also includes enlargement lenses ( without reference numeral ) which are provided in the light path below the exposure arrangement 18 . various storage buffers 20 are positioned along the course of the transport path of the web 12 in order to enable a better temporal or distancewise adaptation of the material transport to the individual activities . at the end of the passage of the material web 12 , another reel arrangement 24 is provided in order to wind the processed material of the web 12 back onto storage reels . in order to guarantee an automatic operation , a threading in arrangement 22 is provided which assists in winding the arriving end of the web 12 ( i . e ., the start of the web ) onto a reel until the material has sufficient hold so that the web 12 can be further automatically wound up onto the reel . the arrangement 24 also includes a carousel in order to be able to provide an empty reel after removal of a full reel to guarantee a continuous operation of the arrangement according to fig1 or fig1 and 2 . a light sensitive band 108 is unwound from a material web roller 104 in a magazine cart 102 ( also called “ cassette ”). this material web 108 is guided out of the magazine cart 102 through a feed - in station 106 and guided to a later exposure process . a splicer arrangement is provided within a path of the web 108 which connects the end of a leading material web 108 with the start of a following material web by heat and pressure . in the path of the band 108 are furthermore provided loops 112 a , 112 b , in order to enable a temporal coordination of the actions within the first device for producing the copies . in the region of the illumination 118 of the material web 108 , light traps 114 a , 114 b ( also called paper masks ) are provided which are intended to keep light of an exposure process away from proceeding and following surfaces of the photo sensitive material web 108 . a marking device 116 is provided at the beginning of the illumination region which marks the end of an order or the region which is kept free of a copy in order to be exposed in a second device for producing data or image data fields ( see fig2 ). the marking device 116 , for example , can spray a colour dot onto the back face of the material web . punch outs or the like can also be provided . advantageous patterns for markings in the form of colour dots , punchings or the like are apparent from fig3 . the exposed material whereon for each order one region has been kept free in order to be exposed in the downstream second device for producing data or image data fields , in a conventional printer 10 moves into a magazine cart , but is here in the form of the mostly exposed material web 108 a fed into an arrangement 50 according to fig2 . the material band 108 b is guided through a light sealed input 52 past a monitoring device 54 , for example , in the form of a light barrier which operates in the infrared range , in order to detect markings which have been applied to or into the web 108 b by the marking device 116 . the material web 108 b is transported into the material storage 58 by way of a pair of conveyor rolls 56 . in the material storage 58 , the material web 108 c is purely randomly laid down . the illustrated course of the material web 108 c is only exemplary and can also look completely different . holes or openings 63 are provided in the side walls of the material storage 58 through which upon entry or exit of the material web 108 c , an air removal or supply between the material webs and / or the material webs and the walls of the material storage 58 can take place . at the pull out 62 with equally referenced output roller pair 62 , a deflecting arrangement 60 is provided , here in the form of a ventilator . the ventilator 60 produces an air cushion before the outlet 62 so that only the end of the material web unit 108 c can enter into the gap between the pair of output rollers 62 . subsequent loops of the material web 108 c are kept away by the air cushion . the outlet 62 is positioned at least at the same height of the inlet 56 to the material storage , but can also be positioned at a different height . especially , the entry 56 can be positioned lower than the outlet 62 . adjacent to the outlet of the material storage or chaos storage 58 is the second device for producing data or image data fields 66 , the exposure region of which is also provided with opaque sections 68 in order to protect those regions of the copy material web 108 c , 108 d which are adjacent to the exposure region of the second device or the crt device 66 from an unwanted exposure . at one end of the exposure region of the second device 66 and especially at the forward end of the exposure region of the device 66 in direction of movement of the material web 108 c , a monitoring arrangement 64 can again be provided which scans or detects a marking on the material web 108 c which was applied onto or placed into the web at the marking arrangement 116 . the second device or crt device 66 can be used to apply an index print to the material web as also explained in the generic prior art , or other types of information . for example , an information field could here also be applied onto the material web by way of which special and possibly fee based services can be offered , for example , copies of corrected light density could be offered , whereby a sample copy of an otherwise badly exposed copy could also be depicted in order to offer such services to the customer in an impressive way . a further storage for web material 108 d can be provided in the further path of the material web 108 c , 108 d , and here especially below the second device or the crt exposure device 66 . this storage can also be a chaos storage but may also be a roller storage . the here temporarily stored material is subsequently transported into a magazine cart 102 a through take out rollers 70 , possibly a cutting device 72 , a docking station or similar known devices , to be rolled up in the form of a roll of exposed material web 104 a . a processor with image storage and the like 74 is also provided in order to intermediately store the image data captured by the scanner duo and processed into the index print images and to thereby correspondingly control the second device or exposure device 66 . control inputs can be made by way of a keyboard 78 or possibly menu driven by way of a mouse 80 . an index print photo can be observed on a screen 76 so that an operator here could possibly still make corrections or comments , if this is desired , for example , in an already mentioned value added manner or the like . fig3 shows a section of a material web 108 with copies on which different markings 200 , 202 , 204 have been applied or possibly punched into through the placement of such markings . it is possible to control the band transporter before and after the material storage 58 , and in the same manner exactly control the transport to as well as the exposure at the device 66 . it will be appreciated by those skilled in the art that the present invention can be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the presently disclosed embodiments are therefore considered in all respects to be illustrative and not restrictive . the scope of the invention is indicated by the appended claims rather than the foregoing description and all changes that come within the meaning and range and equivalence thereof are intended to be embraced therein . | 6 |
referring to the drawings , and in particular to fig1 and 5 , a coke quench system is illustrated and comprises a quench car 10 secured to an equipment trailer 12 by means of a railroad coupler ( not shown ) and movable on rails 14 . the car 10 is moved by a power unit ( not shown ) such as a donkey engine or the like . the equipment trailer 12 contains an operator &# 39 ; s cab 16 which includes remote controls for operating the quenching in the quench car 10 , the draft inducing and scrubbing device on the equipment trailer 12 and the donkey engine . the equipment trailer 12 mounts a combined draft inducing and scrubbing means 18 , which is operative to draw gases emitted by the coke in the quench car 10 and to scrub the same . the draft inducing and scrubbing means 18 is connected to the hooded portion of the quench car by means of a flexible conduit 20 connected to the hood . the quench car 10 has an enlarged side opening 22 which is defined by a sloping bottom wall 24 by a forward wall 26 and a rearward wall 28 and by a roof 30 . the bottom wall 24 has an outer edge 32 , the forward wall 26 and rearward wall 28 have vertical edges 34 , 36 , and the roof 30 has a sidewardly projecting hood 38 which combine to form said side opening 22 . the roof 30 has the sidewardly projecting hood 38 which extends beyond the edges 34 , 36 of the forward and rearward walls 26 , 28 and has an outer edge 40 which reaches to a point not quite vertically aligned with the outer edge 32 of the sloping bottom wall 24 . the quench car 10 defines a cavity 42 into which the coke is gradually pushed and has a plurality of spray nozzles 44 mounted at strategic locations so as to provide a spray mist into the cavity 42 and onto the coke . the draft inducing device 18 on the trailer 12 is connected to the upper portion of the quench car in such a way as to draw gases out of the quench car . the gases drawn from the quench car are passed through the scrubber , and the like , so as to remove the gaseous and particulate emissions therefrom prior to the scrubbed gases being expelled from the scrubber to the atmosphere . the details of the quench car 10 and equipment trailer 12 and the operation of the quench sprays , draft inducing system , scrubber , and the like , are substantially as described and claimed in the j . e . allen u . s . pat . no . 3 , 843 , 461 and the j . e . allen , j . f . hanley , jr ., f . k . armour , f . g . krikau and r . s . patton u . s . pat . no . 3 , 869 , 352 . for details of the operation and construction of the quench car and equipment trailer , reference is made to one or the other , or both , of those patents . a battery of coke ovens 46 are charged , loaded and fired in a conventional fashion . each oven in the battery has a door , such as , 48 which , when opened , presents an opening through which the coke in that oven is pushed when the coke - making function has been complete . a raised set of rails 50 is provided between the battery of coke ovens 46 and the rails 14 upon which the coke quench car 10 and equipment trailer 12 move relative to the battery of coke ovens . on the raised rails 50 is movably mounted an undercarriage 52 upon which is supported a coke oven push guide 54 which is adapted to be aligned with one of the doors 48 into one of the coke ovens 46 . the coke push guide 54 is known in the art and has been used heretofore for aligning the opening in the coke oven with an appropriate quench car . whith the push guide 54 in position in alignment with the opening in the oven , the coke in the oven is pushed from the oven and through the push guide 54 whereupon the coke will fall into the quench car , or the like . as shown in cross section in fig4 the push guide 54 contains a vertical framework 56 secured to the undercarriage 52 and has a rectangular passageway 58 extending transverse to the axis of the undercarriage 52 . one end portion 60 of the passageway projects sidewardly toward the coke oven and has an opening 62 through the passageway which aligns with the opening in the coke oven . a superstructure 64 is built on the opposite side of the vertical framework 56 , which superstructure supports the opposite end of the passageway 58 and supports the front plate 66 . the front plate 66 engages with the edge of the passageway 58 which defines the rectangular opening 62 with the long axis of the opening lying vertically to the undercarriage 52 . the coke is pushed from one of the ovens 46 through the opening 62 in the push guide 54 and will fall from the guide 54 into the cavity 42 in the quench car 10 . mounted on undercarriage 68 and extending in one direction on one side of the push guide 54 is a vertical framework 72 which , as can be seen in fig3 has a superstructure 74 for supporting a flat sidewardly facing closure plate 70 thereon . the lower portion 76 of the closure plate 70 is tapered downwardly and inwardly and terminates at the framework 72 . a counterbalance weight arrangement 77 is suspended on the opposite side of the undercarriage so as to hold the closure plate 70 in a vertical orientation . mounted on undercarriage 78 on the opposite side of push guide 54 is a conventional door machine 79 which has a superstructure 80 supporting another closure plate 70 thereon . the closure plate 70 has the downwardly and inwardly directed lower portion 76 which terminates at the undercarriage 78 . the closure plates 70 are of sufficient height and have the lower portions 76 extending back from the plane of the plates 70 in overlapping relationship with the outer edge 32 of the sloping bottom wall 24 of the quench car . the superstructures 64 , 74 and 80 of the push guide 54 and closure plates 70 , respectively , have upwardly angled frame members 83 such that the downwardly disposed outer edge 40 of the hood 38 overlaps behind the front plate 66 and the closure plates 70 with the top edges 84 of the front plate 66 and of the closure plates 70 disposed reasonably close to the inside of the hood 38 of the quench car 10 to provide a narrow gap 86 therebetween ( fig5 ). the closure plates 70 project horizontally in opposite directions from the push guide 54 an amount such that the vertical remote edge 88 of the closure plate 70 will substantially align with the edge 34 of the forward wall 26 of the quench car 10 when the rearward wall 28 of the quench car aligns just beyond the rectangular opening 62 of the push guide 54 . since the closure plates 70 extend on opposite sides of the push guide 54 , it can be seen that at no time will the enlarged side opening 22 of the quench car 10 be exposed to the atmosphere by an amount in excess of the spacing between the edges of the opening in the quench car and the surfaces of the closure plates , all as will be described more in detail hereinafter . the quench car 10 and equipment trailer 12 are brought up toward the closure plates 70 and coke push guide 54 on the rails 14 by means of the donkey engine . the quench car 10 will be moved until the vertical edge 34 of the side opening 22 of the car 10 is aligned just beyond the opening 62 in the push guide 54 . that is , the edge 34 of the quench car 10 will align with the front plate 66 of push guide 54 just beyond the edge of the rectangular opening 62 in the push guide 54 . the vertical edges 34 , 36 of the opening in the quench car are spaced a short distance from the plane of the closure plates 70 and front plate 66 of the push guide so as to provide a restricted narrow gap therebetween . the top edge 84 of the closure plate 70 will be under the hood 38 of the quench car with the top edge 84 of the closure plate 70 spaced a short distance from the inside surface of the hood to form the narrow gap 86 . the one remote edge 90 of the closure plate 70 will be substantially aligned with the vertical edge 36 of the opposite end of the side opening 22 in the quench car . the sloping wall 24 and the lower portion 76 of the closure plate 70 will overlap with and be relatively closely spaced to the outer edge 32 of the sloping bottom wall 24 of the cavity 42 of the quench car . in this way , the edges of the closure plates 70 and push guide 54 will be spaced a short distance from the quench car so as to provide a narrow gap or opening between the closure plate and the opening into the quench car . with the exhaust device on the equipment trailer 12 operating , a strong suction will be created in the hood 38 of the quench car 10 which will draw a stream of air through the restricted narrow gaps between the closure plate and the edges of the opening 22 in the open side of the quench car . burning coke pushed from the oven will be pushed through the opening 62 in the push guide 54 and will crumble and fall into the one end of the quench car , emitting great clouds of smoke and solid pollutants sometimes called a &# 34 ; push cloud &# 34 ;. the quench sprays in the quench car will be activated to spray water and the like , onto the burning coke . the quench car is moved slowly past the push guide 54 so that as the coke is pushed continuously forward from the oven , it will fall into the cavity 42 in the quench car in a fairly even loading as the quench car passes the guide opening 62 . the closure plate 70 , on both sides of the push guide 54 , will continually line up with the edges of the opening 22 into the quench car so as to provide a substantially continuous , uniform narrow gap into the quench car around the edges of the closure plates 70 . at the time the quench car has the rear edge 36 of the opening 22 aligned with the far edge of the push opening 62 in the push guide 54 , the complete coke batch will have been pushed from the oven and the quench car will be substantially filled with the coke being quenched . the exhausting device will continuously pull the air through the narrow gap around the edges of the closure plate and front plate of the guide and will pick up the gases and particulate emissions from the push cloud and quench cloud and move same through the scrubbers and demisters for cleaning same prior to discharging the cleaned gases to the atmosphere . due to the defining of a narrow gap by the closure plates 70 , air drawn into the quench car will pick up the gases and particulate emissions and transport same to the scrubbers . since the narrow gap between the closure plates 70 and the quench car is relatively small , there is virtually no possibility of any of the gaseous and particulate emissions escaping through the narrow gap to the atmosphere . accordingly , the provision of the closure plates restricts the opening into the quench car in such a way as to restrict the inflow of air so as to prevent the emission of a &# 34 ; push cloud &# 34 ; or a &# 34 ; quench cloud &# 34 ; to the atmosphere from beneath the hood . the horizontal extent of the closure plates is such that at no point in the process of pushing a batch of coke from an oven into the quench car will there be any excessive gap for air to freely flow into the quench car and permit gases to be emitted from said opening . therefore , the location and size of the closure plates with respect to the opening in the quench car is such as to create the necessary high speed flow of air into the quench car opening so as to flush the emissions from the push cloud and quench cloud into the scrubbers without said emissions flowing forth into the atmosphere prior to scrubbing . upon completing the push of coke from one oven , the push guide 54 and closure plates 70 can be moved on the separate set of tracks so as to align the rectangular opening the push guide 54 with the appropriate opening in the other furnace or oven so that a new , fresh batch of coke may be pushed through the coke guide and into the quench car without polluting the atmosphere . the undercarriages 52 , 68 and 78 , upon which the push guide 54 and closure plates 70 are mounted , are individually supported on their own sets of trucks and wheels and coupling means being provided for coupling the one closure plate 70 to one side of the push guide 54 and for coupling the other closure plate 70 to the other side of the push guide 54 . the closure plates 70 can be modularized in such a way that sections such as 70a , 70b and 70c may have an additional section 70d added or may have one section , i . e ., 70c , removed so as to vary the longitudinal extent of the closure plate 70 so as to accommodate different lengths of quench cars . | 2 |
embodiments of the invention will now be described hereinbelow with reference to the drawings . fig2 a and 2b are a front view and a side sectional view showing a rear projection type receiver of the first embodiment according to the invention , respectively . fig3 is a side elevational view showing an example of a construction of a screen 2 in fig2 . fig4 is a front view of an eccentric fresnel lens 2a in fig3 . fig5 is a top cross sectional view showing a part of a construction of a double lenticular lens 2b in fig3 . fig6 is a diagram showing an equivalent positional relation between the screen 2 and a projection tube 4 in fig2 . fig7 is a diagram showing the position of the projection tube 4 in the case where an optical path of a light which is emitted from the light projection tube 4 was bent by using only a second mirror 32 . fig8 is a diagram showing a limitation of an attaching angle of the second mirror 32 . the rear projection type receiver of the embodiment comprises : a casing 1 ; the screen 2 which is attached to a front surface of the casing 1 ; a small first mirror 31 and the large second mirror 32 which are attached to the rear inside of the casing 1 and are formed by surface mirrors each having a reflectance within a range from 90 to 100 %; and the projection tube 4 enclosed on the lower side of the casing 1 . the projection tube 4 is a well - known lens integrated type projection tube similar to the projection tube 104 shown in fig1 . the projection tube 4 comprises : a crt socket board 5 ; a centering magnet 6 ; an electromagnetic focusing coil 7 ; a focusing magnet 8 ; a deflecting yoke 9 ; a crt 10 of seven inches ; a bracket 11 ; and a group of projection lenses 12 . the projection lens group 12 comprises glass or hybrid lenses and is constructed in a manner such that an f number is set to a value within a range from f1 . 0 to f1 . 2 and a distance from the front edge of the lens to the center of the screen 2 is set to about 1 , 000 mm and an image which is formed by the crt 10 is enlargedly projected . the crt socket board 5 , centering magnet 6 , electromagnetic focusing coil 7 , focusing magnet 8 , and deflecting yoke 9 are attached to the crt 10 and those components function so as to form a preferable image on the crt 10 . three projection tubes 4 for color lights of red , green , and blue are arranged in the direction perpendicular to the paper surface of fig2 b and are enclosed in the casing 1 . the crt 10 and the projection lens group 12 are coupled by the bracket 11 also serving as a heat radiation fin . a space between the crt 10 and the projection lens group 12 is filled with a transparent coolant such as an aqueous solution of ethylene glycol or the like , thereby improving a luminance and a contrast of the apparatus . as shown in fig3 the screen 2 comprises the eccentric fresnel lens 2a and the double lenticular lens 2b . the eccentric fresnel lens 2a is made of a methacrylic resin or the like in which a light transmittance is 90 % or more and a thickness lies within a range from 0 . 5 to 5 mm and a refractive index is equal to about 1 . 5 . the double lenticular lens 2b functions so as to widen right and left angles of visibility . the screen 2 is attached to the casing 1 so that the double lenticular lens 2b is located on the side of a viewer a . as shown in fig4 the eccentric fresnel lens 2a is decentered such that the center of a number of concentric circular prisms formed on the prism surface is located to the upper side than the center of the screen 2 . the prism surface is directed to the viewer a . the surface which faces the eccentric fresnel lens 2a and is located on the side opposite to the prism surface is worked so as to have a flat surface . as shown in fig5 both surfaces of the double lenticular lens 2b are constructed by a group of fine barrel - shaped lenses . the above fine lenses and black stripes 2c to emphasize the contrast are alternately formed on the surface of the double lenticular lens 2b on the side of the viewer a . as shown in fig2 the first mirror 31 is arranged on the optical path of the light which is emitted from the projection tube 4 in the direction which is opposite to the screen 2 and is away therefrom . the first mirror 31 reflects the light to the upper side of the casing 1 . the second mirror 32 is arranged on the optical path of the light which was reflected by the first mirror 31 . the second mirror 32 reflects the reflected light in the direction of the screen 2 . the first and second mirrors 31 and 32 are arranged in the casing 1 in a manner such that an angle which is formed by the first and second mirrors is equal to 95 ° and an angle which is formed by the second mirror 32 and the screen 2 is equal to 60 °, respectively . thus , the light reflected by the second mirror 32 is led such that the light beam which passes through the upper edge of the optical path of such a reflected light enters the screen 2 at an incident angle of 0 ° on the upper side of the screen 2 and that the light beam which passes through the center of such an optical path enters the screen 2 at an incident angle of 15 ° at the center of the screen 2 , respectively . therefore , in the embodiment , as shown in fig6 the position of the projection tube 4 for the screen 2 is equivalently set to the right upper side of the screen 2 . the operation of the rear projection type receiver of the embodiment will now be described . in the rear projection type receiver , as shown in fig2 b , the color lights corresponding to the red , green , and blue components of the image signals which are emitted from the three projection tubes including the projection tube 4 are bent like a u - shape by the first and second mirrors 31 and 32 . after that , they are projected to the screen 2 , so that a color image is formed on the screen 2 . as shown in fig3 the color lights which were projected to the screen 2 are converged to the eyes of the viewer a locating at the height of the center position of the screen 2 by the eccentric fresnel lens 2a . therefore , the viewer a can observe the color image which is displayed on the screen 2 at the height of the dyes in a manner similar to the conventional apparatus . in the embodiment , a distance l from the viewer a to the screen 2 is set to a value within a range from 3h to 6h , in which h denotes a height of the screen 2 . therefore , in the rear projection type receiver , the optical paths of the color lights which are emitted from the projection tube 4 are bent like a u shape by the first and second mirrors 31 and 32 and the principal ray of the color light which enters the upper side of the screen 2 is projected to the screen 2 at an incident angle of 0 °. therefore , as shown in fig2 b , a space to enclose the projection tube 4 is assured on the rear side of the screen 2 of the casing 1 . the projection tube 4 can be laterally arranged as compared with the conventional apparatus shown in fig1 b , so that the height of the casing 1 can be set to a very low height . thus , in the case of manufacturing the rear projection type receiver in which a screen size is equal to 50 inches and an aspect ratio is set to 9 : 16 as mentioned above , the receiver can be realized by the casing 1 in which a height is equal to about 800 mm ( about 1 , 280 mm ) and a depth is equal to 820 mm ( about 700 mm ) according to the embodiment and a compact size can be accomplished as compared with the conventional example whose dimensions are shown in the above parentheses . attaching angles of the first and second mirrors 31 and 32 will now be described . as described above , the rear projection type receiver of the embodiment is equivalent to the receiver in which the projection tube 4 is arranged in the right upper portion on the rear side of the screen 2 as shown in fig6 . to reduce the depth of such an equivalent receiver , in the case where the optical path of the light which is emitted from the projection tube 4 was bent by using only the second mirror 32 in a manner similar to the conventional apparatus shown in fig1 the projection tube 4 is located on the lower side of the screen 2 as shown in fig7 . in this case , although the depth of the receiver is decreased , the height of the receiver increases because the projection tube 4 is nearly vertically enclosed in the casing 1 . therefore , in the rear projection type receiver in the embodiment , by previously once bending the optical path of the light which is emitted from the projection tube 4 by using the first mirror 31 , the projection tube 4 is set to the position shown in fig2 thereby reducing both of the depth and height of the receiver . however , to bend the optical path of the light which is emitted from the projection tube 4 by using the first mirror 31 , a limitation in the case of vertically arranging the projection tube 4 as shown in fig8 is maximum . at this time , an angle which is formed by the second mirror 32 and the screen 2 is set to 52 . 5 °. therefore , the attaching angle of the second mirror 32 is set so that an angle between the second mirror and the screen 2 lies within a range from 52 . 5 ° to 90 °. a limit value of the angle between the first and second mirrors 31 and 32 is set to an angle at which the projection tube 4 starts to obstruct the light which is projected to the lower side of the screen 2 . such a limit angle depends on the size of the projection tube 4 or the like . a lower limit value of the angle between the second mirror 32 and the screen 2 is generally set to ( 90 °+ θ °)/ 2 when assuming that an incident angle of the light which is projected to the central portion of the screen 2 is set to θ °. the lower limit value of the angle between the second mirror 32 and the screen 2 can be also further reduced by slightly enlarging the depth of the receiver . fig9 a and 9b are a front view and a side sectional view showing the second embodiment of the rear projection type receiver of the invention , respectively . in the rear projection type receiver shown in fig2 the projection tube 4 has been enclosed on the lower side ( lower side of the screen 2 ) of the casing 1 . however , in the second embodiment , a projection tube 24 is enclosed on the upper side ( upper side of a screen 22 ) of a casing 21 and an arrangement of a first mirror 231 and a second mirror 232 is also opposite to that in the first embodiment shown in fig2 . that is , the first mirror 231 is arranged on the upper side of the casing 21 and the second mirror 232 is arranged on the lower side of the casing 21 , respectively . therefore , in the embodiment , the color lights which are projected to the lower side of the screen 22 enter the screen 22 at an incident angle of 0 °. in the case of using the rear projection type receiver of the second embodiment by hanging down from the ceiling or the like , the receiver can be attached easier than the case of the first embodiment shown in fig1 . the other effects are similar to those in the first embodiment . fig1 a and 10b are a front view and a top cross sectional view showing the third embodiment of a rear projection type receiver of the invention , respectively . the rear projection type receiver of the third embodiment has a structure in which the receiver of the first embodiment shown in fig2 is rotated by 90 ° and is set vertically . a projection tube 44 is enclosed on the right side ( right side of a screen 42 ) of a casing 41 . optical paths of color lights which are emitted from the projection tube 44 are bent like a u - shape by a first mirror 431 and a second mirror 432 so that the color lights which are projected to the left side of the screen 42 enter the screen 42 at an incident angle of 0 °, respectively . in the case of using the screen 42 in a vertical longitudinal state , the rear projection type receiver of the third embodiment is more advantageous than the receivers shown in fig2 and 9 with respect to the installation and the like . the other effects are similar to those in the receiver shown in fig2 . it is also possible to construct in a manner such that the projection tube 44 is enclosed on the left side ( left side of the screen 42 ) of the casing 41 and the color lights which are projected to the right side of the screen 42 enter the screen 42 at an incident angle of 0 °. fig1 a and 11b are a front view and a side sectional view showing the fourth embodiment of a rear projection type receiver of the invention , respectively . the rear projection type receiver of the fourth embodiment is constructed in a manner such that four projection tubes ( only a first projection tube 641 and a second projection tube 642 are shown in the diagrams ) are used and one image or four different images are displayed to a screen 62 which are separated into four sections . two projection tubes including the first projection tube 641 among the four projection tubes are enclosed on the lower side of a casing 61 and remaining two projection tubes including the second projection tube 642 are enclosed on the upper side of the casing 61 . first and second mirrors 631 and 632 are arranged in a manner similar to the first and second mirrors 31 and 32 shown in fig2 . third and fourth mirrors 633 and 634 are arranged in a manner similar to the first and second mirrors 231 and 232 shown in fig9 . the second and fourth mirrors 632 and 634 are arranged so that one side of the second mirror comes into contact with one side of the fourth mirror at the height of the central portion of the screen 62 . each of the first to fourth mirrors 631 to 634 has almost the same length as a length in the lateral direction of the screen 62 . in the fourth embodiment , the color lights which are projected to the central portion of the screen 62 enter the screen 62 at an incident angle of 0 °. in the embodiment , since four projection tubes are used , the effect to realize a compact size is further enhanced . it is also possible to construct a system by combining four vertically longitudinal receivers shown in fig8 in a manner similar to the fourth embodiment . fig1 a and 12b are a front view and a side sectional view showing the fifth embodiment of a rear projection type receiver of the invention , respectively . the rear projection type receiver of the fifth embodiment uses a liquid crystal projecting apparatus 84 as projecting means in place of the projection tube 4 in the rear projection type receiver shown in fig2 . a construction of a mirror assembly and the like are substantially the same as those shown in fig2 . the liquid crystal projecting apparatus 84 comprises : a light source lamp 85 to emit a white light ; a reflector 86 to reflect the white light ; a thermal filter 87 to reflect a heat ray in the incident white light ; a condenser lens 88 to convert the incident white light into the parallel white light ; a liquid crystal display 89 to modulate the parallel white light in accordance with an image signal ; and a group of projection lenses 90 to project the parallel white light which was modulated by the display 89 to the screen 82 through a first mirror 831 and a second mirror 832 . in the embodiment , a compact size can be realized by using the liquid crystal projecting apparatus 84 . even in the rear projection type receivers shown in fig9 to 11 , a further compact size can be realized by using the liquid crystal projecting apparatus 84 . the liquid crystal projecting apparatus 84 is not limited to the construction shown in fig1 but can also use a structure comprising : three liquid crystal displays for respectively separating the parallel white light which is transmitted from the condenser lens 88 to the color lights of red , green , and blue and for modulating the color lights in accordance with the red , green , and blue components of the image signal ; a single projection lens or a group of three projection lenses ; and the like . in the rear projection type receiver shown in fig2 the color lights which are projected to the upper side of the screen 2 enter the screen 2 at an incident angle of 0 °. however , similar effects are also obtained if the color lights enter the screen 2 at an incident angle within a range of 0 °± 5 °. the same shall also applied to the embodiments shown in fig9 to 12 . in the rear projection type receivers constructed as mentioned above , the optical path of the light which is projected from the projecting means to the screen is bent like a u - shape and on the side of the screen opposite to the side on which the projecting means is enclosed , the light beam at the edge of the light is allowed to enter the screen at an incident angle within a range of 0 °± 5 °, so that the projecting means can be laterally installed as compared with the conventional receiver . there is an effect such that a compact size can be realized . on the upper or lower side of the screen , by allowing the light beam at the edge of the light to enter the screen at an incident angle within a range of 0 °± 5 °, there is an effect such that a compact size of an ordinary laterally long rear projection type receiver can be realized . by constructing the screen by using the eccentric fresnel lens , there is an effect such that the light which transmits the screen can be directed to the viewer who faces the screen . the screen which is used in the invention is not limited to the forms shown in fig3 to 5 but any proper one of well - known various kinds of screens can be selected and used . in each of the foregoing embodiments , the optical axes of the projection tubes 4 , 24 , 44 , and 64 and the projecting apparatus 84 , which axes are determined by the lens groups of them , are inclined by an angle of about 22 ° for the axis perpendicular to the screen . such an angle is close to the angle of 15 ° between the screen and the optical axes along the optical path between the screen and the second mirror . as mentioned above , by constructing the apparatus in a manner such that the optical axis of the projection tube or the projecting apparatus is inclined at an angle of about 0 ° to 10 ° for the optical axis between the screen and the second mirror , the apparatus can be sufficiently miniaturized . on the other hand , a construction , an arrangement , and the like of the first and second mirrors as reflectors are also not limited to the structure shown in each of the embodiments . for instance , both of the first and second mirrors can be also connected . | 7 |
the present invention will now be described in more detail with reference to the accompanying drawings . as previously mentioned , this invention relates to the repair of standing poles in situ . primarily , this invention is directed towards the reinforcement or repair of wooden utility poles which have decayed because of their exposure to ground conditions or weather elements . in addition this method applies to the repair of wooden poles and cross bars that have been structurally compromised or damaged by insects , rodents , birds , ( particularly woodpeckers ), or any other environmental effect . although the method of repair of such structural damage caused by the birds , animals , and insects is basically identical to that for the repair of decay , there is one different , initial step for the cases of repair for bird , animal , or insect damage to the exterior . in these cases the pole is damaged primarily from the exterior , unlike decay which , in general , occurs from the inside . the initial step that must be taken when repairing the insect or animal damage involves the restoration of the original diameter of the pole . this may be accomplished by numerous means . one method would be to fill the hole with some material , examples are : an expanded cell foam , some type plastic filler material , or some type of paste or grout packing . because most such external openings do not extend for a large expanse across the surface of the pole , the only purpose of this packing or filler material is to restore the original complete cylindrical shape of the surface of the pole so that the composite wrap method may be applied . in addition , the packing will keep moisture from becoming trapped by filling any voids . as shown in fig1 there is an installed composite repair prior to the refilling of the excavation made for the repair . fig1 and 3 also indicate the area 2 of damage to the pole caused by decay . the components of the repair apparatus and method here described , comprise a quantity of fiberglass mats which are supplied in strips 3 of approximately six feet in length by sixteen to eighteen inches in width . this glass is supplied with the primary fibers 5 that will run in the vertical direction parallel with the longitudinal wood fibers of the pole as the strips are installed . the reason for this is that the maximum number of fibers are required in the vertical direction to resist the tensile stresses that will be the result of wind load upon conductors and cable . the fiberglass blanket utilized in the primary embodiment of this invention is supplied with 50 % of the fibers 5 running in the vertical direction , 25 % of the fibers 6 at 45 degrees to those vertical fibers and the remaining 25 % of the fibers 7 running at 90 degrees to the second set of fibers , which results in fibers 7 also being placed at 45 degrees to the primary longitudinal fibers 5 . this particular orientation of fibers within the fiberglass blanket is not common in the industry . although this orientation is the best method now known for arranging the fibers , further research may indicate that the desired placement of the fibers would be in a similar arrangement , but with different percentages . the weight of the glass mat is not particularly important because of the method of installation , which is described in greater detail below . the reason for the arrangement as previously mentioned is that the primary fibers run in the vertical directions to handle the bending stresses that are transferred to the composite encasement , but in addition to that , there is a need for some hoop strength . the reason the hoop strength is required is because since most of the applications for this repair method are related to wooden poles , installed into the ground , there will be moisture migrating up the pole . the composite repair encapsulates the wooden pole , with a substantially air tight seal to a distance of approximately three feet above the ground . in essence what has occurred is that the ground line has been moved up three feet . the moisture then migrates up that distance . if there is no hoop strength at all , the three feet of the pole above the ground begins to swell from taking on water , and without any hoop strength provided by a horizonal component from the fibers , the composite encapsulation would split apart . as mentioned , it is anticipated that further attention to the design of the orientation of the fibers in the glass mat would indicate that some savings in material could be realized by providing a different orientation . a probable likely design would provide 80 % of the fibers running in the vertical direction with 20 % located to provide the necessary hoop - strength as described above . in other words , 80 % of the fibers would be orientated as are the fibers 5 , with 10 % orientated as fibers ( 6 ) and another 10 % orientated as fiber 7 of fig2 . however , special designed glass would cost more , and until this method is more widely used the expense and redesigning and specially ordering a glass mat would not be worth the expense . at present a fiberglass weave marketed under the name knytex cdb - 340 has been found to work well , but equivalents can be selected using the parameters outlined above . in addition to the fiberglass mat component of present invention , the invention also comprises a coating 8 , a composite resin 9 and in most cases , will also include an exterior ultraviolet resistant coating 10 . fig2 & amp ; 3 . these components and their placement and purpose will now be further described . the primary embodiment of the present invention utilizes a coating whose method of application and sequence will be described in more detail below . the purpose of this coating is to enhance the bonding of the composite encasement to the exterior fibers of the utility pole . this invention therefore achieves a bonding which allows for a load transfer both above and below the structurally compromised area from the undamaged portion of the utility pole to the composite installed around the exterior of the pole about the structurally damaged area . for example , as depicted in fig1 if the bad area is 18 inches in length and located as it will be at the ground line , this invention aims to insure that for a minimum area of one or two pole diameters above and below the damaged area , the composite encasement will be well bonded to the surface of the wood pole . because the pole loads from the outside not the inside , by providing this encasement about the exterior of a pole , the composite repair insures a pole that will structurally take at least the same load as an undamaged pole . the wooden material of these utility poles typically has a fiber stress of 8 , 000 psi . the composite repair encasement installed typically has a tensile strength in the nature of 45 , 000 psi . by providing a sound bond between the encasement composite repair and the wooden pole , as traverse load is put on the pole and the pole develops bending stresses , they will be transferred to the composite encasement rather than to the structurally compromised area of the pole . testing indicates that in every case of a utility pole repaired with the method of this invention , the repaired poles will break at approximately the same locations as a structurally sound , new utility pole will break . two basic problems require the coating that is applied to enhance the bonding between the encasement and the utility pole . the first problem is moisture . moisture exists in the ground , and may have been absorbed in the utility pole to such a degree that the pole is wet . the second problem necessitating some type of coating to enhance the bonding is that utility poles are commonly treated with some type of preservative , a common example of which is creosote . over a period of time the preservative migrates down the pole and tends to migrate out into the soil along the area right at ground line . generally there will be a considerable amount of whatever preservative the pole was treated with still existing in the portion of the pole at or below ground line , which is the portion of the polo which is subject to structural compromise . after cleaning and prior to coating , the pole is treated with fumigant to kill any biological agents . holes are drilled into the pole ; dispersed about the decay area . next , a fumigant is pumped into the pole . three types of coatings have been tried , epoxy , urethanes , and shellac . epoxies are basically impervious to water but sensitive to hydrocarbons , such as the creosote coating preservatives common in utility poles . on the other hand , urethanes are impervious to hydrocarbons but sensitive to water . in this respect it &# 39 ; s a compromise . there are a variety of both epoxies and urethanes on the market and many of them would be suitable for this coating use . the coating is required to minimize the effect of the moisture within the pole or the preservative upon the composite resin during the curing period . the basic criteria for choosing an epoxy or urethane would therefore be to choose an epoxy that is relatively impervious to hydrocarbons or conversely , to choose a urethane that is not highly sensitive to moisture . the next component of the composite repair will be the resin 9 itself , fig2 . resins generally are either epoxies , polyesters , or vinylesters . polyesters are relatively moisture sensitive and if the coating 8 previously described does not achieve a good seal , the result will then be a slow cure between the polyester and the surface of the utility pole . although polyesters have been mentioned as a primary embodiment or as the first choice for the primary embodiment , they are followed as closely by epoxies and vinylesters . in these cases we are discussing common epoxies or component urethanes that are readily available in the industry , and as previously discussed criteria for choosing the components for this composite will be the preservative coatings applied to wooden poles , and the requirement of a good bond between the composite encasement and the surface of the wooden pole . the last component of the composite encasement of the present invention is the ultraviolet resistant coating 10 , fig3 . the ultraviolet resistant coating is required because the composite encasement is exposed to the weather , and ultraviolet has a deteriorating effect on composite resins over a period of time . as is also commonly known in the industry , there are numerous commercial coatings available for composites to provide resistance to ultraviolet and weather conditions . one example is a polane urethane . although the coating 10 is really only required for the above ground portion of the pole , it would typically be applied to the entire length of the composite encasement . the components of the composite repair apparatus of the present invention have been described as comprising ; a fumigant coating 8 applied to the exterior of the pole 4 to enhance the bonding between the pole 4 and the composite encasement 1 , multiple strips of a fiberglass mat 3 with particular fiber ( 5 , 6 , 7 ) orientation and of approximately 18 &# 34 ; width and approximately 6 &# 39 ; in length , a composite resin 9 and some type of ultraviolet resistant coating 10 . see fig2 & amp ; 3 . although the approximate dimensions of the fiberglass mat strips have been described and illustrated , the number has not , because the number will vary depending upon the class and height of the utility pole being repaired . wooden poles used in this country are classified for strength in accordance with ansi 05 . 1 , specifications and dimensions for wood poles . poles of a given class and height develop the same nominal strength regardless of wood species by providing the circumference ( diameter ) necessary for each species . since most of the utility poles are southern pine or douglas fir , ( which have the same dimensional requirements ), these woods have been evaluated for the purposes of patenting this invention . ansi pole classifications identify the lateral load a pole is expected to resist as follows : table 1______________________________________ansi 05 . 1 lateral loads class load ( lbs ) ______________________________________ 4 2400 3 3000 2 3700 1 4500 h1 5400 h2 6400______________________________________ the size ( circumference ) of the poles has been determined by applying the lateral load at a point two feet below the top of the pole and computing the stress at the critical point on the pole , determined by standard principles of engineering . for the purposes of the present invention , an engineering study was done considering the critical section for this repair system as being at the ground line , assuming that all forces would be carried by the composite encasement and assuming that the pole itself would carry none of the force . in other words , the composite repair system was considered as a splice connecting two independent pieces of pole , as if the pole were completely rotted at the ground line and unable to carry any load . based upon the result of this type of analysis , the number of layers of strips for a given class pole was then generated by computer analysis . the thickness requirements for the composite encasement were computed by taking a particular pole length and class , and computing the bending moment at ground line . using a fiber stress of 8 , 000 psi it is indicated in ansi 05 . 1 for douglas fir and southern pine , a minimum ground line diameter was determined . the diameter was consistent with the circumference required by ansi 05 . 1 at six feet from the butt of the pole . the bending stress in the composite encasement is computed considering the encasement to have the same diameter as the pole diameter . a limiting vertical casing stress determined by empirical testing , was used in determining the thickness of the composite encasement required for a given pole class and length . in addition to resisting bending moment , the repair system also transfers lateral load into the lower section of the pole . therefore , the cross section of the composite encasement must resist the sheering forces . the composite encasement thickness required to resist the sheer is quantified by the formula : t = 2 × v / 3 . 14 × d × f ), where v equals the antiload dependent on the pole class , d equals the diameter of the composite encasement and f equals the allowable sheer stress , determined from empirical testing ), range investigated it has been conservatively added to the thickness required to resist the bending moment . this approach vertical tension ratios . to validate the above simple analyses a computer model of the pole casing system was also evaluated . the computer analyses confirmed the suitability of the above described analyses as the resulting stresses were very similar in magnitude . these computer analyses also confirmed the interaction behavior of the composite encasements in the pole as the pole and the casing work together , or compositely to resist applied forces . to work compositely , the forces in the pole transfer from the pole to the composite encasement . the testing and analyses indicate that to accomplish the load transfers the casing must be bonded to the wood . the minimum length of composite encasement required to transfer the forces is about equal to the pole diameter . for design purposes , two diameters have been selected to account for variations in pole materials and bond stress along the bond length . the transfer length is the overlap of the casing and good quality wood . the normal repair arrangement therefore , as described therefore with the composite encasement extending about three feet above and below grade is suitable for the common pole sizes , for the decay will be limited to the immediate ground line region of the pole . based upon the above evaluations , the total composite encasement thicknesses required for the normal range of pole classes is exemplified in the following table , which gives thicknesses in multiples of one sixteenth of an inch indicating how a given casing thickness is applicable for a range of pole sizes and classes . for example a half inch composite encasement could be used for a 75 foot class 3 pole or for a thirty five foot class h2 pole . table 2______________________________________total shell thickness required ( 1 / 16 in .) mo - pole ground ment ← pole class and ansi load ( lb )→ length to arm 4 3 2 1 h1 h2 ( ft ) butt ( ft ) 2400 3000 3700 4500 5400 6400______________________________________20 4 . 0 14 . 0 5 . 00 5 . 00 6 . 00 6 . 0025 5 . 0 8 . 0 5 . 00 6 . 00 6 . 00 7 . 0030 5 . 5 22 . 5 6 . 00 6 . 00 7 . 00 7 . 0035 6 . 0 27 . 0 6 . 00 6 . 00 7 . 00 7 . 00 8 . 00 8 . 0040 6 . 0 32 . 0 6 . 00 7 . 00 7 . 00 8 . 00 8 . 00 9 . 0045 6 . 5 36 . 5 7 . 00 7 . 00 8 . 00 8 . 00 9 . 00 9 . 0050 7 . 0 41 . 0 7 . 00 7 . 00 8 . 00 8 . 00 9 . 00 9 . 0055 7 . 5 45 . 5 7 . 00 8 . 00 8 . 00 9 . 00 9 . 00 10 . 0060 8 . 0 50 . 0 7 . 00 8 . 00 8 . 00 9 . 00 9 . 00 10 . 0065 8 . 5 54 . 5 7 . 00 8 . 00 8 . 00 9 . 00 10 . 00 10 . 0070 9 . 0 59 . 0 8 . 00 8 . 00 9 . 00 9 . 00 10 . 00 10 . 0075 9 . 5 63 . 5 8 . 00 9 . 00 9 . 00 10 . 00 11 . 0080 10 . 0 68 . 0 8 . 00 9 . 00 10 . 00 10 . 00 11 . 0085 10 . 5 72 . 5 9 . 00 9 . 00 10 . 00 10 . 00 11 . 0090 11 . 0 77 . 0 9 . 00 9 . 00 10 . 00 11 . 00 11 . 0095 11 . 0 82 . 0 10 . 00 10 . 00 11 . 00 11 . 00100 11 . 0 87 . 0 10 . 00 10 . 00 11 . 00 12 . 00105 12 . 0 91 . 0 10 . 00 11 . 00 11 . 00 12 . 00110 12 . 0 96 . 0 10 . 00 11 . 00 11 . 00 12 . 00115 12 . 0 101 . 0 10 . 00 11 . 00 12 . 00 12 . 00120 12 . 0 106 . 0 10 . 00 11 . 00 12 . 00 12 . 00125 12 . 0 111 . 0 11 . 00 11 . 00 12 . 00 13 . 00______________________________________ as indicated in the above table the number of strips of glass mat required to repair any given pole will vary depending upon the pole &# 39 ; s length , class , and design load . the number can be easily determined in the field by a workman with a tape measure , who simply applies strips until the required thickness is reached . the application of the strips will be discussed in further detail below . the primary embodiment of the present invention comprises a kit with two five gallon buckets , a roll of glass mat , a shovel , and tape measure . workmen simply go out and excavate the base of the utility pole until they have a hole large and deep enough to work in to clean the pole to a depth of 3 feet below ground line . after they have the hole dug , they will take a wire brush or equivalent to scrape down the pole and restore the surface . then holes are drilled into the pole and the fumigant is pumped into it . the best method for the repair is to set up a table for working the resin . in general , the table is tray - shaped and generally , the mat is supplied in a roll , and the strips are simply rolled off and cut at six foot lengths . the resin and the catalyst is mixed on the table , the glass strip is laid into the mix , and then worked with a paint roller , rolled back and forth , until the glass mat is saturated with the resin . as one man is working the resin into the glass mat , another is applying the saturated mat strips to the cleaned portion of the utility pole from approximately three feet below the ground line to three feet above the ground line . the saturated glass mat is simply placed against the pole , and then rolled with a paint roller to work the glass . when the resin becomes transparent , the workmen know there are no air pockets . the strips are overlapped by hand , beginning on one side of the pole , rolling on the first proceeding around the pole . because the workmen will be supplied with the information embodied in the table above , which describes the thickness of composite encasement required for any given class and length pole , the saturated glass strips are simply applied until the desired composite encasement thickness has been reached . the workmen who are responsible for applying the saturated glass strips can then move their saturation table and the buckets to the next pole where the workmen with the shovel already has the hole completed . by the time the workmen have moved and reset their saturation table , the composite encasement applied to the previous pole will be ready for the application of the ultraviolet inhibiting coating and the hole can be filled back in within 15 minutes of that application . an additional advantage of this method of application over the prior art repair systems , is that many utility poles are equipped with ground wires , small wooden molding , disconnects , switch handles , riser pipes , and other devices of a like nature . any type of mechanical device repair system would require the complete disassembly of the above mentioned devices . with the composite repair system of the present invention , any attachment to the utility pole has only to be pulled out enough to be able to slip a sheet of saturated glass material behind it . the entire process , including digging the holes , takes about an hour and a half to two hours , depending upon how efficient the workmen are . this time includes up to an hour for the digging of the hole , so the time savings , as compared to prior techniques are readily apparent , as are the differences in equipment required . a further advantage that the repair system of this invention exhibits over prior devices , is that in many cases a utility pole is installed so closely to building or concrete footings or the like that there is not enough clearance all the way around the pole for prior art encasement methods . the method of this invention requires only the width of the fiberglass plus perhaps , a few inches of space to work the glass . an additional advantage exhibited by the repair technique of the present invention is that a fumigant to kill bacteria and fungus can be injected into the rotted area of the pole . once such a fumigant has been injected , and the composite encasement applied , the fumigant is sealed within that area and it will permeate the wood . being encapsulated , the fumigant will not escape from the pole and will last much longer in contrast to the non - encapsulated splinting type prior art repair methods . it is to be understood that many combinations and sub - combinations of the concepts taught by this specification will be obvious to those in the art . as many possible embodiments of this invention may be made without departing from the spirit or scope , it is to be understood that all matters set forth are shown in the accompanying drawings , but to be interpreted as illustrative and not in a limiting sense . | 4 |
referring to fig1 there is shown a car seat s having a headrest h mounted to it by means of a pair of upright posts p , which project from the underside of the headrest , being received in respective sockets in the top edge of the back of the seat . a mount 10 is attached to the rear of the headrest h : the mount 10 is arranged for a flat , lcd video screen to be fitted to it to secure the screen against the rear surface of the headrest . the mount 10 comprises a flat , rectangular plate formed , adjacent each of its ends , with a pair of elongate apertures 12 aligned parallel with its length . two straps 14 are provided , and are threaded through the respective pairs of apertures 12 and passed around the top and bottom of the headrest : each strap is pulled tight around the headrest and its free ends are fastened together ( e . g . by means of hook - and - loop ( velcro ) fasteners ) to secure the mount 10 firmly against the rear of the headrest . the front face of the mount 10 may be formed with a pair of vertically - spaced studs 15 ( as shown in fig1 ) to facilitate the mounting of the video screen : instead , it may be formed with a projecting t - section rib 16 ( as shown in fig2 and 3 ), running parallel to the opposite ends of the mount mid - way between them ; the rib 16 enables a video screen , having a corresponding t - section groove in its rear , to be slidably mounted onto the mount 10 . the mount 10 is formed of plastics material and is strengthened by a peripheral lip 11 on its rear surface , as shown in fig2 and 3 . from fig2 it will be appreciated that the mount is symmetrical about both vertical and horizontal medial lines , so can be attached either way up to the headrest . in order to enable adjustment to the orientation of the screen , i . e . the direction in which it faces , a sheet 18 of foam plastics material is interposed between the mount 10 and the rear surface of the headrest . the two straps 14 may be tightened by different amounts , so that the sheet of foam plastics material is compressed to different degrees adjacent its opposite ends , so that the screen is directed to left or right as required . alternatively , the piece of foam plastics material may comprise a packing strip which is positioned as required towards one end or towards the top or bottom of the mount 10 . referring to fig4 there is shown a second embodiment of screen mount attached to the headrest h of the car seat . in this embodiment , the screen mount comprises a strap 20 the ends of which are passed over the top and under the bottom of the headrest , and fastened together , e . g . by means of hook - and - loop ( velcro ) fasteners . the strap 20 is provided with two projecting studs 22 , spaced apart along its length and therefore vertically when the strap is tied around the headrest , onto which the video screen may be mounted : the strap is tensioned sufficiently to hold the screen firmly in position . the strap 20 may be displaced around the headrest to direct the screen as required in the vertical plane : in order to deflect the screen to left or right , a packing strip may be interposed between the back of the screen and the rear of the headrest , towards the right or left end of the headrest . referring to fig5 there is shown a third embodiment of screen mount attached to the headrest h of the car seat . in this embodiment , the screen mount comprises a strap 30 the ends of which are passed around the opposite ends of the headrest and fastened together , e . g . by means of hook - and - loop ( velcro ) fasteners . the strap 30 is provided with two projecting studs 32 , spaced across its width and therefore vertically when the strap is tied around the headrest , onto which the video screen may be mounted . the strap 30 is tensioned sufficiently to hold the screen firmly in position . the strap 30 may be displaced around the headrest to direct the screen as required in the vertical plane : in order to deflect the screen to left or right , a packing strip may be used in the manner described for the embodiment of fig4 . referring to fig6 there is shown a fourth embodiment of screen mount attached to the headrest h of the car seat . in this embodiment , the mount comprises an elasticated cover 40 in the form of an envelope , open along its bottom edge , which is fitted over the top of the headrest . because of its elasticated nature , the cover 40 grips the headrest firmly to maintain its position on the headrest . the cover 40 is provided , in its rear side , with a pair of projecting studs 42 , onto which the video screen may be mounted . the cover 40 may be displaced around the headrest to direct the screen as required in the vertical plane : a packing strip may be interposed between the screen and the headrest , as described for the embodiments of fig4 and 5 , to deflect the screen to left or right . it will be appreciated that , in each of the embodiments which have been described , the video screen may be attached to the mount either after the mount is secured to the headrest , or beforehand . similarly , the video screen may be removed from the mount either before the mount is removed from the headrest , or afterwards . upon leaving the car unattended , the video screen will normally be detached and stored in a safe place : the mount may be left in position on the headrest , or it may be removed . while the preferred embodiment of the invention have been shown and described , it will be apparent to those skilled in the art that changes and modifications may be made therein without departing from the spirit of the invention , the scope of which is defined by the appended claims . | 8 |
the following detailed description is of the best presently contemplated modes of carrying out the invention . this description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating general principles of embodiments of the invention . the invention disclosed herein provides a process for securely enrolling individuals into devices with means for personal identification via use of biometric authentication ( hereafter referred to as ‘ personal identification devices ’). because these devices are intended for use as trusted authentication devices , it is imperative that all of the information stored within the device be placed there in such a manner that it cannot be altered without proper authorization . there are two participants in the enrollment process , the manufacturer of the personal identification device and an enrollment authority . the enrollment process includes identifying the device post - manufacturing and enrolling personal identity credentials and an associated biometric into the personal identification device . furthermore , the invention also discloses methods for creating secure backup and recovery processes , such that an individual may securely store the enrolled information in an electronic storage repository , such as a hard drive . if his personal identification device fails he can use the recovery process to transfer the stored , enrolled information to a new device . the two participants in the enrollment process must be definitely and separately identified for proper enrollment . the first participant in the enrollment system is the manufacturer of the personal identification device . the manufacturer is responsible for maintaining a database of unique identifiers , such as serial numbers , for all of the devices that it produces . this enables it later to determine if it manufactured a particular device . the second party is an enrollment authority , which is responsible for investigating , authorizing and performing individuals &# 39 ; requests for enrollment into a personal identification device . this participant may be a department of motor vehicles , a building security officer , or any other person or organization responsible for issuing personal identification devices . this enrollment system uses the pki described above . each manufacturer and enrollment authority is provided with at least one asymmetric key pair that can be used for identification and encryption . the key pairs may be self generated , but the public key for each must be placed in a digital certificate signed by a trusted authority . additionally , the manufacturer may wish to sign digital certificates owned by the enrollment authority as means for guaranteeing its approval of the enrollment authority . fig1 demonstrates the post - manufacturing process that begins the enrollment process for a personal identification device . immediately following manufacturing , each personal identification device receives a public key possessed by its manufacturer ( step 101 ). in the preferred embodiment this key is received as part of a digital certificate . the personal identification device can use this public key to verify the digital signature on messages transmitted from the manufacturer and accept them as legitimate instructions . this step requires that the manufacturing process be secure and tamper - resistant ; receiving a key other than a trusted manufacturer &# 39 ; s would directly compromise future security verifications . the personal identification device now generates an asymmetric key pair for itself ( step 102 ). the public key and the device &# 39 ; s unique identifier are sent to the manufacturer ( step 103 ). the manufacturer , or other legitimate certificate authority , generates a digital certificate for the device ( step 104 ). this is now sent back to the device , and can be signed by the manufacturer as a token of its legitimacy ( step 105 ). the manufacturer keeps a record of the device &# 39 ; s public key and its unique identifier for future reference ( step 106 ). at this point all functionality within the personal identification device is disabled , such that it is in a state waiting for future enrollment ( step 107 ). as seen in fig2 , upon receipt of a personal identification device , an individual requests enrollment rights from an enrollment authority ( step 201 ). this may require that the individual be physically present in a specified location , or may be performed remotely . the enrollment authority may establish all rules pertaining to the applicant verification process . the security and authenticity of the personal identification device is only as good as that of the verification process , so it is anticipated that these processes will be as stringent as required by the end application . after approving the applicant , the enrollment authority receives the personal identification device &# 39 ; s digital certificate ( steps 202 and 203 ). the enrollment authority validates the digital certificate by prompting the device to encrypt a predetermined string with its private key ( step 204 ). the enrollment authority now decrypts the encrypted string using the public key stored in the device ′ digital certificate , and verifies that the decrypted string matches the predetermined string . at this point the personal identification device will receive and verify the validity of the enrollment authority &# 39 ; s digital certificate ( steps 206 and 206 ). it performs the same prompt and verification process described above , and can also verify the manufacturer &# 39 ; s signature on the certificate if one exists . after confirming the legitimacy of the enrollment authority , the personal identification device creates a session key , encrypts the session key and securely releases it to the enrollment authority ( step 207 ). the personal identification device and the enrollment authority can now communicate freely using the session key ( step 208 ). the biometric may be downloaded into the personal identification device along with the personal identity credentials , or may alternatively be sensed locally using the device and stored locally . the enrollment process , at this stage , is application - dependent and requires the establishment of requisite credentials , etc ., which are not covered within the scope of this invention . it may be necessary in some cases to provide a backup of at least one enrolled personal identity credential and biometric . the backup may be used in the event that the personal identification device fails , such that the individual may re - enroll a new personal identification device without undergoing the entire process described above ; these devices are referred to as the ‘ primary personal identification device ’ and the ‘ secondary personal identification device ,’ respectively . there are two distinct parts of the restoration process . the first part describes a method for archiving the enrolled personal identity credential , which allows an enrolled individual to securely store his personal identity credential and biometric to a user - accessible computer disk or other electronic storage repository . this data is only accessible with permission from a device manufacturer , an enrollment authority , or a recovery authority , as specified by the implementer of the system . in the primary embodiment , this system controller will be the manufacturer of the primary personal identification device . the second part of the restoration process describes a method for restoring the stored data to the secondary personal identification device . as seen in fig3 , the primary personal identification device generates a symmetric biometric encryption and decryption key ( step 301 ). this key is used for encrypting a digital representation of the enrolled biometric ( step 302 ), which can be used to unlock the archived personal identity credential ( s ). after encryption of the biometric , the symmetric biometric encryption and decryption key is divided into two unique and distinct parts ( step 303 ); the scheme of separation may be selected at the discretion of the system implementer . the first part of the symmetric biometric encryption and decryption key is encrypted with a user - selected passphrase ( step 304 ). the second part of the symmetric biometric encryption and decryption key is signed by a private key possessed by the primary personal identification device ( step 305 ), and is then encrypted with a public key owned by the system controller ( step 306 ). as described above , in this embodiment the system controller is the primary personal identification device manufacturer . using the manufacturer &# 39 ; s public key forces an individual to request restoration privileges from the manufacturer during restoration , because the individual needs the manufacturer to decrypt the data with its private key . this is discussed in further detail below . the primary personal identification device then generates a symmetric personal identity credential encryption and decryption key ( step 307 ), which is used for encrypting at least one enrolled personal identity credential . the primary personal identification device first digitally signs the personal identity credential , using a private key ( step 308 ), and then encrypts the personal identity credential and associated digital signature ( step 309 ). similarly to the scheme described above , the symmetric personal identity credential encryption and decryption key is divided ( step 310 ) into two unique and distinct parts . the first part is encrypted with a user - selected passphrase ( step 311 ), which may or may not be the same passphrase as used above . the second part is again signed by the device ′ private key ( step 312 ) and encrypted with the manufacturer &# 39 ; s public key ( step 313 ). all of the encrypted and / or signed data — the biometric , the symmetric biometric encryption and decryption key , the personal identity credential , and the symmetric personal identity credential encryption and decryption key — are now stored in an electronic storage repository ( step 314 ). in typical embodiments the electronic storage repository could be a computer hard drive , floppy disk , or network drive . the primary personal identification device releases its digital certificate to the individual for future use of its public key ( step 315 ). as seen in fig4 , when an individual receives a secondary personal identification device , and wishes to restore data from a primary personal identification device , he must access the electronic storage repository ( step 401 ). the individual must first acquire the two encrypted and / or signed parts of the symmetric biometric encryption and decryption key ( step 402 ). the secondary personal identification device decrypts the first part of the symmetric biometric encryption and decryption key with the user &# 39 ; s passphrase ( step 403 ). it then requests the system controller , the manufacturer of the primary personal identification device , to decrypt the second part of the symmetric biometric encryption and decryption key and the associated digital signature using its ( the manufacturer &# 39 ; s ) private key ( step 404 ). once the data has been decrypted , the secondary personal identification device verifies the digital signature using a public key possessed by the primary personal identification device ( step 405 ). the two parts of the symmetric biometric encryption and decryption key are now combined appropriately ( step 406 ), and can be used to decrypt the biometric ( step 407 ). the biometric is now stored in an appropriate location within the secondary personal identification device ( step 408 ). the individual now obtains the two encrypted and / or signed parts of the symmetric personal identity credential encryption and decryption key ( step 409 ). similarly to the process described above , the secondary personal identification device decrypts the first part of the symmetric personal identity credential encryption and decryption key using a user - selected passphrase ( step 410 ). it now requests the system controller , the manufacturer of the primary personal identification device , to decrypt the second part of the symmetric personal identity credential encryption and decryption key and the accompanying digital signature using its private key ( step 411 ). again , the secondary personal identification device verifies the digital signature using a public key possessed by the primary personal identification device ( step 412 ). the two parts of the key are reconstructed to form one key ( step 413 ). the key is now used to decrypt the personal identity credential and the associated digital signature ( step 414 ), and the signature is verified using a public key owned by the primary personal identification device ( step 415 ). the decrypted personal identity credential can now be stored appropriately within the secondary personal identification device ( step 416 ). fig5 illustrates the components of the bpid , according to an embodiment of the invention . as shown in fig5 , the components of the bpid include a processor , a memory , an rf wireless transceiver , a fingerprint sensor , a battery and a graphic liquid crystal display ( lcd ). a bpid is a handheld electronic device that provides multi - factor authentication and allows its registered and / or enrolled owner to control the release and dissemination of stored information such as financial accounts , medical records , passwords , personal identification numbers , and other sensitive data and information . the device has tamper - resistant packaging with from factors ranging from credit card size to key fobs , and further includes a fingerprint scanner . although those familiar in the art will recognize that this device &# 39 ; s biometrics can be interchanged with another biometric technology , it can be observed that russell &# 39 ; s bpid patent application additionally includes a liquid crystal display ( lcd ) and buttons for user interaction , a wireless interface for communicating with other electronic devices , and a self - generated public key / private key pair for digitally signing data . the device has been developed so that the fingerprint cannot be physically or electronically removed or transmitted from the device , and information cannot be physically or electronically removed or transmitted from the device unless released by the owner of the authorizing fingerprint . all data and processing is performed securely . the bpid can store and run multiple applications , allowing an individual to store a variety of personal information , although it is important to note that the applications are fully independent and cannot affect other applications &# 39 ; data . many of these applications require the owner to transmit information to a terminal ; for example , the bpid may wirelessly transmit financial account information to a cash register during an in - store purchase . in order to make the transaction secure , the bpid uses its private key to create a digital signature on all information that the individual chooses to release . recipients of information from the bpid use the encrypted digital signature and a database of public keys to confirm that the information came from a specific device and that the information has not been altered . if it is desired by , e . g ., a driver license verification application and / or other independent applications , the bpid can encrypt all transmitted data and information so that only the intended recipient can decode the information . the bpid places the control of personal and private information in the hands of the individual that owns the information and the organization that issues the device and / or creates device applications . fig6 is a system diagram illustrating transactions between the bpid of fig5 and a manufacturer database , according to an embodiment of the invention . the bpid can receive from the manufacturer database the manufacturer public key . the bpid can generate an asymmetric key pair and release / send the bpid public key to the manufacturer database , who issues and signs a certificate for the bpid . the manufacturer database can download the certificate and public key of the manufacturer to the bpid . the bpid can receive from the manufacturer database the bpid serial number . fig7 is a system including the bpid of fig5 illustrating communication channels for the enrollment process , according to an embodiment of the invention . the system includes the bpid , a user &# 39 ; s personal computer ( pc ), a manufacturer server and an enrollment authority server . the user &# 39 ; s pc can communicate with the bpid , the manufacturer server and the enrollment authority server . the enrollment authority server can communicate with the manufacturer server . while the description above refers to particular embodiments of the present invention , it will be understood that many modifications may be made without departing from the spirit thereof . the accompanying claims are intended to cover such modifications as would fall within the true scope and spirit of the present invention . | 7 |
fig1 c shows an exemplary product created by the inventive molding and assembly process . as shown in fig1 a – 1c , the exemplary product is a two piece riveted package 10 for surgical sutures . the product includes a top part 12 ( shown in fig1 a ) with a plurality of rivet pins 16 and a bottom part 14 ( shown in fig1 b ) with a plurality of rivet holes 18 . top part 12 and bottom part 14 each also have at least one pilot hole 19 . when top part 12 and bottom part 14 are joined together , plurality of rivet pins 16 extend from the top part through plurality of rivet holes 18 on the bottom part . a heating device welds rivet pins 16 so that the pins melt into rivet holes 18 and heat stake top part 12 to bottom part 14 . fig2 shows a top diagrammatic view of an exemplary system 100 used to perform the molding and assembly process of the surgical suture packages . as shown in fig2 , system 100 comprises a dual injection mold 20 . dual injection mold 20 is a “ stacked ” mold consisting of two separate sets of molds a and b . each of the molds a and b produce top parts 12 and bottom parts 14 . fig3 a shows a side perspective view of molds a and b and fig3 b shows a close up perspective view of mold a . as shown in fig3 a and 3 b , molds a and b each contain a plurality of mold cavities 30 for top parts 12 and a plurality of mold cavities 32 for bottom parts 14 . as can be seen in fig3 b , mold cavities 30 for top parts 12 and mold cavities 32 for top parts 14 are positioned side - by - side to one another so that each of the molds a and b have alternating , parallel columns of mold cavities 30 for the tops parts and mold cavities 32 for bottom parts . referring to fig2 and 3 a , dual injection mold 20 comprises a stationary side 22 , a moveable opposite side 24 , and a moveable center 26 . two helical screws 28 are positioned on each side of mold 20 and connect stationary side 22 , moveable opposite side 24 , and moveable center 26 to one another . fig4 shows a diagrammatic top view of the system during a mold cycle . as shown in fig4 , an operating means ( not shown ), such as an electric motor or any other means well known in the art , causes helical screws 28 to advance so that opposite side 24 moves towards moveable center 26 in the direction of arrows 34 until it contacts the movable center . movable center 26 also moves in the direction of arrows 34 until it comes into contact with stationary side 22 . dual injection mold 20 is collapsed such that the center 26 joins to both the stationary side 22 and the opposite side 24 to form mold cavities 30 for the top parts and mold cavities 32 for the bottom parts . once molds a and b are closed , an injector 54 pumps molten plastic ( shown by arrow 38 ) through a center port 36 . center port 36 runs through both molds a and b in order to fill the mold cavities 30 for the top parts and 32 for the bottom parts . both molds a and b are family molds because each of the molds simultaneously mold separate , distinct parts that are to be joined together to form a single product . fig5 shows the layout of each of the molds a and b . as shown in fig5 , molds a and b each comprise a manifold 46 with center port 36 . a plurality of flow channels 40 branch off of centerport 36 and a plurality of runners 44 branch off of flow channels 40 . at the end of each runner 44 is a gate 42 that connects the runner to either mold cavity 30 or mold cavity 32 . each gate 42 is associated with a pneumatic valve that opens and closes the gate . manifold assembly 46 allows molten plastic to pass from center port 36 , through flow channels 40 , through runners 44 , through gates 42 , and into each of mold cavities 30 and 32 . gates 42 are electronically controlled and are selectively opened at different times during the mold cycle in order to control the timing of the molten plastic entering each mold cavity , and thus ensuring that each part has a similar density as other parts in the mold . this process of opening and closing the gates to the mold at different times is often referred to as “ sequential injection ” molding . once the mold cycle is completed and top parts 12 and top parts 14 are molded , each runner 44 is pinched off at each gate 42 by the pneumatic valve associated with the gate . in this embodiment , each mold a and b produce 16 parts during a mold cycle ( 8 bottom parts and 8 top parts ). however , it is possible to create molds with more or less mold cavities in order to produce more or less parts . after a mold cycle is complete , molds a and b open and molded top parts 12 and bottom parts 14 are removed from mold cavities 30 and 32 . fig6 shows a diagrammatic top view of system 100 during the unloading process . as shown in fig6 , helical screws 28 retreat in the direction of arrows 48 so that movable center 26 and opposite side 24 move away from stationary side 22 . helical screws 28 ensure equal spacing of molds a and b when the molds are completely open . once molds a and b are open , an unloader 50 is inserted between stationary side 22 and movable center 26 of mold a . unloader 50 includes a plurality of vacuum grippers 52 . vacuum grippers 52 contact molded top parts 12 and bottom parts 14 and form a vacuum between the grippers and the top parts and bottom parts . in this manner , vacuum grippers 52 secure these molded parts to unloader 50 in the same arrangement as they were molded in mold a ( i . e ., top parts 12 and bottom parts 14 are placed in four alternating , parallel columns so that each of the top parts is positioned next to one of the bottom parts ). while only the removal of top parts 12 and bottom parts 14 from mold a is shown , the removal of the top parts and bottom parts from mold b will be accomplished with an essentially identical process . the number and location of vacuum grippers 52 on unloader 50 corresponds to the number and location of parts produced by mold a . thus , in this embodiment , unloader 50 can remove and unload all 16 parts from mold a at one time . fig7 shows a diagrammatic top view of system 100 during the transferring process of top parts 12 and bottom parts 14 from unloader 50 to a linear transporter 56 and from the linear transporter 56 to a stacker 58 . as shown in fig7 , unloader 50 is removed from mold 20 and interfaces with linear transporter 56 so that the linear transporter receives top parts 12 and bottom parts 14 from the unloader . linear transporter 56 also has vacuum grippers 52 that correspond in number and location to the vacuum grippers located on unloader 50 . linear transporter &# 39 ; s 56 vacuum grippers 52 contact and form a vacuum on top parts 12 and bottom parts 14 of unloader 50 , while the vacuum is removed from unloader &# 39 ; s 50 vacuum grippers in order to release the top parts and bottom parts . the parts are arranged on linear transporter 56 just as they were molded within molds a and b ( i . e ., top parts 12 and bottom parts 14 are placed in four alternating , parallel columns so that each of the top parts is positioned next to one of the bottom parts ). during the time that unloader 50 places the parts on linear transporter 56 , dual mold 20 collapses and molten plastic 38 is again delivered to the molds a and b and the molding process begins again . still referring to fig7 , linear transporter 56 moves along a path 60 and delivers top parts 12 and bottom parts 14 to stacker 58 . fig8 shows a front view of stacker 58 . as shown in fig8 , stacker 58 includes a plurality of vacuum cups 62 for holding top parts 12 and bottom parts 14 . referring back to fig7 , linear transporter 56 moves along path 60 until top parts 12 and bottom parts 14 come into contact with vacuum cups 62 . when stacker 58 receives parts from the linear transporter , it is in a vertical position . vacuum cups 62 form a vacuum on top parts 12 and bottom parts 14 while the vacuum from the vacuum grippers 52 of linear transporter 56 is removed to release the top parts and bottom parts . vacuum cups 62 are arranged on stacker 58 so that top parts 12 and bottom parts 14 are held on the stacker in the same pattern as the parts are held on linear transporter 56 . fig9 shows stacker 58 after top parts 12 and bottom parts 14 are transferred to stacker 58 from linear transporter 56 . as shown in fig9 , top parts 12 and bottom parts 14 are positioned in four alternating , parallel columns of top parts and bottom parts , so that each top part is positioned next to one of the bottom parts . still referring to fig9 , stacker 58 is positioned on a shaft 64 that can be rotated 360 degrees in both the clockwise and counterclockwise direction by an electrical motor or a variety of other means well known in the art . after receiving top parts 12 and bottom parts 14 from linear transporter 56 , shaft 64 and stacker 58 rotate 90 degrees , so that the stacker is in a horizontal position and interacts with pallet 66 . fig1 shows shaft 64 and stacker 58 being rotated so that the stacker can interact with pallet 66 . as shown in fig7 and 10 , pallet 66 includes two distinct rows of assembly nests 70 . each assembly nest 70 contains tapered pilot pins 72 that are designed for insertion into pilot holes 19 of top parts 12 and bottom parts 14 . pilot pins 72 also contact the edges of the top parts and bottom parts . in this manner , pilot pins 72 interacts with top parts 12 and bottom parts 14 in order to align the top parts with the bottom parts . fig1 shows stacker 58 positioned directly above pallet 66 . as shown in fig1 , stacker 58 rotates until it is positioned directly above pallet 66 in a horizontal position and top parts 12 are directly over assembly nests 70 . once stacker 58 is in this position , it releases top parts 12 , so that each top part falls from the stacker and is received in one of assembly nests 70 of pallet 66 . as top parts 12 are released , pilot pins 72 engage the edges of top part 12 and are inserted into pilot holes 19 of the top part . in this manner , pilot pins 72 ensure that the top part is accurately positioned . still referring to fig1 , stacker 58 , next , shifts in the direction of arrow 74 so that bottom parts 14 are positioned directly over assembly nests 70 and top parts 12 . stacker 58 then releases bottom parts 14 so that each bottom part falls from stacker and is received in one of assembly nests 70 of pallet 66 . in each assembly nest 70 , pilot pins 72 engage the edges of bottom part 14 and pass through pilot hole 19 to ensure that the bottom part is accurately positioned on top of top part 12 , so that the top parts &# 39 ; rivet pins 16 extend through the bottom part &# 39 ; s rivet holes 18 and are exposed upwards . in this manner , top parts 12 and bottom parts 14 are loosely assembled into packages 10 of surgical sutures . referring back to fig7 , once packages 10 are loosely assembled , pallet 66 proceeds along conveyer belt 80 and passes under ultrasonic welders 82 . after pallet 66 proceeds to ultrasonic welders 82 , shaft 64 and stacker 58 rotate back to their original position so that the stacker can receive the next load of top parts 12 and bottom parts 14 and another pallet 66 is put in position . stacker 58 then repeats the above described process to loosely assembly packages 10 on the new pallet . still referring to fig7 , pallet 66 travels down the conveyor belt 80 until it comes to a position below ultrasonic welders 82 . ultrasonic welders 82 descend over loosely assembled packages 10 with their horns bearing on protruding rivet pins 16 . in this manner , ultrasonic welders 82 melt rivet pins 16 down into rivet holes 18 and heat stake the bottom part 14 to the top part 12 . pallet 66 then moves past ultrasonic welders 82 along conveyer belt 80 into a position that allows assembled packages 10 to be removed from pallet 66 and stacked in a magazine for storage and subsequent shipping . fig1 shows a pick and place unit 90 removing fully assembled packages 10 from pallet 66 . as shown in fig1 , pick and place unit 90 has a plurality of vacuum grip heads 92 that contact and form a vacuum on each of the packages 10 . pick and place unit 90 then removes each package 10 from each assembly nest 70 at the same time . fig1 shows pick and place unit 90 delivering completed packages 10 to magazine 94 . as shown in fig1 , each magazine 94 has four slots 96 that are each dimensioned to receive four completed packages 10 at the same time . also shown by fig1 , pick and place unit 90 has enough vacuum heads 92 to place four rows of four packages ( total of 16 ) in magazine 94 . pick and place unit 90 loads packages 10 into each of magazine &# 39 ; s 94 slots 96 by releasing its vacuum grip on packages 10 . pick and place unit 90 repeats this process of transferring the packages 10 from pallet 66 and depositing the completed packages on top of each other in the magazine &# 39 ; s slots 96 ( visible suture package stacks are shown in fig1 ) until the magazine 94 is filled . while a particular embodiment of the subject invention has been described in considerable detail herein , such is offered by way of a non - limiting example of the invention as many other versions are possible . for example , molds a and b , unloader 50 , linear transporter 56 and stacker 58 can be constructed to mold , produce , hold and transport any number of molded parts . further , packages of surgical sutures do not have to be the product molded and assembled using this process . rather , any product or package that requires any number of separate molded parts to be molded , stacked and assembled to one another can be manufactured by this process . moreover , pallet 66 and pick and place unit 90 can be constructed to hold and transport any number of assembled products . it will also be appreciated by one skilled in the art that pallet 66 could be laterally shifted instead of stacker 58 in order to loosely assembly the top part 12 and bottom part 14 into a package 10 . it is anticipated that a variety of other modifications and changes will be apparent to those having ordinary skill in the art and that such modifications and changes are intended to be encompassed within the spirit and scope of the appended claims . | 8 |
referring first to fig1 a fragment of pipe 10 of a stripping line of a sea - going vessel of spun cast iron is shown but it will be appreciated that cast iron is currently used largely because of the widely - held belief that it is less liable to corrosion than steel ; by employing the arrangement , in accordance with the invention conventional mild steel pipe can be used . the pipe 10 is directly connected to an anode - carrier member 12 embodying the invention which is flanged at both ends and this is , in turn , connected by one flange 14 to a corresponding flange 16 of a tee - piece 11 for the loading and unloading of residual oil and the tee - piece is secured by its other flange 18 to one flange 20 of a short connecting piece 22 which is secured to a bulkhead 24 of the vessel . the other flange 15 of the carrier is bolted to a flange 17 of the pipe 10 . stripping lines are more prone to corrosion failure than cargo or ballast lines but the carrier can also be incorporated to advantage in the latter . conventionally , lengths of pipe are connected by flexible couplings of various designs which enable limited degrees of misalignment and movement to be accommodated . details of this coupling 26 are not relevant to the present invention and it has therefore been shown only diagrammatically . however , it is important that individual pipe lengths should be electrically fully bonded together and this can be effected for example by studs welded by capacitance welding to the outside of adjacent ends to two pipe lengths and the studs are connected by heavy strapping 28 to keep the electrical resistance to a minimum . again , the precise method of bonding does not form the subject of the present invention and any conventional device used for the same purpose in the external protection of pipes will be suitable . cathodic protection of a metal surface depends upon the flow of electrical current from an anode , into the liquid electrolyte and onto the surface of the metal in contact with the liquid electrolyte thereby achieving and maintaining particular levels of electrical potential between the metal surface and the liquid electrolyte . the achievement of these levels of potential , the magnitude of which are generally accepted and their maintenance is largely dependent upon an electro - chemical phenomenon termed &# 34 ; polarisation &# 34 ;. polarisation is a time - dependent change in the metal surface / liquid electrolyte interface ; its nature is complex but may be considered , in outline , to involve the formation of concentration gradients of ions soluble in the liquid electrolyte adjacent to the metal surface , the deposition of certain ions from the liquid electrolyte on the metal surface and the metal surface and the formation of a film of hydrogen immediately adjacent the surface . all these factors combine to provide an electrochemical barrier termed &# 34 ; the polarisation barrier &# 34 ; which reduces the current required to maintain the protective levels of electrical potential and stop corrosion . this polarisation barrier will , however , be removed when there is a flow of liquid such as sea water . it has generally been assumed that under conditions of liquid flow , cathodic protection extends no more than three times the pipe diameter from the anode . while this may well be true , the system and method herein described rely upon the fact that in many pipe lines more particularly those employed in tankers , stagnation conditions are operative for a large part of the life of the pipe and flow takes place in stripping , ballast and cargo lines only when the vessel is either loading or unloading or is undergoing some operation at sea , such as tank cleaning . thus , the applicants have been the first to recognise that although cathodic protection is not available for the whole of the life of the pipe it will be available for as much as 90 % of that time and such protection will have an effect in prolonging the useful life of the pipe . further it is desirable that there should be no restriction in the effective cross - section of the pipe since otherwise disturbance of the flow might cause cavitation and other undesirable effects which might cancel out the benefits of cathodic protection . the anode carrier 12 illustrated in greater detail in fig2 and 3 incorporates three anodes 30 each of a shape and form analogous to the pole pieces of a dynamo - electric machine . each anode 30 is rigidly secured to a cover plate 32 so that it can readily be removed , if necessary by crew members , and replaced by a fresh anode when the original is no longer effective . no access is required to the inside of the pipe or carrier . the anodes 30 are of zinc or a special zinc alloy for example an alloy marketed by the applicants known as b . k . l . no . 1 alloy ( or mil . spec . 18001 h ), or of other anodic material , of which there are many alternatives . three of the covers 32 which support the individual anodes 30 are bolted to respective flanges 34 of the anode carrier 12 and , as will be apparent from fig2 the anodes do not obtrude into the hollow cross - section of the carrier 12 and hence of the pipe length 10 . each cover plate has welded thereto a small plate 33 which carries an eye bolt 35 . the anode carrier illustrated is intended for a 12 inch ( 30 . 48 cm .) pipe but the same construction can be employed in pipes of other diameters when the number of anodes may well be reduced , for smaller size pipes and increased to say eight anodes for a pipe of 24 inches diameter . for larger sizes , two anodes or more are mounted on each cover . as illustrated one anode is mounted on the vertical axis below the longitudinal centre line and the other two anodes are mounted with their centre lines above the longitudinal centre line and with these centre lines inclined at a small angle of 15 ° to 25 ° to the horizontal plane passing through the longitudinal centre line . alternatively the other two anodes are mounted similarly but below the longitudinal centre line . in another arrangement the other two anodes are mounted on the horizontal centre line . as is conventional in all anodes used for cathodic protection purposes , the zinc or other sacrificial metal is mounted on a steel core 36 to ensure , as far as possible , that pieces of the anode do not break away and mix with the liquid which could clearly have damaging effects on pumps and valves . by employing the anode carrier in accordance with the invention the risk that such parts will become detached is substantially reduced since at no time is any part of the anode directly placed in the flow within the pipe line . nevertheless , the steel core 36 is provided which is configured that the zinc keys to the skeleton structure . the core is welded to sleeves 38 which accommodate studs 40 by which the anode is secured to the corresponding cover plate 32 with the aid of self - locking nuts 42 . the length of the studs is such they they lie wholly within recesses 44 in the anode material . the weight of the anodes is determined by conventional cathodic protection practice and the size and available surface area will preferably be sufficient to produce an applied current density of 2 to 10ma ./ ft . the internal face of each anode is shown as being flat , but it may be concave to match the internal face of the body 19 . the anode carrier in accordance with the invention enables ready replacement of the anodes without the need to dismantle a pipe line and can be effected manually without the need for hoisting gear . for such a pipe line measuring 180 meters two anode carriers would normally be employed , evenly distributed along the pipe length and for a 100 meter length one anode carrier would be employed at the centre . in more general terms it is believed that for 28 inch pipes a length equivalent of up to 500 diameters will be protected within two days from installation . the time delay to achieve protection for smaller pipes will , however , be greater . conventionally , when a ballast line or a stripping line has been inactive the pipe has been kept empty with a view to reducing corrosion . however , it is impossible to ensure that all sea water drains fully and under these conditions and particularly in warm climates the corrosion rate is as rapid or even more rapid than with a full pipe which has no protection . the system as claimed in serial no . 651 , 160 requires that the pipe should be kept filled at all times . the presence of the sea water electrolyte ensures that cathodic protection is maintained and corrosion is kept to very low limits . experiments have shown that by the employment of cathodic protection the corrosion rate of a 12 inch diameter pipe containing sea water can be reduced very substantially and approximately to 20 % of the rate under operational conditions with no protection . in an alternative , unillustrated embodiment of anode arrangement , a structure similar to that formed by the plates 23 , 25 , 27 and 29 is welded directly to a length of pipe - line around an aperture and the cover plate of an anode is bolted to a flange at the outer ends of the plates . this alternative is particularly suitable for use in newly - constructed ships and oil rigs , and the system and method remain the same . | 2 |
while the following description of the instant invention revolves around fig1 - 6 , the instant invention can be utilized in any semiconductor device structure . the methodology of the instant invention provides a design methodology for logic circuits . as shown in fig2 the source / drain p - region 60 of a pmos transistor can abut a source / drain n - region 65 of a nmos transistor . in this scheme , the contact or silicide 70 that connects the p - region 60 and the n - region 65 can be optional in the “ logic ” sense if the p - n junction between the p - region 60 and the n - region 65 is never reversed biased . unlike bulk cmos technology , therefore , in soi technology the physical connection of a pmos transistor and an nmos transistor along their source / drain regions consumes a silicon area that is compatible to the connection of two nmos transistors or two pmos transistors along their source / drain diffusions . based on this unique property of soi technology , a new logic for soi termed here as “ soi logic ” is defined in which both nmos and pmos transistors can be used in a basic transistor network . specifically , nmos transistors can be used in a pun in addition to pmos transistors and pmos transistors can be used in a pdn in addition to nmos transistors . in soi logic , the gate terminals of the nmos transistors in the pun are not connected to a fixed voltage or the output terminal of the pun . in addition to puns and pdns , both nmos and pmos transistors can be used in a ptn . the buried dielectric layer 90 and the underlying substrate 100 are also illustrated in fig2 along with the transistor gate dielectric 70 , gate electrode 80 , and sidewall structures 85 . soi logic is a true superset of the bulk cmos logic . in other words , any circuit topology in bulk cmos logic also belongs to soi logic ; however , some circuit topologies in soi logic do not belong to bulk cmos logic . in addition to having low - power consumption and high reliability , it is important that soi logic circuits consume minimum space on the wafer . in the design and layout of soi logic circuits the following guidelines will aid in achieving minimum layout space . in a series connected transistor string in a basic transistor network , separately group the pmos transistors and the nmos transistors as much as possible to minimize the number of contacts or silicide areas that connect the p - regions of the pmos transistors and the n - regions of the nmos transistors . in a series connected transistor string in a pun or a pdn , place all the pmos transistors above the nmos transistors , such that the contact or silicide connecting the pmos and nmos transistor source / drain regions is not needed , minimizing the layout area . in addition to layout area , circuit performance can be improved using low threshold voltage techniques such as electrically connecting the transistor gate to the floating body of the soi transistor . the gate - to - body connection can be applied to the nmos transistors and pmos transistors in a pun , the pmos transistors and nmos transistors in a pdn , and both the pmos and nmos transistors in a ptn . the gate - to - body connection utilizes the body effect of the mosfet transistor to lower the threshold voltage thus improving the transistor performance . in general , digital circuits can be divided into two groups , static and dynamic circuits . dynamic circuits can be further subdivided into one - phase “ domino ” circuits , two - phase ratioed , and ratioless circuits . ratioless dynamic circuits can be further divided into two - phase and four - phase circuits . logic networks generally comprise combinational and sequential networks . combinational networks comprise gates and programmable logic arrays , and sequential networks comprise latches , registers , counters , and read - write memory . combinational logic networks operate without the need of any periodic clock signals . however all but the very smallest digital systems require sequential as well as combinational logic . as a practical matter , all systems employing sequential logic require the use of periodic clock signals for correctly synchronized operation . in static soi logic circuits , combinational or sequential , clock signals are introduced only at normal gate inputs , identical to those used for logic inputs . an embodiment of the instant invention for a soi static logic circuit is illustrated in fig3 . this embodiment has an output logic function of { overscore ( a ·)}{ double overscore ( b )} 135 and logic inputs a 145 and b 150 . the pun 155 comprises the parallel connection of a nmos transistor 115 and a pmos transistor 110 . this parallel connection results in a pair of common circuit nodes 132 and 134 . circuit node 132 is connected to the supply voltage v dd 130 . circuit node 134 is connected to the output 135 and the pdn 160 . as illustrated in fig3 both the nmos transistor 115 and the pmos transistor 110 which comprise the pun 160 provide potential conductive paths from the supply voltage v dd 130 to the output node 135 . the pdn 160 comprises a series connection of a pmos transistor 120 and a nmos transistor 125 . these transistors 125 , 120 provide a potential conductive path from the output node 135 to the circuit ground 140 . this is to be contrasted with a bulk cmos circuit implementing the same logic function where the pun will generally comprise only pmos transistors and the pdn comprise nmos transistors . the circuit of fig3 can be extended to any number of pmos and nmos transistors in the pun and the pdn . in addition , the circuit shown in fig3 could be a subset of a larger circuit . thus logic inputs a 145 and b 150 could be provided by addition circuitry 162 and the logic output 135 could be connected to the other circuits 164 . a further embodiment of the instant invention for a soi static logic circuit is illustrated in fig4 . this embodiment has an output logic function of a + b at the output node 200 from logic inputs a 190 and b 195 . the pun 175 comprises the parallel connection of nmos transistors 165 and 170 . this parallel connection results in a pair of common circuit nodes 172 and 174 . circuit node 172 is connected to the supply voltage v dd 180 . circuit node 174 is connected to the output node 200 and the pdn 185 . as illustrated in fig3 both the nmos transistors 165 and 170 which comprise the pun 175 provide potential conductive paths from the supply voltage v dd 180 to the output node 200 . the pdn 185 comprises a series connection of a pmos transistors 205 and 210 . the pmos transistors 205 and 210 which comprise the pdn 185 provide a potential conductive path from the output node 200 to the circuit ground 215 . this is to be contrasted with a bulk cmos circuit implementing the same logic function where the pun will generally comprise only pmos transistors and the pdn comprise nmos transistors . the circuit of fig4 can be extended to any number of pmos and nmos transistors in the pun and the pdn . in addition , the circuit shown in fig4 could be a subset of a larger circuit . thus logic inputs a 190 and b 195 could be provided by addition circuitry 217 and the logic output 200 could be connected to the other circuits 219 . a further embodiment of the instant invention for a soi static logic circuit is illustrated in fig5 . this embodiment has an output logic function of { overscore ( a +)}{ double overscore ( b )} 240 from logic inputs a 245 and b 250 . the pun 230 comprises the series connection of pmos transistor 220 and nmos transistor 225 . the pmos transistor 220 and the nmos transistor 225 which comprise the pun 230 provide a potential conductive path from the output node 240 to the circuit supply voltage 235 . the pdn 255 comprises a parallel connection of a nmos transistor 265 and a pmos transistor 260 . this parallel connection results in a pair of common circuit nodes 262 and 264 . circuit node 264 is connected to the circuit ground 270 . circuit node 262 is connected to the output node 240 and the pdn 230 . as illustrated in fig5 both the nmos transistor 265 and the pmos transistor 260 which comprise the pdn 255 provide potential conductive paths from the circuit ground 270 to the output node 240 . this is to be contrasted with a bulk cmos circuit implementing the same logic function where the pun will generally comprise only pmos transistors and the pdn comprise nmos transistors . the circuit of fig5 can be extended to any number of pmos and nmos transistors in the pun and the pdn . in addition , the circuit shown in fig5 could be a subset of a larger circuit . thus logic inputs a 245 and b 250 could be provided by addition circuitry 272 and the logic output 240 could be connected to other circuits 274 . a further embodiment of the instant invention for a soi static logic circuit is illustrated in fig6 . this embodiment has an output logic function of a · b 295 and logic inputs a 300 and b 305 . the pun 280 comprises a series connection of nmos transistors 285 and 290 . these transistors 285 and 290 provide a potential conductive path form the supply voltage v dd 275 to the output node 295 . the pdn 325 comprises a parallel connection of pmos transistors 310 and 315 . this parallel connection results in a pair of common circuit nodes 312 and 314 . circuit node 314 is connected to the circuit ground 320 . circuit node 312 is connected to the output node 295 and the pun 280 . as illustrated in fig6 both the pmos transistors 310 and 315 which comprise the pdn 255 provide potential conductive paths from the circuit ground 320 to the output node 295 . this is to be contrasted with a bulk cmos circuit implementing the same logic function where the pun will generally comprise only pmos transistors and the pdn comprise nmos transistors . as illustrated in fig6 both the pmos transistors 310 and 315 which comprise the pdn 325 are connected to the circuit ground 320 and provide potential conductive paths from the circuit ground 320 to the output node 295 . the nmos transistors 285 and 290 which comprise the pun 280 provide a potential conductive path from the output node 295 to the circuit supply voltage 275 . the circuit of fig6 can be extended to any number of pmos and nmos transistors in the pun and the pdn . thus logic inputs a 300 and b 305 could be provided by addition circuitry 330 and the logic output 295 could be connected to other circuits 335 . as stated above , circuit performance of the static logic circuits of the instant invention can be improved using low threshold voltage techniques such as electrically connecting the transistor gate to the floating body of the soi transistor . the gate - to - body connection can be applied to the nmos transistors and pmos transistors in a pun , the pmos transistors and nmos transistors in a pdn , and both the pmos and nmos transistors in a ptn . the gate - to - body connection utilizes the body effect of the mosfet transistor to lower the threshold voltage thus improving the transistor performance . the static logic circuits described in the instant invention can also be applied to bulk cmos circuits . thus the embodiments of the invention illustrated in fig3 - 6 can be applied to bulk substrates that do not have a buried dielectric layer . in the bulk cmos embodiment of the instant invention , the source / drain diffusions of the pmos transistor will not abut the source / drain diffusions of the nmos transistor under current bulk cmos transistor isolation schemes . the advantages gain by using the disclosed static logic design over existing bulk cmos static logic designs will be in the speed and performance of the logic circuits . while this invention has been described with reference to illustrative embodiments , this description is not intended to be construed in a limiting sense . various modifications and combinations of the illustrative embodiments , as well as other embodiments of the invention will be apparent to persons skilled in the art upon reference to the description . it is therefore intended that the appended claims encompass any such modifications or embodiments . | 7 |
while the invention has been shown and described with reference to a number of embodiments thereof , it will be recognized by those skilled in the art that various changes in form and detail may be made herein without departing from the spirit and scope of the invention as defined by the appended claims . a simple , but very effective , embodiment relates to two - dimensional ion traps in which the analyte ions collect in an elongated cloud along the longitudinal central axis . these ion traps can be constructed as quadrupole rod systems applied pair - wise with the two phases of an rf voltage ; or with six straight pole rods as hexapole rod systems ; or with eight or more pole rods as multipole rod systems . such hexapole or octopole rod systems can often be found in mass spectrometers as “ collision cells ” for ergodic fragmentations , but there the analyte ions are always being injected into stationary collision gas . two - dimensional ion traps are also known with coiled double or quadruple helices . finally , they can be constructed as stacks of ring diaphragms , where the phases of an rf voltage are applied alternately to the ring diaphragms . to prevent the analyte ions from escaping along the axis , they are trapped by dc electric fields , which are usually generated at apertured diaphragms mounted at both ends . the collision ions can simply be axially injected in a particularly advantageous way through these two - dimensional rf ion traps after the analyte ions have been stored . since collision ions of opposite polarity are not held by the dc fields applied axially at the ends , they can emerge at the opposite end without being reflected . they thus do not remain in the ion trap , do not collect there , and therefore cannot contribute to a deprotonation of the analyte ions . since the injected collision ions usually enter slightly off - axis and at small angles , they oscillate about the axis at their secular frequency as they fly through the ion trap and thus pass through the elongated cloud of analyte ions several times . it is advantageous to modulate the injection conditions , for example the kinetic energy of the collision ions , in order to constantly vary the wavelength of the oscillation and thus reach all the analyte ions . such an arrangement is shown in fig2 . analyte ions from an electrospray ion source ( 21 , 22 ) are transported via an entrance capillary ( 23 ) into the vacuum , where they are collected by an ion funnel ( 24 ) and introduced into the first part ( 25 ) of an ion guide . they then pass via ion guide ( 28 ) into the fragmentation cell ( 30 ), which here is a quadrupole , in which the isolation of the parent ions can also take place . according to the invention , the parent ions can then be bombarded with collision ions with adjustable kinetic energy from the vacuum - internal ion source ( 27 ); these collision ions are introduced into the ion guide ( 28 ) by voltages at the diaphragm ( 26 ). the energy can be set by the lens system ( 29 ). the fragment ions can then be extracted through the lens system ( 31 ), cooled in the next ion guide ( 32 ), and formed into a fine beam ( 35 ) by the lens system ( 33 ) before being injected into the pulser ( 36 ) of the time - of - flight mass analyzer ( 38 ). here they are pulsed out perpendicular to their original direction of flight , form the beam ( 37 ), which is reflected by a reflector ( 39 ) and impinges , highly mass - resolved , on the detector ( 40 ). high - vacuum pumps ( 41 to 45 ) maintain the vacuum in the various sections . the collision ions can be produced in large quantities either in the special ion source ( 27 ) in the vacuum section of the mass spectrometer , or in the electrospray ion source ( 21 , 22 ) outside the mass spectrometer . it is easily possible to generate cesium ions ( mass 133 atomic mass units ) or iodine ions ( mass 127 atomic mass units ) by spraying a solution of cesium iodide ; preferably by using a second spray capillary ( not shown in fig2 ) in the electrospray ion source ( 21 , 22 ). by generating the collision ions in the electrospray ion source , the method of the invention can be performed in any time - of - flight mass spectrometer with orthogonal ion injection equipped with an electrospray ion source ( esi - otof - ms ). where necessary , the collision ions from the internal ion source ( 27 ) or the external electrospray ion source ( 21 , 22 ) can be cleaned by a mass filter to remove accompanying complex ions before being injected into the collision ion trap ( fragmentation cell ) ( 30 ). when they are injected into the ion trap ( 30 ), their kinetic energy can be adjusted over a wide range ; energies between 30 and 100 electronvolts have been shown to be advantageous . during each collision , a few electronvolts of energy is thus transferred to the analyte ion , which is usually not sufficient for a spontaneous fragmentation , particularly not for heavier analyte ions . the strong current of collision ions means that the energy of the analyte ions can be increased in a very short time , usually a few milliseconds . this is , advantageously , much shorter than the heating time in conventional collision - induced dissociation . more fragment ion spectra can thus be acquired in a given time . by being reflected outside the ion trap , the collision ions can be injected a second time through the ion trap and thus utilized even more efficiently . the rf voltage at the electrodes of the two - dimensional ion trap can be set relatively low in order to also collect small fragment ions from the ergodic fragmentation . the fragment ion spectra thus cover a large mass range and are very informative . in order to also trap very light fragment ions , such as the so - called immonium ions , which each consist of only one amino acid , the rf voltage can be reduced even further after the analyte ions have been bombarded with collision ions . the immonium ions indicate which amino acids are present in the analyte ions investigated . such two - dimensional ion traps are not usually constructed as mass analyzers , so the fragment ions are subsequently transferred from the ion trap into a suitable mass analyzer , where they are analyzed . particularly advantageous for this are high - resolution mass analyzers such as time - of - flight mass analyzers with orthogonal injection , ion cyclotron resonance analyzers or special electrostatic ion traps of the kingdon type . for two - dimensional quadrupole ion traps there are embodiments which can also be used as mass analyzers themselves . a further advantageous embodiment relates to three - dimensional ion traps where , after being introduced , the analyte ions collect in a small spherical cloud in the center of the ion trap owing to the damping in the collision gas . if collision ions of opposite polarity are now injected , they oscillate during the capture process , initially with wide oscillatory motions , through the cloud of analyte ions , where they can increase the internal energy of the analyte ions by collisions . as with the analyte ions before , the oscillatory motion of the collision ions is damped by the collision gas within a few milliseconds , depending on the pressure , and they collect in the cloud of the analyte ions . since they would then react with the analyte ions causing mutual neutralization , this damping must be prevented . an advantageous embodiment of a three - dimensional ion trap to carry out a method according to the invention is shown schematically in fig1 . the ion trap here can also be used as a mass analyzer . here , an electrospray ion source ( 1 ) with a spray capillary ( 2 ) outside the mass spectrometer is used to ionize the analyte ions , preferably biopolymer molecules . it will be assumed here that a mixture of digest peptides of a large protein is to be analyzed . the ions are guided in the usual way through an inlet capillary ( 3 ) and a skimmer ( 4 ) with the ion guides ( 5 ) and ( 9 ) through the pressure stages ( 15 ), ( 16 ), ( 17 ) to the 3d ion trap with end cap electrodes ( 11 and 13 ) and ring electrode ( 12 ), where they are captured in the usual way . the ion guides ( 5 ) and ( 9 ) comprise parallel rod pairs , across which the phases of an rf voltage are alternately applied . they can take the form of a quadrupole , hexapole or octopole rod system . a first mass spectrum , obtained by resonant excitation of the unfragmented analyte ions with mass - selective ejection and measurement in the ion detector ( 14 ), provides an overview of the digest peptides . if it is intended to analyze the amino acid sequence of one of the peptides , the triply charged ions of this peptide are isolated by normal methods ; this means that the ion trap is first overfilled and then all ions that are not triply charged ions of this peptide are ejected from the ion trap . the triple charge is recognized by the separation of the isotope lines , for triply charged ions this is exactly ⅓ of an atomic mass unit . if triply charged ions are not available in sufficient numbers , the doubly charged ions can also be used . these multiply charged ions are decelerated into the center of the trap by a short delay of a few milliseconds by the ever - present collision gas . there they form a small cloud around one millimeter in diameter . the negatively charged collision ions are then added . these ions are generated in a separate ion source ( 8 ) and guided via a small ion guide ( 7 ) to an ion merger , where they are introduced into the ion guide ( 9 ) leading to the ion trap ( 11 , 12 , 13 ). in the embodiment shown here , the ion merger simply comprises an apertured diaphragm ( 6 ), to which a suitable dc potential can be applied , and a shortening of two of the eight rods in the ion guide ( 9 ). it is particularly advantageous for this very simple type of ion merger if the ion guide takes the form of an octopole system . this ion merger can allow the ions of the electrospray ion source ( 1 , 2 ) to pass unhindered when there are suitable voltages at the diaphragm ( 6 ); with other voltages the negative ions from the ion source ( 8 ) are reflected into the ion guide ( 9 ). they reach the ion trap via this ion guide ( 9 ), and are stored there in the usual way by an injection lens ( 10 ). the strength and frequency of the initial oscillatory motion , and thus the average kinetic energy , depend on the value of the rf voltage . the closer the minimum mass threshold is to the mass of the collision ions , the faster and more energetic are the oscillatory motions . this allows the average kinetic energy for the collisions to be adjusted within limits . to prevent the collision ions from being damped by the collision gas within a few milliseconds , and so mixing with the analyte ions , it is expedient to continuously excite the collision ions in a weakly resonant way by a suitable ac excitation voltage , which is applied to both the end cap electrodes , for example . after the heating of the analyte ions is complete , the collision ions must be removed from the ion trap . this can occur by an increased resonant excitation , and also by increasing the rf voltage to a level where the collision ions are no longer stably stored and leave the ion trap . instead of the permanent weak resonant excitation , the collision ions can also be repeatedly ejected from the ion trap by periodically raising the minimum mass threshold before they are damped too much . the raising of the minimum mass threshold only needs to last a few tenths of a millisecond . newly injected collision ions then perform the further heating of the internal energy of the analyte ions for about one to two milliseconds . after the heating process has finished and the collision ions have been removed from the ion trap , the rf voltage of the ion trap can also be decreased here in order to trap and analyze the light fragment ions which are produced by the further ergodic fragmentation . also in this case of a 3d quadrupole ion trap , the collision ions can be easily produced in large quantities in the electrospray ion source ( 1 ) outside the mass spectrometer , instead of using the special ion source ( 8 ) in the vacuum section of the mass spectrometer . for instance , cesium ions ( mass 133 atomic mass units ) or iodine ions ( mass 127 atomic mass units ) can produced by spraying a solution of cesium iodide ; preferably by using a second spray capillary ( not shown in fig1 ) in the electrospray ion source ( 1 ) in addition to the spray capillary ( 2 ). by spraying rubidium bromide , rubidium ions ( mass 85 / 97 atomic mass units ) or bromide ions ( mass 79 / 81 atomic mass units ) may be generated , selected by the polarity of the spray voltage . if still lighter ions are to be used as collision ions , potassium chloride may be sprayed , forming either potassium ions ( mass 40 atomic mass units ), or chloride ions ( mass 35 / 37 atomic mass units ). by generating the collision ions in the electrospray ion source , the method of the invention can be performed in any 3d ion trap mass spectrometer equipped with an electrospray ion source . a very similar method of ergodic fragmentation of analyte ions by permanently trapped , oscillating collision ions can also be carried out in two - dimensional quadrupole ion traps that are designed to operate as a mass analyzer . the two - dimensional ion trap must , however , be provided with closures at both axial ends which can hold ions of not just one , but both polarities in the ion trap , for example by pseudopotentials generated by inhomogeneous rf fields at grids or similar electrode structures . both two - dimensional and three - dimensional ion traps equipped with electronic controls for the mass - selective ejection of ions are widely used . the fragment ions can be mass - analyzed with these ion traps themselves , but there is a limit to the mass resolution and mass accuracy that can be achieved . if the masses of the fragment ions must be determined with a very high degree of accuracy , it is advantageous to transfer the fragment ions from the rf ion trap into a high - resolution mass analyzer . in the case of two - dimensional ion traps , the fragment ions can subsequently be axially exported from the ion trap by any of widely known methods , transferred into a suitable mass analyzer and analyzed there . particularly advantageous for this are high - resolution mass analyzers such as time - of - flight mass analyzers with orthogonal ion injection , ion cyclotron resonance analyzers or special electrostatic ion traps of the kingdon type . but also with three - dimensional ion traps , it is possible to successfully export the fragment ions , taking special conditions into account , and introduce them into high - resolution analyzers . the collision ions can be generated in a special ion source in the vacuum section of the mass spectrometer , or can be supplied from an electrospray ion source outside the mass spectrometer . they can be cleaned by a mass filter to remove accompanying complex ions before being injected into the ion trap . ion sources for vacuum - internal generation of the collision ions are known in principle and are not further explained here . an ion merger can be used to introduce the ions produced in the ion source into the ion guides , which convey the ions to the fragmentation cell . this type of ion merger is very simple and can often be retrofitted ( including an ion source ) into existing instruments . other types of ion mergers can also be used , of course . u . s . pat . no . 6 , 737 , 641 b2 ( y . kato ), for example , presents an ion merger , but it seems to be very complicated and expensive compared to the ion merger described above , and fundamentally changes the type of the instrument . the ergodic fragmentation according to this invention , which is characterized by the bombardment of the stationary analyte ions with accelerated collision ions , has remarkable advantages compared to the methods used at present : a . the method is very fast due to the strong current of collision ions ; more fragment ion spectra can be acquired per unit of time . b . the short heating time makes it possible to collect a large proportion of the light fragment ions by reducing the rf voltage after the heating of the analyte ions is complete and the collision ions are removed . c . even without a subsequent reduction in the rf voltage , much lighter fragment ions can be captured , by setting a low rf voltage , than was possible with previous methods . d . in particular , the invention makes it possible for the first time to obtain a good yield when ergodically fragmenting analyte ions of a high physical mass of several kilodaltons . e . if , in rare cases , complexes are nevertheless formed with the collision ions , it is easily possible to use mono - atomic collision ions to identify the complexes on the basis of their mass differences . with knowledge of this invention , those skilled in the art can also create further methods which extend and complete the knowledge about structures of the substances analyzed . for example , from the fragment ions produced in this way it is possible to generate granddaughter ions , again by collisionally induced fragmentation . all these solutions are intended to be included in the basic idea of the invention . | 7 |
fig1 shows a t - shirt 10 to be worn by one wearer . the t - shirt has a message , in this case the word “ best ” 12 , which appears on the front of the t - shirt . in fig2 , there is the front of a second t - shirt 15 , with the word “ friend ” 17 on its front . thus , when the wearer of t - shirt 10 is with the wearer of t - shirt 15 , the message “ best friend ” is conveyed to any onlookers as conveying togetherness between the wearer of t - shirt 10 and the wearer of t - shirt 15 . good friends , lovers , and parent and child will enjoy the message to each other and the message that they are then giving to onlookers when they wear the respective t - shirts 10 and 15 together . fig3 shows the back 20 of the t - shirt of fig2 , and on back 20 the message “ best ” 22 is emblazoned thereon by any of the known methods of t - shirt printing . fig4 shows the back of the t - shirt of fig1 , and on this back 25 the message 27 “ friend ” is also given . thus , the t - shirts convey a completed thought when worn together with the individuals facing one way or the other . likewise , if the t - shirt of either fig1 and 4 or fig2 and 3 is worn alone , there is still a completed message shown , i . e ., “ best friend ” reading from front to back or back to front , as the case may be . in this type of situation , there is also the possibility of adding humor or confusing or entertaining messages of fig5 and 6 . fig5 shows an alternate embodiment of the back of t - shirt 30 of the t - shirt of fig2 . here the word “ worst ” 32 is shown . in fig6 the back of the t - shirt of fig1 is shown with the word “ enemy ” 37 on this back portion 35 of the t - shirt of fig1 . thus , when the wearers of fig1 and 2 are faced , they convey the message of “ best friend ”, but when they are turned away , their back messages are “ worst enemy ”. in this manner , contrary or humorous messages can also be utilized and enjoyed by the wearers and the onlookers . it is not necessary that the markings of one or the other t - shirt be intelligible in and of themselves . as shown in fig7 , the front of t - shirt 40 has the letters “ hap ” 42 , which does not have much meaning alone . when a wearer wears the t - shirt of fig8 , the front of which is shown as 45 with the letters “ py ” 47 , a complete word is fashioned to create a message . that message can be further developed on the back of the respective t - shirts , as fig9 shows the back 50 of the t - shirt of fig8 with the words “ cam ” 52 . likewise , the back of the t - shirt of fig7 is shown as t - shirt 55 in fig1 with the words “ per ” 57 shown . thus , the complete message of all four surfaces , i . e ., when the front and back of each of the two t - shirts is read , the words “ happy camper ” are appreciated by onlookers , thus providing enjoyment to the wearers and the onlookers . as shown in fig1 , the front of t - shirt 60 has the letters “ co ” 62 . in fig1 t - shirt front 65 has the letters “ la ” 67 , thus completing the word “ cola ”, which can be part of an advertising slogan for products shown in such a manner . as shown in fig1 , in a further embodiment the back 70 of t - shirt 65 has the letters “ co ” 72 , which in combination with the letters “ la ” 67 on the front side of t - shirt 65 , can also complete the cola message . further , back 75 of t - shirt 60 in fig1 can display the letters “ la ” 77 , and in combination with the letters “ co ” 62 displayed on the front oft - shirt 60 , can complete the cola message . as shown in fig1 , the front of t - shirt 80 has half of a heart 82 pictorially depicted . in fig1 , the front of t - shirt 85 has the other half of the heart 87 shown to match the depiction of fig1 . thus , the wearers of the t - shirts of fig1 and 16 when seen together complete the heart 82 and 87 in the eyes of the observers . in a further embodiment in fig1 , the back 90 of t - shirt 85 shows a half heart 92 which completes the half heart 87 from fig1 and in fig1 the half heart 97 of back 95 completes the message with half heart 82 of fig1 and also with the half heart 92 of t - shirt 90 of fig1 . thus , the t - shirts of a first and second wearer will convey information when read together . this information can be expanded on by having similar or contrary messages on the backs of the t - shirts as well , so that the compatibility is furthered , or in some cases used for contrary and confusing messages to create a more humorous or thought evoking situation as shown in fig5 and 6 . the information can be compiled so that the first and second wearer create a showing of togetherness , which may be appreciated both by the wearers and the onlookers . further , various messages such as religious or political messages can be set forth , to the enjoyment , education , benefit , consideration or evocation of the wearers and the onlookers alike . further , educational or game - like messages can be produced which will have interesting content for the onlookers , thus providing enjoyment for the wearers . as in the case of the t - shirt of fig1 and 4 , a message may be conveyed from front to back of the same t - shirt . thus , the t - shirt will have some meaning when worn by one person who is not in the company of the second person . also , in the case of , for example , fig8 , a wearer of the t - shirt with the letters “ py ” 47 on the front and “ per ” 57 on the back , shows to onlookers that that person alone is incomplete , thus sending a message which may be perceived as loneliness when that person is in fact alone without the companion wearer . as shown in fig1 - 24 , the t - shirts may also include orienting emblems 105 , 107 . the orienting emblems 105 , 107 maybe the same or different . the orienting emblems maybe on a first lateral half 101 or a second lateral half 103 of the t - shirt . for convenience , these halves may be referred to as a right half 101 or a left half 103 , with the position relative to the wearer &# 39 ; s right and left . the first orienting emblem 105 and the second orienting emblem 107 may independently be on either the right lateral half 101 or the left lateral half 103 of the first t - shirt 10 and second t - shirt 15 , respectively . the orienting emblems 105 , 107 may by on opposite sleeves of the first and second t - shirts . as shown in fig1 and 20 , the first orienting emblem 105 may be on the left lateral side 103 of the first t - shirt 10 , while the second orienting emblem 107 may be on the right lateral side 101 of the second t - shirt 15 . when the first and second orienting emblems 105 , 107 are adjacent to one another , as in fig1 and 20 , the message “ best friend ” will be conveyed to onlookers viewing individuals wearing the t - shirts 10 , 15 . in an alternate embodiment shown in fig2 and 22 , the first orienting emblem 105 may be on the right lateral side 101 of the first t - shirt 10 and the second orienting emblem 107 may be on the left lateral side 103 of the second t - shirt 15 . when the first and second orienting emblems 105 , 107 are opposite one another , as in fig2 and 22 , the message “ best friend ” will be conveyed to onlookers viewing individuals wearing the t - shirts 10 , 15 . the inventive method and system may also include directions instructing the individuals wearing the t - shirts 10 , 15 to remain oriented such that the first orienting emblem 105 is in a specific position relative to the second orienting emblem 107 . depending on the location of the orienting emblems , the instructions may advise that the orienting emblems remain adjacent to one another , as in fig1 and 20 , or opposite one another , as in fig2 and 22 . the orienting emblems and instructions may be used to produce creative combinations of phrases . for example , fig2 - 24 depict two t - shirts which , when positioned with the orienting emblems 105 , 107 opposite one another , communicate “ best friend ” on the front of the t - shirts . when positioned with the orienting emblems 105 , 107 adjacent to one another , the backs of the t - shirts communicate “ worst enemy .” if , however , the wearers turn such that the orienting emblems 105 , 107 are positioned to the same side , i . e . both to the left or both to the right , the t - shirts can communicate either “ worst friend ” or “ best enemy .” this play on words , and other variants , will provide enjoyment for both the wearers and onlookers alike . where the inventive method or system includes instructions , the instructions may provide instructions concerning various messages that will be displayed when the orienting emblems 105 , 107 are in specified orientations relative to one another . yet another embodiment that includes a play on words is shown in fig2 - 28 . in this embodiment , where the orienting emblems 105 , 107 are opposite one another the t - shirts communicate “ best friend ” on the front and “ worst enemy ” on the back . when the individual wearing the “ friend ” shirt turns around the orienting emblems 105 , 107 are positioned to the same side and the t - shirts communicate “ best worst ” when viewed from one direction and “ friend enemy ” when viewed from the opposite direction . thus , through the means of compatible lettering on mating t - shirts , many messages of many different types may be utilized to cause enjoyment or provide education or evocation to onlookers while promoting togetherness of the wearers . it is understood that t - shirts is being used broadly to also include any similar shirts such as vee neck , spaghetti strap , long sleeve t - shirts , and muscle shirts . in addition , while t - shirts are use herein as exemplary articles of clothing , it is to be understood that the claimed method and system apply to other articles of clothing including , but not limited to , hooded shirts , sweat shirts , wind breakers , collared shirts , jackets , shorts , pants , hats , bathing suits and combinations thereof . where the article of clothing is not a shirt , the messages will remain on the front or back of the clothing and the orienting emblem will be located on one of the lateral sides of the article of clothing . in some embodiments , the orienting emblems may be located on the sleeve of a t - shirts , or another location , such as the shoulder , where the orienting emblem is visible from both the front and the back of the wearer . where the article of clothing is not a t - shirt , the orienting emblem may also be located where the orienting emblem is visible from both the front and the back of the wearer . for example , the hip or leg of a pair of pants or the portion of a hat above the wearer &# 39 ; s ear . the orienting emblems may take any form that can be recognized by the wearers . the orienting emblems may be decorative , with their purpose of orientation unknown to everyone except the individuals wearing the articles of clothing . this description has been by way of example of how the invention can be made and carried out . those of ordinary skill in the art will recognize that various details maybe modified in arriving at the other detailed embodiments , and that many of these embodiments will come within the scope of the invention . therefore , to apprise the public of the scope of the invention and the embodiments covered by the invention , the following claims are made : | 0 |
as is well known in the art , fluorescence occurs when a molecule absorbs light photons from a uv - visible light spectrum , known as excitation , and then rapidly emits light photons as it returns to its ground state . fluorimetry characterizes the relationship between absorbed and emitted photons at specified wavelengths . it is a precise quantitative analytical technique that is inexpensive and easily mastered . all chemical compounds absorb energy which causes excitation of electrons bound in the molecule , such as increased vibrational energy or , under appropriate conditions , transitions between discrete electronic energy states . for a transition to occur , the absorbed energy must be equivalent to the difference between the initial electronic state and a high - energy state . this value is constant and characteristic of the molecular structure . this is termed the excitation wavelength . if conditions permit , an excited molecule will return to ground state by emission of energy through heat and / or emission of energy quanta such as photons . the emission energy or wavelength of these quanta are also equivalent to the difference between two discrete energy states and are also characteristic of the molecular structure . fluorescence occurs when a molecule absorbs photons from the uv - visible light spectrum ( 200 - 900 nm ), causing transition to a high - energy electronic state and then emits photons as it returns to its initial state , on the order of less than 10 − 9 sec . some energy , within the molecule , is lost through heat or vibration so that emitted energy is less than the exciting energy ; i . e ., the emission wavelength is always longer than the excitation wavelength . the difference between the excitation and emission wavelengths is called the stokes shift . fluorescent compounds or fluorophors can be identified and quantified on the basis of their excitation and emission properties . the excitation and emission properties of a compound are fixed , for a given instrument and environmental condition , and can be used for identification and quantification . although , maximum emission occurs only for specific excitation and emission wavelength pairs , the magnitude of fluorescent intensity is dependent on both intrinsic properties of the compound and on readily controlled experimental parameters , including intensity of the absorbed light and concentration of the fluorophor in solution . the intensity of the excitation light , which impinges on the sample , depends of the source type , wavelength and other instrument factors . the light source , usually mercury or xenon , has a characteristic spectrum for emission intensity relative to wavelength . at high dye concentrations or short path lengths , fluorescence intensity relative to dye concentration decreases as a result of “ quenching ”. as the concentration of molecules in a solution increases , probability increases that excited molecules will interact with each other and lose energy through processes other than fluorescent emission . by using two standards , materials of high and low intensity fluorescence can be color corrected and objectively compared . by incorporating materials that fluorescence only under long wave ultraviolet , the reference cards can indicate which of the commonly used wavelengths ( long or short wave ultraviolet ) was used to induce the recorded fluorescence . referring now to fig1 there is shown a top - down pictorial illustration of one embodiment of the present fluorescent color calibrator standard 10 . it will be appreciated that although the present invention will be described with reference to the embodiments shown in the drawings , it should be understood that the present invention can be embodied in many alternate forms of embodiments . in addition , any suitable size , shape or type of elements or materials could be used . still referring to fig1 , the fluorescent color calibrator standard 10 includes an indicator 102 for indicating that the standard is , or has been , illuminated with an ultra violet light ( uv ) source . the standard 10 also includes another indicator 101 for indicating that the uv source is , or was , a low intensity uv source . each of the fluorescent color patches or chips , corresponds to the fluorescent colors red , orange - red , yellow - orange , yellow - green , green , blue , darker - gray , lighter - gray , respectively . it will be appreciated that each of the fluorescent colors may be comprised of any suitable organic and / or inorganic fluorogenic material . as will be discussed herein each of the fluorescent colors is mapped to a standard red - green - blue ( rgb ) value set using a spectrometer . the fluorescent paint chips are illuminated with appropriate uv lamps , such as , for example , a high - mercury pressure uv lamp for uva . the spectrometer software may be adjusted to “ colorimeter mode ,” to record the emission of the visible fluorescence from the paint chips . the colorimeter mode provides readings in any number of color spaces , such as munsell , or cie l * a * b * values , which are then translated into the standard low - fluorescent intensity rgb values described herein and shown in fig6 . it should be understood that the rgb values shown in fig6 are for exemplary purposes only . referring also to fig2 there is shown a top - down pictorial illustration of another embodiment of the present fluorescent color calibrator standard 20 . the fluorescent color calibrator standard 20 includes an indicator 202 for indicating that the standard is , or has been , illuminated with an ultra violet light ( uv ) source . the standard 20 also includes another indicator 201 for indicating that the uv source is , or was , a high intensity uv source . each of the fluorescent color patches or chips are comprised of fluorogenic compounds such as available from golden artist colors inc ., and correspond to the fluorescent colors red ( or magenta ), orange - red , yellow - orange , yellow - green , green , blue , darker - gray , lighter - gray , respectively . it will be understood that reference to a colored fluorescent compound means that the compound fluoresces in that color . it will again be appreciated that each of the fluorescent colors may be comprised of any suitable organic and / or inorganic fluorogenic material . similar to the earlier discussion each of the fluorescent colors is mapped to a high - fluorescent intensity standard red - green - blue ( rgb ) value set using a spectrometer . the fluorescent paint chips are illuminated with appropriate uv lamps , such as , for example , uvc lamp for high intensity fluorescent emissions . likewise , the spectrometer software may be adjusted to “ colorimeter mode ,” to record the emission of the visible fluorescence from the paint chips . the colorimeter mode provides readings in any number of color spaces , such as munsell , or cie l * a * b * values , which are then translated into the standard high - fluorescent intensity rgb values described herein . referring also to fig3 there is shown a side - view pictorial illustration of either the low intensity embodiment or the high intensity embodiment of the present fluorescent color calibrator standard 30 . as will be discussed herein the low or high intensity determinants are the selection and formulation of the uv inhibiting coating 34 and the spectrometer illumination . it will be appreciated that this approach advantageously overcomes the prior art approach to reduce the intensity of fluorescence by adding material that does not fluoresce such as a carbon black pigment . it is also understood that the prior art approach alters both the intensity of the fluorescence and the color . such color changes are unacceptable for standardization . still referring to fig3 there is shown fluorescent paint chips 36 a - 36 h . fluorescent paint chips 36 a - 36 h are waterborne acrylic paints produced from polymer coated dyes derived from suitable florescent pigments and dyes , and are coated or suitably attached onto the paperboard support 32 . the paperboard support 32 which may be any suitable support such as resin coated paper . still referring to fig3 , the uv blocking coating 34 is then applied over the fluorescent color paint chips 36 a - 36 f . the predetermined uv blocking coating 34 may be any suitable blocking coating and layer thickness chosen for either low - intensity fluorescence or high - intensity fluorescence . for example , a foil strength uv blocking coating or low strength ( 1 / 20 ) blocking coating or layer may be used for low - intensity fluorescence or high - intensity fluorescence , respectfully . it will be understood and appreciated that the light gray and dark gray paint chips are not uv blocked with uv blocking coating 34 . it will be understood the gray chips advantageously provide visual information about the duration of exposure — brighter grays recorded longer exposure ; darker , shorter exposure . in an indirect way , one can get a sense from the brightness of the grays how strong the object fluoresces — brighter grays , weak object fluorescence ; darker grays , bright object fluorescence . also shown in fig3 is overlay 38 which has suitable openings to expose all the fluorescent colors . overlay 38 is also suitably marked with “ h uv / vis ” or “ l uv / vis ” with fluorophores sensitive to uva and uvc , respectively , i . e ., fluoresces when exposed to a high intensity or low intensity uv source , respectively . overlay 38 is also marked “ c ” with fluorophores sensitive only to uvc . turning now to fig4 there is shown one method for determining and using the fluorescent standards described herein . step 401 determines the standard fluorogenic compound ( sfc ) to use for a desired fluorescent color . after coating the sfc with the desired uv inhibitor agent or blocker . step 403 illuminates the sfc with a suitable uv light source . step 405 measures the sfc fluorescence using a suitable spectrometer to record the emission of the visible fluorescence from the sfc . the spectrometer readings may be in any suitable color space value 406 , such as munsell , or cie l * a * b * values , which are then translated 407 to the desired standard high or low fluorescent intensity rgb values . referring also to fig5 and again to fig1 , there is shown a pictorial representation of a photographic image 50 of a scene 55 exhibiting fluorescence and the fluorescent color calibrator standard 10 shown in fig1 . it will be understood that the scene 55 could be any suitable scene such as another photograph , image , or painting . it will also be understood that scene 55 could also be inorganic material such as a gem stone ; or , organic material such as blood samples . step 409 uv illuminates the scene 55 and the fluorescent color calibrator standard 10 . step 411 images the illuminated scene 55 and the fluorescent color calibrator standard 10 , for example , step 411 photographs the illuminated scene 55 and the fluorescent color calibrator standard 10 to produce fig5 : the pictorial representation 50 of the photographic of a scene 55 and the fluorescent color calibrator standard 10 shown in fig1 . it will be appreciated that the target rgb values may be printed on the calibrator standard 10 or otherwise provided as shown in fig6 b while viewing the pictorial representation 50 with any suitable software program , such as adobe &# 39 ; s photoshop , on any suitable monitor , the rgb value of each fluorescent color chip or patch of the imaged standard is set to the predetermined high or low fluorescent intensity rgb standard for that particular color , step 413 , as shown in fig6 b . it will be understood that the values shown in fig6 b are for illustration purposes only . it will be appreciated that the present invention overcomes prior art problems associated with ultraviolet induced visible fluorescence photography where the present invention provides a fluorescence color range standard within photographs made using long ( uv a ) and short wave ( uv c ) ultraviolet radiation ; the standard recorded in conjunction with the target object , e . g ., a photograph , enables fluorescence phenomenon to be objectively corrected and compared . it is understood that the fluorescent standard recorded , or imaged , with the target object comprises consistent , predetermined values . using these known values , false / erroneous color balance caused by human / instrumental error and numerous other variables e . g ., type of uv lamps , photography equipment , cameras , filters and other variables used to create the photograph can be corrected . the present invention &# 39 ; s relatively inexpensive dyes and coating materials also overcomes the problem of using expensive prior art white standards . it should be understood that the foregoing description is only illustrative of the invention . thus , various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to embrace all such alternatives , modifications and variances that fall within the scope of the appended claims . | 6 |
it may be appreciated that the present disclosure is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings . the invention ( s ) herein may be capable of other embodiments and of being practiced or being carried out in various ways . also , it may be appreciated that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting as such may be understood by one of skill in the art . the following description is directed to various configurations of emissions systems , particularly exhaust gas recirculation ( egr ) systems , apparatuses and methods to be used with an internal combustion engine , particularly of a motor vehicle such as an automobile . with an egr system , one or more cylinders of the internal combustion engine may be used to generate exhaust gas , which may then be recirculated and mixed with an intake stream of fresh ( ambient ) air to provide a mixed charge ( mixture ) of exhaust gas and air to the cylinders of the engine . for the purposes of this disclosure , an engine configured such that substantially an entire output of exhaust gas from a cylinder is to be recirculated for egr may be referred to herein as an engine having a dedicated egr cylinder . referring now to the figures , fig1 illustrates an internal combustion engine 100 . internal combustion engine 100 may power a motor vehicle that utilizes at least two hydrocarbon fuels which have different compositions . the first , or primary fuel , may be gasoline , which may comprise alkanes having four to twelve carbon atoms ( e . g . butane ( c 4 h 10 ), pentane ( c 5 h 12 ), hexane ( c 6 h 14 ), heptane ( c 7 h 16 ), octane ( c 8 h 18 ), nonane ( c 9 h 20 ), decane ( c 10 h 22 ), undecane ( c 11 h 24 ) and dodecane ( c 12 h 26 )). the second , or secondary fuel , may have a hydrogen to carbon ( h : c ) atomic ratio which is greater than that of the primary fuel . for example , gasoline may be understood to have a h : c ratio of about 1 . 86 . in contrast , if secondary fuel is formed exclusively of methane ( ch 4 ) or propane ( c 3 h 8 ), the secondary fuel may be understood to have a h : c atomic ratio of 4 . 0 or 2 . 67 , respectively . secondary fuel may be natural gas , either as compressed natural gas ( cng ) or liquefied natural gas ( lng ). natural gas may comprise 80 %- 99 % methane ( ch 4 ) gas , with liquefied natural gas ( lng ) having more methane ( ch 4 ) gas than compressed natural gas ( cng ). other components of natural gas may include ethane ( c 2 h 6 ), propane ( c 3 h 8 ), butane ( c 4 h 10 ), pentane ( c 5 h 12 ), nitrogen ( n 2 ), carbon dioxide ( co ), oxygen ( o 2 ) and hydrogen ( h 2 ). the secondary fuel may also be liquefied petroleum gas ( lpg ), such as liquefied propane ( c 3 h 8 ) and / or liquefied butane ( c 4 h 10 ). as such , internal combustion engine 100 may be a dual fuel engine which is configured to operate with both gasoline and natural gas being used as fuels simultaneously . internal combustion engine 100 is shown to have four cylinders 150 , 152 , 154 and 156 , although such is not intended to limit the present disclosure . one of the cylinders , cylinder 156 , may be understood to be a dedicated egr cylinder . in other words , it may be understood that substantially all of the exhaust gas 114 expelled from cylinder 156 may be directed ( recirculated ) back to the intake system 110 , here through an egr feedback loop 118 . the exhaust gas from the remaining three cylinders 150 , 152 , and 154 is directed to an exhaust system 190 , with none of the exhaust gas expelled from cylinders 150 , 152 and 154 recirculated to the intake system 110 of engine 100 . while it may be possible , based on the configuration of engine 100 , for all of the exhaust gas ( i . e . 100 %) expelled from cylinder 156 to be optimally recirculated back to the intake system 110 , it should be understood that certain design considerations and operating inefficiencies may only allow a substantial portion of the exhaust gas expelled from cylinder 156 to be recirculated back to the intake system 110 . for example , exhaust gas losses may occur between connection points . accordingly , it is contemplated that on a volume basis , 90 % or more of the exhaust gas expelled from the dedicated egr cylinder is recirculated to the engine intake system 110 . more preferably , 90 - 100 % of the exhaust gas expelled from cylinder 156 is recirculated , including all values therein , in 0 . 1 % by volume increments . furthermore , with four cylinders of equal volume , engine 100 may also be understood to have a nominal “ 25 % dedicated egr content ” because the exhaust gas expelled from each cylinder may be understood to have substantially the same volume , and one of the four cylinders has 100 % of its exhaust gas redirected to the intake system 110 , as noted above . the actual egr content can vary depending on differences in cylinder head pressure drop from cylinder to cylinder . during an operation of engine 100 , fresh ( ambient ) intake air 102 may enter air inlet 104 of air intake system 110 . the air 102 may then travel within intake passage 106 , during which time it may be compressed by intake compressor 108 . thereafter , air 102 may enter air / exhaust gas mixer 112 of air intake system 110 , and more particularly as distribution mixer , which is configured to distribute and mix the recirculated and exhaust gas 114 into the stream of air 102 to be introduced to the internal combustion engine 100 . as shown by fig1 , each of cylinders 150 , 152 , 154 and 156 may receive the primary ( first ) hydrocarbon fuel , such as gasoline , from a fuel ( common ) rail 145 which is in fluid communication with a first fuel tank 192 . gasoline may be provided to each cylinder 150 , 152 , 154 and 156 from the fuel rail 145 by a direct fuel injector 147 located in each cylinder 150 , 152 , 154 and 156 in addition to the foregoing , dedicated egr cylinder 156 may receive the secondary ( second ) hydrocarbon fuel , such as natural gas ( compressed or liquefied ) or liquefied petroleum gas , from a second fuel injector 149 in fluid communication with a second fuel tank 194 . as shown , the second fuel injector 149 a may be located in the intake port 142 of the cylinder head 144 ( i . e . port fuel injection ) dedicated to cylinder 156 , or as shown at 149 b in an intake passage 146 of the intake manifold 136 dedicated to cylinder 156 . in either situation , the second fuel injector 149 a or 149 b is arranged to provide substantially all the fuel ( 90 %- 100 % by volume ) to the dedicated egr cylinder 156 , and not cylinders 150 , 152 or 154 . thus , it may be understood that dedicated egr cylinder 156 operates with a charge comprising the first hydrocarbon fuel , the second hydrocarbon fuel and the mixture of exhaust gas and air to the dedicated egr cylinder , while the remaining cylinders are operated with a charge that does not include the second hydrocarbon fuel ( i . e . 0 % by volume ) or includes such fuel only at a maximum level of up to 10 % by volume . dedicated egr cylinder 156 may be operated fuel rich ( i . e . fuel - air equivalence ratio phi ( φ ) is greater than 1 . 0 ) to produce exhaust gas 114 with carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas which , may in turn , increase the octane number and promote increased egr tolerance and knock tolerance by increasing flame / speed burn rates , as well as increasing the dilution limits of the mixture and associated combustion stability of all the cylinders . it may be understood that the production of exhaust gas 114 with carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas is the result of incomplete combustion of the fuel being provided to dedicated egr cylinder 156 , which may be expressed by the following reaction : c x h y + z o 2 → a co 2 + b co + c h 2 o + d h 2 ( eq 1 ) while incomplete combustion of fuel in dedicated egr cylinder 156 , and the resultant production of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas , may be achieved by operating dedicated egr cylinder 156 solely with the primary fuel such as gasoline , the concentration of hydrogen ( h 2 ) gas in the exhaust gas 114 may be increased by operating dedicated egr cylinder 156 with the secondary fuel , such as natural gas or petroleum gas , simultaneously with the primary fuel . as set forth above , the secondary fuel has a hydrogen to carbon ( h : c ) atomic ratio which is greater than that of the primary fuel and , consequently , provide higher levels of hydrogen ( h 2 ) gas in the exhaust gas 114 than the primary fuel when used alone . alternatively , while incomplete combustion of fuel in dedicated egr cylinder 156 , and the resultant production of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas , may be achieved by operating dedicated egr cylinder 156 solely with the secondary fuel , fuels such as natural gas or petroleum gas may be understood to have slower burning velocities , higher ignition energy requirements and reduced rich combustion limits . as such , while it is possible herein to operate dedicated egr cylinder 156 solely with a secondary fuel such as natural gas or petroleum gas , the foregoing deficiencies encountered in doing such make it less desirable . by using a dual fuel approach to provide exhaust gas enrichment to the dedicated egr cylinder 156 , it is possible to now make efficient use of the increased rich combustion limits of the primary fuel , such as gasoline , and the increased h : c ratio of the secondary fuel , such as natural gas or petroleum gas . referring now to fig2 , fig2 shows hydrogen ( h 2 ) gas and carbon monoxide ( co ) gas emissions as a function of the fuel - air equivalence ratio for both gasoline and natural gas ( e . g . cng or lng ) fuels . the higher h : c atomic ratio of the natural gas ( cng / lng ) results in a higher concentration of hydrogen ( h 2 ) gas in the exhaust gas stream than with gasoline . assuming constant adiabatic flame temperature , hydrogen ( h 2 ) gas content present from the rich combustion of natural gas ( cng / lng ) is 50 % higher than gasoline . now , while carbon monoxide ( co ) gas production is 33 % lower when natural gas ( cng / lng ) in used place of gasoline , and both hydrogen ( h 2 ) gas and carbon monoxide ( co ) gas have been shown to improve knock tolerance and combustion duration of dilute gasoline engines , the benefits of hydrogen ( h 2 ) gas for both knock tolerance and combustion duration are observed to be much greater than carbon monoxide ( co ) gas . therefore , increasing hydrogen ( h 2 ) gas concentration at the expense of a reduction in carbon monoxide ( co ) gas concentration results in a net improvement in fuel efficiency of the dedicated egr engine 100 . after exiting dedicated egr cylinder 156 , exhaust gas 114 from dedicated egr cylinder 156 will enter passage 116 of egr feedback loop 118 . thereafter , exhaust gas 114 will enter mixer 112 of the air intake system 110 and be mixed with a stream of air 102 to provide a mixture 130 of air 102 and exhaust gas 114 . as explained herein , exhaust gas 114 from dedicated egr cylinder 156 may be treated within the egr feedback loop 118 after exiting egr cylinder 156 and prior to mixing with air 102 . to further increase the quantity of hydrogen ( h 2 ) gas in exhaust gas 114 after leaving the dedicated egr cylinder 156 , prior to entering mixer 112 the untreated exhaust gas 114 may enter a water gas shift reactor 120 within the egr feedback loop 118 . upon entering the water gas shift reactor 120 , one or more components of the exhaust gas 114 may react with water ( h 2 o ) vapor using a water gas shift reaction ( wgsr ) with a suitable water gas shift ( wgs ) catalyst contained in a water gas shift reactor 120 . more particularly , with the wgs reaction , carbon monoxide ( co ) gas in the exhaust gas 114 may react with water ( h 2 o ) vapor to produce carbon dioxide ( co 2 ) gas and hydrogen ( h 2 ) gas according to the following reaction : reacting carbon monoxide ( co ) gas in the exhaust gas 114 with water ( h 2 o ) vapor to produce hydrogen ( h 2 ) gas is beneficial by increasing the amount of hydrogen ( h 2 ) gas in the exhaust gas 114 from dedicated egr cylinder 156 . the wgs catalyst performance is highly dependent on exhaust temperature , and the amount of hydrogen ( h 2 ) gas exiting the wgs catalyst is dependent on the amount entering and the amount created . the amount of hydrogen ( h 2 ) gas entering the wgs catalyst is a function of the fuel , the dedicated egr cylinder air / fuel ratio and spark timing . the amount of hydrogen ( h 2 ) gas created is therefore dependent on exhaust gas temperature and the amount of carbon monoxide ( co ) gas in the inlet exhaust . it is possible to manipulate both with the dedicated egr cylinder air / fuel ratio . therefore , for a given operating condition , the dedicated egr cylinder air / fuel ratio may be controlled to increase the amount of hydrogen ( h 2 ) gas exiting the wgs catalyst . examples of wgs catalysts may include iron oxides ( fe 3 o 4 ) or other transition metals and transition metal oxides . after being mixed in mixer 112 , air / exhaust gas mixture 130 may then flow in passage 106 to cooler 132 ( e . g . heat exchanger ) to remove heat therefrom and correspondingly increase the density thereof . in the cooler 132 , the air / exhaust gas mixture 130 is preferably cooled to a temperature in a range of 30 ° c . to 60 ° c . after being cooled by cooler 132 , air / exhaust gas mixture 130 may then flow to an intake flow restrictor 134 , such as an intake throttle valve ( a mechanism by which a flow of the air / exhaust gas mixture 130 is managed by restriction or obstruction ) configured to restrict the volumetric flow and amount ( mass ) of air / exhaust gas mixture 130 provided to cylinders 150 , 152 , 154 and 156 . the intake throttle valve may more particularly comprise a butterfly valve that restricts the flow and amount of air / exhaust gas mixture 130 entering the intake manifold 136 and ultimately provided to cylinders 150 , 152 , 154 and 156 . intake flow restrictor 134 may be considered to be a primary flow restrictor in that it may similarly restrict the flow of the air / exhaust gas mixture 130 to all of cylinders 150 , 152 , 154 and 156 . intake flow restrictor 134 may be located at the entrance of intake manifold 136 . intake manifold 136 may comprise a plenum 138 through which the air / exhaust gas mixture 130 may flow to a plurality of intake passages / runners 140 , shown with one passage / runner 140 dedicated to each cylinder 150 - 156 . each passage / runner 140 may then feed the air / exhaust gas mixture 130 directly into an intake port 142 ( shown by dotted lines ) of a cylinder head 144 , shown with one port 142 dedicated to each cylinder 150 - 156 . after entering cylinders 150 - 156 , the air / exhaust gas mixture 130 may be ignited by an igniter ( not shown ) and combust therein . after combustion of the air / exhaust gas mixture 130 within cylinders 150 - 156 , untreated exhaust gas 114 from cylinders 150 , 152 and 154 may flow through exhaust ports 160 of cylinder head 144 and exhaust passages / runners 162 of exhaust manifold 170 , shown with exhaust ports 160 and one passage / runner 162 dedicated to each cylinder 150 - 154 , and then be collected in collector 164 . from collector 164 , untreated exhaust gas 114 may then flow through turbine 176 , which may turn intake compressor 108 by shaft 178 . after turbine 176 , untreated exhaust gas 114 may flow through exhaust passage 182 to catalytic converter 184 to be treated therein before being expelled from exhaust system 190 and into the atmosphere . catalytic converter 184 may comprise a three - way catalytic converter ( twc ). in other words , a catalytic converter which performs the following : ( 1 ) reduction of nitrogen oxides to nitrogen and oxygen by the reaction : ( 3 ) oxidation of unburnt hydrocarbons ( hc ) to carbon dioxide and water by the reaction : to control the air / fuel ratio , untreated exhaust gas 114 from cylinders 150 , 152 and 154 may be sampled by an exhaust gas oxygen ( ego ) sensor 166 , which may more particularly comprise a heated exhaust gas oxygen ( hego ) sensor , while untreated exhaust gas 114 from cylinder 156 may be sampled by an exhaust gas oxygen ( ego ) sensor 168 , which may more particularly comprise a universal exhaust gas oxygen ( uego ) sensor . to control the mass and volumetric flow rate of the air / exhaust gas mixture 130 entering dedicated egr cylinder 156 , the portion of the intake passage 146 dedicated to cylinder 156 may include an intake charge flow restrictor 148 , such as a throttle valve , configured and arranged to restrict the flow and amount of air / exhaust gas mixture 130 entering cylinder 156 without restricting the flow and amount of air / exhaust gas mixture 130 entering remaining cylinders 150 , 152 or 154 . the throttle may more particularly comprise a butterfly valve that restricts the amount of air / exhaust gas mixture 130 entering cylinder 156 . flow restrictor 148 may be considered to be a secondary flow restrictor in that it may restrict the flow of the air / exhaust gas mixture 130 to a particular cylinder , here cylinder 156 , as opposed to all the cylinders , after the air / exhaust gas mixture 130 has flowed past primary flow restrictor 134 . flow restrictor 148 may be used in conjunction with intake / exhaust valves , fuel injectors and engine controller 180 of engine 100 to operate or otherwise control dedicated egr cylinder 156 at the same or different air / fuel ratio than cylinders 150 , 152 and 154 . further , each cylinder 150 - 156 may be independently operated at an air / fuel ratio which is greater than ( rich ), equal to , or less than ( lean ) a stoichiometric ratio for the air and fuel . as shown in fig1 , flow restrictor 148 may be located on the intake side of cylinder 156 for intake restriction . flow restrictor 148 may be attached to the intake manifold 136 , or arranged between the intake manifold 136 and the cylinder head 144 . as flow restrictor 148 may be at least partially closed , the flow and amount of air / exhaust gas mixture 130 entering cylinder 156 may be decreased . simultaneously , the air / exhaust gas mixture 130 entering cylinders 150 , 152 and 154 may be increased , provided flow restrictor 134 remains unchanged . thus , the flow and amount of the air / exhaust gas mixture 130 entering cylinder 156 may be inversely related to the flow and amount of the air / exhaust gas mixture 130 entering cylinders 150 , 152 and 154 . that is , as the flow and amount of the air / exhaust gas mixture 130 entering cylinder 156 may be decreased , the flow and amount of the air / exhaust gas mixture 130 entering cylinders 150 , 152 and 154 may be increased , and vice - versa . as indicated above , without the use of flow restrictor 148 , the engine 100 in fig1 may be understood to have a maximum “ 25 % dedicated egr content ” because the exhaust gas expelled from each cylinder 150 - 156 may be understood to have substantially the same volume , and one of the four cylinders , cylinder 156 , has 90 - 100 % by volume of its exhaust gas redirected to the intake manifold 136 . however , with the use of flow restrictor 148 , the volume of exhaust gas expelled from cylinder 156 may now be varied by restricting the amount of air / exhaust gas 130 which is consumed by cylinder 156 such as the engine 100 may provide , for example , between 0 . 1 % and 25 % dedicated egr . by decreasing the flow and amount of air / exhaust gas 130 which is consumed by cylinder 156 , the flow and amount of untreated exhaust gas 114 expelled from cylinder 156 and routed / processed through egr loop 118 to air intake system 110 may be correspondingly decreased , which will decrease the amount of treated exhaust gas 114 provided to the cylinders 150 , 152 , 154 and 156 . restriction of untreated exhaust gas 114 expelled from cylinder 156 may be particularly necessary if the quantity of treated exhaust gas 114 adversely effects engine performance . if dedicated egr cylinder 156 is operated fuel rich , particularly with use of the secondary fuel , and / or exhaust gas 114 is processed through water gas shift ( wgs ) catalyst , a relatively significant amount of hydrogen ( h 2 ) gas and carbon monoxide ( co ) gas may be formed , both of which may promote increased egr tolerance by increasing burn rates , increasing the dilution limits of the mixture and reducing quench distances . in addition , the engine 100 may perform better at knock limited conditions , such as improving low speed peak torque results , due to increased egr tolerance and the knock resistance provided by hydrogen ( h 2 ) and carbon monoxide ( co ). also , while the egr tolerance of the engine 100 may now increase , the overall fuel consumption may decrease . while a water gas shift catalyst may result in production of hydrogen ( h 2 ) gas , the water - gas shift catalyst exchanges carbon monoxide ( co ) gas for hydrogen ( h 2 ) gas and carbon dioxide ( co 2 ) gas , meaning that any hydrogen ( h 2 ) gas produced results in a loss of combustible carbon monoxide ( co ) gas and a gain of incombustible carbon dioxide ( co 2 ) gas , which does not provide the same level of combustion benefit as hydrogen ( h 2 ). furthermore , the water - gas shift reaction is mildly exothermic , meaning energy is released as the reaction progresses , and thus energy is lost through the process . more particularly , for an engine system with a traditional low level egr loop , a heat exchanger is generally utilized to reduce the temperature of the egr feed prior to mixing with intake air . this heat is typically rejected to the engine coolant , and is then subsequently rejected to the ambient environment via the radiator . similarly , in a gasoline d - egr application , the energy released during the exothermic water - gas shift reaction is rejected via the same process , meaning that the energy produced by the reaction is not used in a useful manner . as a result , it may be understood that the energy content of hydrogen ( h 2 ) gas created is slightly less than the energy content of the carbon monoxide ( co ) gas consumed . alternatively , in another embodiment as shown in fig3 , to increase the quantity of hydrogen ( h 2 ) gas in exhaust gas 114 after leaving the dedicated egr cylinder 156 , prior to entering mixer 112 the untreated exhaust gas 114 may enter a steam hydrocarbon reformer 121 within the egr feedback loop 118 . upon entering the steam hydrocarbon reformer 121 , one or more components of the exhaust gas 114 may react with water ( h 2 o ) vapor using a steam reformation reaction ( srr ) with a suitable steam reformation ( sr ) catalyst . more particularly , with the srr reaction , hydrocarbons ( hc ) which may exist in the exhaust gas 114 after passing through dedicated egr cylinder 156 , particularly due to the dedicated egr cylinder 156 being operated fuel rich ( i . e . phi ( 4 ) is greater than 1 . 0 ), may react with water ( h 2 o ) vapor to produce carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas according to the following reaction : c n h m + n h 2 o → n co +( n + m / 2 ) h 2 ( eq 6 ) as shown above , use of a steam reformation reaction with a steam reformation catalyst contained in steam hydrocarbon reformer 121 simultaneously produces carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas from unburnt hydrocarbon ( hc ) gas and water vapor in the untreated exhaust gas 114 . thus , reacting a hydrocarbon ( hc ) gas and water vapor in the untreated exhaust gas 114 from dedicated egr cylinder 156 to produce carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas is beneficial by increasing the amount of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas in the untreated exhaust gas 114 from dedicated egr cylinder 156 . the steam reformation catalyst may comprise nickel ( ni ) as the active metal . for example , the steam reformation catalyst may comprise a ni - m composition , where m = gold ( au ), silver ( ag ), tin ( sn ), copper ( cu ), cobalt ( co ), molybdenum ( mo ), iron ( fe ), gadolinium ( gd ) or boron ( b ). apart from such ni - m compositions , one may also use palladium ( pd ) or platinum ( pt ) as the steam reformation catalyst . a particularly preferred catalyst is nickel or palladium . preferably , the steam reformation reaction is carried out at temperatures at or above 500 ° c . untreated exhaust gas 114 entering steam hydrocarbon reformer 121 preferably may have a temperature in a range of 400 ° c . to 800 ° c ., and be exposed to a pressure in a range of 14 . 7 psia to 44 psia . it is generally desirable to maintain exhaust temperatures as high as possible to increase production of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas from a hydrocarbon ( hc ) gas . as such , for d - egr applications , one particular placement of the steam hydrocarbon reformer 121 is as close to the exhaust port 160 as possible , so that the temperature of the exhaust gas 114 entering the steam hydrocarbon reformer 121 is as high as possible . the amount of unburned hydrocarbon ( hc ) gas from dedicated egr cylinder 156 , as well as the amount of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas created in dedicated egr cylinder 156 , and subsequently entering the steam hydrocarbon reformer 120 is a function of the dedicated egr cylinder air / fuel ratio and spark timing . for example , if dedicated egr cylinder 156 is operated fuel rich of stoichiometric a / f ( air / fuel ) ratio , a relatively significant amount of carbon monoxide ( co ) and hydrogen ( h 2 ) may be formed prior to the use of the hydrocarbon reformer 121 . the amount of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas further created in the hydrocarbon reformer 121 is dependent on exhaust gas temperature and the amount of hydrocarbon or methane ( ch 4 ) gas in the untreated exhaust gas 114 entering the reformer 121 . thus , performance of the steam reformation catalyst is dependent on exhaust gas temperature , with the amount of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas exiting the steam hydrocarbon reformer 121 being dependent on the amount existing prior to use of the steam hydrocarbon reformer 121 and the amount created in the steam hydrocarbon reformer 121 . given that the hydrocarbon steam reformation reaction produces carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas simultaneously , which are both combustible , the benefits of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas with respect to octane number and burning velocity can be realized from the steam reformation reaction . generation of both carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas for the egr stream may be understood to have a positive impact on the charge properties of the egr stream . more particularly , the combination and co - existence of carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas in the egr stream may improve flame speed and combustion stability , as well as improve knock and egr tolerance . furthermore , the steam reformation reaction is endothermic , meaning energy is put into the reaction and thus the heating value ( or energy content ) of the formed carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas mixture is greater than the heating value of the consumed methane ( ch 4 ) gas . stated another way , since the hydrocarbon steam reformation reaction is endothermic , waste heat energy ( from the exhaust gas ) is used to produce carbon monoxide ( co ) gas and hydrogen ( h 2 ) gas from hydrocarbons , thereby increasing the final energy content of the mixture . essentially , the steam reformation catalyst functions as a chemical waste heat recuperative device , which makes use of exhaust energy ( that would otherwise be rejected to the environment ) in order to increase the energy content of the fuel . for operation of steam reformation catalysts in an environment containing appreciable amounts of sulfur which may poison the catalyst , it may be necessary to utilize a regenerable or replaceable sulfur trap upstream of the steam reformation catalyst in order prevent sulfation of the steam reformation catalyst . natural gas streams are typically very free of sulfur , and as such may allow for effective use of regenerable or replaceable sulfur traps with satisfactory replacement or regeneration intervals . while the principles of the invention have been described herein , it is to be understood by those skilled in the art that this description is made only by way of example and not as a limitation as to the scope of the invention . other embodiments are contemplated within the scope of the present invention in addition to the exemplary embodiments shown and described herein . modifications and substitutions by one of ordinary skill in the art are considered to be within the scope of the present invention , which is not to be limited except by the following claims . | 5 |
preferred embodiments of the present invention will be described in detail hereinbelow with reference to the attached drawings . fig8 shows a partial view of first and second internal circuits 810 and 820 . the first internal circuit 810 illustratively corresponds to the circuit ip 1 and the second internal circuit 820 illustratively corresponds to one of the other circuits ip 2 or ip 3 . the first internal circuit 810 includes a synchronous circuit 830 and a test cell 840 . the synchronous circuit 830 is illustratively a synchronous latch receiving , at a data input , a data element that is stored in the latch and given at an output of the latch during first edges ( e . g ., the leading edges ) of an internal clock signal h 1 . in embodiments of the present invention , the synchronous circuit 830 is not limited to a latch and can be any type of synchronous circuit ( e . g ., a counter , sequencer , or the like ). in the illustrated embodiment , the test cell 840 is a shift register cell according to ieee standard 1149 . 1 , this cell 840 being a one - way cell and being interposed between two communication lines “ in ” and “ out ”. the first line “ in ” is connected to the output of the synchronous circuit 830 , and the second line “ out ” is connected to an input of the second internal circuit 820 . the test cell 840 furthermore includes a first d - type latch 841 , a second transparent d - type latch 842 , multiplexers 843 to 846 , and a logic gate 847 . the first d - type latch 841 has a data input , a clock input , and an output . the first latch stores and outputs the data present at the data input during the first edges ( e . g ., the leading edges ) of the signal present at its clock input . the second transparent d - type latch 842 has a data input , an output , and a clock input . the second latch outputs the data present at the data input upon the appearance of the second edges ( e . g ., the trailing edges ) of the signal present at its clock input , the second latch being locked upon the appearance of the first edges of the signal present at its clock input . each of the multiplexers 843 to 846 has first and second data inputs , a selection input , and an output . the output is connected to the first data input if the selection input receives a signal in a first state ( e . g ., “ 0 ”) and is connected to the second data input if the signal is in a second state ( e . g ., “ 1 ”). the logic gate 847 , which is illustratively an or - type gate , has two inputs and one output . the test cell receives the following signals defined in ieee standard 1149 . 1 : a data signal di shifted from a previous cell , a data signal do that is shifted to a following cell , a shift / sampling selection command signal sdr , a shift clock signal cdr , an updating signal udr , and a test mode selection signal mode . the data input of the first latch 841 is connected to the output of the first multiplexer 843 . the clock input of the first latch 841 receives the signal cdr . the output of the first latch 841 produces the signal do . the data input of the second latch 842 is connected to the output of the second multiplexer 844 . the clock input of the second latch 842 is connected to the output of the fourth multiplexer 846 . the output of the second latch 842 is connected to the second data input of the third multiplexer 845 . the first inputs of the first to third multiplexers 843 to 845 are connected to the first line “ in ”. the second data input of the first multiplexer 843 receives the signal di . the selection input of the first multiplexer 843 receives the signal sdr . the second data input of the second multiplexer 844 is connected to the output of the first latch 841 . the selection inputs of the second and fourth multiplexers 844 and 846 are connected together and receive the signal mode . the selection input of the third multiplexer 845 is connected to the output of the logic gate 847 . the output of the third multiplexer 845 is connected to the second line “ out ”. the first data input of the fourth multiplexer 846 receives the internal clock signal h 1 . the second data input of the fourth multiplexer 846 receives the signal udr . one of the inputs of the logic gate 847 is connected to the output of the first latch 841 . the other input of the logic gate receives the signal mode . it is necessary to dissociate two modes of operation for the test cell 840 . a first mode of operation is the “ normal ” mode which corresponds to when the signal mode is in a first state ( e . g ., “ 0 ”). a second mode of operation is the “ test ” mode which corresponds to when the signal mode is in a second state ( e . g ., “ 1 ”). in the “ test ” mode , the working of the test cell 840 is similar to that of a conventional cell . the mode signal is in the second state , thus connecting the line “ in ” to the output of the second latch 842 . the signal udr is given to the clock input of the second latch 842 , and the data input of the second latch is connected to the output of the first latch 841 . to shift the data elements between the cells of the test chain , the signal sdr is in the second state and the signal cdr is constituted by a series of pulses to shift test data from cell to cell using signals di and do during each pulse of the signal cdr . when the test data has been placed in the right cells by a series of shifts in the first registers 841 , the pulses of the signal cdr are stopped and then a negative pulse is sent on the signal udr . the data element present in the first latch 841 is then memorized by the second latch 842 and appears at the second line “ out ”. then , the data elements are sampled to be recovered . for this purpose , the signal sdr is positioned in the first state , and a pulse is sent on the signal cdr to memorize the data element on the first line in the first latch 841 . the data element sampled in the first latch 841 can then be recovered through a series of shifts from cell to cell . the operation in “ normal ” mode requires the storing of a state bit in the first latch 841 . the loading of the state bit must be done beforehand through the use of the test mode by a series of successive shifts . the state bit informs the cell 840 whether or not it is necessary to delay the data element traveling on the transmission line . in the illustrated embodiment , a first state of the state bit ( e . g ., “ 0 ”) indicates that the data element should not be delayed and a second state of the state bit ( e . g ., “ 1 ”) indicates that the data element is to be delayed . the normal operation of the cell 840 is illustrated in fig9 a to 9 f . fig9 a shows the internal clock signal h 1 which synchronizes the elements of the first internal circuit 810 . this signal has a succession of first edges 90 and second edges 91 in alternation . fig9 b shows the signal present on the first line “ in ”. the state of this signal is represented by a succession of data elements di − 1 , di , and di + 1 which may be equal to either “ 0 ” or “ 1 ”. since this signal comes from the synchronous circuit 830 , changes in state 92 of data elements occur shortly after each first edge 90 of the internal clock signal h 1 . when the state bit is in the first state and the signal mode is in the first state , the third multiplexer 845 connects the second line “ out ” to the first line “ in ”. thus , the signal present on the second line “ out ” is substantially identical to the signal present on the first line “ in ”, as shown in fig9 c . actually , the signal present at the second line “ out ” is slightly delayed with respect to the signal present at the first line “ in ” because of the third multiplexer 45 ( e . g ., in 0 . 35 μm technology , the delay is typically smaller than 0 . 1 ns ). if the second internal circuit 820 corresponds to the circuit ip 3 , the data element present at the second line “ out ” is stored during the first edges 93 of the internal clock signal h 3 which consequently occur before the first edges 90 of the internal clock signal h 1 , with the data element di present at the second line “ out ” being stable . thus , when the state bit is in the first state , the cell 840 behaves like a conventional cell without adding any further delay . on the contrary , when the state bit is in the second state and the signal mode is in the first state , the third multiplexer 845 connects the second line “ out ” to the output of the second latch 842 . the signal present at the second line “ out ” is substantially identical to the signal present at the output of the second register 842 ( but with a slight delay introduced by the third multiplexer 845 ). the data element present in the second latch is synchronized by the second edges 91 of the internal clock signal h 1 . indeed , since the signal present at the first line “ in ” is stable when the second latch 842 is transparent , it is as if the data element is stored during the second edges 91 although the storage is actually done during the first edges 90 . the signal that is output from the second latch 842 therefore changes state shortly after the second edges 91 of the internal clock h 1 . the signal shown in fig9 e is obtained on the second line “ out ”. this signal corresponds to the signal present at the first line “ in ” delayed by a half - period of the internal clock signal h 1 . if the second internal circuit 820 corresponds to the circuit ip 2 , the data element present at the second line “ out ” is stored during the first edges 94 of the internal clock signal h 2 that occur after the first edges 90 , but well before the second edges 91 of the internal clock signal h 1 . consequently , the data element di present at the second line “ out ” is stable . thus , when the state bit is in the second state , the cell 840 behaves like a test cell that adds an additional delay of one half period of the internal clock signal h 1 . such a cell 840 can easily be used to replace the cells of an integrated circuit without necessitating the redesigning of the internal circuit itself ip 1 to ip 3 . furthermore , such a cell has the advantage of adding a small number ( e . g ., only 20 ) of transistors per connection between internal circuits . numerous variants of the present invention are possible . in the embodiment described above , a test cell is used on an output of the first internal circuit 810 . it is also possible to use this very same cell 840 instead of a test cell 821 placed at the input of the second internal circuit 820 . in this case , the internal clock h 2 or h 3 is used instead of the internal clock h 1 . if an input cell of the present invention is modified , it is not necessary to modify the output cell ( and vice versa ). it is preferred , however , to place the modified cells on the outputs in order to obtain the benefit of a processing time greater than half of the period of the clock signal when the signal is delayed . if the cell is placed at input , the processing time is equal solely to a half period of the clock signal when the signal is delayed . furthermore , in ieee standard 1149 . 1 it is possible for the cells placed at input to be simplified cells having only one latch . the present invention requires the use of a two - latch cell , and this gives a more significant increase in the total size of the integrated circuit . additionally , while the illustrated example refers to a test cell in accordance with ieee standard 1149 . 1 that includes two storage latches , it is not necessary for the latches to be identical to those described above . for example , the second latch may be replaced by a conventional d - type latch ( i . e ., non - transparent ) synchronized with the second edges . the present invention can also be adapted to more complex test cells that have a greater number of latches and do not necessarily correspond to the ieee 1149 . 1 standard . similarly , the illustrated embodiment corresponds to a particular case . it is quite feasible to modify the logic levels being used on condition that the elements used , especially the logic gate 847 and the multiplexers 843 to 846 , are adapted to the chosen levels . further , elements may be replaced by equivalents . for example , the first latch 841 and the first multiplexer 843 may be replaced by a latch having several inputs and selection means . this is also the case for the second latch 842 and the second multiplexer 844 . the multiplexers 843 to 846 may generally be replaced by any other selection means ( e . g ., logic gates or tristate output circuits ). the present invention is particularly suited for use with large - sized integrated circuits that are formed several from indecently designed synchronous circuits . while there has been illustrated and described what are presently considered to be the preferred embodiments of the present invention , it will be understood by those skilled in the art that various other modifications may be made , and equivalents may be substituted , without departing from the true scope of the present invention . additionally , many modifications may be made to adapt a particular situation to the teachings of the present invention without departing from the central inventive concept described herein . furthermore , an embodiment of the present invention may not include all of the features described above . therefore , it is intended that the present invention not be limited to the particular embodiments disclosed , but that the invention include all embodiments falling within the scope of the appended claims . | 6 |
referring now to the figures of the drawings in detail and first , particularly , to fig1 thereof , there is seen a diagrammatic illustration of a sequence of an embodiment of the method according to the invention for producing a catalyst carrier body 1 . step 1 in this case illustrates blending and / or mixing of an adhesive 5 with a passivating substance 6 . the passivating substance 6 is pulverulent and is , in particular , aluminum oxide ( preferably plate - shaped particles ) with a mean grain diameter 8 of 0 . 3 μm to 1 . 5 μm . the two substances are distributed uniformly with one another , for example by using an agitator or the like . in step 2 , a housing 2 is provided on its inside or inner surface 3 with a mixture of the adhesive 5 and of the passivating substance 6 . the housing 2 which is illustrated in this case is shown in section . step 3 shows how a honeycomb body 4 is inserted at least partially into the housing 2 . the honeycomb body 4 is preferably a metallic honeycomb body 4 and the housing 2 is also preferably made from metal . step 4 shows one possibility of how a bonding agent 12 can be introduced into inner regions of the honeycomb body 4 or of the housing 2 . the bonding agent 12 in this case is introduced into the honeycomb body 4 , for example using a capillary plunger or a distributor 24 , in such a way that the distributor 24 comes into contact with an end face 11 of the honeycomb body 4 . the distributor 24 has a multiplicity of passages in which the bonding agent 12 has located itself . upon contact with the honeycomb body 4 , the bonding agent 12 rises into passages 15 ( see step 3 ) as a result of a capillary effect , thus wetting regions to be subsequently provided with brazing material . step 5 shows a fluidized bed 25 , through the use of which pulverulent brazing material 13 is injected into inner regions of the catalyst carrier body 1 . the brazing material 13 in this case remains adhering to the non - illustrated bonding agent 12 . step 6 diagrammatically shows a catalyst carrier body 1 in a furnace 26 . in this case , a thermal treatment of the catalyst carrier body is carried out , in which , initially , the introduced adhesive 5 is evaporated and a passivation layer is formed , before the brazing material 13 liquefies . after the thermal treatment or during the cooling of the catalyst carrier body , the previously liquid brazing material solidifies , and the individual components of the catalyst carrier body are connected to one another . this last method step preferably involves high - temperature vacuum brazing . fig2 diagrammatically shows an embodiment of a catalyst carrier body 1 with a sleeve 9 , in an exploded illustration . a first component of the catalyst carrier body is the honeycomb body 4 . the latter includes a multiplicity of metallic sheet metal layers 16 which are constructed to be partly smooth and partly structured and have been layered alternately and subsequently wound or intertwined with one another . the sheet metal layers 16 in this case have a thickness which is preferably less than 50 μm , in particular less than 20 μm , and preferably less than 15 μm . with regard to the production or configuration of the sheet metal layers for such a honeycomb body 4 , reference may be made at this juncture to european patent application 0 245 737 a1 , corresponding to u . s . pat . nos . 4 , 803 , 189 , 4 , 832 , 998 , 4 , 923 , 109 and 4 , 946 , 822 ; international publication no . wo 90 / 03220 , corresponding to u . s . pat . nos . 5 , 105 , 539 and 5 , 135 , 794 ; and german patent de 37 43 723 c1 , the contents of which are fully incorporated herein by reference . in the illustrated embodiment , the sheet metal layers 16 are wound in an approximately s - shaped manner , and ends 21 of the sheet metal layers 16 can be seen at the periphery . due to the structuring of some sheet metal sheets 16 , passages 15 are formed , which extend substantially or approximately parallel to an axis 17 of the catalyst carrier body 1 and are delimited by the end faces 11 of the honeycomb body 4 . in other words , the passages 15 correspond substantially or approximately to a length 18 of the honeycomb body 4 . the catalyst carrier body 1 is delimited outwardly by the housing 2 which has an extent 23 in the direction of the axis 17 . the sleeve 9 which is disposed between the honeycomb body 4 and the housing 2 has an extent 22 in the direction of an axis 17 . in order to produce such a catalyst carrier body 1 , first , the honeycomb body 4 and the sleeve 9 are produced separately , the honeycomb body 4 subsequently being introduced into the sleeve . the non - illustrated adhesive 5 having the passivating substance 6 , which is provided on the inside 3 of the housing 2 , initially ensures fixing within the housing 2 immediately after the sleeve 9 is pushed in together with the honeycomb body 4 . brazing of the catalyst carrier body 1 on the end face and concluding thermal treatment are subsequently carried out , in which technical joining connections are produced that are not positioned in the region of the non - illustrated previously applied adhesive 5 . in principle , the configuration of the catalyst carrier body 1 in terms of the length 18 of the honeycomb body 4 , of the extent 22 of the sleeve 9 and / or of the extent 23 of the housing 2 is freely selectable , so that not all components have to be flush with one another at the end faces 11 . fig3 shows a view of a portion of a catalyst carrier body 1 in section . this figure partially illustrates a housing 2 and a honeycomb body 4 ( identified by components 15 and 16 ) formed from sheet metal layers 16 and having passages 15 , with a sleeve 9 being disposed between the housing 2 and the honeycomb body 4 . the illustrated section lies in a region of the catalyst carrier body 1 in which no connections are desired between the sleeve 9 and the housing 2 or the honeycomb body 4 . in this region , therefore , in each case adhesive 5 having a passivating substance 6 is provided between the sleeve 9 and the housing 2 and between the sleeve 9 and the sheet metal layers 16 . the embodiment shown herein constitutes virtually a semi - finished product . after the thermal treatment of the catalyst carrier body 1 , a continuous passivation layer 14 ( see fig4 ) is formed from the passivating substance 6 between the sleeve 9 and the adjacent components 2 , 4 . fig4 is a perspective view of a further embodiment of a catalyst carrier body 1 including a honeycomb body 4 and a housing 2 . the honeycomb body 4 is again constructed with a plurality of sheet metal layers 16 . a tying or connection region 20 of the honeycomb body 4 to the housing 2 in this case is illustrated by hatching . the tying region 20 is the region in which a technical joining connection of the honeycomb body 4 or of the sheet metal layers 16 to the housing 2 is subsequently effected . moreover , the adhesive 5 including the passivating substance 6 was provided on the inside 3 of the housing 2 so that , during the subsequent thermal treatment , passivation layers 14 running completely around in strip form and having a width 10 ( also see fig1 , step 2 ) which is smaller than 10 mm are generated . as is evident , the passivation layers 14 are disposed in such a way that they delimit the tying region 20 after the honeycomb body 4 has been pushed completely into the housing 2 . this prevents auxiliary or process materials for the formation of technical joining connections from flowing beyond the limits of the tying region 20 and from causing undesirable connections there . while one passivation layer 14 is disposed directly at one end face 11 of the honeycomb body 4 , the other passivation layer 14 is disposed at a distance 19 from an end face 11 , in the direction of the axis 17 . fig5 shows a further view of a portion of an embodiment of a catalyst carrier body with a housing 2 , with a sleeve 9 and with sheet metal layers 16 forming a honeycomb body 4 . this figure is intended particularly to illustrate the formation of technical joining connections 7 which are preferably formed in the contact regions of the components 2 , 9 , 16 disposed adjacently one another . in this case , the formation of such connections 7 takes place solely in the tying region 20 , since there is no passivation layer 14 provided therein . fig6 is a diagrammatic illustration of a blast - cutting operation for generating the passivation layer . corundum particles 29 with a size 28 of 10 μm to 20 μm are blasted onto a sleeve 9 ( or onto the inside 3 of the housing 2 ) through the use of a nozzle 32 . for this purpose , an energy carrier 31 such as , for example , air or a liquid , to which the corundum particles 29 are supplied , is used . the latter are entrained and impinge onto the surface of the sleeve 9 or the inside 3 . in this case , on one hand , the surface of the sleeve 9 or the inside 3 is scored , stripped off , etc . but , on the other hand , splitting of the corundum particles and settlement of subfragments on the roughened surface also take place . this surface of the sleeve 9 or the inside 3 with the passivation layer 14 is illustrated diagrammatically in fig7 . the passivation layer 14 includes a multiplicity of separate or isolated crystal agglomerations 27 having an averaged height 30 which is in the range of 0 . 3 to 1 . 5 μm . the term “ height 30 ” means the amount by which the crystal agglomerations 27 project with respect to a surrounding level 33 of the passivation layer 14 . the method described herein is particularly simple and cost - effective , so that it is predestined for use in series manufacture . the catalyst carrier bodies resulting from this method are capable , over a long period of time , of withstanding the thermal and dynamic loads in the exhaust system of a motor vehicle . | 8 |
referring now to the drawing , shown therein is a circuit card package , designated generally by the reference numeral 10 , constructed in accordance with the principles of this invention . the package 10 includes a circuit card 12 which is adapted for insertion into a card edge connector 45 on a backplane 46 . the circuit card 12 is commonly referred to as a parent card . a substantially planar faceplate bracket 14 is secured orthogonally to the circuit card 12 . the faceplate bracket 14 is formed with , illustratively , two openings 16 each for receiving therethrough a respective second type of circuit card 17 in parallel to the circuit card 12 . the circuit card 17 is commonly referred to as a child card . a second bracket member 18 is formed from planar sheet material and is bent at a right angle . the bracket member 18 is secured to both the circuit card 12 and the faceplate bracket 14 so as to have a first portion 20 orthogonal to the circuit card 12 and parallel to the faceplate bracket 14 , and a second portion 22 orthogonal to the faceplate bracket 14 and parallel to the circuit card 12 . a card edge connector 24 is mounted on the circuit card 12 . an interface adaptor board 26 is received by the connector 24 and is secured to the first portion 20 of the second bracket member 18 , so as to be parallel to the first portion 20 . the interface adapter board 26 has mounted thereon a pair of card edge connectors 28 , each in alignment with a respective one of the openings 16 in the faceplate bracket 14 so that a circuit card 17 inserted through an opening 16 can have its leading edge received by the respective connector 28 . the interface adaptor board 26 is formed with wiring traces 29 interconnecting the terminals of each connector 28 with corresponding terminals of each connector 24 . there are situations where the circuit card 17 should not be removed or inserted while the telecommunications equipment is operational . such insertion is commonly referred to as “ hot insertion ”. for such a situation , to retain the circuit card 17 within the package 10 , the circuit card 17 is formed with an opening 30 near its leading edge . to cooperate with the opening 30 , there is provided a latch mechanism 32 mounted to the first portion 20 of the second bracket member 18 . a respective latch mechanism 32 is provided for each of the circuit cards 17 which may be installed in the package 10 and illustratively comprises a spring - loaded plunger of the type manufactured by southco , inc ., of concordville , pa , and identified by part no . 56 - 99 - 196 - 20 . each latch mechanism 32 is secured to a respective bent tab 34 formed from the first portion 20 of the second bracket member 18 . the spring - loaded plunger 32 has a spring biased pin secured to the knob 36 , so that when the circuit card 17 is inserted into the package 10 , the knob 36 is pulled away from the bent tab 34 against the force of the internal spring , allowing the leading edge of the circuit card 17 to pass the pin . when the circuit card 17 is fully seated in the connector 28 , the knob 36 is released and the pin extends into the opening 30 of the circuit card 17 , thereby retaining the circuit card 17 within the package 10 . the package 10 can then be installed in a rack of telecommunications equipment and secured thereto by the latches 38 on the faceplate bracket 14 , as is well known in the art . since the latch mechanism 32 is only accessible when the package 10 is out of the rack of telecommunications equipment , the circuit card 17 is not hot insertable . in situations where the circuit card 17 is allowed to be hot insertable , the latch mechanism 32 can be eliminated . accordingly , there has been disclosed an improved circuit card package which allows additional child cards to be installed without requiring any redesign of the backplane . while an illustrative embodiment of the present invention has been disclosed herein , it is understood that various adaptations and modifications to the disclosed embodiment are possible , and it is intended that this invention be limited only by the scope of the appended claims . | 7 |
hereinafter , a method of compensating for an inter - channel offset voltage according to the present invention will be described with reference to fig1 . fig1 illustrates the structure of a column driver in which an inter - channel offset is compensated in accordance with the present invention . analog output voltage from each digital - to - analog converter ( dac ) 100 is applied to the data line for an lc pixel through amplifiers ( or output drivers ) 110 . according to a preferred embodiment of the present invention , a unity gain amplifier can be used for the amplifier 110 . referring to fig1 , an output voltage from each amplifier 110 is delivered to a switch array 120 for each corresponding output channel . although 16 channels are chosen as the output channels in fig1 , the number of channels can be altered and 16 is chosen just for the explanation of the subject matter of the present invention . the number of output channels is not necessarily limited thereto . referring to fig1 , the dac 100 converts a digital signal into an analog signal and converts a positive voltage level as well as a negative voltage level which is represented by 8 bits into an analog signal . herein , a positive and negative voltage is alternatively applied for driving liquid crystal pixels . the physics behind for the alternative switching of the polarity of the applied voltage is well known to those with ordinary skill in the art and thus the detailed description thereof will not be provided here . in accordance with a preferred embodiment of the present invention , sixteen ( 16 ) digital - to - analog converters ( dac ) 100 produces analog for the application to the channels . the column driver according to the present invention can be operated in two types of modes , i . e ., normal operation mode and test mode for the extraction of offset voltages wherein the mode selection is controlled by a controller 160 . the column driver of the present invention initiates test mode when it is turned on with power . in this initiation stage , i . e . test mode , switch points t 0 , t 1 , t 2 , . . . , t 15 of the switch array 120 are set open - circuited and thus do not transfer any output signals to data lines of pixels while switch points s 0 , s 1 , s 2 , . . . , s 15 of the switch array 120 deliver the detected voltages to the non - inverting input of a comparator 130 in a successive manner for each channel in accordance with a pre - defined sequence under the control of the controller 160 . during the test mode , the offset voltage for each channel is sequentially sampled and fed to the input of the comparator 130 since the switch points s 0 , s 1 , s 2 , . . . , s 15 are switched on to the input of the comparator one by one under the control of the controller 160 . according to a preferred embodiment of the present invention , 16 offsets in a positive (+) direction for the 16 channels as well as 16 offsets in a negative (−) direction for the 16 channels , i . e ., a total of 32 offset data can be extracted with respect to a single reference voltage of the comparator 130 , according to a given timing clock signal , which is repeated with varying the reference voltage of the comparator 130 . to compensate for the offset of the comparator 130 during the detection , the extraction process can be repeated while swapping a non - inverting terminal with an inverting terminal . the test mode is controlled by the controller 160 according to the present invention and may be controlled in such a way that 32 offset data can be sequentially extracted according to a given timing clock . the comparator 130 illustrated in fig1 compares the magnitude of a signal sequentially input from the switch array s 0 , s 1 , s 2 , . . . , s 15 with a reference voltage v ref and outputs either high or low digital signal according to the comparison process . a digital signal train comprising either 1 or 0 from the comparator 130 for each channel is then stored in a memory 140 as an offset voltage value for a particular channel . when the column driver operates in the normal operation mode , stored offset data is accessed from the memory and fed to subtracting unit 150 for differentiating the input signal train for compensation under the control of the controller 160 and thus the offset - compensated input signal is input to the dac 100 . according to the present invention , the switches s 0 , s 1 , s 2 , . . . , s 15 are switched on one by one under the control of the controller 160 in order to extract an offset voltage generated in each channel . digital data output from the comparator 130 from the comparison of the detected offset voltage with a reference voltage is serially input and stored in the memory 140 . offset voltage data is accessed when input signal train is received and the input data is adjusted by compensation with accessed offset data . in other words , the subtraction result by the offset is input to the dac 100 , thereby compensating for the offset . the essential feature of the present invention is to extract an overall actual offset voltage in which all offsets present in the entire signal paths of channels as well as an offset generated in the amplifier 110 are reflected . moreover , by detecting offsets for the 16 channels using the comparator 130 , an offset generated in the comparator 130 can also be canceled . in the method of compensating for an inter - channel offset voltage according to the present invention , when the controller 160 controls the column driver to enter the test mode for inter - channel offset voltage detection after the column driver is initially provided with power to start operating , offset voltage detection for all channels are sequentially performed according to a predetermined timing clock sequence as mentioned above . upon completion of the test mode , the controller 160 switches the column driver to the normal operation mode according to a flag . offset data stored in the memory 140 is accessed and subtracted from input digital data , and the subtraction result is input to the dac 100 . in other words , once power supply to a liquid crystal driving chip starts , the column driver starts operating in the test mode and thus the switches t 0 , t 1 , t 2 , . . . , t 15 at a channel output side are all open and the switches s 0 , s 1 , s 2 , . . . , s 15 are sequentially connected according to an offset voltage detection sequence . according to a preferred embodiment of the present invention , the reference voltage of the comparator 130 may have 32 levels and 32 offset voltage detection processes are required for each channel in the test mode for comparison with the reference voltage of 32 levels . since a positive voltage and a negative voltage are applied by turns due to a liquid crystal driving way , a total of 64 comparison processes may be performed for each channel in consideration of 32 levels of the positive voltage and 32 levels of the negative voltage . according to a preferred embodiment of the present invention , by swapping the non - inverting terminal and the inverting terminal to compensate for the offset of the comparator 130 , the offset can be averaged and compensated for . therefore , according to the present invention , for each channel , the reference voltage of the comparator 130 , e . g ., 32 levels , is scanned for comparison , is scanned for the positive voltage and the negative voltage , and is scanned for the swapped terminal of the comparator 130 , thereby accurately measuring and detecting an offset voltage for each channel . as is apparent from the foregoing description , an offset voltage generated in each channel for driving each pixel of an lcd panel is detected for a whole signal path and offset voltages for all channels are compared and extracted by a single comparator according to a timing sequence , thereby reducing the size of the column driver and removing the additional offset of the comparator . furthermore , since the offset voltage is detected in a digital circuit mode , it can be compensated for in circuit terms in spite of variation and fluctuation in a semiconductor chip manufacturing process . the foregoing has outlined rather broadly the features and technical advantages of the present invention in order that the following claims of the invention may be better understood . additional features and advantages of the invention will be described hereinafter which form the claims of the invention . it should be appreciated by those skilled in the art that the conception and specific embodiment disclosed may be readily utilized as a basis for modifying or designing other structures or processes for carrying out the similar purposes of the present invention . in addition , the conception and specific embodiment disclosed may be utilized by those skilled in the art as a basis for modifying or designing other structures or processes for carrying out the same purposes of the present invention . it should also be realized by those skilled in the art that such equivalent constructions do not depart from the spirit and scope of the invention as set forth in the appended claims . | 6 |
by enabling full duplex communication we can simultaneously send in the uplink and downlink and it could mean doubling the use of spectrum ( fig1 ). in half - duplex systems we either receive or transmit in time tdd ( time - division duplex ) or in frequency fdd ( frequency - division duplex ), so it may be thought that we waste half of the resources . the main challenge of the full duplex communication is to cancel the self interference that is orders of magnitude stronger than the received signal from the intended transmitters . this interference is partly known due to the fact that the transmitter exactly knows its own transmitted signal , though the exact channel between the transmit and receive antennas at the base station is not known . it would be even worse if this channel is time varying or fading because we then need to estimate this channel more frequently . fig2 shows the strong self interference in comparison to the weak received signal from a mobile station or user . there are two possible deployment of the full duplex communication with respect to a fixed number of transmit and receive rf chains 302 , 304 , 306 , and 308 . in practice the main complexity involved with the use of multiple antennas 310 and 312 is associated with the number of rf chain due to the fact that channel estimation , precoding , beamforming , multiple stream transmission , and demodulation all depends on the number of receive rf chains or transmit rf chains . depending on if we use one antenna 330 for each pair of transmit rf chain 322 and receive rf chain 324 or if we use two antennas 350 and 354 , which means one 354 for receive rf chain 346 and the other 350 for transmit rf chain 342 , we can have one of the two possible deployment scenarios . see fig3 . both systems may have marginal pros or cons in half duplex systems . we may use one antenna per rf chain for full duplex communication because it does not change the system complexity . however , the cost associated with using more physical antennas well worth the possible gain that can be achieved by this deployment scenario . in the sequel , we address how to allocate the antennas for either transmit or receive if this deployment scenario is used . 1 ) in single link system , if both links have one transmit antenna per rf chain there is no need for antenna splitting and the average gain of fd with respect to hd ( half - duplex ) transmission would be 2 . however , for particular realization of the channel this gain could be different . if one antenna is used for a pair of tx ( transmit ) and rx ( receive ) rf chain , antennas can be split into one or more transmit antennas and one or more receive antennas . the antenna splitting between the transmit and receive antennas is very critical . the antenna splitting may be based on the channel condition . the system may perform the antenna splitting so that capacity gain is increased . if the system cannot dynamically change the antenna selection for full duplex communication very fast , then we may set the antenna splitting that will work in average . we show that the average capacity gain of full duplex with respect to half duplex is given by the following formula : ɛ { g fd } ≈ { ( m - m 1 ) + ( n - n 1 ) 0 . 5 ( m + n ) = 2 - 2 n 1 + m 1 n + m ρ & lt ;& lt ; 1 min ( n 1 , m - m 1 ) + min ( n - n 1 , m 1 ) min ( n , m ) ρ & gt ;& gt ; 1 where g fd is the capacity gain , ε { } is the expectation operator or statistical average , ρ represents the average snr ( signal to noise ratio ), m and n are the numbers of antennas at node 1 and 2 , respectively , and m 1 and n 1 are the numbers of transmit antennas at node 1 and node 2 , respectively . from the above formula , it can be the best to set n 1 and m 1 to one regardless of the number of antennas n and m . this means that each node selects only one antenna for transmission and uses all the other antennas for reception . at high snr , the split can be almost equal between the number of transmit and receive antennas at each node . in particular , if n = m , then m 1 = n 1 = m / 2 maximizes the gain . if n & lt ; m then the solution is to set n 1 = n / 2 . however , m 1 can take different values as long as m & gt ; m 1 + n 1 & gt ; n . m / 2 and n / 2 can be m / 2 ± ½ and n / 2 ± ½ when m and n are odd , respectively . 2 ) when ofdm system is used , one problem is how to find the splits between the ofdm tones into three groups where either one of uplink , downlink or simultaneous fd transmission is used . one strategy is to dynamically let the system finds the splits between these three groups . since initiation of a full duplex communication in a single tone requires the knowledge of the interference in that tone on the downlink users , it is critical to have this information before scheduling any user in the downlink in that particular tone . in time varying environment it is important to periodically have this information before the scheduling . therefore , the system begins the operation by dividing the set of ofdm tones into two groups : one for the uplink and the other one for the downlink . we assume that within a group of frames , e . g . a super frame , the channel does not change . while the system is in operation , the users in the downlink measure the interference on one or multiple ofdm tones that are in the uplink group . the downlink user then report a free channel signal in case that this interference is below a certain threshold . this threshold may be fixed or set periodically by bs ( base station ) or ms ( mobile station ). the initiation of the feedback of this information could be by the base station or by the ms . there may also be a fixed schedule when a downlink user may feedback this information . based on this information , the bs then may select one or more downlink users to be scheduled in the same set of tones as some uplink users . this procedure allows for allocating some of the uplink tones to full duplex operation . this operation can only boost the downlink throughput . in order to allow for enhancement in the uplink , we can also have a secondary method in place . over multiple super frames we measure the downlink enhancement and then we allocate some of the downlink tones to uplink . the enhancement may be measured in terms of the throughput , other quality of service or system utility measures . this reassignment of downlink tones to uplink would be dependent on the enhancement that we have received over a group of past superframes . by having both methods in place , it is then possible to exchange some of the enhancement received in the downlink for enhancement in the system utility for the uplink . 3 ) the scheduling of the users for the simultaneous uplink and downlink is based on an optimization of a system utility such as weighted sum rate where the weight itself changes in time based on the past operation of the systems and channel condition . the entire operation is discussed in the further system details . 4 ) simultaneous uplink and downlink operation in the csma ( carrier sense multiple access ) single cell network also requires a modified mac ( media access control ) layer . the foregoing is to be understood as being in every respect illustrative and exemplary , but not restrictive , and the scope of the invention disclosed herein is not to be determined from the detailed description , but rather from the claims as interpreted according to the full breadth permitted by the patent laws . it is to be understood that the embodiments shown and described herein are only illustrative of the principles of the present invention and that those skilled in the art may implement various modifications without departing from the scope and spirit of the invention . those skilled in the art could implement various other feature combinations without departing from the scope and spirit of the invention . | 7 |
hereinafter , the embodiments of the present invention will be described in detail with reference to the accompanying drawings . fig1 which shows a first embodiment of the present invention , indicates an example of a copy machine of which structure is shown in fig2 . the copy machine is composed of a reader unit and a printer unit . initially , the reader unit will be explained . in fig2 numeral 302 denotes an original feeder ( or document feeder : df ) which feeds an original to an original mounting glass ( platen ) 301 . numerals 303 and 304 denote light sources ( halogen lamp or fluorescent lamp ) which illuminate the original put on the original mounting glass 301 . numerals 305 and 306 denote reflectors which are used to condense light from the light sources 303 and 304 on the original . numeral 314 denotes a carriage which holds the halogen lamps 303 and 304 , the reflectors 305 and 306 and a mirror 307 . numeral 315 denotes a carriage , which holds mirrors 308 and 309 . reflection light ( transmission light ) from the original put on the original mounting glass 301 is guided to a condenser lens 310 by the mirrors 307 , 308 and 309 to be guided on a ccd 101 by the condenser lens 310 . the ccd 101 , which is mounted on a substrate , converts a light signal into an electrical signal . the carriage 314 moves at a speed v in an orthogonal direction to an electrical scan ( main scan ) direction of the ccd 101 and the carriage 315 moves at a speed v / 2 , thereby scanning ( sub scan ) an entire surface of the original . numeral 312 denotes an image process unit , which performs a drive control of the ccd 101 and processes the obtained electrical signal . numeral 313 denotes an interface ( i / f ) unit , which interfaces with an another ipu or the like . subsequently , the printer unit will be explained . in fig2 numerals 340 and 441 denotes cassettes , which hold therein recording paper sheets . numerals 338 and 339 denote pickup rollers , which respectively pick up the sheets one by one from the cassettes 340 and 441 . numerals 336 and 337 denote paper feed rollers , which feed the sheets picked up by the pickup rollers 338 and 339 on a transfer belt 333 . numeral 446 denotes an adsorption charger , which charges the sheets fed by the paper feed rollers 336 and 337 cooperating with a transfer belt roller 448 used for driving the transfer belt 333 . numeral 447 denotes a paper leading edge sensor , which detects a leading edge of the sheet on the transfer belt 333 . a detection signal from the paper leading edge sensor 447 is transmitted from the printer unit to a color reader unit , and is used as a sub - scan sync signal when a video signal is transmitted to the printer unit from the color reader unit . numeral 317 denotes an m ( magenta ) image formation unit , 318 denotes a c ( cyan ) image formation unit , 319 denotes a y ( yellow ) image formation unit , and 320 denotes a k ( black ) image formation unit . these units are arranged opposite to the transfer belt 333 from an upstream side to a downstream side . the m image formation unit 317 , the c image formation unit 318 , the y image formation unit 319 and the k image formation unit 320 substantially have the same structure except for colors of development agents used in development units 322 , 325 , 328 and 331 . the m image formation unit 317 charges a surface of a photosensitive drum 341 up to a predetermined potential by using a primary charger 321 and scans the surface of the photosensitive drum 341 by driving an led array 210 based on first color image data , after a latent image formation to form a latent image on the surface of the photosensitive drum 341 is prepared . the latent image is developed by the development unit 322 to form an m toner image . the development unit 322 contains a sleeve 345 which is used for performing a development by applying a development bias . the m toner image on the photosensitive drum 341 is to be transferred on the recording paper sheet put on the transfer belt 333 by discharging electricity from a back side of the transfer belt 333 by using a transfer charger 323 . the c image formation unit 318 charges a surface of a photosensitive drum 342 up to a predetermined potential by using a primary charger 324 and scans the surface of the photosensitive drum 342 by driving an led array 211 based on first color image data , after a latent image formation to form a latent image on the surface of the photosensitive drum 342 is prepared . the latent image is developed by the development unit 325 to form a c toner image . the development unit 325 contains a sleeve 346 which is used for performing a development by applying a development bias . the c toner image on the photosensitive drum 342 is to be transferred on the sheet put on the transfer belt 333 by discharging electricity from the back side of the transfer belt 333 by using a transfer charger 326 . the y image formation unit 319 charges a surface of a photosensitive drum 343 up to a predetermined potential by using a primary charger 327 and scans the surface of the photosensitive drum 343 by driving an led array 212 based on first color image data , after a latent image formation to form a latent image on the surface of the photosensitive drum 343 is prepared . the latent image is developed by the development unit 328 to form a y toner image . the development unit 328 contains a sleeve 347 which is used for performing a development by applying a development bias . the y toner image on the photosensitive drum 343 is to be transferred on the sheet put on the transfer belt 333 by discharging electricity from the back side of the transfer belt 333 by using a transfer charger 329 . the k image formation unit 320 charges a surface of a photosensitive drum 344 up to a predetermined potential by using a primary charger 330 and scans the surface of the photosensitive drum 344 by driving an led array 213 based on first color image data , after a latent image formation to form a latent image on the surface of the photosensitive drum 344 is prepared . the latent image is developed by the development unit 331 to form a k toner image . the development unit 331 contains a sleeve 348 which is used for performing a development by applying a development bias . the k toner image on the photosensitive drum 344 is to be transferred on the sheet put on the transfer belt 333 by discharging electricity from the back side of the transfer belt 333 by using a transfer discharger 332 . numeral 349 denotes a discharge charger , which discharges electricity from the sheet in order to easily separate the sheet , which flows through the k image formation unit 320 , from the transfer belt 333 . numeral 350 denotes a separation charger , which prevents an image confusion due to separation discharge when the sheet is separated from the transfer belt 333 . numerals 351 and 352 denote pre - fixing chargers , which charge the sheet separated from the transfer belt 333 to prevent the image confusion by reinforcing adsorption of a toner . numeral 334 denotes a fixing unit , which thermally fixes a toner image formed on the sheet by heat of rollers 903 and 904 heated by fixing heaters 901 and 902 . numeral 335 denotes a paper discharge tray , which receives discharged sheets . subsequently , fig1 will be explained . in fig1 numeral 1 denotes a ram ( random access memory ), which stores a heater lighting time setting table . numeral 6 denotes a rom ( read only memory ), which stores a control program . numeral 3 denotes a cpu ( central processing unit ), which detects if the copy machine is in a heat - up state , a standby state or a copy operation state according to the control program stored in the rom 6 . a heater lighting time and a heater lighting off time corresponding to the state of the copy machine detected by the cpu 3 or periodicity of a heater drive pulse are captured from the heater lighting time setting table stored in the ram 1 to set them in a heater control unit 4 . numeral 4 denotes the heater control unit , which controls drives of the fixing heaters 901 and 902 based on the lighting time or the periodicity which is set after capturing it from the ram 1 by the cpu 3 . fig3 is a flow chart showing an example of the control program stored in the rom 6 shown in fig1 . when the power is supplied , ordinary lighting times of the fixing heaters and periodic data are captured from the ram 1 to set a time 240 ms as a lighting time of the main heater 901 and a time 160 ms as a lighting time of the sub heater 902 in the heater control unit 4 , in a step s 201 . in a step s 202 , the heater control unit 4 is caused to execute a heat - up process . a timing is controlled such that the sub heater 902 is not lighted concurrently with the main heater 901 . when a heat - up process by the heater control unit 4 is terminated , a flow advances to a step s 203 . in the step s 203 , it is judged whether or not the copy machine ready for copying is in the standby state . if not in the standby state , the flow advances to a step s 204 . in the step s 204 , it is judged whether or not the copy machine is in the copy operation state . if in the copy operation state , the flow returns to the step s 203 . if not in the copy operation state , the control is terminated . on the other hand , in a case where the judged result in the step s 203 indicates the standby state , the flow advances to a step s 205 . in the step s 205 , changed lighting times of the fixing heaters and periodic data are captured from the ram 1 to set a time 7200 ms as the lighting time of the main heater 901 and a time 4800 ms as the lighting time of the sub heater 902 in the heater control unit 4 . then , in a step s 206 , wait until a copy start key 5 is depressed . in this case , also the timing is controlled such that the sub heater 902 is not lighted concurrently with the main heater 901 . when the copy start key 5 is depressed , the flow advances to a step s 207 . in the step s 207 , the ordinary lighting times of the fixing heaters and the period data are captured from the ram 1 to set the time 240 ms as the lighting time of the main heater 901 and the time 160 ms as the lighting time of the sub heater 902 . then the flow returns to the step s 203 . since it is not required to precisely perform temperature controls of the fixing heaters in the standby state as compared with the copy operation state , the number of lighting times are to be decreased instead of extending the lighting times of the heaters by performing such a control as the lighting time of the main heater 901 is set the time 7200 ms and the lighting time of the sub heater is set the time 4800 ms in the standby state , as described above . as a result , power changes for a main heater control signal and a sub heater control signal come to be in such a state as shown in fig4 . as apparent from fig4 a power change range is decreased and the number of power change times can be considerably decreased . therefore , an obtained value can clear a flicker standardized value of iec555 - 3 ( iec1000 - 3 - 3 ) defining the limits of voltage change and flicker in a commercially available power supply system . the voltage change and flicker occur when electrical loads of an electrical and electronic equipment are switched . in the first embodiment of the present invention , an example of an image record apparatus having the two fixing heaters is described . however , the same effect as above can be obtained in case of having only one fixing heater . the number of power change times can be considerably decreased by changing the lighting time of the main heater 901 and the lighting time of the sub heater 902 respectively in an image record operation state and the standby state . therefore , since the number of power change times in the commercially available power supply system can be decreased , the obtained value can clear the above flicker standardized value . numeral 11 denotes a main heater , 12 denotes a sub heater , 13 denotes a thermistor , 14 denotes a thermostat , and 15 denotes a fixing roller . hereinafter , a second embodiment of the present invention will be described . fig6 indicates a relation among a power variation a in case of controlling an off time of a fixing heater according to a sequence , a control signal b of a fixing main heater and a control signal c of a fixing sub heater . hereinafter , the second embodiment will be explained according to an actual operation . in the second embodiment , during an image formation apparatus is in a standby state , the off time of the fixing heater is set . for example , if a heated and / or cooled enclosed temperature is 190 ° c ., the off time of the fixing main heater ( 500 w ) is set 10 , 000 ms ( a in fig6 ) and the off time of the fixing sub heater ( 600 w ) is set 13 , 000 ms ( b in fig6 ) as shown in fig7 . data corresponding to the off time of each heater shown in fig6 is stored in the rom 6 . since the off time of the heater in the standby state is set sufficiently longer as compared with a driving period of the heater in an image formation operation state , entire number of lighting times of the heater can be reduced . if the image formation apparatus is in the standby state , since it is not required that a surface temperature of a fixing roller always reaches the heated and / or cooled enclosed temperature , there occurs no problem in this control . however , if the heated and / or cooled enclosed temperature in the standby state is not maintained at a certain level , heat quantity required in a fixing can not be immediately obtained after depressing a copy start key . therefore , the off time of the fixing heater has to be properly changed according to power of the heater or the heated and / or cooled enclosed temperature as in a characteristic table indicating a relation between the heated and / or cooled enclosed temperature and the off time of the heater shown in fig7 . lighting times of the fixing main heater and the fixing sub heater in the standby state are determined due to the fact that whether or not the temperature reaches the heated and / or cooled enclosed temperature ( lighting time is not controlled in this case ). that is , when each fixing heater is once lighted , the heater is lighted throughout until it reaches the heated and / or cooled enclosed temperature . if the fixing heater reaches that temperature , the heater is turned off , and the setting off time is counted . as shown in fig6 when a copy is started upon depressing the copy start key during off time counting , the off time counting is released ( a ″, b ″). in this manner , by controlling the off time of the fixing heater , the number of lighting times of the heater can be entirely reduced . therefore , since the number of power change times can be considerably reduced , the obtained value can clear the flicker standardized value . since a value of the off time in the second embodiment is merely an example , the value can be changed according to another consideration . further , the same effect as above can be obtained in case of the one fixing heater . a control taken measures for the flicker will be described hereinafter with reference to a flow chart shown in fig8 . when the power is supplied in a step s 301 , the fixing heaters are simultaneously lighted for the purpose of heating up and a lighting time in an ordinary copying state is set . then , a flow advances to a step s 302 to judge whether or not the process of heating up is terminated ( reaches heated and / or cooled enclosed temperature ). after terminating the process of heating up , the flow advances to a step s 303 to judge whether or not the image formation apparatus is in the standby state . if not in the standby state , the flow advances to a step s 304 . on the other hand , if in the standby state , the flow advances to a step s 305 . in the step s 305 , the off time of the heater read from the rom 6 is set , and the flow advances to a step s 306 . a detailed flow chart at this time will be described later with reference to fig9 . in the step s 306 , it is judged whether or not the copy start key is depressed . if the key is depressed , the flow advances to a step s 307 . in the step s 307 , the lighting time of the heater is reset ( off time setting is released ), and the flow advances to the step s 304 . in the step s 304 , it is again judged whether or not the apparatus is in a copy operation state . if not in the copy operation state , the flow advances to a step s 308 to judge whether or not the apparatus is in the standby state . in the step s 308 , if in the standby state , the flow advances to the step s 305 to perform the control after the step s 305 described above . if not in the standby state , the operation is terminated . subsequently , a control when the off time of the heater is set will be described with reference to fig9 . in a step s 401 , when the off times of the main and sub heaters in the standby state are set , a flow advances to a step s 402 to judge whether or not the temperature of a fixing unit reaches the heated and / or cooled enclosed temperature . if it reaches the heated and / or cooled enclosed temperature , the flow advances to a step s 403 . on the other hand , if it does not reach , the flow advances to a step s 406 . in the step s 406 , the main heater is lighted to judge whether or not the temperature of the fixing unit reaches the heated and / or cooled enclosed temperature in a step s 407 . if it reaches the heated and / or cooled enclosed temperature , the flow advances to the step s 403 . if it does not reach , the main heater is continuously lighted in the step s 406 . in the step s 403 , the main heater is turned off and the sub heater is lighted to start to count the off time of the main heater set in the step s 401 . then , in a step s 404 , it is judged whether or not the copy start key is depressed . if the key is not depressed , the flow advances to a step s 405 . in this step , the main heater is forcedly maintained in an off state until the count terminates . if the key is depressed , the flow advances to a step s 408 . in this step , an off time set of the heater is released , and then operation terminates . the same control as that of the main heater is performed to the sub heater . as a result , by the above control , the obtained value can clear the flicker standardized value . as described above , it is needless to say that the object of the present invention can be also attained when a storage medium storing a program code of software for realizing the function in the above embodiments is supplied to a system or an apparatus , and a computer ( cpu or mpu ) provided in the system or the apparatus reads the program code stored in the medium and executes it . in this case , the program code itself read from the storage medium realizes a new function of the present invention , and the storage medium storing therein the program code constitutes the present invention . as the storage medium for supplying the program code , e . g ., a floppy disk , a hard disk , an optical disk , a magneto - optical disk , a cd - rom ( compact disk rom ), a cd - r ( compact disk recordable ), a magnetic tape , a non - volatile memory card , a rom ( read - only memory ), or the like can be used . it is needless to say that the functions of the above embodiments can be realized not only in the case where the computer reads and executed the program code but also in a case where an os ( operating system ) or the like operating on the computer executes a part or all of the actual processes based on instructions of the program code . further , it is needless to say that the functions of the above embodiments can be realized also in a case where the program code read from the storage medium is written in a memory provided in a function expansion board inserted in the computer or a function expansion unit connected to the computer , and then on the basis of the instruction of the program code , a cpu or the like provided in the function expansion board or the function expansion unit executes a part or all of the actual processes . the present invention is not limited to the above embodiments , but can be modified variously within the scope of the appended claims . | 6 |
in the following detailed description of the preferred embodiments , reference is made to the accompanying drawings , which form a part hereof , and within which are shown by way of illustration specific embodiments by which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural changes may be made without departing from the scope of the invention . the present invention provides several embodiments of the invention in which the use of low cost and environmentally friendly materials are used to enhance the power / energy output of several galvanic cells . a first embodiment includes a controlled delivery of a solid chemical in an electrochemical cell . a second embodiment includes a microbial fuel cell with controlled dispersion and release of organic matter from a hydrogen matrix which enhances the power output of the microbial fuel cell . these embodiments can be combined together , as well as with other encapsulation and dispersing techniques known in the art . in a particular embodiment , the controlled release of the chemicals involved in the energy production of an electrochemical cell can be performed with the use of materials and matrixes that can either encapsulate and / or disperse the chemicals of interest . the proposed encapsulation schemes and / or chemical dispersion matrices schemes are amiable to large mass production , are cost effective and provide a clear benefit to several types of power sources . power source manufacturers and users of the cells described here could potentially commercialize this type of enhanced power source technology . improvements in the art provided by the proposed power sources in accordance with the present invention lie within the power / energy density output as well as in the environmental friendliness of the systems presented . a specific embodiment of the present invention involves the dissolution of a capsule in which a solid has been trapped . in is known in the art that dissolvable gelatin capsules can control the release of the material within the capsule as the capsule dissolves such that the release can be made at a rate controlled by using such capsules . in a particular embodiment , solid sodium peroxide was encapsulated using commercial capsules for a food supplement , such as a gelatin capsule . fig1 illustrates the results of an exemplary embodiment of the present invention in which a solid sodium peroxide material is encapsulated and then dissolved using a water solution to control the potential output of the electrochemical cell at a constant load . in this embodiment , the electrochemical includes an aluminum anode and a composite silver carbon cathode . a microbial fuel cell ( mfc ) or biological fuel cell is a bio - electrochemical system that drives a current by mimicking bacterial interactions found in nature . in an mfc micro - organisms catabolize compounds such as glucose or wastewater . the electrons gained from this oxidation are transferred to an anode , then through an electrical circuit to a cathode . the electrons are then transferred to a high potential electron acceptor such as oxygen . a current flows due to a difference in potential , which results in the generation of power directly from biofuel by the catalytic activity of bacteria . in an additional embodiment , a hydrogel matrix is used to host powdered matter to enhance the performance of a microbial fuel cell ( mfc ). a hydrogel is a network of polymer chains that are water - insoluble , sometimes found as a colloidal gel in which water is the dispersion medium . in an exemplary embodiment , two carbon cloths were used as the electrodes of the mfc . the anode was buried in the sediments and a planar hydrogel matrix was placed on top of the anode . the cathode was held on top of the anode and positioned about 10 centimeters away from the sediment layer . to provide the organic matter , blue runners caught from tampa bay were boiled and the meat was separated and then dried in an oven . after completely dried , the meat was ground and passed through a 250 nm sieve and then stored in a refrigerator before use . to provide the hydrogel , 80 ml of water was added into a mixture of 4 g of monomer n - isopropylacrylamide , 160 mg of n , n - methylenebisacrylamide as a crosslinking agent , 10 mg of ammonium persulphate as an initiator and 0 . 2 g of dried fish powder as the organic matter . the solution was flushed with n 2 for 5 min or until the monomer dissolved . the mixture was under ultrasonication for 5 min for the purpose of mixing . then , 50 μl of temed was added as an accelerator . the solution was flushed with n 2 for 1 min . the solution was sealed for 1 hour at room temperature for polymerization . the results of the hydrogel matrix incorporating organic matter are shown in fig2 . the hydrogels incorporated with dried fish powder and mno 2 inside and nothing are labeled as : om , mno 2 and gel , correspondingly . the systems with hydrogels were compared with a control one that did not use hydrogel . the results are the average between duplicated samples . it can be seen that the hydrogen matrix incorporating organic matter is accordance with the present invention improves the output of the microbial fuel cell . it will be seen that the advantages set forth above , and those made apparent from the foregoing description , are efficiently attained and since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall there between . now that the invention has been described . | 8 |
while this invention is susceptible of embodiment in many different forms , there is shown in the drawings , and will be described herein in detail , specific embodiments thereof with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the invention to the specific embodiments illustrated . cellular telephone users generally subscribe to a wireless service provider . the subscriber may use their mobile devices within the home wireless network served by their wireless service provider in exchange for subscription fees . however , users also may travel , and thus need to have their mobile devices operate outside of their home wireless networks as they visit other areas . fig1 shows a typical wireless infrastructure that provides cellular / pcs services like call origination and call delivery for a roaming mobile device . for call delivery , the visited network 100 tracks the location of a roaming user and the visitors location register ( vlr ) 120 reports that location information via a control network to the home location register ( hlr ) 160 of the home network 150 . control networks may include ansi41 and gsm map types of networks . an authentication center ( ac ) 170 in the home network 150 is used for user registration and authentication , e . g ., checking to see , among other things , if the user has made payments . when a call 165 relayed from the public switched telephony network ( pstn ) 180 to the home msc 149 is to be delivered to a subscriber , the home mobile switching center ( msc ) 149 consults the hlr 160 to determine the current whereabouts of the current vlr 120 , and the call is then directed via links 167 and the pstn 180 to the visited mobile switching center ( msc ) 110 currently serving the mobile device . an msc is a telephone switch specialized for wireless and mobility support . an msc performs various functions , including mobility management , call handoffs , call admission , call control , resource allocation , and so forth . the call is then relayed from the msc 110 to base stations 105 and via wireless communications 143 to the mobile device 140 . since the visited network 100 and home network 150 may be operated by different wireless operators , certain kinds of business roaming agreements are necessary for things like billing settlement . in gsm networks , a gsm memorandum of understanding ( mou ) serves that purpose . in cdma networks , an ansi - 41 roaming business agreement serves that purpose . table 1 summarizes the current cellular / pcs technologies and the network elements that are involved in call origination and call delivery . a problem occurs when a gsm user , who roams to a cdma ( or tdma ) network , may not be provided with cellular services because there lacks a gsm memorandum of understanding ( mou ) between the home gsm network and visited cdma network . a similar problem occurs when a cdma ( or tdma ) user , who roams to a gsm network , may not be provided with cellular services because there lacks a gsm memorandum of understanding ( mou ) between the home cdma ( or tdma ) network and visited gsm network . this is so even when the user &# 39 ; s mobile device is capable of multi - mode ( tdma , cdma or analog , and gsm ) operation and thus there is no technology , barrier , and the user has the ability to pay for cellular calls ( e . g ., call delivery ) with his / her valid credit card . a cdma ( or tdma ) network typically is capable of cdma and analog air interfaces . support of analog in the network ( in addition to cdma ) allows the service provider to offer service and coverage to existing /“ old ” analog cellular phones . a cdma ( or tdma ) mobile device or phone typically is capable of using both cdma and analog air interfaces . support of the analog air interface in the mobile device or phone allows the user to still have cellular service when that user roams to a cellular network that supports only analog air interface , and in the case where analog is the only interface compatible between the mobile device and the instant cellular network . a gsm network typically does not support analog air interfaces , therefore a gsm user roaming to a cdma ( or tdma ) network will require a mobile device that supports the gsm air interface and at least one of cdma ( or tdma ) and analog air interfaces . similarly , for a cdma ( or tdma ) user roaming to a gsm network , the user will require a mobile device that supports cdma ( or tdma , respectively ) air interfaces , possibly an analog air interface , plus a gsm air interface . for a tdma user roaming to a cdma network , and for a cdma user roaming to a tdma network , the mobile device must support the tdma air interface and at least one of the cdma and analog air interfaces . the present invention combines the following technical components to bypass gsm mou and pstn for call delivery : ( 1 ) use of mobile ip to track the location of mobile users ; ( 2 ) use of h . 323 - based voice - over - ip to transport packet voice over mobile ip tunnels ; ( 3 ) use of h . 323 servers in the visited network to convert packet voice to circuit voice ; ( 4 ) use of the user &# 39 ; s credit card as a payment method ; and ( 5 ) use of the diffie - hellman algorithm to encrypt the user &# 39 ; s credit card information for over - the - air transmission . the use of h . 323 servers in the visited network to convert packet voice to circuit voice leverages the existing smooth handoffs capability of circuit cellular voice and the well - engineered cdma / tdma / gsm circuit - mode air interface that provides superior efficiency of radio resource usage . the conversion also allows the roamer to receive call delivery with an existing mobile device as opposed to having to purchase a new kind of “ packet phone .” a wireline / landline voice user can today use “ voice - over - ip ”, which bypasses a pstn , for voice service . since the user &# 39 ; s location is fixed , there is no such issue as user &# 39 ; s location tracking ( e . g . for call delivery ). in contrast , for a wireless voice user who can be in a constant motion ( e . g . moving from a coverage area associated with one visited wireless network to an adjacent / neighboring coverage area associated with a different visited network ), the system must track the current location of the user . traditionally , location tracking for call delivery is through interactions between the vlr and hlr as shown in fig1 . one reasonable summation of the present invention is , in a sense , “ voice - over - mobile - ip ” for wireless voice users . per mobile ip standards as referenced in rfc 2002 , when a user moves to a different area , the user &# 39 ; s mobile device ( capable of mobile ip ) will send , via a foreign agent ( fa ), mobile ip registration / re - registration messages to the user &# 39 ; s home agent ( ha ), so the ha will know the whereabouts of the user ( i . e . the fa that is currently serving the user ). thus the ha must track the ip address of the fa currently serving the roaming user . many of the same reference numbers are used in fig2 through 8 to identify common features . it is to be understood that where the same number is used , it refers to the same feature in each of the drawings . fig2 shows the first step of call delivery , in one embodiment of the present invention , wherein prior to roaming , the mobile device 240 sets up call forwarding from the home wireless network 250 to a voice and data service provider &# 39 ; s network 252 . the voice and data service provider can be an internet service provider ( isp ). the voice and data service provider &# 39 ; s network 252 comprises at least a home h . 323 server 251 that provides a telephone number 242 to the user &# 39 ; s mobile device 240 for call forwarding . the home h . 323 server 251 also acts as mobile ip home agent ( ha ) and provisions a mobile ip shared secret 243 and the ip address 244 of the ha into the user &# 39 ; s mobile device 240 . note that the provisioning of the mobile ip shared secret 243 cannot be done via wireless communication 256 with base stations 255 , because the mobile ip shared secret will be revealed during such a transmission and will no longer be a secret . mobile ip shared secret provisioning can be done through other means . in a preferred embodiment , when the user subscribes to the voice and data service provider , the user will be informed of the ip address 244 of the ha in the voice and data service provider &# 39 ; s network and the mobile ip shared secret 243 assigned to him . this information may be accompanied with instructions how to enter this information into the user &# 39 ; s mobile device as part of the subscription setup . home agent ( ha ) and foreign agent ( fa ) are mobile ip concepts and network elements introduced in rfc 2002 . their functionality and operation are described in detail in rfc 2002 and not detailed further herein . fig3 shows the second step of call delivery in one embodiment of the present invention , wherein the user &# 39 ; s mobile device 240 is roaming in a visited wireless network 200 . as the user powers on the mobile device 240 , the mobile device registers with the visited wireless network 200 , which may be any type of wireless network including cellular or pcs . this registration permits the visited wireless network 200 to track the mobile &# 39 ; s location and perform call delivery , but does not imply conventional vlr 220 / hlr 260 interaction . in the present invention , the roamer &# 39 ; s hlr 260 and the roamer &# 39 ; s ac 270 in the home wireless network 250 are not contacted for call delivery . the registration conveys the mobile device &# 39 ; s international mobile subscriber identifier ( imsi ), the forwarding phone number 242 assigned by the voice and data service provider , and the ip address 244 of the ha , and signature signed by the mobile ip shared secret 243 to the visited msc 210 via the base stations 205 . with the roamer &# 39 ; s imsi , forwarding number 242 , and ha , ip address 244 , the visited msc 210 identifies the mobile device 240 as a special device supporting the present invention . this special identification aborts the conventional vlr / hlr interaction . the visited msc and the mobile device interact with each other to establish a temporary shared secret 245 using the diffie - hellman algorithm . this mechanism is also used in cellular digital packet data ( cdpd ) networks typically used for low speed packet data services . the user &# 39 ; s credit card information is transmitted from the mobile device 240 to the visited wireless network 200 via wireless communication with base stations 205 using the established temporary shared secret 245 . the shared secret 245 permits the sensitive information of the user &# 39 ; s credit card information to be relayed to the visited wireless network 200 securely . the credit card information can be entered by the user on the mobile device keypad , or via a swipe of the card through a card reader slot on the mobile device , or via some other means . in one embodiment , the credit card information is optionally stored within the mobile device . in another embodiment , the credit card information must be entered by the user for each use . in another embodiment , the user selects a credit card number from a list to be used for the outgoing call . the credit card number may belong to the user , the user &# 39 ; s employer , or another third party . the credit card number thus relayed securely is then verified by the visited network &# 39 ; s billing server to ensure it is valid , using methods familiar to anyone exposed to credit card payments and transactions . after credit card verification , the visited msc 210 contacts the visited h . 323 server 211 . the visited h . 323 server 211 also acts as a mobile ip foreign agent ( fa ) which contacts the home h . 323 server 251 , via the ha ip address 244 , to request an ip address to be assigned to the mobile device by home h . 323 server 251 in the voice and data service provider &# 39 ; s network 252 . the request contains a signature so that the ha in the home h . 323 server 251 is able to authenticate the request by making sure that the requestor is indeed one of the subscribers of the voice and data service provider &# 39 ; s network 252 . signature authentication is required because otherwise it would be possible for a third party ( attacker ) to fraudulently impersonate the user &# 39 ; s mobile device 240 and attempt to request ip addresses again and again , potentially depleting the ip address pool managed by the home h . 323 server 251 in the voice and data service provider &# 39 ; s network 252 . in response to the request containing a signature , a dynamic ip address 247 is allocated by the home h . 323 server 251 which also provides dhcp service . dhcp is covered by rfc 2131 . as of the date of this disclosure , rfc 2131 may be obtained from url http :// nic . mil / ftp / rfc / rfc2131 . txt . the major use of dhcp is to support dynamic ip address assignment for example , an isp ( internet service provider ) can use dhcp to dynamically assign an ip address to a subscriber after he / she logs in over a dial - up connection ; once the session is over , the ip address is recycled for other dial - in users . the dynamic ip address 247 from the home h . 323 server 251 is relayed back to the fa of the visited h . 323 server 211 . the fa relays the dynamic ip address to the user &# 39 ; s mobile device 240 during the ip configuration protocol ( ipcp ) phase of point - to - point protocol ( ppp ) initialization . the mobile device initiates a mobile ip registration request with the ha in the home h . 323 server 251 via the fa in the visited h . 323 server 211 . the ha authenticates the request using the mobile ip shared secret 243 provisioned by the ha in the first step of the present invention , prior to the user roaming . per the md5 algorithm of mobile ip , the mobile ip registration request from the mobile device is signed using the provisioned mobile ip shared secret 243 , which permits verification of both message content and sender by the ha . a detailed technical discussion of the md5 algorithm may be located in rfc 2002 which pertains to support of mobile ip . successful verification and receipt of an acknowledgement response by the mobile device from the ha completes the establishment of a mobile ip tunnel 285 . upon successful setup of the mobile ip tunnel 285 , the home h . 323 server 251 in the voice and data service provider &# 39 ; s network 252 updates the ha mobility binding table 276 associated with mobile ip and updates its phone - number - to - ip - address table 275 that maps the user &# 39 ; s forwarding phone number 242 provided by the home h . 323 server 251 to the dynamic ip address 247 now assigned to the user &# 39 ; s mobile device 240 . the visited h . 323 server 211 in the visited wireless network 200 similarly updates its ip - address - to - phone - number table 215 that maps the dynamic ip address 247 of the mobile to the forwarding phone number 242 provided by the home h . 323 server 251 . when establishment of a mobile ip tunnel 285 is complete , the ha mobility binding table 276 is updated , and both h . 323 servers &# 39 ; tables 215 , 275 are updated , the setup for the gsm mou and the pstn bypass of the present invention is complete . the mobile ip tunnel 285 is one example of bypassing the usual interaction between the vlr and the hlr / ac , as well as bypassing the pstn , both as used in the present invention . in a preferred embodiment , the mobile ip tunnel is established within a public ip network such as the internet . in alternate embodiments , the mobile ip tunnel may be established within a private ip network , or a combination of both private networks and the public internet . in another embodiment , the mobile ip tunnel may be layered on top of a different network infrastructure , in a manner consistent with current network practice . an ip tunnel is a specific case of a general network tunnel , which typically has two ends , and encapsulates packets of a first protocol for transmission from the first end to the second end of the tunnel using a potentially different second protocol for actual routing and delivery . setting up a network tunnel generally involves a server or agent setting up each end prior to use . ip tunneling allows internet standard - based routers to route ip packets from one end of a tunnel to the other end of the tunnel , regardless of the topology of the underlying ip network . a detailed technical discussion of ip tunneling may be located in rfc 2002 which pertains to support of mobile ip . fig4 shows the last step of call delivery in one embodiment of the present invention . an incoming call 257 to the user is forwarded by the home wireless network 250 to the forwarding phone number 242 associated with the home h . 323 server 251 . the home h . 323 server 251 looks up the phone number 242 in its phone - number - to - ip - address table 275 and finds the dynamic ip address 247 that has been assigned to the user &# 39 ; s mobile device 240 . the home h . 323 server 251 converts 283 the circuit call 257 to a packet call ( i . e ., voice - over - ip ) and forwards the packets to the ha . the ha forwards the packets over the mobile ip tunnel 285 established in the second step to the fa in the visited h . 323 server 211 . the visited h . 323 server 211 in the visited wireless network 200 looks up the dynamic ip address 247 in its ip - address - to - phone - number table 215 and finds the forwarding phone number 242 that has been assigned to the user &# 39 ; s mobile device 240 for roaming . the fa in the visited h . 323 server 211 converts 287 the packets received via the mobile ip tunnel 285 to a circuit call 286 and relays the circuit call to the visited msc 210 . the visited msc 210 forwards the circuit call 286 on to the wireless base stations 205 for over - the - air transmission to the user &# 39 ; s mobile device 240 . in a preferred embodiment , both the conversions 283 , 287 by h . 323 servers 251 , 211 are performed in each of the respective home and visited wireless provider &# 39 ; s networks 250 , 200 , thus supporting speaking and listening by both the calling and called party . specifically , the home h . 323 server 251 performs conversion 283 for circuit voice originating from a call 257 to be conveyed via the mobile ip tunnel 285 , and performs conversion 287 for voice packet data conveyed via mobile ip tunnel 285 from the user to be delivered as circuit voice to caller 257 . similarly , the visited h . 323 server 211 performs conversion 283 for circuit voice originating from the wireless connection with the base stations 205 to be conveyed via the mobile ip tunnel 285 , and performs conversion 287 for voice packet data conveyed via mobile ip tunnel 285 from the call 257 to be delivered via wireless communication from base stations 205 to the user &# 39 ; s mobile device 240 . in this embodiment , packet data is conveyed via the mobile ip tunnel 285 , and is converted appropriately to circuit calls by the h . 323 servers 251 , 211 at each end appropriately for interface to wireless ( or in the case of the home wireless network 250 , wireline ) communications . when the call is terminated , billing information is collected in the visited network &# 39 ; s billing server 290 . the billing information may include but is not limited to at least one of the duration of the call , which credit card number was used , identification of the ip tunnel , time and date , and other kinds of billing data . at the end of a billing period , or when the accumulated bill amount exceeds some predetermined amount , or when additional services or processing fees may be imposed , or at some other preferential time , the visited network &# 39 ; s billing server 290 interacts with the credit card &# 39 ; s billing server 295 for billing settlement , using the traditional and well - understood practices for accounting for services rendered . in the present invention , the roamer &# 39 ; s hlr 260 and the roamer &# 39 ; s ac 270 are not contacted for call delivery by the vlr 220 . fig5 illustrates a data structure supporting the ip - address - to - phone - number table 215 of the present invention in the visited wireless network . the table 215 consists of associated pairs of entries , wherein each line in the table contains one ip address and one phone number . a selected ip address 510 is used to index within the list of ip addresses 520 in the table , thus selecting a particular record or line 530 . the corresponding phone number 540 in the line 530 is the data retrieved from the table 215 . the ip address 510 is said to “ map to ” the forwarding phone number 540 , uniquely from the list of phone numbers 550 in the table 215 . fig6 illustrates data structures in the user &# 39 ; s mobile device 240 required for the present invention . one of the data structures is the international mobile subscriber identifier ( imsi ) 610 that uniquely identifies the user &# 39 ; s mobile device . provisioned into the mobile device by the voice and data service provider are the forwarding phone number 242 , the mobile ip shared secret 243 , and the ip address 244 of the ha in the home h . 323 server . in the second step of the present invention , the temporary shared secret 245 is established within the mobile device 240 to permit the sensitive information of the user &# 39 ; s credit card information to be relayed to the visited network securely . credit card information 620 may be stored within the user &# 39 ; s mobile device , or it may be entered by the user as required . the leased dynamic ip address 247 is used to establish the second end of the mobile ip tunnel 285 as shown in fig8 . fig7 illustrates a data structure supporting the phone - number - to - ip - address table 275 as shown in fig3 and 4 of the present invention in the home wireless network . the table 275 consists of associated pairs of entries , wherein each line in the table contains one phone number and one ip address . a selected phone number 710 is used to index ( within the list of phone numbers 720 ) in the table , thus selecting a particular record or line 730 . the corresponding ip address 740 in the line 730 is the data retrieved from the table 275 . the forwarding phone number 710 is said to “ map to ” the ip address 740 , uniquely from the list of ip addresses 750 in the table 275 . fig8 illustrates the bypass function of the mobile ip tunnel of the present invention . the home msc 253 in the home wireless network 250 relays the inbound call 257 to the home h . 323 server 251 , which converts ( 283 , 287 ) the call to packets that are conveyed via the ip tunnel 285 . the packet data is converted ( 283 , 287 ) back to circuit voice by the visited h . 323 server 211 and conveyed to the visited msc 210 for over the air transmission from the base stations 205 to the mobile device 240 . the normal interaction of the vlr and the hlr / ac is not used , effectively bypassing the network traditionally used for such interaction . the public switched telephony network ( pstn ) as traditionally used to convey calls between wireless service providers ( e . g ., home wireless network 250 and visited wireless network 200 of fig4 ) is not used in the present invention , and is thus also effectively bypassed . as a result , this invention provides for call delivery to gsm subscribers who roam from their home gsm networks to cdma networks , and call delivery to cdma subscribers who roam from their home cdma networks to gsm networks , by using ip tunnels to convey the calls to be delivered . the present invention includes a method to bypass global systems for mobile communications ( gsm ) memorandum of understanding ( mou ) to provide basic cellular call delivery service . the basic cellular call delivery service uses an internet protocol ( ip ) tunnel . the ip tunnel includes a first end and a second end . a user having a mobile device subscribes to a home wireless service provider , and that provider serves a home wireless network in which the user can place and receive cellular calls . when that user travels outside of their home wireless network , they are said to be roaming . when roaming , a user may be in an area served by a visited wireless service provider . the visited provider serves a visited wireless network distinct and separate from the home wireless network . in the situation where there does not exist a pre - arranged gsm mou between the home wireless service provider and the visited wireless service provider the user can still obtain basic call delivery service if the user has a payment means to pay for the basic visited wireless network call delivery service . a step in the preferred embodiment of the present method of the invention has the user registering with a voice and data service provider . this registration establishes the first end of the ip tunnel . this registration uses a home h . 323 server in the voice and data service provider &# 39 ; s network . the home h . 323 server in the voice and data service provider &# 39 ; s network is enhanced to further have the ability to provide home agent ( ha ) service . another step in the preferred embodiment of the present method of the invention identifies the user &# 39 ; s payment means to the visited wireless service provider . the typical payment means is a credit card , and the credit card information must be securely transmitted from the user to the visited wireless service provider . to securely transmit this information , the mobile device and the visited wireless network establish a diffie - hellman temporary shared secret . with the secret in place , the user &# 39 ; s credit card information can be transmitted securely to the visited wireless service provider , and upon receipt the visited wireless service provider can verify the validity of the user &# 39 ; s credit card information . another step in the preferred embodiment of the present method of the invention is to register with an h . 323 server in the visited wireless network . the h . 323 server in the visited wireless network further has the ability to provide foreign agent ( fa ) service . this registration permits the second end of the ip tunnel to be established to the user &# 39 ; s mobile device . another step of the preferred embodiment of the present method of the invention is to deliver calls to the user &# 39 ; s mobile device , with the calls being conveyed as data via the ip tunnel . as services are rendered to the user , billing information is compiled and collected by the visited wireless service provider . the visited wireless service provider then bills the user based on the billing information collected and the user &# 39 ; s credit card information . the credit card information for the user can be stored within the mobile device by someone other than the user . alternatively , it can be entered by the user directly . in a preferred embodiment , the credit card information is keyed into the mobile device . in another embodiment , the credit card information can be scanned or swiped into the mobile device using a card reader or similar apparatus . the method of the present invention to establish the first end of the ip tunnel includes setting up call forwarding from the home wireless network to the voice and data service provider &# 39 ; s network . this may involve obtaining a telephone number for forwarding , and / or obtaining an ip address corresponding to the home agent ( ha ). additionally , a mobile ip shared secret is set up with the voice and data service provider . the method of the present invention to register with the visited wireless network to establish the second end of the ip tunnel further includes obtaining a dynamic ip address from the home h . 323 server using dhcp . this dynamic ip address is then relayed to the visited h . 323 server and then from the visited h . 323 server via the visited wireless network to the user &# 39 ; s mobile device . the user &# 39 ; s mobile device can authenticate the mobile ip connection by using the mobile ip shared secret and the response from the ha of the home h . 323 server . when complete and authenticated , the ip tunnel is established by the user &# 39 ; s mobile device and then several tables are updated . these tables to be updated include a phone - number - to - ip - address table in the home h . 323 server , a mobility binding table in the ha , and an ip - address - to - phone - number table in the visited h . 323 server . the method of the present invention to deliver calls to the user &# 39 ; s mobile device via the ip tunnel further includes converting a circuit call to packets by the home h . 323 server . these packets are forwarded over the ip tunnel , reassembled at the far end by the visited h . 323 server , and then converted back into a circuit call for transmission to the user &# 39 ; s mobile device . the transmission occurs in the visited wireless network . in a similar fashion to support bidirectional communication typical of a telephone conversation , the visited wireless network receives transmissions from the user &# 39 ; s mobile device as a circuit call . this call is then converted to packets by the visited h . 323 server . these packets are forwarded over the ip tunnel , reassembled at the far end by the home h . 323 server , and then converted back into a circuit call for eventual connection to the entity that originally placed the call in the first place . the method of the present invention to provide basic cellular call delivery service for a user having a mobile device and subscribing to a home wireless service provider serving a home wireless network is used when the user roams to visit an area served by a visited wireless service provider serving a visited wireless network distinct and separate from the home wireless network . if the user has a payment means to pay for the basic cellular call delivery service , the method includes establishing an internet protocol ( ip ) tunnel , having a first end and a second end . this tunnel is used for conveying ip packets in both directions between the first end and the second end . calls are delivered to the user &# 39 ; s mobile device via the ip tunnel . billing information is collected from the visited wireless network by the visited wireless service provider . the user is billed by the visited wireless service provider responsive to the billing information collected and the user &# 39 ; s identified payment means . accordingly , the user &# 39 ; s payment means is identified to the visited wireless service provider . setup of the ip tunnel is started by registering with the voice and data service provider to establish the first end of the ip tunnel at the ha within the voice and data service provider . then the user registers with the visited wireless service provider to establish the second end of the ip tunnel at the fa . the user &# 39 ; s payment means may include credit card information . the step of identifying the user &# 39 ; s payment means to the visited wireless service provider may include establishing a diffie - hellman temporary shared secret between the user &# 39 ; s mobile device and the visited wireless network . the diffie - hellman temporary shared secret permits securely transmitting the user &# 39 ; s credit card information to the visited wireless service provider via the visited wireless network . the visited wireless service provider can then verify the validity of the user &# 39 ; s credit card information . registering with the user &# 39 ; s home wireless service provider to establish the first end of the ip tunnel within the voice and data service provider &# 39 ; s network may include setting up call forwarding from the home wireless network to the voice and data service provider &# 39 ; s network . it may also include obtaining a mobile ip shared secret from the voice and data service provider . call forwarding setup may or may not be performed in or within the home wireless network . setting up call forwarding may include obtaining a telephone number for call forwarding from the voice and data service provider . it may also include providing a home h . 323 server by the voice and data service provider , and providing a home agent ( ha ) function within the home h . 323 server . generally , the user must obtain the ip address of the ha in the home h . 323 server in the voice and data service provider &# 39 ; s network . this address may be stored within the user &# 39 ; s mobile device . the step of registering with the visited wireless service provider to establish the second end of the ip tunnel may include providing a visited h . 323 server in the visited wireless network . this visited h . 323 server generally provides a foreign agent ( fa ) function . dynamic host configuration protocol ( dhcp ) in the voice and data service provider &# 39 ; s network is used to obtain a dynamic ip address . the dynamic ip address is relayed from the ha via the visited wireless network to the user &# 39 ; s mobile device . the user &# 39 ; s mobile device authenticates the connection using the mobile ip shared secret . then the ip tunnel is established by the user &# 39 ; s mobile device , and a number of tables are updated , including a phone - number - to - ip - address table in the home h . 323 server , a mobility binding table in the ha , and an ip - address - to - phone - number table in the visited h . 323 server as previously disclosed . the system of the present invention provides basic cellular call delivery service via an internet protocol ( ip ) tunnel . the ip tunnel has a first end and a second end . a user having a mobile device and subscribing to a home wireless service provider serving a home wireless network can travel outside of the home wireless network . when the user is travelling within the boundaries of a visited wireless network , the user is said to be roaming . if there does not exist a pre - arranged global systems for mobile communications ( gsm ) memorandum of understanding ( mou ) between the home wireless service provider and a visited wireless service provider , the user can obtain basic call delivery service if that user has a means to pay for that service . the system of the present invention may include a payment identification means for identifying the user &# 39 ; s payment means to the visited wireless service provider . it also may include delivery service means for providing basic cellular call delivery service via the ip tunnel , responsive to the payment identification means . the delivery service means further may include a first end means to establish the first end of the ip tunnel within the home wireless network . the delivery service means further may include a second end means to establish the second end of the ip tunnel in the visited wireless network . the delivery service means further may include a circuit conversion means to convert circuit calls to the mobile device to packets for conveyance via the ip tunnel . the delivery service means further may include a packet conversion means to convert the packets conveyed by the ip tunnel to a circuit call . the ip tunnel is established between a foreign agent and a home agent , and is generally transparent to the mobile device . the system of the present invention may include a home h . 323 server in the voice and data service provider &# 39 ; s network , and a visited h . 323 server in the visited wireless network . the home h . 323 server may include a phone - number - to - ip - address table and a mobility binding table . the visited h . 323 server may include an ip - address - to - phone - number table . the system may include means to update the above disclosed tables , and any others that may be necessary . the system of the present invention may include forwarding means for setting up call forwarding from the home wireless network to a voice and data service provider &# 39 ; s network . the forwarding means is typically responsive to the user &# 39 ; s mobile device . the system may also include mobile shared secret means for obtaining a mobile ip shared secret from the voice and data service provider &# 39 ; s network . the mobile shared secret means is also typically responsive to the user &# 39 ; s mobile device . typically , a telephone number for call forwarding is provided by the voice and data service provider responsive to the user &# 39 ; s mobile device . also , the ip address of the ha in the home h . 323 server in the voice and data service provider &# 39 ; s network is provided to the user &# 39 ; s mobile device . the system of the present invention may include dhcp means for obtaining a dynamic ip address from the home h . 323 server . typically , the dynamic ip address is relayed from the home h . 323 server via the visited wireless network to the user &# 39 ; s mobile device . the user &# 39 ; s mobile device may then authenticate the connection by using the mobile shared secret means . authenticating the connection permits an ip tunnel to be established . the system also monitors , collects , and compiles billing information in the visited wireless network for services rendered . this information can be used to bill the user &# 39 ; s credit cards . the system of the present invention can use credit card information entered into the user &# 39 ; s mobile device . this information may be entered by other than the user . alternatively , it can be keyed into the mobile device by the user for each use , or stored for a user selectable time period . another way to enter the information is for the user to scan or swipe a credit card in an appropriate reader apparatus in the mobile device . the user &# 39 ; s payment information can be relayed securely to the visited wireless service provider through the use of a diffie - hellman temporary shared secret . from the foregoing , it will be observed that numerous variations and modifications may be effected without departing from the spirit and scope of the invention . it is to be understood that no limitation with respect to the specific apparatus illustrated herein is intended or should be inferred . it is , of course , intended to cover by the appended claims all such modifications as fall within the scope of the claims . | 7 |
several cell lines were or can be used in these studies ; each cell line has characteristics which make it an appropriate model for testing the biological effects of mutant l3t4 receptors for hiv - 1 . all the cell lines described herein can be obtained from the american type culture collection ( atcc ) of rockville , md . cos - 1 cells are a monkey kidney cell line which is transformed by origin defective sv40 . el - 4 cells are a murine t lymphoma cell line which constitutively expresses wild type l3t4 and have the distinct advantage that they can be activated with lectins and phorbol esters . 3 . nih3t3 ( atcc crl 1658 ) p nih3t3 cells are a murine fibroblast cell line . hela cells are a human fibroblast - like cell line which can be used in the cell conjugation assay to measure class ii mhc binding to l3t4 and l3t4 mutants . jurkat cells are a human leukemia t cell line . like el - 4 cells , they are subject to activation with lectins and phorbol esters to express il - 2 . jurkat cells can be used as a positive control in our hiv - 1 infection studies , since human cells expressing cd4 are susceptible to hiv - 1 infection . ctll - 2 cells are a non - transformed murine cytotoxic t lymphocyte line which does not express l3t4 and is il - 2 - dependent for cell growth . ctll - 2 cells can be induced into quiescence by culturing in il - 2 - free media for 14 hours . hiv - 1 infection studies can be conducted with ctll - 2 cells transfected with l3t4 , cd4 , l3t4 mutants during the period of quiescence and after stimulation with il - 2 . these studies complement the el - 4 studies to determine if cell activation is required in murine cells for viral entry and replication . bcl - 1 cells are a murine b cell line which expresses class ii molecules on the cell surface and thus can be used in a cell conjugation assay to determine the ability of l3t4 mutants to bind with class ii mhc . raji cells are a human ebv - infected b cell line and can be used as a control in the above - mentioned cell conjugation assay , since murine l3t4 does not bind to human class ii mhc proteins . h - 9 / htlv - iiib cells are a human t cell line infected with hiv - 1 which is used as a laboratory source of the virus . eight l3t4 mutants were constructed which mimic human cd4 in the cd4 gp120 binding region . the selection of mutations engineered into l3t4 was based on the identification of amino acids in cd4 which are required for binding to gp120 . the mutants which we constructed range from a minimum of 4 amino acid substitutions and 1 deletion to 14 amino acid substitutions and 3 deletions . the l3t4 mutants were constructed as follows . l3t4 was first prepared following the procedures set forth in littman , et al ., nature 325 : 453 - 455 ( 1987 ). l3t4 cdna with flanking xba i restriction sites was cloned into m13mp18 ( amersham corp ., arlington heights , ill .) at the xba i site of the m13 bacteriophage . correct orientation was determined by restriction enzyme analysis . single - stranded dna was isolated from phage supernatants . site - directed mutagenesis of l3t4 was performed using a commercial kit ( amersham corp ., arlington heights , ill .). the remaining steps in the construction of mutants are as described in the kit instructions . five oligonucleotides , designated as oligo 1 through oligo 5 , respectively , were used to perform site - directed mutagenesis of l3t4 . the sequences of the oligonucleotides and how they correspond to their counterparts in wild type l3t4 ( i . e ., numbers in parentheses ) are shown in table i . table i__________________________________________________________________________oligo 1 ( 247 - 294 ). sup .†: 5 &# 39 ; ggaatcaaaacgatc --- gttcaacttcgaaggtcctctaattaatac * ( seq id no : 4 ) oligo 2 ( 469 - 510 ): 5 &# 39 ; tgtcaaggggttaga --- cccaggggggctatccaaggtcag ( seq id no : 5 ) oligo 3 ( 577 - 612 ): 5 &# 39 ; ggtcacggtgcaggtccaggtgccgctgtcctgaac ( seq id no : 6 ) oligo 4 ( 220 - 267 ): 5 &# 39 ; cgaaggtcctctaattaagaaaga --- gccttggttccccagaatctt ( seq id no : 7 ) oligo 5 ( 271 - 300 ): 5 &# 39 ; ttttttggaatcagcacgatc --- gttcaa ( seq id no : 8 ) __________________________________________________________________________ . sup .† all five oligonucleotides listed here are antisense primers used to construct the l3t4 mutations . the numbering for the dna sequence is according to that of fig1 and 2 of this application . * where the mutants have a codon deletion ( as indicated by dashes ) the numbering scheme is maintained to simplify comparison to the wild type l3t4 sequence . shown in table ii are the scheme used in preparing the eight l3t4 mutants , which are designated as m1 through m8 , respectively , and changes of amino acid residues in each l3t4 mutant . table ii______________________________________mutant oligo used amino acids changed in l3t4______________________________________m1 1 49 : gly to pro ; 51 : pro to lys ; 52 : ser to leu ; 53 : gln to asn ; 54 : delete phem2 1 + 2 all changes in m1 ; 123 : asn to pro ; 124 : ser to pro ; 125 : lys to gly ; 126 : delete valm3 1 + 3 all changes in m1 ; 158 : asp to gly ; 159 : phe to thr ; 161 : asn to thrm4 1 + 2 + 3 all changes in m1 , m2 , m3m5 1 + 4 all changes in m1 ; 39 : gln to asn ; 40 : his to gln ; 42 : delete lys ; 43 : gly to ser ; 44 : val to phem6 1 + 2 + 3 + 4 all changes in m1 to m5m7 1 + 4 + 5 all changes in m5 ; 57 : phe to alam8 1 through 5 all changes in m6 ; 57 : phe to ala______________________________________ fig1 and 2 show the nucleotide sequences of two l3t4 mutants , m1 and m8 , respectively ; also included are the amino acid sequences of the encoded proteins . among the eight l3t4 mutants prepared , m1 contains minimal changes of amino acid residues from the wild type l3t4 and m8 , on the other hand , contains maximal changes . underlined amino acid residues denote differences between wild type and mutant l3t4 proteins ( i . e ., m1 or m8 ). subcloning , plasmid and phage purifications , ligations , etc . were performed according to standard molecular biological procedures . maniatis , et al ., molecular cloning , cold spring harbor laboratory , cold spring , n . y ., 1982 . mutations were screened by dna sequencing using the dideoxy chain termination method . the cdnas were cloned into the xba i site of prc / cmv ( invitrogen , inc , san diego , calif .) for expression studies of l3t4 , cd4 , and the l3t4 mutants in stably transfected hela cells and nih3t3 cells . the cdnas were also cloned into the xba i site of pcdm8 ( invitrogen , inc ., san diego , calif .) for transient expression studies in cos - 1 cells . expression of the cloned dnas in both vectors is driven by the cytomegalovirus promoter ; prc / cmv also contains a neomycin resistance gene for g418 selection of stably transfected cells . the clones were screened for the correct orientation by restriction enzyme analysis . plasmids were linearized by cutting with sca 1 prior to electroporation for stable transfection into hela and nih3t3 cells . more details regarding transfection are described below . murine el - 4 cells were transfected with l3t4 , cd4 , and l3t4 mutants m1 , m5 , and m6 in a manner identical to that in which hela cells were transfected ( see below ). bulk g418 - resistant transfected el - 4 cells were tested for their ability to bind gp120 . two assays , radioligand binding assay and fluorescence activated cell sorter (&# 34 ; facs &# 34 ;) analysis , were used to measure gp120 binding to el - 4 cells . in the radioligand binding assay , 125 i - gp120 was used to react with 3 × 10 6 transfected el - 4 cells for 2 hours at 4 ° c . the transfected el - 4 cells were then centrifuged through a silicon / paraffin oil layer and counted in a gamma counter . as the number of mutations in l3t4 increases and l3t4 becomes more cd4 - like in the gp120 binding region , the affinity of el - 4 transformants for 125 i - gp120 improved ( table iii , middle column ). table iii______________________________________el - 4 . sup . 125 i - gp120 bound gp120 . sup .+ cells by facstransfectant ( cpm ) (%) ______________________________________el - 4 control 100 5 ( 10 % l3t4 . sup .+) l3t4 93 -- m1 4992 6m5 6818 25m6 12 , 631 14cd4 28 , 258 7 ( 9 % cd4 . sup .+ cells ) ______________________________________ gp120 binding to el - 4 transfectants was also measured by the facs analysis . more specifically , the el - 4 transfectants were reacted with 80 nm gp120 ( genentech , inc ., san francisco , calif . ; or prepared following procedures described in lasky et al ., cell 50 : 975 [ 1987 ]) in sterile phosphate buffered saline (&# 34 ; pbs &# 34 ;) for 2 hours at 23 ° c . the cells were then washed twice with cold pbs followed by reaction with mouse anti - g10120 ( new england nuclear , boston , mass .) for 30 minutes at 4 ° c ., two washes with cold pbs , and staining with fitc - labelled goat anti - mouse igg for 30 minutes followed by two washes with pbs . the data ( table iii , right - hand column ) indicate that gp120 bound to el - 4 cells transfected with l3t4 mutants m5 and m6 . gp120 on transfected el - 4 cells was detected by anti - gp120 and fitc - labelled goat anti - mouse igg . however , the low level of cells bound to cd4 - transfected cells is reflected by the low level of cell surface expressed cd4 . all el - 4 transfected cells studies in these preliminary studies were from bulk g418 - resistant cultures . thus , subcloning of transfectants prior to hiv - 1 infection studies was required in order to isolate clones expressing high levels of the transfected gene . cd4 , l3t4 , and l3t4 mutants m1 , m5 , and m6 were stably transfected into hela cells and transiently transfected into cos - 1 cells as follows . hela cells were stably transfected with l3t4 , cd4 , and mutant l3t4 - containing plasmids by electroporating 2 × 10 6 trypsinized cells in 0 . 5 ml of cold phosphate - buffered saline containing 20 ug of the sca 1 digested linearized plasmid at 200 v and 500 ufd . after the transfection , the cells were placed in the culture media . two days later the transfected cells were selected by addition of 600 ug / ml geneticin ( g418 ). dead cells were removed after 3 days and the remaining live cells were cultured for another 1 - 2 weeks . subclones were cultured and screened for cell surface expression of the transfected gene . these cells were grown in media containing a maintenance dose of g418 ( 100 ug / ml ). cos - 1 cells were transiently transfected by the deae method of seed et al ., proc . natl . acad . sci . usa 84 : 3365 [ 1987 ]). briefly , cos - 1 cells were plated on 100 mm tissue culture plates at 40 - 60 % confluence 24 hours prior to the transfection . the cells were then washed and placed in 3 ml rpmi containing 10 % nuserum ( collaborative research , inc ., bedford , mass .) followed by addition of 0 . 33 ml of a 4 mg / ml solution of deae dextran , 3 . 5 ul of 100 mm chloroquine , and 15 ug of plasmid . the cells were incubated for 3 hours followed by removal of the media and incubation with 3 ml of pbs containing 10 % dmso for 1 minute . the cells were washed twice with pbs and incubated in culture media for 2 days prior to hiv - 1 infection studies . the presence of cell surface expressed l3t4 , l3t4 mutants , and cd4 was verified by facs analysis using anti - cd4 and anti - l3t4 ( bectin - dickinson , mountain view , calif .). more specifically , transfected g418 - resistant cells were removed from the petri dishes by incubation with cold pbs containing edta and gentle scrapping with a sterile plastic policeman . the cells were then reacted with anti - cd4 on anti - l3t4 ( gk1 . 5 ) at 4 ° c . for 30 minutes . the cd4 , l3t4 , and mutant l3t4 transfected cells were washed twice with pbs , and reacted with fitc - labelled goat anti - mouse igg or goat anti - rat igg , respectively , and sorted on a cell sorter for analysis of cell surface expression of cd4 and l3t4 . the mutations in the second domain of l3t4 at amino acids 123 , 124 , 125 , and 126 , and 158 , 159 and 161 partially abrogated the anti - l3t4 binding epitope of the gk1 . 5 monoclonal antibody . facs analysis of transfected hela cells reacted with gp120 , anti - gp120 , and recognition by fitc labelled goat anti - mouse igg show that l3t4 did not bind gp120 ( fig3 a ), while cell surface expressed cd4 bound g10120 ( fig3 e ). l3t4 mutants m1 , m5 , and m6 bound gp120 increasingly better as more mutations were engineered into l3t4 ( fig3 b - 3d ). both cos - 1 cells and hela cells transfected with mutants m1 , m5 and m6 exhibited similar gp120 binding patterns . cd4 + cells clearly bound more gp120 as evidenced by the increased florescence level over m6 transfected cells . the number of hela cells expressing cd4 , however , was low . these results show that l3t4 can bind gp120 by reconstruction of a cd4 - like gp120 domain . furthermore , gp120 binding to a l3t4 mutant could be detected , albeit at a very low level , by incorporating into l3t4 as few as 4 amino acid substitutions and 1 deletion at l3t4 codons 49 , 51 , 52 , 53 , and 54 , respectively ( i . e ., m1 ). the change of glycine 49 in l3t4 to a proline residue may induce a large structural change which plays a major role in gp120 binding in cd4 . prolines cause abrupt structural changes in the protein backbone . by increasing the number of mutations in l3t4 to cd4 residues , more gp120 binding was observed . this supports the view that the nature of cd4 residues crucial for gp120 binding is additive . transfected and subcloned cells are used to determine the gp120 dissociation constant ( kd ) for the l3t4 mutants by scatchard analysis . measurement of the affinity of the mutant l3t4 receptors for gp120 provides important information about the potential for these mutants to facilitate hiv - 1 infection . these data also provide information about the quantitative importance of each set of mutations engineered into l3t4 . the gp120 binding data are thus one of the criteria for selecting an l3t4 mutant for development of a transgenic mouse . cell sorted and subcloned transfectants are used in whole cell saturation binding analysis to calculate the affinity of gp120 for cell surface - expressed l3t4 , cd4 , and l3t4 mutants . gp120 is radioiodinated by the lactoperoxidase / glucose oxidase method using a commercially available kit ( bio rad laboratories , richmond , ca ). binding studies of 125 i - gp120 to stably transfected ctll - 2 cells are performed in rpmi - 1640 median containing 1 % bsa at 5 × 10 6 cells / 0 . 1 ml for 2 hours at 22 ° c . the cold gp120 concentration in the binding reaction range from 0 . 5 um to 1 nm with the 125 i - gp120 added at 5 × 10 5 cpm per sample . the cells are then pelleted by centrifugation through a silicone / paraffin oil layer to separate the cells with bound 125 i - gp120 from the free ligand . 125 i - gp120 bound to the cells is measured in a gamma counter to determine the affinity of mutant l3t4 receptors for gp120 . results from infection studies with transfected cells expressing various l3t4 mutants form the basis for selecting a mutant l3t4 gene for developing a transgenic mouse model . the cell activation studies with two murine cell lines , el - 4 and ctll - 2 cells , provide important information concerning the need to stimulate murine cells to allow hiv - 1 entry or replication . also , the experiments with ctll - 2 cells may be desirable , since this cell line approximates normal lymphoid cells more than el - 4 cells , a t cell lymphoma cell line . human cd4 transfected into nih3t3 cells was shown to bind hiv - 1 but viral entry into the cell did not occur ( maddon et al ., cell 47 : 333 [ 1986 ]). we used the polymerase chain reaction (&# 34 ; pcr &# 34 ;) to determine if the l3t4 mutants could act to bind to gp120 and facilitate entry of hiv - 1 into cos - 1 cells and nih3t3 cells . cos - 1 cells , a monkey cell line , were transfected with l3t4 , cd4 , an l3t4 mutants m1 , m5 and m6 , which were cloned into pcdms , a vector designed for high level transient expression in cell lines harboring origin - defective sv40 . transiently transfected cos - 1 cells were infected with hiv - 1 / iiib . all procedures followed the standard practices outlined by the nih for the handling of infectious retroviruses . cells transfected with l3t4 , cd4 and l3t4 mutants were tested for their susceptibility to hiv - 1 infection . hiv - 1 / iiib - titered supernatants were added to 3 × 10 5 transfected cells for 2 - 4 hours at a multiplicity of infection (&# 34 ; moi &# 34 ;) of 0 . 1 . following the infection the cells were washed 3 times with media and cultured for 2 days . the cells were then harvested by trypsinizing from the plate and subjected to pcr analysis to determine the presence of hiv - 1 gag rna and dna . cellular rna and dna were isolated herein by first lysing the . pelleted cells in a buffer containing 25 mmtris - hcl , ph 7 . 5 , 0 . 5 mm edta and 0 . 5 % np40 . vanadyl ribonucleoside complex was added to the lysis buffer to inhibit ribonuclease activity . the cell lysate was then centrifuged and the supernatant containing the rna was treated with 500 ug / ml proteinase k and 1 % sds for 30 minutes followed by phenol extraction and isopropanol precipitation . the rna was treated with rnaase - free dnaase to remove residual viral dna which might originate from lysed cells in the viral stock . the rna was then converted to cdna by mmlv reverse transcriptase as recommended by the supplier ( brl , inc ., gaithersburg , md .) using oligo d ( t ) as the primer , followed by analysis of gag by pcr using hiv - 1 gag sense and antisense primers ( schnittman et al ., science 245 : 305 [ 1989 ]). the pelleted nuclear material from the np40 cell lysis was reconstituted in 200 ul of lysis buffer containing proteinass k , incubated for i hour at 55 ° c ., then at 96 ° c . for 15 minutes . aliquotes of the cdna reaction and the nuclear material were used directly for pcr analysis . pcr analysis was performed as follows . we used as primers a sense sequence sk38 ( id .) and a second antisense sequence ( positions no . 1421 - 1449 ), which define a 310 base pair gag sequence . dna samples were heated at 95 ° c . prior to addition to the pcr . all pcrs described herein were performed using master pcr mixes which are aliquoted and kept at - 20 ° c . taq polymerass ( perkin elmer ) is added to the pcr mix prior to the pcr reaction . the pcr conditions were as follows : denaturation at 95 ° c . for 1 minute , annealing at 55 ° c . for 1 minute , and extension at 72 ° c . for 30 seconds for 30 - 35 cycles . pcr products were separated by agarose gel electrophoresis , southern blotted , and hybridized to nick translated [ 32 p ]- dctp - labelled gag or tat dna probes . hybridization and prehybridization were conducted as follows . filters were washed and uv cross - linked to immobilize the rna and prehybridized at 42 ° c . for 5 hours in a solution containing 50 % formamide , 5 × ssc , 25 mm sodium phosphate , ph 6 . 5 , 0 . 1 % sds , 5 × denhardt &# 39 ; s and 100 ug / ml denatured salmon sperm dna . dna probes were labelled by nick translation using a nick translation kit ( bethesda research labs , inc ., gaithersburg , md .) and [∝ 32 p ]- dctp as a radioactive label . hybridization conditions were similar to the prehybridizing conditions except the solution is 2 × denhardt &# 39 ; s dextran sulfate is added to a final concentration of 8 %, and the hybridization proceeds for 20 hours . following hybridization , filters were washed twice at room temperature in 2 × ssc / 0 . 1 % sds for 10 minutes , and twice at 59 ° c . for 20 minutes each in 0 . 2 × ssc / 0 . 1 % sds . the filters dried and placed against kodak xar film with an intensifying screen . southern blot analysis show that mutant l3t4 - transfected and cd4 - transfected cos - 1 cells contain gag rna ( fig4 a ) and dna ( fig4 b ). non - transfected cos - 1 cells , mock - transfected cos - 1 cells , and l3t4 - transfected cos - 1 cells did not show the presence of gag by pcr analysis . these data provide evidence that mutations designed into l3t4 to construct a gp120 binding domain may facilitate hiv - 1 binding and internalization . the data also correlate to those from the facs analysis for gp120 binding ( fig3 a - 3e ), i . e ., the increased level of gp120 binding to the l3t4 mutants is reflected by the level of hiv - 1 gag pcr products . as a quantitative control , we verified the presence and quantity of cdnas and genomic dna for β - actin by pcr analysis ( data not shown ). we further demonstrated that l3t4 mutant m6 could facilitate hiv - 1 infection in a murine cell line nih3t3 cells . l3t4 , cd4 , and l3t4 mutant m6 were cloned into prc / cmv and stably transfected into nih3t3 cells in a manner described above . nih3t3 transfectants were then incubated with hiv - 1 / iii - b for 4 hours at an moi of 0 . 2 . the cells were washed , cultured for 2 - 7 days prior to analysis for viral internalization and replication . during the post - infection culture period , the cells were passed by treatment with trypsin to remove the cells from the tissue culture plate on the first day after hiv - 1 infection and then every 3 days . trypsin treatment also destroyed any residual virus in the culture . the cells were tested for the presence of internalized hiv - 1 by pcr amplification and southern blotting . for pcr analysis , hiv - 1 gag rna and dna were identified by using the above - mentioned oligonucleotides that specify a 310 base pair dna . results of southern blotting for hiv - 1 gag rna , which was converted to cdna with reverse transcriptase ( fig5 a ), and nuclear dna ( fig5 b ), show that mutant m6 facilitated entry of hiv - 1 into nih3t3 cells . more specifically , the data indicate the presence of a 310 base pair dna in m6 transfected cells amplified with oligonucleotides specifying the gag gene of hiv - 1 . thus , l3t4 mutant m6 , when expressed on the surface of transfected murine cells , can bind hiv - 1 and allow viral entry into the cells . 2 . production of spliced hiv - 1 tat rna in l3t4 - mutant transfected nih3t3 cells infected with hiv - 1 . tat is a 15 kd transactivator protein of hiv - 1 which activates the viral ltr , driving viral replication . the presence of spliced tat rna is a reliable indicator of hiv - 1 infection and replication . tat rna is generated by splicing rna segments from several distant locations within the virion genome during viral replication . tat rna splicing initially occurs during low level viral transcription . production of the tat protein ensues which further activates the viral ltr to amplify hiv - 1 replication . pcr amplification was employed to detect spliced hiv - 1 tat rna in nih3t3 cells transfected with l3t4 , cd4 , and l3t4 mutant m6 . the pcr fragment was designed to detect a 240 base pair dna using as primers two sequences , i . e ., a sense sequence ( 5411 - 5434 ) and an antisense sequence ( 7978 - 8001 ), which are separated by 2600 base pairs within the hiv - 1 genome . we performed southern blot analysis of tat rna ( converted to cdna , using oligo d ( t ) as the primer ) from hiv - 1 infected nih3t3 cells which were transfected with l3t4 , cd4 and the l3t4 mutant m6 . we tested transfected nih3t3 cells for the presence of tat transcripts . southern blot analysis shows l3t4 mutant m6 facilitates entry and replication of hiv - 1 as evidenced by the presence of the 240 base pair spliced tat cdna fragment ; cd4 and l3t4 transfected cells were negative for tat cdna ( fig6 ). 3 . measurement of hiv - 1 p24 gag antigen and reverse transcriptase activity we performed infection studies with hela cells transfected with l3t4 , l3t4 mutant m6 , and cd4 . hela cells were transfected following a procedure similar to that for transfecting nih3t3 cells as described above . 2 × 10 5 transfected hela cells plated on 60 mm plates in 1 . 5 ml of media were then infected with hiv - 1 / iiib at an moi of 0 . 1 for 2 hours . the cells were washed twice with media , cultured overnight , and trypsinized the following day to destroy any remaining virus . three days later the cells were removed by trypsin and split 1 : 5 . on day 6 after the infection , culture supernatant was removed for analysis of hiv - 1 p24 gag antigen by a commercial elisa kit ( new england nuclear , boston , mass .). the results show that hiv - 1 p24 antigen was present in the supernatant of m6 - and cd4 - transfected hela cells while l3t4 - transfected cells only exhibited background levels of p24 antigen ( table iv , experiments 1 , 2 and 3 ). in other words , m6 transfected cells were demonstrated to be capable of producing a viral protein , which is an essential feature of infection . note that m1 causes a consistent but marginal increase in gp120 binding as observed by facs analysis in both hela cells ( fig3 b ) and cos - 1 cells ( data not shown ). as shown in table iii , results from 125 i - gp120 binding studies also indicate that m1 transfected el - 4 cells bind gp120 , but less efficiently than m5 , m6 , and cd4 . the pcr analysis shows clearly that the virus can enter via the m1 receptor ( fig4 a and 4b ). however , only very low levels of p24 gag were observed in infection experiments with m1 - transfected hela cells . apparently , pcr analysis can greatly amplify hiv dna from m1 infections to simulate the data of m5 , m6 and cd4 infections . on the other hand , insufficient virus may enter through m1 to enable us to observe increased p24 gag from viral replication under the conditions of our infection studies , since m1 is less efficient than m5 , m6 , and cd4 for binding gp120 . table iv______________________________________ hela cellexperiment no . transfectant gag p24 ( pg / ml ) ______________________________________1 l3t4 7 m6 125 cd4 1452 hela 16 l3t4 10 m6 355 cd4 4633 hela 3 l3t4 7 m5 472 m6 350 cd4 4594 hela 113 m6 & gt ; 578 cd4 & gt ; 578______________________________________ we further demonstrated that transfected hela cells are susceptible to cd4 - independent hiv - 1 infection as reported by page et al ., j . virol 64 : 5270 [ 1990 ]. hela cell transfectants were infected with hiv - 1 / iiib at an moi of 0 . 2 for 14 hours ( table iv , experiment 4 ). the cells were then treated as described above except that the hela cells in experiment 4 were cultured for 14 days . the p24 levels in the culture supernatant above 30 are positive for hiv according to the supplier of the elisa hiv assay kit ( new england , boston , mass .). when a longer hiv - 1 incubation time was employed , non - transfected hela cells exhibited modest levels of p24 antigen ( table iv , experiment 4 ). these results clearly show that hela cells transfected with l3t4 mutants , such as m6 , can undergo a mode of hiv - 1 infection through the mutant l3t4 receptor . reverse transcriptase is another protein expressed by hiv - 1 and thus can also serve as a criterion of viral infection . reverse transcriptase activity in the supernatant of transfectant cell culture infected by hiv - 1 is measured following the procedure described in poiesz et al ., proc . natl . acad . sci . usa 77 : 741 [ 1980 ]. two murine cell lines , el - 4 and ctll - 2 cells , are used to determine if cell activation is required for viral entry and replication in murine cells transfected with l3t4 , cd4 , l3t4 mutants . jurkat cells , a human cell line expressing cd4 and susceptible to hiv - 1 infection , are used as a positive control . jurkat and el - 4 cells are stimulated by incubation in the presence or absence of phytohemagglutinin (&# 34 ; pha &# 34 ; 5 ug / ml ) and phorbol myristic acid (&# 34 ; pma &# 34 ;, 5 ng / ml ), both from sigma , st . louis , mo ., 24 hours prior to hiv - 1 infection . after the infection , stimulated cells are washed 3 times with media and placed in culture for several days . the cells are then processed for per analysis , and the culture supernatants analyzed for p24 antigen and reverse transcriptase activity . ctll - 2 cells , which are il - 2 - dependent for cell growth , are maintained in media containing 10 u / ml of il - 2 or placed in il - 2 - deficient media 14 hours prior to addition of hiv - 1 . after the infection , the cells are washed 3 times and cultured in the presence of il - 2 for several days . to verify that jurkat and el - 4 cells are activated by pha / pma treatment , we perform a northern blot analysis to detect increased levels of il - 2 mrna . ctll - 2 cell activation by il - 2 , on the other hand , is verifiable by cell growth , i . e ., ctll - 2 cells will die if they fail to respond to il - 2 . l3t4 and cd4 interact with nonpolymorphic determinants of murine and human class ii mhc , respectively . this interaction facilitates association with the t cell receptor resulting in signal transduction . these events are important for efficient recognition of antigen by the t cell receptor . because l3t4 plays a role in immune responses , it is preferred that an analysis of l3t4 mutants be performed to determine how an l3t4 mutant used to establish a transgenic mouse line may affect class ii binding . the need to preserve class ii mhc binding affinity for l3t4 mutants depends on whether preservation of class ii mhc binding ability by l3t4 mutants is an advantage . in any event , l3t4 mutants which bind gp120 but differ in their capability to bind class ii molecules may be useful tools for future in vivo studies with transgenic mice . hela cells transfected with l3t4 , cd4 , and l3t4 mutants are used to analyze the binding to a murine b cell line bcl1 , which expresses class ii molecules on the cell surface . we use a cell conjugation assay to determine the ability of l3t4 routants to bind with class ii mhc determinants . this assay was used to measure the effect of mutations within cd4 on interaction with human class ii mhc . see clayton et al ., nature 339 : 548 [ 1989 ]. the cell conjugation assay involves the visual and radioisotope measurement of l3t4 or mutant l3t4 - transfected hela cells conjugated with the murine b cell line . the conjugation assay is performed as described by clayton et al . id . briefly , 10 8 bcl1 cells is labelled with 0 . 5 mci of 51 cr for 2 hours at 37 ° c . and washed three times . radioactively labelled b cells ( 10 7 ) are incubated with l3t4 - transfected , l3t4 mutant - transfected , or vector alone - transfected hela cells grown to 80 % confluence in 6 well microtiter plates for 1 hour at 37 ° c . unbound b cells are removed from the plate by several washes . the bound cells , on the other hand , are lysed with 1 % triton in pbs and the supernatant is collected and counted . this experiment is also performed without labelling the b cells ; conjugation is scored by viewing the bound cells by light microscopy . the specificity of the interaction is checked by the following controls : 1 ) pretreatment of the b cells with anti - murine class ii mhc ( accurate chemical corp ., westbury , n . y . ); 2 ) treatment of the transfected hela cells with anti - l3t4 , except for m6 and m8 where other anti - l3t4 antibodies are tested ); and 3 ) interaction of raji cells , a human ebv - infected b cell line ; as discussed above , murine l3t4 does not bind to human class ii mhc proteins . syncytia formation is the cell to cell fusion which forms multinucleated giant cells and is observed in aids ( acquired immunodeficiency syndrome ) patients . syncytia results from the interaction of cell surface viral gp120 with a gp120 receptor , e . g ., cd4 , on another cell . syncytia formation is a reliable indicator of hiv - 1 infection and the presence of gp120 - binding proteins which facilitate cell to cell fusion . in analogous to assays for human syncytia formation , we measure syncytia in l3t4 - mutant transfected murine lymphocytic ctll - 2 cells following the method set forth below . 3 × 10 5 l3t4 , cd4 , or mutant l3t4 - transfected ctll - 2 cells are plated in 10 mm microtiter wells . 1 × 10 5 h - 9 / htlv - iiib cells which are chronically infected with hiv - 1 / iiib are added to the wells containing transfected ctll - 2 cells . the cocultivation assays are then incubated 24 - 72 hours at 37 ° c . thereafter , the wells are scored for syncytia formation . ii . establishment of a transgenic mouse line susceptible to hiv - 1 infection one l3t4 mutant is selected for development of a transgenic mouse . the criteria for selection of a candidate l3t4 mutant are based on the following data generated from the studies described above . ( a ) affinity for recombinant gp120 , as determined by scatchard analysis of gp120 for l3t4 mutant - transfected ctll - 2 cells . ( c ) ability of l3t4 - mutant transfected cells to fuse with hiv - 1 - infected h9 cells . ( d ) preservation of mhc class ii interactions . this criteria is not essential where wild type l3t4 are still expressed . preservation of class ii mhc binding is considered a negative factor in the selection of a candidate l3t4 mutant where expression of wild type l3t4 is unaffected in el - 4 cells . 2 . construction of an l3t4 mutant transgene with the cd3δ enhancer - promoter an l3t4 mutant is inserted into pblcat3 ( fig7 a , luckow et al ., nuc . acid res . 15 : 5491 [ 1987 ] containing the murine cd3δ enhancer / promoter , which can be prepared following georgopoulos et al ., embo 7 : 2401 [ 1988 ], for tissue - specific expression of the l3t4 mutant in the transgenic mouse model . cd3δ promoter is inserted into the xba i site and . cd3δ enhancer into the sma i site of pblcat3 . the cd3δ enhancer exhibits tight tissue - specific expression in t cells , while the promoter was not t cell specific . it is preferred to generate enhanced expression of mutant l3t4 in t cells in the transgenic mouse model . expression of mutant l3t4 in t lymphocytes best approximates the human system where cd4 + t cells are a main target for hiv - 1 infection . an l3t4 mutant cdna , e . g ., m6 , is first excised from prc / cmv with xba i and blunt ended with t4 dna polymerase . the l3t4 mutant is then cloned into the xho i - sma i site of cd3δ enhancer / promoter - containing pblcat3 , which is also blunt ended with t4 polymerase . the l3t4 mutant replaces the cat gene between these restriction sites and is situated immediately 3 &# 39 ; to the cd3δ promoter and 5 &# 39 ; to the cd3δ enhancer ( fig7 b ). enhancers are known to function independently of their orientation ; however , the cd3δ is more efficient when it is situated 3 &# 39 ; to the cd3 gene . id . prior to microinjection into eggs , the dna is made linear by cutting with sph i . all dna manipulations are as described in maniatis et al ., molecular cloning . cold spring harbor laboratory , cold spring , n . y ., 1982 . the best readout for testing the hiv - 1 infectivity of mutant l3t4 + cells is in live animals or live animal tissue expressing these genes . founder transgenie mice are developed and bred to establish a transgenic mouse colony . the transgene constructed in e manner as described above is injected into female f 2 hybrid zygotes [( c57b1 / 6j × cba / j ) f 1 female ×( c57b1 / 6j × cba / j ) f 1 male ]. the generation and breeding of transgenic mice is more efficient when f 2 zygotes are used for microinjection . brinster et al ., proc . natl . acad . sci . usa 82 : 4438 [ 1985 ]. the microinjected eggs are then implanted into pseudopregnant c57b1 / 6j female mice to serve as foster mothers for the founder mice . the presence of the transgene in the founder mice is determined by methods as described below . founder mice are bred according to standard methods for breeding laboratory mice and screened for the presence of the injected transgene by performing a pcr analysis and a genomic dna southern blot analysis from a tail biopsy as described below . those bearing the l3t4 mutant are mated with f 1 ( c57b1 / 6j × cba / j ) male or female mice , depending on the sex of the mutant l3t4 - bearing founder mice . we breed heterozygous transgenic mouse population and approximately one - quarter of the heterozygous intercrosses are homozygous for the mutant l3t4 gene . where the integrated dna produces a recessive lethal effect , the heterozygous transgenie mice are used as the sole source of tissue for hiv - 1 infection studies . homozygosity are confirmed by outcrossing the presumptive homozygous mice to a nontransgenic mouse , to confirm that 100 % transmission of the l3t4 mutant takes place as determined by methods described below . the transgene implanted in the eggs must be detectable in offspring transgenic mice in order to establish a transgenic mouse colony which expresses the l3t4 mutant gene . thus , two protocols are devised to detect the presence of the l3t4 mutant in the transgenic mice . the first protocol uses pcr analysis to detect l3t4 mutant sequences , but does not amplify wild type l3t4 . this protocol is used as a qualitative measure for the introduction of mutant l3t4 into the murine genome . the second protocol uses restriction fragment length polymorphism (&# 34 ; rflp &# 34 ;) analysis of genomic dna . this protocol takes advantage of the fact that a new restriction enzyme site was created with oligonucleotide 1 ( see table i , used to make m1 ), which is diagnostic for the presence of the l3t4 mutant by a characteristic band by southern blot analysis . this second protocol is a quantitative method for measuring the potential dosage of the integrated l3t4 mutant , and indicates whether the mice are heterozygous or homozygous . the quantitative measurement of this protocol is linked to the signal intensity observed by southern blot analysis when compared to the intensity given by an internal control in all the samples , i . e ., the wild type l3t4 dna . expression of mutant l3t4 in the tissues and organs of transgenic mice is measured by pcr analysis of tissue and organ - isolatedmrna ( converted to cdna ) and dna . the methods for dna and rna isolation are as described above except in the case of rna isolation from organs , where polytron shearing and the guanidinium isothiocyanate method are used . see chirgwin et al ., biochemistry 18 : 5294 [ 1979 ]. oligonucleotide 5 , shown in table i , is used as the antisense primer while the sense primer encodes a sequence in the 5 &# 39 ; untranslated region . this pcr fragment encodes a 340 base pair dna . oligonucleotide 5 is an excellent diagnostic measure for the presence of mutant l3t4 mrna ( cdna ) because the codons on the 3 &# 39 ; end of this primer encode those mutations designed in oligonucleotide 1 , rendering oligonucleotide 5 useless for pcr analysis of wild type l3t4 . pcr amplification of mutant l3t4 cdna is performed at 95 ° c . for 1 minute , 60 ° c . for 1 minute , and 72 ° c for 30 seconds for cycles . we have successfully used these pcr primers and conditions to discriminate between mutant and wild type l3t4 cdna and genomic dna . the oligonucleotide used to make mutant m1 and contained in all other mutants ( see table i ) creates an ava ii restriction enzyme site . dna isolated from transgenic mice tail biopsies is cut with xho i and ava ii using conditions recommended by the enzyme supplier ( l3t4 cdna contains internal xho i and ava ii sites ). the dna is separated by agarose gel electrophoresis and southern blotted . the blot is then hybridized with a 300 base pair [ 32 p ]- l3t4 - labelled dna probe which includes only l3t4 dna from the l3t4 xho i site in the 5 &# 39 ; untranslated region to codon 35 . this dna probe hybridizes with the mutant l3t4 and wild type l3t4 dna . the mutant l3t4 cut with xho i - ava ii exhibits a 340 base pair hybridization band while the wild type shows a 680 base pair band . the signal intensity of these bands , measured by densitometry of the autoradiograms , are compared to estimate the relative dosage of the mutant l3t4 dna in comparison to the wild type dna . the heterozygosity / homozygosity of the transgenic mice is determined by comparing the signal intensity of known heterozygotes ( some offspring of found mice matings ) with the signal intensity of the heterozygote - heterozygote backcrosses ; one quarter of the backcrossed mice should exhibit a doubling of the 340 base pair dna signal indicating a transgenic mouse homozygous for the mutant l3t4 . quantitation is independent of the amount of dna since the signal intensity of the diagnostic 340 base pair dna can be normalized to the intensity of the wild type dna . rna is isolated from the spleen , thymus , peripheral blood cells , lymph nodes , bone marrow , pancreas , kidney , liver , heart and brain as described above , and converted to cdna and analyzed by pcr analysis for the presence of l3t4 mutant rna . isolated rna is pretreated with rnase - free dnase to destroy any contaminating dna . facs analysis to determine the cell surface expression of mutant l3t4 on isolated cells from the organs and tissues is performed as described above . t cells isolated from the spleen , thymus , and lymph nodes of transgenic mice homozygous for mutant l3t4 are analyzed by facs analysis and 125 i - gp120 binding . we determine the ability of hiv - 1 to infect in vitro lymphoid tissues expressing l3t4 mutant receptors . the results indicate that l3t4 mutant expressed in a transgenic mouse can bind and facilitate hiv - 1 infection of the mouse . more specifically , hiv - 1 infections and analyses of the infections of lymphoid tissue from control , heterozygous , and homozygous transgenic mice are performed essentially as described above . experiments of longer term cultures ( 1 - 3 weeks ) of stimulated cells include periodic measurement of supernatant p24 antigen and reverse transcriptase activity . these supernatants are also used as inocula to infect human cd4 + peripheral blood lymphocytes . splenic t cells from transgenic mice are isolated and tested for their ability to form syncytia with h - 9 / htlv - iiib cells by the methods as described above . the foregoing description has been limited to specific embodiments of this invention . it will be apparent , however , that variations and modifications may be made to the invention , with the attainment of some or all of the advantages of the invention . for example , murine tissue culture cells which express l3t4 mutant protein can be used for screening potential aids drugs . also , dna sequences encoding l3t4 mutants can be used in the development of an mutant l3t4 - toxin chimeric protein for destruction of hiv - 1 infected cells expressing cell - surface hiv - 1 gp120 . in theory , mutant l3t4 - toxin chimeric proteins could be targeted to hiv - 1 infected cells expressing gp120 on the cell surface . these cells would find and internalize the chimera and be intoxicated by the toxin moiety . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 10 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 5 ( b ) type : amino acid ( d ) topology : linear ( xi ) sequence description : sequence id no : 1 : proserlysleuasn ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 5 ( b ) type : amino acid ( d ) topology : linear ( xi ) sequence description : sequence id no : 2 : asnglnglyserphe5 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 4 ( b ) type : amino acid ( d ) topology : linear ( xi ) sequence description : sequence id no : 3 : glythrtrpthr ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 45 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : sequence id no : 4 : ggaatcaaaacgatcgttcaacttcgaaggtcctctaattaatac45 ( 2 ) information for seq id no : 5 :( i ) sequence characteristics :( a ) length : 39 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : sequence id no : 5 : tgtcaaggggttagacccaggggggctatccaaggtcag39 ( 2 ) information for seq id no : 6 :( i ) sequence characteristics :( a ) length : 36 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : sequence id no : 6 : ggtcacggtgcaggtccaggtgccgctgtcctgaac36 ( 2 ) information for seq id no : 7 :( i ) sequence characteristics :( a ) length : 45 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : sequence id no : 7 : cgaaggtcctctaattaagaaagagccttggttccccagaatctt45 ( 2 ) information for seq id no : 8 :( i ) sequence characteristics :( a ) length : 27 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : sequence id no : 8 : ttttttggaatcagcacgatcgttcaa27 ( 2 ) information for seq id no : 9 :( i ) sequence characteristics :( a ) length : 1414 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : sequence id no : 9 : gctcagattcccaaccaacaagagctcaaggagaccaccatgtgccgagccatc54metcysargalaile25tctcttaggcgcttgctgctgctgctgctgcagctgtcacaactccta102serleuargargleuleuleuleuleuleuglnleuserglnleuleu20 - 15 - 10gctgtcactcaagggaagacgctggtgctggggaaggaaggggaatca150alavalthrglnglylysthrleuvalleuglylysgluglygluser51510gcagaactgccctgcgagagttcccagaagaagatcacagtcttcacc198alagluleuprocysgluserserglnlyslysilethrvalphethr152025tggaagttctctgaccagaggaagattctggggcagcatggcaaaggt246trplyspheseraspglnarglysileleuglyglnhisglylysgly303540gtattaattagaggaccttcgaagttgaacgatcgttttgattccaaa294valleuileargglyproserlysleuasnaspargpheaspserlys455055aaaggggcatgggagaaaggatcgtttcctctcatcatcaataaactt342lysglyalatrpglulysglyserpheproleuileileasnlysleu60657075aagatggaagactctcagacttatatctgtgagctggagaacaggaaa390lysmetgluaspserglnthrtyrilecysgluleugluasnarglys808590gaggaggtggagttgtgggtgttcaaagtgaccttcagtccgggtacc438glugluvalgluleutrpvalphelysvalthrpheserproglythr95100105agcctgttgcaagggcagagcctgaccctgaccttggatagcaactct486serleuleuglnglyglnserleuthrleuthrleuaspserasnser110115120aaggtctctaaccccttgacagagtgcaaacacaaaaagggtaaagtt534lysvalserasnproleuthrglucyslyshislyslysglylysval125130135gtcagtggttccaaagttctctccatgtccaacctaagggttcaggac582valserglyserlysvalleusermetserasnleuargvalglnasp140145150155agcgacttctggaactgcaccgtgaccctggaccagaaaaagaactgg630seraspphetrpasncysthrvalthrleuaspglnlyslysasntrp160165170ttcggcatgacactctcagtgctgggttttcagagcacagctatcacg678pheglymetthrleuservalleuglypheglnserthralailethr175180185gcctataagagtgagggagagtcagcggagttctccttcccactcaac726alatyrlyssergluglygluseralaglupheserpheproleuasn190195200tttgcagaggaaaacgggtggggagagctgatgtggaaggcagagaag774phealaglugluasnglytrpglygluleumettrplysalaglulys205210215gattctttcttccagccctggatctccttctccataaagaacaaagag822aspserphepheglnprotrpileserpheserilelysasnlysglu220225230235gtgtccgtacaaaagtccaccaaagacctcaagctccagctgaaggaa870valservalglnlysserthrlysaspleulysleuglnleulysglu240245250acgctcccactcaccctcaagataccccaggtctcgcttcagtttgct918thrleuproleuthrleulysileproglnvalserleuglnpheala255260265ggttctggcaacctgactctgactctggacaaagggacactgcatcag966glyserglyasnleuthrleuthrleuasplysglythrleuhisgln270275280gaagtgaacctggtggtgatgaaagtggctcagctcaacaatactttg1014gluvalasnleuvalvalmetlysvalalaglnleuasnasnthrleu285290295acctgtgaggtgatgggacctacctctcccaagatgagactgaccctg1062thrcysgluvalmetglyprothrserprolysmetargleuthrleu300305310315aagcaggagaaccaggaggccagggtctctgaggagcagaaagtagtt1110lysglngluasnglnglualaargvalserglugluglnlysvalval320325330caagtggtggcccctgagacagggctgtggcagtgtctactgagtgaa1158glnvalvalalaprogluthrglyleutrpglncysleuleuserglu335340345ggtgataaggtcaagatggactccaggatccaggttttatccagaggg1206glyasplysvallysmetaspserargileglnvalleuserarggly350355360gtgaaccagacagtgttcctggcttgcgtgctgggtggctccttcggc1254valasnglnthrvalpheleualacysvalleuglyglyserphegly365370375tttctgggtttccttgggctctgcatcctctgctgtgtcaggtgccgg1302pheleuglypheleuglyleucysileleucyscysvalargcysarg380385390395caccaacagcgccaggcagcacgaatgtctcagatcaagaggctcctc1350hisglnglnargglnalaalaargmetserglnilelysargleuleu400405410agtgagaagaagacctgccagtgcccccaccggatgcagaagagccat1398serglulyslysthrcysglncysprohisargmetglnlysserhis415420425aatctcatctgaggcc1414asnleuile430 ( 2 ) information for seq id no : 10 :( i ) sequence characteristics :( a ) length : 1408 ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( xi ) sequence description : sequence id no : 10 : gctcagattcccaaccaacaagagctcaaggagaccaccatgtgccgagccatc54metcysargalaile25tctcttaggcgcttgctgctgctgctgctgcagctgtcacaactccta102serleuargargleuleuleuleuleuleuglnleuserglnleuleu20 - 15 - 10gctgtcactcaagggaagacgctggtgctggggaaggaaggggaatca150alavalthrglnglylysthrleuvalleuglylysgluglygluser51510gcagaactgccctgcgagagttcccagaagaagatcacagtcttcacc198alagluleuprocysgluserserglnlyslysilethrvalphethr152025tggaagttctctgaccagaggaagattctggggaaccaaggctctttc246trplyspheseraspglnarglysileleuglyasnglnglyserphe303540ttaattagaggaccttcgaagttgaacgatcgtgctgattccaaaaaa294leuileargglyproserlysleuasnaspargalaaspserlyslys455055ggggcatgggagaaaggatcgtttcctctcatcatcaataaacttaag342glyalatrpglulysglyserpheproleuileileasnlysleulys60657075atggaagactctcagacttatatctgtgagctggagaacaggaaagag390metgluaspserglnthrtyrilecysgluleugluasnarglysglu808590gaggtggagttgtgggtgttcaaagtgaccttcagtccgggtaccagc438gluvalgluleutrpvalphelysvalthrpheserproglythrser95100105ctgttgcaagggcagagcctgaccctgaccttggatagcccccctggg486leuleuglnglyglnserleuthrleuthrleuaspserproprogly110115120tctaaccccttgacagagtgcaaacacaaaaagggtaaagttgtcagt534serasnproleuthrglucyslyshislyslysglylysvalvalser125130135ggttccaaagttctctccatgtccaacctaagggttcaggacagcggc582glyserlysvalleusermetserasnleuargvalglnaspsergly140145150155acctggacctgcaccgtgaccctggaccagaaaaagaactggttcggc630thrtrpthrcysthrvalthrleuaspglnlyslysasntrpphegly160165170atgacactctcagtgctgggttttcagagcacagctatcacggcctat678metthrleuservalleuglypheglnserthralailethralatyr175180185aagagtgagggagagtcagcggagttctccttcccactcaactttgca726lyssergluglygluseralaglupheserpheproleuasnpheala190195200gaggaaaacgggtggggagagctgatgtggaaggcagagaaggattct774glugluasnglytrpglygluleumettrplysalaglulysaspser205210215ttcttccagccctggatctccttctccataaagaacaaagaggtgtcc822phepheglnprotrpileserpheserilelysasnlysgluvalser220225230235gtacaaaagtccaccaaagacctcaagctccagctgaaggaaacgctc870valglnlysserthrlysaspleulysleuglnleulysgluthrleu240245250ccactcaccctcaagataccccaggtctcgcttcagtttgctggttct918proleuthrleulysileproglnvalserleuglnphealaglyser255260265ggcaacctgactctgactctggacaaagggacactgcatcaggaagtg966glyasnleuthrleuthrleuasplysglythrleuhisglngluval270275280aacctggtggtgatgaaagtggctcagctcaacaatactttgacctgt1014asnleuvalvalmetlysvalalaglnleuasnasnthrleuthrcys285290295gaggtgatgggacctacctctcccaagatgagactgaccctgaagcag1062gluvalmetglyprothrserprolysmetargleuthrleulysgln300305310315gagaaccaggaggccagggtctctgaggagcagaaagtagttcaagtg1110gluasnglnglualaargvalserglugluglnlysvalvalglnval320325330gtggcccctgagacagggctgtggcagtgtctactgagtgaaggtgat1158valalaprogluthrglyleutrpglncysleuleusergluglyasp335340345aaggtcaagatggactccaggatccaggttttatccagaggggtgaac1206lysvallysmetaspserargileglnvalleuserargglyvalasn350355360cagacagtgttcctggcttgcgtgctgggtggctccttcggctttctg1254glnthrvalpheleualacysvalleuglyglyserpheglypheleu365370375ggtttccttgggctctgcatcctctgctgtgtcaggtgccggcaccaa1302glypheleuglyleucysileleucyscysvalargcysarghisgln380385390395cagcgccaggcagcacgaatgtctcagatcaagaggctcctcagtgag1350glnargglnalaalaargmetserglnilelysargleuleuserglu400405410aagaagacctgccagtgcccccaccggatgcagaagagccataatctc1398lyslysthrcysglncysprohisargmetglnlysserhisasnleu415420425atctgaggcc1408ile__________________________________________________________________________ | 0 |
fig1 is a flow chart illustrating steps of a method for negotiating a secure connection between two peers in a p2p network , illustrating a “ back off and retry ” technique of the invention . this back off and retry mechanism may be applied at the application layer and the transport layer . the following rules used by the receiving and sending peers define an algorithm that allows a p2p communications device to engage in secure communication with other peers using an unmodified client / server handshake protocol . both sending and receiving peers maintain information about the existence of connections with other peers . the steps shown in fig1 begin when a new security message is received by a peer at step 100 . when a new security message arrives at the peer ( i . e ., this does not apply to ordinary traffic the application receives ), the peer first checks in step 102 to see if it has an existing connection with the source peer sending the message . if there is not an existing connection ( including an attempted connection ), then in step 104 the received message is checked to see if it is an handshake initiation request . if the received message was a handshake initiation request , then in step 106 the receiving peer assumes the server role , and participates in the new connection handshake . if the received message was not a handshake initiation request , then an error has occurred as shown in step 108 . the handling of this error will be described later . if the receiving peer does have an existing connection with the sender , then in step 110 the receiving peer passes the received message to the security engine associated with the connection for processing . in step 112 , the message is then checked to see if it is part of an existing handshake process . if the message is part of an existing handshake process , then in step 114 the engine will process the handshake step and modify the connection state accordingly . if the message is not part of an existing handshake ( i . e ., it is application data or a new handshake ), then step 116 checks to see if the handshake has completed and this is application data . if the handshake has completed and this is application data , then in step 118 the engine will attempt to decrypt it and return it for delivery to the application . if the handshake has not completed or this is not application data ( such as a new handshake ), an error has occurred as shown in step 108 . fig2 illustrates steps taken when a security message is to be sent by a peer , according to the “ back off and retry ” technique of the invention . when a message is to be sent to another peer , the sending peer first checks in step 200 to see if a connection exists for the destination of the message . if the sending peer does not have an existing connection for the destination , then in step 202 the sending peer waits for a small random amount of time . after waiting , the sending peer checks for the existence of a connection again in step 204 . if there is still no connection present , then in step 206 the sending peer assumes the role of client , and initiates a new connection handshake . if a connection is now present , then in step 208 the sending peer assumes the role of server , and participates in the connection handshake . note that the delay before the send is a result of the error handling which will be described below . in some embodiments , one could also place the delay after entering the error state , and not use the delay before sending . if step 200 determines that the sending peer does have an existing connection for the destination , then the sending peer determines whether the connection is ready for application data , or requires additional handshake processing : in step 210 , the peer checks to see if the connection is in handshake negotiation state . if the connection is in a handshake negotiation state , then in step 212 the sending peer participates in the existing negotiation and waits for it to complete before sending any application data . if the connection is not in a handshake negotiation state , then step 214 checks if the negotiation has completed . if the peer has successfully completed a handshake , then in step 216 the sending peer provides the application data to the security engine for encryption and wire line transmission . if the connection is not in a handshake negotiation state , but has not successfully completed a handshake , then an error has occurred , as shown in step 218 . once the handshake is complete , application data may be encrypted and sent between the peers . because of the random nature of the waiting period before transmission of the new connection handshake message , it is still possible for two peers to collide on connection setup . if both peers randomly select the same wait time before sending the initial message , they will likely both select client roles . because of this , the following additional rule applies to all connections in the handshake processing state : errors described in relation to the above two flowcharts are handled as follows . if either client or server ever detects that an error has occurred , for example state 108 or 218 , it destroys the connection associated with the error , and begins the process of initiating a connection again . this process can be repeated until the connection succeeds . because each attempt will select different random wait times before sending the initial message , it is likely that one side will eventually be selected as the client . an alternate implementation of this approach places the back off and retry mechanism in the underlying security protocol instead of in the application layer as described above . in this implementation , the algorithm for detecting and resolving role conflict using back off and retry is as follows : when a new secure connection request arrives , the peer checks if there is an existing connection . if not , then it assumes the server role . if there is an existing connection , then it cancels the existing connection , drops the incoming request , calculates a random wait time , and resends the request if no connection exists when random wait period is over . fig3 is a flow chart illustrating steps of a method for negotiating a secure connection between two peers in a p2p network using a “ tie breaking ” technique of the invention . according to this approach to resolving the client / server handshake role conflicts , the underlying protocol is modified to support the condition when both sides of the connection select the same role . specifically , the value of some attribute of the received handshake message is used by the receiving peer together with a corresponding attribute of the handshake message sent by the peer as a tiebreaker to determine which peer will assume the client role . this attribute could , for example , be the random value of a tls or dtls clienthello message . the following rules define a new algorithm that the underlying security protocol implements in order to break ties between two peers who wish to initiate secure communication with each other at the same time . when a new connection request is received in step 300 , the peer checks in step 302 to see if an existing connection to sending peer exists ( including an in - progress connection ). if the receiving peer does not have an existing connection to the sending peer , then in step 304 the receiving peer assumes the server role and participates in the handshake normally . if the receiving peer does have an existing connection to the sending peer , then in step 306 the peer checks to see if handshake is completed . if so , then in step 308 receiving peer treats the connection request as a renegotiation of the existing connection . if handshake is not completed , then in step 310 the receiving peer checks to see if it previously sent a connection request to the sender . if not , then in step 312 the peer processes the message as part of an ongoing or error ( depending on specifics of security protocol ). if so , then both sides have attempted to choose the client role , and the peer uses a tie breaker processing 314 to resolve the conflict . details of step 314 are shown in fig4 which is a flow chart illustrating tie breaker processing steps . the principle to the tie breaker processing is to compare the value of a tiebreaker attribute of the handshake message the peer sent to the value of the corresponding tiebreaker attribute of the handshake message the peer received . the comparison of these tiebreaker attribute values determines which peer will assume the client role and which side will assume the server role . receipt of a handshake message with a tiebreaker attribute value greater than that of the message previously sent could , for example , indicate that the recipient should assume the server role . step 400 computes the tie breaker attribute values from the handshake messages . step 402 then computes a comparison of the values . for example , if one value is larger than another . the result of the comparison then determines which role each peer will assume . if the recipient determines that it should assume the server role as a result of the tie breaking analysis , then in step 404 it discards the handshake message that it previously sent , in step 406 it resets its local state to assume the server role , and in step 408 it processes the received message as a new connection . if the recipient determines that it should assume the client role as a result of the tie breaking analysis in step 402 , then in step 410 it discards the message it just received , in step 412 it retains its client role state , and in step 414 it waits for the other peer to issue a server response . in one implementation , if it is not possible to resolve the tie because both sides have generated the same value for the tiebreaker attributes , then in step 416 each side discards both the sent and received handshake messages and in step 418 restarts the secure connection negotiation process again as new clients . this process is repeated until the role conflicts are resolved and the connection can be established . in accordance with another embodiment of the technique for resolving the role conflict , back off behavior is derived from the value of a tie breaker attribute in the handshake messages . specifically , when a new connection request is received , if the receiving peer previously sent a connection request to the sender , then both sides have chosen the client role . each side then compares the value of the tiebreaker attribute of the handshake message it sent to the value of the tiebreaker attribute of the message it received . whether and how the peers try to establish the connection again depends on the result of this comparison . in one implementation of this approach , both peers discard both sent and received messages , and both retry the connection with new handshake messages . each side waits for an amount of time , functionally derived from the tie breaker attribute value , before sending the new connection attempt . in another implementation , one side , such as the one with the higher tiebreaker attribute value , sends a new connection attempt sooner by preferentially selecting a shorter wait period . this process is repeated until a connection attempt succeeds . in another implementation , both peers discard the original sent and received packets , but only one peer attempts a new connection . this could , for example , be the peer that had the higher tiebreaker attribute value in the original connection attempt . in this example , the peer with the lower tiebreaker attribute value would wait for the other peer to issue the next connection attempt . the techniques of the present invention may be implemented by a peer computing devices connected via a p2p data network . each peer device may include a processor , a memory , and suitable network input / output devices connecting the peer to a p2p data network . the present invention may also be realized as a digital storage medium tangibly embodying machine - readable instructions executable by a peer computer , where the instructions implement the techniques of the invention described herein . the method implemented by the peer computer is directed to a specific technological field of application , namely negotiation of secure connections between peer devices in a p2p data network . | 7 |
examples 1 to 5 of the taking lens used with the electronic imaging system of the present invention are now explained . fig1 ( a ), 2 ( a ), 3 ( a ), 4 ( a ) and 5 ( a ) are illustrative in section of examples 1 to 5 upon focused on an infinite object point . in these figures , g 1 stands for a front lens group , s an aperture stop , g 2 a rear lens group , f an optical filter , and i an image plane . fig1 ( b ), 2 ( b ), 3 ( b ), 4 ( b ) and 5 ( b ) are aberration diagrams for examples 1 to 5 . in these figures , “ sa ”, “ as ” and “ dt ” are representative of spherical aberrations , astigmatisms and distortions , respectively . as shown in fig1 ( a ), this example is directed to a taking lens made up of a first lens group g 1 composed of a negative meniscus lens deeply concave in its image - plane side and a positive meniscus lens steeply convex on its image side , an optical filter f for cutting infrared , an aperture stop s and a rear lens group g 2 composed of a cemented positive lens consisting of a negative meniscus lens element deeply concave on its image side and a double - convex positive lens element . in the instant example , the negative meniscus lens is used as the first lens , thereby keeping the diameter of the front lens small while achieving a wide - angle lens arrangement . as shown in fig2 ( a ), this example is directed to a taking lens made up of a front lens group g 1 composed of a negative meniscus lens deeply concave on its image - plane side and a positive meniscus lens steeply convex on its image side , an optical filter f for cutting infrared , an aperture stop s and a rear lens group g 2 composed of a cemented positive lens consisting of a negative meniscus lens element deeply concave on its image side and a double - convex positive lens element . in the instant example , the thin negative meniscus lens is used as the first lens , thereby achieving weight reductions . as shown in fig3 ( a ), this example is directed to a taking lens made up of a front lens group g 1 composed of a negative meniscus lens deeply concave on its image - plane side and a double - convex positive lens steeply convex on its image side , an optical filter f for cutting infrared , an aperture stop s and a rear lens group g 2 composed of a negative meniscus lens deeply concave on its image side and a double - convex positive lens . as shown in fig4 ( a ), this example is directed to a taking lens made up of a front lens group g 1 composed of a negative meniscus lens deeply concave on its image - plane side and a positive meniscus lens steeply convex on its image side , an optical filter f for cutting infrared , an aperture stop s and a rear lens group g 2 composed of a negative meniscus lens deeply concave on its image side and a double - convex positive lens . as shown in fig5 ( a ), this example is directed to a taking lens made up of a front lens group g 1 composed of a negative meniscus lens deeply concave on its image - plane side and a thick planoconvex positive lens steeply convex on its image side , an optical filter f for cutting infrared , an aperture stop s and a rear lens group g 2 composed of a cemented positive lens consisting of a planoconcave negative lens element deeply concave on its image side and a double - convex positive lens element . in the instant example , the two lenses in the front lens group g 1 are engaged at their planar portions with each other , thereby achieving improvements in assembly precision as well as efficiency of fabrication work . numerical data on the respective examples are given below . symbols used hereinafter but not hereinbefore have the following meanings . r 1 , r 2 , . . . : radius of curvature of each lens surface , d 1 , d 2 , . . . : spacing between adjacent lens surfaces , n d1 , n d2 , . . . : d - line refractive index of each lens , and ν d1 , ν d2 , . . . : d - line based abbe number of each lens . [ 0081 ] f 5 . 32 f no 2 . 80 ω 24 . 2 ° ih 2 . 30 f b 7 . 167 r 1 = 5 . 591 d 1 = 2 . 314 n d1 = 1 . 77250 υ d1 = 49 . 60 r 2 = 2 . 128 d 2 = 2 . 645 r 3 = − 31 . 816 d 3 = 1 . 405 n d2 = 1 . 62004 υ d2 = 36 . 26 r 4 = − 4 . 551 d 4 = 0 . 141 r 5 = ∞ d 5 = 1 . 000 n d3 = 1 . 49782 υ d3 = 66 . 83 r 6 = ∞ d 6 = 0 . 300 r 7 = ∞ ( stop ) d 7 = 0 . 300 r 8 = 21 . 773 d 8 = 1 . 868 n d4 = 1 . 84666 υ d4 = 23 . 78 r 9 = 2 . 928 d 9 = 1 . 706 n d5 = 1 . 67003 υ d5 = 47 . 23 r 10 = − 4 . 366 f b / ih 3 . 116 sf 2 . 229 f / f 1 0 . 039 f b / d s - r 1 . 850 [ 0082 ] f 5 . 24 f no 2 . 80 ω 24 . 5 ° ih 2 . 30 f b 7 . 410 r 1 = 5 . 636 d 1 = 0 . 713 n d1 = 1 . 77250 υ d1 = 49 . 60 r 2 = 2 . 237 d 2 = 3 . 173 r 3 = − 101 . 818 d 3 = 1 . 729 n d2 = 1 . 62004 υ d2 = 36 . 26 r 4 = − 4 . 003 d 4 = 1 . 332 r 5 = ∞ d 5 = 1 . 000 n d3 = 1 . 49782 υ d3 = 66 . 83 r 6 = ∞ d 6 = 0 . 300 r 7 = ∞ ( stop ) d 7 = 0 . 300 r 8 = 13 . 366 d 8 = 0 . 600 n d4 = 1 . 84666 υ d4 = 23 . 78 r 9 = 2 . 78 d 9 = 2 . 069 n d5 = 1 . 67003 υ d5 = 47 . 23 r 10 = − 8 . 307 f b / ih 3 . 222 sf 2 . 316 f / f 1 0 . 385 f b / d s - r 2 . 496 [ 0083 ] f 5 . 54 f no 2 . 82 ω 23 . 3 ° ih 2 . 30 f b 7 . 614 r 1 = 6 . 559 d 1 = 2 . 177 n d1 = 1 . 77250 υ d1 = 49 . 60 r 2 = 2 . 542 d 2 = 2 . 698 r 3 = 328 . 8 d 3 = 1 . 516 n d2 = 1 . 62004 υ d2 = 36 . 26 r 4 = − 5 . 193 d 4 = 1 . 954 r 5 = ∞ d 5 = 1 . 000 n d3 = 1 . 49782 υ d3 = 66 . 83 r 6 = ∞ d 6 = 0 . 300 r 7 = ∞ ( stop ) d 7 = 0 . 300 r 8 = 15 . 038 d 8 = 0 . 600 n d4 = 1 . 84666 υ d4 = 23 . 78 r 9 = 3 . 494 d 9 = 0 . 400 r 10 = 5 . 095 d 10 = 1 . 540 n d5 = 1 . 67003 υ d5 = 47 . 23 r 11 = − 4 . 329 f b / ih 3 . 311 sf 2 . 266 f / f 1 0 . 131 f b / d s - r 2 . 681 [ 0084 ] f 4 . 75 f no 2 . 78 ω 21 . 5 ° ih 1 . 80 f b 6 . 873 r 1 = 4 . 556 d 1 = 1 . 276 n d1 = 1 . 77250 υ d1 = 49 . 60 r 2 = 1 . 809 d 2 = 3 . 257 r 3 = − 30 . 16 d 3 = 0 . 914 n d2 = 1 . 62004 υ d2 = 36 . 26 r 4 = − 3 . 519 d 4 = 0 . 695 r 5 = ∞ d 5 = 0 . 800 n d3 = 1 . 49782 υ d3 = 66 . 83 r 6 = ∞ d 6 = 0 . 240 r 7 = ∞ ( stop ) d 7 = 0 . 240 r 8 = 6 . 463 d 8 = 0 . 480 n d4 = 1 . 84666 υ d4 = 23 . 78 r 9 = 2 . 458 d 9 = 0 . 057 r 10 = 2 . 379 d 10 = 1 . 576 n d5 = 1 . 51633 υ d5 = 64 . 14 r 11 = − 5 . 579 f b / ih 3 . 818 sf 2 . 317 f / f 1 0 . 280 f b / d s - r 2 . 921 [ 0085 ] f 5 . 03 f no 2 . 81 ω 25 . 2 ° ih 2 . 30 f b 7 . 643 r 1 = 5 . 836 d 1 = 0 . 900 n d1 = 1 . 77250 υ d1 = 49 . 60 r 2 = 2 . 273 d 2 = 1 . 000 r 3 = ∞ d 3 = 3 . 800 n d2 = 1 . 62004 υ d2 = 36 . 26 r 4 = − 4 . 201 d 4 = 0 . 940 r 5 = ∞ d 5 = 1 . 000 n d3 = 1 . 49782 υ d3 = 66 . 83 r 6 = ∞ d 6 = 0 . 300 r 7 = ∞ ( stop ) d 7 = 0 . 300 r 8 = ∞ d 8 = 0 . 900 n d4 = 1 . 84666 υ d4 = 23 . 78 r 9 = 2 . 645 d 9 = 2 . 900 n d5 = 1 . 67003 υ d5 = 47 . 23 r 10 = − 4 . 07 f b / ih 3 . 323 sf 2 . 276 f / f 1 0 . 222 f b / d s - r 1 . 864 here the “ ih ” used herein is now explained . the “ ih ” represents a length that is half the diagonal length of an effective plane of the electronic image pickup device . fig6 is illustrative of the diagonal length of the effective image pickup plane of an electronic image pickup device . the “ effective image pickup plane ” used herein is understood to mean a certain area in the photoelectric conversion surface on an image pickup device used for the reproduction of a phototaken image ( on a personal computer or by a printer ). the effective image pickup plane shown in fig6 is set at an area narrower than the total photoelectric conversion surface on the image pickup device ( ccd or cmos ), depending on the performance of the optical system used ( an image circle that can be ensured by the performance of the optical system ). the diagonal length l of an effective image pickup plane , i . e ., the diagonal length l of the effective plane is thus defined by that of the effective image pickup plane . although the image pickup range used for image reproduction may be variable , it is noted that when the taking lens of the present invention is used on an imaging system having such functions , the diagonal length l of its effective image pickup plane varies . in that case , the diagonal length l of the effective image pickup plane according to the present invention is defined by the maximum value in the possible widest range for l . fig6 is illustrative of one exemplary pixel array for the electronic image pickup device , wherein r ( red ), g ( green ) and b ( blue ) pixels or four pixels , i . e ., cyan , magenta , yellow and green ( g ) pixels are mosaically arranged at a pixel spacing a . the present image pickup lens constructed as described above may be applied to electronic phototaking systems where object images formed through image pickup lenses are received at image pickup devices such as ccds for photo - taking purposes , inter alia , digital cameras or video cameras as well as portable telephones . given below are some such embodiments . [ 0088 ] fig7 and 9 are conceptual illustrations of a digital camera , in which the image pickup lens of the present invention is built . fig7 is a front perspective view of the outside shape of a digital camera 20 , and fig8 is a rear perspective view of the same . fig9 is a partly cut - away side view of the construction of the digital camera 20 . in this embodiment , the digital camera 20 is built up of a digital camera body 21 and a taking portion 22 wherein , indicated by a double arrow , the taking portion 22 is mounted on the camera body 21 in a vari - angle fashion . at the taking portion 22 , a taking lens 24 of the present invention including an entrance axis 23 is located together with a reflective member ( reflecting mirror ) 16 and an image pickup device ( ccd ) 15 . at the camera body 21 , a shutter 25 , a flash 26 , a liquid crystal display monitor 27 , etc . are located . as the shutter 25 mounted on the upper portion of the camera body 21 is pressed down while a subject indicated on the liquid crystal display monitor 27 is viewed , phototaking takes place through the taking lens 24 at the taking portion 22 , for instance , the taking lens according to example 1 . in this case , the angle of the camera body 21 with the taking portion 22 is freely settable . although not shown , a finder may or may not be located at the taking portion 22 . in this embodiment , the reflective member 16 is located in such a way that the short - side direction of the image pickup device 15 positioned at the image pickup plane of the taking lens 24 at the taking portion 22 is substantially parallel with the entrance axis 23 , so that the space for receiving the reflecting member 16 can be cut down . the thickness of the taking portion 22 in the direction of the entrance axis 23 is so large relative to the height direction that the size of the system in the height direction can be more reduced to slim down the system . in this embodiment , a shaft and other parts for the vari - angle mechanism may be located in a space on the back of the opposite surface , which is created by holding the image pickup device 15 back with respect to the entrance axis 23 , thereby increasing the degree of freedom in the layout of the whole electronic imaging system . [ 0092 ] fig1 and 11 are conceptual illustrations of a video camera in which the taking lens of the present invention is built . fig1 is a front perspective view of the outside shape of a video camera 30 , and fig1 is a partly cut - away top view of that video camera 30 . in this embodiment , the video camera 30 is built up of a video camera body 31 , and a liquid crystal display monitor 32 that is collapsible with respect to the camera body 31 during carrying and mounted at a controllable angle ( in a vari - angle fashion ). within the camera body 31 , a taking lens 34 having an entrance axis 33 according to the present invention is located together with a reflective member ( reflecting mirror ) 16 and an image pickup device ( ccd ) 15 , and processing means 37 for processing signals of a phototaken image and recording means 38 for recording such signals are incorporated . on the camera body 31 , a manipulation button 36 for manipulating the video camera 30 , a stereo - microphone 35 for capturing sounds , etc . are provided . as the manipulation button 36 is manipulated while a subject indicated on the liquid crystal display monitor 32 is viewed , phototaking occurs through the taking lens 34 , e . g ., the taking lens according to example 1 , and signals of a phototaken image are recorded in the recording means 38 via the processing means 37 . in this case , the angle of the liquid crystal display monitor 32 with the camera 31 is freely settable . although not shown , a finder may or may not be located . in this embodiment , the reflective member 16 is located in such a way that the long - side direction of the image pickup device 15 positioned at the image pickup plane of the taking lens 34 is substantially parallel with an entrance axis 33 , so that the degree of freedom in the layout of the imaging system can be increased . the thickness of the system in the direction of the entrance axis 33 is so large relative to the width direction that the size of the system in the width direction can be more reduced to slim down the system . fig1 ( a ), 12 ( b ) and 12 ( c ) are illustrative of a telephone set that is one example of the information processor in which the taking lens of the present invention is built in the form of a phototaking optical system , especially a convenient - to - carry cellular phone . fig1 ( a ) and fig1 ( b ) are a front and a side view of a cellular phone 40 , respectively , and fig1 ( c ) is a sectional view of a phototaking optical system 45 . as shown in fig1 ( a ), 12 ( b ) and 12 ( c ), the cellular phone 40 comprises a microphone 41 for entering the voice of an operator therein as information , a speaker 42 for producing the voice of the person on the other end , an input dial 43 via which the operator enters information therein , a monitor 44 for displaying an image taken of the operator or the person on the other end and indicating information such as telephone numbers , a phototaking optical system 45 , an antenna 46 for transmitting and receiving communication waves , and processing means ( not shown ) for processing image information , communication information , input signals , etc . here the monitor 44 is a liquid crystal display device . it is noted that the components are not necessarily arranged as shown . the phototaking optical system 45 comprises on a phototaking optical path 47 the taking lens according to the present invention , e . g ., the taking lens according to example 1 as well as a reflective member ( reflecting mirror ) 16 and an image pickup device ( ccd or c - mos ) 15 . these components are built in the cellular phone 40 . the phototaking optical system 45 is provided at its end with a cover glass 49 for protecting the taking lens . an object image received at the image pickup device 15 is entered via a terminal of the image pickup device 15 in processing means ( not shown ), so that the object image can be displayed as an electronic image on the monitor 44 and / or a monitor at the other end . the processing means also include a signal processing function for converting information about the object image received at the image pickup device 15 into transmittable signals , thereby sending the image to the person at the other end . in accordance with the arrangement shown in fig1 ( a ), 12 ( b ) and 12 ( c ), the size of the cellular phone in the height direction can be reduced . a specific layout for reducing the size of the cellular phone in the thickness direction , on the other hand , is shown in fig1 ( a ), 13 ( b ) and 13 ( c ) that are a front , a side and a sectional view of a modification to the cellular phone 40 , respectively . this cellular phone works as shown in fig1 ( a ), 12 ( b ) and 12 ( c ) excepting what is described below . in this embodiment , a light beam is incident on the side of the cellular phone 40 , and an optical path is bent by a reflective member ( reflecting mirror ) 16 in the thickness direction of the cellular phone 40 . in this way , the cellular phone 40 having a phototaking function can be slimmed down . this embodiment provides an additional favorable layout because an antenna 46 is located at a space on the back of the reflecting surface 16 . as can be understood from the foregoing , the present invention can provide an electronic imaging system and an image pickup optical system in which an electronic image pickup device is horizontally located to ensure the space needed for the location of a reflective member while height reductions , length reductions and cost reductions are all achieved . | 6 |
tissue engineering is an emerging area which utilizes collagen , collagenous tissues and cultured tissue cells to construct tissue equivalents which can be used to form graftable tissue . living tissue equivalents have been described extensively in many patents , including u . s . pat . nos . 4 , 485 , 096 ; 4 , 485 , 097 ; 4 , 539 , 716 ; 4 , 546 , 500 ; 4 , 604 , 346 ; 4 , 837 , 379 ; 5 , 374 , 515 and u . s . ser . no . 08 / 193 , 809 ; all of which are incorporated herein by reference . one successful application of a living tissue equivalent is called the “ living skin equivalent ,” which has a morphology similar to actual human skin . the living skin equivalent ( lse ) is composed of two layers : the upper portion is made of differentiated and stratified human epidermal keratinocytes that cover a lower layer of human dermal fibroblasts in a collagen matrix ( parenteau , et al ., j . of cellular biochemistry , 45 : 245 - 251 ( 1991 ); parenteau , et al ., cytotechnology , 9 : 163 - 171 ( 1992 ); and bell et al ., toxic . in vitro , 5 : 591 - 596 ( 1991 )). lse for grafting is under investigation in clinical trials for indications relating to partial and full thickness skin wounds : excision surgery , burns , venous stasis ulcers , diabetic ulcers , decubitus ulcers , and chronic inflammatory ulcers . the lse is a full - thickness , bilayered , in vitro engineered skin tissue . as used herein , the term “ cultured tissue equivalents ” means tissue equivalents of mammalian tissues , wherein the tissue equivalents are made by in vitro techniques and are meant to include monolayer skin equivalents , either a dermal equivalent or an epidermal sheet ; bilayered skin equivalents , particularly lse ; and trilayered cornea equivalents and skin equivalents . the morphology of the cultured tissue equivalents are similar to the in vivo mammalian organ , typically the human organ . for illustration , the morphology of the lse bears many similarities to human skin . metabolically and mitotically active human dermal fibroblasts ( hdf ) are found throughout the dermal layer of the construct , and have been shown to secrete collagen and other matrix components into the lattice . the epidermis consists of a basal layer shown to divide with a mitotic rate similar to that of human skin . the suprabasal epidermis shows the same strata as skin in vivo , with well defined spinous and granular layers containing keratohyalin and lamellar granules covered by a stratum corneum . immunohistochemistry demonstrates the presence of extracellular matrix components routinely found at the dermo - epidermal junction in normal human skin , such as laminin , type iv collagen and kalanin ( gb3 ). cryopreservation of living tissue equivalents has been described in u . s . ser . nos . 08 / 121 , 377 and 08 / 380 , 099 . cryopreservation protocols provide for long term storage and distribution of living tissue equivalents to burn centers and hospitals . the term ‘ autograft ’ is an autologous tissue or organ graft ; a graft that is transferred to a new position in or on the body of the same individual . cultured autografts are skin equivalents that are prepared from a patient &# 39 ; s own cells . the terms ‘ allograft ’ and ‘ homograft ’ can be used interchangeably and refer to a graft transplanted between genetically non - identical , or homologous , individuals of the same species . cadavers are a typical source of allograft material , whereas cultured allografts are skin equivalents that are prepared from donor cells of another individual . the living skin equivalent of the present invention is a bilayered cultured skin equivalent . the term ‘ meshing ’ is defined as a mechanical method by which a tissue is perforated with slits to form a net - like arrangement . meshing is preferably obtained by the use of a conventional skin mesher ( zimmer ®; bioplasty ®). one could also manually score or perforate a tissue with a scalpel or a needle . meshed skin may be expanded by stretching the skin so that the slits are opened and then applied to the wound bed . expanded meshed tissue provides a wound area with maximal coverage . alternatively , meshed skin may be applied without expansion ; simply as a sheet with an arrangement of unexpanded slits . autologous skin is in very short supply and is routinely expanded for maximal surface area coverage . cultured living skin equivalents are potentially in unlimited supply so there is no need to expand meshed skin equivalents for the purposes of conservation . ‘ mesh ratio ’ is defined as the difference of the expanded tissue as compared to its size before expansion . the length of the incisions determines the degree of expansion . tissue equivalents may also have perforations or fenestrations and pores provided by other means . fenestrations may be applied manually using a punch , scalpel , needle or pin . smaller and more uniform holes may be applied using a laser or by chemical etching . ‘ graft persistence ’ is considered the continuing existence of the graft in the wound area . ‘ graft take ’ is considered to be the incorporation of the graft to patient without immunological response . patients with burn injury or elective dermatological surgery undergo immunological testing of blood consisting of an hla antibody screen and the presence of bovine collagen antibodies . for burn indications , the burned wound sites to be grafted are to be prepared for the graft according to standard practice so that the burned skin area is completely excised . excised beds will appear clean and clinically uninfected prior to grafting . for deep partial thickness wounds due to surgical excision , the preoperative area is shaved , if necessary , cleansed with an antimicrobial / antiseptic skin cleanser ( hibiclens ®) and rinsed with normal saline . local anesthesia usually consists of intradermal administration of lidocaine / epinephrine . once anesthesia is accomplished , a dermatome is used to remove skin to an appropriate depth , creating a deep partial thickness wound . hemostasis can be achieved by compression with epinephrine containing lidocaine and by electrocautery . this target site for grafting of lse may either be directly on the excised wound bed or over meshed autograft that has been expanded at a ratio preferably between 1 : 1 and 3 : 1 , more preferably at a ratio between 1 : 1 and 1 . 5 : 1 . the lse should be removed from its carrier using aseptic technique , cut , if necessary , to the appropriate graft size to fit to the excised wound . the lse is then meshed , preferably by use of a meshing apparatus . the mesh ratio of lse should be preferably between 1 : 1 and 3 : 1 , more preferably at a ratio between 1 : 1 and 1 . 5 : 1 . the graft is applied to the wound bed and may be held in place by either staples or sutures and covered with an appropriate dressing . primary wound dressing should be one that is nonadherent to the lse graft site to prevent adherence of the lse . secondary dressings may include absorbent dressings and / or pressure wraps , depending on the indication . appropriate post - operative care will be provided to the patient in examination , cleaning , changing bandages , etc . of the grafted wounds . a complete record of the condition of the grafted sites will be maintained to document all procedures , necessary medications , frequency of dressing changes and any observations made . physical and occupational therapy is done at the investigator &# 39 ; s determination of patient need . meshing the lse prior to grafting allows for the ability greater conformability of the graft to the contours of the patient being grafted . the slits allow for the graft to remain fixed to the wound bed as they are able to open and shift with the patient &# 39 ; s body movements without stressing or disrupting the adhered portions of the graft . meshed grafts allow for better drainage post - operatively by preventing the accumulation of fluid , thus reducing the risk of infection . without preoperative meshing , the graft site may require a technique known as “ pie crusting ” whereby a needle or a scalpel is used to perforate a sheet graft in order to allow for drainage to occur in the event of fluid accumulation . clinical evidence shows that the cultured skin substitutes do provide benefit to the patient . it is postulated that cytokines and growth factors from constituent fibroblasts and keratinocytes may be likely candidates for any success in wound healing . production of tgf - β and il - 8 have been implicated in playing key roles in wound repair . also , better penetration of topical antibacterials and antifungals to the underlying wound is possibly obtained through the mesh . in skin graft applications , the cosmetic result is improved , thus raising the standard of care for these indications . many investigators believe that skin allografts cannot persist for more then 7 days and that their benefits are limited at best . macroscopic evidence from clinical trials suggests that cultured skin substitutes might persist longer than previously thought . dna analysis confirms prolonged persistence of the cultured skin graft . the meshing of a cultured skin equivalent provides a number of unexpected benefits . tissue equivalents derived from collagen and collagenous tissues are described in u . s . pat . nos . 5 , 106 , 949 , 5 , 256 , 418 and 5 , 378 , 469 and u . s . ser . nos . 08 / 177 , 618 , 08 / 215 , 760 and 08 / 417 , 868 , all of which are incorporated herein by reference . preclinical studies have been done for a vascular tissue equivalent , described in u . s . ser . no . 08 / 177 , 618 , for use as a blood vessel replacement . in the construction of the prosthesis , pores are provided to the construct by use of a laser . the structural layer is made of intestinal collagen layer ( icl ) which is wrapped around a mandrel a number of times , preferably 2 or 3 times , to form a tubulated icl construct . a thin layer of bovine type - i dense fibrillar collagen ( dfc ) is then applied to the icl . methods for dfc deposition are described in u . s . pat . no . 5 , 256 , 418 . the construct is then crosslinked , preferably by edc , and the completed two or three layer prosthesis which laser drilled to create micron sized transluminal pores through the completed prosthesis for aid in cell ingrowth using an excimer laser at either krf or xef wavelengths . the pore size can vary from 5 to 60 microns , but is preferably less than 20 microns . spacing of the pores can vary , but about 500 microns on center is preferred . sterilization of collagen and collagenous tissues is disclosed in u . s . ser . no . 08 / 177 , 618 . the following examples are provided to better elucidate the practice of the present invention and should not be interpreted in any way to limit the scope of the present invention . those skilled in the art will recognize that various modifications can be made to the methods described herein while not departing from the spirit and scope of the present invention . the lse was removed from its carrier using aseptic technique and cut , if necessary , to the appropriate graft size to fit the excised wound . the zimmer ® skin graft carrier was aseptically removed from its sterile package and placed smooth side up on the table . the lse was placed on the carrier and spread evenly along the surface of the carrier . the hinged handle of the mesher was locked and closed prior to inserting the carrier . the carrier with the lse was then placed on the guidance plateau of the zimmer ® skin graft mesher with the surface of the lse facing up . the tracks on the bottom of the carrier were aligned with the guidance plateau to ensure straight entry into the gap between the cutter and knurled roller . the leading edge of the carrier was introduced firmly between the cutter and the roller to make sure that it was straight . the ratchet handle was slowly rotated back and forth , from the 10 o &# 39 ; clock to 2 o &# 39 ; clock position , to mesh the living skin equivalent . once meshed , the living skin equivalent was applied to the patient . patients with burn injury were entered into the burn study once he / she had fulfilled all criteria and passed all pre - graft examination for entry . 37 patients were grafted with meshed lse over meshed autograft . lse was applied only to wounds that had treatment within 7 days of burn injury ; and , applied only to a primary site , not to a wound bed which had previously undergone regrafting . patients with burn wound ( s ) requiring grafting were selected , and target treatment sites for placing up to 2 lse of 4 inch × 8 inch size were identified . lse were either placed directly on the excised wound bed or over meshed autograft expanded at a ratio of 2 : 1 or more . if the treatment site was lse directly on the wound bed , then the control site was either autograft or allograft . if the treatment site was lse over meshed autograft , then meshed autograft alone or covered with allograft served as the control . test sites and control sites of meshed autograft were expanded to the same extent . lse and allograft , when used , were of the same mesh ratio . target treatment and control sites were randomized to left / right and top / bottom . the burned wound sites to be grafted were prepared for the graft according to standard practice so that the burned skin area was completely excised . excised beds appeared clean and clinically uninfected . the lse was removed from its carrier using aseptic technique and cut , if necessary , to the appropriate graft size to fit the wound area . the lse and allograft were then meshed separately using the method described in example 1 . the meshed lse was placed dermal side down , unexpanded , over the autograft . the wound was appropriately dressed according to the burn units standard procedure , typically including mesh gauze , petrolatum coated gauze or the dressing . appropriate post - operative care was provided to the patient in examination , cleaning , changing bandages , etc . of the grafted wounds . a complete record of the condition of the grafted sites was maintained to document all procedures , necessary medications , frequency of dressing changes and any observations made . physical and occupational therapy was done at the investigator &# 39 ; s determination of patient need . a human full - thickness surgical excision wound model was used to evaluate lse . patients who elected voluntary dermatological surgery were enrolled once he / she had fulfilled all criteria and passed all pre - graft examination for entry . in this study , 15 patients were enrolled ; 5 patients received meshed lse and 10 received lse that was fenestrated manually with a scalpel . the pre - operative area was cleansed with an anti - microbial / antiseptic skin cleanser ( hibiclens ®) and rinsed with normal saline . deep partial thickness wounds were made in the skin due to surgical excision of a tattoos . the lse was removed from its carrier using aseptic technique and cut , if necessary , to the appropriate graft size to fit the excised wound . lse were meshed according to example 1 . once hemostasis was complete , lse were either placed unexpanded , dermal side down , directly on the excised wound bed . silver sulfadiazane cream ( ssd ) 1 % was applied covering the entire treatment area . xeroform ™ gauze dressing was layered above the ssd cream extending at least 1 cm beyond the wound margin . surgical staples were then placed peripheral to the wound margin securing the xeroform ™ to the surrounding normal skin . a foam bolster cut to the shape of the surgical wound was coated with bacitracin zinc ointment . using the surgical clips as an anchor , surgical 3 - 0 onylon was tied over the bolster , securing it to the wound . the bolster was then covered with sterile 4 inch × 4 inch surgical sponges and adhered with tape or a cohesive bandage . this bolster and bandage remained undisturbed for 1 week and was only removed by the investigator or designated staff at the first follow - up visit . subjects were instructed to prevent shearing of the graft and to keep prolonged pressure off the graft . appropriate post - operative care was provided to the patient in examination , cleaning , changing bandages , etc . of the grafted wounds . efficacy was determined at 1 week , 2 weeks , 1 month , 3 months and 12 months post - graft using acetate tracings , serial photography and assessment of graft persistence . a complete record of the condition of the grafted sites was maintained to document all procedures , necessary medications , frequency of dressing changes and any observations made . preliminary data showed that lse behaved like a skin graft on patients with deep dermal wounds by gradually becoming integrated into the patient &# 39 ; s own skin tissue . the use of ssp - pcr hla ( sequence specific primer - polymerase chain reaction human lymphocyte antigen ) analysis to detect donor cells in a graft biopsy has been applied to allografts of cultured skin substitutes to address persistence . a method using sequence specific primers for a33 hla class i gene , was used to determine whether or not allograft survival was longer than previously thought . human patients in the study were grafted with meshed lse . at time points 6 days and 13 days after grafting , a biopsy was taken . cadaver skin was obtained from the new york firefighters skin bank ( new york , n . y .). serological typing was performed by brigham and women &# 39 ; s hospital tissue typing facility . dna was extracted from the punch biopsy and processed . pcr was carried out using primers that were previously developed for hla subtypes a33 and b53 / 35 . the sequences for the a33 specific primers were gagtattgggaccggaac and gcgcaggtcctcgttcaa . the pcr was carried out in 50 μl volumes containing : 17 mm ammonium sulfate ; 67 mm tris ph 8 . 0 ; 6 . 7 mm edta ; 0 . 017 % bovine serum albumin ; 200 μm dntp &# 39 ; s ; 2 mm mgcl 2 ; 0 . 2 μm of each primer and 0 . 1 μg of target dna . the reaction mix was denatured at 95 ° c . for 5 min . and 1 unit of amplitaq ( perkin elmer cetus ) was added . the amplifications were carried out in a perkin elmer thermocylcer 480 with thin wall tubes . the cycle used was : 1 min . at 95 ° c . ; 1 min . at 55 ° c . ; and 1 min . at 72 ° c . for 30 cycles . pcr products were separated on a 2 % agarose gel containing 0 . 5 μg of ethidium bromide . gels were run for 30 min . at 120 v in 1 × tae buffer ( 40 mm tris base , 20 mm glacial acetic acid , 2 mm edta ph 8 . 0 ) and the dna was visualized by uv illumination and photographed . the sequences for b53 / 35 specific primers were ggagtattgggaccggaac and gccatacatcctctggatga . the pcr was carried out in 50 μl volumes containing : 100 mm tris ph 8 . 3 ; 500 mm kcl ; 200 μm dntp &# 39 ; s ; 1 mm mgcl 2 ; 1 μm of each primer and 0 . 1 μg of target dna . the reaction mix was denatured at 95 ° c . for 5 min . and then 1 unit of amplitaq ( perkin elmer cetus ) was added . the amplifications were carried out in a perkin elmer thermocylcer 480 with thin wall tubes . the cycling was carried out as follows : 1 min . at 95 ° c . ; 1 min . at 60 ° c . ; and 1 min . at 72 ° c . for 30 cycles . pcr products were separated on a 2 % agarose gel containing 0 . 5 μg of ethidium bromide . gels were run for 30 min . at 120 v in 1 × tae buffer ( 40 mm tris base , 20 mm glacial acetic acid , 2 mm edta ph 8 . 0 ) and the dna was visualized by uv illumination and photographed . the resulting bands were sequenced ( sequetech , calif .) directly from pcr and comparison were made between lse vs . patient day 13 product to confirm that we were indeed amplifying hla - a33 sequences the specificity of the primers for hla - a33 was tested against a panel of serologically typed individual or volunteers , lse and a sample of cadaver skin . patient 2 and lse dna was found to be a33 positive while patient 1 , 3 and cadaver skin were negative . individual 2 type had previously been shown to be hla - a33 positive by serological typing techniques . this confirmed the primers were specific . after establishing a source of cadaver skin dna that was hla - a33 negative by pcr analysis , different quantities of cadaver skin dna and lse dna were mixed . as little as 1 μg of lse dna in 99 ng of cadaver skin dna , could be detected by this method . this indicates that as long as 1 % of the biopsy was lse it could be detected . the hla b53 / 35 were shown to detect lse at greater than 25 % of the biopsy . the pcr of the patient biopsies were performed . dna was isolated from each patient &# 39 ; s peripheral blood leukocytes ( pbl ) as a control . dna from lse , patient pbl &# 39 ; s day 7 and day 13 biopsies were analyzed by ssp - pcr - hla using hla - a33 primers . the patient &# 39 ; s peripheral blood leukocytes were negative while the biopsies of the grafted area proved positive at both time points . pcr was performed again and the resulting bands from lse and the day 13 biopsy were sequenced . the sequences match exactly . pcr was also performed , in a like manner as given in the above paragraph , using primers specific for hla b53 / 35 . this primer set can not distinguish between b53 and b35 , however the patient was negative for both these hla types . the results matched the a33 results . persistence of allografts remains has been found to persist out to 13 days with evidence suggesting persistence out to 21 days . porcine intestine was harvested , mechanically stripped , and decontaminated , leaving a strong , predominantly type - i collagenous icl layer . the icl was wrapped around a mandrel of the appropriate diameter , heat welded and lightly crosslinked with a water soluble carbodiimide ( edc ). a thin layer bovine type - i dense fibrillar collagen ( dfc ) coated with benzalkonium chloride heparin was then applied to provide a smooth flow surface . laser drilled 35 micron transluminal holes were made through the prepared grafts using a krypton fluoride ( krf ) laser as shown in fig1 a and 1b . the hole pattern was 500 microns on center . the grafts were peracetic acid sterilized as described in u . s . ser . no . 08 / 177 , 618 and packaged for use . the effect of laser drilled holes on the remodeling of a laser drilled vascular graft prosthesis eight laser - drilled prostheses ( 6 mm diameter × 8 cm long ), as described in example 5 , were implanted as an interposition graft in canine aorta . grafts were harvested at 30 days , 60 days , and 90 days post implantation . sections of each graft were processed histologically to determine the amount and type of cellular ingrowth and remodeling . at 30 days , vascular ingrowth to the lumen was seen throughout the laser drilled grafts , endothelial cells were seen spreading out from those capillaries covering the midsection of the graft , as shown in fig2 . by 60 days , the graft was seen to be completely covered with a confluent endothelial layer . in addition to the transmural migration of endothelial cells , the icl and dfc collagens were seen to be remodeling faster throughout the graft due to the increased presence of smooth muscle cells within the wall of the graft . a meniscus replacement was designed for a preclinical study using sheep . icl was mechanically processed and sterilized by the peracetic acid process described in u . s . ser . no . 08 / 177 , 618 . icl layers were prepared by trimming lymph tags , splitting the tube down the tag side and removing excess moisture . the inner segment was prepared by layering 3 pieces of icl approximately 4 inches then rolling tightly about the long axis to form a solid cylinder . the cylinder was trimmed to about 2 inches . the outer segment was prepared by rolling a single 6 inch length over the cylinder for at least two revolutions , the excess on each end was twisted tight . the sample was curved to fit a specially designed stainless steel meniscus template such that the exposed seam was external to the curve . the sample was clamped between two meniscus templates and heat welded , as described in u . s . ser . no . 08 / 417 , 868 , at 62 ° c . for 55 ± 5 minutes . the sample was quenched in a 4 ° c . water bath for 10 minutes prior to crosslinking by submersion in 100 mm ethyl - 3 -( 3 - dimethylaminopropyl ) carbodiimide hydrochloride ( edc ) overnight . the outer edge of the curved portion was punctured with an 18 gauge sharp tip needle to a maximum depth without penetrating the inner wall of the curve . punctures were placed at 4 mm intervals along the entire length of the outer curve . the prostheses were then sterilized by cold peracetic acid process . a meniscus replacement was designed for a preclinical study using sheep . a 3 - bar woven fabric ( 0 - 1 / 1 - 0 , 1 - 0 / 4 - 5 , 4 - 5 / 1 - 0 ) of 3 - ply 150 denier collagen yarn was prepared as described in u . s . pat . no . 5 , 378 , 469 and u . s . ser . no . 08 / 215 , 760 . the fabric underwent consecutive washes in acetone and water was then air dried flat under weight . lengths of 4 . 5 cm by 4 cm were wet and rolled tightly about the long axis . the sample was secured with split tubing and dried under a cool air flow . an outer sheath of icl was added by wrapping a 6 inch length of icl over the fabric roll for two revolutions , allowing the extra icl on the ends wrap about itself . the sample was curved and dried such that the exposed seam was on the outside of the curve . the sample was heat welded , as described in u . s . ser . no . 08 / 417 , 868 , at 62 ° c . for 2 hours , then quenched in a 4 ° c . water bath for 10 minutes . the sample was then crosslinked by submersion in 100 mm 1 - ethyl - 3 -( 3 - dimethylaminopropyl ) carbodiimide hydrochloride overnight . the outer side of the curve was punctured with an 18 gauge sharp tip needle to a maximum depth without penetrating the inner wall of the curve . punctures were placed at 4 mm intervals along the entire length of the outer curve . the prostheses were then sterilized by cold peracetic acid process . in the description and examples given above , the referenced u . s . patents and pending patent applications are all incorporated herein by reference . further , although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding , it will be obvious to one of skill in the art that certain changes and modifications may be practiced within the scope of the appended claims . | 0 |
a quality control device 10 , constructed in accordance with a preferred embodiment of the present invention , is shown in fig6 . as will be discussed in detail below , the device , hereafter referred to as a four - dimensional computed tomography quality assurance device ( or “ 4d ct qa device ”) 10 , may be used in a preferred embodiment to calibrate , confirm and / or test the accuracy of motion - correlated ct systems that acquire 3 - dimensional image data . referring to fig1 and 6 : a four - dimensional computed tomography quality assurance ( 4d ct qa ) device 10 comprises a test apparatus sub - assembly 12 , which comprises a test cylinder 14 and a test rod 16 , as illustrated in fig1 . test rod 16 is disposed inside of test cylinder 14 . preferably , test rod 16 is both axially and rotationally moveable within test cylinder 14 . the test apparatus sub - assembly 12 has at least two sets of ct markers (“ fiducials ”) 18 and 20 , which are located in the test cylinder 14 and the test rod 16 , respectively . in operation , since test rod 16 is moveable within test cylinder 14 , the two sets of fiducials 18 and 20 are moveable relative to each other . more specifically , fiducials 18 are operationally static ( and are , therefore , referred to herein below as “ static fiducials ” 18 ); and fiducial 20 is operationally moveable ( and is , therefore , referred to herein below as the “ moveable fiducial ” 20 ). referring now to fig2 and 3 : test cylinder 14 is preferably constructed of a solid material such as acrylic . by way of example , in the preferred embodiment of the invention , the test cylinder 14 is 170 mm long , has outside diameter of 2 . 5 inches and an inside diameter of 1 . 75 inches . a cylinder collar 15 , approximately 1 . 75 inches square by 0 . 25 inches thick , is attached to one end of the test cylinder 14 . the inside surface 14 a of the test cylinder 14 extends through the cylinder collar 15 . the outside diameter d 2 of test cylinder 14 is preferably sized so as to allow the outside ( cylindrical ) surface 14 b of test cylinder 14 to slip fit inside of a corresponding opening 30 in a phantom body 32 ( as will be described more fully herein below ). a matrix of holes 28 is located intermediately along test cylinder 14 . in the preferred embodiment of the invention , each of the holes is radially oriented with respect to the longitudinal axis of test cylinder 14 , although the holes 28 may , alternatively , be aligned parallel to each other . in the preferred embodiment of the invention , seven radially spaced apart rows of seven holes 28 each are counterbored into the wall of test cylinder 14 as shown in fig2 and 3 . by way of example , in the preferred embodiment of the invention each hole 28 is approximately 1 mm diameter by 8 . 5 mm deep , so as each to accommodate a 1 mm by 5 mm steel fiducial 18 and adhesive ( not shown ). the seven rows of holes 18 are preferably radially spaced 5 . 0 degrees apart ( center to center ); and adjacent holes within each row are preferably spaced apart 5 . 0 mm ( center to center ). referring now to fig4 and 5 : test rod 16 is preferably constructed of a solid material such as abs , polyethylene or acrylic . by way of example , in the preferred embodiment of the invention , test rod 16 is 175 mm long and has a 30 mm diameter shaft 16 a extending between a test rod distal shoulder 16 b and a test rod proximal shoulder 16 c . the test rod distal shoulder 16 b is preferably 20 mm thick and has an outside diameter d 1 that is sized so as to slip - fit into the inside surface 14 a of the test cylinder 14 . an approximately 1 mm diameter by approximately 5 . 5 mm deep hole 22 extends radially inwardly from the cylindrical surface of the test rod base 16 b so as to accommodate a 1 mm diameter by 5 mm steel fiducial 20 and adhesive ( not shown in fig5 ). it will be understood that , in the preferred embodiment of the invention , the spaced - apart proximal shoulder 16 c and distal shoulder 16 b facilitate maintenance of alignment of text rod 16 inside of test cylinder 14 . a counterbored hole 24 is preferably provided in the end of test rod proximal shoulder 16 c for attachment of test rod 16 to a motion actuator assembly 38 . referring now to fig6 : in the preferred embodiment of the invention , the test apparatus sub - assembly 12 is designed to be used in conjunction with a dynamic phantom system ( such as the one described in u . s . pat . no . 7 , 151 , 253 , which is included herein by reference thereto ), comprising a tissue equivalent phantom body 32 ; a motion actuator assembly 38 ; and a motion controller assembly 40 . the tissue equivalent phantom body 32 is preferably secured to a phantom base member 33 , which is preferably attached to an assembly base 34 . the motion actuator assembly 38 is supported from the assembly base 34 by actuator support fixture 35 . in the preferred embodiment of the invention , the tissue equivalent phantom body 32 is provided with a pair of through - holes 30 and 30 a each of which is a diameter adapted to slideably receive the outside surface 14 b of test cylinder 14 . as described in referenced u . s . pat . no . 7 , 151 , 253 , one of the through holes 30 in the tissue equivalent phantom member 32 preferably runs longitudinally through the phantom approximately parallel to the axis of the phantom ; and the other through hole 30 a is preferably oriented not parallel to the axis of the phantom . in the preferred embodiment of the present invention , motion actuator assembly 38 comprises a moveable actuator rod 42 . actuator rod 42 is attached , ( for example , by threaded engagement ) to test rod proximal shoulder 16 c at counterbored hole 24 . in operation , a motion controller assembly 40 electrically sends signals to motion actuator assembly 38 , which causes actuator rod 42 to oscillate axially and / or rotationally , which causes test rod 16 to slideably move inside of test cylinder 14 . as test rod 16 oscillates inside of test rod 16 , moveable fiducial 20 inside of test rod 16 moves relative to static fiducials 18 inside of test cylinder 14 . in the preferred embodiment of the invention , cylinder collar 15 is in a plane perpendicular to the axis of cylinder 14 , as shown in fig3 . the cylinder collar 15 provides a physical stop for proper insertion of the test apparatus sub - assembly 12 into opening 30 in phantom body 32 . in alternative embodiments of the invention , cylinder collar 15 can be omitted . an exemplary method of using the 4d ct qa device 10 to calibrate , confirm and / or test the accuracy of a motion - correlated ct system that acquires 3 - dimensional image data is described . in response to predetermined signals from motion controller assembly 40 , test rod 16 ( and , therefore , fiducial 20 ) moves periodically ( so as to mimic , for example , breathing motion ) a known distance ( excursion , displacement ) relative to the static fiducials 18 at any given direction , for example anterior - posterior ( ap ), left - right ( lr ) and / or inferior - superior ( is ) or rotationally . the range of motion of test rod 16 is preferably set so that the location of moving fiducial 20 and the location of static fiducials 18 match at the maximum excursion of the test rod 16 . a motion - correlated 4d ct scanner may then acquire and sort images of the moving 4d ct qa device 10 at different motion phases . zero percent and 50 % phases should , preferably , each provide an image wherein the static and moving fiducials 18 and 20 are positioned next to each other . any difference observed and measured between the positions of the static and moving fiducials 18 and 20 , on the static images generated by the 4d ct system , will be indicative of the accuracy ( or lack thereof ) of the 4d ct system &# 39 ; s performance . alternatively , if the range of motion of the test rod 16 is initially set up so that the positions of fiducials 18 and 20 do not match ( i . e ., are not in alignment with one another ) at the maximum excursion , then the distance between the fiducials 18 and 20 can be measured in a static ct ( without motion ), and the generated images of the 4d ct phases should be evaluated against the known static position of the fiducials 18 and 20 . the above example describes a preferred embodiment of the invention that is particularly well suited for calibrating 4d ct systems . i should be understood , however , that modified embodiments of the invention are equally well suited for use in calibrating other medical imaging apparatus , including positron emission tomography ( pet - ct ), magnetic resonance imaging ( mri ) and ultrasound imaging , regardless of the nature of the imaging system that the present invention is to be used to calibrate , in each case the static fiducials 18 comprise discontinuities in the test cylinder 14 ; and the moveable fiducial 22 comprises a discontinuity in the test rod . thus , for ct applications it is desirable that the fiducials 18 and 22 , have different mass densities and / or radiopacity than that of the material of construction of test cylinder 14 and test rod 16 ; and , for mri applications it is desirable that the fiducials 18 and 22 , have different t 1 and t 2 values than that of the material of construction of test cylinder 14 and test rod 16 , so that the magnetic resonance “ signature ” of the fiducials is distinctive from the test rod and test cylinder . for mri applications , for example , the material of construction of test cylinder 14 and test rod 16 may be acrylic , and the fiducials 18 and 22 may be a paramagnetic material such as ferrous oxides , nickel chloride or copper sulfate . while certain advantageous embodiments have been chosen to illustrate the invention , it will be understood by those skilled in the art that various changes and modifications can be made therein without departing from the scope of the invention . for example : the test apparatus sub - assembly 12 can be used in conjunction with a motion actuator assembly , but without insertion of the sub - assembly 12 into a tissue equivalent phantom member ( such as phantom body 32 ); the tissue equivalent phantom body 32 can have one or more through holes ( 30 , 30 a ) for receiving the test apparatus sub - assembly 12 ; and those holes may be oriented either parallel to or not parallel to a major axis of the phantom member ; the motion actuator assembly 38 may be designed to cause the actuator rod 42 ( and , therefore , the test rod 16 ) to move axially or rotationally , or both ; in embodiments of the invention wherein the motion actuator assembly 38 doesn &# 39 ; t cause the actuator rod 42 ( and , therefore , the test rod 16 ) to move rotationally , the cross - sectional geometry of the test rod distal shoulder 16 b , and the cross - sectional geometry of the inside surface 14 a of the test cylinder , can each be of a shape other than circular , provided the two are substantially the same shape ; the number , size , spacing and shape of the holes 28 in the test cylinder 28 can be other than those described for the preferred embodiment of the invention ; the “ fiducials ” 18 and 20 that are inserted into the holes 28 and 22 in the test cylinder 14 and test rod 16 , respectively , may be of any material having a density different from that of the test cylinder 14 and test rod 16 ; the holes 28 and 22 in the test cylinder 14 and test rod 16 , respectively , may alternatively be left empty , so that the “ fiducials ” comprise only air , which , being of a different density than that of the material of the test cylinder and test rod , may render the holes , themselves , as visible markers on static ct images of the apparatus ; the matrix of holes 28 ( as well as the fixed fiducials 18 inserted therein ) may be aligned so that their respective axes are parallel to each other , or , alternatively , so that their respective axes are each oriented radially with respect to the longitudinal axis of the test cylinder 14 ; use of the device 10 is not limited to use in conjunction with computed tomography ( ct ) systems , but may be used in a substantially similar manner to provide quality assurance data in other medical imaging systems , including pet , mri and ultrasound systems ; although the matrix of holes 28 comprise blind ( i . e ., counterbored ) holes into which fiducials 18 may be inserted , the holes may alternatively be through - holes that extend from the outside surface 14 b to the inside surface 14 a of the test cylinder 14 ; various common attachment means , other than by threaded engagement at counterbored hole 24 , may be used for connecting the proximal end of the test rod 16 to a motion actuator 38 ; means , such as treaded fasteners or pins extending , for example , through collar 15 may be provided in order to secure test cylinder 14 to phantom body 32 ; the test rod 16 may be constructed without a distal shoulder 16 b and proximal shoulder 16 a , provided that the test geometry of the test rod conforms with ( and slip fits with ) the geometry of the inside surface 14 b of the test cylinder in the proximity of the moveable fiducial 20 ; and , the material of construction of test rod 16 and test cylinder 14 may be other than abs , polyethylene or acrylic , provided such material is substantially transparent to the imaging equipment ( e . g ., ct , pet , mri , and ultrasound ) that it is to be used to calibrate ; the fiducials 18 , 20 may comprise a gas ( i . e ., air ), a liquid , solid or gel material ; the fiducials 18 , 20 may extend from the outside surfaces of the test cylinder 14 and test rod 16 , respectively , or they may be imbedded inside the test cylinder 14 and test rod 16 , respectively . accordingly , the scope of the invention should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents . | 0 |
in fig1 of the drawings , together with figures 2 - 4 thereof , there is disclosed a wire roller apparatus 10 made in accordance with the present invention . the apparatus is removably attached to a tractor 12 , such as for example a john deer model 70 tractor having the illustrated three point hitch associated therewith . the three point hitch includes spaced lifting arms 14 and 16 which are operatively connected to the illustrated trailing hitch arms 15 and 17 . the trailing terminal end of the hitch arm is provided with attachment members in the form of journals 18 and 19 by which the three point hitch can be connected to any number of different farm implements , including the present invention , as will be more fully understood as this entire disclosure is more fully digested . the wire roller apparatus of the present invention includes a drum shaft 20 which is rotatably supported at one end thereof by a support strut 22 . a wire guide support assembly 24 is arranged parallel respective to the shaft 20 and laterally respective to a tie bar 26 . drum 28 is of a size to receive a considerable quantity of rolled up slick or barbed wire thereon . hydraulic motor 30 is of conventional design and is connected for rotating one end of shaft 20 . the housing of the motor is fixed respective to the support strut ; and , the rotor , or power output shaft of the motor , is preferably directly connected to the terminal end of shaft 20 . the wire guide support assembly includes a pair of gate posts 32 which are more or less parallel to one another and vertically disposed in perpendicular relationship respective to the shaft 20 . the gate posts each support a swinging spring loaded drag plate 34 therefrom , with the marginal adjacent vertical edges of the drag plates overlapping one another when pivoted into the folded configuration . a wire guide 36 is disposed rearwardly of the gate post and provides a window through which a strand of wire extends . a control handle 38 is attached to the upper end of the gate posts and extends into an accessible area respective to the tractor driver . the control handle enables the operator to move the sliding assembly 31 along the support member 24 . in fig2 of the drawings , numeral 39 indicates the trailing marginal end of the support strut . a corner post 40 ties the support member 24 into the terminal end of the strut . the strut is bent at 42 to accomodate the forward marginal length 44 thereof continuing at an obtuse angle respective to marginal portion 39 . a hangar 46 , which includes chain 48 and threaded coupling member 50 , removably affixes the forward end of the strut to a medial length of the tractor hitch arm . a control valve 52 is mounted to the supply hose of the hydraulic motor 30 and controls the flow of hydraulic fluid through flexible pipes 54 . numeral 56 indicates the tractor hydraulic connector box to which quick disconnects are provided so that the terminal ends of flexible piping 54 can easily be connected and disconnected , in a manner known to those skilled in the art . in fig2 a fastener 58 secures a slidable member 60 respective to the support member 24 . journal 62 rotatably receives shaft 20 in a telescoping manner therethrough and in low friction relationship therewith . a large washer and pin assembly 64 prevents the end 18 of the three point hitch from being unfastened respective to the marginal outer end of the shaft . drum hub 66 is fixed respective to shaft 20 so that the drum is rotated therewith . numeral 68 indicates a bearing hub which journals shaft 20 to the strut 44 , and additionally supports the housing of motor 30 respective to the strut so that the motor output shaft can be directly coupled to the end of shaft 20 , with the motor housing being affixed in attached relationship respective to the strut . numeral 70 indicates the springs by which the drag plates 34 are biased towards one another . in operation , the wire roller apparatus 10 is connected to a three point hitch 12 of a conventional farm tractor by removing tie bar 26 and wire drum 28 from shaft 20 , and thereafter inserting the shaft 20 through the support journal 19 of the tractor hitch arm . chain 48 is looped around the tractor hitch arm 17 and made fast with the threaded fastener means 50 , thereby rigidly affixing the strut 22 to one of the tractor hitch arms . the drum is telescoped over the shaft 20 and fastened at 66 , the tie bar 26 is slidably positioned about shaft 20 and member 24 , after which fastener 58 is made up . next the tractor hitch arm 15 is telescoped over the marginal remaining end of the shaft 20 , and the washer and pin at 64 are made up . the entire apparatus can now be elevated as may be required by the three point hitch . the hydraulic flexible hoses 54 are plugged into the tractor hydraulic connector box . valve 52 is adjusted to provide the desired torque on shaft 20 so that the wire received about the drum is placed under any selected tension desired for attaining any particular tautness . in building fences , it is convenient to wind four or five rolls of barbed wire onto the drum to obviate the laborious manual handling of the individual rolls of barbed wire out in the field . this enables the rolled up wire to be transported to the fence line by the tractor , where one end of the wire is tied to the first fence post , and the tractor is next driven down the fence row with the hydraulic motor exerting sufficient torque on the shaft to place the wire under sufficient tension to prevent the wire from becoming entangled in weeds , brush and small trees which may lie along the fence line . the tractor preferably is parked parallel to the fence line , with sufficient tension exerted on the wire by the motor driven wire drum to enable one man to walk back down the fence line , hammering the fasteners which hold the wire into the post . when it is desired to roll used wire onto the drum , such as removing an old fence , the end of the wire is placed through the wire guide 36 and drag plates 32 , and fastened to the drum surface . with the tractor parked in neutral gear , and the engine running at idle speed , the operator begins to slowly manipulate valve 52 with his left hand until the drum turns at the desired speed . with his right hand on handle 38 , he can move the entire sliding assembly 31 longitudinally back and forth on member 24 , keeping the wire level as it builds up on the drum . the operator is positioned at a safe distance from the revolving drum and incoming wire , and controls the power being applied to the drum with the by - pass valve 52 , making this invention much safer than machines with positive power supplies such as gear drives , pto shafts , chain drives , and the like . the drag plates 34 are spring loaded and can be jointly pivoted into a position towards the drum when wire is being rolled thereon , and pivoted away from the drum when the wire is being pulled from the drum . the free edge of the drag plates ride against the wire and influence the wire to lie down in proper rows onto the drum surface . the drag plates also form a barrier between nearby persons and the wire , which is especially important when the wire is under undue tension . the wire guide 36 guides the wire centrally through the spaced drag plates and onto the drum . the entire sliding assembly 31 is slidably received on member 24 and can be moved longitudinally thereon by handle 38 . the operator stands beside the apparatus and anytime he notes that the wire is not lying down in uniform rows across the surface of the drum , he can grasp handle 38 , and reposition the sliding assembly . it is considered within the comprehension of the present invention to employ an electric motor at 30 by connecting the motor into the electrical supply of the tractor . a hydraulic motor is preferred because an infinite selection of constant tension values is available by merely adjusting valve 52 . moreover , a hydraulic motor can be stalled without harm thereto , whereas an electric motor must be specially designed to be operated under extremely slow or stalled conditions . the present invention provides a means by which one person can build or remove a barbed wire fence . the present invention also finds utility in stringing slick line , such as telephone cable , electrical wire , and insulated burial cable . the present invention in combination with a three point hitch associated with a farm tractor provides a unique and very useful tool for the farmer who cannot afford the necessary man power required for building fences and the like . | 1 |
fig1 is an illustration of a workstation 10 , which includes a computer system 12 coupled to a fixed disk 14 , a keyboard 16 , a relative - pointing device ( rpd ) 18 , and a monitor 20 . monitor 20 is shown with a display surface 22 . the examples that follow refer to an image being displayed on display surface 22 of monitor 20 from a collection of object descriptions stored on fixed disk 14 , however the invention is equally applicable to variations such as where the display device is a printer and the display surface is a printed page , or the display device is some other pixelated display device . the source of the object descriptions also need not be disk 14 , but could be rpd 18 , such as a trackball or mouse , for example , keyboard 16 , or some other input mechanism not shown , or a combination of the above . fig2 is a block diagram of computer system 12 . computer system 12 includes a central processing unit ( cpu ) 30 , random access memory ( ram ) 32 , a disk 34 , an rpd driver 36 , a keyboard driver 38 , an image object memory 40 , and image memory 42 , a program memory 44 , an optional graphics accelerator 46 , and a display driver 48 , all coupled by a computer bus 52 . display driver 48 is shown coupled to monitor 20 and a printer 50 . in variations of computer system 12 , one or more elements might be combined . for example image memory 42 might be a part of ram 32 , or rpd driver 36 and keyboard driver might be combined . cpu 30 is used to process instructions of a program to generate an image , and possibly other computing tasks . typically , cpu 30 controls the interaction of the items coupled to bus 52 . for example , cpu 30 uses ram 32 to store variables and data arrays used in processing , disk 34 as a non - volatile memory to store instructions of the program should power be removed , rpd driver 36 to receive input from rpd 18 , and keyboard driver 38 to receive input from keyboard 16 . in a data processing operation , cpu 30 first moves the program to more accessible program storage 44 , and moves a collection of object descriptions into image object memory 40 . running the program causes cpu 30 to read descriptions of objects from image object memory 40 to generate an image , which is then stored in image memory 42 . the processing can either be done all by cpu 30 , or some operations might be passed to graphics accelerator 46 for faster processing . once the image is generated , it can be moved from image memory 42 to display driver 48 , which outputs it to one or more display devices . image object memory 40 is different from image memory 42 , in that image object memory 40 stores descriptions of objects and image memory 42 stores pixels of the image of the objects . for example , for an image of a red sphere illuminated by a white light in front of a blue background , image object memory 40 would store the location in world coordinates of the center of the sphere , its radius , a value representing the color red , the location in world coordinates of the light , a viewpoint , a view opening , and the color of the background . by contrast , image memory 42 contains , after processing , a two - dimensional array corresponding to the two - dimensional array of pixels which make up display surface 22 . in image memory 42 , one color value is stored for each pixel , most likely color values for reds and blues depending on the location of the pixel on display surface 22 . the color values , when displayed , form an image of the red sphere and the blue background . in a preferred embodiment , the details of the operation of computer system 12 needed to generate an image in memory 42 from object descriptions in object memory 40 are determined by the program stored in storage 44 . fig3 is a block schematic diagram of a computer - pointing device ( rpd 18 ) including a preferred embodiment of the present invention . rpd 18 includes a ball 100 mechanically coupled to two encoder wheels ( encoder wheel 102 and encoder wheel 104 ) by contact rollers ( contact roller 106 and contact roller 108 , respectively ). encoder wheel 102 and encoder wheel 104 having alternating dark and light radial stripes . rpd 18 includes an encoder illumination assembly having a light - emitting diode ( led 120 ) and a detector 122 . the encoder illumination assembly is positioned so that led 120 illuminates one of the encoder wheels ( encoder wheel 102 in fig3 ) and detector 122 receives light reflected from the illuminated encoder wheel . a similar encoder illumination assembly is provided , but not shown , for encoder wheel 104 . rpd 18 includes a controller 130 , a non - volatile memory 132 , and a communications port 134 , with communications port 134 coupled to computer system 12 . in the preferred embodiment , non - volatile memory 132 is an electrically - erasable programmable read - only memory ( eeprom ), but other types of non - volatile memory could be substituted . controller 130 is coupled to the encoder illumination assembly , memory 132 and port 134 . controller 130 provides drive current to led 120 and receives signals from detector 122 . controller 130 stores and retrieves configuration data by using memory 132 . controller 130 communicates with computer system 12 using port 134 . controller 130 is able to use many different communications protocols to communicate with computer system 12 . configuration data identifying the particular communications protocol is received by controller 130 through port 134 from computer system 12 and written to memory 132 . thereafter , controller 130 will use the communications protocol identified by the configuration data written to memory 132 . in the preferred embodiment , the particular communications protocol is selected at power - up or reset . in other embodiments , it is possible to immediately change the communications protocol dynamically when reconfigured , if desired . controller 130 is able to provide discrete drive currents to led 120 in order to provide different illumination levels . in the preferred embodiment , controller 130 provides four different current levels : off , low , medium and high . as the current level increases , the illumination intensity increases as well . in the preferred embodiment , controller 130 provides led drive current via line 150 . to achieve the four discrete drive levels , two drive lines ( line 152 and line 154 ) are coupled together . each of line 152 and line 154 provides a different current level , the combination thus providing four discrete drive levels . in operation according to the preferred embodiment , a widely - available type of computer system 12 executes a configuration program to send configuration data to controller 130 . configuration data includes the type of communications protocol to use at power up , and the intensity level of led 120 . setting the communications protocol in this fashion permits a manufacturer of such configurable computer pointing devices as described herein to publish configuration programs for widely - available platforms , and still permit the use of the computer pointing device on less - widely available computer platforms , without publishing configuration programs for every platform for which the computer pointing device is operable . to return the pointing device to its default state ( wherein the pointing device uses a communication protocol for the widely - available computer system 12 ) the preferred embodiment uses activation of two switches during power - up to signal default modes . for the multi - power level led aspect of the preferred embodiment , the configuration data relating to led intensity provides a number of advantages . controller 130 will delay powering up led 120 ( i . e ., led 120 will be off ) in response to a power up or reset of computer system 12 to reduce the power requirements of rpd 18 , and the resulting drain on computer system 12 . thereafter , controller 130 will drive led 120 at the intensity level selected by configuration data stored in memory 132 . controller 130 selects the middle current intensity level as the default intensity level for led 120 . this middle intensity is the normal operating level . there are occasions when it is desirable to alter the intensity level . one occasion is right after manufacture and prior to shipment to a consumer . for post - manufacturing acceptance testing or other quality assurance testing , a manufacturer configures rpd 18 so that controller 130 drives led 120 at the low intensity level . the manufacture conducts testing at the reduced intensity level in order to detect problems that would not appear in normal operation but that could manifest themselves later , such as when led 120 ages and the illumination output at the default drive level decreases . testing at the reduced led intensity level provides for a more reliable device , resulting in prolonged use for the consumer . it is not necessary to store this type of configuration change in a non - volatile memory . another occasion for which it is desirable to change the intensity level is after prolonged use of the pointing device . after prolonged use , the light intensity of led 120 at the normal current level is reduced . in order to ensure sufficient signal - to - noise ratios for the reflected light received by detector 122 , a user reconfigures rpd 18 to use the high current level . the high current level improves performance and reliability of rpd 18 after performance degradation of led 120 . for still another occasion for which it is desirable to reduce led current levels , is when programming the non - volatile memory . as well known , when writing to a non - volatile memory such as an eeprom , greater power requirements exist than when reading the device . therefore , by turning the led off prior to programming the eeprom , better results are obtained . in conclusion , the present invention provides a simple , efficient solution to a problem of configuring computer pointing devices , and to improve computer pointing device performance and reliability . while the above is a complete description of the preferred embodiments of the invention , various alternatives , modifications , and equivalents may be used . for example , other configuration options , other than a desired communications protocol , are optionally configured and stored in the non - volatile memory . these options may include : switch configuration for left or right - handed operation , chording and chording time , reporting rate , baud rate , echo and scaling , for example . for certain operations , it may not be necessary to store led power level configuration data in non - volatile memory . for example , for the testing mode , it may be desirable to temporarily command the low power state . therefore , the above description should not be taken as limiting the scope of the invention which is defined by the appended claims . | 6 |
in an embodiment , a remotely accessible system for use in a retail environment includes functionality for shopping and selecting items for purchase . such a system may be implemented , for example , as an application for a mobile device or as a web client application . as an example , the application may be operable on the ios , android , or windows mobile platforms . in an embodiment , the application communicates via the internet with a server side device as shown in fig1 . in the illustrated embodiment , a security module , which may be a firewall , a secure server , and / or other network security component receives communications from the application via the internet . where the communication is authenticated ( for example , using secure http or other secure communications protocols , it is passed to the enterprise server . the enterprise server , in turn , communicates with a selected in - store system , each representing a particular store in a chain of stores , for example . in another embodiment , shown in fig2 , a web server may be included in the network such that the application , either accessed by a user via a web client or via a mobile app , passes through the web server . by way of example , this approach may involve a user accessing retailer_name . com in order to interact with the system . this access may be via a web browser or an app . in an embodiment , the app may interface by way of a mobile communications link , or by wi - fi ( including in - store wi - fi ) and from there to an internet connection . by way of example , the mobile application may interact with the store system using data in a json format which is passed via a rest transfer architecture . the enterprise server then communicates with the local store software . in an embodiment , the store system may include functionality that allows shoppers to shopping using a mobile device that may be handheld and / or associated with a shopping cart . examples of such mobile devices are described , for example , in u . s . patent application ser . no . 13 / 490 , 174 , herein incorporated by reference . the mobile device may , for example , incorporate a reader , a display , a memory and a user interface . the mobile device may be detachably or permanently connected to a shopping cart , or may be borne by the cart operator , for example on a belt clip or the like . the mobile device and its user interface may operate as the display of the cart mentioned above with respect to the scale , or may alternately communicate with a separate display of the cart to provide an alternate viewing area for the user . in principle , the device may be a store - specific device or may be , for example , a mobile phone running an application that allows it to interface with the store infrastructure . embodiments may include the ability for a user &# 39 ; s device to interface with the store - supplied mobile device , via the communication network . embodiments of the mobile device include wireless communication functionality so that the mobile device may communicate with a store network . the mobile device may communicate using one or more of a number of common protocols including but not limited to bluetooth ( ieee 802 . 15 . 1 and 802 . 15 . 2 ), wimedia ( ieee 802 . 15 . 3 ), wi - fi ( ieee 802 . 11b ), wi - fi5 ( ieee 802 . 11a / hl2 ) and other wireless protocols like protocol 802 . 15 . 4 ( zigbee ). the store network may include functionalities for associate task management , shopper self - checkout , video or location based analytics , price lookup , loss management , and others . in some embodiments , the store network may include one or more of a star network , a multi - network , mesh network , and wireless and / or wired communication lines joining each of the several nodes to a server . in some embodiments , each node may include one or more radios or wired links to communicate with others of the nodes and / or the server . examples of store networks that may be suited to incorporation with embodiments may be found in u . s . pat . no . 7 , 672 , 876 , herein incorporated by reference . in an embodiment , the application receives pricing information directly from the in - store pos by way of the store network . because the in - store pos system is accessible , actual , current pricing is available to the remote shopping application . that is , in this embodiment , the pricing for each product provided to the remote shopping application is exactly the same pricing that would be provided if that product were to be rung up at a register within the store . in this regard , weekly specials , manager &# 39 ; s in - store specials , and other temporary or alternative pricing is available to the remote shopper just as it is available to the in - store shopper . in an embodiment , the store network involved in the pricing and picking system is the same network as is employed by an in - store network of handheld devices , and is separate from the in - store wi - fi network . by way of example , the handheld device network that provides service for self - checkout , associate task management , and other services may be a zigbee network while the store wi - fi network is used separately to provide internet access for other services . in an embodiment , the system includes functionality for providing status to a user as illustrated in fig3 . the user may see the pick progress as well as the assigned store associate &# 39 ; s name , and a total number of bags that the order has generated . additionally , indications of the order number and pickup address are optionally provided . the application may also provide collateral information such as a savings amount , relevant advertising or coupons , and total price . the total price may be updated in real time as the associate performs the pick . for example , where an item is sold by weight , it may not be possible , in advance , to inform the user of the exact price . if , for example , onions are priced at $ 0 . 99 / lb ., a user may request two onions , assuming that they will weigh slightly more than one pound total . when the associate makes the actual pick and weighs the onions , the order will update to indicate , for example , 1 . 2 lbs ., and a price of $ 1 . 19 . the updated order total may be relayed to the remote application , again in real time , or in periodic batch updates . in an embodiment , once the order is 100 % picked , the customer may be given an opportunity to provide final approval / confirmation of pick - up time and / or to provide any pick - up instructions . in one implementation , the system may automatically arrange the pick list for the associate in an order associated with the store layout . again , the store management system may be queried to provide the system with actual current location of goods . in particular , this may be useful where the planogram is variable , where specials are placed on endcaps temporarily for promotional purposes , or where seasonal items are involved . in an embodiment , the system may include a printing function allowing labels to be printed for identifying orders ( e . g ., by order number and / or customer name ) and for indicating a number of bags in the order and / or an identifier for each bag ( e . g ., 1 of 3 ). as the associate performs the pick , he or she may make use of a handheld scanner ( mobile device ) as described above . the associate mobile device may be used to scan identifying information on items to be purchased or under consideration , for example a bar code . as will be appreciated , other machine readable identifying codes may be used in place of bar codes . machine readable media in certain embodiments may also able to be read and understood by humans in addition to being able to be read by machines . examples of a machine readable medium include , but should not be limited to , bar codes in the form of universal product codes ( upc ), radio frequency identification ( rfid ) tags , produce lookup codes ( plu ), including double stack plus , and electronic product codes ( epc ) tags . for items sold by weight , the associate may use a scale to weigh one or more items . the scale may then provide a machine readable code or user enterable code to encode the item &# 39 ; s weight and price . in an embodiment , the associate &# 39 ; s handheld provides a display that indicates the next item on the list as well as a store location for that item . fig4 illustrates a particular system architecture for an implementation of the foregoing described system . while in the foregoing specification this invention has been described in relation to certain particular embodiments thereof , and many details have been set forth for purpose of illustration , it will be apparent to those skilled in the art that the invention is susceptible to alteration and that certain other details described herein can vary considerably without departing from the basic principles of the invention . in addition , it should be appreciated that , structural features or method steps shown or described in any one embodiment herein can be used in other embodiments as well . | 6 |
referring now to the drawings , and more particularly to fig1 - 3 , shown therein is a combination squeegee and hand trowel 10 constructed in accordance with the present invention . the combination squeegee and hand trowel 10 ( hereinafter also referred to as tool ) is provided with a substantially flat blade 12 having an upper surface 14 and a lower surface 16 . a handle 18 is connected to the flat blade 12 so as to extend upwardly from the upper surface 14 of the blade 12 so that a person can grasp the handle 18 . the handle 18 can be releaseably or non - releaseably connected to the blade 12 of the tool 10 . as shown in fig1 , the blade 12 has a semi - circular configuration ( i . e . the shape of a half - circle ) and has a curved edge 20 and a notched edge 22 . the curved edge 20 is a continuous arc which extends from a first end 24 of the notched edge 22 to a second end 26 of the notched edge 22 . that is , the blade 12 is provided with a continuous arcuate curved edge 20 and the curved edge 20 of the blade 12 is sized to substantially correspond to a portion of a curved interior sidewall of the container for which the blade 12 is used to remove material from the interior sidewall of the container as will be described in more detail hereinafter . the notched edge 22 includes a plurality of notches 28 , only a portion of which are specifically indicated by a reference numeral . the configuration of the notched edge 22 can vary widely and will depend , to a large extent , on what the tool 10 is to be used for . for example , the notched edge 22 is shown in fig2 as being crenelate , a desired configuration when using the tool 10 to apply an adhesive to a surface , such as when laying tile . the blade 12 has a length 30 and a width 32 which extends perpendicularly from a center point 33 of the notched edge 22 to the curved edge 20 . the length 30 and width 32 of the blade 12 will vary depending on the size of the container with which the blade 12 is used to scrape material from the sidewall of the container . that is , the blade 12 is provided with a sufficient length 30 and a sufficient width 32 so that the curved edge 20 of the blade 12 can be disposed substantially adjacent a portion of the curved interior surface or wall of the container whereby a material on the sidewall can be removed by the tool 10 . for example , when using the tool 10 to remove material from the sidewall of a conventional five gallon bucket , desirable results have been obtained wherein the blade 12 of the tool 10 is provided with a length of about 10 . 25 inches and a width of about 6 . 75 inches . as previously stated , the curved edge 30 of the blade 12 has a continuous curvature which conforms to or compliments the curvature of an inner surface of a side wall of a container with which the tool 10 is anticipated to be used . that is , the curved edge 30 of the blade 12 is void of any straight line segments . thus , the particular size of the blade 12 of the tool 10 will be determined based upon the size of the container with which the tool 10 is to be used . further , the material removed from the container can be tile adhesives , grouts , stucco , plaster , or other bonding materials as well as paints which are used in construction . such containers are well known in the art . thus , no further discussion concerning the size of such containers or the nature of such containers is deemed necessary . as noted above , the handle 18 of the tool 10 is sized to permit a person to grip the handle so that the tool 10 can be used to scrape material from the inner surface of the sidewall of the container . thus , the handle 18 has a length 34 , a width 36 and a height 38 . the length 34 , width 36 and height 38 of the handle 18 can vary widely depending on the size of the blade 12 . for example , desirable results have been obtained wherein the length 34 of the handle 18 is about 6 . 75 inches , the width 36 is about 1 inch and the height 38 is about 1 . 5 inches . to enhance removal of material from the interior surface of the sidewall of the container , the curved edge 20 of the blade 12 is desirably beveled substantially as shown . the degree of beveling of the curved edge 20 of the blade 12 can vary widely . however , desirable results have been achieved wherein the curved edge 20 of the blade 12 has a bevel height 40 of about 0 . 125 inch and a bevel width 42 of about 0 . 25 inch . as previously noted , the notched edge 22 of the blade 12 is provided with a plurality of notches 28 . each notch 28 has a notch width 44 . the notched edge 22 of the blade 12 shown in fig1 - 3 has a crenelate shape . the distance between the notches 28 of the notched edge 22 can vary widely depending on the intended use of the tool 10 , as can the width of the notches 28 . for example , the notches 28 can be provided with a notched width 40 of about 0 . 25 inches . referring now to fig4 - 6 , shown therein are three additional embodiments of a tool constructed in accordance with the present invention wherein the notched edges of the tools have alternate notch patterns . shown in fig4 is a tool 10 a having a flat blade 12 a . the blade 12 a has a handle 18 a connected to an upper surface 14 a of the blade 12 a such that the handle 18 a extends upwardly therefrom . the blade 12 a has a semi - circular configuration , and as such has a curved edge 20 a and a notched edge 22 a . the curved edge 20 a is a continuous arc which extends from a first end 24 of the notched edge 22 a to a second end 26 a of the notched edge 22 a . thus , with exception of the configuration of the notched edge 22 a , the blade 12 a of the tool 10 a is similar in construction and functioned to the blade 12 of the tool 10 hereinbefore described with reference to fig1 - 3 . that is , the notched edge 22 a of the blade 12 a of the tool 10 a has a serrated or “ toothed ” pattern rather than the notched pattern of the blade 12 of the tool 10 . referring now to fig5 , shown therein is a tool 10 b constructed in accordance with the present invention . the tool 10 b is provided with a flat blade 12 b having a handle 18 b connected to an upper surface 14 b of the blade 12 b such that the handle 18 b extends upwardly therefrom . the blade 12 b has a semi - circular configuration and as such has a curved edge 20 b and a notched edge 22 b . the curved edge 20 b is a continuous arc which extends from a first end 24 b of the notched edge 22 b to a second end 26 b of the notched edge 22 b . thus , with exception of the configuration of the notched edge 22 b , the blade 12 b of the tool 10 b is similar in construction and function to the blade 12 of the tool 10 hereinbefore described with reference to fig1 - 3 . that is , the notched edge 22 b of the blade 12 b of the tool 10 b has a crenelate or scalloped pattern which is “ curved ” or “ wavy ”. referring now to fig6 , shown therein is a tool 10 c constructed in accordance with the present invention . the tool 10 c has a flat blade 12 c . the blade 12 c has a handle 18 c connected to an upper surface 14 c of the blade 12 c such that the handle 18 c extends upwardly therefrom . the blade 12 c has a semi - circular configuration and as such has a curved edge 20 c and a notched edge 22 c . the curved edge 20 c is a continuous arc which extends from a first end 24 c of the notched edge 22 c to a second end 26 c of the notched edge 22 c . thus , with exception of the configuration of the notched edge 22 c , the blade 12 c of the tool 10 c is similar in construction and function to the blade 12 of the tool 10 hereinbefore described with reference to fig1 - 3 . that is , the notched edge 22 c of the blade 12 c of the tool 10 c has a pattern wherein smaller notches 28 c alternate with larger notches 28 cc . while certain patterns for the notched edge of the tools hereinbefore described have been shown , it will be readily apparent to those skilled in the art that other notch patterns can be employed in the construction of the notched edge of the tool of the present invention . as noted before , the handle 18 of the tool 10 may be releaseably connected , i . e . detachable , from the blade 12 . shown in fig7 is a tool 10 d which includes a blade 12 d , a handle 18 d and a connector assembly 47 for connecting the handle 18 d to the blade 12 d . the blade 12 d is provided with a curved edge 20 d and a notched edge 22 d . the blade 12 d of the tool 10 d may be the same as the blade of any other tool described herein . the tool 10 d differs from the tools 10 - 10 c described herein in that the handle 18 d is detachably connected to the blade 12 d . the connector assembly 47 includes a female connector 48 and a male connector 49 . the female connector 48 is formed integrally with the blade 12 d so as to extend outwardly from an upper surface 14 d of the blade 12 d substantially as shown . the male connector 49 is formed on one end of the handle 18 d and is adapted to matingly engage the female connector 48 so that the handle 18 d can be connected to the blade 12 d . any suitable mechanism can be used as the connector assembly 47 . for example , the female connector 48 can include a housing having an opening therein with internally disposed threads and the male connector 49 can be a threaded portion on one end of the handle 18 which can be inserted within the housing for mating engagement with the threads in the housing of the female connector 48 substantially as shown . thus , the handle 18 d can be operably connected or disconnected from the blade 12 d via the connector assembly 47 . any of the tools 10 - 10 d contemplated herein or alternate embodiments of them may be constructed of materials known to be used in the construction of trowels , squeegees , scrapers , or the like , including metals , polymers , plastics ( including thermoplastics ), rubber , wood , wood products , cardboard , or combinations thereof . the tools 10 - 10 d may be flexible or rigid . the tools described herein , such as tools 10 - 10 c , may be formed as an integral one piece construction molded from a thermoplastic material , although the tool 10 d is shown as constructed of separate materials such as a separate blade 12 d and a separate handle 18 d which are connected together via the connector assembly 47 hereinbefore described . referring now to fig8 and 9 , the manner of usage and operation of the combination squeegee and hand trowel of the present invention will now be described with reference to the tool 10 . once a cylindrically shaped container 50 , such as a gallon bucket , a 5 gallon bucket or a 10 gallon bucket has been opened , the tool 10 is inserted into the container 50 to remove material therefrom . once the container 50 has been substantially emptied the curved edge 20 of the tool 10 , which is arcuately shaped to substantially correspond to an arc configuration of a segment of an inner surface 52 of a sidewall 54 of the container 50 , is positioned adjacent the segment of the inner surface 52 of the sidewall 54 and the interior surface 52 of the sidewall 54 is scraped with the curved edge 20 of the tool 10 to remove residual material from the inner surface 52 of the sidewall 54 . the scraping motion utilizing the curved edge 20 of the tool 10 is repeated until substantially all the material has been removed from the inner surface 52 of the sidewall 54 of the container 50 . it should be noted that the tool 10 may also be used to remove residual amounts of material from the bottom of the container 50 or from beneath an interior rim of the container 50 . as such , removal of substantially all material within the container 50 can be effected utilizing the tool 10 ( or any other tool of the present invention ). furthermore , the tools described herein can be utilized to spread or otherwise apply material removed from a container , such as the container 50 , to a surface or substrate in a manner appropriate for the material . that is , the notched edge 22 of the blade 12 of the tool 10 can be utilized to effectively spread material removed from the container 50 as required for a particular application . the size of the container 50 can vary widely but the container 50 will typically be of a size used in various manners of construction and remodeling . further , the size of the tool 10 and any other tools described herein , will vary and desirably be sized and configured to enhance removal of material from the interior surface 52 of the sidewalls 54 of the container 50 . it is to be understood that the dimensional relationships of the materials from which the tools 10 - 10 d and the handles 18 and 18 d are fabricated , and the components of the tools 10 - 10 d of the invention such as the blades 12 - 12 d or the handles 18 and 18 d , can vary , as well as the configuration of the handles 18 and 18 d of the tools 10 - 10 d . therefore , the foregoing is considered as illustrative only of the tools 10 - 10 d of the present invention . further , since numerous modifications and changes will readily occur to those skilled in the art , the tools 10 - 10 d and their uses are not limited to the exact construction and operation shown and described , and all suitable modifications and equivalents of the tools 10 - 10 d described herein may be resorted to , and fall within the scope of the present invention . | 4 |
referring now to fig1 , a first embodiment of an electro - stimulation device 10 includes a housing 12 and a control panel 14 located on an upper surface of the housing 12 . the control panel 14 is divided into a heart stimulation control area 15 and a heart destimulation control area 17 . the stimulation control area 15 includes a rotary dial 16 and scale 16 a for setting the amount of current that is passed to the heart , and as rotary dial 18 and scale 18 a for setting the duration or frequency of cycles that the current is passed to the heart to start the hert beating . likwise , the destimulation control area 17 includes a rotary dial 20 and scale 20 a for setting the amount of current that is passed to the heart , and a rotary dial 22 and scale 22 a for setting the duration that the current is passed to the heart to stop the heart from beating . controls for regulating pulse width , pulse voltage , pulse phases and / or band duration may also be added . a normally open stimulation switch 24 can be pressed to initiate heart stimulation while a normally open destimulation switch 26 can be pressed to initiate the heart destimulation . an on / off switch 28 can be used to turn the entire device off when not in use . a foot petal assembly 30 has a normally open heart stimulation foot switch 32 and a heart destimulation foot switch 34 that can be used as an alternative to switches 24 , 26 . the provision of a foot petal assembly permits the surgeon to control when the heart stimulation and destimulation occurs while leaving the hands free to perform other procedures . this also permits the surgeon &# 39 ; s hands to remain sterile since contact with the housing 12 or switches 26 , 28 is avoided . the foot pedal assembly 30 is connected via cable 36 to an electronic control device 50 ( fig3 ) within the housing 12 . an alternative to providing two different foot switches 32 , 34 would be to provide a single foot switch which intermittently switches between stimulation and destimulation each time the switch is actuated . it is also contemplated that automatic stimulation could be provided after a preset time period or only if the device detects that the heart did not automatically restart . a pair of electrodes 37 , 38 are connected via a pair of leads 39 a , 39 b , respectively , to the electronic control device 50 for supplying electrical current to the heart during stimulation and destimulation . a second pair of electrodes 43 a , 45 a can also be connected via a pair of leads 43 , 45 , respectively , to the electronic control devices 50 for supplying electrical current to the phrenic nerve to control breathing during heart stimulation and destimulation . a lead 48 having a connector 49 may be provided in addition to or alternatively of the phrenic nerve electrodes 43 a , 43 b . the connector 49 interfaces with a respirator ( not shown ) and , upon stimulation or destimulation of the heart , sends a logic signal to activate or deactivate the respirator . referring now to fig2 , a second embodiment of an electro - stimulation device 40 according to a second embodiment is shown , wherein like parts from the previous embodiment are represented by like numerals . the electro - stimulation device 40 is miroprocessor based and includes a housing 41 having a display 42 , a plurality of numeric keys 44 , a heart stimulation switch 46 , and a heart destimulation switch 48 . one of the keys 44 may be an on / off switch for supplying electrical power to the device 40 . the device 40 prompts a user to enter the patient &# 39 ; s age , height , weight , body temperature , etc ., via the keys 44 to calculate the proper amount of electrical current and its duration necessary for proper heart stimulation and destimulation . in most instances , the amount of current and duration to stop the heart will typically be different than the amount of current and duration to start the heart , and will vary from one person to another depending on factors such as height , weight , body temperature , etc . in the embodiments of fig1 and 2 , the current may be of the alternating , direct , or waveform type . referring now to fig3 , the electronic control device 50 for use with the electro - stimulator of fig1 and 2 includes a regulated power source 52 , such as a battery and regulator , a stimulation timer circuit 54 , a destimulation timer circuit 55 , a stimulation power amplifier 56 , and a destimulation power amplifier 57 . the timer circuits and power amplifiers can be chosen from any of several well - known timers and amplifiers that can incorporate the dials 16 , 18 , 20 , and 22 . these dials may be of the variable resistive , capacitive , or pulse type to vary the timer frequency and power dissipation . alternatively , input from the keys 44 stored in a microprocessor 60 ( shown in dashed line ) in the fig2 embodiment can be used to vary the amplification and duration of the applied electrical current . the stimulation switch 24 and stimulation foot switch 32 on pedal assembly 30 are connected in parallel such that actuation of one or the other switch begins heart stimulation . likewise , the destimulation switch 26 and stimulation foot switch 34 on pedal assembly 30 are connected in parallel such that the actuation of one or the other switch begins heart distimulation . preferably , the switches are of the single - shot type that permit current to flow through the circuit for the amount of time set by the timers 54 , 56 , even when the switches are released . alternatively , the switches may be of the type requiring manual positioning between the open and closed positions . in this alternative embodiment , the timers 54 , 56 may provide an audible signal to indicate when the appropriate duration of electrical current application has been reached . the timers 54 , 56 may also be eliminated . in this instance , the appropriate switch is manually closed until the surgeon visually observes that the heart has been properly stimulated or destimulated . with reference now to fig4 , the electrode 37 is connected to the sinoatrial region 72 of heart 70 while the electrode 38 is connected to the atrioventricular region 74 in a unipolar arrangement , while the electrodes 43 a , 43 b are connected to the phrenic nerve ( not shown ) or to other regions of the body or heart . the separate connection regions on the heart serve to alternatively stimulate and destimulate the heart . the electrode terminations may be of the type used in pacemakers , such as corkscrews , clips , pads , tines or barbs , needles , etc . the electrodes 37 , 38 may both be connected to the ventricular wall as shown in fig5 in a bipolar arrangement or at any position that a pacemaker is commonly connected to . the electrodes 43 a , 43 b may be connected in a bipolar arrangement to the vagus nerve or one of its cardiac branches . in the bipolar arrangement , the electrodes 37 , 38 are placed near each other at a particular region for stimulating the heart while the electrodes 43 a , 45 a are placed near each other at a second region for destimulating the heart . the tissue between each pair of serves to close the circuit such that electrical current from the power source and amplifier passes through the tissue to cause stimulation or destimulation of the heart . when the electrodes are connected to other locations besides the heart , a series of current pulses is passed long enough through the tissue to augment any recurring natural heartbeat stimuli to stop the heart from beating . in has been found that a continuous pulse train for 10 - 30 seconds using a constant current of 10 - 100 ma in conjunction with a constant pulse width of 0 . 01 - 0 . 5 msec . and a frequency between 6 hz and 50 hz applied to the epicardial parasympathetic nerves is sufficient to augment the recurring natural heartbeat stimuli to stop the heart . when the electrodes are connected directly to the heart , it is preferred that a burst pulse width of current be applied instead of a continuous pulse train . once activity from the heart is sensed , a burst pulse width having the same current amplitude and frequency as in the constant pulse width is applied during the repolarization phase . typically , the burst pulse time will be less than the continuous pulse train to stop the heart . preferably , the burst pulse is programmable for different burst times , current amplitudes , and frequency . upon cessation of heart destimulation , the natural heart beat stimuli will typically occur again automatically a short time thereafter . the separate heart stimulation leads , therefore , provide an added safety feature in the event that the heart does not automatically restart . in order to stimulate the heart , if required , a series of current pulses are passed through the tissue to initiate the natural heartbeat stimuli . these current pulses are similar to those used in pacemakers . in use , the electrodes 37 , 38 are secured at an appropriate position on the patient 80 ( fig6 ). during open surgery or minimally invasive surgery , as the surgeon 82 performs various steps such as cutting , stitching , etc ., one of the foot switches 32 , 34 is pressed to initiate or stop the heartbeat as required . for example , the surgeon may wish to stop the heartbeat while making one or a plurality of stitches where movement of the heart would normally be a hindrance . the heart may then be stimulated either naturally or artificially through the present device to beat for a predetermined time to permit blood flow throughout the body and then be destimulated or stopped again to continue stitching . if desired , the electrodes 43 a , 45 a may be connected to the phrenic nerve and / or the connector 49 may be attached to a respirator to still the lungs during the surgical procedure . when the electrodes are attached to the phrenic nerve , a continuous pulse train having the range of values as discussed previously is sufficient for controlling lung movement . referring now to fig7 , and according to a further embodiment , a set of four electrodes 102 , 104 , 106 , and 108 are equally circumferentially spaced around a catheter 100 . each electrode 102 - 108 is embedded in and extends from an inner wall 110 to an outer wall 112 of the catheter 100 . a separate insulated lead 102 a , 104 a , 106 a , and 108 a are each soldered or otherwise electrically connected to their respective electrode . the insulated leads extend through the catheter 100 and into the electronic control device 50 . any pair of electrodes can be accessed through extra switches in the control device 50 for supplying electrical current to the heart during stimulation and destimulation . referring now to fig8 , and according to a further embodiment , a set of three electrodes 122 , 124 and 126 are equally circumferentially spaced around a catheter 120 . each electrode 122 - 126 is embedded in and extends from an inner wall 130 to an outer wall 132 of the catheter 120 . a separate insulated lead 122 a , 124 a and 126 a are each soldered or otherwise electrically connected to their respective electrode . as in the previous embodiment , the insulated leads extend through the catheter 100 and into the electronic control device 50 . any pair of electrodes can be accessed through extra switches in the control device 50 for supplying electrical current to the heart during stimulation and destimulation . although the catheters 100 , 120 have been described with three or four electrodes , any number of electrodes may be provided , depending on the particular nerve stimulation application . for example , as shown in fig9 , two electrodes 142 , 144 may be spaced axially on a catheter 140 . the longitudinal centerline of each electrode 142 , 144 extends perpendicularly to the axis of the catheter 140 . in fig1 , two electrodes 152 , 154 are spaced axially and circumferentially from each other on the catheter 150 . their longitudinal centerlines extend parallel to the axis of the catheter . two additional electrodes 156 , 158 ( shown in dashed line ) may be provided on an opposite side of the catheter 150 , as shown in fig1 . in yet another embodiment , as shown in fig1 , a first electrode 162 is spaced axially and circumferentially from a pair of circumferentially electrodes 164 , 166 on a catheter 160 . each of the electrodes 162 - 166 extends approximately 120 ° around the circumference of the catheter 160 . the catheters 100 - 160 as shown in fig7 - 12 are preferably of a small size to fit easily into the internal jugular vein , superior vena cava or other appropriate vessel adjacent to the desired nerve bundle . the internal jugular vein is next to the vagal nerve bundle , and thus presents an ideal path for the catheter when attempting to stimulate the vagal nerve . the human internal jugular vein is about 2 to 6 mm in diameter and tapers over an estimated length of about 15 cm . hence , the use of a 7 f or smaller size catheter is contemplated . the electrodes are placed on the catheter in such a way that the amplitude required to stimulate the nerve fibers would have the correct field distribution . for an internal jugular vein of about 5 mm in diameter and a vagal nerve bundle of about 3 mm in diameter , and for an applied current of 10 ma with a frequency of 2 - 20 hz , the spacing between the electrodes would need to be about 1 - 2 cm to achieve nerve stimulation . this spacing may vary depending on the size of the internal jugular vein and vagal nerve bundle , as well as the amount of applied current . referring now to fig1 , electrodes 104 , 106 of the catheter 100 are in contact with a nerve ( not shown ) and have been selected to apply a current thereto . the circumferential current density through the nerve tissue , as represented by lines 170 , diminishes as the distance increases from the pair of activated electrodes . fig1 shows a similar occurrence for the three - electrode embodiment of fig8 . since the electrodes in this embodiment are spaced a greater distance than the electrodes from in the fig7 embodiment , the current distribution is not as concentrated , and therefore produces a different neural stimulation . an axial current distribution may be required in addition to or in place of the circumferential distribution , as shown in fig1 , depending on the particular nerve stimulation desired . the axial current distribution is obtained by accessing a pair of axially spaced electordes ( fig9 ) or a pair of axially and circumferentially spaced electrodes ( fig1 - 12 ). the preferred use of the electro - stimulation device would be a transvenous implementation through standard transvenous implantation techniques such as those used to implant pace / sense leads into the heart . for the method of transvenous vagal stimulation in laproscopic / endoscopic / minithorascopic surgical coronary artery bypass graft ( cabg ) procedures , the use of vagal nerve stimulation provides a reversible , quick acting ( like an on / off switch ) method for slowing the heart rate . although the foregoing description relates to the stimulation / destimulation of the heart during surgical procedures , it is not intended that the invention be limited thereto . the electro - stimulation device could be provided with two or more electrode - welding catheters for use in multiple transvenous regions for the stimulation of different nerves . for example , a pair of catheters could be inserted into the internal jugular vein for stimulation of the right and left vagal nerve bundles . the right bundle could be used to elicit more specific heart effects and reduce heart rate and increase av delay for antiarrhythmic and hemodynamic benefits ; whereas the left bundle could be used to effect afferent vagal information and potentially reduce epileptic activity . an electrode - wielding catheter could be inserted into the very high internal jugular vein to stimulate the hypoglossal nerve and / or into the very low internal jugular vein or superior vena cava to stimulate the phrenic nerve for respiratory control . the stimulation of the phrenic nerve in conjunction with heart stimulation would insure that the blood is properly oxygenated during surgical procedures on the heart with intermittent heart destimulation . likwise , catheters of the present invention could be inserted into the azygos or accessory hemizygous veins to stimulate the sympathetic nerves for increasing heart rate to altering dft efficacy for antiarrhythmic and hemodynamic benefits . other transvenous routes to nerve stimulation for functional purposes may also be applicable . the electro - stimulation device may also have sepcificity for direction of neural stimulation in regards to the location of the vessel and the nerve bundle that is to be stimulated . for example , the phrenic nerve could be elicited on and off by a mere rotation of the transvenous catheter , depending on the location of the electrodes on the catheter and the resulting electric current density generated . in order to observe and control the amount of catheter rotation , a series of degree markings may be located on an outer circumference of the catheter at a position readily observable by the surgeon . alternatively , the catheter may be associated with a rotary encoder to obtain a digit read - out of the amount of catheter rotation . the electrodes of the intravenous catheters according to the present invention could also be used to manipulate the heart rate or hemodynamics in response to device sensors . in addition , in response to precursors of an arrhythmic event , the devices may stimulate either the sympathetic or the parasympathetic individually or in combination to attempt to delay or prevent the event . alternatively , current may be applied to different pairs of electrodes as discussed above . although the use of catheters having electrodes permanently mounted thereto for temporarily manipulating or stimulating nerves accessibly through blood carrying vessels , it is to be understood that a more permanent nerve stimulation arrangement is possibly by fixing electrodes onto the inside of the vessel adjacent to the nerve to be stimulated . thus , this new device in its preferred embodiment , eliminates the potential for direct nerve damage and reduces the invasiveness of the placement of the electrodes for direct neural stimulation in conjunction with implantable medical devices . examples of how the present invention may be employed in the context of implantable medical devices are illustrated in fig1 - 19 . fig1 illustrates an embodiment of the present invention employing a permanently implantable cardiac pacemaker 300 coupled to an electrode lead 304 used to stimulate the vagal nerve in accordance with the present invention . the pacemaker is also provided with a second electrical lead 308 , which , like electrical lead 304 is coupled to the circuitry within the housing of pacemaker 300 by means of a connector blocks 302 . pacemaker 300 includes therein both a dual chamber cardiac pacemaker and an implantable nerve stimulator , and may correspond to that illustrated in u . s . pat . no . 5 , 334 , 221 issued to bardy ; u . s . pat . no . 5 , 330 , 507 issued to schwartz or u . s . pat . no . 5 , 199 , 428 issued to obel et al , all of which are incorporated herein by reference in the entireties . electrode lead 304 has an array of electrodes as illustrated in fig7 - 15 , discussed above , located at or adjacent its distal end 306 which is positioned within the internal jugular vein 316 , with electrodes chosen to direct the stimulation pulses provided by the electrodes to the vagal nerve in order to slow heart rate . the second electrodes 308 carries a pair of electrodes 310 for sensing depolarizations of the atrium of the patient &# 39 ; s heart and a pair of electrodes 312 for sensing and pacing the ventricle of the patient &# 39 ; s heart . as described in the above cited patents , the electrodes on lead 304 may be employed to slow the patients heart rhythm in order to prevent or treat detected arrhythmias , ischemia , angina or other problems . the electrodes 310 and 312 may be employed to sense the rate of the heart and to ensure that the heart is beating at an adequate rate , preventing over - stimulation of the vagal nerve from causing the heart to drop below a base heart rate determined either as a fixed parameter or as a function of an indwelling activity sensor within pacemaker 300 . electrode lead 304 may be formed with a bend 318 , performed into the body of the lead a distance from the electrode array the distal end of the lead 306 to position it appropriately for vagal nerve stimulation . the lead may be inserted and positioned generally according to the procedure disclosed in u . s . pat . no . 5 , 354 , 318 issued to taepke , describing a similarly located and configured lead , also incorporated herein by reference in its entirety . fig1 illustrates an embodiment of the invention in which an implanted stimulator 400 is used in conjunction with an electrode lead according to the present invention to stimulate the hypoglossal nerve to treat obstructive sleep apnea . the pulse generator may correspond to that disclosed in u . s . pat . no . 5 , 549 , 655 issued to erickson and incorporated herein by reference in its entirety . the stimulator 400 is provided with a first electrode lead 404 which carries adjacent its distal end 406 an array of electrodes as described in fig7 - 15 , discussed above . the lead is located relatively higher up within the internal jugular artery than the electrode array in fig1 and is directed to stimulate the hypoglossal nerve by selection of appropriate electrodes as described above . like the lead 304 described in fig1 , lead 404 may optionally be provided with a preformed bend 414 , an appropriate distance from the location of the electrode array the distal end 406 of the catheter to position it in appropriate position and orientation to stimulate the hypoglossal nerve . the lead , like lead 304 in fig1 , may be inserted according to the procedure described in u . s . pat . no . 5 , 354 , 318 issued to taepke . the pulse generator 400 is additionally provided with a second lead 408 which carries a pressure sensor 410 which is used to synchronize delivery of hypoglossal nerve stimulus pulses to the detected inspiratory phase of the respiration cycle as described in the above cited erickson patent . fig1 illustrates an additional embodiment of the present invention including a pulse generator 500 employed to stimulate the phrenic nerve in order to provide a diaphragmatic pacer . pacer 500 may correspond generally to that disclosed in u . s . pat . no . 5 , 056 , 519 , issued to vince et al . which employs a signal indicative of the normal respirative function of the right diaphragm to regulate stimulation of the left phrenic nerve to correspondingly stimulate the left diaphragm . a pulse generator 500 is provided with a second lead 508 which carries at its distal tip a temperature sensor 510 which is employed to sense the temperature changes within body tissues resulting from inspiration of outside air through the upper airways . temperature sensor 510 may be located within the airway to the right diaphragm as described in the vince patent and employs to regulate stimulus pulses provided to the electrodes on lead 504 so that the left diaphragm functions in synchrony with the inspiratory cycle of the right diaphragm . lead 504 may be provided with a preformed bend 514 located an appropriate distance from the electrode array located at the distal end of 506 of the lead to position the electrode array adjacent the phrenic nerve . the lead may be introduced using the procedure described in the above cited gunderson patent . fig1 illustrates an embodiment of the invention employed in conjunction with an implantable cardioverter / defibrillator 600 which employs vagal nerve stimulation as an adjunct to its array of antiachyarrhythmia therapies including antitachyacardia pacing , cardioversion and defibrillation . pulse generator 600 may correspond , for example , to the pulse generator illustrated in u . s . pat . no . 5 , 014 , 698 issued to collins or u . s . pat . no . 5 , 243 , 980 issued to mehra , both incorporated herein by reference in their entireties . pulse generator 600 is provided with an electrical lead 604 which carries adjacent its distal end 606 an array of electrodes as described in conjunction with fig7 - 14 above . electrode lead 604 may correspond to electrode lead 304 illustrated in fig1 , with its distal end 606 located within the internal jugular vein in a position appropriate to stimulate the vagal nerve . the pulse generator 600 is also provided with a second electrode lead 608 which carries first and second defibrillation electrodes 610 and 612 and pacing / sensing electrodes 614 and 616 which are employed to sense and pace the ventricle of the patient &# 39 ; s heart . the vagal nerve stimulator may be employed in conjunction with delivery of therapies of treatment of arrhythmias or prevention of arrhythmias as described in the above cited collins et al patent or may be employed as part of a diagnostic regimen as described in the above cited mehra patent . the embodiments of the invention illustrated in fig1 - 19 above are intended to be exemplary of general types of devices in which the present invention may be employed by transvenously locating an electrode or array of electrodes in a blood vessel adjacent a desired nerve to be stimulated , as discussed above . it should be understood that permanently implanted leads configured and located according to the present invention may be used with a wide variety of implantable electrical devices not specifically illustrated in conjunction with fig1 - 19 , including implantable drug dispersers , implantable muscle or nerve stimulators , and implantable monitoring systems in which regulation of one or more nervous functions is desired . it should also be understood that in conjunction with such devices , as discussed above , electrodes may be located bi - laterally , and employed to simulate the same or different nerves , also as discussed above . reasonable variation and modification are possible within the spirit of the foregoing specification and drawings without departing from the scope of the invention . | 0 |
fig1 is a perspective view of a recording apparatus according to an example of an electronic apparatus . the recording apparatus includes the following components : a carriage 2 serves as a mechanism on which a recording head 1 for discharging ink is mounted . the carriage 2 is a moving body that scans ( moves ) while being guided and supported by a main guide rail 3 and a sub - guide rail 4 . a flexible board 5 connects an electric connecting portion of a substrate provided in the carriage 2 to a control unit of a main substrate provided in the apparatus body . a timing belt 6 is laid between a motor pulley 8 connected to a motor 7 and a driven pulley 9 opposed to the motor pulley 8 in a tensioned state , and is fixed to the carriage 2 . driving force is transmitted from the motor 7 to the timing belt 6 via a mechanism such as gears , so that the carriage 2 scans over a recording medium ( recording sheet ). a conveying roller 10 is driven by a conveying motor so as to convey a recording medium . a discharge roller 11 discharges the recording medium out of the apparatus after image recording . the main guide rail 3 , the sub - guide rail 4 , etc . are fixed to a housing 12 . fig2 is an explanatory view of a motor control circuit in the embodiment . while this motor control circuit is formed by an application specific integrated circuit ( asic ) as an example , some functions may be performed by a cpu . a drive command signal ( command value ) 103 is a driving profile of the carriage 2 that is programmably determined beforehand . a position calculating unit 106 and a speed calculating unit 107 respectively calculate ( acquire ) the position and speed of the carriage 2 from signals detected by an encoder sensor 13 with encoder slits 14 . an operation unit 104 and an operation unit 105 carry out operation based on signals of the position and speed of the carriage 2 detected by the encoder sensor 13 so that driving of the carriage 2 follows the drive command signal 103 , and output a signal obtained by the operation to a driving circuit 108 . the operation unit 105 is a proportional integral ( pi ) compensator . with the above structures , feedback ( fb ) control is performed . a signal generating unit ( periodic - signal generating unit ) 100 generates a periodic signal for suppressing periodic vibration caused in the motor 7 . using this signal , feed forward ( ff ) control is performed . this periodic signal is given by the following expression ( 1 ): while the periodic signal is described as a sine wave , it may be a rectangular wave . in expression ( 1 ), “ position signal ” refers to a signal of the position of the carriage 2 detected by the encoder sensor 13 , and “ periodic vibration pitch ” refers to a spatial frequency of periodic vibration . for example , assuming that the number of teeth of the motor pulley 8 is designated as n ( teeth ) and the tooth pitch of the timing belt 6 is designated as m ( mm ), the feed amount of the timing belt 6 in one rotation of the motor 7 is given by n × m ( mm ). when periodic vibration includes a p - number of pulses in one rotation of the motor 7 , the periodic vibration pitch is given by n × m / p ( mm ). further , “ amplitude ” refers to an amplitude of the periodic signal output from the periodic - signal generating unit 100 . while the amplitude is expressed by the duty ratio (%) of pulse width modulation ( pwm ) in the embodiment , the present invention is not limited thereto . further , “ phase ” refers to a phase of a periodic signal output from the periodic - signal generating unit 100 . the origin of the position signal may be determined with a rotation angle origin sensor ( not shown ) attached to the motor 7 or an origin position detection sensor of the carriage 2 . the periodic signal output from the periodic - signal generating unit 100 has parameters ( amplitude , phase value , and frequency ) for suppressing the speed variation ( torque variation ). since the amplitude and phase vary according to manufacturing errors of the motor 7 and component errors and assembly of the recording apparatus , they need to be calculated for each recording apparatus . information for this calculation is acquired by an identification process ( preliminary driving process ) that will be described below . the signal generating unit 100 outputs a periodic signal according to information ( parameter ) about the periodic signal . when information about a periodic signal to be output is changed by a change of the apparatus state or switching of the operation mode , the signal generating unit 100 changes the number and type of periodic signals . for example , when the speed of the carriage 2 is a first speed , the signal generating unit 100 outputs periodic signals corresponding to a sixth - order motor cogging frequency and a frequency of the timing belt . when the speed of the carriage 2 is higher than the first speed , the signal generating unit 100 outputs a periodic signal corresponding to a twelfth - order motor cogging frequency . the output from the operation unit 105 and the output from the signal generating unit 100 are added by an adder unit 109 , and the sum is output to the driving circuit 108 . after signal processing is performed by a pwm unit 108 a and a motor driver 108 b in the driving circuit 108 , a control output is given to the motor 7 . a driving - state storage unit 102 stores information about a position signal and a speed signal detected during driving of the carriage 2 . a control - set - value calculating unit ( control - set - value generating unit ) 101 receives the information stored in the driving - state storage unit 102 , and calculates ( generates ) parameters ( set values ) of periodic signals that can suppress periodic vibration . the signal generating unit 100 includes a frequency table that holds the parameters and flags . the signal generating unit 100 generates a periodic signal for a frequency corresponding an on flag , with reference to the parameters . hence , the signal generating unit 100 does not refer to the parameters for a frequency corresponding to an off flag . the control - set - value calculating unit 101 includes a band - pass filter 101 a that serves to divide information about the speed variation into a plurality of frequency signals . for the signals obtained by division , parameters of periodic signals are calculated ( acquired ). fig6 illustrates the function of the band - pass filter 101 a . for example , when the band - pass filter 101 a receives a signal s having a waveform w , it generates a signal sa having a frequency of 100 hz and an amplitude of 5 , and a signal sb having a frequency of 120 hz and an amplitude of 1 . next , a method for identifying torque variation will be summarized . in the embodiment , identification is performed for predetermined frequencies ( e . g ., three frequencies ). for that purpose , it is determined , with reference to values in a threshold value table provided in the driving - state storage unit 102 , which of the three frequencies is to be identified . in the threshold value table , threshold values are kept corresponding to the frequencies to be measured . when a frequency is specified by a threshold value , a parameter of a periodic signal capable of suppressing the speed variation is specified for each frequency . this specification result is set in the frequency table so as to be used in an actual printing operation of the apparatus . for this reason , the control unit of the electronic apparatus can execute an identification mode separately from a print mode . for example , the identification mode can be performed before the print mode . in the print mode , the signal generating unit 100 outputs a periodic signal during scanning of the carriage . fig5 is a schematic view of the control unit of the main substrate . in this control unit , a cpu 23 reads out a program stored in a rom 24 , and executes the program . the cpu 23 controls execution of an identification process that will be described below . the cpu 23 controls an integrated circuit ( asic ) ( not shown ) so as to control image processing for processing print data , communication with the host computer via an interface ( if ) 26 , and driving of the recording head 1 . in addition , the cpu 23 controls processing of signal output from the encoder sensor 13 and signal output to the motor driver 108 b . the cpu 23 may be replaced with an asic including the cpu 23 and other circuits . a ram 25 stores a result of image processing , speed information , information about the speed variation , and a result of operation for acquiring the periodic signal . the pwm unit 108 a generates a signal for modulating a pulse voltage width on the basis of the information operated in the cpu 23 . the motor driver 108 b is a driver circuit for driving the motor 7 according to a signal output from the pwm unit 108 a . an identification process ( preliminary driving process ) will be described with reference to fig3 . in step s 11 , motor driving is performed by fb control , and speed information about the carriage ( moving body ) is acquired . as shown in fig4 c , the carriage moves from a position s to a position e . fb control is performed so that the carriage scans at a constant scanning speed through areas q 1 to q 5 . in this case , the scanning speed is a speed adopted in a print operation . in step s 12 , information about speed variation of the carriage ( first amplitudes ) is acquired . as shown in fig4 a , first amplitudes are obtained in the areas q 1 to q 5 of the carriage . in the first embodiment , the number of areas is five for plain explanation . fig4 b is an example of a threshold value table . in the first embodiment , the threshold value table contains columns corresponding to three frequencies . in the first embodiment , information about speed variation at three frequencies is acquired for plain explanation . fig6 illustrates extraction examples of two frequencies of 100 hz and 120 hz from one piece of information about speed variation . similarly , information is acquired for three frequencies by the band - pass filter . in step s 13 , it is determined whether to detect vibration . this determination is made by comparing the three frequencies acquired in step s 12 with corresponding threshold values . first threshold values in fig4 b serve as threshold values used to determine whether to detect vibration . in the first embodiment , when at least one of the frequencies is higher than ( higher than or equal to ) the corresponding first threshold value , the process proceeds to step s 14 ( yes ). in contrast , when all frequencies are lower than the corresponding first threshold values , it is determined that vibration is not to be detected ( no ), and the process is finished . since the sixth - order motor cogging frequency and twelfth - order motor cogging frequency are higher than the first threshold values in this case , vibration detection is performed for these two frequencies . in step s 14 , motor driving is performed by fb control and ff control , and speed information about the moving body is acquired . for this ff control , a signal is generated by combining a periodic signal corresponding to the sixth - order motor cogging frequency and a periodic signal corresponding to the twelfth - order motor cogging frequency . the parameter ( e . g ., amplitude ) of the combined signal is a preset value . the phase of this signal differs by 2π × 1 / 6 among the areas q 1 to q 5 , as shown in fig4 a . for example , a periodic signal having a phase of 2π × 1 / 6 is output in the first area q 1 from the start , and a periodic signal having a phase of 2π × 2 / 6 is output in the next area q 2 . in step s 15 , information about speed variation of the moving body ( second amplitudes ) is acquired . the second amplitudes shown in fig4 a indicate amplitude of speed variation in driving performed in step s 14 . then , the ratio of the first amplitude and the second amplitude is found in each area . as the amplitude ratio decreases , the degree of suppression of speed variation by the periodic signal increases . referring to fig4 a , the amplitude ratio in the area q 1 is 0 . 69 , which is the lowest of the five amplitude ratios . in step s 15 , an amplitude ratio of the sixth - order motor cogging frequency and an amplitude ratio of the twelfth - order motor cogging frequency in the area q 4 are also acquired . in step s 16 , a frequency to be suppressed is selected . on the basis of the amplitude ratio of each frequency to be suppressed and the second threshold value shown in fig4 b , it is determined whether to perform processing for vibration suppression . the second threshold value is used to determine whether to perform vibration suppression . since the amplitude ratio of the sixth - order motor cogging frequency is higher than the second threshold value in this case , the sixth - order motor cogging frequency is subjected to processing for vibration suppression . in contrast , processing for vibration suppression is not performed for the 12 - order motor cogging frequency . in step s 17 , motor driving is performed by fb control and ff control using the periodic signal , and speed information is acquired . in this case , a periodic signal having a predetermined amplitude is generated corresponding to the sixth - order motor cogging frequency . the phase of the periodic signal is similar to that acquired in step s 14 . in step s 18 , speed variation information ( second amplitude ) and an amplitude ratio of the sixth - order motor cogging frequency are obtained from the speed information acquired in step s 17 . in step s 19 , determination is made using the second threshold value . when the amplitude ratio is lower than the second threshold value , the process proceeds to step s 22 ( yes ). in contrast , when the amplitude ratio is higher than or equal to the second threshold value , the process proceeds to step s 20 ( no ). in step s 20 , the number of times steps s 17 to s 19 are performed is counted . the process proceeds to step s 22 ( yes ) when the count number is three , and to step s 21 ( no ) when the count number is not three . in step s 21 , step s 17 is performed again by changing the amplitude . the amplitude value for this purpose is prepared beforehand . in step s 22 , the parameter of the periodic signal is stored in the frequency table . in this case , a parameter of the sixth - order motor cogging frequency is stored and a flag is set on in the frequency table . in step s 23 , it is determined whether or not the frequency to be subjected to processed is acquired . when acquisition is completed ( yes ), the process is finished . when acquisition is not completed , processing is performed for the next frequency in step s 24 . further to that , in the identification process , the flag corresponding to the frequency lower than the threshold value ( frequency that does not need a periodic signal ) is set off in the frequency table . the above process will be roughly described below . in steps s 11 and s 13 , it is determined whether to perform processing for vibration suppression , and the frequency to be measured is selected . in steps s 14 to s 16 , the frequency to be suppressed is selected . in steps s 17 to s 22 , the parameter of the periodic signal of the selected frequency is specified , and the specified parameter is stored in the memory . further to steps s 17 to s 22 , the specified parameter is used to specify parameters of other frequencies . for example , in a case in which there are a plurality of frequencies to be suppressed ( 100 hz and 120 hz ), as shown in fig6 , and the frequencies influence each other , step s 17 is first performed while reflecting a parameter of a periodic signal for the frequency of 100 hz having a larger amplitude . then , a parameter of a periodic signal for the frequency of 120 hz is specified . this procedure can shorten the processing time . next , when the recording apparatus carries out a print ( recording ) operation , the signal generating unit 100 acquires a parameter of a frequency having an on flag in the frequency table so as to generate a periodic signal . for example , when the flag of the sixth - order motor cogging frequency and the flag of the twelfth - order motor cogging frequency are on , a periodic signal is generated using the parameters corresponding to the sixth - order motor cogging frequency and the twelfth - order motor cogging frequency , of the three frequencies . hence , for example , the signal generating unit 100 includes a signal synthesizing section for synthesizing a signal of the sixth - order motor cogging frequency and a signal of the twelfth - order motor cogging frequency . next , a description will be given of a first modification of the first embodiment . in the above - described first embodiment , the parameter of the periodic signal used for ff control in step s 14 is registered in the frequency table provided in the signal generating unit 100 . in the first modification , a parameter stored in a separate memory , such as a nonvolatile memory ( flash memory ), may be used . the parameter can be stored in the nonvolatile memory via an interface of the recording apparatus . next , a description will be given of a second modification of the first embodiment . in the above - described first embodiment , the phase of the periodic signal used in ff control in steps s 14 and s 17 differs among the canning areas of the carriage . in the second modification , the same phase may be used , regardless of the area . this simplifies the configuration of the signal generating unit 100 for generating the periodic signal . next , a description will be given of a third modification of the first embodiment . in the above - described first embodiment , information about speed variation is acquired by performing driving by fb control in steps s 11 to s 13 . in the third embodiment , steps s 11 to s 13 may be omitted , and the identification process may start from step s 14 . in this modification , a threshold value different from the threshold values in fig4 b is prepared for each frequency . for example , a third threshold value relating to the amplitude of the speed variation may be provided to be used for comparison in step s 19 . next , a description will be given of a fourth modification of the first embodiment . when the recording apparatus includes a control unit that performs printing ( recording ) while selecting a first scanning speed or a second scanning speed different from the first scanning speed , the identification process ( preliminary process ) may be performed for each of the first scanning speed and the second scanning speed . in this case , the number of areas and the scanning width described with reference to fig4 c may be determined in accordance with the scanning speed . next , a description will be given of a fifth modification of the first embodiment . while the frequency table storing parameters and flags is provided in the periodic - signal generating unit 100 in the first embodiment , it may be provided in the ram 25 as an example . in this case , the cpu 23 may read out a parameter of a frequency having an on flag , and sets the value of the parameter in the periodic - signal generating unit 100 . while the embodiment and the modifications have been described above , the present invention is not limited to the above - described numerical values . for example , the frequencies included in the speed variation are not limited to the frequencies relating to the motor cogging and the timing belt , and may be a frequency relating to a motor pulley , a gear , or the like . further , the frequency of motor cogging is not limited to the sixth - order frequency and the twelfth - order frequency , and for example , it may be a high - order ( twenty - fourth - order ) frequency or a low - order ( e . g ., second - order or third - order ) frequency . further , the phase of the periodic signal does not always need to be changed in correspondence with the number of areas where speed information is acquired . still further , the unit of change of the phase is not limited to 2π / 6 , and it may be other values , for example , 2π / 10 and 2π / 8 . the number of areas where speed information is acquired is not limited to five , and may be other numbers . in addition , while the recording apparatus has been described as an example of an electronic apparatus , the present invention is also applicable to an image input apparatus for reading an image on a document by scanning a reading unit , and to various apparatuses ( devices ) for moving or rotating a driven object by a motor serving as a driving source . further , the above - described embodiments may be combined . while the present invention has been described with reference to exemplary embodiments , it is to be understood that the invention is not limited to the disclosed exemplary embodiments . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions . this application claims the benefit of japanese patent application no . 2009 - 066510 , filed mar . 18 , 2009 , which is hereby incorporated by reference herein in its entirety . | 7 |
the invention is directed to a magnetic filter that removes paramagnetic particles or sludge , and at least a portion of the non - magnetic sludge from liquid petroleum or chemical process streams , especially streams that contain organic solvents and by - products . carbon steel , a common material for plant construction , tends to corrode in the presence of acidic contaminants in process streams of refineries or chemical plants . the corrosion generates ferrous ions which react with sulfur , oxygen and water to form paramagnetic fes , feo , fe ( oh ) 2 , fe ( cn ) 6 , and the like in the form of fine particles or visible flakes . these paramagnetic materials tend to attract degradation sludge , which may be organic by - products , thereby rendering a major portion of the contaminants paramagnetic . it has been demonstrated that a substantially large portion of the contaminants can be removed from a process stream by employing one or more permanent magnets . the remaining contaminants which are not attracted by the magnets consist primarily of non - magnetic ( or weakly - magnetic ) particles that do not respond sufficiently to the magnetic fields from the magnets . the magnetic filter of the present invention is particularly suited for treating contaminated process streams wherein the majority of the contaminants in the stream comprise magnetic contaminants . in this fashion , the remaining small amount of non - magnetic contaminants in the process stream downstream from the initial magnetic filtration stage can be readily separated in a subsequent second stage that employs one or more filter screens . the magnetic filter as shown in fig1 includes an enclosure or housing 1 having a bevel - shaped base 40 and vertical peripheral walls 42 that are secured to mounting legs 44 . housing 1 defines an interior region 32 that is accessible preferably from opposite horizontal ends or plenums 30 , 34 of housing 1 . in this fashion , the magnetic filter can be readily incorporated into the straight section of existing piping that transports a contaminated stream in a refinery or chemical plant . for example , a length of piping can be removed to form two ends : ( 1 ) the upstream end from which process stream flows is welded to inlet section 2 of housing 1 and ( 2 ) the downstream end of the pipe is similarly secured to outlet section 3 of housing 1 . as further described herein , the configuration within interior 32 directs the process stream entering magnetic filter housing 1 to initially traverse through the magnetic core assembly that attracts magnetic contaminants and to subsequently encounter a screen cylinder that strains non - magnetic and weekly magnetic contaminants therefrom before exiting the filter housing as a treated stream . the outer perimeter of top opening of housing 1 is encircled by flange 4 , on which a cover 5 is fitted and connected at one end with collars 6 that are fastened with a fitting pin 7 . cover 5 thus swings open horizontally around fitting pin 7 or other hinge mechanism . the other end of cover 5 is securely attached to flange 4 by a hand operated screw 8 that is equipped with handle bars or other fastening device that preferably does not require mechanical or power tools . a polymer gasket or other suitable sealing means may be inserted between cover 5 and flange 4 to insure a tight fit during the filtration operations . magnetic filter housing 1 is equipped with a drain valve 26 at the bottom for periodical discharge and with a safety relief valve 27 for relieving excess pressure before opening cover 5 for service of the unit including clean out . a flexible metal band 22 , which is attached to top supporting plate 16 , facilitates the removal of either the entire magnetic core assembly or of the holder sleeve plate assembly 13 ( fig2 c ) ( with or without the holder sleeves 14 ) from filter housing 1 . fig2 a depicts the vertical cross sectional view of a magnet bar assembly 9 that includes a plurality of stacked magnet bars each of which preferably consists of a short permanent magnet block or cylinder 10 with north and south poles . the plurality of magnet bars 10 is arranged so that like poles of adjacent magnets are positioned next to each other . the individual magnet bars 10 are fitted into a sealed non - magnetic tubular enclosure 11 which has a pulling ring 12 on top . each magnet bar assembly 9 is inserted into a separate holder sleeve 14 . as described further herein , magnetic contaminants will adhere to the exterior surface of holder sleeve 14 during the filtration process . fig2 b depicts the cross sectional top view showing the inner position of magnet block 10 , mid - position tubular enclosure 11 and outer position of magnet bar holder sleeve 14 . while magnet block 10 has a rectangular cross section , it is understood that the shape of the magnet block 10 and the corresponding tubular enclosure 11 and hold sleeve 14 can have any suitable exterior configuration . fig2 c illustrates the arrangement of a plurality of spaced - apart elongated holder sleeves 14 as they are secured on a holder sleeve assembly 13 which includes three parallel supporting plates 16 , 17 , and 18 . each holder sleeve 14 is preferably equipped with two pulling handles 21 so that the holder sleeves can be freely lifted from the plate assembly 13 after the magnet bar assembly 9 has been withdrawn from the holder sleeve during the clean - up cycle . upper support and middle support plates 16 , 17 have apertures or holes 15 that are sized and aligned so that a holder sleeve 14 can readily fit into the apertures 15 and rest on the surface of lower support plate 18 . a top lid or rim cover 19 that is attached to the open end of each holder sleeve 14 and that has a diameter that is larger than that of the fitted hole 15 supports each sleeve 14 at the top supporting plate 16 . top supporting plate 16 bears the entire weight of the plurality of magnet bar assemblies 9 and their associated holder sleeves 14 . in addition , top support plate 16 shields the open end of each holder sleeve 14 and , therefore each magnet bar assembly 9 as well , from coming into direct contact with the process fluid during the operation . middle plate 17 , as further described herein , secures a screen cylinder 24 ( fig1 ) in place by pressing it against a supporting ring 25 ( fig1 ) which is permanently connected to filter housing 1 . bottom plate 18 secures the lower portions of the plurality of holder sleeves 14 . at least one of the elongated holder sleeves 14 ( preferably the middle one ) is stationary and rigidly secures each of the three supporting plates 16 , 17 , and 18 so that the plates remain parallel and vertically spaced - apart and provide structural integrity to holder sleeve assembly 13 . as is apparent , the elongated holder sleeve 14 which secures the supporting plates is stationary integral with the magnetic bar and holder sleeve assembly 13 . instead of using a stationary holder sleeve to secure the plates , one or more rigid rods can be employed . fig2 d shows the top view of the holder sleeve assembly depicting an array of evenly distributed holder sleeves 14 that are inserted through holes 15 ( fig2 c ) on top support plate 16 . in the case of treating a stream that is heavily contaminated with paramagnetic materials , each available hole 15 has a holder sleeve 14 inserted therein so as to expose the stream to maximum magnetic field strength in order to attract the paramagnetic particles . the flow rate through the magnetic filter may have to be reduced in order to increase the residence time . in situations where the stream is not heavily contaminated , it may not be necessary to fully equip the holder sleeve assembly with magnet bars . incorporating fewer magnet bars allows the magnetic filter to accommodate larger process stream flow rates . in this scenario , not all the holes 15 on upper support plate 16 will be occupied by a holder sleeve 14 rather , some holes 15 will simply be stop up with a plug that is preferably made of a paramagnetic material such carbon steel and that has the same shape and dimensions as that of top cover 19 for the holder sleeves 14 . when magnet bars are required for a different application , the plugs can then be replaced by holder sleeves that carry additional magnet bars . a representative side view of a plug 39 is shown in fig2 e and a 90 ° rotated side view of the plug is shown in fig2 f . fig3 a and 3b depict hollow screen cylinder 24 that is constructed of a suitably sized metal material with pores that permit passage of fluids and particles of a certain size . the cylinder defines a chamber 45 that preferably has a flat base so that captured particles accumulate evenly at the bottom . screen cylinder 24 preferably includes two layers of non - magnetic metal screens with a finer screen of a mesh size of 1 to 200 ( wires per inch ), preferably of a mesh size of 10 - 100 for the inner layer 29 and with a coarser screen of a mesh size of 10 - 100 , preferably of a mesh size of 10 - 50 for the outer layer 30 . screen cylinder 24 includes two handle bars 28 that are attached to upper protruding rim 23 . referring to fig1 , in assembling the magnetic filter , screen cylinder 24 is first lowered into interior 32 of housing 1 with the underside of outer rim 23 being positioned on the upper surface of supporting ring 25 which is welded onto the filter housing . thereafter , magnetic core assembly 13 ( fig2 c ) is positioned partially inside the chamber of the screen cylinder such that middle support plate 17 comes to rest on the upper surface of rim 23 while the lower surface of upper support plate 16 comes to rest on supporting ring 20 , which is also welded onto the upper part of housing 1 . a gasket can also be positioned between support plate 16 and ring 20 . in this arrangement , a screen cylinder 24 partially encloses the magnetic core assembly so that the ends of the elongated of the holder sleeves 14 ( fig2 c ) are entirely situated within the chamber of hollow screen cylinder 24 . in addition , the space between supporting plates 16 and 17 define a channel through which process stream fluid enters ; wall 36 that flanks the downstream end of this channel diverts the fluid downward into the chamber of cylinder 24 . top cover 19 on the holder sleeves 14 and top supporting plate 16 , and the supporting ring 20 are preferably made from paramagnetic materials , such as carbon steel . with each holder sleeve 14 ( fig2 c ) being equipped with a magnet bar assembly 9 ( fig2 a ), the holder sleeves 14 generates strong magnetic forces from the magnet bars that helps keep the top supporting plate 16 as well as all the holder sleeves 14 securely in position . a gasket can be positioned between hole 15 and top cover 19 to provide a better seal . flexible metal band 22 that is secured to top supporting plate 16 also functions as a metal biasing spring that presses top support plate 16 against supporting ring 20 and presses middle plate 17 against top rim 23 of screen cylinder 24 . this feature keeps both the plate assembly 13 and screen cylinder 24 securely in place when top cover 5 of the filter housing is closed and compresses against metal band 22 . in operation , after contaminated process stream 2 enters the magnetic filter paramagnetic materials in the stream are attracted by the strong magnetic fields within the magnetic core assembly . these materials adhere to the outer surfaces of plurality of the holder sleeves 14 . within the chamber of screen cylinder 24 , the process stream travels in an axial direction that is parallel to the axis of the elongated holder sleeves 14 and in a radial , transverse direction . the direction of flow will depend on the pressure gradients that develop as contaminants build up within the magnetic core assembly . it is expected that most of the paramagnetic materials will have been removed by the magnetic filter . subsequently , both non - paramagnetic and weakly paramagnetic materials of a certain size and that are still in the process stream will be captured as the fluid passes through screen cylinder 24 . the cleaned process stream which is substantially free of both paramagnetic and non - paramagnetic contaminants exits the magnetic filter via exit outlet section 3 . after the holder sleeves 14 becomes loaded with magnetic contaminants and the screen cylinder 24 becomes loaded with non - magnetic contaminants , inlet 2 and outlet 3 of the magnetic filter are valve shut . top cover 5 is opened for the removal of the various components for cleaning . preferably the parts are removed in reversed order with holder sleeve assembly 13 ( fig2 c ) being freely lifted from the interior . removing the magnetic bars from the holder sleeve assembly releases the attractive magnetic force that helped keep the paramagnetic components aligned and drawn to each other thereby allowing the paramagnetic contaminants to drop off from the exterior surface of the holder sleeves . alternatively , individual magnet bars 9 can be freely separated from their holder sleeves 14 or individual holder sleeves 14 can be freely lifted from top supporting plate 16 . the foregoing has described the principles , preferred embodiments and modes of operation of the present invention . however , the invention should not be construed as being limited to the particular embodiments discussed . thus , the above - described embodiments should be regarded as illustrative rather than restrictive , and it should be appreciated that variations may be made in those embodiments by workers skilled in the art without departing from the scope of the present invention as defined by the following claims . | 1 |
with reference now to the drawings , and in particular to fig1 to 8 thereof , a new and improved bicycle brake light embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . more specifically , the bicycle brake light apparatus 10 of the instant invention essentially comprises a combination with a conventional bicycle 11 formed with a forward wheel and a rear wheel 12 with a brake caliper 13 mounted in operative engagement with the rear wheel . reference to fig2 illustrates the caliper 13 with a first caliper arm 14 pivotally mounted about a central caliper pivot to a second caliper arm 15 . the second caliper arm 15 includes a &# 34 ; u &# 34 ; shaped leg remote from the bracket pad arrangement on an opposite side of the caliper pivot . the &# 34 ; u &# 34 ; shaped leg 16 includes an upper and lower leg 16a and 16b respectively spaced a fixed and parallel distance apart relative to one another . a switch 17 is mounted between the upper and lower legs 16a and 16b and receives the brake cable 18 reciprocatably therethrough with the brake cable fixedly mounted relative to the upper leg 16a via a cable guide 19 to direct the cable 18 therethrough . switch 17 includes a first reciprocating contact 20 fixedly secured to the cable 18 with diametrically opposed arcuate recesses 20a formed within the perimeter surface of the reciprocating cylindrical first contact 20 to receive guide ribs 22 that are electrically conductive and are mounted parallel to one another onto interior diametrically opposed surfaces of the cylindrical housing of the switch 17 . a second contact 21 is adjustably mounted relative to an upper end of the switch housing with a single or plurality of return springs 23 to bias the second contact away from the first contact 22 . the second contact slidably receives the brake cable therethrough . an elongate adjustment cam 24 is mounted rotatably above the second contact 21 and is rotated with a screw angle 25 formed with a forwardly positioned drive head that may include a screw driver fitting or a hexagonal recess to enable rotation of the screw axle 25 . the axle 25 is fixedly secured to the adjustment cam 24 and is formed with a threaded rear terminal end portion 26 that is threaded through a rear wall of the housing of the switch 17 to enable rotation of the adjustment cam 24 by rotation of the forwardly mounted head that is accessible through a coaxially aligned opening through a cylindrical wall of the switch 17 . the second contact 21 includes diametrically opposed arcuate second contact recesses 21a that are formed with an insulative layer to prevent electrical contact between the second switch 21 and the electrically conductive guide ribs 22 . a first conductive wire 27 is in electrical communication with at least one guide rib 22 with a second conductive wire 28 in electrical communication with a second contact 21 . upon physical contact of the two electrical contacts 21 and 22 , a circuit is effected through an associated battery 29 of a conventional dry cell configuration positioned as desired within the bicycle framework and thereby actuate lights 30 formed within the circuit . a first light 31 is formed with a forward transparent lens and a rearwardly positioned securement bracket for securement to a rear portion of the bicycle 11 , as illustrated in fig1 for example . fig8 is illustrative of a second brake light that is optionally employed by the instant invention and utilizes a mounting bracket 34 to support an upwardly extending cylindrical resilient tubular rod 32 formed with a transparent lens cap 33 at its upper terminal end with associated electrical wires 27 and 28 directed coaxially of the resilient tubular rod 32 . an included illumination bulb is actuated upon completion of the electrical circuit , as noted above . the resilient character of the tubular rod 32 accommodates impact with the light during conventional use of the bicycle . as to the manner of usage and operation of the instant invention , the same should be apparent from the above disclosure and accordingly no further discussion relative to the manner of usage and operation of the instant invention shall be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . | 1 |
fig1 is a view showing the overall configuration of a printer 20 as a first example of the invention . the printer 20 is a serial inkjet printer for performing the bidirectional printing described hereinafter , and as shown in fig1 , the printer 20 is composed of a mechanism for conveying ( the conveyance direction is also referred to hereinafter as the sub - scanning direction ) a printing medium p through use of a paper feed motor 74 ; a mechanism for reciprocally moving a carriage 80 in the axial direction ( also referred to hereinafter as the main scanning direction ) of a platen 75 through use of a carriage motor 70 ; a mechanism for driving a print head 90 mounted to the carriage 80 to discharge ink and form dots ; and a control unit 30 for governing the exchange of signals between the paper feed motor 74 , the carriage motor 70 , the print head 90 , and an control panel 99 . the mechanism for reciprocally moving the carriage 80 in the axial direction of the platen 75 is composed of a slide shaft 73 for retaining the carriage 80 so as to enable the carriage 80 to slide , the slide shaft 73 being provided parallel to the axis of the platen 75 ; a pulley 72 for suspending an endless drive belt 71 between the pulley 72 and the carriage motor 70 ; and other components . ink cartridges 82 through 87 for color ink , which accommodate cyan ink c , magenta ink m , yellow ink y , black ink k , light cyan ink lc , and light magenta ink lm , respectively , as color inks are mounted to the carriage 80 . nozzle rows corresponding to each color of color ink are formed in the print head 90 at the bottom of the carriage 80 . when the ink cartridges 82 through 87 are installed in the carriage 80 , ink can be fed to the print head 90 from each cartridge . in the controller 30 , a cpu 40 , a rom 51 , a ram 52 , and an eeprom 60 are connected to each other by a bus . the controller 30 controls the overall operation of the printer 20 by deploying a program stored in the rom 51 or eeprom 60 to the ram 52 and executing the program , and also functions as an input unit 41 , a halftone processor 42 , and a printing unit 46 . the functions of the halftone processor 42 include functioning as a region determination processor 43 , a comparison unit 44 , and an error diffusion unit 45 . the details of these functional units are described hereinafter . a dither mask 61 is stored in a portion of the eeprom 60 . the dither mask 61 is used in halftone processing by ordered dithering , and is composed of a plurality of threshold values . in the dither mask 61 in the present example , the distribution of threshold values is provided with a so - called blue noise characteristic . a threshold value distribution having a blue noise characteristic is a threshold value distribution in which dots occur with irregularity and the spatial frequency component of set threshold values is largest in high - frequency regions of two pixels or less in each cycle when dots are formed using a dither matrix having such a distribution of threshold values . a threshold value distribution having a green noise characteristic as described hereinafter is a threshold value distribution in which dots occur with irregularity and the spatial frequency component of set threshold values is largest in middle - frequency regions of two to several tens of pixels in each cycle when dots are formed using a dither matrix having such a distribution of threshold values . in the present example , the dither mask 61 has a predetermined dot formation characteristic . specifically , the dither mask 61 has a characteristic whereby any of the dot pattern of the dot group formed by forward movement of the carriage 80 in bidirectional printing , the dot pattern of the dot group formed by backward movement , and the dot pattern of the overall dot group formed by the combination of forward and backward movement has satisfactory dot dispersion properties . this technique is described in japanese laid - open patent publication no . 2007 - 15359 . the dither mask 61 may be one that is configured so that satisfactory dot dispersion properties are obtained for each main scan group which indicates whether dots are formed by any main scan of a plurality of main scans by the carriage 80 instead of or in addition to groups for each abovementioned reciprocal movement . satisfactory dot dispersion properties can be specified as the presence of a blue noise characteristic or a green noise characteristic in a dot pattern . alternatively , satisfactory dot dispersion properties can be specified as the presence of a positive correlation coefficient , preferably , a correlation coefficient of 0 . 7 or higher , between the spatial frequency distribution of the print image and each spatial frequency distribution of the dither mask threshold values set for the pixels of each of a plurality of groups . a memory card slot 98 is connected to the controller 30 , and image data org can be read and inputted from a memory card mc inserted in the memory card slot 98 . in the present example , the image data org inputted from the memory card mc are data composed of the three color components red ( r ), green ( g ), and blue ( b ). in the printer 20 having a hardware configuration such as described above , driving the carriage motor 70 causes the print head 90 to reciprocally move in the main scanning direction with respect to the printing medium p , and driving the paper feed motor 74 causes the printing medium p to move in the sub - scanning direction . the controller 30 drives the nozzles at the appropriate timing on the basis of the printing data in conjunction with the reciprocal movement of the carriage 80 and the paper feed movement of the printing medium , and ink dots of the appropriate colors are thereby formed in the appropriate positions on the printing medium p . the printer 20 can thereby print a color image inputted from the memory card mc onto the printing medium p . the printing process performed in the printer 20 will be described . fig2 is a flowchart showing the flow of printing process in the printer 20 . this printing process is started in response to an operation by the user using the control panel 99 or the like issuing an instruction to print a predetermined image stored in the memory card mc . when printing process is started , as the process of the input unit 41 , the cpu 40 reads and inputs image data org in rgb format as the data to be printed from the memory card mc via the memory card slot 98 ( step s 110 ). when the image data org are inputted , the cpu 40 references a lookup table ( not shown in the drawings ) stored in the eeprom 60 , and converts the image data org from rgb format to cmyklclm format ( step s 120 ). when color conversion process is performed , as the process of the halftone processor 42 , the cpu 40 performs halftone process for converting the image data to dot on / off data of each color ( step s 130 ). this halftone process is described in detail hereinafter . the halftone process is not limited to processing for converting to the two values on and off for dots , and can be processing for converting to large dot and small dot on / off data , or other multi - value process . the image data processed in step s 130 can also be subjected to resolution conversion process , smoothing , or other image process . when halftone process is performed , the cpu 40 performs interlace process for ordering into dot pattern data printed in single main scan units , in accordance with the nozzle arrangement , paper feed rate , and other characteristics of the printer 20 ( step s 160 ). when interlace process is performed , as the process of the printing unit 46 , the cpu 40 drives the print head 90 , the carriage motor 70 , the paper feed motor 74 , and other components to execute printing ( step s 170 ). halftone process ( step s 130 ) will next be described in detail . fig3 is a flowchart showing the flow of halftone process . when this process is started , the cpu 40 first acquires coordinate data n ( x , y ) of the position of a denoted pixel , and pixel data dn for the image data color - converted in step s 120 ( step s 131 ). when the coordinate data n ( x , y ) of the position of the denoted pixel and the pixel data dn are acquired , the cpu 40 performs region determination process as the process of the region determination processor 43 ( step s 132 ). the region determination process ( step s 132 ) will be described in detail . the region determination process is processing for determining whether the denoted pixel ( x , y ) is a pixel on a dense color side ( also referred to hereinafter as a higher - density - side edge pixel ) among pixels that constitute an edge ( also referred to as edge pixels ) in the printing image , and assigning , on the basis of the determination result , a threshold value fluctuation parameter th_add as a predetermined parameter used in subsequent halftone process . fig4 is a flowchart showing the flow of the region determination process . when the region determination process is started , the cpu 40 performs processing for determining whether the denoted pixel ( x , y ) is a higher - density - side edge pixel ( step s 133 in fig4 ). specifically , the gradation values of pixels ( also referred to hereinafter as pixels subject to difference study ) at positions a predetermined distance d ( where d is a positive integer ) from the denoted pixel are subtracted from the gradation value of the denoted pixel , and a determination is made as to whether the difference thus calculated is greater than a predetermined threshold value ( also referred to hereinafter as the edge determination threshold value edge_th ). the value of the distance d can be set at the design stage of the printing device , manually set by the user at the printing stage , automatically set by the printing device upon determining characteristics of the image data during printing process , or at various other stages . in the case that d = 1 , for example , the pixels subject to difference study can be set as ( x − 1 , y ), ( x + 1 , y ), ( x , y − 1 ), and ( x , y + 1 ). the denoted pixel ( x , y ) is determined to be a higher - density - side edge pixel when any of the following conditions are met : in these expressions , date [ . . . ] indicates the gradation value of the pixel with the coordinates enclosed by the brackets . fig5 is a view showing the manner in which region determination process is performed by the method described above . in the present example , the denoted pixel is moved from top to bottom and left to right in the image data in a case in which predetermined directions are designated as references in the printing image , i . e ., a case in which an observer is directly facing the printing image . in this case , some pixels subject to difference study can be absent when the denoted pixel is positioned at a corner of the image data , but in this case , dummy pixels are set for the absent pixels subject to difference study , and region determination process is performed under the assumption that the gradation value of the dummy pixels are the same as the gradation value of the denoted pixel . in fig5 , pixels having higher - gradation values ( also referred to hereinafter as higher - gradation pixels ) are represented by dot hatching , and higher - density - side edge pixels are represented by cross hatching . in the case that d = 2 , for example , the pixels obtained by adding ( x − 2 , y ), ( x + 2 , y ), ( x , y − 2 ), ( x , y + 2 ), ( x − 1 , y − 1 ), ( x + 1 , y − 1 ), ( x − 1 , y + 1 ), and ( x + 1 , y + 1 ) to the pixels subject to difference study of d = 1 can be set as pixels subject to difference study . in the same manner as when d = 1 , a determination is made as to whether the denoted pixel is a higher - density - side edge pixel by size comparison with the edge determination threshold value edge_th . fig6 is a view showing the manner in which region determination process is performed when d = 2 . in the case that the denoted pixel is determined to be a higher - density - side edge pixel ( step s 133 : yes ), the cpu 40 assigns a value of “ 0 ” to the threshold value fluctuation parameter th_add for the denoted pixel ( step s 134 ). on the other hand , in the case that the denoted pixel is determined to not be a higher - density - side edge pixel ( step s 133 : no ), the cpu 40 assigns a value of “ 64 ” to the threshold value fluctuation parameter th_add for the denoted pixel ( step s 135 ). the cpu 40 performs the region determination process in this manner . the description now returns to halftone process ( fig3 ). after assigning the threshold value fluctuation parameter th_add for each denoted pixel , the cpu 40 performs provisional dithering ( step s 141 ) as the process of the comparison unit 44 . this provisional dithering is processing for comparing the sizes of the gradation value of the pixel data dn and the value of a threshold value thn_d that corresponds to the pixel data dn from among a plurality of threshold values which constitutes the dither mask 61 stored in the eeprom 60 . this process is formally the same process as that for determining the dot on / off status by normal dithering . essentially , in normal dithering , the on state is determined for a dot when the gradation value of the pixel data dn is equal to or greater than the threshold value thn_d , and the off state is determined for a dot when the gradation value of the pixel data dn is less than the threshold value thn_d . however , the present example differs in that the provisional dithering is pre - processing for assigning an on / off state to a dot by the error diffusion described hereinafter , i . e ., processing for assigning an error diffusion threshold value . as a result of provisional dithering , when the gradation value of the pixel data dn is equal to or greater than the threshold value thn_d ( step s 141 : yes ), the threshold value the used in error diffusion is set to a low - order threshold value the_l ( step s 141 ). in setting the low - order threshold value the_l , the cpu 40 subtracts the threshold value fluctuation parameter th_add assigned in the previous region determination process ( step s 132 ) from a reference error diffusion threshold value edth ( 128 , for example ) set in advance , and sets the resultant value as the low - order threshold value the_l . for example , in the case that the denoted pixel is a higher - density - side edge pixel , since the threshold value fluctuation parameter th_add is equal to zero , the low - order threshold value the_l is computed as edth − 0 . in the case that the denoted pixel is not a higher - density - side edge pixel , since the threshold value fluctuation parameter th_add is equal to 64 , the low - order threshold value the_l is computed as edth − 64 . as a result of provisional dithering , when the gradation value of the pixel data dn is less than the threshold value thn_d ( step s 141 : no ), the threshold value the used in error diffusion is set to a high - order threshold value the_h ( step s 143 ). in setting the high - order threshold value the_h , the cpu 40 adds the threshold value fluctuation parameter th_add assigned in the previous region determination process ( step s 132 ) to a reference error diffusion threshold value edth ( 128 , for example ) set in advance , and sets the resultant value as the high - order threshold value the_h . for example , in the case that the denoted pixel is a higher - density - side edge pixel , since the threshold value fluctuation parameter th_add is equal to zero , the high - order threshold value the_h is computed as edth + 0 . in the case that the denoted pixel is not a higher - density - side edge pixel , since the threshold value fluctuation parameter th_add is equal to 64 , the high - order threshold value the_h is computed as edth + 64 . a configuration is thus adopted in the present example whereby the threshold value the used in error diffusion is changed on the basis of the result of provisional dithering . when the threshold value the is set , the cpu 40 adds a diffusion error edn stored in a separately provided error buffer to the gradation value of the pixel data dn ( step s 144 ). the diffusion error edn is computed in step s 148 described hereinafter , and the specifics thereof are described hereinafter . when the diffusion error edn is added to the gradation value of the pixel data dn , the cpu 40 compares the gradation value of the pixel data dn to which the diffusion error edn is added and the threshold value the set in step s 142 or step s 143 ( step s 145 ). as a result , when the gradation value of the pixel data dn with the diffusion error edn added thereto equal to or greater than the threshold value the ( step s 145 : yes ), the on state is assigned for the dot of the denoted pixel ( step s 146 ), and when the gradation value of the pixel data dn with the diffusion error edn added thereto is less than the threshold value the ( step s 145 : no ), the off state is assigned for the dot of the denoted pixel ( step s 147 ). when the dot on / off state is assigned , the cpu 40 computes a binarization error en and a diffusion error edn ( step s 148 ). the binarization error en is the difference between the dot on / off result ( here , a gradation value of 255 or 0 ) and the gradation value of the pixel data dn with the diffusion error edn added thereto . the diffusion error edn is the error in computing the gradation value of the pixel data dn in step s 144 described above . in the present example , the binarization error en is distributed as the diffusion error edn for the surrounding pixels , whose dot on / off states are unassigned , at a ratio of 7 / 16 for the neighboring pixel to the right of the denoted pixel , 3 / 16 for the pixel below and to the left , 5 / 16 for the pixel below , and 1 / 16 for the pixel below and to the right . the diffusion error edn computed in this manner is stored in the error buffer . the process of steps s 144 through s 148 is halftone process by error diffusion , and is executed as the process of the error diffusion unit 45 . since error diffusion is a publicly known technique , no detailed description thereof will be given , but error diffusion is a procedure whereby each item of image data is compared with a predetermined threshold value and quantized while a quantization error of each item of image data is added at a predetermined distribution ratio to the surrounding image data . in the example described above , steps s 135 through s 139 are binarization process for assigning only and on or off value to a dot , but processing for converting to large dot and small dot on / off data , or other multi - value process can be performed . when the binarization error en and the diffusion error edn are computed , the cpu 40 repeats the process of steps s 131 through s 139 with all the pixels as pixels of interest ( step s 149 ). the halftone process of step s 130 ( see fig2 ) is thus completed . the principle of this halftone process is described below using fig7 . as described above , in the process of steps s 141 through s 143 , in the case that the gradation value of the pixel data dn is equal to or greater than the threshold value thn_d , i . e ., in the case that a dot on state would occur were processing by dithering to be performed , the threshold value the used in error diffusion is set to the low - order threshold value the_l . in the case that the gradation value of the pixel data dn is less than the threshold value thn_d , i . e ., in the case that a dot off state would occur were processing by dithering to be performed , the threshold value the is set to the high - order threshold value the_h . here , the threshold value difference δthe is defined as being equal to the_h − the_l , and a case is considered in which the threshold value difference δthe is “ 0 ,” i . e ., the denoted pixel in the present example is a higher - density - side edge pixel ( threshold value fluctuation parameter th_add = 0 ). in this case , since the result of provisional dithering does not affect the threshold value the , the process of steps s 141 through s 143 has no bearing on the final dot on / off assignment by the error diffusion ( steps s 144 through s 148 ). this means that in the halftone process of step s 130 , the final dot on / off state is assigned solely by error diffusion method elements . in fig7 , error diffusion method elements are shown as being strong in the dot data characteristics . a case will next be considered in which the threshold value difference δthe is greater than zero ( the_h & gt ; the_l ), i . e ., the denoted pixel in the present example is a pixel other than a higher - density - side edge pixel ( threshold value fluctuation parameter th_add = 64 ). in this case , when a dot on state is determined by provisional dithering ( the gradation value of the pixel data dn is equal to or greater than the threshold value thn_d ), the cpu 40 sets the threshold value the to the correspondingly small low - order threshold value the_l . on the other hand , when a dot off state is determined by provisional dithering ( the gradation value of the pixel data dn is less than the threshold value thn_d ), the cpu 40 sets the threshold value the to the correspondingly large high - order threshold value the_h . in other words , when a dot on state is determined by provisional dithering , the cpu 40 performs control so that a dot can readily be on by error diffusion , and when a dot off state is determined by provisional dithering , the cpu 40 performs control so that a dot can readily be off by error diffusion . this means that the final results of dot on / off determination by error diffusion are closer to the results of dot on / off determination by provisional dithering than in a case in which the threshold value difference δthe is zero . in other words , the final dot on / off state is determined by dithering - type factors in addition to error diffusion method elements . in fig7 , dithering - type factors are shown as being strong in the dot data characteristics . in short , by changing the threshold value the according to the results of provisional dithering , i . e ., by changing the size of the threshold value difference δthe , the contribution of dithering - type factors and error diffusion method elements in halftone process can be controlled . in the present example , this principle is used to dynamically control the dithering - type factors and error diffusion method elements in halftone process according to whether the denoted pixel is a higher - density - side edge pixel . this can also be taken to mean that the degree of control of the likelihood of dot formation by error diffusion is controlled by the size of the threshold value difference δthe . as described above , when dot data are generated by error diffusion in the printer 20 configured as described above , the results of provisional dithering are used to control the likelihood of dot formation by error diffusion . in other words , the likelihood of dot formation by error diffusion is controlled using the result of dot on / off determination for a case in which temporary dithering is used . consequently , halftone process can be performed that incorporates dithering - type factors and error diffusion method elements . specifically , in the case that the result of provisional dithering indicates a dot on state in the printer 20 , the threshold value the used in error diffusion is set to the low - order threshold value the_l , and control is performed so that a dot is readily formed by error diffusion . in the case that the result of provisional dithering indicates a dot off state , the threshold value the is set to the high - order threshold value the_h , and control is performed so that a dot is not readily formed by error diffusion . in either of these cases of control , the presence or absence of dot formation is closer to the result of dithering than to the dot data produced merely by error diffusion , and dithering - type factors are therefore strengthened . consequently , it is possible to set the degree of each type of control to a predetermined degree ; i . e ., it is possible to set the degree to which dithering - type factors and error diffusion method elements contribute in halftone process by appropriately setting the threshold value difference δthe , or in the present example , by setting the size of the threshold value fluctuation parameter th_add . since the likelihood of dot formation by error diffusion is controlled merely by changing the threshold value the on the basis of the results of provisional dithering , a simplified configuration is obtained which contributes to increased processing speed . the printer 20 of the present example is configured so that the threshold value difference δthe is changed according to whether the pixels forming the image to be printed are higher - density - side edge pixels . specifically , in the case that the denoted pixel is a higher - density - side edge pixel , error diffusion method elements in halftone process are strengthened by increasing the size of the threshold value difference δthe , and in the case that the denoted pixel is not a higher - density - side edge pixel , dithering - type factors in halftone process are strengthened . since halftone process by error diffusion features excellent reproducability of both resolution and gradation , when error diffusion is applied to pixels forming the contours of fine lines and to surrounding pixels thereof in cases in which the image to be printed includes fine lines ( e . g ., text or line drawings ) drawn at low density , the fine lines can be precisely reproduced without interruptions in the fine lines . in halftone process by dithering , quality loss due to misalignment of the landing positions of ink dots can be suppressed by giving predetermined characteristics to the dither mask that is used . generating a dither mask so as to have a high - order characteristic has not effect on execution speed during halftone process . halftone process by dithering is thus extremely effective with regard to processing speed and in suppressing image degradation due to misalignment of landing positions in a beta region of the image to be printed . in the present example , the reproducability of fine lines is increased by performing halftone process in which error diffusion method elements are strengthened for higher - density - side edge pixels of the image to be printed , and processing speed is increased and image degradation due to misalignment of the landing positions of ink dots is suppressed by performing halftone process in which dithering - type factors are strengthened in regions other than fine lines . specifically , in the image data to be printed , halftone process is performed so that error diffusion method elements are strengthened in regions in which the merits of error diffusion are utilized over the merits of dithering , and dithering - type factors are strengthened in regions in which the merits of dithering are utilized over the merits of error diffusion . a printed image can therefore be obtained which has excellent reproduction of fine lines , and in which image degradation due to misalignment of landing positions of ink dots is suppressed . a printed image having adequately excellent reproduction of fine lines can be obtained even when halftone process is performed in which error diffusion method elements are strengthened for pixels on a low - density side ( also referred to hereinafter as low - density - side edge pixels ) among edge pixels that constitute an edge , as well as for the higher - density - side edge pixels in the image to be printed . however , in the present example , halftone process is performed in which error diffusion method elements are strengthened only for higher - density - side edge pixels . specifically , processing speed can be increased by reducing the number of regions for which time - consuming halftone process having strengthened error diffusion method elements is performed . corresponding relationships with the claims are as follows . the halftone processor 42 corresponds to the dot data generator described in the claims , and the gradation value of the pixel data dn with the diffusion error edn added thereto corresponds to the corrected gradation value described in the claims . steps s 134 , s 135 , and s 141 through s 143 shown in fig3 and 4 correspond to the functions of the determination value adjustment unit described in the claims , and steps s 144 through s 148 correspond to the functions of the dot data generator described in the claims . the invention is not limited to the examples or embodiments described above , and can be implemented in various forms within the intended scope thereof . for example , such modifications as those described below are possible . in the example described above , halftone process in which error diffusion method elements are strengthened is performed for all edge pixels above , below , to the left , and to the right in a line drawing region ( in the case of the first example , the edge pixels that are higher - density - side edge pixels ), but halftone process in which error diffusion method elements are strengthened can also be performed only for one side of an edge . specifically , halftone process in which error diffusion method elements are strengthened is performed only for edge pixels on the right side or left side of a left - right edge , and only for edge pixels on the top side or bottom side of a top - bottom edge . in this case , by setting the pixels subject to difference study as shown in fig8 or fig9 , the application of halftone process in which error diffusion method elements are strengthened can be restricted to only the higher - density - side edge pixels on one side in a line drawing . in low - density fine lines , since dots still occur near edges in which error diffusion method elements are strengthened , fine lines can be printed with excellent reproducability and without interruptions in the fine lines . in the case that halftone process in which error diffusion method elements are strengthened is performed for only one side of an edge as described above , when , considering the relationship with the direction ( also referred to as the processing direction ) in which the denoted pixel is moved in the image data , halftone process in which error diffusion method elements are strengthened is performed for edge pixels at the rear of the line drawing region in the processing direction , i . e ., for edge pixels at the right and edge pixels at the bottom of the line drawing region , line drawings can be printed with particularly excellent reproducability . when that halftone process in which error diffusion method elements are strengthened is performed for edge pixels at the rear of the line drawing region , in the case that no dots occur in the line drawing region ( the region in which dithering - type factors are strong ) before the rear , the effect of the diffusion error makes dots occur more readily in rear edge pixels , i . e ., pixels for which error diffusion method elements are strengthened . when halftone process in which error diffusion method elements are strengthened is performed for edge pixels at the front of the line drawing region , i . e ., edge pixels at the left and edge pixels at the top of the line drawing region in the case that processing is directed left to right and top to bottom , in the case that no dots occur in the edge pixels , the diffusion error edn is diffused by the surrounding pixels . specifically , the diffusion error edn is diffused by also by the pixels at the rear in the processing direction and is reflected in the halftone process for the rear pixels . however , since dithering - type factors are strong in the rear pixels , the effect of the diffusion error is essentially suppressed , and dots less readily occur than in the case of performing halftone process in which error diffusion method elements are strengthened for the edge pixels at the rear in the processing direction . for this reason , in the case that halftone process in which error diffusion method elements are strengthened is performed only for one side of an edge , line drawings can be printed with particularly excellent reproducability by performing halftone process in which error diffusion method elements are strengthened for edge pixels at the rear of the line drawing region in the processing direction . in the example described above , the pixels in the image data are divided into two types of regions in which processing with strengthened error diffusion method elements and processing with strengthened dithering - type factors is performed , but an intermediate region ( also referred to hereinafter as a transition region ) between these two types of regions can also be provided for halftone process . specifically , the threshold value fluctuation parameter th_add is set to a value between the region in which error diffusion method elements are strengthened and the region in which dithering - type factors are strengthened . in the configuration of the first example , it is possible to perform halftone process in which dithering - type factors and error diffusion method elements are placed at a middle degree by setting the threshold value fluctuation parameter th_add equal to zero ( see fig4 ) in regions in which dithering - type factors are strengthened , setting the threshold value fluctuation parameter th_add equal to 64 in regions in which error diffusion method elements are strengthened , and setting the threshold value fluctuation parameter th_add equal to 32 , for example , in transition regions . as a method for providing the transition region , in the method of the first example for detecting the higher - density - side edge pixels , the pixels detected by the pixels subject to difference study at distance d = 1 described in fig5 are designated as the pixel region in which error diffusion method elements are strengthened ( threshold value fluctuation parameter th_add = 64 ), the pixels other than those detected at d = 1 of the pixels detected by the pixel subject to difference at distance d = 2 described in fig6 are designated as the transition region ( threshold value fluctuation parameter th_add = 32 ), and the remaining pixels are designated as the pixel region in which dithering - type factors are strengthened ( threshold value fluctuation parameter th_add = 0 ). through this configuration , a transition region is provided as an intermediate region between the region of strengthened dithering - type factors and the region of strengthened error diffusion method elements , halftone process can be performed in which there is a stepwise transition between dithering - type factors and error diffusion method elements , and the boundary at which the threshold value fluctuation parameter th_add is switched can be prevented from being recognizable in the printed image . not only the transition region described above , but a plurality of transition regions can be provided so as to create a continuous transition from a region of strengthened dithering - type factors to a region of strengthened error diffusion method elements . specifically , the number of transition regions can be set to two or three for halftone process by using pixels subject to difference study with distance d = 3 or pixels subject to difference study with distance d = 4 . in the example described above , halftone process in which error diffusion method elements are strengthened is performed for edge pixels that are higher - density - side edge pixels , but this configuration is not limiting , and halftone process in which error diffusion method elements are strengthened can also be performed for edge pixels including low - density - side edge pixels . for example , in the case of d = 1 ( see fig5 ), the pixels subject to difference study are set as ( x − 1 , y ), ( x + 1 , y ), ( x , y − 1 ), and ( x , y + 1 ), and the denoted pixel ( x , y ) is determined to be an edge pixel when any of the following conditions are met : halftone process in which error diffusion method elements are strengthened is performed for the edge pixels detected in this manner . printing process having excellent reproducability of low - density fine lines can be performed in this case as well . in the example and modifications described above , an edge pixel is detected by computing the size of the differential between the gradation of a denoted pixel and the gradation of a pixel subject to difference study , but this configuration is not limiting , and since pixels that form characters or line drawings are self - evident in cases in which the data to be printed are vector data or text data , for example , pixels that form contours , i . e ., edge pixels , can easily be detected by processing the inputted data so as to flag pixels which form characters or line drawings . this method of detecting edge pixels enables a further increase in processing speed . in the halftone process of the embodiment described above , the gradation values of the pixel data dn are compared with various threshold values to determine dot on / off states by provisional dithering or error diffusion , but a configuration can be adopted in which the gradation values of the pixel data dn are converted to recording rates on the basis of a predetermined conversion rule , and gradation values of the recording rates are compared with the various threshold values . the recording rate is the ratio at which dots are recorded for a pixel in an arbitrary region . for example , in a case in which the printer 20 forms an image out of dots of a plurality of sizes , such as large dots or small dots , a gradation value of a recording rate computed for each dot size on the basis of the gradation value of the pixel data dn can be compared with the various threshold values . in the embodiment described above , the printer 20 is configured so as to execute all the printing process shown in fig2 , but in a case in which printing process is performed in a printing system ( a printing device in the broad sense ) in which a printer and a computer are connected , some or all of the printing process or halftone process can be performed by the computer or the printer . embodiments of the invention are described above , but the invention is not limited to these embodiments and can , of course , be implemented in various ways within the intended scope thereof . for example , the invention is not limited to application in a serial inkjet printer such as described in the embodiments , and can be applied in inkjet line printers , laser printers , and various other types of printing devices . besides the printing device configuration described above , the invention can be realized as a printing method , program , storage medium , or the like . | 7 |
according to an embodiment of the present invention , a videoscope system comprises a video means , e . g ., stereo pair of imaging cameras , a display means , preferably a stereo display , a mechanical support means , and tracking means . the display can be a video - see - through display with an external mechanical support . for a head - mounted implementation , the external mechanical support can partially support the weight of a head - mounted display when it is worn . the external mechanical support can completely carry the display - camera - assembly during use . in both cases , the user can easily step back from the videoscope or swing it out of position . in this “ non - use ” state the videoscope is completely self - supporting . according to an embodiment of the present invention , a videoscope can provide augmented reality image guidance for surgical procedures , for example , as described in u . s . patent application ser . no . 09 / 971 , 554 , entitled augmented reality visualization device , incorporated herein by reference . thus , data , such as a magnetic resonance imaging ( mri ) scan , can be shown in - situ , overlaid on a surgeon &# 39 ; s view of a patient . the internal structures can be directly presented in the surgeon &# 39 ; s workspace in a registered fashion . the surgeon can wear a head - mounted display and can examine the spatial relationship between the anatomical structures from varying positions in a natural way . thus , a surgeon can better focus on a task and perform an operation more precisely and confidently without the need for referring to a remote display . referring to fig2 a and 2 b , a videoscope comprises a pair of stereo video cameras 202 and stereo display 203 and mechanical 204 support such as an articulated arm . any number of video cameras can be provided depending on the viewing needs . for augmented reality applications the videoscope system comprises a tracking means 206 and computer processor for tracking and visualization . the tracking means 206 can have a fixed position with respect to the imaging cameras 202 . [ 0025 ] fig3 illustrates a videoscope system comprising a support 301 , for example , a wall , a ceiling or portable cart . a videoscope head comprises a stereo pair of video cameras 202 and stereo display 203 . the videoscope head is connected to a mechanical support 204 such as an articulated arm . an optical tracking system implementing remote tracking cameras , for example , mounted around a workspace can track the videoscope head . the videoscope head can be adapted to comprise one or more elements , including , for example , the imaging cameras , the display , and a tool . the imaging cameras may be pitched at an angle . the angle of the imaging cameras preferably enables a user to maintain a comfortable and relaxed posture . for example , a surgeon may prefer to pitch the imaging cameras downward at a particular angle , with a view of a patient . thus , the surgeons head and neck posture can remain substantially upright throughout the procedure . the angle between the optical axes of the imaging camera 202 and the viewing direction of the user can be between about 0 degrees and about 60 degrees . the pitch angle of the imaging cameras 202 can be between about 0 degrees and greater than about 60 degrees down angle . the videoscope system can comprise an imaging tool , for example , a graphics application for allowing the user to enhance or adjust the views with color , or text . in addition , the user may select objects in the workspace , or include graphical objects as guides . referring to fig3 a surgical light is another example of a tool 302 . the light can illuminate the field of view of the imaging cameras . the light source can be mounted close to the imaging cameras . thus , the light can reach into narrow openings into which the cameras are directed . according to an embodiment of the present invention a videoscope system can comprise a remote display 304 . a remote display can be used where , for example , the imaging cameras are connected to a remotely controlled arm . thus , a user can view an area of interest from the viewpoint of an instrument connected to the arm , wherein the instrument is in the proximity of the imaging cameras , for example , a few centimeters apart . the videoscope system can comprise a control means , wherein the control means can be analog and / or digital , e . g ., a pair of joysticks for controlling the pose of an articulated arm . the control means , such as a handle connected to the arm , can provide the user control over the movement of the arm . the control means can be configured to remotely control the mechanical support and / or tools , for example , through the use of electromagnetic motors at the joints of the mechanical support . in addition , the control means can be used to adjust the attributes of the imaging cameras and other tools , such as a light source . the mechanical support 204 allows easy movement of videoscope head in a range of poses , and locking of these poses . the videoscope system can comprise a means for locking the videoscope head in place . for example , a mechanical means such as a clamp or ratchet mechanism or an electromagnetic lock at each joint , e . g ., 306 , of the support mechanism . movement can be guided by hand or head movements . the support can be connected to any suitable surface or carriage , for example , a wall , a ceiling , or a moveable cart . according to an embodiment of the present invention , a videoscope can be understood as an operating microscope , where the direct optical observation has been replaced by an indirect observation via the electronic camera - display combination . the concept of the videoscope is not limited to high magnification applications and can be implemented in scenarios needing various levels of magnification including no magnification . different videoscopes can be made for different magnifications and field - of - views . the level of magnification can be controlled via an optical / digital zoom function or via switching of camera - lens combination . for correctly registering the graphics overlay onto the video images , the optomechnical system comprises sensors that report the state of all the relevant parameters like zoom factor , etc . in the case of head guidance , the videoscope head can be designed similarly to a head - mounted display . the user puts it on his head and tightens it with a mechanism like an adjustable headband or chin strap , for example , 208 in fig2 a and 2 b . the user can wear a headband to which the videoscope can be docked at a predetermined pose . a mechanical guide , e . g ., with a female part attached to the head band and a male part attached to the videoscope head ( or vice versa ), can bring the videoscope into the predetermined pose . a mechanical latch or a magnetic / electromagnetic coupling can be used to attach the headband and videoscope . the videoscope can be implemented in conjunction with other systems , such as ultrasound imaging devices , computerized axial tomography ( cat ) scanners and mri scanners . thus , the videoscope can provide in - situ visualization of a patient using the images captured by these and other systems . the videoscope can be implemented as a guidance system for directing the use of instruments associated in these devices . for example , using an augmented view with in - situ visualization of an ultrasound image , a user can guide a needle towards a target . tracking is needed for in - situ visualization . the viewpoint of the imaging cameras is needed to precisely overlay graphics as seen from the viewpoint of a user . tracking can be by , for example , mechanical , magnetic , inertial , or optical means . optical tracking systems based on stereo - camera system are commercially available . a multicamera system , wherein each camera has a view of the videoscope and workspace can be used for tracking the videoscope . markers can be attached to the videoscope for tracking by these remotely mounted cameras . alternatively , a tracking camera can be mounted to the videoscope , for example , 206 in fig2 a and 2 b , for tracking markers in or around the workspace , for example , as shown in fig4 . a videoscope according to the present invention should allow relaxed work posture . in a surgical scenario , e . g ., the displays can be straight so that the surgeon does not have to tilt down his head , while the video cameras are tilted downward . a computer processor connected to the videoscope can render , in real time , an augmented stereo view . the processor can receive video images from the imaging cameras , video images for determining pose information from the tracking camera , and stored volume and / or 3d surface data relating to the virtual view . the virtual view can be rendered according to the camera pose information , determined by the processor , and blended with the corresponding video images . the augmented images can be displayed stereoscopically . referring to fig4 a and 4 b , the field of view of the tracking camera 401 includes four non - collinear marker points 405 - 408 on the workspace frame 402 . any number of markers can be used , preferably a number is used to enable tracking in six degrees of freedom . the markers define a common coordinate system for the workspace . the markers are used to determine the pose of the tracking camera in the common coordinate system . knowing the relationship between the tracking and imaging cameras , the pose of imaging cameras can be determined . therefore , augmenting graphics objects may be rendered or registered into stereo video images from the video viewpoints of the imaging cameras . the graphics can appear anchored in the augmented scene . having described embodiments for an augmented reality system , it is noted that modifications and variations can be made by persons skilled in the art in light of the above teachings . it is therefore to be understood that changes may be made in the particular embodiments of the invention disclosed which are within the scope and spirit of the invention as defined by the appended claims . having thus described the invention with the details and particularity required by the patent laws , what is claimed and desired protected by letters patent is set forth in the appended claims . | 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.